article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
intestinal intussusception is relatively common in children, whereas in adults it is a rare clinical entity, which occurs most often secondary to a defined pathologic abnormality. although surgical resection is recommended, there is still no consensus regarding optimal management of adult intussusception caused by intestinal cancer. considering the theoretical risk of perforation, which could cause seeding of tumor cells and the release of microorganisms into the intraabdominal cavity however, less invasive management may be indicated and laparoscopy appears to be an attractive alternative to laparotomy for selected patients [5, 6 ]. we describe how we performed an emergency laparotomy for adult colonic intussusception caused by sigmoid colon cancer. the successful reduction allowed us to treat the extensive intussusception with a more limited anterior resection instead of en bloc wide abdominoperineal resection. a 47-year - old woman was admitted to our emergency department with sudden and severe abdominal cramping pain after suffering repeated episodes of colicky and intermittent abdominal pain for about 1 week. on physical examination, the results of laboratory investigations were normal including tumor markers of carcinoembryonic antigen and ca19 - 9. plain abdominal radiography showed a distended colon and digital rectal examination revealed a protuberant mass - like lesion with a smooth surface. 1), sigmoid - rectum intusussception caused by sigmoid colon cancer was diagnosed. at surgery, the sigmoid colon was found to be intussuscepted into the rectum very close to the anus, making reduction difficult. after dividing the peritoneum, the surgeon inserted his hands below the peritoneal reflection along the rectum and pushed the intussusception back from the distal to the proximal rectum using a milking action (fig. the rectum was divided 5 cm from the peritoneal reflection using a stapler, and the sigmoid colon was divided 10 cm proximal from the intussusception. we removed the intussuscepted part of the colon as well as the rectum, intermediate lymph nodes, and regional lymph nodes, and performed an anterior resection. histological examination revealed well - differentiated adenocarcinoma with invasion of the muscularis propriae (fig. the lymph nodes were negative for cancer cells. at present, three year after surgery, she is free of symptoms and she has had an uneventful course. intussusception is a major cause of intestinal obstruction in children, but it is relatively unusual in adults. adult intussusception accounts for only 1% of all bowel obstructions, 5% of all intussusceptions, and 0.0003 - 0.020% of all hospital admissions. few general surgeons encounter more than one or two adult patients with colon intussusception during their careers, and most cases are undiagnosed before laparotomy. intussusception of the sigmoid colon is often misdiagnosed as a large polyp or rectal prolapse. however, a delay in diagnosis could result in death, so surgeons must be aware of the possibility of this type of intussusception if they find an unusual rectal tumor in a patient with intestinal obstruction. our patient presented with sudden and severe abdominal pain, after a short history of repeated episodes of colicky and intermittent abdominal pain. although abdominal pain is the most common symptom, colonic intussusception can also manifest as a variety of acute, intermittent or chronic symptoms, making its preoperative diagnosis difficult. ultrasonography has been used to evaluate suspected intussusception and findings include the target and doughnut signs on the transverse view and the pseudokidney sign on the longitudinal view. the major limitation of ultrasonography in evaluating acute intestinal obstruction is the presence of air in the bowel, which results in poor transmission and difficulties in interpreting the image. the characteristic ct findings of intussusception include an early target mass with enveloped, eccentrically located areas of low density. the characteristic appearance of intussusception on barium enema is a cup - shaped filling defect with a spiral or coil - spring appearance. the ct findings proved helpful in establishing the preoperative diagnosis in our patient. for patients with intussusception and an inflamed, ischemic or friable bowel wall, it is advisable not to attempt operative reduction, but to proceed with resection. given the likelihood of malignancy, most cases of colo - colonic intussusception should be resected en bloc without reduction, which should be avoided because it may result in the spread of malignant cells [2, 4 ]. even when a benign tumor is suspected before surgery, careful manipulation is mandatory to avoid perforating the strangulated bowel with poor stability. according to nagorney. lynn and agrez reported a case of sigmoid colon intussusception in whom the rectum was opened circumferentially with diathermy at the point of the intussusception, and the intussuscepted sigmoid colon was delivered out of the rectum through the anus. however, this procedure would cause contamination of the abdominal cavity. in our case, the peritoneal incision was clean and allowed us to deliver the sigmoid colon out of the rectum, whereby abdominoperineal resection was avoided [3, 4 ]. laparoscopic surgery is now widely used for the resection of benign and malignant gastrointestinal tumors ; however, its application for intussusception is still controversial. reported that a laparoscopic approach is safe and effective for most cases of small bowel obstruction and recommended its use as the first - line treatment. chiu. described the successful laparoscopic resection of ileocolic intussusception caused by primary ileal lymphoma. the usefulness of laparoscopic surgery in emergency situations, particularly for non - decompressed intestinal obstruction, remains controversial because adequate intraperitoneal visualization is almost impossible in such cases. in our case, the small and large bowel were so dilated that laparoscopic manipulation would have been difficult. the choice of a laparoscopic or open approach depends on the clinical condition of the patient, the location and extent of the intussusception, the possibility of underlying disease, and whether the surgeon has sufficient laparoscopic expertise. | adult intussusception is rare and most often associated with cancer. we report a case of intussuscepted sigmoid colon into the rectum protruding from the anus of a 47-year - old woman. the cause of the intussusception was sigmoid colon cancer. we removed the intussuscepted part of the sigmoid colon as well as the rectum and regional lymph nodes. the patient recovered uneventfully and there has been no evidence of recurrence of the cancer. |
autosomal dominant polycystic kidney disease (adpkd) is associated with several extra - renal manifestations including coronary artery aneurysm and ectasia as well as cerebral aneurysms, hepatic and pancreatic cysts, cardiac valve disease, aortic root dilatation and colonic diverticulae [15 ]. abnormalities in the polycystic kidney disease (pkd) gene manifested in arterial smooth muscle cells and myofibroblasts could explain the expression of these extra - renal complications of the disease. despite some case reports [15 ] the aim of this retrospective study was to determine the incidence of coronary artery aneurysms and ectasia in the adpkd population and to assess if the size of the coronary arteries was larger compared to a control population. we retrospectively reviewed all end - stage renal failure (esrf) patients on haemodialysis over a 10-year period (20002010) at westmead hospital using the australia and new zealand dialysis and transplant registry (anzdata) data. the study population had a diagnosis of adpkd and esrf at the time of coronary angiogram. the control group of 15 patients was selected from the hospital cardiology database if they had both a diagnosis of end - stage kidney disease not due to adpkd at the time of catheterisation. relevant clinical details including patient medical history, medications at the time of angiography and coronary risk factors were obtained from the case records. baseline heart rate, systolic blood pressure, diastolic blood pressure and mean arterial pressure were obtained from the coronary angiography report. angiograms were analysed offline by a single observer (j.c.) using computerised edge - detection software (xcelera, philips healthcare, netherlands). the proximal left main coronary artery (lmca), left anterior descending (lad), left circumflex (lcx) and right coronary (rca) arteries were analysed. arterial segments were viewed in two orthogonal planes at end - diastole to maximise vessel diameter. the start and end points of a 5 mm segment of vessel were determined by the user. the average diameter within this 5 mm chosen segment was used to calculate the diameter of the proximal artery for each view. the start and end points were chosen by the user and the length of vessel measured was 5 mm. categorical data are reported in percentages and continuous data are represented as mean value sd. continuous variables were compared using the student s t - test and confirmed with a mann whitney test. the pearson chi - square or the fisher exact test was used as appropriate to compare categorical data. the baseline demographics, prevalence of cardiac risk factors and use of aspirin, clopidogrel, -blockers, calcium channel blockers, angiotensin - converting enzyme inhibitors and statins between the groups were not statistically different (table 1). the average diameters of the lmca, lad and rca were significantly larger in the adpkd group compared to the control group (table 1). demographics and mean coronary artery size in the adpkd and non - adpkd groupsa ace, angiotensin - converting enzyme. this retrospective study shows that subjects with adpkd have larger diameter coronary arteries independent of coronary risk factors and medication use. to our knowledge, this has not been demonstrated previously. our study showed that the esrf group with no history of adpkd had lmca, lad and rca vessel diameters similar to this normal range in contrast to the adpkd group whose average vessel diameter was larger. adpkd is associated with abnormalities in vascular smooth muscle and myofibroblasts as well as the extra - cellular matrix and collagen through defects in the pkd gene [6, 8 ]. it is likely that polycystin has a role in maintaining the integrity of the arterial wall. dysfunction of polycystins regulate cell cell and cell matrix interactions in vascular cells, and in the vasculature, this may lead to abnormalities in endothelial function, vascular tone as well as vascular integrity. these pathophysiological abnormalities support that pkd gene mutations may contribute to coronary artery dilatation ; however, the mechanisms remain to be defined. it is thought that the presence of coronary aneurysmal segments leads to an increased risk of acute myocardial infarction and ischemia through the promotion of sluggish and turbulent blood flow in the relevant artery. it is possible that larger coronary arteries might precipitate coronary events due to a similar process ; however, this requires further study. further studies examining the change in vessel size and presence of aneurysms and ectasia in adpkd subjects at diagnosis and longitudinally over time using non - invasive imaging would be beneficial. in addition, it would also be of interest to examine the incidence of clinical events in the same population. a detailed understanding of the incidence and pattern of coronary artery disease in adpkd patients will allow us to determine the optimal time to screen patients for the presence of coronary artery disease and may assist in choosing the most appropriate treatment strategy, especially if the risk of arterial dissection is greater. | autosomal dominant polycystic kidney disease (adpkd) can affect several organs in addition to the kidney. there is paucity in the literature on the cardiac manifestations of this disease. this retrospective study aimed to assess whether adpkd was associated with a larger coronary artery diameter and to evaluate for the presence of coronary artery aneurysm and ectasia. this study shows that subjects with adpkd and end - stage renal failure have dilatation of coronary arteries independent of traditional coronary risk factors and medication use. |
inhibition of estrous cycle in lactating rats mostly results from an inhibition of luteinizing hormone (lh) and gonadotropin releasing hormone (gnrh) secretion (2). suckling is an important inhibitory cue of lh surge during the first 8 days of lactation in rats ; separating pups from their dams restores lh secretion (3). furthermore, the administration of bromocriptine (a dopamine agonist that is used in treatment of hyperprolactinemia) has been shown to have no effect on the inhibitory effect of suckling on lh pulse (4).. suckling may be an appropriate model for studying the reproductive endocrine hormones involved during lactation. kisspeptins belong to a family of peptides, encoded by the kiss-1 gene, mostly located in arcuate nucleus (arc) and anteroventral periventricular (avpv) region in rat brain (6). kisspeptin has a fundamental role in controlling the gonadal axis (7), being a key regulator in lh secretion (8, 9). kisspeptin neurons are located upstream of gnrh neurons and stimulate lh release by affecting these cells (10). administration of kisspeptin stimulated lh secretion and induced ovulation in female rats (11, 12). despite suppressed basal levels, lh secretory response to kisspeptin were preserved in pregnant and lactating female rats, although the magnitude of lh bursts and the sensitivity to kisspeptin were much higher in pregnant rats (13). alterations in kisspeptin and kiss-1 concentrations in the hypothalamus of rat during estrous cycle have been previously addressed (14 - 16). an increased kiss-1 mrna expression in arc probably mediates the negative feedback effect of estrogen on gonadotropin secretion, which might be the gnrh pulse generating center (15). in contrast to arc, kiss-1 mrna expression in avpv and preoptic nucleus was reduced following ovariectomy and increased through estradiol implantation. it has been hypothesized that avpv might be involved in preovulatory gnrh / lh surge (15). the level of kiss-1 mrna in arc was highest during diestrus and lowest during proestrus in female rats (14). levels of lh pulsatile secretion are low in lactating rat (6) and human (18). estrus and ovulation are delayed about 20 days in lactating rats suckling 6 to 10 pups. if the number of pups is greater than 12 with a 2-day - long water and food withdrawal period, then the strength of suckling is increased (19). therefore, the number of pups and strength of suckling may be critical stimulants in inhibiting the lh surge. the aims of the present study were to evaluate the effects of litter size and intensity of suckling on the expression of kiss-1 mrna in lactating rats. the findings would be beneficial to better clarifying the underlying mechanism(s) involved in the lower reproductive performance due to lactation anestrous in high - producing dairy cows or in prolific species (e.g. ovine and caprine). thirty two pregnant and 4 ovariectomized (3 - 4 months old) female sprague - dawley rats (rattus norvegicus), weighing 205.9 10.7 g (mean sd), were housed in individual cages under controlled temperature (22 2c) and lighting (14 l : 10 d ; lighting starting at 07:00 through 21:00) with free access to food and water in the laboratory animal center of shiraz university of medical sciences, shiraz, iran. the rats were fed 15 g / kg of food pellets diet which had 90% dry matter, 8% ash, 4.1% crude fat, 21.6% crude protein, 70.8% total digestible nutrients (tdn), 0.4% calcium, 0.3% potassium and 0.1% sodium. the rats were treated humanely and in compliance with the recommendations of the animal care committee of our college. the rats were randomly assigned into 9 groups (n = 4 per group, table 1). the rats, assigned to the ovariectomized group, were anaesthetized by an intraperitoneal injection of ketamine (100 mg / kg ; woerden, netherlands) and xylazine (7 mg / kg ; alfazyne, woerden, netherlands) and ovariectomized through ventral midline incision. lactating rats were allotted to 8 groups (4 rats each) and they were allowed to suckle their pups until day 8 postpartum. in 3 groups, the litter size was adjusted to 5, 10, or 15 pups upon parturition and allowed to suckle their pups continuously. in further 3 groups of rats, the litter size was adjusted to 5 upon birth, the pups were separated from their dams on day 8 postpartum for 6 hr, after which the pups were allowed to suckle their dams for 2.5, 5, or 7.5 min before the dams were killed. the minimum of 2.5 min and 2.5 min intervals were selected according to the minimum time in increase in rna levels was immediately detected after transcription stimulation of a single cell (20). two groups of lactating rats with either 10 or 15 pups were similarly separated from their pups for 6 hr on day 8 postpartum, after which the pups were allowed to suckle their dams for 5 min, before the dams were killed. rats were anaesthetized by ether and killed via cervical dislocation at 15:00 to 16:00 on day 8 postpartum. brains were immediately removed and the diencephalon was dissected out by an anterior coronal section, anterior to the optic chiasm, and a posterior coronal cut at the posterior border of the mammillary bodies. to separate arc, a third coronal cut was made through the middle of the optic tract, just rostral to infundibulum (21). total rna was extracted, using the rnx - plus buffer (cinnagen, tehran, iran). briefly, the tissue (100 mg) was ground in liquid nitrogen, transferred to rnx - plus buffer (1 ml) in an rnase - free microtube, mixed thoroughly, and kept at room temperature for 5 min. the mixture was centrifuged at 12,000 g (4c) for 20 min and the supernatant was transferred to another tube and precipitated with an equal volume of isopropanol for 15 min. the rna pellet was washed with 75% ethanol and quickly dried and re - suspended in 50 l rnase - free water. the purified total rna was quantified by nano - drop nd 1000 spectrophotometer (nano - drop techno - logies, wilmington, de, usa). the dnase - treated rna (3 g) was used expression of the target mrnas over the reference for the first strand cdna synthesis, using 100 pmol oligo - dt, 15 pmol dntps, 20 u rnase inhibitor, and 200 u m - mulv reverse transcriptase (fermentas, st. primers were designed, using allele i d 7 software (premier biosoft international, palo alto, usa) for reference gene and kiss-1 (nm_181692). the rat glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene (m32599) was used as a reference gene for data normalization (table 2). relative real - time pcr was performed in a 20 l volume containing 1 l cdna, 1x syber green buffer and 4 pmol of primer. the amplification reactions were carried out in a line - gene k thermal cycler (bioer technology co., ltd, hangzhou, china) under the following conditions : 2 min at 94c, 40 cycles of 94c 10 sec, 57c 15 sec, and 72c 30 sec. after 40 cycles, the specificity of the amplifications was tested by heating from 50c to 95c, resulting in melting curves. all amplification reactions were repeated 3 times under identical conditions, including a negative control and 5 standard samples. to ensure that the pcr products were generated from cdna, but not the genomic dna, proper control reactions were implemented in the absence of reverse transcriptase. for quantitative real - time pcr data, the relative expression of the kiss-1 the ct for each sample was calculated, using line - gene k software (22). accordingly, the fold values was calculated by the equation 2(23), where ct is determined by subtracting the corresponding gapdh ct value (internal control) from the specific ct of the target (kiss-1). the ct was obtained by subtracting the ct of each experimental sample from that of the calibrator one (non - lactating ovariectomized rats). the data on relative expression of kiss-1 gene were subjected to the test of normality and analyzed by one - way anova (sas 9.1sas institute inc., cary, nc), and mean separation was performed by tukey 's test at p = 0.01. thirty two pregnant and 4 ovariectomized (3 - 4 months old) female sprague - dawley rats (rattus norvegicus), weighing 205.9 10.7 g (mean sd), were housed in individual cages under controlled temperature (22 2c) and lighting (14 l : 10 d ; lighting starting at 07:00 through 21:00) with free access to food and water in the laboratory animal center of shiraz university of medical sciences, shiraz, iran. the rats were fed 15 g / kg of food pellets diet which had 90% dry matter, 8% ash, 4.1% crude fat, 21.6% crude protein, 70.8% total digestible nutrients (tdn), 0.4% calcium, 0.3% potassium and 0.1% sodium. the rats were treated humanely and in compliance with the recommendations of the animal care committee of our college. the rats were randomly assigned into 9 groups (n = 4 per group, table 1). the rats, assigned to the ovariectomized group, were anaesthetized by an intraperitoneal injection of ketamine (100 mg / kg ; woerden, netherlands) and xylazine (7 mg / kg ; alfazyne, woerden, netherlands) and ovariectomized through ventral midline incision. lactating rats were allotted to 8 groups (4 rats each) and they were allowed to suckle their pups until day 8 postpartum. in 3 groups, the litter size was adjusted to 5, 10, or 15 pups upon parturition and allowed to suckle their pups continuously. in further 3 groups of rats, the litter size was adjusted to 5 upon birth, the pups were separated from their dams on day 8 postpartum for 6 hr, after which the pups were allowed to suckle their dams for 2.5, 5, or 7.5 min before the dams were killed. the minimum of 2.5 min and 2.5 min intervals were selected according to the minimum time in increase in rna levels was immediately detected after transcription stimulation of a single cell (20). two groups of lactating rats with either 10 or 15 pups were similarly separated from their pups for 6 hr on day 8 postpartum, after which the pups were allowed to suckle their dams for 5 min, before the dams were killed. rats were anaesthetized by ether and killed via cervical dislocation at 15:00 to 16:00 on day 8 postpartum. brains were immediately removed and the diencephalon was dissected out by an anterior coronal section, anterior to the optic chiasm, and a posterior coronal cut at the posterior border of the mammillary bodies. to separate arc, a third coronal cut was made through the middle of the optic tract, just rostral to infundibulum (21). total rna was extracted, using the rnx - plus buffer (cinnagen, tehran, iran). briefly, the tissue (100 mg) was ground in liquid nitrogen, transferred to rnx - plus buffer (1 ml) in an rnase - free microtube, mixed thoroughly, and kept at room temperature for 5 min. the mixture was centrifuged at 12,000 g (4c) for 20 min and the supernatant was transferred to another tube and precipitated with an equal volume of isopropanol for 15 min. the rna pellet was washed with 75% ethanol and quickly dried and re - suspended in 50 l rnase - free water. the purified total rna was quantified by nano - drop nd 1000 spectrophotometer (nano - drop techno - logies, wilmington, de, usa). the dnase - treated rna (3 g) was used expression of the target mrnas over the reference for the first strand cdna synthesis, using 100 pmol oligo - dt, 15 pmol dntps, 20 u rnase inhibitor, and 200 u m - mulv reverse transcriptase (fermentas, st. primers were designed, using allele i d 7 software (premier biosoft international, palo alto, usa) for reference gene and kiss-1 (nm_181692). the rat glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene (m32599) was used as a reference gene for data normalization (table 2). relative real - time pcr was performed in a 20 l volume containing 1 l cdna, 1x syber green buffer and 4 pmol of primer. the amplification reactions were carried out in a line - gene k thermal cycler (bioer technology co., ltd, hangzhou, china) under the following conditions : 2 min at 94c, 40 cycles of 94c 10 sec, 57c 15 sec, and 72c 30 sec. after 40 cycles, the specificity of the amplifications was tested by heating from 50c to 95c, resulting in melting curves. all amplification reactions were repeated 3 times under identical conditions, including a negative control and 5 standard samples. to ensure that the pcr products were generated from cdna, but not the genomic dna, proper control reactions were implemented in the absence of reverse transcriptase. for quantitative real - time pcr data, the relative expression of the kiss-1 the ct for each sample was calculated, using line - gene k software (22). accordingly, the fold values was calculated by the equation 2(23), where ct is determined by subtracting the corresponding gapdh ct value (internal control) from the specific ct of the target (kiss-1). the ct was obtained by subtracting the ct of each experimental sample from that of the calibrator one (non - lactating ovariectomized rats). the data on relative expression of kiss-1 gene were subjected to the test of normality and analyzed by one - way anova (sas 9.1sas institute inc., cary, nc), and mean separation was performed by tukey 's test at p = 0.01. relative expression of kiss-1 gene in rats continuously housed with 5 pups was greater than those suckling either 10 or 15 pups (p 0.05). expression of kiss-1 mrna in the arc of lactating rats was decreased as the number of suckling pups was increased. consistent with our findings, yamada (17) reported that suckling stimulus inhibited the expression of kisspeptin in arc neurons. increased number of pups per lactating rat results in higher milk production, and therefore the negative energy balance becomes more exacerbated (24). regardless of the level of energy intake, the efficiency of energy use is increased substantially during lactation in rats. the mechanisms involved in negative energy balance play an important role in the change (24). kiss-1 neurons are direct targets for regulation by leptin(25) and leptin levels were low in underfed rats (26). decreased leptin production and action during lactation increases feed intake, necessary for successful rearing of the offspring (27). during periods of negative energy balance, have no receptor for leptin(29). therefore, during early lactation, low leptin levels may suppress kisspeptin and inhibit gnrh neuron. the present study showed that increased intensity of suckling resulted in lower expression of kiss-1 mrna, with a greater influence of increased suckling intensity compared to the litter size. there is little data reporting the relationship between lactation stress and expression of kisspeptin, but it has been shown that corticotrophin - releasing factor decreased kiss-1 expression in arc of female rats (30). there are projections from corticotrophin - releasing factor neurons in the paraventricular nucleus to the regions where kisspeptin neurons are found (30). an inverse relationship was reported between the blood levels of adrenocorticotropin and corticosterone during lactation in rat (31). moreover, cortisol treatment suppressed lh release in rats (32). suckling is also an important inhibitor of lh surge in lactating rats (3). therefore, increased glucocorticoid secretion due to increased litter size and/or suckling intensity may inhibit gnrh secretion through suppression of kisspeptin. results of the present study showed the negative effect of litter size on the expression of kiss-1 gene. a relationship was reported between the height of the suckling - induced prolactin (prl) rise and litter size in rat (33). there was a high degree of colocalization of prl receptor mrna in kiss-1 mrna - containing cells (34). moreover, tuberoinfundibular dopaminergic (tida) neurons in arc are known as the key regulator of prl release (35). there is a close apposition between kisspeptin fibers and tida neurons in the arc, suggesting kisspeptin may contribute to prl release (35). decreased kisspeptin was conversely correlated with lh secretion, and prl inhibited lh secretion (36). one hypothesis is that kisspeptin neurons are inhibited as a result of suckling, and that some of kisspeptin fibers affect tida neurons and prl secretion, with some kisspeptin neurons projecting to poa to stimulate gnrh release. expression of neurokinin b (nkb) in arc neurons were decreased in lactating rats and nkb neurons colocalise with kisspeptin neurons (37). nkb neurons in arc are thought to stimulate lh release (37), therefore, the suckling stimulus may inhibit kisspeptin and nkb neurons. an increased litter size and intensity of suckling decreased kiss-1 mrna expression in rat hypothalamic arc which may suppress the pulsatile gnrh / lh secretion during lactation anestrus. the findings of the present study may help to characterize the mechanism(s) contributing to a decreased reproductive performance in high - producing dairy cows or in those twinning is a common phenomenon (e.g. ovine and caprine). the results described in this paper were part of student thesis and this research was financially supported by the shiraz university vice - chancellor for research, shiraz university, shiraz, iran. | objective(s):the effect of litter size and suckling intensity on the expression of kiss-1 mrna in the arcuate nucleus (arc) of rats were evaluated.materials and methods : thirty two pregnant and four non - lactating ovariectomized (as control group) rats were used in this experiment. lactating rats were allotted to eight equal groups. in three groups, litter size was adjusted to 5, 10, or 15 pups upon parturition and allowed to suckle their pups continuously by 8 days postpartum. in the other three groups, litter size was adjusted to five upon birth ; the pups were separated from the dams for 6 hr on day 8 postpartum, after which the pups were allowed to suckle their dams for 2.5, 5, or 7.5 min prior to killing the dams. two groups of lactating rats with either 10 or 15 pups were separated from their pups for 6 hr on day 8 postpartum, after which the pups were allowed to suckle their dams for 5 min before the dams were killed on day 8 postpartum. the arc was removed and the expression of kiss-1 mrna was evaluated, using real - time pcr.results : the expression of kiss-1 mrna in the arc was decreased as the litter size and intensity of suckling stimulus were increased. the effect of suckling intensity on the expression of kiss-1 mrna was more pronounced than that of litter size.conclusion:increased litter size and suckling intensity decreased kiss-1 mrna expression in the arc which may contribute to lactation anestrus in rat. |
chronic myeloid leukemia (cml) is a myeloproliferative disorder characterized by overproduction of immature and mature myeloid cells in the peripheral blood, bone marrow and spleen. in more than 90% of cases, the disease is diagnosed during the initial chronic phase (cml - cp), which is characterized by expansion of functionally normal myeloid cells. if untreated, cml progresses to an initial accelerated phase (ap), and subsequently to a more aggressive blast phase (bp), with loss of terminal differentiation capacity. a hallmark of cml is the presence of (9 ; 22) (q34 ; q11) reciprocal translocation, which is cytogenetically visible as philadelphia chromosome (ph) and results in the formation of bcr - abl1 fusion protein. this fusion protein is a constitutively active tyrosine kinase which is necessary and sufficient for malignant transformation (1). in vitro studies have demonstrated that bcr - abl1 is oncogenic, and leads to leukemic cell proliferation and inhibition of apoptosis (2). it is believed that bcr - abl1 gene is initially generated in a single hematopoietic stem cell (hsc) which gives it proliferative advantage over its normal counterparts, eventually leading to an expanded myeloid compartment (3). the introduction of imatinib, a bcr - abl1- targeting tyrosine kinase inhibitor (tki) has revolutionized cml therapy. following the success of the pivotal iris (international randomized study of interferon and sti571) trial, imatinib mesylate (gleevec, novartis, basel, switzerland) - formerly known as sti571- rapidly became the preferred first line treatment for patients with newly diagnosed cml in chronic phase (4, 5). subsequently, two other novel tkis with increased activity against bcr - abl1 were developed, dasatinib (sprycel, bristol - myers squibb, princeton, nj) and nilotinib (novartis), which were approved for newly diagnosed cml patients and those with previously treated cml (6, 7). another bcr - abl1 inhibitor is bosutinib (tasigna, pfizer, new york, ny) which has been approved for the treatment of chronic, accelerated, or blast phase of cml (8). ponatinib (iclusig, ariad, cambridge, ma) is a potent multitargeted kinase inhibitor that has been approved for the treatment of cml - cp, cml - ap, and cml - bp (9). the first is the development of resistance to bcr - abl1 inhibitors in some patients, which can be due to bcr - abl1 overexpression, differences in cellular drug influx and efflux, activation of alternative signaling pathways, or emergence of bcr - abl1 kinase domain mutations during tki treatment (10). the second is the limited efficiency of bcr - abl1-tkis in blast crisis (bc) cml (11). this can be due to generation of additional chromosomal and molecular changes during transition from chronic phase to blast phase. therefore, these cml blast cells may not depend entirely on bcr - abl1 pathway for survival (12, 13). the third is the insensitivity of cml stem cells to bcr - abl1 inhibitors (14, 15). cml is sustained by a population of cd/ bcr - abl1 progenitor cells with stem cell properties. therefore, conventional chemotherapeutics and bcr - abl1 inhibitors which act by inhibiting cell proliferation and inducing apoptosis, are ineffective against these non - proliferating stem cells (16, 17). to reach an ultimate cure, development of new and more effective therapies involving elimination of cml stem cells is required. the breakpoints within the abl1 gene occurs either upstream of exon 1b, downstream of exon 1a, or more frequently, between exons 1b and 1a (figure 1 a). in most patients with cml, the breakpoints within the bcr gene take place in a 5.8-kilobase area spanning exons 12 - 16, referred to as the major breakpoint cluster region (m - bcr) (figure 1 b) (1). 1a, the abl1 gene is located on chromosome 9q34 and spans more than 230 kb. it contains two alternative first exons, exon 1b and 1a, followed by exons 2 to 11. the breakpoints that create the philadelphia chromosome, are scattered over a large area (more than 300 kb) at the 5 end of the gene, either upstream of alternative exon 1b, between alternative exons 1b and 1a, or between exons 1a and 2. the breakpoint is in the major breakpoint cluster region that spans exons 12 - 16. the n - terminal coiled - coil domain of bcr - abl1 has dimerization and trans - autophosphorylation activity (18). autophosphorylation of tyrosine-177 of bcr - abl1 results in formation of a complex between grb2, gab2, and sos, leading to activation of ras and phosphatidylinositol 3-kinase (pi3k) pathways (19). signaling from ras - raf - mek - mapk pathway pi3k activates the serine - threonine kinase akt, which results in : 1, promoting survival by inhibiting foxo transcription factors (20) ; 2, activation of mtor which increases protein translation (21) ; and 3, increasing the expression of skp2, the recognition protein of scf e3 ubiquitin ligase, which degrades p27 and results in enhanced proliferation (22). another crucial consequence of bcr - abl activation is stat5 activation, either through direct phosphorylation or indirectly through phosphorylation by jak2 or hck (23). lack of stat5 inhibits both myeloid and lymphoid leukemogenesis (24) (figure 2). dimerization of bcr - abl1 induces autophosphorylation and activation of the kinase, generating docking sites for adaptor proteins like grb2. this signaling pathway results in activation of multiple downstream targets, leading to increased proliferation, enhanced survival, and perturbation of cell adhesion and migration. imatinib, dasatinib, and nilotinib bind to the atp - binding pocket of the abl kinase domain and inhibit bcr - abl activity (25 - 27). imatinib binds to the inactive conformation of bcr - abl, and prevents conformational changes needed for bcr - abl activation (25). nilotinib was developed by changing the structure of imatinib and binds to bcr - abl with a higher affinity. nilotinib is 10 to 50 times more potent than imatinib for inhibiting bcr - abl (26). dasatinib has a different chemical structure and binds to a slightly different region of the atp- binding pocket. dasatinib binds to the active conformation of bcr - abl and is 325 fold more potent than imatinib and 16 fold more potent than nilotinib (27). conventional cytogenetic analysis of bone marrow aspirates is performed by assessing ph positivity in at least 20 giemsa- stained metaphase cells. complete cytogenetic response (ccyr) is defined as the absence of detectable ph+ metaphase cells, which is a clinically important prognostic marker in cml patients. in patients without complete cytogenetic response, the degree of cytogenetic response is classified as partial (1% - 35% ph metaphase cells), major (0% - 35% ph metaphase cells), or minor (> 35% ph metaphase cells). a limitation of cytogenetic testing is the need for an invasive bone marrow biopsy to culture cells and obtain metaphase spreads. furthermore, the limit of detection of this method is relatively low, because a minimum of 20 metaphase cells are analyzed (1:20 or 5%). however, cytogenetic testing has the advantage of detecting, in addition to philadelphia chromosome, other chromosomal abnormalities which may have prognostic value (28). a more sensitive detection method is to assess peripheral blood interphase cells with fluorescence in situ hybridization (fish), thereby analyzing a higher number of cells in comparison with conventional cytogenetic testing. approximately, 100 to 500 interphase cells are usually assessed with fish, so this method is more sensitive (1:500 to 1:100, or 0.2% to 1%). however depending on the probes used, fish can have a false - positive rate of 1% to 10%. fish method can be used for monitoring response to therapy until fish levels are less than 5% to 10%. this method is not useful for analyzing further reduction in ph metaphases (28). real - time quantitative pcr is an effective and clinically validated method to quantify bcr - abl1 transcript levels and assess molecular responses. guidelines from national comprehensive cancer network (nccn) and european leukemianet (eln) recommend serial bcr - abl1 rt - qpcr assays at regular 3 to 6-month intervals for routine minimal residual disease (mrd) monitoring of cml treatment (28, 29). molecular monitoring includes rna extraction from a bone marrow or peripheral blood sample and subsequent rt - qpcr to measure the level of bcr - abl1 transcripts relative to a reference gene. in comparison with cytogenetic testing, pcr - based molecular monitoring offers exquisite sensitivity, almost 100 to 1000 times greater than fish or conventional cytogenetic analysis. it can assess bone marrow or peripheral blood samples, and provides quantitative results with validated clinical response thresholds (30, 31). a significant proportion of cml patients do not achieve a satisfactory response to first - line tki therapy, which is mostly due to drug resistance. tki resistance is classified as primary (lack of initial response to tki) or acquired (loss of response). primary imatinib resistance is defined as failure to achieve any of the following criteria : a complete hematologic response (chr) within 3 to 6 months, any cytogenetic response (cyr) by 6 months, a major cytogenetic response (mcyr) by 12 months or a complete cytogenetic response (ccyr) by 18 months on imatinib treatment. primary hematologic resistance is very rare in newly diagnosed cml - cp patients, whereas primary cytogenetic resistance is seen in 15% to 25% of patients. suboptimal response is defined as : no cyr at 3 months, less than mcyr at 6 months, less than ccyr at 12 months, or less than major molecular response at 18 months. acquired resistance is defined as loss of chr or ccyr or progression of cml at any time on treatment (28, 29, 32). it has been shown that the risk of imatinib resistance varies depending on cml phase : the risk is lowest in cml - cp and highest in cml - bp (4, 33). mutations in the abl1 tyrosine kinase domain of bcr - abl1 are responsible for a substantial proportion of imatinib resistance. bcr - abl1 mutations have been detected in 35% - 45% of cml patients with imatinib resistance (4, 34, 35). these mutations are more frequently found in patients with acquired resistance rather than primary resistance (36). furthermore, bcr - abl1 mutations occur more often in patients with advanced cml compared to cml - cp (37). less frequently, amplification of bcr - abl1 gene or increased bcr - abl1 expression can also lead to tki resistance (34, 38). bcr - abl1 independent mechanisms include activation of the src family of kinases, cytogenetic clonal evolutions with emergence of additional chromosomal abnormalities in ph cml cells, or the presence of quiescent stem cells may also contribute to tki resistance (34, 39). point mutations in the abl1 kinase domain are the most frequent mechanism of tki resistance. these mutations impair drug binding by changing essential amino acids for direct contact with the tki or by preventing bcr - abl1 from adopting the inactive conformation appropriate for tki binding. the t315i mutation is one of the most frequent mutations detected in 4% to 19% of resistant cases (37, 40). some investigators have suggested that t315i is associated with disease progression and poor survival (40, 41) different mutations in the abl1 kinase domain have been classified into four categories : a, in the imatinib binding site ; b, in the p - loop (atp binding site) ; c, in the catalytic domain ; d, in the activation (a) loop. mutations in the p - loop (residues 244 - 255 of abl1) accounts for about 48% of all mutations in imatinib resistant cases, a worse prognosis regardless of sensitivity to imatinib (42 - 44). mutations in the catalytic domain (residues 350 - 363 of abl1) can also affect imatinib binding. the activation loop is the major regulatory component of abl1 kinase domain and can adopt an open - active or closed - inactive conformation. mutations in the activation loop impair adopting the inactive conformation which is required for imatinib activity. amino acid substitutions at seven residues [m244v, g250e, y253f / h, e255k / v (p - loop), t315i (imatinib binding site), m351 t, and f359v (catalytic domain) ] account for 85% of all resistance associated mutations (36, 45). although point mutations have more frequently been detected in tki resistant and advanced cml, they have also been detected prior to tki treatment. these findings suggest that prior to tki therapy ; these mutations do not confer a survival advantage (46). it is unclear whether certain mutations are responsible for cml progression or they are a consequence of genomic instability in advanced disease (47). it seems that gain of function mutations may contribute to cml progression, whereas loss of function mutations are frequently subject to selective pressure by imatinib (48, 49). table 2 summarizes in vitro sensitivity of bcr - abl1 kinase domain mutations to imatinib, nilotinib and dasatinib. although nilotinib and dasatinib inhibit most of the clinically relevant abl1 mutations, with the exception of t315i mutation, the presence of mutations after imatinib failure as well as development of new mutations on subsequent tki treatment is a potential source of resistance to successive tki (50 - 53). it has been shown that in imatinib - resistant patients, subsequently treated with an alternative tki, 83% of cases after an initial response are associated with emergence of newly acquired mutations. patients already harboring imatinib - resistant kinase domain mutations, had higher likelihood of relapse associated with development of further mutations compared to patients who did not have mutations (54). the presence of additional chromosomal abnormalities besides ph chromosome is defined as clonal evolution and is considered to be a feature of advanced cml (55). the most frequent chromosomal abnormalities include, in order, an additional ph chromosome (38%), trisomy 8 (34%), and isochromosome 17q (56) ; which have been associated with bcr - abl1 overexpression, myc overexpression, and loss of 17p, respectively (57, 58). other aberrations, such as trisomy 19, trisomy 21, trisomy 17, and deletion of 7, have been reported in less than 10% of patients with clonal evolution. it has been reported that cml - cp patients harbor 0.47 copy number alterations per case (range 0 - 8), but cml - bp patients carry 7.8 copy number alterations (range 0 - 28), supporting the notion that multiple genomic alterations accumulate during cml progression to bp phase (59). clonal evolution is associated with reduced response to imatinib, increase in relapse of disease, and reduction in overall survival (60, 61). it is proposed that clonal evolution reflects the genomic instability of the highly proliferative cml progenitor cells associated with disease progression. the frequency of clonal evolution increases with advancing stage, from 30% in accelerated phase to 80% in blast phase (55). cml stem cells originate from hematopoietic stem cells (hscs) by acquiring the bcr - abl1 mutation. this fusion oncoprotein can transform hscs, but is not sufficient to transform committed myeloid progenitors which lack inherent self - renewal capability (62). cml stem cells are cd/ cd cells which have entered the g0 phase of the cell cycle and are therefore quiescent. these cells account for less than 1% of cd cells present at diagnosis (15). it is postulated that this quiescent fraction sustains the disease with constant potential to aggravation. during transition from chronic phase to blast phase, cml stem cells acquire further genetic and/or epigenetic aberrations that provide survival advantage and resistance to programmed cell death. the resistance of quiescent stem cells to tki seems to be multifactorial and include altered drug influx and efflux (decreased expression of oct1 and increased expression of abcb1 and abcg2) (63), increased bcr - abl1 transcript level and decreased degradation of bcr - abl1 transcript (15). crkl phosphorylation is a downstream target of bcr - abl1 and dasatinib, contrary to imatinib, can inhibit its phosphorylation in cd cd cells. dasatinib can also inhibit an earlier progenitor population, but is unable to eradicate the most primitive quiescent stem cells (15, 64). the breakpoints within the abl1 gene occurs either upstream of exon 1b, downstream of exon 1a, or more frequently, between exons 1b and 1a (figure 1 a). in most patients with cml, the breakpoints within the bcr gene take place in a 5.8-kilobase area spanning exons 12 - 16, referred to as the major breakpoint cluster region (m - bcr) (figure 1 b) (1). 1a, the abl1 gene is located on chromosome 9q34 and spans more than 230 kb. it contains two alternative first exons, exon 1b and 1a, followed by exons 2 to 11. the breakpoints that create the philadelphia chromosome, are scattered over a large area (more than 300 kb) at the 5 end of the gene, either upstream of alternative exon 1b, between alternative exons 1b and 1a, or between exons 1a and 2. the breakpoint is in the major breakpoint cluster region that spans exons 12 - 16. the n - terminal coiled - coil domain of bcr - abl1 has dimerization and trans - autophosphorylation activity (18). autophosphorylation of tyrosine-177 of bcr - abl1 results in formation of a complex between grb2, gab2, and sos, leading to activation of ras and phosphatidylinositol 3-kinase (pi3k) pathways (19). signaling from ras - raf - mek - mapk pathway pi3k activates the serine - threonine kinase akt, which results in : 1, promoting survival by inhibiting foxo transcription factors (20) ; 2, activation of mtor which increases protein translation (21) ; and 3, increasing the expression of skp2, the recognition protein of scf e3 ubiquitin ligase, which degrades p27 and results in enhanced proliferation (22). another crucial consequence of bcr - abl activation is stat5 activation, either through direct phosphorylation or indirectly through phosphorylation by jak2 or hck (23). lack of stat5 inhibits both myeloid and lymphoid leukemogenesis (24) (figure 2). dimerization of bcr - abl1 induces autophosphorylation and activation of the kinase, generating docking sites for adaptor proteins like grb2. this signaling pathway results in activation of multiple downstream targets, leading to increased proliferation, enhanced survival, and perturbation of cell adhesion and migration. imatinib, dasatinib, and nilotinib bind to the atp - binding pocket of the abl kinase domain and inhibit bcr - abl activity (25 - 27). imatinib binds to the inactive conformation of bcr - abl, and prevents conformational changes needed for bcr - abl activation (25). nilotinib was developed by changing the structure of imatinib and binds to bcr - abl with a higher affinity. nilotinib is 10 to 50 times more potent than imatinib for inhibiting bcr - abl (26). dasatinib has a different chemical structure and binds to a slightly different region of the atp- binding pocket. dasatinib binds to the active conformation of bcr - abl and is 325 fold more potent than imatinib and 16 fold more potent than nilotinib (27). complete hematologic response is assessed by analysis of peripheral blood counts. conventional cytogenetic analysis of bone marrow aspirates is performed by assessing ph positivity in at least 20 giemsa- stained metaphase cells. complete cytogenetic response (ccyr) is defined as the absence of detectable ph+ metaphase cells, which is a clinically important prognostic marker in cml patients. in patients without complete cytogenetic response, the degree of cytogenetic response is classified as partial (1% - 35% ph metaphase cells), major (0% - 35% ph metaphase cells), or minor (> 35% ph metaphase cells). a limitation of cytogenetic testing is the need for an invasive bone marrow biopsy to culture cells and obtain metaphase spreads. furthermore, the limit of detection of this method is relatively low, because a minimum of 20 metaphase cells are analyzed (1:20 or 5%). however, cytogenetic testing has the advantage of detecting, in addition to philadelphia chromosome, other chromosomal abnormalities which may have prognostic value (28). a more sensitive detection method is to assess peripheral blood interphase cells with fluorescence in situ hybridization (fish), thereby analyzing a higher number of cells in comparison with conventional cytogenetic testing. approximately, 100 to 500 interphase cells are usually assessed with fish, so this method is more sensitive (1:500 to 1:100, or 0.2% to 1%). however depending on the probes used, fish can have a false - positive rate of 1% to 10%. fish method can be used for monitoring response to therapy until fish levels are less than 5% to 10%. this method is not useful for analyzing further reduction in ph metaphases (28). real - time quantitative pcr is an effective and clinically validated method to quantify bcr - abl1 transcript levels and assess molecular responses. guidelines from national comprehensive cancer network (nccn) and european leukemianet (eln) recommend serial bcr - abl1 rt - qpcr assays at regular 3 to 6-month intervals for routine minimal residual disease (mrd) monitoring of cml treatment (28, 29). molecular monitoring includes rna extraction from a bone marrow or peripheral blood sample and subsequent rt - qpcr to measure the level of bcr - abl1 transcripts relative to a reference gene. in comparison with cytogenetic testing, pcr - based molecular monitoring offers exquisite sensitivity, almost 100 to 1000 times greater than fish or conventional cytogenetic analysis. it can assess bone marrow or peripheral blood samples, and provides quantitative results with validated clinical response thresholds (30, 31). a significant proportion of cml patients do not achieve a satisfactory response to first - line tki therapy, which is mostly due to drug resistance. tki resistance is classified as primary (lack of initial response to tki) or acquired (loss of response). primary imatinib resistance is defined as failure to achieve any of the following criteria : a complete hematologic response (chr) within 3 to 6 months, any cytogenetic response (cyr) by 6 months, a major cytogenetic response (mcyr) by 12 months or a complete cytogenetic response (ccyr) by 18 months on imatinib treatment. primary hematologic resistance is very rare in newly diagnosed cml - cp patients, whereas primary cytogenetic resistance is seen in 15% to 25% of patients. suboptimal response is defined as : no cyr at 3 months, less than mcyr at 6 months, less than ccyr at 12 months, or less than major molecular response at 18 months. acquired resistance is defined as loss of chr or ccyr or progression of cml at any time on treatment (28, 29, 32). it has been shown that the risk of imatinib resistance varies depending on cml phase : the risk is lowest in cml - cp and highest in cml - bp (4, 33). mutations in the abl1 tyrosine kinase domain of bcr - abl1 are responsible for a substantial proportion of imatinib resistance. bcr - abl1 mutations have been detected in 35% - 45% of cml patients with imatinib resistance (4, 34, 35). these mutations are more frequently found in patients with acquired resistance rather than primary resistance (36). furthermore, bcr - abl1 mutations occur more often in patients with advanced cml compared to cml - cp (37). less frequently, amplification of bcr - abl1 gene or increased bcr - abl1 expression can also lead to tki resistance (34, 38). bcr - abl1 independent mechanisms include activation of the src family of kinases, cytogenetic clonal evolutions with emergence of additional chromosomal abnormalities in ph cml cells, or the presence of quiescent stem cells may also contribute to tki resistance (34, 39). point mutations in the abl1 kinase domain are the most frequent mechanism of tki resistance. these mutations impair drug binding by changing essential amino acids for direct contact with the tki or by preventing bcr - abl1 from adopting the inactive conformation appropriate for tki binding. the t315i mutation is one of the most frequent mutations detected in 4% to 19% of resistant cases (37, 40). some investigators have suggested that t315i is associated with disease progression and poor survival (40, 41) different mutations in the abl1 kinase domain have been classified into four categories : a, in the imatinib binding site ; b, in the p - loop (atp binding site) ; c, in the catalytic domain ; d, in the activation (a) loop. mutations in the p - loop (residues 244 - 255 of abl1) accounts for about 48% of all mutations in imatinib resistant cases, a worse prognosis regardless of sensitivity to imatinib (42 - 44). mutations in the catalytic domain (residues 350 - 363 of abl1) can also affect imatinib binding. the activation loop is the major regulatory component of abl1 kinase domain and can adopt an open - active or closed - inactive conformation. mutations in the activation loop impair adopting the inactive conformation which is required for imatinib activity. amino acid substitutions at seven residues [m244v, g250e, y253f / h, e255k / v (p - loop), t315i (imatinib binding site), m351 t, and f359v (catalytic domain) ] account for 85% of all resistance associated mutations (36, 45). although point mutations have more frequently been detected in tki resistant and advanced cml, they have also been detected prior to tki treatment. these findings suggest that prior to tki therapy ; these mutations do not confer a survival advantage (46). it is unclear whether certain mutations are responsible for cml progression or they are a consequence of genomic instability in advanced disease (47). it seems that gain of function mutations may contribute to cml progression, whereas loss of function mutations are frequently subject to selective pressure by imatinib (48, 49). table 2 summarizes in vitro sensitivity of bcr - abl1 kinase domain mutations to imatinib, nilotinib and dasatinib. although nilotinib and dasatinib inhibit most of the clinically relevant abl1 mutations, with the exception of t315i mutation, the presence of mutations after imatinib failure as well as development of new mutations on subsequent tki treatment is a potential source of resistance to successive tki (50 - 53). it has been shown that in imatinib - resistant patients, subsequently treated with an alternative tki, 83% of cases after an initial response are associated with emergence of newly acquired mutations. patients already harboring imatinib - resistant kinase domain mutations, had higher likelihood of relapse associated with development of further mutations compared to patients who did not have mutations (54). the presence of additional chromosomal abnormalities besides ph chromosome is defined as clonal evolution and is considered to be a feature of advanced cml (55). the most frequent chromosomal abnormalities include, in order, an additional ph chromosome (38%), trisomy 8 (34%), and isochromosome 17q (56) ; which have been associated with bcr - abl1 overexpression, myc overexpression, and loss of 17p, respectively (57, 58). other aberrations, such as trisomy 19, trisomy 21, trisomy 17, and deletion of 7, have been reported in less than 10% of patients with clonal evolution. it has been reported that cml - cp patients harbor 0.47 copy number alterations per case (range 0 - 8), but cml - bp patients carry 7.8 copy number alterations (range 0 - 28), supporting the notion that multiple genomic alterations accumulate during cml progression to bp phase (59). clonal evolution is associated with reduced response to imatinib, increase in relapse of disease, and reduction in overall survival (60, 61). it is proposed that clonal evolution reflects the genomic instability of the highly proliferative cml progenitor cells associated with disease progression. the frequency of clonal evolution increases with advancing stage, from 30% in accelerated phase to 80% in blast phase (55). cml stem cells originate from hematopoietic stem cells (hscs) by acquiring the bcr - abl1 mutation. this fusion oncoprotein can transform hscs, but is not sufficient to transform committed myeloid progenitors which lack inherent self - renewal capability (62). cml stem cells are cd/ cd cells which have entered the g0 phase of the cell cycle and are therefore quiescent. these cells account for less than 1% of cd cells present at diagnosis (15). it is postulated that this quiescent fraction sustains the disease with constant potential to aggravation. during transition from chronic phase to blast phase, cml stem cells acquire further genetic and/or epigenetic aberrations that provide survival advantage and resistance to programmed cell death. the resistance of quiescent stem cells to tki seems to be multifactorial and include altered drug influx and efflux (decreased expression of oct1 and increased expression of abcb1 and abcg2) (63), increased bcr - abl1 transcript level and decreased degradation of bcr - abl1 transcript (15). crkl phosphorylation is a downstream target of bcr - abl1 and dasatinib, contrary to imatinib, can inhibit its phosphorylation in cd cd cells. dasatinib can also inhibit an earlier progenitor population, but is unable to eradicate the most primitive quiescent stem cells (15, 64). the emphasis is currently on overcoming imatinib resistance and the development of alternative tki engineered to surmount this problem. combination of tkis and different targeting agents, including those targeting self - renewal and those inducing apoptosis increases the efficacy of tkis on cml cells. a better understanding of the mechanisms that underlie tki resistance, progression to bp, genomic instability and stem cell quiescence is essential to develop curative strategies for patients with cml. | context : chronic myeloid leukemia (cml) is a myeloproliferative disorder characterized by overproduction of immature and matured myeloid cells in the peripheral blood, bone marrow and spleen.evidence acquisition : a hallmark of cml is the presence of (9 ; 22) (q34 ; q11) reciprocal translocation, which is cytogenetically visible as philadelphia chromosome (ph) and results in the formation of bcr - abl1 fusion protein. this fusion protein is a constitutively active tyrosine kinase which is necessary and sufficient for malignant transformation. the introduction of imatinib, a bcr - abl1- targeting tyrosine kinase inhibitor (tki) has revolutionized cml therapy. subsequently, two other tkis with increased activity against bcr - abl1, dasatinib and nilotinib, were developed and approved for cml patients. nevertheless, cml therapy faces major challenges.results:the first is the development of resistance to bcr - abl1 inhibitors in some patients, which can be due to bcr - abl1 overexpression, differences in cellular drug influx and efflux, activation of alternative signaling pathways, or emergence of bcr - abl1 kinase domain mutations during tki treatment. the second is the limited efficiency of bcr - abl1-tkis in blast crisis (bc) cml. the third is the insensitivity of cml stem cells to bcr - abl1 inhibitors. conventional chemotherapeutics and bcr - abl1 inhibitors which act by inhibiting cell proliferation and inducing apoptosis, are ineffective against quiescent cml stem cells.conclusions:a better understanding of the mechanisms that underlie tki resistance, progression to bc, genomic instability and stem cell quiescence is essential to develop curative strategies for patients with cml. |
preeclampsia is defined as increase in systolic blood pressure 140 mmhg or diastolic 90 mmhg and proteinuria 300 mg protein/24 hours urine and starts after 20 weeks of pregnancy. eclampsia is the condition in which generalized seizure occur in the absence of other neurologic defects. preeclampsia and eclampsia are among the common causes of death and disability in pregnant women and are associated with increased vascular resistance and decreased uteroplacental perfusion. it is characterized by vascular contraction, lesions in the placenta and umbilical arteries, high blood pressure, proteinuria, and seizure. maternal complications include acute renal failure, liver damage, intracerebral hemorrhage, pulmonary edema, and death. fetus complications are preterm birth or intrauterine growth restriction.[35 ] magnesium sulfate (mgso4) is used for the treatment of severe preeclampsia and can help prevent serious complications. effect of mgso4 on cerebral vessels are still controversial and it is unclear whether it reduces cerebrovascular vasospasm. studies in this area are still ongoing.[811 ] the mechanism of action may include changes in vascular permeability and reduction of edema. it seems to have no adverse effects on the fetus, but in response to mgso4 injection, fetal brain perfusion may also alter. in pregnancy, usually umbilical artery is tested by doppler ultrasound but some recent studies also test maternal and fetal middle cerebral arteries (mca).[1417 ] in one study, the reference value of resistive index (ri) and pulsatility index (pi) have been investigated in iranian patients. the ratio of middle cerebral artery / umbilical artery (c / u ratio) can be a good indicator of fetal prognosis and fetal well - being.[1620 ] doppler ultrasound is a useful tool for studying pathophysiological mechanisms that can affect the fetal hemodynamic status. assessing the changes in the arteries with doppler ultrasound can show the adaptation of fetus to the situation. investigating the mechanism of action of mgso4 on the fetus is one of the important issues in this disease. the purpose of this study is to evaluate the effect of mgso4 in severe preeclampsia on fetal middle cerebral artery and umbilical artery using doppler parameters. prior to the intervention, doppler ultrasound was used to evaluate the fetal middle cerebral and umbilical arteries of the patients. patients with severe preeclampsia who attended imam reza hospital, kermanshah iran during the period 2011 - 2012 were included in the study. inclusion criteria were : age in the range of 20 - 35 years, first pregnancy, gestational age above 28 weeks, systolic blood pressure 140 mmhg, and diastolic pressure 90 mmhg with the proteinuria of at least 300 mg in 24 hour urine or having urinary protein level + 2, and epigastric pain. exclusion criteria were : any type of systemic disease (e.g., diabetes, hypertension, and autoimmune disorders), history of taking opium, smoking, twin pregnancy, and history of taking specific drugs. during the study period 21 the goal of the study and the method were described to all patients and written consent form was taken prior to the initiation of study. after admission of the patient in a room that had cardiopulmonary resuscitation (cpr) facilities, a radiologist recorded the color doppler ultrasound of fetal umbilical and mca, using a siemens ultrasound device (germany), model g40, with a deep probe of 3/5 - 5 mhz. the mean ri and pi of mca from the proximal part of two mca arteries (left and right) and the c / u ratio (middle cerebral artery ri / umbilical artery ri) were evaluated. ri = peak systolic velocity - end diastolic velocity / peak systolic velocity pi = peak systolic velocity - end diastolic velocity / mean velocity after initial assessment, a gynecologist injected the primary and maintenance dose of mgso4. the primary dose had 14 g of mgso4 of which 4 g in the form of a 20% solution was injected intravenously for at least 4 min and then immediately 10 g of mgso4 in the form of 50% solution was injected muscularly. twenty minutes after intravenous injection (4 g), doppler ultrasound was again performed to measure blood flow in fetal mca and umbilical arteries. chicago, il, usa). kolmogrov - smirnov test was used to prove the normal distribution of variables and all variables had normal distribution. then the before and after intervention values were compared by paired t - test. in the 21 patients studied, average ri - umbilical before and after the intervention were 0.72 (0.1) and 0.62 (0.09), respectively, which showed a statistically significant decrease (p < 0.001). the before and after pi - umbilical values were 1.35 (0.47) and 1.28 (0.49), respectively, which was not a significant change (p = 0.1). in addition, the average before and after ri - mca were 0.71 (0.16) and 0.71 (0.11), respectively, and this particular index did not show any significant change (p = 0.96). but, a statistically significant decrease (p = 0.001) was observed in the average amount of before pi - mca 1.63 (0.84) and the after value 1.47 (0.69). according to calculations, the before c / u ratio value was 1 (0.26) and the after value was 1.17 (0.29), which showed a statistically significant increase (p < 0.001) [figure 1 ]. the power of the test to compare before and after pi - umbilical values was calculated as 61.6% and 33.3% for ri - mca. comparison of resistivity index (ri) and pulsatility index (pi) of umbilical and middle cerebral artery and c / u ratio before and after 20 min of administering magnesium sulfate (mgso4) injection. this study investigated the effect of administration of mgso4 in severe preeclampsia cases on fetal umbilical and mca blood flow. based on the results of this study, the injection of mgso4 could significantly decrease the ri - umbilical, pi - mca, and increase c / u ratio. fetal distress caused by hypoxia is one of the effects of preeclampsia on the fetus. inadequate placental perfusion can cause fetal reduction of oxygen supply, and thus lead to fetal distress. several studies have shown the medical effects of mgso4 in treating patients with preeclampsia and eclampsia. souza, assessed fetal mca and umbilical artery doppler parameters and measured these parameters 20 min after injection of mgso4. they showed that umbilical and mca ri and pi values are significantly reduced. while in our study these parameters showed no significant change. in addition, another study showed the reduction of pi in the fetal umbilical artery and mca due to the injection of mgso4. in dasgupta 's study, when compared with control group, the umbilical artery pi value decreased, but the fetal mca - pi did not change significantly. in another study, the impaired perfusion in fetal mca can be associated with hypoxia and fetal complications. in our study, after injection of mgso4, c / u ratio had a significant increase, which shows that the fetal blood supply had improved. various studies confirmed the efficacy of doppler ultrasound examination for assessing the vascular status of the fetus and have introduced the c / u ratio as a parameter in assessing fetal blood supply. the c / u ratio shows both inadequate fetal circulation and changes and adaptations in the artery. hence, this drug (mgso4) can cause vasodilatation in the fetal umbilical artery. the fetal mca resistance increases in normal pregnancy slightly and the increase is more substantial in preeclampsia and eclampsia. the administration of mgso4, therefore, can have beneficial effects on the fetus and can increase perfusion. c / u ratio is a good indicator for assessing the growth and prognosis of the fetus, while the fetal mca alone does not have the same value. however, due to the special status of patients with severe preeclampsia, there are inevitable limitations in the design of this study and similar studies. the small sample size was another limitation, which reduced the test power of pi - umbilical and ri - mca to less than 80%. the lack of significant statistical differences in these two indicators might result from the small sample size of patients. results of our study and studies of others indicate more extensive studies with larger patient numbers are required to be conducted and if possible a meta - analysis of the results of all existing studies to confirm conclusions about the effects of mgso4 on fetal blood flow is also essential. infusion of mgso4 significantly decreases the fetal ri - umbilical and pi - mca and increases c / u ratio indices obtained with color doppler ultrasound evaluations. | objective : to assess the effect of injecting magnesium sulfate on doppler parameters of fetal umbilical and middle cerebral arteries (mca) in women with severe preeclampsia.materials and methods : a total of 21 patients with severe preeclampsia admitted to imam reza hospital, kermanshah (iran), were evaluated. before and after administration of magnesium sulfate, doppler ultrasound scan was carried out to measure fetal middle cerebral artery and umbilical artery blood flow. paired t - test was used for statistical analysis.results:after injection of magnesium sulfate, the mean resistivity index (ri)-umbilical, and pulsatility index (pi)-cerebral showed a statistically significant reduction (p < 0.001). the cerebroumbilical c / u ratio increased after the intervention (p < 0.001). the pi - umbilical (p = 0.1) and pre- and post - ri - cerebral (p = 0.96) did not have statistically significant changes.conclusions:infusion of magnesium sulfate significantly decreases the flow in the fetus ri - umbilical and pi - mca, and it increases c / u ratio indices in color doppler ultrasound. |
child bearing is one of the hazardous experiences that women engage in while bringing new life to this world. it is often associated with complications that may cause morbidities, disabilities, and mortalities. world health organization (who) estimates that more than half a million women lose their lives in the process of reproduction worldwide every year ; of these deaths, about 99 percent are from developing countries. the share of sub - saharan africa from the total death toll for developing countries is more than fifty percent and lifetime risk of dying from pregnancy is extremely high ; that is, for every 26 mothers, one mother dies as the result of pregnancy and childbirth in sub - saharan africa. this frequency is about 281 times more than the maternal death in more developed countries in which one mother dies from 7300 mothers. in addition to the risk of dying during pregnancy and childbirth, many more women suffer from short and long - term maternal disabilities and illness. according to who (2001) for every maternal death, an estimated 30 to 50 women suffer pregnancy related health problems such as vesicovaginal fistulae, infertility, and depression that can be permanently debilitating. globally more than 70 percent of maternal deaths are due to five major complications (which are direct obstetric complications) : hemorrhage (25 percent), infection (15 percent), complication of unsafe abortion (13 percent), hypertension (12 percent), and obstructed labor (8 percent). this complication can occur at any time during pregnancy and childbirth, often without fore warding and often requiring immediate access to emergency obstetric care for their management. the world bank estimates that 74 percent of maternal deaths could be averted if all women had access to interventions that address complications of pregnancy and childbirth, especially emergency obstetric care. similarly, studies that focused on maternal morbidity and mortality in developing countries have repeatedly recommended the need for antenatal care and availability of trained personnel to attend women during labor and delivery. anc provides avenue to provide pregnant women with information, treat existing social and medical conditions, and screen for risk factors. however, it is not enough to receive anc, since majority of the fatal complications occur during or shortly after delivery. it is therefore important that pregnant women have skilled obstetric attendance during delivery. however, utilization of these services in most developing countries is constrained due to various cultural, socioeconomic, and demographic factors. as the result disparities between developed and developing countries in terms of utilization of antenatal, delivery, and postnatal services are unfairly large, in developed countries, it is estimated that about 97 percent of the pregnant women receive anc and 99 percent use skilled obstetric service at delivery, whereas in developing countries, only 65 percent and 53 percent of women use anc and skilled obstetric care services, respectively. ethiopia is one of the sub - saharan african countries that experience the highest maternal mortality ratios in the world ; that is, 673 per 100,000 live births and more than fourteen thousand mothers die as the result of pregnancy and related causes each year. in addition, more than 400,000 suffer long - term disabilities due to complications during pregnancy, delivery, or postpartum periods. the use of anc, delivery, and postnatal services by ethiopian women is one of the lowest in the world. almost all births take place at home in ethiopia (94 percent) with only six percent of women delivering in heath institutions. attendance of prenatal care is very low ; only 28 percent of all ethiopian mothers received prenatal care from a trained heath professional. the quality and frequency of this care are variable ; many women receive the care either too late or too few times in their pregnancy. most maternal mortalities and disabilities in the country are due to direct obstetric complications, which are avoidable if women can get adequate and timely antenatal, delivery, and postdelivery services. the major causes of maternal death are abortion (32 percent), obstructed labor (22 percent), hypertension (9 percent), sepsis (12 percent), haemorrhage (10 percent), and others (15 percent). reducing maternal morbidities and mortalities is the issue that is given due attention by ethiopia as the ethiopian government is among the first african governments to make a strong commitment to the united nations inspired millennium development goals (mdgs) by making one of the mdg targets, maternal health, central to its national development strategy, that is, reducing maternal mortality by three quarters between 1990 and 2015, which would mean reducing to 250/100,000 live births by 2015 from the 1990 estimate of 990 [10, 11 ]. however, in spite of the concerted efforts of the ethiopian government, the level of maternal mortality is not reduced as desired. the 2011edhs, for instance, estimates the maternal mortality to be 676 maternal deaths per 100,000 live births. similarly, regional variations in terms of the level of utilizing maternal health care services are very high. the uses of these services in oromia national regional state are relatively low compared to other regions in the country and the factors for this low utilization in the region in general and for the various parts of this region are not well examined. the situation of maternal health care utilization in oromia national regional state in which the current research is done is low even compared to the national level. the 2005edhs shows that the proportion of mothers who received anc, delivered at health institutions, delivered with assistance of health professionals, and made postnatal checkup was 24.8, 4.3, 4.8, and 4.5 percent, respectively, for oromia national regional state, while it was 27.6, 5.3, 6.0, and 5.5 percent, respectively, for the country as a whole. moreover, utilization of maternal health care services was lower for oromia national regional state compared to other regions in the country. for example, the use of both delivery and postnatal care services was lower for oromia region compared to addis ababa, gambella, harari, and dire dawa regions. the use of antenatal care was higher for urban women (69 percent) than their counterparts in rural areas (23.7 percent). in general the variations in utilizing maternal health care services and factors affecting its utilization varied by geographic area and socioeconomic and cultural settings in the country which calls for investigation of area and culture specific determinants of maternal health care utilization. however, the magnitude of utilization of maternal health care services and factors affecting it are not investigated in eastern hararghe zone in general and kombolcha district in particular while this part of the country has its own peculiar geographic, socioeconomic, and cultural setting which might affect utilization of these services. studies trying to explore factors affecting utilization of maternal health care services in eastern hararghe zone in general and kombolcha district in particular are very scanty and it is this knowledge gap that leads us to initiate this study. thus, identifying factors specific to each area so as to identify area specific measures that can help minimize the hindrances is very crucial. the purpose of this research is therefore to identify the major factors that influence the utilization of maternal health care services in kombolcha district, eastern hararghe zone, oromia regional state. studies have been done to explore the determinants of maternal health care services utilization in the different parts of the country and these studies have shown that the magnitude of maternal health care services utilization varied by geographic areas and socioeconomic and cultural settings, and similarly the factors determining the utilization of these services varied by geographic area and socioeconomic and cultural settings. eastern hararghe zone of oromia region in general and kombolcha district in particular is the area where the factors that determine utilization of maternal health care services are not assessed and the level of utilization of these services is not examined. thus, identifying factors peculiar to a given geographic area and socioeconomic and cultural settings is crucial for understanding community level determinants of maternal health care service utilization. the potential beneficiaries of the results of this study are the society in general and women and children in particular as the interventions made on maternal health care services improve the utilization of these services. moreover, governmental and nongovernmental organizations working on maternal and child health care may use the results of this study as an input in their planning for improving maternal and child health. the general objective of this study was to assess the factors that affect utilization of maternal health care services and to suggest relevant recommendations that enable the concerned bodies to design relevant intervention strategies in kombolcha district. a community based cross - sectional study design that employed quantitative data collection method was carried out to assess factors affecting utilization of maternal health care services in june 2012 in kombolcha district, eastern hararghe zone, eastern ethiopia. its capital city, melkarafu, is located at a distance of 18 kms from harar town to the north direction. the district had 20 kebeles of which three were urban and 17 were rural. in 2007/2008, the total population of the district was 104,248 of which about 51% were males, while 49% were females. in 2007/2008, there were 13 clinics, 11 health posts, one health center, and one drug shop. the study populations were women of reproductive age (1549 years) who gave at least one live birth in the five years prior to the survey date and who were the usual residents of the district. the sample size was determined using the formula of cochran n = zpq / d. thus, taking the prevalence of one of the major parameters in this study, that is, antenatal care utilization, which was 24.8 percent (0.25) for oromia regional state, the sample size was determined. the estimate of the sample in this study was desired to be precise at confidence level of 95 percent and margin of error of four percent (d). then, using the formula n = zpq / d, the sample was determined to be (1.96)(0.25) (0.75)/(0.04) = 450. adding 10 percent allowance for nonresponse, the total sample size was determined to be 495. to identify the study units, the district was first stratified into urban and rural areas and one urban and five rural kebeles were selected from the district using simple random sampling technique. then lists of eligible women who live in the selected kebeles were obtained from kebele health extension workers registration books. a probability sample proportional to the population size technique was used to determine the number of respondents that were selected from each kebele. finally, the respondents included in the study from each kebele were identified by using simple random sampling technique. it was further developed after reviewing of relevant literatures that address the objectives of the study. after extensive revision, the final version of the english questionnaire was developed and translated to the local language, that is, afaan oromo, to make the communication between the data collectors and respondents easy. pretesting of the questionnaire was made in rural kebele adjacent to the study area, that is, haramaya kebele, which has similar sociodemographic setting with the study population. ten data collectors who completed minimum of grade ten and can speak local language and two nurses with diploma for supervision were recruited, trained, and assigned as data collectors and supervisors, respectively. in collecting the data, the outcome variables in this study are antenatal and delivery care services utilization for which the categories are either use or nonuse of the services. the independent variables were categorized into demographic which include age of women and their husbands, marital status, and place of residence and socioeconomic which includes education of women and their husbands, occupation of women and their husbands, religion of women and their husbands, women 's knowledge / attitude towards maternal health care services, availability, and accessibility of maternal health care services, women 's perception of quality of services, and cost of transportation and services. the data was entered using epi info version 3.51 and finally was exported to spss version 16.0 for analysis. frequencies and summary statistics such as means, standard deviations, percentages, and ranges were computed to describe the study population in relation to relevant variables. the association and significance between the dependent and independent variables were measured using binary logistic regression analysis. the ethical clearance was obtained from haramaya university, college of health sciences research ethics review committee. the survey was commenced after obtaining permission from eastern hararghe zonal health department and district council. a total of 495 women were included in this study to investigate the factors that influence utilization of maternal health care services. all of the respondents were muslims in religion, more than 95 percent were married, and more than 60 percent were housewives. the majority of respondents were illiterate (71.9%) and primary level (grades 1 to 8) educated constituted 26.3%. the majority of respondents were in the age category from 20 to 34 which is the peak reproductive age category and about 93.3 percent of the respondents lied in this age category. more than 95 percent of the respondents have access to health facility in their own kebele while only 1.8 percent of respondents have no access to health facility in their own kebeles. of these 35.5% started attending anc in the first trimester, 46.2% in the second trimester, and the remaining 18.3% in the third trimester. out of 426 mothers who received anc for their recent pregnancy, 263 (61.7%) made less than four visits while 163 (38.3%) made four and more anc visits during the course of their recent pregnancy. only 25.3% of respondents gave birth in health institutions for their recent birth with the help of health professionals while majority (74.7%) of respondents gave birth at home without the help of health professionals. rural women were less likely to use institutional delivery, 20.9%, as compared to urban women, 35.9%. those women who delivered at home were asked why they preferred home and their reasons were as follows : easy labor 281 (75.9%), feeling shame to go to health institutions 42 (11.4%), health facility being far 36 (9.7%), and other reasons 11 (3.0%). of those who gave birth at home, 255 (69.1%) were attended by ttba 's followed by neighbors 103 (27.9%) and the remaining 12 (3.0%) by others. those women who delivered at health institution were asked why they prefer health institution and their reasons were as follows : being sick 32 (25.6%), received health education 37 (29.6%), saving mother 's life 31 (24.8%), good service 15 (12.0%), no fee 6 (4.8%), and other reasons 4 (3.2%). of those who gave birth at health institutions 52 (41.3%) were attended by midwifes, followed by nurses 34 (27.0%), medical doctors 17 (13.5%), health extension workers 4 (3.2%), health officers 2 (1.6%), and do not remember 16 (13.5). about 92.1% of husbands of respondents lied in the age category from 25 to 44 years. the major occupation of husbands was farming (90.1%) followed by merchant (7.3%) and the remaining occupations constitute less than three percent. the majority of husbands were illiterate (51.7%) and primary level (grades 1 to 8) educated constituted 44.6%. the bivariate analysis of factors affecting attendance of anc indicated that age of women, education of women, health education on maternity of women, presence of health facility in the kebele, family size of the household, history of abortion / still birth, means of transport to the nearest health facility, perception of women to the quality of maternal services, and rural - urban residence were found to be significant predictors of anc utilization. on the other hand, the bivariate analysis of factors affecting delivery at health institution indicated that occupation of women, education of women, occupation of husband, education of husband, family member / s education, household family size, history of difficult labor, means of transport to the nearest health facility, women 's perception of quality of maternal services, and rural - urban residence to be significant predictors of utilization of institutional delivery. to examine the net effect of the variables on anc and institutional delivery utilization by controlling for the confounders, two models were fitted, that is, one for anc utilization and one for institutional delivery. as the result, the variables such as age and education of mothers and perception of mothers to quality of maternal services provided were found to be significant predictors of anc utilization (see table 1 for detail). the results of logistic regression for institutional delivery on the other hand showed that variables like occupation of mothers and their husbands, education of husbands, history of difficult labor, and so forth were found to be significant predictors of institutional delivery (see table 2 for detail). 61.7% of mothers had less than four visits and 46.2% of mothers started attending anc in the second trimester. the finding differs from edhs 2011 in which 34% of mothers received anc from skilled providers for their recent births. but this finding is consistent with the findings of the study done by zeine. in hadiya zone in 2009 in which 86.3% of women made at least one anc visit during the course of their recent pregnancy. about 38.3% of mothers made four and more anc visits which is higher than the national level in 2011 in which only 19% of mothers made four and more anc visits. demographic and socioeconomic variables such as age of women, education of women and their husbands, receiving health education on maternity, presence of health facility in the kebele, presence of family member / s attending formal school, family size, history of abortion / still birth, history of difficult labor, means of transport, perception of quality of maternal services, and rural - urban residence were found to be strongly related to maternal health care services utilization. in this study, education of women and their husbands remained strong predictor of maternal health care services utilization and these results are consistent with the findings elsewhere [1618 ]. women engaged in farming and merchant activities were more likely to use institutional delivery compared to housewives. similarly, women married to merchants and others were more likely to use institutional delivery compared to women married to farmers. mothers who previously experienced obstructed labor were found to be higher users of maternal health care services. similarly, mothers who previously experienced abortion / still birth were better users of maternal health care services than mothers who did not. this could be because of the fact that mothers who had history of obstructed labor / abortion / still birth have practical experience about the dangers associated with pregnancy and childbirth than those who did not and this could motivate them to receive anc and give birth at health facility. those women with low level of education, women married to husbands with low level of education, women who are unemployed and married to farmers, women from household with no family member attending formal school, women who never experienced difficult labor, abortion / still birth, women who use foot as means of transport, and women who perceived the quality services provided to be low quality and residing in rural areas were greatly disadvantaged in utilizing maternal health care services. thus, improving education of the population in general and women and girls in particular and availing appropriate package of maternal services to the disadvantaged groups could be an appropriate strategy to utilization of maternal health care services in the area. lack of awareness about the dangers associated with pregnancy and childbirth and the feeling that labor is easy at home and feeling shame to go to health institutions for delivery are some of the factors that affect maternal health care services utilization in the study area. thus, concerted efforts should be made by the concerned stakeholders to teach the negative effects of these attitudes through mobilization activities. perception of mothers to the quality of services provided is the other factor influencing it. this could be because of absence of adequate information about the services provided in the health institutions and hence provision of information should be strengthened by the concerned governmental and nongovernmental organizations so as to encourage mothers to utilize maternal health care services. | introduction. world health organization estimates that more than half a million women lose their lives in the process of reproduction worldwide every year and most of these mortalities are avoidable if mothers have access to maternal health care services. objectives. this study was conducted with objectives of determining the prevalence of utilization of maternal health care services and identifying factors affecting it. methodology. a community based cross - sectional survey was conducted in six kebeles of kombolcha district. a total of 495 women of reproductive age participated in the study and their selection was made using simple random sampling technique and data was collected using an interviewer - administered structured questionnaire. the data was analyzed using spss version 16. results. a total of 495 women were included in this study and from these women about 86.1% had at least one anc visit during their last pregnancy. about 61.7% of mothers had less than four visits which is less than the recommended and 46.2% started it in the second trimester. only 25.3% of respondents gave birth in health institutions and rural women were less likely to use institutional delivery 20.9% compared to urban women 35.9%. recommendations. more efforts should be given to educate society in general and mothers in particular, to strengthen community participation and to increase the accessibility of maternal health care services. moreover, providing accurate information about the services provided in the health institutions is required from the concerned governmental and nongovernmental organizations. |
a 61-year - old white woman with aquaporin-4 immunoglobulin (ig) g antibody seropositive nmo had 10 clinical relapses in the first 4 years of her disease despite treatment with iv pulse cyclophosphamide, chronic glucocorticoids (up to 60 mg / day prednisone), mycophenolate mofetil (up to 3,000 mg / day), rituximab (2,000 mg iv, divided doses), and multiple courses of pulsed high - dose glucocorticoids and plasma exchange for acute flares. relapses included 8 episodes of myelitis, one episode of intractable hiccups, and one episode of postchiasmal visual pathway injury. functional recovery was poor, and her expanded disability status scale score ranged from 7.5 to 8.0 (severely paraparetic, essentially restricted to a wheelchair much of the day, preserved cognition). alemtuzumab 12 mg iv 5 days (total dose 60 mg) was administered. prednisone was tapered from 20 mg / day to 10 mg / day over the next year. fifteen months after her initial infusion, she was retreated with alemtuzumab 12 mg iv 3 days (total dose 36 mg) and oral prednisone was discontinued the following month. for the first 19 months after the initial alemtuzumab infusion, she did not experience any discrete clinical relapses or have evidence of abnormally enhancing lesions on brain or spinal cord mri. however, she did experience insidiously progressive nausea and vomiting that became intractable, resulting in 27 kg of weight loss in the final year of life. she also developed insidiously progressive bilateral vision loss : jaeger 1 od and j2 os (20/25 and 20/30 snellen equivalent respectively) to j2 od and j3 os (20/30 and 20/40 snellen equivalent respectively) at 15 months post - alemtuzumab and j4 (20/50 snellen equivalent) by 17 months. she remained seropositive for aquaporin-4 igg. prior to receiving alemtuzumab, while on other immunosuppressive therapies, she had multiple urinary tract infections, one episode of urosepsis requiring hospitalization, herpes zoster ophthalmicus, a deep venous thrombosis in the leg, hematomas following plasma exchange, and a broken femur after falling from her wheelchair. following alemtuzumab treatment, her course was complicated by clostridium difficile colitis (2 months after the initial alemtuzumab infusion) and recurrent urosepsis (16 and 20 months after the first cycle of alemtuzumab). enteral feeding was initiated 20 months after the initial alemtuzumab infusion for refractory nausea and appetite loss. the patient and her family requested transition to comfort care, and she died at home. gross neuropathologic evaluation of the spinal cord revealed severe destruction at the thoracic and upper lumbosacral levels such that the normal gray white junction and the delineation of dorsal, lateral, and anterior columns were completely effaced. the optic nerves showed gray - tan discoloration on cross sections, with the left more prominent than the right. in addition, there were numerous areas of demyelination where gray, gelatinous lesions appeared to involve the periventricular white matter, middle cerebellar peduncles, cerebellar white matter, and brainstem. foci suspicious for demyelination were noted in the area postrema of the medulla oblongata and the pontine tegmentum. coronal sections of the cerebrum showed a 0.5 cm diameter brown - tan cavitary lesion in the periventricular white matter at the anterior horn of the left lateral ventricle extending into the genu of the corpus callosum. another soft cavitary lesion was found in the periventricular white matter of the posterior horn of the right lateral ventricle. microscopic examination showed a range of acute, subacute, and chronic demyelinating lesions in the aforementioned areas in the gross examination. one of the most extensively involved areas (figure 1) extended from the pons into the right middle cerebral peduncle and cerebellar white matter and correlated clinically with the mri t2/fluid - attenuated inversion recovery abnormality shown in figure 2. all foci of demyelination demonstrated marked loss of myelin on luxol fast blue periodic acid - schiff stain and infiltration by cd68-positive macrophages. the actively demyelinating lesions showed dense macrophage infiltrates, whereas the subacute to chronic lesions showed cavity formation and relatively fewer macrophages. in all of the lesions there was a loss of the normal volume of oligodendroglia and a relative paucity of mature lymphocytes and neutrophils. the spinal cord showed extensive demyelination in the thoracic segment and peripheral demyelination at the cervical level (figure 3). there was no evidence of progressive multifocal leukoencephalopathy on autopsy. the gray discoloration and softening noted in the right cerebellar peduncle (arrow, a) corresponds to an area of pallor on neuropathologic examination (b, hematoxylin & eosin, 100). the pale area is infiltrated by numerous macrophages (c, cd68, 100) and shows marked myelin loss (d, luxol fast blue periodic acid - schiff, 100). immunohistochemistry for lymphocyte markers cd4 and cd20 shows no evidence of an adaptive immune response (e and f, cd20/cd4, 100). brain mri (a c) shows interval progression of white matter lesions involving the pontine tegmentum (thin arrow in a and b), right cerebellum (arrowhead in a and b), and periventricular (wide arrows in c). there was no abnormal contrast enhancement in the first 3 studies shown ; no contrast was administered for the last mri. mri thoracic spine (d) at month 12 after alemtuzumab administration shows multiple t2 parenchymal hyperintensities and prominent myelomalacia. there was no abnormal contrast enhancement (not shown). flair = fluid - attenuated inversion recovery. a cross - section of the cervical spinal cord shows similar areas of pallor on microscopic examination (a, hematoxylin & eosin, 20). high - magnification examination of the boxed area from panel a shows macrophage infiltration (b, cd68, 100) and loss of myelin staining (c, luxol fast blue periodic acid - schiff, 100). there is also a marked increase in staining for glial fibrillary acidic protein (gfap), corresponding to reactive astrogliosis (d, gfap, 100). a portion of the optic nerve (a, hematoxylin & eosin, 200) shows some myelin loss (b, luxol fast blue periodic acid - schiff, 200) and striking macrophage infiltration (c, cd68, 200). we recognize that nmo can be a difficult disease to treat and that some patients do not respond to immune suppression. we believe that this case is noteworthy because following alemtuzumab treatment there appeared to be ongoing innate immune activation associated with tissue destruction. we interpret the cessation of clinical relapses, absence of contrast - enhancing lesions on mri, and scarcity of lymphocytes at autopsy to be indicative of suppression of adaptive immunity as a consequence of alemtuzumab treatment. in contrast, extensive mononuclear cell infiltrates on neuropathology correlated with new, enlarging, nonenhancing lesions on t2-weighted mri. the neuroanatomical areas of cns involvement on imaging and neuropathology corresponded to the patient 's progressive neurologic impairments. we believe that there is a possible relationship between these observations and alemtuzumab 's presumed mechanism that primarily targets adaptive immune function. we speculate that an underlying disease process involving the innate immune system causing massive monocytic infiltration and tissue destruction occurred. this observation may be relevant to ms as well as nmo and might explain why in secondary progressive ms alemtuzumab did not seem to inhibit disability progression despite a dramatic decline in contrast - enhancing lesions. mononuclear inflammation is a prominent histologic feature of progressive ms, particularly foamy macrophages in periplaque white matter, subpial mononuclear inflammatory infiltrates associated with cortical demyelination, and widespread microglial activation. in progressive ms, t - cell infiltration typically is also present in normal - appearing white matter associated with diffuse axonal injury and in perivascular cuffs. it is possible that alemtuzumab treatment contributed to worsening in this patient, possibly through triggering monocyte activation ; however, alemtuzumab treatment does not appear to precipitate worsening in most patients with relapsing or progressive ms. therefore, if alemtuzumab somehow contributed to the decline in this patient, this effect may be patient- or disease - specific. it is also important to note that our patient was already severely disabled at the time of alemtuzumab treatment. nmo can be an exceedingly difficult disease to treat, with some patients succumbing to their illness despite empiric use of immune suppressants. we believe that this case illustrates that progressive worsening in nmo can occur in the absence of clinical relapses or contrast - enhancing lesion activity on mri as a consequence of tissue injury associated with monocytic infiltration. dr. gelfand : drafting the manuscript, study concept, analysis / interpretation of data, acquisition of data. cotter : revising the manuscript for important intellectual content, analysis / interpretation of data, acquisition of data. huang : revising the manuscript for important intellectual content, analysis / interpretation of data, acquisition of data. cree : revising the manuscript for important intellectual content, study concept / design, analysis / interpretation of data, acquisition of data, study supervision. research reported in this publication was supported by the national center for advancing translational sciences of the nih under award number kl2tr000143 and american academy of neurology clinical research training fellowship (j.m.g.). its contents are solely the responsibility of the authors and do not necessarily represent the official views of the nih. gelfand has received research support from the national center for advancing translational sciences of the nih and he and his spouse have received compensation for expert witness medical - legal consulting. huang is an associate editor for the journal of neuroscience and is on the editorial board for brain pathology. cree is an editor for annals of neurology ; is a consultant for abbvie, biogen idec, emd serono, genzyme, novartis, sanofi aventis, and teva neurosciences ; has received research support from acorda, avanir, biogen idec, emd serono, hoffman la roche, and novartis ; and has been an expert consultant for biogen idec. | objectives : to describe the clinical course and neuropathology at autopsy of a patient with neuromyelitis optica (nmo) treated with alemtuzumab.methods:case report.results:a 61-year - old woman with aquaporin-4 immunoglobulin g antibody seropositive nmo had 10 clinical relapses in 4 years despite treatment with multiple immunosuppressive therapies. alemtuzumab was administered and was redosed 15 months later. for the first 19 months after the initial alemtuzumab infusion, the patient did not experience discrete clinical relapses or have evidence of abnormally enhancing lesions on brain or spinal cord mri. however, she experienced insidiously progressive nausea, vomiting, and vision loss, and her brain mri revealed marked extension of cortical, subcortical, and brainstem t2/fluid - attenuated inversion recovery (flair) hyperintensities. she died 20 months after the initial alemtuzumab infusion. acute, subacute, and chronic demyelinating lesions were found at autopsy. many of the lesions showed marked macrophage infiltration with a paucity of lymphocytes.conclusions:following alemtuzumab treatment, there appeared to be ongoing innate immune activation associated with tissue destruction that correlated with nonenhancing t2/flair hyperintensities on mri. we interpret the cessation of clinical relapses, absence of contrast - enhancing lesions, and scarcity of lymphocytes at autopsy to be indicative of suppression of adaptive immunity by alemtuzumab. this case illustrates that progressive worsening in nmo can occur as a consequence of tissue injury associated with monocytic infiltration. this observation may be relevant to multiple sclerosis (ms) as well as nmo and might explain why in previous studies of secondary progressive ms alemtuzumab did not seem to inhibit disability progression despite a dramatic decline in contrast - enhancing lesions. |
the pathogenesis of circumscribed palmar hypokeratosis (cph) is still controversial, and to date there is no treatment of choice. the clinical course and histopathological features in our observation point towards the possibility of an underlying squamous cell carcinoma in situ presenting as cph. we suggest that fluorouracil cream treatment should be considered as a therapeutic option in cases of cph. the pathogenesis of circumscribed palmar hypokeratosis (cph) is still controversial, with several different hypotheses having been considered so far. similarly, various therapies have been applied, and none have been established as a treatment of choice. in this paper, we report on a multifocal case of cph responding to treatment with fluorouracil cream. a 67-year - old female presented with a 10-year history of a nonhealing circular erythematous depressed lesion on her right index finger measuring 12 mm in diameter. the lesion gradually healed after 9 months treatment with fluorouracil cream, applied 12 times daily with intermittent occlusion. she subsequently developed three similar lesions, two of which were on her left thenar eminence and one on her left distal medial middle finger, measuring 5, 3, and 4 mm in diameter, respectively. the lesions on the thenar responded to intermittently - applied fluorouracil cream within 18 months, but recurred 3 months after cessation of treatment (figure 1). figure 1recurrence of two lesions of circumscribed palmar hypokeratosis on the left thenar eminence recurrence of two lesions of circumscribed palmar hypokeratosis on the left thenar eminence histopathology of a biopsy of the left thenar obtained from the margin of the lesion (figure 2) showed a lateral aspect of normal volar skin with orthokeratosis, descending in a frayed fashion to an area with mild parakeratosis and hypogranulosis. no significant atypia of keratocytes was noted ; however, the lesional part of the epidermis stained fainter, compared with the noninvolved epidermis. there was a moderate dilatation of capillaries in the papillary dermis. some bacteria (due to their dotted and rod - like appearance, probably corynebacteria) the periodic acid - schiff (pas) stain did not reveal any fungi. an in - situ hybridization test for low- and high - risk papillomavirus was negative. figure 2biopsy from the margin of the left thenar lesion (upper lesion in figure 1). lateral portion of normal skin descending in a frayed fashion to an area of mild parakeratosis and hypogranulosis ; moderate dilatation of superficial capillaries. note the sharp demarcation with different quality of epidermal staining, which is fainter within the lesion. in addition, bacteria with dotted and rod - like appearance are present in the frayed portion. biopsy from the margin of the left thenar lesion (upper lesion in figure 1). lateral portion of normal skin descending in a frayed fashion to an area of mild parakeratosis and hypogranulosis ; moderate dilatation of superficial capillaries. note the sharp demarcation with different quality of epidermal staining, which is fainter within the lesion. in addition, bacteria with dotted and rod - like appearance are present in the frayed portion. cph was first described in 2002 in a series of 10 patients.1 there was a striking female predominance, and the lesions usually presented in middle - aged to elder adults as a long - standing solitary palmar area of erythematous depressed skin. multiple lesions,24 as in the present observation and in plantar presentation,1,5,6 appeared to be the exception. in a few patients, repeated trauma was reported to play a role in the pathogenesis.3,7 however, most patients, including the one in the present study, can not recall this,1,2,8 and there is no explanation as to why the majority of lesions do not tend to heal spontaneously. prez.1 considered that the disease might result from a clone of abnormal keratocytes, but in view of its benign behavior, favored an epidermal malformation. this theory has been challenged due to its late onset in life and occasional enlargement.2 other hypotheses include a variant of epidermolysis bullosa,3 a defect in keratinization,5,9 which has been supported by the finding of altered keratin expression,6 and a hyperproliferative epidermal state, along with enhanced corneocyte fragility.4 case reports detected human papillomavirus type 6 and 4,10 a finding which was not present in two examined specimens of the original series,1 other studies,4,5,11 and in the present observation. an interesting histopathological finding in our patient that has not been commented on previously was the presence of rod - like bacteria, likely representing corynebacteria. they are presumably coincidental. however, in the right clinical setting, pitted keratolysis must be considered in the differential diagnosis. in addition, parakeratosis is a feature which has been reported in other publications as well,3,8,11,12 but has not been present in the cases of the original series1 and other reports,5,8 possibly pointing towards different evolutionary stages,8 malignant transformation,11 or different diseases. parakeratosis per se is a nonspecific finding, but together with the presence of a fainter stained epidermis, hypogranulosis, and dilated vessels in the papillary dermis, might point towards an underlying squamous cell carcinoma in situ presenting as cph. in contrast to a previous observation,10 most of the lesions responded to treatment with fluorouracil cream, with the lesions on the left thenar showing recurrence later on. failure of the left middle fingers lesion to heal and the long period of treatment for the other lesions are possibly due to their distal location, with impaired effectiveness of fluorouracil cream during activities such as daily housework. to date, no other treatment has been shown to be the treatment of choice in cph. steroids, immunomodulators, retinoids, and hydrocolloid dressings have been applied without success.1,4,7,11 calcipotriol led to improvement in a number of patients,1,9 while it failed to have an effect in others.4,8 further case reports documented partial remission by photodynamic therapy,12 and complete healing with cryotherapy.7 local excision was performed in another case and was curative with a follow - up of 6 months.8 one patient with bilateral involvement experienced spontaneous healing.3 although one should be cautious in generalizing the outcome of a single case, from the present observation we suggest that fluorouracil cream treatment should be considered as a therapeutic option in cases of cph when the histopathological features point toward the possibility of an underlying squamous cell carcinoma in situ. | introductionthe pathogenesis of circumscribed palmar hypokeratosis (cph) is still controversial, and to date there is no treatment of choice.methodswe report on a patient with cph responding to treatment with fluorouracil cream.resultsthe clinical course and histopathological features in our observation point towards the possibility of an underlying squamous cell carcinoma in situ presenting as cph.conclusionwe suggest that fluorouracil cream treatment should be considered as a therapeutic option in cases of cph. |
developmental exposures to environmental chemicals have become an important public health concern because of their possible toxic impact on sensitive development and programming of organ functions (1). unfortunately, the degree to which different persistent pollutants pass from the mother to the child is only partially known (2). thus, the partition between maternal and fetal tissues is of importance to the risk assessment of environmental chemicals and to selection of samples for biological monitoring. cord blood has the advantage of being a noninvasive sample and has been used for assessing exposure to a variety of metals and organohalogen compounds (38). while collecting the umbilical cord is easy, this tissue has been utilized only occasionally for exposure assessment, e.g., for methylmercury (9). despite a low lipid content, the placenta is a more complex tissue, because of its mixed maternal / fetal origin, thus ideally requiring removal of the maternal part before chemical analysis (7,13). finally, human milk concentrations reflect the maternal body burden as well as the nursing infant s lactational exposure (7,17,18). the relation between concentrations of environmental chemicals in maternal and fetal tissues and tissue fluids, and the conversion factors for concentrations in commonly used samples previous studies of paired samples suggest that organohalogen pollutant concentrations, when expressed on a lipid basis, tend to be somewhat higher in milk than in maternal serum, which again contains higher levels than umbilical cord serum (6,1925). while the distribution may depend on the molecular weight of the compound, molecular size, differences in lipophilicity, and affinities to biological molecules (26), the overall effect of the physicochemical properties is difficult to predict. the present study therefore aimed at determining the extent to which important environmental chemicals follow similar partitions between media frequently used for biological monitoring purposes. we collected paired motherchild samples to measure the concentrations of 87 environmental chemicals, including 20 polychlorinated dibenzo - p - dioxins (pcdds), polychlorinated dibenzofurans (pcdfs), and coplanar polychlorinated biphenyls (pcbs) ; 58 other pcbs, organochlorine pesticides, and polybrominated diphenyl ethers (pbdes) ; five perfluorinated compounds ; and four trace elements. these substances are also part of the centers for disease control and prevention s national human health and nutrition examination survey (nhanes), which is a biannual survey of the noninstitutionalized population of the united states (27). matched motherchild samples were obtained in connection with consecutive normal parturitions in the faroe islands. we chose to carry out the study in this fishing community because of an anticipated wide range of exposures. the traditional faroese diet includes pilot whale, which accumulates high concentrations of pcbs, certain pesticides, and other persistent lipophilic compounds in the blubber, while methylmercury is accumulated in the meat (28,29). in connection with the recruitment of a cohort from consecutive births at the national hospital in torshavn, faroe islands (30), maternal blood, maternal hair (for mercury analysis), placenta (fetal part), umbilical cord tissue, cord blood, and milk were obtained. detailed information on sampling, chemical analyses, and abbreviations is given in the supporting information (s1). two weeks after childbirth, each mother was interviewed by use of a questionnaire on the frequency of meals and portion sizes that included traditional foods, such as pilot whale meat, pilot whale blubber, fish, fulmars, and other seabirds. hair from all sample sets was first analyzed for mercury, and all milk samples were analyzed for major pcb congeners. on the basis of these initial results, 15 complete sample setsmaternal hair, whole blood, serum and milk, placenta, and infant cord tissue, whole blood, and serumwere selected for pollutant analyses. five sets represented mothers who had not eaten whale meat or blubber at all during pregnancy (group 1). five represented the highest hair - mercury concentrations among the samples analyzed, as a likely reflection of a high intake of whale meat in the recent past (group 2). the last five sets of samples had the highest milk - pcb concentrations as an indication of a high lifetime blubber intake (group 3). the project was approved by the faroese ethical review committee and subsequently by the irb at harvard school of public health ; written informed consent was obtained from each mother. concentration ratios were calculated for the various matrices in regard to the concentration in maternal blood. each set of pairwise data was processed when at least five pairs of samples had results for the specific analyte above the detection limit, and an average concentration ratio was calculated if pearson s correlation coefficient was at least 0.7 (r 0.5). for each matrix, the ratios obtained for the analytes were ranked, and extreme results were eliminated sequentially until the overall average showed a coefficient of variation of no more than 20%. this strategy ensured that almost all individual ratios for the different analytes were within one standard deviation from the overall average. if based on results with correlation coefficients above 0.7, outlier ratios are reported separately as the arithmetic means. concentration dependence of the ratios was assessed by calculating regression coefficients, where the regression line was forced through the origin. apart from increased uncertainty of results close to the detection limit, regression coefficients were in accordance with the average ratios, and regression analyses are therefore not reported. maternal age, parity, body weight, and weight gain during the 15 pregnancies are shown in table 1. the three exposure - based groups differed only slightly from one another in regard to background information. whereas maternal serum and milk were analyzed for the complete set of 87 environmental chemicals, the 20 pcdds, pcdfs, and coplanar pcbs were not determined in cord blood, cord tissue, and placenta due to insufficient sample sizes combined with low lipid contents. the perfluorinated compounds (pfcs) were analyzed in 12 sets of maternal serum, cord serum, and milk. of the 58 organohalogen compounds determined in fetal samples, only 2,2,5,5,8,9,9,10,10-nonachlorobornane (parlar-62), bde-85, and pcb-18 were below the detection limit for all samples. parlar-62 was detected in maternal serum, although in only three samples. in general, environmental chemical concentrations for group 1, who did not eat traditional food during pregnancy, tended to be lower than the results for the two other groups, and the results for group 3 with the high milk - pcb concentrations were among the highest also for most of the chemicals analyzed. concentrations in umbilical cord serum and milk, and to a lesser extent those from cord tissue and placenta, correlated well with the maternal serum concentrations. in cord serum, only pentachlorobenzene (pcbz) and -hch seemed to diverge from this pattern. in placenta and cord tissue, the highly chlorinated pcbs correlated the best with the maternal serum concentration, whereas pcb congeners 28, 44, 49, 52, 66, 101, 105, 128, and 149 showed much scattering. the a priori requirement of at least five sample pairs with detectable concentrations reduced the numbers of sample pairs to 43, 45, 50, and 59 for cord serum, cord tissue, placenta, and milk, respectively. a correlation coefficient of at least 0.7 resulted in further reduction to 39, 34, 29, and 56 sample pairs. based on the required agreement with an overall ratio in regard to maternal serum, the partition ratios for the four specimens were based on 33, 22, 21, and 38 sample pairs. based on the overall mean ratios, cord serum, cord tissue, and placenta had lower lipid - based concentrations of organohalogen substances than maternal serum, while the relative lipid - based concentrations in milk were higher (table 2). support for these overall results was also obtained from several median ratios calculated for sample pairs with correlation coefficients below 0.7 (tables s1s3). among the brominated substances, bde-47 and, less clearly, bde-100 tended to show increased concentrations in tissue and milk compared to maternal serum (table s1). the chlorinated pesticides pcbz and -hch showed a relative excess in fetal samples (table s2). when compared to the -hch concentrations, the results for the gamma isomer were generally almost 2 orders of magnitude lower in maternal serum and milk, but of similar magnitude in the fetal samples. p, p - dde concentrations showed averages about 50-fold higher than those of the ddt isomers, which had less stable ratios. several pesticides showed concentrations in milk that were higher than anticipated from the overall average ratio. for the sum of polychlorinated biphenyls (figure 1), the lipid - based cord serum concentration correlated very well with that of the maternal serum (r = 0.99) and showed a concentration ratio of 0.56. for milk, the correlation was not as close (r = 0.87), and the average ratio was 1.35. cord tissue pcb concentrations correlated as well as milk (r = 0.88), although with an average ratio of 0.64, while placenta concentrations showed a poorer correlation of 0.53. lipid - based concentration (ng / g) of the sum of all quantified polychlorinated biphenyl congeners in milk and fetal tissues (identified by different symbols), as compared to the concentration in maternal serum in fifteen sets of samples. some pcb congeners showed higher lipid - based concentrations in fetal samples than in maternal serum and milk (table s3), but some of these ratios may be imprecise due to concentrations close to the detection limit and poor correlations between paired samples. when the pcbs were grouped according to chlorination, the partition between maternal serum and milk decreased at higher number of chlorine substitutions (figure 2). for the other paired samples, correlations between partitions and the degree of chlorination were less clear and more variable. average partition ratio between lipid - based concentrations of polychlorinated biphenyl congeners in milk and maternal serum from 15 sample pairs in regard to the number of chlorine substitutions of each congener measured. still, several pcdds and pcdfs, and pcb congeners 126 and 169, showed high correlations between paired maternal serum and milk samples, and they were in agreement with regard to the relative distribution in the two matrices. overall, the partitioning between the lipid phases agreed with the ratio of approximately 1.5 for milk versus maternal serum for 1,2,3,7,8-pentachlorodibenzo - p - dioxin (12378d), 123478d, 123678d, 2,3,4,7,8-pentachlorodibenzofuran (23478f), 123478f, 123678f, and pcb congeners 126 and 169. although sufficient numbers of detectable concentrations were not available for several dioxin - like substances, increased chlorination tended to show a lower ratio between milk and maternal serum concentrations. perfluorooctanic acid (pfoa), perfluorooctane sulfonic acid (pfos), perfluorononanoic acid (pfna), and perfluorodecanoic acid (pfda) revealed excellent correlation between maternal and cord serum concentrations, with ratios of 0.72, 0.34, 0.50, and 0.29, respectively (table 3). perfluorohexane sulfonic acid (pfhxs) showed a poor correlation, but the median ratio of 0.74 confirmed that transplacental passage occurred. in the milk samples, only pfoa was detected, and then only in 7 of 11 samples analyzed. assuming a pfoa concentration of 0 in the milk samples below the detection limit, the correlation with the maternal serum pfoa concentration was 0.80 and with cord blood was 0.72. four of eleven samples available had a pfoa concentration below the detection limit, and none of the other analytes were detected. in regard to the trace elements (table 4), lead was below the detection limit in all cord tissue samples. although poorly correlated, the average lead concentrations were quite similar in cord blood and milk, but higher in the placenta. cadmium showed a 100-fold excess in placenta in comparison to that in cord blood, but blood concentrations close to the detection limit made partition calculations unstable. mercury and selenium showed similar partition ratios, although the average ratio for cord tissue versus cord blood was much higher for mercury than for selenium. mercury showed excellent correlations among concentrations in different matrices (figure 3), while selenium showed much scattering. in the matrices analyzed, the two elements correlated only poorly (e.g., r = 0.27 for cord blood), and the average molar concentration of selenium in cord blood, placenta, and milk exceeded that of mercury by approximately 20-fold. total mercury concentrations in cord tissue and placenta (left vertical scale), and maternal hair (right vertical scale) in relation to those in cord blood (horizontal scale) from 15 sets of samples. this study addressed the partition between maternal and fetal tissues for a large number of environmental chemicals of toxicological interest. the samples were selected from normal births in a fishing community, where elevated exposures to marine contaminants occur. a range of exposures was intended for determination of relative partitions at different concentration levels. the results cover a large number of important environmental chemicals, particularly substances commonly present in human samples. virtually all substances detected in the samples were present in fetal tissues and cord blood as an indication that transplacental passage had occurred. concentrations of cadmium were relatively increased in the placenta, thus suggesting a partial barrier for this trace element, as also reported in previous publications (1416). for the lipophilic substances, possible placental accumulation was observed only for some low - chlorination pcbs, although increases also occurred for concentrations in cord tissue and cord serum. cord serum concentrations of lipophilic substances averaged slightly more than half of the levels in maternal serum after adjustment for lipid concentrations. g / l), and on a volume basis, concentrations in cord serum therefore averaged only 20% of those occurring in maternal serum. lipids are likely to pass more rapidly than the contaminants into the fetal circulation, but may then be metabolized, thereby lowering the concentration on the fetal side. lipid - adjusted concentrations in placenta and cord tissue were slightly more than one - third of the results observed for maternal serum. the lipid concentration of the placenta was about 5-fold higher than in cord tissue, but only small differences occurred in the number of samples of these tissues with detectable concentrations of the lipophilic substances. overall, the correlations between paired samples and the partition of lipophilic substances in maternal and fetal samples extend similar observations reported in previous studies (38). the lipid - based concentration of dioxins tended to be about 50% higher in human milk, but the ratio was not constant for all analytes. two highly chlorinated substances ocdd and 1234678d were excreted to a lesser extent into milk compared to maternal serum concentrations. this finding suggests that the passage into milk may be more difficult for larger molecular sizes (5,24), as also seen for pcb congeners (figure 2). although the dioxin - related substances were not measured in fetal samples, other studies suggest that some degree of barrier may exist in the placenta (31). considerable differences have been reported in lipid - adjusted concentrations of some environmental chemicals in maternal serum and milk from the same individual (32). in particular, a uniform distribution in the lipid phase between the samples had been called into question for pcbz, -hch, hcb, and the more lightly chlorinated pcbs (8,25). the present study confirmed that several substances deviate from a uniform pattern of distribution, in particular pcbs with low chlorination, such as congeners 28, 44, 49, 52, 66, 101, 110, and 149. compared to their concentrations in maternal serum, the gamma, but not the beta, hch stereoisomer showed much higher concentrations in cord serum and fetal tissues. the reasons for such discrepancies are unclear, but they could reflect a difference between maternal and immature fetal metabolism or an enantiospecific uptake. however, the observation that some lipophilic contaminants differ in their relative distribution across the placenta must also be considered in regard to short - term toxicokinetic differences. because the maternal serum was collected in the 32nd week of pregnancy, analytical results are compared for samples collected up to two months apart. the relatively short elimination half - life of lightly chlorinated pcbs could therefore lead to unstable tissue concentrations, and variable exposures could then easily affect the calculated partition coefficients. however, such variability would not be likely to explain the large differences in average concentrations. brominated substances have been previously reported to be less efficiently transferred into cord blood, while much higher concentrations are present in human milk than in serum (33). thus, bde47 concentrations were reported to be similar in maternal and cord blood plasma, but poor correlations were obtained for the more highly brominated congeners, bde99, bde100, and bde153, which tended to show lower concentrations in cord blood plasma, thereby suggesting a less efficient passage through the placenta (34). these substances have been reported to accumulate in the fetal liver, while very little is retained in the placenta (35). in the present study, a low ratio for bde153 in cord serum was corroborated and our findings also support the notion of increased milk concentrations of bde congeners 47 and 100, while congeners 99 and 153 were closer to the overall average ratio, and pbb153 was lower. these results suggest that relative bromination may affect the partition to a greater extent than chlorination, perhaps as a result of differences in molecular size. the pfc concentrations were higher in maternal serum than in cord serum, and the ratio suggested that the length of pfc chain as well as the active group affected the ability to pass the placenta. pfcs with a short chain length showed higher relative cord serum concentrations than pfcs with a longer chain length. pfcs with sulfonic acid as the active group seemed to pass more easily into the fetal circulation than pfcs with carboxylic acid as the active group. these results appear to fit in well with the findings of a previous study that examined maternal and cord serum concentrations of four pfcs (36). while a significant association with serum levels was found for pfos, the milk concentrations were very low, as has previously been reported (37,38). among the trace elements, mercury showed excellent correlations among concentrations in different matrices ; the correlations thus support the use of all the specimens included in the present study, including easily collected umbilical cord tissue (39). however, much greater variability was seen with cadmium, lead, and selenium (15,40). the close correlation between lipid - based concentrations in maternal serum and milk for a large number of lipophilic substances supports the notion that either matrix is appropriate for assessment of exposure levels. a general proportionality factor can be considered as a feasible approximation for comparing the results, as only few of the contaminants commonly measured will require a substance - specific conversion factor.. however, measured concentrations in cord tissue and placenta are more variable, the former perhaps affected by the low lipid content. these matrices are therefore not as useful for monitoring purposes, except perhaps for cadmium, which accumulates in the placenta. although dekoning. (20) recommended that several types of specimens be collected to assess perinatal exposure levels, the present study suggests that an efficient strategy would emphasize specimens with a high rate of detectable concentrations. the main finding of this study is that the contaminants tend to be present in all matrices examined. in general, lipid - based concentrations of lipophilic chemicals in maternal serum are correlated with concentrations in the other media. however, the transfer to the fetal circulation results in lower concentrations, while milk levels tend to be about 50% higher than the maternal serum. these patterns are complex, and the complexity must be taken into account when selecting samples for analysis and when interpreting the results. | passage of environmental chemicals across the placenta has important toxicological consequences, as well as for choosing samples for analysis and for interpreting the results. to obtain systematic data, we collected in 2000 maternal and cord blood, cord tissue, placenta, and milk in connection with births in the faroe islands, where exposures to marine contaminants is increased. in 15 sample sets, we measured a total of 87 environmental chemicals, almost all of which were detected both in maternal and fetal tissues. the maternal serum lipid - based concentrations of organohalogen compounds averaged 1.7 times those of cord serum, 2.8 times those of cord tissue and placenta, and 0.7 those of milk. for organohalogen compounds detectable in all matrices, a high degree of correlation between concentrations in maternal serum and the other tissues investigated was generally observed (r2 > 0.5). greater degree of chlorination resulted in lower transfer from maternal serum into milk. concentrations of pentachlorbenzene, -hexachlorocyclohexane, and several polychlorinated biphenyl congeners with low chlorination were higher in fetal samples and showed poor correlation with maternal levels. perfluorinated compounds occurred in lower concentrations in cord serum than in maternal serum. cadmium, lead, mercury, and selenium were all detected in fetal samples, but only mercury showed close correlations among concentrations in different matrices. although the environmental chemicals examined pass through the placenta and are excreted into milk, partitions between maternal and fetal samples are not uniform. |
corneolimbal epithelial progenitor / stem cells are a small subpopulation of oligopotent cells that are primarily located in the basal epithelial layer of the limbus. they produce undifferentiated progeny with limited proliferative potential that centripetally migrate from the periphery of the cornea to replace cells that desquamate during normal life [17 ]. corneolimbal stem cells primarily reside in the palisades of vogt in a niche that maintains their stemness by producing a unique anatomical and functional milieu [8, 9 ]. although in humans the exact anatomical location of the niche is considered to be in the limbus, it has recently been proposed that epithelial progenitor / stem cells of equal potency are distributed throughout the entire ocular surface in other mammals. detection of corneal epithelial stem cells is the object of controversy among several groups because corneal progenitor / stem cell markers remain undetermined. hes1 is known to be important for maintaining the self - renewal ability of progenitors and repressing the commitment of multipotent progenitor cells to a neuronal fate. in addition, nakamura. reported that hes1 regulates the corneal development and homeostatic function of corneal stem / progenitor cells. p75ntr is a member of the tumor necrosis factor receptor superfamily, originally identified as a receptor for neurotrophins, and is expressed in the nervous system. p75 is also selectively expressed by basal epithelial cells in the corneal limbus ; however, it is absent in the central cornea. atp - binding cassette subfamily g member 2 (abcg2) and keratin 19 and 15 as putative corneal epithelial stem / progenitor cell - associated molecules are also expressed in the corneal limbal basal cells. diabetes mellitus is a systemic disease that is characterized by chronic hyperglycemia [12, 13 ]. ocular complications, such as retinopathy, cataract, and glaucoma, are well known. in particular, patients with diabetic keratopathy (dk) show various symptoms such as persistent corneal epithelial defects [1417 ]. alterations in the epithelial basement membrane, insufficient tear secretion, and neuropathy - associated denervation have been linked to abnormalities of the ocular surface. diabetes / diabetes (db / db) mice are generally used to study the pathophysiology of type 2 diabetes. these mice have mutations in the genes that code for the leptin receptor, which is primarily localized in the hypothalamic region where it regulates the body weight and energy balance. db / db mice are hyperglycemic, hyperinsulinemic, and insulin resistant, and they demonstrate impaired tissue inflammatory responses in the cornea. these mice have sensory nerve conduction deficits, small sensory nerve fiber neuropathy, and intraepidermal sensory nerve fiber loss. several studies have shown that skin wound healing is impaired in db / db mice, which is associated with a dysregulated inflammatory response. to the best of our knowledge, there have been only a few reports that have focused on the influence of corneal progenitor / stem cells in neurodegenerative disorder such as type 2 diabetes. we have previously reported that corneolimbal stem cells significantly reduce after depletion of sensory nerves by electrocoagulation of the ophthalmic branch of the trigeminal nerve [22, 23 ]. our data suggested a critical role of innervation in maintaining stem cells and/or the stem cell niche. the purpose of this study was to elucidate whether putative corneal stem / progenitor cells are altered in type 2 diabetic corneas and understand the pathogenesis of dk. the prevention and amelioration of various complications caused by type 2 diabetes have been investigated. the insulin - like growth factor (igf) system has been shown to play a role in diabetic retinopathy. in previous studies, recombinant human insulin - like growth factor - i (rhigf - i) has been shown to enhance the proliferation of several cell lines and protect cells from apoptosis induced by various factors [2430 ]. we further aimed to assess and clarify whether igf - i treatment is capable of protecting against corneal nerve damage and corneal stem / progenitor cells in diabetes. our data demonstrate that sensory nerve degeneration of cornea affects stem cell homeostasis and leads to a significant increase in the number of corneolimbal stem / progenitor cells and corneal nerve in the rhigf-1-treated diabetes. herein, we hypothesized that there is a therapeutic potential of igf-1 administration in neurodegenerative diseases such as type 2 diabetes. twelve - week - old male leptin receptor mutant (db / db) mice on a c57bl/6 background and 12-week - old male c57bl/6 mice were obtained from the jackson laboratory (bar harbor, me, usa). the research protocol conformed to the standards of the association for research in vision and the ophthalmology statement for the use of animals in ophthalmic and vision research and was approved by the animal care facility of st. rhigf - i was purchased from peprotech (rocky hill, nj, usa). rhigf - i was reconstituted in phosphate - buffered saline (pbs) containing 0.1% bovine serum albumin (bsa) and stored at 80c until use according to the manufacturer 's instructions. in brief, the mice were anesthetized and placed in a stereotaxic frame (narishige scientific instrument lab, tokyo, japan). for rhigf-1 treatment of the diabetic group, 11-week - old ob / ob mice were administered a retrobulbar injection of 100 g / kg rhigf - i twice daily for 7 days. on day 7 of the postexperimental procedure, the corneas from diabetic animals (n = 8) were enucleated. cryostat sections of 5 m thickness were prepared from tissue that was embedded in tissue - tek oct compound (sakura finetek usa, inc., after fixation with cold acetone for 10 min, the tissues were incubated with 10% goat serum containing 0.1% triton x-100 and 1% bsa (room temperature (rt) ; 1 h) for cytokeratin 19 (ck19) and with 1% bsa and goat serum (rt ; 30 min) for hairy enhancer of split 1 (hes1). for the ck19 staining, overnight incubation with a mouse monoclonal antibody against ck19 (1 : 200) (abcam plc, cambridge, ma, usa) was performed. for hes1 staining, a rabbit anti - hes1 polyclonal antibody (1 : 1,000) was used (from dr. these sections were subsequently incubated (rt, 1 h) with the appropriate primary antibody and washed 3 times in pbs containing 0.15% triton x-100 for 15 min. antibody binding was detected by alexa 488 or alexa 594 conjugated secondary antibodies (life technologies gmbh, darmstadt, germany). the slides were washed 3 times in pbs containing 0.15% triton x-100 for 15 min, coverslipped with antifading mounting medium containing 4,6-diamidino-2-phenylindole (vectashield, vector laboratories, inc., burlingame, ca, usa), and examined under a confocal microscope (lsm-510, carl zeiss microscopy gmbh, jena, germany). for whole - mount immunofluorescence corneal staining, freshly excised corneas including the limbus were harvested and fixed in 4% paraformaldehyde, stained with anti- tubulin - iii antibody (1 : 200) (rabbit anti- tubulin - iii polyclonal antibody, emd millipore corporation, billerica, ma, usa), and incubated with a secondary antibody that was conjugated with fluorescein isothiocyanate (1 : 200) (donkey anti - rabbit igg, santa cruz biotechnology, inc., radial cuts were prepared in the cornea so that it could be flattened by a coverslip, and the cornea was mounted using the mounting medium (vectashield, vector laboratories, inc., burlingame, ca, usa). control incubations were performed with the appropriate normal mouse or rabbit iggs at the same concentration as the primary antibody. valencia, ca, usa) and reverse - transcribed (superscript iii kit ; life technologies corporation). real - time pcr was performed with a pcr mix (taqman universal pcr master mix ; life technologies corporation, carlsbad, ca) and preformulated primers for abcg2 (assay i d mm00496364_m1), hes1 (assay i d mm00468601_m1), keratin15 (assay i d mm00492972_m1), p75 (assay i d mm01309635_m1), and 18s ribosomal rna (assay i d mm03928990_g1) (all applied biosystems, austin, tx, usa). the 18s ribosomal rna was used as the endogenous reference for each reaction. the results were derived from the relative threshold cycle (ct) by the deltadelta ct method and normalized by 18s ribosomal rna used as an internal control. the relative messenger rna (mrna) level in the normal corneas (normal group) was used as the normalized control for the groups with diabetes. image j 1.45 (provided program from national institutes of health) was used to create stacked images and calculate the corneal nerve density for the subbasal nerve branches of normal, diabetic, and rhigf-1-treated mice. corneal nerve fiber density was subsequently determined with the length of the nerve fibers in each 1 mm area. the differences in corneal nerve fiber density between the two consecutive groups of mice were compared by the analysis of variance using a statistical analysis software package (ssri co., ltd., statistical evaluation of data was performed with the unpaired t - test and the nonparametric mann - whitney u test for comparisons among groups. the data are presented as mean standard error of the mean and the value of p < 0.05 was considered statistically significant. the morphology of the corneal epithelium and stroma was compared between a normal cornea (figure 1(a) : the center and figure 1(c) : the limbus) and the diabetic cornea of 12-week - old db / db mice (figure 1(b) : the center and figure 1(d) : the limbus) with hematoxylin and eosin staining, and the swelling and stratification of the diabetic corneal epithelium, both in the center (figure 1(b)) and limbus (figure 1(d)), were noted compared with that of the normal corneas (figures 1(a) and 1(c)). in the diabetic group, the corneal subbasal nerve branches in the diabetic group (figure 1(i)) appeared faint and disrupted. moreover, no clear nerve structure of the epithelial branches could be significantly detected in the diabetic group (figure 1(h)) compared with that in the normal group (figure 1(e)). we analyzed the expression levels of abcg2, hes1, p75, and keratin15 in normal and diabetic corneas using real - time pcr (figure 2). decreased mrna expression levels of p75 (3-fold ; p = 0.019), hes1 (3-fold : p = 0.035), and keratin15 (5-fold ; p = 0.043) were observed in diabetic corneas compared with normal corneas. an approximately 1.5-fold reduction in abcg2 was also observed, although this was not statistically significant. 18s ribosomal rna expression showed no significant difference between the normal group and group with diabetes (p = 0.254). to further compare protein expression of corneal stem / progenitor markers the expression levels of hes1 and keratin19 was examined in normal corneal limbal cells (figures 3(a) and 3(c)). the expression levels of both these stem cell markers decreased in the diabetic corneas (figures 3(b) and 3(d)). figure 4 provides representative illustrations of the nerve fibers innervating the corneal epithelium (a) and the subbasal layer (b) in rhigf-1-treated diabetic mice. in rhigf-1-treated diabetic mice, we compared the corneal subbasal nerve density between the normal and diabetic corneas (figure 4(d)). mm / mm, whereas that of diabetic corneas was 27.01 3.70 mm / mm (p < 0.00001). the subbasal nerve density in rhigf-1-treated diabetic mice significantly increased (38.06 1.67 mm / mm) compared with that in the diabetic mice (p < 0.01). there was no significant difference in the corneal stromal nerve trunk densities among the normal, diabetic mice, and rhigf-1-treated diabetic mice (data not shown). moreover, the decrease in hes1 and keratin19 staining was suppressed in the rhigf - treated diabetic cornea (figures 4(e) and 4(f)) compared with that in diabetic corneas (figures 3(b) and 3(d)). in this study, we used db / db model mice and observed that the impaired corneal stem / progenitor cells that were observed in the type 2 diabetes models could have involved a loss of corneal nerves. corneal nerves, in addition to their well - known sensory functions, help maintain the integrity of the ocular surface by releasing epitheliotrophic substances that promote corneal surface health. in particular, the subbasal corneal nerve plexus contains the highest number of nerve branches in the cornea, and these branches directly extend into the corneal epithelium [3234 ]. prior studies have shown a reduction of the subbasal plexus in subjects with diabetes compared with normal subjects. we also observed a decreased density of the corneal subbasal nerve plexus and corneal epithelial branches in leptin receptor mutant mice, which are an accepted animal model of type 2 diabetes. in this model, diabetic patients suffer severe peripheral neuropathy, which is associated with the development of persistent corneal epithelial defects [3638 ]. although various nerve - secreted factors and peptides, such as ngf, substance p, and brain - derived neurotrophic factor, are important for epithelial regeneration and wound healing [3944 ], corneal stem / progenitor cells are also closely related to corneal wound healing. however, seitz. have shown that the underlying leptin deficiency in db / dbmice further amplifies these impairments in skin repair. to characterize this, we studied the expression of putative corneal progenitor / stem cell markers and found a 60% reduction in p75, keratin15, and hes1 expression in diabetic corneas. in our study, not only were epithelial abnormalities and decreased innervation present in diabetic corneas but also the corneal epithelial progenitor / stem cells were altered and/or impaired. the high tear glucose concentration and various complications of diabetes make it difficult to fully dissociate the contribution of nerve depletion versus other pathological aspects of the disease with the stem cell reduction. however, given that the corneal limbus, where the corneal progenitor / stem cells reside, is densely innervated, delayed corneal epithelial wound healing may result, at least in part, due to impaired corneal progenitor / stem cells in diabetic corneas. furthermore, these results supported those of our previous studies that the number of corneal stem / progenitor cells significantly decrease after deprivation of the sensory nerves. with regard to physiological effects of diabetes, there are several studies that indicate a potential role for igf, glucagon - like peptide-1 (glp-1), and dipeptidyl peptidase inhibitors in neuroprotection. our results demonstrated that the rhigf - i - treated diabetes group exhibited a significantly accelerated recovery of the corneal subbasal nerve and epithelial branches. the corneal subbasal nerve tortuosity remained in the rhigf-1-treated diabetic mice, although we observed an increase in the density of the subbasal nerves. with topical administration of rhigf-1 in diabetic corneas, alterations in the expression patterns of the corneal stem / progenitor proteins became consistent with healing. the normal corneal epithelium is a stratified layer of cells connected by tight junctions that provide a barrier against compounds larger than 1 nm. the pharmacological action was considered to be poorly effective because the high molecular weight (e.g., rhigf-1) made penetration of the corneal epithelium difficult. the ciliary nerves of the trigeminal nerve entering the sclera are anatomically located close to the optic nerve at the posterior globe. in previous reports, the sclera permeability was significantly higher than the respective permeability across the cornea and conjunctiva for macromolecular substances. it was difficult to inject the precise volume and maintain the drug so that the mouse cornea could exhibit minimum thickness at the limbus. furthermore, we aimed to inhibit the fluctuating or low concentration of the drug by tear fluid. although there are no studies on the effectiveness of retrobulbar igf-1 injections, we used a periocular approach for retrobulbar injection in order to avoid any delivery loss of the medicine because of frequent blink and to achieve high infiltration and drug retention in the periocular tissue. recently, chen reported that treatment with rhigf - i can promote hematopoietic stem cell / progenitor survival, as shown by the increased frequency of sca-1 + cells in bone marrow harvested after subcutaneous injection with rhigf - i following total body irradiation. the direct neuronal (intrathecal) delivery of igf - i improved and reversed the slowing of motor and sensory conduction velocity in rats with diabetes. in addition, insulin and igf - i prevented atrophy in myelinated sensory axons in the sural nerve. as they also mentioned, it is thought that the direct delivery of igf - i to neurons may correct diabetes - associated abnormalities by restoring suitable mitochondrial function. moreover, it has been demonstrated that rhigf - i decreases apoptosis and promotes cell survival in a pi3-kinase - dependent manner. taken together, our data suggested that the preservation of corneal stem / progenitor cells could be a consequence of regenerative changes in the corneal nerves in type 2 diabetes. with regard to the healing of corneal nerve and stem / progenitor cells, the topical administration of igf-1 may become applicable in severe situations caused by persistent corneal ulcers in patients with type 2 diabetes. in conclusion, our results suggest that the number of corneal progenitor / stem cells significantly reduce in an animal model of type 2 diabetes. we provided novel evidence for the critical role of innervation in maintaining corneal epithelial cells and/or the stem cell niche in diabetes. furthermore, our studies showed that rhigf-1 prevented and/or decreased changes in the corneal progenitor cells and nerves that were associated with type 2 diabetes. these findings were also innovative results, wherein alterations in the corneal nerve and stem / progenitor cells were consistent with healing in igf-1-treated diabetes. it is provocative to guess that the functional relationship between the nerve and stem cells that was described in this paper could apply to other epithelial / nonepithelial stem cells in the body. thus, these findings contributed to our understanding of the factors that are relevant to maintaining the progenitor / stem cell niche in diabetes. | this study aimed to investigate whether corneal nerve and corneal stem / progenitor cells are altered in insulin - like growth factor - i (igf - i-) treated individuals with diabetes. a group consisting of db / db mice with type 2 diabetes mellitus (dm) and a wild - type group were assessed by neural and corneal stem / progenitor cell markers immunostaining and real - time pcr. moreover, the expression of corneal nerve and stem / progenitor cell markers was examined in igf-1-treated diabetic mice. compared with a normal cornea, swelling and stratification of the corneal epithelium were noted in db / db mice. beta - iii tubulin immunostaining revealed that the corneal subbasal plexuses in diabetic mice were thinner with fewer branches. mrna expression levels of hes1, keratin15, and p75 (corneal stem / progenitor cell markers) and the intensity and number of positive cells of hes1 and keratin19 immunostaining diminished in the diabetic corneas. compared with the subbasal nerve density in the normal group, a decrease in the diabetic group was observed, whereas the corneal subbasal nerve density increased in igf-1-treated diabetic group. the decreased expression of hes1 and keratin19 was prevented in igf-1-treated diabetic group. our data suggest that corneal nerve and stem / progenitor cells are altered in type 2 dm, and igf - i treatment is capable of protecting against corneal damage in diabetes. |
an aryl sulfotransferase, whose cdna was isolated from the rat liver library, was found to catalyze bioactivation of minoxidil through n - o - sulfation and n - sulfation of a carcinogenic heterocyclic amine, iq, by expression in cos-1 cells. cdna of a human ortholog also was isolated and characterized as a major minoxidil - activating enzyme in human liver. another group of aryl sulfotransferases catalyzing o - sulfation of carcinogenic n - hydroxyarylamines was separated from livers of rats and humans. these sulfotransferases have been shown to possess similar functional properties and also to relate immunochemically with each other. current understanding on the primary structure of these sulfotransferases also is discussed.imagesfigure 2. |
|
beyond anecdotal, literary and even lyrical acknowledgments, a rapidly expanding corpus of scientific evidence supports a causal role for sleep in memory processing. this review aims to provide a synthesis of recent findings in humans, with a focus on hippocampal - dependent memory. our goal is to extract consistent themes across domains of memory function that appear to be regulated by sleep, and provide a framework of sleep - dependent hippocampal memory processing within which these findings can be understood. we examine two stages of memory processing (1) a role for sleep before learning in preparing the hippocampus for initial formation or encoding of new experiences, and (2) a role for sleep after learning in both non - specific and specific offline consolidation of recently encoded experiences. some of the earliest evidence describing the impact of prior sleep loss on subsequent learning of declarative memories was described by morris. (1960), and later by harrison and horne (2000), demonstrating impairment in encoding and retention of temporal memory (memory for when events occur). in the latter study, significant impairments in memory were evident even in a subgroup that received caffeine to overcome non - specific effects of lower alertness. interestingly, sleep - deprived subjects displayed significantly worse insight into their memory encoding performance, resulting in lower predictive ability of performance, a function itself that may also rely in part upon the hippocampus (huijbers., 2011) (2000) has examined the neural basis of similar memory impairments using fmri, investigating the effects of 35 h of total sleep deprivation on verbal learning. in those who were sleep - deprived, regions of the temporal lobe were significantly less active during learning, relative to a control group that had slept, while the prefrontal cortex actually expressed greater activation. most interesting, the parietal lobes, which were not activated in the control group during learning, were significantly more active in the deprivation group. such findings suggest that sleep loss prior to learning (at least following one night) produces bi - directional changes in verbal encoding activity, involving the inability of the temporal lobe regions to engage normally during learning, combined with potential compensation attempts by higher cortical regions (drummond., the impact of sleep loss on the specific neural dynamics of hippocampal memory encoding have been examined using event - related fmri (yoo., 2007a). in addition to performance impairments under conditions of sleep deprivation, and relative to a control group that slept, a highly significant yet selective deficit was identified in bilateral regions of the posterior hippocampus, known to be critical for learning new episodic information (figure 1). (2009), demonstrating that selective slow wave sleep deprivation alone is sufficient to impair hippocampal memory encoding ability. taken together, this collection of findings indicate that sleep disruption as well as total sleep deprivation prior to learning compromises the function of human hippocampus to effectively commit new human experiences to memory. regions of decreased encoding activation in the sleep deprivation group relative to the sleep control group in bilateral posterior hippocampus, together with a histogram of parameter estimates (effect size) of averaged hippocampal activity in each group. the impact of sleep deprivation on memory formation does not appear to be universal, but instead, may differ on the basis of factors such as emotionality. we have examined the encoding of emotionally negative, positive, and neutral words (walker, unpublished results). across all stimulus types combined, sleep deprivation imposed a 40% reduction in the ability to form new memories, relative to sleep rested individuals (figure 2a). however, when these data were separated into the three affective categories (negative, positive, or neutral), the magnitude of encoding impairment differed (figure 2b). in those that had slept, both positive and negative stimuli were associated with superior retention levels relative the neutral condition, consonant with the notion that emotion facilitates memory encoding (cahill and mcgaugh, 1998). however, there was severe disruption of encoding and hence later retention for neutral and especially positive emotional memory in the sleep - deprived group. in contrast, a relative resistance of negative emotional memory was observed in the deprivation group. these data suggest that, while the effects of sleep deprivation are directionally consistent across memory subcategories, the most profound impact is on the encoding of positive emotional stimuli, and to a lesser degree, emotionally neutral stimuli. in contrast, the encoding of negative memory appears to be more resistant to the effects of one night of total sleep deprivation. sleep deprivation and encoding of emotional and non - emotional declarative memory. effects of 38 h of total sleep deprivation on encoding of human declarative memory (a) when combined across all emotional and non - emotional categories ; (b) when separated by emotional (positive and negative valence) and non - emotional (neutral valance) categories. when comparing between positive and negative words, within group, no significant difference was found for the sleep group while those that were deprived demonstrated greater recall for negative items (p < 0.05). p < 0.08, p < 0.05, p < 0.01, error bars represent s.e.m. while such evidence describes the detrimental impact of a lack of sleep, recent work has conversely demonstrated the proactive benefit of sleep, and specific sleep physiology, in restoring episodic memory encoding ability (mander., 2011). following the first learning session at 12:00, half of the subjects remained awake, while the other half obtained a 100 min nap opportunity. hippocampal - dependent learning deteriorated across the day in those who remained awake (figure 3a). in contrast, sleep not only blocked this deterioration in learning capacity, but triggered a numeric enhancement in hippocampal - dependent encoding ability. within the nap group, the extent of learning restoration (pre- to post - sleep) was positively correlated with both the amount of stage-2 nrem, and specifically the number of fast sleep spindles over the left prefrontal cortex (figures 3b d). moreover, and motivated by the role of the lateral prefrontal cortex and medial temporal lobe structures in episodic memory, eeg source analysis of these left prefrontal spindles was performed, revealing an oscillation of activity throughout the spindle event looping through the left temporal lobe (figure 3e). such findings can parsimoniously be accounted for within a hippocampal - neocortical framework of memory processing (discussed in the following section), predicting decreased episodic learning capacity with continued waking experience ; a potential limitation of sparse hippocampal representational coding (treves., 1996). consequently, nrem sleep spindles, which co - occur with hippocampal sharp - wave ripples (siapas and wilson, 1998 ; clemens. 2009), are proposed to support a proactive shift from hippocampal- to increasing cortical - dependence of previously encoded representations, thereby restoring post - sleep episodic encoding ability. (a) episodic learning ability (% face - name pairs encoded) in the nap and non - nap group at 12:00 and 18:00 (left), and the change in episodic learning ability between sessions (18:0012:00 ; right). episodic learning ability in a subset of nap and no - nap subjects (n = 10 per group), matched on initial 12:00 performance, is presented in the center box. comparisons (line across bars) in both plots reflect significance at : p < 0.05. (b) within the nap group, correlations with stage-2 nrem sleep and episodic learning ability at 12:00 (left - panel), 18:00 (middle - panel), and the change in learning ability between session (18:0012:00 ; right - panel). (c) topographic correlations (color - bar indicates pearson s correlation strength) in the nap group between fast sleep spindles and episodic learning ability at 18:00 (post - nap), significant in derivations f3, f4, fz, f7, f8, fp1, and fp2 over pfc, maximal at f7 (r = 0.536, p = 0.018). (d) of these derivations, the change in episodic learning ability (18:0012:00), significantly and conjointly correlated with fast spindles at derivation f7 over left pfc (r = 0.535, p = 0.018). (e) sloreta source time - series of fast sleep spindles identified by onset at f7, demonstrating a current - density loop recurring in left temporal lobe, proceeding the peak of the spindle. modified from mander. (2011). of note, neither the impairments in encoding following deprivation (yoo., 2007a) nor the restoration of encoding following a nap (mander., 2011) appear to be parsimoniously accounted for on the basis of changes in basic alertness or attention. specifically, response times during encoding and testing in both studies, often used as an indexing of alertness, did not predict learning ability or associated encoding brain activity, and were not different between the respective control groups in either study. moreover, in the nap study (mander., 2011), no differences were observed between the sleep and no sleep groups on a specific alertness control task. one consideration when interpreting the findings of studies that compare between evening and morning learning and testing phases are the inherent changes in alertness and fatigue at these different times, as well as changes in circadian clock time. in addition to measuring objective and subject alertness and attention as potential confounding factors, a nap - paradigm can also be advantageous in this context (e.g., mander., 2011), allowing for a manipulation of sleep and wakefulness whilst holding timing (both clock and circadian) of learning and testing constant between conditions. a robust and consistent literature has demonstrated the need for sleep after learning in the subsequent consolidation of hippocampal - dependent memory (gais., 2002 ; graves., 2003 ; rauchs., 2004 ellenbogen., 2006 ; ferrara., 2006 ; fogel and smith, 2006 ; gais., 2006 ; marshall., 2006 ; wagner., 2006 ; gais., 2007 ;, 2007 ; alvarenga., 2008 ; axmacher., 2008 ;, 2008 ; landsness., 2009 ; ramadan., 2009 ;, 2010 ; wamsley., 2010). in humans, arguably the first experimental description of a beneficial role of sleep for memory stabilization was provided by jenkins and dallenbach (1924), indicating a protective benefit of sleep (after approximately 4 h) in preventing the normal decay - curve of forgetting that develops across time spent awake. (2006), have since revealed the extent of sleep s ability to protect declarative memories from forgetting by systematically manipulating interference, employing an a b a c paradigm. in this paradigm, participants first learned unrelated word - pair associates, designated as list a b (e.g., leaf - wheel etc.). after sleep at night, or wakefulness during the day, half of the subjects in each group learned a new, interfering list containing a new associate paired with the first word, designated as list a c (e.g., leaf nail etc), before being tested on the original a b list (e.g., leaf wheel etc). in the groups that did not experience the interfering challenge simply being trained and then tested on list a however, when testing the groups that were exposed to interfering list learning (list a b), a large and significant protective benefit was seen in those that slept (figure 4). therefore, sleep conferred a consolidation benefit that rendered recently encoded episodic memories resistant to the potentially aggravated effects of new learning of somewhat overlapping (hence potentially competing) memory representations the next day. yet, it was only by using an interfering challenge, the a c list, that the true benefit of sleep s protection of memory was revealed ; a benefit that would not necessarily have been evident in a standard study - test memory paradigm. such evidence would favor a mechanism by which sleep either (1) solidified the original (a b) hippocampal representations, forcing encoding of related representations (a c) in non - overlapping hippocampal networks, or (2) the transformation of the original (a b) representations to a less hippocampally dependent state, allowing for hippocampal encoding of related new (a c) representations that overlap with those previously coding the original (a b) representations, but without detrimental interference. percent correct recall for b words from the original a b pair after a 12 h retention interval of either wake or sleep following no interference or interference learning (list a c). p < 0.10, p < 0.05, p < 0.001 ; error bars indicate s.e.m. modified from ellenbogen. several reports by born and colleagues have shown offline improvement on hippocampus - dependent memory following post - learning sleep attributed to early night sleep, rich in sws (diekelmann and born, 2010). evidence for such an effect comes first from studies demonstrating that partial deprivation of early sws - rich sleep impairs recall of memories learned prior to sleep (gais., 2000 ; wagner., 2001 ; wagner., 2002 ; gais and born, 2004 ; fischer., 2011). the same group has also recently demonstrated a causal role for the slow cortical oscillation (< 1 hz) of nrem sleep in beneficially enhancing the consolidation of declarative memories by increasing activity in this frequency range. following learning of a word - pair list, transcranial direct current stimulation was applied over the prefrontal cortex of participants during early night sws, inducting slow oscillation - like field potentials (in this case, at 0.75 hz ; marshall., 2004, 2006). consequently, a greater benefit on overnight retention was observed for the set of information learned prior to sleep. direct current stimulation not only increased the amount of slow oscillation activity, as well as sleep spindle frequency activity, during the simulation period (and for some time after), but also enhanced next - day word - pair retention. these findings were interpreted in the context of slow oscillations potentially triggering spindle - regulated plasticity in cortex. one mechanism proposed to underlie the benefit of sleep on hippocampal - dependent learning is the reactivation of previously encoded hippocampal memory representations during subsequent nrem sleep. in animals, the signature firing patterns of these hippocampal (as well as cortical) networks expressed during waking performance of spatial tasks and novel experiences appear to be replayed during subsequent nrem sleep (and in some studies, also rem ; wilson and mcnaughton, 1994 ; skaggs and mcnaughton, 1996 ; dave., 1998 ; dave and margoliash, 2000 ; poe., 2000 ; louie and wilson, 2001 ; ribeiro and nicolelis, 2004 ; jones, 2005 ; ji and wilson, 2007). extending these findings, related evidence has been reported in the human brain using a virtual maze task in combination with positron emission tomography (pet) scanning (peigneux., 2004). then, during post - training sleep, there was a re - emergence of hippocampal activation, specifically during sws. most compelling, however, the amount of sws reactivation in the hippocampus was proportional to the amount of next - day task improvement, suggesting that this reactivation is associated with offline memory improvement. building on the framework that memories, particularly those involving the hippocampus, are reactivated at night during sleep, recent work has taken advantage of the classical psychology effect of cue - dependent recall, and translated it into a sleep - dependent consolidation paradigm rasch. following learning of a spatial memory task that was paired with a rose sent cue, the same rose odor was re - presented during subsequent sws that night a time when consolidation was presumed to be occurring. relative to a control condition where the odor was not presented again during sws, the re - perfusion of the rose scent at night resulted in significantly improved recall the following day (when recall occurred without any odor cue). moreover, the representation of the odor during sws when previously paired with learning during encoding resulted in greater (re)activation of the hippocampus during sws, as measured with fmri. these findings support a role for sws in the consolidation of declarative memory in relation to a prior context (here, odor), and may indicate an active reprocessing of initially hippocampal - dependent information during sws. building on these findings, rudoy. (2009) have recently demonstrated similar sleep - dependent reactivation of memory using auditory rather than olfactory cues, describing a selective ability to manipulate individual item memory consolidation during nrem. determining the neural mechanisms that promote sleep - dependent human memory consolidation remains an active topic of research, and debate. it is perhaps unlikely that multiple different memory systems, involving diverse cortical and/or subcortical networks, require the same underlying neural mechanisms for their modulation. even if they do, it is not clear that this process would rely on just one type of sleep - stage physiology. multiple models of sleep - dependent memory have been offered to account for the overnight facilitation of recall, which build on different aspects of neural activity during sleep. a systems - level model of sleep - dependent memory processing (for discussion of a homeostatic cortical model of sleep - regulated plasticity, see tononi and cirelli, 2003) can be considered that involves reciprocal hippocampal - neocortical communication, with potential benefits not only for offline consolidation, but also renewed hippocampal encoding capacity upon awakening. within this framework (marr, 1971 ; squire and alvarez, 1995 ; squire., 2004 ; frankland and bontempi, 2005), the hippocampus initially binds cortical elements of an experience, creating a holistic episodic memory by way of hippocampal - cortical connections (figure 5). over time, and by way of iterative offline processes, increasing cortico - cortical connections develop, associated with decreasing dependence on the hippocampus. therefore, the classical model of memory consolidation holds that neocortical structures become increasingly important for the representation of consolidated episodic memories, while the corresponding contribution of the hippocampus progressively decreases. in addition to its role in binding distributed cortical memory components, the hippocampus plays a critical role in reactivating these networks, specifically during sleep. this process of reactivation, assumed to occur over multiple sleep cycles across a night and/or multiple occurrences of sleep over many nights, is proposed to gradually strengthen the initially weak connections between neocortical sites, thereby reinforcing them. eventually, this strengthening is suggested to allow the original information to be engaged in the cortex, largely independent of the hippocampus. (b) successive sleep - dependent reactivation of this hippocampal - cortical network leads to progressive strengthening of cortico - cortical connections, (c) which over time, allow these memories to become independent of the hippocampus and gradually integrated with pre - existing cortical memories. modified from frankland and bontempi, 2005. it has been posited that such a sleep - dependent process can offer two symbiotic benefits (walker, 2009). the first is that episodic memories from the day prior should be more resistant to interference from new hippocampal learning the next day, due to the increased cortico - cortical connections formed during overnight consolidation (figure 5). it is precisely this behavioral effect that was reported in the study by ellenbogen. (2006), showing greater post - sleep resistance to interference, using the a in addition to consolidation, however, the second suggested benefit of this sleep - dependent dialog is the post - sleep reinstatement of sparse encoding capacity within the hippocampus, restoring the efficient ability for renewed next - day episodic encoding (figure 5). this second premise appears to accurately explain the findings previously discussed describing a reduction in hippocampal encoding ability without intervening sleep (yoo., 2007a ; van der werf., 2009), and conversely, the restoration of hippocampal - dependent learning following the presence of sleep (mander., 2011) several reports have provided evidence supportive of this sleep - dependent dialog and neural transformation of declarative memory. in the first such report, takashima. in addition to a long - term evaluation of memory over 3 months, there was also a short - term evaluation of memory across the first day, which included an intervening nap period (90 min) between training and testing of the original studied (remote) stimuli. the duration of nrem sws during the intervening nap correlated positively with later recognition memory performance, yet negatively with retrieval - related activity in the hippocampus, consistent with the notion of episodic representations becoming less dependent on the hippocampus, post - sleep. extending these findings, maquet and colleagues have since demonstrated that one night of post - training sleep deprivation, even following recovery sleep, significantly compromises these hippocampal - neocortical neural dynamics and associated memory recollection (gais., 2007). beyond the contribution of nrem slow waves, a number of reports have described an association between nrem sleep spindle events and memory, including hippocampal - dependent learning. these short (1 s) synchronous bursts of activity are expressed in the eeg in the 1115 hz frequency range (sejnowski and destexhe, 2000 ; steriade, 2001 ; smith., 2004), and coincide with hippocampal sharp waves and ripples (siapas and wilson, 1998 ; sirota., 2009 ; diekelmann and born, 2010), possibly reflecting reactivation of learned memory representations (mlle., 2006 ; born, 2010 ; oneill., 2010). (2002), have shown significantly higher sleep spindle density following daytime episodic learning session (encoding of word - pair associates). (1999), who reported a similar increase in spindles following learning of a hippocampally dependent maze task, and by clemens. (2005) who have since identified a correlation between spindle density and overnight verbal memory retention (although interesting, not memory for faces). that such results reflect spindle - related memory processing is supported by recent data demonstrating that the same cortical areas active during learning are also (re)activated during post - encoding sleep spindle events this learning - dependent change in spindle - related activity extends that of use - dependent changes in eeg slow waves that may reflect homeostatic process (kattler., 1994 ; huber., 2006). continued evidence suggests that sleep spindles can be separated into two subtypes based on frequency : slow (1315 hz ; werth., 1997 ; zeitlhofer., the relevance of this separation from a memory consolidation perspective is highlighted by neuroimaging findings demonstrating that fast spindles are associated with, amongst other regions, significantly greater activation within the hippocampal complex (schabus. moreover, recent fmri data have demonstrated that the occurrence of fast sleep spindles coincide with moments of increased functional connectivity between the hippocampus and areas of neocortex (andrade., 2011), supporting a postulated component of the hippocampal - neocortical model of sleep - dependent memory consolidation. indeed, a growing number of reports describe select associations between episodic memory and fast- but not slow - spindle activity (tamaki., 2008 ; mander., 2011 ; saletin. nevertheless, the role of specific spindle frequency subtypes, and their local topographic influence, in hippocampal- and extra - hippocampal - dependent memory processing represents a target for future research, with early discriminatory findings beginning to emerge (van der helm., 2011). secondly, while the role for sleep spindles in declarative memory processing is increasingly clear, there remains the need to dissociate which feature or combination of features of the spindle oscillation govern these memory processing advantages (e.g., number clemens., 2005, density saletin., 2011, or amplitude / power schabus., 2008) a consensus on the differential role of slow waves and spindles has also yet to be reached, with reports implicating sleep spindles (e.g., gais., 2002 ; schabus., 2004 ; clemens., 2006 ; nishida and walker, 2007 ; genzel., 2009 ; saletin., 2011) or however, what, if any, inter - relationships exist between spindles and slow waves remains largely uncharacterized (molle., 2011) and will require studies capable of distinguishing between spindle - driven and slow wave - driven memory mechanisms, or identifying their combined influence. moreover, the potential role for rem sleep and its associated physiological features in declarative memory processing remains relevant (rauchs., 2004 ; walker, 2009, see below discussion). by way of such future investigations, an increasingly nuanced characterization of dissociable sleep - dependent memory mechanisms can be reached. while evidence reviewed above focuses on nrem sleep in declarative memory consolidation, rem sleep should not be discounted. early work reported that the overnight retention of emotional details of a narrative story, relative to emotionally neutral details, was superior following late - night sleep (a time period rich in rem sleep ; wagner., 2001). it has subsequently been demonstrated that the speed of recognizing emotional face expressions presented prior to sleep is significantly improved the next day, the amount of which positively correlated with the amount of intervening rem sleep (wagner., 2007). moreover, not only does the amount of time and speed of entry into rem sleep predict the degree of subsequent strengthening and hence offline consolidation of emotional (and not neutral) memory, but specifically the amount of rem sleep theta eeg activity (47 hz) expressed over the prefrontal cortex that predicts memory retention (nishida. these findings have lead to the proposal that rem sleep represents a neurobiological brain - state particularly amenable to emotional memory processing (pare., 2002 ; hu., 2006 ; walker, 2009 ; walker and van der helm, 2009), with theta oscillations proposed as a carrier frequency that potentially allows disparate brain regions that initially encode information to selectively interact offline. by doing so, rem sleep theta may afford the ability to strengthen distributed aspects of specific memory representations across related but different anatomical networks, and/or promote their integration into pre - existing autobiographical memory networks (cahill, 2000 ; jones and wilson, 2005). evidence reviewed to this point implicates sleep in the consolidation and hence superior offline retention of declarative memory, relative to equivalent time awake. however, the capacity to forget can, in certain contexts, be as important as the need for memory retention, both in day - to - day life (e.g., forgetting last week s parking spot in preference for today s), and clinically (e.g., post - traumatic stress disorder and addiction). considered to be adaptive, selective forgetting has been shown to decrease neural resources required for targeted remembering (levy and anderson, 2002 ; kuhl., 2007), and as a consequence, may afford improved efficiency of subsequent recall of select information (block, 1971 ; anderson., 2004 ; levy and anderson, 2008). building on such evidence, here we offer the thesis that the goal of offline sleep - dependent memory processing is not the verbose, ubiquitous, and non - selective consolidation of all information recently encoded. nor instead, we suggest offline sleep - dependent memory processing may involve a discriminatory mechanism, affording a balance of retention, and forgetting, with item selection determined by salience cues present during wake, such as novelty, emotionality, reward value, and explicit conscious instruction (figure 6). new selective model of sleep - dependent hippocampal - neocortical memory consolidation. (a) at encoding the hippocampus rapidly integrates information within distributed cortical modules, however certain memories (colored nodes) are weighted over others by means of relevant information (e.g., emotion, reward, or intention), whereas other memories lack this relevance tag (gray nodes). (b) successive sleep - dependent reactivation of this hippocampal - cortical network, by way of synchronous nrem (sleep spindle and slow wave) as well as rem (theta) oscillation, leads to progressive strengthening of cortico - cortical connections, though only for those memories deemed relevant by associated encoding information (c) which over time, leads to a selective consolidation of certain learned items, whereas other items, not given a benefit of selectivity, are allowed to dissipate at both hippocampal and neocortical levels. modified from frankland and bontempi (2005). emerging reports have begun to support this more nuanced, discriminatory framework of sleep - dependent memory processing., 2006 ; atienza and cantero, 2008), and specifically rem sleep (wagner., 2001 ; nishida., 2009), has been demonstrated to target the selective consolidation of emotional relative to non - emotional experiences. moreover, sleep appears capable of separating episodic experiences into component parts, preferentially consolidating those of greatest affective salience (payne., 2008). beyond emotion, sleep has recently been demonstrated to selectively enhance information based on waking knowledge of potential monetary reward prior to sleep (fischer and born, 2009), even when such knowledge of a reward was announced after initial learning (but before sleep). further, the mere knowledge that some learned items will be subject to later post - sleep testing, presumably involving a difference in salient relevance, amongst other things, can selectively increase the offline sleep - dependent consolidation benefit (wilhelm., 2011). explicit conscious instruction at the time of encoding also appears to represent a powerful modulatory influence on subsequent sleep - dependent consolidation. using a directed forgetting paradigm, the impact of cued instruction during learning to either remember or forget, prior to sleep, on subsequent differential retention of memory after sleep has recently been examined (saletin., 2011). relative to time awake, sleep subsequently and selectively ignored the facilitation of items previously cued to be forgotten, yet preferentially enhance recall for items cued to be remembered (figure 7a). this effect was further characterized as a difference - score (remember words forget words). this difference measure, reflecting the efficiency of accomplishing targeted remembering and forgetting, demonstrating a greater separation between recall of remember relative to forget items following sleep (figure 7b). thus, sleep did not benefit all memories universally, instead being selective for those items cued for remembering and not those cued to be forgotten, indicative of specificity based on prior waking instruction. moreover, the magnitude of this directed forgetting effect was positively predicted by fast spindles over left parietal cortex, suggesting their potential role in differential gating of offline consolidation, governing the directional fate of each memory item class (remember, forget ; figure 7c). additionally, the same parietal fast spindles differentially and bi - directionally modulated each word class individually ; positively predicting recall for remember words alone while, conversely, negatively predicting recall for forget words (figure 7d, e). this evidence favors a sleep mechanism that not only promotes remembering but also actively instigates forgetting. offering deeper anatomical insights, eeg source analyses revealed an loop of activity occurring during these parietal fast spindle events, consisting of areas previously implicated in differential remembering and forgetting memory (wylie., 2008) : prefrontal, medial temporal, and posterior parietal cortices. such a network may support memory modulation whereby top - down cues of instructed intent (prefrontal cortex ; remember, forget) are coordinated and utilized during offline processing of bottom - up item memory (medial temporal lobe), and potentially integrated into association regions (parietal cortex) for consolidation (shimamura, 2011). related findings have been reported using an episodic memory paradigm involving the intentional suppression and contemplation of word items prior to sleep, with those intentionally suppressed during initial exposure showing significantly less offline sleep - dependent memory benefit (fischer., 2011). adding to these findings, post - encoding sleep deprivation can further impair the subsequent offline development of these differential remember and forget consolidation effects, dependent, in part, on hippocampal signals at the time of encoding (rauchs. (a) memory performance : number of words recalled based on prior cue instruction (remember, r - words ; forget, f - words) in the nap and no - nap groups and the (b) efficiency measure of directed forgetting, calculated as the subtraction of these scores (r f ; expressed as a proportion of total recall). between group comparisons (line across bars) reflect significance at : p < 0.05 and p < 0.01. relationship between memory performance and sleep spindles : (c) scatter - plot and linear regression of the relationship between fast sleep - spindle density at p3 and the r (c d) scatterplots demonstrating that the same p3 fast spindles (d) positively predict r - words and (e) negatively predict f - words, though neither correlation is as strong as the r f difference measure, suggesting a relative selectivity of sleep - dependent memory consolidation. modified from saletin. (2011). it is of note that the presentation of olfactory cues during sleep for memory reactivation described earlier only resulted in facilitated overnight consolidation when the same odor was initially presented at the time of learning (rasch., 2007). odor presented during sleep in isolation, without prior waking association with learning, conferred neither an overnight memory consolidation advantage nor elevated hippocampal reactivation during sleep. this finding appears consistent with the proposed model of selective memory consolidation, suggesting that even the success of memory reactivation during sleep critically depends on associating those memories with the cues during initial encoding, prior to sleep. such associations would effectively label specific memory representations at the time of learning with contextually salient tags ; offering the capacity for selective reactivation, and subsequent consolidation, during sleep. a further circumstance that may determine selective memory consolidation is the relationship between newly learned representations and pre - existing autobiographical memory schemata (lewis and durrant, 2011). experiences that hold relevance to the organism s autobiographical past have the potential for being registered, as a consequence, with superior salience, and hence undergo preferential overnight consolidation. similarly, employing learning strategies such as mnemonic techniques that assist in elaboration on, and integration amongst, new learning (or even pre - existing information ; wang and thomas, 2000) may similarly promote selective offline consolidation during sleep. when taken together, this collection of studies suggest that sleep does not universally consolidate all episodic memories learned during the prior day(s). instead, sleep appears to be more ecologically attuned to qualitative aspects of encoded experiences at the time of initial learning e.g. emotionality (hu., 2006 ; wagner., 2006, 2007 ; payne., 2008 ; walker and van der helm, 2009 ; payne and kensinger, 2011), reward potential (fischer and born, 2009 ; wilhelm., 2011), or explicit cue instructions and intentions (fischer., 2011 ; rauchs., 2011 ; saletin., 2011), resulting in discriminatory offline memory processing. such findings additionally offer key anatomical targets for the understanding of sleep - dependent memory processing, focusing on those regions whose interactions with the medial temporal lobe support selective memory processing e.g., amygdala for emotional memories (hu., 2006 ; yoo., 2007b ; nishida., 2009 ; walker and van der helm, 2009 ; payne and kensinger, 2011), striatum for reward signals (knutson and adcock, 2005) and the prefrontal cortex for directed intentional cues (anderson., 2004 ; parenthetically, this selective sleep benefit, including the bi - directional influence of spindles on remembering and forgetting, seems difficult to reconcile within simple opportunistic frameworks of offline consolidation (mednick., 2011). instead, such evidence appears to warrant a shift in perspective from notions of sleep affording a universal consolidation benefit to recently encoded information (figure 4), to one in which unique and specific sleep - stage physiologies select item information for preferential retention, based on prior waking cues (figure 6) ; a process conceptually similar to a sleep - slave consolidation system, governed by prior waking cues, and yielding discriminatory long - term memory consolidation. while remaining speculative, potentially novel clinical and therapeutic implications stem from this revised model of selective memory consolidation. perhaps most prominent are the circumstance of anxiety disorders as well as major depression, both of which express dysfunction in memory as well as sleep abnormalities (armitage, 1995 ; van wingen., 2010 ; dickie., 2011 ; harvey, 2011). in major depression, disproportionate rumination of past negative autobiographical events can be prevalent, contributed to by the proposal of a bias in initial encoding of negative experiences (taconnat., 2010 ; van wingen., 2010). in the context of our model, this initial encoding bias may lead to the maladaptive further potentiation of those selectively negative experiences during sleep, the consequence of which would be their persistent dominance in long - term memory, further encouraging negative rumination. in anxiety disorders, including post - traumatic stress disorder and phobia, a similarly biased associative encoding of episodic experiences with strong negative aversive emotion (mitte, 2008 ; dickie., 2011) may tag those experiences for disproportional selective consolidation, potentiating the trauma experiences or phobic associations (and see walker and van der helm, 2009 for discussion of emotion processing of memory in ptsd). conversely, however, these same mechanisms could be considered for use in therapeutic intervention. in both conditions, targeting the problematic memory sources during wake, by recollection and hence reactivation (lee., 2004 ; stickgold and walker, 2005 ; tronson and taylor, 2007), can offer the capacity for developing new positive (rather than negative), or simply neutral, associations, pre - sleep. subsequent selective consolidation of these new positive or neutral associations in sleep, put in place during prior wake, could help foster a revised and therapeutically advantageous collection of memory representations in the individual s autobiographical history. finally, similar bi - directional notions of memory modulation may also be relevant in addiction, both in the maladaptive potentiation of addiction associations, but also their potential targeted reversal leading to extinction of acquired associations. while not fully complete, a new taxonomy of sleep - dependent memory processing is emerging. this revised view describes a symbiotic role for sleep both before and after learning in optimally coordinating the initial encoding and subsequent consolidation of hippocampal - dependent memory, respectively. by way of such a mechanism, sleep appears capable of maximizing retention only of the most salient, relevant hippocampal memories, while forgetting (perhaps actively), those non - essential to the organism an optimal algorithm for equilibrium within memory networks. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | as critical as waking brain function is to learning and memory, an established literature now describes an equally important yet complementary role for sleep in information processing. this overview examines the specific contribution of sleep to human hippocampal memory processing ; both the detriments caused by a lack of sleep, and conversely, the proactive benefits that develop following the presence of sleep. first, a role for sleep before learning is discussed, preparing the hippocampus for initial memory encoding. second, a role for sleep after learning is considered, modulating the post - encoding consolidation of hippocampal - dependent memory. third, a model is outlined in which these encoding and consolidation operations are symbiotically accomplished, associated with specific nrem sleep physiological oscillations. as a result, the optimal network outcome is achieved : increasing hippocampal independence and hence overnight consolidation, while restoring next - day sparse hippocampal encoding capacity for renewed learning ability upon awakening. finally, emerging evidence is considered suggesting that, unlike previous conceptions, sleep does not universally consolidate all information. instead, and based on explicit as well as saliency cues during initial encoding, sleep executes the discriminatory offline consolidation only of select information. consequently, sleep promotes the targeted strengthening of some memories while actively forgetting others ; a proposal with significant theoretical and clinical ramifications. |
pituitary adenylate cyclase activating polypeptide (pacap) is a neuropeptide with widespread occurrence in various organs and diverse effects both in the nervous system and in the periphery [1, 2 ]. pacap is strongly expressed in the central nervous system, where it exerts several effects such that it is a central regulator of circadian rhythmic activities, plays a role in memory formation and psychiatric processes, and is involved in central feeding control. pacap is also known to be expressed in the retina, along with its receptors (pac1, vpac1, and vpac2 receptors). numerous studies have provided evidence that the neuroprotective effects are mainly mediated by the pac1 receptor and diverging downstream pathways upon its activation [79 ]. the pac1 receptor has several splice variants, which can mediate not only different but also opposing effects. several research groups have proven that pacap has strong protective effects against various retinal injuries. in vitro, it protects retinal explants against excitotoxic injury and retinal pigment epithelial cells against oxidative stress. in vivo retina studies show that pacap protects against nmda- and msg - induced excitotoxic damage [13, 14 ], uv light - induced lesion, and optic nerve lesion. retinal ischemia can be induced by several methods, mimicking pathological features seen in human glaucoma - related retinal lesions, in chronic retinal hypoperfusion, and in other types of retinal lesions accompanied by ischemia. the protective role of pacap has also been proven in models of retinal ischemia [18, 19 ]. based on these studies, evidence for the protective effects of pacap in the retina is now well established. the bioavailability and fast degradation of pacap limit its therapeutic use and attention has been drawn to the application of shorter fragments and/or analogs. n - terminally shorter fragments of pacap usually have antagonistic effects, but some reports have documented agonistic behavior, depending on the cell / tissue type [79, 21, 22 ]. in contrast, c - terminally shorter fragments usually differ in the strength of receptorial binding [79 ]. therefore, it is necessary to test whether shorter pacap fragments have any effect, ameliorating or damaging, on retinal lesions. we have previously shown that pacap 6 - 38, the most widely used antagonist of pacap, has an aggravating effect on retinal excitotoxic lesion. however, it is not known, whether the shorter fragments of pacap have any effect on the retina. therefore, the first aim of our present study was to examine the effects of pacap fragments 4 - 13, 4 - 22, 6 - 10, 6 - 15, 11 - 15, and 20 - 31 on chronic retinal hypoperfusion induced by bilateral carotid artery occlusion. possible fragments to be tested were selected in order to cover a wide range of the molecule, from the n - terminal to the c - terminal and middle region of the peptide. in addition, the n - terminal fragments show a high similarity with the structure of vip. furthermore, the 4 - 13 domain, for example, shows high selectivity to the pac1 receptor, which is mainly responsible for the neuroprotective effects of pacap [79 ]. in a recent study we have shown that the peptide most closely related to pacap, namely, vasoactive intestinal peptide (vip), is also protective in retinal ischemia. however, to achieve a degree of neuroprotection similar to pacap, higher doses are required. other members of the peptide family have not been tested in retinal ischemia so far. therefore, the second aim of the present study was to investigate whether secretin and glucagon have any effect on a rat model of retinal ischemia. animals were housed in individual cages, fed, and watered ad libitum, under light / dark cycles of 12/12 h. all animal procedures complied with the university of pecs (number ba02/2000 - 15024/2011) for the ethical use of animals. adult male rats (n = 32) weighing 250300 g were exposed to permanent bilateral common carotid artery occlusion (bccao) under isoflurane anesthesia and both common carotid arteries were ligated with a 3 - 0 filament through a midline incision. a group of animals underwent anesthesia and all steps of the surgical procedure, except ligation of the carotid arteries. these animals served as sham - operated animals (n = 7). immediately following the operation, pacap 1 - 38 or its fragments (pacap 4 - 13, 4 - 22, 6 - 10, 6 - 15, 11 - 15, and 20 - 31) or other members of the peptide family such as secretin and glucagon (100 pmol/5 l) were injected intravitreally using 30-gauge hamilton syringe into the right vitreous body of animals. the left eyes received the same volumes of vehicle treatment (physiological saline) and served as ischemic eyes. rats were sacrificed with an overdose of anesthetic after 2 weeks of bccao and the eyes were processed for histological analysis. briefly, the eyes were dissected in pbs and fixed in 4% paraformaldehyde dissolved in 0.1 m pb. following fixation, tissues were embedded in durcupan acm resin, cut at 2 m, and stained with toluidine blue. four tissue blocks from at least four animals were prepared and central retinal areas within 1 mm from the optic nerve were used for measurements (n = 5 measurements from one tissue block). sections where the gcl appeared thicker than a single cell row were omitted from evaluation. the following parameters were measured : (i) the width of the outer and inner nuclear and plexiform layers (onl, opl, inl, and ipl, resp.) ; (ii) the number of cells/100 m section length in the ganglion cell layer (gcl) ; (iii) the number of cells/500 m area in the inl. statistical comparisons were made using the anova test followed by tukey - b 's post hoc analysis. bccao resulted in severely reduced thickness of retinal layers as observed two weeks after ligation compared to sham - operated controls (figure 1(a)). marks of degeneration with individual variations are visible in all retinal layers (figure 1(b)). morphometric analysis revealed that the most pronounced reduction in thickness in retinas with bccao was found in the opl (figure 2). this layer was significantly thinner than that of the control specimens (figure 2). many cells in the ganglion cell layer (gcl) also suffered degeneration, shown by necrotic cells in this layer (figures 1 and 2). this fact is well reflected in the reduced number of cells in the gcl (figure 2). intraocular pacap 1 - 38 treatment following bccao led to nearly healthy appearance of the retinal layers (figure 1(c)). the thickness of the major retinal layers was almost identical with that of the sham - operated animals and was significantly larger than that of control ischemic ones (figure 2). this was especially conspicuous in the opl, which disappeared, and the onl and inl layers were fused in several control animals and were preserved in all pacap 1 - 38 injected animals. however, the number of cells in the gcl seemed to be lower than in the sham - operated animals (figure 2). intravitreal injection of different pacap fragments (pacap 4 - 22, 6 - 15, 11 - 15, 20 - 31, 6 - 10, and 4 - 13) did not ameliorate the ischemic damage of the retina (figures 1(d)1(i)). in all samples, nuclear layers (onl, inl) and plexiform layers (opl, ipl) were reduced, and the cell number in the gcl was significantly less than in sham - operated controls. however, injection with pacap 6 - 10 and 4 - 13 resulted in further reduction of the inner plexiform and nuclear layers (figures 1(h) and 1(i)). treatment with members of the pacap - related peptide superfamily, glucagon and secretin, led to no aggravation or amelioration of the ischemic retinal lesion (figure 3). pacap is thought to play an important role in visual processing, as it is an important cotransmitter in the retinohypothalamic tract that is the major input for the biological clock situated in the suprachiasmatic nucleus. besides its supposed physiological actions in the retina, pacap is a well - established retinoprotective peptide. endogenous protection is proven by the increased vulnerability of the retina in mice lacking endogenous pacap in ischemic retinal lesion and in nmda - induced excitotoxic injury. these observations are further supported by the increased apoptotic activity in retinas injected by the pacap antagonist pacap 6 - 38. as pacap is a well - accepted retinoprotective agent in models of different retinal injuries, several studies have attempted to explore the molecular mechanisms explaining this strong retinoprotection. we have shown that pacap activates the antiapoptotic, while it inhibits the proapoptotic signaling pathways in retinal toxic lesions. in retinal ischemia, we have shown that pacap administration provides protection by involving akt, mapk pathways, and anti - inflammatory actions. given the very potent actions of pacap in retinal and other pathologies, there is an urging demand for developing novel analogues and/or fragments to increase the bioavailability and stability of the peptide for future potential therapeutic use [7, 8 ]. binding pacap to other carrier molecules is a possibility to increase its capacity to traverse through membranes and to exert cytoprotective effects. it has also been shown that pacap is able to pass through cell membranes and convey nonreceptor mediated effects. this has raised the possibility of using pacap fragments also for supporting transport of other nonpenetrable molecules. several analogues have also been developed for these purposes [7, 8, 32 ]. interestingly, however, a stable analogue did not provide stronger neuroprotection in a stroke model than the natural peptide. unfortunately, all these efforts do not seem to lead to obtaining of a more effective molecule than the original peptide or to obtaining of a biologically more stable analogue that has the same protective property as pacap 1 - 38. the evolutionary pressure on the form of pacap 1 - 38 seems to be very strong, as effects found in vertebrates have also been described in invertebrates. although a lot of pharmacological and receptor binding studies have been performed with fragments / analogues of pacap, only few studies have tested the biological efficacy of these forms. since some studies suggest that there are unconventional binding sites, unusual behavior of the peptide forms in some tissues and even implies the existence of unknown receptor splice variants [21, 22, 34 ] ; it is important to test the biological effects of fragments in a system that is well standardized in numerous earlier studies. our present results show that the shorter fragments of pacap, as expected, do not provide any neuroprotection. in addition, we can confirm that most of them do not deteriorate the degree of damage either, although some parameters were worsened in cases of pacap 6 - 10 and 4 - 13. this is in accordance with our earlier observations showing that pacap antagonists pacap 6 - 38 and 6 - 27 lead to aggravated retinal lesion in an msg - induced retinal injury model. some other members of this family have been localized in the vertebrate retina and several functions have been attributed to them [35, 36 ]. glucagonergic amacrine cells represent a small subpopulation of the amacrine cells possibly playing a role in the visual processing [37, 38 ]. other studies have shown that glucagon plays a role in eye bulb growth and glucagon is suggested to be an endogenous mediator of emmetropization. an early study has shown that glucagon increases camp in chick retinal muller cells, similar to the actions of vip. the protective effects of secretin and glucagon in cerebral pathologies have been implicated in a few studies [4143 ]. in cerebral ischemia, glucagon has been shown to exert neuroprotective effects in vivo. it has not been investigated so far whether secretin or glucagon is protective in retinal lesions. based on our present study, neither glucagon nor secretin based on our present and previous results, a strong neuroprotective effect is a specific pacap - action, since vip could exert its protective effects only in much higher doses, while secretin and glucagon did not have any effects. our present results confirm that the natural form of the peptide, pacap 1 - 38, is the most effective peptide form in retinal ischemia, and the 38 amino acid form of the peptide can not be replaced by another fragment or another member of the peptide family that we know of. our results further support the potent retinoprotective effects of pacap and call for further studies to establish the future possible clinical introduction of pacap - related retinoprotective therapeutic approach. | pituitary adenylate cyclase activating polypeptide (pacap) has neuroprotective effects in different neuronal and retinal injuries. retinal ischemia can be effectively modelled by permanent bilateral common carotid artery occlusion (bccao), which causes chronic hypoperfusion - induced degeneration in the entire rat retina. the retinoprotective effect of pacap 1 - 38 and vip is well - established in ischemic retinopathy. however, little is known about the effects of related peptides and pacap fragments in ischemic retinopathy. the aim of the present study was to investigate the potential retinoprotective effects of different pacap fragments (pacap 4 - 13, 4 - 22, 6 - 10, 6 - 15, 11 - 15, and 20 - 31) and related peptides (secretin, glucagon) in bccao - induced ischemic retinopathy. wistar rats (3 - 4 months old) were used in the experiment. after performing bccao, the right eyes of the animals were treated with pacap fragments or related peptides intravitreal (100 pm), while the left eyes were injected with saline serving as control eyes. sham - operated (without bccao) rats received the same treatment. routine histology was performed 2 weeks after the surgery ; cells were counted and the thickness of retinal layers was compared. our results revealed significant neuroprotection by pacap 1 - 38 but did not reveal retinoprotective effect of the pacap fragments or related peptides. these results suggest that pacap 1 - 38 has the greatest efficacy in ischemic retinopathy. |
surface ligands determine, to a great extent, the biologically relevant functions of various nanosized particles. this is particularly important for drug delivery, where active ligands provide specific interactions to guide particles to the desired place in the body, and for biosensing, where moieties that recognize the analyte of choice provide the necessary selectivity in binding the analyte to the sensor surface. metal organic frameworks (mofs), also known as coordination polymers, are a relatively new class of crystalline porous materials that are formed by the assembly of metal ions with rigid rodlike organic ligands in suitable solvents.1 mofs offer ultrahigh porosity, large internal surfacetovolume ratios, tunable structures, and tailorable chemistry.2 mofs have attracted considerable interest in many potential applications.3 in particular, the use of mofs in biomedicine is growing rapidly because of their advantages in drug delivery and imaging applications over traditional carriers such as organic polymers4 and inorganic materials.5 therefore, surface modification strategies are important for tuning the properties of mofs toward specific applications, such as drug delivery and biosensing. mofs can be used in the development of multifunctional nanocarriers for biomedicine, because they can be tailored in order to have : (i) a particle size appropriate for intravenous applications,6 (ii) a specific trigger for assembly and disassembly that allows controlled drug encapsulation and release,3f, 7 (iii) the ability to serve as a contrast agent8 (e.g., to differentiate between normal and cancerous cells), (iv) a surface functionalized with stabilizers6, 9 (such as peg) to permit circulation in the bloodstream for a prolonged period of time, and (v) celltargeting surface moieties to allow targeted drug delivery.8b, 10 in particular, mil88a has been used for drug encapsulation and as a contrast agent by horcajada, gref, and coworkers.6 mil88a has many advantages compared to other mofs because of its flexible framework, low toxicity, endogenous degradation products (iron and fumaric acid), and easy synthesis in an aqueous medium, resulting in beneficial properties such as a good biocompatibility, degradability, imaging properties, and high loading capacities. recently, dna moieties have been incorporated on mof surfaces to allow particle stabilization, dna detection, and cellular entry.11 mirkin.11a created the first nucleic acid mof nanoparticle hybrids, in which the oligonucleotides were appended with a dibenzylcyclooctyne containing linker to an azidefunctionalized uio66 mof ; these were used to create a steric and electrostatic barrier that stabilize the particles in highly dielectric media and at the same time allows them to enter cells. moreover, nanosized mofs (nanomofs) were noncovalently linked to fluorescently labeled pna for mirna detection.12 many researchers used mofs as sensing platforms for dna detection using electrostatic interactions and stacking. chen.11b developed a selective fluorescence sensor for sequencespecific recognition of hiv dsdna in vitro, using a mof functionalized with triplexforming oligonucleotide (tfo) probes as the sensing platform. using a similar approach, li.11c introduced mil101 as a fluorescence anisotropy (fa) amplifier for dna detection. this mof provided a strong affinity for negatively charged ssdna through stacking and electrostatic interactions. jiang.11d used a similar approach but using uio66nh2 instead of mil101. here, dna was detected by electrostatic interactions and stacking between ssdna and the benzylamino group in uio66nh2. the authors developed a platform that is capable of distinguishing complementary and mismatched target sequences with high sensitivity and selectivity. kang.12 used this concept for sensing multiplexed mirnas in living cancer cells by a peptide nucleic acid labeled with a fluorophore adsorbed on a nanomof. previously our group developed a strategy to simultaneously control both the size and the surface functionalization of mof particles.13 mil88a was synthesized and its size was tuned by varying the stoichiometric ratio between multivalent and monovalent ligands. at the same time, surface functionalization was successfully accomplished and the surface coverage was quantified using a fluorinecontaining capping ligand. moreover, surface functionalization with peg and biotin groups was shown, and the latter was bound to fluorescently labeled streptavidin. here, we describe the development of general surface functionalization strategies of mofs, using both covalent and noncovalent approaches, based on the concept of simultaneous particle formation and surface functionalization. the noncovalent strategy is applied to the formation of peptide nucleic acid (pna)functionalized mil88a, which is used subsequently for the selective binding of dna at the mof surface. flow cytometry is used to analyze sufficiently large numbers of particles so that differences in hybridization efficiency can be detected with statistical significance. native mil88a was synthesized using ferric chloride (as the metal ion providing the secondary building unit) and fumaric acid (as the organic linker) providing a final structure of fe3o(oocc2h2coo)3clz3 h2o. using a previously described methodology,13 mil88a mil88a) by replacing a small fraction of the organic linker fumaric acid with 10undecynoic acid (5 %) or biotin cooh (1 %), respectively, as shown in scheme 1 a. powder xray diffraction (xrd) (see figure s1 in the supporting information) showed that all mofs were semicrystalline. the changes observed in the spectra of the functionalized mofs compared to the native mil88a are attributed to the flexibility of the framework and the effect of water absorption into the pores.13, 14, 15 the presence of the ligands may further affect the degree of hydration. figure 1 shows scanning electron microscopy (sem) images and the average length and width of mil88a, alkynemil88a, and biotinmil88a particles, which confirm the successful synthesis of the mofs. as observed before,13, 15 adding smallmw ligands to the mof surface has only limited effect on the mof particle size. here, we only observe a significant decrease in the width but not the length of the particles. because functionalization was our primary target here a) synthesis of mil88a functionalized with a capping ligand ; b) covalent surface functionalization by the click reaction between alkyne mil88a and azide coumarin ; c) noncovalent surface interactions between biotin mil88a, af488sav, and biotin pna ; d) chemical structures of the compounds used here. sem images of a) mil88a and mil88a functionalized with b) 5 % 10undecynoic acid and c) 1 % biotin cooh capping ligand ; d) average particle dimensions from sem images (a c) ; length (dark gray) and width (light gray). teller (bet) surface area, from 347 m g for unfunctionalized mil88a to 13.4 m g for biotinmil88a. this strong decrease is consistent with earlier observations.2b, 13, 15 given the similar molecular weight of undecynoic acid compared to the fluorinecontaining capping ligand described before,13 we presume the bet areas to be similar. the zeta potential values of uncoated mil88a (19.43.4 mv) were shifted to more neutral values of 12.40.3 and 12.40.4 mv in the case of alkynemil88a and biotinmil88a, respectively, in line with a partial capping of free fe coordination sites at the surface, as discussed before.15 in summary, we successfully functionalized the surface of mil88a with alkyne and biotin groups, which can be used for further covalent and noncovalent functionalization, respectively. covalent surface functionalization was achieved by employing the cucatalyzed click reaction at the surface of alkynemil88a (see scheme 1 b) using 3azido7hydroxycoumarin as reagent, resulting in coumarin the reaction was carried out by adding an excess of azide, using tetrakis(acetonitrile)copper(i) hexafluorophosphate as catalyst, in the presence of tris(benzyltriazolylmethyl)amine (tbta), followed by continuous stirring overnight at room temperature. after the click reaction, bright field and fluorescence microscopy images (figure 2) were taken. the images show mof particles with a high fluorescence intensity, demonstrating the successful functionalization of the surface of mil88a. performing the click reaction at approximately twofold higher concentrations of both alkyne and azide (data not shown) led to a small increase of fluorescence intensity. control experiments were performed with a mof lacking the alkyne function (control 1), or with alkyne mof but in the absence of the copper catalyst (control 2). the bright field and fluorescence images of these controls (figure s2 in the supporting information) indicate the absence of fluorescence in both cases, which confirms the need of alkyne groups on the mof surface and the presence of the catalyst to achieve the successful click synthesis. in summary, these results demonstrate the specific covalent surface functionalization of mil88a using the cucatalyzed click reaction. bright field (a) and fluorescence (b) microscopy images of mil88a after reaction of alkyne mil88a (0.49 mm of alkyne) with coumarin azide (3.3 mm). to demonstrate the feasibility of employing mil88a as a platform for pna / dna functionalization for binding target dna, we chose to functionalize mil88a with pna with a specific sequence that has already been tested in sensing applications.16 three different dna targets were chosen to evaluate the binding selectivity of the mof pna system : the full match (dnafm) strand, a singlebase mismatched (dna1 mm) strand, and a randomized sequence (dnarand) (scheme 2). all dna targets were labelled with cy5 for visualization. to bind biotinylated pna to the mof platform for the selective binding of dna (scheme 2 a), we employed the specific noncovalent interaction between biotinmil88a and alexafluor488labeled streptavidin (af488sav) (scheme 1 c).13 a) noncovalent surface interactions between biotin mil88a, af488sav, and biotin pna and further hybridization with dna and b) structures of the oligonucleotides used here. as shown in scheme 2 a, af488sav was first attached to biotin mil88a using a high sav / biotin ratio of 15 to suppress interparticle crosslinking that was observed before at lower ratios.13 the fluorescence intensities of af488sav and cy5 (dna targets) were measured using flow cytometry, as shown in figure 3 and figure 4. mil88a particles in the absence of any dyes were below 10 for emission of both dyes (figure 3 a). for biotin mil88a conjugated with af488sav, significantly higher intensities were observed for the emission of af488 (figure 3 b) confirming the conjugation between biotin mil88a and af488sav. to focus on the dnarecognition properties of the particles conjugated with af488sav, we selected in all cases those particles that passed the minimum relative fluorescence intensity of 10 for the af488 emission (figure 3 c). this enables easier visualization of differences in selectivity for the different cy5labeled dna target probes used here. the few events above the relative fluorescence cy5 intensity of 10 observed in figure 3 c (purple markers) are attributed to background noise because cy5 is not present in this sample. for the pna dna hybridization, we used a relative fluorescence intensity staining of 10 for cy5 and used the same gate settings for both dyes at all experiments described below. flow cytometry results for : a) biotin mil88a, and b) the conjugate of biotin mil88a and af488sav, and c) the fraction of particles of b for which the af488 intensity is above 100. the blue regions indicate the fractions of particles for which the af488 intensity is below 100, green indicates the fractions of particles for which the af488 intensity is above 100 (indicative of conjugation between biotin mil88a and af488sav), and pink represents the fractions of particles for which both the af488 and cy5 intensities are above 100. flow cytometry (a, c, e, g) and confocal microscopy (b, d, f, h) results for biotin mil88a particles after incubation with af488sav followed by incubation with either dnafm (a, b) or biotin pna followed by hybridization with dnafm (c, d), dna1 mm (e, f), and dnarand (g, h) after washing at 40 c. in the flow cytometry graphs, only the fractions of particles are shown for which the af488 intensity passed the relative fluorescence intensity of 100. the green regions indicate particles with a high intensity of af488 and pink represents a high intensity for both af488sav and cy5. in the confocal images (b, d, f, h), the top left panel corresponds to af488sav, and top right corresponds to cy5 (marker bound to dna) fluorescence channels, bottom left is the microscope bright field image, and bottom right is the overlay. mil88a, preconjugated with af488sav, were incubated with biotin pna at room temperature using a pna / sav ratio of 3. thereafter, hybridization between pna and the complementary dnafm target, labeled with cy5, was performed at 30 c for 1 h using a pna / dna ratio of 1, followed by washing at 40 c. washing at room temperature instead gave nonspecific electrostatic interactions between the mof particles and the dna targets (figure s3 in the supporting information). the same hybridization and washing procedure was followed for the dna1 mm and dnarand targets. the samples were characterized using flow cytometry and confocal microscopy. in the absence of biotin pna, incubation with dnafm did not yield cy5 fluorescence for the particles (figure 4 a, b). in contrast, in the presence of pna, incubation with dnafm gave colocalization of high fluorescence intensities of af488 as well as cy5 (figure 4 c, d). these results indicate that pna and dnafm have been successfully and specifically hybridized at the mof surface. in addition to dnafm, the singlemismatch target dna1 mm and the random dnarand target were used to investigate the selectivity of the sensing platform, likewise characterized using flow cytometry and confocal microscopy (figure 4 d h). flow cytometry showed high cy5 intensities for the adduct of mof+pna and dna1 mm (figure 4 e) but low intensities for the adduct of mof+pna and dnarand (figure 4 g). the high intensity of mof+pna with dna1 mm is attributed to the high sequence similarity (93 %) of dna1 mm compared to dnafm. in the case of the interaction of mof+pna with dnarand, the fluorescence intensity distribution (figure 4 g) was similar to the control without biotin pna (figure 4 a). fluorescence imaging (figure 4 f, h) confirmed these findings by the colocalization of fluorescence of af488sav and cy5 (figure 4 f) for the interaction between mof+pna and dna1 mm, and a strong intensity of only af488sav (figure 4 h) for mof+pna with dnarand. fluorescence intensity profiles were taken from several confocal images, as shown in figure s4a d (see the supporting information). the ratio, r, of the intensity differences of i cy5 and i af488 between the peak and background intensities of cy5 and af488sav, respectively, was measured and plotted in figure s4e for all cases. figure s4e shows that the hybridization of mof+pna with complementary dnafm exhibited the largest r value, followed by mof+pna with singlebase mismatch dna1 mm. the adducts of mof (without pna) with dnafm and of mof+pna with dnarand show very small r values, due to very low cy5 intensities in these cases. statistical analyses (ttests), shown in table 1, gave p values below 0.05 only for the comparisons of mof+pna with dnafm with mof (no pna) with dnafm and mof pna with dnarand. in the case of mof pna with dna1 mm, the confocal intensity ratios were not significantly different. the main reason for this is most likely the lack of a sufficiently large number of analyzed particles. pna+dnafm vs. different cases using the average r values from figure s4e (confocal imaging) and the mean intensity values from figure 5 (facs). in contrast, flow cytometry provides convenient access to the analysis of much larger numbers of particles. to analyze these results more deeply, we compared the mean cy5 intensities (m cy5) of all events for each sample as well as the fractions of particles with a cy5 intensity over 10 (table 2, also including the total numbers of particles analyzed). pna+dnafm gave the highest m cy5 value (103), followed by mof as expected, the values for mof, mof (no pna)+dnafm, and mof pna+dnarand had similar and low m cy5 values. pna+dnafm showed the largest fraction (46.5 %) of particles with a cy5 intensity above 10 in comparison to all other cases, indicating higher degrees of hybridization. in the case of mof pna+dna1 mm (18.3 %), the highintensity fraction was still higher than for mof, mof (no pna)+dnafm, and mof average intensity, m cy5, for all the events, fractions (%) with a cy5 intensity below or above 100, and total numbers of particles, as measured by flow cytometry for mof (= adduct of af488sav and biotin mil88a), mof pna+dnafm, mof (no pna)+dnafm, mof pna+dna1 mm, mof pna+dnarand after washing at 40 c. next, we determined the average cy5 intensities of only those particles with a cy5 intensity above 10, as shown in figure 5. the values for mof incubated with dnafm (in the absence of pna ; 163), mof+pna with dnarand (148) are comparable to the value of mof (153), and are based on comparably low numbers of particles because the highintensity fraction of particles is small for these cases. pna incubated with dna1 mm, the average intensity was only slightly less, with a mean intensity value of 180. yet, a statistical analysis (ttest) of the data shown in figure 5 (table 1) showed that all p values for comparisons of the adduct of mof+pna with dnafm with those of mof (no pna) with dnafm, mof pna with dna1 mm, and mof pna with dnarand were below 0.05. thus, we conclude that pna immobilized on mil88a is able to distinguish between complementary dnafm and singlebase mismatch dna1 mm when analyzing the data using flow cytometry, because sufficiently large numbers of particles can be analyzed simultaneously. in summary, these results indicate that (i) pna is mandatory for the specific binding of dna, (ii) dnafm and dna1 mm are hybridized with this pna but to measurably different extents, and (iii) this sensing platform is able to differentiate between the fully complementary dnafm, mismatched dna1 mm, and random dnarand targets. mean fluorescence intensities as measured by flow cytometry for mof and mof pna, upon incubation with dnafm, dna1 mm, or dnarand, after washing at 40 c. in conclusion, we have developed versatile methods for the surface functionalization of mil88a using either covalent or noncovalent interactions. using the noncovalent approach with biotin we tested this wellknown ligand attachment strategy because of its easy procedure and high rate of attachment. future work will have to show whether the covalent click chemistry can result in a similarly robust pna attachment strategy. the pnafunctionalized mof particles were used to achieve dna binding and to assess the dna binding selectivity. by washing mofs at moderately high temperature, nonspecific adsorption between dna and the particles can be avoided. overall, the sensing platform was able to distinguish between complementary and singlebase mismatched or random sequences. the difference between complementary and singlebase mismatched dna was small, but statistically significant when analyzing large numbers of particles using flow cytometry. the difference between these targets can possibly be improved further by washing at a temperature closer to the melting temperature of the dna pna duplex. for future work, we envisage the creation of different dna binding strategies for recognizing proteins, transcription factors, etc. this method can in principle be used to assay different analytes by introducing probes that selectively bind to the analytes. these features contribute to a simpler, efficient, and more general platform that could be expanded to other mofs and applications. as a service to our authors and readers, this journal provides supporting information supplied by the authors. such materials are peer reviewed and may be reorganized for online delivery, but are not copyedited or typeset. technical support issues arising from supporting information (other than missing files) should be addressed to the authors. | abstracta dnasensing platform is developed by exploiting the easy surface functionalization of metal organic framework (mof) particles and their highly parallelized fluorescence detection by flow cytometry. two strategies were employed to functionalize the surface of mil88a, using either covalent or noncovalent interactions, resulting in alkynemodified and biotinmodified mil88a, respectively. covalent surface coupling of an azidedye and the alkyne mil88a was achieved by means of a click reaction. noncovalent streptavidin biotin interactions were employed to link biotin pna to biotin mil88a particles mediated by streptavidin. characterization by confocal imaging and flow cytometry demonstrated that dna can be bound selectively to the mof surface. flow cytometry provided quantitative data of the interaction with dna. making use of the large numbers of particles that can be simultaneously processed by flow cytometry, this mof platform was able to discriminate between fully complementary, singlebase mismatched, and randomized dna targets. |
a 7-year - old female presented complaining of intermittent diplopia and blurred vision for 2 months. 1). however, variable degrees (10 to 30 prism diopters [pd ]) of esodeviation and miotic pupils were evident only at near fixation (fig. her esodeviation did not change with the addition of + 3.0 diopters (d) lenses. however, cycloplegic refraction revealed that both eyes were nearly emmetropic (+ 0.5 d). the patient also complained of frequent headaches and abdominal pain ; the results of all physical and neurological examinations were normal, including a brain magnetic resonance imaging with contrast. the patient was diagnosed with convergence spasms and was referred to the psychiatry department for her somatic complaints. plus lenses (+ 1.5 d) for reading were prescribed for atropinization of her eyes. one month after prescribing atropine eyedrops and reading glasses, the patient 's best corrected visual acuity increased to 20/20. she continued to complain of intermittent diplopia, but the frequency and duration were decreased. however, the patient 's mother did not bring her daughter to the psychiatric department ; the patient was again referred to the department of psychiatry. during a mental status examination at the department of psychiatry, the patient was given a psychiatric diagnosis of childhood emotional disorder owing to an emotionally unavailable mother suffering from major depressive disorder. (antidepressants, selective serotonin reuptake inhibitor [ssri ]) and diazepam 2 mg p.o. (anxiolytics, benzodiazepine) for the patient. additionally, escitalopram 10 mg p.o. one month after initiation of the antipsychotic medications, the patient 's esodeviation at near fixation was resolved and all somatic complaints had ceased (fig. the patient 's visual acuity was 20/20 without glasses and her refraction was nearly emmetropic (+ 0.5 d). as such, successful cessation of the atropinization of the patient 's eyes was achieved after only 2 months. after the patient and her mother finished 6 months of the antipsychotic medication regimen, no symptoms were evident of either convergence spasms or any other somatic disorders. most convergence spasm cases are caused by a functional disorder, such as hysteria or neurosis.. emotional instability may result in a variety of ocular manifestations besides convergence spasms, such as blurred vision, monocular diplopia, tunnel vision, blepharospasm, and nystagmus. emotional instability should be considered as a possible cause when patients present with these symptoms. if no signs of emotional problems are present, a thorough neurological work - up is recommended. there are several organic causes of convergence spasms, including encephalitis, tabes, labyrinthine fistulas, arnold chiari malformation, posterior fossa neurofibroma, trauma, and pituitary adenoma. some authors have reported positive outcomes from supportive psychotherapy and amytal interviews. however, the conventional therapy for convergence spasms consists of atropinization of the eyes and the prescription of plus lenses for near vision. it is useful to produce cycloplegia in an attempt to break the cycle of sustained maximal convergence and accommodative spasm. dilated pupils can lead to photophobia and blurred vision with near fixation and the wearing of reading glasses can cause discomfort. other adverse events may include allergic conjunctivitis and, rarely, fever and aggravation of asthma. in the present case, the successful cessation of the atropinization of the patient 's eyes was achieved only one month after the patient and her mother initiated antipsychotic medications. of course these events may occur early in treatment with a high dose (> 100 mg) of the drug or following the addition of drugs that inhibit the metabolism of ssris. in addition, some patients also experience ataxia (< 2%) and dizziness (< 1%) with benzodiazepines. however, most benzodiazepines, especially low potency benzodiazepines like diazepam, are generally well tolerated. the low dose and low potency of the antipsychotic medications given to the present patient did not elicit any of these side effects. we report a case of early resolution of convergence spasms after the addition of antipsychotic medications. additional treatment for childhood emotional disorder, which was the indirect cause of the patient 's convergence spasms, reduced the required duration of atropinization of the eyes from one year to 2 months. we recommend active referral and collaboration with psychiatrists when treating patients whose disease may be functional in origin. | we report a case of early resolution of convergence spasms following the addition of antipsychotic medications and present it as a possible alternative to the conventional treatment for convergence spasms. the cessation of atropinization of the eyes and the use of reading glasses was achieved after only 2 months following the initiation of antipsychotic medications for childhood emotional disorder. |
ophthalmoplegic migraine (om) is characterized by recurrent attacks of migrainous headache, associated with paresis of one or more ocular cranial nerves with absence of demonstrable intracranial lesions, other than magnetic resonance imaging (mri) of the brain changes within the affected nerve. from the recent observations, international headache classification (ihcd - ii) has reclassified om from a variant of migraine to the category of neuralgia. we report an adolescent girl with om, who had been treated with steroid and showed dramatic improvement. an 11-year - old girl presented with abrupt unilateral (right) ptosis and diplopia for 3 weeks [figure 1 ]. at the beginning, it was associated with severe throbbing headache, pain in the right eye, nausea and recurrent vomiting. within 7 days, except ptosis and diplopia, all other symptoms had spontaneously subsided. she had denied having trauma, fever, diurnal variation of ptosis, tinnitus, transient visual blurring or limb weakness. past history revealed that she had experienced similar attacks 56 times in the past 4 years. in each episode, ptosis was unilateral and involved mostly right eyelid, but left eyelid was involved in one occasion. image of face showing right sided ptosis ophthalmologic examination revealed incomplete ptosis of the right eyelid and paresis of the right, upward and downward gaze. pupillary constriction was normal in the left eye and sluggish in the right eye to both direct and consensual light stimulation. acuity of vision without correction and intraocular pressure in both eyes were within normal limit. anterior and posterior segment examination as well as macula, vessels and periphery were normal. investigations including complete blood counts, erythrocyte sedimentation rate (esr) and c - reactive protein, fasting blood sugar (fbs), thyroid function tests, antinuclear antibody (ana) were within normal limits. mri brain (plain and contrast) was also normal. om was taken as diagnosis and oral prednisolone (2 mg / kg / day) was started, which resulted in resolution of painful ophthalmoplegia within 7 days. steroid was continued for weeks and then tapered off and antimigraine prophylaxis (flunarizine) was started. on follow - up, she is now attack free for the last 18 months. ophthalmoplegic migraine was named by charcot in 1890 ; since then, it was being considered as a variant of migraine. clinical criteria for oculomotor om are : 1) childhood onset, 2) headache preceding and ipsilateral to the third nerve paresis, 3) a dilated pupil, 4) ophthalmoplegia that may be permanent and rarely accompanied by aberrant oculomotor regeneration, 5) a minimum of two episodes and 6) no evidence for a structural lesion. recently, different pathogenic mechanisms, which include compressive, ischemic and inflammatory, have been suggested. in some cases, mri shows gadolinium uptake in the cisternal part of the affected cranial nerve. the recent revision of the ihcd - ii has reclassified om from a subtype of migraine to the category of neuralgia. however, other varieties of migraine like common or classic are invariably found in family. onset of disease in our patient was about 7 years of age, but majority of the patients experience initial attack in the first decade, usually before 5 years of age. thus, the first attack is incorrectly attributed to aneurysm, trauma, infection or recent immunization ; only when the condition resolves and recurs again, correct diagnosis is made. rarely, patients experience their first attack in adulthood, but such patients mostly have a history of typical migraine headaches with or without aura since childhood or a family history of migraine or both. approximately, 86% of patients of om have transient, reversible mri contrast enhancement of the affected cranial nerve. contrast - enhanced studies also showed focal thickening at the exit of the nerve in the interpeduncular cistern without enhancement of the cavernous sinus or adjacent dura. although enhancement is associated with om, it is not a sine qua non for the diagnosis of om, as in our patient normal neuroimaging may be seen in om. the differential diagnoses of om include intracranial aneurysms or tumors, oculomotor nerve schwannoma, sphenoidal sinus mucoceles, raised intracranial tension (ict) with brain herniation, tolosa hunt syndrome (ths), myasthenia gravis (mg), and diabetic neuropathy. although reported in a young child, intracranial aneurysm is extremely rare below 14 years of age. in our patient, the normal mri brain excludes that diagnosis. in the case of oculomotor nerve schwannoma, slowly progressive weakness of the third nerve over the years that is also a less likely diagnosis because the patient 's diplopia was recurrent and she was absolutely normal in between episodes. mucocele of the sphenoidal sinus or tumors or inflammatory lesions that invade the cavernous sinus can cause painful ophthalmoplegia. however, the headache in such disorders is of rather gradual onset and is usually accompanied by systemic symptoms or signs of other cranial nerve palsies. in the index case, raised ict can cause herniation of hippocampal gyrus, producing an oculomotor paresis which may be transient, recurrent and associated with severe headache. in our patient, normal fundoscopic examination and absence of findings of brain herniation in mri ruled out that diagnosis. evidence of inflammation in the superior orbital apex and cavernous sinus region supports a diagnosis of ths. however, proximal enlargement with gadolinium enhancement of the oculomotor nerve within the prepontine cistern has been reported both in om and ths. the girl had normal mri brain ; so, it was difficult to differentiate om from ths on the basis of neuroimaging in our patient. however, ths is a disease of adults, associated with retro - orbital pain and is slow to resolve, especially without prednisone. in our patient, the previous histories of a recurrent third nerve palsy which resolved spontaneously and whose onset was associated with headache also made om a more likely diagnosis. ocular mg was a less likely diagnosis because there was absence of diurnal variations of ptosis and presence of pupil abnormality. ophthalmoparesis due to uncontrolled diabetes mellitus (dm) rarely occurs in children. besides dm, patients with hypertension although differential diagnosis is rather large, most other possible causes of ophthalmoplegia and headache have distinctive clinical presentations. as in our case, optimal prophylactic and acute treatment is still unclear, but migraine prophylactic medications such as beta blockers and calcium channel blockers have been proposed. prognosis is good because symptoms almost always resolve, but after several episodes, some deficits may persist. | ophthalmoplegic migraine (om) is characterized by recurrent attacks of headache with paresis of ocular cranial nerves. previously, it was classified as a variant of migraine, but recently, international headache classification (ihcd - ii) has reclassified om to the category of neuralgia. presently, om is considered a type of recurrent demyelinating cranial neuropathy. we report an adolescent girl with om, who had been treated with steroid and showed dramatic improvement. |
obesity has become a huge burden worldwide. according to the 2013 korea national health and nutrition examination survey, one in three korean adults are obese and more than half are considered to be at least overweight, implying that korea is not an exception to this worldwide pandemic. environmental factors such as unhealthy dietary habits, sedentary lifestyle and socioeconomic influences are considered as the major contributors. in the past several decades, evidence suggests that obesity is a state of chronic, low - grade inflammation. one of the earliest evidence demonstrated the expression of proinflammatory cytokine, tumor necrosis factor (tnf-), in rodent adipose tissue during the development of obesity and the attenuation of insulin resistance followed by neutralization of tnf-. this study supports the role of inflammation in obesity and regulation of its complications by inflammatory mediators. thereafter, significant advances in understanding the complex role of immune - metabolism have been accomplished, and obesity is now known to be associated with proinflammatory cytokine secretion, immune cell infiltration, and disrupted function of tissues involved in glucose homeostasis, leading to insulin resistance. nitric oxide (no) is an endogenous signaling molecule produced by nitric oxide synthase (nos). no is involved in various physiologic processes such as the regulation of synaptic transmission, vasodilation, leukocyte - endothelial interactions, immune function, and angiogenesis. besides these pleiotropic effects, no has recently emerged as an important regulator of energy metabolism. for example, no bioavailability reflected by nos activity is decreased in animal models of diet - induced obesity (dio) and in obese and insulin - resistant patients. the reduction of no content occurs early in the course of developing insulin resistance, followed by vascular and peripheral tissue (such as liver, muscle, and adipose) inflammation and insulin resistance during dietary excess. furthermore, genetic deletion of endothelial nitric oxide synthase (enos) is associated with insulin resistance even in the absence of high - fat (hf) stimuli. conversely, interventions to increase no output has remarkable effects on obesity and insulin resistance in both animal and human studies, implying that anti - inflammatory and anti - obesity properties of no might serve as a potential therapeutic approach against obesity and its related metabolic outcomes. vasodilatory - stimulated phosphoprotein (vasp) is a 40 kda protein associated with cell adhesion and modulation of cytoskeletons and found in various cell types, but is highly expressed in vascular endothelial cells, smooth muscle cells, fibroblasts, and platelets. recently, a growing body of evidence suggests that vasp as a downstream mediator of no signal transduction pathway exerts anti - obesity effects by improving inflammation and insulin resistance in various tissues involved in glucose metabolism. therefore, in this review, we evaluate the current evidence supporting the protective effect of no / cyclic guanosine monophosphate (cgmp)/vasp signaling pathway against obesity and possibly, type 2 diabetes mellitus. the enos is mainly expressed in endothelial cells and generates enos - derived no. in cardiovascular tissues, enos - derived no is known to exert vasodilatory, anti - inflammatory, and anti - proliferative effects via cgmp - dependent protein kinase (pkg) by increasing cgmp levels. the no / cgmp - induced pkg activation in various cell types exerts diverse biological function by modulating its multiple downstream effectors. for example, pkg interacts with vasp and survival molecules such as the apoptosis - regulating protein bad, the oncogenic tyrosine kinase c - src, and the transcription factor cyclic adenosine monophosphate (camp)-responsive element binding protein (creb) to regulate cell migration, survival, and proliferation. on the other hand, pkg - mediated activation of the mitogen - activated protein kinase (mapk) family regulates angiogenesis in vascular endothelial cells and the contractile function of myocardial fibers and vascular smooth muscle cells (fig. implication of modulating vasp in cancerous or neural cells has been widely studied due to its role in cell adhesion, migration, and proliferation. however, recently, phosphorylation of vasp by pkg on a specific serine residue (ser-239) has been found to improve inflammation and insulin resistance in various peripheral organs such as the adipose tissue, the liver, and the vasculature. in visceral adipose tissue, nutrient excess leads to the infiltration of macrophages via the production of monocyte chemoattractant protein 1 (mcp-1), a key mediator recruiting macrophage precursors into the adipose tissue. subsequent release of proinflammatory cytokines such as interleukin 6 (il-6) and tnf- results in impaired insulin signaling. hence, improving obesity - induced insulin resistance by regulating inflammatory signaling has been of great interest as it can serve as a potential therapeutic target. based on the anti - inflammatory role of endothelial no signaling in the vasculature and the decline of vascular no levels early in the course of dio, handa. made an attempt to unravel the role of no / cgmp / vasp signaling pathway in the pathogenesis of obesity - associated inflammation in adipose tissue. in this study, hf feeding significantly reduced phospho - enos and phospho - vasp in white adipose tissue, compared to mice fed a low - fat (lf) diet. genetic deficiency of enos induced increased expression of proinflammatory cytokines in adipose tissue of enos mice ; however, a lf diet could not prevent adipose tissue inflammation in these mice, further reflecting the significance of endothelial no signaling in attenuating adipose tissue inflammation. by contrast, administration of sildenafil, a drug that increases signaling downstream of vascular no, prevented hf diet - induced proinflammatory gene expression and adipose tissue macrophage infiltration while improving insulin sensitivity in wild type (wt) mice. because the authors hypothesized that vasp, a downstream target of the no / cgmp pathway, is crucial to the anti - inflammatory effects of no signaling pathway on adipose inflammation, they used vasp and wt littermate mice fed an lf and hf diet. as expected, in vasp mice, levels of mrna encoding proinflammatory cytokines mcp-1, il-6, and tnf- the recapitulation of the effect of enos deficiency to increase adipose tissue inflammation in vasp - null mice suggests that vasp must be present for no / cgmp signaling pathway to exert its anti - inflammatory effect in adipose tissue. it is highly vascularized receiving 20% of cardiac output, and hepatic sinusoidal endothelial cells make up half of nonparenchymal cells of the liver. sinusoidal endothelial cells have shown to express enos and produce no basally, regulating hepatic vascular resistance. in a dio setting, reduced vascular no levels were followed by enhanced liver nuclear factor-b (nf-b) signaling and impaired insulin - mediated phosphorylation of akt, highlighting the possible role of no signaling in regulation of hepatic insulin resistance and inflammation. macrophages are myeloid - derived mononuclear cells that are a critical component of the innate immune response. they are more enriched in the areas that are exposed to pathogens, toxins and tissue damages such as the lung and the liver. accumulating evidence supports a role for tissue macrophages in a broad spectrum of inflammatory conditions, and the number and activity of macrophages are associated with insulin resistance and metabolic deterioration in states of over nutrition such as obesity. kupffer cells, the liver - specific macrophages, reside on the luminal side of the sinusoidal endothelium, and are mainly involved in scavenging, host immunity and immune tolerance in the liver. recent studies demonstrated that increased kupffer cell activity is responsible for hepatic insulin resistance, and that depletion of kupffer cells attenuated the development of hepatic steatosis and hepatic insulin resistance, both of which suggest an important early role of kupffer cells in diet - induced alterations in hepatic insulin resistance. questioned whether endothelial no signaling contributes to the effect of hf feeding to induce inflammatory activation of kupffer cells and associated hepatic insulin resistance. in the study, proinflammatory activation of kupffer cells was induced both in wt mice fed hf diet and in genetically enos - deficient mice, highlighting the protective effect of no signaling in hepatic inflammation and insulin resistance. similarly, targeted deletion of vasp in vivo, a key downstream target of endothelially derived no, predisposed to hepatic and kupffer cell inflammation regardless of diet, whereas agent - enhanced vasp signaling reversed the inflammatory activity and insulin resistance in vasp - deficient hepatocytes and macrophages in vitro. subsequently, tateya. have also demonstrated that no / vasp signaling increases hepatic fatty acid oxidation by activating ampk in mice models, suggesting that direct activation of vasp could be a potential therapeutic target of hepatic steatosis. the mechanism through which endothelial no / cgmp / vasp signaling exerts protective effect against inflammation and insulin resistance in kupffer cells has also been explored. using mice model with transgenic enos overexpression, this study demonstrated that the protective effect of no signaling against hf diet - induced hepatic inflammation and insulin resistance is associated with reduced proinflammatory m1 and increased anti - inflammatory m2 activation of kupffer cells. similar effects were induced by overexpression of vasp in macrophages, whereas vasp deficiency induced proinflammatory m1 macrophage activation. in attempt to determine whether vasp deficiency, specifically in the macrophage compartment, is sufficient to explain the hepatic inflammation and hepatic insulin resistance, transplantation of bone marrow from vasp - deficient donor mice into normal recipients was performed. as a result, the transplantation led to hepatic inflammation and insulin resistance resembling that induced in normal mice fed hf diet. taken together, no / vasp signal transduction inhibits proinflammatory m1 activation of the kupffer cells, and it can serve as a physiological determinant of macrophage polarization and a promising therapeutic target to prevent hepatic inflammation and insulin resistance. metabolic deterioration related to obesity is linked with cardiovascular diseases, and atherosclerosis is responsible for the vast majority of these cardiovascular events. thus, it is important to detect and delay the progression of atherosclerosis in its early stage. in recent years, it has become evident that insulin resistance and endothelial dysfunction play a central role in the pathogenesis of atherosclerosis. metabolic dysfunction causes lipid deposition and oxidative stress to the vessel wall, triggering an inflammatory reaction, and the release of chemoattractants and cytokines worsens the insulin resistance and endothelial dysfunction. within this context, therapies that improve vascular insulin resistance and inflammation would be ideal as it may reduce cardiovascular morbidity and mortality in clinical settings. reduced no bioavailability occurs within 1 week of hf feeding in mice, causing endothelial cell to be significantly more vulnerable to the inflammatory effects of excess nutrition. this further reduces no production, leading to a " vicious cycle " of increased vascular inflammation and reduced no levels. by contrast, increasing downstream no signaling in mice fed hf diet attenuates vascular inflammation ; thereby, breaking this vicious cycle and restoring vascular insulin sensitivity. investigated the role of vasp as a downstream mediator of the anti - inflammatory effect of no signaling in vascular tissue. compared to mice fed a lf diet, markedly reduced levels of vasp ser239 phosphorylation, a marker of vasp activation, were observed in aortic tissue of dio mice. hf feeding was associated with increased aortic inflammation, as measured by increased nf-b dependent gene expression, and reduced vascular insulin sensitivity (including insulin - stimulated phosphorylation of enos and akt). these hf - diet - induced responses recapitulated in vasp mice, whereas overexpression of vasp in endothelial cells blocked inflammation and insulin resistance induced by palmitate, reflecting the protective effect against inflammatory signaling and insulin resistance in vasculature. these findings implicate that vasp can serve as a potential therapeutic target in the treatment of obesity - related vascular inflammation and insulin resistance. peripheral insulin resistance in obese state is crucial to the etiology of metabolic disorders such as type 2 diabetes mellitus, and thus, understanding the molecular mechanisms of insulin resistance in the organs involved in glucose homeostasis can provide further insights to the development of potential targeted therapy. the series of studies we have evaluated in this review commonly indicate that no / cgmp signaling limits obesity - related inflammation and insulin resistance in multiple organs, such as adipose tissue, liver, and vascular endothelium and also that vasp is a critical downstream mediator required for this protective effect of no / cgmp signaling (fig. developing potential drugs that alter no signaling has been of caution due to its cytotoxic effect at high levels, generated by inducible nos. however, targeting downstream molecules of no - cgmp signaling pathway, such as soluble guanylyl cyclase or pkg could potentially overcome this drawback no - targeted therapeutic approach possesses. in this standpoint, vasp can be a promising therapeutic target to limit peripheral insulin resistance in obese state, although accumulation of more evidence is necessitated. | obesity has quickly become a worldwide pandemic, causing major adverse health outcomes such as dyslipidemia, type 2 diabetes mellitus, cardiovascular disease and cancers. obesity - induced insulin resistance is the key for developing these metabolic disorders, and investigation to understand the molecular mechanisms involved has been vibrant for the past few decades. of these, low - grade chronic inflammation is suggested as a critical concept in the development of obesity - induced insulin resistance, and the anti - inflammatory effect of nitric oxide (no) signaling has been reported to be linked to improvement of insulin resistance in multiple organs involved in glucose metabolism. recently, a body of evidence suggested that vasodilatory - stimulated phosphoprotein (vasp), a downstream mediator of no signaling plays a crucial role in the anti - inflammatory effect and improvement of peripheral insulin resistance. these preclinical studies suggest that no / vasp signaling could be an ideal therapeutic target in the treatment of obesity - related metabolic dysfunction. in this review, we introduce studies that investigated the protective role of no / vasp signaling against obesity - related inflammation and insulin resistance in various tissues. |
both environmental and genetic factors are well established to contribute to the pathogenesis of cardiovascular disease (cvd), a leading cause of death in persons with diabetes (1). a genome - wide association study identified rs10911021, a single nucelotide polymorphism (snp) upstream of the glutamate - ammonia ligase gene (glul), as being specifically associated with cvd in the setting of type 2 diabetes (t2d) (2) and all - cause mortality (3). this finding was novel because rs10911021 was not associated with the risk of developing t2d, insulin resistance, or glucose intolerance (2). the look ahead (action for health in diabetes) study is a multicenter trial that tested whether a randomly assigned intensive lifestyle intervention (ili) designed to bring about weight loss and increased fitness would reduce the incidence of cvd compared with diabetes support and education (dse) that did not have weight - loss or physical activity goals. participants in the ili arm lost significantly greater amounts of weight, and showed greater improvement in fitness and indices of diabetes control compared with participants in the dse arm after 1 year (4). despite this, after a median of 9.6 years of follow - up, look ahead participants in the two study arms showed similar rates of cardiovascular morbidity and mortality (5). in the study here, we sought to independently replicate the association of the c allele at glul rs10911021 with incident cvd in the setting of t2d by determining whether glul rs10911021 predicted the primary and secondary study cvd end points in look ahead and, if so, whether the effect of rs10911021 on cvd outcomes was diminished by a randomized lifestyle intervention. the design and methods of look ahead have previously been reported (6), as have the baseline characteristics of the randomized cohort (7). briefly, 5,145 ethnically diverse overweight and obese subjects with t2d, aged 4576 years, were randomized to either the ili or dse arm. of the 5,125 look ahead participants, we previously derived an unrelated subset of 4,016 participants based on genotyping using the cardio - metabochip (8). the final analysis was based on 3,845 participants (genotyping of the glul rs10911021 snp using a taqman assay on a 7900ht [life sciences ] was not successful in 171 participants) data contributing to the current analyses were collected through 14 september 2012 when the ili was stopped because of lack of effect on the incidence of major cvd events (5). the median follow - up was 9.6 years (interquartile range 8.910.3), and 0.35 in participants of self - reported non - hispanic white, african american, and a combined group of hispanic and american indian ancestries). the glul rs10911021 c allele was not associated with risk factors for cvd including ldl, systolic and diastolic blood pressure, triglycerides, hdl, and hba1c (supplementary table 1). baseline characteristics of look ahead participants included in genetic substudy data are n (%), mean sd, or median (interquartile range). p values for continuous measures are based on anova or kruskal - wallis tests as appropriate. for categorical measures, p values event rates of the primary and secondary composite outcomes in this genetic substudy of look ahead are presented in supplementary table 2. prospective associations of the glul rs10911021 variant with the primary composite outcomes of look ahead are presented in table 2. when analyzed using an additive model, the risk (c) allele for rs10911021 as described by qi. (2) was significantly associated with cvd outcomes in participants who did not have cvd at baseline (hazard ratio [hr ] 1.17 [95% ci 1.011.36 ] ; p = 0.032), with a somewhat weaker but similar effect in all participants regardless of cvd history (p = 0.069) and in the subsample of non - hispanic white participants only. association of rs10911021 with the primary composite cvd outcome in the look ahead study primary composite cvd outcome includes death from cardiovascular causes, nonfatal myocardial infarction, nonfatal stroke, or hospitalization for angina. hr per each additional copy of the risk c allele for rs10911021. adjusted for age, sex, top three multidimensional scaling axes, intervention arm (no interaction model), history of cvd, and clinic (gamma frailty). adjusted for age, sex, intervention arm (no interaction model), history of cvd, and clinic (gamma frailty). the glul rs10911021 cc genotype was significantly associated with the primary composite end point of death from cardiovascular causes, nonfatal myocardial infarction, nonfatal stroke, or hospitalization for angina (hr per risk allele 1.21 [95% ci 1.031.42 ]) (fig. consistent effects were observed among the largest racial / ethnic group, non - hispanic white participants (hr 1.04 [95% ci 1.021.07 ]). similar to the additive models presented in supplementary table 3, results were most robust among individuals without a history of cvd at baseline (full sample with cvd history : hr 1.32 [95% ci 1.081.61 ]) in which the level of significance surpassed correction for multiple hypothesis testing. in no case did the magnitude of genetic association differ across the ili and dse intervention arms for the primary outcome in the additive models (interaction p > 0.61). the incidence of the primary outcome (death from cardiovascular causes, nonfatal myocardial infarction, nonfatal stroke, or hospitalization for angina) over a 9.6-year median follow - up by rs10911021 genotype and randomized study intervention arm. solid lines denote participants randomized to ili, and dashed lines indicate randomization to dse. a significant association was found between the glul rs10911021 polymorphism and secondary outcome 2, which was comprised of death from any cause or first occurrence of nonfatal myocardial infarction or nonfatal stroke in the full sample (hr 1.20 [95% ci 1.041.38 ]), non - hispanic white participants (hr 1.18 [95% ci 1.001.39 ]), and individuals with no known history of cvd at baseline (full sample : hr 1.26 [95% ci 1.061.50 ] ; non - hispanic white subsample : hr 1.24 [95% ci 1.021.52 ]). association of rs10911021 using recessive model with secondary composite cvd outcomes in the look ahead study secondary outcome 1 includes death from cardiovascular causes or first occurrence of nonfatal myocardial infarction or nonfatal stroke. secondary outcome 2 includes death from any cause or first occurrence of nonfatal myocardial infarction or nonfatal stroke. secondary outcome 3 includes death from any cause or first occurrence of nonfatal myocardial infarction, nonfatal stroke, hospitalization for angina, coronary artery bypass surgery, percutaneous coronary intervention, hospitalization for heart failure, carotid endarterectomy, or peripheral vascular disease. hr for rs10911021 cc homozygotes vs. tt or ct genotypes. adjusted for age, sex, top three multidimensional scaling axes, intervention arm (no interaction model), history of cvd (hx of cvd), and clinic (gamma frailty). adjusted for age, sex, intervention arm (no interaction model), history of cvd, and clinic (gamma frailty). first, our replication of the association of the c allele at glul rs10911021 with incident cvd in look ahead individuals without a prior history of cvd model should reduce any concern about false discovery or the demonstration that glul rs10911021 was associated with incident and not prevalent coronary artery disease present at baseline further emphasizes that the risk associated with glul rs10911021 occurs in the context of established t2d. it is important to note that the adjudicated composite cvd outcomes in look ahead include stroke, which was not part of the end point used by qi. the consistency of our findings across the primary and one of the secondary end points that include fatal and nonfatal myocardial infarction suggests that the results are comparable. our findings should motivate further study of rs10911021 in stroke risk in the setting of diabetes. the lack of association of glul rs10911021 with traditional risk factors of cvd, including ldl, hdl, triglycerides, and blood pressure, suggests that the cvd risk may be through a novel mechanism. previously, the association of rs10911021 with cvd was shown to be weakened by adjustment for serum pyroglutamic - to - glutamic acid ratio (2) consistent with genetic effects on glul triggering abnormal glutamate / glutamic acid metabolism leading to cvd in the setting of t2d. chronic glutamate treatment has a cytotoxic effect on pancreatic -cells (11) that may promote -cell failure. biochemical and basic science studies are required to further define the mechanism by which rs10911021 and its associated abnormalities of glutamic acid metabolism may uniquely contribute to cvd in the setting of t2d. second, the behavioral intervention did not conclusively alter the association of glul rs10911021 with the primary and secondary end points of look ahead despite demonstrated efficacy of the intervention at 1, 4, and 10 years in producing weight loss (4,5). none of the snp treatment arm interactions were statistically significant. in some respects, a lack of treatment interaction of glul rs10911021 with cvd may be understandable because the ili had no overall effect on the primary or secondary cvd outcomes (7). the association of the snp with coronary artery disease was identified in multiple cohorts of people with t2d and who likely had a wide range of behavioral and fitness practices (12). in addition, the lifestyle intervention was not designed to influence dietary glutamine content, which may be important because a separate randomized trial of a glutamine supplement observed beneficial effects on obesity, systolic blood pressure, and glucose control (13). this ancillary study is derived from the largest randomized, controlled trial of behavioral weight loss, including 3,850 individuals who gave genetic consent, randomly assigned to a control group or an intensive lifestyle intervention focusing on weight - loss and physical activity promotion that reduced weight and improved fitness relative to the control group. the subject group of look ahead is further comprised exclusively of overweight or obese individuals with t2d and is similar in size to the composite of all three independent cohorts studied by qi. cvd morbidity and mortality were prospectively adjudicated by treatment - blind reviewers over a median of 9.6 years of follow - up with excellent retention rates. limitations include a relatively small number of cvd events that, although sufficient to detect genetic effects across treatment arms, may have precluded detection of snp treatment arm interaction. moreover, although our findings from look ahead may apply to a growing population of individuals with t2d, our findings are not generalizable to population without diabetes. overall, our findings build upon prior research by demonstrating prospective association of glul rs10911021 with incident cardiovascular morbidity and mortality over a median of 9.6 years of follow - up among individuals at high risk for cvd owing to being overweight or obese and having t2d. this prospective association was not conclusively altered by lifestyle intervention promoting weight loss and physical activity. | genetic studies have identified a glutamate - ammonia ligase gene (glul) polymorphism associated with cardiovascular disease morbidity and mortality among people with type 2 diabetes (t2d). we sought to determine whether glul rs10911021 is associated prospectively with adjudicated cardiovascular composite end points among overweight / obese individuals with t2d and whether a lifestyle intervention resulting in weight loss could diminish this association. look ahead is a randomized, controlled trial to determine the effects of intensive lifestyle intervention (ili), including weight loss and physical activity, relative to diabetes support and education, on cardiovascular outcomes. look ahead participants included in this report were 3,845 overweight / obese individuals with t2d who provided consent for genetic analyses. over a median of 9.6 years of follow - up, the risk (c) allele for glul rs10911021 was significantly associated with the primary composite end point of death from cardiovascular causes, nonfatal myocardial infarction, nonfatal stroke, or hospitalization for angina among individuals with no history of cardiovascular disease (cvd) at baseline using additive genetic models (hazard ratio 1.17 [95% ci 1.011.36 ] ; p = 0.032). results appeared more consistent in recessive models and among individuals with no known history of cvd at baseline ; ili did not alter these associations. these results extend the association of glul rs10911021 to incident cvd morbidity and mortality in the setting of t2d. |
after obtaining approval from the institutional ethical committee, a prospective, cross - sectional, questionnaire - based study was carried out at n. k. p. salve institute of medical sciences and research centre, nagpur, from january 2013 to june 2013 [iec / nkp sims-84/2013 ]. the study was conducted on 488 medical students of all batches selected by simple random sampling. history of sm in the preceding one year from the day of study was noted. a structured and validated questionnaire was used for the study to collect information regarding age, gender, awareness of sm practice, type of drugs self - medicated, source of information. before starting the study, it was pretested on a group of 20 students, 5 students from each batch, who were excluded from final analysis. prior to administrating the questionnaire, they were informed that data collected would be anonymous and their participation would be voluntary. the present study was carried out among 488 mbbs students, of which 230 (47.2%) were males and 258 (52.8%) were females. the mean age of students was 19.891.41 years ranging from 17 to 24 years. among these 488 students, 132 (27.1%), 109 (22.3%), 131 (26.8%), and 116 (23.8%) were studying in i mbbs, ii mbbs, iii - i mbbs, and iii - ii mbbs, respectively (table 1). we observed that 350 (71.7%) students practiced sm in the preceding one year with 185 (52.8%) female participants outnumbering male participants 165 (47.2%). the prevalence of sm varied amongst different years of students, the prevalence increasing from first to final year as depicted in (table 2). among the self - medicators, the majority followed allopathic system of medicine 318 (90.9%) followed by ayurvedic 18 (5.1%) and homeopathic system of medicine 14 (4%). 1 and 2, fever and headache 296 (84.5%) were the most frequently reported illnesses followed by acidity 188 (53.7%) and cough and cold 168 (48%) for which sm was practiced and the commonly used drugs were antipyretics and analgesics 282 (80.6%) and antacids 193 (55.1%). as per the frequency of using drugs is concerned, it was on as and when required 261 (74.6%), monthly 45 (12.9%), only once 27 (7.7%) and weekly 02 (0.6%). route for administration of medicine preferred by students was oral route 328 (93.7%), topical route 63 (18%), and inhalational route 6 (1.7%) for sm. a- fever and headache, b- cough and cold, c- acidity, d- nausea and vomiting, e- diarrhea, f - skin problems and g- ear / eye problems. a- antipyretics and analgesics, b- antacids, c- antibiotics, d- antihistaminic, e- gastrointestinal ailments, f- skin problems, g- ear / eye drops and h- topical ointment. we observed that respondents got information about drugs through the reading material 183 (52.3%) followed by previous prescriptions 61 (17.4%) and pharmacist 60 (17.4%) and the reasons for sm quoted by respondents were minor ailments 194 (55.4%) followed by quick relief 87 (24.9%) and urgency 71 (20.3%) as found in figs. 3 and 4. the main source for drug procurement was pharmacy without prescription 261 (74.6%) followed by free physician samples 46 (13.2%) and friends / relatives 39 (11.2%) (table 3). blue colour represents family members and relatives (16.3%), red colour represents pharmacist (17.1%), green colour represents seniors / classmates (12.6%), purple colour represents reading material (52.3%), sky blue colour represents previous prescription (17.4%) and orange colour represents media (5.4%). blue colour indicates time saving (19.7%), red colour indicates minor ailments (55.4%), green colour indicates economical (3.5%), purple colour reflects confidence in self diagnosis (11.2%), sky blue colour indicates previous expertise (12.3%), orange colour represents urgency (20.3%) and light blue colour indicates quick relief (24.9%). source for drug procurement we noticed that majority of students 277 (79.1%) read package inserts and labels and followed the instructions written on them. most of the students were aware about non - prescription medicines 171 (48.9%), dose and frequency of drugs 303 (86.6%), adverse effects of medicines used 290 (82.9%), expiry date 325 (92.6%), and importance of completing course of medicines 321 (91.7%) which was more among final year students (84.8%) (table 4). awareness of various aspects of self - medication we found that 92 (26.3%) students experienced adverse effects of medicines of which, 49 (53.3%) students stopped medications and consulted doctor, 24 (26.1%) students changed medications and started other drugs, and 19 (5.4%) stopped medications. we noted that 338 (96.6%) students agreed that medical knowledge is necessary for administration of medicine by self. sm is the utilization of medicines by persons on their own without any proficient medical supervision. in developing countries like india, most episodes are treated by sm due to easy availability of non - prescription drugs. it is more likely to be inappropriate without complete knowledge although it is becoming a routine practice nowadays especially by undergraduate medical students. the present study revealed that 71.7% of students reported sm practices in the preceding one year. it is very difficult to compare the prevalence of different studies with present study due to different demographic characteristics, different methodology, and different socioeconomic status. the prevalence of sm varied amongst different years of students and found increasing from first year to final year and the reason might be the knowledge of medicines in final year students which is comparable with the findings of previously conducted studies. conversely, a study carried out in maharashtra reported more prevalence in first year students. also, the sm practice was found more in female students as compared to male students which is in concordance with previous works, whereas few studies reported similar proportion in both sexes and slightly higher in males as compared to females. among the self - medicators, the majority followed allopathic system of medicine followed by ayurvedic and homeopathic system of medicine which is in conformity with earlier studies, which, might be due to easy access of allopathic medicines. the reason attributed to the use of other system of medicines have been stated as practice from childhood, earlier prescriptions available for same ailments, easy accessibility, belief in those systems. the commonest illnesses that led to sm in this study (fever, headache, acidity) were also reported similarly in other studies, though it differs from a study carried out in south india which revealed cough and cold as the most common reason. various researchers revealed antipyretics and analgesics as commonly used drugs for sm which, is in agreement with the present study whereas, the study carried out in a tertiary care medical college of west bengal reported antibiotics to be the most commonly used drugs. regarding frequency of sm, most of the students had taken medicines on as and when required basis followed by once daily. majority of students preferred oral route followed by topical and inhalational route for sm which, is in congruence with findings of study conducted in gujarat. the study group mentioned the most common source of information for sm as reading material followed by previous prescriptions ; this is comparable with previously conducted studies. on the contrary, other studies revealed the source of information as self decision, seniors, family and friends, and previous prescriptions. with respect to the source of drug procurement, we observed that the pharmacy and free physician samples were the most common source which is similar to the results of previous studies. the reason being easy availability and prior relief from the illness by the drug procured from the pharmacy. though the students have easy accessibility to the physicians the cumbersome procedure of consultation, prescription procurement and then going to the pharmacy increased the practice of sm. most common reasons for sm reported in our study were minor ailments and quick relief. these findings are comparable with the findings in literature, however other workers reported previous expertise, lack of time to consult doctor, quick relief, and time saving as common ailments. the observations regarding reading package inserts and labels and following the instructions written on them are in accordance with earlier studies. our findings regarding awareness of non - prescription medicines are in agreement with the findings of studies carried out in maharashtra and jammu. the findings of various studies regarding awareness of dose and frequency are comparable with the present study. findings regarding awareness about expiry date are in accordance with previous studies and that of awareness about importance of completing course of medicines is supported by findings of the study carried out in maharashtra. majority of the students irrespective of the year of the study reported that they were aware of adverse effects of medicines used by them which, are analogous with the findings of other workers. findings related to adverse effects of medicines are in agreement with the studies conducted in egypt and india, but differ from previous studies. majority of students agreed that medical knowledge is necessary for administration of medicine by self which, is in accordance with other studies. thus our study demonstrates that sm is highly prevalent in medical students of central india. although the occurrence of sm is more in senior students, junior students who are not yet exposed to facts of drugs are also indulged in same, the reason might be the awareness of drugs due to easy accessibility of information through media. since sm is at an alarming pace, education of the youth to ensure safe practices is the need of the hour. though sm is difficult to eradicate, various measures can be taken to discourage such practices. if action is not taken, the danger of interactions and adverse effects could increase. for this, we conducted a 3-hour awareness program to educate the students regarding various aspects of sm. the inputs were basics of pharmacology, adverse effects of drugs, and prescription drugs and its importance. this will sensitize the students regarding the irrational use of medicines in terms of sm and will also guide in the designing various health education strategies which, are required to educate the students and the community in large. | the study was undertaken to evaluate various aspects of self - medication in medical students. a prospective, cross - sectional, questionnaire - based study was carried out among 488 medical students selected by simple random sampling from january 2013 to june 2013. data was collected and analyzed for counts and percentage. students reported self - medication in the preceding one year was 71.7 % and the prevalence was more in final year students. fever and headache were the most frequently reported illnesses, commonly used drugs were antipyretics and analgesics, obtained information through reading material, and reasons quoted were minor ailments and quick relief. majority students agreed that medical knowledge is necessary for administration of medicine by self. self - medication is highly prevalent in medical students, which is quite alarming. |
tuberculosis (tb) is well known as an airborne infectious disease that is preventable and curable. people who are recently in contact with active tb patient are more likely to have latent tuberculosis infection (ltbi). the mycobacterium tuberculosis bacilli can remain dormant in the host body for a long period. in general, people with ltbi usually remain asymptomatic, with only 5% to 10% of cases progress to overt tb disease. moreover, the risk of ltbi progressing to active tb is the highest risk during the first 6 to 18 months of infection. during the dormant period, thus, administering drugs to treat ltbi during this period can effectively minimize the risk of subsequent disease development. isoniazid is the main drug for treating ltbi, and it is the only ltbi treatment drug approved by the united states food and drug administration (fda). after continually taking this prophylactic drug for 9 months, people with ltbi can reduce the likelihood of disease development by 60% to 90% ; hence, isoniazid is an economically viable prophylactic drug. however, asymptomatic patients who are prescribed isoniazid tend to have low adherence due to the extensive treatment period and undesirable side effects. consequently, patients discontinue taking the drug without the consent of clinicians, resulting in medical problems. therefore, how to effectively administer prophylaxis in a manner that is convenient for people is a concern among medical personnel and studies in this area are ongoing. to ensure adherence to treatment by tuberculosis patients, the direct observation of treatment (dots) by a trained supervisor cdc has approved treating ltbi by administering a high dosage of combined isoniazid (900 mg) and rifapentine (900 mg) once a week for 12 weeks under directly observed treatment, short course (dots). researchers from the united states, united kingdom, and canada have successively compared the ltbi treatment regimens in terms of economic influence, drug efficacy, immunity duration, and side effects. in taiwan the need of taking daily tb prophylactic drug under dots for 9 months and the potential side effects makes the new regimen look attractive to be implemented in taiwan. no studies related to the high rifapentine / isoniazid regimen have been conducted in taiwan, thus this study aims to investigate the effects, costs, and adherence of the 9-month isoniazid regimen (9h) and the 3-month rifapentine / isoniazid regimen (3hp) and compare the differences between the 2 treatments. the active tuberculosis patients referred to the changhua hospital and had been diagnosed with the need to undertake ltbi treatment were enrolled in the study group, from february to july 2014. participation criteria were : recent contact with patients who have newly developed tb disease and are not resistant to isoniazid or rifampin. positive tuberculin skin test result (ppd - rt23 + tween80 2 tu/ 0.1 ml mantoux) with an in duration 10 mm within 72 hours of undergoing a skin test, or purified protein derivative (ppd) < 10 mm, but measured 10 mm after 3 months. no clinical tb symptoms, such as coughing, fever, and weight loss. a chest x - ray image presents no sign of disease development or bacteriological evidence (e.g., negative sputum culture). the exclusion criteria were : pregnant women or women who plan to be pregnant. children younger than abnormal liver and kidney function indices, and cirrhosis or uremia diagnosed by a hepatobiliary, gastroenterology, or liver specialist. consent forms were given and signed by participants following a full explanation of the importance of ltbi treatment, the treatment course, and potential side effects of the treatment. in the study group, 12-dose combined regimen of weekly rifapentine (900 mg) plus isoniazid (900 mg) was administered via dots. the control group (9h group) comprised tb contacts who were required to receive ltbi treatment after being referred for assessment by the changhua county public health bureau. the treatment drug was administered once daily for 270 doses (9 months) and was also administered via dots. we estimated the direct costs (medications and visits) of 3hp and 9h in contacts. the risk of developing tb of all contacts with ltbi without treatment during the 5 years following the diagnosis of ltbi was estimated according to the method of vynnycky and fine. thus, the total cost was assessed according to the number of cases of tb avoided as cost - effectiveness. this study was approved by the institutional review board of chung - shan medical university hospital (csmuh no : cs12161), and informed written consent to participate in the study was obtained from each participant. basic demographic data (such as sex, age, medical history) of the participants were collected and the relationships between the participants and the index cases were investigated. each month, the participants underwent a follow - up examination to monitor and record any medication side effects, symptoms as well as their severity. results of the examination were compared to determine the differences between the 2 treatment groups. blood samples were collected before administrate the drug (baseline), 1 month after the drug treatment and at the completion of treatment to monitor the liver function of the participants. while administering the drug, participants who experienced side effects underwent a blood test immediately. asymptomatic participants with an aminotransferase (ast) level equal to or higher than 5 times the normal level were required to discontinue any medication. symptomatic participants with an ast level equal to or higher than 3 times the normal level were also required to discontinue their medication. patients with a baseline liver function exceeding the upper limit of normal, patients with liver disease, patients who were hiv - positive, or alcoholic (high - risk groups for hepatitis) were carefully monitored and underwent monthly liver function tests. all continuous variables were expressed as the median and range, and the number (n) was expressed as percentages for categorical variables. the test and fisher exact test were used to analyze the difference in medication adherence, types, and severity of side effects from the treatment. statistical analyses were conducted using spss 15.0 statistical software (spss, chicago, il). the active tuberculosis patients referred to the changhua hospital and had been diagnosed with the need to undertake ltbi treatment were enrolled in the study group, from february to july 2014. participation criteria were : recent contact with patients who have newly developed tb disease and are not resistant to isoniazid or rifampin. positive tuberculin skin test result (ppd - rt23 + tween80 2 tu/ 0.1 ml mantoux) with an in duration 10 mm within 72 hours of undergoing a skin test, or purified protein derivative (ppd) < 10 mm, but measured 10 mm after 3 months. no clinical tb symptoms, such as coughing, fever, and weight loss. a chest x - ray image presents no sign of disease development or bacteriological evidence (e.g., negative sputum culture). the exclusion criteria were : pregnant women or women who plan to be pregnant. children younger than abnormal liver and kidney function indices, and cirrhosis or uremia diagnosed by a hepatobiliary, gastroenterology, or liver specialist. consent forms were given and signed by participants following a full explanation of the importance of ltbi treatment, the treatment course, and potential side effects of the treatment. in the study group, 12-dose combined regimen of weekly rifapentine (900 mg) plus isoniazid (900 mg) was administered via dots. the control group (9h group) comprised tb contacts who were required to receive ltbi treatment after being referred for assessment by the changhua county public health bureau. the treatment drug was administered once daily for 270 doses (9 months) and was also administered via dots. we estimated the direct costs (medications and visits) of 3hp and 9h in contacts. the risk of developing tb of all contacts with ltbi without treatment during the 5 years following the diagnosis of ltbi was estimated according to the method of vynnycky and fine. thus, the total cost was assessed according to the number of cases of tb avoided as cost - effectiveness. this study was approved by the institutional review board of chung - shan medical university hospital (csmuh no : cs12161), and informed written consent to participate in the study was obtained from each participant. basic demographic data (such as sex, age, medical history) of the participants were collected and the relationships between the participants and the index cases were investigated. each month, the participants underwent a follow - up examination to monitor and record any medication side effects, symptoms as well as their severity. results of the examination were compared to determine the differences between the 2 treatment groups. blood samples were collected before administrate the drug (baseline), 1 month after the drug treatment and at the completion of treatment to monitor the liver function of the participants. the results were also compared to determine the different effects on the liver function. while administering the drug, participants who experienced side effects underwent a blood test immediately. asymptomatic participants with an aminotransferase (ast) level equal to or higher than 5 times the normal level were required to discontinue any medication. symptomatic participants with an ast level equal to or higher than 3 times the normal level were also required to discontinue their medication. patients with a baseline liver function exceeding the upper limit of normal, patients with liver disease, patients who were hiv - positive, or alcoholic (high - risk groups for hepatitis) were carefully monitored and underwent monthly liver function tests. all continuous variables were expressed as the median and range, and the number (n) was expressed as percentages for categorical variables. the test and fisher exact test were used to analyze the difference in medication adherence, types, and severity of side effects from the treatment. statistical analyses were conducted using spss 15.0 statistical software (spss, chicago, il). among the 104 contacts who provided informed consent to participate in the study, 1 participant was excluded due to the potential interaction of the concurrent medications, and 2 were excluded and their medication was discontinued due to the exclusion of the index cases. the final research sample comprised 44 men and 57 women (mean age, 34.94 years ; age range, 1375 years). sixteen participants had other chronic diseases, including diabetes, heart disease, and hypertension (table 1). the participants underwent monthly follow - up examinations, during which they were prescribed for 4 doses of medication and requested to describe any side effect they experienced. their blood biochemistry values were examined before drug administration, 1 month after drug administration and again after completing the treatment (table 2). data from 101 contacts was collected ; however, 3 of them discontinued their medication because of side effects. moreover, in the control group, a total of 590 contacts received the 9-month isoniazid treatment (mean age, 34.49 years ; age range, 088 years), 515 of whom completed the treatment (table 3). regarding the remaining 75 contacts who discontinued the treatment in the control group, the main reasons for discontinuing the medication were the extensive treatment period and the severity of the side effects from taking the medication. the difference in the completion rate between the control group (515/590 : 87.29%) and experimental group (98/101 : 97.03%) was statistically significant (p < 0.001), indicating that patients who were administered the short - term high - dosage rifapentine and isoniazid regimen had a high treatment completion rate. in addition, the discontinuation rate was lower in the experimental group (2.97%, 3/101 cases) than in the control group (4.75%, 28/590 cases) (table 3). characteristics of the 3-month rifapentine / isoniazid regimen (3hp) population and 9-month isoniazid regimen (9h). treatment results of the 9h and 3hp regimen. during the follow - up examinations in the experimental group, elevation of got is noted in only 2 cases (2/101 = 1.98%) after the treatment. got level of these 2 cases iu / l, respectively, while this phenomenon was not observed in the rest of patients. in addition, although not considered significant clinically, a noticeable decrease in averaged wbc count, from 7900 (median) before the treatment to 6850 after the treatment, was seen in our study (table 2). moreover, 37 participants reported experiencing uncomfortable side effects, including fever, headache, skin itchiness, and vomiting (table 4). furthermore, the side effects of the 3 participants discontinued their medications was listed in table 5. these 3 patients who discontinued their medication presented a fever higher than 38.5c and grade 2 or 3 toxicity. however, in the control group, 28 participants discontinued their medications due to the side effects (table 5). the uncomfortable side effects included fatigue (21 cases), headache (3 cases), skin rashes (2 cases), diarrhea (1 case), and chest distress (1 case). furthermore, elevation of got / gpt was noted in 21 cases with fatigue event (21/590 = 3.56%). side effects and severity (who toxicity grading) caused discontinue medication in 9h and 3hp groups. regarding the cost of treatment, according to taiwanese labor law, minimum hourly wages is us$3.5 per hour and normally dots spend an hour for 1 patient approximately. thus, the medication and labor fee of the 3hp treatment program were approximately us$219.24 and us$42.00 respectively (table 6). on the other hand, the medication and manual costs for the 9h group were approximately us$24.3 and us$693.00, respectively. furthermore, the cost - effectiveness ratio with isoniazid for 9 months was us$ 15392/avoided 1 case of tuberculosis and us$ 5225/avoided 1 case of tuberculosis with 3hp (table 7). therefore, 3hp was dominant in the sensitivity analysis. therefore, the 3hp treatment was substantially cheaper than 9h. the cost - effectiveness ratio to avoided 1 case of tuberculosis in 3hp group and 9h group. this study verified that in taiwan, the administration of a short - term high - dosage rifapentine and isoniazid regimen was significantly more favorable than the standard 9-month isoniazid treatment in terms of medication compliance, treatment completion rate, and economic benefit. the national tuberculosis control program should focus on achieving adequate tb diagnosis and treatment outcomes first, and then prioritize ltbi treatments. taiwan has a moderately high incidence rate of tb, where the diagnosis rate and treatment outcomes remain undesirable ; hence, selective ltbi treatment can serve as a supporting strategy for tb control. however, according to the fda, only an average of 60% patients who have received prophylactic treatment (or less) completed the treatment in accordance with their doctors instructions. among the 101 patients who participated in this study, 98 of them completed ltbi treatment (completion rate, 97.03%), which was significantly higher than the completion rate of the control group (87.29%). this is similar to a large - scale study by sterling, who reported an 82.1% completion rate for the 3-month treatment program and a 69% completion rate for the 9-month treatment program. we do not know the contribution of dots and the shorter regimen both probably contributed to the higher completion rate. therefore, dots seems to be the effective method to monitor ltbi closely as well as to decrease default rate. medication side effect was another factor causing patients to discontinue the ltbi treatment course, hepatitis is one of the toxic effects of isoniazid. in the control group, among the 590 patients who underwent the 9-month treatment program, 28 of them did not complete their treatment because of side effects. of the 28 subjects, 21 patients who discontinued their medication presented with elevated got / gpt grade 1 to 4. the proportion of subjects with elevated got / gpt for the 9-month treatment program (21/28 = 75%) was substantially higher than that for the 3-month treatment program. moreover, the discontinuation rate for the 9-month treatment program (4.75%) was also higher than that for the 3-month treatment program (2.97%). sterling showed that the side - effects ratio of grade 1, grade 2, and other side effects observed with the combination therapy was lower than that of the group treated with isoniazid. in the 3hp group, 3 patients who discontinued their medication presented a fever higher than 38.5c and grade 2 or 3 toxicity. however, the control group data in our study was obtained from the cdc central area control center, and the data consisted of only basic patient information and the side effect ratio of the treatment. indeed, the liver function indices of patients receiving ltbi treatment are important and require continuous monitoring and consideration. further analysis of the side effects related to the control group and the ratio of each side effect requires additional data to be collected. in addition to the completion rate and side effects, the lower cost of the treatment course is also a crucial consideration with implementation of ltbi treatment. several large - scale studies have indicated that the efficacy of 3-month rifapentine / isoniazid regimen was similar to that of 9-month isoniazid or 4-month rifampin regimen. therefore, despite those studies might be accurate in stating that the 9-month isoniazid treatment method is the most economical regimen, they fail to consider the labor costs of dots. in taiwan, dots visit ltbi patients 5 days a week for 9 months and spend approximately an hour with each patient. on the other hand, dots only need to visit ltbi patients once a week for 12 weeks for 3hp group. in this study, the medication costs of the 3-month and 9-month treatment programs were approximately us$219.24 and us$24.30, respectively. although the 9h medication fee appears less than the 3hp, the labor costs of the 3-month and 9-month programs were approximately us$42 and us$693, respectively (table 6). the cost - effectiveness ratio with isoniazid for 9 months was us$ 15392/avoided 1 case of tuberculosis and us$ 5225/avoided 1 case of tuberculosis with 3hp. therefore, the 3-month treatment was substantially more beneficial (table 7). compared with the previous studies in the united states, united kingdom, and canada, our study in taiwan found the similar results that the short - term high - dosage ltbi treatment was cost - effective and associated with higher treatment completion rate. however, we failed to provide data regarding side effects in our control group, which should be collected and analyzed in the future. overall, we determined that the 3-month program was substantially more economically viable than the 9-month program. in conclusion, this project is the first study to investigate and compare 2 dissimilar ltbi treatment regimens in the taiwan area in terms of treatment adherence and the cost. our results showed that the short - term high - dosage ltbi treatment via dot improved the treatment completion rate among the tb contacts in this study. compared with the conventional 9-month ltbi treatment via dot, the short - term high - dosage treatment method improved patient adherence to the treatment, thereby reducing the chance of disease development. moreover, this new prophylactic medication could save a considerable amount of labor cost in preventing tb. a large - scale follow - up study will confirm whether this treatment regimen is appropriate for the general population in taiwan, thereby reducing the disease development rate among tb contacts. | abstracttreatment of latent tuberculosis infection (ltbi) is essential for eradicating tuberculosis (tb). moreover, the patient adherence is crucial in determining the effectiveness of tb control. isoniazid given by dots daily for 9 months (9h) is the standard treatment for ltbi in taiwan. however, the completion rate is low due to the long treatment period and its side effects. the combined regimen using a high dose of rifapentine / isoniazid once weekly for 12 weeks (3hp) has been used as an alternative treatment option for ltbi in the united states. this may result in a higher completion rate. in this pilot study, patient adherence and cost of these 2 treatment regimens were investigated. thus, we aimed to assess the treatment completion rate and costs of 3hp and compare to those with 9h.data from 691 cases of ltbi treatments including 590 cases using the conventional regimen and 101 cases with rifapentine / isoniazid were collected. the cost was the sum of the cost of treatment with isoniazid for 9 months or with rifapentin / isoniazid for 3 months of all contacts. the effectiveness was the cost of cases of tuberculosis avoided.in this study, the treatment completion rate for patients prescribed with the 3 months rifapentine / isoniazid regimen (97.03%) was higher than those given the conventional 9-month isoniazid regimen (87.29%) (p < 0.001). the cost of 3hp and 9h was us$261.24 and us$717.3, respectively. the cost - effectiveness ratio with isoniazid for 9 months was us$ 15392/avoided 1 case of tuberculosis and us$ 5225/avoided 1 case of tuberculosis with 3hp. in addition, when compared with the conventional regimen, there were fewer patients discontinued with rifapentine / isoniazid regimen due to undesirable side effects.this was the first study to compare the 2 treatment regimens in taiwan, and it showed that a short - term high - dosage rifapentine / isoniazid treatment regimen reduced costs and resulted in higher treatment completion than the standard ltbi isoniazid treatment. |
in the past decade, vocal fold injection (vfi) has re - emerged as a valuable treatment modality for a variety of laryngeal disorders. recent advances in injection materials have broadened the indications for this technique, while the increasing capabilities of endoscopic technology have increased the number of available approaches and precision of injection delivery. the basic indications for vfi have expanded to include treatment for vocal fold paralysis, paresis, atrophy, and scar or sulcus (1). however, the myriad of options in patient selection, injectable materials, and approach to injection has made utilizing this modality increasingly complex for the clinician. in the broadest sense, vfi can include procedures that target the superficial (subepithelial space) aspect of the vocal fold. useful for mild - to - moderate vocal fold scar and lamina propria defects, superficial injection provides correction of vibratory defects rather than global augmentation. in the stricter sense, vfi refers to deep or lateral injection, as a means for vocal fold augmentation. typically, deep injection allows for placement of a filler substance in the lateral aspect of the thyroartyenoid / lateral cricoarytenoid muscle complex (medial aspect of the paraglottic space). the result is a medially displaced free edge of the vocal fold, akin to laryngeal framework surgery, or type i thyroplasty. the procedure allows for correction of glottal insufficiency from a variety of causes, and is typically used to treat temporary or permanent mild - to - moderate glottal insufficiency (< 1 to 3 mm glottal gaps). for the purposes of this review, vfi will refer to this latter method of deep vocal fold injection augmentation. with advancing technology, such as distal chip and flexible working channel laryngoscopes, awake in - office techniques have become viable alternatives to the traditional microsuspension laryngsocopy technique. available technology, choice of materials, surgeon preference, and patient preference must all dictate the approach used for vfi. traditionally, microscopic suspension laryngoscopy is performed under general anesthesia with a small endotracheal tube or under jet ventilation, and with an adequately sized laryngoscope in suspension. the degree of glottic incompetence is assessed through a combination of pre - operative awake stroboscopy and intra - operative visualization with microlaryngoscopy and zero-, thirty-, and seventy - degree angled telescopes. as an alternative, vfi may be done with a combination of conscious sedation and topical anesthesia, without endotracheal intubation, using a smaller slotted laryngoscope with 0-degree telescopic visualization endoscopic vocal fold injection (2). both techniques provide direct access to the vocal fold, and allow for precise needle placement along the superior arcuate line with a direct, linear trajectory. these techniques prove especially valuable in the patient who is otherwise unable to tolerate an awake procedure. however, both techniques do not provide real time assessment of vocal fold closure or voice quality. though vfi in the awake patient was initially described over a century ago, vfi in an in - office setting has re - emerged in the past decade as an attractive alternative to microsuspension laryngoscopy. pointing to the popularity of this technique, a recent multi - institutional review revealed that vfi was performed equally often in an awake patient as one under general anesthesia (3). vfi in the awake setting has the distinct advantages of providing direct feedback of vocal fold closure and voice outcome during the injection, avoiding limitations of difficult exposure, and avoiding general anesthesia with its inherent risks and increased cost (4). technical successes, as well as voice outcomes, as measured by standardized patient - based voice surveys, are similar to injection performed under general anesthesia when performed by an experienced laryngologist (4, 5). patient selection is critical when choosing vfi in an awake patient ; a cooperative, calm patient without a strong gag reflex is required for successful completion. one concern about awake vfi lies in the relative decrease in needle control, leading to decrease in precision of injection. in fact, there is some evidence that minor complications are slightly increased in an in - office setting (5). in - office vfi encompasses percutaneous (trans - cricothryoid membrane, trans - thyroid cartilage, and trans - thyrohyoid membrane), per - oral, and trans - nasal endoscopic approaches. typically the three approaches are performed with a flexible laryngoscope in place, visualizing the larynx for visualization and to monitor injection effects. in most cases, optimal visualization is provided with a distal chip laryngoscope with digital, high quality video image output. the trans - cricothyroid membrane approach typically utilizes a submucosal path ; a 25 g needle bent 45-degrees is inserted below the inferior border of the thyroid cartilage, 3 - 7 mm lateral to midline and subsequently passed cephalad and laterally. applying gentle pressure medially transmits motion to the vocal fold, allows the surgeon to confirm submusocal location of the needle and thus prevents perforation of the mucosa by the needle. alternatively, with adequate tracheal anesthesia, the needle can be inserted into the midline in the infra - glottis, and then directed superior and lateral, intraluminally, to the deep aspect of the vocal fold. anatomic studies using multidetector array computed tomography has confirmed this approximate 45-degree cephalad angle from a typical injection point 7 mm off of the midline (6). the trans - thyroid cartilage approach utilizes a percutaneous approach perpendicular to the thyroid cartilage ala. a 24- or 25 gauge needle is inserted 3 mm to 5 mm above the lower border of the thyroid cartilage and passed gently through the cartilage. advancing the needle toward midline with gentle pressure transmits motion to the vocal fold, and allows the surgeon to estimate the location of the needle tip. occasional obstruction of the needle with cartilage may be overcome through pressure on the plunger, with care to avoid excessive pressure and possible overinjection of material. a trochar - based injection devise has been made to assist tran - thyroid cartilage vfi (casiano needle, medtronic inc., once through the thyrohyoid membrane, the needle is directed sharply caudal and advanced ; with this maneuver, the needle can be visualized entering the lumen at the petiole of the epiglottis. from this position, with direct visualization using the flexible laryngoscope, the needle can be directed toward the vocal fold for injection. bending the needle, while improving the inferior angle, often makes directing the needle more difficult, and therefore is discouraged. among the percutaneous techniques, the trans - thyrohyoid membrane approach offers the distinct advantage of direct needle placement, increasing precision of the injection (7, 8). the per - oral vocal fold injection approach utilizes a direct approach and offers excellent precision and needle visualization. topical anesthesia of the oropharynx and larynx is critical, as the needle is guided from the mouth to the vocal fold with a per - oral approach. typically the patient is placed in a seated " sniffing position ", with the neck flexed and the head slightly extended. a flexible laryngoscope is inserted through the nose while the patient protrudes and holds his or her own tongue. topical anesthesia may be given via an abrahms cannula passed per - oral to the base of tongue, epiglottis, and true vocal folds. alternatively, topical anesthetic may be applied through a flexible catheter directed through the working channel of a flexible laryngoscope ; the laryngoscope is used to drip anesthetic onto the base of tongue, epiglottis, and, while the patient is phonating, onto the true vocal folds. the route of the needle is typically a 90-degree path, though this varies from patient to patient, and may be approximated by comparing with the abrahms cannula passage. typically, the false vocal fold will be retracted with the shaft of the needle, allowing for a lateral injection. several commercially available needles, length 220 mm to 250 mm, may be purchased separately or included with injectate materials for per - oral vfi. a final injection approach is the trans - nasal endoscopic approach to the vocal fold. this approach utilizes a flexible working channel laryngoscope with a 23- or 25-gauge flexible needle introduced through the working channel. with the needle slightly from the tip of the endoscope advocates describe utilizing this technique as an alternative to other approaches for its ease of use, patient tolerance, and ability to overcome anatomic and patient limitations. however, it should be noted that the fine gauge injection needles only accommodate dilute preparations of most substances unless a mechanical injection device is used. this approach has been advocated using a dilute concentration of micronized deep dermal tissue (cymetra), mixed with 2.3 ml of 1% lidocaine for all cases (9). it should also be noted that due to the length and caliber of the injection needle, this approach requires more than the normal amount of injection material to accommodate the relatively large dead space in the needle. in the past 10 years material sciences have increased the number of injectables with increased safety profile and improved biomechanical profiles. materials developed have sought to eliminate the deleterious foreign body and inflammatory reactions caused by some of the early injectable materials such as paraffin, silicone, and teflon. recent efforts have focused on matching the biomechanical and viscoelastic properties of the superficial lamina propia. materials for deep augmentation injection are typically described as temporary, and permanent / long lasting. long lasting, and sometimes, permanent injectable materials include autologous fat, calcium hydroxylapatite (radiesse), polydimethylsiloxane (pdms or particulate silicone), and historically, and polytef paste (teflon). temporary injection materials include bovine gelatin (gelfoam, surgifoam), collagen - based products (cymetra, zyplast, cosmoplast / cosmoderm), hyaluronic acid (restylane, hyalaform), and carboxymethylcellulose (radiesse voice gel). the materials vary in the duration of integration and are thought to vary in their specific viscoelastic properties and biocompatibility. autologous fat typically lasts from one to several years, and is considered a permanent injection by many. though the material is autologous, may be generously injected, and is readily available, it is typically harvested in the operating suite under sterile conditions. additionally, the survival is highly, which may be due to fat preparation techniques ; indeed, many suggest substantial overinjection of due to this immediate variability. in addition to global augmentation, autologous lipoinjection has been described for vocal fold scar and vocal fold atrophy (10, 11). polydimethylsiloxane, or particulate silicone, has been advocated by some for global vocal fold augmentation. the duration of this substance is likely permanent, as alluded to in follow up of close to 10 years post - injection (12). recent evidence points to safety and efficacy in both the short and long term, though complications of extrusion and foreign body reaction have been reported. in addition, recent studies comparing this directly to some of the more accepted materials do not exist (13, 14). polytetrafluoroethylene, or teflon, is another permanent injectable that is of considerable historical significance but has fallen out of favor in the past 20 years. long - term studies have revealed significant foreign - body inflammatory reactions to this substance, often requiring removal with subsequent significant vocal fold tissue loss. calcium hydroxylapatite (caha), known by the trade name radiesse voice, is currently a fda approved substance for potentially long - term vocal fold injection. comprised of microspheres of caha in a carboxymethylcellulose carrier, this substance has been studied in both animal and human studies. in an in vivo canine vocal fold model, it has been shown that caha injection provided adequate medialization of the canine vocal fold up to 12 month follow up without migration or resorption, and a giant cell reaction without appreciable chronic inflammation (15). a recent multi - institutional clinical trial revealed excellent results of 80% improvement at 12 month follow - up (16). long term clinical results show that persistent medialization after caha injection may be present up to 2 years and more, with an average duration of 18 months (17). bovine - based gelatin products, such as gelfoam and surgifoam, can be used for temporary vocal fold injection augmentation. an injectable version of this product may be prepared by mixing the powder with saline. the resulting substance is highly viscous, and may be used for injection by injecting with a pressurized syringe through a 18- or 19-gauge large bore needle. this has been used extensively for temporary augmentation, lasting 4 - 6 weeks and found to be very safe (18). despite the excellent track record, this material has little utility due to development of new substances that are easier to use and last longer. bovine - based collagen products, such as zyplast, have been used for longer injection. thus, the fda advocates skin hypersensitivity testing prior to using this substance. despite this possibility, the rarity of this reaction in laryngeal injection augmentation has led some to question the need for testing (19). atelocollagen, a water - soluble form of bovine dermal collagen, has been used in the past for injection augmentation and for scar and sulcus, though some evidence exists that this may impair normal mucosal wave when injected submucosally. human based collagen injectables include micronized cadaveric dermis, such as cymetra, and tissue engineered human collagen, such as cosmoplast / cosmoderm. the former has been used extensively and results have been positive for vocal fold immobility and presbylarynx (20). it has also been used sparingly for scar and sulcus, though this has not been studied extensively. cymetra is clinically effective for 2 to 3 months, and radiographic evidence of the injectable up to 11 months has been reported (21). because this is prepared from human cadaveric tissue, potential for infectious transmission exists, though this has not been documented to date. cosmoplast / cosmoderm has recent use as a dermal filler, though the experience as an augmentation filler for vocal folds is limited. hyaluronic acid gels, such as restylane, hyalaform, and juvederm, are animal or bacterial derived variations of the naturally occurring extracellular matrix glycosaminoglycan found in various human tissues, including the vocal fold lamina propia. clinical studies have supported the safety and efficacy of this injectable for deep vocal fold augmentation (22, 23). some clinical studies, supported by rheologic studies and animal model work suggest hyaluronic acid derivatives may be useful as a lamina propia replacement for vocal fold scar and sulcus. however, our clinical experience has been very disappointing and has even worsened vocal fold vibration when placed superficially (23 - 25). the substance is believed to last 4 - 6 months, though clinical effects may last up to 12 months (22, 23). carboxymethylcellulose, sold as radiesse voice gel, is the carrier substance used in the longer lasting radiesse voice injectable. this has been utilized extensively for temporary vocal fold paralysis and for trial vocal fold injection augmentation for a variety of causes of glottic incompetence. though each approach has advantages and drawbacks, no formal algorithm exists in the considerable circumstances where either approach may be acceptable. in general, vocal fold augmentation is used for the temporary correction of incompetence due to unilateral vocal fold paralysis / paresis, permanent correction of mild - to - moderate glottic insufficiency, and glottic insufficiency from soft tissue loss of the vocal fold (27). temporary vocal fold injection is currently the treatment of choice for the treatment of glottic incompetence when prognosis for recovery is unclear. this is best illustrated in the case of acute unilateral vocal fold paralysis or paresis. during the time for potential recovery of function, usually up to 6-months post - onset, vocal fold injection with a shorter duration substance has been shown to alleviate voice symptoms and improve swallowing until function recovers or the patient is a candidate for a more permanent treatment option. in this setting, injection with collagen, ha, or radiesse voice gel provides the best treatment option (20, 26, 28). vocal fold injection may also be used to treat permanent causes of mild - to - moderate glottic insufficiency. specifically, this has been successfully used to treat vocal fold atrophy, paralysis, paresis, and augmentation after previous framework surgery. specifically, results with calcium hydroxyapatite (3, 29) and autologous fat injections (30) have proven acceptable in the treatment of atrophy, paralysis, and paresis. though some have reported inconsistent results with fat when compared to type i thyroplasty in cases of unilateral vocal fold paralysis (10), many may find better results with the ability to " fine tune " serial injections for progressive vocal fold atrophy and presbylarynx. additionally, results are promising for those requiring injection augmentation for recalcitrant glottic insufficiency after type i thyroplasty with or without arytenoid adduction (31). though studies purport vocal fold injection is comparable to laryngeal framework surgery in many clinical scenarios, the former modality has several advantages over the latter. patients with very mild forms of glottic gap (less than 1 mm) may be better suited for injection than framework surgery. additionally, the ability to perform vocal fold injection in the awake setting has numerous distinct advantages over framework surgery ; patient preference not to undergo an operation, and the ability to obtain direct voicing and vocal fold vibration feedback during the procedure are particularly desirable. ease of performing the procedure with limited experience is greater in the case of vocal fold injection performed under general anesthesia, when compared with laryngeal framework surgery. finally, significant cost benefit has been found in the case of in - office awake injection when compared to those performed in the operating room (4). it is generally considered feasible for a glottic gap up to 3 mm, after which the insufficiency becomes increasingly difficult to correct. in cases of posterior glottic gap or significantly foreshortened vocal fold, one limitation is the ability to permanently correct for glottic incompetence ; autologous lipoinjection may be inconsistent due to the variability in viability within the first several weeks and calcium hydroxyapatite typically lasts 1 to 2 years, with an average of 18 months (17). currently, three clinical scenarios exist to guide the timing of vocal fold injection augmentation. the options for trial injection, temporary injection, or permanent injection should guide the timing and material selection for injection. specific laryngeal pathology, patient expectations, and adjunctive diagnostics will all aid in choosing the proper timing of injection when considering the type of injection performed. trial injection augmentation consists of injection of temporary substance in patients for whom injection benefits are unclear. in the case of bilateral vocal fold atrophy, voice results with injection may be unpredictable, and in these cases trial injection may reasonably predict the results of a more permanent augmentation (vfi or thyroplasty). in another subset, patients with dysphonia with a significant dysarthria component may undergo trial augmentation to predict if articulation difficulties do or do not preclude improved communication outcomes with permanent augmentation. finally, in a subset of patients, apprehension or unrealistic expectations exist ; in these patients, trial injection will give an idea of realistic expectations after injection (32). a temporary vocal fold injection may be performed for acute unilateral vocal fold paralysis or paresis. in these cases of uncertain recovery, laryngeal electromyogram (lemg) sensitivity for lemg in predicting no recovery in the case of a " poor " or " fair " prognosis is 91%. specificity for predicting adequate recovery in the case of " excellent " prognosis for recovery is only 44%, however (33). recent evidence suggests that the presence of laryngeal synkinesis can effect the prognosis for recovery. specificity of lemg with synkinesis analysis increases to 64%, while accuracy is increased from 59% to 84% (34). given this, lemg with synkinesis testing can play a major role in assessing the prognosis for recovery., early permanent injection may be considered in the lemg - determinedcase of poor prognosis for recovery with or without synkinesis. alternatively, it may be performed after 6-month duration in the case of persistent vocal fold immobility. as discussed previously, currently, no optimal materials exist for superficial lamina propia replacements ; injectable materials that improve or enhance mucosal wave would prove to be immensely useful in the treatment of vocal fold scar and sulcus vocalis. improvements in the delivery methods or the viscosity of materials would allow for improved injection delivery through a trans - nasal endoscopic approach. finally, improvements in instrumentation, such as articulating cannulas may aid in performing injections in the awake, in - office setting. currently, much research concentrates on optimizing the biomechanical matches of injectables with the host tissue. the thyroarytenoid / lateral cricoarytenoid muscle complex as well as the superficial lamina propria have specific rheologic properties affecting mucosal wave characteristics, vocal fold vibration, and ultimately voice quality. studies examining the effects of injection on the viscoelastic properties of the specific host site exist. future development of vocal fold injectable materials will likely focus on providing a product that is not only safe, but functionally matches host viscoelastic properties. this is important both in the short - term and in the long - term, where tissue incorporation may alter the typical characteristics of the material / vocal fold interactions. vocal fold injection is a proven technique with favorable results for the treatment of mild - to - moderate glottic insufficiency due to a variety of causes. the technique has the advantages of ability to perform in an in - office, awake setting and may be easier to master than laryngeal framework surgery. in select cases of temporary paralysis or paralysis with uncertain prognosis, temporary vocal fold injection may be considered the standard of care for treating glottic insufficiency. recent advances in material engineering and digital imaging technology have made this an attractive alternative to laryngeal framework surgery that must be considered in a variety of clinical scenarios. | vocal fold injection is a procedure that has over a 100 year history but was rarely done as short as 20 years ago. a renaissance has occurred with respect to vocal fold injection due to new technologies (visualization and materials) and new injection approaches. awake, un - sedated vocal fold injection offers many distinct advantages for the treatment of glottal insufficiency (vocal fold paralysis, vocal fold paresis, vocal fold atrophy and vocal fold scar). a review of materials available and different vocal fold injection approaches is performed. a comparison of vocal fold injection to laryngeal framework surgery is also undertaken. with proper patient and material selection, vocal fold injection now plays a major role in the treatment of many patients with dysphonia. |
however, thyroid nodules in children are only found in 3.7% of healthy children aged 1118 years old. compared to adults, these nodules have an increased risk of being malignant (16% in children versus 5% in adults) [46 ]. thyroid cancer in children is also unusual in that it often presents with advanced disease including lymph node involvement and lung metastasis as compared to their adult counterpart [5, 79 ]. multiple modalities are frequently employed in an attempt to characterize thyroid nodules including ultrasound, radionuclide scans, fine needle aspiration (fna), thyroid function tests, and evaluating patient demographics. in the adult population although these tests are also performed in the pediatric population, these patients frequently undergo partial or total thyroidectomy for diagnosis the aim of this paper is to explore the utility of radiographic imaging and preoperative fine needle aspiration (fna) in the evaluation of pediatric thyroid nodules, more specifically, to determine if any of these modalities identifies those thyroid nodules that are at high risk of harboring a malignancy. a retrospective chart review was performed (20042009) at a tertiary medical center with a 100% pediatric patient population (irb approval no. fifty patients < 21 years of age were identified who underwent partial or total thyroidectomy. five patients with a family history of multiple endocrine neoplasia (men) were excluded, giving a total of 45 patients evaluated in the present study. patient demographics, preoperative workup, type of procedure performed, and pathology results were reviewed. forty - five patients underwent either partial or total thyroidectomy ; the majority of patients were female (n = 41). there was no difference in the median age at presentation for malignant and benign lesions 15 years (range of 719 years) versus 14 years (range of 821 years) (p =.88), respectively. ninety - one percent of patients underwent preoperative imaging with ultrasound (n = 31), ct scan (n = 4), i scan (n = 2), or ultrasound and a second modality (n = 4). of the 4 patients who had no preoperative imaging several nodules (n = 12) were found to have increased vascularity concerning malignancy ; however, these nodules were found to be both malignant (n = 3) and benign (n = 9). fna was performed in forty - nine percent of patients (n = 22). one fna was interpreted as a follicular lesion but returned multifocal papillary carcinoma on final pathologic evaluation. nine out of forty - five patients were identified with papillary carcinoma on pathologic examination (20%). cervical lymph node involvement was identified in 56% percent of patients (n = 5) at the time of thyroidectomy. there was no significant difference in the average size of the nodules in patients with malignant or benign disease (2.7 cm and 2.9 cm, resp. total thyroidectomy was performed as the initial procedure in those patients identified with malignancy by fna (n = 4). two patients underwent completion thyroidectomy after pathologic examination of their thyroid lobe revealed papillary carcinoma. both patients underwent preoperative imaging ; the first patient with an ultrasound that showed a vascular nodule, while the second patient had a ct scan that showed a small nodule. in addition, one patient was diagnosed with papillary carcinoma on an intraoperative frozen section and had a completion thyroidectomy at that time. one patient had an incidentally found micropapillary carcinoma in the setting of grave 's disease, and one patient with a multinodular goiter had a preoperative fna showing follicular cells, and the final pathologic diagnosis was papillary carcinoma. these patients did have preoperative imaging that showed nodules. of those patients with benign disease (n = 36), 12 (33%) underwent a total thyroidectomy for either an enlarging multinodular goiter or grave 's disease refractory to medical treatment. sixteen underwent a right lobectomy (45%), and 8 had a left lobectomy (22%). hypocalcemia was the most common postoperative complication, occurring in 8 patients (38%). half of these patients (n = 4) experienced symptoms with tingling or paresthesias, whereas the other half (n = 4) were identified with hypocalcemia on routine postoperative labs measurements. all patients were managed with supplemental oral calcium, and none experienced permanent hypocalcemia / hypoparathyroidism. the average length of stay was similar for all patients after total thyroidectomy : 1.46 days for those with malignancy (range 15 days) and 1.53 days for benign pathology (range 18 days). thyroid nodules in children represent an uncommon entity but carry a greater risk for malignancy than in their adult counterpart. in the pediatric population, this should be limited to an ultrasound examination to determine that if indeed the nodule is within the thyroid gland. if feasible, given the patients age and anxiety level, a fna should be performed. in those patients who have an inadequate fna, or fna total thyroidectomy remains the procedure of choice for those lesions identified preoperatively as cancer, while lobectomy should be employed for those lesions in which the diagnosis is uncertain [1014 ]. this facilitates the use of i therapy postoperatively as well as the ability to monitor thyroglobulin levels after treatment for recurrent disease. overall, thyroid cancer has a very good prognosis with a 98.8% survival at 10 years in children [2, 7 ]. the female predominance of thyroid nodules noted in our cohort has been previously reported in the literature and is likely secondary to the estrogen sensitivity of the thyroid gland [1518 ]. in our cohort, patient age and radiologic imaging bears no impact in determining whether a nodule was malignant or benign. increased intranodular vascularity is an ultrasound characteristic that has been suggested as an indicator of malignancy [19, 20 ]. in our group, patients were found to have intranodular vascularity suggestive of malignancy (n = 12) however, the lesions returned both benign (n = 9) and malignant (n = 3). fine needle aspiration and cytology evaluation in the pediatric patient is controversial [5, 2125 ]. follicular lesions can not be differentiated as malignant or benign because of the inability of fna to assess capsular invasion. if the lesion is identified as malignant, the patient should undergo a total thyroidectomy at initial operation versus an initial lobectomy when indeterminate or benign. if fna identifies the nodule as benign or a cyst, a patient can be followed if the lesion is small and avoid operative intervention. in adults, the accuracy of fna can reach 97%, while the pediatric population accuracy only reaches 90% [5, 8, 21, 23, 26 ]. other limitations of fna include sampling error, experience of the cytopathologist, or need for sedation in younger children. postoperative complications of hypocalcemia and recurrent laryngeal nerve injury are a great cause of concern in patients undergoing total thyroidectomy. hypocalcemia is largely due to incidental stunning or removal of the parathyroid glands, which may be embedded in the thyroid gland [7, 27 ]. another risk of total thyroidectomy is recurrent laryngeal nerve injury (rln), resulting in hoarseness, dysphagia, and respiratory failure if a bilateral injury occurs. permanent rln after total thyroidectomy has been reported as 1% in the literature [28, 29 ]. we report no instances of rln injury in our group. in our retrospective review, we report no instances of major complications, such as rln injury or permanent hypocalcemia, following total thyroidectomy. transient hypocalcemia is considered to be of moderate risk and is readily managed with oral calcium supplementation. in conclusion, there does not seem to be any component found in the preoperative evaluation of a pediatric thyroid nodule, with the exception of a positive fna to indicate that a lesion is malignant or benign. our experience suggests that patients can not be risk stratified based on age, size of the thyroid lesion, or characteristics of the lesion by all radiographic imaging techniques. in addition, postoperative risk to patients undergoing lobectomy or total thyroidectomy remains low and predominantly consists of transient hypocalcemia. at our institution we have found minimal utility of an extensive preoperative workup in a child with a thyroid nodule. ct scans have not been shown to be sensitive or specific for determining whether a lesion is cancerous or benign. therefore, the lifelong risk of cancer associated with ct is not justified (lifetime cancer risk associated with ct is estimated to be 2/1000 to 3/1000 in children under age 15). we advocate ultrasound evaluation to determine an intrathyroidal location, an fna if feasible, and then either total thyroidectomy for those with malignancy identified on cytology or lobectomy for those whose diagnosis is uncertain. | thyroid nodules in children are uncommon but often present an increased risk of malignancy in comparison to their adult counterpart. multiple diagnostic modalities are frequently employed to characterize these nodules including ultrasound, radionuclide scans, fine needle aspiration (fna), thyroid function tests, and evaluation of patient demographics. we chose to evaluate if any of these modalities influence treatment or signify a tendency for a nodule to represent a malignant lesion. a retrospective review of patients < 21 years of age who underwent partial or total thyroidectomy from 2004 to 2009 was performed (irb no. 4695). other than an fna indicating a malignancy, there does not appear to be any value to extensive preoperative imaging, nor can patient risk be stratified based upon age. we conclude that there is minimal utility in an extensive preoperative workup in a child with a thyroid nodule. |
discovered by berzelius in 1817, selenium (se) belongs to the 16 group (formerly group 6a) in the periodic table, together with oxygen, sulfur, tellurium, and polonium (nogueira and rocha 2011). initially, se was considered only as a toxic element, but for several decades it has been known as an essential trace element associated with significant health benefits in humans and mammals (schwarz and foltz 1958). the basic role of se activity is its presence in catalytic sites of various selenoproteins. in eukaryotic cells, se can be incorporated into 25 human and 24 rodent selenoproteins during translation, as selenocysteine (sec), 21st aminoacid, which is unique for essential trace elements incorporation (hesketh 2008). selenoproteins may perform various functions in humans, including antioxidant action (e.g., glutathione peroxidases), transport and storage of se (selenoprotein p), redox signaling (thioredoxin reductases), thyroid hormone metabolism (iodothyronine deiodinases), protein folding (e.g., selenoprotein 15 kda), and others (table 1).table 1human selenoproteinsfunctionabbreviationsselenoproteincellular ; tissue localizationantioxidant enzymesgpx1cytosolic glutathione peroxidase (gpx)cytosol, mitochondria ; widely expressedgpx2gastrointestinal gpxcytosol, er ; gastrointestinal tissue, livergpx3plasma gpxsecreted ; plasma, extracellular fluid, liver, kidney, heart, lung, thyroid, gastrointestinal tissue, breastgpx4phospholipid hydroperoxide gpxcytosol, mitochondria, nucleus ; widely expressed, testesgpx6olfactory gpxunknown ; embryo and oilfactory epitheliumselkselenoprotein ker, membrane proteinselrselenoprotein r ; methionine sulfoxide reductase b1cytosol, nucleus ; widely expressedselwselenoprotein wcytosol ; widely expressed, brain, colon, heart, skeletal muscle, prostatetransport and storage of sesepp1selenoprotein psecreted, cytosol ; plasma, widely expressed, brain, liver, testesredox signalingtrxr1thioredoxin reductase, type icytosol, nucleus ; widely distributedtrxr2thioredoxin reductase, type iimitochondria ; widely distributedtrxr3thioredoxin reductase, type iiicytosol, er, nucleus ; testis - specificthyroid hormone metabolismdio1iodothyronine deiodinase, type imembrane protein ; kidney, liver, thyroid, brown adipose tissuedio2iodothyronine deiodinase, type iier, membrane protein ; thyroid, central nervous system, brown adipose tissue, skeletal muscledio3iodothyronine deiodinase, type iiimembrane protein ; placenta, central nervous system, fetusprotein foldingsep15selenoprotein 15 kdaer lumenselnselenoprotein ner membrane ; widely expressedselmselenoprotein mer lumenselsselenoprotein ser, membrane protein ; widely expressedsec synthesissps2selenophosphate synthetasecytosolunknownselhselenoprotein hnucleus ; widely expressedseliselenoprotein itransmembraneseloselenoprotein ounknownseltselenoprotein ter membraneselvselenoprotein vtestesadapted from papp. (2010) genetic polymorphism associated with cancer the role of se and selenoproteins in human health and diseases has been intensively studied with special attention on the determination of relevant biomarkers of se status., se is largely found in animal foods, and to a lesser extent also in plants, which indicates large individual differences in se intake, associated with dietary menu composition, but also with the origin of food, which can be grown (plants) or bred (animals) on soils with different se content (gromadzinska. 2008). in humans, dietary se intakes also vary geographically from low to high se areas. well documented se deficiency health effects keshan and kashin - beck (kbd) diseases, associated with muscle disorders, were found in a broad zone running from northeast to southwest china, from the border of heilongjiang to the yunnan province, where concentration of se in the soil was very low (oldfield 1999). in european countries, dietary se intake is lower than that observed in usa, mainly due to low se soils. recommended dietary intake (rdi) value of se for adults in usa and europe is 55 g / day. tolerable upper intake level determined by the us food and nutrition board (nas 2000) is 400 g / day, while that determined by the scientific committee on food in europe is 300 g / day (efsa 2008). average intake of se by european population ranges from 27 to 70 g per day (efsa 2008), which is insufficient to meet the daily requirement. clinical signs of marginal se deficiency in europe have not been observed or documented yet. however, it should be noted that several groups of healthy individuals may be specially prone to se deficiency, which includes breast - fed neonates, pregnant women, and elderly people (bellinger. the relationship between se level and health effects is represented by a u - shaped curve that suggests health pathologies associated with se deficiency as well as its excess (ip 1998 ; jablonska. the altered se status resulting from insufficient se intake is very often associated with different diseases, including immune diseases, cardiological diseases, and cancer. on the other hand, recent studies have indicated that long - term high dietary se supply seems to be related to the risk of type 2 diabetes, amyotrophic lateral sclerosis, and some types of cancer (bellinger. although se levels in blood and blood compartments are easily accessible markers of human se nutritional status, se level itself does not reflect its functional significance. plasma or serum se, very often used in various se investigations, reflects rather short - term se status, while platelet, leukocyte, and erythrocyte se reflects its longer - term status. two best known selenoprotein biomarkers that have been widely used in discriminating of se status are as follows : plasma selenoprotein p (sepp1) level and plasma glutathione peroxidase (gpx3) activity. in healthy humans, plasma se is incorporated as sec in two selenoproteins : sepp1 (4070%), gpx3 (2040%), while 610% of se is bound to albumin in the form of selenomethionine, through the replacement of methionine. free se accounts for less than 1% of total plasma se (vincent and forceville 2008). these biomarkers generally reflect the major sources of human body se, because gpx3 and sepp1 are the unique secreted selenoproteins. gpx3 is mainly synthesized in kidney, where it is produced by the cells of proximal tubular ephitelium and by parietal cells of bowman s capsule and then it is released into the plasma (gromadzinska. mammalian sepp1 that contains multiple sec residues (10 sec residues in humans and rodents) is synthesized in liver and then secreted into the blood and transported to other tissues. recently, specific apolipoprotein e receptor-2 (apoer2) for sepp1 uptake in brain and testis and apoer2 homolog megalin for sepp1 uptake in kidney proximal tubule epithelial cells were found, suggesting receptor - mediated uptake of se in these organs (burk and hill 2009). there is a growing interest in the use of transcripts level as a molecular biomarker with special regard to whole blood. since early 1990s, research on this new molecular biomarker of se status has been extended to se studies in rodents, showing prioritization of preservation and degradation of specific selenoprotein mrna under se deficiency and under conditions of adequate and enhanced supply (bermano. 1995). the observed hierarchy of the expression of selenoprotein mrna in response to dietary se supply has indicated the order of selenoproteins, some of them dramatically affected under se deficiency or its excess, and others only marginally. selenoprotein transcripts analysis in the blood gives an opportunity to obtain genomic fingerprints, in response to se status, but also reflect an impact of genetic polymorphism of selenoproteins. in a few recent human studies, selenoprotein gene expression level in circulating human blood leukocytes was used as a longer term se status indicator. some other studies have been focused on the role of se incorporation during selenoprotein synthesis under different se dietary status in humans (pagmantidis. 2008 ; ravn - haren. 2008a, b ; reszka. 2009 ; sunde. 2008). levels of se for optimization of sepp1 concentration and gpx3 activity in plasma have been determined in people living in se - adequate areas. however, these biomarkers may be unsuitable under conditions of high se status, because of plateau levels obtained at such concentrations. on the other hand, se levels in blood of individuals living in low se areas with low se intake may be insufficient to ensure maximal activity and/or concentration of selenoproteins gpx3 and sepp1 (thomson 2004). therefore, determination of se intake and se status in humans with variable se supply seems to be important in assessing the most sensitive se status biomarkers. in this review, we present recent findings regarding molecular se biomarkers, based on rodent and human studies. se status measured by serum / plasma se, plasma sepp1 concentration and plasma gpx3 activity may differently respond to se supplementation, which can give information about low, adequate, and high se dietary intake. since several years, it has been generally accepted that selenoprotein level and/or activity may be more useful in determining se status than se itself. two human selenoproteins, gpx3, and sepp1 are believed to be good nutritional se biomarkers in humans. studies on se - deficient populations showed that full expression of sepp1 required larger intake of se than did gpx3 activity (xia. therefore, setting rdi values for se intake was based on their assessment of the amount of se required to achieve optimal activity or two - thirds optimal activity of gpx3 in plasma to meet the requirements of people living in low, adequate, and high se areas (rayman 2004). different chemical forms of dietary se from animal foods and plants, such as selenite, selenocysteine, and selenomethionine, are involved in metabolic pathways to form selenide. selenide is then transformed into sec for selenoprotein biosynthesis or may be methylated to the main metabolite selenomethionine is a major form of organic selenium in plant foods, similarly like selenium - enriched yeast in se supplements. because of different metabolism of se compounds in organism, absorption of se from different organic and inorganic se food sources, and se supplements, their incorporation in selenoprotein and urinary se excretion may vary in humans. 2005) clearly indicate that se in the form of selenomethionine is more easily absorbed than selenite. absorption of se from yeast was greater than this inorganic form but less than selenomethionine. interestingly, plasma se seemed to reflect selenomethionine content of yeast but not the other yeast se forms, indicating its effective bioavailability (burk. in several populations in suboptimal se areas in europe, china, new zealand, concentration of sepp1 could not reach the plateau because of low se daily intake, suggesting that se nutritional requirements had not been achieved (xia. different plateaus reached by plasma gpx3 activity and plasma sepp1 level indicates that the latter is a better indicator of se status in humans, because a larger intake of se has been required for optimized sepp1 concentration than did gpx3 activity (xia. in addition to gpx3 activity, plasma sepp1 level may be a suitable se status and se intake biomarker in individuals from low se populations with additional supply of se. in populations living in high se areas, e.g., australia (queensland), usa, and canada (central states and provinces) (oldfield 1999), where gpx3 activity and sepp1 level in plasma can be optimized by dietary se supply, plasma se seems to reflect se status and se intake (burk. the unique conserved stem - loop sec insertion sequence (secis) in the 3-untranslated region of mammalian selenoprotein mrna is essential for the recognition of uga as a codon for sec. sec may be synthesised from different se dietary sources : selenomethionine, selenocysteine or selenite, se compounds which are further metabolized to selenide and then in the presence of selenophosphate synthetase 2 to selenophosphate this process requires specific sec trna[ser]sec, several translation factors like sbp2, efsec, and others that serve to distinguish between uga codons designated for sec from those terminating translation. sec synthesis occurs directly on its sec trna[ser]sec, initially carrying a serine residue, which serves as an acceptor for selenophosphate. maturation of sec trna[ser]sec requires methylation, and two isoforms of methylated and unmethylated sec trna[ser]sec are observed. se supplementation is known to modulate the relative ratio between these two isoforms and promote the methylation of sec trna[ser]sec. (hatfield and gladyshev 2002 ; hesketh and villette 2002 ; jameson and diamond 2004 ; schomburg and schweizer 2009 ; small - howard and berry 2005). it has been observed that the alterations in selenoprotein activity and concentration during se depletion and repletion are accompanied by changes in the mrna level. under severe se deficiency, this microelement is accumulated mainly in the brain and endocrine tissues, where elevated expression and activity of phospholipid glutathione peroxidase (gpx4) and thyroxine deiodinase (dio) were observed, indicating the biological importance of these selenoproteins (schomburg and schweizer 2009). according to rodent studies, the main selenoproteins that are resistant to dietary se changes are gpx4 and dio ; thioredoxine reductases (trxr) and sepp1 are moderately sensitive, while gpx1, selw, selh are very sensitive to low se supply (reeves and hoffmann 2009 ; sunde 2010). several in vitro and in vivo studies have shown that, under se deficiency, the degradation of selenoprotein mrna occurs through nmd (nonsense codon - mediated mrna decay) (moriarty. 1998 ; weiss and sunde 1998). due to specific nucleotide sequences and preferential binding of sbp2 translation factor, 14 of 25 human selenoprotein mrnas may be sensitive to nmd - based degradation under low se supply (squires. however, a study on rodents, suggesting regulation of selenoprotein expression, irrespective of this hypothetical preference, indicates that also other mechanisms concerning differences in the expression efficiency of some selenoproteins under se deficiency must exist (sunde. 2009). in addition, methylated sec trna[ser]sec supports the biosynthesis of selenoproteins gpx1, gpx3, selr, selt, sensitive to low se supply, while other selenoproteins, like trxr1 and gpx4, moderately sensitive and resistant to low se supply, require unmethylated isoform (schomburg and schweizer 2009). an attempt to answer the question whether selenoprotein gene expression may be used as a biomarker of se status was presented for the first time by roger a. sunde s team. sepp1 mrna shows the highest expression in rat testes and liver, while gpx3 mrna expression is highest in rat kidney (evenson. 2004), which is in agreement with observed selenoprotein activity and protein expression in these organs. therefore, these molecular biomarkers may be also useful for the determination of se status as well as for establishing physiological requirements of se for adequate selenoprotein gene expression. these authors found also that, in rodents, gpx1, selh, and selw mrna levels were highly regulated by se status (sunde 2010). analysis of hierarchical regulation of different selenoprotein mrnas by se status indicates that gpx1 transcripts level is the best and adequate molecular biomarker in rats, because dietary se deficiency similarly decreased gpx1 mrna in blood and liver. by way of comparison, decrease in se supply in diet gpx1 mrna expression in rat liver was the highest, while in blood, expression of this selenoprotein was at 4th place in tissue rank, comparable with the expression in heart and kidney. interestingly, other investigated selenoprotein transcripts also presented distinct expression pattern across the tissues and it was found that gpx1, gpx3, gpx4, sepp1, trxr1 expression in blood were comparable with those observed in the major organs (evenson. regulation of selenoprotein mrna under se dietary deficiency presents diversity, from dramatic decrease in gpx1 mrna to lack of changes for gpx4 mrna. low selenoprotein mrna observed in rodents reflect depletion of se supply in the diet, and adequate se supply regulates expression level very efficiently. it has been found that at least half of the dietary se necessary to provide plateau for enzymatic activity or protein expression is adequate to provide plateau for mrna expression in liver, muscle, and kidney of rats (barnes., selenoprotein mrna level is expressed as hyperbolic curve presenting plateau breakpoints at low se supply for majority of selenoproteins. minimal se requirement for growing rats was 0.1 g se / g diet based on liver se, liver, and rbc gpx1 activity. slightly lower dietary se requirements based on plasma gpx3 activity, liver trxr activity, and liver and kidney gpx3 activity were observed. based on dose response curves for selenoprotein mrna indifferent tissues, the minimum dietary requirements were lower than for physiological se biomarkers, ranging between 0.04 and 0.06 g se / g diet in liver and kidney and was between 0.03 and 0.05 g se / g diet in muscles. besides, it has been assumed that it is not feasible to use selenoprotein mrna in rat tissues as a biomarker for super - nutritional se level (up to 0.8 g se / g diet). these experiments evidently suggest that marginal level of se in diet is able to increase selenoprotein mrna to adequate level in rats and mice, what may suggest common mechanism in regulation of selenoprotein mrna expression by dietary se supply (barnes. recently, sunde (2010) proposed the panel of molecular biomarkers, which could be useful for the assessment of selenium status in rats and might be effective as the traditional biomarker panel in rat tissues. gpx1, gpx3, selt, and selw mrna panel of transcripts level was significantly correlated with liver se concentration, gpx1 and selk mrna were associated with liver gpx1 activity, while sepw and selk mrna reflected kidney selenium status, and gpx1, sepw, txnrd1 transcripts level correlated with gpx1 kidney activity. interestingly, recent studies suggest that regulation of selenoprotein mrna by se dietary status is not a general phenomenon in rodents. it was found that in mice, majority of analyzed selenoprotein transcripts in liver and kidney were not significantly regulated by se deficiency (sunde. it has been found that minimum se requirement of the turkey is higher than for rodents (sunde and hadley 2010). dietary requirement was decreased at least 50% in old rats as compared to requirements of young animals (sunde and thompson 2009). expression of the majority of selenoprotein mrna in testis, except for gpx1, sepp1, sepw, and also apoer2, was not regulated by dietary se status (schriever. 2009). the mrna abundances of the 12 selenoprotein genes in thyroid and pituitary of young pigs were resistant to increasing se dietary supply in diet and also se deficiency, but not in liver, where nmd under se deficiency was observed for gpx1, sepw, sepn, txrd1. the testicular mrna of txnrd1 and sep15 were decreased by increasing dietary se supply, indicating that high se status may be associated with a decrease in selenoprotein mrna transcripts level (zhou. differences in dietary minimal se supply required for maximal mrna expression and/or selenoenzyme activity suggest differential regulation depending on the type of selenoprotein as well as tissue. therefore, findings regarding ranking of different selenoproteins synthesis within tissue and also different distribution of selenoproteins in various tissues should be considered in establishing a universal se status biomarker (sunde 2010). in 2003, the panel of experts in uk food standards agency has issued specific research recommendations after evaluation of current knowledge regarding the assessment of se status, including further development of functional biomarkers (elsom. recently, a special emphasis is laid on the application of population of circulating white blood cells (wbc) transcriptome patterns in nutritional studies. transcriptomics studies suggest that genes with various functional annotations can be significantly expressed in wbc (visvikis - siest. gene expression patterns may be also useful to define biological processes associated with human health and disease. however, only a few studies assessing selenoprotein gene expression in various populations of circulating wbc in humans have been conducted so far (table 2).table 2human studies on selenoprotein molecular biomarkersstudybaseline daily se intake (g)mean sdbaseline plasma se level (ng / ml)mean sdselenoprotein gene expression in wbcuk, selgen study, n = 39, both sexes, 6 week. se intervention (pagmantidis. 2008)not presented93.9 1.7lymphocyteup - regulation : sps11.15 (1.061.23)selk1.11 (1.041.19)sep151.11 (1.021.20)denmark, n = 20, 1840 years.. 2008a)49.8 13.6113.2 12.2leukocyteno effect : gpx1, trxr1 sepp1denmark, precise pilot study, n = 105, both sexes, up to 5 years. 2008b)49.8 13.693 11.2leukocyteno effect : gpx1uk, n = 39, both sexes, 28 week. se intervention (sunde. 2008)48 1489.2 12.5whole bloodno effect and no association between se status and gpx1,gpx3, gpx4, sepp1, sepw, sephpoland, n = 47 healthy men (reszka. 2009)24.2 17.4 (unpublished data)54.3 14.6leukocyteno association between se status and gpx1, gpx3, sepp1, sep15 human studies on selenoprotein molecular biomarkers human studies have not confirmed the hypothesis that selenoprotein transcript level in circulating leukocytes and in whole blood may be the reliable biomarker of se status in population with adequate (sunde. 2008) and suboptimal (reszka. 2009) baseline se level in plasma (fig. 1). after short - term 100 g sodium selenite supplementation, healthy subjects from the selgen population were chosen at random for microarray analysis of rna isolated from lymphocytes. the greatest changes after se supplementation were observed for genes that encode proteins functioning in protein biosynthesis. up - regulation of selenoprotein k (selk) and selenoprotein 15 kda (sep15) after se supplementation was observed, indicating that only a small number of selenoprotein encoding genes was altered by different se dietary supply (pagmantidis. (2008a, b) also indicated lack of se impact on selenoprotein mrna expression in wbc after short- and long - term se supplementation. after 1 week of supplementation with nonorganic se or organic form among healthy young danish men, there were no differences in mrna expression of gpx1, trr1, and sep1 in leukocytes (ravn - haren. similarly, after 5 years of se - enriched yeast supplementation of the precise danish subjects, there were no differences in the expression of gpx1 in circulating wbc (ravn - haren. moreover, selenoprotein expression level in whole blood was not significantly associated with se status measured in the blood and se supply measured according to dietary questionnaire in uk population (sunde. the baseline se level in uk and danish populations was relatively high as compared to other european populations and it approximately averaged 100 ng / ml in plasma (table 2). lack of changes in selenoprotein mrna levels after se supplementation indicates that protein synthesis may already be saturated in leukocytes at such sufficient se concentration. in the small group of 47 healthy polish individuals, plasma se levels were below the level required to optimize plasma gpx3 activity (54.3 14.6 ng / ml). however, no relationship between serum se and gpx1, gpx3, sepp1, and sep15 mrna transcripts level, as well as gpx1 and gpx3 activities and selenoprotein mrna expression was found (reszka. daily se intake in studied european groups was lower than rdi (55 g / day) for adults in europe and us. the observed hyperbolic curve describing the relationship between selenoprotein mrna expression and dietary supply in rodents suggests that suboptimal se status in humans may be sufficient for selenome transcription machinery. interestingly, gpx1, gpx3, sepp1, and sep15 selenoprotein mrna expression in circulating blood leukocytes was significantly positively correlated, indicating similar regulation of expression in circulating blood leukocytes. although significant correlations were found between several selenoprotein mrnas in the circulating blood leukocytes of healthy individuals, no correlation was found in the blood of bladder cancer patients, which may suggest an alteration of selenoprotein synthesis during carcinogenesis (reszka. british (whole blood) (sunde. 2008) (a) and suboptimal polish (leukocyte) (reszka. 2009) (c) se level and correlation between plasma se level and sepp1 transcripts level in population with adequate british (whole blood) (b) and suboptimal polish (leukocyte) (d) se level a and b reproduced with permission from sunde. (2008) correlation between plasma se and gpx3 transcripts level in population with adequate british (whole blood) (sunde. 2008) (a) and suboptimal polish (leukocyte) (reszka. 2009) (c) se level and correlation between plasma se level and sepp1 transcripts level in population with adequate (d) se level a and b reproduced with permission from sunde. functional significance of blood se status is mainly related to selenoprotein activity in specific tissues. therefore, both traditional and molecular biomarkers of se status measured in different human tissues, except for controlled se intake, may depend on additional major modifiers, like health status (e.g., endocrine and immunological status), inter - individual variations (age, sex, genetic polymorphism), environmental exposure, diet, medication, etc. therefore, establishing the se status and intake which would be optimal for human health seems to be very difficult, especially in many populations experiencing suboptimal se supply, including europe. epidemiological and animal studies clearly indicate that biological effects of se are sex - specific, which may be associated with endocrine regulation and also immunological status. it has been suggested that cancer risk in men is more profoundly influenced by se status than in women (waters. selenoprotein gene expression displays sexual dimorphism in various organs of females and males, e.g., se status was linked to male fertility due to gpx4 function during spermatogenesis (schomburg and schweizer 2009). sex - specific selenoprotein expression pattern may vary or be sustained with age. in the selgen study, an effect of se supplementation was associated with gpx4 genetic polymorphism in a sex - specific manner (meplan. plasma se level is not likely to accurately reflect tissue se status or selenoenzyme activity and level. 2006). se metabolism may be altered in different health pathologies, e.g., in patients with inflammatory diseases. during critical illness, like sepsis, acute phase response, and other immunological disturbances, serum se status may be lower and insufficient to support organ function. in systemic inflammatory response syndrome patients, serum se concentration was significantly lower (vincent and forceville 2008). tobacco smoking or occupational exposure can also increase dietary requirement of se. it is generally agreed that smoking can decrease the activity of antioxidative selenoproteins, probably due to formation of complexes of se with cadmium (ellingsen. a scheme of traditional and molecular biomarkers measurements with the impact of potential modifiers (physiological, environmental, genetic). the optimal selenium biomarker should reflect all putative egzo- and endogenous factors which can modulate selenium bioavailability, metabolism and selenoprotein transcription, biosynthesis, transport, activity and function. a type of measurement used for the determination of selenium status should be also considered biomarkers of selenium status in humans. a scheme of traditional and molecular biomarkers measurements with the impact of potential modifiers (physiological, environmental, genetic). the optimal selenium biomarker should reflect all putative egzo- and endogenous factors which can modulate selenium bioavailability, metabolism and selenoprotein transcription, biosynthesis, transport, activity and function. a type of measurement used for the determination of selenium status should be also considered in human population, there is a large individual variation in response to se supplementation, appearing to be unrelated with the baseline se status (brown. recent human studies indicate that selenium status, measured as body se, as well as sepp1 plasma level and gpx activity, may be significantly influenced by genetic polymorphism of specific selenoproteins, including gpx1 (rs1050450) (jablonska. 2007, 2009), gpx4 (rs713041) (meplan. 2008). the impact of sepp1 variations in codon 234, associated with ala to thr change (rs3877899) and g to a transition within 3 untranslated region (utr) of sepp1 mrna (rs7579), resulted in the alteration of se status before as well as after se supplementation (meplan.. these polymorphisms also influence proportion of two sepp1 50 and 60 kda isoforms in plasma, which was proposed as the modulation factor of se incorporation during selenoprotein synthesis (meplan. 2009). se availability modulated by sepp1 variants, resulting in difference in isoform pattern was restricted just to males. interestingly, a possible impact of gender was observed for functional significance of gpx4 genetic polymorphism. single nucleotide polymorphism in 3-utr of gpx4 mrna, associated with c to t change (rs713041) influenced the level of gpx4 in lymphocytes, and also other selenoproteins ; however, this effect was more evident in females (meplan. one may hypothesize that separate molecular mechanisms for gpx4 synthesis in testes and high dietary se requirements in males override genetic polymorphism in gpx4 and sepp1. recent findings suggest also that the association between gpx1 activity and se concentration, analyzed separately for each gpx1 pro198leu (rs1050450) genotype group, was the highest for pro / pro and the lowest for leu / leu genotype, suggesting different response of gpx1 activity to se. this also points to the importance of the genetic background in the assessment of the se status with the use of selenoprotein biomarkers such as gpx1 activity (jablonska. adaptation of humans to suboptimal dietary se supply with low se level was observed by finley. (1999) in healthy study participants living in new zealand, where people consume less se than suggested by the rdi of 55 g / day. se level in blood of individuals living in low se areas and with low se intake may be insufficient for maximal activity of gpx3 and level of sepp1 in plasma. however, supplementation had no effect on se status in platelets and erythrocytes, which can be regarded as indicative of long - term se intake. interestingly, high retention of stable se isotope in placebo individuals was observed as compared to individuals supplemented with 30 g se daily for 5 months, suggesting maintenance of critical se pool in the human body and adaptation to low se status by adjusting of its secretion. therefore, physiological requirements of se are lower than recommended in humans, but enabling selenoprotein synthesis. besides, in patients with diseases like kbd and cancer, where low se level in blood is observed, down - regulation of specific selenoprotein gene expression was found to occur in circulating wbc. significant down - regulation of sepp1 mrna level was observed in han chinese with kbd (sun. 2010). in caucasian bladder cancer male patients, sepp1, gpx1, gpx3, sep15 mrna levels were lower than in the control group (reszka. preferential incorporation of sec into selenoprotein mrna in circulating blood leukocytes under relatively low se supply merits investigations intended to identify potential sensitive and resistant selenoproteins under se deficiency in humans. while the levels of se required for optimization of sepp1 and gpx3 activities in plasma are well known, estimating se level that is required for maximal selenoprotein gene expression in humans requires further research. according to rodents studies and studies among humans, which have been discussed in this review, it appears that suboptimal se intake may be sufficient to achieve selenoprotein mrna expression and molecular requirements of se are lower than the established recommended dietary intake in humans55 g / day (efsa 2008 ; nas 2000). it should be noted that the expression of individual selenoprotein mrna may be not always linked with protein expression. therefore, since we have not understood the transcriptional and translational link of selenoprotein under different se supply in different human tissues, biological functionality of selenoprotein could be recognized only at protein level. preferential incorporation of se into selenoproteins in rodents was observed even at suboptimal dietary se level. in rats, minimum se requirements for achieving a plateau of selenoprotein mrna expression have been low, reached plateau at half of the dietary se concentration required for maximal activity of gpx1, gpx3, and maximal level of sepp1 in different tissues (barnes. therefore, in rodents, selenoprotein mrna expression does not seem to be a good indicator for se status. hypothetically, in almost all populations, even in those with low and moderate se intake and se level in blood compartments, selenoprotein encoding gene expression might reach the plateau levels and serve as a sensitive functional biomarker of se status. however, it should be noted that regulation of selenoprotein gene expression, metabolic pathways, and responses to se interventions in animals may differ from those in humans. none of the human studies conducted so far has indicated that selenoprotein mrna in the whole blood and blood cells may be a good indicator of se status in humans (pagmantidis.. low se status may be adequate for proper regulation of selenoprotein transcription, but not for proper physiological activity of selenoproteins. preferential incorporation of se into selenoprotein and its optimal saturation at low dietary se level does not provide adequate activities and selenoprotein expression in different tissues. therefore, it may be suggested that functional rather than molecular biomarkers of se are optimal indicators of its supply. it seems reasonable to conclude that sepp1 concentration in plasma may clearly indicate sub - optimal to optimal se supply, because it can reflects functional significance of se activity in organism. in over - optimal se supply, where sepp1 level is optimized, plasma se seems to reflect se intake and achieved se status. all possible modifiers of se status determined by means of biochemical and molecular techniques, including smoking, occupational exposure, diet, health parameters, sex, age, endocrine and immunological status, should be included, as these factors can potentially modulate selenoprotein gene expression. impact of polymorphism of selenoproteins should be also included in complete analysis of se requirements of individuals with different genotypes and haplotypes. therefore, comprehensive intervention studies of circulating leukocyte selenoprotein transcript levels in a population with suboptimal and with adequate compared to over - optimal selenium status should be conducted. | the most commonly used methods for assessing the selenium (se) status in humans involve analysis of se concentration, selenoprotein activity, and concentration in the blood and its compartments. recently, it has been suggested that the expression of selenoprotein mrna in circulating blood leukocytes could differently reflect se status, due to prioritization of specific selenoprotein synthesis in response to dietary se supply. whereas the se levels required for optimization of selenoprotein p level and plasma glutathione peroxidise activity are well known, estimation of se level that is required for maximal mrna expression of selenoprotein in humans is the subject of current investigations. studies on rats suggest that whole blood selenoprotein mrna level can be used as the relevant molecular biomarker for assessing se status, and suboptimal se intake may be sufficient to achieve effective expression. human studies, however, did not confirm this hypothesis. according to studies on rodents and humans discussed in this review, it appears that suboptimal se intake may be sufficient to satisfy molecular requirements of se and it is lower than current recommended dietary intake in humans. the use of selenoprotein transcripts as a molecular biomarker of se status requires further studies on a large group of healthy individuals with different baseline se, including data regarding genetic polymorphism of selenoproteins and data regarding potential modifiers of se metabolism. |
fracture healing of bone is a complex process affected by systemic, biological and mechanical factors, the combination of which can lead to successful and complete repair of a fracture, or deficiencies of which can cause delayed healing or even non - union. angiogenesis is an important early phase of fracture healing, leading to invasion of the initial haematoma by fine vessels and subsequent conversion into soft callus. impaired angiogenesis can compromise fracture healing [8, 14 ], whereas enhanced vascularity is known to improve fracture healing [37, 43 ]. neovascularisation of the haematoma occurs from the adjacent soft tissues [4, 9, 10, 13 ], especially when the medullary supply has been disrupted. standard histology uses staining to visualise tissue types or tissue components (such as smooth muscle or endothelial cells) in the fracture callus and surrounding tissue [3, 21, 32, 42 ]. immunohistochemistry techniques label proteins particular to blood vessels, such as vegf and cd31, to identify regions of angiogenesis and quantify small vessels [22, 28, 36 ]. capillary proliferation around the fracture site has been demonstrated by micro - angiography, and vascular budding adjacent to the fracture defect was revealed with contrast perfused histological sections. electron microscopy [21, 23, 38, 46 ] and intra - vital microscopy [47, 49 ] provide high - resolution images that can indicate fine details of the angiogenesis process, such as changes in cell morphology, gene expression or endothelial cell activity. these techniques can indicate fine details of the vessel structure and distribution, but most are two - dimensional and static, providing little quantitative information on blood flow. detailed three - dimensional structural information is provided by ct scanning with the vessels perfused with contrast resin at killing [2, 34 ], or in vivo [20, 26, 30, 31 ], but these are often limited snapshots at particular time points and provide no information of the time course of neovascularisation. for example, tomlinson and associates used silicone contrast perfusion of vessels and micro - computer tomography (micro - ct) scanning of forelimb stress fractures at 3 and 7 days after loading - induced stress fractures. measures of blood flow or blood perfusion are possible with probe - based laser doppler [6, 1517 ], ultrasound, radioactive tracer clearance [1, 33, 45, 48 ] or functional ct [1820, 39 ]. these functional measures must be performed in vivo and provide temporal analysis of the neovascularisation process throughout the fracture healing period. probe laser doppler measures at discrete points (sometimes several across a region) and tracer clearance can be used to provide a regional integral of the measured flow. laser doppler scanning, however, scans continuously over a region and provides 2d surveys of blood perfusion, which can be used to identify vessels and regional flow patterns. in this study, we combined laser doppler scanning (for longitudinal percutaneous information) and micro - ct imaging (for end - point three - dimensional structural information) to investigate the location and extent of neovascularisation of the soft tissues around the fracture gap during healing. thirty - two sprague dawley rats (350500 g ; 1220 weeks of age) underwent left mid - femoral osteotomy fixed with an external fixator. all procedures were approved by the imperial college, london, ethical review process and were strictly conformed to the animals (scientific procedures) act 1986 uk home office guidelines. experiments were performed under a home office licence ppl 70/6472 (the conditions of which also fulfil the us nih guide for the care and use of laboratory animals). inhalation anaesthesia was induced in an induction chamber (4 % isoflurane in oxygen at 2 l / min ; isoflo, abbott laboratories ltd., maidenhead, sl6 4xe, uk), the animal was transferred to a rat mask and anaesthesia was maintained with 1 l / min oxygen and isoflurane varied as appropriate between 1.5 and 3 % to maintain full anaesthesia and analgesia but to allow optimal recovery. newbury, rg14 1ja, uk) and analgesia (buprenorphine ; vetergesic 0.3 mg / ml. ; reckit benckiser healthcare (uk) ltd, hull, hu8 7ds, uk) were administered in appropriate doses ; both thighs were shaved and laser doppler scanned (model ldi2-hr, moor instruments plc, axminster, england). the animal was then prepared recumbent on its side on a heating mat, surgically draped and skin disinfected for surgery. the left femur was exposed through a lateral skin incision and blunt dissection, four stainless steel fixation pins (1.25 mm thread diameter) were inserted transversely 7 mm apart along the femoral length and the femur was cut transversely mid - shaft using a fine hand saw (fig. 1). the muscle layers and skin were closed (and sutured with resorbable suture material), the pin shafts were passed retrograde through the skin and a custom - designed unilateral fixator was assembled to the pin ends. after rehydration by injection of two 2 ml aliquots of sterile water subcutaneously, the animal was awoken with administration of pure oxygen through the anaesthesia equipment under observation and once fully awake was returned to standard housing. all animals were housed individually with analgesic (rimadil) and antibiotic cover (enrofloxacin 0.05 %) in the drinking water for 4 days. thereafter, the animals were housed in threes and allowed water and standard laboratory feed ad libitum. the fracture zone is outlined radiograph of healed fracture (and fixator) sacrificed 6 weeks after fracture. the fracture zone is outlined the full medial aspect of both thighs was laser doppler scanned (2.5 cm 2.5 cm) at a resolution of 0.1 mm, pre- and post - operatively and at 1, 2, 4 and 7 days and thence weekly until sacrifice. animals were killed at 2 and 4 days post - operatively, and at 1, 2, 4 and 6 weeks post - injury (n = 5 per group). at sacrifice, the anaesthetised animal was laser doppler scanned, and then the common iliac artery was cannulated, heparinised and infused with silicone contrast agent (microfil mv-120, flow tech inc., carver, mass. the animal was immediately euthanised with pentobarbital, and the hindquarters were harvested and fixed in 10 % neutral - buffered formalin solution for at least 2 weeks. from laser doppler scans, the femoral artery was identified by its bifurcation and location, and four regions of interest were analysed : (1) femoral artery, (2) distal femoral artery, (3) the zone cranial to the artery (adjacent to the fracture) and considered to be the tissue most probably involved in neovascularisation of the fracture site [13, 23, 29 ] and (4) the zone caudal to the artery (fig. 2). proprietary software (moor ldi v5.1, moor instruments plc, axminster, england) computed mean and maximum perfusion in each region ; the mean values were used in subsequent analysis. daily variations in perfusion due to depth of anaesthesia or body temperature were determined by calculating the change of perfusion in each region in the contralateral leg relative to the pre - operative value in that region (dailyvar). we divided the perfusion values of the fractured leg by this parameter to account for fluctuations not associated with the neovascularisation process. mean perfusion measures (corrected for daily variations) were then expressed as a percentage change from the pre - operative value for the fractured leg. inter - operator repeatability of the laser doppler analysis was determined by three separate investigators analysing 20 separate scans independently. intra - operator repeatability was determined by one - operator repeating analysis on 20 scans four times. 2laser doppler scan with four regions of interest identified : 1 femoral artery, 2 distal femoral artery, 3 cranial region overlying the fracture zone and 4 caudal region laser doppler scan with four regions of interest identified : 1 femoral artery, 2 distal femoral artery, 3 cranial region overlying the fracture zone and 4 caudal region micro - ct scanning of the limb - fixator constructs and intact contralateral femora was performed at 180 kv and 133 ma and a resolution of 21 microns (hmx st225, x - tek systems ltd. the excised femora were typically 30 mm in length and thus consisted of about 1,450 slices. the ct scans of both limbs were reconstructed to show the bone and the vessels (fig. the steel fixator pins caused some artefactual whiteout of the scans at their level, masking some of the vascular regions on those sections, but the fracture zone (which is the region of interest) was between the middle pins. scans of fractured limbs were therefore analysed just between the pins on either side of the fracture site (proximally and distally, pins number 2 and 3), a length of about 8 mm. intact limbs were analysed over the mid - third of the femur, which corresponded to the same level as the fracture region on the contralateral limb. the image stack of the scan was then thresholded automatically (trainable segmentation, fiji image manipulation software, http://fiji.sc/wiki/index.php/fiji) to identify four regions : bone, vessel, tissue and air ; the contrast medium - filled vessels displayed ct density midway between bone and soft tissue. the scans were binarised and manipulated to smooth and cohere the vessel regions and minimise all other regions. an automated particle counter (fiji) was then used to count the vessels on each cross - section, the total cross - sectional (vessel) area and area fraction for each section, and the size and number of vessels in each slice were output to a spreadsheet. the particle counter also reported the size of every particle counted (cross - sectional area of each vessel at each slice) in voxels, which was recorded, and the distribution of sizes was characterised in decades (1, 2, 5, 10, 50, 100, 500, 1,000 and 5,000 voxels, corresponding to vessels of cross - sectional area of less than 20, then approximately 30, 50, 70, 150, 200, 500 and 1,000 m). the proportion of small vessels was then calculated as the number of vessels whose cross - section was two voxels or less, summed for all slices in the fracture region divided by the total number of vessels in that region. 3three - dimensional reconstruction of -ct of bone 6 weeks after fracture (medial view). pins were left in during scanning to preserve fracture morphology, resulting in artefacts at the level of the pins (gaps in the scan). a whole bone without vessels (the united fracture site can be seen mid - shaft, and the pin locations are indicated by dotted lines). b whole bone and vessels (the femoral artery is clearly seen running across the medial aspect of the central zone of the femur) three - dimensional reconstruction of -ct of bone 6 weeks after fracture (medial view). pins were left in during scanning to preserve fracture morphology, resulting in artefacts at the level of the pins (gaps in the scan). a whole bone without vessels (the united fracture site can be seen mid - shaft, and the pin locations are indicated by dotted lines). b whole bone and vessels (the femoral artery is clearly seen running across the medial aspect of the central zone of the femur) statistical analysis of the perfusion data was performed using one - way analysis of variance (anova) and also a multilevel (growth) model in spss (ibm spss statistics, version 20 2011, ibm corp. the growth model was used to analyse the raw perfusion measures from regional analysis considering the effects of time under a linear and quadratic model and using the corresponding measures in the intact leg (intact), cranial (cranial) and cranial intact and body temperature measures as covariates. anova was used to test for differences between the fractured side and intact side measures. vessel density (vessel count) and vessel size in the study (fractured) limb were compared to those in the contralateral (intact) limb for the same region and at the same time point using paired student s t tests with the bonferroni correction. one cannulation failed, preventing contrast infusion, and two animals scans were compromised by wound difficulties (although they were still available for analysis). one longer term animal developed respiratory distress and was killed 1 week early (at 5 weeks). therefore, 31 valid animals were micro - ct analysed at 2 days (n = 4), 4 days (n = 5), 6 days (1), 1 week (n = 5), 2 weeks (n = 6), 4 weeks (n = 5), 5 weeks (1) and 6 weeks (n = 4). all 6-week animals appeared successfully healed on radiographic projection (fig. 1). inter - operator repeatability studies of the laser doppler analysis gave a spearman s correlation coefficient of r = 0.88 for femoral artery regions and 0.83 for the cranial region. spearman s correlation coefficients for intra - operator repeatability were 0.96 and 0.94 for the femoral artery and cranial region, respectively. blood perfusion in the femoral artery (region 1) and the cranial region (region 3, which is adjacent to the fracture region) dropped immediately after operation, increased greatly from 4 days post - operatively to 2 weeks and then declined. the two other regions (2 and 4) showed similar trends to a lesser degree (fig. 4). the mean regional perfusion values over all animals also demonstrated this trend (fig. 4laser doppler scans at successive time points in a typical subject (above) and the corresponding plot of mean perfusion by zonesfig. 5perfusion (relative to pre - operative measures) in femoral artery region and cranial region (adjacent to fracture) ; pooled data for all animals and all time points laser doppler scans at successive time points in a typical subject (above) and the corresponding plot of mean perfusion by zones perfusion (relative to pre - operative measures) in femoral artery region and cranial region (adjacent to fracture) ; pooled data for all animals and all time points statistical analysis confirmed these observations ; multilevel statistical analysis showed that time after fracture significantly predicted perfusion in the femoral zone of the fractured leg, f(1,169.8) = 4.042, p = 0.046, and the corresponding measures on the intact limb also significantly predicted perfusion [f(1,181.7) = 8.83, p = 0.003 ]. the dependence on time was significantly better represented by the quadratic model than a linear growth model [(1) 9.858, p < 0.05 ], and inclusion of the intact measure was highly significant in improving the model [(5) 21.213, p < 0.001 ]. body temperature did not significantly predict perfusion [f(1,187.92) = 0.167, p = 0.664 ] nor was there significant interaction between time and the perfusion measures [f(1,137.6) = 1.165, p = 0.282 ]. anova demonstrated a highly significant difference between the femoral (fractured limb) perfusion measure and the intact side (f = 24.5, p < 0.001), with post hoc comparisons using the least - significant difference (lsd) technique indicating significant differences between pre - operative perfusion and post - fracture measures at days 214 : immediate post - fracture perfusion was highly significantly different (p < 0.001) from all time points except 35 days (p = 0.018 from pre - fracture perfusion). perfusion at day one was highly significantly different from post - fracture perfusion, but not from the pre - fracture measure (p = 0.109). micro - ct scans indicated no clear changes in spatial distribution of the vessels over time of healing, with an even distribution of vessel densities throughout the region surveyed. fractured limbs at all time points displayed highly significantly greater vessel densities (vessel number) than their contralateral intact limbs (p = 0.005, student s paired t test). the number of small vessels for each limb expressed as a fraction of the total number of vessels also showed a significantly greater proportion of smaller vessels on the fractured side (fig. this proportion also showed an increase from 2 days post - operatively to 14 days post - operatively, and then, the difference from the intact side diminished. 6small blood vessel fraction (number of vessels <3 voxels / total number of vessels) in the fractured limb and contralateral intact limb) (p = 0.021, student s paired t test) small blood vessel fraction (number of vessels <3 voxels / total number of vessels) in the fractured limb and contralateral intact limb) (p = 0.021, student s paired t test) this study is the first to use two - dimensional laser doppler scanning longitudinally throughout the healing period, to show an immediate post - operative decrease in perfusion adjacent to the fracture site, with a subsequent increase, especially throughout the first 2 weeks of healing. by combining this with micro - ct scanning, we have shown that this was achieved by an increase in the number and proportion of small vessels adjacent to the fracture zone. this elaborates the findings of matsumoto. who used laser doppler scanning of the whole hind limbs of mice to identify perfusion changes (post - fracture and 2 weeks later) and histology to measure vessel density. others have used single - point measures by laser doppler probe to impute perfusion in whole regions, also reporting increased perfusion after fracture [32, 50 ]. our laser doppler measurements confirm that neovascularisation begins soon (214 days) after fracture, particularly in the soft tissues surrounding the fracture (cranial region of interest in laser doppler scans). this indicates that neovascularisation of the tissue occurs in a spatially targeted region, not just through general limb perfusion, and is temporally organised to provide quick supply of nutrients and blood to the fracture site. the micro - ct vessel analyses indicate that this increased perfusion is achieved by more and finer vessels and not just by vasodilation of existing vessels. the vessel distributions around the fracture site (along the axis of the femur) were predominantly even and showed no consistent variation or trend towards one side of the fracture line or location. although the pins were placed in the blunt dissected surgical approach, it is not possible to exclude any vascular response to this or the cortical fixation of the pins. similar time trends were reported by melnyk., who also found increased perfusion shortly after fracture followed by a decline, in their study of perfusion in fracture healing with soft tissue damage, using a probe - based transcutaneous laser doppler flowmeter measuring single points at the fracture site and one centimetre distally and proximally. perfusion near the fracture site was only clearly greater than preoperatively at 3 and 7 days, and 14 days slightly greater. previous studies have shown similar trends in neovascularisation of soft tissue around the fracture callus, dating back to gothman s studies in the 1960s [912 ]. these studies established clinical practice for treatment of displaced fractures by underlining the benefit of soft tissue neovascularisation. however, neovascularisation analyses were limited to ex vivo assessment of 2d angiographs or histology, or single - point measures of perfusion. by combining laser doppler scanning and micro - ct analysis, we were able to provide 3d structural and 2d functional measurements of vascularisation, showing that neovascularisation occurred by angiogenesis (new vessel formation) and not only vasculogenesis (vasodilation of existing vessels). micro - ct scanning undecalcified bones enabled localisation of the vascularity with respect to the fracture gap, although segmentation and scan analysis were thereby made more difficult. our images indicate that angiogenesis (as evident by number of small vessels) was evenly distributed along the fractured bone length. our micro - ct results correlate with the findings of tomlinson., who also used microfil infiltration and micro - ct to identify vessels in osteogenic response to overloading. using anti - angiogenic treatment, they showed that angiogenesis was significant in the increased vascularity at 3 and 7 days after loading - induced stress fracture - related osteogenesis. the use of microfil to image vessels down to 10 microns was reported by marxen. and demonstrated by vasquez., working with similar 20 micron micro - ct resolution. neovascularisation of the soft tissues is critical as it provides a blood source for the healing fracture callus. in our current study, we were not able to visualise or quantify vessels directly within the fracture callus. the resolution and depth of penetration of the laser doppler scan were insufficient to quantify the angiogenic processes in the callus. though our micro - ct images most probably captured the intra - cortical vessels, the contrast between bone and vessels was insufficient to allow thresholding differentiation and segmentation. further work will use histology and decalcified bones to examine the vessel structure in the bone and fracture callus. though variations in perfusion were large between animals (large standard deviations in fig. 5), the temporal and spatial patterns of revascularisation were similar for all animals (statistical analysis, p < 0.05). large variation in blood perfusion measurements is not uncommon due to the numerous internal and external factors that influence perfusion. sample size at each time point was small (n = 5) but comparable to similar studies, and larger sample sizes would probably not change the overall trends seen. our preliminary data indicated that laser doppler scanning can detect flow through 5 mm of muscle tissue, and melnyk. report laser penetration of bone to 2 mm depth and skin / muscle to 6 mm. perfusion images are weighted projections of perfusion as a function of depth (i.e., deeper vessels appear to have less flow). a few animals suffered skin nicks during shaving, which resulted in extremely high perfusion values despite relatively small skin injury. the injury caused by surgery was all on the lateral side of the leg, and scanning was performed on the medial side, minimising the skin effects of the surgical site. reed has shown that revascularisation at early time points is critical for ensuring healing. in that rat model, that we have developed methods for functional and structural characterisation of neovascularisation, future work will examine methods for increasing vascularity of the soft tissue in these early time points. laser doppler scanning is a non - invasive in vivo measurement causing minimal distress to the animal which can be used for longitudinal studies of treatment effects and responses. micro - ct complements the functional measures provided with laser doppler with 3d structural information of the vessel network. further investigation using these modalities in fracture healing studies may enable correlation with other factors that promote the healing process. | vascularity of the soft tissues around a bone fracture is critical for successful healing, particularly when the vessels in the medullary canal are ruptured. the objective of this work was to use laser doppler and micro - computer tomography (micro - ct) scanning to characterise neovascularisation of the soft tissues surrounding the fracture during healing. thirty - two sprague dawley rats underwent mid - shaft osteotomy of the left femur, stabilised with a custom - designed external fixator. five animals were killed at each of 2, 4 days, 1, 2, 4 and 6 weeks post - operatively. femoral blood perfusion in the fractured and intact contralateral limbs was measured using laser doppler scanning pre- and post - operatively and throughout the healing period. at sacrifice, the common iliac artery was cannulated and infused with silicone contrast agent. micro - ct scans of the femur and adjacent soft tissues revealed vessel characteristics and distribution in relation to the fracture zone. blood perfusion dropped immediately after surgery and then recovered to greater than the pre - operative level by proliferation of small vessels around the fracture zone. multi - modal imaging allowed both longitudinal functional and detailed structural analysis of the neovascularisation process. |
consistent with estimates throughout developed countries, the australian survey of disability, ageing and carers estimates that ~3% of the population has an intellectual disability, and for one third of that group that disability arose in childhood. of this group who identify in the survey as having intellectual disability (or mental retardation) as a main disabling condition, ~50% are over the age of 15 years (i.e., 0.4% of the australian population), and this ratio is increasing [13 ]. as a result of the increased longevity of people with persisting neurological disabilities, more specifically, the health policies of government agencies now encourage annual comprehensive health checks by general practitioners and referral of adults with complex, or multiple, impairments associated with their intellectual disability, to specialist medical officers for consultations. in 2006, with the express purpose of reducing some of the known barriers to good specialist health care, a specific outpatient clinic for adults with intellectual disability was established within the department of rehabilitation medicine at concord hospital in sydney, australia. this paper reflects on the outcomes from this clinic firstly because of its novel status amongst adult rehabilitation medicine programs and secondly for the value of its data in planning for service development for this special population. the consultant in rehabilitation medicine in australia is a specialist physician with training in the assessment and management of the medical and functional status of people with disabilities. the assessment includes history taking and physical examination with respect to cognition, neuromotor activity, bladder function, bowel function, musculoskeletal function, organ illnesses, and behavior. the model of a multidisciplinary clinic with case conferencing is common in the rehabilitation medicine setting, for low incidence complex conditions. it provides the convenience for patients and carers to have access to a number of disciplines at one visit in comparison with attendance at multiple specialist appointments without coordination. it also allows for the convenience of discussion of benefits and disadvantages of management strategies within a multidisciplinary team at one time, in order to reach consensus on treatment recommendations. in this developmental disability clinic model, the patients are referred by their primary care general practitioners to specialist rehabilitation physicians and psychiatrists who conduct their own initial assessments, and then present the cases to a multidisciplinary conference team expanded to include a neurologist, geriatrician, and designated allied health professionals. these weekly case conferences are considered the keystone of the program, offering the regular opportunity for discussion and referral for further management. these case conferences may also be attended by the relevant carers and family members, and referring general practitioners are invited to participate by teleconference. allied health professionals (psychologists, speech pathologists, occupational therapists, physiotherapists, dietitians, social workers, and registered nurses) from the concord hospital rehabilitation services (or the local disability services for out - of - area patients) attend the case conferences and provide episodic clinical care when required. the aim of this observational study was to report on the demographic characteristics, functional disabilities, and complexity of illnesses of adults with intellectual disability who were referred by primary care clinicians in an identified region, to medical specialists in the outpatient hospital setting in australia. the research is a descriptive study based on an audit of information from a database setup in early 2006 with the approval of the concord hospital / sydney university research ethics committee. this developmental disability database accommodates de - identified information on all attendees of the developmental disability rehabilitation clinics at concord hospital, and on other adult in- and out - patients with intellectual disability seen individually by the consultants who participate in this clinic, at other sites throughout sydney (rehabilitation physicians, psychiatrists, neurologists, geriatricians, and some paediatricians). the data have been entered from the medical information recorded at the time of initial history taking and assessment. outcomes of investigations and treatments are entered as they are retrieved during the episode of care. the database currently contains information on over 1400 adults with intellectual disability seen between 2006 and 2011. subjects were included in this study if they had a diagnosis of intellectual disability and were aged 16 + years. so that the study subjects were representative of people who might be referred to this kind of clinic, subjects were only included if they lived within the four local government areas (lgas) regarded as those served by concord hospital (total population 180,000 in 2008). the suburbs that make up these 4 lgas are the catchment for the aged care assessment team that operates from the department of geriatric medicine of the hospital. these local government areas also constitute an administrative subset of the central sydney division of general practice and a subset of the government disability services. data from the electronic database were extracted as spreadsheet files that could be analysed directly for descriptive statistics or exported into spss version 18 for more detailed analysis. data concerning hospitalisations and follow - up clinician assessments were obtained from both the database records and hospital medical records systems. data were collected on age at initial assessment, known clinician determined cause for intellectual disability, living environment, functional dependence, level of intellectual disability, medications, epilepsy characteristics, neurological disabilities, other organ disorders, lifestyle behaviours, and mental status. note was made of challenging behaviours such as impulsive or compulsive behaviours if these activities were leading to self - injury or otherwise causing stress to carers. carer observation on general behaviour over the previous year was recorded as unchanged, fluctuating, deteriorating or much worse. completion of the adaptive behaviour in dementia questionnaire (abdq) by attending carers was also utilised occasionally by assessing clinicians to establish progress of deterioration. information was collected on reasons for hospital admissions, details of medical interventions (such as botulinum toxin injections), and the involvement of clinicians in the twelve months prior to initial assessment. data were also sought from the disability pension database and the nsw disability services database for pension and service recipient numbers of people living in the study region who identified as having intellectual disability. these data were used to estimate the proportion of people with intellectual disability living within the defined geographical area who were seen in the clinics. all subjects seen in the clinic have their functional status determined using the functional independence measure (fim) instrument. it is a standardised instrument whose development was initiated by a national taskforce in the usa in 1983 [11, 12 ]. the fim has 18 domains of care and a seven - level scale of support ranging from 7, independent, needing no assistance, through to 1, completely dependent, possibly needing two helpers. the 13 motor domains incorporate personal care, continence, transfers, and mobility, and there are 5 domains in the cognition group (comprehension, expression, problem solving, social interaction, and memory). a profile of scores across the domains is established for use in goal setting and review of progress. the fim total score (fimtot) has been demonstrated to correlate well with hours of care need in the community. for this study, a person with fimtot 100126 was recorded as needing intermittent support (mostly supervisory), fimtot 6099 as needing intensive support (supervision and assistance), and fimtot < 60 as needing pervasive support (continuous assistance). patients were included in the database if the carers nominated, or past files indicated, that they have had low intellectual functioning since childhood and they demonstrate the need for assistance from another person in communication, mobility, or self - care. when the physical examination was suggestive of an undiagnosed syndrome, and the families were agreeable, genetics testing was undertaken. the descriptor of the level of intellectual disability has usually been applied in childhood following testing in the school setting and been retained throughout adulthood in documentation. some people may have had cognitive neuropsychological testing in adulthood at the time of entry to employment services or accommodation support services (to establish eligibility). for many the level was an estimate made by caregivers. the descriptors follow the who conventions : mild refers to iq level approximating 5569, moderate refers to iq level approximating 4054, severe refers to iq level approximating 2539, and histories of past and current illnesses, and physical findings, were obtained from multiple sources including the subjects ' general practitioners, notes recorded in group home files, hospital medical records, or by inference from the medications, for example, hypothyroidism implied by prescription of thyroid hormone and diabetes implied by prescription of hypoglycaemics. data were also collected on whether specific management interventions were initiated as a result of the specialist clinic visits, for example, botulinum toxin injections for spasticity, percutaneous endoscopic gastrostomy feeding, behaviour management plans, epilepsy interventions, and psychotropic drug prescription. hospitalisations are recorded in the files of patients attending the clinics, and note is made in the database. however, in the search for all adults with intellectual disability who had accessed secondary health services in the region, an additional audit was conducted for this study. the regional inpatient statistical collection (isc) for january 2006 till december 2009, for the four public hospitals in the region, was interrogated for all separations (inpatient admissions) of adults (16 + yrs), living in the four lgas of interest, with a comorbidity code relating to intellectual disability : that is, f70 mild mental retardation, f71 moderate mental retardation, f72 severe mental retardation, f73 profound mental retardation, f78 other mental retardation, f79 unspecified mental retardation, or f84 pervasive developmental delay (retts, aspergers, autism). the full hospital records of these people were scrutinized to establish the correctness of the code. after excluding people whose medical records indicated a diagnosis of schizophrenia or dementia in any of these identified admissions, and confirming our inclusion criteria for the study, we established that 68 adults with intellectual disability had been admitted to hospital for day - only or overnight care in the period, all of whom were already known to clinic team members or have been followed up since that time. in 2009/2010, there were 333 people (aged 1664 yrs) with intellectual disability living in the four local government areas of interest in receipt of the disability pension and 295 people with intellectual disability in the same age group in receipt of disability services, giving an administrative prevalence for adults with intellectual disability in this region, of 19/10,000. this regional prevalence is lower than expected when compared with the national survey prevalence of ~4/10,000 (80,000 15 + yrs of 19.6 m total population in 2003) which would lead to an expectation of 720 adults. information was obtained on 162 adults seen between january 2006 and december 2010, who met the criteria for inclusion in this study, that is, 162 out of probable 350 adults in the region (when an estimate for those over 65 yrs is added). the age range was 1686 years at time of assessment, with a mean age of 44 years. chromosomal abnormalities were identified as a cause for the childhood brain damage in 18%, and 38% had a history of a catastrophic hypoxic perinatal event. forty - four per cent (44%) had no known cause for their intellectual disability. one third had mild intellectual disability and two thirds had moderate, severe, or profound intellectual disability. almost 90% of the patients in the study group were in receipt of some form of formal support. intermittent support (drop - in or case management) was provided for 31% who lived alone or with unpaid carers who provided advice and assistance with complex executive functions such as financial planning. twenty - three per cent (23%) needed the support of another person throughout the day for some activities of daily living. the other 46% of the group consisted of people who were extremely dependent, with fimtots less than 60, i.e., they were receiving nursing - home - type assistance 24 hours per day. the largest group were those people under the age of 45 years needing intensive - pervasive support. figure 2 demonstrates a pattern across the age groups for dependency, which is similar to that for level of intellectual disability, depicted in figure 1. table 2 shows the lifestyle risk factors, neurological disabilities, and medical comorbidities identified at initial assessments or diagnosed by the clinicians. there was a high prevalence of neurological dysfunction (epilepsy, spasticity, and behavioural disturbance) but low prevalence of chronic disease or illness. table 3 summarises the types of interventions that occurred as a result of the subjects being seen in the clinic. for twenty people (12%), the initial assessment and provision of advice to gps was the only involvement of the clinic practitioners. for the rest, there was a period of episodic management and followup by the relevant medical specialists, consultant nurses, or allied health professionals. in terms of lifestyle behaviours the group had very low levels of smoking, and no cases of illicit drug use or unsafe sex practices. thirty per cent of the group were overweight or obese, and 77% were categorized as inactive after questions were asked about their levels of daily activity. eighty people had challenging behaviour, specifically for which they had been referred to the clinic. fifty - six people (35%) were described as having some form of impulsive aggressive behaviour or compulsive self - injurious behavior. twenty - two (13%) had demonstrated fluctuating or deteriorating behaviours in the previous 12 months. fifteen per cent of the study group were referred, following case conference, for continuing review by the clinic psychiatrists and/or the local behaviour intervention team psychologists for special plans to assist care workers. the were 22 people described as having changing behaviour (i.e., fluctuating or declining over the previous 12 months). current criteria for the descriptor of dementia do not easily incorporate people with intellectual disability, and so decisions about dementia were based on the history of cognitive changes with behavioural manifestations. the adaptive behaviour in dementia questionnaire was used in interviewing carers about the changes in identified behaviours over the previous 12 months. possible dementia was diagnosed by the case conference team in 4 people and probable dementia in 7. of those 11, two people had down syndrome and one had fragile x ; all had onset of their dementia before the age of 60 years. carers of people with changing behaviour were offered assistance and advice in dealing with behavioural changes, and documentation was provided for five people who needed justification for more care hours in their existing accommodation environment or a shift to one in which more care could be provided. approximately 10% of the group with significant spasticity were seen beyond their initial clinic assessments, by the clinic rehabilitation physicians for medication management of their dystonia. the clinic physicians initiated investigations, referred to speech pathologists, and discussed with gastroenterologists when needed. advice was offered to carers on the day to day practices which should be initiated in people with swallowing difficulty. twenty - one people (21) had been in receipt of percutaneous endoscopic gastrostomy (peg) feeding prior to initial assessment by this clinic. about half of this group they continued with monitoring by their existing specialist gastroenterologists or were linked with new local practitioners. for a small number, the outcome of the clinic assessment, in relation to dysphagia, was referral to the local palliative care teams for ongoing management advice and conjoint care. vision disorders (33%) and hearing impairments (12%) were also common neurological disabilities. where relevant, nursing and allied health professionals in the clinic teams or local disability teams provided assessment and immediate management, and referrals were made to other linked specialist clinicians such as ophthalmologists when necessary. of the 162 people in the study, 89 had a history of epilepsy and 85 were taking anticonvulsant medications : all but 8 had childhood onset epilepsy. of the 85 people taking anti - convulsants for epilepsy, 32 had had no seizures since childhood or were well controlled on one or two medications. fifty three (32% of the study group) continued to experience monthly, weekly, or daily seizures. in accordance with the health policy operational for all residents of supported accommodation, all people taking more than one anticonvulsant were seen at least annually by a specialist neurologist and all had emergency epilepsy management plans. the study group was seen by one of four neurologists in two practice sites in the region. in two cases in the past two years prolonged admission adult onset epilepsy was a new finding in 8 people of the 11 in whom dementia was eventually diagnosed. prevalence of hypertension, coronary vessel illness, diabetes, chronic respiratory disorders, and osteoarthritis were low, although as is depicted in figure 3, the prevalence of diabetes, hypertension, and osteoarthritis did rise with age. consultant physicians reviewed the physical health, investigated where appropriate and suggested changes to a medication regimen when necessary. in general, few changes were suggested to existing medications for medical illnesses, and there were few in which new diagnoses were made. fifty per cent of the group were taking anticonvulsants, 20% antidepressants, and 26% antipsychotics as shown in table 4. a large proportion of the study group (47%) were taking more than one class of psychotropic medication. in the four - year period, from january 2006 to december 2009, 68 of the people in the study were noted to have been hospitalised (22 of 86 aged 1544 yrs, 20 of 50 aged 4564 yrs, and 26 of 26 aged 65 + yrs). there were 77 day - only admissions and 100 overnight stays, to any of the four hospitals in the region under study (one of which was a centre for mental health). table 5 summarises the separations (admissions and discharges) by age groups and demonstrates an average occupancy of 60 overnight bed days per year for the whole group in any hospital in the region. when accounting for the numbers in each age group, the incidence of overnight hospitalisation was highest in the older age group. there were four main reasons for admission to hospital for overnight care, described in table 6 : mental health, epilepsy, rehabilitation, and miscellaneous medical disorders. in the calendar year 2009, there were 6 transfers to the rehabilitation ward : for recuperation following medical events (2), back pain (2), fractured neck of femur (1) and spasticity management (1). this study extends our current knowledge of the health care needs of adults with intellectual disability by reviewing the health status of people referred by primary care practitioners to specialists in the hospital - based health system. the main findings of the study are that in this group the prevalence of significant dependency is high, the prevalence of neurological disability is high, the prevalence of chronic disease is low, although it does rise with age, and multiple specialist medical officers and other clinicians can be organized to provide coordinated care. although the study group is small, it does represent about 50% of the known adults living with intellectual disability in a region which has a well - organized and resourced health support system. in terms of the disability support system, this region did not have a large institution in devolution in its midst, and so it is not surprising that the prevalence of adults (0.18%) may be lower than the national average of 0.4%. it is well established that people with intellectual disability may be disadvantaged in promoting their own health because they are unable to take this responsibility themselves, and they are unable to convey their symptoms adequately to their carers. the individual difficulties are compounded by lack of time committed by health professionals to whom they are taken, the lack of responsiveness in the secondary health system that they may experience, and the inability of carers to adequately coordinate the multiplicity of specialists to whom they may need referral. by creating an outpatient clinic service that involves multiple interested specialist clinicians, encouraging both formal and informal carer attendance, and establishing protocols with colleagues in the investigation sectors of the hospital, a multidisciplinary - clinic - with - regular - case - conferencing model can overcome some of these known barriers to provision of high - quality care. guidelines for hospital - based specialty clinics for people with intellectual disability have been suggested, and the concord hospital clinic in the department of rehabilitation medicine meets all of these criteria for best practice. in the australian setting, the prescription of some psychotropic drugs by general practitioners is not subsidised by the government, and their prescription is restricted even amongst specialists to psychiatrists, neurologists, and rehabilitation physicians. a large proportion of the study group (47%) were taking more than one class of psychotropic medication a reflection of their complexity and need for specialist consultation. the clinic setting offers the opportunity for efficient prescription and consensus discussion of the advantages and disadvantages for the patients who may benefit from this group of medications among this group of specialists. time is considered an important monitor of the quality of care provided by the clinic. the findings of high levels of spasticity, epilepsy, and behavioural disturbance in this group are consistent with other national and international literature on clinic cohorts and accommodation support cohorts of adults with intellectual disability [1720 ]. the findings of age - related rises in prevalence of hypertension, arthritis, and diabetes mellitus in adults with intellectual disability, are also beginning to be highlighted in literature from developed countries [2124 ]. a level of inactivity of 60% in those who could be active (purposefully walking for 30 mins per day) is slightly higher than the figure for the general australian population. in our study, these people form the group who are overweight or obese and are being prescribed psychotropic medications. clinic staff have been active in the development of special health promotional material for clients and carers, and in the organization of healthy eating and being a healthy person education programs. although the numbers are small, our identification of early onset dementia in this group is consistent with recent studies on ageing in people with intellectual disability wherein it has been documented that people with down syndrome manifest their alzheimer 's disease at much younger ages than the general population. non - down 's patients may develop dementia at the same rate as the general population, or perhaps slightly earlier [26, 27 ]. care and advice for the carers of this group are similar to that for people without intellectual disability. about 50% of the study group had presented to an emergency department or been admitted to a hospital for overnight care in the past four years and their reasons for admission were numerous. their average length of stay for overnight care was similar to that of the general population for these aggregated groupings of rehabilitation, mental health, seizure / neurology, and miscellaneous medical. while it could be postulated that people with intellectual disability might need a longer stay in hospital for each admission because of diagnostic overshadowing or poor communication, it appears that this is not occurring in the few hospitalizations that have been documented in our region. it could be surmised that the existence of the special clinic and its in - built followup and liaison mechanisms may be assisting in maintaining their lengths of stay at the general population averages. the low bed day utilization figures per year are significant in that an identified ward for people with intellectual disability in a regional hospital would be impractical. it is therefore even more important that organised liaison is provided to ensure that communication at all levels is facilitated and high - quality care provided. almost all of the group in the study were residents of supported accommodation, provided either by government or nongovernment organisations. the intense accountability scrutiny under which the staff are put to implement health promoting policies ensures that in general : the residents are living in a healthy environment, they have protocols in place for the early identification of risk, their access to interested health practitioners is facilitated. although all the referrals to the clinic came from general practitioners (government convention), they were often initiated by care workers in supported accommodation organisations, and many were mandated by the national prescribing rules and state health policy. this is the group considered traditionally to be at greater risk of health care inequalities. it is possible that in our region they continue to be a group with significant problems that are not being addressed. it is possible also that they were being seen regularly by their general practitioners who did not feel their needs were of a level requiring specialist care, and so they would not be visible in our specialist clinic dataset. those who were not referred to specialist services appeared to be the younger group, and therefore possibly likely to be less complex we believe that our clinic may be addressing a previously unmet need in our region. this study concludes that the known prevalence of adults with intellectual disability in the community is quite low (~4 in 1,000 in australia and 19 in 10,000 in our region) ; approximately 50% of adults with intellectual disability in our community also have associated illnesses and multiple disabilities requiring specialist medical referral ; almost all of that group are very dependent, and living in formal care ; those who need specialist attention need multiple specialists ' attention ; chronic physical illness is more prevalent in the older subgroup of people referred to secondary services. as expected, the most common reasons for referral to specialist health services for advice and treatment are related to the neurological damage or delay experienced in childhood, that is, challenging behaviour, spasticity, dysphagia and epilepsy. system wide planning for increasing access of adults with intellectual disability to interested specialist clinicians should focus on continuing education and skill development in consultant physicians, nurses, and allied health professionals who have identified expertise in the management of epilepsy, movement disorders, neurological disability, challenging behavior, and ageing. this training and skill development may be facilitated in the setting of a multidisciplinary outpatient clinic at a regional level. | aims and method. the developmental disability database in the department of rehabilitation medicine at a metropolitan hospital was audited for observations on adults with intellectual disability living in the local region (total population 180,000) who were seen in an identified multidisciplinary specialist clinic, during 20062010. results. there were 162 people (representing half the known number of adults with intellectual disability living in the region) : 77 females, 85 males, age range 1686 years. the most common complex disabilities referred to the specialists in this clinic were epilepsy (52%), challenging or changing behavior (42%) and movement disorders (34%). early onset dementia was a feature of the group (7%). the prevalence of prescription of medications for gastro - oesophageal reflux was high (36%) and similar to the numbers of people taking psychotropic medications. the rates of chronic cardiovascular disease (2%), chronic respiratory disease (10%) and generalised arthritis (11%) were low overall, but did rise with increasing age. conclusions. complex neurological disabilities are common, and chronic medical illnesses are uncommon in adults with intellectual disability referred to specialist clinicians in this region. a combined, coordinated, multidisciplinary clinic model addresses some of the barriers experienced by adults with intellectual disability in the secondary health system. |
meningiomas account for approximately 30% of all primary intracranial tumors, and the majority are benign. the growth rate is variable in these tumors, and after radiographic diagnosis a large proportion of meningiomas frequently plateau in size and either stop growing or grow very slowly.1 asymptomatic solitary meningiomas are therefore typically managed with clinical and radiographic follow - up. the relationship between meningiomas and sex hormones is well known, and a growing number of reports have illustrated regression of meningiomas after hormonal withdrawal.2 3 4 regression after intratumoral hemorrhage has also been reported,5 whereas spontaneous regression is probably extremely rare.6 here, we report regression of a meningioma associated with 1-blocker treatment for benign prostatic hyperplasia (bph), a drug that has previously not been linked directly to regression of meningioma. the patient did not present with, or went through, intratumoral hemorrhage, which would explain the regression. a 59-year - old male patient had experienced slight memory problems and unspecific visual disturbances. the initial magnetic resonance imaging (mri) showed a lateral sphenoid wing meningioma on the right side with a maximum diameter of 43 mm, and the estimated tumor volume was 29.9 cm (fig. c). the tumor showed all typical characteristics of a meningioma including extra - axial location, contrast enhancement, and dural tail. the tumor was considered an incidental finding, the surgery was not recommended and the patient was followed with serial mri. the first control mri after 12 months demonstrated that the tumor was reduced by 50% to 14.8 cm (fig. the tumor had shrunken further to 10.0 cm (not shown). on the last mri after 37 months the tumor was reduced further to 6.7 cm, that is a reduction of 78% from the initial volume (fig. (a c) at diagnosis (october, 2010) showing a right - sided typical sphenoid wing meningioma with a maximum diameter of 43 mm and an estimated tumor volume of 29.9 cm. (d f) after 12 months (october, 2011), the tumor volume was reduced to 14.8 cm. (g i) after 37 months (november, 2013), the tumor volume was reduced further to 6.7 cm. the patient did not receive any steroid medication before or during the follow - up. he had not been treated for any malignant disease. during the follow - up, however, the patient was treated with an 1-adrenoceptor antagonist (tamsulosin) for bph. data regarding the natural history of untreated meningiomas have been published in several studies, but evidence - based guidelines for treatment of patients with small meningiomas are still lacking. in patients selected for observation, sughrue found that 51% of untreated meningiomas < 2.5 cm in largest diameter demonstrate no growth over a follow - up period of 4.6 years, and that an additional 26% grew < 10% per year.7 since most meningiomas are benign tumors, the principal reason to treat meningiomas is to relieve symptoms related to tumor compression of surrounding neurological structures, or to arrest growth in small asymptomatic tumors documented to be growing on serial imaging. the fact that intracranial meningiomas arise in women at 2 to 3 times the incidence for men, along with modulation of meningioma biology during pregnancy, suggests a plausible link. hormone receptor analyses have revealed that, unlike breast cancer, meningiomas are commonly strongly progesterone receptor - positive, but only rarely and weakly estrogen receptor - positive.8 progesterone receptors are expressed predominantly in benign meningiomas with low proliferation indices.9 whereas progesterone - agonist treatment may promote growth in meningiomas,10 11 treatment with the antiprogesterone receptor agent mifepristone may induce regression.12 13 14 it has been suggested that multiple meningiomas possess more hormonal dependency than an isolated meningioma since there is a higher female preponderance (sex ratio 8.8/1 in multiple meningiomas vs. 23/1 in solitary meningiomas). regression of multiple tumors has been observed after cessation of long - term progesterone agonist therapy.4 regression of a meningioma has been reported in an 80-year - old male patient with bph following change of medication from chlormadinone acetate (a progestin steroid with an antiandrogen and antigonadotropic effect) to naftopidil (1-adrenoceptor antagonist).2 the cessation of the progesterone agonist was interpreted as the explanation for the effect on tumor, but in light of the present case report, we propose that the observed regression could as well be due to the introduced 1-blocker or a combination of the two drugs. the 1-receptor is a mediator of contraction in smooth muscles, and can be found in skin, sphincters, gastrointestinal tract, nerves, and brain. a possible explanation for an induced regression of meningioma by 1-blockade could be decreased effect of receptor activation that maintains growth and sustains the size of the tumor.15 16 whether meningiomas express adrenoceptors, however, has not been extensively investigated. the first logical step would therefore be to perform receptor analysis to investigate whether meningiomas express adrenoceptors to any extent or other receptors that may represent targets for designed drug therapy. biopsies from all patients operated for meningiomas at our hospital are stored and are available for later investigations. some recent studies show that the 1-adrenoceptor antagonist naftopidil induces apoptosis in malignant mesothelioma cells by activating caspase-8 in association with upregulated tumor necrosis factor- and increased fasl secretion followed by the effector caspase-3.17 studies of 1-adrenoceptor blockade and tumor treatment have mainly been done on prostate cancer, renal cell tumors, malignant pleural mesothelioma, and bladder tumors.18 19 due to the high incidence of meningiomas and the large proportion of small tumors that do not grow, a relatively large group of patients are currently followed for incidental meningiomas without treatment. the encouraging observation in our patient warrants further appropriate evaluation of 1-adrenoceptor blockade in a prospective trial with accurate volumetric assessment in a preselected population with incidental meningiomas. men above the age of 60 would for natural reasons be good candidates, but since 1-blockers have a low adverse effect profile a study group should not necessarily be that restricted. we are able to match our national drug registry with the cancer registry and thereby identify eligible patients. this report of regression of an asymptomatic meningioma associated with 1-antagonist treatment is a reminder that treatment of incidental meningiomas must be based on thorough consideration of the patients medication history, especially in elderly men undergoing endocrine therapy for prostate disease and women treated for uterine cancer. whereas surgery and occasionally radiation therapy are standard treatment for solitary meningiomas, these treatment modalities are not suitable for meningomatosis. the prospect of medical treatment is furthermore tempting in multiple meningiomas and recurrent disease, since surgery and radiation often are insufficient. although approximately 50% of incidentally diagnosed meningiomas do not grow, genuine spontaneous regression is extremely rare. however, a few cases of regression after progestative hormonal treatment withdrawal have been reported. furthermore, regression of a meningioma has been reported in a male after changing the medication for bph from progesterone agonist therapy to 1-blocker. we here report regression of a meningioma to 22% of the initial volume after 3 years during treatment with 1-adrenoceptor antagonist, indicating an association between the adrenoceptor blocking and the observed regression of the meningioma. after the last mri (3-years follow - up), 1-blocker treatment was discontinued. if the meningioma should regrow, we have to consider putting the patient back on 1-adrenoceptor blocker or should we alternatively operate the tumor to study its receptor expression ? | background regression of meningioma has been reported after hemorrhage or hormonal withdrawal. here, we report a case of an incidentally diagnosed meningioma that regressed in association with 1-adrenoceptor antagonist. case report a 59-year old male patient with an incidentally diagnosed lateral sphenoid wing meningioma was followed with serial magnetic resonance imaging. the tumor with a maximum diameter of 43 mm showed progressive regression, and after 3 years the size was reduced to 22% of the initial volume. during follow - up the patient was treated with an 1-adrenoceptor antagonist (tamsulosin) for benign prostatic hyperplasia. possible mechanisms are discussed, including our main hypothesis of reduced mitogenic effects through phospholipase c - signal transduction. conclusion this is the first report of regression of an incidentally diagnosed meningioma associated with 1-adrenoceptor antagonist treatment. |
the female genital and urinary tracts are anatomically closely related ; therefore, the potential for injury to one must always be considered when operating on the other. owing to improvements in gynecological and obstetric techniques that help to prevent urinary tract injury and an emphasis on immediate recognition and repair should any injury occur, long - term complications are less frequent nowadays. the risk of damage increases when the normal anatomy is altered by primary pathologic factors or when it is insufficiently identified during intraoperative complications, such as severe bleeding or pelvic adhesions. urinary tract injury complicates an estimated 0.2 to 1% of all gynecologic procedures and pelvic operations. however, if cases of indeterminate origin are included, it can be estimated that many more cases of urinary tract injury occur during pelvic surgery. the true incidence is difficult to ascertain from the literature because most studies review only patients who became symptomatic and required urologic intervention. eighty - two percent of ureter injuries occur during pelvic surgery, and 75% of urinary tract injuries are due to gynecologic surgery. urinary tract injuries due to obstetric and gynecologic surgery are normally divided into two categories : acute complications such as bladder laceration or ureter laceration that can be identified immediately during the operation, and chronic complications such as vesicovaginal fistula, ureterovaginal fistula, and ureter stricture, which can occur later on. to avoid injury to the urinary tract, the gynecologist must have an accurate understanding of pelvic anatomy, use a meticulous and methodical surgical technique, and maintain a constant high degree of vigilance. in the case of ureter injury, early detection and treatment can prevent the deterioration of renal function and bring about a satisfactory prognosis, but nonsurgical treatment is the recommended first - line method in iatrogenic ureteral injuries with delayed diagnosis. increasingly, complex, minimally invasive endoscopic procedures are being carried out by urologists to treat pyelo - ureteric disorders. this study was performed to investigate the clinical features of urologic complications such as iatrogenic ureter, bladder, and kidney injuries following obstetric and gynecologic surgery and to help to prevent future occurrences of urinary tract injury. all patients who underwent obstetric and gynecologic surgeries in the pelvic cavity from 2007 through 2011 at cheil general hospital were analyzed. ninety - seven of these patients developed urological complications and were enrolled in this study (table 1). all patients had a detailed history taken and a clinical examination performed. through retrospective review, we researched the site of injury, etiologic characteristics of the injury, etiologic disease of obstetric and gynecologic surgery, and therapeutic success rate with respect to time of diagnosis and treatment of complications. urological complications were defined as laceration, transection, rupture, or ligation of the genitourinary tract found during surgery or as hydronephrosis and leakage of contrast media out of the urinary tract found after surgery that required interventional or surgical treatment. patients were followed up in the outpatient clinic at 1, 3, and 6 months with complete urinalyses and urine cultures at each visit. the most common type of urinary tract injury was bladder injury, including bladder laceration and vesicovaginal fistula. of the 97 patients, 69 (71.8%) had bladder injury, 23 (23.9%) had ureteral injury, 2 (2.1%) had vesico - vaginal fistula, 2 (2.1%) had uretero - vaginal fistula, and 1 (1.0%) had renal injury (table 1). of the 23 cases with ureteral injury, 10 had lacerations, 7 had transections, and 6 had ligation. the right and left ureters were injured with similar frequency, and no patients had bilateral injury. laparoscopic - assisted radical vaginal hysterectomy had the highest rate of injury, with 3 (3.06%) of 98 cases. the incidence of urinary tract injury in relation to the type of surgery was 2.78% for radical abdominal hysterectomy, 0.47% for laparoscopic - assisted vaginal hysterectomy, 0.41% for vaginal hysterectomy, 0.38% for total abdominal hysterectomy, and 0.08% for cesarean section (table 1). the indications for pelvic surgery in the bladder injury patients were uterine myoma (35 cases), cesarean section (15 cases), adenomyosis (7 cases), and cervical cancer (3 cases). the gynecological and obstetric diseases requiring surgery that were responsible for ureteral injuries were cervical cancer (8 cases), uterine myoma (6 cases), endometrial cancer (3 cases), and endometriosis, uterine myoma, and ovarian cancer (2 cases each). vesicovaginal fistula resulted from treatment of ovarian cancer and uterine myoma in one patient each. ureterovaginal fistula resulted from treatment of one case each of uterine myoma and uterine prolapse. one case of renal injury resulted from treatment of endometrial cancer (table 2). all 69 cases of bladder injury underwent combined transabdominal and transvaginal primary repair during surgery with a 100% success rate. every patient received a urethral catheter, which was left indwelling for at least 10 to 14 days. seven of these had a ureteral catheter inserted, five underwent ureteroureterostomy, and two cases had ureteroneocystostomy performed with no major complications. of the remaining nine cases with delayed diagnosis of ureteral injury, ureteral catheter insertion was carried out in three cases, ureteroureterostomy in four cases, and ureteroneocystostomy in two cases. the success rate of ureteroureterostomy in the delayed diagnosis group was 50% (two of four cases). however, in the two cases with a failed initial ureteroureterostomy, one underwent ureteroneocystostomy and the other underwent ureteral balloon dilatation and the ureteral injury was successfully repaired in both. in the two cases in which ureteroneocystostomy was performed as a primary intervention, the success rate was 100%. all four cases of vesicovaginal fistula and ureterovaginal fistula were cured after trans - vaginal primary suturing and ureteroureterostomy following percutaneous nephrostomy (table 3). in the case of ureterovaginal fistula, ureteral catheter insertion and percutaneous nephrostomy were initially performed, followed by ureteroureterostomy after a set period to complete the repair. its incidence is reported to be from 0.5 to 1.5%, and bladder injury is more common than ureter injury. most bladder injuries, but only one third of all ureter injuries, are identified during surgery. it has been reported that intraoperative cystoscopy reduces the occult ureter injury rate. the detection rate of ureter injury is 1.6 in 1,000 without cystoscopy, and 6.2 in 1,000 with cystoscopy, which implies that occult injury occurs more often than expected. in our study, if it were possible to follow up all patients for an extended period of time, the actual incidence of urinary tract injury would certainly be higher. of the observed urinary tract injuries, 80% involved bladder laceration, and 74% of all cases of fistula involved vesicovaginal fistula. this suggests that the bladder is the most common site of urinary tract injury during pelvic surgery. the observed high incidence of bladder injury may be due to the fact that such injuries are easier to detect than injuries occurring at other sites. the most common indication for pelvic surgery was leiomyoma of the uterus, and the most common type of surgery was transabdominal hysterectomy. although urinary tract injury was most commonly associated with transabdominal hysterectomy, its rate of complication was 0.28%, which is not much higher than the rate for other pelvic procedures. radical hysterectomy was associated with a 0.74% incidence of fistula formation, which was the highest among all types of pelvic surgery. this may be due not only to the fact that wide dissection was performed during surgery, but also that its main indication was gynecologic cancer, which can cause pelvic adhesion and changes in normal pelvic configuration. this can be explained by the fact that it is hard to dissect the bladder with adhesions. the incidence of urinary tract injury during obstetric and gynecologic surgery could depend on the experience of the surgeon. surprisingly, we found that experience of the surgeon, or lack thereof, did not correlate with the rate of urinary tract complications. intravenous pyelography prior to the operation was used to reduce the risk of urologic complications. however, performing intravenous pyelography in all patients is not cost - effective. in selected cases, preoperative stent insertion was recommended when patients had a history of previous pelvic surgery or there was a strong suspicion of pelvic adhesion. this makes the identification of the ureter easier and makes it less prone to injury. the most common sites of ureteral injury during hysterectomy are along the pelvic wall lateral to the uterine artery, the area of ureterovesical junction, and the base of infundibulopelvic ligament. this procedure requires special attention during dissection. in cases of gynecologic surgery with severe pelvic adhesion, methylene blue injection or intraoperative cystoscopy when there is any suspicion of urinary tract injury, this procedure is very useful for preventing and identifying it. the timing of repair of ureteric injuries is somewhat controversial, with some urologists advocating immediate repair whereas others favor delayed repair. it has been argued that recognition and repair of injury at the time of urinary tract injury or within a week of the injury allows for better results with fewer complications. intraoperatively recognized injuries are usually more easily repaired at the time without the need for a second surgical intervention. however, we found that postoperative diagnosis of ureteral injury and delayed repair had its own merits. in this situation, surgeons were able to find the borders of viable tissues more readily and were able to avoid unnecessary excision. as a result, the urinary tract - vaginal fistula, which was the most common complication detected after pelvic surgery, originates as the result of urine leakage from the vagina and was sometimes accompanied by fever, flank pain, and chills. our findings in this study were similar to those of others who reported that the duration from operation to appearance of symptoms was from 3 to 33 days. in the cases of fistula that we treated, repair was performed and stent insertion was also included when the fistula was accompanied by ureter stricture. the variety of injured states, difficulty of diagnosis, and time to complete cure were much greater among patients with ureteral injury. when a urologic complication develops, early diagnosis and early urologic intervention are necessary to prevent the occurrence of delayed urologic complications. | purposeurologic injuries occur frequently during surgery in the pelvic cavity. inadequate diagnosis and treatment may lead to severe complications and side effects. this investigation examined the clinical features of urologic complications following obstetric and gynecologic surgery.materials and methodswe accumulated 47,318 obstetric and gynecologic surgery cases from 2007 to 2011. ninety - seven patients with urological complications were enrolled. this study assessed the causative disease and surgical approach, type, and treatment method of the urologic injury.resultsof these 97 patients, 69 had bladder injury, 23 had ureteral injury, 2 had vesicovaginal fistula, 2 had ureterovaginal fistula, and 1 had renal injury. with respect to injury rate by specific surgery, laparoscopic - assisted radical vaginal hysterectomy was the highest with 3 of 98 cases, followed by radical abdominal hysterectomy with 15 of 539 cases. all 69 cases of bladder injury underwent primary suturing during surgery without complications. of 14 cases with an early diagnosis of ureteral injury, 7 had a ureteral catheter inserted, 5 underwent ureteroureterostomy, and 2 underwent ureteroneocystostomy. of nine cases with a delayed diagnosis of ureteral injury, ureteral catheter insertion was carried out in three cases, four cases underwent ureteroureterostomy, and two cases underwent ureteroneocystostomy.conclusionsbladder injury was the most common urological injury during obstetric and gynecologic surgery, followed by ureteral injury. the variety of injured states, difficulty of diagnosis, and time to complete cure were much greater among patients with ureteral injuries. early diagnosis and urologic intervention is important for better outcomes. |
sorcin (soluble resistance - related calcium binding protein) is a 21.6 kda protein identified in the cytosol of multidrug resistant cells that belongs to the penta - ef - hand (pef) family, a small group of regulatory calcium binding proteins comprising calpain, alg-2, grancalcin, peflin and pef1 [38 ]. it has a two - domain architecture, characterized by a flexible and hydrophobic gly / pro - rich n - terminal domain and a c - terminal calcium binding domain containing the five ef - hand motifs (fig. 1), and dimerizes through the unpaired ef5 hand. like the other pef proteins, sorcin undergoes a ca - dependent activation that promotes translocation to membranes where interaction with several molecular targets occurs. in turn, these features render sorcin an effective participant in a number of ca - mediated processes. sorcin activation is induced by ca binding to the two functionally relevant ef3 and ef2 motifs, that are not paired structurally as in most ef - hand proteins, but are connected by the long and rigid d helix (fig. 1). an essential step of sorcin activation therefore consists in the transfer of information concerning ca binding from the site with the highest affinity for the metal, ef3, through the d helix to ef2, and from there to the rest of the molecule. the ensuing conformational change is believed to loosen the hydrophobic and hydrophilic interactions that bring the n- and c - terminal domains together. this renders both domains available for target protein recognition, in particular the d helix residues. it follows that the ef3-d helix - ef2 region should be considered as a tightly coupled functional unit. sorcin is expressed in most human tissues including the heart where ca - bound sorcin interacts with and regulates several ionic channels, such as the l - type voltage - dependent channel, the ryanodine receptor, ryr2, and the sarcoplasmic reticulum ca - atpase, serca2a, and thus plays an important role in the regulation of the excitation discordant effects of sorcin overexpression on cardiac function have been reported. according to seidler. cardiac - specific overexpression of sorcin in rabbit myocytes and transgenic mice leads to a significant reduction in contractility, while suarez. and frank. reported that transfection of rat or mouse heart or isolated cardiac cells with sorcin - expressing vectors significantly enhanced cardiac function. the overexpression of sorcin in cardiomyocytes has also been associated with increased activity of the na ca exchanger, ncx. the mammalian ncx family includes three genes (ncx1, ncx2 and ncx3) with very similar functional properties. ncx1, the main isoform expressed in the heart, catalyzes the electrogenic exchange of ca and na across the plasma membrane in both the ca influx and ca efflux mode and is one of the crucial regulators of ca homeostasis within cardiomyocytes and of cardiac contractility. ncx1 consists of nine transmembrane helices with an extracellular n - terminus and a cytosolic c - terminus that is organized in four domains. there are two adjacent homologous ca - binding domains, cbd1 and cbd2, arranged in an antiparallel fashion, that are connected via a regulatory catenin - like domain (cld) to the membrane part of the exchanger (fig. 2). a rise in cytosolic na stimulates rapidly and then inactivates the exchanger ; in contrast, cytosolic ca activates the exchanger and relieves the na - dependent inactivation [2528 ]. regulation by cytosolic na and ca involves sites that do not participate directly in the ion translocation process. thus, an amphipathic sequence, the xip region (exchanger inhibitory peptide), takes part in regulation by na, whereas cbd1 and cbd2 are responsible for the ca - dependent activation of the exchanger. both cbd1 and cbd2 have an ig - like fold with the ca - binding sites in the distal loops. they contain also an unstructured loop, the fg loop, which in cbd2 is characterized by the presence of a tissue - specific, alternatively spliced region (fig. 2). despite the structural similarity, cbd1 binds four ca with high affinity (kd = 0.3 m), whereas cbd2 binds only two metal ions with lower affinity (kd = 5 m). in cbd1, the four ca ions are brought into close proximity by a complex arrangement of the coordinating residues. thus, aspartate and glutamate carboxylate oxygens provide bidentate ligands that coordinate two (asp500) or three (glu451) ca simultaneously. in cbd2, the two ca - binding sites are only 5.4 apart, such that the two metal ions are coordinated by two carboxylate oxygens of a single aspartate side chain (asp578). mutations of acidic ca - binding amino acid residues in cbd1 decrease affinity for ca, as expected, but do not eliminate ca - dependent regulation. in contrast, mutations e516l, d578v and e648l in the cbd2 ca - binding sites completely remove ca regulation, placing the exchanger in a constitutionally active state. in accord with these observations, the alternatively spliced ncx1 kidney isoform with an arginine at position 578 and the brain isoform carrying a d578r mutation are not regulated by ca. taken together these data point to cbd1 and cbd2 as major determinants of the ncx1 functional regulation. several experimental data point to an effect of sorcin on ncx function in the heart, indicative of a possible direct interaction between the two proteins. in particular, ncx activity is increased in sorcin - overexpressing cardiomyocytes, while a low ncx activity has been observed in a rabbit model of left ventricular dysfunction (lvd) with a reduced sorcin expression level. in the present work, the study of the sorcin - ncx1 system was investigated by parallel experiments on the isolated components and on cardiomyocytes. overlay assay and surface plasmon resonance (spr) experiments allowed us to establish the occurrence of a direct interaction between sorcin and the two ncx1 calcium binding domains and to characterize its kinetic and equilibrium parameters, while measurements of the ncx current in cardiomyocytes as a function of voltage furnished information on the functional effect of the interaction. further, the surface of the sorcin molecule involved in complex formation was determined by means of previously characterized sorcin variants carrying mutations at sites involved in ca binding or information transfer. the effects of the mutations on the interaction parameters were assessed in surface plasmon resonance experiments, while those on function were determined by means of ncx current measurements. specifically, the c - terminal, sorcin ca - binding domain (scbd) was employed to establish whether this domain is the interacting one ; the e124a mutant was used to gain information on the ca - dependence of the interaction since this variant is unable to bind ca at physiological concentrations due to substitution of the bidentate ca ligand at the ef3 hand ; the w99 g and w105 g variants were utilized as selective probes of the local structural perturbations introduced by substitution of the two tryptophan residues located at the beginning and end of the d helix. the results obtained point to the ca - dependent interaction between sorcin and ncx1 as the basis for the activation of the transporter. in sorcin, the interacting surface can be mapped on the ca - binding c - terminal domain in the region of the d helix comprising w99. in ncx1, intriguingly, the rates of complex formation / dissociation are fast and could permit a beat - to - beat interaction. wild type human and chinese hamster sorcin, scbd (sorcin calcium binding domain) and sorcin mutants were cloned, expressed and purified as described previously. the cdna of mus musculus ncx1 (cdna clone mgc:90693 image:30532156) was used as template in pcr experiments in order to clone the nucleotide regions 11921619, encoding for cbd1 (calcium binding domain 1), corresponding to amino acids 397539, and 15812137, encoding for cbd2 (calcium binding domain 2), corresponding to amino acids 527712. the pcr products, digested with ndei and hindiii restriction enzymes, were cloned in the pet22 vector. protein expression was induced by 1 mm iptg for 5 h at 37 c. after sonication (1 min at 14 hz / ml cell solution), the lysates were centrifuged at 15,000 rpm for 20 min : cbd1 was recovered in the supernatant, whereas cbd2 remained in the insoluble fraction. cbd1 purification was carried out by 30% (w / v) ammonium sulphate precipitation at room temperature for 1 h, while cbd2 purification required protein extraction by treatment with 0.3% n - lauryl - sarcosine in 50 mm caps buffer ph 11.0. an anion exchanger column mono - q (ge healthcare) was used to improve purification of both ncx1 domains. hcl buffer at ph 7.5, were loaded onto the column and were recovered upon application of a linear gradient of nacl between 0 and 0.5 m. based on sds page electrophoresis, the degree of enrichment was 80% for cbd1 and 70% for cbd2. in the spr experiments the concentration of cbd1 and cbd2 was calculated from the intensity of the respective bands in sds gels (supplementary fig. wt sorcin and scbd were subjected to electrophoresis on a 15% polyacrylamide gel under denaturing conditions and transferred to polyvinyl difluoride membranes (pvdf) in transfer buffer [25 mm tris hcl, 192 mm glycine, and 20% methanol (ph 8.3) ] at 100 ma for 45 min. the pvdf membranes were incubated at room temperature separately with cbd1 and cbd2 (20 g / ml) in 1% gelatin in tbst buffer [20 mm tris hcl, 0.5 m nacl, and 0.05% tween 20 (ph 7.5) ] containing either 50 m cacl2 (total concentration) or 1 mm egta to assess the calcium dependence of the interaction. subsequently, the membranes were incubated in 1% gelatin in tbst buffer with a mouse anti - ncx1 monoclonal antibody (antigen : purified canine cardiac ncx ; biocompare). the antibody was used at 1:3000 dilution, a condition where it recognizes equally well cbd1 and cbd2 and does not recognize other proteins like albumin and gelatin, as established in preliminary experiments. the blots were developed by incubation for 45 min with alkaline phosphatase conjugated monoclonal anti - mouse igg in 1% gelatin in tbst. control experiments ruled out the existence of cross reactivity between sorcin or scbd and the anti - ncx monoclonal antibody. surface plasmon resonance (spr) experiments were carried out using a biacore x system (biacore ab, uppsala, sweden). the sensor chip (cm5, biacore ab) was activated chemically by a 35 l injection of a 1:1 mixture of n - ethyl - n-(3-(dimethylaminopropyl) carbodiimide (200 mm) and n - hydroxysuccinimide (50 mm) at a flow rate of 5 l / min. in one set of experiments, the reaction was carried out in 20 mm sodium acetate at ph 6.0 ; the remaining ester groups were blocked by injecting 1 m ethanolamine hydrochloride (35 l). this procedure ensures immobilization of sorcin principally via the n - terminus. as a control, the interaction of immobilized sorcin with the cbd1 and cbd2 domains of ncx1 was detected through mass concentration - dependent changes in the refractive index on the sensor chip surface expressed as resonance units (ru). the increase in ru relative to baseline indicates complex formation ; the plateau region represents the steady - state phase of the interaction, whereas the decrease in ru represents dissociation of the ncx1 calcium binding domains from immobilized sorcin after injection of buffer. a response change of 1000 ru typically corresponds to a change in the protein concentration on the sensor chip of 1 ng / mm. the experiments were carried out at 25 c in 10 mm hepes (ph 7.4), 150 mm nacl, and 0.005% surfactant p-20. the concentration of cbd1 and cbd2 ranged between 500 nm and 22 m at a constant calcium concentration. in a second set of experiments, cbd1 was immobilized on the activated cm5 chip at ph 4.5 using the procedure described above. the interaction with wt sorcin or sorcin mutants (e124a, w99 g, w105 g and scbd) at a concentration of 1 m was measured in the presence of 20 and 50 m ca. scatchard analysis of the dependence of the spr signal at steady state (req) on the concentration of cbd1 and cbd2 was performed to determine the equilibrium dissociation constant. the amine coupling kit, the p-20 surfactant, and the cm-5 sensor chip were purchased from biacore ab and all the other reagents were high - purity grade. negative controls for the spr experiments were obtained by transformation of e. coli bl21(de3) with pet22, induction with 1 mm iptg for 5 h at 37 c, and subsequent sonication and centrifugation ; the supernatants were treated as for the cbd1 and cbd2 preparations, but the last purification step by anion exchanger chromatography was omitted (supplementary fig. procedures were undertaken in accordance with the united kingdom animals (scientific procedures) act 1986 and conform to the guide for the care and use of laboratory animals published by the us national institutes of health (nih publication no. new zealand white male rabbits were given an intravenous injection of 500 u heparin together with an overdose of sodium pentobarbitone (100 mg / kg) and their hearts were removed. isolated hearts were perfused retrogradely (25 ml min, 37 c) with a nominally ca - free krebs henseleit solution containing 0.6 mg ml collagenase (type 1, worthington chemical co) and 0.1 mg ml protease (type xiv, sigma chemical co) for 68 min. after isolation of the left ventricular free wall, the epicardial layers of the free wall were isolated from the remaining tissue by dissecting a 11.5 mm layer from the epicardial surface. the layers of tissue were incubated separately for 5 min in enzyme solution containing 80 mol / l cacl2 and 4% bovine serum albumin (bsa, fraction v, sigma). isolated cardiomyocytes were superfused with a hepes - based tyrode 's solution at 3637 c in a chamber mounted on the stage of an inverted microscope. voltage clamp was achieved a using an axoclamp 2a amplifier (axon instruments, foster city, ca, usa) in discontinuous (switch clamp) mode. pipette resistance was 12 m. the tyrode 's solution superfusing isolated cells contained (mmol / l) : nacl (140), kcl (4), hepes (5), mgcl2 (1), cacl2 (1.8), and glucose (11.1), ph 7.4 with naoh. the perfusate also contained strophanthidin (0.01 mmol / l) and nifedipine (0.01 mmol / l, to block k currents) and niflumic acid (0.1 mmol / l, to block ca - activated cl currents. the pipette solution contained (mmol / l) : cscl (45), egta / caegta (cs 100, egta 50, ca 25), hepes (20), mgcl2 (11, calculated free mg 1.2 this pipette solution was designed to buffer [ca]i to 250 nmol / l (confirmed by separate [ca ] measurements). after achieving the whole - cell configuration, a period of 510 min was allowed for dialysis of the pipette solution into the cell. currents were then measured in response to a 3 s ramp from 120 mv to + 80 mv from the holding potential of 80 mv. an ascending ramp was chosen since this has been shown to cause less perturbation of sub - sarcolemmal [ca ] than a descending ramp, and the resulting currents are closer to those obtained using a voltage step protocol. the ramp protocol was performed at 0.1 hz, when steady - state currents were achieved ; data from 12 ramps were recorded for subsequent averaging. the protocol was repeated in the presence of 5 mmol / l ni to obtain the background current, and this was subtracted to obtain the current attributable to ncx (see fig. sorcin or the mutant proteins were added to the intracellular pipette solution for dialysis into the cell at a concentration of 3 m using a protocol similar to previous work, designed to supplement endogenous intracellular sorcin by comparable amounts of exogenous protein. allowing sorcin to dialyse into the cell for 10 to 20 min had no additional effects (data not shown). preliminary experiments using 1 m sorcin had no significant effect on the ncx current (see supplementary fig. as previously described, a partial rabbit sorcin sequence was amplified using primers based on the known human sorcin sequence by reverse transcription of rna from a chinchilla bastard rabbit. sense and antisense oligonucleotides were chosen to target the 19 nucleotide segment complementary to the rabbit sorcin mrna sequence gcaagaucaccuucgauga and ligated downstream of a u6 promoter into vector psiren - dnr (bd biosciences clontec, palo alto, usa). six different sirna sequences were cloned into psiren and verified for their effectiveness in a rabbit tumor cell line vx2. recombination with the remaining adenoviral genome using padeno - x vector was carried out according to the manufacturer 's instructions (bd adeno - x expression system, bd, biosciences clontech, palo alto, usa). infection of adult ventricular cardiomyocytes with the adrnai virus (100 moi) resulted in downregulation of native sorcin expression to 27 7% of control value after 36 h of quiescent culture. example blots demonstrating of downregulation of sorcin rna and protein are shown in the online supplement (supplementary fig. | sorcin is a penta - ef - hand protein that interacts with intracellular target proteins after ca2 + binding. the sarcolemmal na+/ca2 + exchanger (ncx1) may be an important sorcin target in cardiac muscle. in this study, rnai knockdown of sorcin, purified sorcin or sorcin variants was employed in parallel measurements of : (i) ncx activity in isolated rabbit cardiomyocytes using electrophysiological techniques and (ii) sorcin binding to the ncx1 calcium binding domains (cbd1 and (iii) using surface plasmon resonance and gel overlay techniques. sorcin is activated by ca2 + binding to the ef3 and ef2 regions, which are connected by the d helix. to investigate the importance of this region in the interaction with ncx1, three variants were examined : w105 g and w99 g, mutated respectively near ef3 and ef2, and e124a that does not bind ca2 + due to a mutation at ef3. downregulation of sorcin decreased and supplementation with wt sorcin (3 m) increased ncx activity in isolated cardiomyocytes. the relative stimulatory effects of the sorcin variants were : w105 g > wt sorcin > sorcin calcium binding domain (scbd) > w99 g > e124a. sorcin binding to both cbd1 and 2 was observed. in the presence of 50 m ca2 +, the interaction with cbd1 followed the order w105 g > scbd > wt sorcin > w99 g > e124a. in sorcin, the interacting surface can be mapped on the c - terminal ca2 + -binding domain in the d helix region comprising w99. the fast association / dissociation rates that characterize the interaction of sorcin with cbd1 and 2 may permit complex formation / dissociation during an excitation / contraction cycle. |
ovarian cancer is the fifth leading cause of cancer - related mortality of women in the u.s., with over 15 000 deaths per year. early diagnosis is associated with improved overall survival ; however, the majority of patients are currently diagnosed with advanced disease. the 5 year survival rate for late - stage ovarian cancer remains less than 30%. despite the identification of serum ca 125 as a biomarker for ovarian cancer in 1983, there are currently no screening biomarkers recommended for use for the general population. the utility of ca 125 as a screening test is limited by a low sensitivity of 50% for early stage disease at 99% specificity. combining ca 125 with transvaginal ultrasound (tvus) increased the specificity of detection in the ukctocs large - scale screening trial. in a joint validation study of 28 potential markers for detecting ovarian cancer in blood, panels of markers demonstrated only marginal improvements over ca 125 alone for the early detection of disease. a recent study showed that the addition of cea and vcam-1 to ca 125 and he4 increased the sensitivity of detection of stages i and ii ovarian cancer to 86% at 98% specificity, but this remains to be confirmed in a blinded validation study using prediagnostic sera. protein overexpression or mutation can lead to the spontaneous development of autoantibodies (aab) in the sera of patients with cancer. tumor antigen - specific aab have been identified in the sera of patients with cancer, including patients with early stage disease. there are several potential advantages of aab biomarkers, including signal amplification by the immune response and persistence of antibodies after antigen is no longer detected. p53-specific aab, which are associated with p53 mutation and resultant protein stabilization, have been detected in early stage ovarian cancer. we detected p53-specific aab in 41.7% of patients with serous ovarian cancer at 91.7% specificity. unlike ca 125 and he4, p53-aab were associated with improved survival (hr = 0.56). we hypothesized that the identification of novel aab biomarkers beyond p53-aab would increase the sensitivity of detection of serous ovarian cancer. we used the custom protein microarray technology nucleic acid protein programmable arrays (nappa), which are generated by printing full - length cdnas encoding the target proteins at each feature of the array. the proteins are then transcribed and translated by a cell - free system and immobilized in situ using epitope tags fused to the proteins. nappa arrays have been used to identify antibody signatures in early stage breast cancer. the objective of this study was to identify novel aab biomarkers for the detection of serous ovarian cancer. to profile the ovarian cancer immune response, we developed protein microarrays displaying 5177 full - length candidate antigens. we used a sequential screening strategy to select candidate aab biomarkers to limit the false discovery rate inherent to large - scale proteomic screening. first, we screened 34 cases of serous ovarian cancer and 30 matched healthy controls (cohort 1) on all 5177 candidate tumor antigens and selected 741 antigens for further testing. second, we screened 60 cases and 60 healthy controls (cohort 2) on the 741 antigens and identified 12 potential candidate aab biomarkers. third, we used an independent assay (luminex bead array) to display these autoantigens and rescreened sera from women in cohort 2. finally, we displayed a smaller set of 7 autoantigens and screened sera from an independent set (cohort 3) of non - serous cancers (n = 30), false - negative ca 125 (n = 20), benign ovarian disease (n = 15), and healthy controls (n = 15). the sensitivity and specificity of each individual biomarker, as well as the biomarker panel, are presented. sera used in these analyses were obtained from brigham and women s hospital and the dana - farber cancer institute with support from the nci early detection research network and ovarian spore program. sera derived from ovarian cancer patients were obtained at the time of presentation prior to surgery, and patients received routine postoperative therapy (as described in ref (12)). the non - serous cases were derived from 10 patients with endometrioid cancer, 10 patients with clear cell carcinoma, and 10 patients with mucinous carcinoma. the benign disease samples were derived from 19 patients with serous cytadenomas and 11 patients with mucinous cystadenomas. sera from age - matched general population control women were obtained from brigham and women s hospital using a standardized serum collection protocol and stored at 80 c until use. cases and matched controls were processed simultaneously. women with a personal history of cancer (other than non - melanoma skin cancer) were excluded as controls. written consent was obtained from all subjects under institutional review board approval. sequence - verified, full - length cdna expression plasmids in flexible donor vector systems were obtained from the arizona state university biodesign institute and are publicly available (www.dnasu.org). these were converted to the t7-based mammalian expression vector pant7_gst using lr recombinase (invitrogen, carlsbad, ca). the high - throughput preparation of high - quality supercoiled dna for cell - free protein expression was performed as described. for bead array elisas, larger quantities of dna were prepared using standard nucleobond preparation methods (macherey - nagel inc., plasmid dna (1.5 g / ml), capture antibody (50 g / ml anti - gst antibody, ge healthcare biosciences, piscataway, nj) or anti - flag antibody (sigma - aldrich, st. louis, mo), protein cross - linker (2 mm, bs3, pierce, rockford, il), and bsa (3 mg / ml, sigma - aldrich) were co - printed onto the array surface. all samples were printed using a genetix qarray2 with 300 m solid tungsten pins on amine - treated glass slides. the printed dna was transcribed and translated in situ using reticulocyte lysate according to previously published protocols. protein expression was detected using anti - gst mab (cell signaling, danvers, ma) diluted at 1:200. for detecting serum antibodies, the arrays were incubated with serum diluted 1:2501:600 in 5% pbs milk with 0.2% tween 20 overnight and detected with anti - human igg - hrp (jackson immunoresearch laboratories, west grove, pa) with tyramide (perkinelmer, waltham, ma). the highly immunogenic ebv - derived antigen, ebna-1, was included as n- and c - terminal fragments for positive control antigens. registration spots for array alignment were printed with purified human igg proteins. in vitro expression and display of target protein antigens on luminex bead arrays was described in ref (17). briefly, each target gene was expressed as a c - terminal gst - fusion protein using t7 reticulocyte lysate (promega corporation, madison, wi) per the manufacturer s recommendations with 500 ng of dna. the in vitro transcription / translation (ivtt) products were each captured onto seromap carboxylated microspheres (luminex corporation, austin, tx) coupled with anti - gst antisera. protein - bound microspheres were pooled together and blocked with 10% each of normal sera from mouse, rabbit, goat, and rat (jackson immunoresearch laboratories, inc., west grove, pa), 0.5% poly(vinyl alcohol) (pva, sigma - aldrich, st. louis, mo), 0.8% poly(vinylpyrrolidone) (pvp, sigma - aldrich, st. louis, mo), and 2.5% chemicon (millipore, billerica, ma) in pbs-1% bsa. test sera were diluted 1:80 in blocking buffer, preincubated at room temperature for 1 h with rotation, and then incubated with the beads overnight at 4 c while shaking. bound igg was detected with biotin - conjugated goat anti - human igg antibody (jackson immunoresearch laboratories, inc., west grove, pa) and streptavidin - r - pe (molecular probes, inc., eugene, or). to control for nonspecific and gst - specific autoantibody background, the ratio of mfi for individual abs to the mfi for the control p21-gst antigen was determined. protein expression was confirmed with a mouse anti - gst monoclonal ab (cell signaling technology, danvers, ma) and pe - conjugated goat anti - mouse igg (jackson immunoresearch laboratories, inc., ca 125 was detected by immunoassay using two monoclonal antibodies) m 11 and oc 125, fujirebio diagnostics). the upper 95th percentile cutoff for healthy pre- and postmenopausal women is 35 u / ml. [he4 ] for the prescreen, 34 cases and 30 control sera (test set, cohort 1) were screened on 5177 antigens displayed in nappa protein array format. each array was normalized by first removing the background signal estimated by the first quartile of the nonspots and then log - transforming the median - scaled raw intensities to bring the data to the same scale and stabilize the variance across the range of signals. candidate antigens from the initial 5177 antigens were selected if they met two different criteria : (1) comparison of the 95th percentiles of the cases and controls using quantile regression and (2) comparison of the proportion of cases with intensities above the 95th percentile of controls to the expected number seen by chance using binomial tests, with a p - value 0.05. independent arrays of these 741 candidate antigens were screened with a fully independent set of age - matched sera consisting of 60 healthy controls and 60 patient sera. first, we removed any duplicate antigen pairs that differed by more than 3 times the median absolute deviation, resulting in removal of 0.2% of spots. second, we removed background signal by subtracting the first quartile of control spot (no dna) intensity. third, to normalize across arrays and 384-well plates, we divided the excess intensity by the median excess intensity for each array and 384-well plate. two case sera failed our qc measures (more than 20% of spots below background signal) and were excluded from further analysis. we computed the sensitivity at an approximate 95% specificity for each antigen as follows. we determined a threshold by computing the 95% empirical percentile of the normalized intensity values of the controls. we then computed the sensitivity as the proportion of the cases that exceeded that threshold and the actual specificity as the proportion of the controls that did not exceed the threshold. to identify the most sensitive antigens at a high level of specificity, we used receiver operator characteristic (roc) curve analysis. specifically, we tested the hypothesis that the partial area under the roc curve (pauc) in the region where the specificity > 95% exceeds 0.00125, which is the pauc for a noninformative diagnostic test. p - values were computed using a normal approximation to the bootstrap sampling distribution, and q - values were computed using the q - value package in r. we used the training set to identify 13 potential antigen biomarkers with q - values 5 mean). from these data, 12 antigens were selected as potential biomarkers for further analysis based on a statistical test of the partial area under the receiver operator characteristic curve (see statistical analysis). the selected antigens had p 60% for p53, ptgfr, ptpra (p 5 ; p 93%. three of these biomarkers, p53, ptgfr, and ptpra, were consistently selective for serous ovarian cancer with individual aucs ranging from 64.8 to 73.8% across two independent serum screenings and two technologic platforms (slide microarrays and bead arrays), involving a total of 94 cases/90 control samples. if at least two aab of the three were positive, then the sensitivity was 23.3% at 98.3% specificity. while the clinical sensitivity is modest, the reproducibility, signal intensity, and clinical specificity across multiple sample sets may provide utility beyond the biomarkers ca 125 and he4. these biomarkers maintain sensitivity in the setting of false - negative ca 125 levels and, unlike ca 125, maintain specificity when compared to benign ovarian disease. this study is the first demonstration of the use of programmable protein microarrays for the proteomic detection of novel aab biomarkers for ovarian cancer. almost all of the sera used for this study were from patients with stage iii / iv ovarian cancer ; evaluation of the performance characteristics of these biomarkers will require testing of prediagnostic, prospectively collected cohorts such as the roca or plco trials. it is reassuring that of the 5177 antigens we screened one of the top 12 aab biomarkers was the well - established p53-aab. none of the 12 aabs were detected in a similar screen for primarily er+ breast cancer aab, although p53-aab have been detected in er - breast cancers, which are more commonly mutated in tp53. the top antigen biomarkers did not correlate with known epidemiologic risk factors, such as parity, breastfeeding, or ovulatory years. many of the top 12 antigen biomarkers that we identified have also been described as being important in ovarian cancer tumor biology and pathogenesis (table 4). in addition to p53, which we had previously described, we consistently identified two novel ovarian autoantigens, ptgfr and ptpra. ptgfr (fp) is the cell surface prostaglandin f receptor that functions to initiate luteolysis in the corpus luteum. it is aberrantly expressed in endometrial carcinoma, and stimulation of the receptor triggers mapk signaling and cell proliferation. ptgfr is strongly expressed in murine ovarian follicles as well as lncap prostate cancer cells upon disease progression. ptpra is a cell surface protein tyrosine phosphatase that is overexpressed in gastric cancers and prostate cancers and mediates signaling through erk2. ptpra is also upregulated in the setting of her2 inhibition in breast cancer cell lines. of the other candidate aab biomarkers, validation testing using our bead - array elisa and independent sera sets failed to confirm significant selectivity of the biomarkers. this may reflect poor overall performance characteristics of these biomarkers or decreased sensitivity of the bead arrays for the detection of aab compared to that of slide - based microarrays. dihydrofolate reductase (dhfr) is a folate metabolism enzyme and is critical for dna biosynthesis. dhfr has long been a target for chemotherapy in multiple cancers, and gene amplification has been described in ovarian cancer. in our data, elevated serum prolactin (prl) has been identified in the serum of ovarian cancer patients. many proteomics - based technologies have been used for the detection of antigen - specific antibodies in ovarian cancer (reviewed in ref (33)). the snyder laboratory used serum screening of spotted protein microarrays to identify 94 autoantigens. although the difference in detection between cases and controls did not reach statistical significance, they found that lamin a and ralbp1 were overexpressed in ovarian cancer tissue. lc ms - based approaches can identify native epitopes and post - translationally modified antigens ; in one study, 100 aab were identified in at least one patient. reverse - phase protein microarray can identify ptm - specific abs, and the s100a7 antigen has been identified. phage - displayed antigen microarrays have been used to identify 62 different antigens, including rcas1, nibrin, and rpl4. finally, o - glycopeptide epitopes have been identified within muc1 using glycoprofiling elisa assays. additional proteomic methods have been used to identify ovarian cancer autoantigens. using ascites fluid and protoarrays, using commercial protein arrays, 202 candidate ovarian antigens were identified, with dhfr being identified in at least one patient. using 2d immunoblots of exosomes, ovarian cancer antigens plap, survivin, ny - eso-1, grp78, and ca 125 were identified. of the other 15 aabs that we identified, only casein kinase 1 a has similarity to a previously identified autoantigen, ck1-epsilon. in multiplexed analysis of select antigens (survivin, p53, p16, and cyclins b1, d1, a, and e) to our knowledge, other than p53, aabs to these antigens have not been identified in ovarian cancer. in summary, these studies identify a potential panel of three autoantibody biomarkers for the early detection of serous ovarian cancer using custom protein microarrays populated with cancer - related target antigens. | sera from patients with ovarian cancer contain autoantibodies (aab) to tumor - derived proteins that are potential biomarkers for early detection. to detect aab, we probed high - density programmable protein microarrays (nappa) expressing 5177 candidate tumor antigens with sera from patients with serous ovarian cancer (n = 34 cases/30 controls) and measured bound igg. of these, 741 antigens were selected and probed with an independent set of ovarian cancer sera (n = 60 cases/60 controls). twelve potential autoantigens were identified with sensitivities ranging from 13 to 22% at > 93% specificity. these were retested using a luminex bead array using 60 cases and 60 controls, with sensitivities ranging from 0 to 31.7% at 95% specificity. three aab (p53, ptpra, and ptgfr) had area under the curve (auc) levels > 60% (p < 0.01), with the partial auc (spauc) over 5 times greater than for a nondiscriminating test (p < 0.01). using a panel of the top three aab (p53, ptpra, and ptgfr), if at least two aab were positive, then the sensitivity was 23.3% at 98.3% specificity. aab to at least one of these top three antigens were also detected in 7/20 sera (35%) of patients with low ca 125 levels and 0/15 controls. aab to p53, ptpra, and ptgfr are potential biomarkers for the early detection of ovarian cancer. |
invasive cancer is among the leading causes of death worldwide, and rates are still increasing, due to ageing and changes in lifestyle. cancer is a collective term for many diseases, rather than a single disease, with the common characteristic that tissue growth goes haywire. patients who have undergone cancer treatment show an increased risk of developing a second tumor, mainly due to the same risk factors that were responsible for the first tumor but also in part due to the treatment of the first tumor with mutagenic chemotherapeutics or radiation. therefore, new strategies for cancer treatment with as little as possible adverse side effects are needed that effectively eradicate the primary tumor and also do not increase the risk of recurrence. a tumor initially grows without any connection to the vasculature until it reaches a critical size of about two mm in diameter. then it remains in a dormant state, in which proliferation and apoptosis due to lack of oxygen, are in a dynamic equilibrium unless it develops in a well - vascularized region or is able to recruit its own vasculature. hanahan and weinberg have proposed six hallmarks of cancer, one of them being the induction of angiogenesis [4, 5 ]. for further growth, the tumor needs to hook up to the vascular system by forming neovessels. during tumor progression, an angiogenic switch is activated causing a continuous neovessel formation emanating from the normally quiescent vasculature, which sustains tumor growth. this process called tumor angiogenesis is a collective term that is generally used for all types of tumor neovascularization. in addition to vessel co - option and to endothelial cell (ec) sprouting, tumor vessels can also develop by intussusceptive or glomerular angiogenesis, or, in a way of vascular mimicry, even tumor cells themselves can form vessel - like hollow structures. these types of vessel formation can occur in parallel, and also gradual transitions are possible. vessel formation by the latter types requires less energy than sprouting angiogenesis, is thus carried out faster, and usually can be observed in, for example, gliosarcoma multiforme, melanoma, and breast and colon cancer. for neovessel formation, ecs need to migrate into a previously avascular region and to extensively remodel the extracellular matrix (ecm). in this process, integrins, which are cell adhesion receptors for various ecm proteins and immunoglobulin superfamily molecules, are the most important matrix receptors [8, 9 ]. therefore, integrins are appealing targets for cancer therapy using a variety of integrin - specific antagonists, ranging from endogenous antagonists over humanized or chimeric antibodies to peptides and small nonpeptidic compounds [1012 ]. in this paper, based on the general assembly of blood vessels, the specific organization of tumor vasculature will be described, as well as the dynamic sequence of events by which a tumor gains access to the body 's vasculature. in this context, the role of integrins and possibilities of their pharmacological manipulation are explored. the tissue 's ecm is a structure - shaping molecular scaffold and also a repository for cytokines and other growth factors. cells embedded in this matrix need to be supplied with oxygen and nutrients, signaling molecules need to be received and emitted, and metabolic waste products need to be disposed of. these tasks are optimally fulfilled by the cardiovascular system with its intricate and dynamic network of blood vessels. depending on their functions, different types of blood vessels show special histological and molecular adaptations. the heart, as a double - acting pump, drives the blood circulation within the vasculature via the aorta through arteries and arterioles into capillaries, from where the blood flows back through venules and veins. due to the prevailing pressure conditions, the body fluid is forced through the vessel wall to form the lymph, which then is drained by lymph vessels back to the blood circulation. additionally, the vasculature serves as highway system for leukocytes to patrol the body during immunological surveillance and to quickly reach sites of inflammation. the vascular wall is capable of self - sealing upon smaller injuries, and leukocytes are able to penetrate the blood vessel wall in a complex interplay without any obvious vessel leakage. pathologically, tumor cells capitalize the blood vessel system to disseminate from a primary tumor and to colonize distant organs where they develop metastases. histologically, the walls of blood vessels comprise three concentric layers, that is, tunica intima, tunica media, and tunica adventitia, which are separated by two sheet - like structures of ecm proteins. the membrana limitans interna and externa establish a border between tunica media and tunica interna and adventitia, respectively. these ecm sheaths tightly connect the cell layers of the vessel wall to form a functional unit, which becomes evident when too weak cell - matrix interactions lead to life - threatening aneurysms. the tunica intima comprises a single layer of squamous ecs and lines the inner surface of all blood vessels. the tunica media, which is usually the thickest layer in arteries, is composed of mural cells, which are smooth muscle cells in larger blood vessels and pericytes in capillaries. the tunica adventitia finally interconnects the blood vessel with the surrounding connective tissue, and it is usually most prominent in veins. in different vessel types, that is, arteries, arterioles, capillaries, venules, and veins, this general blueprint is modified corresponding to the respective functional requirements. for example, endothelia, which are continuous in most instances, can become fenestrated, as in exocrine or endocrine gland tissues, or even discontinuous, as in liver, spleen, or bone marrow, in order to facilitate the exchange of hormones or metabolites. elastic and muscular arteries illustrate other examples for a modification of this general blueprint. in order to even the pulsatile blood flow coming from the heart, the proteins elastin and fibrillin are abundant in the tunica media ecm of elastic arteries, which is the direct cause for the vessel wall 's elastic properties. muscular arteries possess numerous concentric sheaths of smooth muscle cells. by means of vasoconstriction and vasodilation the ecm of blood vessels together with their resident cells contributes to essentially all physiological functions of blood vessels and has been reviewed recently. the subendothelial basement membrane (bm) compartmentalizes the vessel 's single - layered endothelium from the vascular connective tissue. fibronectin, incorporated between endothelial and perivascular cells, is essential for blood vessel morphogenesis. the presence of von willebrand factor (vwf) is characteristic for the subendothelial bm, where also other bm proteins, such as the network - forming collagens iv and xviii can be found, together with laminins, nidogens, and perlecan. thirteen different collagens are present in the vascular wall [20, 21 ]. the network - forming collagen iv plays a key role for the mechanical stability of the bm, which, especially in arterial regions of the circulatory system, has to withstand a considerable blood pressure. in the tunica media of elastic and muscular arteries, covalently crosslinked supramolecular aggregates of elastin form concentric lamellae and fibers in a proportion of up to 50% of the vessel 's dry weight and confer resilience to pulsatile blood flow [2426 ]. regions of the ecm that consist mostly of elastin are confined by emilins, that is, homotrimeric elastin microfibril interphase - located proteins. anchored to microfibrillar bridges of fibrillin-1 and fibulin-5 between these concentric elastin lamellae, vascular smooth muscle cells (vsmcs) are sandwiched in a fishbone - like pattern and thus can effectively regulate the vessel 's caliber [25, 2831 ]. dependent on the vessel type, distinct fibulins are involved in the assembly of the ecm. while fibulin-1 is widespread and occurs in the bms of all blood vessels, heart valves and septa, fibulin-3, and fibulin-4 occur in the walls of capillaries and larger blood vessels. the innermost and outermost elastic lamellae are referred to as membrana limitans interna and membrana limitans externa, respectively. between the elastic lamellae, type i and iii collagens are deposited that bear tensile forces exerted on the vessels and limit their elastic dilatability. in contrast, in the interstitial connective tissue between the subendothelial membrane and the membrana limitans interna, type vi and type viii collagens are found [21, 33 ]. the connection of the membrana limitans interna to the subendothelial bm by type xviii collagen is assumed. also type xvi collagen, which is produced by vsmcs and found close to both elastic microfibrils and fibrillar type i and type iii collagens, may contribute to the connection between the elastic and collagenous phases of the ecm [35, 36 ], especially, as type xvi collagen contains a binding site for the major collagen receptor on vsmcs, integrin 11 [37, 38 ]. the ecm of the tunica media is synthesized by vsmcs, which are all encapsulated by an (incomplete) bm containing the usual bm proteins, type iv collagen and laminins [33, 39 ]. depending on microenvironmental cues, vsmcs can reversibly acquire distinct phenotypes, which can be characterized as either (i) contractile and differentiated or (ii) secretory, migratory, and less differentiated [37, 39 ]. under physiological conditions, the contractile phenotype prevails, at which the vsmcs transduce forces on the pericellular matrix especially by the collagen - binding integrin 11, by the laminin - binding integrin 71 and by dystroglycan. in contrast, in the secretory, proliferatory, and migratory phenotype, the integrin equipment of the vsmcs predominantly consists of the fibronectin receptor, 51, and the integrins 41 and 91. consistently, in the proximity of secretory vsmcs, the fibronectin splice variants v (iiics) and eiiia with binding sites for the integrins 41, 51, and 91 are abundant. in capillaries, scattered pericytes, each encapsulated by an own bm, stabilize the endothelium and its subendothelial bm [4042 ]. the fibroelastic connective tissue of the tunica adventitia connects the blood vessel with the perivascular connective tissue. it is rich in versican, a glycoprotein, which can interact with fibrillin-1, fibulin-1, and fibulin-2, as well as with other ecm molecules. to interact with their microenvironment and to spatiotemporally regulate their differentiation state, morphology, metabolism, and survival, integrins are the largest family of these receptors, and they mediate adhesion to collagens, laminins, and fibronectin. in addition, there are other receptors and coreceptors, such as the syndecans. binding to a wide variety of different ecm molecules and transmitting signals bi - directionally in an outside - in and inside - out manner, integrins constitute functional hubs, which, according to an interesting concept in network theory and systems biology, integrate networks of angiogenic signaling cues that orchestrate the behavior of ecs and vsmcs during angiogenesis [47, 48 ]. thus, therapeutically targeting integrins as the operationally important circuit - integrating hubs rather than single pathways of the complex system may result in a more pronounced inhibition of angiogenesis. ecs express the vitronectin receptors v3 and v5 ; moreover, on ecs and pericytes the following integrins are expressed : the collagen receptors 11 and 21, the laminin receptors 31, 36, and 64, the osteopontin receptor 91, and the fibronectin receptors 41 and 51. pericytes additionally express the laminin receptor 71, and the osteopontin receptor 81, and integrin v3 is also expressed on glial cells. as ec - derived tumors, angiosarcomas express the integrins 11, 21,31,51, and 61, and in benign and malignant mesenchymal tumors as well as in the desmoplastic stroma of carcinomas, integrins 11 and 51 are widely distributed. integrins 11 and 21 bind to the same ligand in the ecm and are vegf - dependently upregulated on migrating ecs, and antagonists against both integrins inhibit vegf - mediated angiogenesis without affecting the existing vasculature [51, 52 ]. therefore, and against the background of gene ablation studies, important coreceptors for integrin 21 are the syndecans-1 and -4, which weaken the invasiveness of tumor cells into a collagenous matrix. cells bind to fibronectin and vitronectin preferentially via the rgd - dependent integrins v3 and 51. cell - fibronectin interactions are modulated by proteoglycans, glycoproteins of the ecm, and the coreceptors syndecans. in contrast to quiescent ecs, integrin v3 is highly expressed on activated ecs during tumor angiogenesis, as well as on some tumor cells [58, 59 ]. in the tumor microenvironment, angiogenic ecs can interact due to their increased levels of the integrins v3 and v5 with provisional matrix proteins, such as vitronectin, fibrinogen, vwf, osteopontin, and fibronectin. also, partially proteolyzed collagen in the tumor exposes rgd sites and is a further ligand for integrin v3. thus, the ecm of the tumor microenvironment both provides survival signals and facilitates invasion. integrin-v3-mediated adhesion to platelets protects malignant cells from clearance through the immune system, and moreover, v3 integrin also helps tumor cells to adhere to the vessel endothelium and to spread into adjacent tissues. the pharmacological inhibition of integrin-v3-mediated cell - matrix interaction impedes tumor angiogenesis and growth, as does a replacement of the 3 subunit with a mutated nonphosphorylatable subunit in a murine model, which provides evidence for a proangiogenic role of integrin v3, in contrast to integrin v5, which does not seem to play an essential role in angiogenesis. interestingly, the analysis of v - knock - out mice revealed that, despite being embryonic or perinatally lethal, the vascular endothelium was not impaired in the absence of the v subunit, whereas the primary cause of death was brain hemorrhage [6567 ]. also endothelial tie-2-specific knockout of the v subunit did not result in any vascular or angiogenesis defect. moreover, in an integrin subunit 3- and also 5-deficient mouse model, pathologic angiogenesis and tumor growth are increased. a possible cause for these seemingly contradictory phenomena could be a relief of a transdominant inhibition by v3 on other integrins or other molecules, which would enhance their proangiogenic function [69, 70 ]. moreover, inhibition could also stabilize the integrin v3 in its unligated conformation and thus induce apoptosis by triggering an integrin - mediated death program. integrin v8 is important for vascular development in the embryonic brain and in the yolk sac. it is expressed on astrocytes but not on ecs or pericytes, nevertheless plays an important role in angiogenesis, as it binds in addition to several ecm proteins also to the latency - associated peptide (lap) of tgf1, which in cooperation with the membrane - type metalloproteinase mt1-mmp / mmp14 results in activation of tgf and triggering of its downstream signal cascades [7375 ]. collagen iv, an essential component of bms, is bound by integrin 11, which is expressed on mesenchymal cells and can also bind to other collagens [76, 77 ]. further collagen - binding integrins are 21, the main receptor for fibrillar collagens, which is expressed on epithelial and some mesenchymal cells as well as on thrombocytes, 101 in cartilage, and 111, a key receptor for fibrillar collagen on fibroblasts. the integrins 11 and 21 are involved in the regulation of collagen and mmp synthesis and thus of special importance for ecm turnover [8183 ]. discoidin domain receptors ddr1 on epithelial cells and ddr2 on mesenchymal cells are further collagen receptors with tyrosine kinase function and are relevant for cancer. other collagen receptors are glycoprotein gpiv on platelets, the leukocyte - associated immunoglobulin - like receptor lair-1/cd305, and the urokinase - type plasminogen activator receptor - associated protein uparap / endo180, which is involved in matrix turnover during malignancy. laminin, as a further integral component of bms, is bound by the integrins 31, 61, 64, and 71 [8891 ] and also by -dystroglycan [92, 93 ] and by the 67 kda laminin receptor 67lr. 67lr is increased in various tumors and correlates with their metastatic potential [95, 96 ]. the different laminin receptors may also act cooperatively in laminin binding, for example, laminin - binding 1 integrins and 67lr or integrin 64 and syndecan 1. integrin 31, which in the vascular wall binds to laminins-411 (laminin 8) and-511 (laminin 10), thrombospondin (tsp), timp2, tetraspanin cd151, and to the c - terminal domain of the collagen iv 3 chain, is controversially ascribed either a positive or a negative role in angiogenesis (cf.). there is controversy whether the hemidesmosomal integrin 64, which is expressed on a subset of ecs and on tumor ecs, aggravates pathological angiogenesis or whether it is a negative regulator of angiogenesis that is downregulated at its onset. thus, many molecules of the ecm scaffold, for example, laminins, collagens, fibronectin, and vitronectin, are ligands for integrins that link the cell 's cytoskeleton to the ecm. picking up signals from the cell 's microenvironment, integrins functionally sense, interpret, and distribute information, which allows the cell to modulate its proliferation, differentiation, migration, and shape. the modulatory and regulating function of integrins is emphasized by direct interaction with a multitude of proteins, such as mmps, upa / upar, tissue inhibitor of matrixmetalloproteinase-2 (timp-2), vwf, tsp-1, osteopontin, syndecan-1, insulin - receptor substrate-1 (irs-1), cytohesin-1, integrin cytoplasmic domain - associated protein-1 (icap-1), integrin - linked kinase (ilk), calcium- and integrin - binding protein (cib), 3-endotoxin, talin, actinin, tensin, nischarin, and the ras - related protein rab 25. the subendothelial bm of the tunica intima serves as a mechanical support to which ecs are anchored by various adhesion molecules, especially integrins [46, 105108 ]. additionally, the subendothelial bm provides microenvironmental information that regulate the metabolic activity of attached ecs, such as their production of leukocyte adhesion molecules or antithrombotic prostacyclins, as well as other properties, for example, the tightness of intercellular contacts. therefore, angiogenesis is regulated not least by integrins which are adhesion receptors for matricellular proteins, ecm proteins, and immunoglobulin superfamily molecules, on nearly all cells including ecs [8, 58 ]. in addition to their mechanical function, integrins also assist growth factor receptors and play important roles in signaling processes, in particular as soluble growth factors, and other signaling molecules are bound by integrins as well. for example, the proangiogenic vegf - a165 is bound by integrins v3 and a31 and also by the tenascin - c- and osteopontin - receptor integrin 91. the latter integrin, furthermore, binds the lymphangiogenic growth factors vegf - c and vegf - d. integrin 61 is a receptor for the proangiogenic ccn - family member cyr61, and is involved in in vivo in tube formation [116, 117 ]. the fibronectin receptor integrin v3, which is the best - studied integrin in relation to angiogenesis and is upregulated during wound healing and retinal vascularization and especially on tumor blood vessels, also binds to fibroblast growth factor fgf-1. stimulated by pdgf, vascular smooth muscle cells express the laminin receptor integrin 71, which plays an important role in recruitment and differentiation of vsmcs [120, 121 ]. integrin 91 is not only involved in lymphangiogenesis but also plays a role in ec adhesion. while binding of tsp-1 to integrin 91 promotes angiogenesis, vegf - a is another ligand of integrin 91. the crucial involvement of integrins in ec biology has been elucidated substantially by the examination of genetic knock - out studies. by ablation of the respective genes, the ec integrins 11, 21, 41, 51, 61, 64, 91, v3, and v5 and also the vsmc integrin 71 and the glial cell integrin v8 have been implicated in regulation of cell growth, survival, and migration during angiogenesis (for recent reviews of the findings from knock - out mice cf. [8, 10 ]). however, due to redundancy and compensatory mechanisms, the interpretation of knock - out results is often difficult. itgb1/ mice die at e5.5 before they start to develop their vasculature [125, 126 ]. mice with a conditional knockout in tie-2-positive ecs survive until e9.5e10.5, and they are capable of vasculogenesis, but their angiogenesis is disturbed showing defects in sprouting and branching [127129 ]. another endothelial - specific knockout of the integrin 1 subunit is mediated via ve - cadherin - cre recombinase and becomes manifest later in embryogenesis resulting in lethality between e13.5 and e17.5. in this mouse model, loss of 1 integrin leads to a decreased expression of the cell polarity gene par3 and thus to disruption of ec polarity and lumen formation. itga1/ mice, deficient for the collagen - binding integrin 11, show a normal vascular development and a reduced tumor angiogenesis in adulthood, which has been attributed to increased mmp activity, while 21-deficient itga2/ mice show an enhanced tumor angiogenesis in adulthood, but an otherwise normal vascular development [131, 132 ], and integrin 21 is involved in the plgf - dependent regulation of vegfr-1. although integrin 11 and 21 bind to the same ligand in the ecm, their differential knockout results in opposing effects on angiogenesis, suggesting a regulatory role for this pair of integrins. da silva and coworkers generated ec - specific conditional 3 integrin knock - out mice and showed that these mice, in contrast to a global ablation, are viable and fertile but display enhanced tumor growth, elevated hypoxia - induced retinal angiogenesis and tumor angiogenesis, and increased vegf - mediated neovascularization. the authors also could show that 31 is a positive regulator of ec - derived vegf, which again represses vegfr2 expression. their data demonstrated that endothelial 31 negatively regulates pathological angiogenesis and implicated an unexpected role for low levels of ec - derived vegf as an activator of neovascularization. itga4/ mice, deficient for fibronectin- and vcam1-binding integrin 41, are embryonic lethal with 50% dying at e9.510.5 due to failure of chorion - allantois fusion and 50% dying at e11.5 due to cardiovascular defects. mice, which by ablation of itga5 are deficient for the fibronectin receptor integrin 51, show normal vasculogenesis but no angiogenesis, which results in embryonic lethality at e10 - 11 due to defects in posterior somites, yolk sac, and embryonic vessels [133, 134 ]. this demonstrates the requirement of the integrin 5 subunit during embryonic development of early blood vessels and other tissues. accordingly, integrin 51, which is poorly expressed on normal quiescent ecs, is markedly upregulated during tumor angiogenesis. among the laminin - binding integrins, integrin 6 is not essentially required for vascular development, although 6-deficiency is lethal with skin blistering defects resembling epidermolysis bullosa. in line with the 6 knockout mice, itgb4/ mice, lacking a functional laminin - binding integrin 64 by deletion of its signaling domain, show normal vascular development, although with reduced angiogenesis, but die of severe skin defects. in neovascularization, while it is not required for ec proliferation and survival, it promotes tumor angiogenesis. in contrast, genetic ablation of 71, which is expressed on vsmcs but not on ecs, leads to incomplete cerebral vascularization and hemorrhage and also to placental vascular defects, which results in partial embryonic lethality and demonstrates that integrin 71 is important for recruitment and survival of vsmcs [121, 137 ]. deletion of itga8 resulting in lack of integrin 81, a receptor for fibronectin and tenascin, results in partial embryonic lethality, but no defects in vascular development (mller and reichardt, cited in). itga9/ mice lacking integrin 91, which is the receptor for tenascin - c, osteopontin, vcam-1, and also for vegf - a, -c, and -d [113, 114 ], have defects in large lymphatic vessels and die postnatally at p8 - 12 from a bilateral chylothorax. ablation of itgav, resulting in simultaneous loss of the two integrins v5, a receptor for vitronectin, osteopontin, and del-1 (developmental locus 1), and v3, a receptor for a variety of ecm proteins, such as fibronectin, vitronectin, laminins, fibrinogen, fibrin, tsp, tenascin - c, vwf, denatured collagen, osteopontin, mmp-2, del-1, bone sialoprotein, fgf-2, thrombin, and ccn1 (cystein - rich protein 61), leads to 80% embryonic lethality at e9.5, and the other 20% die at p0 with brain hemorrhage. on the other hand, itgb3/ mice, which are just integrin-v3 deficient, show 50% embryonic and early postnatal lethality and an enhanced angiogenesis in surviving adult animals, indicating that this integrin is not strictly required for vascular development. surprisingly, animals with an intact but nonfunctional 3 integrin subunit develop normally but show defects in angiogenesis in adulthood. in contrast, itgb5/ animals lacking integrin v5 develop normally and angiogenesis is not significantly affected, indicating that this integrin is not mandatory for vascular development. this strongly suggests that these integrins are not required for vascular development or for pathological angiogenesis, pointing out that the mode of action of v3 antagonists and antiangiogenic therapeutics is still insufficiently understood. ablation of itgb8 leads to the loss of integrin v8 on glial cells and thus to disrupted blood vessel formation in the brain, thereby demonstrating that this integrin is mandatory for brain 's blood vessel development. moreover, the phenotype of 8-deficient mice resembles that of v - deficient mice, which provides evidence that most defects in v - deficient mice are due to the loss of integrin v8. the family of integrins contains 24 structurally related n - glycosylated heterodimeric proteins assembled noncovalently from 18 -subunits and eight -subunits. each subunit comprises a large extracellular domain, a single transmembrane domain, and with the exception of the 4 integrin subunit, a short noncatalytic cytoplasmic tail. integrins are of special importance as they mediate cell matrix crosstalk via both outside - in and inside - out signaling [54, 142 ]. moreover, the 24 different integrins possess promiscuous and redundant ligand specificities, which is of importance when distinct signals are to be transduced or when in a particular context a defined cellular response is elicited, as is discussed by regg and alghisi. integrin structure and function have been studied in detail at the molecular level [143, 144 ]. the extracellular headpiece is formed by a disk - like propeller domain of the subunit and globular domains of the subunit [145, 146 ]. the joint globular head harbors the ligand - binding site [146, 147 ]. the crystal structure of the integrin-v3-binding site with an inserted rgd ligand helped to map functional amino acid residues on other integrins. recently, the binding pocket of integrin 51 has been mapped by swapping regions of zebrafish and human 5 subunit in a gain - of - function approach. depending on their activity, integrins adopt distinct conformations (figure 1). in the inactive resting conformation, the headpiece of the heterodimer bends towards the plasma membrane, and the transmembrane domains of the and subunits are associated. upon ligand binding, the previously bent integrin ectodomain adopts an activated upright conformation [106, 151 ]. this conformational change is conveyed through the transmembrane domains towards the cytoplasmic tails [54, 105, 152 ], where cytoskeletal proteins and signaling molecules relay the incoming signal intracellularly. in inside - out signaling, the binding of intracellular molecules, such as talin or kindlins [154, 155 ], to the cytoplasmic integrin tails leads via a separation of the transmembrane domains to a switch blade - like erection of the extracellular domains [147, 157, 158 ]. likewise, in outside - in signaling, ecm ligand binding to the integrin headpiece also induces a conformational change in the hybrid domain and thereby a separation of the integrin subunits ' legs. this parting of the legs separates the cytosolic tails and allows binding of cytosolic proteins and thus clustering of integrins and formation of focal adhesion sites (figure 1). by clustering into focal adhesions, integrins recruit talin, paxillin, -actinin, tensin, and vinculin and thereby mechanically couple the ecm scaffold to the actin cytoskeleton. additionally, integrins bind scaffolding molecules, such as p130 crk / bcar1, and recruit and activate kinases, such as focal adhesion kinases (faks), src family kinases (sfks), and integrin - linked kinase (ilk), the latter forming a complex with the adapter molecules parvin and pinch / lims1. in addition, tetraspanins can recruit integrins to membrane microdomains, thus regulating integrin function. thereby, the rather unstable nascent adhesions are transformed into focal complexes, focal adhesions, fibrillar adhesions, or podosomes. this clustering of integrins leads to a reorganization of the plasma membrane around the focal adhesion into caveolin - containing lipid rafts, to which also growth factor receptors often localize, and to the assembly of adhesion signaling complexes [161163 ]. this allows a regulation of growth factor signals by integrin - mediated caveolae trafficking [164, 165 ]. in the assembly of such integrin adhesions, up to 156 distinct molecules, amongst other adaptor proteins, kinases, and phosphatases, are involved [48, 163 ]. membrane lipid - protein interactions that modulate the homo- or heterotypic association of receptor molecules in the cell surface, or between adjacent cells, have been reviewed recently. from the focal adhesion sites signal pathways diverge that regulate diverse cellular programs, such as adhesion, migration, proliferation, and survival. to provide an overview, integrins generally relay their signals via the fak, erk, and nf-b pathways. in most cases, in mechanosensory signaling fak, src, and sh2, domains containing protein tyrosine phosphatase 2 (shp2) are involved. upon integrin binding, fak autophosphorylates and binds to src, which further phosphorylates fak and several downstream binding partners, amongst others, jnk and rho [168170 ]. activated fak also recruits pi3k, which mediates the activation of akt and procures integrin - mediated cell survival, and likewise the antiapoptotic akt can be activated via ang-1. moreover, signals relayed via integrins and src can be integrated by fak with growth factor receptor - relayed signals via ras, mek, and mapk. nevertheless, mek1 and raf1 are important interfaces between integrin - relayed and growth - factor - relayed signaling, because both mek1 and raf1 need to be activated via adhesion - mediated activation of src and fak in order to activate mapk [173, 174 ]. an endothelial - specific ablation of fak results in impaired blood vessel development and embryonic lethality downstream of fak, src couples integrin - mediated and vegf - receptor - mediated proangiogenic signaling in ecs [176178 ]. however, endostatin can also activate src via integrin 51 and thereby disassemble actin stress fibers and focal adhesions and thus inhibit cell migration, which is regulated by integrins via the ras / erk pathway [179181 ]. important for adhesion and migration of endothelial and vsmcs are also p130cas and plc-, which can interact with fak [182185 ]. pi3k is of pivotal importance for angiogenesis, because its deletion results in embryonic lethality e9.5 to e10.5, when angiogenesis is important for vascular development. pi3k deletion also causes decreased tie-2 expression and thus creates a phenotype resembling tie-2 deficiency [186, 187 ]. moreover, ec - specific deletion of the pi3k isoform p110 impairs angiogenesis. in ecs, adhesion via integrins elicits a survival signal via fak / pi3k / mtor/4e - bp1 and cap - dependent translation. in addition to a direct activation of erk, integrins can also activate a raf / mek / erk signaling cascade in ecs [189, 191, 192 ]. raf - deficient and mek - deficient mice have severe vascular defects [193, 194 ]. growth - factor - mediated erk signaling is linked with integrin - mediated signaling via fak. integrin - mediated erk signaling is important for cell proliferation and migration of ecs [191, 196 ]. integrin 11 is unique among the collagen - binding integrins because it promotes cell proliferation by activating the ras - shc - mapk pathway, and cell cycle progression is regulated via fak, rac, and cyclin d by integrin - mediated adhesion and matrix stiffness [197199 ]. integrins can also activate the nf-b pathway in ecs and protect them from apoptosis [200202 ]. additionally, nf-b signaling regulates the expression of cyclooxgenase-2 (cox-2), which again is involved in ec spreading and migration and in the induction of vegf and fgf-2 [177, 203, 204 ]. however, inhibition of the nf-b pathway increases angiogenesis pathologically. integrins alone are not oncogenic, but some oncogenes may depend on integrin signaling for tumor growth and invasion. for example, integrin - triggered fak signaling is essential for ras- and pi3k - mediated oncogenesis [206, 207 ]. also the expression of the cancer stem cell marker cd44 is integrin - regulated, and it can be speculated that integrin - relayed signals are needed to maintain a cancer stem cell population [12, 208 ]. on the other hand, there is evidence that the collagen receptor integrin 21 has a tumor - suppressing function [209, 210 ]. ligated integrins promote survival, whereas unligated integrins recruit caspase-8 to the plasma membrane and promote apoptosis in a process termed integrin - mediated death [71, 211 ], which differs from anoikis induced by loss of cell adhesion to the ecm [103, 212 ]. loss of caspase-8 confers resistance to integrin - mediated death of tumor cells, and unligated integrin v3 promotes the malignancy of such tumors [213, 214 ]. cell survival is promoted by integrin ligation - dependent upregulation of bcl2 and flip / cflar, activation of the pi3k - akt pathway, nf-b signaling, and p53 inactivation [176, 202, 215217 ]. survival is also promoted by crosstalk between integrins and growth factor receptors, for example, v3 and fgfr or v5 and vegfr2 [195, 218 ]. in various steps of angiogenesis and tumor progression, crosstalk between integrins and growth factor receptors on tumor cells and also on host cells is important. this crosstalk can consist in either an activation of a latent growth factor, a regulation of common pathways for signaling or internalization and recycling, a collaborative or a direct activation, or also a negative regulation. the outcome of a growth factor signal in a particular context is often determined by a synergistic and reciprocal interaction of integrins with growth factor receptors, such as tyrosine kinase receptors like vegfrs and tie-2, met, and fgfr, and semaphorins regulate integrin function as well [111, 219221 ]. a complex of vegf with the fibronectin heparin ii domain increases, upon cell binding via integrin 51 and the signaling via vegfr2 synergistically. expression of integrin 111 on tumor - associated fibroblasts has a tumor - promoting effect, because it upregulates the expression of insulin - like growth factor 2 (igf2), which is another example of integrin - regulated growth factor signaling. beside binding ecm proteins and thus regulating adhesion and migration in addition, integrin 91 can directly interact with vegf - a, -c, and -d and also with hepatocyte growth factor (hgf) [113, 114, 225 ]. moreover, integrin 31 and v3 bind vegf - a165 and vegf - a189. angiopoietins also can directly interact with many integrins [115, 221, 227, 228 ]. in the context of a hypoxic tumor microenvironment, it is especially interesting that the expression of integrins 11 and 21 is upregulated by vegf. angiogenesis is an important step in the metastatic cascade, which not only provides the tumor with nutrients but also is a route for dissemination. an oxygen diffusion limit of about 150 m restricts tumor growth to just a few millimeters in diameter. thus, in this prevascular phase of tumor dormancy, there is a dynamic equilibrium between proliferation and hypoxia - induced apoptosis. the dormant phase ceases when a tumor recruits its own vasculature by the secretion of angiogenic factors into its environment, a process denoted as angiogenic switch [2, 6 ]. after this angiogenic switch is thrown, the tumor hooks up to the body 's vascular system and thus resumes its growth. in tumor development, the establishment of an angiogenic phenotype is a crucial and general step [232234 ]. depending on tumor type and environment, this induction of new vessel sprouting can occur at different stages of the tumor progression pathway, and it leads to exponential macroscopic tumor growth [2, 4, 6 ]. in addition, recent data indicate that angiogenesis also contributes to the microscopic premalignant phase of neoplastic progression. infiltration of bone - marrow - derived monocytes that differentiate into macrophages can trigger this angiogenic switch in spontaneous tumors by releasing both numerous proangiogenic cytokines, for example, vegf, tnf, il-8, and bfgf [235, 236 ] and mmps (e.g., mmps-2, -7, and -9) together with elastase and upa. these matrix - degrading enzymes loosen the avascular ecm for the angiogenic ingrowth of neovessels. from the multitude of proangiogenic molecules, such as fgf-1 and -2, g - csf, hgf, il-8, pd - ecgf, pge-1 and -2, plgf-1, and -2, tgf- and -, tnf-, and vegf - a through e, only the vegfs and plgfs are specific for ecs. vegf - a, which exists in five splice variants, is the most intensively studied one. tumor cells express ccl2/mcp-1 (c - c - motif ligand 2/monocyte chemotactic protein-1), and thus, tumor - associated macrophages (tams) are recruited, resulting in an inflammatory response. these tams are again a source for angiogenic growth factors, such as, vegf and fgf-2 [239, 240 ]. mcp-1 also mediates the recruitment of mural cells in an ang-1-dependent manner in an ex vivo model. multiple sequential steps are required for angiogenesis to be successful and in all steps of this angiogenic cascade integrins, which mediate interactions of cells with surrounding insoluble ecm proteins, in addition to soluble growth factors, play an important role. in a first step, the bm of an existing vessel is degraded by mmps that are expressed by ecs, such as mmp-1, mmp-2, mmp-9, and mt1-mmp / mmp14 [242244 ], at which mmp-9 is required for tumor vasculogenesis rather than angiogenesis. subsequently, cell - matrix contact influences the outgrowth of tip cells and the proliferation of stalk cells that thereupon form endothelial tubes. a new bm is assembled by newly synthesized bm proteins. finally, the newly generated capillaries undergo maturation, pruning, and expansion. during embryonic morphogenesis, endothelial precursor cells called angioblasts initiate the body 's vasculature by forming tubes in a process called vasculogenesis. this is subsequently accompanied by sprouting (angiogenesis) of new vessels from already existing ones. once morphogenesis is completed, the adult vasculature is largely quiescent, except for transient events, such as wound healing or menorrhea. however, angiogenesis takes place under many pathological conditions, such as atherosclerosis, endometriosis, osteomyelitis, diabetic retinopathy, rheumatoid arthritis, psoriasis, and tumor growth. during tumor progression, the quiescent vasculature becomes permanently activated to sprout new vessels that enable blood supply and thus help sustain tumor growth [5, 6 ]. due to its increased metabolic rate, tumor tissue requires blood supply for expansive growth, which is circumstantiated by the observation that tumor cells, which are p53 deficient and thus show a reduced apoptosis rate, die beyond an oxygen diffusion limit in the range of 150 m. tumor cells proliferate around the continuously formed neovessels which markedly differ from normal vessels in morphology and molecular composition [219, 249 ]. the vessels themselves are leaky due to a discontinuous endothelium, a poorly formed bm, and a lack of mural cells. this poor quality of tumor - associated blood vessels compromises blood flow, impairs drug delivery, and facilitates tumor cell intravasation leading to hematogenous or lymphatic metastasis. in addition to histological vessel malformations, tumor vessels show an anomalous composition of their ecm, for example, tenascin - c and w, and the oncofetal fibronectin ed - b splice variants are associated with tumor vessels [250, 251 ]. melanoma and glioblastoma cells secrete tenascin - c as do cancer - associated fibroblasts (caf) of most carcinomas. tenascin - c stimulates angiogenesis in ecs, mediates survival of tumor stem cells, enhances proliferation, invasiveness, and metastasis in tumor cells, and blocks immunosurveillance [250, 253 ]. tenascin - w is more strictly associated with tumorigenesis and can be used as a tumor biomarker for breast and colon cancer, because it is undetectable in healthy stroma but overexpressed in the tumor stroma [254, 255 ]. new tumor blood vessels can either arise by vessel co - option or be formed by tumor angiogenesis, but there is also evidence for vasculogenesis or recruitment of circulating bone - marrow - derived endothelial progenitor cells that differentiate into ecs [230, 258260 ] (figure 2(a)). depending on the tumor type, tumor blood vessels build different and characteristic vascular beds, and, according to the function of the vascular bed and the osmotic pressure of the surrounding tissue, endothelia represent highly heterogeneous vascular addresses. tumor vessels constantly change their shape due to persistent growth, and about 30% of the vasculature comprise arteriovenous shunts bypassing capillaries. the concomitant poor perfusion leads to hypoxia of ecs, which consequently synthesize more proangiogenic molecules and thus crank tumor angiogenesis. endothelial sprouting can be triggered by hypoxia, hypoglycemia, and inflammatory or mechanical stimuli, such as blood pressure, and is regulated by many angiogenic growth factors, such as vegf, and matrix proteases. when neovessels sprout from capillaries, pericytes are selectively lost, and upon receiving an angiogenic stimulus, select ecs differentiate into tip cells that invade the avascular ecm (figure 2(b)). these tip cells migrate into the ecm following the stimulatory gradient. behind the tip cells, other ecs begin to proliferate and, as stalk cells, form cord - like structures. these develop into endothelial tubes [130, 261, 262 ] that subsequently anastomose and thus allow blood flow. finally, pericytes and smooth muscle cells are recruited, a new bm is synthesized, and the ecs become quiescent again. the molecular background of capillary sprouting and the key role of vegf have been reviewed by carmeliet. upon a hypoxic stimulus, vegf is produced, and as a consequence the endothelium 's permeability is increased and the bm loosened by the activity of mmps [243, 263 ] and the urokinase plasminogen activator system. the mmp inducer emmprin / cd147 also upregulates soluble vegf isoforms 121 and 165 and vegfr-2 on ecs and thus promotes sprouting angiogenesis. integrin v3 mediates migration into the fibrin - rich cancer stroma and furthermore can associate with mmp-2, thus enabling ecs to maintain the bm in the sol state and to promote tumor cell invasion. in addition to vegf, fgf, pdgf, and pldgf are involved, and ang-2/tie-2 signaling regulates the detachment of pericytes. later, pdgf - bb recruits pericytes and smooth muscle cells to the newly formed ec tube, and tgf-1 and ang-1/tie-2 stabilize the ec - mural cell interaction. another way of tumor neovascularization is intussusceptive angiogenesis, which represents a nonproliferative and noninvasive mechanism for the enlargement of a capillary plexus by intussusceptive growth, arborization, and remodeling (figure 2(c)). as this mode of vascularization is mostly independent from ec proliferation and migration, as well as bm degradation, this process is more economical and, occurring within hours or even minutes, is noticeably faster than sprouting angiogenesis. their subsequent expansion splits the preexisting vessel into two, thereby enhancing the vascular surface. in a subsequent process of arborization, the disorganized capillary network is remodeled into a functional tree - like structure by serial pillar formation. in a final remodeling step, the formation of new capillaries is initiated by sprouting angiogenesis that is later accompanied or followed by intussusceptive angiogenesis, which increases the ec surface. intussusceptive angiogenesis is synergistically regulated by vegf and ang-1, and it seems to be induced by laminar shear stress on the vessel walls, whereas oscillating shear stress favors sprouting angiogenesis. in many aggressive tumors, glomeruloid angiogenesis gives rise to complex vascular structures termed glomeruloid bodies, in which several microvessels together are ensheathed by a bm of varying thickness containing sparse pericytes (figure 2(d)). the frequency of occurrence of such glomeruloid bodies is an indication for the tumor 's aggressiveness and the patient 's survival. the formation of such glomeruloid bodies is rather a remodeling than true angiogenesis, because proliferating and migrating tumor cells can actively pull capillaries of the surrounding host vasculature and adjacent capillary branching points into the tumor node. thereby, formed coiled vascular structures develop subsequently into glomeruloid bodies that are connected to the surrounding vasculature via numerous narrowed capillaries. malignant cells can initially grow in the vicinity and along pre - existing microvessels and thus use the host vasculature for their own benefit (figure 2(e)). this co - option of the host vasculature was originally believed to be limited to the initial phase of tumorigenesis. meanwhile, however, there is evidence that vessel co - option might persist during all stages of primary and metastatic growth of various tumors, for example, cutaneous melanoma, which appears to grow by co - opting the vascular plexus in its surrounding connective tissue, while there is no sign of directed vessel ingrowth. vessel co - option is regulated dependent on the tumor type and the host environment, but the key regulators are again vegf and angiopoietins [272, 274 ]. ang-1 binds to tie-2 and thus triggers signaling cascades, assuring survival and quiescence of ecs, and thus causing tumor vessel maintenance, whereas the nonsignaling tie-2 ligand ang-2 acts as a negative regulator and destabilizes the capillary walls by detachment of pericytes [272, 274 ]. subsequently, vegf via its receptor vegfr-2 promotes both survival of ecs and growth of new vessels [237, 275 ]. aggressive melanomas can form fluid - filled vessel - like channels without any ec lining in a nonangiogenic process termed vascular mimicry (figure 2(f)). these channels allow perfusion independent of angiogenesis, and they can arise by two types of vasculogenic mimicry, designated the tubular and the patterned matrix type. these tubular vessel - like networks resemble the pattern of embryonic vascular networks, and, in their gene expression pattern, aggressive tumors that form such channels resemble endothelial, pericytes, and other precursor stem cells, suggesting that tumor cells might disguise as embryonic stem - cell - like or other cell types. vasculogenic mimicry of the patterned matrix type looks completely different and is characterized by a fluid - conducting meshwork of extravascular patterned depositions of matrix proteins such as laminins, collagens iv and vi, and heparin sulfate proteoglycans that anastomose with blood vessels [277279 ]. although it is not yet elucidated how such channels are connected to the vasculature, the latter type of vascular mimicry has been reported for many cancers, such as breast, ovarian, and prostate carcinoma, melanoma, soft tissue sarcomas, osteosarcoma, and phaeochromocytoma [277, 280 ]. in aggressive melanoma, the expression of tissue factor pathway - associated genes, such as tissue factor (tf), tf pathway inhibitor-1 (tfpi-1), and tfpi-2, is upregulated, suggesting an anticoagulation mechanism in the channel - forming tumor cells. fluid propelled through these channels by a pressure gradient might facilitate the supply with nutrients and oxygen, and, additionally, this fluid - conducting network could substitute for a lymphatic vascular system and drain extravasated interstitial fluid in tumors that lack lymphatic vessels, for example, uveal melanoma [279, 280 ]. cell - matrix interactions regulate signaling pathways that are intricately interconnected with cytokine - regulated pathways, which complicates the analysis of their contribution to a particular step in angiogenesis. ecm receptors can be manipulated with a wide variety of different compounds ranging from endogenous compounds, such as matrikines, over their synthetic analogues and peptides mimicking only integrin - binding sites to function - blocking antibodies and small molecules with integrin inhibitory function. other starting points for an antiangiogenic therapy are the inhibition of signaling cascades downstream of the ecm receptors or cytokine receptors and as a new avenue the blocking of micrornas with antisense rnas in ecs [282, 283 ]. an efficient antivascular cancer therapy can target either the angiogenic signaling pathways or the vascularization mechanism. a combination of conventional chemotherapy with angiosuppressive or vascular disrupting therapy is often problematic and needs careful design. in addition to soluble growth factors, such as vegf, there are several endogenous angiogenesis inhibitors, for example, endostatin, endorepellin, and tumstatin, which share the common feature that they all are proteolytic fragments of ecm molecules [284, 285 ]. in tumor angiogenesis within a primary tumor, such ecm fragments are generated by the release of mmps, in order to degrade the bm. this results not only in labile and leaky tumor vessels but at the same time keeps metastases from growing, as these endogenous angiogenesis inhibitors are distributed via the blood stream. therefore, they are of pharmacological interest with regard to their use as angiogenesis inhibitors. intensive efforts have been directed towards the development of integrin antagonists for the treatment of cancer and many other diseases, ranging from autoimmune diseases over inflammatory to thrombotic diseases, and their applications seem promising [11, 286 ]. integrin - mediated interactions of cells with their surrounding ecm can be manipulated by antibodies, peptides, small nonpeptidic compounds, and endogenous inhibitors (figure 3). integrin antagonists with antiangiogenic activities have been reviewed recently with special emphasis on drugs that are in clinical trials. spurred by the success in pharmacologically targeting rgd - dependent integrins, there are also attempts to pharmacologically manipulate rgd - independent integrins, such as the collagen- and laminin - binding integrins, as reviewed recently. the collagen - binding subgroup of integrins with their common a domain comprises interesting targets in the development of drugs against thrombosis, inflammatory diseases, and cancer. tsps-1 and -2 are naturally occurring potent angiogenesis inhibitors, and their anti - angiogenic effects can be imitated by short - peptide mimetics that among other targets bind to 1 integrins [288, 289 ]. an endogenous inhibitor, which blocks the interaction of integrin 11 with collagen i and also binds to heparan sulfate proteoglycans, is arresten, the c - terminal fragment of the collagen iv 1 chain [290, 291 ]. endorepellin, a c - terminal fragment of perlecan specifically blocks the function of integrin 21 and interestingly also binds to endostatin, thus counteracting its antiangiogenic effect. additionally, integrin 11 can be specifically inhibited with obtustatin from the snake venom of vipera lebetina obtusa [294, 295 ]. the interaction of integrin 21 with collagen can be specifically inhibited with the c - type lectin rhodocetin from the snake venom of calloselasma rhodostoma [296, 297 ]. in addition, it can also be selectively antagonized by the protein angiocidin, which was first detected in lung carcinoma cells [298, 299 ]. the aromatic tetracyclic polyketides maggiemycin and anhydromaggiemycin from streptomyces, which have been described as potential antitumor agents, inhibit collagen binding by blocking the a domain of the integrin subunits 1, 2, 11, and to a lesser extent 10 while cell adhesion to fibronectin, mediated by integrins 51, v3, v5, is unaffected. recently, the sulfonamide derivative btt-3016 has been described as a potent antithrombotic small - molecule inhibitor of integrin 21 with only slight effect on other collagen - binding integrins and no effect on fibronectin- or vitronectin - binding integrins. another sulfonamide derivative, e7820, which does not interfere with integrin - ligand interaction, reduces integrin 2 expression on the mrna level. angiogenesis can be inhibited with antibodies against the subunits of the integrins 11 and 21, whereas quiescent vessels are not affected. in a phase i clinical trial, endostatin, the c - terminal fragment of collagen xviii, blocks the function of integrin 51 [179, 304, 305 ] and also binds to heparin and with lower affinities to other heparan sulfate proteoglycans that are involved in growth factor signaling [306, 307 ]. endostatin 's antiangiogenic activity can also be mimicked with derived short non - rgd but arginine - rich peptides. integrin 51 can also be blocked by the synthetic non - rgd peptides phscn, named atn-161, and cyclic crretawac, as well as by the peptide mimetics sj749 and jsm6427, and it can be inhibited by the affinity - matured humanized chimeric monoclonal antibody m200/volociximab. angiostatin is a proteolytic fragment of plasminogen that effectively inhibits integrin v3, and its antiangiogenic effect can also be achieved by its isolated kringle-5 domain. kringle-1 to 3 show the same antiproliferative effect as the whole angiostatin, but hardly inhibit migration, whereas kringle-4 inhibits ec migration but shows only a marginal antiproliferative effect. other endogenous integrin v3 inhibitors are the collagen xviii fragment endostatin, and the c - terminal fragment of the collagen iv 3-chain termed tumstatin, which also binds to integrin 61. the n - terminal site mediates an antiangiogenic signal, whereas the c - terminal binding site is associated with the antitumor cellactivity [318, 319 ]. canstatin, the nc1 domain of the collagen iv 2 chain, inhibits both integrins v3 and v5 and seems to interact with integrin 31 too. a hemopexin - like domain comprising c - terminal fragment of mmp-2, termed pex, also antagonizes integrin v3 by preventing its binding to mmp-2 and thus inhibiting proteolytic activity on the cell surface, especially during vessel maturation [322, 323 ]. fastatin and other fas1 domains, which are present in the four human proteins periostin, feel1, feel2, and hig - h3, also function via integrin v3 as endogenous regulators of pathogenic angiogenesis. next to these natural antagonists there is a variety of synthetic rgd containing peptide inhibitors that mimic a motif that occurs on many ecm molecules, such as fibronectin, vitronectin, fibrinogen, osteopontin, tsp, vwf, and partially degraded collagen. most integrins of the v subfamily and the integrins 51 and iib3 bind to this motif. therefore, adhesion and spreading of ecs to the ecm can be competitively inhibited by rgd peptides, whereby anchorage - dependent ecs undergo apoptosis. to this group belong compounds, such as cilengitide / emd121974, s137 and s247 [326, 327 ], the tsp - derived peptide tp508/chrysalin, and several integrin v3- and v5-specific peptidomimetics, such as bch-14661, which preferentially inhibits v3 and bch-15046, which blocks v3, v5, and 51, sch221153, and st1646. another inhibitor is the non - peptide antibiotic thiolutin, which intracellularly blocks paxillin and thus, indirectly, integrin v3-mediated adhesion to vitronectin. antibodies against the 3 subunit inhibit contact of ecs to vitronectin and concomitantly vegf - induced tyrosine phosphorylation of vegfr-2 in cell culture studies. moreover, integrin v3 can be effectively antagonized with the monoclonal antibody lm609/medi-552 and its humanized derivative abegrin in contrast, the humanized anti-v antibody cnto95 targets both integrins v3 and v5. the humanized fab fragment 17e6/abciximab / reopro of the monoclonal antibody c7e3 inhibits the integrins v3 and also m2/mac-1 [339, 340 ], whereas the human - specific monoclonal antibody 17e6 targets all v integrins. currently, humanized or chimeric integrin antibody antagonists of v3, v5, and 51, and peptide inhibitors of these integrins are in clinical trials as antiangiogenic agents. integrins and their binding partners are of special interest as potential therapeutic targets, and several are already in clinical trials. however, the results fall short of the initial expectations, pointing out that monotherapy with a single angiogenesis inhibitor is not sufficient to counteract the numerous angiogenic factors involved in tumor progression. moreover, there are some caveats in aiming at integrins as therapeutic targets. obviously, integrins are expressed on virtually all cells under physiological as well as pathological conditions, and it is a major challenge to target exclusively integrins on tumor or tumor - associated cells. another problem is that low concentrations of antagonists alter the signaling of integrins and other receptors. when administered in nanomolar concentrations, the rgd - containing inhibitors cilengitide and s 36578 alter the trafficking of integrins and vegfr2 in tumor ecs, thus stimulating angiogenesis and tumor growth. current tumor therapy aims at vessel eradication in order to disrupt the connection of the tumor to the vascular system and thus cut off the supply of nutrients and oxygen. this can be done with compounds that preferentially affect tumor endothelia rather than normal cells, that is, (i) specific angiogenesis inhibitors, (ii) tumor vessel toxins that attack inherent weaknesses in static tumor vessel endothelia and associated vascular structures, and (iii) dual - action compounds. however, within the last years, a paradigm shift has taken place [344, 345 ]. vessel normalization by pruning immature vessels and increasing pericytes and bm coverage of the remaining vessels comes to the fore, rather than vessel eradication, because mere antiangiogenic treatment can worsen malignancy. a malformed tumor vasculature creates and aggravates a hypoxic and acidic milieu which hampers drug delivery and perfusion [347349 ], and, due to its leaky endothelium, it promotes tumor cell dissemination. therefore, chemotherapeutic efficacy can be ameliorated by a concomitant vessel normalization therapy which improves delivery and efficacy of cytotoxic drugs and also sensitizes the tumor cells to radiation [345, 350 ]. in vessel normalization, however, many antiangiogenic compounds, for example, atn-161, endostatin, and integrin inhibitors, show hormetic, that is, bell- or u - shaped, dose - response curves and thus present a challenge for clinical translation. nanomolar concentrations of rgd - mimetic v3 and v5 inhibitors (s 36578 and cilengitide) can paradoxically stimulate tumor growth and angiogenesis by altering the trafficking of v3 integrin and vegfr2. thus, they promote the migration of ecs towards vegf, which has important implications for the use of rgd mimetics in tumor therapy. thus, depending on tumor type, dose, and manner of application, the currently available - integrin targeting compounds can act either anti- or proangiogenic. a promising approach may be a combination therapy that blocks simultaneously angiogenic integrin v3 and vegfr activities [352355 ]. to circumvent these problems, instead of targeting the integrins, which are in principle present on both normal and malignant cells, another strategy aims at tumor - promoting integrin ligands, such as ed - b fibronectin, tenascin - c, and tenascin w [252, 253, 255 ]. invasive tumor cells partially degrade and denature their surrounding ecm, and the thereby released cryptic collagen iv epitope hu177 may also be a potential target for antiangiogenic and tumor - selective drug delivery. in comparison to a systemic administration of a chemotherapeutic agent, its therapeutic index can be increased by selectively targeting integrins that are overexpressed on tumor cells. chemotherapeutic small molecules, peptides, and proteins as well as nanoparticle - carried chemotherapeutics, which are conjugated to ligands of integrins that are overexpressed on angiogenic ecs or tumor cells, can be selectively internalized after integrin binding. especially nanoparticles, such as micelles, liposomes, polymeric nanospheres, and polymersomes loaded with chemotherapeutic or radiotherapeutic drugs and equipped with multivalent integrin ligands show decreased systemic toxicity, prolonged half - life and passive retention in the tumor, improved binding affinity, and facilitated internalization, thus resulting in increased drug delivery [12, 357, 358 ]. a therapeutic strategy that targets several integrins and receptors by such chemo-, radio-, and possibly gene therapeutic approaches may be more effective than a monotherapy [231, 357 ]. coadministration of the v integrin - targeting cyclic peptide irgd (crgdkgpdc), or structurally closely related peptides, with anticancer drugs considerably enhances their efficacy and selectivity. upon binding to v integrin - expressing tumor ecs, irgd is proteolytically processed to crdgk with a much weaker integrin affinity, whereas this truncated peptide shows an increased affinity to neuropilin-1 (nrp-1), thus increasing vascular and tissue permeability in a tumor - specific and nrp-1-dependent manner. interestingly, this coadministration does not require chemical conjugation of the drug with the irgd peptide ; that is, approved drugs could be used unmodified. coadministration of such a tumor - penetrating peptide with either small molecules, such as doxorubicin, antibodies, such as trastuzumab, or nanoparticles, such as nab - paclitaxel (abraxane) or doxorubicin - loaded liposomes, resulted in equivalent or increased delivery and efficacy, and it improved their therapeutic index by lowering the effective dose. additionally, integrins can be used as biomarkers to noninvasively assess the efficacy of chemotherapeutic and radiotherapeutic drugs. integrin - targeted probes can be used to visualize tumor angiogenesis and the response to chemo- and radiotherapy by various imaging methods, such as magnetic resonance imaging (mri), positron emission tomography (pet), and ultrasonography [360362 ]. moreover, fluorescence labeling of integrin ligands allows intraoperative fluorescence imaging, thus providing a tool to intraoperatively detect and remove metastases of submillimeter size. in summary, the above data illustrate the importance of integrins and integrin - binding and signaling proteins in both physiological and pathological blood vessel formation. although our knowledge concerning this matter has increased remarkably within the last years, the understanding is far from complete. | physiological as well as pathological blood vessel formation are fundamentally dependent on cell - matrix interaction. integrins, a family of major cell adhesion receptors, play a pivotal role in development, maintenance, and remodeling of the vasculature. cell migration, invasion, and remodeling of the extracellular matrix (ecm) are integrin - regulated processes, and the expression of certain integrins also correlates with tumor progression. recent advances in the understanding of how integrins are involved in the regulation of blood vessel formation and remodeling during tumor progression are highlighted. the increasing knowledge of integrin function at the molecular level, together with the growing repertoire of integrin inhibitors which allow their selective pharmacological manipulation, makes integrins suited as potential diagnostic markers and therapeutic targets. |
granulocytic sarcoma or extramedullary myeloid tumor (emmt) is an uncommon neoplasm of immature hematopoetic cells. these tumors are reported in 3.1 - 9.1% of patients with myeloblastic leukemia and occur concomitantly with, after, or rarely before the onset of leukemia. we report a case with multiple tumors involving the lymph nodes, breast and orbit. the diagnosis was established on fine needle aspiration cytology (fnac) of the masses which subsequently led to the diagnosis of the underlying leukemia. a 15 year - old girl presented with bilateral, cervical lymphadenopathy, bilateral breast masses, and gradually developing proptosis of both eyes, in that order. nodes were firm to hard with restricted mobility and the breast masses were 4.5 cm (left) and 5.0 cm (right) along their maximum dimension. fine needle aspiration cytology (fnac) was done from the lymph nodes and breast masses. both wet - fixed and air - dried smears were prepared for papanicolaou and may - grnwald giemsa (mgg) staining respectively. smears from lymph nodes and the breast showed similar features with a polymorphous population of large atypical cells scattered in a background of mostly mature and a few reactive lymphoid cells [figures 1 and 2 ]. cytoplasm was pale blue and a fair number of cells showed auer rods and a few fine granules ; the background showed lymphoglandular bodies. cell morphology from both sites was suggestive of myeloid blasts, so a diagnosis of granulocytic sarcoma / extramedullary myeloid tumor was made. smears from lymph node show infiltration by numerous myelomonoblasts (mgg, 400) aspirate from breast with leukemic cells (mgg, 400) the peripheral smear showed normocytic, normochromic anemia with leukocytosis. total leucocyte count (tlc) was 48000 cells / mm with the differential count showing 70% blasts, 2% promyelocytes, 8% myelocytes, 8% metamyelocytes, 2% band forms, and 10% lymphocytes. platelet count was adequate and the blasts were as described above with mostly indented nuclei and auer rods [figure 3 ]. out of these, a considerable proportion showed monocytoid features ; the blasts were diffusely positive for sudan black b (sbb) and negative for periodic acid schiff (pas). non specific enolase (nse) was noncontributory, based on which, a diagnosis of acute myeloid leukemia (aml)-m4 was given. peripheral smear shows myeloblasts with auer rods and cells in mitosis (giemsa, 1000) the patient was started on standard chemotherapy to which she responded well. granulocytic sarcoma or extramedullary myeloid tumor may be seen in association with chronic myeloid leukemia (cml), myelodysplastic syndrome, (mds), myeloproliferative syndrome (mps), polycythemia vera, and essential thrombocytosis. emmt may be seen in known patients of aml or may occur (rarely) as the first manifestation of the disease. in other cases, it may be the first sign of systemic relapse of a case of treated aml. emmts may occur at any site in the body, common ones being the skin (leukemia cutis), lymph nodes, and mediastinum. other sites such as epidural, uterus, ovaries, testis, and orbits have also been reported. a few case reports have described it in the breast[13 ] where it is often misdiagnosed as lymphoma. granulocytic sarcomas of the orbit have mostly been described as isolated masses which may precede systemic manifestations. the soft tissue counterparts may present months before the involvement of peripheral blood and bone marrow. they produce symptoms according to their anatomic location but they may be asymptomatic as well. problems in diagnosis arise when they are suspected in patients without a background of myeloprolifrative disease. they may often be misdiagnosed as non - hodgkin 's lymphomas, rhabdomyosarcomas, amelanotic melanomas, or undifferentiated carcinomas. light microscopy reveals collections of cells that can be usually recognised as being myeloid. undifferentiated or minimally differentiated blasts generally pose diagnostic problems and these are cases that are misdiagnosed as lymphoma. the cells in our case were positive for sbb and myeloperoxidase ; pas was negative. immunostaining with monoclonal antibodies against myeloperoxidase ; anti - cd43, and anti - lysozyme are the most sensitive antibodies ; cd68 and cd20 are useful in differentiating it from lymphoma. it is regarded as a poor prognostic indicator by some, whereas others have not considered it as an independent prognostic factor. if they are diagnosed in patients previously treated for aml, they signify relapse whereas in a patient of chronic myeloproliferative disease, they may be indicative of an impending blast crisis. most tumors, whether detected prior to or during the therapy of leukemia, respond well to standard chemotherapeutic agents. | granulocytic sarcomas or extramedullary myeloid tumors represent the soft tissue counterpart of acute myeloid leukemia. the term is used for any solid collection of leukemic cells. there have been reports of these tumors occurring before the involvement of blood or bone marrow. our patient had simultaneous involvement of three sites, which was diagnosed on cytology. further confirmation was done on peripheral blood and bone marrow evaluation. |
alopecia areata can affect any hair - bearing area. it is a lymphocyte cell - mediated inflammatory type of hair loss, although the exact pathogenesis is unclear. phenol, also known as carbolic acid, is well known as an antiseptic agent. it is a bactericide (> 1%), fungicide (> 1.3%), and a local anaesthetic. at concentrations over 80%, phenol coagulates proteins. pertaining to its easy availability and affordability, it finds great usefulness in being used in many office procedures in dermatology clinics. the mechanism of action is based on its irritating property that leads to tissue necrosis. phenol has the property of penetrating into the layers of skin, and this is inversely proportional to its concentration. the application of pure, undiluted 88% phenol to the skin causes rapid and complete coagulation of epidermal keratin protein and produces a partial blockade for further chemical penetration. the more dilute solution of 50% has greater penetration and, thus, peel potency than the full strength of 88% straight phenol preparation. there is a risk of systemic absorption leading to toxicity that can be averted by dividing the desired area into small areas and using a gap of 15 min while applying phenol to each of the affected areas. a 13 year old girl presented to us with diffuse hair loss over the scalp involving more than 50% of the scalp [figure 1 ] for the past 6 months. she had consulted many dermatologists in the past 6 months since the onset of her complains, but none of the treatment brought relief. therefore, it was not only the disease entity that we needed to consider but also the financial and psychosocial impact on the patient. after taking a prior informed consent, phenolisation was done over the bald patches with 88% phenol until a uniform ivory white frost appeared. phenol was applied all over the bald patches, covering more than 50% of scalp surface ; 1 ml of phenol was taken in a container and applied to the scalp by dipping a bud in phenol. we assume that out of 1 ml, some amount of phenol was left in the bud. she began to show response to therapy after the 2 sitting when vellus hair regrowth was evident diffusely all over the bald patches. after five sessions done with 88% phenolisation and 4 pulses of dexamethasone intravenous therapy, she showed marked improvement with well - marked hair growth over the patches. phenol has been used for the treatment of various conditions like vitiligo, molluscum contagiosum, epidermal cysts, acne scars, and facial rejuvenation. the mechanism by which phenol acts in alopecia areata is unclear ; however, various mechanisms have been proposed such as the release of various growth factors during the wound repair process that stimulate the follicles. also, various cytokines released during wound healing neutralise the peribulbar infiltrates, causing re - growth of hair through immunomodulation. lastly most of the follicles in alopecia areata are in the telogen phase and thus lie in the dermis. therefore, it is proposed that phenol passes through the follicular opening and directly stimulates the germinal centre. alopecia areata is an organ - specific autoimmune disease directed against various cellular components of hair follicles, thus dexamethasone pulse has a profound but transient action on the perifollicular lymphocytes that restores normal hair cycle. use of phenol in the concentration of 20% alone or in combination with oral mini pulse with betamethasone or 2% minoxidil has been reported previously, and it was reported that combination therapy is better than use of single agent. this could probably be because concentration of phenol used was low as compared to that in this study. the rationale for combining phenol and dexa pulse is to get a fast and better result. the patient has shown marked improvement with 5 sessions of phenol and 4 monthly pulses of dexamethasone over a period of 4 months and has not shown any relapse even after 6 months of follow - up. keeping the safe limit in consideration, | phenol is an aromatic hydrocarbon derived from coal tar or manufactured from monochlorobenzene. alopecia areata is a common non scarring autoimmune condition characterised by patchy loss of hair without atrophy. various treatment modalities have been proposed and used for the treatment of alopecia areata, which is indeed a difficult condition to treat. variable results have been documented using intralesional corticosteroid injections, topical minoxidil, topical anthralin ointment, topical contact sensitizers like diphencyprone, dinitrochlorobenzene or squaric acid dibutyl ester, and oral mini pulse with betamethasone. the use of 88% phenol for the treatment of alopecia areata has been documented in literature, but it has failed to secure a place in the priority list. herein we have reported a case of a young girl who was treated with short - time aggressive therapy using 88% phenol and dexamethasone pulse therapy and who responded well to the treatment with no recurrence in the last 6 months of follow - up. |
headache is one of the most common complaints during medical curriculum and it occurs due to numerous psychological and physical stressors, which are more common in medical students than general population. frequent and severe headache have a major impact on academic performance and quality of life, and may bring about limitation in daily activities and work. the problem may also influence the students future job performance, causing a large burden for individual and the society, considering the role of medical students in improving the community 's health. on the other hand, since the mechanisms of migraine and tension - type headache (tth) are still elusive, epidemiological studies on specific populations are needed to help clinicians and researchers find the origin of pain and the factors influencing the frequency of headache. the prevalence rates of migraine and tth have been reported in the range of 11 - 40% and 5.6 - 40.8% in different countries, respectively. as mentioned, several studies have been performed on medical students as the target population. considering this and also scarcity of the data on headache epidemiology in our society, the current study was conducted as the first epidemiological study to evaluate the frequency of different types of headache and its associated factors among medical students in iran. this cross - sectional study was conducted in isfahan university of medical sciences, isfahan, iran from september 2011 to january 2012. first- to seven - year medical students who have experienced some forms of headache in their life and had headache attacks during the past 6 months were included in this study. exclusion criteria were as follows : (1) students who completed less than half of the structured questionnaire ; (2) having headache not classified according to the criteria of the international headache society (ihs) ; (3) short - term headache ; and (4) those in which the diagnosis was not confirmed by the neurologist. the study protocol was approved by the ethics committee of isfahan university of medical sciences. the informed consent was prepared by the local scientific ethical committee of isfahan university of medical sciences in accordance with the ethical standards of the 2000 revision of the declaration of helsinki. the data was collected using a structured check list, which was designed in two parts. the first part consisted of demographic data such as age, gender, medical curriculum, family socio - economic condition, medical history, and family history of headache. the second part included items on headache characteristics to determine the headache type according to the second edition of the ihs criteria. in addition, a neurologist performed a complete neurological evaluation for students who reported migraine or tth in their questionnaires to confirm the type of headache diagnosis. the students with migraine were sub - classified into migraine with aura and migraine without aura. the statistical analysis was performed using the statistical package for the social sciences (spss) software, version 20.0 (spss, inc., on a total of the 512 students, who were included in the study, 498 students completed the questionnaire. the neurologist did not confirm the diagnosis for 18 participants who reported migraine and tth in their questionnaires and they were excluded from study. 258 males (53.8%) and 222 females (46.2%) (male - to - female ratio, 1.2:1) were enrolled. the mean age of students was 23.9 3.6 years, ranging from 18 to 31 years. on a total of the participants, 50 (10.4%), 54 (11.3%), 70 (14.6%), 76 (15.8%), 66 (13.8%), 72 (15%), and 92 (19.2%) were 1, 2, 3, 4, 5, 6, and 7 year students, respectively. among the participants, the mean age of headache sufferers and non - sufferers were 24.1 3.8 and 24 3.7 years, respectively, and two groups were not significantly different in this respect (p = 0.77) (confidence interval 95% = 0.58 to 0.78). women had a higher frequency of migraine than the men (18.5% vs. 10.5%), while tth was more common in men (49.2% vs. 39.2%). in addition, 41.2% of migraine cases were with aura and 58.8% were without aura. according to the chi - square test, there was statistical difference between the gender and type of headache (p = 0.004). prevalence of different type of headache according to gender the difference between socio - economic condition of those students with headache and those without was statistically significant [table 2 ] (p < 0.001). prevalence of different type of headache according to socio.economic condition the highest frequency of tth was observed among 5 year students, while the highest frequency of migraine was among 3 year students and there was significant difference in distribution of headache based on the year of study (p = 0.001). a positive family history of headache was found in 0.5%, 20.6%, and 6.1% of students without headache, with migraine, and with tth, respectively, and there was statistically significant association between positive family history and the ty pe of headache (p < 0.001). in contrast, we found 61 (12.7%) participants with concomitant diseases such as psychological disorders (11 cases), anemia (7 cases), arthritis (7 cases), thyroid disorders (5 cases), weight loss (7 cases), trauma (6 cases), gastrointestinal disorders (9 cases), and other disease (9 cases). there was no statistically difference between headache and concomitant disease (p = 0.25). here, in this report, headache was found to be common in medical students of isfahan university of medical sciences with the overall prevalence of 58.7%. the generally believed higher prevalence rate of headache among women, reflected by several studies, was not observed in our subjected population. this may be due to the higher number of male student included in the study (male - to - female ratio, 1.2:1). the prevalence of 14.2% for migraine in our study is similar to that (12.6%) reported by balaban. among medical students of sivas university, nevertheless, the rate was higher than that of 2.4% reported by mitsikostas. among medical students in athens and 6.4% by ojini. from the university of lagos in nigeria. the females are more affected by migraine in our study (male - to - female ratio, 1:1.5) as published, previously. in the current study, tth was more frequent than migraine in both sexes. different prevalence rates of tth have been obtained in several epidemiological studies, ranging from 5.9% to 34.5% in males and from 11.1% to 40.8% in females. in our experience, the prevalence rate of tth was higher than those in the majority of similar studies, except the recent work by ferri - de - barros., with the rate of 64.7% among brazilian medical students. this might be due to the socio - economic condition in the developing countries especially, for those of medical students who have no certain income for 7 years. in their earlier study on headache in khoramabad, iran, bahrami. however, since the target population and age coverage was thoroughly different from the current study, the results could not be compared. although, most studies supported the female predominance of tth, in our experience it was more frequent among males. this is in agreement with the findings of the study carried out in oman reporting a female - to - male ratio of 1:1.3. in our society, men play the pivotal role to provide the financial outcome of the family, so the concern of male students about their occupation can be associated with higher tth rates than that in females. these inter - study differences in the prevalence of migraine and tth may be due to differences of ethnicities, genetic / individual backgrounds, and study designs. taking all the results together, stovner estimated the frequency of migraine (with or without aura) and tth as 11% and 42%, respectively, which is in line with our results. considering the limited age range in this study ; we did not observe any effect of age among sufferers from migraine and tth. that reported an association between lower socio - economic status and the risk of headache. nevertheless, this needs further research to seek for any association between this factor and headache. owing to the cultural differences among various societies, this item should be cautiously applied to other populations. our results show that the prevalence of headache in 3 year students is significantly higher than that in other students. this might be explained by the fact that in our educational system, 3 year medical students prepare themselves for basic - science exam, causing stress in this year of medical curriculum. total students with headache, 12.7% reported concomitant diseases and the frequency of some diseases, e.g., psychological disorders and anemia were increased in students with headache. most of the studies showed that a high - percentage of students had a positive family history of headache. consistently in our report, 10% of students with headache had a positive family history being less than that reported by ojini. this highlights the role of genetics in this regard. in the current study, 20.6% and 6.1% of students with migraine and tth had positive family history of headache, respectively the reason for a relatively lower frequency of positive family history of headache in our study is elusive, though, the high prevalence of tth, which is actually associated with certain individual, psychosocial, and environmental conditions, might be regarded as an explanation. one of the strengths of our study is that our participants were directly examined by a neurologist so that inaccurate diagnosis could be minimized. in conclusion, the results of this study suggest that prevalence of headache is high among medical students in isfahan and tth is its most common type. socio - economic and the year of study might be significant factors in the prevalence of headache. of note, our study population was not completely representative of the all the medical students of iran. hence, further multicenter studies are necessary to evaluate the epidemiology of headache among medical students of the country. | background : headache is one of the most common complaints during medical curriculum and it occurs due to numerous psychological and physical stressors, which are more common in medical students than general population. the purpose of this study was to evaluate the frequency of different types of headache and associated factors.materials and methods : this cross - sectional study was conducted in isfahan university of medical sciences, from september 2011 to january 2012. first- to seven - year medical students who have experienced some forms of headache in their life and had headache attacks during the past 6 months were included in this study. all medical students completed a structured check list, which consisted of demographics data, associated factors, and headache characteristics.results:a total of 480 (258 [53.8% ] males and 222 [46.2% ] females) students (93.7%) were evaluated. the prevalence of headache was 58.7%, the prevalence of migraine, and tension - type headache was 14.2% (10.5% in male vs. 18.5% in female, p = 0.08) and 44.2% (49.2% in male vs. 39.2% in female, p = 0.006), respectively. a family positive history was found in 9.5% of students with headache. the lower socio - economic status, year of study (3rd and 5th year students), was seemed to had higher prevalence in students with headache. there was no significant difference between headache and concomitant disease.conclusion:the results demonstrate that prevalence of headache is high among medical student. socio - economic and the year of study might be significant factors in the prevalence of headache. further multicenter studies would be necessary to evaluate headache epidemiology among medical students in the whole country. |
the diagnosis of occult gastrointestinal bleeding of obscure origin is one of the most vexing problems confronting physicians. despite impressive technological advances during the last 30 years, the management of bleeding from the lower gastrointestinal tract remains a diagnostic and therapeutic challenge. although a generally accepted treatment protocol for upper gastrointestinal tract hemorrhage has been established, there is no similar consensus for the management of hemorrhage originating distal to the treitz ligament. a 29-year - old white male was seen in the emergency room of the american - british hospital of mexico city, referred from a rural clinic in one of the neighbor states of mexico city with a 4-day history of severe gastrointestinal bleeding characterized at first by melena and then hematochezia. six units of packed red blood cells were transfused to the patient before his admission to the emergency room. past history was unrewarding except for a laparoscopic fundoplication nine months before for severe gastroesophageal reflux disease. an emergency esophagogastroduodenoscopy was negative for bleeding and showed a properly functioning fundoplication ; a colonoscopy performed two hours later after bowel preparation showed fresh blood in the large bowel coming from the ileum. the next morning the patient was taken to the operating room, and, under general anesthesia, a 10 mm trocar was placed in the umbilicus. the abdominal cavity was inspected and immediately a 6 5 cm ileal cystic dark mass was identified in the pelvic area (figure 1). another 10 mm trocar was placed in the right flank and a 5 mm one in the left flank. the whole small bowel was inspected from the ligament of treitz to the ileocecal valve and the tumor was located at 50 cm proximal to the latter. the umbilical incision was extended 3 cm downwards, the wound protected, the tumor exteriorized (figure 2), and a 20 cm ileal resection was performed, followed by a termino - terminal stapler anastomosis. the postoperative course was uneventful : a liquid diet was tolerated the following day, a normal bowel movement occurred on postoperative day 2, and the patient was discharged on postoperative day 4 and remains asymptomatic 18 months later. the specimen was a segment of small intestine which measured 17 2.5 cm. on its outer surface, it had a reddish - brown hue, bosselated surface with areas of recent hemorrhage and measured 6 5.5 4 cm. on sectioning, it had a firm consistency, and the surface was trabeculated, gray - pink and with focal hemorrhage at the periphery. the base of implantation was 3 cm wide, and part of the neoplasia protruded through the bowel wall, creating a dumbbell shape (figure 3). microscopically, the tumor was hypercellular and made up of bundles of fusiform cells with bland nuclei, homogeneous chromatin pattern, occasional small, inconspicuous and usually single nucleolus. there were 2 mitotic figures in a 150 hpf count, no necrotic foci, no pleomorphic cells nor skeinoid fibers, and only scattered hemorrhagic areas (figure 4). the immunohistochemical profile showed focal positivity for ps-100, cd34 (qbend/10) ; actin antigen (pcna) was strongly positive in 4.1% of neoplastic cells. dna analysis (cas-200) showed a hypodiploid population (dna index : 0.4, s - phase : 3.3). low risk small bowel stromal tumor (gist), based on size (6 5.5 cm), no necrosis, 2 mitotic figures in hpfs and pcna index lower than 10%. low risk small bowel stromal tumor (gist), based on size (6 5.5 cm), no necrosis, 2 mitotic figures in hpfs and pcna index lower than 10%. etiology of acute lower gastrointestinal bleeding is closely associated with the patient 's age. in adolescents and young adults, meckel 's diverticulum, inflammatory bowel disease and polyps account for the majority of cases. in adult patients up to 60 years of age, diverticulosis, inflammatory bowel disease, and polyps are the most common cause, whereas in patients older than 60 years angiodysplasia, diverticulosis and cancer are the most common etiologies. most acute lower gastrointestinal bleeding episodes arise from the colon ; however, 15% to 20% originate in the small intestine. it must be mentioned that the yield of small bowel series performed to evaluate patients with obscure gastrointestinal bleeding is 2% to 3% for small bowel tumors ; use of enteroclysis, or double - contrast small bowel series, may increase the yield 6% to 10%. push enteroscopy should be the next step in the evaluation of all cases of gastrointestinal bleeding of obscure origin because diagnostic yield has been reported to be that of 5% to 20% for small bowel masses. other tests such as ct scan and endoscopic ultrasound have occasionally showed good results. in this case, the colonoscopy was of great importance because it gave us the information that the bleeding site was located within the limits of the jejunum and the ileum. following the endoscopic procedures, it was decided that the patient should be explored in the operative room given the negligible morbidity of a diagnostic laparoscopy. the rationale was that arteriography has a relatively high complication rate (up to 9%) that includes arterial thrombosis, embolization, and renal failure and success rates vary widely (14% to 72%) ; that radionuclide scanning is time consuming, and several reports in the literature are not encouraging ; that the bleeding site was located somewhere between the proximal jejunum and the ileum and given the patient 's age the likelihood of an etiologic factor that could be readily identified by laparoscopy. primary benign and malignant as well as metastatic neoplasms of the small bowel are rare entities, comprising less than 5% of all gastrointestinal tumors and 0.35% of all malignancies. gastrointestinal stromal tumors (gists) have been the subject of considerable debate since their earliest descriptions, with controversy centering on the cell of origin, line of cellular differentiation and the prediction of clinical behavior. it is hard to estimate the exact incidence of gist from previous reports in the literature. both benign and malignant stromal tumors may occur at any age and either sex. whereas most of them are asymptomatic, the most common presenting symptom is gastrointestinal bleeding ; other manifestations are obstruction, intussusception or, rarely, perforation. despite advances in technology, preoperative diagnosis of gist - specially of those in the small bowel most of these tumors are located in the stomach (47%), small bowel and rectum (11%), colon (7%), duodenum (5%) and esophagus (5%). both benign and malignant tumors can share a similar appearance, even when the latter tend to be bigger than the former. from a microscopic standpoint, there is not, however, a single immunohistochemical profile that allows one to predict the neoplasm 's biological behavior. generally accepted malignancy criteria include a diameter of more than 5 cm, invasion to nearby structures, necrosis, hypercellularity, increased nucleus / cytoplasm ratio, mitotic rate greater than 1 - 5 per 10 hpf, and infiltration of the overlying mucosa. sometimes, the term the greatest value of tests using proliferative markers is the possibility to re - classify with more precision tumors that were considered as borderline or of unknown biological conduct into high or low - risk groups. lymph nodes are affected in 7%-10% of cases, and rarely are extra - abdominal structures invaded : lung, subcutaneous tissue, brain, thyroid, bone, kidney, adrenals, heart, larynx, skin and spermatic cord. as gists are usually radio - resistant and insensitive to chemotherapeutic agents, the only curative therapy is surgical excision. it is likely that this tumor was present during the previous laparoscopic surgery, but a careful review of the video a posteriori did not reveal any abnormality during the abdominal inspection (although an examination of the small bowel was not done), and the patient did not have any evidence of anemia and/or any other gastrointestinal symptoms. laparoscopic surgery for small bowel obstruction, perforated diverticulitis, and for benign and malignant tumors of the small and large intestine has produced excellent results in experienced hands, although in some cases may require conversion to laparotomy and/or an assisted procedure. in the case herein presented, the tumor was localized immediately with the aid of a simple diagnostic laparoscopy, which allowed a successful assisted resection. it is recommended that in some selected, well - evaluated patients with lower gastrointestinal bleeding of unknown origin and stable vital signs, laparoscopy may provide a precise diagnosis and adequate treatment within the same procedure, avoiding the need for time - consuming studies with substantial morbidity and expense. | the authors report a case of a 29-year - old male patient with a severe lower gastrointestinal hemorrhage in whom a successful laparoscopic diagnosis and resection (assisted) of an ileal gastrointestinal stromal tumor (gist) was performed. laparoscopy can be very useful in the diagnosis and treatment of selected cases of lower gastrointestinal bleeding. |
retinal vein occlusion (rvo) is a multifactorial microvascular vitreoretinal eye disease, with complex mechanical, hemodynamic, and rheological shear stress, coagulation, as well as biochemical and immunological factors involved in its pathogenesis. regarding the pathogenesis of rvo, various proinflammatory cytokines and angiogenic growth factors induced by hypoxia have been implicated in increased microvascular permeability, inflammation, and fibroproliferation by controlling the inner blood - retinal barrier breakdown, extracellular matrix cytoskeletal remodeling, and endothelial - mesenchymal cell transition. especially, the presence of ischemia - regulated growth factors, such as vascular endothelial growth factor (vegf) and angiopoietin 2, as well as of matrix metalloproteinases has been implicated in the pathogenesis of rvo. in adults, pathological angiogenesis and lymphangiogenesis are dynamic hierarchical biological processes related to tissue ischemia / hypoxia in numerous conditions, such as cancer, inflammatory diseases, and various eye disorders [2, 3, 4, 5, 6, 7, 8 ]. in pathological conditions, the secondary ingrowth of lymphatic vessels can also occur in physiologically alymphatic parts of the eye. in lymphatic vasculature, the differentiating lymphatic endothelial cells (lecs) are known to express lymphatic vessel endothelial hyaluronan receptor 1 (lyve-1), podoplanin (pdpn), and prospero - related homeobox protein 1 (prox-1) [9, 10, 11 ], showing phenotypic variation according to anatomic location and functional state. interestingly, solitary adult blood ecs (becs) have the capability of clonal expansion, and some of the end - differentiated, mature vascular wall ecs have the potential to acquire stem cell - like characteristics in vivo in angiogenic disorders by turning on the adult stem / progenitor cell cd117 (c - kit) expression. in our study, we performed vitrectomy for the management of end - stage hemi - rvo coupled with vitreous hemorrhage (vh), fulminant intraocular neovascularization, and tractional retinal detachment (trd). we hypothesized that the natural development of hemi - rvo could rely on ischemia - induced lymphatic - like differentiation and adult vascular endothelial stem cell (vesc) proliferation. therefore, we investigated by immunohistochemistry (ihc) the pathogenesis of rvo - related neovessel formation focusing on multiple known lymphatic markers (lyve-1, pdpn, and prox-1), the vascular stem cell marker cd117 (c - kit), and the marker for active cell proliferation ki67. our study is considered important since the development of a treatment armamentarium for rvo remains a priority. to develop more effective treatments, the study was conducted according to the principles of the declaration of helsinki, and it was approved by the institutional review board of helsinki university central hospital and its ethical committee. we present a 58-year - old caucasian woman who had hypertension, hyperlipidemia, and hypothyreosis. the patient was examined in may 2011 in a private eye hospital when her visual acuity (va) was still full at 1.0 in both eyes. thereafter, she did not have regular ophthalmic controls until she developed acute painless central va loss in her left eye in august 2012. in the private eye hospital, biomicroscopic examination revealed inferior hemi - rvo with macular edema (me) and minor vh. the patient was admitted to the university eye clinic for laser treatment. on presentation at the helsinki university hospital eye clinic in september 2012, her va in the left eye had decreased to finger counting at 1 m, with tension measured by applanation tonometry being normal at 13 mm hg. slit - lamp examination of the anterior segment was normal, and the crystalline lens was clear. on dilated fundus examination, dense vh prevented an examination of the fundus structural details and also prevented documentation with fluorescence angiography and optical coherence tomography. ocular ultrasonography revealed some elevation in the inferior part of the retina. in october 2012, the left eye underwent 23-gauge vitrectomy (constellation vision system, alcon laboratories, inc., fort worth, tex. perioperatively, the patient was found to have hemi - rvo with fulminant floating neovessel formation at the optic disc and me with epiretinal fibrosis membrane situated in the macular area and along the inferior temporal retinal vascular arcade together with neovascularization as well as local trd (size of 3 disc diameters). the neovessel formation at the optic disc was excised and removed with microforceps (maxgrip, alcon laboratories) for ihc analysis. epiretinal and internal limiting membrane peeling was performed, and the ischemic inferior retinal hemisphere was laser photocoagulated at 180 degree with confluent spots. finally, the eye was filled with c3f8 (octafluoropropane) endotamponade, and the patient was seen 1 week after surgery to attach the detached retina. postoperatively, at the final follow - up visit in november 2012, the va was 0.4 on the snellen chart, and the intraocular pressure was normal at 14 mm hg. the inferior temporal retina was fully attached, and the photocoagulation had been well performed. her right eye was normal, with full 1.0 va on the snellen chart and normal fundus details. rabbit polyclonal antibodies against lyve-1 (abcam ; 1:100) and ki67 (ncl - ki67p, leica microsystems ; 1:3,000), mouse monoclonal antibodies against cd117 (k45, thermo scientific ; 1:100), -sma (1a4, sigma - aldrich ; 1:1,000), pdpn (d2 - 40, ventana ready - to - use reagent 760 - 4395, roche), and cd31 (jc70a, dako ; 1:50), as well as goat polyclonal antibodies against prox-1 (r&d systems ; 1:40) were used. briefly, the hemi - rvo neovascular membrane was fixed with 4%percnt ; paraformaldehyde for 3 h, immediately after surgical excision, washed in pbs, dehydrated, and embedded in paraffin. standard hematoxylin and eosin (h&e) staining was employed on each first and last section, before and after a series of sections had been cut for ihc staining. for ihc, sections were deparaffinized in tissueclear (tissue - tek) and rehydrated in graded ethanol series. antigen retrieval was performed by boiling the tissue sections in sodium citrate buffer or by treatment with 0.025%percnt ; trypsin for 30 min at % plus;37c. sections were subsequently incubated for 10 min in 0.6%percnt ; (v / v) hydrogen peroxide. tissue sections were then rinsed and incubated with blocking buffer (2.5%percnt ; normal horse serum ; vector laboratories) for 30 min. pretitrated dilutions of primary antibodies were incubated for 2 h in blocking buffer, followed by incubation with peroxidase - conjugated anti - mouse ig or anti - rabbit ig secondary antibodies for 30 min (-sma and cd31) or biotinylated anti - mouse ig or anti - rabbit ig secondary antibodies (lyve-1, prox-1, cd117, and ki67). for the staining of lyve-1, prox-1, cd117, and ki67 were incubation with peroxidase - labeled streptavidin (vectastain ; vector laboratories) for 30 min. subsequently, the sections were incubated for 10 min with biotinylated tyramine, followed by a 30-min incubation with peroxidase - labeled streptavidin. staining was developed by incubation with 3-amino-9-ethyl - carbazole solution (lyve-1, prox-1, cd117, and ki67) or with chromogen substrate diaminobenzidine (vectastain abc kit) according to the manufacturer 's instructions. after washes, slides were counterstained with hematoxylin (sigma), dehydrated, and mounted using cytoseal (for sma and cd31 ; electron microscopy sciences) or directly mounted with aquamount mounting medium (for lyve-1, prox-1, and cd117). immunofluorescence of paraffin sections was performed using alexa 488 and alexa 594 conjugated secondary antibodies, counterstained with dapi, and mounted with immumount mounting medium. light micrographs were taken using a leica dmlb microscope combined with a computer - controlled olympus digital camera and studio lite software. n plan 5, bf, 0.12 na, n plan 10, bf, 0.25 na, n plan 20, bf, 0.4 na, and n plan 40, bf, 0.65 na objectives were used. epifluorescence micrographs of immunofluorescence staining were obtained using zeiss axio imager z2 upright epifluorescence microscopes with a plan - apochromat 40, 0.75 na, objective lens., e.g., k.l., and p.s.) and an experienced pathologist (j.l.). five non - diabetic epiretinal or subretinal membranes were used as negative controls and melanoma sections as positive controls for cd31 and lyve-1, essentially as described in our previous study. in addition, cd31, pdpn, and prox-1 antibody specificities were confirmed on venolymphatic malformation of the human lip, containing dilated capillaries, small venules, and pdpn - positive slit - like lymphatic capillaries (fig. rabbit polyclonal antibodies against lyve-1 (abcam ; 1:100) and ki67 (ncl - ki67p, leica microsystems ; 1:3,000), mouse monoclonal antibodies against cd117 (k45, thermo scientific ; 1:100), -sma (1a4, sigma - aldrich ; 1:1,000), pdpn (d2 - 40, ventana ready - to - use reagent 760 - 4395, roche), and cd31 (jc70a, dako ; 1:50), as well as goat polyclonal antibodies against prox-1 (r&d systems ; 1:40) were used. ihc was done essentially as described in our previous report. briefly, the hemi - rvo neovascular membrane was fixed with 4%percnt ; paraformaldehyde for 3 h, immediately after surgical excision, washed in pbs, dehydrated, and embedded in paraffin. standard hematoxylin and eosin (h&e) staining was employed on each first and last section, before and after a series of sections had been cut for ihc staining. for ihc, sections were deparaffinized in tissueclear (tissue - tek) and rehydrated in graded ethanol series. antigen retrieval was performed by boiling the tissue sections in sodium citrate buffer or by treatment with 0.025%percnt ; trypsin for 30 min at % plus;37c. sections were subsequently incubated for 10 min in 0.6%percnt ; (v / v) hydrogen peroxide. tissue sections were then rinsed and incubated with blocking buffer (2.5%percnt ; normal horse serum ; vector laboratories) for 30 min. pretitrated dilutions of primary antibodies were incubated for 2 h in blocking buffer, followed by incubation with peroxidase - conjugated anti - mouse ig or anti - rabbit ig secondary antibodies for 30 min (-sma and cd31) or biotinylated anti - mouse ig or anti - rabbit ig secondary antibodies (lyve-1, prox-1, cd117, and ki67). for the staining of lyve-1, prox-1, cd117, and ki67 were incubation with peroxidase - labeled streptavidin (vectastain ; vector laboratories) for 30 min. subsequently, the sections were incubated for 10 min with biotinylated tyramine, followed by a 30-min incubation with peroxidase - labeled streptavidin. staining was developed by incubation with 3-amino-9-ethyl - carbazole solution (lyve-1, prox-1, cd117, and ki67) or with chromogen substrate diaminobenzidine (vectastain abc kit) according to the manufacturer 's instructions. after washes, slides were counterstained with hematoxylin (sigma), dehydrated, and mounted using cytoseal (for sma and cd31 ; electron microscopy sciences) or directly mounted with aquamount mounting medium (for lyve-1, prox-1, and cd117). immunofluorescence of paraffin sections was performed using alexa 488 and alexa 594 conjugated secondary antibodies, counterstained with dapi, and mounted with immumount mounting medium. light micrographs were taken using a leica dmlb microscope combined with a computer - controlled olympus digital camera and studio lite software. n plan 5, bf, 0.12 na, n plan 10, bf, 0.25 na, n plan 20, bf, 0.4 na, and n plan 40, bf, 0.65 na objectives were used. epifluorescence micrographs of immunofluorescence staining were obtained using zeiss axio imager z2 upright epifluorescence microscopes with a plan - apochromat 40, 0.75 na, objective lens., e.g., k.l., and p.s.) and an experienced pathologist (j.l.). five non - diabetic epiretinal or subretinal membranes were used as negative controls and melanoma sections as positive controls for cd31 and lyve-1, essentially as described in our previous study. in addition, cd31, pdpn, and prox-1 antibody specificities were confirmed on venolymphatic malformation of the human lip, containing dilated capillaries, small venules, and pdpn - positive slit - like lymphatic capillaries (fig. first, we examined cellular components and morphological features of the specimen by ihc and histological analysis in light microscopy. corresponding histological whole - tissue h&e staining showed a fibrotic state, with capillary - like vascular structures (fig. the hemi - rvo specimen displayed neovessels lined by a layer of cd31-positive becs, and these becs were covered by -sma - positive pericytes or smooth muscle cells (fig. 1b). next, we investigated possible lymphatic vessel involvement or potential lec differentiation by ihc for lec markers lyve-1, pdpn, and prox-1 (fig. 2). lymphatic - like capillary structures stained positive with lyve-1 antibody (fig. immunoreactivity for pdpn was not found in any vascular structures in our tissue but only outside lumen - like structures, representing potentially inflammatory macrophages or bone marrow - derived cells (fig. interestingly, nuclear staining of lymphatic - specific transcriptional factor prox-1 was observed in many cd31-positive lumen - lining ecs and adjacent cells (fig. as expected, slit - like pdpn - expressing lymphatic capillaries showed positivity for prox-1 (fig. 2c). notably, coimmunostaining of prox-1 and ki67 showed active proliferation of prox-1-positive lumen - lining cells (fig. to estimate the extent of the neoangiogenic process and stem cell - like properties in the hemi - rvo tissue, we analyzed the expression of the proliferation marker ki67 and the stem cell marker cd117 (c - kit ; fig. additionally, immunoreactivity for the active proliferation marker ki67 could be detected both in lumen - lining cells and, extravascularly, in our specimen. thus, the expression of the stem cell marker cd117 and ki67 is consistent with vesc activity. next, we investigated possible lymphatic vessel involvement or potential lec differentiation by ihc for lec markers lyve-1, pdpn, and prox-1 (fig. 2). lymphatic - like capillary structures stained positive with lyve-1 antibody (fig. immunoreactivity for pdpn was not found in any vascular structures in our tissue but only outside lumen - like structures, representing potentially inflammatory macrophages or bone marrow - derived cells (fig. interestingly, nuclear staining of lymphatic - specific transcriptional factor prox-1 was observed in many cd31-positive lumen - lining ecs and adjacent cells (fig. as expected, slit - like pdpn - expressing lymphatic capillaries showed positivity for prox-1 (fig. 2c). notably, coimmunostaining of prox-1 and ki67 showed active proliferation of prox-1-positive lumen - lining cells (fig. to estimate the extent of the neoangiogenic process and stem cell - like properties in the hemi - rvo tissue, we analyzed the expression of the proliferation marker ki67 and the stem cell marker cd117 (c - kit ; fig. additionally, immunoreactivity for the active proliferation marker ki67 could be detected both in lumen - lining cells and, extravascularly, in our specimen. thus, the expression of the stem cell marker cd117 and ki67 is consistent with vesc activity. this descriptive, morphologic, immunohistochemical study indicates that some intraocular lymphatic - like ec differentiation and vesc activity occur in the end - stage ischemic hemi - rvo neovessel formation. our unique neovessel specimen was considered to represent the natural outcome of hemi - rvo since no intervening confounding treatment such as laser photocoagulation or intravitreal anti - vegf agent had been given to the patient before vitreoretinal microsurgery. our novel findings support the potential involvement of lec - like endothelial differentiation towards lec signature together with stem cell activation in rvo pathogenesis, suggesting that the natural antilymphangiogenic mechanisms are overwhelmed in sight - threatening forms of rvo. by ihc, we could detect both lyve-1- and prox-1-positive vessel structures in our hemi - rvo neovessel specimen. we focused on these lec markers since they were known to most plausibly define the lymphatic vessels versus blood vessels [10, 14 ]. in our study, the excised hemi - rvo neovessel tissue specimen expressed both the best - characterized lec marker lyve-1 as well as the master regulator of lymphatic development, the nuclear transcription factor prox-1. thus, the lymphatic - like vessels observed in our hemi - rvo specimen could represent the true development of lymphatic - like vessels, and prox-1 could serve as the inducer of lymphatic reprogramming of becs to lecs. physiologically, lymphatic - like vessels are needed for tissue drainage (homeostasis), metabolism, and immune responses. in pathological fibrovascular rvo eye condition, lymphatic endothelial - like differentiation would occur as a tissue response to growing fluid and metabolic imbalance. until now, the potential role of pdpn in pathological lymphangiogenesis in adult vascular rvo has not been well explored. although, according to previous studies, pdpn is known to be one of the most highly expressed genes in lymphatic endothelium, it was not expressed in lumen - lining ecs in our hemi - rvo tissue sample, but rather in extravascular cells. while pdpn has been reported to be expressed also by e.g. inflammatory macrophages, the identity of these cells, as well as the reason for the lack of luminal pdpn expression, remain subjects for future studies probably, the developmental and/or the functional state of our hemi - rvo neovessels could relate to the lack of luminal pdpn expression, suggesting that the lymphatic vessels remained immature. that could explain why our hemi - crvo tissue specimen did not display all features of terminally differentiated lymphatic endothelium. interestingly, the same features of pdpn expression were also observed in our previous pdr study. notably, neoangiogenic mechanisms seemed to be activated in our hemi - rvo tissue specimen, since cd117 (c - kit) was expressed in the vessel - lining ecs. a previous experimental study had shown that a small subpopulation of cd117-positive ecs have proliferative capacity and the ability to differentiate toward functional ecs in adult blood vessel endothelium. indeed, according to that study, such a single c - kit - positive vesc could generate in vivo functional blood vessels that are capable of connecting to the host circulation. even though vescs were known to display long - term self - renewal capacity, leading to the growth of a greater number of proliferative daughter cells in an experimental study, it was unclear whether this mechanism could be relevant also in advanced ischemic human hemi - rvo. another possible explanation for our novel finding is that some end - differentiated mature retinal vascular wall ecs of our hemi - rvo eye were able to acquire stem cell - like characteristics in vivo by turning on the cd117 expression. our present work contradicts the current understanding that the intraocular posterior part of the human eye is devoid of lymphatics in ischemic hemi - rvo. our study suggests that also in a severe sight - threatening fibrovascular rvo milieu, the antiangiogenic mechanisms can be overwhelmed and the physiological immune privilege broken, supporting our findings of lymphatic endothelial - like differentiation also in pdr. in our study, the perfused, partially fibrotic neovascular tissue was situated at the optic nerve head. since our ihc data verified the presence of vessel - like structures that stained with major lec markers (lyve-1 and prox-1), we suggest that lecs might originate through sprouting from retinal venous becs also in an advanced pathological rvo condition. alternatively, tissue - resident and recruited circulating bone marrow - derived lec progenitor cells such as macrophages or mesenchymal precursor cells could participate in the process of lymphatic - like differentiation in our pathological hemi - rvo case. in the future, to further investigate the development of rvo, double staining with lyve-1%plus ; or prox-1%plus ; cd68 % plus ; macrophages should be performed. unfortunately, in our study, we only rely on the expression of lymphatic and neoangiogenic markers / antigens, but have no functional data to prove our hypothesis. however, recently, several in vivo and in vitro models of lymphangiogenesis have been developed. a further limitation of our study is that we have only examined one case with hemi - rvo. therefore, we need to be careful of conclusions which have been based on only one sample. the lack of surgical patients suffering from this disease prevents us from receiving enough representative tissue material for the study. presently, it is acknowledged that active angiogenesis in rvo eyes leads to vh, fibrosis formation, and ultimately to trd, glaucoma, and visual loss. thus far, the role of the lymphatic - like differentiation process in rvo has not been published. currently, only limited evidence of efficient treatment options exists for rvo, with intravitreal injections of anti - vegf agents emerging as a part of the first - line treatment, despite their potential, detrimental, long - term retinal side effects. our novel findings suggest that some lymphatic - like differentiation or bec - to - lec transdifferentiation occurs in the adult eye with hemi - rvo. this kind of plasticity between mature bec and lec phenotypes has been suggested by in vitro analyses more than a decade ago. our work suggests that the immune privilege in the posterior eye segment is devoid under a very advanced ischemic fibrovascular condition related to hemi - rvo. this finding is of great importance, considering the future treatment modalities for this devastating eye disease. our current study suggests that in addition to angiogenic mechanisms, lymphatic and neoangiogenic mechanisms seem to be implicated in the hemi - rvo pathophysiology as well, suggesting that current treatment modalities such as anti - vegf agents are and will not be efficient enough as therapeutic agents, but should potentially include the adjuvant anti - vegfr-3 agents, since, generally, lymphangiogenesis can be inhibited by blocking the vegf - c / vegf - d / vegfr-3 signaling pathway [5, 16 ]. additionally, knowledge of the mechanisms regulating lymphatic - like differentiation and progenitor cell activity would be an important topic of further research in other devastating vitreoretinal ischemic eye disorders, and, therefore, functional in vitro or in vivo studies seem a great necessity in the nearby future as well. our data also highlight the need to investigate vascular tube morphogenesis with ultrastructural analysis through transmission electron microscopy to unravel mechanisms underlying the pathological vascular hem- and lymphangiogenesis in rvo in more detail. | purposepathological vascular differentiation in retinal vein occlusion (rvo)-related neovessel formation remains poorly characterized. the role of intraocular lymphatic - like differentiation or endothelial progenitor cell activity has not been studied in this disease.methodsvitrectomy was performed in an eye with hemi - rvo ; the neovessel membrane located at the optic nerve head was removed and subjected to immunohistochemistry. characterization of the neovascular tissue was performed using hematoxylin and eosin, -smooth muscle actin, and the pan - endothelial cell (ec) adhesion molecule cd31. the expression of lymphatic ec markers was studied by lymphatic vessel endothelial hyaluronan receptor 1 (lyve-1), podoplanin (pdpn), and prospero - related homeobox protein 1 (prox-1). potential vascular stem / progenitor cells were identified by active cellular proliferation (ki67) and expression of the stem cell marker cd117.resultsthe specimen contained blood vessels lined by ecs and surrounded by pericytes. immunoreactivity for lyve-1 and prox-1 was detected, with prox-1 being more widely expressed in the active ki67-positive lumen - lining cells. pdpn expression was instead found in the cells residing in the extravascular tissue. expression of the stem cell markers cd117 and ki67 suggested vascular endothelial progenitor cell activity.conclusionsintraocular lymphatic - like differentiation coupled with progenitor cell activation may be involved in the pathology of neovessel formation in ischemia - induced human hemi - rvo. |
selective logging is the dominant commercial activity in forested areas of the tropics with strong conservation potential (frumhoff, 1995 ; struhsaker, 1997). this potential is arguably strongest in central africa, where a combination of weak communications and infrastructure, lack of logistics systems, and high transportation costs result in highly selective timber extraction, focusing on a few economically valuable species occurring at low densities (boardman., 2007 ; clark., 2009). during the last decade, the timber industry has thrived in central africa and many of the remaining forests have been allocated to timber concessions. with extraction rates of 14 trees harvested per hectare, damage to remaining forest this is compared to extraction rates of 510 trees per hectare and associated disruption of 2550% of the canopy typical of other forested regions of the tropics (skorupa, 1987 ; chapman., 2000). whereas some species of wildlife thrive in such low - intensity operations, even low - level extraction appears to have a negative effect on some primate species, including chimpanzees (white, 1992 ; barnes and lahm, 1997 ; white and tutin, 2001 ; matthews, 2004). although logging is known to reduce the abundance of some primate species due to associated hunting and the loss of food sources for frugivores (wilkie and carpenter, 1998 ; chapman., 2000), the potential role of parasite infections in such primate population declines remains largely unexplored. logging results in a suite of alterations in host ecology forest structure and human - wildlife overlap that may alter infection prevalence and infection risk in resident populations. patterns of parasitism in wildlife populations are influenced by host ranging patterns, density, intraspecific and interspecific contact rates, diet, and immune function (hudson., 2001 ; nunn., 2003 ; gillespie., 2005, 2008 ; beldomenico., 2008). studies on a variety of species have demonstrated that these characteristics can be affected by changes in forest structure (olupot., 1994 ; heydon and bulloh, 1997 ; patriquin and barclay, 2003). giardia and cryptosporidium are protozoal pathogens that infect humans, domestic animals, and wildlife worldwide (appelbee., 2005). in humans and livestock, these parasites cause diarrhea and other enteric disorders that can contribute to nutritional deficiencies and impaired weight gain (savioli., 2006 ; thompson, 2004). little information exists about the clinical affects of these parasites on their wildlife hosts ; however, environmental pollution with human fecal material is recognized as a potential pathogen pathway for wildlife infections with zoonotic protozoal parasites, such as giardia and cryptosporidium (appelbee., 2005). considering the capacity of such infections to put wildlife populations at risk, it is important to monitor the health status of wildlife in general and endangered species in particular. it is equally important to identify potential pathogen transmission pathways from humans and domestic animals to wildlife. to better understand the affect of selective logging on the transmission and persistence of these protozoal pathogens, we examined noninvasively collected fecal samples from 134 sympatric western lowland gorillas (gorilla gorilla gorilla) and chimpanzees (pan troglodytes troglodytes) in the northern republic of congo. we compared patterns of infection between ape samples from the kabo logging concession with those sampled from the adjoining undisturbed forest of the nouabal - ndoki national park. the sangha river tri - national conservation area (36,236 km) is notable for its extensive tracks of forest and transboundary protected area network : nouabal - ndoki national park in republic of congo, lobk national park in cameroon, and dzanga - ndoki national park and dzanga - sangha special reserve in central african republic (fig. 1). this region is largely unpopulated with human densities estimated at 0.7 to 0.8 people per km (auzel and wilkie, 2000). semi - nomadic baaka pygmies and bantu agriculturalist - fishermen live in complex, interdependent economic and social relationships (eves and ruggiero, 2000). most villages are along major waterways leaving the remote interior forest with little human development and associated pressures. however, commercial logging is rapidly expanding along the periphery of the tri - national conservation area. timber exploitation in these remote areas is relatively labor - intensive and can result in the transient relocation of skilled workers and their families, introducing the risk of novel opportunities for pathogen transmission from people to resident wildlife.figure 1land use in the sangha tri - national conservation area at the boundary of republic of congo, cameroon, and the central african republic. the goualougo triangle is located in the southern portion of the nouabal - ndoki national park. land use in the sangha tri - national conservation area at the boundary of republic of congo, cameroon, and the central african republic. the goualougo triangle is located in the southern portion of the nouabal - ndoki national park. the kabo logging concession (2800 km), operated by the congolaise industrielle des bois, has been logged to varying degrees for the past 40 years. the pristine forests of the adjoining goualougo triangle (310 km) were initially part of the kabo concession until biological surveys by the wildlife conservation society revealed the conservation significance of this region s great ape populations and their habitat. in june 2003, the congolese government announced that it would annex the majority of the goualougo triangle to the nouabal - ndoki national park (4400 km, 2.053.03n, 16.5116.56e). however, the adjacent forest remains in an active logging concession. as part of the goualougo triangle ape project s mandate to evaluate the impacts of logging on wild apes, this area was stratified into study zones (a, b1, b2, c, and d) with relation to the national park boundaries and logging activities (fig. 2). zone d was logged in the early 1970s, and zone c is slated for logging in the near future. all study zones are characterized by similar terra firma forest dominated by mixed species interspersed with monodominant gilbertiodendron dewevrei, seasonally flooded forest, and open swamp forests (morgan., 2006).figure 2location of study zones within the goualougo triangle (a, b1, and b2) and adjacent logging concession (c and d) in republic of congo. location of study zones within the goualougo triangle (a, b1, and b2) and adjacent logging concession (c and d) in republic of congo. between 2004 and 2009, we conducted repeated reconnaissance and line transect surveys for ape signs in zone d of the kabo logging concession and zones a and b1 within the goualougo triangle (morgan. our first surveys of zone d were conducted after forestry activities had been dormant for more than 30 years. ape fecal samples were collected opportunistically in the field and preserved in 10% neutral buffered formalin (gillespie, 2006). fecal samples were characterized as chimpanzee or gorilla based on morphological features. at similar sites using similar methods, samples characterized in this fashion were verified to the correct species more than 94% of the time by genetic methods, with field researchers able to correctly identify gorilla dung (318/324 = 98%) more often than chimpanzee fecal remains (200/211 = 94%) (arandjelovic, 2009, personal communication). when collected, fecal material was characterized as soft or firm depending on the consistency, assuming that sick apes will evacuate soft stools (gillespie., 2008). a merifluor cryptosporidium / giardia direct immunofluorescent detection kit (meridian bioscience, inc., cincinnati, oh) was used to detect both parasites (johnston., 2003). fecal samples were scored both for presence or absence of the pathogens as well as quantification of cryptosporidium sp. oocysts and giardia sp. cysts in feces. counts were calculated by analyzing 10 l of the 1 g / ml solution of concentrated feces from each sample. oocysts or cysts were then quantified by counting total numbers in 150 microscope fields (400 magnification) and extrapolating results to the entire sample. this method was validated by spiking negative fecal samples with known numbers of cryptosporidium sp oocysts and giardia sp. results were analyzed using epiinfo, version 3.3.2 (centers for disease control, atlanta, ga). a power analysis was conducted using the finite population correction for proportions (israel 1992). the corrected sample sizes are calculated using the original sample size results calculated using the equation for a large population. these numbers are based on a confidence level of 95% and level of precision of 0.05. the sangha river tri - national conservation area (36,236 km) is notable for its extensive tracks of forest and transboundary protected area network : nouabal - ndoki national park in republic of congo, lobk national park in cameroon, and dzanga - ndoki national park and dzanga - sangha special reserve in central african republic (fig. 1). this region is largely unpopulated with human densities estimated at 0.7 to 0.8 people per km (auzel and wilkie, 2000). semi - nomadic baaka pygmies and bantu agriculturalist - fishermen live in complex, interdependent economic and social relationships (eves and ruggiero, 2000). most villages are along major waterways leaving the remote interior forest with little human development and associated pressures. however, commercial logging is rapidly expanding along the periphery of the tri - national conservation area. timber exploitation in these remote areas is relatively labor - intensive and can result in the transient relocation of skilled workers and their families, introducing the risk of novel opportunities for pathogen transmission from people to resident wildlife.figure 1land use in the sangha tri - national conservation area at the boundary of republic of congo, cameroon, and the central african republic. the goualougo triangle is located in the southern portion of the nouabal - ndoki national park. land use in the sangha tri - national conservation area at the boundary of republic of congo, cameroon, and the central african republic. the goualougo triangle is located in the southern portion of the nouabal - ndoki national park. the kabo logging concession (2800 km), operated by the congolaise industrielle des bois, has been logged to varying degrees for the past 40 years. the pristine forests of the adjoining goualougo triangle (310 km) were initially part of the kabo concession until biological surveys by the wildlife conservation society revealed the conservation significance of this region s great ape populations and their habitat. in june 2003, the congolese government announced that it would annex the majority of the goualougo triangle to the nouabal - ndoki national park (4400 km, 2.053.03n, 16.5116.56e). however, the adjacent forest remains in an active logging concession. as part of the goualougo triangle ape project s mandate to evaluate the impacts of logging on wild apes, this area was stratified into study zones (a, b1, b2, c, and d) with relation to the national park boundaries and logging activities (fig. 2). zone d was logged in the early 1970s, and zone c is slated for logging in the near future. all study zones are characterized by similar terra firma forest dominated by mixed species interspersed with monodominant gilbertiodendron dewevrei, seasonally flooded forest, and open swamp forests (morgan., 2006).figure 2location of study zones within the goualougo triangle (a, b1, and b2) and adjacent logging concession (c and d) in republic of congo. location of study zones within the goualougo triangle (a, b1, and b2) and adjacent logging concession (c and d) in republic of congo. between 2004 and 2009, we conducted repeated reconnaissance and line transect surveys for ape signs in zone d of the kabo logging concession and zones a and b1 within the goualougo triangle (morgan., 2006, 2009). our first surveys of zone d were conducted after forestry activities had been dormant for more than 30 years. ape fecal samples were collected opportunistically in the field and preserved in 10% neutral buffered formalin (gillespie, 2006). fecal samples were characterized as chimpanzee or gorilla based on morphological features. at similar sites using similar methods, samples characterized in this fashion were verified to the correct species more than 94% of the time by genetic methods, with field researchers able to correctly identify gorilla dung (318/324 = 98%) more often than chimpanzee fecal remains (200/211 = 94%) (arandjelovic, 2009, personal communication). when collected, fecal material was characterized as soft or firm depending on the consistency, assuming that sick apes will evacuate soft stools (gillespie., 2008). a merifluor cryptosporidium / giardia direct immunofluorescent detection kit (meridian bioscience, inc., cincinnati, oh) was used to detect both parasites (johnston., fecal samples were scored both for presence or absence of the pathogens as well as quantification of cryptosporidium sp. oocysts and giardia sp. cysts in feces. counts were calculated by analyzing 10 l of the 1 g / ml solution of concentrated feces from each sample. oocysts or cysts were then quantified by counting total numbers in 150 microscope fields (400 magnification) and extrapolating results to the entire sample. this method was validated by spiking negative fecal samples with known numbers of cryptosporidium sp oocysts and giardia sp. cysts. results were analyzed using epiinfo, version 3.3.2 (centers for disease control, atlanta, ga). a power analysis was conducted using the finite population correction for proportions (israel 1992). the corrected sample sizes are calculated using the original sample size results calculated using the equation for a large population. these numbers are based on a confidence level of 95% and level of precision of 0.05. three of 34 chimpanzee samples (8.82%) from the logged site, 1 of 33 chimpanzee samples from the undisturbed site (3.03%), 0 of 31 gorilla samples from the logged site (0%), and 1 of 36 gorilla samples from the undisturbed sites (2.78%) were infected with giardia sp. (table 1). prevalence of infection with giardia sp. was not significantly different between logged and undisturbed forest for chimpanzees (= 1.00, p = 0.32, degrees of freedom (df) = 1) or gorillas (= 0.87, p = 0.35, df = 1).table 1prevalence and intensity of cryptosporidium and giardia spp. in chimpanzees and gorillas in the goualougo triangle of nouabal - ndoki national park and kabo logging concession, republic of congospeciespopulationsamplescryptosporidiumgiardiaprevalence (%) mean intensityprevalence (%) mean intensitychimpanzeegoualougo33003.031000kabo34008.821833 573.49gorillagoualougo36009.78900kabo310000mean intensities are expressed as oocysts (cryptosporidium) or cysts (giardia) per gram, standard error of the mean ; negative samples are not included in this calculation. prevalence and intensity of cryptosporidium and giardia spp. in chimpanzees and gorillas in the goualougo triangle of nouabal - ndoki national park and kabo logging concession, republic of congo mean intensities are expressed as oocysts (cryptosporidium) or cysts (giardia) per gram, standard error of the mean ; negative samples are not included in this calculation. of all 67 chimpanzee samples, one was characterized as soft (1.5%) and the remainder as firm (98.5%). of all 67 gorilla samples, 3 were characterized as soft (4.5%) and the remainder as firm (95.5%). there was no relationship between fecal consistency and giardia infection status for chimpanzees (= 0.00, p = 0.78, df = 1) or gorillas (= 0.07, p = 0.78, df = 1). our power analysis demonstrated that additional zone d chimpanzee sampling would be required to ensure that the lack of significance observed in intersite comparisons of chimpanzees giardia sp. prevalence is indeed valid (47 zone d compared with the 34 collected thus far). samples were collected during repeated line transect surveys during a period of 5 years. three to five samples can be collected in a day by a team of five trackers. samples are collected by backtracking sighted apes to find feces voided within the past hour. aged feces, such as those from night nests are not collected. due to these limitations, we regard the lack of significant differences in giardia sp. prevalence between sites for chimpanzees to be preliminary. we also compared the intensity of infection for each ape species between logged and undisturbed sites. the mean intensity of infection was highest in chimpanzees from the disturbed site (1833 573.49 cysts / g), followed by chimpanzees in the undisturbed site (1000 cysts / g). mean intensity of infection was slightly lower for gorillas from the undisturbed site (900 cysts / g), and no infections were found in gorillas from the disturbed site, resulting in an intensity of zero (table 1) ; mean intensities of infection could not be compared statistically across sites due to rarity of infection. our results demonstrate that giardia sp. is present at low prevalence in chimpanzees and lowland gorillas in undisturbed forests and forests with a history of selective logging. in these same populations a lack of cryptosporidium sp. in all samples examined suggests that cryptosporidium sp. is not a natural component of ape parasite communities at this site and that historical land - use patterns are not exposing apes to zoonotic sources of this pathogen. regardless of historical land - use patterns suggest that a low level of circulating giardia is a natural component of congolese ape parasite communities and that historical land - use patterns are not exposing apes to zoonotic sources of this pathogen. our study area is located only 32 km from the nearest village and the large river that serves as a major transportation source for the region. however, the forest is continuous and the encounter rate of human signs in the study zones was low, which confirms that these forests have remained relatively undisturbed despite past timber exploitation. this post - logging scenario is much different than the high human densities and forest fragmentation typical in east and west africa. giardia and cryptosporidium are notable for cross - species transmission (thompson, 2004). the propensity of these protozoans to cross species barriers results from the host nonspecificity of trophozoites of either genus, and the high infectivity and environmental stability of giardia cyst and cryptosporidium oocysts (smith and nichols, 2006). previous field - based studies confirm this pattern, demonstrating that high levels of primate (nizeyi., 2002 ; graczyk., 2001a, b ; graczyk. the results of the current study are the first to examine the long - term effects of historical primate human overlap on contemporary patterns of infection with these pathogens. considered among the most common human intestinal protozoa, giardia ranges in clinical presentation from asymptomatic to highly pathogenic, causing chronic malabsorptive diarrhea in some patients (thompson, 2004). both host factors (e.g., nutrition, immunity, coinfection with other agents) and pathogen factors (e.g., strain, infectious dose) are thought to contribute to the severity of clinical disease (thompson, 2000). giardiasis is now considered by the world health organization to be a neglected disease, due to its ubiquity in equatorial latitudes, its chronic detrimental health effects (especially in children), its propensity to infect economically disadvantaged populations, and the paradoxical availability of relatively inexpensive and effective pharmaceuticals for its treatment (savioli., 2006). in our study, we found no relationship between infection status and fecal consistency (soft vs. firm). the lack of a strong measurable association between infection and acute gastrointestinal symptoms in our study population was surprising, but it is concordant with recent studies of humans. although giardia is associated with clinical diseases in developed economies, evidence is nevertheless mounting that it may be commensal in rural settings where people may normally be exposed to diverse parasite communities from an early age. for example, perz cordn. (2008) found giardia at 28.1% prevalence in diarrheic peruvian children, as well as in 19.5% of nondiarrheic children, emphasizing the importance of asymptomatic patients in giardia transmission where hygiene and sanitation are poor (perz cordn., 2008). ethiopia (ayalew., 2008), bangladesh (dib., 2008), and peru (hollm - delgado., 2008) have found similarly weak or nonexistent associations between g. duodenalis infection status and gastrointestinal symptoms, suggesting that g. duodenalis may coexist benignly with human hosts under conditions where acquired immunity to the pathogen can develop. lack of early exposure and acquired immunity to g. duodenalis may, in fact, account for the role of the pathogen as a cause of sporadic diarrheal outbreaks in developed countries (istre., 1984), as well as a major cause of traveler s diarrhea for people from developed countries who visit endemic areas (reinthaler. we hope to explore in detail the association between symptom and infection in apes in more detail in future work. our results from the goualougo triangle provide a rare opportunity to observe baseline patterns of infection in undisturbed ape populations. baseline patterns of parasitism are necessary to understand both individual animal health status and to assess what would constitute an outbreak : a level of disease or parasitism in excess of what is normally observed. thus, these results provide a first step toward an index of population health and disease risk assessment for conservation and management plans of these endangered african ape populations. our results from the kabo concession suggest that a legacy of low - intensity selective logging did not result in the persistence of elevated prevalence of cryptosporidium sp. and giardia sp. in these ape populations. it is encouraging that the resident ape populations are not suffering from infections of these protozoa, because this suggests such potential health threats may be mitigated. however, if these protozoa are exceptionally pathogenic in wild ape populations, infected individuals may have been removed from the population long ago due to high associated mortality. we have yet to examine how patterns and risk of parasitism may differ during the various stages of the active logging process (i.e., exploration, road construction, and timber harvesting) from those that are the product of a legacy of selective logging. the expansion of timber activities in the neighboring undisturbed forests of the kabo concession will enable us to address these questions through an ongoing progressive monitoring program that involves documenting ape populations, human disturbance, and the health implications during their interactions. | many studies have examined the long - term effects of selective logging on the abundance and diversity of free - ranging primates. logging is known to reduce the abundance of some primate species through associated hunting and the loss of food trees for frugivores ; however, the potential role of pathogens in such primate population declines is largely unexplored. selective logging results in a suite of alterations in host ecology and forest structure that may alter pathogen dynamics in resident wildlife populations. in addition, environmental pollution with human fecal material may present a risk for wildlife infections with zoonotic protozoa, such as cryptosporidium and giardia. to better understand this interplay, we compared patterns of infection with these potentially pathogenic protozoa in sympatric western lowland gorillas (gorilla gorilla gorilla) and chimpanzees (pan troglodytes troglodytes) in the undisturbed goualougo triangle of nouabal - ndoki national park and the adjacent previously logged kabo concession in northern republic of congo. no cryptosporidium infections were detected in any of the apes examined and prevalence of infection with giardia was low (3.73% overall) and did not differ between logged and undisturbed forest for chimpanzees or gorillas. these results provide a baseline for prevalence of these protozoa in forest - dwelling african apes and suggest that low - intensity logging may not result in long - term elevated prevalence of potentially pathogenic protozoa. |
conventional biomedicine is giving way to an expanded, integrative medical model that emphasizes healthcare as well as illness care, treats people not just diseases, and incorporates multiple therapeutic approaches, old and new, to offer patients greater choice. this emerging model questions the dominant biomedical paradigm of molecular reductionism that focuses on genes, proteins encoded by genes, and molecules synthesized by proteins and that is based on an inherent belief that complex systems can be understood by identifying their components. by contrast, an integrative model of health and medicine appreciates the complexity of our biology, which can give rise to emergent phenomena that are not, in general, predictive from isolated parts. such a model also views health - care from several perspectives beyond the molecular approach, including what has been called energy medicine. advances in biophysics, biology, psychology, and the developing fields of mind - body research such as psychoneuroimmunology and psychosocial genomics have helped substantially to form a foundation for this expanded integrative medical model. in addition to biochemical signals, the idea that living systems generate and respond to energy fields as integral aspects of physiological regulation reflects a convergence of several disparate paths. numerous spiritual traditions describe modes and pathways of energy within and surrounding the physical body (jain, 2015, this issue). many complementary and alternative medicine (cam) therapies utilize variants of laying - on - of - hands and other minimally invasive procedures to improve endogenous energy flows. moreover, western biomedicine routinely examines electrical fields from the heart (via electrocardiogram [ecg ]) and brain (via electroencephalogram [eeg ]) as indices of clinical pathology. furthermore, contemporary cell biology and biophysics provide evidence that endogenous electromagnetic and other types of fields play active roles in development, tissue repair, and an array of homeodynamic processes. the term biofield fills the need for a unifying concept to bridge traditional and contemporary explanatory models of energy medicine and provides a common language for aspects of both clinical practice and scientific research that focus on energy fields of the body. this paper summarizes the recent origins of the biofield concept and describes the levels of scale for which the term has been applied, from biophotons and cell membranes to whole organisms to gaia and the tao. working definitions of biofield and related terms are offered with the proviso that such descriptions are and should be based in the cultural and scientific vantage points of the observers and may not always be completely comparable. in this light, in their descriptions of the biofield, a tibetan buddhist, a neurologist, a reiki practitioner, a cell biologist, and a physicist (classical or quantum) enrich us all and bring us closer to a complete understanding of this emerging concept. the term biofield was proposed in 1992 by an ad hoc committee of cam practitioners and researchers convened by the newly established office of alternative medicine (oam) at the us national institutes of health (nih). the committee was one of several meeting as part of an nih / oam - hosted conference in chantilly, virginia, to inform the oam as it established its program priorities and initiatives. manual medicineconsisting of structural and manipulative approaches such as chiropractic, classical osteopathy, and massage and energetic therapies such as reiki, therapeutic touch, and external qigong. most of the latter group of healing modalities were founded on a concept of a vital force, although each has its own explanatory model and terminology that reflect a particular cultural context. the committee sought to bring unity to the diversity of energetic practices by creating a term that would be amenable to the scientific and broader healthcare communities. such a term was also needed to describe a central organizing biological field that healers were detecting and interacting with in their practice. the term biofield was coined for these purposes with the hope that it would be generic and malleable enough to fit differing explanatory models of therapy. the committee defined biofield as a massless field, not necessarily electromagnetic, that surrounds and permeates living bodies and affects the body. subsequently, one committee member succeeded in getting the term biofield accepted as a medical subject heading (mesh term) at the national library of medicine so that it became an official search term for scholars to locate peer - reviewed literature. further, the committee sought to consolidate the diverse modes of energetic healing under the single term biofield therapies, which was also accepted by the nih. an additional realization was that both diagnostics and therapeutics may be involved in these biofield modalities. subsequently, a round of frontier medicine research grants in biofield science was funded by the national center for complementary and alternative medicine, the successor to the oam. simultaneously, another of the 1992 ad hoc committees advising the oam categorized distant healing or distant healing intentionremote healing over a distance performed through intention and/or intercessory prayer as a mind - body modality. thus, energy healing that was performed locally by healers directly on patients, which had been termed biofield therapy, was separated from distant healing due to this initial categorization. a rationale for this separation between local and distant healing was that they may operate by different modes of action. whereas local or proximal energy healing might involve electromagnetic fields (emfs) that diminish over distance by an inverse square law, the same fields are unlikely to be involved in healing across large distances. however, local and distant healing are commonly performed by the same practitioner, such as in reiki, which poses a conundrum. democritus, who coined the word atom, maintained that everything, including organisms, is reducible to its constituents, while aristotle held that life processes are autonomous and organisms are integral wholes. these 2 viewpoints remain today, with the biochemical view of life represented by molecular reductionism and a holistic view that embraces a field concept of life. in science, the notion of a vital force or lan vital dates back to the 1600s. in vitalism, living matter was believed to involve a life force : a metaphysical entity intrinsic to life that renders it alive. experimental electrophysiology had replaced the notion of vital force with electricity, effectively banishing vitalism from biological science. nevertheless, many contemporary cam practitioners continue to use terms from non - western explanatory models and medical systems to evoke a vital force or vital energy. for example, there is qi (chi) in chinese medicine, ki in japanese medicine, prana in ayurveda, and similar terms in other traditions of indigenous medicine. these descriptions of life energy originated from metaphysical considerations of the nature of consciousness and its interaction with mental, emotional, and physical systems (jain, 2015, this issue) and were based on first - person observations by adept spiritual practitioners. in the modern age, the notion of a universal life energy is nearly ubiquitously employed by energy healing practitioners, who often describe energy coming from their hands and other parts of the body. these same practitioners report utilizing energy awareness not only to sense imbalances in patients ' energy fields but to regulate energy flow and release energy blockages perceived to be impeding the healing process. most traditional healing practices maintain that disease starts with an energetic imbalance such as a blockage or other irregularity in the energy flow through the body. modern cam systems such as chiropractic, homeopathy, and classical osteopathy are also founded on principles of a vital force. the scientific concept of force, however, is very much in the physical realm, whereas the vital force at the basis of many cam therapies is considered by mainstream science to be a metaphysical concept. the concept of a field from physics refers to a spatially distributed nonmaterial element that is able to impart a force upon an object within it. therefore, a field can not be detected directly but only through its action upon a suitable probe for example, a charge in an electric field. contemporary physics holds that there are only 4 types of force operating throughout nature : gravity, electromagnetism, and the strong and weak nuclear forces, the latter 2 having a range limited to the atomic nucleus. a particular form of energy (defined in physics as the ability to do work : ie, to move a particle through a distance) is associated with each force : for example, electric, magnetic, and electromagnetic energies are associated with the electromagnetic force, which is most important in living systems. the concept of the biofield as proposed herein is firmly grounded in science, although other putative fields, as yet unknown to science, may also be involved. the concept of a biological field first arose in embryology as an underlying informational template to explain the developmental process. the ukranian histologist alexander gurwitsch, phd, coined the term morphogenetic field to describe the highly coherent and dynamic process that appeared to be guiding development of the unfolding embryo as well as biological regeneration. gurwitsch also discovered mitogenetic radiation, ultraviolet light emission during cell division in onion roots. from 1900 to 1950, other prominent developmental biologists including hans driesch, paul weiss, and others worked from this same perspective. weiss, who discovered that the morphogenetic field was unchanged if he removed portions of embryonic tissue, proposed that the biological field was a holistic property of the entire organism. these early embryologists formed the concept of a morphogenetic field guiding development but did not determine its physical basis. the biofield concept soon gained traction and was extended from an entity that surrounds and permeates living bodies to include a more extensive variety of endogenous phenomena generated by living bodies. it has also been scaled - up to test its fit to macrolevel concepts including gaia, a model of our planet as a complex, self - regulatory system. thus, at this point in time, the concept of biofield may be better considered in its plural form of biofields. from this perspective, the term may continue to be usefully applied across a broad range of disciplines, in manners both evidence - based and speculative, including biophysics, cell biology, therapeutics, and ecology. one line of research on endogenous biofields followed from the early discovery by gurwitsch, as mentioned above, of ultraviolet light emission during cell division. recent studies have reported evidence for a variety of biophoton - mediated regulatory processes, including cell - cell communication, cell - cell orientation sensing, secretion of regulatory neurotransmitters, modulation of respiratory activity in white blood cells, and accelerated seed germination. these findings, as well as results of research correlating biophoton emission with human physiology, suggest the existence of coherent biophoton fields that play fundamental roles in intercellular signaling and human health. more generally, a wide variety of bioelectromagnetic activities has been identified, often associated with interaction energies substantially below that of thermal noise, which produce clinically significant effects, including enhancement of growth, wound repair, regeneration, and the reduction of pain and inflammation. in addition, field - like phenomena appear to contribute to the underlying principles of biological organization, including embryonic development and the coordinated maintenance of biological structure and function. for example, regenerative healing of whole limbs in animals such as salamanders has been shown to involve emfs, and limb regeneration in higher animals has also been stimulated by means of externally applied emfs. more recently, the patterning of arrays of cell membrane resting potentials has been shown to play key roles in directing stem cell behavior during embryogenesis and in complex organ regeneration. the biofield, or information associated with it stemming from multicellular electrical activity, is also the basis of a decades - old clinical tool most commonly in the form of the ecg (the detector of electrical wave forms generated by synchronous activity of heart muscle cells) and eeg (the detector of wave forms reflecting summative spontaneous or evoked electrical activity of neuronal arrays). while the ecg and eeg are readily detected from the body surface, the heart 's magnetic field, generated by moving electric charges associated with electrical activity, can be recorded up to several feet from the body surface via a magnetocardiogram. magnetic fields produced by the heart appear to carry information that may be detectable by other persons or animals. an example of the informational potential (bioeffectiveness) of these heart fields is cardiac - induced entrainment (or frequency locking) detected when the r - waves of one subject 's ecg become precisely synchronized with the onset of eeg alpha waves of another subject at a distance up to 5 feet. at the interpersonal level, the biofield concept encompasses a large body of research on the effects of biofield therapies, as practiced both locally with the practitioner in the same room as the patient (jain, 2015, this issue), animals, or cell cultures (gronowicz, 2015, this issue), and nonlocally, which includes distant mental interaction with living systems, as well as intercessory prayer and distant healing (radin, 2015, this issue). studies with biofield therapies in clinical settings reflect the propensity of certain practitioners and schools of healing to perform therapy with hands on and/or hands off the body, therapeutic touch, and healing touch which raise questions about the physical effects of touch itself on biofield interactions and outcomes. however, recent reviews examining nontouch biofield therapies also report significant changes in outcome measures, suggesting that effects of biofield therapies on outcomes may not be ascribed only to effects of physical touch, and an explanation in terms of quantum entanglement or other nonlocal causes may be needed. the term biofield may even be invoked to explain fundamental properties of individual molecules by considering them as ordered electromagnetic structures. the argument can be made that molecular interactions, such as between hormone and receptor, are those usually described at close range eg, ionic, hydrophobic, and aromatic pi - electron interactions. such properties, however, do not explain how molecular partners attain proximity to each other ; the necessary preludes to docking are unlikely to occur via simple diffusion and brownian motion. resonant recognition model in which molecules are attracted to their targets by a form of electromagnetic resonance, which clearly falls within the biofield rubric. at the planetary level, there is increasing evidence that the biofield concept can include effects of geocosmic fields on human health and behavior : for example, solar storms that significantly perturb the geomagnetic field correlate with increased rates and mortality from myocardial infarction. early biofield studies were motivated in part by the many cam modalities that appear to involve energy and/or informational fields and are broadly known as energy medicine. these include energy healing, homeopathy, acupuncture, magnet therapy, bioelectromagnetic therapies, electrodermal therapy, and applied kinesiology, among others. some of these modalities involve novel ways of obtaining useful information from the body 's energy field as well as applying energy fields therapeutically. laying on of hands is one of the oldest, most ubiquitous forms of healing known to humankind, apparently having emerged independently among ancient cultures worldwide. the father of modern western medicine, hippocrates, referred to it as the force which flows from many people 's hands. there are a growing number of studies on this and other related biofield healing modalities (as indicated in other articles in this journal issue) demonstrating a spectrum of beneficial results from the psychological and behavioral levels down to clinically relevant bio - markers. another area is bioelectromagnetic medicine, where it has now been demonstrated that nonthermal emfs, often with interaction energies substantially below that of thermal noise, produce a wide variety of clinically significant effects, including enhancement of growth, wound repair, regeneration, and the reduction of pain and inflammation. in addition, the underlying principles of biological organization, including embryonic development and the coordinated maintenance of biological structure and function, are beginning to be better understood, with evidence suggesting that field - like phenomena underlie many of these processes as described earlier. field effects have also been invoked as explanations of a large body of research on human intention effects and nonlocality. recent reports with relevance to cam practices include effects on cultured cells, seed germination, and distant healing of surgical wounds. further, several studies have reported eeg correlations between isolated human subjects with in vitro corroboration using neurons adhering to printed circuit boards. experiments performed with shielding suggest that some of these results are not mediated by emfs, perhaps suggesting a role for quantum entanglement or another nonlocal process. such phenomena, which clearly call for scientific explanations at levels of organization beyond the molecular realm, may be explained by a common model of biofield effects. concepts of sentience, mind, and consciousness have also evolved from the mechanistic approach of biochemical neuroscience to a field - oriented approach. the application of quantum theory to these concepts has led to several proposals of the body - mind as a macroscopic quantum system. while the predictive power of these models is as yet unclear, there is increasing experimental evidence showing quantum signaling, communication, and conductivity in the cytoskeletal network of microtubules, and the electric fields generated by synchronized oscillations of microtubules have been demonstrated to play key roles in the regulation of cell division and chromo - some folding and transcription. similarly, it has been proposed that the acupuncture system and the patterning of cell resting potentials described above act through the continuum of liquid crystalline collagen fibers that make up the bulk of the connective tissues. in this model, supported by evidence from biochemistry, cell biology, biophysics, and neurophysiology, the collagen matrix provides pathways for rapid intercommunication throughout the body, enabling the organism 's mind - body to function as a coherent whole. together, these results describe the mind - body as an interconnected system in which electromagnetic and quantum interactions act through field - coherent oscillatory activity to regulate biological processes and mediate interactions correlated with sentience and mental activity. as a regulator and mediator of biological interactions, the biofield appears intimately connected with information delivery within the organism. the biofield thus holds and conveys information that is vital for biocommunication and bioregulation. here it must be said that the concept of information in biology is nothing new ; it is already used successfully to explain numerous molecular mechanisms in molecular biology, such as information encoded in dna, hormone - receptor interactions, enzyme - substrate interactions, and many other forms of molecular recognition, as well as in ecg and eeg data. further, many of these well - understood mechanisms may also be thought of as biofield interactions because information itself is often an emergent property of dynamical interactions that can not be meaningfully understood from a reductionist viewpoint. at the cellular and subcellular levels, oscillatory behaviors emerge from negative feedback loops and coupled positive and negative feedback loops and result from stochastic, nonlinear biological mechanisms interacting with the fluctuating environment. for example, the emergence of phase - synchrony across large numbers of cells in circadian cooperative systems is the result of nonlinear coupling of oscillators across the cellular and multicellular levels. similarly, electrically phase - coupled systems in neuronal networks give rise to cooperative behaviors across large numbers of neurons. the concept of biofield regulation offers a shift from a mechanical, chemistry - based view of biology to an information - based view. unlike machines, living organisms have an immense network of internal and external interconnections across which information flows to modulate life functions. furthermore, new relationships along with new information exchanges emerge at higher levels of organization in life, forming new wholes. the biofield may be considered one such multilevel organizational concept in which information flows within and between the various levels of the organism. a wealth of information exchange, much like a conversation between the elements of these various levels of order the whispering between cells and other units of life is critical to sustaining life and promoting healing. biofield information can manifest beyond mechanistic concepts ; bioelectromagnetic medicine presents another example of the informational aspect of biofield interactions. the concept of electromagnetic bioinformation was advanced by fritz - albert popp to describe findings that biophotons and other extremely low - level energy transactions in bioelectromagnetics below the thermal noise limit could induce biological effects. in addition to the above - mentioned weak emf effects, a large body of literature has demonstrated the existence of nonthermal emf resonance interactions. bioeffects often occur only for particular frequencies, amplitudes, or waveforms, and the precise location of resonances is in general determined by the characteristics of the emf / biological target system, which can vary with changes in state of health, disease, or injury. entrainment of physiological functions such as eeg and ecg with external fields may be also seen as induced synchronization, which constitutes a flow of information from an external field to the body. furthermore, other elements of the biofield may carry information important for medical diagnostics, beyond the eeg and ecg, that provide useful medical information and suggest new modes of treatment via informational medicine. indeed, information offers a unifying concept in the modus operandi of cam and integrative medical modalities. while information is exchanged across multiple levels of order in living systems, perhaps the most definitive information flow in humans is from the top down, from intention to the material body, to affect health and promote healing with conscious intention, purpose, context, and meaning. information may thus be seen to mediate or serve as a bridge between mind and body : for example, in mind - body modalities, intent to heal, etc.. however, bell 's theorem (quantum nonlocality) supports observations of instantaneous interaction between entangled states. the quantum potential function conveys active information everywhere, as does the morphogenetic field, with no diminution over distance. information may thus be everywhere instantaneously, but it is active only where it is specifically directed for example, by conscious intent and may be considered intelligent information, producing a very specific response only where it is intended. thus, information itself may be considered causal even though it does not always have a physical carrier. as described above, the biofield has evolved into a multiscale concept that offers a broader context for understanding biological regulation and information flow than does the currently dominant molecular paradigm of biological systems. as such, a biofield, whether at the level of biophotons, patterns of cell membrane resting potentials, eeg of brain, ecg of heart, or the synchronous movements of birds in flight, can succinctly be described as an organizing influence distributed over space and time. while biofields have most often been described as electromagnetic in nature, there have been several proposals of biofields involving quantum information flow. in their organizing capacity, it seems more useful to speak of biofields in terms of their homeodynamic activities than as individual entities : ie, to describe what they do rather than what they are. as presented earlier, the concept of a field from physics refers to a nonmaterial element that interacts with an object and a field can not be detected directly but only through its action upon a probe. thus, biofield interactions can influence and be influenced by a variety of biological pathways including biochemical, cellular, and neurological processes as they modulate activity and information flow across multiple levels of living systems. at this stage, the biofield may be considered as a massless or information - based organizing principle in accordance with the original definition proposed by the 1992 nih advisory committee. finally, it is of interest to reflect again on the relation of the biofield concept to energy medicine, a term especially in vogue in the latter part of the 20th century. while biofields play a substantive role in guiding health processes, here they are conceived as playing a broader regulatory and informational role in biology than solely as a form of medical intervention as implied by energy medicine. the term biofield therapy, which involves healer - based interactions with biofields both within and around living systems, best captures this aspect of healing beyond limited implication of medicine as a treatment for illness. the biofield concept, emerging initially from vitalist perspectives, offers an increasingly useful approach to explain a variety of physiological phenomena. endogenous biofield interactions with environmental, geocosmic, and other exogenous fields provide the rudiments of a scientific foundation for a holistic view of life and a modus operandi for numerous cam modalities. the family of energy healing practices that have been widely practiced since antiquity, now called biofield therapies, may involve biocommunication and/or energy transfer through the biofield. while the biofield concept is a useful construct to guide new research on energy healing and other cam modalities, it is also a requisite for a better understanding of contemporary developments in biophysics and biology. moreover, information connected with the biofield may serve as a bridge between mind and body, which is fundamental to understanding mind - body interactions. there are numerous examples from the history of science where metaphor and analogy have been key elements in the construction of successful theories. the use of metaphor in science is especially appropriate and critical for success in the exploratory phase of investigation when detailed descriptions and theories are unavailable. metaphors provide foundational material for forming hypotheses, conducting studies, and eventually elucidating testable theories. scientific metaphors can be key elements for posing truly novel questions, which upon experimental testing, advance our knowledge and understanding. the concept of the biofield, while still in its nascent stages, may well serve this purpose as biology moves from a local, chemistry - based model to an interconnected, information - based viewpoint. further investigations in biofield science and healing, especially those involving multidisciplinary collaborations including clinical and preclinical trials, physiology, biophysics, device technology, and theoretical and philosophical models will guide the way to a new paradigm in biology and medicine. | biofield science is an emerging field of study that aims to provide a scientific foundation for understanding the complex homeodynamic regulation of living systems. by furthering our scientific knowledge of the biofield, we arrive at a better understanding of the foundations of biology as well as the phenomena that have been described as energy medicine. energy medicine, the application of extremely low - level signals to the body, including energy healer interventions and bio - electromagnetic device - based therapies, is incomprehensible from the dominant biomedical paradigm of life as chemistry. the biofield or biological field, a complex organizing energy field engaged in the generation, maintenance, and regulation of biological homeodynamics, is a useful concept that provides the rudiments of a scientific foundation for energy medicine and thereby advances the research and practice of it. an overview on the biofield is presented in this paper, with a focus on the history of the concept, related terminology, key scientific concepts, and the value of the biofield perspective for informing future research. |
the negative health outcomes of obesity, including elevated mortality risk, are widely documented and accepted (13). however, numerous studies in free - living populations (4) and individuals with chronic disease, including chronic kidney disease (5), heart failure (6), and cancer (7), reported that obese individuals have a lower mortality risk than normal weight individuals, a phenomenon termed the obesity paradox. although type 2 diabetes is typically associated with excess weight, the prevalence among normal weight individuals has increased over the past decade (8) to 1020% of individuals with diabetes (8,9). a number of studies suggested that normal weight individuals have increased mortality risk compared with overweight or obese individuals with diabetes (911). conversely, tobias. (12) did not find evidence of an obesity paradox. as a result, the relationship between bmi and mortality is controversial. questions remain regarding potential confounding of relationships by inflammation, kidney function, physical function, and hypertension (1315). also suggested but not tested is that physical function, low muscle, and differences in adipose tissue distribution may mediate the obesity paradox (9) because these factors are related to both bmi and mortality. our objective was to provide a deeper understanding of factors underlying associations between bmi and mortality among individuals with type 2 diabetes by investigating mortality risk factors known to vary by weight : adipose tissue, muscle size, and physical function. we hypothesized that normal weight individuals would have a more advanced disease profile, including less muscle, different adipose distribution, and poorer physical function, compared with overweight or obese individuals. therefore, after comprehensively adjusting for comorbid conditions, adipose tissue, muscle size, and physical function, we hypothesized that risk differences among bmi categories would be minimal and that this conclusion would be supported by mediation analysis. the age, gene / environment susceptibility study - reykjavik study (ages - reykjavik) is a random sample of 5,764 men and women nested in the reykjavik study, a single - center population - based cohort begun in 1967 to study heart disease. at study baseline (20022006), participants were aged 6696 years. all participants provided written informed consent, and the study was approved by the institutional review board (vsn : 00 - 063). type 2 diabetes was determined from self - reported diabetes, diabetes medication use, or fasting plasma glucose 7 mmol / l based on american diabetes association diagnosis recommendations (17). bmi from measured height and weight (kg / m) and waist circumference (cm) were determined using standardized protocols (16). midlife bmi was available from height and weight measured in the reykjavik study (16,18,19). bmi categories of normal weight (18.524.9 kg / m), overweight (25.029.9 kg / m), and obese (30.0 kg / m) were used to classify participants. computed tomography imaging of the midthigh and abdomen at the l4/l5 vertebrae was performed with a four - row detector system (sensation ; siemens medical systems, erlangen, germany). visceral adipose tissue (vat) and subcutaneous adipose tissue (sat) were estimated from a single 10-mm - thick transaxial section. vat was distinguished from sat by tracing along the facial plane defining the internal abdominal wall. adipose areas (cm) were calculated by multiplying the number of pixels by the pixel area using specialized software (university of california, san francisco). total thigh muscle cross - sectional area was determined from a single 10-mm - thick transaxial section in the left and right legs as described previously (20). thigh muscle attenuation (hounsfield units), an indicator of fat infiltration, was recorded. usual gait speed was determined over 6 m. knee extensor strength was assessed as the maximal isometric strength from three trials of the dominant leg (20). mortality was ascertained through 31 may 2011 from the icelandic national roster (33), an adjudicated registry of deaths. cause - specific mortality was collected from national health system records through 31 december 2009. participants who were not identified as deceased were censored at the date through which vital records were complete. diabetes duration was calculated as the difference between self - reported age of diabetes diagnosis and age at baseline examination. medication use was determined from medications brought to the clinic and self - report questionnaire. blood pressure was assessed in a recumbent position using a mercury sphygmomanometer and large cuff on the right arm after participants had rested for 5 min. hypertension was determined from self - report, use of hypertensive medication, systolic blood pressure 140 mmhg, or diastolic blood pressure 90 mmhg. microalbuminuria was defined as urinary albumin / creatinine ratio between 30 and 300 mg / g (21). total cholesterol, hdl cholesterol, triglycerides, c - reactive protein (crp), glucose, and hba1c were analyzed from fasting blood samples using reagents from roche diagnostics (mannheim, germany) on a hitachi 912 analyzer according to manufacturer instructions. the coefficients of variation for the entire ages - reykjavik study were 1.8% for plasma glucose, 1.4% for total cholesterol, 2.3% for hdl, 4.8% for urinary albumin, and 1.3% for crp. participants with type 1 diabetes (diabetes before age 25 [n = 2 ]) and incomplete data on diabetes history (n = 66) were excluded, leaving 749 participants with diabetes. participants missing bmi (n = 18) and thigh muscle area (n = 90) data or with a bmi 60% met gait speed thresholds for poor performance, but the prevalence of illness - related weight loss and weakness (grip strength) was low (data not shown). further studies that address frailty directly in older populations with a wider range of physical functioning are warranted. the finding of muscle as a mediating factor of relationships between bmi and mortality in diabetes is a step forward in our understanding of risk factors. however, potential mechanisms need to be investigated, particularly because the effect of muscle does not seem to reflect muscle function or quality (no attenuating effect of intermuscular fat). muscle mass is inversely associated with insulin resistance (26). because insulin resistance is an etiologic factor for cardiovascular disease (27) and cancer (28), this may help to explain the elevated mortality risk among normal weight participants who had less muscle than overweight or obese participants. however, the results provide conflicting support that overweight or obese participants have more - favorable metabolic profiles than normal weight participants. fasting glucose, hba1c, and type of diabetes medication did not differ, but the duration of diabetes was longer among normal weight participants. an alternative explanation for the obesity paradox in diabetes is that of selection bias (29,30). it has been suggested that conditioning on a variable (diabetes) that is affected by exposure (bmi) may induce associations with mortality (31). however, the notion that restricting analyses to populations with diabetes results in normal weight individuals with more risk factors for mortality than overweight or obese individuals is not supported by the present data. the distribution of baseline factors suggests differences that would be expected to be both risk and protective factors. for example, relative to overweight or obese participants, normal weight participants were older and had longer duration of diabetes and higher prevalence of current smoking but had higher hdl cholesterol, lower triglycerides, lower crp, and similar hba1c. furthermore, although current smoking was more prevalent among normal weight individuals, the positive direction of the association between normal weight and mortality persisted when the analysis was restricted to never smokers. strengths of this study are the measures of physical function and body composition from radiographic imaging, which enabled novel examination of factors known to vary by bmi. a criticism of previous studies has been that bmi often is assessed up to several decades after diabetes diagnosis, thereby increasing the risk of reverse causation (12). in the present analysis, normal weight participants had lost weight since midlife, but adjustment for midlife bmi did not attenuate mortality risk. excluding deaths within 2 years of study baseline also did not attenuate risk, suggesting that the results were not driven by early mortality from undetected subclinical disease at baseline. we were also able to address the possibility of survival bias by referencing a comparative analysis by olafsdottir. (32) of type 2 diabetes in the reykjavik study and the ages - reykjavik study (survivors from the reykjavik study) who were examined 11 years apart. the rate for all - cause and cardiovascular mortality was lower in the ages - reykjavik study, but the decline in mortality was similar to that in the general icelandic population over that time period (33). thus, it does not appear that individuals with type 2 diabetes in the present cohort had a survival bias relative to the general type 2 diabetes population. the main limitation of this study is the small sample size, which did not permit us to restrict the study population to those with incident diabetes. thus, we were unable to avoid reverse causation or possible differences in mortality that reflect complications from longer diabetes duration in normal weight participants. the study was undertaken with the aim of examining the effects of weight - related measures from imaging and clinical tests, which are typically not available in large samples, rather than providing a definitive answer regarding the presence or absence of an obesity paradox in type 2 diabetes. although we adjusted for diabetes duration, we can not rule out possible residual confounding from self - reported age at diabetes diagnosis. it is noteworthy that the prevalence of diabetes complications, such as cardiovascular disease and peripheral neuropathy, in old age is similar for individuals diagnosed with diabetes in midlife versus old age (34), and chronic diseases did not differ by bmi despite differences in diabetes duration. also possible is that we had residual bias from adjusting for smoking status rather than stratifying by smoking status, but the number of deaths did not vary by smoking status, and analyses restricted to never smokers indicated increased mortality risk for normal weight participants, although the sample size was limited. the finding of muscle as a mediating factor was tested in a statistical model that provides insight into causal relationships but is not a substitute for clinical studies. it is also important to test the possible mediating effect of muscle in younger populations that may have a different body composition from older adults (35). in conclusion, the results illustrate the importance of identifying type 2 diabetes among normal weight individuals and suggest that muscle size may help to explain relationships between bmi and mortality in type 2 diabetes. the divergence of muscle size and muscle function as mediators of relationships is likely to spur additional debate on the importance of muscle size versus physical function in old age (3638), and further studies in this area are warranted. | objectivestudies in type 2 diabetes report both increased mortality for normal weight and no evidence of an obesity paradox. we aimed to examine whether adipose tissue, muscle size, and physical function, which are known to vary by weight, mediate associations between bmi and mortality.research design and methodsthe ages - reykjavik cohort comprised participants aged 6696 years with diabetes defined by fasting glucose, medications, or self - report. bmi was determined from measured height and weight and classified as normal (18.524.9 kg / m2, n = 117), overweight (25.029.9 kg / m2, n = 293, referent group) or obese (30.0 kg / m2, n = 227). thigh muscle area and intermuscular, visceral, and subcutaneous adipose tissues were assessed with computed tomography. function was assessed from gait speed and knee extensor strength. hazard ratios (hrs) and 95% cis were estimated by cox proportional hazards regression adjusted for demographics and diabetes - related risk factors.resultsthe median follow - up was 6.66 years, and there were 85, 59, and 44 deaths among normal weight, overweight, and obese participants, respectively. there was no mortality risk for obese participants and an increased risk among normal weight compared with overweight participants (hr 1.72 [95% ci 1.122.64 ]). associations remained with adjustment for adipose tissues and knee extensor strength ; however, mortality risk for normal weight was attenuated following adjustment for thigh muscle (hr 1.36 [95% ci 0.872.11 ]) and gait speed (hr 1.44 [95% ci 0.912.27 ]). linear regression confirmed with bootstrapping indicated that thigh muscle size mediated 46% of the relationship between normal weight and mortality.conclusionsnormal weight participants had elevated mortality risk compared with overweight participants. this paradoxical association was mediated in part by muscle size. |
psoriasis is a chronic genetically determined and immunomediated inflammatory skin disease that affect approximately 2% of the population. in its typical form, psoriasis results in patches of thick, red skin covered with silvery scales.1 psoriatic arthritis is an inflammatory rheumatic joint disease associated with psoriasis and commonly included among seronegative forms of spondyloarthropathy.2 it affects 2%3% of the population, however its incidence has been rising over the last 30 years.3 in approximately 6%39% of patients, psoriasis is present many years before the onset of arthritis.4 psoriatic arthritis damages cartilage, synovium and bone of the joints causing pain, impairment and disability making early recognition and intervention important.5 its marked entheseal involvement (the origin and insertion of ligaments, tendons and joint capsules) is a distinctive clinical aspect that helps to discriminate it from other conditions observed at their onset such as rheumatoid arthritis. it may be isolated to tendon insertions such as the achilles tendon or plantar fascia or be more diffuse including multiple ligamentous attachments.6 current methods for diagnosis of and monitoring the disease are only able to detect clinical manifestations of arthritis late in the process. however with the recent onset of successful treatments for inflammatory arthritis, it becomes important to identify factors that can predict the evolution of arthritis. this is especially critical in the early phases of the disease so that these treatments can started as soon as possible to slow down progression of the disease.7 ultrasound has been increasingly used in rheumatology for assessing soft tissue involvement in patients with arthritis.8 inspite of the high number of studies supporting its role and validity in the assessment of patients with rheumatoid arthritis and osteoarthritis, the potential role of ultrasound imaging in patients with psoriasis and psoriatic arthritis still waits to be adequately investigated including accuracy and reproducibility.9 ultrasound particularly when coupled with power doppler imaging can detect subclinical abnormalities of soft tissues, tendons and ligaments especially enthesitis, which has been postulated to be the hall mark and the initial site of joint inflammation in spondyloarthropathies.10 another valuable approach to monitor arthritis would be by measuring biological markers of cartilage degradation and repair which reflect variations in joint remodeling. one such potential marker of arthritis is cartilage oligomeric matrix protein (comp).7 comp is a tissue specific pentameric glycoprotein and one component of the extracellular articular cartilage matrix and belongs to the thrombospondin family.11 it was first detected in the serum and synovial fluid of patients suffering from rheumatic disorders such as rheumatoid arthritis and osteoarthritis.12 however much less known about comp production in synovial cells in other rheumatic diseases.13 originally it is considered a marker of cartilage breakdown, but it has also been identified in tendons, ligaments and synovium.14 it has potential as a diagnostic and prognostic indicator and as a marker of the rheumatic disease severity and the effect of treatment.12,15 the aim of the present study was to evaluate the role of entheseal ultrasonography and serum comp in the preclinical diagnosis of psoriatic arthritis. they were recruited from rheumatology, dermatology departments and rheumatology outpatient clinic, ain shams university hospital. they were divided into 2 groups ; group i included 30 patients with psoriasis without any typical joint symptoms or signs, and group ii included 30 patients with psoriatic arthritis (who were diagnosed according to the classification criteria for psoriatic arthritis caspar criteria)16 as control group. both groups were age and sex matched and also matched as regard duration of skin disease and severity of skin affection as assessed by the psoriasis area and severity index (pasi) score.17 patients with evidence of other rheumatic diseases, malignancies and infections were excluded from the study. all patients were subjected to full history taking and thorough clinical examination including dermatological and rheumatological examination to detect arthritis, clinical dactylitis (swelling of an entire digit) and enthesitis (swelling, pain, tenderness along the course of the achilles tendon or at the level of the calcaneal insertion or its functional impairment). for psoriatic arthritis patient only the disease activity was assessed by modified disease activity score (das28).18 radiological examination was done for all patients including : plain x - ray on hands, feets, spine and sacroiliac joints, then the psoriatic arthritis disease severity was assessed by modified steinbrockers scoring method.19real time musculoskeletal ultrasonography using esaote mylab 70x vision. an adequate amount of gel was used to obtain the best visualization of superficial soft tissues. subjects were not allowed to assume nonsteroidal anti - inflammatory drugs three weeks before ultrasound examination. power doppler sonography was used to detect the degree of vascularization as an indirect sign of inflammation. early ultrasound signs of enthesitis are loss of normal fibrillar echogenicity, hypoechoic swelling of the tendon insertion, effusion, increase of blood flow detectable with power doppler.20,21 plain x - ray on hands, feets, spine and sacroiliac joints, then the psoriatic arthritis disease severity was assessed by modified steinbrockers scoring method.19 real time musculoskeletal ultrasonography using esaote mylab 70x vision. an adequate amount of gel was used to obtain the best visualization of superficial soft tissues. subjects were not allowed to assume nonsteroidal anti - inflammatory drugs three weeks before ultrasound examination. power doppler sonography was used to detect the degree of vascularization as an indirect sign of inflammation. early ultrasound signs of enthesitis are loss of normal fibrillar echogenicity, hypoechoic swelling of the tendon insertion, effusion, increase of blood flow detectable with power doppler.20,21 five milliliters of venous blood were collected from each patient, 2 ml on edta for esr by westergren method and 3 ml in a plane tube where serum was collected and stored at 70 for subsequent assay of comp and c - reactive protein (crp). three milliliters of blood were withdrawn from 20 age and sex matched healthy lab workers for determination of normal comp values. comp was assayed by enzyme immunoassay using human cartilage oligomeric matrix protein elisa kit (biovendon research and diagnostic products. the mean sd of serum comp among healthy lab workers was 0.9 0.28 mg / ml. omega house, hillfoots business village, alva fk12 5dq, scotland, united kingdom). statistical analysis of data was done by ibm computer using spss (statistical program for social science version 12). mean and standard deviation (sd) were used to describe quantitative variables and number and percentage for qualitative variables. unpaired t - test was used to compare quantitative variables between both groups while mann whitney willcoxon u test was used instead of t - test in non parametric data (sd > 50% mean). spearman correlation test was used to rank different variables against each others positively or inversely. the sensitivity, specificity, positive predictive value, negative predictive value and accuracy of both entheseal ultrasound and serum comp of both groups were calculated from the following equations : sensitivity = % true positive cases / true positive cases + false negative cases, specificity = % true negative cases / true negative cases + false positive cases, positive predictive value = % true positive cases / true positive cases + false positive cases, negative predictive value = % true negative cases / true positive cases + false negative cases and accuracy = % true positive cases + true negative cases / total number of cases.22 five milliliters of venous blood were collected from each patient, 2 ml on edta for esr by westergren method and 3 ml in a plane tube where serum was collected and stored at 70 for subsequent assay of comp and c - reactive protein (crp). three milliliters of blood were withdrawn from 20 age and sex matched healthy lab workers for determination of normal comp values. comp was assayed by enzyme immunoassay using human cartilage oligomeric matrix protein elisa kit (biovendon research and diagnostic products. the mean sd of serum comp among healthy lab workers was 0.9 0.28 mg / ml. omega house, hillfoots business village, alva fk12 5dq, scotland, united kingdom). statistical analysis of data was done by ibm computer using spss (statistical program for social science version 12). mean and standard deviation (sd) were used to describe quantitative variables and number and percentage for qualitative variables. unpaired t - test was used to compare quantitative variables between both groups while mann whitney willcoxon u test was used instead of t - test in non parametric data (sd > 50% mean). spearman correlation test was used to rank different variables against each others positively or inversely. the sensitivity, specificity, positive predictive value, negative predictive value and accuracy of both entheseal ultrasound and serum comp of both groups were calculated from the following equations : sensitivity = % true positive cases / true positive cases + false negative cases, specificity = % true negative cases / true negative cases + false positive cases, positive predictive value = % true positive cases / true positive cases + false positive cases, negative predictive value = % true negative cases / true positive cases + false negative cases and accuracy = % true positive cases + true negative cases / total number of cases.22 the present study was carried out on 60 psoriatic patients divided into 2 groups : group i included 30 patients with psoriasis and group ii included another 30 patients with psoriatic arthritis as control group. no statistically significant difference was detected between both groups as regard age, sex, duration and severity of skin disease (p > 0.05). while there was significant difference between them as regard clinical enthesitis and dactylitis and crp (p 0.05) (table 1) and (fig. 2). serum comp was significantly elevated in group i and ii patients with no statistically significant difference between them as regard its mean levels (table 1 and fig. 2). while there was statistically significant difference between both groups as regard crp table 1. serum comp was more sensitive while entheseal ultrasonography was more specific in the preclinical diagnosis of psoriatic arthritis, both had the same accuracy (table 2). serum comp correlated significantly with crp in both group i and ii (r = 0.57, 0.86 respectively, p = 0.003) and with modified das28 and modified steinbrockers scores in group ii (r = 0.94 and 0.88 respectively, p = 0.0002). while no correlation was found between serum comp and pasi score in both groups (r = 0.069 and 0.18 respectively, p = 0.09). early ultrasound signs of enthesitis included loss of normal fibrillar echogenicity, hypoechoic swelling of the tendon insertion, effusion, increase of blood flow detectable with power doppler, retrocalcaneal bursitis and plantar fasciitis. achilles tendon and plantar fascia calcifications were also found in psoriatic arthritis patients (fig. no statistically significant difference was detected between psoriatic and psoriatic arthritis patients as regard these ultrasonographic findings (p > 0.05) (table 1) and (fig. serum comp was significantly elevated in group i and ii patients with no statistically significant difference between them as regard its mean levels (table 1 and fig. 2). while there was statistically significant difference between both groups as regard crp table 1. serum comp was more sensitive while entheseal ultrasonography was more specific in the preclinical diagnosis of psoriatic arthritis, both had the same accuracy (table 2). serum comp correlated significantly with crp in both group i and ii (r = 0.57, 0.86 respectively, p = 0.003) and with modified das28 and modified steinbrockers scores in group ii (r = 0.94 and 0.88 respectively, p = 0.0002). while no correlation was found between serum comp and pasi score in both groups (r = 0.069 and 0.18 respectively, p = 0.09). psoriatic arthritis occurs in up to one - third of patients with psoriasis.23 usually the skin disease precedes the onset of psoriatic arthritis with two thirds of patients developing psoriasis before the onset of arthritis.24 enthesopathic changes have been suggested as being the unifying feature of the clinical subtypes of psoriatic arthritis, and the disease can be considered an enthesis associated disorder rather than primary synovitic arthropathy.25 so we aimed in this work to evaluate the role of entheseal utrasonography and serum comp in the preclinical diagnosis of psoriatic arthritis. in the present study despite there was significant difference between psoriatic and psoriatic arthritis patients as regard clinical enthesitis, however ultrasonography showed almost the same entheseal abnormalities with no significant difference between them. the achilles tendons are among the most frequent sites of enthesopathic involvement in psoriatic arthritis. ultrasound has shown that enthesitis can be asymptomatic and that some cases of achilles tendinitis can go undiagnosed. it allows visualization of lesions less than 5 mm in diameter and identification of minimal amounts of fluid at the level of the tendon, peritendinous structures and serous bursae. the high specificity of ultrasound allow its use as a complementary procedure when clinical examination yields normal findings because the signs of involvement are mild and may be not accompanied by specific symptoms.26 simone found sonographic evidence of involvement of the achilles tendon in 35 of 59 psoriatic patients whereas clinical examination yielded 18 diagnosis of achilles tendinitis. power doppler ultrasonography provides information on the perfusion of the synovial tissue, tendons and entheses, so very slight changes in vascularity can be easily detected.10,21 in the present study, the sensitivity of ultrasound in the preclinical diagnosis of psoriatic arthritis was 47%, while its specificity was 67%. weiner and coworkers28 found that the sensitivity of ultrasound in the detection of overall joint pathology in painful and/or swollen joint in psoriatic arthritis was 71%, and in clinically unaffected joints was 17%, while its specificity ranged between 84% and 94% depending on the joint pathology. the low cost and the acceptable specificity suggest that ultrasound is a useful imaging tool in early psoriatic arthritis. ozakar found that the percentage of asymptomatic enthesopathy detected by ultrasound in psoriatic patients was 56%, they strongly believed that ultrasound has an advantageous role in rendering the enthesopathy in psoriasis patients whether or not they are symptomatic. comp expressed primarily in cartilage, ligament and tendon.14 it is considered a marker of early cartilage breakdown in patients with psoriatic arthritis.30 it was also found elevated in the serum of patients with rheumatoid arthritis31 and osteoarthritis.12 in the present study serum comp was significantly elevated in both psoriatic and psoriatic arthritis patients with no significant difference between them. the increased serum comp levels in patients with psoriasis propose that patients with psoriatic skin lesions might have additional joint involvement.13 t cells and proinflammatory cytokines like tumor necrosis factor- (tnf-) play an essential role in the pathogenesis of psoriasis and psoriatic arthritis. they stimulate chondrocytes to release destructive proteases which lead to loss of proteoglycans, to destruction of collagen bundles and to the release of comp.13 despite the presence of previous studies on the utility of ultrasound and serum comp in many rheumatic diseases, their combined validity, sensitivity and specificity in patients with psoriasis and psoriatic arthritis has not been previously reported. in the present study the sensitivity of serum comp in the preclinical diagnosis of psoriatic arthritis was 87% while its specificity was only 27%. the lack of specificity of serum comp for cartilage may limit its use in assessing changes in joint damage in arthritis. the assay may need to be complemented by radiographic or mri evaluation.7 in patients with symptoms and clinical signs of hip pathology but not radiographic evidence of osteoarthritis, a significant association was found between serum comp and hip - related symptoms. this would support the use of serum comp as a biomarker of hip joint pathology prior to radiographic findings.32 in the present study serum comp levels have been demonstrated as an indicator for disease activity and severity in patients with psoriatic arthritis as it was significantly correlated with modified das28 and modified steinbrockers scores. also significant correlation was found between serum comp levels and laboratory disease activity in psoriatic patients. while no correlation was found between serum comp and the extent of skin disease in both psoriatic and psoriatic arthritis patients. skoumal could nt find any evidence that extended skin lesions of psoriasis have any influence on serum comp and thus its elevated levels were due to on going joint inflammation. patients with active psoriatic arthritis showed significantly elevated serum comp levels compared to the patients with low clinical and laboratory disease activity.13 this reflects increased cartilage tumour in inflammatory diseases with high activity similar to findings in rheumatoid arthritis.33 serum comp levels were significantly high in rheumatoid arthritis patients positive for bone erosions on mri compared with those who were negative for bone erosions, this may reflect joint damage that is dependent on the synovial inflammatory process in early rheumatoid arthritis.34 entheseal ultrasonography and measurement of serum comp may be used for all patients with psoriasis for preclinical diagnosis of psoriatic arthritis to get the benefit of the high sensitivity of serum comp and the high specificity of ultrasound. in addition serum comp seems to be promising marker of disease activity and severity in psoriatic arthritis patients. these findings might have an influence on the clinical decision in patients with psoriasis and psoriatic arthritis, and have implication for therapy since the new biologic drugs can delay or stop joint damage when given in time. further prospective studies for patients with psoriasis without history of arthritis are needed to clarify the value of entheseal ultrasound and serum comp in detecting their progression to psoriatic arthritis. | objective : to evaluate the utility of entheseal ultrasonography and serum comp in the preclinical diagnosis of psoriatic arthritis.methods:60 psoriatic patients were divided into : 30 patients with psoriasis (group i) and 30 patients with psoriatic arthritis as control (group ii). they underwent independent clinical and ultrasonographic examination of both lower limbs at the calcaneal insertions of achilles tendons. psoriatic arthritis disease activity and severity was assessed by modified das28 and steinbrockers scores. serum levels of comp were measured for all patients by elisa.results:on clinical examination, no entheseal abnormalities were detected in group i while they were present in 23.3% of group ii with statistically significant difference between them (p 0.05). serum comp were significantly elevated in group i and ii with no statistically significant difference between them (mean sd 5.9 3 and 6.8 12 respectively, p > 0.05). entheseal ultrasound was more specific (67%) while serum comp was more sensitive (87%) in the preclinical diagnosis of psoriatic arthritis. serum comp levels were significantly correlated with crp in both groups and with das28 and steinbrockers scores in group ii (p < 0.01).conclusion : entheseal ultrasonography and serum comp levels may be used complementary to each other for preclinical diagnosis of psoriatic arthritis. serum comp seems to be promising prognostic marker for psoriatic arthritis patients. |
the rna molecule, once perceived as a passive carrier of genetic material from dna, has long been shown to possess an active role that is reminiscent to proteins. moreover, in the past several years, new discoveries have demonstrated the peculiar possibilities of an rna molecule to control fundamental processes in living cells [reviews of some of these recent discoveries can be found in (13) ]. although the functional role of rnas are often related to their 3d structure, the rna secondary structure is experimentally accessible and in a variety of systems contains a significant amount of information to shed light on the relationship between structure and function. in general, rna folding is thought to be hierarchical in nature (4,5), where a stable secondary structure forms first and subsequently there is a refinement to the tertiary fold. thus, rna secondary - structure prediction as performed in energy minimization software packages (6,7) is also important for tertiary structure prediction, by itself. for example, in the recently discovered genetic control elements called riboswitches (2,3), a mechanism for bacterial gene regulation by rnas was already observed by examining the secondary structure even before any knowledge about tertiary structure became available. on the prediction side, mutational analysis using the program implemented in our rnamute webserver was performed on a tpp - riboswitch, and experimental results were able to verify the predictions of a deleterious and a compensatory mutation on that riboswitch (8). this type of prediction, knowing that it could be verified, may offer prospects for rational design in the future. in general, the purpose of the rnamute webserver is as follows. for a given biological system that involves rna, for example, an rna virus or a segment of an mrna of interest or any other type of an rna sub - sequence in the length order of 100150 nt, there are most probably some rna secondary - structure motifs - like unique stem loops (9,10) that are believed to possess some kind of a functional role. oftentimes, there is a motivation to find a mutation that may alter this functional role. a logical step toward this goal is to predict which mutations may exhibit a fold that is significantly different in its secondary structure than that of the wild - type. in principle, when no other knowledge is available on the behavior of mutations in that system and a multiple alignment is not at hand to use an approach that analyzes substitutions (11), or to perform comparative modeling (12) or to generate covariance models (13), the best that can be done and could be very useful is to predict the folding of the wild - type sequence and several mutants by energy minimization using software such as zuker s mfold (6) or vienna s rnafold (7). for performing this type of mutational analysis in a systematic way, a basic approach that can be traced back to preliminary ideas in (1416) and later was developed into the rnamute program (17,18) is to order mutations in various tables according to their distance from the wild - type predicted structure. that way, the mutations with the largest distances can be singled out from the rest for further examination. other approaches that use the same energy parameter rules (19) were also developed, notably rdmas (20) and rnamutants (21,22), and are reviewed in (23). in practice, the most straight - forward application for performing mutational analysis using rnamute is to guide biochemical experiments that directly involve the insertion of mutations, such as site - directed mutagenesis. despite the limitations of the approach that are mentioned in the continuation in addition, the growing importance of snp detection based on high - throughput sequencing may also present a need for coarse - grained mutational analysis, such as in investigating the structural behavior of synonymous snps. as a consequence, we have now developed the rnamute webserver that can easily be used by practitioners with no prior knowledge and basically performs mutational analyzes based on energy minimization predictions in a user - friendly way. the rnamute program uses folding predictions by energy minimization in an efficient way to analyze neighboring mutants (e.g. single - point, two - point, three - point and more) relative to a given wild - type rna sequence. it employs routines from the vienna rna package (24), including the folding prediction of suboptimal solutions. for convenience with the problem, the vienna way of calculating the suboptimals (25) was chosen for the core of rnamute (18), although the final output of rnamute can be checked by either mfold (6) with its original way of calculating suboptimal solutions (26) or the vienna rna secondary - structure server (7) for verifying the results. this final verification step is recommended after the user has been able to find some interesting mutations by examining the output of rnamute interactively. it should be clarified that the desired number of mutations is made in the rna sequence, not the secondary structure, allowing the researcher to see the effects of point mutations on the overall structure of the rna. after the user supplies an input sequence and the number of mutations to be analyzed, the initial step of rnamute is to calculate all suboptimal solutions of the input sequence using vienna s rnasubopt. next, an appropriate filtering step is applied to reduce the number of suboptimal solutions, after which only the mutations that stabilize the suboptimal solutions and destabilize the optimal one are considered. in the final step, the mutations reached from the previous step are sorted according to their distance from the wild - type predicted structure, starting from mutations that are with zero distance from the wild - type (mutations that fold into the same structure as that of the wild - type) and ending with mutations that are with large distances from the wild - type. the latter, most probably some conformational rearranging mutations, are examined by comparing between the folding prediction of the wild - type and the folding prediction of the mutants. the information for comparison is available to the user in output screens reached by single - clicks, and this visualization processing continues until the user collects all the desired candidates for deleterious mutations based on the output at hand. more features are available for the user to control which mutations are to be analyzed using the parameter values, for example the user can choose to discard the mutations that change amino acid after translation. for more details on the method employed by rnamute, the reader is referred to (18). the rnamute webserver (http://www.cs.bgu.ac.il/~xrnamute/xrnamute) runs on a unix cluster with four types of computation nodes, including : ibm x3550 m3 servers with 2 quad core xeon e5620 2.40 ghz smt processors with 12 m l3 cache and 24 g ram max ppn = 16, intel smp server with 2 quad core e5335 2.00ghz processors with 4 m l2 cache and 4 g ram max ppn = 8, intel smp servers with 2 dual core xeon 5140 2.33 ghz processors with 4 m l2 cache and 4 g ram max ppn = 4 and pentium4 2.40 ghz processors with 512 the input screen of the rnamute webserver is shown in figure 1 (containing default parameter values). in addition, the number of mutations should be inserted (a value of 1 corresponds to single - point mutations, a value of 2 corresponds to double - point mutations, and a value of m corresponds to m - point mutations). next, the user can choose to select do not change amino acids, in which case the start of reading frame should also be supplied in order for the constraint that considers the genetic code to be effective. on the right, the clustering resolution for each of the three tables should be chosen. this controls how the grouping of the mutations will appear in each table, but the exact values are less critical because they can also be updated at a later stage for a convenient examination of the corresponding tables. after selecting the above options, the parameters are dist1, dist2, e - range, type of distance, type of method. they are all described in detail in the tutorial page that is accessible by pressing help at the bottom of the screen, and in the methodology paper for the efficient version of rnamute (18). the user can choose between two different types of distance for filtering the suboptimal solutions : hamming distance, or base pair distance. hamming distance calculates the number of mismatches between the two dot - brackets being compared, whereas the base pair distance is given by the number of base pairs that have to be opened or closed to transform one structure into the other. the base pair distance has been widely used for comparing between two rna secondary structures, and is a fine choice for being selected by the user, although there are certain situations when the hamming distance can slightly be preferred in perhaps some special instances. for example, suppose we are comparing the following two dot - brackets : figure 1.the input screen of the rnamute webserver including default parameters. the base pair distance between these two dot - brackets is 8, whereas the hamming distance is 2, faithfully reflecting a slight change to the overall structure if this is indeed desired. in performing mutational analysis by filtering and categorization, it was noticed that both these distance types give very similar results, and therefore picking either one is legitimate. once the distance type is specified, numerical values should be inserted for dist1, dist2 and e - range. the two parameters dist1 and dist2 are used for filtering the suboptimal solutions that are close to the optimal and close to each other, respectively. it is recommended that their values will be 25% of the sequence length, and this value should be lowered if more solutions are desired. the parameter e - range is the one used in the rnasubopt routine from the vienna rna package (7,24). in general, a larger e - range value will provide better results but also take a longer time to compute. our suggestion is that e - values between 8 and 15 will be used for a sequence length of 100 bases. it is advisable to use lower values first and if the running time is too short, one can always increase the e - range and try another run. for the method type, we provide four different complexity modes for our algorithm : fast, only stabilizing, slow, only stabilizing, fast, stabilizing and destabilizing and slow, stabilizing and destabilizing. we suggest using initially one of the two the first option is the fastest and can be used for the initial trial calculation, providing a sufficient number of solutions to begin with, whereas the third option is slower but provides more solutions compared to the first, offering a refinement. fast options and they will run even slower. by default, fast, only stabilizing is selected. finally, the user specifies whether the results should arrive by email, in which case the email address should be specified. when submitting the job interactively, in some cases the results may take several minutes to compute, and patience is advised while following the instructions on the screen. the results are guaranteed to be kept for at least one week after they are generated in the web link that is provided to the user. in addition to keeping the web link for later use, the user has an option to download the essence of the results as a static file containing textual information. after the example parameters in the input screen of figure 2 are inserted and the form is submitted, the preliminary results screen appearing in figure 3 is obtained. the query rna sequence appears at the top, and below it are three tables for ordering mutations using tree - edit distance, base pair distance and hamming distance. it should be noted that the more expensive tree - edit distance was not considered during the stage of filtering suboptimal solutions (the choice was between base pair distance and hamming distance), but it is being used together with the other two for sorting mutations according to their distance from the wild - type predicted structure. each row in the tables contains some distance range and the number of mutations that are within this distance range. clustering resolution, which is a technical feature that is used to control the amount of resolution in each table being displayed for convenience to the user, can be updated for each table separately using the figure 4 illustrates how the changes in the tables of figure 3 occurred as a consequence of fine tuning the clustering resolution parameter. when the clustering resolution was manually changed and updated to a value of 1 in the base pair distance table, all the mutations in the 826 group have been re - distributed to subgroups where there is a difference of only 1 between the upper value in the distance range of a particular group and the lower value in the distance range of the next group, exclusive of the group 66 that contains only one mutation. next, the user can click on each distance range table entry to obtain the list of mutations belonging to that group. figure 5 displays the mutation group list screen as a result of clicking on the 2226 hamming distance range entry in the hamming distance table of figure 4. in the mutations table appearing in figure 5, each row in the table contains the mutation name, corresponding distance from the wild - type, mean free energy of the mutant predicted fold in units of kcal / mol, and the dot - bracket representation of the mutant predicted fold. finally, by pressing on each mutation name, a corresponding new page appears with detailed structure and energy information for the mutation. figure 6 shows the output screen that corresponds to mutation g7c - a9u available in figure 5. it contains secondary - structure drawings of the wild - type and mutation that facilitates examination of the structural change. the sequences of the wild - type and mutant predicted structures, with the mutated bases in the mutated sequence and structure painted in red, appear below the secondary - structure drawings. detailed information about the free - energies, dot - bracket representations and the various distances of the mutant predicted structure from the wild - type predicted structure are given at the bottom of the page. this way the user can scan several rearranging mutations by clicking on promising candidates that are available in figure 5, until a desired mutation for a specific task is reached. figure 2.the input screen of the rnamute webserver with the example parameters inserted. in the example, the number of mutations is set to 2 and a more time consuming method is employed relative to the default one. figure 3.the preliminary results screen of the rnamute webserver, ordering mutations in tables according to their distances from the wild - type predicted structure. figure 4.the preliminary results screen of the rnamute webserver after fine tuning the clustering resolution parameter in some of the tables. figure 5.mutation group list screen as a result of running rnamute for the case of two - point mutations for the example sequence. figure 6.output screen of a rearranging mutation is the example sequence as a result of running rnamute for the case of two - point mutation and single clicking in the mutation group list screen shown in figure 5 on the highlighted mutation g7c - a9u. the secondary - structure drawings for the wild - type and the mutants are plotted. the input screen of the rnamute webserver with the example parameters inserted. in the example, the number of mutations is set to 2 and a more time consuming method is employed relative to the default one. the preliminary results screen of the rnamute webserver, ordering mutations in tables according to their distances from the wild - type predicted structure. the preliminary results screen of the rnamute webserver after fine tuning the clustering resolution parameter in some of the tables. mutation group list screen as a result of running rnamute for the case of two - point mutations for the example sequence. output screen of a rearranging mutation is the example sequence as a result of running rnamute for the case of two - point mutation and single clicking in the mutation group list screen shown in figure 5 on the highlighted mutation g7c - a9u. the secondary - structure drawings for the wild - type and the mutants are plotted. the rnamute webserver (http://www.cs.bgu.ac.il/~xrnamute/xrnamute) runs on a unix cluster with four types of computation nodes, including : ibm x3550 m3 servers with 2 quad core xeon e5620 2.40 ghz smt processors with 12 m l3 cache and 24 g ram max ppn = 16, intel smp server with 2 quad core e5335 2.00ghz processors with 4 m l2 cache and 4 g ram max ppn = 8, intel smp servers with 2 dual core xeon 5140 2.33 ghz processors with 4 m l2 cache and 4 g ram max ppn = 4 and pentium4 2.40 ghz processors with 512 the input screen of the rnamute webserver is shown in figure 1 (containing default parameter values). in addition, the number of mutations should be inserted (a value of 1 corresponds to single - point mutations, a value of 2 corresponds to double - point mutations, and a value of m corresponds to m - point mutations). next, the user can choose to select do not change amino acids, in which case the start of reading frame should also be supplied in order for the constraint that considers the genetic code to be effective. on the right, the clustering resolution for each of the three tables should be chosen. this controls how the grouping of the mutations will appear in each table, but the exact values are less critical because they can also be updated at a later stage for a convenient examination of the corresponding tables. after selecting the above options, the parameters are dist1, dist2, e - range, type of distance, type of method. they are all described in detail in the tutorial page that is accessible by pressing help at the bottom of the screen, and in the methodology paper for the efficient version of rnamute (18). the user can choose between two different types of distance for filtering the suboptimal solutions : hamming distance, or base pair distance. hamming distance calculates the number of mismatches between the two dot - brackets being compared, whereas the base pair distance is given by the number of base pairs that have to be opened or closed to transform one structure into the other. the base pair distance has been widely used for comparing between two rna secondary structures, and is a fine choice for being selected by the user, although there are certain situations when the hamming distance can slightly be preferred in perhaps some special instances. for example, suppose we are comparing the following two dot - brackets : figure 1.the input screen of the rnamute webserver including default parameters. the base pair distance between these two dot - brackets is 8, whereas the hamming distance is 2, faithfully reflecting a slight change to the overall structure if this is indeed desired. in performing mutational analysis by filtering and categorization, it was noticed that both these distance types give very similar results, and therefore picking either one is legitimate. once the distance type is specified, numerical values should be inserted for dist1, dist2 and e - range. the two parameters dist1 and dist2 are used for filtering the suboptimal solutions that are close to the optimal and close to each other, respectively. it is recommended that their values will be 25% of the sequence length, and this value should be lowered if more solutions are desired. the parameter e - range is the one used in the rnasubopt routine from the vienna rna package (7,24). in general, a larger e - range value will provide better results but also take a longer time to compute. our suggestion is that e - values between 8 and 15 will be used for a sequence length of 100 bases. it is advisable to use lower values first and if the running time is too short, one can always increase the e - range and try another run. for the method type, we provide four different complexity modes for our algorithm : fast, only stabilizing, slow, only stabilizing, fast, stabilizing and destabilizing and slow, stabilizing and destabilizing. we suggest using initially one of the two the first option is the fastest and can be used for the initial trial calculation, providing a sufficient number of solutions to begin with, whereas the third option is slower but provides more solutions compared to the first, offering a refinement. fast options and they will run even slower. by default, fast, only stabilizing is selected. finally, the user specifies whether the results should arrive by email, in which case the email address should be specified. when submitting the job interactively, in some cases the results may take several minutes to compute, and patience is advised while following the instructions on the screen. the results are guaranteed to be kept for at least one week after they are generated in the web link that is provided to the user. in addition to keeping the web link for later use, the user has an option to download the essence of the results as a static file containing textual information. after the example parameters in the input screen of figure 2 are inserted and the form is submitted, the preliminary results screen appearing in figure 3 is obtained. the query rna sequence appears at the top, and below it are three tables for ordering mutations using tree - edit distance, base pair distance and hamming distance. it should be noted that the more expensive tree - edit distance was not considered during the stage of filtering suboptimal solutions (the choice was between base pair distance and hamming distance), but it is being used together with the other two for sorting mutations according to their distance from the wild - type predicted structure. each row in the tables contains some distance range and the number of mutations that are within this distance range. clustering resolution, which is a technical feature that is used to control the amount of resolution in each table being displayed for convenience to the user, can be updated for each table separately using the figure 4 illustrates how the changes in the tables of figure 3 occurred as a consequence of fine tuning the clustering resolution parameter. when the clustering resolution was manually changed and updated to a value of 1 in the base pair distance table, all the mutations in the 826 group have been re - distributed to subgroups where there is a difference of only 1 between the upper value in the distance range of a particular group and the lower value in the distance range of the next group, exclusive of the group 66 that contains only one mutation. next, the user can click on each distance range table entry to obtain the list of mutations belonging to that group. figure 5 displays the mutation group list screen as a result of clicking on the 2226 hamming distance range entry in the hamming distance table of figure 4. in the mutations table appearing in figure 5, each row in the table contains the mutation name, corresponding distance from the wild - type, mean free energy of the mutant predicted fold in units of kcal / mol, and the dot - bracket representation of the mutant predicted fold. finally, by pressing on each mutation name, a corresponding new page appears with detailed structure and energy information for the mutation. figure 6 shows the output screen that corresponds to mutation g7c - a9u available in figure 5. it contains secondary - structure drawings of the wild - type and mutation that facilitates examination of the structural change. the sequences of the wild - type and mutant predicted structures, with the mutated bases in the mutated sequence and structure painted in red, appear below the secondary - structure drawings. detailed information about the free - energies, dot - bracket representations and the various distances of the mutant predicted structure from the wild - type predicted structure are given at the bottom of the page. this way the user can scan several rearranging mutations by clicking on promising candidates that are available in figure 5, until a desired mutation for a specific task is reached. figure 2.the input screen of the rnamute webserver with the example parameters inserted. in the example, the number of mutations is set to 2 and a more time consuming method is employed relative to the default one. figure 3.the preliminary results screen of the rnamute webserver, ordering mutations in tables according to their distances from the wild - type predicted structure. figure 4.the preliminary results screen of the rnamute webserver after fine tuning the clustering resolution parameter in some of the tables. figure 5.mutation group list screen as a result of running rnamute for the case of two - point mutations for the example sequence. figure 6.output screen of a rearranging mutation is the example sequence as a result of running rnamute for the case of two - point mutation and single clicking in the mutation group list screen shown in figure 5 on the highlighted mutation g7c - a9u. the secondary - structure drawings for the wild - type and the mutants are plotted. the input screen of the rnamute webserver with the example parameters inserted. in the example, the number of mutations is set to 2 and a more time consuming method is employed relative to the default one. the preliminary results screen of the rnamute webserver, ordering mutations in tables according to their distances from the wild - type predicted structure. the preliminary results screen of the rnamute webserver after fine tuning the clustering resolution parameter in some of the tables. mutation group list screen as a result of running rnamute for the case of two - point mutations for the example sequence. output screen of a rearranging mutation is the example sequence as a result of running rnamute for the case of two - point mutation and single clicking in the mutation group list screen shown in figure 5 on the highlighted mutation g7c - a9u. the secondary - structure drawings for the wild - type and the mutants are plotted. recent discoveries of functional rna secondary - structure motifs in a variety of non - coding rnas and others, such as viruses, have boosted the interest in analyzing the effect of mutations on structure. they brought to an increasing number of site - directed mutagenesis experiments that affect these motifs. whether the purpose is to study the structural properties of these functional motifs or to perform smart modifications for rational design purposes, there is a clear motivation to develop a computational framework for the mutational analysis of rna secondary structures. when no rna alignments are available, only a single rna sequence, one relies at present on thermodynamic parameters as the main framework (as was done in the development of rnamute, rdmas and rnamutants, see (23) for their descriptions and comparison). toward this end, rna secondary - structure predictions by energy minimization are performed on rna wild - type and mutant sequences. thus, sequences that have been shown to fold correctly by experimental structure determination techniques to their energy minimization predicted structure are the best to work with as inputs to these programs in order to achieve reliable results. though exceptional cases exist, in general the upper range estimate for the sequence length that these programs are useful for is 150 nt ; therefore, the rnamute webserver supports sequences of up to 200 nt long. for example, rna functional motifs of up to 150 nt that form stable stem loop structures and are taken from utrs or orfs of viruses may constitute favorable candidates for their analysis with the rnamute webserver although this is by no means inclusive. the goal of the methodology behind the webserver is to process a large number of mutations efficiently. the analysis of multiple point mutations without any efficient strategy is highly expensive since the running time is o(n) for a sequence of length n with m - point mutations. the rnamute method that is now implemented in a webserver was developed to meet this challenge. by calculating in the initial stage all suboptimal solutions, after which only the mutations that stabilize the suboptimal solutions and destabilize the optimal one are considered as candidates for being deleterious, the method employed reduces the running time from several hours to several minutes as was described in (18). thus, the methodology behind the webserver enables its practical use for the analysis of multiple - point mutations. the rnamute webserver was developed with the goal of making the efficient method for the mutational analysis of rna secondary structures available for the entire biological community. the webserver is user - friendly and accessible to practitioners, both in terms of ease of use and simplification of the output. we believe that it will serve experimental groups for improving their capability to perform rna mutational analysis. the lynne and william frankel center for computer sciences, ben - gurion university ; united states israel binational science foundation (2003291). funding for open access charge : the lynne and william frankel center for computer sciences, ben - gurion university. | rna mutational analysis at the secondary - structure level can be useful to a wide - range of biological applications. it can be used to predict an optimal site for performing a nucleotide mutation at the single molecular level, as well as to analyze basic phenomena at the systems level. for the former, as more sequence modification experiments are performed that include site - directed mutagenesis to find and explore functional motifs in rnas, a pre - processing step that helps guide in planning the experiment becomes vital. for the latter, mutations are generally accepted as a central mechanism by which evolution occurs, and mutational analysis relating to structure should gain a better understanding of system functionality and evolution. in the past several years, the program rnamute that is structure based and relies on rna secondary - structure prediction has been developed for assisting in rna mutational analysis. it has been extended from single - point mutations to treat multiple - point mutations efficiently by initially calculating all suboptimal solutions, after which only the mutations that stabilize the suboptimal solutions and destabilize the optimal one are considered as candidates for being deleterious. the rnamute web server for mutational analysis is available at http://www.cs.bgu.ac.il/~xrnamute/xrnamute. |
nonalcoholic fatty liver disease (nafld) is a pathological condition that encompasses a wide spectrum of liver damage, ranging from simple steatosis to nonalcoholic steatohepatitis (nash), cirrhosis, and hepatocellular carcinoma. the pathogenesis of nafld is multifactorial and is characterized by overweight and insulin resistance (ir). recently, some studies reveal that bone mineral density (bmd) is also influenced by nafld. reported a significant association between mean lumbar bmd and nafld in postmenopausal subjects after adjusting for age, body mass index (bmi), alanine aminotransferase (alt), smoking status, and alcohol consumption, and they concluded that postmenopausal women with nafld had an increased risk of osteoporosis. pardee. reported that obese children with nafld had significantly lower bmd z - scores than obese children without nafld ; among children with nafld, those with nonalcoholic steatohepatitis (nash) had a significantly lower bmd z - scores than nafld children without nash. however, when this phenomenon is explained by overweight and insulin resistance (ir), there is a paradox. in obese subjects, it has been argued that there is a positive relationship between body weight and bone mass especially in adults. however, some recent studies reveal that severe ir may negatively affect bmd [4, 5 ]. the role of cytokines and other bone - influencing molecules released from the inflammatory liver is still unclear. osteocalcin (oc), which is a specific marker of bone formation, has been found to be decreased in liver with nafld [6, 7 ]. besides its role in the calcium and bone metabolism nafld patients present with a marked reduction in serum 25(oh) vitamin d when compared with controls. however, although these cytokines are associated with both nafld and bmd, none of them have been confirmed to be involved in the process whereby nafld influences bone metabolism. considering that little is known about chinese patients and that the mechanism underlying the relationship between nafld and bone defect is poorly understood, this cross - sectional study was performed in china to explore the role of overweight, ir, osteocalcin, and vitamin d in the interaction between nafld and bmd patients were recruited from the shanghai tenth people 's hospital of tongji university from october 2011 to april 2012. all subjects were screened using a questionnaire on their medical history, symptoms, and findings in physical examination. inclusion criteria were as follows : (1) subjects who were 4070 years old and (2) males or postmenopausal females with or without nafld. (1) there were other causes of chronic liver disease (hepatitis b and c, wilson disease, -1-antitrypsin deficiency, autoimmune hepatitis, and cystic fibrosis), severe alcohol abuse (> 10 g of alcohol per day), and drug induced fatty liver disease, especially related to amiodarone, estrogens, and vitamin a. (2) subjects were current or former smokers who quitted smoking less than 6 months ago. (3) there were conditions known to affect bone metabolism, such as kidney, thyroid or parathyroid diseases, hyperprolactinaemia, ovary excision, rheumatoid arthritis, ankylosing spondylitis, malignant tumors, and medication with agents influencing bone metabolism (such as calcium, vitamin d, and anti - osteoporosis drugs). a total of 99 males and 125 postmenopausal females were enrolled and divided into 4 groups according to the gender and the presence of nafld : males without nalfd, males with nafld, females without nafld, and females with nafld. this study was conducted according to the principles in the declaration of helsinki, and written informed consent was collected before study. the whole protocol was approved by the ethics committee of shanghai tenth people 's hospital of tongji university. weight was measured with a plethysmography scale, where patients wore minimal clothing, and height was measured with a stadiometer. body mass index (bmi) was calculated by dividing the weight by height squared (kg / m). nafld was diagnosed based on the ultrasonographic evidence of hepatic steatosis, such as a bright hepatic echo pattern, increased echo attenuation, and loss of intrahepatic architecture. liver ultrasonography was conducted with a 4 mhz probe (eub-6500, hitachi, tokyo, japan) and evaluated by an experienced radiologist. bmd was measured by dual - energy x - ray absorptiometry (dexa) (hologic (qdr-4000), usa). the bmd of lumbar spine (l), right hip (rh), and femoral neck (fn) was evaluated, and the means of l, rh, and fn served as the mean bmd (table 4). biochemical markers, including total cholesterol (tc), triglyceride (tg), high density lipoprotein (hdl), low density lipoprotein (ldl), fasting plasma glucose (fpg), fasting insulin level (fins), alt, alkaline phosphatase (akp), aspartate aminotransferase (ast), and serum creatinine (scr) were measured with standard biochemical methods. bone metabolic markers including type i collagen (ctx), parathyroid hormone (pth), oc, calcitonin (ct), bone alkaline phosphatase (bap), and 25-hydroxyl - vitamin d (25(oh)d) were measured by elisa (roche) according to the manufacturer 's instructions. insulin sensitivity and ir were evaluated by homeostasis model assessment 2 (homa2), including homa2%b, homa2%s, and homa2ir, calculated by homa2 v2.2 (http://www.dtu.ox.ac.uk/homa). analysis of variance (anova) was used to compare the baseline morphometric measurements (table 1), bmd, and biomarkers in the control group and the nafld group for both genders (tables 2 and 3). analysis of covariance was used to adjust for weight, bmi, wc, lipid profiles, and alt (table 2, p value (a)). multiple linear regression analysis was performed to analyze the variables associated with mean bmd and nafld (table 4). statistical product and service solutions version 17.0 (spss 17.0) software was used for statistical analysis. at baseline, the age, height, fpg, fins, akp, ast, and scr were comparable between the control group and the nafld group, whereas the weight, bmi, wc, lipid profiles, and alt in subjects of the nafld group were markedly different from those in the control group (table 1). subjects in the nafld group had significantly lower bmd in rh and fn of males and in rh of females. after adjustment for parameters (weight, bmi, wc, lipid profiles, and alt) at baseline, serum bone metabolic markers including ctx, pth, oc, ct, bap, and 25(oh)d were comparable between the nafld group and the control group in both genders. although calcium was significantly different, we did not think this difference was clinically significant. in the nafld group, homa2ir was higher in both genders, but homa2%s was lower in females (table 3). three models were used to analyze the correlation between bmd and nafld taking into account all the parameters including age, bmi, waist, homa2ir, and nafld that would affect the bmd. in all the models, nafld played a very important role in the process of the influence on bone. in our study, subjects in the nafld group had significantly lower bmd than those in the control group for both genders, and the difference was still present after adjustment for variables. however, most clinical trials [1, 9 ] showed a negative association between nafld and lumbar bmd. in the present study, there was no significant difference in the lumbar bmd between the nalfd group and the control group, which might be attributed to the differences in the ethic and age. since the bmd of femur neck and hip was not detected in previous studies, the bmd of femur neck and hip could not be compared among studies. at baseline, subjects in the nafld group were characterized by higher weight, bmi, and wc, which was in accordance with other studies in which overweight or obesity was a predictor for nafld and other serious medical conditions [10, 11 ]. there is a significant relationship between bmi and relative body fat mass. consequently, bmi is a widely accepted index of obesity, correcting for gender and ethnicity. furthermore, there is a direct association of bmi with hepatic steatosis, nash, and advanced liver fibrosis [12, 13 ]. wc is highly correlated with visceral adipose tissue (vat) and a marker for abdominal obesity. excess vat, or abdominal obesity, is a risk factor of ms as compared to individuals with fat located predominantly in the lower body and subcutaneously. overweight, bmi and wc are related to bone mass to a certain extent because any increase in body mass, fat, or lean will expose the skeleton to greater forces during locomotion. bone is sensitive to, but not limited to, a variety of mechanical parameters. found that the obesity failed to protect against bone mineral loss in postmenopausal women. in our study, correlation analysis showed that there was no significant relation of bmd with weight, bmi, and wc. hoy. speculated that the bone quality of overweight adolescents adapted to lean mass but not to greater fat mass, because the fat composition ratio was not significantly different between the control group and the nafld group. ir was negatively associated with bmd in obese or t2 dm patients [17, 18 ]. even having higher bone density, as in the ir state, diabetic women have lower femoral neck strength relative to load. in ir obese women circulating concentrations of inflammatory cytokines are reckoned to be the most important factor in causing and maintaining ir. it has been found that ir induced by 12-week high fat diet (hfd) could impair the osteoblastic insulin signaling, osteoblast proliferation, and osteoblast survival and result in osteoporosis of the jawbone. obesity status - associated ir may induce high circulating intact (ifgf-23) and c - terminal fgf-23 (ctfgf-23), which is positively associated with pth and negatively associated with vitamin d, resulting in low bone mass. elevated alt and nafld are associated with ir, and thus, alt has been proposed as a useful serum marker for early ir, which reflected a balance between oxidative stress and antioxidant response [24, 25 ]. failed to find low bmd in nafld patients, but elevated serum alt was found to be associated with lower bmd. in our study, negative association was noted between alt and bmd in nafld group, which was consistent with previously reported studies. alt, an indicator of inflammation state in either the liver or system, will affect bone metabolism. osteoblasts can secrete oc, but recent work indicates that, besides acting as a specific bone marker for bone formation, oc is also associated with insulin secretion and sensitivity. after administration of recombinant oc, insulin secretion increases, blood glucose decreases, and experimental obesity is attenuated. consequently, oc has been considered to link bone to energy metabolism, although this was not evident in our study. possible explanations for this discrepancy may be that only total serum oc was tested, whereas undercarboxylated osteocalcin (ucoc) affects energy metabolism. secondly, the association between oc and steatohepatitis is not confirmed by multivariate analysis. thirdly, decreased serum oc in chinese nafld patients as compared to subjects in western countries suggests the potential role of ethnicity. vitamin d receptors are present in several cell types and play an important role in both energy metabolism and bone metabolism. 25(oh)d is a major circulating form of vitamin d and constitutes the best clinical indicator of vitamin d stores. reported that nafld patients had a marked reduction in serum 25(oh)d as compared to controls, and this decrease was closely associated with the histopathological features of nafld. however, a report on 102 nafld patients and 54 healthy controls showed no difference in the serum vitamin d, which was consistent with our results. in our study, we did not take the seasonal variation of vitamin d ; since it was a cross - sectional study, we could not balance every impact factor. moreover, vitamin d was not the only one of the factors that affect the bone metabolism ; there were still other markers including type i collagen (ctx), parathyroid hormone (pth), oc, calcitonin (ct), and bone alkaline phosphatase (bap). future studies are needed to clarify the correlation between vitamin d status and nafld. this retrospective study still had some limitations. firstly, being a cross - sectional study, it failed to completely exclude that some correlations were incidental. secondly, bmd could be influenced by many factors such as physical activity, calcium / vitamin d intake, and peak bone mass, which were not evaluated in this study. thirdly, only total oc, instead of carboxylated and uncarboxylated forms of oc, was measured. moreover, we did not perform hepatic biopsy to evaluate the severity of nafld. that was because hepatic biopsy which was considered as the golden standard to diagnose nafld was invasive. liver ultrasonography was also considered an effective way to investigate whether the fat existed in the liver. further studies are needed to evaluate the effect of nafld on bmd in different extent. for example, we could conduct magnetic resonance spectroscopy (mrs) on the subjects or a hepatic biopsy on the animal model of nafld. in conclusion, bmd is significantly decreased in elderly male and female chinese nafld patients as compared to controls. further studies are needed to identify the causative factors, especially the role of ir. | aim. to investigate bone metabolic characteristics in chinese adults with nonalcoholic fatty liver disease (nafld). methods. a total of 224 patients (99 males and 125 postmenopausal females) were recruited and divided into 4 groups : males without nafld, males with nafld, females without nafld, and females with nafld. bone mineral density (bmd) was evaluated according to body mass index (bmi), waist circumference (wc), and serum biomarkers. cell function was evaluated by homa2%b, homa2%s, and homa2ir. results. males in the nafld group had lower bmd of the right hip and the femoral neck (0.852 0.117 versus 0.930 0.123, p = 0.002 ; 0.736 0.119 versus 0.812 0.132, p = 0.004), and females had lower bmd of the right hip (0.725 0.141 versus 0.805 0.145, p = 0.002) even after adjusted for weight, bmi, waist, hdl, and alt. there was no significant difference in bone metabolic markers between patients with and without nafld. nafld was an important factor that affected the bone ; moreover, the effect attenuated when homa2ir entered into the model (r2 = 0.160, = 0.172, and p = 0.008). conclusions. nafld exerts a detrimental effect on bmd in both males and females. insulin resistance may play an important role in this pathophysiological process. |
nuts are rich in unsaturated fats, fibre, minerals, vitamins, and phytonutrients [15 ]. regular consumption of nuts has been associated with reductions in blood cholesterol concentrations and the risk of cvd [611 ]. however, nuts are energy - dense, high - fat foods, meaning that they contain high amounts of energy per unit weight. in general, the consumption of energy - dense foods is associated with weight gain and obesity [12, 13 ]. therefore, the public health recommendation to consume nuts on a regular basis could potentially result in weight gain and possibly negate their beneficial effects. also, the general public perceive nuts as fattening and thus might not heed the advice to consume nuts regularly as a means of reducing cvd risk. it is, therefore, important for policy makers to determine whether the regular consumption of nuts may promote weight gain and hence increase obesity rates among the general population and, based on findings, change the wording of the health recommendation to consumers as appropriate to clarify any misperceptions. epidemiological studies show that nut consumers tend to be leaner than those who do not regularly consume nuts. this research tends to show an inverse or no association between nut consumption and body mass index (bmi) as well as adiposity [1519 ]. also, clinical trials, where the primary outcomes have included cardiovascular risk factors such as blood cholesterol, have failed to show an increase in body weight with regular consumption of different kinds of nuts, albeit over the short term [7, 9, 2025 ]. however, these studies were not designed to assess body weight and in many instances the investigators provided dietary advice or adjusted energy intake to prevent weight gain. studies that have looked at the role of nuts in the context of supervised weight loss diets reported that subjects who consumed nut - enriched diets experienced greater weight loss and greater improvement in cvd risk factors compared with a low - fat diet [26, 27 ], a complex carbohydrate diet, or an isocaloric diet without nuts. thus, incorporating nuts into diets intended for weight loss and weight control has the potential to result in more favourable changes in body weight and cvd risk. four randomised crossover trials involving the consumption of nuts have specifically looked at body weight as the primary outcome [3033 ]. in general these studies indicate that the daily inclusion of nuts into the diet results in either no weight gain or less weight gain than predicted from the additional energy intake. there have been several purported reasons why regular nut consumption may not result in the theoretically predicted weight gain [3437 ]. firstly, nuts are high in protein and fibre with low glycaemic index value, which may promote satiety resulting in a reduction in calories from other foods, that is, dietary compensation [3033, 38, 39 ]. the crunchy textural property of whole nuts may also promote satiety as the mechanical act of mastication results in the secretion of appetitive hormones such as cholecystokinin and glucagon - like peptide-1 [28, 4044 ]. secondly, previous work has suggested that nut consumption may lead to an increase in energy expenditure. in humans, a high unsaturated - to - saturated - fat ratio in the diet can increase rmr. thus, the high unsaturated fat content of nuts may increase rmr [30, 41, 45, 46 ]. thirdly, some research has suggested that the lipid found in nuts may not be highly bioaccessible [47, 48 ], meaning that a high proportion of this fat is excreted in the faeces and therefore not available for energy metabolism [32, 40, 49, 50 ]. all the above - mentioned studies were not designed to answer the question as to whether nut consumption is different to the ingestion of other isoenergetic foods with regard to dietary compensation and energy metabolism. this information is needed to determine whether there is something unique about nuts, setting them apart from other more highly processed energy - dense foods. it is also needed to confirm current public health advice that nuts, though an energy - dense food, are nutrient - dense and thus should be consumed regularly as part of a cardio - protective diet. therefore, the purpose of this study was to assess the effects of providing daily portions (~1100 kj / d) of hazelnuts, chocolate, or, potato crisps for twelve weeks on body weight and composition, blood lipids and lipoproteins, rmr, appetite indices, and diet quality compared with the control group. one hundred and twenty - four participants were recruited from the general public in dunedin, new zealand (nz). the exclusion criteria were people with bmi 30 kg / m, people who have asthma, women who are pregnant or breastfeeding, people with a chronic disease such as cancer, heart disease, or diabetes, and people with food allergies or food aversions. the study protocol was approved by the human ethics committee of university of otago, nz. the trial was registered at the australian new zealand clinical trials registry (http://www.anzctr.org.au/), registration number actrn12609000265279. all the ennis hazelnuts used in this study were purchased from uncle joe 's walnuts (blenheim, marlborough, nz). all nuts were stored at room temperature in darkness prior to opening. dairy milk chocolate (cadbury, dunedin, nz) and ready salted potato crisps (bluebird, auckland, nz) were chosen as comparison foods because they are both popular snack foods in nz and have a very similar energy density to nuts, with one being savoury and the other sweet. the energy density for the study hazelnuts was 26 kj / g, while the energy density for the chocolate and potato crisp was 22 kj / g. this study was conducted using a randomised, controlled, parallel design with four arms : ~1100 kj / d for each of hazelnuts (42 g) chocolate (50 g), and potato crisps (50 g) or no additional food (control group). participants were informed that the purpose of the study was to assess the effects of consuming three different snacks on energy balance and blood cholesterol concentrations. we purposely did not emphasise body weight so that participants were unaware that this was the focus of the research. they were asked to complete a recruitment questionnaire, which included contact information, demographic and relevant health details that might affect the study outcomes. all participants were asked to consume their regular diets (baseline diet) during a two - week run - in period. these included body weight and composition, blood lipids and lipoproteins, rmr, appetite indices, a three - day diet record (3ddr), and physical activity levels. after collecting all baseline measurements, participants were randomly allocated to one of the four groups for a period of 12 weeks. due to the strong possibility of age, sex, and bmi effects, groups were balanced using eight strata covering all possible combinations of age group (1840, 4165), sex (male, female), and self - reported bmi group (30 kg / m despite their self - reported bmi being 70% compliance to the study snacks, there was evidence of a difference in changes in plasma total cholesterol from baseline to week 12 between the groups (p = 0.035). plasma total cholesterol in the hazelnut group was lower compared to the chocolate group (p = 0.006), with a tendency for the hazelnut group to be lower than the control (p = 0.057). there was an additional tendency for total cholesterol in the chocolate group to be higher than the potato crisp group (p = 0.099). from the itt analysis, there was no evidence of a difference in changes in the recordings of subjective appetite sensations among the intervention groups (all p 0.384, table 5). overall there was an increase in fullness ratings, decrease in hunger, desire to eat, prospective consumption, and preoccupation with thoughts of food ratings after consuming the study snacks. one concern with this recommendation is that, because nuts are high in fat and thus energy - dense, frequent consumption may lead to weight gain. however, epidemiological studies report that nut consumers tend to be leaner than those who do not consume nuts and clinical trials show lower than predicted weight gain from the addition of nuts. firstly, decreased energy intake via increased satiety levels and food displacements [28, 3033, 3844 ], and energy malabsorption as a result of a reduction in bioaccessibility of the fat [32, 40, 4750 ], or, secondly, increased energy expenditure via increased diet - induced thermogenesis or increased rmr due to the high unsaturated fat content [30, 41, 45, 46 ]. it is, therefore, plausible that these unique properties of nuts help maintain energy balance. however, there is limited data comparing the body composition of those regularly consuming nuts compared to the intake of other snacks of equal energy density. it was hypothesised that consuming nuts may provide some protection against weight gain compared to other energy - dense snacks based on the aforementioned mechanisms. however, the present study found no evidence that changes in body weight or composition differed between the control group and those offered regular consumption of any of the three energy - dense snacks. in addition, blood lipid and lipoprotein response to the different snack foods did not differ significantly. nevertheless, the diet quality among the nut consumers was appreciably improved compared to the other groups. it was somewhat unexpected that changes in body weight and composition were not different amongst the four groups. we hypothesised that the nut group would gain less weight than predicted and that body weight would be lower compared to the other snack groups. our study shows that the reported satiety levels after consuming the study snacks were found to be similar across all intervention groups. it appears that participants tended to compensate to a similar extent irrespective of the snack they were provided with, where 61% of the extra energy from the study snacks was displaced by reductions in other foods. this finding is in line with a recent review, which reports that the dietary compensation accounts for 5575% of the energy from nuts. no change in physical activity level was observed in the intervention groups throughout the study, and the predicted weight gain given the additional calories provided by the snacks was 2.8 kg. however, on average actual weight gain was only 0.64 kg, which equated to 23% of that predicted and did not differ between the snack groups and the control group. this compensatory response has been seen in other studies where nuts have been provided as additional foods and the observed weight gain ranged from 0 to 28% of the predicted weight gain [3033 ]. one recent study comparing the effects of the consumption of almonds and cereal bars with the control group on body weight reported similar results to the current study. the addition of either almonds or cereal bars did not result in a significant increase in body weight from baseline indicating a compensatory response for both foods. however, this study had a small sample size (n = 45) and the energy provided from the almonds (1430 kj) was significantly higher than that from the cereal bars (950 kj). this discrepancy in energy makes comparison difficult but would suggest that compensation was greater in the almond group. as with our study, research showing some degree of compensation has been conducted in non - obese populations [30, 32, 41, 45 ]. it is speculated that obese individuals compensate differently than their lean counterparts [41, 58, 59 ]. we note that employing a pp analysis (using 70% compliance as an indicator of adherence to the dietary advice to eat the snacks) showed that a higher baseline bmi was associated with a lower waist circumference at follow - up in the nut group compared to the control group (p = 0.005) and to a lesser extent in the potato crisp group compared to the control group (p = 0.034). given this, dietary compensation in response to nuts and possibly potato crisps may be more pronounced in overweight individuals compared to those who are of normal weight. however, this result was only marginally statistically significant and should be interpreted with caution unless it can be replicated in other studies. one purported mechanism whereby nuts may provide a beneficial effect on energy regulation a previous review suggested this may account for approximately 10% of the energy contributed by nuts. in the present study, rmr was measured in a subsample (n = 52) and there was no evidence of a difference in rmr between any of the snack groups. three studies showed that there was a significant increase in rmr following 219 weeks of peanut consumption in lean [30, 45 ] and overweight participants. in contrast, daily almond supplementation for ten weeks and six months failed to show any changes in rmr or respiratory quotient. it is unclear whether the increment in rmr is specific to peanut consumption only. given the inconsistencies among studies, this is an area requiring further research. another explanation provided by some researchers for the less than predicted weight gain when consuming nuts involves the reduction in the bioaccessibility of the lipid in nuts. a recent review estimates 1015% of the energy contributed by nuts similar results were obtained in the first and only trial specifically designed to investigate this effect, whereby 5% of dietary fat was excreted in the whole peanut group (70 g / d), which could potentially offset around 9 - 10% of the energy provided by nuts. however, recent studies reported that there were no statistically significant differences in body weight after consuming three different forms of hazelnuts (30 g / d) and five different forms of peanuts (56 g / d) for four weeks each, suggesting that the bioaccessibility of lipids was similar for all forms of nuts. thus, the potential difference in bioaccessibility for the amount of nuts (42 g) provided in the present study may be too small to significantly influence body weight. most previous literature suggests that regular nut consumption in hypercholesterolemic individuals results in significant reductions in tc and ldl - c [21, 25, 6064 ] with some showing increases in hdl - c [25, 62, 63 ] whilst others do not [21, 60, 61, 64 ]. it is likely that we did not observe an improvement in blood lipoproteins with regular nut consumption due to the low baseline tc (4.8 mmol / l) and ldl - c (2.9 recent studies have shown that the magnitude in the reduction in tc and ldl - c following regular nut consumption was dependent on the baseline concentrations [11, 22, 65, 66 ]. using pp analysis, plasma tc was significantly lower in the hazelnut group compared to the chocolate group (p = 0.006), with a tendency to be lower when compared to the control (p = 0.057). in addition, there was a tendency for the chocolate group to have higher tc than the potato crisp group (p = 0.099). this would indicate that among those actually following the advice to consume the different snacks, nuts show a more favourable effect on blood lipids. the cholesterol - lowering properties of nuts are largely due to their unsaturated fat content, but also due to other bioactive compounds such as phytosterols [15 ]. one important finding of this study is that the regular consumption of nuts improved diet quality compared to the consumption of other energy - dense snacks. the percent of energy derived from safa was significantly lower while the energy from mufa and pufa was significantly raised in the nut group compared to all the other groups. in addition, the intake of vitamin e during the intervention was significantly raised in the nut group compared to the other groups. these dietary changes support the findings of other studies, which have observed improvements in diet quality with the simple addition of nuts without any further healthy eating advice [2, 19, 38, 67 ]. such changes would be expected to reduce the risk of chronic disease, in particular, cvd. a recent study has shown that substituting one unhealthy snack such as crisps and chocolate bars with one healthy snack such as unsalted nuts or seeds per day has a positive impact on nutrient density and could prevent approximately 6000 cardiovascular deaths every year in the uk. although nuts provided no additional benefits compared to isocaloric quantities of other energy - dense snacks in terms of body weight and composition, blood lipids and lipoproteins in this group of non - obese, normocholesterolaemic individuals, diet quality was substantially enhanced in the nut group. this study supports the findings of other studies, which suggest that nuts can be incorporated into the diet without the risk of adverse weight gain and can improve diet quality. the authors ' responsibilities were as follows s. l. tey : study coordinator, designing the study, collecting, entering and analyzing the data, disseminating findings, and preparing the paper ; r. brown : study design, supervision of data collecting, data analysis, preparing the paper ; a. gray : assistance with study design, statistical analysis, editing of the paper ; a. chisholm : study design, supervision of data collection, editing of the paper ; c. delahunty : assistance with study design, editing of the paper. | previous studies have reported that regular nut consumption reduces cardiovascular disease (cvd) risk and does not promote weight gain despite the fact that nuts are energy - dense. however, no studies have investigated the body composition of those regularly consuming nuts compared to similar intakes of other snacks of equal energy density. this parallel study (n = 118) examined the effects of providing daily portions (~1100 kj / d) of hazelnuts, chocolate, or potato crisps compared to a control group receiving no snacks for twelve weeks. effects on body weight and composition, blood lipids and lipoproteins, resting metabolic rate (rmr), appetite indices, and dietary quality were compared. at week 12, there was no significant difference in any of the outcome measurements between the groups except for dietary quality, which improved significantly in the nut group. nuts can be incorporated into the diet without adversely affecting body weight and can improve diet quality. |
gender differences has been observed in hypertentension, cardiovascular and kidney diseases. over activity of rennin angiotensin system (ras) the ras has an important role in the control of body fluid, electrolyte balance and arterial pressure. estrogen activates the synthesis of the rennin substrate angiotensinogen and it inhibits plasma renin activity. it is reported that estrogen administration in ovarectomised rats is caused upregulation of angiotensin type 2 receptor (at2r), and angiotensin ii (angii) is caused a stronger vasoconstriction in ovarectomised rats. nitric oxide (no) is an endogenous mediator in different biological actions including vasodilation. it also was reported that no releasing was significantly higher in ovarectomised rats treated with estradiol (ove) and estrogen induces augmentation of no production through vascular endothelium. so, with attention to role of estrogen in at2r expression and no releasing, in this study we attempt to find the role of estrogen on no releasing in response to angii in presence and absence of at2r in female rats. the rats were housed at a temperature of 23 - 25c with a 12 h light / dark cycle and they had free access to water rat chow. the experimental groups were as (1) intact animals ; (2) ovariectomised rats treated with placebo for 2 weeks (ovx), and (3) ove valerate (0.5 mg / kg body weight, i.m) for 2 week (ove). louis usa), trachea was isolated to insert air ventilation tube and catheters were implanted into the carotid artery and jugular vein. blood pressure was monitor through carotid artery and after the equilibration period, rats from each group were divided into two subgroups. one subgroup received saline vehicle (0.9% saline) and the other subgroup received at2r antagonist ; pd123319 (sigma, st. louis, mo, usa, 1 mg / kg as bolus plus continuous infusion of 1 mg / kg / h during the experiment). at 30 min after commencing vehicle or antagonists treatments, intravenous infusions angii (20 g / kg / h) for period of 60 min commenced. the blood samples also were obtained before and after the angii infusion for nitrite concentration determination. the level of nitrite was measured using a colorimetric assay kit (promega corporation, usa) that involves the griess reaction. the serum level of nitrite before (control) and after (treat) angii infusion between the groups were compared via repeated measures anova with factors group (intact, ovx and ove) and time (before and after angii infusion) and their interaction. the serum level of nitrite before (control) and after (treat) angii infusion between the groups were compared via repeated measures anova with factors group (intact, ovx and ove) and time (before and after angii infusion) and their interaction. the results are presented in figure 1a and b. at control phase (before angii administration), no significant differences were observed between the subgroups neither treated with vehicle nor pd123319. after angii administration when at2r antagonist (pd123319) was not infused, the serum level of nitrite in response to angii administration in ove groups increased significantly [figure 1a ] (p < 0.05). however, this increase was abolished by at2r antagonist [figure 1b ]. the serum level of nitrite in three groups of experiments before (control) and after (treat) angiotensin ii administration without (a) and with (b) antagonist ; pd123319. significant difference was observed between estradiol and other groups when angiotensin type 2 receptor was present. star () indicate significant difference from others group (p < 0.05). ovx ; ovariectomised rats treated with placebo, ove ; ovariectomised rats treated with estradiol, and n in the top legend shows the number of animal in each subgroups the results are presented in figure 1a and b. at control phase (before angii administration), no significant differences were observed between the subgroups neither treated with vehicle nor pd123319. after angii administration when at2r antagonist (pd123319) was not infused, the serum level of nitrite in response to angii administration in ove groups increased significantly [figure 1a ] (p < 0.05). however, this increase was abolished by at2r antagonist [figure 1b ]. the serum level of nitrite in three groups of experiments before (control) and after (treat) angiotensin ii administration without (a) and with (b) antagonist ; pd123319. significant difference was observed between estradiol and other groups when angiotensin type 2 receptor was present. star () indicate significant difference from others group (p < 0.05). ovx ; ovariectomised rats treated with placebo, ove ; ovariectomised rats treated with estradiol, and n in the top legend shows the number of animal in each subgroups in this short study, we found that the serum level of nitrite increased significantly after angii administration in ove group when at2r is present, and this increase was abolished by at2r antagonist. estrogen is responsible of complex effects on ras components and there is interaction between estrogen and at2r. at2r activation opposes with at1r actions and estrogen decreases at1r / at2r ratio. confirmed with our result other studies have reported that ovariectomised rats treated with estrogen is caused enhancing endothelium derived relaxing factor level due to increasing of endothelial no synthase. the vasodilatory effect of estrogen response to angii administration may mediate by at2r to increase the serum level of no metabolite in female rats. due to gender difference of angii receptors activities, the role of at2r in no formation response to angii infusion may be different in male. | background : renin - angiotensin system activity is gender related. the vasodilatory response of angiotensin ii (angii) angiotensin type 2 receptor (at2r) may involve nitric oxide (no) production. we attempted to find the role of at2r on no formation response to angii administration in ovariectomised rats treated with estradiol (ove).methods : a total of 33 female wistar rats were divided into 3 groups ; intact animals, ovariectomised treated with placebo (ovx) and ove. at 2 weeks later, all animals were subjected to anesthetize and catheterize and each group was divided into two subgroups that received at2r antagonist (pd123319) or vehicle. each animal was subjected to 1 h continuous infusion of angii (~20 g / kg / h) and the level of no metabolite (nitrite) was measured before and after angii infusion.results:at the presence of at2r, the serum level of nitrite in response to angii administration in ove groups increased significantly (p < 0.05).conclusions : however, this increase was abolished by at2r antagonist. it seems that at2r involves nitrite production response to angii in ove. |
catalysis at the nanoscale has attracted significant attention in the past two decades due to the unique properties of materials that arise at the nanoscale. following the discovery by valden. of catalytically active gold nanoclusters, gold, in particular, has become the basis for novel catalysts due to its activity at the nanoscale. metal nanocatalysts have found a wide range of applications including co oxidation, carbon nanotube nucleation, alcohol dehydrogenation, and formic acid electrooxidation. in particular, nanocatalysts have played an extensive role in fuel cell catalysts by reducing oxygen and oxidizing methanol. theoretical tools have allowed for the prediction of novel catalysts for oxygen reduction, olefin / paraffin separations, and ammonia synthesis. bimetallic nanoparticles are particularly useful due to the additional degrees of freedom composition and structure that may be adjusted in order to improve catalytic behavior. bimetallic catalysts frequently display catalytic activity that is higher than either constituent material. for instance, two epitaxially grown overlayers of pd on au have been predicted to bind co stronger than either pure metal. similar effects have been exploited in the ni / au bimetallic system in order to design a steam reforming catalyst with a higher efficiency. the interplay between geometry and electronic structure has been extensively studied both theoretically and experimentally for bimetallic systems in order to determine how these factors affect the catalytic properties of these materials. the role of electronic structure in metals, specifically the d - band center, was first modeled by newns and later expanded upon with first principles calculations by hammer and nrskov. this model, which relates the d - band center with binding energy, has been applied to co adsorption on bimetallic systems, hydrogenation of olefins by bimetallics, nitrobenzene hydrogenation by bimetallic nanoclusters, and many other surface reactions. first - order surface reactions, which are of particular importance for catalysis, are typically constrained to a linear relationship between adsorption energy and reaction rate. polanyi (bep) relation, has been demonstrated to fundamentally constrain many surface reactions. the bep relation predicts that strong adsorption energies to the surface result in faster reaction rates for first - order surface reactions. in practice, the turnover frequency of a catalyst is limited in both the weak binding and strong binding regimes. in the strong binding regime where the bep relation shows the smallest reaction barriers, the catalytic performance is limited by the desorption of products. in the weak binding regime, the reaction rate is limited by the large activation energies predicted by bep. an optimal catalyst will balance these two regimes such that the barriers are low enough to be overcome and that the adsorbed molecules may diffuse and desorb from the surface. the balance between these two regimes is described graphically by the so - called volcano plot. the volcano plot, a scatter plot of turnover frequency as a function of adsorption energy, peaks at the center and avoids both the weak and strong binding limits. by using bimetallic dens, we demonstrate that a catalyst for p - nitrophenol (pnp) reduction may be designed by tuning den composition and structure in order to bind the product molecule with an adsorption energy closest to the peak in the volcano plot. pnp, as with other nitrophenols and derivatives, is a common byproduct from the production of pesticides, herbicides, and synthetic dyes. coinage metals, in particular, have been demonstrated to be excellent catalysts for pnp reduction at the nanoscale. bimetallic coinage metal nanoparticles have been demonstrated to catalyze pnp reduction with rates that strongly differ from a simple linear interpolation between the rates of the two pure metals. these types of bimetallic nanoparticles may be easily synthesized in solution with dendrimer encapsulation methods that allow for precise control over particle size and composition. experimentally, pnp has a strong absorption at 400 nm, which allows for an easy and reliable means to measure reaction rates by uv vis spectroscopy. the overall reaction rate is pseudo - first - order when both the metal catalyst and nabh4 are in excess. the reduction of pnp is, thus, an ideal model system for demonstrating the bep relation for pseudo - first - order reactions and the tunability of bimetallic nanoparticles in order to produce an optimal catalyst. when nabh4 is in excess, the rate is controlled by the adsorption of pnp. experimental approach in order to tune the reaction rate of pnp reduction by adjusting the composition of the metal nanoparticle catalysts. in particular, we show that the bep relation accurately represents this type of multistep, pseudo - first - order reaction and that bimetallic dens can be used to approach the peak in the resulting volcano plot. this systematic study demonstrates that theoretically predicted adsorption energies onto simple bimetallic surfaces provide a simple and accurate predictor for catalytic reaction rates in pseudo - first - order reactions. we note that when the lattice constants of the constituent metals of the bimetallic nanoparticles are similar, the resulting properties are essentially a linear combination of the properties of the two pure metals. in contrast, the synthesis of aucu, pdcu, and ptcu dens was reviewed by yeung and crooks. preparation of ptau bimetallic particles by cocomplexation in g6-oh dendrimers has not been previously reported, but the uv vis spectra presented here match those for bimetallic ptau dens prepared by lang. using galvanic exchange. nabh4 was purchased from emd, haucl4 was purchased from acros organics, cuso4 was purchased from mallinckrodt, and both k2pdcl4 and k2ptcl4 were purchased from alfa aesar. all solutions were prepared with water acquired from a barnstead nanopure diamond uv deionization system, > 18.2 mohmcm (denoted as nanopure water). g6-oh pamam dendrimer (13.22% w / w in methanol) was a donation from dendritech, inc. each dendrimer solution was prepared by evaporating the methanol from 5.46 l of g6-oh pamam dendrimer in a 20 ml vial (i - chem) with septum cap. the dendrimer was hydrated with enough nanopure water to result in a final volume of 10 ml and a final dendrimer concentration of 1 m after the addition of metal salt, the ph adjustment, and the addition of reductant. for a 55 molar excess of metal - to - dendrimer, 5.5 l of 0.1 m metal salt was added. complexation time was dependent on the metal salt used : haucl4 was complexed for < 10 min, cuso4 for 15 min, k2pdcl4 for 3060 min, and k2ptcl4 for 72 h. dendrimer metal complexes were reduced with a 10 molar excess of nabh4 to metal (except au, for which only 12 molar excess was used) by adding freshly prepared 0.2 m nabh4. the ph of the reduced nanoparticle solution was adjusted to < 8 using 0.1 m hcl. the dens were characterized via uv vis spectroscopy prior to and immediately after reduction. bimetallic dens were synthesized as described above, except only a 28 molar excess of each metal was added (2.8 l of 0.1 m metal salt). the longer complexing metal salt was added first, the ph was adjusted to 67, and then at the appropriate time before reduction, the second metal salt was added. vis spectra were collected using a spectral bandwidth of 1.0 nm with an agilent 8453 uv vis diode array spectrophotometer and agilent chemstation software. fresh 0.2 m nabh4 was prepared 10 min before each set of kinetic trials. polystyrene cuvettes were prepared by adding 2.35 ml of nanopure and 0.250 ml of 600 m pnp. an ocean optics visible spectrophotometer was set to monitor the absorbance at 400 nm (the max for pnp) and 600 nm (for background) by sampling three times per second. the spectrophotometer was placed on a stir plate, and a microstir bar was added to the reaction cuvette. immediately after initiating data collection, 0.750 ml of 0.2 m nabh4 was added to the cuvette using a micropipet (gilson) and 0.600 ml of 1 m den solution was added to the cuvette via gastight syringe. the minimum absorbance at 400 nm was subtracted from all absorbances to correct for background absorption from the dens. the natural log of the absorbance at 400 nm was plotted against time, and the steepest part of the curve was fit with a line, the negative slope of which was considered the apparent rate constant, kapp. the rate constant is considered apparent because previous work by other groups has shown that the observed rate constant depends on the concentration of sodium borohydride as well as the starting concentration of pnp. all calculations were performed by density functional theory (dft) within the vienna ab initio simulation package. the kohn sham single - electron orbitals for the valence were expanded in a plane - wave basis with an energy cutoff of 300 ev. the exchange - correlation (xc) energy was treated by the pw91 implementation of the generalized - gradient approximation. the interpolation of the xc term was performed using the method of vosko. adsorption was considered on the (100) face of a 79-atom nanoparticle in a truncated octahedron geometry, which was found to be the most stable for pt by both total x - ray scattering experiment and dft calculations. this face is the most undercoordinated and taken to be the most active for catalysis. the pnp molecule was then allowed to adsorb onto the surface such that the total force per atom was less than 0.01 ev /. this bonding geometry is shown for a sample pd / au random alloy in figure 1. for each bimetallic system, ten random 50/50 alloys by composition were generated ; geometries that significantly distorted from the truncated octahedron were removed. chosen binding geometry for pnp chemisorption on a 79-atom pd / au random alloy nanoparticle. at least 8 of vacuum was included to separate periodic images in order to prevent spurious image image interaction. for density of states (dos) calculations, the bulk lattice constants calculated by wang. were used for a cell that consisted of five layers of the 3 3 face - centered cubic unit cell. the brillouin zone for the unit cell was integrated using a 4 4 1 monkhorst adsorption energies were determined by calculating the difference between the total energy of the relaxed nanoparticle pnp chemisorbed complex and the total energies of the two constituent pieces : the nanoparticle and the pnp molecule. thus, the adsorption energy represents the energy difference between taking the pnp molecule from infinite distance and allowing it to chemisorb onto the nanoparticle surface. the binding energy, which has the opposite sign from the adsorption energy, represents the energy required to separate the bound pnp molecule from the nanoparticle and move it to infinite distance. in order to accurately compare reaction rates for different catalysts, a systematic and uniform method for both synthesizing the catalyst and maintaining similar reaction conditions is required. through an encapsulation synthesis route using the g6-oh pamam dendrimer, we are able to reliably synthesize nanoparticles of similar size and with known composition. this synthetic route produces nanoparticles of either pure metals or bimetallic random alloys with a 50/50 composition. figure 2 shows scanning transmission electron microscopy (stem) images and size distribution histograms for the synthesis of au, pd, and pd / au nanoparticles. as seen in figure 2, dens of au, pd, and pd / au have very similar average diameters on the order of 1 nm. the dens are spherical in shape ; given the size distributions and shape, the nanoparticles contain 55 atoms. as noted previously, the experimental conditions are nearly uniform for each pure metal and bimetallic nanoparticle synthesis route. because of these tight experimental controls, we can directly measure catalytic properties of the resulting particles under both uniform synthesis and reaction conditions. the reduction of pnp in the presence of nabh4 is fast when performed in solution with coinage metal catalysts. the overall reaction of interest is shown in scheme 1. the full catalytic reaction, however, is a multistep process that is not characterized by a single saddle point from which an arrhenius rate may be extracted. in the presence of excess nabh4 and sufficient catalyst, the reaction is pseudo - first - order and dependent only upon the concentration of pnp in solution. the role of the metallic catalyst is to bind the pnp molecule through the two oxygens of the nitro group. this adsorbed geometry is shown in figure 1, where a single molecule binds to two atoms of a (100) surface and creates a pentagonal m o n o m cyclic intermediate. pnp is a strong visible absorber with a maximum absorbance at 400 nm. as shown in figure 3, the reduction of pnp to p - aminophenol (pap) is evidenced by a decrease in absorbance at 400 nm and a new absorbance growing in at 315 nm associated with formation of pap. because the reaction is pseudo - first - order in the presence of excess nabh4, the slope of a plot of the natural log of the absorbance at 400 nm yields the apparent reaction rate, kapp. this process for determining apparent rates is shown in figure 3 for the case of the pd / cu alloy. thus, we show that the reaction rates can be easily determined by ultraviolet visible (uv vis) spectroscopy. stem images of dens (a) g6-oh(au55), (b) g6-oh(pd55), and (c) g6-oh(pd28au28) and corresponding size distributions. the average diameter of the au, pd, and pd / au nanoparticles was 1.4 0.7, 1.0 0.3, and 1.1 0.3 nm, respectively. images were collected on a jeol 2500se stem. because of the sole dependence of the rate on the concentration of pnp in solution, the initial adsorption of the pnp molecule to the nanoparticle surface directly correlates with the rate constant for the full reaction. binding of organic molecules to metal surfaces has been extensively modeled beginning with newns and later expanded upon by hammer and nrskov. because p - nitrophenol is insoluble in water, the resulting nitrophenolate is then reduced via sodium borohydride in the presence of the metal catalyst. the hammer nrskov model identifies the center of the d - band of the metal surface as the primary controlling factor in chemisorption strength. when the adsorbate interacts with the metal d - band, the adsorbate state overlaps with the metal states and is split off into bonding and antibonding interactions. as the d - band becomes farther below the fermi energy, the antibonding states are increasingly populated, and the overall chemisorption strength weakens. a scatter plot of the d - band against the adsorption energy is shown in figure 4. from figure 4, a general trend of increasing adsorption strength with a d - band center closer to the fermi energy a further trend, however, is that adsorption energy decreases as one moves down columns of the periodic table. this effect has been noted by hammer for oxygen adsorption onto noble metals. for the coinage metals, the d - band is nearly filled, so many antibonding states are populated. the population of bonding and antibonding states is net repulsive, which increases with orbital size as one moves down a column. this increasingly repulsive interaction for the coinage metals accounts for the weaker adsorption onto pt and pd rather than cu, despite the differences in d - band centers. when disparate metals are alloyed, charge rearranges due to the disparate fermi levels that are brought into contact. because of charge rearrangement, noble metal atoms become less noble and reactive metal atoms become less reactive. in addition, alloying of metals from different rows on the periodic table has been demonstrated to activate surfaces by introducing localized electronic states. for instance, small amounts of au alloyed into previously inert ag(111) surfaces allow it to bind ethylene. the 5d electrons of the au atoms overlap poorly with the 4d of the ag surface and create localized states where ethylene may bind. (a) shows the decreasing absorbance at 400 nm corresponding to decreasing pnp concentration ; spectra are shown at 1 s intervals. (b) shows the plot of the natural log of the absorbance at 400 nm versus time ; data points are separated by 0.5 s intervals. the slope in (b) yields the apparent rate constant kapp = 0.12 0.03 (s) for this trial. g6-oh(pd28cu28) dens were used for this trial. because of the direct dependence of the reaction rate constant on the binding energy, our goal is to optimize the reactivity of bimetallic dens by combining metals which are inactive due to strongly binding the reactants with metals that are inactive due to weakly binding the reactants. this relationship is typically demonstrated via a volcano plot, which is a scatter plot of the reaction rate in the presence of the catalyst against the adsorption energy of the reactant to the catalyst. in principle, overly strong binding renders the adsorbate catalyst so strongly bound that a reaction can not occur. in the regime of overly weak binding, the catalyst has no interaction with the reactant. we consider chemisorption onto the (100) face of the truncated octahedron np as a representative site for chemisorption onto the synthesized nps in solution. chemisorption onto the (100) face is possible in both truncated octahedron and cuboctahedron geometries ; effects from undercoordination are likely to be smaller than 0.1 ev. in figure 5, we present a volcano plot of calculated adsorption energies of the pnp molecule onto the various nanoparticle catalysts plotted with the experimentally measured reaction rates for pnp reduction. in this plot,, au has a low reaction rate constant due to its weak binding, whereas cu has a very low rate constant due to its overly strong binding. pt and pd fall between these extremes. a scatter plot of the d - band center of the metal surface vs the adsorption strength of p - nitrophenol shows a general increasing binding interaction with a d - band center closer to the fermi energy. the d - band center is a weighted average of the local dos for a single surface atom. one effect that is immediately noticeable in figure 5 is that alloying au with either pt or pd results in a stronger binding energy and yields a correspondingly faster reaction rate constant. when pd is alloyed with cu, the adsorption energy is much stronger than as compared to pure pd and is followed by a slower reaction rate. somewhat surprisingly, then, is the behavior of pt / cu, which has a higher reaction rate than either pure pt or pure cu. even worse, au / cu would seem to have an average adsorption energy that sits very near to the peak in the volcano, and yet it has a reaction rate that is very close to pure au. the solution to this seeming paradox lies in the distribution of the adsorption energies for different configurations of the bimetallic alloys. cu is much smaller than either pt or au, so the lattice constant mismatch compresses the atoms in the system. similarly, the 3d cu valence orbitals overlap very weakly with the 5d orbitals of pt and au. the net result is that configurations in which pnp is bound to two cu atoms is bound quite strongly and is bound weakly when au or pt is present. the range in the binding energy data is shown in figure 6, which shows that pd / cu displays a unimodal distribution centered around the average of pd and cu, whereas au / cu displays binding energies that correspond to either binding strongly on two cu atoms or weakly when au is present. a scatter plot of the calculated adsorption energy of pnp on various nanoparticles plotted against the experimentally observed reaction rates. solid black dots are pure metals, and red dots are random alloys of two metals. the solid lines are best - fit lines for the strong- and weak - binding regimes. the dashed lines represent the range of calculated binding energies for various allowed structures that were considered. in addition, the fact that alloying with cu weakens the adsorption energy on pt and au atoms compared with the pure is also explained by the d - band model. when a metal with a large lattice constant is compressed by alloying with a smaller metal, the orbital overlap between its atoms increases. the effect of this compression is that the d - band center shifts away from the fermi level ; this effect results in decreased reactivity at the site of compression. because of this decrease in d - band center, the larger metal atoms become less likely to form a covalent bond with an adsorbate. this effect is demonstrated by the fact that two pt atoms bind pnp weaker in the alloy than in the pure nanoparticle. more pronounced, two au atoms bind pnp in a pure nanoparticle significantly stronger than in the alloy, where the two au atoms are forced closer together. thus, the effect on the reaction rate is significant. a change in adsorption energy results in an exponential change in the reaction rate. thus, the system reacts at the rate of its most active component along the volcano plot. the molecule is too strongly adsorbed on cu, so the reaction rate is controlled by the orders of magnitude faster rate associated with binding at an au cu two - atom site. in the case of pt / cu, two pt atoms bind pnp weaker than two pt atoms in a pure metal nanoparticle ; thus, the reaction rate is faster than pure pt. the ensemble binding energies, represented by the two data points, are less significant to predicting the overall reaction rate than the spread in the data and the maxima and minima of adsorption energies in the set of random alloys. histograms of the adsorption energies of pnp on nanoparticles of pd / cu and au / cu are shown. the y - axis of the histogram is the number of nanoparticles in the randomly generated sample of bimetallic alloys of the specified composition, and the x - axis is the binding energy of pnp. the pd / cu distribution is centered around a single ensemble average for binding energy ; however, the au / cu binding energy has two peaks that correspond to the pure cu site and the au cu site. in particular, we show that for metals of similar lattice constants, one can alloy a metal that binds the target molecule too strongly with one that binds it too weakly to yield a more active particle. in contrast, when the lattice constants are disparate, the results do not follow this trend. instead, the resulting adsorption energies are broadly distributed, so the overall ensemble average of binding energy can be completely uncorrelated from the observed reaction rate. in this case, catalysts with a specific geometry at the binding site are the most active and dominate the reaction rate. the result is that two metals that bind too strongly can alloy to create a significantly more active catalyst, even though the average binding energy appears to be unfavorable. in summary, we have presented a systematic method for the synthesis of uniform pure and bimetallic nanoparticles using a dendrimer - encapsulation synthesis route. this systematic synthesis method leads naturally into controlled, uniform reaction conditions for measuring catalytic activity of pnp reduction in presence of sodium borohydride. in this manner, reaction rates for similar particles under the same reaction conditions can be accurately measured and compared to binding energies from electronic structure calculations. we demonstrate that the reaction rates fall along a standard volcano plot. in order to selectively tune the reaction rate toward the maximum in the volcano plot, we produced several bimetallic catalysts. for alloys of metals with similar lattice constants, the result was perfectly intuitive the ensemble binding energy was the average of the two metals. in this case, the reaction rates fell along the volcano plot as expected. in contrast, metals with dissimilar lattice constants pt / cu and au / cu did not fall along the volcano plot as predicted. pt / cu catalyzed the reaction much faster than expected from the ensemble binding energy, and au / cu catalyzed it much slower than expected. we demonstrated that the reaction rate was not controlled by the ensemble binding energy, but by the binding energy of the most active metal atoms, whose binding energies were quite different from the ensemble average. overall, we have demonstrated a joint experimental theoretical method for evaluating catalysis by bimetallic and pure dens and analyzed the factors, such as lattice mismatch, that determine whether or not the properties of a bimetallic will be a simple average of the constituents properties. | we demonstrate that the reduction of p - nitrophenol to p - aminophenol by nabh4 is catalyzed by both monometallic and bimetallic nanoparticles (nps). we also demonstrate a straightforward and precise method for the synthesis of bimetallic nanoparticles using poly(amido)amine dendrimers. the resulting dendrimer encapsulated nanoparticles (dens) are monodisperse, and the size distribution does not vary with different elemental combinations. random alloys of pt / cu, pd / cu, pd / au, pt / au, and au / cu dens were synthesized and evaluated as catalysts for p - nitrophenol reduction. these combinations are chosen in order to selectively tune the binding energy of the p - nitrophenol adsorbate to the nanoparticle surface. following the brnsted evans polanyi (bep) relation, we show that the binding energy can reasonably predict the reaction rates of p - nitrophenol reduction. we demonstrate that the measured reaction rate constants of the bimetallic dens is not always a simple average of the properties of the constituent metals. in particular, dens containing metals with similar lattice constants produce a binding energy close to the average of the two constituents, whereas dens containing metals with a lattice mismatch show a bimodal distribution of binding energies. overall, in this work we present a uniform method for synthesizing pure and bimetallic dens and demonstrate that their catalytic properties are dependent on the adsorbate s binding energy. |
recurrent abdominal pain (rap) is common among children, leading to absence from school and impaired quality of life. a recent systemic review, including studies with a variety of definitions for rap, found a prevalence as high as 19% in children. the rome iii diagnostic criteria established a uniform method of classifying rap into different categories of functional gastrointestinal disorders (fgids), such as abdominal migraine, cyclic vomiting syndrome, functional abdominal pain syndrome, functional dyspepsia, and irritable bowel syndrome. although the data are limited, children of lower socioeconomic status may harbor a higher risk for developing rap. preliminary data from tertiary referral centers also suggest a relationship between fgids and somatic comorbidities, such as migraine headaches, fibromyalgia, sleep disturbances, and chronic fatigue. however, these associations were found in a self - selected, more affected population and may not be present in all children with fgids. this study aimed to investigate the prevalence of fgids in an inner - city primary care pediatric clinic in the united states using rome iii diagnostic criteria. a secondary aim was identification of comorbid nonpsychiatric symptoms among children meeting criteria for fgids in this population. this cross - sectional questionnaire study was approved by the university hospitals case medical center institutional review board. it was conducted between august 2012 and may 2013 at a large urban primary care clinic in cleveland, ohio. healthy patients between the ages of 9 and 17 seen in clinic for well - child visits were recruited. patients in clinic for a sick visit or patients with a history of organic gastrointestinal disorders including inflammatory bowel disease, cancer, celiac disease, liver disease, peptic ulcer disease, and food allergies were excluded. a modified version of the ohio dysautonomia (odysa) instrument was administered to participants (see the appendix). the odysa is a comprehensive survey of somatic symptoms across organ systems developed for both adult and pediatric use. it uses validated published question sets where available (e.g. rome iii modular questions for fgids, international headache association criteria for migraine headache symptoms, and the epworth sleepiness scale for daytime sleepiness) or, alternatively, face - valid questions. the odysa instrument was modified by removing question - sets relevant only to adults. besides fgids, the odysa instrument assessed participants for migraine headache symptoms, recurrent syncope, daytime sleepiness, chronic body pains, chronic fatigue, urinary frequency (defined as feeling a strong need to urinate with little or no warning), orthostatic symptoms, and raynaud - like symptoms (defined as fingers or toes turning white, red, or blue on cold exposure). statistical analyses were performed using sas version 9.3 (sas institute inc, cary, nc). the prevalence of fgids and other somatic complaints were summarized descriptively using frequency and percentage. demographics were compared between patients with and without fgids using fisher exact tests and wilcoxon 2-sample tests. two - sided p values were reported ; p <.05 was considered statistically significant. a proportion of patients fulfilled criteria for several fgids, most commonly abdominal migraine (table 2). demographics and overall somatic symptoms in patients with and without fgids. abbreviations : fgid, functional gastrointestinal disorder ; iqr, interquartile range. characteristics of the patients with fgids. abbreviation : fgid, functional gastrointestinal disorder. raynaud - like symptoms occurred more often in participants with fgids, and while trending toward significance, there was likely inadequate power to achieve true statistical significance. raynaud - like symptoms were reported in 3/11 (27.2%) of participants with fgids as compared to 11/134 (8.2%) of participants without fgids, p =.07. no statistical association was found between fgids and the other symptoms investigated (figure 2). fgids, while not extensively studied, are highly prevalent and often underrecognized in the pediatric population. children with fgids may manifest symptoms that affect physical and emotional well - being as well as have a negative effect on academic performance. overall, it is a significant cause of impaired quality of life in pediatrics. in order to provide better care for children with fgids, it is necessary to understand the extent of the disorder, identify potential associated risk factors, and recognize comorbid conditions. this study investigated the prevalence of fgids in an inner - city primary care pediatric practice in the united states and found the prevalence using rome iii diagnostic criteria to be 7.6%. to our knowledge, this is the first study investigating the prevalence of fgids based on rome iii criteria in this population. there are several reasons why this study population may have had a lower prevalence of fgids. first, whereas other studies defined rap in a variety of ways, this study used rome iii diagnostic criteria, which has strict diagnostic cutoffs. additionally, whereas several scandinavian studies suggested that socioeconomic status may be associated with rap, this is the only known us study to investigate this association. the results of the current study may suggest a lower prevalence of fgids among us children of low socioeconomic status. further research will need to investigate the association between socioeconomic status and fgids among children in the united states. another difference found in this study, compared with prior literature, was the high prevalence of abdominal migraine, typically present in only a small portion of the population. our cohort is too small to meaningfully interpret this finding, but this does suggest that the prevalence of fgids and the predominant type of fgids should be further investigated in this population. additional thought - provoking findings from this data set include the high prevalence of any somatic symptom, daytime sleepiness, and orthostatic symptoms in this population, regardless of the presence or absence of fgids. the high prevalence of these symptoms in an unselected group of subjects without fgids is surprising and requires further investigation to understand the basis of these findings. the main limitations of this study include the small sample size and the use of a questionnaire as a diagnostic tool rather than physician assessment. additionally, participants with food allergies were excluded from the study possibly lowering the prevalence of fgids in the study population. in summary, the lower prevalence of fgids in this study compared to previous studies may suggest a link between socioeconomic status and the prevalence of fgids. additionally, these data are consistent with the prior literature that depicts an association between fgids and other somatic complaints, such as raynaud - like symptoms, although likely related to the small sample size this was not statistically significant in our study. a similar population - based study with a larger sample size and a heterogeneous cohort from a variety of socioeconomic backgrounds may provide new insight regarding any possible association between fgids and socioeconomic status. dizzy : a feeling of motion such as spinning, whirling or sliding, or a sensation that you may fall. lightheaded : a feeling of weakness or loss of blood to the brain that might eventually lead to fainting. for the following sections (a through j) listen to each statement and reply with which comes closest to how you have been feeling. for each situation, please choose one number to describe the frequency of your symptom that is clearly linked to that situation. during the past month | functional gastrointestinal disorders (fgids) are a common problem in pediatric patients and can affect quality of life. however, the extent of these disorders may vary in different subpopulations of children. this study investigated the prevalence of fgids in an inner - city primary care practice. healthy patients between the ages of 9 and 17 were administered a validated questionnaire that assessed for fgids and other somatic complaints. eleven of 145 patients (7.5%) met criteria for fgids based on rome iii diagnostic criteria. raynaud - like symptoms tended to occur more often in patients meeting criteria for fgids, although this association was not statistically significant (p =.07). the lower prevalence of fgids in this population compared with earlier studies may suggest a link between socioeconomic status and the prevalence of fgids. larger population - based studies consisting of a heterogeneous cohort from a variety of socioeconomic backgrounds are necessary to further elucidate the true connection between fgids and socioeconomic status. |
skeletal muscles are innervated by sensory neurons that provide the central nervous system with important information about the muscle environment. muscle spindles are highly specialized encapsulated structures composed of intrafusal muscle fibers that are located in parallel with extrafusal muscle fibers. spindles are innervated by group ia and ii afferents that encode changes in muscle length and intrafusal fiber tone is dynamically regulated by innervating gamma motor neurons. group ib afferents are positioned between muscle fibers and their tendon insertions and are sensitive to changes in muscle force, for instance during muscle contraction. the group ia, ib and ii afferents provide proprioceptive feedback that aids in appropriate motor control. additional populations of muscle afferents located throughout the muscle (group iii and iv) serve to signal metabolite buildup, the presence of nociceptive stimuli, and muscle temperature. this muscle sensory information is critical to maintaining homeostasis, preventing muscle damage and modulating movement. activation of nociceptors can lead to the induction of chronic pain states and aberrant signaling from the muscle proprioceptors can lead to problems with balance or movement. we use an isolated muscle - nerve in vitro preparation to study the response of muscle sensory neuron receptor endings from adult mice of both sexes (shown are responses from 2 - 4 month old c57bl/6 mice). this preparation requires the isolation of the deep peroneal branch of the sciatic nerve and the extensor digitorum longus (edl) muscle, a fast twitch muscle of the peroneal group found in the lateral part of the lower leg. the edl is often used to study muscle contractile properties, has tendons that are easy to isolate and is small enough to allow adequate diffusive oxygen supply at rest and with reasonable contraction duty cycles. other muscles in this area (for instance soleus and tibialis anterior) are of similar size and this preparation could be easily modified to record from afferents from these muscles. a suction electrode is placed onto the cut end of the nerve to record muscle sensory afferent firing. individual neurons can be identified and analyzed based on their spike shape using spike sorting software. stimulating electrodes in the bath or on the nerve can be used to evoke muscle contraction. muscle length and force similar in vitro preparations have been used in rodents to study group iii and iv muscle afferents in the rat edl, group ia and ii spindle afferents in the rat fourth lumbrical toe muscle and group iii and iv muscle afferents in the mouse plantar muscle. an in vitro system has the advantages of pharmacological accessibility and direct control of perfusate and physiochemical variables like temperature and ph. an in vitro approach eliminates the potential in vivo confounds of anesthesia and muscle perfusion status. while the muscle - nerve preparation allows for the study of the direct response of a perturbation on the afferents, the ability to study gamma efferent modulation of spindle sensitivity and other integrated responses that is possible with in vivo or ex vivo preparations this preparation was previously used to characterize the response of mouse muscle spindle afferents to a battery of ramp and hold stretches and vibrations and it was determined that mouse spindle afferent responses were similar to those reported in other species such as rats, cats, and humans. mouse spindle afferent responses were found to be similar at both 24 c and 34 c bath temperatures, although at 34 c absolute firing rates were faster and the afferents were more able to respond to faster length changes. we describe below how this preparation can be used to identify and study the muscle spindle afferents. moreover, this preparation can easily be modified to study the response of other muscle afferent subtypes, to compare the properties of sensory afferents in response to a drug or disease state or assorted other variables (e.g., age, sex, gene knockout). appropriate national and institutional ethics should be obtained before performing animal experiments. weigh and deeply anesthetize an adult mouse with inhaled isofluorane using a vaporizer with 5% isofluorane plus a 1.5 l / min oxygen flow rate or a bell jar with isofluorane soaked cotton on the bottom. ensure that the mouse is deeply anesthetized and does not respond to a toe pinch. make a ventral midline cut through the ribs using scissors and remove the internal organs. skin the animal by grasping the skin from the neck area and pulling it past the feet. remove the legs by cutting above the hips and place the skinned legs into a dish with chilled (4 c), carbogenated (95% o2, 5% co2) low calcium, high magnesium bicarbonate buffered saline solution containing in mm : 128 nacl, 1.9 kcl, 1.2 kh2po4, 26 nahco3, 0.85 cacl2, 6.5 mgso4, and 10 glucose (ph of 7.40.05). place the legs dorsal side up in the dish and pin the legs and hips down using needles or insect pins so that the knee and ankle joints are at a 90 angle. place a pin on each end of the feet and one pin on each of the anterior and posterior thighs to hold the tissue in place. using castroviejo spring scissors, lift up the top layer of muscle on the thighs and make a midline cut to expose the sciatic nerve directly below. the sciatic nerve is located just below the top muscle layer and runs above the femur from its exit near the hips until it branches into the common peroneal and tibial nerve just before the knee joint. remove the muscle above the sciatic nerve until the point at which the deep peroneal nerve branch dives into the flexor hallucis longus (fhl) muscle is visible. using # 55 forceps, dissect the connective tissue around the peroneal branch to free it from the gastrocnemius and soleus muscles, which are on the medial side of the tibia. cut the tendons of the gastrocnemius and soleus muscles and carefully remove them from under the nerve. remove the superficial muscle on the lateral side of the tibia to expose three distinct tendon bundles at the ankle joint from medial to lateral : fhl, edl, and tibialis anterior (ta), with the edl hidden underneath the ta. cut the ta tendon at the ankle joint, lift the ta up and away from the edl, and cut the muscle near the knee to remove it. cut the fhl tendon at the ankle and lift it back to reach the area where the nerve enters the fhl. cut just below that point and remove ~2/3 of the fhl muscle. cut the sciatic nerve as close to the hip joint as possible and gently strip away all nerve branches except for the deep peroneal branch. cut the edl tendons at both the ankle and knee joints using large spring scissors. using sharp scissors, remove the edl, the remaining fhl and nerve from the surrounding tissue by cutting through the tibia bone at the knee and midway through the thigh. cut away the remaining tibia bone so that just the edl, part of the fhl and nerve remain. before the start of the experiment, constantly perfuse the bath with oxygenated (100% o2) synthetic interstitial fluid (sif) containing (in mm) 123 nacl, 3.5 kcl, 0.7 mgso4, 1.7 nah2po4, 2.0 cacl2, 9.5 nac6h11o (sodium gluconate), 5.5 glucose, 7.5 sucrose, and 10 n-2-hydroxyethylpiperazine - n-2-ethanesulfonic acid (hepes) ; ph 7.40.05. a flow rate of 15 - 30 shown is a commercially available bath of 25 ml capacity with two stimulating electrodes fixed to the bottom of the bath, a mounted tissue post and a mount for a force and length controller (approximate bath dimensions 8.5 cm x 3 cm x 1 cm ; for specifications see table of materials / equipment). use the remaining fhl tissue to handle the isolated muscle - nerve and place it into the tissue bath. place a small piece of sylgard on the bottom of the dish and use 6 - 0 silk sutures to tie both tendons and affix one end to the tissue post and the other to the lever arm of the force and length controller (see table of materials / equipment for specifications). use the smallest suture length that is practical. note : to facilitate easy connection to the lever arm a small piece of wire can be bent into a the suture can then be tied to the wire instead of threaded into the small hole on the lever arm. make suction electrodes from sa 16 glass by first using a glass micropipette puller (heat = 286, pull = 0, velocity = 150, time = 200) ; break the tip back and manually grind it on a sharpening stone until there is about a 3 mm taper. melt the tip using a microforge to the desired tip inner diameter of between 10 - 100 m depending on the area of nerve one wishes to sample from (see figures 1b-1c for electrode schematic and table of materials / equipment for product information). fill a premade glass suction electrode to the inner silver wire with sif. suction the cut end of the nerve into the electrode and connect to the positive port of a differential amplifier. wrap the electrode with a chlorided silver wire that connects to the negative port of the headstage. ground the sif bath by running a second chlorided silver wire from the bath to the headstage s ground port. also ground the perfusion tubing to the faraday cage at multiple points to mitigate electrical noise introduced via the perfusion pumps. stimulate the muscle via the electrodes mounted on either side of the muscle in the tissue bath to induce a twitch contraction. alternatively place a stimulating electrode on the cut end of the nerve. increase the stimulating voltage until a peak contractile force is observed and then increase the voltage by an additional 15% to reach supramaximal voltage (0.5 msec pulse width). continue the twitch contractions at the supramaximal voltage, with a 10 sec rest in - between, but vary the length of the muscle until a peak contractile force is reached to find the optimal length (lo) of the muscle. all length ramps and vibrations will start with the muscle at this length. allow the muscle - nerve preparation to remain in the bath for at least 1 hr before subsequent data collection to allow the tissue to reach the bath temperature and for normal synaptic transmission to recover following dissection in a low calcium solution. to collect data at a temperature other than room temperature, place a temperature probe into the tissue bath near the muscle. slowly bring the bath up to temperature by pumping heated water through the tissue bath base plate. wrap clay microwavable heating pads around the sif reservoir to help maintain a steady temperature. to identify an afferent as a spindle afferent, record the neuronal activity during repeated twitch contractions produced by a 0.5 msec supramaximal voltage stimulus delivered once every second. note : muscle spindle afferents should pause during the twitch contraction (figure 2). use data acquisition software to apply length changes at different speeds and to different lengths. use a custom script to automate this task (see supplemental information for a screenshot of the script and directions on how to customize the stretches given). apply ramp - and - hold stretches of 4 sec at stretch lengths of 2.5%, 5%, and 7.5% lo and stretch speeds of 20, 40, or 60% lo / sec. note : see user manual for specific force and length controller for necessary voltage - to - millimeter conversion factor. at the end of the experiment, determine muscle health at 24 c using maximal isometric tetanic contractions (500 msec train, 120 hz train frequency, 0.5 msec pulse width, supramaximal voltage). weigh and deeply anesthetize an adult mouse with inhaled isofluorane using a vaporizer with 5% isofluorane plus a 1.5 l / min oxygen flow rate or a bell jar with isofluorane soaked cotton on the bottom. ensure that the mouse is deeply anesthetized and does not respond to a toe pinch. make a ventral midline cut through the ribs using scissors and remove the internal organs. skin the animal by grasping the skin from the neck area and pulling it past the feet. remove the legs by cutting above the hips and place the skinned legs into a dish with chilled (4 c), carbogenated (95% o2, 5% co2) low calcium, high magnesium bicarbonate buffered saline solution containing in mm : 128 nacl, 1.9 kcl, 1.2 kh2po4, 26 nahco3, 0.85 cacl2, 6.5 mgso4, and 10 glucose (ph of 7.40.05). place the legs dorsal side up in the dish and pin the legs and hips down using needles or insect pins so that the knee and ankle joints are at a 90 angle. place a pin on each end of the feet and one pin on each of the anterior and posterior thighs to hold the tissue in place. using castroviejo spring scissors, lift up the top layer of muscle on the thighs and make a midline cut to expose the sciatic nerve directly below. the sciatic nerve is located just below the top muscle layer and runs above the femur from its exit near the hips until it branches into the common peroneal and tibial nerve just before the knee joint. remove the muscle above the sciatic nerve until the point at which the deep peroneal nerve branch dives into the flexor hallucis longus (fhl) muscle is visible. using # 55 forceps, dissect the connective tissue around the peroneal branch to free it from the gastrocnemius and soleus muscles, which are on the medial side of the tibia. cut the tendons of the gastrocnemius and soleus muscles and carefully remove them from under the nerve. remove the superficial muscle on the lateral side of the tibia to expose three distinct tendon bundles at the ankle joint from medial to lateral : fhl, edl, and tibialis anterior (ta), with the edl hidden underneath the ta. cut the ta tendon at the ankle joint, lift the ta up and away from the edl, and cut the muscle near the knee to remove it. cut the fhl tendon at the ankle and lift it back to reach the area where the nerve enters the fhl. cut just below that point and remove ~2/3 of the fhl muscle. cut the sciatic nerve as close to the hip joint as possible and gently strip away all nerve branches except for the deep peroneal branch. cut the edl tendons at both the ankle and knee joints using large spring scissors. using sharp scissors, remove the edl, the remaining fhl and nerve from the surrounding tissue by cutting through the tibia bone at the knee and midway through the thigh. cut away the remaining tibia bone so that just the edl, part of the fhl and nerve remain. before the start of the experiment, prepare the tissue bath. constantly perfuse the bath with oxygenated (100% o2) synthetic interstitial fluid (sif) containing (in mm) 123 nacl, 3.5 kcl, 0.7 mgso4, 1.7 nah2po4, 2.0 cacl2, 9.5 nac6h11o (sodium gluconate), 5.5 glucose, 7.5 sucrose, and 10 n-2-hydroxyethylpiperazine - n-2-ethanesulfonic acid (hepes) ; ph 7.40.05 shown is a commercially available bath of 25 ml capacity with two stimulating electrodes fixed to the bottom of the bath, a mounted tissue post and a mount for a force and length controller (approximate bath dimensions 8.5 cm x 3 cm x 1 cm ; for specifications see table of materials / equipment). use the remaining fhl tissue to handle the isolated muscle - nerve and place it into the tissue bath. place a small piece of sylgard on the bottom of the dish and use an insect pin through the remaining fhl tissue to stabilize the muscle. use 6 - 0 silk sutures to tie both tendons and affix one end to the tissue post and the other to the lever arm of the force and length controller (see table of materials / equipment for specifications). use the smallest suture length that is practical. note : to facilitate easy connection to the lever arm a small piece of wire can be bent into a the suture can then be tied to the wire instead of threaded into the small hole on the lever arm. make suction electrodes from sa 16 glass by first using a glass micropipette puller (heat = 286, pull = 0, velocity = 150, time = 200) ; break the tip back and manually grind it on a sharpening stone until there is about a 3 mm taper. melt the tip using a microforge to the desired tip inner diameter of between 10 - 100 m depending on the area of nerve one wishes to sample from (see figures 1b-1c for electrode schematic and table of materials / equipment for product information). fill a premade glass suction electrode to the inner silver wire with sif. suction the cut end of the nerve into the electrode and connect to the positive port of a differential amplifier. wrap the electrode with a chlorided silver wire that connects to the negative port of the headstage. ground the sif bath by running a second chlorided silver wire from the bath to the headstage s ground port. also ground the perfusion tubing to the faraday cage at multiple points to mitigate electrical noise introduced via the perfusion pumps. stimulate the muscle via the electrodes mounted on either side of the muscle in the tissue bath to induce a twitch contraction. alternatively place a stimulating electrode on the cut end of the nerve. increase the stimulating voltage until a peak contractile force is observed and then increase the voltage by an additional 15% to reach supramaximal voltage (0.5 msec pulse width). continue the twitch contractions at the supramaximal voltage, with a 10 sec rest in - between, but vary the length of the muscle until a peak contractile force is reached to find the optimal length (lo) of the muscle. all length ramps and vibrations will start with the muscle at this length. allow the muscle - nerve preparation to remain in the bath for at least 1 hr before subsequent data collection to allow the tissue to reach the bath temperature and for normal synaptic transmission to recover following dissection in a low calcium solution. to collect data at a temperature other than room temperature, place a temperature probe into the tissue bath near the muscle. slowly bring the bath up to temperature by pumping heated water through the tissue bath base plate. wrap clay microwavable heating pads around the sif reservoir to help maintain a steady temperature. to identify an afferent as a spindle afferent, record the neuronal activity during repeated twitch contractions produced by a 0.5 msec supramaximal voltage stimulus delivered once every second. note : muscle spindle afferents should pause during the twitch contraction (figure 2). use data acquisition software to apply length changes at different speeds and to different lengths. use a custom script to automate this task (see supplemental information for a screenshot of the script and directions on how to customize the stretches given). apply ramp - and - hold stretches of 4 sec at stretch lengths of 2.5%, 5%, and 7.5% lo and stretch speeds of 20, 40, or 60% lo / sec. note : see user manual for specific force and length controller for necessary voltage - to - millimeter conversion factor. at the end of the experiment, determine muscle health at 24 c using maximal isometric tetanic contractions (500 msec train, 120 hz train frequency, 0.5 msec pulse width, supramaximal voltage). compare the peak contractile force to previously reported values (~24 n / cm). the response of muscle afferents can be recorded following a variety of perturbations, depending on which afferent subtype is being studied. representative responses of muscle spindle afferents to muscle contraction and ramp and hold stretch are shown here. to identify an afferent as a spindle afferent, twitch contractions are given once every second (0.5 msec pulse width) to see if there is a pause in firing during contraction. figure 2 shows a representative trace of neuronal activity and muscle tension during these twitch contractions. if the recorded afferent was a group ib golgi tendon organ afferent, an increase in firing rate during the contraction would be expected. under control conditions most afferents with a regular firing pattern (~12 impulses / sec at 24 c and ~32 impulses / sec at 34 c) are muscle spindle afferents. a subset of spindle afferents will only fire during stretch (in our hands ~11% of spindle afferents). figure 3a shows a representative raw trace of two muscle spindle afferents responding to a ramp and hold stretch produced by the force and length controller. the spike histogram feature of labchart is used to identify and analyze the instantaneous firing frequency of the two individual neurons separately (figures 3b-3c). isolated muscle preparation a) the extensor digitorum longus (edl) and innervating sciatic nerve are mounted in an isolated tissue bath perfused with oxygenated synthetic interstitial fluid (sif). an extracellular amplifier connected to a suction electrode records neural activity. a dual force and length controller with appropriate software controls and measures muscle force and length. c) magnified depiction of the ideal tip shape for the suction electrode that is produced using a microforge neuronal activity (top trace) and muscle tension (bottom trace) from 30 twitch contractions are superimposed with top overlapping trace in black. afferent activity pauses during contraction - induced tension increase, which is a characteristic response of muscle spindle afferents. bracket and arrow above the top trace denote the time during contraction when activity is paused. spindle afferent response to ramp and hold stretch a) raw neural activity of two afferents (top trace) during a ramp and hold stretch applied to the edl (muscle length shown in bottom trace). fr., impulses per sec) of the unit exhibiting activity at lo from a (shown in blue). c) instantaneous firing frequency of the smaller unit that only fires during the stretch (shown in orange). both units exhibit the spike frequency adaptation during stretch that is characteristic of muscle spindle afferents. the goal of this article was to describe a method for recording from muscle spindle afferents in an isolated mouse muscle - nerve preparation. we have found that mouse spindle afferents respond similarly to stretch as those from rats, cats and humans, and other laboratories have used mice as model organisms to study sensory neurons in both the muscle and the skin in vitro (for example). muscle sensory afferents can be recorded for at least 6 - 8 hr at both 24 c and 34 c. to minimize handling the edl and nerve, use the remaining portion of the fhl to handle the tissue whenever possible. following the dissection, wait at least 1 hour to start data collection to allow the tissue to equilibrate to bath temperature and for normal synaptic transmission to recover. previously, muscle health was verified on a subset of muscles used in this preparation by determining that the maximal tetanic contractile force generated by the muscles is similar to that reported by others at the beginning and end of the experiment. muscle spindle afferents were identified functionally in this preparation by looking for a characteristic pause in firing in response to twitch contraction (figure 2) as well as the expected instantaneous frequency increases in response to length changes (figure 3). in our experience, the length of the nerve retained in this preparation (~7 mm maximum) is not long enough to use afferent conduction velocity differences to identify muscle afferent subtypes. additionally, unlike in cats and humans, measures of dynamic sensitivity were not able to clearly differentiate group ia and ii afferents in mice (for further discussion see wilkinson.). other subtypes of afferents (i.e., group iii and iv) can be identified using additional functional tests in this preparation, for instance by adding substances like capsaicin, atp, or bradykinin, decreasing bath ph, exposing the muscle to ischemia, etc. using suction electrodes allows the activity from multiple sensory neurons to be recorded at once, which increases the amount of data that can be collected from a single muscle. this preparation can be used to gauge the overall effect of a perturbation on sensory neuron population responses or the responses of identified afferents. if the spike shapes are unique enough, up to 4 sensory neurons can be discriminated by software (both spike2 (cambridge electronic design) and labchart pro (ad instruments) have performed similarly). in cases where neurons can not be discriminated, changes in electrode placement or tip diameter can easily be implemented. in summary, the mouse muscle - nerve in vitro preparation is a simple experimental approach that can be used to investigate the response properties of muscle sensory afferents to various physicochemical perturbations, injury and disease models. additionally, this preparation is ideally suited to take advantage of the powerful genetic tools available in mice, including transgenic animals and optogenetic tools. the open access charges for this manuscript have been paid by aurora scientific, inc., the company that makes the force and length controller and in vitro bath plate used in this manuscript. | muscle sensory neurons innervating muscle spindles and golgi tendon organs encode length and force changes essential to proprioception. additional afferent fibers monitor other characteristics of the muscle environment, including metabolite buildup, temperature, and nociceptive stimuli. overall, abnormal activation of sensory neurons can lead to movement disorders or chronic pain syndromes. we describe the isolation of the extensor digitorum longus (edl) muscle and nerve for in vitro study of stretch - evoked afferent responses in the adult mouse. sensory activity is recorded from the nerve with a suction electrode and individual afferents can be analyzed using spike sorting software. in vitro preparations allow for well controlled studies on sensory afferents without the potential confounds of anesthesia or altered muscle perfusion. here we describe a protocol to identify and test the response of muscle spindle afferents to stretch. importantly, this preparation also supports the study of other subtypes of muscle afferents, response properties following drug application and the incorporation of powerful genetic approaches and disease models in mice. |
the human growth hormone (hgh) is a ~22 kda polypeptide synthesized and stored by somatotroph cells within the anterior pituitary gland. it acts either directly or indirectly on various tissues and physiological systems such as longitudinal bone, skeletal muscle, liver, total body nitrogen balance, and so on. expression of hgh polypeptide has been performed in escherichia coli. since the signal peptides of proteins from eukaryotes are not recognized in prokaryotes, fusion proteins such as maltose binding protein mal e or thioredoxin a major disadvantage of this approach is that the fusion partner contributing the majority of the total mass of the fusion protein could be highly immunogenic. the hgh has also been expressed in sf9 cells, eukaryotic alga, and other eukaryotic system. on the whole, then the effective bombyx mori (b. mori) baculovirus system was employed to express 654bp hgh cdna encoding signal and mature peptide ; as a result, 160 g rhgh /ml but the expression level was still limited and it was not easy to purify the rhgh expressed by larvae. therefore, it was very difficult that the recombinant hgh could be used as a injectable drug. proved that protein expressed by silkworm pupae bioreactor could bring into effect as active cytokine through oral administration. in this study, we inserted hgh cdna encoding mature peptide into bmnpv by baculovirus system. constructed recombinant virus infected diapausing b. mori pupae instead of larvae. furthermore, hypophysectomized male rats were used to evaluate the biological activity of bmrhgh by oral administration. the b. mori - derived cell line bmn (conserved by our lab) was maintained at 27c in tc-100 medium (gibco) supplemented with 10% fetal bovine serum. wild type bmnpv (wt bmnpv, conserved by our lab) were propagated on bmn cells. the human erythroleukemia k562 cell was the gift from the cancer institute of zhejiang university. briefly, the hgh cdna was amplified from the plasmid pwr - hgh by pcr using the following primers : forward : 5ggggatccagtttcctactataccac3 and reverse : 5ttgaattcctagaagccacagctgcc3. enzyme sites of bamh i and ecor i were introduced at 5-terminus and 3-terminus, respectively, by designing primers. pcr products were digested by the two enzymes and ligated into the same cloning site of pbacpak8 using t4 dna ligase. the sequence of the inserted hgh dna synthesized by pcr was confirmed by nucleotide sequencing. the purified dnas of pbacpak - hgh and linearized wt bmnpv were used for cotransfection of bmn cells (1 10 cells) with lipofectin (roche applied science) as described previously. six days after the transfection, the culture medium was removed and the recombinant virus was isolated by the end point dilution method in 96-well plates. the recombinant virus isolates, showing cytopathic effect but no polyhedral inclusion body production, were purified by three cycles of plaque assay. the titer of the vbmrhgh preparation determined by tcid50 was about 6 10 pfu / ml. total cellular genomic dna was isolated from bmn cells infected by vbmrhgh or wt bmnpv and used for southern blotting to confirm the authenticity of inserted fragment. they were probed by enzyme - digested hgh cdna from pwr - hgh labeled by dig (dig dna labeling and detection kit, roche applied science). b. mori pupae (qingsonghaoyue, purchased from zhejiang chinagene biomedical co., ltd.) were released from cocoons and inoculated by vbmrhgh or wt bmnpv in body cavity through a syringe at a multiplicity of 10 pfu / pupa. the pupae mash was centrifuged at 15,000 g for 30 minutes at 4c to remove most of the top lipids and the bottom depositions. the upper solution was centrifuged for two more times as described to remove the remaining lipids and depositions. protein samples were electrophoresed through 15% sds - page and stained with coomassie brilliant blue (cbb). the blots were blocked with 1% bsa in 20 mm pbs (ph 7.4) for 1h at room temperature and incubated with 1 : 2000 dilution of anti - hgh antiserum (sigma) in blocking reagent for 2 hours at room temperature. the membrane was washed three times in pbs having 0.2% tween-20 (pbst) for 10 minutes and incubated in goat antirabbit igg antibody conjugated with horseradish peroxidase (vector lab, with a dilution of 1:2000 in blocking reagent) for 1 hour at room temperature. after washed with pbst for two times and pbs for another one time, the blots were monitored for color development in 10 ml 100 mm tris - cl (ph 7.4) including 0.05% diaminobenzidene and 0.2% hydrogen peroxide. the amount of recombinant bmrhgh expressed in silkworm pupae was assayed by elisa according to the protocol of ausubel.. the elisa standard curve was constructed using a series of hgh standard (from zhejiang shao yifu hospital) from 39 ng / ml to 1.2 g / ml according to the manual of wang and fan. protein samples (hgh standard protein and pupae supernatant solution) were coated onto 96-well polystyrene plate overnight at 4c. the plate was blocked with 1% bsa in pbs for 2 hours at room temperature. then it was incubated with 1 : 3000 dilution of anti - hgh antiserum in pbst for 2 hours at 37c. the plate was washed and incubated with 1 : 2000 dilution of goat antirabbit igg conjugated with peroxidase for 45 minutes at 37c. wells were washed and incubated with detecting buffer in dark for 20 minutes at room temperature. values of od490 were read in elx800 universal microplate reader (bio - tek instruments, inc, usa). standard curve was gained based on the od490 value and corresponding concentrate of standard protein. the amounts of rhgh synthesized in pupae were determined by its od490 value from the standard curve. bmrhgh expressed by silkworm pupa was diluted with 1 m tris (ph9.0) to a series of concentrations (40 ng / ml, 80 ng / ml, 100 ng / ml, and 200 ng / ml). l.8% methyl cellulose was added into the 24-well plastic culture plate for 1 ml / well, and then 2 (prm1640 + bsa) medium was also added for 1 ml / well. 50 l k562 cell culture medium (containing approximately 2000 cells) and 50 l bmrhgh with different concentrations were mixed, transferred into the 24-well plastic culture plate, and cultured at the conditions of 37c, 5% co2. the cells treated with hgh standard protein were defined as positive control, and the tris (ph9.0) solution - treated cells were defined as negative control. after cultured for 4 days, the number of colonies was counted under invert microscope (nikon, japan). the colony forming rate was calculated as follows : colony forming rate = the number of cell colonies in treatment group / the number of cell colonies in negative control group 100%. the colony forming rate can identify the ability of rhgh for promoting cell colony - forming. male wistar rats, 26~28d, provided by national institute for the control of pharmaceutical and biological products (china), were hypophysectomized according to zhu. beginning two weeks after hypophysectomy, the body weight (bw) of hypox rats was measured daily for 14 days. the rats whose body weight gain (bwg) was greater than 1g / day during the 14-day period were considered incompletely hypox and excluded from the bioassay. at the end of the 14-day period, the remaining hypox rats were assigned to treatment groups of eight rats each according to the bw. mean bw of hypox rats was 100~110 g. silkworm pupae supernatant solution from insects infected by vbmrhgh or wt bmnpv was dried frozenly into powder. when treating animals, protein samples were prepared by dissolving powders in 0.9% nacl solution. one group of hypox rats was gavaged with the protein sample of bmrhgh from pupae infected by vbmrhgh. the other group of animals as control was gavaged with the protein sample from pupae infected with wt bmnpv at the same dose. the third group of animals as blank was dealt with the same volume of 0.9% nacl solution. the bw of each rat was measured daily throughout the entire period of bioassay, beginning on the first day of gavage. after sliced from the top in an arrowy side, tibias were stained in 2% agno3 for 2 minutes and washed in water. then tibias were exposed in strong light until they were brown. the width of tibias epiphyseal was measured in inverted microscope (zoomed in 10 10). with all statistical analysis by t - test, differences were considered statistically significant for p <.05. a recombinant bmnpv harboring correct hgh cdna was generated by recombinant between plasmid pbacpak - hgh dna and wt bmnpv genome lipofected into bmn cells. by three cycles of plaque assays, the b. mori pupae were infected with purified vbmrhgh, and pupae supernatant solution was extracted as protein sample. the sds - page analysis of pupae protein sample showed a specific 22-kda band corresponding to the size of native hgh, which was obviously absent from the protein samples of both pupae infected by wt bmnpv and normal pupae (figure 1(a)). the identity of the protein to hgh was confirmed by its specific reaction with anti - hgh antiserum in a western blotting (figure 1(b)). in silkworm pupae, the expression of bmrhgh in b. mori pupae was quantified by elisa (figure 2). bioreactor could produce recombinant hgh effectively. at 48 hours after infection, the amount of bmrhgh was approximately 70 g/ ml pupae supernatant solution. then the amount increased day by day until 120 hours postinfection. the peak level of bmrhgh was approximately 890 g / ml supernatant solution and then it decreased. the bioactivity of bmrhgh in vitro was determined by the effect of it on colony formation of human erythroleukemia k562 cells. the result showed that bmrhgh could stimulate the colony formation of k562 cells (figure 3). the ability of k562 cells colony formation gradually increased along with the increase of hgh concentration (< 100 ng / ml). most cell colonies could be found when the concentration of hgh reached 100 ng / ml and then cell colony - forming ability declined when the hgh concentration continued to increase. the effect of bmrhgh on the colony formation in k562 cells was similar to hgh standard protein and the dose - dependent was clear too ; the result was in accordance with the report by gauwerky. the growth curves of hypox rats ' groups in our laboratory are presented in figure 4. the bwg of the group treated with bmrhgh was 12.50 0.831 g and that of the control group was 1.78 0.343 g. while in blank group no bwg was observed. by statistic analysis, it was interesting to note that there was a significant difference between the group treated with bmrhgh and the control group (p <.01). to evaluate the difference of liver weight and epiphyseal width between different groups, rats were killed at the 14th day, and the two parameters were measured (table 1). the result showed that the mean liver weight of the group treated with bmrhgh was 4.973 0.1633 g. while the mean value of the control group was 4.424 0.0928 g. the result of t - test showed that there was a significant difference between them (p <.05). comparing the liver weight between treated group and blank group, we also found the significant difference (p <.05). at the same time, the values of epiphyseal width were compared. we observed that the mean epiphyseal width of the group treated with bmrhgh was approximately 44.777 0.9867 m, while that of the control group was 39.453 0.9216 m. result of t - test showed that there was a similar significant difference between them (p <.05). the baculovirus expression system was first reported to produce human interferon in b. mori larvae. because of its ability to efficiently synthesize the highly active products, in the following decades it has been successfully used to produce various recombinant protein. for example, the b. mori has synthesized hepatitis b virus surface antigen, human insulin - like growth factor ii, human -interferon, human interleukin-2, human lactoferrin, and so forth. therefore, bmn cells and b. mori were the preferred bioreactors in most work. in our present work we found that this bioreactor was more efficient than other systems. in our work, the peak expression of bmrhgh was approximately 890 g / ml pupae supernatant solution (figure 2), which was corresponded to an average yield of 200~300 g per pupa. we also detected that the bmrhgh expressed in silkworm larvae and the peak production was 200 g / ml larvae hemolymph (data not shown) and approximately 60~70 g per insect, which is similar to previous work. it is interesting to find that the expression of bmrhgh is about 4~6 times more in diapausing silkworm pupae than that in larvae. this difference might be the result of the different protein metabolism of silkworm in different developing stages. from the present work, we found that the synthesis of bmrhgh increased at first day until reaching a peak, and then it decreased rapidly. the decrease of bmrhgh might be the result of a cysteine protease encoded by the bmnpv, which causes the degradation of the recombinant proteins and destruction of tissues during the later stages of the infection. a mutated bmnpv lacking the cysteine proteinase gene was constructed to express recombinant protein and the stability of recombinant protein could be enhanced in later postinfection stage. the physiological role of hgh is achieved by stimulating the synthesis of sm factor in liver. at the same time, many reports have proven that hgh itself can also act directly on multiple tissues and organs, promoting synthetic metabolism and growth. the results of tests in vitro showed that ng - level hgh can promote the physiological activity of many cells, including thymus cells, rat epithelial cells, and islet cells. in present study, effects of bmrhgh on colony formation of k562 cells at different dose were investigated. the most colonies were found at the dose of 100 ng / ml hgh and bmrhgh, respectively. the result indicated that rhgh expressed by b. mori pupa showed bioactivity similar to hgh. additionally, fbs is composed of many complex compositions which might contain some hormone - like factors and could affect the colony formation of k562 cells. therefore, the fbs was replaced by bsa in the cell culture medium, and thus the effect on colony formation of k562 was only caused by bmrhgh. biological activities of hgh preparations have been determined mostly by the body weight gain (bwg) assay, or the tibia assay test by the way of injection, both in hypox rats. hypox rats were also used in our study to evaluate the biological activity of expressed bmrhgh. for thousands of years, pupa was nutritious food, and we tried the way of oral administration instead of injection. we are interested to find that the rat 's body weight increased significantly (figure 4, p <.01), and we also discovered the improving activity of bmrhgh in pupae extracts to both the parameters of tibia epiphysial growth plate width and liver weight. it could be concluded that the bmrhgh in pupae extracts had biological activity by oral administration in hypox rats. we deduced that there were some factors in pupae that could protect functional proteins from digesting in stomach, or bmrhgh was digested into functional peptides that could be absorbed by body. the previous studies in our lab proved that bmrhgm - csf, a 29 kda recombinant hgm - csf protein expressed by silkworm pupae bioreactor, could bring into effect as active cytokine through oral administration. the clinical trial for bmrhgm - csf has been carried out and demonstrated that the oral administered bmrhgm - csf was absorbed into the blood. we also expressed many useful proteins by silkworm pupae bioreactor, such as cholera toxin b subunit insulin fusion protein, osteoprotegerin, human lactoferrin, and so forth, and also found the bioactivities of them by oral administration [16, 2628 ]. due to the oral administration activity, bmrhgh might be a potential choice for short stature dementia or alzheimer 's disease. more over, another interesting result in our work is that there are some other proteins in silkworm pupae that are reactive to anti - hgh antiserum (figure 1(b)). interestingly, the band was also found in the protein sample from silkworm pupae infected by wt bmnpv. bwg bioassay of hypox rats indicated that the protein sample from wt virus infected pupae is effective compared with the blank group (p <.05). the result indicated that there might be some proteins in b. mori pupae with similar characteristic and activity to hgh. taken together, the recombinant hgh protein bmrhgh was synthesized with a level of approximately 890 g / ml pupae supernatant solution, which was five times more than the level using larvae. the animal experiments proved that bmrhgh has a high oral administration bioactivity. due to the high activity and oral administration, bmrhgh might be used as a potential drug for short stature dementia or alzheimer 's disease and would be a low - cost choice. | the human growth hormone (hgh) has been expressed in prokaryotic expression system with low bioactivity previously. then the effective b. mori baculovirus system was employed to express hgh identical to mature hgh successfully in larvae, but the expression level was still limited. in this work, the hgh was expressed in b. mori pupae by baculovirus system. quantification of recombinant hgh protein (bmrhgh) showed that the expression of bmrhgh reached the level of approximately 890 g / ml pupae supernatant solution, which was five times more than the level using larvae. furthermore, animals were gavaged with bmrhgh at the dose of 4.5 mg / rat.day, and the body weight gain (bwg) of treated group had a significant difference (p <.01) compared with the control group. the other two parameters of liver weight and epiphyseal width were also found to be different between the two groups (p <.05). the results suggested that bmrhgh might be used as a protein drug by oral administration. |
ectodermal dysplasia (ed) are group of inherited disorders involving the developmental defects of ectodermal structure with an incidence of 1 in 1,00,000 live births. this group of inheritable disorders are characterized by an abnormality of two or more structures derived from ectoderm such as the hair, teeth, nails, sweat glands, craniofacial structures, digits, and others. the x - linked recessive is the most common pattern of inheritance while autosomal dominant and recessive are rare. in few cases, review of the literature revealed few case reports in the living individuals however to the best of our knowledge this is the first description of perinatal autopsy findings in a case of ed. a 21-year - old primigravida with 28 weeks of gestation, presented with a history of not appreciating fetal movements since 2 days. there was no history of fever with rashes during pregnancy and no history of any drug intake except iron and folic acid supplements. sonography revealed the absence of fetal cardiac activity and intrauterine growth retardation. after obtaining consent, the pregnancy was terminated and the fetus was sent for pathological examination. on gross examination, fetus weighed 700 g. all the fetal measurements were within normal limits. a tiny piece of umbilical cord attached to the fetus showed two vessels. the fetus had potter 's facies that is low set ears, depressed nasal bridge, and increased intercanthal distance. an orthopantomogram was done, which revealed decreased calcification and absence of tooth buds in many sockets (oligodontia) [figure 1d ]. (a) gross photograph showing sparse hair on scalp and absence of lips, (b) gross photograph showing sparse hair on chest, absence of nipple and skin deficient areas on left elbow joint. (c) gross photograph showing skin deficient areas on right elbow joint and right hand. (e) microphotograph of skin showing thinned out epidermis, immature hair follicle, and absence of sweat glands (h and e, 10). (f) microphotograph of skin showing negative immunostaining for herpes simplex virus (hsv) antibody (ihc hsv, 10) on dissection, all organs are in situs except left kidney which was malrotated and nonascended to the left lumbar region. the capsule was easily strippable and fetal lobulations were present. in the thorax, the lungs appeared hypoplastic and the heart was normal in development. the hair follicles were decreased in number and were immature (hypotrichosis), the sweat glands were absent [figure 1e ]. immunohistochemical (ihc) staining for herpes simplex virus (hsv) was carried out on skin sections and was negative [figure 1f ]. histopathological section of the skin from age and sex matched fetus studied, which showed normal development of epidermis and adnexal structure thus confirming the nondevelopment of skin and its appendages in the present fetus. with the above features, a final diagnosis of hypohidrotic ed was made. weech first used the term hereditary ed to describe the congenital anomalies affecting the ectodermal structure. in 1838, wedderburn 's reported ed in 10 men in a hindu family the highlight being x - linked recessive inheritance and oligodontia in the family. cockyane in 1933 postulated x - linked recessive inheritance in families where only males were affected and autosomal dominant if female also manifested the features. it was levit in 1936 who pointed out that females never exhibit full syndrome, hence opening up a new possibility of de novo mutation. ectodermal dysplasia is commonly transmitted as x - linked recessive pattern with autosomal dominant and recessive being rare. the defective genes that are associated with ed are ed-1, muscle segment homeobox homology-1, ectodysplasia-1 (edar), and paired box gene (pax 9)., observed a new genetic locus of ed, the protein product is 135 residue transmembrane protein and is predicted to belong to noval class with a role in epithelial and mesenchymal signaling. monreal. in their study isolated human homolog of mouse dl (human dl) in three families, one displaying recessive inheritance and two displaying dominant inheritance. the putative protein is predicted to have single transmembrane domain and is similar to tumor necrosis factor receptor family. organogenesis is a complex process that occurs due to synergistic interaction between ectoderm and mesoderm. the genes ed, edar and others synergistically act to produce protein ectodysplasin-1, which forms a part of signaling pathway that is critical for the interaction between ectoderm and mesoderm. with respect to ectodermal derived structure, 6 week of embryonic life is critical, as at this point the single layer of ectoderm divides into two cell layer leading to subsequent organ development. dental lamina also begins at 6 week ; hence, any mutation at this point leads to a severe form of ed involving all the ectodermal structure along with teeth. (as observed in our case) ectodermal dysplasia are primarily classified into four different types, ed1 (trichodysplasia), ed2 (dental dysplasia), ed3 (onychodysplasia), and ed4 (dyshidrosis). from these major types 150 different combinations of subtypes are classified, most common being subtype 1 - 2 - 3 - 4 involving all the structures that is, hypohidrotic ed. skin is usually thin, soft and dry (as observed in our case). there is hyperkeratosis of palm and foot. there is wrinkling and pigmentation around the eyes and mouth. hair over the scalp is often blond, fine, stiff, and short (as observed in our case). other rare abnormalities recorded with ed are frontal bossing, depression of the nasal bridge, small face, central nervous system defects, and adrenal medullary defects. the pharyngeal, laryngeal, oral, and nasal mucosal glands are defective leading to dryness and repeated infections. our case in addition to classical abnormalities highlighted the absence of nipple, nails, and lips, which may be due to the severe mutation involving the genes. testing of lacrimal gland sections, skin biopsy, sweat pore test, and molecular tests help in diagnosis of the condition in the living. sweat pore test in addition to detect the affected individuals also helps in identification of carriers. in suspected cases, a near complete work up was done and hsv, which is known to cause defective embryogenesis has been ruled out. based on morphology and histological finding we arrived at a diagnosis of hypohidrotic ed with a possibility of de novo mutation. ectodermal dysplasia is rare disorder and its presentation in a female fetus on autopsy makes it even rarer. such rare case beckons a thorough evaluation with family history, radiological, and ihc methods along with genetic counseling. | ectodermal dysplasia are group of inherited disorders involving the developmental defects of ectodermal structures like hair, teeth, nails, sweat glands, and others. x - linked recessive inheritance is most common. here we describe perinatal autopsy findings in a case of de novo ectodermal dysplasia in a female fetus. to the best of our knowledge, this is the first fetal autopsy description in a case of ectodermal dysplasia. |
zolpidem, a nonbenzodiazepine hypnotic which binds to the benzodiazepine binding site on the gamma - aminobutyric acid type a (gaba - a) receptors, was introduced in europe in 1986, then in france in 1987 (stilnox) and in united stated of america (usa) in 1993 for treatment of insomnia. metabolism of zolpidem mediated by human cytochromes p450 (cyp) ; so that cyp3a4 has a dominant role and cyp2c9, 1a2, 2d6, and 2c19 have a contributory role in decreasing order of importance ; but cyp 2a6, 2e1, or 2c8 have no role in zolpidem metabolism. zolpidem has a sedation property without interfering with other benzodiazepine properties linked to other receptor subtypes. zolpidem has no residual effects and this may be due to its rapid metabolism via cyp3a4 and cyp1a2 isoenzymes and a short elimination half - life. several studies have reported efficacy and safety of zolpidem, its well - tolerance in adults and elderly during administration and minimal risk of abuse or dependence.[23461011 ] interestingly, in this case, zolpidem induced euphoric state and gradually cause tolerance, withdrawal syndrome, and led to dose increase. the patient was 32-year - old jeweler man who had diploma degree was referred to psychiatric clinic because of restlessness, irritability, myalgia, muscle cramps, sweating, palpitation, insomnia, muscle tic, and jump due to withdrawal of daily use of 400 mg zolpidem. he started to use heroin recreationally since 1997 and after 1 year had used it daily in snuff route for 3 years. then, he was introduced to narcotics anonymous (na) and was abstinent for 6 years. two years ago, he used orap (pimozide) and xanax (alprazolam) to treat tic and simultaneous anxiety, but he discontinued xanax because of failure to reduce anxiety and insomnia and his physician prescribed 10 mg tablet of zolpidem instead of xanax. after use of first dose of zolpidem, he experienced euphoric mood of his heroin addiction and reminded heroin use. the next day, to avoid experience of heroin dependency and its induced euphoria, he used 40 tablets of diphenoxylate with zolpidem, but gradually increased dose of zolpidem and diphenoxylate simultaneously so that he used 100 tablets of zolpidem and 120 tablets of diphenoxylate within 6 months. then, 6 months later, he discontinued diphenoxylate and used 110 - 140 10 mg tablets of zolpidem (1,100 - 1,400 mg) until he experienced convulsion with use of 200 10 mg tablets of zolpidem and hospitalized, and after discharge zolpidem was discontinued completely for 1 month but prescribed zolpidem 10 mg / day again after 1 month. tics were treated completely with zolpidem use but its dosage increased to 1,000 mg / day again and within 6 months decreased to 400 mg / day and discontinued completely a few days before attending psychiatric clinic and he had classic symptoms and signs of opioid withdrawal (runny nose, diarrhea, myalgia, irritability, insomnia, and). he had no history of physical problems and known diseases and only had a history of tic in past psychiatric history. benzodiazepines exert their effects through three subtypes of gaba - a receptors. binding to omega 1 (1) subtype has hypnotic and anxiolytic effects and binding to omega 2 (2) receptor has anxiolytic, myorelaxant, respiratory depression, psychomotor dysfunction effects, and anticonvulsant property. omega 3 (3) subtype has different structure and function and are on glial cells and other cells. zolpidem as an imidazopyridine is not considered a classic benzodiazepine because of lack of diazepine cycle in chemical structure, but its clinical effect is through benzodiazepine receptors and its effect could be blocked by benzodiazepine antagonists such as flumazenil.[178 ] it has been reported that zolpidem has low abuse and dependency capability ; however, many cases of zolpidem abuse and dependency were reported in various european countries and usa.[2368910111213 ] this case showed that zolpidem can exert abuse and dependency capability and in this case it may be through nonbenzodiazepine receptors because with first dose of zolpidem, the patient experienced euphoric mood ; and interestingly, he discontinued a potent benzodiazepine such as alprazolam due to lack of euphoria and sedation and used zolpidem instead of it and increased zolpidem dose gradually. after a while, according to the patient, he had reminded euphoric mood due to heroin in first use of zolpidem. thus, despite primary reports of zolpidem safety and minor abuse and dependency capability, recent reports especially this case showed that zolpidem can exert abuse and dependency. it has been reported that zolpidem pharmacodynamics and pharmacokinetics may have a crucial role in cases of zolpidem abuse, dependence, and withdrawal syndrome. it is suggested that zolpidem might lose its selectivity on gaba - a receptor and exert the same pharmacological effects as classical benzodiazepines. also, low zolpidem clearance capacity in elderly and female population might predispose patients to zolpidem dependence. it has been proposed that possible gaba - a receptor mutations may be a predisposing factor in zolpidem dependency. | zolpidem, a nonbenzodiazepine hypnotic, binds to the benzodiazepine binding site on the gamma - aminobutyric acid type a (gaba - a) receptors. many studies have reported efficacy and safety of zolpidem in treatment of insomnia, low abuse, and dependence capability. however, many cases of zolpidem abuse and dependence were reported around the world. this case showed that zolpidem can exert abuse capability, euphoric mood, tolerance, and withdrawal syndrome. |
b - cell chronic lymphocytic leukemia (cll) is the most common adult leukemia in the western world. cll cells express 1 or more b cell associated antigens, generally cd19, cd20 and cd23 with coexpression of cd5, a t cell marker [1, 2 ]. fluorescent in situ hybridization (fish) for specific karyotypic markers and polymerase chain reaction (pcr) for immunoglobulin heavy chain variable region (igvh) gene mutations [4, 5 ] provide prognostic information. the 70 kda zeta - associated protein (zap-70) a cytoplasmic tyrosine kinase measured by flow cytometry [7, 8 ] or by rt - pcr and immunohistochemistry (ihc), appears to improve the prognostic significance of cytogenetics and igvh mutational status. cll patients who are zap-70 positive irrespective of their clinical stage, cytogenetics and igvh mutational status have a shorter progression free survival. several groups have performed gene expression profiling (gep) on cll [1116 ] to establish a gene expression signature, prognostic groups, cell of origin, correlation with genomic defects and diagnostic markers. these studies provide evidence that the cll gep is related to memory b - cells. further, there appears to be a correlation between gep and genomic loss or gain suggesting that gene dosage may be important to cll pathogenesis [11, 17 ]. more recently microrna (mirna) expression profiles have been utilized to distinguish normal b - cells from cll cells and provide a signature that is associated with prognosis and progression. the wnt / fzd canonical pathway has been proposed as a possible mechanism of oncogenesis in cll [1921 ]. ror-2, a close member of ror-1, has been shown to bind wnt-5a via the cysteine rich domain (crd) and to activate the jnk signaling pathway. current treatments can not cure cll and more effective therapies based on abrogating key oncogenic signaling pathways are needed. here, we pose several key objectives and goals to address this statement by utilizing gene expression and cytokine profiling of rai stage 0/i cll patients which include, (a) what are the differentially expressed genes in cll ? previous studies used a microarray platform containing fewer genes, and therefore the current study with > 10,000 novel genes would likely yield novel differentially expressed genes, (b) what oncogenic signaling pathway(s) are likely to drive cll progression ?, as they may help identify parallel cross - talking pathways, (c) what serum cytokines are associated with immune evasion and survival ?, that may activate cll and/or stromal cells, (d) what are the six hallmarks of cancer for cll and can they be targeted rationally ?, (e) what is the status of p53 and zap-70 in low stage cll ?, since both are associated with a poor prognosis, (f) does ge change when cll cells are cultured for a given time ? this would address the important question of why it is difficult to grow cll cells in culture and help identify differentially expressed genes after treatment with drugs (e.g., thalidomide, an immunomodulatory agent). based on gep studies we identified over - expression of members of the non - canonical wnt / pcp - ror-1 signaling pathway genes that were validated by rt - pcr. two other pathways (cxcl9/cxcr3 and flt3l - flt-3 rtk) were identified where both ligand serum levels and cognate receptors, on cll cells, were elevated. we show that the majority of the patients differentially over - expressed zap-70 while p53 was down regulated. the gep of cll cells at 0 hours and 24 hours in culture showed differential over - expression of the cytokine cxcl5. treatment of cll cells with thalidomide, a potent anti - angiogenic and immunomodulatory drug, had no effect on cell viability but led to the over - expression of cytokine ccl5. together, these results provide novel biological insights and potential therapeutic targets for low - stage cll patients. isolated and purified cll cells from patients were cultured in 10% human serum albumin (gemini bioproducts, woodland, ca) in rpmi-1640 media. polyclonal antibodies to fzd3 (r&d systems, mn), ror-1 (r&d systems, mn) and flt-3 (santa cruz, ca) were obtained. secondary antibody at a 1 : 5000 dilution (irdye 800 donkey anti - rabbit, rockland immunochemicals) was used to visualize bands with a li - cor odyssey infrared imaging system. thalidomide powder (sigma) was freshly dissolved in dimethyl sulphoxide (dmso) at a 5 mm stock solution and diluted into rpmi-1640 media with 10% human serum immediately prior to use. cd19 + normal pb b - cell rna from 4 normal volunteers was purchased from allcells, ca. all patients studied had a diagnosis of cll stage 0 or i. patient blood samples (n = 26) were collected after obtaining informed consent on an institutional review board approved protocol. mononuclear cells were separated and either stored frozen at 80c or maintained in rpmi-1640 medium with 10% human serum (gemini bioproducts, ca) at 37c in 5% co2. separated serum was stored in 0.5 ml aliquots at 80c until further studies were performed. mononuclear cells were separated from peripheral blood samples by ficoll - hypaque density centrifugation and phenotype was determined by immunofluorescent flow cytometry analysis. the cll cells were then maintained in culture in rpmi-1640 at 37c for further studies. total rna was extracted using the rneasy mini kit (qiagen, ca) from 8 patient cll cells at collection. further, rna was extracted from 4 patient cll cells in culture for 24 hours and after treatment with thalidomide (1 m) for 24 hours. the amount of total rna isolated from the cells was quantified using spectrophotometric od260 measurements with yields25 g / sample. control rna was obtained from normal peripheral (pb) b - cells from 4 volunteers (allcells, ca). 5 g of mrna was used to generate first - strand cdna by using a t7-linked oligo(dt) primer. after second - strand synthesis, in vitro transcription (ambion) was performed with biotinylated utp and ctp (enzo diagnostics), resulting in 40- to 80-fold linear amplification of rna. 40 g of biotinylated rna was fragmented to 50- to 150-nt size before overnight hybridization at 45c to hg - u133a 2.0 affymetrix array comprising ~18,400 transcripts and 22,000 probe sets (santa clara, ca). after washing, arrays were stained with streptavidin phycoerythrin (molecular probes) and scanned on a hewlett - packard scanner. intensity for each feature of the array was captured by using genechip software (affymetrix, ca), and a single raw expression level for each gene was derived from the 10 - 20 probe pairs representing each gene by using a trimmed mean algorithm. intensity values were scaled such that overall intensity for each chip of the same type was equivalent. the arrays were first inspected visually for artifacts and b2 oligo performance per manufacturer 's instructions (affymetrix, inc. chip cel files were then imported into r - bioconductor (v. 1.7) (http://genomebiology.com/2004/5/10/r80). mas5 present / absent calls were generated with the simpleaffy (http://bioinformatics.picr.man.ac.uk/simpleaffy/) package using a target scaling factor of 100. the scale factors were within 3-fold of each other as recommended in the guidelines provided in the affymetrix gene chip expression analysis : data analysis fundamentals manual. the quality control metrics were generated using the qc function provided in the simpleaffy package. all chips performed as follows : the average backgrounds fell between 20 and 100, hybridization controls (biob, bioc, biod and cre) were all called present with increasing signal intensities and the 3/5 ratios for the internal controls (gapdh and -actin) were less than 1.25 and 3 respectively. further quality control was performed using the affy plm package provided in the bioconductor suite. the microarray data were normalized by robust multi - chip analysis (rma) using the fitplm function (default values). chip pseudo - images of the weights and residuals, normalized unscaled standard error (nuse) and relative log expression (rle) values were used for chip - level quality assessment. chip pseudo - images displayed no apparent artifacts that warranted excluding a chip from further analysis. log - fold changes were calculated from the normalized log2 expression values. for each cll sample at collection, in culture for 24 hours or treated with thalidomide for 24 hours a comparison to the control samples (normal b - cells) and lists of robust increasers ' or robust decreasers ' was generated utilizing the affymetrix data analysis program (affymetrix mas 5.0). fundamentals ' guide was used to import these lists into genespring (version 5.0) and obtain the intersection of robust increasers or decreasers across all patients. increasers or decreasers common to cll patients were compared to normal pb b - cells. in order to assess quality and reproducibility of our data, gep for each patient was further classified according to the hallmarks of cancer, to determine cll specific tumor profile signatures '. intersection of the gene lists for each target with the commonly up - regulated and down - regulated genes across patient samples was obtained. this was also performed on the intersects of the up- and down - regulated gene lists with the genespring one hundred nanograms of total rna were used for reverse transcriptase (rt) reactions (20 ml total volume) carried out using superscript iii platinum reverse transcriptase (invitrogen, carlsbad, ca). reactions were incubated at 42c for 50 minutes followed by incubation at 37c with rnase h for 20 minutes. an opticon dna engine (mj research, reno, nv) was used to perform real - time fluorescence detection pcr. 1 l cdna was added to 12.5 l of platinum sybr green qpcr supermix - udg (invitrogen, carlsbad, ca), 1 l of gene - specific or -actin specific primer pair (see primer design), and 10.5 l of dh2o (final volume of 25 l). amplification (95c for 15 s, 55c for 30 s, and 72c for 30 s) was repeated for 44 cycles. threshold cycle value (ct) for each sample indicated the cycle at which a statistically significant increase in fluorescence was first detected. these data were then normalized to -actin, which served as an unaffected control gene, for each data point and compared to a normal b - cell control to determine relative expression ratios. pcr primers were designed using macvector (accelrys, san diego, ca) to produce amplicons with lengths ranging from 80 - 250 bp to optimize the efficiency of qpcr. -actin primers from quantumrna-actin internal standards (ambion, austin, tx) were used to normalize the qpcr data. the following genes were analyzed by real time quantitative rt - pcr : axin1, blk, csn1a1, ctnnb1, dvl1, frat1, fzd3, fzd6, flt-3, gsk3, itk, jak2, jun, lef-1, mapk10, mapk8, mapk9, prkcb1, ror-1, ror-2, syk, tcf4, p53, wnt-3a, wnt-5a and zap70. stored (80c) or fresh patient serum samples were utilized (n = 26 patients). array slides were thawed at room temperature as serum was diluted 3.5-fold with 1x blocking buffer (cytokine array protocol, raybiotech, inc # aah - cyt - g1000). slides were blocked with blocking buffer and 50 l of each sample was hybridized with the slide for 2 hours ; 1 l internal controls were also added. after washing, provided biotin - conjugated anti - cytokine antibodies were diluted with 300 l of blocking buffer, added to the slide, and incubated for 2 hours at room temperature. washing steps were repeated, followed by addition of a 1:1500 dilution of alexa flour 555-conjugated streptavidin and incubated overnight at 4c. slides were washed multiple times and read on the axon genepix using the cy3 channel. 500 g clarified lysate per sample was incubated at 4c overnight with anti - ror-1 polyclonal antibodies followed by the addition of protein a agarose (upstate biotechnology) for a further 2 hours. after page and transfer to immobilon membranes (millipore, ma), immunoblotting was performed using the anti - ror-1 antibody. alternatively, 50100 g of protein from cell extracts was separated by page and immunoblotted with protein - specific antibodies. protein bands were visualized utilizing the secondary antibody at a 1:5000 dilution (irdye 800 donkey anti - rabbit, rockland immunochemicals) with a li - cor odyssey infrared imaging system. the purity of the cll samples estimated from the percentage of cd19 cells was at a mean of 89% (range 8095%) (supplementary figure 1) which is very similar to that described by stratowa.. a gep was conducted on 8 low stage cll patients, 4 normal volunteers without age - matched cd19 + b - cells (allcells, ca) utilizing the affymetrix platform (22,000 genes) with > 10,000 genes than previously published gep studies. we compared the most significantly over - expressed and down - regulated genes of cll versus normal b - cells in our gep to that of klein. ten distinct genes represented by 15 probe sets were differentially expressed in all three studies (table 1). hence, our data validate and add to the current knowledge on cll gep studies. an analysis of differentially expressed genes by fold change between cll versus normal pb b - cells was performed in a gene - by - gene analysis for differences between the 2 groups. genes that are robustly highly over - expressed or down regulated that are common to all 8 cll patients were compared to normal pb b - cells. for brevity only the 20 top over - expressed (table 2(a)) or down regulated (table 2(b)) genes are shown. of the over - expressed genes (table 2(a)), 5 are listed in table 1 (abca6, fibromodulin, lef-1, igfbp4, rasgrf1) confirming the data from klein., novel over - expressed genes from this study are hba, hbb, pdgf - dd, ror-1, fry, selp, hla - dqa1 and vipr1 all of which are implicated in human malignancies including leukemia, lymphoma and solid tumors. it appears that the comparison of cll patients to normal pb b - cells demonstrates that several of the differentially genes are represented within the 6 hallmarks of cancer. for cll they are tumor invasion (col9a2, rapgef3, spock2, wnt3, coro1b, ccl5, il2rb, map2k6), anti - apoptosis and survival (lef1, igfbp4, ror-1, mybl1, pim-1, lck, flt-3), cell cycle deregulation (pftk1, plk3) and angiogenesis (pdgf - dd, fgf2). consistent with cll several of the ig gene family members (light chain variable and heavy chain constant) are the most highly down regulated. other highly down regulated genes of significance to tumor biology include ccr6, bcl7a, myc, mafb, casp2 and hsp70b. serum samples from 26 cll patients and 4 normal volunteers were analyzed utilizing the cytokine array g-1000 platform consisting of 120 cytokines / chemokines / growth factors (raybio, ga). fold change was calculated for each patient, corrected for absolute lymphocyte count and a mean sd obtained for each cytokine for all patients. our cytokine profile identified all of the published elevated cytokines associated with cll cell survival (il-1, il-2, il-4, il-6, il-8, il-10, tnf, ifn or, g - csf or gm - csf) or inhibition (il-5, tgf). in our cytokine profile the 1st ranked is ifn (14.46 fold) which is well known to prevent apoptosis of cll cells. the 2nd ranked is igfbp-4 (14.22 fold) and of significance is that it is also over - expressed in the gep indicating that serum levels reflect cll production of this cytokine. the function(s) igfbp-4 are not well characterized except for binding igf - i and igf - ii. in most human malignancies igfbp-4 the 3rd ranked is g - csf (10.89 fold) which is known to decreases cll cell apoptosis. the 4th ranked is il-3 (8.45 fold) which provides a proliferative signal to cll cells especially during the lymphoblastoid phase. other significantly increased serum cytokines are flt-3 ligand (7.82 fold), scf (6.76 fold) and sdf-1 (6.54 fold). utilizing both the gep and scp, an analysis of ligand - receptor (l - r) pairs of the cytokine - cytokine receptor or growth factor - growth factor receptor (pdgf, tnf, tgf, wnt) that are simultaneously elevated in our cohort of cll patients table 3b highlights several of these l - r pairs with their respective fold changes and known function(s). we identified 3 major oncogenic signaling pathways : gpcr cxcl9/cxcr3 pathway ; and the rtk pathways of wnt / fdz3-ror-1 pcp and flt-3l / flt-3. previously, it has been shown that cxcr3 is expressed on cll cells and may play a role in chemotaxis. moreover, the cxcr3 ligand, cxcl9, is coexpressed in cll cells implicating an autocrine mechanism of activation. our data confirm these individual observations, extend the finding that low stage cll patients express both cxcl9 and cxcr3 that may promote immune mediated cell homing in addition to chemotaxis. the expression and activation of the classical wnt / fzd signaling cascade has been implicated in cll. lu., 2004, quantified the gep of the wnt family and their cognate fzd receptors in cll cells, and determined the role of wnt signaling in promoting cll cell survival. our gep identified ror-1 rtk to be over - expressed, which is a member of the non - canonical wnt / pcp pathway. the coreceptor of ror-1, fzd3 and fzd6 are also over - expressed implicating the activation of the wnt non - canonical pathway in cll (table 3(b)). hence, we analyzed 20 representative members of the canonical and non - canonical pathway from the cell membrane to the nucleus by quantitative real time rt - pcr to ascertain which pathway was active in cll. the members of the canonical pathway are down regulated (dvl1, axin, gsk-3, tcf-1) except for lef-1 (figure 1), while members of the non - canonical pathway are over - expressed (ror-1, fzd3, jak2, jnk2, itk) (figure 2). gep identified over - expression of several members of the non - canonical pathway : wnt3 (8-fold), wnt16 (2-fold), fzd3 (3-fold), fzd6 (2-fold) and pck (7-fold) to be over - expressed. western blotting analyses performed on 4 representative cll patient cells for ror-1 confirmed expression at the protein level (supplementary figure 2). these studies provide evidence for importance of the wnt - ror-1 non - canonical pathway in cll. the scp and gep identified flt-3l to be elevated (serum) and flt-3 to be over - expressed (microarray) in all 8 cll patients. rt - pcr of 20 cll patients for flt-3 showed that 8 (40%) had over - expression while 12 (60%) had no change in expression (supplementary figure 3) please see in supplementary materials avilable online at doi:10.1155/2007/453634. we next searched for downstream signaling molecules associated with flt-3 activation and identified over - expression of pim-1 (8-fold) (proviral insertional mutagenesis-1 serine / threonine kinase) and c - myb (4-fold) proto - oncogenes. this novel finding implicates activation of the flt-3 rtk pathway in a subset of cll that may contribute to cell survival. in acute myeloid leukemia (aml), flt-3 signaling up - regulates pim-1 expression and activation but such a role has not been previously described for cll. hence, our finding of coexpression of flt-3l and flt-3 l - r pair is novel and requires further investigation. both zap-70 and p53 have been demonstrated to be important prognostic factors in cll. in a subset of cll patients with 17p deletion where p53 is lost an aggressive chemo - resistant clinical course ensues. we conducted quantitative real time rt - pcr on 21 low stage cll patients for zap-70 and p53 expression (supplementary figure 4). the results show that p53 is down - regulated in almost all patients, while zap-70 is over - expressed in 18 of 21 patients. it is possible that a small fraction of contaminating normal t - cells in the purified cll samples may affect the zap-70 rt - pcr data, however the differential expression observed by gep suggests this is minimal. the down regulation of p53 expression in low stage cll appears to be an early event in the oncogenic program. it is an enigma as to why cll cells purified from patients are not amenable to medium and long term cell culture. these predominantly mature malignant b - cells are resistant to apoptosis but once in cell culture lose viability. a key goal of the study was to identify factor(s) that may contribute to loss of viability and differential gene expression by gep was utilized to investigate this phenomenon. a gep study of 4 cll patients at 0 hours and at 24 hours in culture showed several genes to be differentially expressed at 24 hours (supplementary table 1). the chemokine cxcl5 was ~120 fold over - expressed followed by several other chemokines, ccl (2, 3 and 23) and cxcl (1, 2 and 3) subtypes. interleukins-1 (and), il-6 and il-8 were also over - expressed. the imids thalidomide and lenalidomide are currently under evaluation as potential novel agents in phase i trials in cll (24). we investigated the effect of thalidomide on the differential gene expression of 4 cll patient cells treated in culture for 24 hours. since there were gene expression changes at 24 hours in culture without thalidomide therapy, these changes were taken into account when analyzing the effects of thalidomide on changes in gene expression. cell viability studies indicated thalidomide was not cytotoxic to cll cells (data not shown). thalidomide induced modest differential gene expression changes (supplementary table 2), with ccl5 ~2.5 fold over - expressed. our study also analyzed potential therapeutic targets that may be amenable to targeting either with small molecular inhibitors and/or monoclonal antibodies. for patients with cll the following are novel targets : small molecular inhibitors to protein kinases (ror-1, flt-3, zap-70, pim-1, lck pftk1, plk-3), monoclonal antibodies to circulating ligands (cxcl9, igfbp4, flt-3 ligand, pdgf - dd, fgf2) and monoclonal antibodies to cell surface receptor (fzd3, flt-3, ror-1, cxcr3). we undertook a gene expression and serum cytokine profile study of low stage cll patients to glean biological insights into disease pathogenesis. first, our data confirmed the key gep findings of klein., 2001 and jelinek. second, we identified several significantly over - expressed novel genes that enhance further differentiation of cll from normal circulating pb b - cells. this has allowed an extension of the molecular signature profile based on the six hallmarks of cancer for cll. third, a serum cytokine profile of 26 cll patients show several elevated cytokines / growth factors that are novel and help identify ligand - receptor pairs that may be pertinent to cll biology. finally, quantitative real time rt - pcr and western blotting analyses of key genes and proteins respectively were utilized to validate and confirm the gep. the wnt / fdz3-ror-1 pcp non - canonical pathway is over - expressed in cll cells. the pcp signaling pathway controls tissue polarity and cell movement through activation of rhoa, c - jun n - terminal kinase (jnk), and nemo - like kinase (nlk). human wnt5a, wnt5b, and wnt11 are non - canonical wnt ligands that transduce pcp signals through fzd3 or fzd6 receptors, and coreceptors ror-1, ror-2 or ptk7. the aberrant activation of wnt / pcp signaling pathway leads to a malignant phenotype with associated abnormal tissue polarity, invasion, and metastasis. previously, lu., 2004, provided evidence for the wnt / fzd canonical pathway as a possible mechanism of oncogenesis and cell survival in cll. rt - pcr of both the canonical and non - canonical pathway members, confirmed down regulation of the wnt / fdz canonical pathway (dlv1, axin, frat-1, gsk-3, -catenin, tcf) except for lef-1 which was over - expressed in all patients (figure 1). over - expression of lef-1 in cll cells has been described [12, 17, 19 ] and appears to play a role in pro - b cell development but not in mature b - cells. in contrast, we found that fzd3 to be over - expressed and fzd6 to be down - regulated, while their coreceptor ror-1 and jnk-2 of the wnt / pcp pathway are over - expressed (figure 2). ror-1 is a neural developmental kinase (937 amino acids) but its cellular role has not been fully characterized. a truncated ror-1 is found to be expressed in human leukemia and lymphoma cell lines and in several human neuroectodermal malignancies. a mechanism is proposed for activation of the fzd3-ror-1 pcp pathway (figure 3) via wnt binding to the ror-1 crd. thus a switch from wnt / fzd canonical to wnt / pcp non - canonical signaling in cll is proposed. although key members of the wnt / fzd canonical pathway are down regulated in cll, lef-1 is over - expressed. this discrepancy may be due to expression and activation of lef-1 via an alternative signaling pathway(s). evidence points to the tgf pathway, where tgf-1 and -3 are elevated in the serum cytokine profile while tgf- receptor iii (tgf- riii, -glycan) and smad2 are over - expressed in the gep. the tgf pathway is known to cross - talk with the wnt signaling pathway via smads [35, 36 ]. tgf can also induce novel lef-1 splice variants through a smad - independent signaling pathway. therefore, in cll the expression and activation of lef-1 may occur through tgf -smad dependent or independent mechanisms (figure 3). moreover, cll cells respond abnormally to tgf stimulation and over - expression of tgf-riii has been linked to over - expression of mutant k - ras. hence, it is conceivable that over - expression of rasgrf1 in cll (table 1) may activate the map kinase pathway leading to lef-1 activation. mikels and nusse (2006) have shown that when ror-2 is expressed, wnt5a and more recently igfbp-4 have been shown to inhibit canonical signaling downstream of -catenin stabilization at the level of tcf driven transcription. a similar mechanism may operate in cll where ror-1 is expressed and an alternative pathway activates lef-1. the study identified cxcl9-cxcr3 l - r pair where cxcl9 levels are elevated in the serum and cxcr3 was over - expressed in the gep (table 3(b)). cxcr3, a g - protein coupled chemokine receptor is normally expressed on th1 cells and its expression is associated with peripheral inflammation. th1 cells express cxcr3 during activation and differentiation implying effector functions in both central and peripheral lymphoid tissue. cll cells highly express cxcr3, which promotes efficient migration in response to cxcl9 in comparison to normal pb b - cells. cxcl9 is coexpressed with cxcr3 in cll implicating an autocrine mechanism of malignant b - cell activation and promotion of migration (figure 3). interferon- (ifn) the 1st ranked elevated cytokine (table 3(a)) in the cytokine profile is known to induce cxcl9 required for t - cell recruitment and effector functions. flt-3l is elevated in the serum cytokine profile and flt-3 is over - expressed by gep. rt - pcr analysis of 20 cll patients confirmed over - expression of flt-3 (6 - 40 fold) in a subset of cases (40%) (supplementary figure 3). flt-3 is constitutively activated due to internal tandem duplication (it d) mutations in the juxta - membrane domain in a majority of patients with acute myeloid leukemia (aml) and acute b - cell leukemia (all). 2005, demonstrated that pim-1, a proto - oncogene with serine / threonine kinase activity is significantly down - regulated when flt-3 is inhibited with cep-701, an flt-3 tyrosine kinase inhibitor. a similar inhibitory effect with cep-701 was also shown for bad (bcl-2 antagonist of cell death) phosphorylation. in our gep, pim-1 is over - expressed while its substrates c - myb, bcl11b, stat4 and cdc25b are also over - expressed. pim-1 is known to be up - regulated by stat 5, which is also a downstream target of flt-3 signaling. we propose that activated flt-3 up - regulates and activates pim-1 kinase providing proliferative and anti - apoptotic signals to some cll cells. hemoglobin (hb) a and b are over - expressed in cll patients (table 2(a)). alpha and beta - globin rna have been detected in erythroid cells (fetal liver and reticulocytes) and non - erythroid tissues (adult brain and liver, and cultured lymphoma, untransformed, and transformed fibroblast cell lines). reactive oxygen species (ros) at physiological concentrations are required for normal cell function but excessive production of ros is detrimental to cells. it has been shown that treatment of ht-29 colon cancer cells with hb enhanced proliferation via reactive oxygen species (ros) production and significantly blunts the cytotoxic effects of 5-fu and 5-dfur. papillary thyroid carcinomas (ptc) express hbb at similar levels to normal thyroid gland but over - expression of hbb in kta2 cells (anaplastic thyroid cancer cell line), significantly suppressed their growth. in cll, there is progressive accumulation of well differentiated malignant cells that are arrested in g0/g1 and generation of excessive ros in this setting would be detrimental. therefore, over - expression of hba and hbb may counter excessive ros production and be protective to cll cells. we show that p53 expression is down regulated and zap-70 is over - expressed in low stage cll (supplementary figure 4). when the white cell count or the absolute lymphocyte count (alc) was plotted against p53 or zap-70 level of expression, there is no significant correlation. hence, the loss of p53 or gain of zap-70 function is independent of disease burden, but may be related to initiation and progression of the abnormal cll clone. cll cells are resistant to apoptosis but once in cell culture appear to lose viability. several different approaches to maintain cll cells in culture have been investigated but none has been successfully implemented. we hypothesize that a major reason for inability to grow these cells is due to the removal of a factor or factors from their natural (plasma or serum) environment. we demonstrate that cll cells elaborate a chemokine - cytokine response to being in culture at 24 hours. it is known that cll cells regulate the microenvironment through modulation of the cytokine milieu that recruit and activate immune cells (t - cells). since standard culture conditions do not have access to accessory survival mechanisms, these cells undergo apoptosis over a period of 1 - 2 weeks. targeting of the tumor microenvironment with immunomodulatory (imid) agents such as thalidomide and lenalidomide has been evaluated in cll with promising clinical activity. thalidomide therapy in cll cells showed no cytotoxicity, and a similar result has been reported for lenalidomide in in vitro tumor models of cll. we also evaluated differential gene expression between thalidomide untreated and treated cll cells in culture for 24 hours and showed very modest gene expression changes. this is consistent with its proposed mechanism of action on the stroma and activation of the immune system rather than a direct effect on malignant cells. the lack of a direct effect of thalidomide on cll cells in culture and activity in patients implies a role for imids in modulating the stromal microenvironment for their therapeutic efficacy. our study identified 3 novel differentially expressed oncogenic pathways pertinent to low stage cll patients. these pathways are implicated aberrant regulation of cell proliferation, survival and migration of cll cells. further, in most of the patients p53 is down - regulated while zap70 is up - regulated suggesting a common mechanism of pathogenesis. interferon, flt-3l and igfbp4 are the most prominent serum cytokines in low stage cll with the latter implicated in modulating the wnt signaling pathway. the 6 essential alterations in cell physiology that collectively dictate malignant growth (cll) are represented by 2530 up - regulated over - expressed cancer genes and down - regulated tumor suppressors which appear to determine a slow proliferator phenotype. this cll phenotype has gained the ability to avoid immune attack by nk and t - cells by secreting factors that inhibit effector activity and appears to subvert the bone marrow stromal environment for survival. our data provide a platform to extend these studies to high stage (rai iii / iv) cll patients. a recent gep study of waldenstrom macroglobulinemia (wm) showed a phenotype similar to cll and pb b - cells than multiple myeloma implicating a small set of differentially expressed genes which may distinguish between these lymphoproliferative diseases. | gene expression profiling (gep) of 8 stage 0/i untreated chronic lymphocytic leukemia (cll) patients showed over - expression of frizzled 3 (fzd3)/ror-1 receptor tyrosine kinase (rtk), flt-3 rtk and cxcr3 g - protein coupled receptor (gpcr). rt - pcr of 24 genes in 21 patients of the wnt pathway corroborated the gep. transforming growth factor, fibromodulin, tgfriii and smad2 are also over - expressed by gep. serum cytokine profiling of 26 low stage patients showed elevation of ifn, csf3, flt-3l and insulin - like growth factor binding protein 4. in order to ascertain why cll cells grow poorly in culture, a gep of 4 cll patients cells at 0 hr and 24 hr in culture demonstrated over expression of cxcl5, ccl2 and cxcl3, that may recruit immune cells for survival. treatment with thalidomide, an immunomodulatory agent, showed elevation of ccl5 by gep but was not cytotoxic to cll cells. our data suggest an interplay of several oncogenic pathways, cytokines and immune cells that promote a survival program in cll. |
an adrenal incidentaloma (ai) is defined as an adrenal lesion that is discovered when a radiological study is performed for indications other than suspected adrenal disease. all patients with an ai should be evaluated for hypercortisolism, pheochromocytoma and (if hypertensive) hyperaldosteronism. a combination of pheochromocytoma and cushing 's syndrome due to pathology in same adrenal gland is extremely rare. there are few case reports suggesting the different etiologies for this association, namely, pheochromocytoma secreting adrenocorticotropin hormone (acth) or its precursors, corticomedullary mixed tumors and focal adrenocortical hyperplasia. here, we report a case of ai with the clinical and biochemical evidence of both pheochromocytoma and sub - clinical cushing 's syndrome. a 42-year - old female patient was admitted under department of gastroenterology with abdominal pain for 1 week. routine biochemical evaluation including complete blood count, renal function tests (including serum electrolytes) and liver function tests were normal. abdominal computed tomography (ct) revealed a right supra - renal mass (40 mm 39 mm 40 mm), which was heterogeneously enhancing with multiple cystic areas and a homogenously enhancing solid component within the anterior limb of the right adrenal gland. as per the ct findings, right - sided adrenal adenoma with the possibility of pheochromocytoma was suspected. computed tomography image of abdomen showing 4.0 cm 3.9 cm 4.0 cm heterogeneously enhancing right suprarenal mass (a) coronal section and (b) sagittal section on endocrine assessment, she had a complaint of intermittent palpitations and headache for 4 years. there was no history of fractures, muscle weakness, easy bruisability, menstrual irregularity and hirsutism. she was on treatment for hypertension and diabetes for 4 years with an adequate control. she was not on any exogenous steroids. on examination, her height was 155 cm, weight was 60 kg, body mass index was 24.97 kg / m, blood pressure was 130/80 mmhg and pulse rate was 82/min. absence of abdominal striae, moon facies and hyperpigmentation her endocrine investigations revealed raised 24-h urinary metanephrines and nor - metanephrines with value of 3268 g/24-h (normal range 52 - 341) and 4591 g/24-h (normal range 88 - 444), respectively ; raised 8 a.m. serum cortisol with value of 80 g / dl (normal range 5 - 25) ; and normal plasma aldosterone level of 32.84 pg / ml (normal range 34 - 273). she had non - suppressible serum cortisol of 56.91 g / dl and 25.86 g / dl after 1 mg - overnight dexamethasone suppression test (dst) and 48 h - 2 mg / day dst, respectively. after pre - operative management with alpha and beta blockers, she underwent laparoscopic right adrenalectomy. during the post - operative period, she was watched for hypotension and hypoglycemia, but the entire course remained uneventful. repeat 8 a.m. serum cortisol on 1 post - operative day was 11.20 g / dl and she was started on intravenous hydrocortisone 50 mg tid. the excised mass measured 4 cm 3.5 cm 3 cm with weight of 12 g. the pathologist concluded that the lesion was pheochromocytoma staining positive for chromogranin and synaptophysin with hyperplastic adrenal cortex [figure 2 ]. two weeks later, she was re - evaluated and her 24-h urinary fractionated metanephrines came out to be in normal range and fasting 8 a.m. serum cortisol level was 10 g / dl (prednisolone stopped 2-day prior to testing). prednisolone dose was tapered slowly over 2-month and presently ; she is not on any medication and doing well. this patient represents a rare case of ai with evidence of both pheochromocytoma and sub - clinical cushing 's syndrome. patient 's condition improved with adrenalectomy of involved side and there was immediate fall in serum cortisol levels reflecting that the same adrenal gland was the source of excess cortisol. pheochromocytoma may secrete various substances such as somatostatin, enkephalines, calcitonin, vasoactive intenstinal peptide, neuropeptide - y, renin, acth, parathyroid hormone, erythropoietin, adrenomedullin and dihydroxyphenylalanine (dopa) in addition to catecholamines. there are about thirty cases reported in the literature of cushing 's syndrome due to acth - secreting pheochromocytoma. in some of these cases, there was pre - dominance of hyperpigmentation, hypokalemic alkalosis and evidence of contralateral adrenal gland hyperplasia on imaging, but these features were absent in our case. mixed tumors involving the cortical and medullary components of the adrenal gland are quite rare. on histochemical staining, patient 's tumor was not a corticomedullary mixed tumor, but a pure pheochromocytoma. there was prominent cortex showing hyperplasia on staining with no evidence of neoplastic changes [figure 3 ]. (a) h and e stain (low power) showing hyperplastic adrenal parenchyma with pheochromocytoma cells (b) high power view of tumor cells, arranged in nests, round to polygonal with scanty cytoplasm, vesicular nucleus and prominent nucleoli (c and d) low and high power view of immunohistochemical staining showing tumor cells stained positive for chromogranin and absence of stain in the adrenal cortex in this case, we speculate that adrenocortical hyperplasia, which was possibly because of paracrine stimuli from the pheochromocytoma, was the source of autonomous cortisol production. although, the possibility of acth - secreting pheochromocytoma can not be completely ruled out as we do not have plasma acth levels. furthermore, we have not observed until now such high levels of serum cortisol (8 a.m. value of 80 g / dl), in cases of sub - clinical cushing 's syndrome without any cushignoid features. the clinical aspects of this case suggest the importance of proper pre - operative recognition of the dual hormone secretion from adrenal mass, which, if goes unnoticed could lead to adrenal or hypertensive crisis in perioperative period. hence, to conclude, we think all patients with adrenal mass should undergo evaluation based on the guidelines for management of ai. | adrenal incidentalomas (ais) are a cluster of different pathologies, but ais with dual functional aspects are very rare. we report a case of ai with the evidence of both pheochromocytoma and sub - clinical cushing 's syndrome. a 42-year - old female patient presented with the history of abdominal pain. abdominal computed tomography revealed right adrenal mass suggestive of pheochromocytoma. on endocrine evaluation, she admitted history of intermittent headache and palpitations for 4 years and was on treatment for hypertension and diabetes. there were no signs and symptoms suggestive of cushing 's syndrome. the laboratory data demonstrated 10 times raised 24-h urinary fractionated metanephrines with non - suppressible serum cortisol after 2-day low - dose dexamethasone suppression test. she underwent right - sided adrenalectomy with subsequent resolution of both pheochromocytoma and hypercortisolism. patient was discharged in good clinical condition. |
an arterio - venous malformation (avm) is an abnormal fistulous connection between the feeding arteries and draining veins, without an intervening capillary bed within the subcutaneous layer. its management is difficult because of its complex vascular anatomy, high - shunt flow (in high - flow avm), intracranial connection (when present) and possible cosmetic complications. they are relatively rare vascular lesions present as an subcutaneous scalp lump or a large, pulsatile mass with a propensity to skin erosion and massive haemorrhage. several treatment options that have been described to treat these lesions, including surgical excision, ligation of feeding vessels, transarterial and transvenous embolization, injection of sclerosant into the nidus and electro thrombosis. here, we have described our experiences of surgical management of scalp vm (svm) and result along with a short literature review. eleven patients with scalp avm and svm who underwent surgical excision of lesion in dhaka medical college hospital and few private hospitals in dhaka, bangladesh from 2006 to 2012 were included. all clinical data, investigations, surgical procedures and postoperative follow - up were recorded and studied prospectively. all suspected high - flow avm were investigated with the selective internal and external carotid digital subtraction angiogram (dsa) computed tomography (ct) scan of brain with ct angiogram or magnetic resonance imaging (mri) of brain with mr angiogram, and all suspected low - flow vascular malformation (vm) was investigated with mri of brain + mr angiogram. no scale or criteria was used for the assessment of cosmetic appearance other than patient 's own and his / her relatives appreciation of the final appearance (excellent, good, acceptable or not acceptable). the patient was positioned according to the site of lesion with the head elevated 20 - 30 above the level of the heart. the scalp flap was made according to the anatomy of the avm and vm, and the direction of the feeding arteries and draining veins. in very high - flow avms, proximal control of external carotid artery the feeding arteries were preserved at the base of the scalp flap, and the flap incorporated one or more normal non - feeding vessels so as not to jeopardize its vascularity. the skin incision line was infiltrated adequately with lignocaine with adrenaline (1:100000 strength) only in low - flow svm. the scalp was incised in short segments with careful haemostasis using haemostatic forceps and bipolar coagulation. the feeding arteries were identified along their course at the base of the scalp flap, the pericranium and galea were incised, the vessels were traced distally towards the nidus of the scalp malformations, ligated, and/or coagulated and then divided. as the feeding vessels were ligated, the vm was devascularized. the pericranium and the galea were circumferentially incised, and the vm was excised. where there was unavoidable skin loss with the excised lesion, wound was closed multiple galeal incisions and scalp mobilization and/or rotational flaps. the patient was positioned according to the site of lesion with the head elevated 20 - 30 above the level of the heart. the scalp flap was made according to the anatomy of the avm and vm, and the direction of the feeding arteries and draining veins. in very high - flow avms, proximal control of external carotid artery the feeding arteries were preserved at the base of the scalp flap, and the flap incorporated one or more normal non - feeding vessels so as not to jeopardize its vascularity. the skin incision line was infiltrated adequately with lignocaine with adrenaline (1:100000 strength) only in low - flow svm. the scalp was incised in short segments with careful haemostasis using haemostatic forceps and bipolar coagulation. the feeding arteries were identified along their course at the base of the scalp flap, the pericranium and galea were incised, the vessels were traced distally towards the nidus of the scalp malformations, ligated, and/or coagulated and then divided. as the feeding vessels were ligated, the vm was devascularized. the pericranium and the galea were circumferentially incised, and the vm was excised. where there was unavoidable skin loss with the excised lesion, wound was closed multiple galeal incisions and scalp mobilization and/or rotational flaps. among the 11 cases as seen in table 1 [figures 1 - 11 ] eight were high - flow avm and three were low - flow svm (two cavernoma and one venous malformation - sinus pericranii). only two patients had history of trauma, and two patients had history of prior surgery for their lesions. in five patients, the avm extended on the both side of midline. there was no supply to avm from mca, anterior cerebral (aca) or vertebro - basilar system. in one case (case 5), there was some intracranial venous communication. in case 2, bleeding was not a problem in ten cases where blood transfusion was one unit or less. in case 5, three unit blood was required due to external carotid artery (eca) partial rupture and intracranial venous communication. complete excision was done satisfactorily in all cases without any recurrence until the last follow - up. minor infection occurred in one case (case 5), and wound infection and wound dehiscence occurred in two cases. in case 7, wound infection and dehiscence were managed conservatively with antibiotic and regular dressing. in case 10, the dehiscence was very big, and a second operation was needed to close it with local scalp rotational flap. excellent cosmetic result was observed in nine cases. in two cases, wound healing was acceptable with scar formation in hairy area. (b) post - operative picture of patient (a and b) pre - operative picture of lesion and patient. (c and d) post - operative picture patient with good cosmetic outcome (a and b) cta of head showing frontal venous malformation (sinus pericranii) with normal intracranial venous sinuses. (d) per - operative picture after complete excision of lesion (a and b) cta of extracranial vessel showing left posterior parietal avm with feeder from superficial temporal and occipital artery peroperative picture of temporal cavernoma (a and b) ct scan of head showing huge diffuse extracranial soft tissue swelling and multiple vascular marking (guttering and erosion by avm vessels) (a - i) dsa of eca and internal carotid artery (ica) showing bilateral feeding vessels from branches of eca and ica through supratrochlear and supraorbital arteries. there was aneurysmic and ecstatic dilatation of right eca and its branches (a - c) immediate pre - operative picture of avm. (g and h) post - operative picture of 9 post - operative day. (i) post - operative picture 4 week after operation with good cosmetic outcome (a and b) pre - operative picture of patient and lesion. (d) per - opeartive picture after complete removal of low - flow vascular malformation (a) pre - operative picture of lesion and patient. (b and c) immediate pre - operative picture of lesion. (e and f) post - operative picture of patient with ultimate outcome of operating site 2.5 months after operation (a and b) post - avm excisional wound infection and large wound gap. (c and d) pictures of wound 12 day after second operation (wound closure by rotational flap of scalp). (e and f) pictures 1 year after operation showing acceptable cosmetic outcome an 8-month - old male child presented with a 9 11 cm swelling in mid - frontal region extending more to the right up to the supra - orbital region. swelling increased in size during cry and prone position of the baby, and it was compressible and non pulsatile. ct scan of brain showed extra - calvarial soft tissue mass in frontal region, and there was no apparent bony gap infront of anterior fontanel. ct angiogram showed soft tissue mass was vascular lesion connected with sss through emissary veins and intracranial dural sinuses including sss were normal. the lesion was excised completely by elevation of a bi - frontal flap through a post - hairline bi - coronal incision. connecting emissary veins were coagulated and cut to remove the lesion. the lesion was well - defined capsulated without septation and filled with venous blood. the patient recovered uneventfully (figures 2 and 3) and has remained asymptomatic for last 5 years (until the last follow - up). a 43-years - old male patient presented with right - sided pulsatile, progressively increasing fronto - parieto - temporal swelling measuring about 15 19 cm. he had a history of surgery 5 years back in another institution. according to the patient, he also had recurrent attack of haemorrhage from the ulcerated area but none were of serious nature to cause shock and were controlled by pressure dressings. ct scan showed large soft tissue swelling [figure 6 ] and the bony windows showed multiple erosions and prominent vascular marking. right - sided common carotid artery and eca angiogram showed huge dilatation of branches (occipital artery, posterior auricular artery, superficial temporal artery and maxillary artery and its branches, including meningeal and middle temporal arteries) of eca supplying the avm. left eca angiogram showed enlargement and tortuousity of left occipital, posterior auricular and superficial temporal arteries supplying the avm crossing the midline. both internal carotid artery (ica) aca, middle cerebral (mca) and vertebro - basilar arterial systems were normal and intracranial venous drainage system seemed to be normal [figure 7 ]. right - sided eca was ligated at the beginning of operation through a neck incision (during ligation, partial rupture of eca occurred, which was immediately controlled). then, avm was excised completely with some part of skin (ulcerated and infected area). at the posterior part of avm postoperatively, there was minor wound infection that was controlled by regular dressing and antibiotic. the patient has remained free of recurrence of avm for last 1.5 years (until the last follow - up). an 8-month - old male child presented with a 9 11 cm swelling in mid - frontal region extending more to the right up to the supra - orbital region. swelling increased in size during cry and prone position of the baby, and it was compressible and non pulsatile. ct scan of brain showed extra - calvarial soft tissue mass in frontal region, and there was no apparent bony gap infront of anterior fontanel. ct angiogram showed soft tissue mass was vascular lesion connected with sss through emissary veins and intracranial dural sinuses including sss were normal. the lesion was excised completely by elevation of a bi - frontal flap through a post - hairline bi - coronal incision. the patient recovered uneventfully (figures 2 and 3) and has remained asymptomatic for last 5 years (until the last follow - up). a 43-years - old male patient presented with right - sided pulsatile, progressively increasing fronto - parieto - temporal swelling measuring about 15 19 cm. he had headache and tinnitus. he had a history of surgery 5 years back in another institution. according to the patient, he also had recurrent attack of haemorrhage from the ulcerated area but none were of serious nature to cause shock and were controlled by pressure dressings. ct scan showed large soft tissue swelling [figure 6 ] and the bony windows showed multiple erosions and prominent vascular marking. right - sided common carotid artery and eca angiogram showed huge dilatation of branches (occipital artery, posterior auricular artery, superficial temporal artery and maxillary artery and its branches, including meningeal and middle temporal arteries) of eca supplying the avm. left eca angiogram showed enlargement and tortuousity of left occipital, posterior auricular and superficial temporal arteries supplying the avm crossing the midline. both internal carotid artery (ica) vertebro - basilar arterial systems were normal and intracranial venous drainage system seemed to be normal [figure 7 ]. right - sided eca was ligated at the beginning of operation through a neck incision (during ligation, partial rupture of eca occurred, which was immediately controlled). then, avm was excised completely with some part of skin (ulcerated and infected area). at the posterior part of avm postoperatively, there was minor wound infection that was controlled by regular dressing and antibiotic. the patient has remained free of recurrence of avm for last 1.5 years (until the last follow - up). an 8-month - old male child presented with a 9 11 cm swelling in mid - frontal region extending more to the right up to the supra - orbital region. swelling increased in size during cry and prone position of the baby, and it was compressible and non pulsatile. ct scan of brain showed extra - calvarial soft tissue mass in frontal region, and there was no apparent bony gap infront of anterior fontanel. ct angiogram showed soft tissue mass was vascular lesion connected with sss through emissary veins and intracranial dural sinuses including sss were normal. the lesion was excised completely by elevation of a bi - frontal flap through a post - hairline bi - coronal incision. the patient recovered uneventfully (figures 2 and 3) and has remained asymptomatic for last 5 years (until the last follow - up). a 43-years - old male patient presented with right - sided pulsatile, progressively increasing fronto - parieto - temporal swelling measuring about 15 19 cm. he had a history of surgery 5 years back in another institution. according to the patient, he also had recurrent attack of haemorrhage from the ulcerated area but none were of serious nature to cause shock and were controlled by pressure dressings. ct scan showed large soft tissue swelling [figure 6 ] and the bony windows showed multiple erosions and prominent vascular marking. right - sided common carotid artery and eca angiogram showed huge dilatation of branches (occipital artery, posterior auricular artery, superficial temporal artery and maxillary artery and its branches, including meningeal and middle temporal arteries) of eca supplying the avm. left eca angiogram showed enlargement and tortuousity of left occipital, posterior auricular and superficial temporal arteries supplying the avm crossing the midline. both internal carotid artery (ica) aca, middle cerebral (mca) and vertebro - basilar arterial systems were normal and intracranial venous drainage system seemed to be normal [figure 7 ]. right - sided eca was ligated at the beginning of operation through a neck incision (during ligation, partial rupture of eca occurred, which was immediately controlled). then, avm was excised completely with some part of skin (ulcerated and infected area). at the posterior part of avm postoperatively, there was minor wound infection that was controlled by regular dressing and antibiotic. the patient has remained free of recurrence of avm for last 1.5 years (until the last follow - up). the scalp avm is an abnormal arteriovenous communication situated within the subcutaneous fatty layer of the scalp. in low - flow vm (i.e., cavernoma, cavernous hemangioma, venous malformation and sinus pericranii), usually, no arteriovenous shunt is present and they are seen as well - demarcated lesions. the origin of avm of the scalp is still uncertain, but trauma is an important factor in most of the patients, though some are congenital (spontaneous) in origin. spontaneous avm of the scalp may present at birth, but, in most patients, it is asymptomatic until adulthood. traumatic avm of the scalp develops months or years after the scalp trauma. about 10 - 20% of scalp avms various names being used to describe the vms of the scalp include aneurysm cirsoide, aneurysma serpentinum, aneurysm racemosum, plexiform angioma, arteriovenous fistula and avm. the origin of the main feeding arteries is in the subcutaneous tissue of the scalp. the origin of these main feeders, most frequently, arises from the external carotid, occipital and supraorbital arteries. two patients had blunt injury to the head. however, these patients noticed the swelling many years later. most of the patients had a history of progressive increase in the size of the lesion and had become symptomatic in the third decade of life. the patients may present with a pulsatile mass, headache, local pain, tinitus, numbness, necrosis, ulcer and/or haemorrhage. angiography is the gold standard investigation to delineate the lesion and to exclude an intracranial component ; it is of great importance for diagnosis and treatment selection. selective angiography should be carried out for differential diagnosis of the vascular lesions, such as aneurysms, sinus pericranii, venous malformation and cavernous hemangioma. scalp high - flow avms are needed to differentiate from low - flow avms as the latter are more susceptible to sclerotherapy. avms show flow void signs on mri due to the rapid flow in the lesions. management of scalp avm is difficult because of its high shunt flow, intracranial communication, complex vascular anatomy and cosmetic problems. when sinus pericranii or venous malformation associated with intracranial sinus occlusion or congenital absence of sinus, then treatment become difficult. the indication of treatment includes cosmetic relief of the pulsatile or non - pulsatile mass, prevention of haemorrhage and other symptoms such as headache and tinnitus. the treatment options include surgical excision ligation of feeding vessels, transarterial and transvenous embolization, injection of sclerosant into the nidus and electro thrombosis. surgical excision is the most common and successful method of dealing with scalp vascular lesion. surgical treatment is particularly indicated in order to rule out bleeding and for the resolution of cosmetic problems, as well as treat the accompaning issues of tinnitus and headache. thus, pre - operative radiological evaluation should be used for the assessment of feeding arteries, drainage vessels, numbers of fistulas, connected vascular structures and shunt flow volume in order to prevent any possible complications. various techniques have been used to control the haemorrhage during surgery including percutaneous sutures of the feeding vessels, interlocking suture along the line of incision and use of tourniquet and intestinal clamp over the base of the flap. a step - wise incision with careful pressure control is a useful method to control the scalp bleeding. reflection of the pericranium along with the scalp flap prevents inadvertent rupture of the nidus. in avm, there may be significant pericranial component of the malformation as was evident in one of our cases. due to the anomalous arteriovenous communication, avm must be completely eliminated because recurrence or enlargement is reported after an incomplete treatment. endovascular treatment may be applied in order to decrease the haemorrhage and facilitate the surgical treatment or in the direct treatment of avms. embolization of both feeders and nidus before surgery is safer than embolization of the feeders alone to reduce the risk of excessive haemorrhage. three different approaches have been used to access the fistula, namely femoral transarterial, femoral transvenous and direct percutaneous catheterization of the feeding arteries or draining veins. direct percutaneous catheterization of the fistula has been used whenever access through the artery or vein was not possible. the percutaneous placement of thrombogenic coils is a simple and effective method to produce thrombosis of cirsoid aneurysm of the scalp, especially after slowing down the blood flow through transvascular intra - arterial embolization. embolization and endovascular treatment may not be sufficient in the treatment of large scalp avms. the most important step is total surgical excision without causing scalp necrosis and excessive blood loss. the low- and high - flow scalp avms have different management protocol. a thorough clinical evaluation for differentiation of high - flow malformation from low - flow, should be followed by either a ct angiogram or mr angiogram and/or dsa. a high - flow avm with large size, multiple feeders, skin changes, skin necrosis / ulceration and haemorrhage are the right candidate for surgical treatment as it gives best chances of cure with better cosmetic result and less chance of recurrence. appropriate management plan should be made on the basis of clinical data, investigation findings, available treatment options (surgery, embolization + surgery or embolization alone) and surgical expertise. in scalp avm, usually there are multiple feeders, even with single feeder cure without recurrence is probably rare. moreover, per - operative feeder control is very easy for a skilled surgeon even if it needs a separate incision. the scalp flap should be planned in such a way that the feeding arteries are preserved in the base of the scalp flap and the flap incorporate one or more normal non - feeding vessels so as not to jeopardize the flap blood supply once the feeding vessels are ligated. in case of unavoidable skin excision with avm the flap should be raised along with the pericranium, the feeders should be identified, the pericranium and galea incised, the vessels traced distally towards the nidus and ligated, and/or coagulated and divided. the pericranium and the galea should be circumferentially incised for excision of avm. wherever needed, scalp should be reconstructed with scalp mobilization or rotational flap. in the management of low - flow vm patient age, size of lesion, presenting complains, skin thickness and intracranial venous sinus communication with direction of venous blood flow are important factors. in our series, among the three low - flow vms, two were under 1 year of age with a large lesion and the skin overlying the lesion was thin. in one case, scalp lesion was connected with superior saggital sinus. in the remaining case, patient wanted removal of mass. due to possible intracranial complications, and chances of scalp necrosis, bleeding, ulceration, and scarring and other systemic complication, we did not use interventional radiology or sclerosants in our series but with expert interventional radiologists these are very valuable tools of management of such lesions. with pre - operative appropriate surgical planning, scalp avm and svm can be excised safely without any major complication. though some cases may be treated with percutaneus or endovascular embolization, surgery remains the mainstay of treatment. in the event of scalp ulceration and haemorrhage, ct / mr angiography and/or dsa helps us to differentiate between low flow and high flow lesions as well as identify the feeders and the nidus. | aims : scalp arterio - venous malformation (avm) and scalp venous malformation (svm) are rare conditions that usually need surgical treatment. here, we have reported our experience of the surgical management of such lesions with a short review of the literature.materials and methods : in this prospective study, 11 patients with scalp avm and svm, who underwent surgical excision of lesion in our hospital from 2006 to 2012, were included. all suspected high - flow avm were investigated with the selective internal and external carotid digital subtraction angiogram (dsa) computed tomography (ct) scan of brain with ct angiogram or magnetic resonance imaging (mri) of brain with mr angiogram, and all suspected low - flow vascular malformation (vm) was investigated with mri of brain + mr angiogram. eight were high - flow and three were low - flow vm.results:all lesions were successfully excised. scalp cosmetic aspects were acceptable in all cases. there was no major post - operative complication or recurrence till last follow-up.conclusions:with preoperative appropriate surgical planning, scalp avm and svm can be excised without major complication. |
spontaneous rupture of the rectum is a rare occurrence with less than seventy cases being reported in literature. this has to be differentiated from rectal perforations which occur due to underlying pathology or direct rectal trauma. a spontaneous rupture of the rectum is defined as a rectal perforation in the absence of the above two conditions and is usually attributed to a sudden increase in the intra - abdominal and intra - rectal pressures. the traditional management is via a laparotomy with repair of the tear in the rectum with or without a covering colostomy. a total laparoscopic approach to rectal perforation we report an unusual case of a young boy who developed a spontaneous rupture of the rectum following a trivial fall which was successfully managed laparoscopically. a 17-year - old boy slipped in the bathroom and landed on his gluteal region. when he got up, he developed pain in his lower abdomen and noticed bleeding from his rectum along with mass. he was taken to a nearby hospital where they documented it to be prolapsed omentum which was digitally repositioned and was referred to our centre. on examination at our centre, about 3 h after his fall, he had tachycardia but was haemodynamically stable. a magnetic resonance imaging (mri) of the abdomen was performed which picked up a tear in the rectum about 23 cm just above the peritoneal reflection with the omentum plugging it [figure 1a and b ]. on repeated questioning he was administered broad spectrum antibiotics and taken up for a diagnostic laparoscopy during which a 3 cm transverse tear in the left anterolateral aspect of the rectum just at the peritoneal reflection with the omentum plugging it was seen with minimal contamination [figure 2 ]. the tear was repaired in two layers [figure 3 ] using four ports, one 10 mm and three 5 mm. eight weeks later, a rectal contrast study was done which showed no leak of contrast, and a sigmoidoscopy to rule out an underlying pathology was normal following which his colostomy was closed. he was repeatedly questioned but denied any direct trauma, in any form that could have caused the injury. (a) axial sections of magnetic resonance imaging of the abdomen showing a tear in the rectum about 23 cm just above the peritoneal reflection with the omentum plugging it, (b) axial section of t2 fs images showing a bulky tail of the pancreas with mild fat stranding in the tail region laparoscopic view showing the tear in the rectum at the level of the peritoneal reflection along with the omentum that was plugging it intra - operative photograph showing the repaired rectal tear usually seen in older patients, cases as young as 6 years of age have been reported. in the younger patients, it is imperative to rule out a history of deliberate or accidental trauma as the cause. although termed as spontaneous, the pathogenesis of such rupture is a sudden increase in the intra - luminal pressures which can occur as a result of blunt abdominal trauma, lifting heavy weights, straining while passing stools, sneezing, micturation and even vomiting. in our case, we believe that the sudden contraction of the abdominal muscles and anal sphincters as a protective mechanism during the fall would have led to an increase in the intra - abdominal and intra - rectal pressures. at least one case of a spontaneous rupture occurring during sleep has been described. these ruptures occur in the presence of pre - disposing factors such as rectal prolapse, chronic constipation or the presence of a deep rectovesical / uterine pouch. the location of rupture in the rectum, it is almost always just proximal to the peritoneal reflection in its anterior aspect. only occasionally, a prolapse of omentum or small bowel as a presentation of rectal perforation has been reported. in the presence of peritoneal signs or prolapsed bowel / omentum, no imaging is really required to clinch the diagnosis and the patient proceeds to surgery. in our case, there were no peritoneal signs, and since we did not find a prolapsed omentum, notwithstanding the findings of the previous hospital, we proceeded to do an mri for the patient. this was also because we did not believe that a fall, so trivial, on the gluteal region could cause a rectal rupture. once suspected, an urgent surgery is needed and follows the principles of colorectal trauma. a laparoscopic approach to repair of rectal perforation is feasible, especially in cases which present early. one of the first reports of this approach was by najah and pocard in 2015. the challenge in these cases would be to suture the rent which is just at the peritoneal reflection, deep in the pelvis and in a limited space the site of perforation is identified and the extent of contamination assessed. the prolapsed bowel or omentum, the rectal tear is repaired and a biopsy of the edges is warranted if an underlying pathology is suspected. although there are some reports that have avoided a colostomy in the absence of gross contamination, a covering stoma is usually done as this would avoid the devastating pelvic sepsis in the event of a leak from the repair. we believe that this may be necessary only in the presence of large tears with significant contamination or a faecal loading of the sigmoid colon proximal to the tear as it would render the diversion ineffective. some authors suggest obliteration of the deep pouch if present to prevent recurrences. an associated rectal prolapse needs to be dealt later, possibly at the time of colostomy closure. spontaneous rupture of the rectum is a rare occurrence. it can occur in younger age groups and even in the absence of significant trauma. in all such cases, one needs to diligently bring out a history of a history of rectal trauma, deliberate or otherwise. | spontaneous rupture of the rectum is a rare occurrence. a total laparoscopic approach to rectal perforation has only occasionally been reported. we report an unusual case of a young boy who developed a spontaneous rupture of the rectum following a trivial fall. a magnetic resonance imaging revealed a tear in the rectum at the peritoneal reflection with the omentum plugging it. he denied any history of rectal instrumentation or abnormal sexual activity. he had no history of constipation or rectal prolapse. the tear was repaired laparoscopically and a covering loop sigmoid colostomy was added. he made an uneventful post - operative recovery. spontaneous rupture of the rectum can occur in younger age groups and even in the absence of significant trauma. one needs to diligently bring out a history of rectal trauma. equally important is to rule out any underlying pathological condition. a laparoscopic approach is feasible, especially in early cases. |
using two independent analyses, it is demonstrated that natural (e.g., estradiol) and some xenoestrogens (e.g., methoxychlor metabolite) are characterized by a lipophilic region that is absent in nonestrogens as well as in phytoestrogens. it is suggested that this lipophilic region affects binding to specific receptors and may, in fact, differentiate harmful from beneficial estrogens.imagesfigure 1. |
|
(see related articles by basile and lomonte. a neglected issue in dialysis practice : haemodialysate. | in two recent ckj reviews, experts (basile and lomonte and locatelli.) have reviewed haemodialysate composition. a long - neglected issue, observational studies have associated the composition of haemodialysate to adverse outcomes. however, the scarcity of clinical trial - derived information results in limited guideline recommendations on the issue. indeed, guidelines have more frequently indicated what not to do rather than what to do. in this setting, expert opinion becomes invaluable. in designing haemodialysate composition, a balance should be struck between the need to correct within a time frame of around 4 hours the electrolyte and water imbalances that take 48 to 72 h to build, with the need for gradual correction of these imbalances. the issue is complicated further by the impact of individual variability in dietary habits, medications and comorbidities. in this regard, a personalized medicine approach to individualization of haemodialysate composition offers the best chance of improving patient outcomes. but how can haemodialysate individualization be achieved, and what clinical trial design will best test the impact of such approaches on patient outcomes ? |
the cultivation of the apple (malus domestica) for human consumption dates back centuries, and apples are now estimated to be the third most commonly consumed fruit, after bananas and citrus. epidemiological studies have related the ingestion of one apple or more a day to the prevention of pulmonary and colon cancers, cardiovascular disease, type 2 diabetes, pulmonary disorders, and alzheimer 's disease. some apple components have even been found to have beneficial effects with regard to cognitive loss with ageing, osteoporosis, gastrointestinal protection, and the maintenance of body weight. the protective effects are attributed to phytochemical compounds such as triterpenes and polyphenols due to their antioxidant properties. however, the composition of phytochemicals depends on factors including the variety, cultivation conditions, harvesting, soil, and climate, in addition to the type of fruit tissue that is considered (peel, pulp, and seed). the peel contains the greatest amount of polyphenols because it is the main physical, chemical, and biological protection of the fruit from the external environment. the relationship between oxidative stress with diabetes and its micro- and macrovascular complications has been known for years, but the mechanisms involved have only relatively recently begun to be understood. interestingly, the redox state and diabetic cardiomyopathy that involves both mechanical and electrical cardiac dysfunction are closely related and are responsible for an increased vulnerability to developing heart arrhythmias and sudden death. nonetheless, to date, there has been only one study, which indicates that red delicious apple peel (rdp) has direct actions on the heart 's electrical activity with diabetic cardiomyopathy. within this context, the objectives of this study are (1) to evaluate and compare the action of the 50 mg / kg dose of rdp on the duration of cardiac action potentials (aps) at 30, 50, and 90% in normal and diabetic rats and (2) to analyse the functional organization of the ventricular syncytium through the input resistance versus threshold current curve of the hearts of control rats, control rats with rdp, diabetic rats, and diabetic rats with rdp administered daily for 90 days. the results obtained indicate that (1) rdp induced a significant decrease in action potential duration (apd) and absolute refractory period (arp) ; (2) the cardiac syncytium in healthy animals and in those with diabetes is heterogeneous, in terms of input resistance and intracellular thresholds. however, in animals with diabetes, this irregularity is more accentuated ; and (3) rdp administered orally to diabetic rats attenuates the irregularities of the relationship between input resistance and threshold current. the production of apple varieties in mexico is mainly concentrated on the golden delicious and red delicious varieties. only red apple varieties contain anthocyanins ; these flavonoids are responsible for the red and blue tones occurring in various fruits, such as grapes, berries, and figs. for this reason we decided to use the red delicious variety, which also has the highest concentration of free polyphenols [1012 ]. red delicious apples, harvested in 2011, were purchased in the market of ciudad juarez, chih. to obtain the apple peels, once the peels were lyophilized, they were pulverized to obtain a fine powder that was vacuum - packed in plastic bags, shielded in black plastic bags, and stored at 20c until being utilized. the proximate analysis of the rdp was performed according to the official methodology outlined by the association of official analytical chemists (aoac). the total nitrogen was determined by the kjeldahl technique, and the crude protein was calculated by multiplying the total nitrogen by 6.25. the crude fat was quantified by the soxhlet technique. phenol extraction was performed using 20 g of rdp dissolved in 125 ml of 80% methanol. the measurement was compared to a standard curve of gallic acid, and the results were expressed in units of mg of gallic acid equivalent (gae) per 100 g dry weight. the determination and quantification of the isomers of chlorogenic acid and epicatechin were performed in the laboratories of the silliker company at mrieux nutrisciences in grand prairie, tx, usa. the male wistar rats that were used were acquired from rismart and research global solutions in mexico city. the rats were maintained at a constant temperature of 25c with a ld 12 : 12 cycle. the treatment period was equivalent to 90 days, and 36 rats were utilized. they were divided into four groups : control (n = 10), control with rdp treatment (n = 4), type 1 diabetes (n = 11), and type 1 diabetes with rdp treatment (n = 11). the groups treated with rdp received a daily dose of 150 mg / kg. the concentrate was dissolved in distilled water in small volumes and administered orally with a tuberculin syringe. the dose was equated to the daily consumption of the peels of three apples / day ingested by an adult man weighing 70 kg. the induction of diabetes mellitus type 1 was accomplished using a single intraperitoneal administration of 45 mg / kg of streptozotocin (stz, sigma chemical company) dissolved in a citrate buffer at ph 4.8. to decrease the mortality due to the hypoglycaemia generated by the stz, 60 mm of sugar water was provided ad libitum for one week. the glycaemia of the blood was determined at eight days after stz injection using a commercial blood glucose metre (onetouch ultra 2). for this study, only those rats with glycaemia values above 150 mg / dl were used. all experiments were performed according to the guidelines established by the ethics committee for experimental animals of the autonomous university of ciudad jurez. prior to experimentation, the rats were anesthetized with sodium pentobarbital at 50 mg / kg and 0.2 units of heparin / ml. once an animal was anesthetized, its abdomen was opened ; from this area, cardiac puncture was performed, and a 4 ml blood sample was obtained. then, proceeding to the isolation of the heart, it was placed in an isolated tissue chamber and continuously perfused with oxygenated tyrode 's solution at 37c. under these conditions and by dissection of the left ventricle, the preparation thus obtained was stimulated through external bipolar silver electrodes coated with insulating material, except for the tip, at a basic cycle of 500 milliseconds. the stimuli were rectangular pulses of one millisecond in duration and an intensity 1.5 times the threshold, obtained from a digitimer model d4030 pulse generator and passed through a digitimer model ds2 stimulus isolation unit. when the propagation of premature responses (extrasystoles) was explored, the preparation was stimulated regularly at a basic cycle of 500 milliseconds and, after applying eight basic stimuli, a test stimulus was introduced through the same pair of stimulation electrodes at different time intervals. the intracellular action potentials were obtained using glass microelectrodes filled with 3 m kcl solution and with a tip resistance of between 10 and 20 megaohms. the signal obtained by the microelectrodes was passed through high input impedance amplifiers, wpi model 750, and an hv electrometer model 400e. the recording of the aps was performed on the screen of a tektronix model tds3034b oscilloscope. the quantifications of glucose and glycosylated haemoglobin (hba1c) were determined at 90 days by spectrometry in the servalab clinical laboratory (puebla, mexico). to determine the glucose concentration, a glucose pap kit (elitech clinical systems) was used in a vitros dt60 chemistry system, whereas the hba1c was performed with a labonacheck a1c kit in an hba1c analyser. the evaluation of the plasma insulin levels was performed by chemiluminescence in the italo gaya laboratory (puebla, mexico). the data were analysed with graphpad prism version 4.00 for windows (graphpad software, la jolla, california, usa). the numerical results are expressed as mean values sem (standard error of the mean). the differences observed between the control and the treated groups were assessed using unpaired two - tailed student 's t - test. the polyphenol content was 1,100 g gae/100 g dry weight. specifically, the isomers of chlorogenic acid and epicatechin were present at a concentration of 0.1148 and 2.35 mg / g dry weight, respectively. the determination of the total polyphenols by means of the folin - ciocalteu method depends on the extraction of the polyphenols and the units used to report them ; thus, it is difficult to compare the results. however, the levels of chlorogenic acid and epicatechin in the peels are in line with those published by other authors. both chlorogenic acid and epicatechin are the most abundant polyphenols in the apple. table 2 presents variables relating to the body weight and biochemical blood parameters of the rats 90 days after diabetes mellitus was induced. figure 1 shows the overlapping mean aps, recorded in the isolated papillary muscles of hearts from the control rats (blue diamond) and the diabetic rats (red circle), evoked by a basic 500-millisecond cycle. figure 2 shows the result of averaging the aps of the diabetic rats and the diabetic rats treated for 90 days with 150 mg / kg of rdp. figure 3 summarizes the apd at 30, 50, and 90% and the arp of the control rats, the diabetic rats, and the diabetic rats treated with rdp. concisely, (1) the papillary heart muscles of the rat present a syncytial geometric organization and (2) to evaluate the possible potential changes of this syncytial organization, it is necessary to quantify the parameters of the input resistance and the threshold current (necessary to evoke a propagated ap). to quantify the input resistance and the threshold current, the microelectrodes were cemented or glued, aligned under a microscope, and separated between their tips at a distance of approximately 10 m. the microelectrodes were mounted in a double micromanipulator (narishige md-4) with independent vertical movement. with this system, it was possible to impale the two microelectrodes in the same cell or in two adjacent cells connected by their nexus. under these strict conditions, depolarizing or hyperpolarizing current pulses were injected through one microelectrode, and, with the other, the changes in the transmembrane potential were recorded. figure 4 shows the steps that were followed to quantify the input resistance and the intracellular thresholds in the papillary muscles of the control rats. the top trace in figure 4(a) shows the injection of three constant current hyperpolarizing pulses, in late diastole, with a duration of 7.0 milliseconds and intensities of 35, 68, and 100 nanoamperes, and their corresponding variations in the membrane potential of 5, 10, and 16 millivolts (lower trace). by plotting the change in membrane potential with respect to the injected current, a straight line is obtained, with a slope that is the value of the input resistance. in figure 4(b), the current polarity is inverted, and a pulse of depolarizing current is injected. the pulse duration is 7.0 milliseconds, and its intensity is gradually increased until it can evoke an action potential. in this case, the intracellular threshold is 805.5 nanoamperes. figure 4(c) shows the simultaneity and the same configuration of the depolarization phase of the action potentials recorded in the same cell by both of the microelectrodes. finally, in figure 4(d), the zero potential of both action potentials recorded in the same cell is obtained. therefore, it is important to note that the value of the input resistance of the cell will be valid provided that the requirements shown in figures 4(c) and 4(d) are met. using this procedure, sufficient data on the input resistance and threshold current were obtained in the control rats to show that their product (ohms amperes = volts) equals a mean value of 30 mv. in other words, the experimental results are fitted to the theoretical curve of an equilateral hyperbola in the form y = k / x, where k is a constant with a value equalling 30 mv ; and the xy product (resistance current) is the drop in potential that corresponds to the value of the constant, k, with units in volts. these experimental relationships are shown in figure 5, with a function, f, and p < 0.05. in this graph, the experimental values of the input resistance ranged between 24 and 171.4 k, and the minimum current threshold necessary to initiate propagated responses ranged from 175 to 1,220 nanoamperes. because the preparation of the papillary muscle of the rat heart maintains its force of contraction, the duration of the impalement of the microelectrodes is brief. determining the threshold is achieved by small amplitude steps of increasing current until initiating an ap ; consequently, our threshold values lacked absolute precision. therefore, if the input resistance and threshold current are adequately related, with the equation of an equilateral hyperbola with constant value, k = 30 mv, then we can quantify the intracellular thresholds more precisely and explore more of the cells in the papillary muscles, impaling two independent microelectrodes at different sites in the preparation. thus, we can inject the current in smaller steps through one electrode up to the threshold and record the propagated ap through the other. under these conditions, the input resistance values can be calculated with the equation of the equilateral hyperbola : y = k / x. to make the electrode impalement technique more efficient, obtain a greater amount of experimental data, and have more precise current threshold values, the microelectrode recording the aps remains fixed somewhere in the biological preparation, and the other microelectrode is impaled into many other sites of the papillary muscle for the determination of their thresholds. figure 6 shows the relationships between the papillary muscles of the control rats and the papillary muscles of the control rats treated with 150 mg / kg of rdp over a 90-day period. the values for the input resistance found in the control rats are between 24 and 316.5 k, and their corresponding threshold currents range from 94 to 1,232 nanoamperes. figure 7 shows the changes between the input resistance and threshold current values due to the diabetogenic effects. wide variations in input resistances, ranging from 24 to 814.1 k, in threshold currents, ranging from 36 to 1,232 nanoamperes, and the resting membrane potential of 77.50 0.3554 mv (n = 109) were found in the papillary muscles of the diabetic rats, while in the control rats the variations in input resistance range from 24 to 316.5 k and corresponding threshold current ranges from 1,232 to 94 nanoamps with a resting membrane potential of 76.62 0.5664 mv (n = 252). observe the displacement towards higher input resistance values and low thresholds in the hearts of the diabetic rats. figure 8 shows the effects of rdp on the input resistance - threshold current values obtained in the papillary muscles of the diabetic rats and the diabetic rats treated with rdp. the results clearly indicate a reduction in diabetogenic effects due to the administration of the rdp, based on the values of the input resistance and threshold current. the modifications in the input resistance and the intracellular threshold found in the papillary muscles of the rats with diabetes can cause the propagation of aps that may become critical ; under these conditions, reentrant bioelectrical activity may arise which initiates ventricular fibrillations and sudden death. figure 9 shows the response evoked by the application of an early extrasystole in the papillary muscle of diabetic rats. the upper trace corresponds to the aps recorded in the area proximal to the site of the external stimulation electrodes ; the lower trace corresponds to the aps recorded in a site distal to the stimulation electrodes. the first response corresponds to the last of a series of eight aps evoked by basic stimuli. the second response corresponds to the activity generated by a test stimulus applied 40 milliseconds after the last basic stimulus. it is observed that the ap evoked by the test pulse is followed by two aps (asterisks) that were not initiated by stimulation, which demonstrates the hypersensitivity of the ventricular syncytium of diabetic rats to generate reentrant action potential activity. this result provides additional evidence that when a test pulse is applied early, the evoked response is followed by multiple reentrant activity. in this case this study was designed with the purpose of obtaining solid experimental evidence of the effects of rdp on diabetic cardiomyopathy. a well - established model of diabetes induced by streptozotocin in the rat was used for this purpose [15, 16 ]. the effects of rdp were quantified with the electrophysiological parameters of the papillary muscle of the hearts of male wistar rats. the electrophysiological properties studied included (1) the duration of the arp and aps at 30, 50, and 90% of their repolarization and (2) the organization of the ventricular syncytium muscle in terms of the input resistance - current threshold relationship in control rats, control rats treated with rdp, diabetic rats, and diabetic rats treated with rdp. it is important and necessary to clarify that we are unable to provide an adequate explanation of or the mechanisms that are involved in the actions and effects of the rdp for the following reasons : (1) this is the first study in which the action of rdp is assessed. (3) their concentrations and pharmacokinetic and pharmacodynamic properties prevent us from formulating an explanation. considering the foregoing and with the aforementioned reservations the results obtained clearly show that the duration of the action potentials increases in the papillary heart muscles of the diabetic rats compared to the control rats (figures 1 and 3) [1620 ]. additionally, the increase in the duration of the action potential is more pronounced at 30% than at 90%. there are several ionic currents that intervene spatially and temporally in the repolarization of the action potential in the ventricular myocardium of the rat. the early phase of ventricular repolarization is performed by the activation of two potassium currents (ik), the transient outward current (ito) and the delayed rectifier current (ik), whereas the late phase of repolarization is due to the activation of the na / ca exchanger current, which is responsible for the final elongation of the repolarization of the action potential. furthermore, the increase observed in the early phase of the repolarization of the action potentials in the diabetic rats is due to the decrease in the potassium currents, ito and ik [16, 18, 20 ], whereas the increase in apd90% is attributed to the increase in the na / ca exchanger current, causing an overload of ca in the ventricular myocytes [2325 ]. figures 2 and 3 show that the supplementation of apple peels to the diabetic rats for 90 days after having induced diabetes significantly decreased the duration of the action potentials and the arp. it has been reported that the polyphenols contained in apple extract decrease the duration of the action potential in the ventricular myocytes of the mouse heart with dilated cardiomyopathy. such a decrease in the apd is the result of an increased k current (ik1), induced by the polyphenols extract. the results obtained in the papillary muscles of diabetic rats with treatment can be explained if we assume that the rdp has the same types of polyphenols and is at concentrations similar to those found in the apple extracts tested. consequently, the rdp could cause an increase in the transient outward k current (ikto), given that it is the principal k current affected in the ventricular myocytes of the hearts of diabetic rats [16, 20 ]. indeed, it is necessary to measure this current in the ventricular myocytes of the diabetic rats to provide a more sustainable affirmation. our study was conducted in the isolated papillary muscles of the left ventricle of the rat heart. before considering the interpretation of the results, in which the organization of the ventricular functional syncytium was analysed, we must consider the following factors : the first work in which the organization of the ventricular functional syncytium was analysed was developed in the right anterior papillary muscle of the dog heart. the morphologies of the intracellular action potentials revealed the existence of three functionally distinct areas in the right anterior papillary muscle of the dog heart. the same authors designated the end portion of the conduction tissue as terminal purkinje fibres. the terminal purkinje fibres establish low - resistance electrical contact with the ventricular muscle fibres and give rise to the purkinje - muscle junctions. in this manner, the preparation of the papillary muscle of the dog provides a syncytium composed of different cellular elements that can be easily identified.nonetheless, the rat is an experimental model widely used in cardiac electrophysiology studies. to date, there is no interest in performing the classification made in the anterior papillary muscle of the dog in the papillary muscle of the left ventricle of the rat. with that condition, it is assumed that there is a similar functional structure in their proximal and middle thirds (composed of specialized conduction fibres and ordinary ventricular muscle cells). this asseveration is supported by the similarity of the input resistance values evaluated in the proximal and middle thirds (high resistance values and low thresholds). low resistance values and high thresholds are found in the distal third, which indicates that the distal third may possibly be composed exclusively of muscle tissue. the first work in which the organization of the ventricular functional syncytium was analysed was developed in the right anterior papillary muscle of the dog heart. the morphologies of the intracellular action potentials revealed the existence of three functionally distinct areas in the right anterior papillary muscle of the dog heart. the same authors designated the end portion of the conduction tissue as terminal purkinje fibres. the terminal purkinje fibres establish low - resistance electrical contact with the ventricular muscle fibres and give rise to the purkinje - muscle junctions. in this manner, the preparation of the papillary muscle of the dog provides a syncytium composed of different cellular elements that can be easily identified. nonetheless, the rat is an experimental model widely used in cardiac electrophysiology studies. to date, there is no interest in performing the classification made in the anterior papillary muscle of the dog in the papillary muscle of the left ventricle of the rat. with that condition, it is assumed that there is a similar functional structure in their proximal and middle thirds (composed of specialized conduction fibres and ordinary ventricular muscle cells). this asseveration is supported by the similarity of the input resistance values evaluated in the proximal and middle thirds (high resistance values and low thresholds). low resistance values and high thresholds are found in the distal third, which indicates that the distal third may possibly be composed exclusively of muscle tissue. the knowledge of the structural organization of the ventricular syncytium is made possible through the study of its active and passive functional properties. the foregoing involves first determining the characteristics of the generation and propagation of its aps. in making these determinations, understanding its behaviour as a functional syncytium is favoured, in addition to the importance that it represents for the structural geometry of the organization of the cardiac ventricular syncytium. it also helps to explain, under normal conditions, the proper propagation of the aps, even when there is a low margin of safety for the propagation. it was observed that the experimental data on the input resistance - threshold current obtained in the cardiac syncytial system of the rat fit an equilateral hyperbola (figures 5, 6, 7, and 8) and that the values of the input resistance and intracellular thresholds change, with relatively broad ranges. these results show the following characteristics of the mammalian ventricular functional syncytium : (1)the input resistance and threshold current are inversely related.(2)the functional organization of the ventricular syncytium in the left papillary muscle of the rat heart is irregular in terms of the values of the input resistance and the current threshold for initiating an action potential. however, they maintain the same constant value ; k = 30 mv.(3)in terms of the threshold current, the cellular excitability is different in each of the explored sites of the papillary muscle preparation.therefore, in relatively small areas, the extension of the abundance of low resistance junctions can be an important parameter that can determine and explain the hyperbolic nature of the relationship between the input resistance and the current threshold. with this experimental evidence, we conclude that the papillary heart muscles from the control rats constitute an irregular syncytium and that the principal cause for this lack of homogeneity is the possible nonuniformity of the spatial distribution of the nexus (figures 5 and 6). similarly, the experimental data indicate that the smaller the value of the input resistance, the higher the threshold current. the only way we can explain this fact is by assuming that the density of the nexus varies from one small area to the next. the small areas that we refer to would be the amount of cells needed to permit the formation of the wavefront, and, under these circumstances, every initiation of a wavefront will have a different threshold and, consequently, will present a different nexus density. the results shown in figures 5 and 6 indicate the lack of homogeneity in the ventricular syncytium of the hearts of the control rats. the input resistance and threshold current are inversely related. the functional organization of the ventricular syncytium in the left papillary muscle of the rat heart is irregular in terms of the values of the input resistance and the current threshold for initiating an action potential. however, they maintain the same constant value ; k = 30 mv. in terms of the threshold current, the cellular excitability is different in each of the explored sites of the papillary muscle preparation. the irregularity of the ventricular syncytium of the hearts of healthy rats does not imply ventricular electrophysiological abnormalities. however, under pathological conditions such as diabetes (figure 7), the heterogeneity of the cardiac syncytium is accentuated in these new conditions and increases the probability of the development of lethal arrhythmias. the greater heterogeneity found in the heart of the diabetic rats includes areas of tissue in the papillary muscle with higher input resistance values and lower intracellular thresholds, which implies the existence of areas of tissue with less nexus density in the papillary muscle. this phenomenon, observed with high input resistance values and low threshold current values, is firmly supported by studies in diabetic rats in which the decreases in the expression of connexin 43 were found, in addition to the redistribution of their nexus [31, 32 ]. the accentuated changes in the values of the input resistance and the intracellular thresholds found in the papillary muscles of the diabetic rats become critical to the propagation of the aps. under these conditions, a wavefront originating from a low - resistance area (high threshold) to high - resistance area (low threshold) propagates easily. however, the opposite case, in which an area of high resistance (low threshold) comes into contact with an area of low resistance (high threshold), faces greater difficulty in propagation because the depolarizing current provided by the wavefront is insufficient for reaching the threshold. consequently, blocking of the propagation occurs at the site of low resistance, and reentrant activity is facilitated. figures 9 and 10 clearly show that this phenomenon occurs. with regard to the results obtained in the papillary muscles of the diabetic rats, it follows that the phenomena exhibited in the propagation of premature responses are the result of discontinuous propagation. under these conditions, two factors that can cause conduction block in the ventricular syncytium are added : (1) the small efficacy of the premature action potentials, as physiological stimulus, and (2) the irregularity in the input resistance and the intracellular threshold for initiating propagated action potentials (cellular excitability). it is well known that the propagation of the ap in areas of tissue whose excitability is found to be reduced (low input resistance) is performed through electronic potentials and that the magnitude and temporal development of such potentials depend on the organizational geometry of the syncytium. this study presents two important findings : (1) simultaneous modifications in the input resistance - intracellular threshold in the hearts of diabetic rats and (2) the alterations in the propagation of premature responses. these phenomena allow us to provide an adequate explanation of the arrhythmogenic phenomenon shown by the heart in pathological situations such as diabetes ; furthermore, they produce a partial understanding with respect to the high vulnerability of the heart in presenting ventricular fibrillation and sudden death. under normal conditions, the daily ingestion of at least one apple is sufficient to decrease the incidence of cardiovascular disease and/or diabetic cardiomyopathy. the dose of rdp provided to the healthy rats for 90 days maintained the heterogeneity of the ventricular syncytium observed in the papillary muscles of the healthy rats (figure 6). however, the oral supplementation of rdp to the diabetic rats attenuated the increase in the input resistance and the decrease in the threshold current (figure 8). we noted above (figure 7) that the increase in the heterogeneity of the ventricular syncytium in the diabetic rats occurs due to a decrease in the density of the nexus, which causes an increase in the input resistance values and a decrease in the intracellular thresholds. these changes are supported by the decreased expression of connexin 43, and, therefore, the spatial redistribution of the nexus occurs [31, 32 ]. in the papillary muscles of the diabetic rats with rdp the latter indicates that, in the papillary muscles of the diabetic rats with rdp, there are areas of tissue with a greater density of nexus. this observed phenomenon can be explained if we consider that the alterations that occur in the diabetic rats may also occur in dilated cardiomyopathy in the mouse. in this model of dilated cardiomyopathy, it was reported that oral supplementation of the mice with an extract of polyphenols contained in the apple increased the expression of connexin 43 ; consequently, there was an increase in the density and interconnection of the nexus in the cardiac myocytes. finally, the decrease in the amplitudes of the heterogeneities of the ventricular syncytium and the decrease in the absolute refractory period are two factors that favour the disappearance of the critical propagation of action potentials. the ventricular syncytium of the control rats is heterogeneous.in diabetic cardiomyopathy, the organization of the ventricular syncytium muscle proceeds with functional modifications that are evaluated in terms of input resistance and threshold current.the propagation of premature responses is associated with conduction blocks.the hearts of rats with induced diabetes are more vulnerable to reentrant arrhythmias.the apple peel achieves its protective action by reducing the arp and attenuating the modifications that the ventricular syncytium suffers during diabetes. the ventricular syncytium of the control rats is heterogeneous. in diabetic cardiomyopathy, the organization of the ventricular syncytium muscle proceeds with functional modifications that are evaluated in terms of input resistance and threshold current. the apple peel achieves its protective action by reducing the arp and attenuating the modifications that the ventricular syncytium suffers during diabetes. | this study was designed to examine the effects of lyophilized red delicious apple peel (rdp) on the action potentials (aps) and the input resistance - threshold current relationship. the experiments were performed on isolated papillary heart muscles from healthy male rats, healthy male rats treated with rdp, diabetic male rats, and diabetic male rats treated with rdp. the preparation was superfused with oxygenated tyrode 's solution at 37c. the stimulation and the recording of the aps, the input resistance, and the threshold current were made using conventional electrophysiological methods. the rdp presented no significant effect in normal rats. equivalent doses in diabetic rats reduced the apd and arp. the relationship between input resistance and threshold current established an inverse correlation. the results indicate the following : (1) the functional structure of the cardiac ventricular syncytium in healthy rats is heterogeneous, in terms of input resistance and threshold current. diabetes further accentuates the heterogeneity. (2) as a consequence, conduction block occurs and increases the possibility of reentrant arrhythmias. (3) these modifications in the ventricular syncytium, coupled with the increase in the arp, are the adequate substrate so that, with diabetes, the heart becomes more arrhythmogenic. (4) rdp decreases the apd, the arp, and most syncytium irregularity caused by diabetes. |
human immunodeficiency virus (hiv) infection is a major public health challenge in europe. nearly 29,381 new diagnoses of hiv are reported yearly for european countries and the european economic area member states, with a rate of 5.8 diagnoses per 100,000 inhabitants.1 in italy, an incidence of 6.5 new diagnoses of hiv per 100,000 inhabitants has been reported.2 the highest prevalence of acquired immunodeficiency syndrome (aids) cases and one of the highest incidence rates of new diagnosis in italy has been observed in the lombardy region (10.5 cases per 100,000 inhabitants), with a strong burden on the regional health care budget. in particular, the cost of antiretroviral therapy in this region has gradually increased from about 92 million in 2004 to more than 193 million in 2010.3 use of highly active antiretroviral therapy (haart) has reduced morbidity and mortality in hiv - infected patients.4 for those patients who have access to these drugs, life expectancy now approaches that of individuals without hiv infection, particularly if treatment is started early in the course of the disease,5,6 although a significant percentage of patients experience only a partial response to haart. adherence to therapy is one of the key factors that increase the efficacy of the antiretroviral response.79 several studies have demonstrated that adherence is second only to cd4 t - cell count in accurately predicting progression to aids and death.10,11 other determinants of haart failure or success include genetic differences in drug metabolism, a high baseline viral load, inherited or acquired drug resistance, concurrent opportunistic infections, and non hiv - related comorbidities.6 studies have documented that high interindividual variability in the pharmacokinetics of antiretroviral agents plays an important role in predicting the outcome for hiv - infected patients.1215 inadequate exposure to antiretroviral drugs can increase the risk of a poor virologic response, whereas higher drug concentrations have been associated with an increased incidence of adverse events. therapeutic drug monitoring (tdm) is a tool for clinicians to individualize and optimize drug dosage in order to obtain drug concentrations associated with the highest therapeutic efficacy with a reduced risk of concentration - dependent adverse effects. this approach consists of measurement of drug concentration in a biologic matrix and adjustment of the dose according to the actual drug concentration in the patient. tdm has already been incorporated into us and europe treatment guidelines recommending application of tdm in certain situations and special populations.15 tdm for antiretroviral agents, however, is not recommended for routine use in the management of hiv - infected adults (c - iii).16 antiretroviral monitoring remains in its infancy and there is currently no consensus about whether tdm should be used in routine clinical practice in the management of hiv infection. the current economic recession in european countries has forced governments to devise emergency measures to reduce spending on drugs, including antiretroviral therapies.17 in a context of limited health care resources, pharmacoeconomic considerations are thus crucial to help policy - makers make the most appropriate decision on resource allocation. evidence is available from observational studies in several clinical conditions showing that tdm helps to optimize drug use and, as a consequence, also to contain disease - related costs. this has been shown for a variety of drug classes including antibiotic, antiepileptic, psychiatric, and immunosuppressant drugs.18 a recent study has shown that tdm - guided dosing of citalopram has a positive impact and decreases the duration of hospitalization.19 in particular, the introduction of tdm led to significant changes in clinical dosing strategies, ultimately resulting in a mean difference in length of hospital stay of 23 days between patients who undergo tdm and those who do not. considering daily hospitalization costs of 250, the potential savings amounted to 5,750 per patient. in the present study we aimed to evaluate whether tdm is a useful tool to optimize haart and reduce the costs associated with handling hiv infection. to address this issue, we compared hiv - infected patients treated with antiretroviral drugs in which tdm was or was not used, assessing several clinical outcomes, including length of hospitalization (related to reduced therapeutic response and/or occurrence of serious adverse drug reactions) and cost of illness. data for the study subjects were extracted from the administrative and clinical databases of l sacco university hospital, milan, italy. the following databases were used : the health - assisted subjects database, containing patient demographic data ; the medications prescription database, providing information for each medication prescription, the anatomic therapeutic chemical (atc) classification system code for the drug purchased, the number of packs, the number of units per pack, the dosages, the unit cost per pack, and the prescription date ; the hospital discharge database, containing information on discharge for each hospitalization, in particular the date of admission and discharge, main and accessory diagnosis coded according to the international classification of diseases, ninth revision, clinical modification (icd-9 cm) ; the ambulatory care specialist, which records outpatient specialist services (visits, laboratory tests, diagnostic tests) provided to the patient, including the type and date of visit ; and laboratory test databases, containing information on the application of tdm in routine clinical practice for optimization of drug dosing in hiv - infected patients. using appropriate data linkage procedures, a population databank containing individual, analytical, and chronologic profiles of all patients enrolled was created. this administrative database is complete, includes validated data, and has been used in previous epidemiologic studies.20 the italian ministry of health defined these archives as 100% complete and 95% accurate.21 in compliance with privacy laws, the patients identification code was encrypted and the individuals / bodies involved in processing of the data for the purposes of the analysis were blinded to the identification of patients. the patient code in each database permitted electronic linkage between all databases. in order to guarantee patient privacy, the local institutional ethics committee was informed of the study according to the legal requirements concerning observational analysis and waived the need for consent. this was a retrospective cohort study and included all hiv - infected patients aged 18 years with at least one prescription of antiretroviral drugs and routinely followed by outpatient visits at l sacco university hospital. the inclusion period was from january 2010 to december 2011 and the follow - up observational period was from january to december 2012 (ie, 12 months). enrolled patients were stratified in two cohorts according to the presence / absence of at least one tdm evaluation during the inclusion period. antiretroviral therapy prescribed during the study period included all components of haart, namely nucleoside analog reverse transcriptase inhibitors (nrtis), non - nucleoside analog reverse transcriptase inhibitors (nnrtis), protease inhibitors, or other drugs in atc group j05a. for control patients (ie, those who did not undergo tdm evaluations) the inclusion date was the date of the first prescription of antiretroviral drugs occurring after the start date of the study including patients who were already on haart, whereas for patients who underwent tdm, the inclusion date was that of the first assessment of tdm. the therapeutic regimen was analyzed in relation to the backbone (a combination of two nrtis) and the third drug (usually a protease inhibitor or an nnrti, raltegravir, or maraviroc). the cohort of patients that switched to a new treatment regimen, whether or not controlled via tdm, was excluded from our study because it could have created potential bias in the evaluation, given that switching may modify clinical parameters and increase hospitalizations and therapeutic failures. causes of hospitalization were identified by icd-9 cm codes, and included in the analysis were those with a principal or secondary diagnosis of hiv (icd-9 codes 042.x). data and costs were collected for medications, hospitalizations, diagnostic tests, and specialist visits for the 12 months after the first prescription of antiretroviral therapy (follow - up). history of aids - defining events was evaluated in the 12 months preceding the inclusion date according to the centers for disease control and prevention classification.22 coinfection with hepatitis b virus or hepatitis c virus was evaluated for the 12-month period preceding the inclusion date based on the presence of a hospitalization with a primary or secondary diagnosis of hepatitis b virus (icd-9 codes 0702, 0703) and/or hepatitis c virus (icd-9 codes 0704, 0705, 0707). patient health status was defined by viral load and cd4 t - cell count, evaluated at baseline and at the end of follow - up. cd4 t - cell levels were defined to be within range when between 0.6 cells/l and 1.510 cells/l.. only patients with continuous eligibility for at least 24 months (12 months before and 12 months after the enrollment date) were included. treatment adherence was calculated according to methods described in the literature.23 adherence was determined by calculating the proportion of days on which a patient had a supplied medication in the time interval of 12 months after the enrolment date. overall adherence for each patient was calculated as the duration - weighted average adherence of up to three regimens. specific programming was developed to account for overlapping prescriptions, regimen modifications, and overlapping regimens to ensure that these factors did not contribute to the differences in adherence detected. plasma concentrations of antiretroviral drugs were assessed by validated chromatographic methods coupled with ultraviolet light detectors (atazanavir, darunavir, etravirine, lopinavir, tipranavir) or with triple quadrupole mass spectrometry (efavirenz, maraviroc, nevirapine, raltegravir, amprenavir, tenofovir, ritonavir, indinavir, saquinavir, nelfinavir). reference ranges for antiretrovirals were retrieved from the recently updated us department of health and human services guidelines.16 descriptive statistics were mainly used due to the descriptive nature of the study. quantitative variables (eg, age) were expressed as the mean standard deviation or as the median (interquartile range), as deemed appropriate. all analyses were performed using stata se version 12.0 (statacorp lp, college station, tx, usa) using 95% confidence intervals. all health care resources for antiretroviral drug treatments (atc code j05a), hospitalizations for hiv (icd-9 codes 042.x ; diagnosis related groups 488, 489, 490), and laboratory tests / visits used during the observation period were considered in the cost of illness calculation. the price for drug treatments was the one at the time of drug purchasing, costs for visits were retrieved from regional tariffs, while the costs for the hospitalizations were derived from diagnosis related group codes. data for the study subjects were extracted from the administrative and clinical databases of l sacco university hospital, milan, italy. the following databases were used : the health - assisted subjects database, containing patient demographic data ; the medications prescription database, providing information for each medication prescription, the anatomic therapeutic chemical (atc) classification system code for the drug purchased, the number of packs, the number of units per pack, the dosages, the unit cost per pack, and the prescription date ; the hospital discharge database, containing information on discharge for each hospitalization, in particular the date of admission and discharge, main and accessory diagnosis coded according to the international classification of diseases, ninth revision, clinical modification (icd-9 cm) ; the ambulatory care specialist, which records outpatient specialist services (visits, laboratory tests, diagnostic tests) provided to the patient, including the type and date of visit ; and laboratory test databases, containing information on the application of tdm in routine clinical practice for optimization of drug dosing in hiv - infected patients. using appropriate data linkage procedures, a population databank containing individual, analytical, and chronologic profiles of all patients enrolled was created. this administrative database is complete, includes validated data, and has been used in previous epidemiologic studies.20 the italian ministry of health defined these archives as 100% complete and 95% accurate.21 in compliance with privacy laws, the patients identification code was encrypted and the individuals / bodies involved in processing of the data for the purposes of the analysis were blinded to the identification of patients. the patient code in each database permitted electronic linkage between all databases. in order to guarantee patient privacy, the local institutional ethics committee was informed of the study according to the legal requirements concerning observational analysis and waived the need for consent. this was a retrospective cohort study and included all hiv - infected patients aged 18 years with at least one prescription of antiretroviral drugs and routinely followed by outpatient visits at l sacco university hospital. the inclusion period was from january 2010 to december 2011 and the follow - up observational period was from january to december 2012 (ie, 12 months). enrolled patients were stratified in two cohorts according to the presence / absence of at least one tdm evaluation during the inclusion period. antiretroviral therapy prescribed during the study period included all components of haart, namely nucleoside analog reverse transcriptase inhibitors (nrtis), non - nucleoside analog reverse transcriptase inhibitors (nnrtis), protease inhibitors, or other drugs in atc group j05a. for control patients (ie, those who did not undergo tdm evaluations) the inclusion date was the date of the first prescription of antiretroviral drugs occurring after the start date of the study including patients who were already on haart, whereas for patients who underwent tdm, the inclusion date was that of the first assessment of tdm. the therapeutic regimen was analyzed in relation to the backbone (a combination of two nrtis) and the third drug (usually a protease inhibitor or an nnrti, raltegravir, or maraviroc). the cohort of patients that switched to a new treatment regimen, whether or not controlled via tdm, was excluded from our study because it could have created potential bias in the evaluation, given that switching may modify clinical parameters and increase hospitalizations and therapeutic failures. causes of hospitalization were identified by icd-9 cm codes, and included in the analysis were those with a principal or secondary diagnosis of hiv (icd-9 codes 042.x). data and costs were collected for medications, hospitalizations, diagnostic tests, and specialist visits for the 12 months after the first prescription of antiretroviral therapy (follow - up). history of aids - defining events was evaluated in the 12 months preceding the inclusion date according to the centers for disease control and prevention classification.22 coinfection with hepatitis b virus or hepatitis c virus was evaluated for the 12-month period preceding the inclusion date based on the presence of a hospitalization with a primary or secondary diagnosis of hepatitis b virus (icd-9 codes 0702, 0703) and/or hepatitis c virus (icd-9 codes 0704, 0705, 0707). patient health status was defined by viral load and cd4 t - cell count, evaluated at baseline and at the end of follow - up. cd4 t - cell levels were defined to be within range when between 0.6 cells/l and 1.510 cells/l. undetectable viral load was defined as fewer than 50 copies / ml. this analysis was done on a randomly selected sample of patients. only patients with continuous eligibility for at least 24 months (12 months before and 12 months after the enrollment date) were included. treatment adherence was calculated according to methods described in the literature.23 adherence was determined by calculating the proportion of days on which a patient had a supplied medication in the time interval of 12 months after the enrolment date. overall adherence for each patient was calculated as the duration - weighted average adherence of up to three regimens. specific programming was developed to account for overlapping prescriptions, regimen modifications, and overlapping regimens to ensure that these factors did not contribute to the differences in adherence detected. plasma concentrations of antiretroviral drugs were assessed by validated chromatographic methods coupled with ultraviolet light detectors (atazanavir, darunavir, etravirine, lopinavir, tipranavir) or with triple quadrupole mass spectrometry (efavirenz, maraviroc, nevirapine, raltegravir, amprenavir, tenofovir, ritonavir, indinavir, saquinavir, nelfinavir). reference ranges for antiretrovirals were retrieved from the recently updated us department of health and human services guidelines.16 quantitative variables (eg, age) were expressed as the mean standard deviation or as the median (interquartile range), as deemed appropriate. all analyses were performed using stata se version 12.0 (statacorp lp, college station, tx, usa) using 95% confidence intervals. all health care resources for antiretroviral drug treatments (atc code j05a), hospitalizations for hiv (icd-9 codes 042.x ; diagnosis related groups 488, 489, 490), and laboratory tests / visits used during the observation period were considered in the cost of illness calculation. the price for drug treatments was the one at the time of drug purchasing, costs for visits were retrieved from regional tariffs, while the costs for the hospitalizations were derived from diagnosis related group codes. overall, 5,347 patients (3,861 males and 1,486 females) were eligible for analysis and were enrolled from january 2010 to december 2011. no relevant difference in demographic characteristics or haart therapy regimes that could have introduced potential sources of biases was observed. presence of at least one aids - defining conditions was found in 7% versus 5% (p=0.417) of patients who did or did not undergo tdm (tdm and tdm, respectively). ninety - four percent of the tdm group versus 72% of the tdm group (p<0.001) had been treated with antiretroviral drugs before the observational study period. during the study period, 40 of the 143 tdm patients (28%) were switched to a new treatment regimen versus 1,056 of the 5,204 tdm patients (20.3%). adherence was significantly higher in tdm patients versus tdm patients (94% versus 78%, p<0.001, figure 1). at the end of the follow - up period, the percentage of patients with a viral load < 50 copies / ml was 85.3% in tdm patients and 81.4% in tdm patients (p=0.474). no difference was observed between the tdm and tdm patients with regard to whole cd4 t - cell count or the percentage of patients with a cd4 t - cell count within the therapeutic range (p=0.917, figure 2). no significant differences were detected between the tdm group and the tdm group in terms of number of patients hospitalized during the observation period (p=0.623). however, the mean length of hiv - related hospitalization stay was 7.21 days in the tdm group versus the 29.47 days observed in the tdm groups. the costs of illness reflecting the difference in adherence and hospitalization parameters between the tdm and tdm groups are shown in figure 3. patients in the tdm group showed a significantly lower mean cost of 10,227 (p=0.004). the difference in overall costs between the two groups is a consequence of the higher adherence level for tdm patients, who also showed incremental consumption of the following resources : specialist examinations (2,493 versus 1,278), current antiretroviral regimen (9,021 versus 8,066), and concomitant medications (235 versus 195), which were the factors leading to increased health care costs in these patients. in contrast, during the same observation period, the average cost of hospitalization was significantly higher in the group without tdm (688 versus 293). the difference in hospitalization costs between the two group was thus 395 per patient. overall, 5,347 patients (3,861 males and 1,486 females) were eligible for analysis and were enrolled from january 2010 to december 2011. no relevant difference in demographic characteristics or haart therapy regimes that could have introduced potential sources of biases was observed. presence of at least one aids - defining conditions was found in 7% versus 5% (p=0.417) of patients who did or did not undergo tdm (tdm and tdm, respectively). ninety - four percent of the tdm group versus 72% of the tdm group (p<0.001) had been treated with antiretroviral drugs before the observational study period. during the study period, 40 of the 143 tdm patients (28%) were switched to a new treatment regimen versus 1,056 of the 5,204 tdm patients (20.3%). adherence was significantly higher in tdm patients versus tdm patients (94% versus 78%, p<0.001, figure 1). at the end of the follow - up period, the percentage of patients with a viral load < 50 copies / ml was 85.3% in tdm patients and 81.4% in tdm patients (p=0.474). no difference was observed between the tdm and tdm patients with regard to whole cd4 t - cell count or the percentage of patients with a cd4 t - cell count within the therapeutic range (p=0.917, figure 2). no significant differences were detected between the tdm group and the tdm group in terms of number of patients hospitalized during the observation period (p=0.623). however, the mean length of hiv - related hospitalization stay was 7.21 days in the tdm group versus the 29.47 days observed in the tdm groups. the costs of illness reflecting the difference in adherence and hospitalization parameters between the tdm and tdm groups are shown in figure 3. patients in the tdm group showed a significantly lower mean cost of 10,227 (p=0.004). the difference in overall costs between the two groups is a consequence of the higher adherence level for tdm patients, who also showed incremental consumption of the following resources : specialist examinations (2,493 versus 1,278), current antiretroviral regimen (9,021 versus 8,066), and concomitant medications (235 versus 195), which were the factors leading to increased health care costs in these patients. in contrast, during the same observation period, the average cost of hospitalization was significantly higher in the group without tdm (688 versus 293). the difference in hospitalization costs between the two group was thus 395 per patient. because of the massive and growing public health impact of hiv infection, knowledge of its economic implications is urgently required for practical purposes. in an era when health care budgets are under increasing pressure, individual hiv care providers, administrators, and national and international scientific steering committees for hiv - infected cohorts will play a crucial role in promoting the collection of high - quality and detailed data on all components of resource use and costs of care.24 decision - makers and health planners require this information for several purposes : to quantify current expenditures and to project future direct medical costs associated with hiv management ; to evaluate the impact of policy decisions ; and to assess the economic consequences of different treatment options in health care management.25 poor virologic response or toxicity are the most frequent reasons for discontinuation or switch of first - line antiretroviral therapy.26 consequently, it is now mandatory to investigate the variables affecting the clinical outcome in hiv - infected patients, since such understanding is crucial to being able to tailor antiretroviral regimens according to patient characteristics in order to increase the probability of tolerability of combination antiretroviral therapy, enjoying longer survival, and having better quality of life. within this context, tdm - guided intervention could help to extend the effectiveness of individual treatments and to reduce the use of costly drugs. previous studies have documented that tdm for some antiretroviral drugs, namely protease inhibitors and nnrtis, is associated with important improvements in the response of hiv - infected patients to haart, in terms of increased efficacy1315,27 and/or improved drug safety.14,28 in this study, we extended those findings by investigating the impact of tdm on health costs in a real life scenario, considering at the same time demographic, clinical, and laboratory variables known to influence the response to antiretroviral therapy. a first important observation is the low proportion of patients who underwent tdm of antiretroviral drugs for optimization of their dosing, which most likely reflects the fact that such assessments were not done systematically but rather requested within a context of individual clinical problems. as a consequence, it can be reasonably assumed that tdm is not used yet as a diagnostic tool for the day - by - day management of antiretroviral therapy in the context of hiv. our results suggest also that in clinical practice the choice of the clinician to use tdm is based on its suitability to contribute towards solving specific clinical scenarios such as uncertain compliance, poor response to therapeutic doses,29 or to determine dose reductions without risking loss of efficacy. of importance, there were no significant differences between the tdm and tdm groups with regard to demographic and laboratory covariates nor in coinfections at baseline that may have justified the need or otherwise for tdm. in this respect, our results are in line with those of a previous study, although in a selected group of patients, suggesting that tdm is a promising strategy for increasing the success of antiretroviral therapy.30 however, larger well designed trials are required in order to assess conclusively the potential utility of tdm - based intervention before it can be definitely recommended for routine clinical practice. it is well known that good adherence to antiretroviral therapy is necessary for success of treatment.31,32 a recent study33 also showed that nearly 42% of patients (672 of 1,605 eligible participants) were hospitalized for one or more days after initiating haart. median adherence levels were 92 (interquartile range 58100) and 100 (interquartile range 83100) among those hospitalized and those never hospitalized, respectively. after controlling for confounders, those with < 95% adherence had a 1.88-fold (95% confidence interval 1.62.21) higher risk for hospitalization. identifying and addressing factors contributing to poor adherence in the early treatment period could improve patient care and lower hospitalization costs. although poor adherence is one of the most important factors in the development of virologic failure, applying tdm in this setting represents a challenge.34 numerous approaches have been used to evaluate adherence, including patient self - reports, physician assessment, electronic monitoring, pill count, and prescription refill compliance.35 using these approaches, tdm was found to enhance adherence, the most likely reason being that it enhances patient awareness of the therapy and the sense of being properly taken care of.36,37 only the association of therapeutic failure with the detection of subtherapeutic or more specifically null drug levels is a strong indicator of noncompliance with treatment. our data show that the cohorts of patients we studied did not differ in demographic / confounding factors, leaving tdm as the main critical difference and thus the variable affecting adherence to treatment. overall, cost models have shown that high levels of adherence are associated with overall lower total health care costs in the usa38 and south africa.39 timely and practical combination of antiretroviral therapy adherence monitoring and interventions are thus advisable for hiv / aids programs in both developed and developing countries. our results support this evidence, by demonstrating that use of tdm was associated with a reduction in the length of hospital stay from 29.47 days to 7.21 days per patient. thus, it can be reasonably hypothesized that use of tdm in routine clinical management of hiv - infected patients has a positive impact on the duration and cost of hospitalization. indeed, in our cohort, the cost of hospitalization per patient was 395 less in the tdm group than in the tdm group. this does not cover the increased cost due to the mean health care per patient, that was 1,815 more in the tdm+ group, a value including also the costs incurred to analyze the plasma drug concentrations. it does not cover the costs for a specialized clinical laboratory to perform quantitation of antiretroviral concentrations, that includes high - performance liquid chromatography and tandem mass spectrometry ; these may cost in the range of 200,000. this implies that, to be cost - effective, tdm has to be performed in centralized structures servicing more than one hospital. this is related to a considerably higher adherence level that in the long run will benefit the patient and reduce costs further. the reduced costs of hospitalization may also impact positively long term on health care resources because of the reduced number of hospital beds and associated health care operators required, although the possible longer life expectancy of tdm patients might lead to higher lifetime costs per patient. despite the demonstrated relevance of tdm, there are still some problems that limit its use in routine clinical practice. these include timing of sample collection for tdm and the presence of confounding factors, such as virologic and immunologic parameters, protein binding, intracellular kinetics, and the nature of combination therapy, which may also complicate the interpretation of tdm results. nevertheless, tdm has already been incorporated in the treatment guidelines from the usa and europe. our results provide the first evidence that introducing tdm for hiv - infected patients is not only a useful tool to improve the response of patients to haart, but is also potentially cost - effective. a limitation of this study was that the differences between the tdm and non - tdm groups were not fully explored and we do not have enough information to run a univariate or multivariate analysis adjusting for potential confounders and allowing determination of whether hospitalization or admission costs truly differ by use of tdm. some numeric differences did not reach statistical significance, and this might be due to lack of power. missingness is a common problem in register - based observational studies. in our study, however, due to the limitations described above, the results of this study have to be interpreted with caution. finally, we excluded evaluation of patients that incurred in drug switches. this was due to a limitation of the database, that it does not provide the reason behind the drugs switches. we found that inclusion of tdm as part of the clinical routine for optimization of drug dosing in hiv - infected patients is associated with higher adherence to therapy, fewer hospitalizations, and a significant reduction in the cost to health care systems. ongoing research on tdm may provide a useful tool for future improvement of haart. in a context of limited health care resources, pharmacoeconomic considerations are crucial to help policy - makers in making the most appropriate decisions regarding resource allocation. in the case of antiretroviral drugs | backgroundhighly active antiretroviral therapy (haart) has reduced morbidity and mortality in patients infected with human immunodeficiency virus (hiv). studies have documented high interindividual variability in the pharmacokinetics of antiretroviral drugs, which may impair the success of haart if not managed properly. therapeutic drug monitoring (tdm) is a useful diagnostic tool that helps clinicians to optimize drug doses so that drug concentrations associated with the highest therapeutic efficacy are obtained with a reduced risk of concentration - dependent adverse effects. the aim of this study was to assess whether use of tdm improves clinical outcomes and cost of illness.methodsa retrospective cohort study was conducted at l sacco university hospital in milan, italy, in hiv - infected patients aged 18 years with at least one prescription of antiretroviral drugs for which tdm was applied. the inclusion period was from january 2010 to december 2011, with a follow - up period of up to 12 months. laboratory and administrative databases were analyzed and matched with each other.resultsthe cohort consisted of 5,347 patients (3,861 males and 1,486 females) of mean age 43.912.5 years. we found that tdm had been used in 143 of these patients, among whom adherence with therapy was significantly higher than among those in whom tdm had not been used (94% versus 78%). in tdm - controlled patients, the mean length of hiv - related hospitalization stay and mean cost of hospitalization were significantly reduced with respect to those observed in the group in which tdm had not been used (7.21 days versus 29.47 days and 293 versus 688, respectively).conclusioninclusion of tdm as part of routine clinical optimization of drug dosing in hiv - infected patients is associated with higher adherence to therapy, reduced length of hospitalization stay, and reduced cost of illness. |
a multidisciplinary group developed the strega statement by using literature review, workshop presentations and discussion, and iterative electronic correspondence after the workshop. thirty - three of 74 invitees participated in the strega workshop in ottawa, ontario, canada, in june, 2006. participants included epidemiologists, geneticists, statisticians, journal editors and graduate students. before the workshop, an electronic search was performed to identify existing reporting guidance for genetic association studies. they prepared brief presentations on existing reporting guidelines, empirical evidence on reporting of genetic association studies, the development of the strobe statement, and several key areas for discussion that were identified on the basis of consultations before the workshop. these areas included the selection and participation of study participants, rationale for choice of genes and variants investigated, genotyping errors, methods for inferring haplotypes, population stratification, assessment of hardy weinberg equilibrium (hwe), multiple testing, reporting of quantitative (continuous) outcomes, selectively reporting study results, joint effects and inference of causation in single studies. additional resources to inform workshop participants were the hugenet handbook [57, 58 ], examples of data extraction forms from systematic reviews or meta - analyses, articles on guideline development [59, 60 ] and the checklists developed for strobe. to harmonize our recommendations for genetic association studies with those for observational epidemiologic studies, we communicated with the strobe group during the development process and sought their comments on the strega draft documents. we also provided comments on the developing strobe statement and its associated explanation and elaboration document. in table 1, we present the strega recommendations, an extension to the strobe checklist for genetic association studies. the resulting strega checklist provides additions to 12 of the 22 items on the strobe checklist. during the workshop and subsequent consultations, we identified five main areas of special interest that are specific to, or especially relevant in, genetic association studies : genotyping errors, population stratification, modeling haplotype variation, hwe and replication. we elaborate on each of these areas, starting each section with the corresponding strega recommendation, followed by a brief outline of the issue and an explanation for the recommendations. complementary information on these areas and the rationale for additional strega recommendations relating to selection of participants, choice of genes and variants selected, treatment effects in studying quantitative traits, statistical methods, relatedness, reporting of descriptive and outcome data, and issues of data volume, are presented in table 2.table 1strega reporting recommendations, extended from strobe statementitemitem numberstrobe guidelineextension for genetic association studies (strega)title and abstract1(a) indicate the study s design with a commonly used term in the title or the abstract.(b) provide in the abstract an informative and balanced summary of what was done and what was found.introductionbackground rationale2explain the scientific background and rationale for the investigation being reported.objectives3state specific objectives, including any pre - specified hypotheses.state if the study is the first report of a genetic association, a replication effort, or both.methodsstudy design4present key elements of study design early in the paper.setting5describe the setting, locations and relevant dates, including periods of recruitment, exposure, follow - up, and data collection.participants6(a) cohort study give the eligibility criteria, and the sources and methods of selection of participants. describe methods of follow-up.case-control study give the eligibility criteria, and the sources and methods of case ascertainment and control selection. give the rationale for the choice of cases and controls.cross-sectional study give the eligibility criteria, and the sources and methods of selection of participants.give information on the criteria and methods for selection of subsets of participants from a larger study, when relevant.(b) cohort study for matched studies, give matching criteria and number of exposed and unexposed.case-control study for matched studies, give matching criteria and the number of controls per case.variables7(a) clearly define all outcomes, exposures, predictors, potential confounders, and effect modifiers. give diagnostic criteria, if applicable.(b) clearly define genetic exposures (genetic variants) using a widely used nomenclature system. identify variables likely to be associated with population stratification (confounding by ethnic origin).data sources / measurement8(a) for each variable of interest, give sources of data and details of methods of assessment (measurement). describe comparability of assessment methods if there is more than one group.(b) describe laboratory methods, including source and storage of dna, genotyping methods and platforms (including the allele calling algorithm used, and its version), error rates and call rates. specify whether genotypes were assigned using all of the data from the study simultaneously or in smaller batches.bias9(a) describe any efforts to address potential sources of bias.(b) for quantitative outcome variables, specify if any investigation of potential bias resulting from pharmacotherapy was undertaken. if relevant, describe the nature and magnitude of the potential bias, and explain what approach was used to deal with this.study size10explain how the study size was arrived at.quantitative variables11explain how quantitative variables were handled in the analyses. if applicable, describe which groupings were chosen, and why.if applicable, describe how effects of treatment were dealt with.statistical methods12(a) describe all statistical methods, including those used to control for confounding.state software version used and options (or settings) chosen.(b) describe any methods used to examine subgroups and interactions.(c) explain how missing data were addressed.(d) cohort study if applicable, describe analytical methods taking account of sampling strategy.(e) describe any sensitivity analyses.(f) state whether hardy weinberg equilibrium was considered and, if so, how.(g) describe any methods used for inferring genotypes or haplotypes.(h) describe any methods used to assess or address population stratification.(i) describe any methods used to address multiple comparisons or to control risk of false positive findings.(j) describe any methods used to address and correct for relatedness among subjects.resultsparticipants13(a) report the numbers of individuals at each stage of the study, numbers potentially eligible, examined for eligibility, confirmed eligible, included in the study, completing follow - up, and analysed.report numbers of individuals in whom genotyping was attempted and numbers of individuals in whom genotyping was successful.(b) give reasons for non - participation at each stage.(c) consider use of a flow diagram.descriptive data14(a) give characteristics of study participants (e.g., demographic, clinical, social) and information on exposures and potential confounders.consider giving information by genotype.(b) indicate the number of participants with missing data for each variable of interest.(c) cohort study summarize follow - up time, e.g. average and total amount.outcome data15cohort study report numbers of outcome events or summary measures over time.report outcomes (phenotypes) for each genotype category over time.case-control study report numbers in each exposure category, or summary measures of exposure.report numbers in each genotype category.cross-sectional study report numbers of outcome events or summary measures.report outcomes (phenotypes) for each genotype category.main results16(a) give unadjusted estimates and, if applicable, confounder - adjusted estimates and their precision (e.g., 95% confidence intervals). make clear which confounders were adjusted for and why they were included.(b) report category boundaries when continuous variables were categorized.(c) if relevant, consider translating estimates of relative risk into absolute risk for a meaningful time period.(d) report results of any adjustments for multiple comparisons.other analyses17(a) report other analyses done e.g., analyses of subgroups and interactions, and sensitivity analyses.(b) if numerous genetic exposures (genetic variants) were examined, summarize results from all analyses undertaken.(c) if detailed results are available elsewhere, state how they can be accessed.discussionkey results18summarize key results with reference to study objectives.limitations19discuss limitations of the study, taking into account sources of potential bias or imprecision. discuss both direction and magnitude of any potential bias.interpretation20give a cautious overall interpretation of results considering objectives, limitations, multiplicity of analyses, results from similar studies, and other relevant evidence.generalizability21discuss the generalizability (external validity) of the study results.other informationfunding22give the source of funding and the role of the funders for the present study and, if applicable, for the original study on which the present article is based.strega strengthening the reporting of genetic association studies, strobe strengthening the reporting of observational studies in epidemiologygive information separately for cases and controls in case - control studies and, if applicable, for exposed and unexposed groups in cohort and cross - sectional studiestable 2rationale for inclusion of topics in the strega recommendationsspecific issue in genetic association studiesrationale for inclusion in stregaitem(s) in stregaspecific suggestions for reportingmain areas of special interest (see also main text)genotyping errors (misclassification of exposure)non - differential genotyping errors will usually bias associations towards the null [65, 66 ]. when there are systematic differences in genotyping according to outcome status (differential error), bias in any direction may occur.8(b) : describe laboratory methods, including source and storage of dna, genotyping methods and platforms (including the allele calling algorithm used, and its version), error rates and call rates. specify whether genotypes were assigned using all of the data from the study simultaneously or in smaller batches.13(a) : report numbers of individuals in whom genotyping was attempted and numbers of individuals in whom genotyping was successful.factors affecting the potential extent of misclassification (information bias) of genotype include the types and quality of samples, timing of collection, and the method used for genotyping [18, 61, 136].when high throughput platforms are used, it is important to report not only the platform used but also the allele calling algorithm and its version. for example, some of the currently used algorithms are notably less accurate in assigning genotypes to single nucleotide polymorphisms with low minor allele frequencies (85%) or, as the corollary, when genotyping specificity is poor and genotype prevalence is low (85%) or, as the corollary, when genotyping specificity is poor and genotype prevalence is low (< 15%). when measurement of the environmental exposure has substantial error, genotyping errors of the order of 3% can lead to substantial under - estimation of the magnitude of an interaction effect. when there are systematic differences in genotyping according to outcome status (differential error), bias in any direction may occur. unblinded assessment may lead to differential misclassification. for genome - wide association studies of snps, differential misclassification between comparison groups (for example, cases and controls) can occur because of differences in dna storage, collection or processing protocols, even when the genotyping itself meets the highest possible standards. in this situation, using samples blinded to comparison group to determine the parameters for allele calling could still lead to differential misclassification. to minimize such differential misclassification this is one of the reasons for our recommendation to specify whether genotypes were assigned using all of the data from the study simultaneously or in smaller batches. recommendation for reporting of methods (table 1, item 12(h) : describe any methods used to assess or address population stratification. population stratification is the presence within a population of subgroups among which allele (or genotype ; or haplotype) frequencies and disease risks differ. when the groups compared in the study differ in their proportions of the population subgroups, an association between the genotype and the disease being investigated may reflect the genotype being an indicator identifying a population subgroup rather than a causal variant. in this situation, population subgroup is a confounder because it is associated with both genotype frequency and disease risk. the potential implications of population stratification for the validity of genetic association studies have been debated [6983 ]. modeling the possible effect of population stratification (when no effort has been made to address it) suggests that the effect is likely to be small in most situations [75, 76, 7880 ]. meta - analyses of 43 gene disease associations comprising 697 individual studies showed consistent associations across groups of different ethnic origin, and thus provide evidence against a large effect of population stratification, hidden or otherwise. however, as studies of association and interaction typically address moderate or small effects and hence require large sample sizes, a small bias arising from population stratification may be important. study design (case - family control studies) and statistical methods have been proposed to address population stratification, but so far few studies have used these suggestions. most of the early genome - wide association studies used family based designs or such methods as genomic control and principal components analysis [85, 86 ] to control for stratification. these approaches are particularly appropriate for addressing bias when the identified genetic effects are very small (odds ratio < 1.20), as has been the situation in many recent genome - wide association studies [85, 87105 ]. in view of the debate about the potential implications of population stratification for the validity of genetic association studies, we recommend transparent reporting of the methods used, or stating that none was used, to address this potential problem. this reporting will enable empirical evidence to accrue about the effects of population stratification and methods to address it. recommendation for reporting of methods (table 1, item 12(g) : describe any methods used for inferring genotypes or haplotypes. a haplotype is a combination of specific alleles at neighboring genes that tends to be inherited together. there has been considerable interest in modeling haplotype variation within candidate genes. typically, the number of haplotypes observed within a gene is much smaller than the theoretical number of all possible haplotypes [106, 107 ]. motivation for utilizing haplotypes comes, in large part, from the fact that multiple snps may tag an untyped variant more effectively than a single typed variant. the subset of snps used in such an approach is called haplotype tagging snps. implicitly, an aim of haplotype tagging is to reduce the number of snps that have to be genotyped, while maintaining statistical power to detect an association with the phenotype. maps of human genetic variation are becoming more complete, and large scale genotypic analysis is becoming increasingly feasible. in consequence, it is possible that modeling haplotype variation will become more focussed on rare causal variants, because these may not be included in the genotyping platforms. in most current large - scale genetic association studies, data are collected as unphased multilocus genotypes (that is, which alleles are aligned together on particular segments of chromosome is unknown). it is common in such studies to use statistical methods to estimate haplotypes [108111 ], and their accuracy and efficiency have been discussed [112116 ]. some methods attempt to make use of a concept called haplotype blocks [117, 118 ], but the results of these methods are sensitive to the specific definitions of the blocks [119, 120 ]. reporting of the methods used to infer individual haplotypes and population haplotype frequencies, along with their associated uncertainties should enhance our understanding of the possible effects of different methods of modeling haplotype variation on study results as well as enabling comparison and syntheses of results from different studies. information on common patterns of genetic variation revealed by the international haplotype map (hapmap) project can be applied in the analysis of genome - wide association studies to infer genotypic variation at markers not typed directly in these studies [121, 122 ]. essentially, these methods perform haplotype - based tests but make use of information on variation in a set of reference samples (for example, hapmap) to guide the specific tests of association, collapsing a potentially large number of haplotypes into two classes (the allelic variation) at each marker. it is expected that these techniques will increase power in individual studies, and will aid in combining data across studies, and even across differing genotyping platforms. if imputation procedures have been used, it is useful to know the method, accuracy thresholds for acceptable imputation, how imputed genotypes were handled or weighted in the analysis, and whether any associations based on imputed genotypes were also verified on the basis of direct genotyping at a subsequent stage. recommendation for reporting of methods (table 1, item 12(f) : state whether hardy weinberg equilibrium was considered and, if so, how. weinberg equilibrium has become widely accepted as an underlying model in population genetics after hardy and weinberg proposed the concept that genotype frequencies at a genetic locus are stable within one generation of random mating ; the assumption of hwe is equivalent to the independence of two alleles at a locus. views differ on whether testing for departure from hwe is a useful method to detect errors or peculiarities in the data set, and also the method of testing. in particular, it has been suggested that deviation from hwe may be a sign of genotyping errors [126128 ]. testing for departure from hwe has a role in detecting gross errors of genotyping in large - scale genotyping projects such as identifying snps for which the clustering algorithms used to call genotypes have broken down [85, 129 ]. however, the statistical power to detect less important errors of genotyping by testing for departure from hwe is low and, in hypothetical data, the presence of hwe was generally not altered by the introduction of genotyping errors. furthermore, the assumptions underlying hwe, including random mating, lack of selection according to genotype, and absence of mutation or gene flow, are rarely met in human populations [132, 133 ]. in five of 42 gene - disease associations assessed in meta - analyses of almost 600 studies, the results of studies that violated hwe significantly differed from results of studies that conformed to the model. moreover, the study suggested that exclusion of hwe - violating studies may result in loss of the statistical significance of some postulated gene - disease associations and that adjustment for the magnitude of deviation from the model may also have the same consequence for some other gene - disease associations. given the differing views about the value of testing for departure from hwe and about the test methods, transparent reporting of whether such testing was done and, if so, the method used, is important for allowing the empirical evidence to accrue. for massive - testing platforms, such as genome - wide association studies, it might be expected that many false - positive violations of hwe would occur if a lenient p value threshold were set. there is no consensus on the appropriate p value threshold for hwe - related quality control in this setting. so, we recommend that investigators state which threshold they have used, if any, to exclude specific polymorphisms from further consideration. for snps with low minor allele frequencies, substantially more significant results than expected by chance have been observed, and the distribution of alleles at these loci has often been found to show departure from hwe. for genome - wide association studies, another approach that has been used to detect errors or peculiarities in the data set (due to population stratification, genotyping error, hwe deviations or other reasons) has been to construct quantile - quantile (q / q) plots whereby observed association statistics or calculated p values for each snp are ranked in order from smallest to largest and plotted against the expected null distribution [129, 130 ]. the shape of the curve can lend insight into whether or not systematic biases are present. recommendation : state if the study is the first report of a genetic association, a replication effort, or both. (table1, item 3). articles that present and synthesize data from several studies in a single report are becoming more common. in particular, many genome - wide association analyses describe several different study populations, sometimes with different study designs and genotyping platforms, and in various stages of discovery and replication [129, 130 ]. when data from several studies are presented in a single original report, each of the constituent studies and the composite results should be fully described. for example, a discussion of sample size and the reason for arriving at that size would include clear differentiation between the initial group (those that were typed with the full set of snps) and those that were included in the replication phase only (typed with a reduced set of snps) [129, 130 ]. describing the methods and results in sufficient detail would require substantial space in print, but options for publishing additional information on the study online make this possible. the choices made for study design, conduct and data analysis potentially influence the magnitude and direction of results of genetic association studies. however, the empirical evidence on these effects is insufficient. transparency of reporting is thus essential for developing a better evidence base (table 2). transparent reporting helps address gaps in empirical evidence, such as the effects of incomplete participation and genotyping errors. it will also help assess the impact of currently controversial issues such as population stratification, methods of inferring haplotypes, departure from hwe and multiple testing on effect estimates under different study conditions. first, it is based on existing guidance on reporting observational studies (strobe). second, it was developed from discussions of an interdisciplinary group that included epidemiologists, geneticists, statisticians, journal editors, and graduate students, thus reflecting a broad collaborative approach in terminology accessible to scientists from diverse disciplines. finally, it explicitly describes the rationale for the decisions (table 2) and has a clear plan for dissemination and evaluation. we welcome comments, which will be used to refine future versions of the recommendations. we note that little is known about the most effective ways to apply reporting guidelines in practice, and that therefore it has been suggested that editors and authors collect, analyze, and report their experiences in using such guidelines. we consider that the strega recommendations can be used by authors, peer reviewers and editors to improve the reporting of genetic association studies. we invite journals to endorse strega, for example by including strega and its web address in their instructions for authors and by advising authors and peer reviewers to use the checklist as a guide. it has been suggested that reporting guidelines are most helpful if authors keep the general content of the guideline items in mind as they write their initial drafts, then refer to the details of individual items as they critically appraise what they have written during the revision process. we emphasize that the strega reporting guidelines should not be used for screening submitted manuscripts to determine the quality or validity of the study being reported. adherence to the recommendations may make some manuscripts longer, and this may be seen as a drawback in an era of limited space in a print journal. the place in which supplementary information is presented can be decided by authors and editors of the individual journal. we hope that the recommendations stimulate transparent and improved reporting of genetic association studies. in turn, better reporting of original studies would facilitate the synthesis of available research results and the further development of study methods in genetic epidemiology with the ultimate goal of improving the understanding of the role of genetic factors in the cause of diseases. | making sense of rapidly evolving evidence on genetic associations is crucial to making genuine advances in human genomics and the eventual integration of this information in the practice of medicine and public health. assessment of the strengths and weaknesses of this evidence, and hence the ability to synthesize it, has been limited by inadequate reporting of results. the strengthening the reporting of genetic association studies (strega) initiative builds on the strengthening the reporting of observational studies in epidemiology (strobe) statement and provides additions to 12 of the 22 items on the strobe checklist. the additions concern population stratification, genotyping errors, modeling haplotype variation, hardy weinberg equilibrium, replication, selection of participants, rationale for choice of genes and variants, treatment effects in studying quantitative traits, statistical methods, relatedness, reporting of descriptive and outcome data, and the volume of data issues that are important to consider in genetic association studies. the strega recommendations do not prescribe or dictate how a genetic association study should be designed but seek to enhance the transparency of its reporting, regardless of choices made during design, conduct, or analysis. |
a benefit of lifetime methods is that they are independent of dye concentration ; however, they often require specialized and more costly instrumentation. intensity - based methods are compatible with common fluorescence detection techniques, even standard digital cameras, but they often require calibration of local dye concentration versus standards. this criterion has been met by ratiometric methods that rely on multicomponent systems combining an oxygen - sensitive phosphor and an oxygen - insensitive standard in an inert, readily processable matrix. when fashioned as nanoparticles or films, previously we reported a class of single - component dual - emissive oxygen sensing polymeric materials composed of boron difluoride -diketonates (bf2bdk) linked to poly(lactic acid) (pla), that combine sensor (phosphorescence, p), standard (fluorescence, f), and polymer matrix in one. specifically, with bf2dbmpla (dbm = dibenzoylmethane) and its halogenated, heavy atom congener, bf2dbm(i)pla, we demonstrated that emission wavelengths, relative f / p intensities, and oxygen sensitivities are tunable with heavy atom substitution and polymer molecular weight and that these materials can be exploited for cellular, tissue, and in vivo imaging studies (e.g., tumor hypoxia). in a recent model study, blending bf2bdk dyes with pla, it was noted that emission is comprised of and intramolecular charge transfer (ict) processes. in symmetrical phenyl phenyl (ph ph) dyes like dbm, processes dominate, whereas in unsymmetrical ph np or ph an systems (np = naphthyl, an = anthracene), ict processes dominate. computational studies showed that electron density is localized on the larger arene donor (np or an vs ph) in the homo but is distributed across the molecule in the lumo. luminescence data support these claims, with additional ict bands in absorption and emission spectra (i.e., for ph an systems) and longer radiative lifetimes. building upon this observation that the larger arene donor dominates the ict emission properties in unsymmetrical dye systems, a set of ph np dyes with bromide heavy atom substitution were prepared and blended with pla to explore the effects of heavy atom position on luminescence properties. it was demonstrated that lifetimes, intensities, and oxygen sensitivity can be systematically modulated by placing the heavy atom on the more electron - rich naphthyl versus phenyl ring, with naphthyl ring substitution showing the strongest heavy atom effect (i.e., more intense, shorter lived phosphorescence). more recently, this concept was generalized with lewis acid aryl ketone systems. here we contribute new findings to the growing boron luminescent materials field by extending investigations to a series of naphthyl - phenyl dye covalent attachment of the dye to the polymer is preferred over blends for practical uses, given decreased dye leaching and dye / polymer phase separation at high loadings. diketonate ligands (14), boron initiators (58), and associated polymers (912) were designed with the following fundamental and applied considerations in mind. first, extended conjugation afforded by the naphthyl ring in np ph systems (vs ph ph in dbm) can lead to more red - shifted dyes in new color regimes for multiplexing applications. additionally, understanding ways that conjugation length correlates with emission wavelengths for bf2bdk pla materials is important for generating red - shifted materials for greater tissue penetration of light in biological contexts. previous studies show that overall conjugation length is not the only determinative factor for emission wavelength, given ict effects. second, substituents and their placement influence electron density at arene rings and thus material optical properties. though modulation of triplet emission was achieved by heavy atom placement in np ph dye / polymer blends, here we test whether this phenomenon extends to dye polymer conjugates. in the present series, polymers are attached to dyes via electron - donating alkoxy linkages that can perturb the donor strength of the two arene rings. thus, polymer and bromide substituent attachments at either phenyl or naphthyl rings are compared. third, for ratiometric oxygen sensing, strong phosphorescence intensity is desirable. thus, bromide heavy atom substitution is compared to non - brominated systems, and phosphorescence is further modulated via molecular weight tuning, as previously reported. for example, low molecular weight polymers (i.e., higher dye loading) result in increased intersystem crossing from the singlet to the triplet state, increased relative phosphorescence intensity, and shorter lifetimes. furthermore, for bf2dbm(i)pla, nearly full range f / p intensity tuning was possible to generate materials for different kinds of sensing through molecular weight tuning alone. for instance, materials with strong phosphorescence versus fluorescence serve as turn on sensors, whereas systems with comparable, readily detectable f and p intensities are exploited for ratiometric tumor hypoxia imaging and other biomedical uses. however, the sensitivity of f / p to polymer molecular weight is not known for different dyes, and this is an important parameter for sensor materials design. fourth, discrete, clearly distinguishable fluorescence and phosphorescence peaks with measurable f / p ratios are important for ratiometric sensing. here emission wavelengths and can be further modulated by molecular weight, with greater peak separation achievable with higher molecular weights (i.e., low dye loading). importantly, systems with poor fluorescence and phosphorescence peak separation are nonetheless useful for gated emission and lifetime sensing modalities, and non - halogenated systems with longer lifetimes result in more sensitive materials for oxygen sensing. 1-[4-(2-hydroxyethoxy)phenyl]-3-(2-naphthyl)propane-1,3-dione, nbmoh (1), and bf2nbmoh (5) were prepared as previously described. l - lactide, aldrich) was recrystallized twice from ethyl acetate and stored under nitrogen. tin(ii) 2-ethylhexanoate (sn(oct)2, spectrum), boron trifluoride diethyl etherate (aldrich, purified, redistilled), and all other reagents and solvents were used as received without further purification. solvents ch2cl2 and thf were dried and purified by over 3 molecular sieves activated at 300 c. all other chemicals were reagent grade from sigma - aldrich and were used without further purification. h nmr (300 mhz) spectra were recorded on a unity inova 300/51 instrument in cdcl3. h nmr were referenced to the signals for the residual protiochloroform at 7.26 ppm, protiodmso at 2.50 ppm, and protioacetone at 2.09 ppm. polymer molecular weights were determined by gel permeation chromatography (gpc) (thf, 25 c, 0.8 ml / min) using multiangle laser light scattering (mals) (= 658 nm, 25 c) and refractive index (ri) (= 658 nm, 25 c) detection. polymer laboratories 5 m mixed - c columns (guard column plus two columns) along with wyatt technology (optilab t - rex interferometric refractometer, minidawn treos multiangle static light scattering (mals) detector, astra 6.0 software) and agilent technologies instrumentation (series 1260 hplc with diode array (dad) detector, chemstation) were used in gpc analysis. vis spectra were recorded on a hewlett - packard 8452a diode - array spectrophotometer. steady - state fluorescence emission spectra were recorded on a horiba fluorolog-3 model fl3 - 22 spectrofluorometer (double - grating excitation and double - grating emission monochromator). time - correlated single - photon counting (tcspc) fluorescence lifetime measurements were performed with a nanoled-370 (ex = 369 nm) excitation source and a datastation hub as the spc controller. phosphorescence lifetimes were measured with a 1 ms multichannel scalar (mcs) excited with a flash xenon lamp (ex = 369 nm ; duration < 1 ms). lifetime data were analyzed with datastation v2.4 software from horiba jobin yvon. fluorescence quantum yields (f) of initiator and polymer samples in ch2cl2 were calculated versus anthracene as a standard as previously described using the following values : f(anthracene) = 0.27,nd(etoh) = 1.360, nd(ch2cl2) = 1.424. optically dilute ch2cl2 solutions of the dyes were prepared in 1 cm path length quartz cuvettes with absorbances < 0.1 au. thin films were prepared on the inner wall of vials by dissolving polymers in ch2cl2 (1 mg / ml) and then evaporating the solvent by slowly rotating the vial under a stream of nitrogen. all compounds were modeled using the gaussian 09 suite of programs using density functional theory. b3lyp/6 - 31+g(d) was utilized for ground state geometry optimization with a tomasi polarized continuum for dichloromethane solvent. the vibrational frequencies for the optimized geometries were all positive, assuring that the geometries are at least a local minimum. single point energy calculations were used to generate the molecular orbital diagrams utilizing b3lyp/6 - 31g(d). time - dependent density functional theory, td - b3lyp/6 - 311+g(d), was employed for estimates of the absorption spectra, at the respective optimized geometries. the naphthyl precursor was prepared as previously described with the following exceptions. 6-methoxy-2-acetonapthalene (1.5 g, 7.5 mmol) dissolved in 12 m hcl (500 ml) was heated at 90 c for 2 h. the hot reaction mixture was filtered through a sintered glass frit (m) to remove a greenish - black precipitate. the filtrate was allowed to cool to room temperature, and then the flask was further cooled in an ice water bath. the resulting white solid was collected by filtration and was washed with copious quantities of distilled water until the ph of the wash fraction was neutral (ph 6.5). (note : in certain preparations, when the sample was greenish or brownish in color, further purification by recrystallization from hexane / etoac was performed.) after drying in vacuo, a white powder was obtained : 1.27 g (91%). h nmr (300 mhz, cdcl3, ppm) : 8.41 (s, 1h, 1-arh), 8.00 (d, 1h, j = 8.7 hz, 8-arh), 7.89 (d, 1h, j = 9.0, 3-arh), 7.72 (d, 1h, j = 9.0, 4-arh), 7.207.16 (bm, 2h, 5, 7-arh), 5.42 (s, 1h, oh), 2.71 (s, 3h, ch3). 6-hydroxy-2-acetonapthalene (515 mg, 2.8 mmol) was dissolved in dmf (100 ml) in the presence of k2co3 (1.22 g, 8.8 mmol) and ki (50 mg, 0.3 mmol) and was refluxed at 100 c overnight (16 h). dmf was removed via h2o / ch2cl2 extraction (1 l of h2o, 100 ml ch2cl2). the organic layer was washed with h2o (2 20 ml) and brine (2 20 ml) and then was dried over na2so4, filtered, and concentrated via rotary evaporation. the crude product was purified by column chromatography (3:1 hexanes / etoac) and dried in vacuo to yield a white powder : 460 mg (72%). h nmr (300 mhz, cdcl3, ppm) : 8.40 (s, 1h, 1-arh), 8.02 (d, 1h, j = 9, 8-arh), 7.88 (d, 1h, j = 9.0, 3-arh), 7.76 (d, 1h, j = 9, 4-arh), 7.23 (d, 1h, j = 9, 7-arh), 7.18 (s, 1h, 5-arh), 4.23 (t, j = 4.5, 2h, aroch2ch2oh), 4.05 (t, j = 4.5, 2h, aroch2ch2oh), 2.06 (s, 1h, oh). the ligand precursor was prepared as previously described using 6-(2-hydroxy)ethoxy-2-acetonapthalene instead of 1-[4-(2-hydroxyethoxy)phenyl]ethanone. the crude product was purified by silica column chromatography (6:1 hexanes / etoac) to give a tan solid : 1.12 g (68%). h nmr (300 mhz, cdcl3, ppm) : 8.40 (s, 1h, 1-arh), 8.00 (d, 1h, j = 9, 8-arh), 7.86 (d, 1h, j = 9.0, 3-arh), 7.57 (d, 1h, j = 9.0, 4-arh), 7.26 (d, 1h, j = 9.0, 7-arh), 7.19 (s, 1h, 5-arh), 4.74 (t, 1h, j = 3.5,o ch (ch2)o), 4.31 (t, 2h, j = 4.5, aroch2ch2or), 3.92 (t, 2h, j = 4.2, aroch2ch2or), 3.55 (t, 2h, j = 6, och2c3h6ch (r)o), 2.70 (s, 3h, ch3), 1.801.65 (bm, 6h, och2c3h6ch (r)o). hrms (esi, tof) m / z calcd for c19h23o4 315.1596 [m ] ; found 315.1596. h nmr (300 mhz, cdcl3) : 17.03 (s, 1h, oh), 8.49 (s, 1h, 1-arh) 8.107.90 (m, 4h, 2,6-arh, 3,5-arh,), 7.887.71 (m, 2h, 7,8-arh), 7.63 (d, j = 9, 1h, 3-arh), 7.03 (d, j = 9, 2h, 3, 5-arh), 6.93 (s, 1h, cochco), 4.19 (t, j = 4.2, aroch2ch2oh), 4.03 (m, 2h, aroch2ch2oh), 3.48 (s, 1h, ch2ch2oh). hrms (esi, tof) m / z calcd for c21h18o4br 413.0388 [m + h ] ; found 413.0401. h nmr (300 mhz, cdcl3) : 17.02 (s, 1h, oh), 8.49 (s, 1h, 1-arh), 8.067.99 (bm, 3h, 8-arh, 2,6-arh) 7.90 (d, j = 9, 1h, 3-arh) 7.81 (d, j = 9, 1h, 4-arh), 7.577.51 (bm, 3h, 3,4,5-arh), 7.25 (d, j = 9, 1h, 7-arh), 7.20 (s, 1h, 5-arh) 6.98 (s, 1h, cochco), 4.25 (t, j = 6, 2h, aroch2ch2oh), 4.06 (t, j = 6, 2h, aroch2ch2oh), 2.2 (s, 1h, aroch2ch2oh). hrms (esi, tof) m / z calcd for c21h19o4 335.1283 [m ] ; found 335.1289. h nmr (300 mhz, cdcl3) : 16.96 (s, 1h, oh), 8.48 (s, 1h, 1-arh), 8.00 (d, j = 8.7, 1h, 8-arh), 7.947.90 (m, 3h, 2, 6-arh, 3-arh), 7.81 (d, j = 8.7, 1h, 4-arh), 7.64 (d, j = 8.7, 2h, 3, 5-arh), 7.26 (d, j = 8.7,1h, 7-arh), 7.19 (s, 1h, 5-arh), 6.94 (s, 1h, cochco), 4.25 (t, j = 4.2, 2h, aroch2ch2oh), 4.094.04 (m, 2h, aroch2ch2oh), 2.05 (s, 1h, ch2ch2oh). hrms (esi, tof) m / z calcd for c21h18o4br 413.0388 [m + h ] ; found 413.0376. a representative preparation for difluoroboron initiators is provided for complex 6 below. h nmr (300 mhz, cdcl3) : 8.76 (s, 1h, 2-arh), 8.21 (d, 2h, 2,6-arh), 7.98 (m, 5h, 4,7,9,10-arh, cochco), 7.68 (m, 2h, 5,6-arh), 7.08 (d, 2h, 3,5-arh), 4.23 (t, j = 4.2, 2h, aroch2ch2oh), 4.05 (t, j = 4.2, 2h, aroch2ch2oh). hrms (esi, tof) m / z calcd c21h16bo4f2na 405.1099 [m + na ] ; found 405.1094. the ligand nbmoh, 2 (250.0 mg, 0.605 mmol), was added to a flame - dried two - neck round - bottom flask under nitrogen and was dissolved in thf / ch2cl2 (20/20 ml) to give a pale yellow solution. boron trifluoride diethyl etherate (115 l, 0.907 mmol) was added via syringe, and the solution turned bright yellow. the reaction was stirred at room temperature for 48 h. solvents were removed via rotary evaporation, resulting in a yellow solid. the crude material was purified by recrystallization in 1:1 etoac / acetone to yield a yellow - orange powder : 143 mg (53%). h nmr (300 mhz, dmso) : 9.07 (s, 1h, 1-arh), 8.438.38 (bm, 4h, 3,8-arh, 2,6-arh), 8.188.11 (bm, 2h, 5,7-arh), 7.98 (s, 1h, cochco), 7.81 (d, j = 9, 1h, 4-arh), 7.23 (d, j = 9, 2h, 3,5-arh), 4.98 (t, j = 5.4, 1h, oh), 4.19 (t, j = 4.8, 2h, aroch2ch2oh), 3.77 (t, j = 4.5, 2h, aroch2ch2oh). hrms (esi, tof) m / z calcd c21h16bo4f2brna 483.0191 [m + na ] ; found 483.0180. the ph - np complex was prepared as described for 6. h nmr (300 mhz, dmso) : 9.07 (s, 1h, 1-arh), 8.39 (d, j = 9, 2h, 2,6-arh), 8.31 (d, j = 9, 1h, 8-arh), 8.13 (d, j = 9, 1h, 3-arh), 8.037.98 (m, 2h, 4-arh, cochco), 7.81 (d, j = 9, 1h, 7-arh), 7.68 (t, j = 6, 2h, 3,5-arh), 7.50 (s, 1h, 5-arh), 7.34 (d, j = 9, 1h, 4-arh), 5.00 (t, j = 6, 1h, oh), 4.18 (t, j = 6, 2h, aroch2ch2oh), 3.80 (t, j = 6, 2h, aroch2ch2oh). hrms (esi, tof) m / z calcd c21h18bo4f2 383.1266 [m ] ; found 383.1252. h nmr (300 mhz, dmso) : 9.07 (s, 1h, 1-arh), 8.32- 8.28 (m, 3h, 2,6-arh, 8-arh), 8.13 (d, j = 9.0, 1h, 3-arh), 8.037.99 (m, 2h, 7-arh, cochco), 7.90 (d, j = 9, 2h, 3,5-arh), 7.50 (s, 1h, 5-arh), 7.32 (d, 1h, 4-arh), 5.0 (t, j = 6, 1h, oh), 4.18 (t, j = 6, 2h, aroch2ch2oh), 3.80 (t, j = 6, 2h, aroch2ch2oh). hrms (esi, tof) m / z calcd c21h16bo4f2brna 483.0191 [m + na ] ; found 483.0193. preparative scale reactions were conducted as follows. the boron initiator and d, l - lactide were placed in a kontes flask and sealed under n2. the bulb of the flask was entirely submerged in an oil bath at 130 c. after the d, l - lactide melted, sn(oct)2 in hexanes was added, and the reaction was heated for the designated time (13 h). (see table s1 for reagent loadings and reaction times for specific samples.) the polymer was collected by centrifugation, the filtrate was decanted, and the rubbery solid was redissolved in ch2cl2 and reprecipitated in cold meoh (20 c). the resulting solid was reprecipitated from ch2cl2/hexanes, collected by centrifugation, the filtrate was decanted, and the residue was dried in vacuo to give the polymers as foams. number - average molecular weights (mn), polydispersity indices (pdis), and yields for samples of different molecular weights are collected in table s1. polymer 9a was obtained as a yellow crystalline solid : 81 mg (45%). mn (gpc / ri) = 5400 da, pdi = 1.05 ; mn (nmr) = 3800 da. h nmr (300 mhz, cdcl3) : 8.76 (s, 1h, 1-arh), 8.20 (d, j = 9, 2h, 2,6-arh), 8.107.90 (bm, 5h, 3,4,5,8-arh, cochco), 7.607.55 (bm, 2h, 6,7-arh), 7.05 (d, j = 9, 2h, 3,5-arh), 5.305.16 (bm, 48h, pla ch ch3), 4.55 (m, 2h, aroch2ch2oh), 4.35 (m, 2h, aroch2ch2oh), 1.57 (bs, 146 h, pla chch3). polymer 10a was obtained as a yellow crystalline solid : 151 mg (44%). mn (gpc / ri) = 6800 da, pdi = 1.03 ; mn (nmr) = 6900 da. h nmr (300 mhz, cdcl3) : 8.72 (s, 1h, 1-arh), 8.20 (d, j = 9, 2h, 2,6-arh), 8.108.08 (m, 2h, 3,8-arh), 7.897.87 (m, 2h, 5,7-arh), 7.69 (d, j = 9, 1h, 4-arh), 7.23 (s, 1h, cochco), 7.05 (d, j = 9, 2h, 3,5-arh), 5.315.11 (bm, 89h, pla chch3), 4.55 (m, 2h, aroch2ch2oh), 4.35 (m, 2h, aroch2ch2oh), 1.57 (bs, 205h, pla chch3). polymer 11a was obtained as a yellow - orange foam : 71 mg (64%). mn (gpc / ri) = 5200 da, pdi = 1.04 ; mn (nmr) = 3300 da. h nmr (300 mhz, cdcl3) : 8.73 (s, 1h, 1-arh), 8.20 (d, j = 9, 2h 2,6-arh), 8.10 (d, j = 9, 1h, 8-arh), 7.95 (d, j = 9, 1h, 3-arh), 7.85 (d, j = 9, 1h, 7-arh), 7.71 (t, j = 6, 1h, 4-arh), 7.58 (t, j = 6, 2h, 3,5-arh), 7.317.25 (m, 2h, cochco-, 4-arh), 7.19 (s, 1h, 5-arh), 5.305.16 (bm, 45 h, pla chch3), 4.55 (m, 2h, aroch2ch2oh), 4.35 (m, 2h, aroch2ch2oh), 1.57 (bs, 144 h, pla chch3). polymer 12a was obtained as a bright yellow - green crystalline foam : 101 mg (40%). mn (gpc / ri) = 5600 da, pdi = 1.07 ; mn (nmr) = 3100 da. h nmr (300 mhz, cdcl3) : 8.73 (s, 1h, 1-arh), 8.108.03 (bm, 4h, 8-arh, 2,6-arh, cochco), 7.95 (d, j = 9, 1h, 3-arh), 7.85 (d, j = 9, 1h, 7-arh), 7.73 (d, j = 9, 2h, 3,5-arh), 7.33 (d, j = 9, 1h, 4-arh), 7.19 (s, 1h, 5-arh), 5.215.11 (bm, 72 h, pla chch3), 4.58 (t, j = 4.8, 2h, ochh2ch2), 4.35 (t, j = 4.8, 2h, aroch2ch2oh), 1.57 (s, 241 h, pla chch3). bf2n(br)bmoh (30 mg, 0.06 mmol) and d, l - lactide (0.467 g, 3.25 mmol) were placed in a kontes flask sealed under n2. the bulb of the flask was entirely submerged in an oil bath at 130 c. after the d, l - lactide melted, sn(oct)2 (0.24 mg, 0.60 mol) in hexanes was added, and the flask was resealed under n2. aliquots were drawn up into a pipet tip at the specified times (table s2 ; figure 1a c) until 93% conversion. percent monomer conversion was determined via h nmr spectroscopy by comparing the integration of monomer versus (monomer + polymer) peaks. molecular masses of dye polymer conjugates were measured by h nmr spectroscopy and gpc with dad, mals, and ri detectors. a representative boron polymer synthesis via -diketonate ligand 3 and boron complex initiator 7 is illustrated in scheme 1 for bf2bnmpla 11. primary alcohols are installed on the ketones to serve as sites for d, l - lactide polymerization. commercially available 4-hydroxyacetophenone, or 6-hydroxy-2-acetonapthone prepared by acid hydrolysis of 6-methoxy-2-acetonapthone, is functionalized with och2ch2oh via williamson ether synthesis and protected with 1,2-dihydropyran for claisen condensation in the presence of nah. following deprotection and purification by recrystallization, the -diketonate ligands (14) were boronated with bf3oet2. reactions were stirred until ligands were completely consumed, according to tlc. in many instances, products precipitated from the reaction mixture over time. after purification by recrystallization powders 58 were obtained. the structure and purity of boron dye products were confirmed by ms and h nmr spectroscopy. hydroxyl - functionalized boron initiators 58 were used to produce dye polymer conjugates 912 by solvent - free ring - opening polymerization of d, l - lactide using a tin octoate catalyst at 130 c. samples were purified by precipitation from ch2cl2/hexane to remove the catalyst and multiple times with ch2cl2/cold methanol until h nmr spectroscopy confirmed all monomer was removed. reagent loadings, reaction times, and molecular weight data are provided in table s1. monomer loadings were increased to achieve higher molecular weights. to test the maximal molecular weight attainable with good molecular weight control, initiator 6 after 24 h, a 21 kda polymer was achieved (pdi 1.14 ; 84% conversion). extended reaction time did not result in further chain extension (71 h, 20.3 kda, pdi 1.17, 96% conversion) ; chain transfer or thermal depolymerization may occur. gpc traces of purified polymer products revealed minor high molecular weight shoulders (figure 1a). in previous studies, reactions were typically stopped at 70% conversion to avoid transesterification and broader pdis at high monomer conversion, but here data suggest that other factors are at play. first, here too, kinetics studies (e.g., with 6, figure 1b, c) reveal relatively linear mn vs % conversion and pseudo - first - order kinetics plots to 70% conversion, but pdis are higher than usual at the onset (1.33 for 23% conversion) and only drop after 25% conversion (pdi = 1.05). second, the high molecular weight shoulders are consistently double the molecular weight of the main polymer peak. furthermore, gpc analysis of aliquots shows evidence of this feature throughout this polymerization, not just at high conversions (figure 1a). these findings point to initiator aggregation rather than diminished control as the polymerization progresses, though at very high conversions (e.g., 90%) slightly increased pdis and nonlinear mn vs conversion is observed, consistent with chain transfer and transesterification. in fact, the naphthyl dyes show lower solubility in common organic solvents compared to previous bf2dbmoh initiators. for all naphthyl complexes, residual solid initiator was evident in the lactide melt at the onset of polymerization reactions ; however, the mixtures clarified and solids disappeared as the reactions progressed. gpc trace (a) and kinetics plots (b, c) for lactide polymerization with initiator bf2n(br)bmoh 6 (130 c, 6:lactide : sn(oct)2 = 1:50:1/50). aliquots were taken at 10, 30, 60, 80, 105, and 190 min as indicated. while this might point to slow initiation relative to propagation, in fact, no induction period is noted and no tailing is evident on the low molecular weight side of the main polymer peak. attempts to facilitate the reaction with increased catalyst loading resulted in increased polymerization rate but showed no obvious effect on molecular weight control. difluoroboron bdk dyes are reported to dimerize and form h - aggregates, which can influence the optical properties. certain naphthyl initiators show higher percentages of dimeric products than others in the eluting polymer fractions (8 : 1012% dimer vs 57 : 57% dimer by mass). alternatively, polymer aggregation could occur during gpc analysis, polymer purification, or processing. that dimeric shoulders increase slightly in gpc traces for purified polymer samples versus analytical samples from kinetics runs lends some support for this hypothesis. all complexes have high extinction coefficients (48 00065 000 m cm) typical for transitions in this family of dyes and high - energy features on dominant peaks. for initiators 5 and 6, the high - energy shoulders at 402 and 395 nm are more distinct. previously this has been correlated with boron complex dimerization and ascribed to h - aggregates. this is consistent with decreased solubility for naphthyl complexes and gpc results in thf solution discussed above. introduction of the bromide heavy atom onto the np site of bf2nbmoh resulted in a slight bathochromic shift (3 nm) and increase in extinction coefficient, whereas bromination of the ph site of bf2bnmoh showed a slightly greater red - shift (7 nm) but a decrease in molar absorptivity. representative uv / vis spectral data for polymers (8 kda samples) are also provided in table 1. (see table s3 for optical properties of polymers with other molecular weights.) spectra are very similar to corresponding boron initiators with slightly decreased extinction coefficients, typical for these boron bdk pla materials. fluorescence lifetimes excited with a 369 nm light - emitting diode (led) monitored at the emission maxima. luminescence data for initiators and representative polymers in solution are given in table 1. initiators 5 and 6 with alkoxy donors on the phenyl rings show intense blue emission at 452 and 448 nm, respectively, while fluorescence for 7 and 8 with or donors on the naphthyl rings are red - shifted to 505 and 521 nm, respectively. once pla is grown from the initiators, the emission maxima slightly blue - shift (47 nm), which may be attributed to a solvatochromic effect or enhanced solubility and thus a diminished tendency to dimerize (table 1). boron dye initiators 58 in ch2cl2 showing emission colors. typically, increased conjugation results in red - shifted emission. naphthyl - phenyl systems here are red - shifted as predicted, compared to previously reported phenyl phenyl (i.e., dbm) derivatives. for example, bf2dbmpla showed an absorption maximum, abs = 396 nm, and emission maximum, em = 426 nm, which are both more blue - shifted than data for samples 912 red - shifted (table 1 ; e.g. 9b : abs = 414 nm, em = 458 nm). fluorescence wavelengths for samples 512 with the och2ch2or initiator (r = h) and polymer (r = pla) tails are consistent with this trend. for example, 5 (np - ph) with alkoxy substitution on the phenyl ring emits at 452 nm and displays a small stokes shift (2031 cm). in comparison, dye 7 (ph - np) with substitution on the naphthyl ring has further red - shifted emission (i.e., 505 nm) and shows a larger stokes shift (4121 cm). in addition to red - shifting absorbance, bromide heavy atom incorporation in dyes 6 and 8 also affects emission. it is well - known that halide heavy atoms result in decreased luminescence lifetimes and quantum yields via enhanced intersystem crossing. results for brominated and parent (i.e., h) compounds are consistent with this trend. for example, the presence of bromide in bf2n(br)bmoh 6 results in a decrease in fluorescence lifetime compared to bf2nbmoh 5 (i.e., 5 : = 1.55 ns (no heavy atom) vs 6 : = 0.53 ns (heavy atom)) and a decrease in fluorescence quantum yield (5 : f = 0.4 vs 6 : f = 0.19). a similar trend is noted in the corresponding polymers 9 and 10. in samples 6 and 10, heavy atom substitution is on the larger, more electron - rich naphthyl donor, but in 8 and 12, when the bromide is present on the smaller, less electron - rich phenyl donor, the heavy atom effect is much less pronounced. lifetimes and quantum yields for 8 and 12 are very similar (table 1). these results with initiators and polymer conjugates are consistent with prior bf2bdk model studies indicating moderate to strong ict character for unsymmetrically substituted difluoroboron diketonates. a greater disparity in -electron - donating ability of the two arene rings results in stronger ict character dominated by the more electron - rich aryl group. previously, it was shown that the electronic transitions of bf2bdks depend on their molecular symmetries. according to td - scf calculations, stronger ict is observed for complexes with unsymmetrical diarene ligands, where there is a disparity in electron donor ability from one arene ring (e.g., anthracene) compared to another (e.g., phenyl). on the other hand, when the bdk arene rings are comparable (i.e., ph - ph in dbm), a delocalized model is proposed. similar trends are noted here for initiator complexes, 58, which were chosen as the subjects for computational modeling given their relative simplicity compared to the respective polymers. molecular orbital diagrams for compounds 5, 7, and 8 suggest intramolecular charge transfer (ict) (figure 4). electron density is localized on the stronger naphthyl donor in the homos for 5, 7, and 8, whereas in the lumos it is distributed across the molecular structure. in contrast, for 6 the electron density is more distributed through the molecular structure on both homo and lumo and the to transition dominates (figure 4). the electron - withdrawing bromide substituent may diminish electron density on the naphthyl ring, making donor capacity of br np and ph or rings comparable. radiative lifetimes, rad increase with increasing ict character, and this is a trend that is observed for samples 5, 7, and 8 (3.885.33 ns) compared to 6 (2.89 ns), with 6 showing the shortest rad. additionally, both 7 and 8 have larger stokes shifts compared to 5 and 6. this is consistent with a geometry change in the excited state that can be expected for compounds with stronger charge transfer character. as in naphthyl model studies, these systems show no distinct itc features in absorption or emission spectra. molecular orbital diagrams for compounds 58 showing the highest occupied molecular orbitals (homo) and lowest unoccupied molecular orbitals (lumo) in ch2cl2. thin films were prepared in vials by slow evaporation of ch2cl2 solutions, followed by drying in vacuo. optical properties for polymers 912, including different molecular weights, are presented in table 2. fluorescence spectra and lifetime measurements were obtained under ambient conditions (e.g., air, 21% oxygen). number - average molecular weights detected by dad, ls / ri detectors in thf solvent. fluorescence lifetimes excited with a 369 nm light - emitting diode (led) monitored at the emission maxima. excitation source : xenon flash lamp ; rtp lifetime fit to triple - exponential decay. for polymers 911 the emission wavelengths in pla matrices are more red - shifted than in ch2cl2 solution (for mn 78 kda, 9b : ch2cl2 : 458 nm, film : 526 nm ; 10a : ch2cl2 : 448 nm, pla : 491 nm ; 11b : ch2cl2 : 501 nm, film : 533 nm). this trend is consistent with previous reports. dye polymer 12a (mn = 5.6 kda) is an anomaly ; there is little difference between emission in solution (514 nm) versus film (518 nm), and the emission only blue - shifts further with increasing molecular weight. previously and here for samples 911, emission wavelengths for polymers in solution and in films were only comparable for high polymer molecular weights (i.e., low dye loading), where dyes are diluted and monomeric dye structures are favored. previous studies showed that bf2bdk luminescence properties are dependent upon the molecular weight of polylactide or dye loading in dye / polymer blends. shorter dye dye distances corresponding to low dye pla molecular weight resulted in lower energy green emission for bf2dbmpla, whereas longer polymer chains (small dye loadings) with diminished dye dye interactions correlate with blue - shifted emission. polymers 912 also follow this trend, namely, emission wavelength blue - shifts with increasing polymer molecular weight. for example, polymers 9a c display emission wavelengths of 526, 496, and 461 nm, respectively. furthermore, the sensitivity to dye loading (i.e., mn) varies for different dyes. for instance, for 9a (5.4 kda) and 9c (16.1 kda) the emission wavelength shifts 65 nm, while from 12a (5.6 kda) to 12c (16.6 kda) it shifts only 23 nm (figures 5, 6 and table 2). comparison of the emission spectra of dye polymer conjugates 912 of different molecular weights. images showing emission color changes for polymers 912 of different molecular weights under air with uv lamp excitation. fluorescence lifetimes were recorded for bf2bdkpla films under ambient conditions (tables 2 and table s7). in all cases, lifetimes fit to triple - exponential decay, which may be ascribed to different fluorophore associations or polymer microenvironments in the solid state. as the polymer molecular weight increases, dye dye interactions decrease, and the pre - exponential weighted lifetimes, pw0, steadily decrease. for the entire molecular weight range examined in this study, dye aggregation may be present in polymer films, because only for 12c do lifetimes approach the value measured for monomeric structures in solution. as expected, the heavy atom has a significant influence on the fluorescence lifetime. for nonhalogenated polymers 9a and 11a lifetimes are 13 ns, whereas lifetimes for brominated analogues 10a and 12a decrease to 3.7 and 5.0 ns, respectively (table 2). phosphorescence measurements for polymer films were performed under a nitrogen atmosphere, and spectra were recorded with a 2 ms delay. previous studies showed that bf2bdk dyes exhibit room temperature phosphorescence (rtp) in rigid media such as poly(lactic acid) (tg 60 c). here, the phosphorescence maxima vary little (538568 nm) for dyes in this series and for different molecular weights (i.e., dye loadings) of a given dye. for example, the rtp for bf2nbmpla polymers 9a c is 555 nm, and for its brominated derivatives bf2n(br)bmpla 10a d the phosphorescence maxima slightly red - shifted to 565 nm. for the bf2bnmpla polymers 11a c, the rtp is 545 nm, and the br derivatives bf2b(br)mpla, 12a c show slightly blue - shifted rtp at 538 nm (figure 7). normalized delayed emission spectra (i.e., phosphorescence + delayed fluorescence) for polymer films 912 at room temperature under nitrogen (ex = 369 nm). the polymers without a bromide heavy atom usually have longer triplet state lifetimes than their heavy atom derivatives. heavy atoms increase intersystem crossing (isc), decrease quantum yields, and also shorten singlet and triplet state lifetimes. for example, the phosphorescence lifetime p for bf2nbmpla, 9b (7.7 kda), is 103 ms, and p for the corresponding brominated derivative, bf2n(br)bmpla, 10a (6.8 kda), is 11 ms. when the heavy atom is present on the weaker phenyl donor instead of the naphthyl ring, the effect is not so pronounced. 12a (5.6 kda) show comparable phosphorescence lifetimes, p of 20 and 26 ms, respectively. this provides further evidence that it is the stronger arene donor that dominates emission properties in these boron -diketonate systems. polymer molecular weight has a significant influence on the fluorescence wavelength. because the phosphorescence energy remains relatively constant throughout the series, the singlet previously for bf2dbm(i)pla we showed that phosphorescence intensity increases with heavy atom substitution and for lower molecular weights. nearly full range fluorescence / phosphorescence (f / p) intensity tuning was possible ; namely, for high molecular weight polymers, fluorescence was strong and phosphorescence was weak and for low molecular weight polymers, the opposite was true. in this study, we explore how fluorescence and phosphorescence peak separations and f / p intensity ratios vary for the naphthyl dye series. this is important for ratiometric oxygen sensing, where the oxygen invariant fluorescence signal serves as the standard and oxygen sensitive phosphorescence serves as the sensor. a comparison of total emission spectra under air (fluorescence) with emission under nitrogen (fluorescence and phosphorescence) reveals a red shoulder for 9 and slight peak broadening for 11 and 12 under nitrogen (figure 8). this contrasts with bf2n(br)bmpla 10, with a distinct fluorescence peak at f 490 and a more intense phosphorescence peak at 565 nm (figure 9). total emission spectra also reveal a much stronger heavy atom effect when the bromide is present on the major donor (i.e., naphthalene ring). for 11 and 12, phosphorescence and fluorescence emission maxima are comparable and emission bands effectively overlap for the entire molecular weight range investigated. as expected, for 11 and 12, the overall intensity at the emission band maximum increases under nitrogen (fluorescence + phosphorescence) versus air (fluorescence ; phosphorescence is quenched). though not useful for ratiometric oxygen sensing, materials with small singlet triplet energy gaps are of interest for high efficiency oled materials. for polymer 9, in contrast, distinct fluorescence and phosphorescence bands are observed for the high molecular weight polymer 9c with maximal peak separation. however, at this lower dye loading the phosphorescence is weak relative to fluorescence, corresponding to a smaller dynamic range for oxygen sensing. total emission spectra for polymers 912 under air and under a nitrogen atmosphere. fluorescence and phosphorescence peaks are well separated, and the phosphorescence intensity is strong for all samples 10a d (mn = 726 kda) (figure 9). even the sample with the lowest dye loading has strong phosphorescence intensity and could be useful for sensing, minimizing the valuable dye reagent and possible toxicity in a biological environment. what is more, the fluorescence and phosphorescence peaks are well aligned with the blue and green channels of rgb ccd cameras, allowing for ratiometric sensing with a simple hand - held imaging modality. (a) total emission spectra showing relative fluorescence and phosphorescence intensities for films of bf2n(br)bmpla 10a d of different molecular weights under n2. (b) images showing emission (excitation by uv lamp) : top, under ambient conditions ; bottom, under n2. in summary, naphthyl - substituted bf2bdks with and without bromide heavy atoms were prepared for use as initiators to generate polymers with different molecular weights. compared to previous dbm systems, the naphthyl materials displayed red - shifted absorbance, fluorescence, and phosphorescence. even when the general structure and the conjugation length of the dye are the same, the polymer attachment site whether on the naphthyl or phenyl ring plays an important role in electron density delocalization and optical properties. computational studies and homo and lumo analysis for the dye initiators 5 (och2ch2oh attached to phenyl ring) and 7 (och2ch2oh attached to the naphthyl ring) revealed that both have ict character. nevertheless, the experimentally stokes shift for 5 is small and for 7 it is large in solution. in the solid state, fluorescence is sensitive to the position of polymer attachment whereas phosphorescence remains relatively constant. consequently, fluorescence and phosphorescence peaks are well separated for polymers with blue - shifted fluorescence (e.g., 9) but are poorly separated for those with the most red - shifted fluorescence (11). aside from altering the dye molecular structure, it is also possible to adjust fluorescence energies and emission lifetimes via polymer molecular weight. increasing the molecular weight decreases dye dye interactions and results in blue - shifted fluorescence, decreased fluorescence lifetimes, increased phosphorescence lifetimes, and a larger singlet to triplet energy gap. achieving fluorescence and phosphorescence peak separation in these ways is important for ratiometric sensing. heavy atom substitution and placement also play an important role in optical properties. halide substitution shifts the homo from ict to character (e.g., 5 vs 6), as supported by computational studies and radiative lifetimes. fluorescence lifetimes and quantum yields decrease significantly upon bromide substitution on the major donor, namely the naphthyl ring (6), whereas the heavy atom effect is considerably weaker for bromide substitution on the minor arene donor (e.g., phenyl ring) (8). dyes without heavy atoms such as bf2nbmpla have longer phosphorescence lifetimes and thus are more sensitive to oxygen. furthermore, it is possible to fine - tune the lifetime and thus oxygen sensitivity with polymer molecular weight (i.e., dye loading). dyes such as bf2bnmpla and bf2b(br)nmpla with very small singlet triplet energy gaps, indistinguishable fluorescence and phosphorescence signals, could be of interest for oled materials. finally, bf2n(br)bmpla, with red - shifted emission, good fluorescence and phosphorescence peak separation, strong phosphorescence versus fluorescence intensity, and emission wavelengths that are well aligned with the blue and green channels of a ccd camera make this material an excellent candidate for ratiometric oxygen imaging. | luminescent materials are important for imaging and sensing. aromatic difluoroboron -diketonate complexes (bf2bdks) are classic fluorescent molecules that have been explored as photochemical reagents, two - photon dyes, and oxygen sensors. a series of bf2bdks with naphthyl and phenyl groups was synthesized, and photophysical properties were investigated in both methylene chloride and poly(lactic acid) (pla). polymer molecular weight and dye attachment site along with bromide heavy atom placement were varied to tune optical properties of dye pla materials. systems without heavy atoms have long phosphorescence lifetimes, which is useful for lifetime - based oxygen sensing. bromine substitution on the naphthyl ring resulted in intense, clearly distinguishable fluorescence and phosphorescence peaks important for ratiometric oxygen sensing and imaging. |
hip or knee dislocations are usually treated as a surgical emergency, but ipsilateral hip and knee dislocation should be considered a dual emergency that must be addressed immediately and reduced at the earliest. we present here the sequence of events and the final functional outcome of one such rare injury manages by us. he presented to the emergency department in 4 h injury time with painful deformities of the right hip and knee, along with type i open wound right leg with abnormal mobility suggestive of fracture in the ipsilateral leg. simultaneous ipsilateral hip and knee fracture - dislocation with open tibial fracture is a rare injury that should be approached as limb - threatening injury and dual orthopedic emergency. we report this case for its rarity and to document that good results can be achieved with early appropriate treatment. the dislocation of hip or knee is usually treated as a surgical emergency, but ipsilateral hip and knee dislocation should be considered as dual emergency that must be addressed immediately and reduced at the earliest. when it presents along with neurovascular compromise, it threatens the limb survival and the outcome may be poor. we report a case who presented to us with an ipsilateral hip and knee dislocation with type i open fracture distal fourth both bones of the same leg and absent pulse with common peroneal nerve palsy. we present here the sequence of events and the final functional outcome of this rare injury. a 22-year - old male, driver of the car was involved in a road traffic accident when his car hit against a bridge with his ipsilateral hip and knee in flexion. he presented to the emergency department in 4 h injury time with painful deformities of the right hip and knee, along with type i open wound right leg with abnormal mobility suggestive of fracture in the ipsilateral leg. on examination, he was drowsy and disoriented with a glasgow coma scale 8/15 and found to be hemodynamically unstable. physical examination of the extremities revealed a flexed and adducted right hip with the right knee flexed to 30 and with posterior dislocation (fig. however, the doppler showed weak signals over posterior tibial and dorsalis pedis artery, and the toes were found to be warm with delayed capillary filling. radiographs showed a posterior dislocation of the right hip and posterior dislocation of right knee with comminuted fracture right distal tibia (fig. the firstly, an ankle spanning exfix was applied to address the distal tibial fracture, and the knee dislocation was reduced by gentle traction given to the leg. further traction on the right hip with the hip in 90 flexion with an assistant stabilizing the pelvis reduced the right hip dislocation, which was found to be stable after reduction. then, ankle spanning external fixator extended to span the knee. immediately following the procedure, distal pulses were clinically not palpable but relatively good flow was noted in the doppler both in the posterior tibial and dorsalis pedis artery. the patient was on continued ventilator support for 48 h in intensive care unit and serial monitoring of the right lower limb vascularity was done using doppler. post reduction ct of the pelvis showed only a minor posterior wall fracture with congruently reduced hip joint (fig. distal pulses were felt clinically from 4 day following which locking compression plate fixation of distal tibia was done. postreduction computed tomography pelvis shows minor posterior wall fracture with congruent hip. at 6 weeks, external fixator was removed and bone grafting was done for the distal tibial fracture and the right knee gently manipulated. the distal tibial fracture healed in 4 months with good recovery of common peroneal nerve. magnetic resonance imaging (mri) of right knee showed posterior cruciate ligament (pcl) avulsion fracture and lateral collateral ligament avulsion fracture (fig. 4). it was planned arthroscopic evaluation which showed a torn pcl at tibial attachment and torn anterior cruciate ligament (acl) at anterolateral bundle but the continuity maintained with posterolateral bundle. arthroscopic pcl reconstruction using bio screws and open posterolateral corner repair using hamstring graft and endobutton was done. post - operative rehabilitation included the protocol for multi - ligament instability. at 2 years follow - up, he had full range of movements at the right hip and knee. there was complete recovery of the common peroneal nerve (fig. 5, 6). magnetic resonance imaging shows posterior cruciate ligament avulsion fracture at tibial attachment, posterolateral corner injury, and lateral collateral avulsion fracture. - ray pelvis shows viable femoral head, and x - ray of knee and leg shows stable knee and healed tibial fracture. good range of movements at right hip and knee. the patients presenting with hip or knee dislocation are usually treated as true orthopedic emergencies, as they usually occur following very high energy violence. when hip and knee dislocation presents simultaneously, it should be approached as dual emergency as other associated systemic injuries may be present. the general physical examination with appropriate x - rays of the injured part should be performed on the arrival to the emergency room. the neurovascular status of the injured lower limb should be documented and it should be serially monitored. hip dislocations in these injuries occur following axial forces acting on the flexed hip and are often associated with acetabular fractures, particularly posterior wall. hip dislocations should be reduced as early as possible to decrease the incidence of avascular necrosis of the femoral head, secondary arthritis of hip and nerve injury. the extent of acetabular involvement and the stability of hip following reduction determines the management. when it involves > 65% of the posterior wall reconstruction of the acetabular wall is essential for the stable hip. post reduction ct scan is sensitive in planning the post reduction management. in our case, post reduction ct showed a posterior wall rim fracture involving < 10% with congruent containment of hip. but in some cases of irreducible or unstable hip following closed reduction may require open reduction [1, 2, 3, 4 ]. some authors have used schanz screws in the proximal femur in aid reduction of hip to minimize further injury to neurovascular injury at knee [1, 5 ]. a knee dislocation can be accompanied by popliteal artery injury. of these three studies had no surgical requirement for patients with normal pulses [7, 8, 9 ]. the investigation modalities have been followed with different opinion are ankle - brachial index, angiography, color duplex scan, ct angiography, and recently mri angiography. the most appropriate vascular evaluation for a patient with a knee dislocation without signs of ischemia and palpable or weak pulses continues to be controversial. in our case, we used serial doppler along with pulse oximeter waveform for monitoring and the doppler signals were compared to the uninjured side. mri provides critical information regarding ligament injuries, meniscal injuries, chondral injuries, and fractures to guide treatment, particularly after an acute knee dislocation. in patients who present 6 weeks or later, mri may not provide as clear of a picture of the injury pattern. therefore, in chronic injuries, it is important to rely on the clinical examination findings in addition to the mri findings to determine the pattern of injury. approximately, 50% of knee dislocations are associated with tears of the acl, whereas 75% are associated with tears of the pcl. many authors have debated about the timing of intervention, the type of reconstruction and operative versus nonoperative treatment. however, recent studies have shown that improved functional and clinical outcomes in operative treatment compared with nonoperative treatment. immediate surgical intervention is absolutely indicated for irreducible knee by closed reduction or an unstable knee, which requires a vascular repair and open knee dislocation. in these instances, avulsion fractures or cruciate and collaterals can be fixed with nonabsorbable sutures. if there are no injuries that need to be addressed acutely, the timing of surgery is largely dependent on the patient general condition, the condition of the knee and surgeon preference. analyzed five studies that compared early versus delayed surgery. among them, two studies showed no statistical difference in outcome scores and found a statistical difference in higher sports activities in another three studies. in our case, because of head injury and open tibial fracture on the same leg, it was planned for late reconstruction. however, the functional outcome was excellent at final follow - up. neurological involvement in hip dislocations occurs in approximately 10% and partial recovery can be expected in 60 - 70% cases. the peroneal branch is most commonly involved. in knee dislocations, nearly 20 - 40% is complicated by common peroneal nerve palsy and prognosis is fairly poor as recovery is incomplete in 50% of the patients. in our case, common peroneal nerve was injured at the level of the knee and full recovery was observed in 6 months. simultaneous ipsilateral hip and knee fracture - dislocation with open tibial fracture is a rare injury that should be approached as limb - threatening injury and dual orthopedic emergency. we report this case for its rarity and to document that good results can be achieved with early appropriate treatment. hip and knee dislocations are emergencies which should be treated immediately. in this case report, we have discussed the technique for reduction of ipsilateral hip and knee dislocations with ipsilateral open both bones fracture leg. when you are unable to feel distal pulses clinically, we can use doppler for vascularity monitoring. ligament injury of the knee also should be addressed, and acl can also be intact in knee dislocations. | introduction : hip or knee dislocations are usually treated as a surgical emergency, but ipsilateral hip and knee dislocation should be considered a dual emergency that must be addressed immediately and reduced at the earliest. we present here the sequence of events and the final functional outcome of one such rare injury manages by us.case report : a 22-year - old male was involved in a road traffic accident. he presented to the emergency department in 4 h injury time with painful deformities of the right hip and knee, along with type i open wound right leg with abnormal mobility suggestive of fracture in the ipsilateral leg.conclusion:simultaneous ipsilateral hip and knee fracture - dislocation with open tibial fracture is a rare injury that should be approached as limb - threatening injury and dual orthopedic emergency. we report this case for its rarity and to document that good results can be achieved with early appropriate treatment. |
acute kidney injury (aki) is a common complication after cardiac surgery, with reported incidences between 8.9% and 39% as well as mortality of 3.8% to 54.4%, and even slight renal function changes were reported to affect short and longterm outcome after cardiac surgery.1, 2, 3 because early prediction in those patients at high risk of developing cardiac surgery associated acute kidney injury (csaaki) may enable prevention of complications, in the last 2 decades various predictive models have been developed to forecast csaaki or renal replacement therapy (rrt)aki after cardiac surgery,4, 5, 6, 7, 8, 9 in which adequate predictive power was validated among whites.10, 11 however, by now, the predictive value for estimating aki, rrtaki, or death incidence of 5 established models, including the method published by palomba,7 the cleveland clinic score,8 the scoring system published by mehta,6 the simplified renal index score,9 and the euro score12 in other racial cohorts after cardiac surgery is uncertain. (1) there was no consensus in the definition of aki when those models were developed. in the akics score, aki was defined as an increase of serum creatine (cr) levels above 2.0 mg / dl in patients with baseline serum cr lower than 1.5 mg / dl. in patients with baseline serum cr between 1.5 and 3.0 mg / dl, aki was defined as a serum cr increase of 50% over the baseline value. in the new 2012 kidney disease : improving global outcomes (kdigo) aki definition,13 urine output, as another indicator besides serum creatine, was not utilized to define aki in palomba 's study, and aki may be missed. (2) with the recognition of intraoperative and postoperative risk factors, especially the modifiable factors, contributing to csaaki, risk scores6, 8, 9 including only preoperative risk factors can hardly meet the predictive requirement. (3) in some developing countries such as china, the proportions of valve surgery, comorbidities, and population race14 are quite different from those of the existing model derivation cohorts. with the development of medical technology, cardiac surgery in developing countries meanwhile complications of surgery and economic burdens are also increasing due to restriction of medical technology and management. we aimed to develop a dynamic predictive model for csaaki based on the recent kdigo aki definition, which was devised to predict the incidence of csaaki from preoperative to early postoperative periods and to validate its predictive capacity for improved clinical application. in our prospective study we included 7233 patients who were divided into a derivation cohort (6081 patients between january 2010 and october 2012) and a validation cohort (1152 patients between november 2012 and april 2013) ; all were admitted to the zhongshan hospital, shanghai medical college, fudan university. the study was approved by the ethical committee of the zhongshan hospital, and all participants provided written informed consent. inclusion criteria were adult patients who underwent coronary artery bypass grafting (cabg), offpump coronary artery bypass (opcab), valve surgery, or valve combined with cabg surgery. excluded were patients with previous heart transplantation, preoperative mechanical ventilation or tracheotomy, preoperative defibrillator or ventricular assist devices, preoperative rrt, preoperative liver dysfunction, or sepsis. the clinical characteristics of both derivation and validation cohorts have been collected and were extracted from the database of zhongshan hospital cardiac surgery. all data were checked twice by medical personnel (postgraduate and resident doctor) before being admitted to the database. we collected data including sex, age, weight, length of stay, length of icu stay, and outcome ; preoperative data including diagnosis, comorbidities including hypertension, diabetes mellitus, atrial fibrillation, endocarditis, coronary artery disease, cerebral vascular disease, anemia, chronic obstructive pulmonary disease, kidney disease without renal replacement therapy ; and laboratory reports including estimated glomerular filtration rate (egfr), which were calculated with ckdepi formulas,15 in addition to new york heart association (nyha) functional classification, left ventricular ejection fraction (lvef), preoperative congestive heart failure, preoperative intraaortic balloon pump (iabp), previous cardiac surgery history, recent contrast media (cm) exposure, and renal toxic drug exposure. intraoperative data included emergency surgery, procedure type, cardiopulmonary bypass (cpb) application and time, transfusion, and fluid balance ; postoperative data comprised low cardiac output syndrome (lcos), central venous pressure, medicine application, mechanical ventilation, rrt, and renal recovery. aki was defined according to the kdigo guideline13 as any of the following : increase in scr by 0.3 mg / dl (26.5 mol / l) within 48 hours ; or increase in scr to 1.5 times baseline that is known or presumed to have occurred within the prior 7 days or urine volume 60, > 30 to 60, 30 ml / min), and lvef (> 50, 3650, 35). there were statistically significant differences between the csaaki patients and the unaffected group regarding sex, age, preoperative kidney function, some comorbidities such as hypertension and copd, preoperative heart function, cm exposure, procedure type, perioperative erythrocyte transfusion, postoperative central venous pressure, and shortterm mortality (table 2). the multivariate logistic regression analysis was conducted at 3 time points : preoperative, icu admittance, and 24 hours after icu admittance ; the statistically significant risk factors identified by the analysis are shown in table 3, which shows that male sex, age, kidney disease without rrt, nyha score > 2, previous cardiac surgery, valve and cabg procedure, application of cpb, erythrocyte transfusion, and postoperative lcos at the indicated time points were risk factors for csaaki development (table 3). characteristics of the patients in the derivation cohort aki indicates acute kidney injury ; cabg, coronary artery bypass grafting ; cm, contrast media ; copd, chronic obstructive pulmonary disease ; cpb, cardiopulmonary bypass ; cvd, cerebral vascular disease ; cvp, central venous pressure by icu admittance ; dm, diabetes mellitus ; egfr, estimated glomerular filtration rate, as was calculated based on the ckdepi formulas ; lcos, low cardiac output syndrome ; lvef, left ventricular ejection fraction ; nyha, new york heart association ; opcab, offpump coronary artery bypass. multivariate logistic regression analysis of factors for csaaki cabg indicates coronary artery bypass grafting ; csaaki, cardiac surgery associated acute kidney injury ; lcos, low cardiac output syndrome ; nyha, new york heart association ; rrt, renal replacement therapy. only the statistically significant risk factors in the logistic regression the variable age was categorized and (age 40) was set as the reference level. next we developed a point system for predicting csaaki occurrence with the regression coefficient data from the multivariable regression analyses of the derivative cohort patients (table 4). depending on the scores, the risks of csaaki development were categorized into low, medium, and high in accordance with the practically observed incidence of csaaki (table 5). the preoperative predictive risks of csaaki occurrence were low with 0 to 1 patient (9.5%), medium with 2 to 3 patients (22.1%), and high with 4 patients (37.3%). the predictive risks of csaaki development at the day of icu admission were low with 0 to 4 patients (11.5%), medium with 5 to 9 patients (42.6%), and high with 10 patients (83.3%). the postoperative predictive risks for developing csaaki were low with 0 to 4 patients (11.6%), medium with 5 to 9 patients (44.2%), and high with 10 patients (88.8%). the efficiency of the scores for predicting medium and high risk for csaaki improved with the procedure progress and additional risk factors being added. we further analyzed the score models at the 3 time points by auroc determinations and derived 0.75 (preoperative), 0.81 (icu admittance), and 0.82 (24 hours after icu admittance) area under curve (auc) values. the calibrations of them by hosmerlemeshow statistics resulted in 0.569 (preoperative), 0.684 (icu admittance), 0.829 (24 hours after icu admittance). factor scoring for predicting of csaaki development cabg indicates coronary artery bypass grafting ; cpb, cardiopulmonary bypass ; csaaki, cardiac surgery associated acute kidney injury ; icu, intensive care unit ; lcos, low cardiac output syndrome ; nyha, new york heart association. risk stratification of csaaki development at indicated time points the distinction of low / medium / high was based on the incidence of csaaki in each sector ; eg, the incidence of aki in the sector of 10 pts in the 24 hours after icu admittance column was 88.8%, which meant in the patients who scored 10 points at the time of 24 hours after admission, the incidence of csaaki was 88.8%. the clinical characteristics of the 1152 patients in the validation cohort are shown in table 1. application of the scoring system led to auc values of 0.74 (preoperative), 0.75 (at icu admission), and 0.82 (postoperative) (figure 1). there was no statistically significant difference between the predicted and observed csaaki incidences in the validation cohort (preoperative =6.346, p=0.175 ; at the day of icu admittance =4.65, p=0.703 ; and postoperative =3.669, p=0.886). roc curves for predicting csaaki in the validation cohort with point scores from table 5. application of the scoring system led to auc values of 0.74 (preoperative), 0.75 (at icu admission), and 0.82 (postoperative). score calibrations for predicting csaaki (a) preoperative, (b) at the day of icu admittance, (c) postoperative. there was no statistically significant difference between the csaaki incidences predicted by point scores and those observed in the validation cohort (preoperative =6.346, p=0.175 ; at the day of icu admittance =4.65, p=0.703 ; and postoperative =3.669, p=0.886). we categorized the following variables for subgroup observation : age (40, 4160, 6180, 81), estimated gfr (> 60, > 30 to 60, 30 ml / min), and lvef (> 50, 3650, 35). there were statistically significant differences between the csaaki patients and the unaffected group regarding sex, age, preoperative kidney function, some comorbidities such as hypertension and copd, preoperative heart function, cm exposure, procedure type, perioperative erythrocyte transfusion, postoperative central venous pressure, and shortterm mortality (table 2). the multivariate logistic regression analysis was conducted at 3 time points : preoperative, icu admittance, and 24 hours after icu admittance ; the statistically significant risk factors identified by the analysis are shown in table 3, which shows that male sex, age, kidney disease without rrt, nyha score > 2, previous cardiac surgery, valve and cabg procedure, application of cpb, erythrocyte transfusion, and postoperative lcos at the indicated time points were risk factors for csaaki development (table 3). characteristics of the patients in the derivation cohort aki indicates acute kidney injury ; cabg, coronary artery bypass grafting ; cm, contrast media ; copd, chronic obstructive pulmonary disease ; cpb, cardiopulmonary bypass ; cvd, cerebral vascular disease ; cvp, central venous pressure by icu admittance ; dm, diabetes mellitus ; egfr, estimated glomerular filtration rate, as was calculated based on the ckdepi formulas ; lcos, low cardiac output syndrome ; lvef, left ventricular ejection fraction ; nyha, new york heart association ; opcab, offpump coronary artery bypass. multivariate logistic regression analysis of factors for csaaki cabg indicates coronary artery bypass grafting ; csaaki, cardiac surgery associated acute kidney injury ; lcos, low cardiac output syndrome ; nyha, new york heart association ; rrt, renal replacement therapy. only the statistically significant risk factors in the logistic regression the variable age was categorized and (age 40) was set as the reference level. next we developed a point system for predicting csaaki occurrence with the regression coefficient data from the multivariable regression analyses of the derivative cohort patients (table 4). depending on the scores, the risks of csaaki development were categorized into low, medium, and high in accordance with the practically observed incidence of csaaki (table 5). the preoperative predictive risks of csaaki occurrence were low with 0 to 1 patient (9.5%), medium with 2 to 3 patients (22.1%), and high with 4 patients (37.3%). the predictive risks of csaaki development at the day of icu admission were low with 0 to 4 patients (11.5%), medium with 5 to 9 patients (42.6%), and high with 10 patients (83.3%). the postoperative predictive risks for developing csaaki were low with 0 to 4 patients (11.6%), medium with 5 to 9 patients (44.2%), and high with 10 patients (88.8%). the efficiency of the scores for predicting medium and high risk for csaaki improved with the procedure progress and additional risk factors being added. we further analyzed the score models at the 3 time points by auroc determinations and derived 0.75 (preoperative), 0.81 (icu admittance), and 0.82 (24 hours after icu admittance) area under curve (auc) values. the calibrations of them by hosmerlemeshow statistics resulted in 0.569 (preoperative), 0.684 (icu admittance), 0.829 (24 hours after icu admittance). factor scoring for predicting of csaaki development cabg indicates coronary artery bypass grafting ; cpb, cardiopulmonary bypass ; csaaki, cardiac surgery associated acute kidney injury ; icu, intensive care unit ; lcos, low cardiac output syndrome ; nyha, new york heart association. risk stratification of csaaki development at indicated time points the distinction of low / medium / high was based on the incidence of csaaki in each sector ; eg, the incidence of aki in the sector of 10 pts in the 24 hours after icu admittance column was 88.8%, which meant in the patients who scored 10 points at the time of 24 hours after admission, the incidence of csaaki was 88.8%. the clinical characteristics of the 1152 patients in the validation cohort are shown in table 1. application of the scoring system led to auc values of 0.74 (preoperative), 0.75 (at icu admission), and 0.82 (postoperative) (figure 1). there was no statistically significant difference between the predicted and observed csaaki incidences in the validation cohort (preoperative =6.346, p=0.175 ; at the day of icu admittance =4.65, p=0.703 ; and postoperative =3.669, p=0.886). roc curves for predicting csaaki in the validation cohort with point scores from table 5. application of the scoring system led to auc values of 0.74 (preoperative), 0.75 (at icu admission), and 0.82 (postoperative). score calibrations for predicting csaaki (a) preoperative, (b) at the day of icu admittance, (c) postoperative. there was no statistically significant difference between the csaaki incidences predicted by point scores and those observed in the validation cohort (preoperative =6.346, p=0.175 ; at the day of icu admittance =4.65, p=0.703 ; and postoperative =3.669, p=0.886). in our study we utilized the kdigo definition of aki to establish the dynamic risk score to predict csaaki. with the kdigo guideline, which is accepted by the global nephrology community, some authors carried out risk factor analysis for csaaki16, 17 with the new aki definition. to the best of our knowledge, there were no dynamically designed risk scores for predicting csaaki from preoperative to early postoperative periods. not only preop risk factors but also the intraop and postop risk factors were enrolled in the analysis for better predictive efficiency. the result of our study showed that the predictive value of the dynamic risk scores was close to that of the previous scores and improved as the intraop (auc=0.75) and postop (auc=0.82) risk factors were admitted into the multivariate regression analysis and the subsequent scores. these risk scores can help clinicians to evaluate the risk of csaaki from preoperative to early postoperative periods. in this study all the major risk factors of csaaki were collected to derive the predictive score system, including the intraop and postop risk factors. male sex and age were risk factors for csaaki in all 3 time points, and with increasing age, the incidence of csaaki also increased. ageassociated aki was reported to occur more frequently in the elderly due to structural changes such as vascular sclerosis, increased percentages of sclerosing glomeruli, and other degenerative changes that occur with increasing age,18, 19 and our finding is in agreement with other publications from fang,20, 21 who noted that the incidence of csaaki in the older patients was higher than that in younger patients. in our cohort we conducted a subgroup analysis according to the categorized age and found significant differences in csaaki incidence between groups (figure 3). the risk factor of male sex is in disagreement with other publications in which female sex was a risk factor,22, 23 which needs further analysis. the csaaki incidence was statistically significantly different within the subgroups, and increased with age. preoperative renal dysfunction was related to csaaki in several other studies.4, 8, 23 however, we excluded preoperative rrt patients and also drew the same conclusion. in table 2, the egfr was statistically significantly different between aki and nonaki cohorts (p 2, previous cardiac surgery, and postoperative lcos were also found to be risk factors for csaaki in our study. among the above factors, preoperative nyha scores > 2 and previous cardiac surgery are not modifiable. the lcos may result from delayed recovery of postop cardiac function and cause pulmonary edema and pulmonary infection, which in turn aggravate lcos in a vicious circle.30 for those csaaki patients who were unable to eliminate excess fluid and adverse inflammatory factors, either lcos or pulmonary infection would result in a worse prognosis. some studies31 were carried out to break this vicious circle by means of perioperative goaldirected hemodynamic resuscitation therapy, which was considered to be useful in reducing adverse complications including lcos as well as 30day mortality in highrisk patients undergoing cardiac surgery. the lack of a consensus aki definition has led to inaccuracy in data regarding the actual incidence of this complication, as can be confirmed by the large variation (1% to 30%) in the reported incidence of aki following cardiac surgery.22 by the time of this study, no consensus aki definition was utilized in the risk scores above, and so their worldwide applicability is suspect. the kdigo criterion, published in 2012, was regarded as a complement to previous aki definitions.32, 33 sampaio compared the kdigo aki definition with akin and rifle criteria and validated its superiority, especially for prognoses in unstable hemodynamic cardiac surgery patients.34 therefore, risk scores with the kdigo aki definition were better for predicting csaaki. cardiac surgery in developing countries such as china, india, and brazil has grown at a steady pace for decades, but most centers performing open heart surgery are located in the major cities, which is a common problem for most developing countries. although as the economy has developed, and cardiac surgery has become affordable for more patients, its complications are adding to the social economic burden in developing countries.35, 36 considering the tremendous population in developing countries, this is worthy of concern. the occurrence of valve surgery is becoming higher in developing countries such as china than it was in previous risk stratification development centers, in which cabg is the major procedure (table 6). this change may be due to the lack in early diagnosis and imbalanced distribution of medical resources ; it is also one of the reasons why csaaki incidence was high in our cohort. patients who undergo valve surgery typically demonstrate low stroke volume related to regurgitation, which increases the vulnerability of the kidney to injury during cardiac surgery. the comorbidities in developing countries such as china are also different from those in the western population. in our derivation cohort, the ratios of hypertension and diabetes mellitus are also remarkably lower than those in the previous developmental populations (table 6). comparison of derivation cohort and other risk scores in comorbidities and procedures cabg indicates coronary artery bypass grafting ; copd, chronic obstructive pulmonary disease ; cvd, cerebral vascular disease ; dm, diabetes mellitus ; rrt, renal replacement therapy ; sri, simplified renal index. therefore, the difference in ethnicity, comorbidities, and underlying disease may affect the efficacy of the existing models predicting csaaki in patients of developing countries. as in thakar 's and palomba 's studies,7, 8 the present risk scores are validated in a sample extracted from the original population with good discrimination and calibration. for simpler clinical application, the maximum predictive risk of 88.8%, which is higher than those in other studies, may be attributed to the kdigo aki definition, which was verified with better efficacy, and the inclusion of intraop and postop predictors, with which the course of disease can be well simulated. the limitation of this study was that the data were derived from a singlecenter chinese database, implying differences in procedures and comorbidities with other existing risk scores, so their predictive efficiency should be prospectively validated in more centers and on a larger scale. we carried out this study prospectively and developed dynamic predictive scores for csaaki in cardiac surgical patients with the kdigo definition for aki. this may improve the early recognition and intervention against csaaki, fix those modifiable factors, reduce the incidence of csaaki, and improve the renal and overall prognosis. embedding these scores into the electronic medical record (emr) system the study was funded by natural science foundation of china (no. 81430015). | backgroundcardiac surgery associated acute kidney injury (csaaki) is a common complication with a poor prognosis. in order to identify modifiable perioperative risk factors for aki, which existing risk scores are insufficient to predict, a dynamic clinical risk score to allow clinicians to estimate the risk of csaaki from preoperative to early postoperative periods is needed.methods and resultsa total of 7233 cardiac surgery patients in our institution from january 2010 to april 2013 were enrolled prospectively and distributed into 2 cohorts. among the derivation cohort, logistic regression was used to analyze csaaki risk factors preoperatively, on the day of icu admittance and 24 hours after icu admittance. sex, age, valve surgery combined with coronary artery bypass grafting, preoperative nyha score > 2, previous cardiac surgery, preoperative kidney (without renal replacement therapy) disease, intraoperative cardiopulmonary bypass application, intraoperative erythrocyte transfusions, and postoperative low cardiac output syndrome were identified to be associated with csaaki. among the other 1152 patients who served as a validation cohort, the point scoring of risk factor combinations led to area under receiver operator characteristics curves (auroc) values for csaaki prediction of 0.74 (preoperative), 0.75 (on the day of icu admission), and 0.82 (postoperative), and hosmer lemeshow goodnessoffit tests revealed a good agreement of expected and observed csaaki rates.conclusionsthe first dynamic predictive score system, with kidney disease : improving global outcomes (kdigo) aki definition, was developed and predictive efficiency for csaaki was validated in cardiac surgery patients. |
between january 2006 and december 2009, a total of 50 consecutive patients fulfilling the inclusion criteria were included in a randomized controlled trial (fig. 1). fully edentulous patients, referred to the department of oral and maxillofacial surgery (university medical center groningen, the netherlands), suffering from lack of retention and stability of the upper denture and lower denture, were considered for inclusion if they fulfilled the following criteria : flow diagram of the study. at least 18 years of age;capable of understanding and giving informed consent;at least 1 year edentulous in the maxilla and mandible;bone dimensions in the region between the bicuspids in the anterior area of the maxilla had to be at least 12 mm in height and at least 5 mm in width to reach initial stability of the implant;sufficient interocclusal space for a barsupported attachment system in this region. at least 18 years of age ; capable of understanding and giving informed consent ; at least 1 year edentulous in the maxilla and mandible ; bone dimensions in the region between the bicuspids in the anterior area of the maxilla had to be at least 12 mm in height and at least 5 mm in width to reach initial stability of the implant ; sufficient interocclusal space for a barsupported attachment system in this region. excluded were patients with american society of anesthesiologists score (asa score) iii (smeets. 1998), who were smoking, with a history of radiotherapy in the head and neck region or a history of preprosthetic surgery or previous implant placement. the patients were informed about the study on overdenture treatment with insertion of four or six dental implants in the maxilla and about the extra efforts associated with the study (questionnaires, evaluation visits) before they signed an informed consent. the study was approved by the medical ethical committee of the university medical center groningen (abr nl32503.042.11). rotational panoramic radiographs, lateral cephalograms and posteroanterior oblique radiographs were taken to assess the volume of the maxillary alveolar bone, the dimensions of the maxillary sinus and the anteroposterior relationship of the maxilla to the mandible. in addition, to assess the bone volume of the maxillary processus, a ridgemapping procedure was performed as described by ten bruggenkate. a diagnostic setup of the planned overdenture was made to obtain insight into the available dimensions for the barsupported attachment system and overdenture. the treatment and evaluation procedures have been described in detail with the reporting of 1year results of the study by slot. four or six dental implants with a length of at least 11 mm and a diameter of 4 mm were inserted in the maxillary anterior region (osseospeed 4.0 s dental implants, astra tech ab, mlndal, sweden). the implants were placed at crestal bone level in predefined positions (positions 15, 13, 11, 21, 23, 25 in the six implants group and positions 13, 11, 21, 23 in the four implants group) with the help of a surgical template following a submerged healing protocol. in some cases, the most distal implant position may be 16 or 26 (in the six implants group), but it is always without a large sinus floor elevation. small dehiscences or fenestrations were covered with bone harvested from the maxillary tuberosity and organic bovine bone (biooss ; geistlich pharma ag, wolhusen, switzerland) and subsequently covered with a resorbable membrane (biogide ; geistlich pharma ag, wolhusen, switzerland). if the most distally placed implants (usually in the six implants group) were partially placed in the anterior part of the maxillary sinus, a small sinus floor elevation surgery was performed in that region to prevent a perforation of the sinus membrane by the implant. after a 3month osseointegration period, secondstage surgery was performed and healing abutments (uni healing abutments, astra tech ab) were placed. after the secondstage surgery, prosthetic procedures were initiated. healing abutments were replaced by 20 uni abutments (astra tech ab) and with impression copings and polyether material (impregum f ; 3 m espe, st. paul, minn), a complete arch impression was made. a composite resin record base (lightplast base plates ; dreve dentamid gmbh, unna, germany) with a wax occlusion rim was used to determine the occlusal vertical dimension and to record the maxillomandibular relationship. acrylic resin artificial teeth (ivoclar sr orthotyp dcl and ivoclar vivodent pe, ivoclar vivadent ag, schaan, liechtenstein) were selected and arranged on the record base for a trial arrangement. the final superstructure consisted of a milled titanium eggshaped bar with distal extensions, screwretained to abutments, and an overdenture with builtin cobalt chromium reinforcement structure and gold retentive clips attached to it (slot. the design of the overdentures was with full coverage of the alveolar process, but with limited palatal coverage. the patient was instructed in hygiene procedures associated with the dentures and the bars (fig. 2). fiveyear panoramic radiograph of a patient with four implants connected with a bar in the maxillary anterior region. secondary outcome measures were implant survival, overdenture survival and soft tissue conditions (plaque index, presence of calculus, gingiva index, sulcus bleeding index and pocket probing depth). these parameters were scored at placement of the overdenture, and 1 year and 5 years after loading. patients ' satisfaction was also scored before treatment, and 1 year and 5 years after loading. thereafter, the patients were followed up for routine checkup visits at 2, 3 and 4 years. if plaque and/or calculus were present at an evaluation period, cleaning was performed with additional hygiene reinstructions. standardized intraoral radiographs were taken according to a longcone paralleling technique with an individualized xray holder as described by meijndert. the digital images were analysed using computer software (biomedical engineering, university medical center groningen, the netherlands) to perform linear measurements on digital radiographs. the known implant length was used as a reference to transform the linear measurements into mm. reference line for bone level evaluation was the outer border of the neck of the implant. implant survival was defined as the percentage of implants initially placed that was still present and not mobile at followup. survival of maxillary overdentures was defined as the percentage of overdentures initially placed that was still present at followup. remake or adjustment of the maxillary overdenture was scored any time after placement. for presence of plaque, the presence of calculus (score 1) or the absence of calculus (score 0) was scored. to qualify the degree of periimplant inflammation, probing depth was measured at four sites of each implant (mesial, labial, distal and lingual) using a manual periodontal probe (williams colourcoded probe ; hufriedy, chicago, il, usa). periimplant mucositis and periimplantitis was calculated at patient level. as definition for periimplant mucositis and periimplantitis, the consensus reached at the vi and vii european workshop on periodontology (lindhe & meyle 2008, lang & berglundh 2011) and reconfirmed at the viii european workshop on periodontology (sanz & chapple 2012 has been used, being : periimplant mucositis (radiographic bone loss 0.05, table 2). mean scores of the indices for plaque, calculus, gingiva and bleeding were very low at all evaluation periods and did not differ between the groups. also no timedependent significant changes in probing depth were observed between the groups (p > 0.05, table 3). patientlevel incidence of periimplant mucositis was 41.7% and 45.5%, and of periimplantitis was 8.3% and 4.5% in the four and six implants groups respectively. mean values and standard deviations of marginal bone loss in mm, and frequency distribution of bone loss 1 and 5 years after placement of the overdenture of the four and six implants groups. mean marginal bone loss did not differ significantly between the groups differences between study groups were tested with the independent student 's ttest (p 0.05). after 5 years, patients continued to be very satisfied with their overdentures ; the results are rather similar to the 1year data. mean score of 5 scales concerning the denture complaints (possible range 03), mean scores of chewing ability of soft, tough and hard food (possible range 02) and overall satisfaction score (possible range 110) before, and 1 and 5 years after treatment. no significant differences between the four and six implants group were observed at all evaluation periods differences between study groups were tested with the independent student 's ttest (p < 0.05). the surgical and prosthetic aftercare during 5 years of followup revealed a small number of events, mostly repair of the denture base or teeth. surgical treatment of periimplantitis was not performed during the 5year followup (table 5). at the 5year followup evaluation, a number of patients were identified as having periimplant mucositis (treatment : cleaning and reinstruction) or periimplantitis (treatment : cleaning, reinstruction and openflap surgical treatment). this study revealed that both four and six dental implants placed in the anterior region of the edentulous maxilla, connected with a bar, form a proper base for the support of an overdenture. in none of the parameters studied, significant differences were observed between the four and six implants group. fiveyears ' survival rate of implants was high in both the four and six implants group. these results are on the high end compared to the implant survival reported in the 5year followup case series of jemt. (1997) and bergendal & engquist (1998) who used implants with a machined surface (5year implants survival 72.479%) and similar to those reported by mangano. the latter studies also used implants with a roughened surface, as in this study. although a study comparing various implant designs was not analysed, apparently implants with a roughened surface perform better than implants with a machined surface in the maxilla. the mean marginal bone loss between baseline (placement of the overdenture) and the 5year evaluation was limited in both groups and again comparable to those reported by mangano. the very limited marginal bone loss might be due to the neck design of the implants used (hermann. mean indices for plaque, calculus, gingiva and bleeding were very low at the 5year evaluation and probing depth was not deviating. there might be some extra effort in performing hygiene tasks with six implants, but this does not result in worse results. incidence of periimplantitis after 5 years was 8.3% and 4.5% in the four and six implants groups respectively. because there was no significant change in pocket probing depth at an earlier stage, no extra radiographs were made. nevertheless, bone loss as a sign of periimplantitis could not be reliably excluded in some patients before the 5year evaluation period. in a systematic review of de waal. (2013), it was reported that numbers of prevalence of periimplant mucositis and periimplantitis with standardized threshold levels are missing in studies with fully edentulous patients. in this study, the patientlevel incidence of periimplant mucositis was 41.7% and of periimplantitis was 8.3% in the four implants group. in the six implants group, patientlevel incidence of periimplant mucositis was 45.5% and of periimplantitis was 4.5%. also in fully edentulous patients, but for mandibular overdentures, 51.9% periimplant mucositis and 16.9% periimplantitis was reported after 5 years (meijer. existing studies have demonstrated clearly that edentulism per se is no protection from periimplant disease and that continuous supportive care is essential in maintaining periimplant health. patients ' satisfaction improved significantly when wearing implantsupported maxillary overdentures and results were shown to be favourable at both the 1 and 5year evaluation, again in agreement with data reported by krennmair. (2008) also mentioned in their case series that patients with an overdenture on four or six implants in the anterior maxilla were equally satisfied. in other words, patients ' satisfaction seemed to be irrespective of whether the bar was supported by four or six implants in the anterior maxillary region. the high satisfaction might be due to the fact that the overdenture is supported by a bar, which gives a comparable stability for both treatment options. the idea that six implants gives more stability than four implants, and resulting in more patients ' satisfaction, turned out to be not true. probably because four and six implants are more or less placed in the same area and the fact that the length of the bar is the same in both designs. the high satisfaction with maxillary overdentures, including opinions on speech, resemble the results of heydecke. (2004) in which favourable results of an overdenture were displayed compared with a fixed implant prosthesis. (2011) reported that the majority of complications were related to the weakness of the anchorage components connecting bar and overdenture. this is in contrast with this study in which no clip repairs were recorded. in this study, an overdenture with builtin cobalt chromium reinforcement structure and gold retentive clips attached to it were used, which probably led to a minimum of prosthetic complications (slot. rotational panoramic radiographs, lateral cephalograms and posteroanterior oblique radiographs were made to assess bone volume and possible pathology. nowadays, in terms of radiation protection and diagnostic possibilities, cone beam computer tomography is preferred. in the study, some studies reveal that periimplant hygiene of solitary attachment systems are superior compared with bar attachment systems (zou. longterm studies on comparison of attachment systems would be advantageous. from this 5year followup study, it was concluded that barconnected maxillary overdentures on four or six implants resulted in a comparable treatment outcome with high implant survival, limited loss of periimplant marginal bone and high patient satisfaction. | abstractobjectiveto compare a four and siximplant maxillary overdenture after an observation period of 5 years.material and methodsfifty subjects with functional problems concerning their maxillary denture, who had ample bone volume in the anterior region to place four or six implants, were included and randomly assigned to either group. implant and overdenture survival, clinical performance, marginal bone loss and patient satisfaction were assessed.resultsfortysix patients completed the 5year followup. one implant failed in the six implants group (99.2% survival) and none in the four implants group (100% survival). no overdentures had to be replaced during the observation period and the number of complications was limited. clinical function was good, with no difference in clinical parameters between the groups. mean marginal bone resorption was 0.50 0.37 and 0.52 0.43 mm in the four and six implant group respectively.conclusionin patients with functional complaints of their maxillary denture, barsupported overdentures on four implants in the anterior maxillary region were not inferior to overdentures supported by six implants after 5 years of function. implant survival and patient satisfaction were high, clinical parameters favourable, bone loss and complications to the denture were minor in both groups (clinical trial registration number : ntr2969). |
n - acetylaspartate (naa) is considered to be the marker of neuron dysfunction and/or loss.13 akin to the level of creatine (cr) plus phosphocreatine and some other brain metabolites, the naa level can be determined using in vivo proton magnetic resonance spectroscopy (h mrs). upon the cessation of an adverse impact or treatment, the naa level may prove itself reversible.47 a meta - analysis that compared naa levels in patients with schizophrenia and healthy controls found significant naa reductions in the frontal lobe and hippocampus in patients with schizophrenia. the main results are presented in table 1.831 naa changes occur in the early stage of illness. no further decrease in the naa level was found among chronic patients.9,10 the aim of this study was to investigate the correlates of a clinical therapeutic response by using the parameters measured by h mrs after the administration of atypical antipsychotics. the specific aim was to establish the influence of atypical antipsychotics on the naa / cr ratio in the dorsolateral prefrontal cortex of antipsychotic - nave first - episode patients with schizophrenia, as well as to investigate the relationship between the naa / cr ratio and positive, negative, and cognitive symptoms and functioning of patients. the study enrolled patients diagnosed with schizophrenia and schizophreniform disorder in line with diagnostic and statistical manual of mental disorders, fourth edition criteria.32 throughout the follow - up course, all patients were expected to meet the diagnostic criteria observed with schizophrenia. patients were recruited from the pool of consecutive outpatients seen by the polyclinic neuron (zagreb, croatia) and were all antipsychotic - nave at the time of the first scan. exclusion criteria were : other psychiatric disorders, neurological disorders, a history of significant drug abuse, drug use in the past year, pregnancy and lactation, major somatic conditions, head trauma that rendered the patient unconscious, risk of suicide as estimated by the columbia suicide severity rating scale,33 and the incapacity to give informed consent. no brain atrophy or other brain morphology alteration was seen on any baseline mr imaging. upon being thoroughly informed about the study concept, the patients gave their written informed consent. two mr imaging scans were completed ; the first one took place at baseline and the second one was scheduled for the end of the 1-year follow - up period (1 month). prior to each scan, the patients were administered 510 mg diazepam. throughout the follow - up course, patients were administered antipsychotics in line with the study protocol. at first, quetiapine (400800 mg qd) was introduced. in cases where a treatment response was not seen within 3 months despite dose adjustments (as established using adequate scales), olanzapine (1020 mg qd) was introduced. in cases where the above history repeated itself, olanzapine was first replaced by risperidone (28 mg qd) and then by clozapine (100900 mg qd). two of them were subsequently excluded after they had an overwhelming fear response that prevented the completion of either the first or second scan. one examinee withdrew his informed consent, while one witnessed a major deterioration and had to be hospitalized, rendering him unable to complete the study. following the first scan, one examinee suffered an injury to his eye caused by metal foreign body penetration. ten patients were treated with quetiapine, ten with olanzapine, and four with risperidone, while clozapine was not taken by any of the patients. despite the study s protocol, in the single case where a patient developed metabolic syndrome, ziprasidone had to be introduced. both at baseline and at every 3 months for the remainder of the study, the following tests were administered : positive and negative syndrome scale (panss)34 applicable for psychopathology, clinical global impression of severity (cgi - s)35 suitable for the determination of severity level, tower of london drexel university (tol dx),36 trail making test a (tmt - a)37 and letter number span test (ln)38 suitable for swift neuropsychological assessment, and personal and social performance scale (psp)39 suitable for the determination of functionality level. panss consists of positive, negative, and general psychopathology scales. for tol dx, which is viewed as the executive functions test, the examinee is required to move several differently colored beads across three pegs in line with a predestined pattern, making as few moves as possible. within the frame of tmt - a, which is viewed as the visual attention test, the examinee is asked to connect randomly arranged numbers in their sequential order. ln, which is considered to be a working memory test, requires the examinee to sort relatively short sequences of randomly presented letters and numbers in both sequential and alphabetic order. treatment response was evaluated using cgi - s and cgi of improvement35 every 3 months. angus scale40 for parkinsonism, abnormal involuntary movements scale41 for tardive dyskinesia, and the barnes akathisia rating scale42 for akathisia were used every 3 months. patients were scanned using a 3 t mr device (magnetom trio ; siemens ag, erlangen, germany) equipped with a 12-channel head coil suitable for mrs. standard t1 and t2 sequences completed in the coronal, sagittal, and axial plane and covering the entire brain were acquired for each subject to the effect of spectral localization and exclusion of possible structural brain damage. the spectroscopic volume of interest, having a size of 151515 mm, was selected in the left dorsolateral prefrontal cortex region (figure 1) so as to minimize the amount of cerebrospinal fluid contained in the volume of interest. given the fact that the patients profiles called for shorter scanning times, the left dorsolateral prefrontal cortex, which is the brain area frequently targeted by other authors as well, was focused on. single - voxel spectra were acquired using a point - resolved spectroscopy ; the echo time equaled 135 milliseconds, with a repetition time of 2,000 milliseconds and a spectral width of 10 ppm. the target area was scanned 128 times on average with a scanning time of 4:17 minutes. an appropriate automated procedure was used to optimize field homogeneity, radiofrequency pulse power, and water suppression, as well as to convert the lines into a gaussian shape. a typical h mrs spectrum is shown in figure 1. by virtue of the foregoing, integral values of naa and cr peaks were obtained, while naa / cr ratios were used for further analysis. the smirnov kolmogorov test was used to analyze data distribution. due to the nature of the findings and a relatively small sample size, differences in antipsychotic drug use and quantitative scores (panss, cgi - s, tol dx, ln, tmt - a, and psp scores and naa / cr values) seen between the study groups, were analyzed using the mann the wilcoxon test was used to assess differences between quantitative variables seen at the beginning and at the end of the study (after 12 months). spearman s correlation coefficients (rho) were calculated so as to analyze the correlation between mr findings and test scores. all statistical analyses made use of ibm spss statistics version 19.0.0.1 (ibm corporation, armonk, ny, usa). the study enrolled patients diagnosed with schizophrenia and schizophreniform disorder in line with diagnostic and statistical manual of mental disorders, fourth edition criteria.32 throughout the follow - up course, all patients were expected to meet the diagnostic criteria observed with schizophrenia. patients were recruited from the pool of consecutive outpatients seen by the polyclinic neuron (zagreb, croatia) and were all antipsychotic - nave at the time of the first scan. exclusion criteria were : other psychiatric disorders, neurological disorders, a history of significant drug abuse, drug use in the past year, pregnancy and lactation, major somatic conditions, head trauma that rendered the patient unconscious, risk of suicide as estimated by the columbia suicide severity rating scale,33 and the incapacity to give informed consent. no brain atrophy or other brain morphology alteration was seen on any baseline mr imaging. upon being thoroughly informed about the study concept, the patients gave their written informed consent. two mr imaging scans were completed ; the first one took place at baseline and the second one was scheduled for the end of the 1-year follow - up period (1 month). prior to each scan, the patients were administered 510 mg diazepam. throughout the follow - up course, patients were administered antipsychotics in line with the study protocol. at first, quetiapine (400800 mg qd) was introduced. in cases where a treatment response was not seen within 3 months despite dose adjustments (as established using adequate scales), olanzapine (1020 mg qd) was introduced. in cases where the above history repeated itself, olanzapine was first replaced by risperidone (28 mg qd) and then by clozapine (100900 mg qd). two of them were subsequently excluded after they had an overwhelming fear response that prevented the completion of either the first or second scan. one examinee withdrew his informed consent, while one witnessed a major deterioration and had to be hospitalized, rendering him unable to complete the study. following the first scan, one examinee suffered an injury to his eye caused by metal foreign body penetration. the study was completed by 25 examinees. upon the study s completion, ten patients were treated with quetiapine, ten with olanzapine, and four with risperidone, while clozapine was not taken by any of the patients. despite the study s protocol, in the single case where a patient developed metabolic syndrome, ziprasidone had to be introduced. both at baseline and at every 3 months for the remainder of the study, the following tests were administered : positive and negative syndrome scale (panss)34 applicable for psychopathology, clinical global impression of severity (cgi - s)35 suitable for the determination of severity level, tower of london drexel university (tol dx),36 trail making test a (tmt - a)37 and letter number span test (ln)38 suitable for swift neuropsychological assessment, and personal and social performance scale (psp)39 suitable for the determination of functionality level. panss consists of positive, negative, and general psychopathology scales. for tol dx, which is viewed as the executive functions test, the examinee is required to move several differently colored beads across three pegs in line with a predestined pattern, making as few moves as possible. within the frame of tmt - a, which is viewed as the visual attention test, the examinee is asked to connect randomly arranged numbers in their sequential order. ln, which is considered to be a working memory test, requires the examinee to sort relatively short sequences of randomly presented letters and numbers in both sequential and alphabetic order. treatment response was evaluated using cgi - s and cgi of improvement35 every 3 months. angus scale40 for parkinsonism, abnormal involuntary movements scale41 for tardive dyskinesia, and the barnes akathisia rating scale42 for akathisia were used every 3 months. patients were scanned using a 3 t mr device (magnetom trio ; siemens ag, erlangen, germany) equipped with a 12-channel head coil suitable for mrs. standard t1 and t2 sequences completed in the coronal, sagittal, and axial plane and covering the entire brain were acquired for each subject to the effect of spectral localization and exclusion of possible structural brain damage. the spectroscopic volume of interest, having a size of 151515 mm, was selected in the left dorsolateral prefrontal cortex region (figure 1) so as to minimize the amount of cerebrospinal fluid contained in the volume of interest. given the fact that the patients profiles called for shorter scanning times, the left dorsolateral prefrontal cortex, which is the brain area frequently targeted by other authors as well, was focused on. single - voxel spectra were acquired using a point - resolved spectroscopy ; the echo time equaled 135 milliseconds, with a repetition time of 2,000 milliseconds and a spectral width of 10 ppm. the target area was scanned 128 times on average with a scanning time of 4:17 minutes. an appropriate automated procedure was used to optimize field homogeneity, radiofrequency pulse power, and water suppression, as well as to convert the lines into a gaussian shape. a typical h mrs spectrum is shown in figure 1. by virtue of the foregoing, integral values of naa and cr peaks were obtained, while naa / cr ratios were used for further analysis. the smirnov kolmogorov test was used to analyze data distribution. due to the nature of the findings and a relatively small sample size, nonparametric tests were employed with other analyses. differences in antipsychotic drug use and quantitative scores (panss, cgi - s, tol dx, ln, tmt - a, and psp scores and naa / cr values) seen between the study groups, were analyzed using the mann the wilcoxon test was used to assess differences between quantitative variables seen at the beginning and at the end of the study (after 12 months). spearman s correlation coefficients (rho) were calculated so as to analyze the correlation between mr findings and test scores. all statistical analyses made use of ibm spss statistics version 19.0.0.1 (ibm corporation, armonk, ny, usa). twenty - five patients were monitored for 12 months : 15 (60.0%) had used more than one antipsychotic drug. the majority of patients were men (20 ; 80.0%). the educational background of the study group was as follows : 16 examinees (64.0%) had 12 years of formal education. thirteen patients (52.0%) were unemployed, 17 (68.0%) were single, and 18 (72.0%) declared themselves tobacco smokers. viewed on the whole - group level, no significant naa / cr changes were seen after 12 months of study (p=0.668). the subsequent analysis embraced two distinctive patient groups : one included patients who due to their favorable and swift therapeutic response remained on initial quetiapine therapy throughout the study course, and the other included patients who, within the same timeframe, had to be administered two or more atypical antipsychotics. it is possible that the first group maintained better therapy compliance or social support. throughout the monitoring period, these two groups showed no significant differences in their scores on the following psychiatric tests : panss, cgi - s, tol dx, ln, tmt - a, and psp. the only exception was the naa / cr ratio after 12 months, which was significantly higher in the group that stayed on the same antipsychotic drug throughout the study course (median [iqr ] 1.93 [1.872.27 ]) compared to the drug - changing group (1.70 [1.371.77 ] ; p=0.006). as for the differences between paired measures (baseline versus month 12), the drug - changing group exhibited noteworthy dynamics : total panss score (p=0.001), positive panss score (p=0.001), general panss score (p=0.011), cgi - s score (p=0.018), and naa / cr (p=0.008) decreased, while ln score (p=0.001) and psp score (p=0.001) increased (table 3). in the group that stayed on the same antipsychotic drug throughout the study course, total panss score (p=0.032), positive panss score (p=0.009), negative panss score (p=0.027), and cgi - s score (p=0.025) decreased, while ln score (p=0.005), psp score (p=0.008), and naa / cr (p=0.005) increased (table 4). in the group with more than one antipsychotic drug, significant negative correlations of naa / cr with panss positive and tol dx score were found at the beginning of the study. after 12 months, naa / cr levels were significantly positive correlated with hamilton depression rating scale and ln scores. at the beginning of the study in the group with only one antipsychotic drug, a significant correlation after 12 months, significant and strong negative correlations of naa / cr with cgi - s and tmt - a scores were found (table 5). viewed on the whole - sample level, no significant correlations between naa / cr values and other scores were seen either at baseline or after 12 study months. the same goes for the baseline status of the patients changing their antipsychotic drugs in the further course. after 12 study months, significant correlations between naa / cr and other scores were noted only among drug - switching patients, in whom a positive correlation with ln score was established (rho=0.617 ; p=0.014). this study failed to demonstrate any significant difference in naa / cr throughout the administration of the novel antipsychotic drug. similar results were obtained in several recent studies.10,19 however, an intra - sample comparison of patients who favorably and swiftly responded to initial therapy with patients who needed two or more antipsychotic drugs (in order to attain a satisfactory therapeutic response) pointed towards different outcomes. upon completion of the therapy, the first patient group showed a significant rise in naa / cr, both from baseline and compared to the second patient group s month 12 results. the second patient group not only failed to experience a rise in naa / cr, but also experienced a drop in naa / cr throughout the therapy course, despite the satisfactory end - study stage therapeutic response (figure 2). to the best of the authors knowledge, this is the very first follow - up study carried out in antipsychotic - nave first - episode schizophrenic patients. the baseline scan was performed without any antipsychotic or other treatment except 510 mg diazepam for all patients. the differing results of the two groups might explain why the outcomes of previous studies vary to such a great extent. differences in study outcomes could also be attributed to the differences in duration of the monitoring period, as well as the differences in sample sizes, selection of the target brain region, and the employed h mrs technique. in addition, the administered antipsychotic drugs were mutually different and given in various disease and treatment stages. the authors are fully aware of the limitations of this study, which can be attributed to the size of the studied sample. this was especially apparent with the intra - sample patient grouping ; however, the fact that the patients who stayed on a single antipsychotic drug throughout the monitoring period exhibited a unanimous rise in naa / cr levels deserves attention and should be considered indicative. the current results correspond with those of another study which demonstrated a drop in naa levels across the non - remitting patients and a rise in naa levels across the remitting patients, even though a 28-day treatment of manic adolescents failed to yield any rise in total naa levels.43 it is worth noting that the patients treated within the framework of the above study received olanzapine, which failed to yield a rise in naa levels in the examinees (n=10) despite the achieved therapeutic response. that could be best explained by the fact that this study focused on patients with schizophrenia, while the study in reference was comprised of type i bipolar disorder patients. the results could also be related to the affective basis of bipolar disorder.44 in addition, the naa rise witnessed within the framework of the latter study is more likely to be attributed to the alleviation of manic symptoms than to the olanzapine - related therapeutic effects. even though the patients in the current study were treated with more than one atypical antipsychotic drug and unanimously responded to treatment (thereby taking the study design into account), the rise in naa / cr levels was witnessed only in the quetiapine monotherapy arm. such a finding, together with the lack of olanzapine - related therapeutic benefits, could be suggestive of differences in the acting mechanisms of various atypical antipsychotic drugs, at least when it comes to naa. pending additional research, of course, mrs might prove to be a useful guide for choosing the early - stage therapy of patients with schizophrenia. however, the fact that olanzapine was the first administered and the last withdrawn drug in the study protocol that is to say, the only drug administered to the study group throughout the entire 12-month study course should not be neglected. this study failed to reveal any substantial relationship between naa / cr and a psychopathology profile. the correlation between the investigated variable and cognitive functioning is merely suggested by the positive correlation with ln scores, which was seen only at follow - up month 12 and only in patients taking more than one antipsychotic drug. the absence of correlation between the investigated parameter and cognitive functioning could be attributed in part to a lower number of employed tests compared to some of the previous studies. that is, within the frame of the current study, only rapid neuropsychological testing was carried out, mostly because of the patients profiles ; on the occasion of the first testing, the patients were acute and antipsychotic medication - nave. while some of the studies from the introduction managed to demonstrate a correlation between the alterations in h mrs established metabolite concentrations and various symptoms (only in functionally - related brain regions, however), other studies failed to reveal such a specific pattern and operated on the presumption of wider white and gray matter damage inflicted by schizophrenia.45 bustillo are of the opinion that studies investigating schizophrenia, which implies minor, albeit widespread, white and gray matter alterations, should aim to target wider brain regions.46 this is also a limitation of the current study, which targeted one brain region only. additional scans would significantly contribute to a better understanding of naa / cr study dynamics, especially when it comes to scores obtained with the employed battery of tests.47 in summary, a 1-year administration of atypical antipsychotic drugs to antipsychotic - nave patients failed to evoke any substantial rise in naa / cr. however, a significant increase in naa / cr levels was seen in patients who stayed on their initial antipsychotic medication, which yielded a favorable therapeutic response. despite the limitations of the current study, this finding points towards a link between naa / cr levels and atypical antipsychotic medication, which should be further investigated within a broader framework.48 | purposeto investigate the correlates of a clinical therapeutic response by using the parameters measured by proton magnetic resonance spectroscopy after the administration of atypical antipsychotics.patients and methodstwenty - five antipsychotic - nave first - episode patients with schizophrenia were monitored for 12 months. the patients were evaluated using 1h magnetic resonance spectroscopy in the dorsolateral prefrontal cortex and positive and negative syndrome scale, clinical global impression scale of severity, tower of london drexel university, letter number span test, trail making test a, and personal and social performance scale. they were administered atypical antipsychotics, starting with quetiapine. in the absence of a therapeutic response, another antipsychotic was introduced.resultsafter 12 study months, the n - acetylaspartate / creatine (naa / cr) level did not significantly change at the whole - group level. additional analysis revealed a significant rise in the naa / cr level in the study group that stayed on the same antipsychotic throughout the study course (p=0.008) and a significant drop in naa / cr in the study group that switched antipsychotics (p=0.005). on the whole - group level, no significant correlations between naa / cr values and other scores were found at either baseline or after 12 study months.conclusionone-year treatment with atypical antipsychotics administered to antipsychotic - nave patients did nt result in a significant rise in the naa / cr ratio. however, a significant rise was witnessed in the study group in which a satisfactory therapeutic response had been achieved with a single antipsychotic administration. |
local excision (le) techniques for rectal cancer are appealing due to their lower perioperative morbidity and mortality rates and better functional outcomes compared with standard transabdominal resection. however, le with curative intent is currently recommended for strictly selected t1 rectal cancers with favorable features such as < 30% rectal circumference, <3 cm in size, mobile, non - fixed, within 8 cm of the anal verge, well to moderately differentiated, and no evidence of lymphadenopathy on pretreatment imaging. although several studies have reported the treatment results of le for patients with ct2 tumors, le has not gained widespread acceptance due to disappointing outcomes even with adjuvant therapy. for more advanced tumors, le should be restricted to palliative purposes only. in the era of preoperative chemoradiotherapy (crt), the potential advantages of preoperative crt have increased interest in the use of le for patients with locally advanced rectal cancer (larc) who show significant tumor regression after preoperative crt. several retrospective studies have reported the treatment outcomes of le for a highly select subset of patients with ct2 - 3 rectal cancer who respond well to preoperative crt. however, most reported data were limited by being assessed in only a few single - center studies involving relatively small numbers of patients with favorable features. the american college of surgeons oncology group (acosog) trial z6041 recently published preliminary results of preoperative crt and le for ct2n0 rectal cancer. in addition, the capecitabine, radiotherapy and transanal endoscopic microsurgery surgery (carts) study, which will investigate the feasibility of preoperative crt followed by transanal endoscopic microsurgery in patients with ct1 - 3n0 rectal cancer, is currently recruiting participants. however, retrospective series or clinical trials regarding clinical experience with the use of preoperative crt and le for larc are sparse. this study investigated the treatment outcomes of le following preoperative crt for patients with ct3 - 4 rectal cancer who refused ablation of the anal sphincter, were considered inoperable due to medical comorbidities that contraindicated a major surgery, or achieved good response to preoperative crt. the patient database was reviewed to select patients with larc who received preoperative crt followed by le. all patients were required to meet the following inclusion criteria for entry into the study : 1) histologically confirmed rectal adenocarcinoma, 2) ct3 - 4 classification, 3) no distant metastasis, and 4) the initiation of preoperative crt before september 30, 2009. eight korean radiation oncology centers participated in the data collection, and a total of 27 patients were registered. one was when the doctor recommended le as the primary option limited to clinical complete response (cr) patients. the other was when the doctor recommended the procedure as an alternative to radical surgery due to refusal of radical surgery, old age, medical inoperability, etc. in the case of the former, the patient showing clinical cr following preoperative crt would have given his or her consent to an experimental treatment after being sufficiently informed. this study was approved by the institutional review board of the national cancer center, republic of korea (nccncs-12 - 649) and the korean radiation oncology group (krog 12 - 04). preoperative radiation therapy was given to a dose of 44.0 to 50.4 gy (median, 50.4 gy) in 1.8 to 2.0 gy daily fractions. conventional or three - dimensional treatment planning using three- or four - field techniques was used. chemotherapy was administered concurrently with radiation therapy using a fluoropyrimidine - based regimen (n=23, 85%) or irinotecan - based regimen (n=4, 15%). four to 8 weeks after completion of preoperative crt, le was performed by a transanal approach under general anesthesia. nineteen patients (70%) received adjuvant chemotherapy comprising a fluoropyrimidine - based regimen (n=18, 67%) or oxaliplatin - based regimen (n=1, 4%). the chemotherapeutic regimens, both preoperative and postoperative, were selected for each patient according to the preferences of the attending medical oncologists. all patients underwent a standard pretreatment workup including medical history, physical examination, serum carcinoembryonic antigen level, and imaging studies including chest x - ray and computed tomography (ct), transrectal ultrasonography, f - fluorodeoxyglucose positron emission tomography, or magnetic resonance imaging. the response to preoperative crt was evaluated using the tumor regression grading system proposed by dworak.. tumor regression was graded as follows : grade 0, no regression ; grade 1, minimal regression ; grade 2, moderate regression ; grade 3, near - complete regression ; and grade 4, complete regression. all tumors were staged according to the american joint committee on cancer staging manual 7th edition. all patients underwent standardized follow - up comprising a physical examination, digital rectal examination, complete blood counts, biochemical profiles, and serum carcinoembryonic antigen level at each visit. follow - up imaging studies, such as abdominopelvic ct and colonoscopy, were performed as clinically indicated or at the physician 's discretion. disease recurrence was pathologically proven by surgical resection, biopsy, or cytology and/or radiological findings. the primary endpoint was relapse - free survival (rfs), defined as the time interval from the initiation of crt to any type of recurrence other than death. local failure was defined as any disease recurrence within the pelvis, and any failure outside the pelvis was classified as a distant metastasis. survival was estimated using the kaplan - meier method, with differences compared using the log - rank test. the patient database was reviewed to select patients with larc who received preoperative crt followed by le. all patients were required to meet the following inclusion criteria for entry into the study : 1) histologically confirmed rectal adenocarcinoma, 2) ct3 - 4 classification, 3) no distant metastasis, and 4) the initiation of preoperative crt before september 30, 2009. eight korean radiation oncology centers participated in the data collection, and a total of 27 patients were registered. one was when the doctor recommended le as the primary option limited to clinical complete response (cr) patients. the other was when the doctor recommended the procedure as an alternative to radical surgery due to refusal of radical surgery, old age, medical inoperability, etc. in the case of the former, the patient showing clinical cr following preoperative crt would have given his or her consent to an experimental treatment after being sufficiently informed. this study was approved by the institutional review board of the national cancer center, republic of korea (nccncs-12 - 649) and the korean radiation oncology group (krog 12 - 04). preoperative radiation therapy was given to a dose of 44.0 to 50.4 gy (median, 50.4 gy) in 1.8 to 2.0 gy daily fractions. conventional or three - dimensional treatment planning using three- or four - field techniques was used. chemotherapy was administered concurrently with radiation therapy using a fluoropyrimidine - based regimen (n=23, 85%) or irinotecan - based regimen (n=4, 15%). four to 8 weeks after completion of preoperative crt, le was performed by a transanal approach under general anesthesia. nineteen patients (70%) received adjuvant chemotherapy comprising a fluoropyrimidine - based regimen (n=18, 67%) or oxaliplatin - based regimen (n=1, 4%). the chemotherapeutic regimens, both preoperative and postoperative, were selected for each patient according to the preferences of the attending medical oncologists. all patients underwent a standard pretreatment workup including medical history, physical examination, serum carcinoembryonic antigen level, and imaging studies including chest x - ray and computed tomography (ct), transrectal ultrasonography, f - fluorodeoxyglucose positron emission tomography, or magnetic resonance imaging. the response to preoperative crt was evaluated using the tumor regression grading system proposed by dworak.. tumor regression was graded as follows : grade 0, no regression ; grade 1, minimal regression ; grade 2, moderate regression ; grade 3, near - complete regression ; and grade 4, complete regression. all tumors were staged according to the american joint committee on cancer staging manual 7th edition. all patients underwent standardized follow - up comprising a physical examination, digital rectal examination, complete blood counts, biochemical profiles, and serum carcinoembryonic antigen level at each visit. follow - up imaging studies, such as abdominopelvic ct and colonoscopy, were performed as clinically indicated or at the physician 's discretion. disease recurrence was pathologically proven by surgical resection, biopsy, or cytology and/or radiological findings. the primary endpoint was relapse - free survival (rfs), defined as the time interval from the initiation of crt to any type of recurrence other than death. local failure was defined as any disease recurrence within the pelvis, and any failure outside the pelvis was classified as a distant metastasis. survival was estimated using the kaplan - meier method, with differences compared using the log - rank test. table 1 shows the individual and clinical characteristics of the patients. at the time of diagnosis, all patients had an eastern cooperative oncology group performance status of 0 to 1. all tumors were assessed by digital rectal examination and were located within 7 cm of the anal verge. in the present study, the most common reasons for undergoing le were good clinical response and doctor 's recommendation (n=14, 52%) and patient 's refusal of radical surgery (n=8, 30%), followed by old age (n=2, 7%), medical inoperability (n=2, 7%), and unknown (n=1, 4%). two patients were considered medically inoperable owing to poor pulmonary function and cerebrovascular accident, respectively. the duration of crt was 29 to 42 days (median, 37 days). one patient did not complete the planned radiation therapy (45 gy) at a dose of 39.6 gy due to severe enteritis. another patient received three of six cycles of postoperative capecitabine due to a cardiovascular event. the median follow - up time was 81.8 months (range, 28.6 to 138.5 months). the 5-year local relapse - free survival (lrfs), distant metastasis - free survival (dmfs), rfs, and overall survival (os) were 88.9%, 81.1%, 77.8%, and 85.0%, respectively. six (22%) patients developed treatment failure during the follow - up period : one (4%) patient had local recurrence only ; three (11%) patients had distant recurrence only ; and two (7%) patients had both. among six patients with disease recurrence, three were alive at the last follow - up with a relapse - free status after salvage treatment : one patient (ypt0n0) who developed local recurrence only at the excision site after 14 months was salvaged with abdominoperineal resection (rpt2n0) and adjuvant chemotherapy (six cycles of 5-fluorouracil plus leucovorin) ; another patient with hepatic metastasis was salvaged with radiofrequency ablation and chemotherapy ; and the other patient with both local and distant recurrences was treated with salvage chemotherapy (capecitabine plus oxaliplatin). during the study period until the time of analysis, a total of five (19%) patients died : three (11%) died of disease recurrence ; one (4%) died of newly developed non - small - cell lung cancer ; and one (4%) died of an unknown cause (no known recurrence). in this study in one patient, recurrence did not occur during the follow - up period, and in the other two, it occurred only in a distant organ, thus our results indicated that margin positivity did not increase local recurrence. univariate analysis was performed to identify the prognostic value of all clinicopathologic factors listed in tables 1 and 2. the 5-year os (94.1% vs. 66.7%, p=0.073) (fig. 1b) were better in patients with ypt0 - 1 than in those with ypt2 - 3, respectively, with borderline significance. the 5-year lrfs rates for patients with ypt0 - 1 and ypt2 - 3 were 94.1% and 77.8%, respectively (p=0.244) (fig. the dmfs rate of patients with ypt0 - 1 was significantly better than that of ypt2 - 3 (94.1% vs. 55.6%, respectively ; p=0.016) (fig. none of the other variables tested were significantly correlated with lrfs, dmfs, rfs, or os. table 1 shows the individual and clinical characteristics of the patients. at the time of diagnosis, all patients had an eastern cooperative oncology group performance status of 0 to 1. all tumors were assessed by digital rectal examination and were located within 7 cm of the anal verge. in the present study, the most common reasons for undergoing le were good clinical response and doctor 's recommendation (n=14, 52%) and patient 's refusal of radical surgery (n=8, 30%), followed by old age (n=2, 7%), medical inoperability (n=2, 7%), and unknown (n=1, 4%). two patients were considered medically inoperable owing to poor pulmonary function and cerebrovascular accident, respectively. the duration of crt was 29 to 42 days (median, 37 days). one patient did not complete the planned radiation therapy (45 gy) at a dose of 39.6 gy due to severe enteritis. another patient received three of six cycles of postoperative capecitabine due to a cardiovascular event. the median follow - up time was 81.8 months (range, 28.6 to 138.5 months). the 5-year local relapse - free survival (lrfs), distant metastasis - free survival (dmfs), rfs, and overall survival (os) were 88.9%, 81.1%, 77.8%, and 85.0%, respectively. six (22%) patients developed treatment failure during the follow - up period : one (4%) patient had local recurrence only ; three (11%) patients had distant recurrence only ; and two (7%) patients had both. among six patients with disease recurrence, three were alive at the last follow - up with a relapse - free status after salvage treatment : one patient (ypt0n0) who developed local recurrence only at the excision site after 14 months was salvaged with abdominoperineal resection (rpt2n0) and adjuvant chemotherapy (six cycles of 5-fluorouracil plus leucovorin) ; another patient with hepatic metastasis was salvaged with radiofrequency ablation and chemotherapy ; and the other patient with both local and distant recurrences was treated with salvage chemotherapy (capecitabine plus oxaliplatin). during the study period until the time of analysis, a total of five (19%) patients died : three (11%) died of disease recurrence ; one (4%) died of newly developed non - small - cell lung cancer ; and one (4%) died of an unknown cause (no known recurrence). in this study, there were three patients who had resection margin positive. in one patient, recurrence did not occur during the follow - up period, and in the other two, it occurred only in a distant organ, thus our results indicated that margin positivity did not increase local recurrence. univariate analysis was performed to identify the prognostic value of all clinicopathologic factors listed in tables 1 and 2. the 5-year os (94.1% vs. 66.7%, p=0.073) (fig. 1b) were better in patients with ypt0 - 1 than in those with ypt2 - 3, respectively, with borderline significance. the 5-year lrfs rates for patients with ypt0 - 1 and ypt2 - 3 were 94.1% and 77.8%, respectively (p=0.244) (fig. the dmfs rate of patients with ypt0 - 1 was significantly better than that of ypt2 - 3 (94.1% vs. 55.6%, respectively ; p=0.016) (fig. none of the other variables tested were significantly correlated with lrfs, dmfs, rfs, or os. the purpose of this study was to evaluate the treatment outcomes of patients with larc who underwent le following preoperative crt. at present, nevertheless, there has been increasing interest in the use of le as a fallback option for larc as well as early rectal cancer. some patients who want a better functional outcome and quality of life may refuse radical surgery mostly due to nonacceptance of permanent colostomy. however, one of the major problems related to le for larc is the higher recurrence rate. two cooperative group trials have provided information on the local recurrence rates of le followed by adjuvant crt for larc. the radiation therapy oncology group protocol 89 - 02 evaluated the efficacy of le in 38 patients with ct2 - 3 rectal cancer and reported that le was a feasible alternative treatment but that the local recurrence rates (16% in t2 and 23% in t3) and distant dissemination rates (12% in t2 and 31% in t3) appeared to escalate with increasing t classification. the cancer and leukemia group b (calgb) 8,984 study reported the updated outcomes of 51 patients with t2 rectal cancer. thus, the high rate of local recurrence with le remains unresolved, and the advantages of le should be balanced against this high local recurrence rate. several studies have shown promising results for le after preoperative crt in patients with select ct2 - 3 tumors that responded well to crt. preoperative crt allows downstaging of the primary tumor, sterilization of micrometastases in the pelvis, improved locoregional control, and decreased complication rates. among these, significant tumor responses to preoperative crt may lead to the use of le even in patients at a high risk of disease recurrence because a pathologically complete response (ypcr) after crt was suggested to have a favorable outcome. the key rationale for this approach is the correlation between radiosensitivity and the inherent low aggressiveness of rectal cancer.. demonstrated that local control and survival rates of patients treated with crt followed by le were comparable to those of patients treated with crt followed by mesorectal excision. borschitz. analyzed previously published data regarding le after preoperative crt for ct2 - 3 rectal cancer. the local recurrence rate of patients with ypt1 disease consistently showed a low incidence of 2% (range, 0 to 6%), whereas those in patients with ypt2 and ypt3 were 6% to 20% and up to 42%, respectively. reported that selected patients with ct3 tumors that were downstaged and met the criteria for le appeared to have excellent survival outcomes. our study also showed that patients with ypt0 - 1 tumors had a trend toward better treatment outcomes than those with ypt2 - 3 tumors. the 5-year local recurrence and os rates in the present study for patients with ypt0 - 1 tumors were 5.9% and 94.1%, respectively, which were comparable to those reported for patients who underwent total mesorectal excision for early rectal cancer. we included 12 (44%) patients with clinically positive pelvic lymph node(s) who were diagnosed by one or more imaging studies. if lymph node metastasis can not be sterilized with preoperative crt, le in these patients may result in increased risks of local and distant recurrence because the residual lymphatic metastasis would have been left unresected. however, it is difficult to evaluate the status of lymph node involvement after preoperative crt because le did not provide information on ypn classification, and conventional imaging studies have limitations in assessing the response to preoperative crt for rectal cancer due to radiation - induced edema, inflammation, and fibrosis. kim. reported that pathologic nodal classification is an important prognostic factor for survival outcomes in patients with rectal cancer treated with preoperative crt, and the ypt classification has been suggested as the most reliable predictor of ypn status : the ypn+ rate was 3.4% in ypt0 - 1 ; 16.9% in ypt2 ; and 49.3% in ypt3 patients. although the ypn classification was not reported in the present study, ypt classification may help to predict ypn status. we have confirmed an association between the tumor responses to preoperative crt and treatment outcomes. the results of the present study suggest that le may be a reasonable alternative treatment for patients with larc who achieve ypt0 - 1 after preoperative crt. although the treatment outcome of le in this patient subset seems promising, careful consideration should be given to preoperative patient selection. we hope that the results described here will add to the growing evidence and guide any future changes in the use of le for larc. | purposeto evaluate the treatment outcomes of local excision following preoperative chemoradiotherapy in patients with locally advanced rectal cancer who have not undergone radical surgery for any reason.materials and methodsthe data of 27 patients with locally advanced rectal cancer who underwent preoperative chemoradiotherapy followed by local excision were analyzed retrospectively. the primary endpoint was the 5-year relapse - free survival rate, and the secondary endpoint was the pattern of recurrence.resultsthe median follow - up time was 81.8 months (range, 28.6 to 138.5 months). the 5-year local relapse - free survival (lrfs), distant metastasis - free survival (dmfs), relapse - free survival (rfs), and overall survival (os) were 88.9%, 81.1%, 77.8%, and 85.0%, respectively. six (22%) patients developed treatment failure ; one (4%) patient had local recurrence only, three (11%) patients had distant recurrence only, and two (7%) patients had both. the 5-year lrfs, dmfs, rfs, and os for patients with ypt0 - 1 compared with ypt2 - 3 were 94.1% vs. 77.8% (p=0.244), 94.1% vs. 55.6% (p=0.016), 88.2% vs. 55.6% (p=0.051), and 94.1% vs. 66.7% (p=0.073), respectively.conclusionlocal excision following preoperative chemoradiotherapy may be an alternative treatment for highly selected patients with locally advanced rectal cancer who have achieved ypt0 - 1 after preoperative chemoradiotherapy. |
internal limiting membrane (ilm), the basement membrane of retinal mller cells, is the structural interface between the vitreous and retina. histologically, ilm tissues isolated from patients with macular holes (mhs) revealed amorphous linear structure in which glial cells, hyalocytes, and myofibroblast - like cells could be intermingled.1,2 today, brilliant blue g (bbg) is well known to be a useful agent to stain ilm with blue coloration and to facilitate ilm peeling.3 ilm removal in mh surgeries relieves tangential traction around the holes, increases mh closure rates, and contributes to reduced frequency of epiretinal membrane formation.4 thus, ilm peeling during vitrectomy has become one of the pivotal procedures in surgical intervention for mhs. however, vitreoretinal surgeons can not always close every mh using vitrectomy with conventional ilm peeling. especially, surgical interventions for large mhs, measuring > 400 m in the base diameter, and for high - myopic mhs are challenging because of their low closure rates.5 sometimes, such holes could be closed with exposure of the retinal pigment epithelium to the vitreous space, resulting in postoperative poor visual acuity.6 in order to improve the hole closure rate, inverted ilm flap technique has recently been applied to patients with refractory mhs. indeed, this technique includes isolation of ilm tissues, which are not completely peeled off but placed on the hole. this technique is also useful for closure of a large mh secondary to uveitis.7 however, it is largely unknown whether it is possible to use bbg - negative membranes as materials for autologous transplantation in order to facilitate the hole closure. in addition, it has not been clarified how the inverted ilm flap technique leads to morphological changes following the mh closure and to postoperative visual outcomes. the aim of this study is to analyze optical coherence tomography (oct) imaging of large mhs treated with inverted ilm flap technique. this study further performed a histological examination of an ilm - like membrane tissue obtained during vitrectomy. the diagnostic criterion for large mh includes the minimum diameter of the holes > 400 m determined by oct imaging at an initial presentation. high - myopic mh is identified as follows : spherical equivalent > 7.0 d and the ocular axis > 26 mm determined by a - scan ultrasonography and/or intraocular lens (iol) master. this study also excluded cases showing a minimum mh diameter of 400 m determined by oct imaging at an initial presentation. high - myopic mh is identified as follows : spherical equivalent > 7.0 d and the ocular axis > 26 mm determined by a - scan ultrasonography and/or intraocular lens (iol) master. this study also excluded cases showing a minimum mh diameter of 0.2 logmar in six patients. oct findings were available 13 days after the surgery under gas tamponade in three eyes, in which all the patients examined showed findings suggestive of favorable closure. the complete closure of mh following ppv with inverted ilm technique was eventually achieved in all patients determined by oct imaging (100%) by 1 month after surgery. in this study, after ppv with inverted ilm flap technique, the closure type was u - type (figures 1d, h and 2a, b) and v - type (figure 2c and d) in eight eyes and one eye, respectively. oct detected linear configuration, consistent with transplanted ilm tissues, in four eyes 1 month after the surgery. three out of nine eyes showed elongation of outer nuclear layer 3 months after the surgery. only one patient (case 6 in table 1) showed recovery of ellipsoid zone and interdigitation zone, and elongation of photoreceptor outer segment length following the surgery. there are no significant changes in oct finding between 3 and 6 months after the surgery. the tissue of an ilm - like membrane was isolated during ppv in one patient with stage iii mh (case 2 in table 1). the ilm - like membrane not stained with bbg revealed an eosinophilic amorphous structure in conjunction with mononuclear cell infiltration (figure 3a). pas staining showed negative for cell infiltration but positive for the amorphous structure, which is consistent with ilm (figure 3b). oct findings were available 13 days after the surgery under gas tamponade in three eyes, in which all the patients examined showed findings suggestive of favorable closure. the complete closure of mh following ppv with inverted ilm technique was eventually achieved in all patients determined by oct imaging (100%) by 1 month after surgery. in this study, after ppv with inverted ilm flap technique, the closure type was u - type (figures 1d, h and 2a, b) and v - type (figure 2c and d) in eight eyes and one eye, respectively. oct detected linear configuration, consistent with transplanted ilm tissues, in four eyes 1 month after the surgery. three out of nine eyes showed elongation of outer nuclear layer 3 months after the surgery. only one patient (case 6 in table 1) showed recovery of ellipsoid zone and interdigitation zone, and elongation of photoreceptor outer segment length following the surgery. there are no significant changes in oct finding between 3 and 6 months after the surgery. the tissue of an ilm - like membrane was isolated during ppv in one patient with stage iii mh (case 2 in table 1). the ilm - like membrane not stained with bbg revealed an eosinophilic amorphous structure in conjunction with mononuclear cell infiltration (figure 3a). pas staining showed negative for cell infiltration but positive for the amorphous structure, which is consistent with ilm (figure 3b). in this study, ppv with inverted ilm flap technique achieved 100% closure rates at the initial surgery in nine patients with large mhs. michalewska first described the initial closure rate of 98% by inverted ilm flap technique in the patients with large mh. kuriyama reported primary closure following the surgery in five eyes out of six eyes with highly myopic mh. imai proposed oct - based evaluation of mh closure following vitrectomy. briefly, u - type closure is the most favorable closure type possibly leading to good postoperative visual acuity. next, v - type shows notch configuration covered with thin retinal tissue. finally, w - type is not favorable closure, so - called open - closed mh, exposing retinal pigment epithelium to the vitreous space. this case series also proved ideal u - type closure, a successful closure configuration, in most eyes using the inverted ilm flap technique. in this study, the ilm - like membrane was partially removed in one eye showing no staining with bbg, which was submitted for pathological analyses. histologically, the ilm - like membrane contained an amorphous linear structure that is pas positive, which is typically observed in the ilm tissue. uemoto reported that bbg - positive ilm isolated from mh and epiretinal membrane revealed a membrane with few cell infiltration based on pathological analysis. therefore, the bbg - negative case shown in this report may represent more glial cell infiltration within the ilm tissue than ilm stained with bbg. as shown in figure 1, the postoperative oct findings were similar to those transplanted by common bbg - positive ilm tissues. kuriyama reported that epiretinal membranes / ilm tissues were transplanted in the hole during vitrectomy in three eyes among six high myopic eyes. taken together, our data also suggest that even bbg staining - negative ilm - like membrane can be safely used as a material for autologous transplantation to the hole. it has been speculated that ilm peeling may induce retinal gliosis, leading to the formation of a bridge between the deficit of retinal tissues in the hole.8 this study indicated that the ilm - like membrane including gfap - positive retinal glial cells contributed to the hole closure with a favorable configuration determined by oct. these results suggest that glial cells placed on the hole may produce intermediate filaments and provoke tissue remodeling within the mh. the oct demonstrated no recovery of deficit of ellipsoid zone and no elongation of photoreceptor outer segment length in eight out of nine patients examined, although six patients showed improvement of > 0.2 logmar visual acuities. de sisternes addressed that recovery of visual acuity was correlated with preoperative degree of the ellipsoid zone deficit in patients with mh. we recently showed that elongation of photoreceptor outer segment length following mh surgery correlated with postoperative visual acuities.12 however, these results are not consistent with the present study, indicating that the recovery of visual acuity did not depend on preoperative severity of ellipsoid zone and photoreceptor damage in patients with large mh treated with inverted ilm flap technique. in this study, elongation of outer nuclear layer and external limiting membrane was noted in a few patients, indicating that alteration of visual fixation may correlate with the recovery of visual acuity following the surgery in selected cases. further studies are needed to analyze the mechanisms underlying postoperative recovery of visual acuity in inverted ilm flap technique. ppv with inverted ilm flap technique achieved 100% closure rates with favorable configuration at an initial surgery in large mhs. our data also suggest that even bbg staining - negative membrane may be one of useful materials for autologous transplantation to the hole. | purposethe aims of this study were to analyze optical coherence tomography (oct) imaging of large macular holes (mhs) treated with inverted internal limiting membrane (ilm) flap technique and to perform a histological examination of an ilm - like membrane tissue obtained during vitrectomy.patients and methodsthis is a retrospective observational case study. nine patients, comprising of five males and four females, showing large and myopic mhs, underwent pars plana vitrectomy (ppv) with inverted ilm flap technique assisted by brilliant blue g (bbg) staining. ophthalmological findings including visual acuity and oct were investigated based on medical records. formalin - fixed paraffin - embedded tissue section of an ilm - like membrane was submitted for immunohistochemistry with glial fibrillary acidic protein (gfap).resultsilm was clearly stained with bbg in eight patients, whereas the ilm in one case revealed no staining with bbg during ppv. visual acuities improved to > 0.2 logmar in six patients. the complete closure of mh following ppv with inverted ilm technique was eventually achieved in all patients determined by oct imaging (100%). only one patient showed recovery of ellipsoid zone and interdigitation zone following the surgery. elongation of outer nuclear layer was noted in three eyes. the ilm - like membrane not stained with bbg histologically revealed an amorphous structure admixed with gfap - positive mononuclear cell infiltration.conclusionppv with inverted ilm flap technique achieved 100% closure rates with favorable configuration at an initial surgery in large mhs. our histopathological data also suggest that even bbg staining - negative membrane may be a useful material for autologous transplantation to the hole. |
kikuchi fujimoto disease (kfd), or histiocytic necrotizing lymphadenitis, is an infrequent idiopathic disorder.1 it is usually a self - limited condition with a good prognosis because it has a low complication rate.2 it mainly affects young women.3 the most common clinical symptoms are fever and laboratory finding of cervical lymphadenopathy associated with leukopenia.3 cases of kfd associated with autoimmune disorders, such as systemic lupus erythematosus (sle), have been reported.4 herein, we describe a female patient who presented with cervical necrotizing lymphadenitis and febrile syndrome and subsequently met the diagnostic criteria for sle.5 a 27-year - old female patient, without any relevant past medical history, presented to the clinic with a 30-day history of voluminous and tender enlargement of cervical and nuchal lymph nodes. five days after the onset of the symptoms, the patient developed asthenia and fever of 3839c that responded poorly to antipyretics. a week before visiting us, the patient had symmetric arthralgias, mainly of proximal and distal interphalangeal joints of hands and elbows. on physical examination, multiple indurated, fixed, and tender lymphadenopathies were evident in the cervical and nuchal areas. a recent occurrence of an erythematous, indolent node of diameter 5 mm was detected in the right cheek. laboratory test results showed hypochromic normocytic anemia and elevated lactate dehydrogenase, erythrocyte sedimentation rate, glutamic oxaloacetic transaminase, and glutamic pyruvic transaminase. institutional approval by the hospital privado ethics committee and written informed consent from the patient was obtained to report the findings of this case. serology test results for human immunodeficiency virus (hiv), hepatitis b and c, epstein an ultrasonography of the neck revealed bilaterally enlarged submandibular and jugular chain lymph nodes (the largest was 2 cm in diameter), with some showing signs of necrosis. cervical and chest computed tomography scans only showed lymph node enlargements as previously described. an abdominal computed tomography scan evidenced infracentimetric inguinal, intercavoaortic, and left lateroaortic lymph nodes of measuring up to 9 mm in diameter. the histopathological report disclosed more than ninety percent of the lymph node sample showed necrosis with distortion of the normal architecture ; periodic acid the polymerase chain reaction analysis of the biopsy material was negative for histoplasma, aspergillus, mycobacteria, and cytomegalovirus. twelve days after the onset of the symptoms, the patient developed arthritis of the proximal and distal interphalangeal joints of the hands, malar rash, photosensitive erythema in the chest, and painful oral ulcers. the patient then developed generalized erytroderma in the chest, abdomen, and upper and lower limbs, as well as diffuse alopecia. pending autoimmune screen test results were received, which revealed positive antinuclear antibodies (hep2) with a titer of 1:320 and a speckled pattern ; negative anti - double - stranded - dna antibodies ; positive anti - ro antibodies ; and negative anti - la, anti - smith, anti - ribonucleic protein, lupus anticoagulant, and anticardiolipin antibodies. owing to the nonspecific findings of the first lymph node sampling, it was decided to perform a second biopsy guided by ultrasound to select tissue with less necrosis (figure 1). the histopathological examination of the specimen revealed scarce lymphoid tissue due to extensive geographic necrosis and numerous histiocytes diffusely laid out surrounding the necrotic foci. immunohistochemical panels evidenced residual lymphoid tissue that expressed positive cd20, cd3, and bcl-2. a diagnosis of associated sle was made because the patient presented malar rash, photosensitivity, oral ulcers, alopecia, arthritis, and positive antinuclear antibody (2012 systemic lupus international collaborating clinics classification criteria).5 the patient has begun treatment with hydroxychloroquine (200 mg / d) and prednisone (20 mg / d), with a marked improvement in the symptoms 1 week after the treatment was started and a progressive reduction in the lymphadenopathies until complete resolution after 1 month of treatment initiation. histiocytic necrotizing lymphadenitis was described by kikuchi and fujimoto in 1972.3 it was mainly described in young adults < 40 years of age.6 this disease is more prevalent in asia, but some cases have been reported in other continents also. its etiology is unknown, although the most accepted hypothesis is its viral autoimmune origin.7 three patterns of presentation of this association were found by medline / pubmed search until 2015 : kfd before the onset of sle (30%), simultaneous occurrence of both disorders (47%), and kfd after sle (23%). some cases of familial occurrence of kfd were observed in japan within a short period of time and in a similar setting.8 only one human leukocyte antigen (hla)-typing study was found.9 also, few reports of kfd proposed the possibility of familial clustering. one of them described two nontwin sisters with hla - identical phenotype who lived contemporarily in the same environment.10 other report showed two nontwin sisters with hla - identical phenotype who developed the disease in different locations and 10 years apart from each other.8 a current publication described the development of kfd in four members of the same family (three confirmed cases and one possible case) at different periods of time. its onset may be acute or subacute and may last 2 or 3 weeks.11 no studies have shown if familial cluster of kfd is present when it links with sle. cervical lymphadenopathy, which is usually tender to palpation, is the main clinical feature. other lymph node regions can also be involved.12 the common presenting symptoms are fever, sweating, chills, tender lymph nodes, malaise, weight loss, and cough.1214 the laboratory and radiologic tests available for the diagnosis are nonspecific. the common laboratory abnormalities are leukopenia, usually neutropenia ; anemia ; thrombocytopenia ; elevated c - reactive protein and erythrocyte sedimentation rate ; impaired liver function ; and atypical lymphocytes on peripheral blood smear.7,12 the diagnosis is mainly made by histopathological assessment of the lymph node. clinical and histological differential diagnoses of kfd should take into account the following diseases : non - hodgkin lymphomas and other lymphoid malignancies ; lymphadenopathies associated with connective disorders such as sle, rheumatoid arthritis, and still s disease ; and bacterial or viral infections such as cat scratch disease, infectious mononucleosis, herpes simplex, hiv, toxoplasmosis, tuberculosis, and atypical mycobacterial lymphadenitis.6 because of the clinical and pathological correlation between kfd and sle, some authors have postulated that kfd may be a clinical feature or an incomplete phase of lupus lymphadenitis.1518 however, there are several case reports of kfd without sle,1 which may support the fact that they are two independent entities that may commonly coexist, as it happens with most of the autoimmune diseases in susceptible subjects. in kfd, the most common histologic finding is lymph node showing geographic necrosis with foci of apoptotic cells with abundant karyorrhectic fragments surrounded by histiocytes.6 characteristically, neutrophils and eosinophils are absent.6 only in those cases in which the pathologist notes hematoxyphilic bodies (clusters of basophilic material within lymph node sinuses), dna deposits in the wall of the vessels, or areas of vasculitis surrounding the necrotic foci, he or she would suggest the diagnosis of lupus lymphadenitis and not kfd.2 immunohistochemical analysis has great value and is generally used to exclude hematologic malignancies. cd8 also, positive immunostaining appeared for cd68 and cd4 in histiocytes. from a clinical approach, usually, kfd takes a monophasic and benign course that limits itself in 16 months.1518 however, if it coexists with sle, it can have a more aggressive course and should be treated to prevent sequelae. a long - term follow - up is necessary to monitor for recurrence.19 in addition, there have been reports of death in patients with kfd and sle due to severe infections and development of hemophagocytic syndrome.19 our patient did not have this complication. in our case, a new ultrasonographically guided biopsy was repeated to select the lymph nodes with less necrotic tissue. we propose this strategy to reach a histological diagnosis. in order to do that, the abovementioned ancillary studies were requested and the lymph node biopsy was repeated to ultrasonographically select the lymph nodes with less necrotic tissue to reach a histological diagnosis. kfd is one of the differential diagnoses of cervical necrotizing lymphadenitis, and when it is present, it would be wise to suspect, during its clinical course, a possible association with other autoimmune conditions, such as sle. | kikuchi fujimoto disease, or histiocytic necrotizing lymphadenitis, is an infrequent idiopathic disorder. it has been associated with autoimmune disorders, of which systemic lupus erythematosus is the most outstanding. the basis of its diagnosis relies on the histological examination of lymph nodes, which typically reveals necrosis surrounded by histiocytes with crescentic nucleus, immunoblasts and plasma cells, and absence of neutrophils. we report the case of a 27-year - old argentinian female patient without any relevant past medical history to demonstrate the correlation between kikuchi fujimoto disease and systemic lupus erythematosus. |
there is rising incidence of noncommunicable diseases like diabetes, hypertension, and coronary heart diseases globally [13 ]. increased risk of impaired glucose tolerance, insulin resistance, and type 2 diabetes (t2 dm) has been found to be associated with obesity in adolescents. the american academy of paediatrics and the american diabetes association have recommended that children aged 10 years or at the onset of puberty who are overweight and have at least two other risk factors should be tested every two years for t2 dm [5, 6 ]. the risk factors for developing t2 dm include family history of t2 dm in first- or second - degree relative, belonging to certain ethnic groups (i.e., native american, african american, hispanic, japanese, or other asian / pacific islanders), or having signs associated with insulin resistance (hypertension, dyslipidemia, acanthosis nigricans, or polycystic ovarian syndrome) [5, 7 ]. similarly other endogenous populations, for instance, in canada, australia, russia, and latin america, may share similar genetic predispositions. beck - nielsen and groop proposed a three - stage model for the development of t2 dm. stage 1 includes fasting hyperinsulinemia with normal or slightly increased blood glucose, especially mild fasting hyperglycemia. stage 2 is characterized by prediabetic glucose intolerance with insulin resistance, and stage 3 is development of classical symptomatic or nonsymptomatic t2 dm with more persistent hyperglycemia present. many of the macrovascular changes associated with diabetes and related to cardiovascular disease (cvd) begin in stages 1 and 2, well before overt diagnosis. adolescents are a dependent population and development of diabetes mellitus or other noncommunicable diseases will pose a burden to parents and society at large,, hence the need to continually assess the fbg of adolescents in rapidly changing communities. this will help in early detection and hopefully the control of the prediabetic phase through education and lifestyle modification. it will also help in prompt commencement of treatment in those with established diabetes to improve quality of life and prevent complications. data on fbg among nigerian adolescents are scarce, hence the need for the present study especially in ado - ekiti, a relatively new and rapidly developing state capital in nigeria with changes in lifestyle associated with urbanization such as inappropriate dietary practices (fast food consumption, low fruit consumption) and low physical activity [11, 12 ]. secondary school adolescents of both sexes who satisfied the inclusion criteria were recruited for the study from three different schools in ado - ekiti, the capital of ekiti state, nigeria. ethical clearance and permission to enter the schools were obtained from the research and ethics committee of the ekiti state university teaching hospital, ado - ekiti, and the state 's ministry of education, respectively. inclusion criteria for the study were apparently healthy secondary school adolescents aged between 10 and 19 years, with no history of diabetes. with parental consent, volunteers completed a structured questionnaire, and fbg was measured after an overnight fast. capillary blood sample was collected for fbg measurement using accu - chek active glucometer, after the thumb or index finger had been cleaned with wet (water) cotton wool. subjects were grouped based on their age, gender, family history of obesity and diabetes, and fasting blood glucose (fbg). cross tabulation and tests for association with chi square () were done and p values less than 0.05 were regarded as significant. the subjects in the present study comprised 346 male and 282 female adolescents (male to female ratio of 1.2 : 1) with mean age of 14.2 1.7 years and age range of 10 to 19 years. four (0.6%) adolescents had fbg in diabetic range ; 180 (28.7%) had impaired fbg and 121 (67%) of these were in the 1014-year age group. also, all the four adolescents who had diabetic fbg range were in the same 1014-year age group (table 1). there were 77 (41.8%) males and 107 (58.2%) females in the 184 (29.3%) adolescents with high fbg (180 in prediabetic and 4 in diabetic range) among the studied 628 adolescents giving a male to female ratio of 0.7 : 1. the proportion of males with high fbg of the overall studied male population of 346 was 77 (22.3%) while the proportion of females with high fbg of the overall female population of 282 was 107 (37.9%). this difference was statistically significant (= 18.462, df = 1, p = 0.000). figure 1 shows the fbg profile in the studied sample of secondary school adolescents in ado - ekiti. the mean (sd) for their fbg was 95.3 (10.9), median was 94.0, and it ranged from 68 to 149 mg / dl. the variability of fbg in both genders was comparable except that the median fbg for females was slightly higher (figure 2). the mean (sd) fbg for males was 93.4 (10.8) and for females was 97.6 (10.5). the fbg chart for age (figure 3) showed two distinct peaks which occurred at 12 and 17 years though there appears to be a little rise at the age of 14 years. female gender, early adolescence (age group 1014 years), and family history of obesity have statistically significant influence on fbg levels (p value < 0.001, < 0.001, and 0.045, resp.). the review of the fasting blood glucose of the adolescents in ado - ekiti showed that the majority (70.7%) had normal fbg, and a rather large number, about a third (28.7%), had impaired fbg in the prediabetic range and 0.6% of them had presumed diabetic fbg range. the possibility of secondary school adolescents falsely denying taking some juice or snack before the test can not be completely ruled out and this may contribute to the unusually high proportion of those with impaired fbg in this study. there may also be some bias using plasma meter bg readings rather than more centralized sampling systems as reported in other studies [2, 13 ]. some nervousness of participants not used to finger pricks may also have contributed to some false elevations and repeat testing will be proposed to double - check these results. the fbg profile of the adolescents plotted against their ages showed two distinct peaks which occurred at 12 and 17 years (figure 3) ; this is similar to the peaks in their bmi which occurred at the same ages of 12 and 17 years. this finding is in concordance with findings among adolescents in beijing area of china whose fbg peaked at 12 - 13 years and at 17 years of age. increased secretion of growth hormone and adrenocortical and gonadal hormones during puberty usually causes increase in insulin resistance and this could explain the peaks in fbg of adolescents at 12 and 17 years which roughly correspond to early and late phase of puberty in both genders combined. it was also demonstrated in this index study that early adolescence (age group 1014 years), female sex, and family history of obesity have statistically significant association with impaired fasting blood glucose and this finding agrees with findings from previous studies [13, 14 ]. moreover, the mean fbg in the male and female adolescents in index study (93.4 10.8 ; 97.6 10.5 mg / dl, resp.) is slightly higher than those of moroccan male and female adolescents of a similar age (92 14.0 ; 89 10.0 mg / dl, resp.). this difference may be due to different methods used for analysis of fbg. in the moroccan study, mehdad. used hexokinase method to determine fbg while the current study assessed capillary fbg with accu - chek active glucometer. also, the moroccan study had a smaller and disproportionate study population (44 males ; 123 females) compared to the index study of 346 male and 282 female adolescents. strength and limitation of the study the sample size for this study is adequate and both genders were well represented.the population of adolescents available for this study from private secondary school was small compared to those from public secondary schools, hence preventing meaningful comparison. the population of adolescents available for this study from private secondary school was small compared to those from public secondary schools, hence preventing meaningful comparison. the present study among secondary school adolescents in ado - ekiti, nigeria, showed that fbg was normal in two - thirds of them while the remaining one - third had impaired fbg. also, impaired fbg is significantly more common among younger female adolescents (1014 years) with positive family history of obesity. | background. over the past two decades there has been an increase in type 2 diabetes mellitus (t2 dm) in children. baseline data is needed to assess the impact of changing lifestyles on ado - ekiti, a previously semiurban community in southwest nigeria. this study was therefore conducted to assess the fasting blood glucose (fbg) of adolescents in ado - ekiti, nigeria. methodology. this was a cross - sectional study involving 628 adolescents from three different secondary schools in ado - ekiti, nigeria. with parental consent, volunteers completed a structured questionnaire, and an overnight fbg was measured. results. there were 346 males and 282 females (male : female ratio = 1.2 : 1). their ages ranged from 10 to 19 years (mean age : 14.2 1.7 years). four hundred and forty - four (70.7%) had normal fbg, while 180 (28.7%) and 4 (0.6%) had fbg in the prediabetic and diabetic range, respectively. female gender, age group 1014 years, and family history of obesity were significantly associated with impaired fbg (p value < 0.001, < 0.001, and 0.045, resp.). conclusion. impaired fbg is common among secondary school adolescents and it is more prevalent among younger female adolescents (1014 years) with positive family history of obesity. |
iran, a country with a population of about 75 millions, is one of the most populated countries of the middle east. due to substantial investments by the government of iran on health care system in past decades iran ministry of health (moh) is the responsible body for providing and regulating health care services for the nation. blood transfusion is an essential component of health care which worldwide saves millions of lives each year. despite encouraging results, researches are not able to introduce artificial substitutes that can routinely replace the need for donated human blood. therefore, blood and blood components are still required for the management of patients suffering from cancer, blood diseases, trauma and emergencies. in some countries, transfusion is mostly used to support advanced medical and surgical procedures e.g. cardiovascular surgery, neurosurgery and transplantation. however, in developing countries majority of blood is used to treat trauma cases, women with obstetric emergencies and children suffering from severe anemia and malnutrition. therefore, lack of access to sufficient quantities of safe blood and its components may compromise the obvious right of patients to health care. while the need for blood is universal, millions of patients requiring transfusion do not have timely access to safe blood and there is also a major imbalance between developing and high income countries in access to safe blood. according to who statistics (1) about 48% of around 92 million blood donations which are collected annually worldwide from all types of blood donors (voluntary, family / replacement and paid) collected in high - income countries. these countries are home to about 15% of the world s population. on the other hand residents of 43 countries in the african region with more than 12% of world population reported collecting only 4 million units of blood (represents for 4.3% of global donations). although in 62 countries including iran, national blood supplies are based on 100% voluntary unpaid blood donations, in 40 countries less than 25% of their national blood supplies donated by voluntary blood donors (2). in iran blood transfusion is an integral part of the national health system. blood donation is voluntary and unpaid and blood and its components may not be a source of income. the costs of collection, components preparation, preserving and distribution of blood and its components are paid by the government. currently blood and its components are free of charge for all iranian patients in need of such treatments. new era of blood transfusion in iran started in 1940s with a non centralized and inappropriately supervised service. until the early 1970s iran had no organized blood service and the requirements of hospitals were supplied by commercial and professional blood donors. since 1970s iran has adopted the basic principles of blood safety criteria set by who for a national blood organization (3) including well organized nationally coordinated blood transfusion services with quality systems in all areas, the collection of blood only from voluntary non - remunerated blood donors of low risk populations, the quality assured testing of all donated blood, the safe and appropriate use of blood and blood products and global collaboration for blood safety. in 1974 based on a parliamentary law, iran blood transfusion organization (ibto) was established in order to centralize all blood transfusion activities from donor recruitment to production of blood components and delivery of blood and blood products under one umbrella. the law banned all other public and private organizations to perform any activity in blood transfusion section. the establishment of ibto was a milestone toward emergence of a developed and scientifically based blood transfusion system in iran. ibto is a public and non - profit organization that relies on the government of iran for its financial budget and delivers all of its basic services including produced basic blood components free of charge both to the public and private hospitals. according to its constitution the main scope and responsibilities of ibto are to define standards for transfusion services, to recruit voluntary donors and conduct donation screening tests, to develop blood supply network throughout the country and to prepare blood components and deliver them to health centers. self sufficiently of country for blood and blood components has always been one of the main objectives of ibto. therefore ibto has spent enormous efforts on increasing blood collection form volunteer donors. during islamic revolution in 197879, blood donation statistics shows a peak (fig. this is due to the need to more blood for treatment of injuries from street conflicts between people and the regime forces. this trend was also continued afterward during an eight year long (198088) war of iraq against iran. despite the long period of the war blood supplies currently 283 fixed blood donation sites are available throughout the country which collects 80% of the donated blood. mobile collecting blood units at work places, educational institutes and cities are responsible for collecting the other 20%. 1). despite the fact that iran population has increased about 24% between 1996 and 2010 fig. 1 shows a 74% increase in blood donation by the donors during this period. in recent decade administration of whole blood in health centers of iran has drastically declined and therefore majority of donated blood are converted to blood components including rbc, platelets and plasma. due to high number of thalessemic patients in iran, more than 25% of packed rbcs produced by ibto are administered to these patients (4). demographic evaluation of iranian blood donors indicates that most of the donors are educated young male donors. currently about 28% of donors have a university degree showing an increase from 22% in 2002 (fig. 2). obviously in addition to educational activities of ibto increasing literacy rate among general population has contributed to this improvement. although it is reported that about 39% of blood donors worldwide are women (1), participation of women in blood donation in iran is very low and female donors consist only 6% of iranian blood donors (fig. implementation of more strict national standards for blood donation has increased percentage of deferred potential donors from blood donation. percent of potential donors who deferred from blood donation has increased from 14% in 2001 to about 22% in 2011 (fig. 2). causes related to safety of donors such as low blood pressure, low hemoglobin (5) and low weight are the main reasons for deferral of potential donors at ibto. however, in addition to this some very strict regulations regarding to potentially risky behaviors including travel to some specific regions or possible risky sex behaviors are among other reasons for increasing percentage of deferred potential donors. although this has caused to substantial deferral of the donors from donation, it has significantly improved safety profile of donated blood in iran. today developing countries face considerable obstacles to ensuring a safe blood supply and safe blood transfusions. the leading source of blood in the less developed and developing countries is replacement donors. however iran has successfully removed family donors from its national transfusion policy. since 2007 iran has reached to a 100% voluntary donation and ibto collect blood only from non remunerated voluntary blood donors (2). after reaching to 100% voluntary donation ibto this is mainly because repeat donors have a better safety profile (6) and ibto could rely on these donors for improving the blood safety profile at national level. serious blood shortages and the lack of a reliable donor base and inadequate quality assurance system for screening donors and testing donated blood contribute to an increased risk of transfusion - transmitted infections such as hiv and viral hepatitis. an inadequate stock of blood forces a reliance on unsafe replacement or paid donors and also increases the risk of the issue of blood without adequate testing. therefore, many recipients are exposed to avoidable, life - threatening risks through the transfusion of unsafe blood. according to data published by who (1) in 39 countries blood donations are still not routinely tested for transfusion - transmissible infections including hiv, hepatitis b, hepatitis c and syphilis and 47% donations in low - income countries the essential purpose of ibto is a sufficient supply of blood and blood components with maximum efficiency and minimum risk to the donors and recipients. the main purpose of donor selection procedures including donor interview and physical examination by a qualified physician and testing procedures are protection of the donors and minimizing the adverse reaction from blood donation. in iran in addition to the screening of the donors through interviewing, all donated bloods undergo lab testing for possible presence of important and known blood borne disease including hbv, hcv, hiv and syphilis. currently ibto uses serological (ab / ag) methods for screening of donated bloods and has recently implemented a pilot nat system in its screening protocol for donated bloods. percent of confirmed hbsag positive samples in blood donated by iranian donors has drastically decreased from 0.8% in 2002 to 0.20% in 2011. although this is partly due to national strategies on controlling hbv in general population (7), improving donor selection and screening strategies at ibto have also significantly contributed to this achievement. prevalence of confirmed hcv positive results in donated bloods has also decreased from 0.18% in 2002 to 0.06% in 2011. despite increasing prevalence of hiv in general population, ibto succeeded to reduce confirmed positive hiv samples in donated bloods from 0.007% in 2002 to 0.004 in 2011 (89). figure 3 shows trend of prevalence of important transfusion transmissible infections in ibto in past decade. although currently ibto is evaluating cost effectiveness of implementing a nat system for improvement of blood safety, it has recognized that implementation of an efficient look - back and hemovigilance system can contribute effectively to improve blood safety. therefore, ibto has also recently implemented a nationwide hemovigilance system as a powerful tool to improve transfusion safety. currently implemented look back system in ibto is mainly concern with reports about safety of the blood and blood components (10). every report indicating possible breach of safety of the donated bloods and/or patients receiving blood and blood components will be seriously traced through the product identity to the donors for appropriate actions. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors. | despite importance of blood transfusion services as life saving procedures, some countries are unable to meet their national requirements for blood and blood components in a timely manner. since establishment of iran blood transfusion organization (ibto) in 1974 as an integral part of national health system, iran has experienced a drastic improvement both in availability and safety of blood and blood products. iran now has not only reached to a 100% non remunerated voluntary blood donation but also secured a national self sufficiency of blood and blood components. efforts of ibto as the sole player of transfusion medicines in iran enabled the country for timely providing of life saving blood transfusion services for all iranian patients in need of such services. in order to meet the country s demand in 2011 about 2 million units of whole blood for a population of about 75 million collected by ibto. this indicates 26.2 donations per 1000 population. currently about 94% of blood donors in iran are 2535 years old males and contribution of female donors in blood donation is less than 6%. ibto screen all donated blood for important transfusion transmissible infections such as hbv, hiv, hcv and syphilis. prevalence of hbsag, hcv and hiv in donated blood in ibto in 2011 was 0.20%, 0.06% and 0.004% respectively. |
classically, copd is defined as chronic progressive airflow limitation that is partially reversible and causes significant extrapulmonary effects, culminating in a reduction in the functional capacity, social interaction, and well - being of the patients, negatively affecting their health - related quality of life (hrqol). (,) the literature indicates that the chronic symptoms of copd associated with the systemic manifestations of the disease are the major factors responsible for the worsening of hrqol. although the airflow obstruction is partially reversible, the disease control interventions are primarily aimed at improving the hrqol of patients, which thereby becomes an important measure to be assessed. (,) the administration of questionnaires to assess the hrqol of patients with copd has been widely discussed in the literature. the results inferred by the use of these instruments generate reliable, valid, and reproducible evidence. () disease - specific questionnaires designed to assess copd impact are widely used in clinical studies. however, these questionnaires are still considered complex and extensive, requiring a substantial amount of time to completion. chief among them are the saint george 's respiratory questionnaire (sgrq), () the chronic respiratory questionnaire (crq), () the breathing problems questionnaire, () and the airways questionnaire 20 (aq20), () all of which have been validated for use in brazil. recently, a group of researchers in the united kingdom developed and validated the copd assessment test (cat), which is a short, simple instrument for quantifying copd impact during routine clinical practice, in addition to aiding health status assessment and facilitating communication between patients and health professionals. () however, this questionnaire has not been validated for use in brazil. therefore, the objective of the present study was to validate a portuguese - language version of the cat for use in brazil and to assess the reproducibility of this version. this was a cross - sectional study, conducted between january and november of 2012, involving patients treated at the pulmonology outpatient clinic of the federal university of cear walter cantdio university hospital and patients eligible for pulmonary rehabilitation at the dr. carlos alberto studart gomes messejana hospital, both of which are located in the city of fortaleza, brazil. the present study was conducted in accordance with brazilian national health council resolution 196/96, which sets out the ethical principles for human research, and was approved by the ethics committees of the two hospitals (ruling no. the inclusion criteria were as follows : having been clinically diagnosed with copd with moderate to severe airflow obstruction and having an fev1/fvc ratio < 0.7 (as measured by spirometry), in accordance with the recommendations of the global initiative for chronic obstructive lung disease () ; being between 40 and 80 years of age ; being clinically stable (no hospitalizations or infections in the three months prior to the study) ; and being a smoker or former smoker with a smoking history greater than 10 pack - years. the exclusion criteria were as follows : experiencing an exacerbation of copd requiring therapeutic intervention ; and having other nonpulmonary diseases that are considered disabling, severe, or difficult - to - control. the cat consists of eight items, designated cough, phlegm, chest tightness, breathlessness, activity limitations at home, confidence leaving home, sleep, and energy. for each item, the patient chooses only one response option, which is scored from zero to five (appendix 1). at the end of the test, all response scores are summed, and then the clinical impact of copd is determined on the basis of the stratification scoring of the study that developed and validated the cat. () the results vary according to the range within which the scores obtained lie, being classified by clinical impact as follows : 6 - 10 points, mild ; 11 - 20, moderate ; 21 - 30, severe ; and 31 - 40, extremely severe. in order to test the inter - rater reliability of the cat, the patients were administered the questionnaire twice by two observers, 30 minutes apart, during the first visit (v1). the second visit (v2) occurred 7 days after the first one, and the cat was again administered to the same patients by only one of the observers in order to test the intra - rater reliability. also at baseline, the patients underwent the six - minute walk test (6mwt) and spirometry, as well as being administered the previously validated portuguese - language versions of the sgrq, () hospital anxiety and depression scale (hads), and modified medical research council (mmrc) dyspnea scale. spirometry was performed with a respiradyne ii plus spirometer (sherwood medical, st. louis, mo, usa), in accordance with brazilian guidelines, () using the reference values for the brazilian population established by pereira. () the 6mwt was performed in accordance with guidelines established by the american thoracic society, () with the patient being encouraged to walk as far as possible, in six minutes, on a 30-m level corridor. at the end of the test, the examiner recorded the distance covered. the hads consists of 14 items, of which 7 focus on the assessment of anxiety (hads - a) and 7 focus on the assessment of depression (hads - d). each item can be scored from zero to three, the maximum score on each subscale being 21 points. we adopted the cut - off points recommended for both subscales : 0 - 8 points, absence of anxiety and/or depression ; and 9 points, presence of anxiety and/or depression. () data were statistically analyzed with the statistical package for the social sciences, version 17.0 (spss inc., chicago, il, usa) and graphpad prism, version 6.0 (graphpad software inc., san diego, ca, usa). for the analysis of the reliability of the administration of the cat (v1 vs. v2), we used the intraclass correlation coefficient (icc). the wilcoxon test was used to compare the scores obtained from the administration of the cat by the observer in v1 and v2. in order to assess the agreement between v1 and v2, we used bland & altman plots. the instruments were tested for internal consistency by cronbach 's alpha coefficient. in order to validate the cat, we assessed the correlations (spearman 's correlation test) of its scores with those obtained on the sgrq (gold standard questionnaire), hads, and mmrc dyspnea scale, as well as with 6mwd and spirometry values. the study sample comprised 50 patients with copd, 26 of whom were female (52%). the mean age of the patients was 62.2 8.4 years, whereas the mean height and weight were 1.58 0.08 cm and 65.8 15.9 kg, respectively (table 1). table 1 characteristics of the sample of 50 copd patients studied.a there were no significant differences between the total scores obtained from the administration of the cat by the same observer in v1 and v2 (20.7 9.8 vs. 20.1 9.4 ; p = 0.8). the icc for intra - rater reliability (v1 vs. v2) was 0.96 (95% ci : 0.93 - 0.97). there were also no significant differences in the scores between the two observers of the study (20.7 8.5 vs. 21.2 9.0 ; p = 0.4). the icc for inter - rater reliability was 0.98 (95% ci : 0.96 - 0.98). the cronbach 's alpha coefficient for the cat was 0.98 (p < 0.001). bland altman plots showed good test - retest reliability and good inter - rater reliability (figure 1). figure 1 bland & altman plots. in a, intra - rater analysis : mean = 0.64 ; upper limit (ul) = 5.69 and lower limit (ll) = 4.41. in b, inter - rater analysis : mean = 0.26 ; ul = 4.80 and ll = 5.32. there were significant correlations between the cat score and the sgrq total and domain scores (0.51 < r < 0.64). the cat score correlated better with the mmrc dyspnea scale score than with the hads - d score (r = 0.48 vs. r = 0.39 ; p < 0.05 for both). the cat scores correlated negatively with 6mwd (r = 0.37) and with some pulmonary function measurements, such as fev1 in l (r = 0.38) ; fvc in l (r = 0.39) ; and fvc as % of the predicted value (r = 0.30 ; table 2). table 2 correlations (spearman 's correlation test) of the copd assessment test scores with the saint george 's respiratory questionnaire scores, spirometry values, six - minute walk distance, modified medical research council dyspnea scale scores, and hospital anxiety and depression scale scores. the present study showed that the portuguese - language version of the cat had excellent reliability when administered by different observers and when administered by the same observer at two distinct time points. bland altman plots showed that the cat has good test - retest reliability, as well as a high cronbach 's alpha coefficient and a good correlation with the sgrq (total and domain scores). the process of development and preparation of the cat arose from the need for new instruments for evaluating copd impact on hrqol and clinical practice in a simple, fast, and effective way. () various studies conducted in countries such as spain, () china, () south korea, and saudi arabia (,) have validated versions of the cat in their language and reported the instrument to have good reproducibility. we found no studies validating a portuguese - language version of the cat for use in brazil or assessing the reproducibility of the cat. during test - retest jones. () found high icc values and high cronbach 's alpha coefficients when they performed the first validation of the cat in a multicenter study. the cronbach 's alpha coefficient of 0.98 found in the present study shows that the questionnaire has excellent internal consistency. the questionnaires used for the validation of the cat were the sgrq, mmrc dyspnea scale, and hads. these instruments were used because they are related to some specific items of the cat, such as those concerning respiratory symptoms and limitations in activities of daily living (which are also addressed in the sgrq and mmrc dyspnea scale) and those concerning self - confidence and energy (which are also addressed in the hads and sgrq). in general, there were high and significant correlations between the cat scores and the sgrq total and domain scores. previous studies have demonstrated that the cat can measure the impact of copd on the lives of patients, showing correlations with standard questionnaires other than the sgrq, such as the crq and the clinical copd questionnaire. (-) regarding the pulmonary function variables, the present study showed that there was a weak but significant correlation of the cat scores with some spirometry values and 6mwd. this might represent a discrepancy between patient experiences and perspectives and the degree of respiratory dysfunction. other studies have also shown weak correlations between the cat scores and pulmonary function values, especially fev1. (,,,) regarding the sensation of dyspnea, the cat scores correlated significantly with mmrc dyspnea scale scores and sgrq symptom scores, showing that the cat can detect the patient 's respiratory complaints. there was no significant correlation between the cat scores and the anxiety scores. this might have occurred because, among the cat questions, only the items concerning energy and confidence leaving home address issues that are more directly related to the psychological component of the patient. the administration time of the cat in the present study was, on average, 104 s ; this occurred because of the simplicity of the questions and response options. while administering the cat to patients with copd, ringbaek. () found that it required a shorter administration time than did the sgrq and crq (107 s, 134 s, and 578 s, respectively). there was no back - translation analysis of the cat, since there is already a portuguese - language version, written in congruent, easy - to - understand language, ready for use. none of the items in the present version sounded odd in brazilian portuguese or seemed to be alien to the brazilian culture and society, and therefore there was no need for any significant adaptations. since the present study was cross - sectional in design, it was not possible to evaluate the responsiveness of the portuguese - language version of the cat to interventions, such as pulmonary rehabilitation. this can be considered a limitation of the study ; however, other studies have used the same approach. (,,,) following this line of thought and knowing that the portuguese - language version of the cat proved to be valid and reproducible, we believe that, in future studies, it will prove to be responsive. in conclusion, the portuguese - language version of the cat is a valid, reproducible, and reliable instrument for assessing the impact of copd on the lives of patients in brazil. realizar a validao e verificar a reprodutibilidade da verso em portugus do brasil do copd assessment test (cat). estudo multicntrico, no qual foram selecionados pacientes com dpoc estvel em dois hospitais de ensino na cidade de fortaleza, ce. a verso do cat foi aplicada duas vezes a 50 pacientes com dpoc por dois observadores independentes no mesmo dia. aps uma semana, esse mesmo questionrio foi aplicado novamente aos mesmos pacientes por um dos observadores. no primeiro dia, os pacientes foram submetidos prova de funo pulmonar e ao teste de caminhada de seis minutos (tc6) e responderam as verses validadas de qualidade de vida relacionada sade (qvrs). (sgrq), escala de dispneia modified medical research council (mmrc) e hospital anxiety and depression scale (hads). as reprodutibilidades interobservador e intraobservador foram excelentes (coeficiente de correlao intraclasse [cci ] = 0,96 ; ic95% : 0,93 - 0,97 ; p < 0,001 ; e cci = 0,98 ; ic95% : 0,96 - 0,98 ; p < 0,001, respectivamente). as disposies grficas de bland altman demonstraram boa confiabilidade teste - reteste. houve correlaes significativas do escore total do cat com os resultados de espirometria, tc6, sgrq, escala de dispneia mmrc e hads - depresso. a verso brasileira do cat um instrumento vlido, reprodutvel e confivel para a avaliao dos pacientes com dpoc na populao brasileira. a dpoc conceituada classicamente como uma limitao crnica e progressiva ao fluxo de ar, parcialmente reversvel, que ocasiona efeitos extrapulmonares significantes, o que culmina na reduo da capacidade funcional, socializao e bem - estar desses pacientes, influenciando negativamente a qualidade de vida relacionada sade (qvrs).(1,2) a literatura aponta que os sintomas crnicos da dpoc associados s manifestaes sistmicas da doena so os principais responsveis pela piora da qvrs. apesar de o quadro de obstruo ao fluxo de ar ser parcialmente reversvel, as intervenes para o controle da doena so principalmente destinadas melhora da qvrs dos pacientes, tornando - se assim uma importante medida a ser avaliada. (,) a aplicao de questionrios para avaliar a qvrs de pacientes com dpoc j foi amplamente discutida na literatura. os resultados inferidos pela utilizao desses instrumentos geram evidncias confiveis, vlidas e reprodutveis. () os questionrios especficos para a avaliao do impacto da dpoc so bastante utilizados em estudos clnicos ; porm, ainda so considerados complexos e extensos, demandando uma quantidade maior de tempo para que sejam respondidos. dentre eles, destacam - se o saint george 's respiratory questionnaire (sgrq, questionrio do hospital saint george na doena respiratria), () chronic respiratory questionnaire (crq), () questionrio para problemas respiratrios, () e airways questionnaire 20 (aq20, questionrio de vias areas 20),todos j validados no brasil. recentemente foi desenvolvido e validado para a lngua inglesa o copd assessment test (cat), que tem como caracterstica ser um instrumento curto e simples para a quantificao do impacto dos sintomas da dpoc na prtica clnica rotineira, alm de auxiliar na avaliao do estado de sade e facilitar a comunicao entre o paciente e os profissionais de sade.entretanto, esse questionrio ainda no conta com uma verso validada para uso no brasil. dessa forma, o objetivo do presente estudo foi realizar a validao e verificar a reprodutibilidade da verso em portugus do brasil do cat. foi realizado um estudo do tipo transversal com pacientes atendidos no ambulatrio de pneumologia do hospital universitrio walter cantdio da universidade federal do cear e com pacientes candidatos reabilitao pulmonar do hospital de messejana dr. carlos alberto studart gomes, localizados na cidade de fortaleza (ce), no perodo entre janeiro e novembro de 2012. o presente estudo seguiu os preceitos ticos segundo a resoluo 196/96 do conselho nacional de sade, que estabelece os princpios ticos para as pesquisas em seres humanos, sendo aprovado pelos comits de tica dos dois hospitais (parecer n 108.10/11 e parecer n 880/12, respectivamente). todos os pacientes deram consentimento formal para sua participao no estudo ao assinarem o termo de compromisso esclarecido antes de sua incluso. preencheram os critrios de incluso os pacientes com diagnstico clnico de dpoc com obstruo ao fluxo de ar de moderada a grave, apresentando valores espiromtricos da relao vef1/cvf < 0,7, conforme as recomendaes da global initiative for chronic obstructive lung disease () ; idade entre 40 e 80 anos ; estveis clinicamente (ausncia de episdio de internao ou infeco nos trs meses anteriores realizao do estudo) ; e fumantes ou ex - fumantes com histria de carga tabgica acima de 10 anos - mao. foram considerados como critrios de excluso a presena de exacerbao de dpoc que necessitasse de interveno teraputica e presena de outras doenas no pulmonares consideradas incapacitantes, graves ou de difcil controle. o cat composto de oito itens, denominados tosse, catarro, aperto no peito, falta de ar, limitaes nas atividades domiciliares, confiana em sair de casa, sono e energia. para cada item, o paciente escolhe apenas uma opo de resposta, cuja pontuao varia de zero a cinco (anexo 1). ao final do teste, soma - se a pontuao de todas as respostas e, assim, avalia - se o impacto clnico da dpoc conforme a pontuao de estratificao do estudo de desenvolvimento e validao do cat. () os resultados variam de acordo com a faixa dos escores obtidos, classificados da seguinte forma em relao ao impacto clnico : 6 - 10 pontos, leve ; 11 - 20, moderado ; 21 - 30, grave ; e 31 - 40, muito grave. para a avaliao da reprodutibilidade interobservador do cat, os pacientes completaram duas vezes o questionrio por dois examinadores em um intervalo de 30 minutos durante a primeira visita (v1). a segunda visita (v2) foi realizada 7 dias aps a primeira, sendo o cat aplicado novamente aos mesmos pacientes por somente um dos examinadores para a avaliao da reprodutibilidade intraobservador. ainda no primeiro dia, os pacientes foram submetidos ao sgrq, j traduzido e validado no brasil, () teste da caminhada de seis minutos (tc6), espirometria, hospital anxiety and depression scale (hads, escala hospitalar de ansiedade e depresso) e modified medical research council (mmrc, escala modificada do medical research council). a espirometria foi realizada com um aparelho respiradyne ii plus (sherwood medical, st. louis, mo, eua) e seguiu as normas de diretrizes brasileiras, () sendo utilizados como valores de referncia para a populao brasileira aqueles encontrados no estudo de pereira. () o tc6 foi realizado conforme as orientaes estabelecidas pela american thoracic society, () sendo o paciente estimulado a caminhar a mxima distncia possvel em um corredor de superfcie plana com 30 m de comprimento por um perodo de seis minutos. ao final do teste, o examinador registrou a distncia percorrida. a hads composta de 14 itens, dos quais 7 so voltados para a avaliao da ansiedade (hads - a) e 7, para a depresso (hads - d). cada um dos seus itens pode ser pontuado de zero a trs, compondo uma pontuao mxima de 21 pontos para cada escala. foram adotados os pontos de cortes recomendados para ambas as subescalas : 0 - 8 pontos, ausncia de ansiedade e / ou depresso ; e 9 pontos, presena de ansiedade e / ou depresso. () a dispneia foi avaliada por meio da escala mmrc. () os dados obtidos foram analisados estatisticamente atravs dos programas statistical package for the social sciences, verso 17.0 (spss inc., chicago, il, eua) e graphpad prism, verso 6.0 (graphpad software inc., san diego, ca, eua). para a anlise da reprodutibilidade da aplicao do cat (v1 vs. v2), foi utilizado o coeficiente de correlao intraclasse (cci). o teste de wilcoxon foi utilizado para comparar os escores obtidos na aplicao do cat pelo examinador na v1 e v2. a concordncia entre a v1 e a v2 foi avaliada a consistncia interna dos instrumentos foi avaliada por meio do coeficiente alfa de cronbach. para a validao do cat, foi avaliada a correlao de spearman de seus resultados com os obtidos no sgrq (questionrio padro ouro), tc6, espirometria, hads e mmrc. participaram do estudo 50 pacientes com dpoc, sendo 26 do sexo feminino (52%). a mdia de idade dos pacientes foi de 62,2 8,4 anos, enquanto as mdias de altura e de peso foram de 1,58 0,08 cm e 65,8 15,9 kg, respectivamente (tabela 1). tabela 1 caracterizao da amostra de 50 pacientes com dpoc estudados.a na comparao da pontuao total obtida entre a aplicao e a reaplicao do cat (v1 e v2) por um mesmo observador, no foram observadas diferenas significativas (20,7 9,8 vs. 20,1 9,4 ; p = 0,8). o cci intraobservador entre v1 e v2 foi de 0,96 (ic95% : 0,93 - 0,97). quando comparada a pontuao entre os dois examinadores do estudo, tambm no houve diferena significativa (20,7 8,5 vs. 21,2 9,0 ; p = 0,4). o coeficiente alfa de cronbach do cat foi de 0,98 (p < 0,001). em relao concordncia das pontuaes do cat obtidas pelos dois examinadores por meio da anlise da disposio grfica de bland altman, evidenciou - se uma boa concordncia entre a aplicao e a reaplicao do questionrio, assim como na comparao das pontuaes entre os dois observadores (figura 1). em a, anlise intraobservador : mdia = 0,64 ; limite superior (ls) = 5,69 e limite inferior (li) = 4,41. em b, anlise interobservador : mdia = 0,26 ; ls = 4,80 e li = 5,32. foram observadas correlaes significativas do cat com o escore total e os domnios do sgrq (0,51 < r < 0,64). o cat apresentou uma correlao melhor com a escala mmrc do que com hads - d (r = 0,48 vs. r = 0,39 ; p < 0,05 para ambos). houve uma correlao negativa do cat com o tc6 (r = 0.37) e com algumas medidas de funo pulmonar, tais como vef1 em l (r = 0,38) ; cvf em l (r = 0,39) ; e cvf em % do previsto (r = 0,30 ; tabela 2). tabela 2 coeficientes de correlao de spearman dos escores obtidos no teste de avaliao da dpoc com os resultados do saint george 's respiratory questionnaire, valores espiromtricos, distncia percorrida no teste de caminhada de seis minutos, escala modified medical research council e hospital anxiety and depression scale. o presente estudo mostrou que a verso brasileira do cat apresentou excelente confiabilidade tanto em sua aplicao por diferentes observadores quanto em sua aplicao por um mesmo observador em dois momentos. observada uma boa concordncia a partir das disposies grficas de bland altman entre as aplicaes intra e interobservador do cat, alm de um elevado coeficiente alfa de cronbach e uma boa correlao com os diferentes domnios e escore total do sgrq. o processo de desenvolvimento e elaborao do cat surgiu a partir da necessidade de novos instrumentos que avaliassem de forma simples, rpida e efetiva o impacto da dpoc na qvrs e na prtica clnica. () diversos estudos em pases como espanha, () china, () coreia do sule arbia saudita (,) j realizaram o processo de validao do cat e verificaram uma boa reprodutibilidade do questionrio. durante a aplicao e a reaplicao do questionrio, o cci observado foi de 0,98. jones.encontraram valores elevados para o cci e coeficiente alfa de cronbach ao realizarem a primeira validao do cat em um estudo multicntrico. o coeficiente alfa de cronbach de 0,98, observado no presente estudo, revela que o questionrio apresenta uma excelente consistncia interna. os questionrios / escalas utilizados para a validao do cat foram o sgrq, mmrc e hads. esses instrumentos foram utilizados porque esto relacionados a algumas perguntas especficas do cat, tais como sintomas respiratrios, limitao nas atividades da vida diria (itens tambm abordados no sgrq e mmrc), autoconfiana e disposio (itens tambm abordados no hads e sgrq). de um modo geral, houve correlaes elevadas e significantes do cat com os domnios e o escore total do sgrq. estudos anteriores j demonstraram que o cat capaz de mensurar o impacto da dpoc na vida dos pacientes, sendo evidenciadas correlaes com outros questionrios padres alm do sgrq, tais como o crq e clinical copd questionnaire. (-) quanto s variveis de avaliao da funo pulmonar, o presente estudo mostrou uma correlao fraca, porm significativa, do cat com alguns valores de espirometria e tc6. esse fato pode refletir a discrepncia entre as experincias e perspectivas do paciente e o seu grau de disfuno respiratria. outros estudos tambm evidenciaram a fraca correlao do cat com a funo pulmonar, principalmente com o vef1. (,,,) quanto avaliao da sensao de dispneia, houve correlaes significativas do cat com a escala mmrc e com o domnio sintomas do sgrq, mostrando que o cat capaz de captar as queixas respiratrias dos indivduos. isso pode ter ocorrido porque, entre as questes do cat, apenas os itens autoconfiana e energia abordam questes mais direcionadas para o componente psicolgico do paciente. o tempo de aplicao do cat na presente pesquisa foi, em mdia, de 104 s ; isso ocorreu pela simplicidade das questes e de opes de respostas. () ao aplicarem o cat pacientes com dpoc, observaram um tempo de resposta mais rpido quando comparado ao tempo de aplicao do sgrq e crq (107 s, 134 s e 578 s ; respectivamente). uma avaliao da retraduo do cat para o ingls, pois j existe uma verso em portugus com linguagem harmnica, de fcil compreenso e pronta para ser preenchida. nenhum item na presente verso apresentou discordncia com a lngua portuguesa ou com a realidade cultural e social do brasil, e, por isso, no houve necessidade de adaptaes importantes. como o presente estudo de tipo transversal, no foi possvel avaliar a responsividade da verso em portugus do cat a intervenes, como, por exemplo, reabilitao pulmonar. esse fato pode ser considerado como uma limitao do estudo ; porm, outros estudos j demonstraram essa abordagem. (,,,) seguindo essa linha de pensamento e sabendo - se que a verso em portugus mostrou - se vlida e reprodutvel, acredita - se que, em futuros estudos, ela se mostre responsiva. concluindo, a verso brasileira do cat vlida, reprodutvel e confivel quanto avaliao do impacto da dpoc na vida dos pacientes. | objective : to validate a portuguese - language version of the copd assessment test (cat) for use in brazil and to assess the reproducibility of this version. methods : this was multicenter study involving patients with stable copd at two teaching hospitals in the city of fortaleza, brazil. two independent observers (twice in one day) administered the portuguese - language version of the cat to 50 patients with copd. one of those observers again administered the scale to the same patients one week later. at baseline, the patients were submitted to pulmonary function testing and the six - minute walk test (6mwt), as well as completing the previously validated portuguese - language versions of the saint george 's respiratory questionnaire (sgrq), modified medical research council (mmrc) dyspnea scale, and hospital anxiety and depression scale (hads). results : inter - rater and intra - rater reliability was excellent (intraclass correlation coefficient [icc ] = 0.96 ; 95% ci : 0.93 - 0.97 ; p < 0.001 ; and icc = 0.98 ; 95% ci : 0.96 - 0.98 ; p < 0.001, respectively). bland altman plots showed good test - retest reliability. the cat total score correlated significantly with spirometry results, 6mwt distance, sgrq scores, mmrc dyspnea scale scores, and hads - depression scores. conclusions : the portuguese - language version of the cat is a valid, reproducible, and reliable instrument for evaluating patients with copd in brazil. |
a 2-year - old female grauer s gorilla, confiscated from poachers in goma, democratic republic of the congo, in november 2005, was group - housed in a facility with 6 other juvenile grauer s gorillas and 1 juvenile mountain gorilla (g.b. all gorillas had daily direct contact with one another and with human caretakers who provided hands - on care. in march 2007, 5 of three of the affected gorillas, including the gorilla from goma, were chemically immobilized for examination. all 3 gorillas exhibited multiple clear fluid - filled vesicles up to 2 cm in diameter that affected the mucosa of the lips and gingiva (figure 1, panel a). the biopsy sample was fixed in 10% buffered formalin ; the swab samples were stored frozen at 80c, and these specimens were shipped to the united states for diagnostic testing. vesicular stomatitis in a wild - caught juvenile grauer s gorilla (gorilla beringei graueri). gross lesions, histopathologic examination, transmission electron microscopy, and molecular screening confirmed human herpesvirus type 1 (hsv-1) as the etiologic agent. a) human hsv-1 lip lesions in a wild - caught juvenile grauer s gorilla. b) section of oral mucosa adjacent to a vesiculo - ulcerative lesion exhibits epithelial cell necrosis, cytoplasmic swelling, nuclear chromatin margination (sometimes with discrete cowdry type a inclusions), and multinucleated syncytia typical of herpesviral cytopathic effects (hematoxylin and eosin stain). c) electron micrograph of the same lesion demonstrates intranuclear, unenveloped virions 100 nm in diameter that are budding through the nuclear membrane to form enveloped virions 140 nm in diameter ; morphologic features of both are compatible with a herpesvirus. histologic examination of the biopsy sample showed variably thickened, ulcerated, nonkeratinizing, stratified squamous oral mucosae. margins of ulcers showed marked epidermal swelling (intracellular edema, ballooning degeneration) and large numbers of epithelial syncytial cells, often with marginated chromatin and smudgy intranuclear inclusion bodies filling the nucleus (figure 1, panel b.). inclusion bodies were present in individual cells in the stratum basalis and stratum spinosum adjacent to the ulcers. using transmission electron microscopy, we observed virions consistent with herpesvirus in shape and size within the nucleus of syncytial cells and budding through the nuclear membrane (figure 1, panel c.). histopathology and transmission electron microscopy findings were essentially identical to findings from human hsv-1 infections (7). dna was extracted from swab samples from this animal (8) and amplified by pcr using pan - herpesvirus specific primers designed to the dna polymerase gene (ul30) (9). a cloned and sequenced 731-nt amplicon (genbank accession no. kj396198) showed 99% identities with the dna and protein sequences of hsv-1 ul30, and 94% and 95% identities (dna and protein, respectively) to ul30 of hsv-2 (table). because sequences from gorilla - specific herpesviruses have not been annotated, we performed a phylogenetic analysis of the amplicon from the gorilla swab sample using the ul30 genes from broadly representative isolates from the 3 herpesvirus subfamilies. the gorilla - derived dna and protein (figure 2, panels a and b) exhibited the strongest phylogenetic relationship with hsv-1. alignments of human and nhp alphaherpesvirus representatives show that the region amplified with the consensus herpesvirus primers is a highly conserved region of ul30 (technical appendix figure). the sequence alignments strongly suggested that the herpesvirus dna in the oral lesion was hsv-1, although the gorilla - derived amplicon was an outlier in comparison with other hsv-1 isolates (data not shown). the relative divergence of the amplicon was due primarily to nucleotide changes encoding a 3-aa motif not found in any other annotated sequence (technical appendix figure). whether adaptation of the putative hsv-1 in the gorilla host represents a compensatory change to replication in the ectopic gorilla host is not known. kj396198) and predicted amino acid sequence of the corresponding region of hsv-1 (hhv-1 ; afi98948), hsv-2 (hhv-2 ; agi44412), mahv-1 (aat67222) ; pahv-2 (yp_443877), hhv-3 (varicella zoster virus ; abf21820), hhv-4 (epstein - barr virus ; yp_401712), hhv-5 (human cytomegalovirus ; aap37469), hhv6 (baf93477), hhv-8 (kaposi sarcoma virus ; acy00400), and ehv-1 (adi96155). dna alignments were performed by using the wilbur - lipman method of the megalign (dnastar, madison, wi, usa) sequence alignment program (ktuple = 3 ; gap penalty = 3 ; window = 20). protein alignments were performed by using the lipman - pearson method (ktuple = 2 ; gap penalty = 4 ; gap length penalty = 12). ehv, equid herpesvirus ; hsv, herpes simplex virus ; hhv, human herpesvirus ; mahv, macacine herpesvirus ; pahv, papiine herpesvirus. phylogenetic analysis of the nucleotide sequence (a) and predicted amino acid sequence (b) from the swab sample amplicon from the gorilla with the corresponding regions of hsv-1 (hhv-1 ; genbank accession no. afi98948) ; hsv-2 (hhv-2 ; agi44412) ; mahv-1 (aat67222) ; pahv-2 (yp_443877) ; hhv-3 (varicella zoster virus ; abf21820) ; hhv-4 (epstein - barr virus ; yp_401712) ; hhv-5 (human cytomegalovirus ; aap37469) ; hhv-6 (baf93477) ; hhv-8 (kaposi sarcoma virus ; acy00400), and ehv-1 adi96155). sequences were aligned by the clustal w method (http://www.clustal.org) by using the megalign (dnastar, madison, wi, usa) sequence alignment program (multiple alignment parameters : gap penalty = 15.00 ; gap length penalty = 6.66 ; delay divergent seqs (%) = 30 ; dna transition weight = 0.50. pairwise alignment parameters : slow - accurate ; gap penalty = 15.00 ; gap length = 6.66). ehv, equid herpesvirus ; hsv, herpes simplex virus ; hhv, human herpesvirus ; mahv, macacine herpesvirus ; pahv, papiine herpesvirus. to confirm our conclusion that the lesion was associated with hsv-1 infection, we used hsv-1specific primers to amplify a region of ul30 (aa 134246) outside of the amplicon defined by the pan - herpesvirus specific primers. amplification was positive for the oral swab sample dna with this second primer pair and for 3 human - isolated hsv-1 strains. sequence analysis of the amplicon demonstrated 100% and 89% sequence identity with hsv-1 and hsv-2, respectively (data not shown). on the basis of the results of the histopathologic features and molecular screening of the virus, we concluded that the stomatitis in this juvenile female grauer s gorilla confiscated from poachers in goma, democratic republic of the congo, was caused by hsv-1. alphaherpesvirus exposure in wild gorillas in this region has been reported (10), but to our knowledge, human hsv infection in wild - born captive gorillas has not been detected with molecular techniques. fatal hsv-1 infection in a captive - born, nursery - reared western lowland gorilla (g. gorilla gorilla) (11) has been reported. serologic tests for hsv-1 on samples collected before the outbreak from other gorillas in the confiscated gorilla s group showed that 2 clinically unaffected gorillas were seropositive for hsv-1, suggesting previous exposure to an alphaherpesvirus (12). however, serologic tests for hsv-1 and -2 exposure in the 5 clinically affected gorillas during this outbreak, including the gorilla from goma, were negative, which suggests these animals were experiencing their first hsv infections, and antibodies were not yet detectable. although the hsv infection status of the poachers who captured and initially held the gorilla from goma was unknown, as was the human hsv infection status of the caretakers (from whom samples were not collected) who had daily contact with this gorilla and her captive cohort, we can safely assume most of these persons were representative of the general human population and therefore infected because hsv-1 seropositivity has been documented at a prevalence of > 90% in the region (1315), and hsv infections are lifelong. our findings have major ramifications for the possible reintroduction of these confiscated gorillas into the wild (all remain in captivity) because such a management action might introduce a novel (human) pathogen to a nave population. screening wild grauer s gorillas and other gorilla populations for human hsv and other human pathogens will be critical to adequately assess the risk for reintroducing captive gorillas to wild populations of these endangered great apes. from a global health standpoint, our finding of human hsv-1 in a gorilla proves once again that pathogens transfer among human and nhp hosts. sequence alignment of the regions of ul30 from the gorilla amplicon, herpes simplex virus (hsv) 1, hsv-2, macacine herpesvirus 1, papiine herpesvirus 2, and varicella - zoster virus with a majority sequence presented representing the amino acids found in most of the individual sequences. | in 2007, we detected human herpes simplex virus type 1, which caused stomatitis, in a juvenile confiscated eastern lowland gorilla (gorilla beringei graueri) that had a high degree of direct contact with human caretakers. our findings confirm that pathogens can transfer between nonhuman primate hosts and humans. |
every government has the responsibility to provide access to the safe, effective and quality medication to its people. therefore it enacts specific laws to regulate every aspect of the drugs i.e., manufacture, sale, distribution, import and clinical research in humans. these regulatory measures are dynamic and ever evolving in consonance with the developing technologies. in india, there is broadening of regulation, since independence, from mere manufacture and sale to newer aspects like import, clinical research and adverse drug reaction monitoring. indian drug regulatory system has been built on the basis of principles enshrined in documents of ministry of chemicals and fertilizers, department of chemicals and petrochemicals [table 1 ]. basic principles of drug regulatory legislation quite evolved, though, history of drug regulation dates back to the british rule in india when majority of the drugs were imported from abroad. in early decade of 20 century, many unscrupulous foreign manufacturers flooded the indian market with spurious and adulterated drugs. in response to widespread gigantic quinine fraud ; the government, then, formed a drug inquiry committee under sir ram nath chopra also known as chopra committee whose recommendations later on tabled amidst growing protest in legislative assembly as the drug bill later on amended to the drugs and cosmetic act 1940 (d and c act) and drugs and cosmetic rules of 1945. this would be the central legislation that regulates india 's drug and cosmetic import, manufacture, distribution and sale. this also established the central drugs standard control organization (cdsco), and the office of its controller, the drugs controller general (india) (dcg(i)). the cdsco in the directorate general of health services, is a division in ministry of health and family welfare, government of india, headed by drug controller general of india (dcgi). it has four zonal, three sub - zonal and seven port / airport offices and six laboratories to carry out its activities. the drugs and cosmetic act, 1940 came into force from 1 april 1947. later on, government, in 1962, extended the regulatory provisions to the cosmetics, and finally the act came to known as drugs and cosmetic act 1940. drugs and cosmetic act has been divided in chapters, rules and schedules and is amended from time to time to control the safety, efficacy and quality of the drugs. it is an act to regulate the import, manufacture, distribution and sale of the drugs and cosmetics. manufacture and sale is under the respective states governments and union territories through their respective drug control organization, whereas setting standard, import, marketing authorization and monitoring of adverse drug reactions of a new drug is under central government. under chapter two of this act, one statutory board and a committee have been framed called drugs technical advisory board (dtab) and drug consultative committee (dcc) separately for modern scientific system of medicine and indian traditional system of medicine and a provision of central drug laboratory at central research institute, kasauli for testing drugs has been made in this act. dtab comprises of technical experts who advises central and state governments on technical matters of drug regulation. amendment, if any, to drug and cosmetic are made after consulting this board. drug consultative committee, which has central and state drug control officials as its members, ensures drug control measures in all over india. it is an advisory body for the central government, the state government and dtab. later on, after the recommendations of justice rajagopala ayyanger committee report (1958) came the era of process patent when india followed the socialist - inspired policies. it included product patents for non - chemical substances and process patent for chemical substances including pharmaceuticals, agrochemicals and food products. here is how it was done : indian companies were able to copy still - patented drugs by slightly altering a process of production resulting in booming india 's generic market. resultantly, western firms had apprehension in introducing their new innovative products in indian markets. in 1994, government signed the agreement on trade related aspects of intellectual properties (trips) to provide minimum protection to the intellectual property by the member states of world trade organization (wto). india amended the patent (amendment) bill before 2005 and extended its weak process patent to strong trips competent product patent system for pharmaceutical products.[3234 ] the indian government, realizing the potential of clinical research for new therapies, has modified and amended schedule y to the drug and cosmetics rules of 1945. however, schedule y was written with the generics industry in mind but increase entry of foreign pharmaceutical companies after the introduction of strict patent rules in the area of clinical research led the government to introduce many changes. the government recognized the importance of their regulation and thus developed ethical and regulatory guidelines. the indian council of medical research (icmr) issued the ethical guidelines for biomedical research on human subjects in 2000 and cdsco released indian good clinical practice (gcp) guidelines in 2001. without a regulatory requirement for gcp compliance, however, most companies did not invest in clinical trials. low quality data resulted in worsening india 's reputation. also, india 's strict bureaucratic system made it hard to manage simple tasks like getting customs clearance for the equipment 's. there were regulations which resulted in a phase lag, allowing companies to conduct a phase ii trial in india only if a phase iii study was going on somewhere else. but in 2005, cdsco made drastic revisions to schedule y to try to bring it on at par with internationally accepted definitions and procedures. the changes which took place were definitions for phase i - iv trials, which eliminated the phase lag.clear responsibilities for investigators ; and sponsors.requirements for notifying changes in protocol. then, application of product patent in 2005, recognizing individual 's innovations through the trade related aspects of intellectual property rights (trips) agreement, which india had signed in 1995, became effective. indian companies began to respect intellectual property rights, consistent with international standards. with the increasing faith in the system, companies flooded the market and more global trials came. lately, to decrease the review time of application from 16 weeks to 10 weeks the cdsco has introduced the fast tracking of clinical trials in 2006. the dcg (i) created two categories of applications ; category : (a) those also being conducted in countries with competent, mature regulatory systems, and category : (b) everything else. trials that fell into category a (received approval in the u.s., britain, canada, germany, south africa, switzerland, australia, japan and countries in the european medicines agency (emea)) would be eligible for fast tracking in india, with approval taking no more than two to four weeks. trials in category b would fall under more scrutiny ; with approval taking 12 weeks once an application is considered under category b, it, in any case, can not be shifted to category a. nearly all global trials are in the category a. the indian government gave another boost to the drug - development industry by canceling the 12 percent service tax on clinical trials in 2007. in february 2009, the industry applauded new regulations on exporting samples. previously, an export license was needed to get samples out of india but it has been removed now saving the time. a comprehensive understanding of regulatory issues is paramount due to dynamic changes at national and international levels, especially with reference to ongoing changes in good manufacturing practices (gmp), good clinical practices (gcp), good laboratory practice (glp) and good clinical laboratory practices (gclp). it is the responsibility of regulatory bodies in india to ensure a quality drug supply, their monitoring in the market and maintaining rights, safety and well - being of the clinical trials participants. towards this end, there are multiple regulatory bodies entrusted with the responsibility of ensuring production, pre - clinical, clinical trials and marketing of the drugs including pricing. the central drugs standard control organization (cdsco) under ministry of health and family welfare (moh and fw) prescribes standards for ensuring safety, efficacy and quality of drugs, cosmetics, diagnostics and devices in india. it also regulates the market authorization of new drugs and clinical trials standards ; supervises drug imports and approves license to manufacture. the department of chemical and petrochemicals of ministry of chemicals and fertilizers through national pharmaceutical pricing authority (nppa) sets or revise the prices of drugs ; maintains data on production, exports and imports ; and enforces and monitors the availability of medicines and also gives opinions to parliament on the related issues. it also ensures administration of drug policy, 1986 (updated in 2002) ; drug (price control) order, 1995 and pharmaceutical policy, 2002. there are two main ministries which regulate the drugs in india ; the ministry of health and family welfare concerned with public health and the ministry of chemicals and fertilizers on industrial policy. other ministries, though indirect, also have a role in regulation process ; ministry of environment and forests, ministry of finance, ministry of commerce and industry and the ministry of science and technology. regulation of patents, drug exports is governed by department of industrial policy and promotion and directorate general of foreign trade under the aegis of ministry of commerce and industry and the ministry of chemical and fertilizers respectively. licensing and quality control and distribution maintained by cdsco, moh and fw, department of biotechnology, ministry of science and technology (dst) and department of environment and forests especially after the decline of vulture population. apart from these there are other statutes and ministries [tables 2 and 3 ] that regulate the various aspects of drugs such as ; the poison act, 1919 ; the pharmacy act, 1948 ; the drug and magic remedies (objectionable advertisement) act, 1954 ; the narcotic drugs and psychotropic substances act, 1985 ; the insecticide act, 1968 ; the medicinal and toilet preparation (excise duties) act, 1956 and the drug (price control) order, 1995 (under the essential commodities act). some more laws having a bearing on pharmaceutical manufacture, distribution and sale in india are the industries (development and regulation) act, 1951, the trade and merchandise marks act, 1958, the indian patent act, 1970 and the design act, 2000 and the factories act, 1948. regulatory bodies in india involved in drug regulation statutes related to drug regulation lack of co - ordination between various agencies has resulted in approvals of around 33 drugs without any clinical trials between january 2008 and october 2010 as concluded by the 59 report of parliamentary standing committee on health and family welfare. however, clinical trials in india are regulated by the following guidelines / rules such as rule 122 a to e of drugs and cosmetic act, schedules y of drugs and cosmetic act and rules thereunder (amended in 2005), gcp guidelines issued by cdsco in 2001 and ethical guidelines for biomedical research on human subjects by icmr. rule 122 da of d and c act enshrines that clinical trials for a new drug / investigational new drug, whether for clinical investigations, or any clinical experiment by an institution shall be conducted except under, in accordance with, the permission, in writing of the licensing authority designated by central authority while rule 122 e of schedule y clearly defines new drug as new molecules as well as drugs used abroad but to be introduced for the first time in the country. new indication or new dosage form of an already approved drug is also considered as a new drug. clinical trials has been defined in rule 122daa of the d and c act in india as systemic study of new drugs in human subject(s) to generate data for discovery and/or verifying the clinical, pharmacological (including pharmacodynamics and pharmacokinetics) and/or adverse effects with the objective of determining safety and/or efficacy of the new drugs. investigators, ethics committee, sponsor, regulatory authority to ensure the safety and wellbeing of subjects and obtaining the quality data. new revised schedule y of d and c act is step of indian government towards harmonizing with the guidelines of international bodies such as world health organization (who) and ich guidelines based on declaration of helsinki. for conducting a clinical trial in india it is necessary to apply in prescribed form indian government has strengthened cdsco and dcg (i) office by expanding and reorganizing it along the line of fda. dcg (i) along with icmr have adopted many international guidelines for framing the local regulatory version such as guidelines. schedule y defines the clinical trials as the requirements and guidelines for import and manufacture of new drugs for sale or for clinical trials. it describes the details of application process for conducting clinical trials ; responsibilities of the sponsor, investigators and the independent ethics committee. a clinical trials can only be initiated after obtaining written permission from iec and dcg (i). application utilizes form 44 accompanied by the requirement [table 4 ], as per schedule y, such as documents pertaining chemical, pharmaceutical information, animal pharmacology, toxicology and clinical pharmacology data. other documents submitted with application are investigator 's brochure, trial protocol, case report form, informed consent form, patient information sheet and investigator 's undertaking. additional requirements for studies in special population, e.g., children, pregnant women, nursing women, elderly patients, patients with renal or other organ system failure, and those on specific concomitant medication(s). the protocol must be reviewed and approved by an iec, at minimum, seven members, including a medical scientist, a clinician, a statistician, a legal expert, a social scientist and a common person from the community. important forms and rules of drug and cosmetic act for clinical research once approved by dcg(i) and iec, an applicant can start clinical trial as per schedule y. product imported from other countries require a separate license called t - license (trial license), this license is valid for multiple shipments for one year and issued simultaneously with that of the clinical trial approval. a no objection certificate (noc) through separate application is required for shipping biological samples collected from the trial subjects out of india. both t - license and noc are granted within two to four weeks after approval of the study. the protocol of the study can be amended in between, if necessary, whether major or minor changes. but all amendments should be notified in writing to the dcgi along with the approval of ethics committee. no changes should be implemented, unless to eliminate hazards to the participating subjects, without prior written approval of ethics committee and the dcgi. however administrative and/or logistic changes in the protocol should be notified to the approving authorities within 30 days of implementation. all unexpected serious adverse events (saes) must be communicate to the dcg (i), directorate general of health services, cdsco, pharmaceutical company, sponsor, cro and all participating study investigators within 14 calendar days. sae notification must be submitted along with the proof that the same information has been submitted to the regulatory agencies in other countries where study is being conducted. in addition sponsor is required to submit progress report every 6 months as per the schedule y format. for studies which are prematurely discontinued for any reason, a summary report this report should provide a brief study description, the number of patients exposed to the drugs, dose and duration of exposure, details of adverse drug reactions, if any, and the reason for discontinuing the study or not pursuing the new drug application. with the increasing pressure to manage research and development (r and d) in pharmaceutical industry, the government is taking many more initiatives to regulate it. indian council of medical research (icmr) has started an online registration system of clinical trials in 2007 known as mainly western and southern cities in india are involved in clinical trials related activities such as mumbai, pune, ahmedabad, hyderabad, bangalore and chennai. although every sponsor is mandated to submit developmental safety update report and periodic safety update report but many drugs when exposed to larger masses during the marketing cause newer and unpredictable adverse effects. the government of india has launched the pharmacovigilance programme for india (pvpi) in july 2010 through cdsco to monitor such developments. the first phase was introduced in mid-2010 with an objective of inducting adr monitoring center (amc) in 40 medical colleges in one year ; 60 more amc centers are to be added by early 2012 and 100 by 2013. cdsco will provide the operational and logistic support such as internet connection, computer, telephone line and who will provide free softwares for adr monitoring such as vigibase and paniflow for adrs due to vaccines. indian pharmacopoeia commission (ipc), ghaziabad and provides all the technical supports to the cdsco office. adr reports generated at amcs are sent to coordinating center which collate, assess and incorporate them into pharmacovigilance database. clinical research activities by pharmaceutical firms are generally outsourced to clinical research organizations (cros). there are many issues associated with clinical trials like inadequate informed consent, weaknesses of irb / iec, inadequate compensation and lack of post - access treatment by these cros. cdsco has put up a registration criteria and has issued a draft rules for these mushrooming cros registration. as per schedule y-1, a cro can carry out clinical research activities for five years if it is duly registered. review process of clinical trials related applications by cdsco has been very slow earlier but it has been speeded up by dividing applications in two categories ; category a is a category where applications are received from the countries where review processes are matured and follow international ethical norms. the median review process has reduced from 16 weeks to 10 weeks and is targeted to be 45 days only. the introduction of e - governance initiatives has made file tracking system and daily dispatch of reports more transparent and accountable. in 2008 the cdsco started inspection of clinical trials in india. but full fledge onsite inspection started quite recently in 2010 by us - fda trained indian inspectors and regulatory experts to uphold the quality of the trials. cdsco has also started a clinical trial inspection programme and released a guidance document for clinical trial inspection of the site of clinical trial, sponsor and cros facilities as well as providing information to the investigators, sponsors and cros about procedures of inspection and follow up action. despite good guidelines in the book, many cases including anticancer drug study in kerala, recruitment of poor family 's children at aiims resulting in death of around 49 kids points to the finger at the weaknesses of institutional review board / independent ethics committee. furthermore, many startling lapses on the part of indian drug regulatory bodies have surfaced after the observation of 59 report of the parliamentary standing committee on health and family welfare. it is now obvious that much more needs to be done to prevent the unnecessary approvals of drug under waiver clause of 122a, 122b, 122d, 122da, 122daa and 122e of the schedule y rules and blocking the approvals of fdcs which are already banned in other countries. in our view the indian regulatory agency still have much to learn and realize the need for availability of safe medication in the public domain. there is a need to introduce new updated dynamic monitoring tools such as adverse events reporting system (aers) inbuilt in its website and risk evaluation and mitigation strategies (rems) by the pharmaceutical companies as needed by fda. it needs to frame a more systematic review process of drugs before approval as well as framing a priority review setup for indian specific drugs discovery and marketing. | the central drugs standard control organisation and its chairman drug controller general of india are bequeathed to protect the citizens from the marketing of unsafe medication. the startling findings, of the 59threport of the parliamentary standing committee on health and family welfare, have uncovered the lax standards followed by the regulatory authorities in india. the growing clinical research after the product patents rights for the pharmaceutical industries as per the trade related aspects of intellectual property rights agreement and adverse drug reaction monitoring of the marketed drugs have raised many ethical and regulatory issues regarding the promotion of new drugs in indian markets. many controversial group of medicines ; unauthorised and irrational fdcs not relevant to india 's medical needs, are available which are not sold in any of the countries with matured regulatory bodies. it becomes vital to understand the history, growth and evolution of the regulatory aspects of drugs which are handled by multiple ministries and departments of the government of india. although amendment to schedule y, registration of contract research organisations, registration of clinical trials, speeding up review process, pharmacovigilance (phv) programme for india and inspection of clinical trial sites have been started by the various regulatory agencies. however due to casual approach in marketing approval for sale of the drugs, the unethical steps taken by some pharmaceutical companies and medical practitioners has reiterated the need to get appropriate understanding of present regulation of drugs and clinical research especially regarding the practical rules and regulations. |
endocardial fibroelastosis (efe) is a disorder of fetuses and infants of unclear etiology that is characterized by deposition of collagen and elastin, and that leads to ventricular hypertrophy and diffuse endocardial thickening.1) however, a recent study has shown that even in adult heart recipients, efe is a relatively frequent finding in histological samples of explanted hearts.2) the basic feature of the disease is the formation of fibrous tissue on the endocardium in the inflow tract of the right or left ventricle or both, leading to partial obliteration of the ventricle with decreased ventricular distensibility and impaired diastolic filling.3) in korea there were no reports of a case of efe in adults. therefore, we now report the case of a 57-year - old woman with efe confirmed by histological examination of her explanted heart after heart transplantation. she had been diagnosed with restrictive cardiomyopathy secondary to endomyocardial fibrosis when she was 38 years old. afterward, she had remained in good functional status until she was 53-years - old. when the patient was admitted to our hospital, she complained of dyspnea on exertion { new york heart association (nyha) functional class 3 } and abdominal distension over the last several months. the initial blood pressure was 112/56 mmhg, the heart rate 67/minute, the respiratory rate 18/minute, and temperature 35.9. on physical examination, increased jugular venous pressure with kussmaul 's sign and decreased breathing sounds in both lower lung fields were observed. in addition, there were a shifting dullness on her distended abdomen and peritibial pitting edema (grade 3). laboratory findings showed anemia (hb 7.9 g / dl), hypoalbuminemia (2.0 g / dl), and elevated n - terminal pro - b - type natriuretic peptide level (359.0 pg / ml). the electrocardiogram showed no specific abnormality. on the chest x - ray, bilateral pleural effusion the echocardiogram showed severe diastolic dysfunction (grade 4) with normal ventricular size and normal systolic function. coronary angiography was performed and showed normal coronary arteries. on cardiac catheterization, mild pulmonary hypertension (pulmonary arterial pressure 40/13 mmhg), diastolic equilibrium of four chambers, and dip and plateau configuration of ventricular pressure were observed. on cardiac mri, a contrast - enhanced delayed myocardial image demonstrated endocardial hyperenhancement in diffuse area of both ventricles (fig. finally, the patient received a heart transplantation 5 months later because of progressive heart failure. histological examination showed irregularly thickened endocardium with fibrosis and elastosis in the left ventricle, compatible with the diagnosis of efe (fig. her one - year follow - up echocardiography and cardiac biopsy showed normal cardiac function and no allograft rejection. efe usually occurs in infants and young children who present with signs of congestive heart failure. efe is an adverse prognostic factor for children and adolescents with dilated cardiomyopathy.4) there have been many reports about efe presenting in fetuses, infants and children including a korean report, in which efe was proved by autopsy after sudden unexpected death of the infant.5 - 7) there was a korean paper about idiopathic restrictive cardiomyopathy in children, but the pathologic diagnosis was not investigated.8) several cases with efe in young adults have also been reported in other countries.4)9) interestingly, however, our patient showed an unusually benign course despite extensive fibroelastosis and remained in good functional status until her 50s.. it may be secondary to congenital heart disease, mainly left ventricle obstructive malformations and hypoplastic left ventricle. as for primary efe, different pathogenetic mechanisms have been suggested, such as genetic factors, viral infections, carnitine deficiency, or transplacental crossing of maternal antibodies (anti - ro, anti - la). it has also been suggested to be a nonspecific response to chronic myocardial dysfunction.4) in our case, we could not find any etiology for the efe. the diagnosis of efe is difficult to establish because clinical symptoms, electrocardiographic findings and even echocardiographic findings are nonspecific.10) there have been papers that concluded that cardiac mri and ct could be useful in establishing the presence of efe.10 - 12) stranzinger.10) reported that, on mri, efe manifested at the endocardial surface as a rim of hypointense signal in the perfusion sequences and as a rim of hyperintense signal in the myocardial delayed - enhancement sequences. on mri for our case, we also noticed a hyperintense signal along the endocardium in the contrast - enhanced delayed myocardial image. the mri image was obtained using a balanced turbofield echo technique after injection of gadobutrol. as the gross specimens of other reported cases showed,4)13) we could see the typical efe finding referred to as a whitish fibrous tissue lining the endocardium.14) in summary, we report, for the first time in korea, the case of a 57-year - old woman with primary efe presenting as heart failure. we observed very similar findings in her mri image and in the examination of her explanted heart with previous cases of efe reported in other countries. | endocardial fibroelastosis (efe) is characterized by deposition of collagen and elastin leading to ventricular hypertrophy and diffuse endocardial thickening. here we report (for the first time in korea) the case of a efe presenting with heart failure. the patient was a 57-year - old woman who had complained of dyspnea on exertion { new york heart association (nyha) functional class 3 } and abdominal distension at the time of hospital admission. echocardiography showed severe diastolic dysfunction with normal systolic function. on mri, the contrast - enhanced delayed myocardial image demonstrated hyperenhancement in the endocardium. owing to progressive heart failure, the patient was transplanted. histological examination of the explanted heart showed irregularly thickened endocardium with fibrosis and elastosis in the both ventricles, compatible with the diagnosis of efe. |
plasma cell gingivitis (pgc) is a rare disease of gingival tissues which is difficult to treat. it has a higher rate of reoccurrence and needs a detailed and careful analysis of etiology. further, its association with chelitis is rare, only few cases have been reported and the condition with this presentation poses a diagnostic dilemma. this paper reports a 16 year old male with a complaint of bleeding and swelling of gingiva since 3 years. the gingival enlargement occurred on facial aspect of upper and lower anterior teeth involving attached gingival. he also presented with swelling of both lips which was recurrent and for the same duration of 3 years. based on clinical features and histopathological findings, a diagnosis of plasma cell gingivitis with inflammatory chelitis was made. a detailed history of possible allergen exposure was taken and patch test was conducted to identify any such allergens. plasma cell gingivitis (pcg) is a rare inflammatory benign condition of gingival tissue characterized by a marked infiltration of plasma cell into sub epithelial connective tissue (1). exact etiology of pcg is still obscure and some believe it is a hypersensitivity reaction to certain allergens such as mint - candy or herbal ingredients of toothpaste, red pepper, cinnamon, clove, khat leaves and food flavouring agents (2, 8). the occurrence of pcg is associated with a number of allergens and hence it is also known by various names such as allergic gingivostomatitis, stomatitis venenata, irritant contact stomatitis, atypical gingivostomatitis. we here report a 16 year old boy with plasma cell gingivitis and cheilitis possibly granulomatous secondary to some contact allergen. the coexistence of both conditions together suggests that they have a common etiopathogenesis and the fact that this association is rare needs reporting. however, on conducting a search on medline database for publications in english language on 29 january 2013 with keywords plasma cell gingivitis and inflammatory chelitis, we came across only one such case report similar to ours. a 16 year old, 45 kg student of indian nationality was referred from the department of dermatology to the department of dental surgery for gingival enlargement and bleeding gums along with swelling of lips. on collecting a detailed medical and drug history, the patient had a mixed diet and his blood investigation and radiographic examination were within normal limits. his complaints were bleeding from gums for the past 3 years spontaneously or following minor trauma of brushing. the gingival enlargement was persistent and progressed slowly to reach its present size and extent involving upper and lower anterior on buccal aspect. swelling of lips was temporary initially lasting for few days with recurrences after 23 weeks involving the upper lip more than the lower one. however, since the past 6 months, it became persistent and was slowly progressing. the patient reported history of not using herbal toothpastes, khat leaves and mint - candy. on clinical examination, the patient 's lips were diffusely enlarged without any surface change, the upper lip more than the lower lip with loss of philtrum. the inner surfaces of both lips were smooth, and on squeezing, did not show any pin - point oozing of saliva. attached gingiva of facial aspect was involved from mesial aspect of maxillary right second premolar to left second premolar and mesial aspect of mandibular right second premolar to left second premolar. pseudo pockets were present in the upper and lower incisors and in the canine region. differential diagnosis kept for lip swelling was granulomatous chelitis and plasma cell chelitis, and for gingival enlargement was plasma cell gingivitis. a score of 3.7 of oral hygiene index (ohi) suggested poor oral hygiene and sub gingival band of calculus was present. complete blood counts, peripheral blood picture and routine biochemical investigation results were within normal limits. an external bevel gingivectomy was carried out to remove the excess gingival tissue and was sent for histopathology examination. protective periodontal dressing was applied and the patient was instructed not to brush over it and to return after 7 days. simultaneously, a punch of biopsy was taken from the mucosal surface of upper lip. he was also advised to refrain from possible contact with allergens including mint - candy, herbal tooth pastes and spices. after a week, significant reduction in lip swelling was reported and philtrum became visible. the present case report is of rare disorder of gingival origin associated with granulomatous chelitis. this is a very rare case and to the best of our knowledge is the second case reported in the literature. an interspeciality approach of a periodontist and dermatologist is essential to manage this type of condition. no relevant drug history was present and this excluded the possibility of drug induced gingival enlargement. granulomatous gingivitis was ruled out by absence of multinucleated giant cells on histopathologic examination, and no association with systemic condition such as crohn disease or wegener granulamatosis was observed. clinical appearance of pcg is striking ; it is presented as fiery red erythematous lesion involving the attached gingival extending to mucogingival junction (9, 10). diagnosis is made by selective exclusion through haematological screening, allergen test and histopathological examination. remission of lesion on removal of suspected allergen confirms the allergic gingivosomatits when allergen is not identified. it is termed idiopathic gingivostomatitis (11). on conducting a literature search on pubmed data base janam reported a 15 year old female with a complaint of mild reddish discoloration involving her upper lip around 5 years back, which progressively increased in size without any apparent discomfort. gingival changes started at around the same time, the gingiva appearing fiery red and friable with an edematous consistency and granular surface texture (12). their finding is similar to our case, in which we report a 16 year old male with a similar complaint. unlike the case reported by janam, in the present case a lip biopsy was taken to confirm the lip lesion. the histopathological examination gave us a definitive and valid diagnosis for lip lesion. also, an indian standard series allergen patch test was done to rule out any standard allergen as a cause for present case. furthermore, our case report provided a follow - up time of more than a year to show stable result of surgery. gingivitis, chelitis and glossitis have been described as a triad for plasma cell gingivostomatitis (1). in the present case, removal of gingival lesion by gingivectomy resulted in reduction of lip swelling. this suggests that the combined lesion of lip and gingiva could be due to contact dermatitis as inner aspect of lip was in close contact of gingiva. granulomatous chelitis, actinic chelitis and plasma cell chelitis was considered as differential diagnosis for lip lesions (14). cinnamonaldehyde in chewing gums was reported by kerr. as an etiological factor for plasma cell gingivitis, chelitis and glossitis (3). our case report showed similar results to that of janam for lip and gingival lesions (12). results regarding gingival lesion were similar to that of owings, silverman, and farrier (11, 13, 14). histopathology of gingival tissue revealed dense infiltrate of plasma cell in subepithelial connective tissue with peculiar cart wheel appearance and that of lip showed chronic inflammatory infiltrate of lymphocytes without specific granulomas. thus, the final diagnosis was plasma cell gingivitis with inflammatory cheilitis. however, absence of granulomas in lip biopsy can not be taken as strong evidence against granulomatous cheilitis as they are not always present and history of initial remissions and relapses was in favour of granulomatous cheilitis. patient is currently not under any medication and is kept on close follow up of 3 months. the contour and texture of gingival tissues obtained after surgery were stable and no reoccurrence was seen even after 1 year. lip swelling gradually came down and the lip lesion has also regressed completely and stably for past 1 year. diagnosis by clinical exclusion, haematological and histopathological examination helps to arrive at diagnosis of pcg and inflammatory chelitis. interdepartmental management of case is crucial to attain treatment success and close follow - up is required to maintain the results achieved. clinical significance : plasma cell gingivitis is a difficult entity to manage. it has a high recurrence and poses a severe esthetic and functional problem on the patient, and further association with chelitis make it more problematic for the patient. finding the allergen and its discontinuation is a prime step in the successful management of the case. association of pcg and chelitis is very rare and proper involvement of periodontist and dermatologist is necessary to treat the condition. | backgroundplasma cell gingivitis (pgc) is a rare disease of gingival tissues which is difficult to treat. it has a higher rate of reoccurrence and needs a detailed and careful analysis of etiology. further, its association with chelitis is rare, only few cases have been reported and the condition with this presentation poses a diagnostic dilemma.case reportthis paper reports a 16 year old male with a complaint of bleeding and swelling of gingiva since 3 years. the gingival enlargement occurred on facial aspect of upper and lower anterior teeth involving attached gingival. he also presented with swelling of both lips which was recurrent and for the same duration of 3 years.discussionbased on clinical features and histopathological findings, a diagnosis of plasma cell gingivitis with inflammatory chelitis was made. a detailed history of possible allergen exposure was taken and patch test was conducted to identify any such allergens. other conditions were ruled out by blood investigation, detailed medical and drug history.conclusiona close collaboration between periodontist and dermatologist is essential to manage such a case. |
the incidence of liver injury is continuously rising due to increase in the incidence of road traffic accidents usually as a part of poly - trauma. mortality of liver trauma has considerably decreased due to improvement in the diagnostic and therapeutic strategy of such patients with current mortality fluctuating around 10% depending upon type and grade of injury. over the last several decades, non - operative management (nom) of blunt hepatic injuries has been demonstrated, in selective patients, to be both safe and highly successful. many studies have confirmed that 8090% of all blunt liver injuries may be managed without laparotomy.[24 ] from the 1990s onwards in the emergency room of trauma centers, before a ct evaluation, surgeons or emergency physicians have routinely been performing focused assessment sonography for trauma (fast) in the recognition of the presence of intra - abdominal free fluid. regardless of the initial ultrasonography (us) result, repeated sonographic examination could be performed in patients who were initially managed non - operatively, to monitor quantitative changes in fluid collection or detect new findings not initially detected. the selection of further appropriate imaging studies, after initial and indispensable ct evaluation, may be institution- or physician - specific, as expert interpretation is, perhaps, the most important factor in deciding which imaging study to employ. the appropriate approach should be determined by local resources, expertise, clinical conditions, and, furthermore, by instrumental location. restriction of physical activities has been recommended by several authorities in an attempt to prevent complications. however no clear guidelines exist regarding the time frame for these restrictions or follow - up scans. even richardson shares the same opinion in a recent discussion at the american college of surgeons 90 annual clinical congress, new orleans, la, october 2004. he pointed out that there are numerous unresolved questions about liver and spleen non - operative management (nom), in particular in the role of follow - up scans. keeping in view the underlying trauma of a soft organ, it seems logical to restrict strenuous activity for 56 months, even though the recommendation is not supported by any sound clinical date. so it becomes imperative to emphasize on young people to avoid any strenuous work for at least 56 months who invariably are impatient to resume their strenuous physical activity. this common recommendation is given in order to safeguard them against re - injury, which might, arguably, have a higher failure rate with nom. there is, however little data available which could nicely explain the time taken by the injured liver to undergo the reparative process. as a matter of fact, the knowledge of the healing time of blunt hepatic injuries is based on presumptive time of scar development ascertained in a few young patients or animal models. the initial report on conservative management of blunt liver injury in four pediatric patients was published in 1972 by richie and others. since then several other published studies have supported this approach, which has become the treatment of choice for stable patients of all ages with blunt liver injury. the purpose of study was to evaluate the role of non - operative management of liver injury due to blunt abdominal trauma. criteria for selecting a patient for non - operative management of liver injury are : hemodynamic stability : we define as a)good volume pulseb)rate less than 100 beats per minutec)systolic blood pressure of more than 90 mmhg no demonstrable peritoneal signs on abdominal examination, which means a)abdomen moving comfortably with respirationb)coughing did not cause any aggravation or localization of painc)palpation would reveal a soft abdomen with no tenderness or rebound tenderness in any quadrant. the absence of any intraperitoneal or retroperitoneal injuries on computerized axial tomography scans requiring operative intervention. hemodynamic stability : we define as a)good volume pulseb)rate less than 100 beats per minutec)systolic blood pressure of more than 90 mmhg rate less than 100 beats per minute systolic blood pressure of more than 90 mmhg no demonstrable peritoneal signs on abdominal examination, which means a)abdomen moving comfortably with respirationb)coughing did not cause any aggravation or localization of painc)palpation would reveal a soft abdomen with no tenderness or rebound tenderness in any quadrant. abdomen moving comfortably with respiration coughing did not cause any aggravation or localization of pain palpation would reveal a soft abdomen with no tenderness or rebound tenderness in any quadrant. the absence of any intraperitoneal or retroperitoneal injuries on computerized axial tomography scans requiring operative intervention. all patients with liver injury from blunt trauma abdomen between 1 january 2000 and 1 january 2010, who were selected for non - operative management were studied. ethical committee clearance was obtained from the local review board and informed consent was taken from every patient. a total of 198 patients presented with liver injury due to blunt abdominal trauma. of these hemodynamic instabilityperitoneal signs on abdominal examinationpresence of associated abdominal injuriesmoore 's grade v and vi injury hemodynamic instability peritoneal signs on abdominal examination presence of associated abdominal injuries moore 's grade v and vi injury hundred and three (67.77%) patients were males and 49 (32.23%) were females. most of the injuries were because of road traffic accidents 124/152 (81.57%) [table 1 ]. all of these patients (46 in number) had other associated visceral injury on laparotomy. hemodynamically stable patients were subjected to computed tomography with i / v contrast enhancement immediately after ultrasonography [figures 14 ]. patients were categorized into different grades of injury according to moore 's grades [table 2 ]. baseline investigations like hemogram, kidney function test, liver function test, x - ray chest, cervical spine and pelvis were done. patients were subjected to intensive hemodynamic monitoring for first 48 h in surgical intensive care. they were kept on intravenous fluids as per central venous pressure and antibiotics empirically (third - generation cephalosporin). serial hemoglobin and hematocrit levels were measured every 24 h. repeated abdominal assessment was done by clinical and ultrasonic means. ct showing grade i liver injury ct scan showing grade ii liver injury ct scan showing grade iii injury ct scan showing grade iv liver injury moore 's classification of liver injury hemodynamic instabilityperitoneal signs on abdominal examinationpresence of associated abdominal injuriesmoore 's grade v and vi injury hemodynamic instability peritoneal signs on abdominal examination presence of associated abdominal injuries moore 's grade v and vi injury hundred and three (67.77%) patients were males and 49 (32.23%) were females. most of the injuries were because of road traffic accidents 124/152 (81.57%) [table 1 ]. all of these patients (46 in number) had other associated visceral injury on laparotomy. hemodynamically stable patients were subjected to computed tomography with i / v contrast enhancement immediately after ultrasonography [figures 14 ]. patients were categorized into different grades of injury according to moore 's grades [table 2 ]. baseline investigations like hemogram, kidney function test, liver function test, x - ray chest, cervical spine and pelvis were done. patients were subjected to intensive hemodynamic monitoring for first 48 h in surgical intensive care. they were kept on intravenous fluids as per central venous pressure and antibiotics empirically (third - generation cephalosporin). serial hemoglobin and hematocrit levels were measured every 24 h. repeated abdominal assessment was done by clinical and ultrasonic means. ct showing grade i liver injury ct scan showing grade ii liver injury ct scan showing grade iii injury ct scan showing grade iv liver injury moore 's classification of liver injury mean age was 32.8 years. physical examination picked pallor in 10.52% of the patient. there were 30 patients with grade i injury, 63 with grade ii, 26 with grade iii and 33 with grade iv injury [table 3 ]. head injury was the most common associated injury followed by skeletal injury and chest injury [table 4 ]. grade iii and iv injury had greater requirement of blood transfusion as compared to grade i and ii. the length of hospital stay was 5 to 17 days with an average of 8.6 days. blood culture was done in patients who developed fever any time during their stay in hospital. primary repair of liver laceration was done using liver needle and co - opting sutures. two of them were treated with broad spectrum antibiotics and two with ultrasound - guided catheter drainage. there has been a significant shift from operative to non - operative management of liver injuries in the past two decades. this significant shift towards non - operative management was because of high precision of diagnostic algorithm given by ultrasonography, computed tomography, angiography (cta, mra). as a result of these diagnostic modalities and availability of critical care units, management of liver injuries has shifted from operative to non - operative means. we favored conservative management in hemodynamiccaly stable patients with no peritoneal signs, no other associated abdominal injury requiring laparotomy. laparotomy is indicated in patients with hemodynamic instability with signs of massive bleeding into peritoneal cavity and patients with other intra - abdominal organ injury requiring laparotomy. karp. presented one of the first studies with a long - term follow - up after liver injury and nom. in their study, patients had repeated ct scans at 1214 days, 6 weeks, 2 months, and 4 months after their injury. described 13 children with blunt liver injuries managed non - operatively who had follow - up us and/or ct every 24 h until stabilization. the most appropriate time for documenting the resolution of liver injuries with ct in children has been suggested to be 3 months for mild injuries, 36 months for moderate injuries, and 9 months for the most severe injuries. the author, however, suggests the necessity of restrictions of full activities until a ct examination shows complete healing. in 1990, dulchavsky. investigated liver healing in both canine and porcine models, and they found that hepatic repair by secondary intention is rapid and complete. however, this model was a surgical transverse incision made with a smith single - edge razor. since then, some articles have discussed follow - up imaging studies and many authors have questioned the need for routine ct or us follow - up. all retrospectively studied ct and us in both adults and children with blunt hepatic injury. they stated that follow - up imaging does not contribute to the final outcome and that, with an asymptomatic patient, either us or ct does not provide additional information. the two major objections to routine non - operative management of blunt hepatic injuries the unnecessary use of excessive blood transfusion and the prolonged length of stay have never materialized. pachter and others report of multicenter (14 institutions) experience with 495 patients and croce and others report documented mean transfusion rate 1.9 unit / patient.[1820 ] mean hospital stay in reports by pachter and others, with 495 and 404 patients in two successive studies was 13 days.[1820 ] our mean hospital stay was 8.6 days. in instances where in comparable groups of patients underwent operative intervention, three authors (boone and others, sherman and others, and meredith and others) noted that intensive care unit stay and mean length of hospitalization for these patients were either comparable or exceeded that of patients managed non - operatively.[2123 ] a known disadvantage of non - operative management of liver trauma is possibility of missing an associated intra - abdominal injury with a reported incidence of 3%. another disadvantage of conservative management is the development of peri - hepatic abscess which can be safely managed by percutaneous drainage or conservative treatment. based on this study we recommend that non - operative management of liver trauma is safe and effective method of management in hemodynamically stable patients with grade i to iv liver trauma. | aim : there has been a steep rise in incidence of liver injury in the past few years because of increase in incidence of road traffic accidents. the aim of this study was to evaluate the role of non - operative management of liver injury due to blunt abdominal trauma.materials and methods : all patients with liver injury from blunt trauma abdomen were studied between january 2000 and january 2010. a total of 152 patients with liver injury were put on conservative management. hundred and three (67.77%) patients were males and 49 (32.23%) were females with an age range of 15 - 60 years (32.8 years). most of the injuries were because of road traffic accidents (81.57%). liver injuries were graded according to moore 's classification using computed tomography. patients with grade v and vi were excluded from the study. patients who were unstable hemodynamically on admission were also excluded from the study.results:there was no mortality in our series. eight patients needed exploration because they developed hemodynamic instability. four of the patient developed post - operative liver abscess which was treated conservatively.conclusion:non-operative management of liver injury due to blunt trauma abdomen is a safe, effective and treatment modality of choice in hemodynamically stable moore 's grade i to grade iv injury. |
according to the recently published guidelines for the treatment of head and neck cancer all patients with t1-t2 laryngeal cancer should be treated, at least initially, with the intent of larynx preservation. the recommended strategies for early glottic cancer (gc) with the intent of larynx preservation are radiotherapy (rt), transoral laser surgery, and partial laryngectomy. the 5-year local control (lc) rates for t1 gc treated with rt have been reported in the range 73.694% in the t1 larynx. at 10 institutions in the tokai district, japan, the 5-year lc rates for t1a and t1b gcs treated with rt alone between 2000 and 2005 were reported to be 86.5% and 83.6%, respectively. the 5-year lc rates reported by other institutions were more than 90% for t1a and t1b tumors. definitive rt for t1 gc using a dose of 2.25 gy per fraction has been reported to yield a higher response rate compared to 2 gy per fraction. in addition, because of the increase in the number of patients who require radiotherapy treatment, reducing the treatment duration helps avoid delays in the administration of starting rt in new patients. we, the tokai study group for therapeutic radiology and oncology (tostro), started definitive rt for t1 gc using a rt dose of 2.25 gy per fraction in 2011. in our institute and others, we administered a hypofractionated rt dose of 2.25 gy for t1 gc, and aimed for a better outcome without increasing adverse events in clinical practice. in the present study, we reported the initial 5-year experience for the 10 institutes of tostro. this study was approved by the institutional review board of the nagoya university hospital, and after approval of the ethics committee of each participating institution, anonymized treatment information was collected in the form of a questionnaire. ecog, eastern cooperative oncology group ; ctcae : common terminology criteria for adverse events ; ps, performance status patients aged > 20 years with t1 glottic squamous cell carcinoma who underwent rt alone were included in the analysis. three - dimensional treatment planning was performed for all patients with patients placed in a supine position and immobilized with thermoplastic masks. a standard radiation dose of 63 gy was administered in 28 fractions (2.25 gy per fraction). the patients were treated using lateral opposed fields, and weighted beams and wedges were used as appropriate to improve dose homogeneity (field size, approximately 5 5 cm). in a periodic follow - up, symptoms occurring in the interval between the initiation of rt and 90 days after this time point were classified as acute adverse effects. late adverse events were defined as those appearing 3 months after the completion of the treatment. the evaluation of acute adverse events and late adverse events was performed using the common terminology criteria for adverse events version 4.0. sixty - two patients (60%) had exophytic and 35 patients (34%) had superficial tumor types. sixty - three patients (61%) had localized lesions and 41 (39%) had extended lesions (2/3 in vocal cord length). sixty - seven patients (64%) were treated using a 4 mv treatment beam and 37 (36%) patients were treated using a 6 mv treatment beam. the total dose range was 56.2567.5 gy and 96 patients (92%) received an rt dose of 63.0 gy. complete local response was achieved in 102 patients (98%) and 2 patients showed local recurrence. acute grade 3 adverse events were observed in 10 patients ; 7 with dermatitis (7%) and 3 with mucositis (3%) (table 4). for the assessment of late adverse events, we evaluated the 85 patients who were followed up for more than half a year (table 5). nine patients (11%) had overall treatment times 44 days owing to periods of infectious diseases in 2 patients and long holidays in 7 patients. the details of the 2 patients who experienced local recurrence are summarized in table 6. treatment factors and possible outcomes cr, complete response ; pr, partial response ; nc, no change list of acute adverse events categorized according to the common terminology criteria for adverse events ver. 4.0 common terminology criteria for adverse events ver. 4.0 ps, performance status ; ott, overall treatment time ; ac, anterior commissure invasion ; lf, local failure ; mo, months ; lf, local failure ; mo, months ; st, salvage treatment, hf, heart failure secondary cancers were observed in 11 patients (11%) and no evidence of regional lymph node metastases and/or distant metastases were observed during the follow - up period. rt is an effective treatment method for early gc with the advantage of larynx preservation. the 5-year lc rates of stage t1 gcs treated with rt were approximately in the range 73.694%. the 5-year lc rates for stages t1a and t1b gcs treated with rt alone were previously reported by the 10 institutes in the tostro group to be 86.5% and 83.8%, respectively. definitive rt for stage t1 gc administered in 2.25 gy fractions was previously reported to yield a higher response rate than that administered in 2 gy fractions. moreover, recent randomized studies have shown an improvement in the lc rates of patients with stage t1 or t1a gc when the total planned radiation was delivered over a shorter overall treatment time using high - dose fractionation. in addition, no significant differences were observed in the incidences of acute or late skin toxicities, mucous membrane, or larynx between the two treatment arms. in the present study, we analyzed the accumulation results of the fractions that were modified from 2.0 gy to 2.25 gy in dose. one of the patients was an elderly patient with a bulky stage t1 tumor that involved the anterior and posterior commissure. the primary effect was a partial response and the tumor was residual, but salvage operation could not be performed due to a very old man. the patient was still alive with cancer at the time of the study. according to the report that evaluated 208 stage t1 gc patients in a retrospective analysis, both the tumor bulk and anterior commissure involvement were significant factors for the lc rate in univariate analysis and tumor bulk was identified as the only significant factor for the lc rate in multivariate analysis. although the benefits of hypofractionation have already been reported in a single - institution randomized trial for stage t1 gcs by yamazaki., the multi - institutional randomized study conducted in korea could not statistically demonstrate the non - inferiority of the hypofractionation arm compared to the conventional fractionation arm. however, in a subgroup exploratory analysis of stage t1a disease, the 5-year local progression - free survival trended positively in the hypofractionation arm (76.7% vs. 93.0% ; hazard ratio [hr ], 3.65 ; p = 0.056). it was reported that they were unable to evaluate the effect of tumor bulk on the lc rate by hypofractionation. we hypothesize that the lc rate of t1 with bulky or extended tumor is still inadequate, even if the dose has increased to 2.25 gy. the another local recurrent patient was superficial gc treated using a 6 mv treatment beam. the treatment outcome in early gc patients who received primary irradiation using a 6 mv treatment beam is limited and controversial. from fundamental research with monte carlo simulation of radiation treatment for gc with 6 mv parallel - opposed photon beams in the ct - based model of the neck, the significant underdosage at the air - tissue interface in the larynx occurs in traditional rt treatments, especially in the glottic part of the larynx. we hypothesized this case had local recurrence because of the prolongation of the overall treatment time, less total dose, and underdosage of the tumor. the present study was at its 5 year of long - term follow - up at the time of the writing of the report and further long - term follow - up is required. if an increase in adverse events has not been observed and the improvement of lc compared to the 2 gy has been likewise obtained, this treatment method is very useful and beneficial in clinical practice due to the reduction in the treatment period. further investigation is recommended for its local control and the development of late adverse events. in conclusion, the rates of acute adverse events in a multicenter survey for stage t1 gc patients treated with 2.25-gy fractions were comparable to those in previous studies that used 2 gy in fractions. the local control of gc appears to be good and we are gratified at the results. | abstractthe purpose of this study was to evaluate the acute and late toxicity as well as local control (lc) in t1 glottic cancer (gc) patients treated with hypofractionated radiotherapy (rt) in clinical practice. the tokai study group for therapeutic radiology and oncology started rt treatment with a dose of 2.25 gy for t1 gc in 2011. ten institutions combined data from 104 patients with t1 squamous cell carcinoma between 2011 and 2015. in total, 104 patients with t1 gc were irradiated with a standard radiation dose of 63 gy in 28 fractions.the median follow - up duration was 18 (3.749.5) months. acute grade 3 adverse events were observed in 7 patients, with 4 patients (5%) having dermatitis and 3 patients (4%) having mucositis. late adverse events above grade 3 were not observed. two patients developed local recurrence. the rates of acute adverse events in the present study were comparable to those in previous studies that have used 2 gy fractions of rt. |
the growth of keratinocytes in the epidermis is regulated by a delicate balance between molecules that control cell survival and cell death. if this regulation is disturbed, epithelial cells may become pathological hyperproliferative lesions, such as cholesteatoma. the molecular and cellular processes resulting in the clinical hallmarks of cholesteatomas (i.e., migration, uncoordinated proliferation, altered differentiation, and aggressiveness) are not yet fully understood. in cholesteatoma, keratinocytic differentiation and proliferation may be modulated by many cytokines, transcription factors, and inflammatory mediators such as tnf- and il-1. the tumor suppressor gene cyld, which was recently identified as the cylindromatosis gene, has a deubiquitinating enzyme (dub) activity and inhibits activation of the transcription factor nf-b, which has key roles in inflammation, immune responses, carcinogenesis, and protection against apoptosis. in cholesteatoma for example, nf-b was reported to be found in cholesteatoma epithelium, but it appeared to be inactivated. however, a recent report suggested that activated nf-b plays a role in cellular hyperplasia of cholesteatoma. generally, in normal resting cells, nf-b is localized within the cytoplasm as a heterodimeric complex composed of p50 and p65 subunits bound to members of the class of inhibitory proteins called inhibitor kappa b (ib). after various stimuli, the phosphorylation of ibs, an important step in nf-b activation, is mediated by ib kinase (ikk). the ikk complex consists of at least three subunits, including the kinases ikk- and ikk- and the regulatory subunit ikk-. phosphorylated ib is then ubiquitinated, which targets it for degradation by the 26s proteasome, thereby releasing nf-b dimers from the cytoplasmic nf-b ib complex and allowing them to translocate to the nucleus and induce target gene expression [4, 5 ]. at this point, cyld binds to nf-b essential modulator (nemo)/ikk- and appears to regulate its activity through deubiquitination of tnf receptor - associated factor 2 (traf 2). cyld was recently reported to negatively regulate nf-b signaling by deubiquitination, and loss of deubiquitinating activity of cyld is correlated with tumorigenesis [57 ]. cyld also negatively regulates the c - jun n - terminal kinase (jnk) signaling pathway and mitogen - activated protein kinase (mapk) pathway, which are known to participate in a wide range of cellular processes, including proliferation, differentiation, and apoptosis of cholesteatoma [1, 8 ]. in addition, cyld negatively regulates rank signaling, which is known to be a key factor in bone resorption in cholesteatoma. therefore, investigation of cyld expression may be a key step to understanding the cellular survival or hyperplasia in cholesteatoma epithelium. we hypothesized that cyld may be involved in the nf-b signaling pathway and that the inverse correlation between cyld and activated nf-b level may be related to the mechanism of cellular hyperplasia in cholesteatoma epithelium. to determine the role of cyld in nf-b signaling of cholesteatoma, cyld and nf-b expression levels in middle ear cholesteatoma epithelium were examined by immunohistochemical analysis to determine protein level and localization and compared to those of normal retroauricular (ra) skin. we also examined the relationship between cyld expression and nf-b activation in middle ear cholesteatoma. tissues of acquired cholesteatoma, diagnosed clinically and confirmed pathologically after surgery, were used in this study. all cholesteatomas extended to the mastoid, with varying degrees of attic bone destruction with keratin retention. the samples were obtained from patients ranging in age from 45 to 60 years (mean age : 52 years) who had undergone middle ear surgery for cholesteatomatous otitis media between november 2008 and may 2009 at the department of otolaryngology, kyung hee university east - west neo medical center, seoul, korea. paired normal ra skin sixteen samples of cholesteatoma and paired normal ra skin samples were obtained for this study. the institutional review boards (ifc / irb) of the kyung hee university east - west neo medical center approved the protocol used in this study (irb approval no. cholesteatoma and normal ra skin were fixed in 4% formaldehyde, dehydrated in a graded ethanol series (70%, 95%, and 100%), and finally embedded in paraffin. paraffin - embedded tissues were cut into 10 m thick sections using a paraffin block cutter (thermo shandon, runcorn, cheshire, uk) and mounted on adhesive slides coated with poly - l - lysine (cat., sections were deparaffinized, rehydrated, and treated in 10 mmol / l citric acid buffer (ph 6.0) at 95c100c for 20 minutes for antigen retrieval. endogenous peroxidase activity was blocked by incubation in 0.5% h2o2 in methanol for 20 minutes. sections were then processed for immunohistochemistry using antibodies against cyld (1 : 500 dilution ; abcam inc., cambridge, ma) and nf-b (1 : 300 dilution ; santa cruz biotechnology, santa cruz, ca) overnight at 4c. the abc method was used to detect cells labeled specifically using a vectastain kit (vector laboratories, burlingame, ca). the sections were subjected to a single immunostaining by enzyme - antibody method as described above. to confirm the colocalization of cyld and nf-b, two serial sections (1020 m thickness) were subjected to single immunostaining using each antibodie. images were obtained using an olympus (tokyo, japan) microscope and spot (diagnostic instruments inc., sterling heights, mi). in all immunohistochemical controls, reaction to the substrate was absent if the primary antibody was omitted or if the primary antibody was replaced by nonimmune control antibody. three investigators blinded to the experimental groups examined immunostained sections with an image analyzer attached to a light microscope. the total number of cells in the fixed domain, the number of cells with nuclear staining for nf-b and cyld - positive cells in the epithelial layer of cholesteatoma and normal ra skin tissues, was counted under five 400 fields in the fixed domain. then, both the levels of activated nf-b (number of cells with nuclear staining / total number of cells counted) and cyld expression (number of positively stained cells / total number of cells counted) were obtained and expressed as percentages. the level of significance was set at p <.05. the pearson 's correlation test was used to determine the association between activated nf-b and cyld, with the level of significance set at 0.05. we also analyzed activated nf-b and cyld levels according to the existence of active otorrhea and state of bony destruction using the mann - whitney test. the spss10 software package (spss, chicago, il) was used for the analyses. the following results were obtained by immunohistochemical analysis of 16 cholesteatoma tissues and paired normal ra skin specimens. immunohistochemical data indicated that immunoreactivity of cyld was mainly present in the cytoplasm and perinuclear region of the basal layer and granular layer in normal ra skin (figure 1(a)). in the cholesteatoma tissue, cyld expression was seen in a few cells in the basal layer (figure 1(b)). the percentage of cyld - positive cells in cholesteatoma tissues was 38.48% 21.20% compared to 80.95% 8.08% in paired normal ra skin. the percentage of cyld - positive cells in cholesteatoma tissue was significantly lower as compared to paired normal ra skin (p =.022). the differential expression of nf-b was found between normal ra skin and cholesteatoma epithelium. as shown in figure 2(a), nf-b expression was seen mostly in the cytoplasm (inactivated form) and was localized mainly in the basal epithelial layer of normal skin. in addition, we found some nuclear staining of nf-b in the basal and suprabasal layers of the normal ra skin in some cases. in cholesteatoma tissue, however, most nf-b expression was observed in the nucleus (activated form) and was localized in all layers of the epithelium (figure 2(b)). the percentage of activated nf-b expression in the cholesteatoma epithelium was 62.62% 18.97% and that in paired normal ra skin was 5.47% 1.12%. the percentage of activated nf-b expression in the cholesteatoma epithelium was significantly higher compared to normal ra skin (p =.0001). to find the association between cyld and nf-b, we examined the correlation between cyld and activated nf-b expression. using pearson 's correlation test, we found a significant inverse correlation between cyld and activated nf-b expression in cholesteatoma (figure 3, r = 0.630, p =.007). based on the overwhelming evidence indicating the roles of cyld and activated nf-b in immune regulation, apoptosis, and bone resorption, we examined whether the expression levels of activated nf-b or cyld are regulated according to clinical aspects, such as the presence of active otorrhea and state of bony destruction [6, 9 ]. the cholesteatoma groups in this study consisted of 6 cases with and 10 cases without active otorrhea at the time of treatment. we found no significant differences in expression levels of nf-b or cyld between these two groups with and without active otorrhea (p =.309). based on operative findings, the above patients were classified retrospectively into two groups to determine the extent to which the cholesteatoma destroyed bone ; the mild group had disruption of one ossicle, while the severe group had widespread bone destruction, including disruption of more than two ossicles and destruction of the sigmoid sinus, post wall of the external auditory canal, and the facial canal. we then compared the expression levels of cyld and activated nf-b between the two groups. the degree of bone destruction was mild in 5 cases and severe in 11 cases in this study. no significant relationships were observed between the degree of bone destruction and the expression levels of cyld (p =.769) or activated nf-b (p =.432). turban tumor syndrome, an autosomal - dominant condition that confers a predisposition to multiple skin tumors. the gene product, cyld, is a dub recently implicated in the negative regulation of the nf-b pathway, a transcription factor suggested to promote cell proliferation [1, 5 ]. the present study was performed to examine the possible role of cyld expression in the pathogenesis of cholesteatoma. specifically, we were interested in whether cyld expression is altered in cholesteatoma and whether cyld expression level affects the activity of nf-b in cholesteatoma. the results of the present study indicated that the level of cyld expression was significantly downregulated in cholesteatoma in comparison with normal ra skin. the primary function of dubs is to remove single or multiple ubiquitin chains from different proteins / substrates. recently, different specific substrates for cyld have been identified, such as traf2/6, nemo, and bcl-3 from which cyld could remove the ubiquitin chains by direct association [1, 10 ]. the removal of lysine63-(lys63-) linked polyubiquitin chains from traf2 or traf6 by cyld attenuates nf-b signaling, leading to programmed cell death. therefore, loss of the deubiquitinating activity of cyld may be correlated with tumorigenesis. recently, reduced cyld was also found in human carcinomas, such as hepatocellular carcinoma and colon cancer, as compared with nonneoplastic tissue. moreover, exposure of cyld knockdown hela cells to anti - inflammatory drugs such as sodium salicylate or prostaglandin a1, which inhibit nf-b, abolished the protective knockdown of apoptosis, suggesting that loss of cyld confers resistance to apoptosis through activation of nf-b. as noted above, a series of reports have shown that cyld blocks signal transmission through the classical or alternative nf-b cascade by deubiquitinating the tnf receptor - associated factor 2 (traf2), traf6, and ikk- (nemo) [1, 5, 6 ]. however, a recent report showed that the loss of cyld in keratinocytes of mice did not affect transcription induced by the classical p65p50 nf-b dimers but had clear effects on bcl-3-linked p50- or p52-dependent gene regulation. bcl-3 acts as a nuclear coactivator that switches the transcriptional properties of nf-b p50 and p52 homodimers from a repressive to an active state leading to cellular proliferation through activation of the cyclin d1 gene. after translocation of bcl-3 from the cytoplasm to the perinuclear region, cyld removes k63-linked polyubiquitin chains from bcl-3, and thus prevents translocation of bcl-3 into the nucleus. these data suggest that the mechanism of cyld - mediated nf-b suppression may vary in different cell types. in the present study, the cytoplasmic and perinuclear expression levels of cyld suggest that cyld may play a role in the deubiquitination of bcl-3 and/or traf in nf-b signaling within the cytoplasm or perinuclear region in keratinocytes of normal skin and cholesteatoma, in agreement with previously reported results. in addition, the present findings suggested that downregulation of cyld expression, which is highly expressed in normal skin, may be involved in the pathogenesis of human cholesteatoma. the role of nf-b in epithelial keratinocytes has been described as being paradoxical in other cell types such as t cells and b cells. for example, mice overexpressing rel / p65 nf-b showed epidermal hypoplasia and growth inhibition, whereas a study on ib-null mice showed epidermal keratinocyte hyperplasia and dermal infiltration of lymphocytes. this variation in outcome of nf-b activation may reflect the cell types and differentiation state of the cells. lizzul suggested that the antiproliferative effects of activated nf-b in normal epithelial cells without inflammation or apoptotic stimuli may be superior to its anti apoptotic effects. activated nf-b, however, has an anti - apoptotic effect in proliferative skin disorders such as psoriasis. in normal murine skin, only basal keratinocytes can proliferate and differentiate into mature cells that undergo enucleation to generate the cornified layer. therefore, nf-b is found in the cytoplasm (inactivated form) of only basal keratinocytes of normal skin. our immunohistochemical results of normal ra skin were in agreement with these findings. in the present study, however, significant differences in nf-b expression pattern were observed between cholesteatoma and normal ra skin. in cholesteatoma, strong immunostaining for nf-b was seen mostly in the nucleus and was localized in not only the basal layer but also the suprabasal layers. this was in contrast to normal ra skin, which showed nf-b immunoreactivity mostly in the cytoplasm of cells in the basal epithelial layers. some debate exists regarding the role of nf-b in cholesteatoma [2, 3 ]. the keratinocytes in cholesteatoma are clearly in an abnormal state, and one would anticipate changes in the epidermis and keratinocyte. perhaps, this is why we observed in contrast control ra skin. that is, cholesteatoma may represent a chronic inflammatory state, and therefore, an imbalance exists between the anti - apoptotic role and cell cycle inhibitory role of nf-b, whereby the scale is tipped toward protection against cell death in the context of a constitutive cytokine - rich inflammatory milieu. this allows for the hyperproliferation seen in cholesteatoma. therefore, our results suggest that activated nf-b, which may provide protection against apoptosis, plays a role in the pathogenesis of cholesteatoma, unlike normal ra skin. vasudevan reported that the tumor suppressor pten, which functions as a negative regulator of the phosphorylated akt - mediated cell survival pathway in cholesteatoma, is downregulated by activated nf-b [18, 19 ]. these findings also support the results of the present study. to elucidate the role of cyld in the expression of activated nf-b in human cholesteatoma, we examined the correlation between cyld and activated nf-b expression in cholesteatoma. we found a significant inverse correlation between cyld and nf-b in cholesteatoma, suggesting that nf-b activation is inhibited in cases with normal cyld function but that it tends to be overexpressed in the absence of functional cyld. in addition, our results support the possibility that nf-b activation accompanied by loss of cyld may be an important step in the development and/or progression of cholesteatoma. we also examined the relationships between cyld / nf-b and clinical data, such as the presence of active otorrhea and degree of bone destruction, but no such relationships were found in the present study. in addition to the critical role of cyld in the nf-b pathway, cyld has the ability to function as a negative regulator of the jnk signaling pathway, which plays an important role in cell survival in human cholesteatoma. the precise mechanisms underlying the downregulation of cyld in cholesteatoma remain to be elucidated. nevertheless, our data suggest the potential role of cyld inactivation in cholesteatoma epithelium via multiple mechanisms, ranging from genetic alteration to epigenetic silencing. we found that cyld expression was lower and activated nf-b expression was higher in cholesteatoma epithelium in comparison to normal ra skin. these observations suggest that the activation of nf-b and downregulation of cyld may be involved in the cellular hyperplasia in patients with cholesteatoma. | the tumor suppressor cyld is a deubiquitinating enzyme that inhibits activation of the nf-b, which has key roles in inflammation and apoptosis. we hypothesized that cyld may regulate the nf-b signaling pathway in cholesteatoma. we conducted immunohistochemistry to examine the expression of cyld and nf-b in 16 cases of cholesteatoma and paired cases of retroauricular (ra) skin. in cholesteatoma epithelium, activated nf- b expression was significantly higher than in ra skin, whereas cyld expression was significantly lower in cholesteatoma epithelium than in ra skin (p <.05). furthermore, a significant inverse correlation was detected between cyld and activated nf-b expression in cholesteatoma epithelium (r = 0.630). we found that cyld reduced and activated increased nf-b in cholesteatoma epithelium in comparison to ra skin. the inverse correlation between cyld and activated nf-b in cholesteatoma may be involved in cholesteatoma epithelial hyperplasia. |
the online version of this article (doi:10.1007/s11626 - 008 - 9162 - 5) contains supplementary material, which is available to authorized users. pbx1 is a tale (three amino acid loop extension) family non - hox homeodomain transcription factor involved in the execution of multiple developmental programs of gene expression. pbx1 cooperatively binds dna together with hox proteins from paralogue groups 110 as well as several transcription factors, e.g., engrailed, pdx1, and prep / meis (chang. 1996 ; lu and kamps 1996 ; peltenburg and murre 1996 ; shen. 1996, 1997 ; knoepfler. 1997 ; berthelsen. 1998 ; goudet. cooperative interactions of pbx1 and its partner proteins modify hox protein dna binding (mann and chan 1996). the functional importance of these interactions has been revealed by the observation that the pbx1 nullizygous embryos exhibit diffuse patterning defects restricted to the domains specified by hox paralogues that bear the pbx dimerization motif (selleri. on the side of pbx, interactions with hox partners are facilitated by residues within the homeodomain and immediate carboxy - terminal to it (chang. hox complexes are thought either to positively or negatively regulate expression of target genes dependent on the context of cell signaling (saleh. in particular, activation of the protein kinase a pathway has been shown to switch pbx hox complexes from repressors to activators of transcription (saleh. loss of pbx1 is associated with decreased cellular proliferation during development of bone, pancreas, blood, kidney, and the male genital ridge (dimartino. however, it is not clear how pbx1 regulates early embryonic lineage commitment. to address this issue, we generated mouse embryonic stem cells bearing a homozygous deletion of exon-6 of the pbx1 gene, coding for the part of protein, which interacts with dna and hox proteins. subsequently, both the wild - type (wt) and pbx1 mutant cells were differentiated in vitro using retinoic acid (ra) induction / aggregation methods, and gene expression profiles of their differentiated progeny were compared. the pbx1 targeting vector was constructed by cloning of three adjacent pbx1 genomic fragments into pflox plasmid (chui. the targeted sequence (subsequently referred to as the target) was composed of pbx1 exon-6 (1,1921,356 bp in pbx1a af020196 mrna) flanked by 700 bp upstream and 280 bp downstream intronic sequences (fig. (a) schematic representation of the first allele targeting by homologous recombination and subsequent transient cre recombinase expression. the targeting vector was based on the pflox plasmid coding loxp flanked pgkneo / hsv - tk selection cassette. the first targeting vector contained a 1191-nucleotide fragment of pbx1 locus bearing exon-6 flanked by loxp sequences. the hindiii site within the 5 homology arm was removed from the targeting vector to allow homologous recombination detection by southern blot. the 5 external probe used for the southern blot analysis h hindiii, n noti, bg bglii, b bamhi, e ecori, s sali. as a result of the first homologous recombination and subsequent transient cre expression, the sequence containing exon-6 as well as the selection cassette was removed from the first allele, yielding neomycin - sensitive pbx1 es cell clones. (b) for the second targeting, the vector was modified by removing the target sequence containing exon-6 with bamhi. (a) schematic representation of the first allele targeting by homologous recombination and subsequent transient cre recombinase expression. the targeting vector was based on the pflox plasmid coding loxp flanked pgkneo / hsv - tk selection cassette. the first targeting vector contained a 1191-nucleotide fragment of pbx1 locus bearing exon-6 flanked by loxp sequences. the hindiii site within the 5 homology arm was removed from the targeting vector to allow homologous recombination detection by southern blot. the 5 external probe used for the southern blot analysis is shown as a solid black box above the mutated allele. h hindiii, n noti, bg bglii, b bamhi, e ecori, s sali. as a result of the first homologous recombination and subsequent transient cre expression, the sequence containing exon-6 as well as the selection cassette was removed from the first allele, yielding neomycin - sensitive pbx1 es cell clones. (b) for the second targeting, the vector was modified by removing the target sequence containing exon-6 with bamhi. a hindiii restriction digest site was removed from the genomic sequence upstream of the targeted exon-6 (fig. removal of this restriction site by enzymatic digest and klenow polymerase fill - in reaction allowed for southern detection of homologous recombination events with the external southern probe located upstream of the vector sequences (fig. the noti linearized pbx1 plasmid was electroporated into the e14 embryonic stem (es) cells followed by 6 d of g418 selection. the homologous recombination positive clones were identified using external southern probe and two polymerase chain reaction (pcr) systems (fig. 2 ; see online electronic supplementary material for primer sequences). (a) southern blot analysis of pbx1 clones after the first homologous recombination, before cre treatment. dnas of individual clones resistant to g418 were digested with hindiii and analyzed by southern hybridization using a pcr - derived 5 external southern probe (for primer sequences, seeelectronic supplementary material). (b) confirmation of southern blot analysis by long - range 8-kb pcr and standard 2-kb pcr on the 5 and 3 homology arms of the vector. in both pcrs, one primer was based on the sequences external to the targeting vector and one inside the vector sequence. (c) southern blot analysis of the clones after cre recombination using a 5 external hybridization probe. cre recombinase catalyzed removal of the selection cassette together with the target sequence resulted in a decrease of the original 16-kb band of the correctly targeted first allele to 11 kb pbx1 band (fig. the second homologous recombination resulted in a shift of the 8-kb wt allele band to the 14.5-kb correctly targeted second allele band. (a) southern blot analysis of pbx1 clones after the first homologous recombination, before cre treatment. dnas of individual clones resistant to g418 were digested with hindiii and analyzed by southern hybridization using a pcr - derived 5 external southern probe (for primer sequences, seeelectronic supplementary material). (b) confirmation of southern blot analysis by long - range 8-kb pcr and standard 2-kb pcr on the 5 and 3 homology arms of the vector. in both pcrs, one primer was based on the sequences external to the targeting vector and one inside the vector sequence. (c) southern blot analysis of the clones after cre recombination using a 5 external hybridization probe. cre recombinase catalyzed removal of the selection cassette together with the target sequence resulted in a decrease of the original 16-kb band of the correctly targeted first allele to 11 kb pbx1 band (fig. the second homologous recombination resulted in a shift of the 8-kb wt allele band to the 14.5-kb correctly targeted second allele band. cells were electroporated with 20 g of cmv - cre plasmid (a kind gift of dr. colonies were picked and pcr - analyzed for the loss of target and selection cassette sequences (data not shown). a single es cell clone carrying a desired deletion of target and selection cassette sequence in the first copy of the gene (further referred to as pbx1) was subjected to the second allele targeting with a modified pbx1 vector (fig., target sequence was removed from between loxp sequences by bamhi digest and re - ligation (fig. due to this modification, integration of pbx1 into the second copy of the pbx1 gene causes direct exon-6 ablation without the necessity of a subsequent round of cre recombination (fig. es cells were cultured in the presence of 1,000 u / ml of recombinant leukemia inhibitory factor (lif ; esgro, chemicon international, schwalbach, germany) on the mitomycin (sigma - aldrich, munich, germany) treated cd-1.mtkneo2 embryonic fibroblasts according to standard procedures (wasserman. the cells were differentiated according to the previously described aggregation / ra induction protocol (bain. 1997) with two modifications : cell culture dishes were coated with 0.1% gelatin (sigma)/20 g / ml laminin (gibco / invitrogen, karlsruhe, germany) prior to embryoid body (eb) reattachment.the cells were allowed to differentiate for nine instead of 6 d after eb reattachment, in which time, media was exchanged daily. cell culture dishes were coated with 0.1% gelatin (sigma)/20 g / ml laminin (gibco / invitrogen, karlsruhe, germany) prior to embryoid body (eb) reattachment. the cells were allowed to differentiate for nine instead of 6 d after eb reattachment, in which time, media was exchanged daily. total rna was isolated from trypsinized cells using tripure isolation reagent (boehringer mannheim, mannheim, germany). reverse transcription was performed with taqman reverse transcription reagents (applied biosystems, foster city, ca) and random hexamer primers according to supplied protocol. the reactions were done in 30-l volumes using sybr green pcr master mix (applied biosystems) in the abiprism 7900ht cycler using primers listed in fig. results were standardized to the level of gapdh expression using a standard curve method according to applied biosystems guidelines. the reverse transcriptase pcr (rt - pcr) derived probes specific for insulin growth factor-2 (igf-2), insulin growth factor-2 receptor (igf-2r), insulin growth factor-1 (igf-1), insulin growth factor-1 receptor (igf-2r), h19, oct3/4, colipase and actin were labeled with [-p]dctp (3,000 ci / mmol ; amersham biosciences, freiburg, germany) using a megaprime dna labeling system (amersham biosciences). whole cell lysates of differentiated cells were resolved by electrophoresis in 12% sodium dodecyl sulfate polyacrylamide gels and transferred onto polyvinylidene fluoride (amersham) as described previously (stock. pbx proteins were detected with pbx1/2/3 sc-888 antibody (santa cruz, heidelberg, germany) and actin with sc-1615 antibody (santa cruz). immunostaining. immunostaining of -iii - tubulin and erk1 was performed as described previously using antibodies against beta - tubulin (iii) mms-435p (babco, berkeley, ca) and erk1 sc-94 (santa cruz ; bain. total rna purified with the tripure isolation reagent (boehringer mannheim) was repurified with rneasy mini kit (qiagen, valencia, ca) and was used for experiments with murine genome u74a version 2 genechip arrays (affymetrix, santa clara, ca), which contain probes for detecting 6,000 well - characterized genes and 6,000 expressed sequence tags. the software identified differentially expressed transcripts by comparison of the differences in values of perfect match to mismatch of each probe pair in the baseline array (differentiated wt es cells) to its matching probe pair on the experimental array (differentiated pbx1 cells). the signal log ratios calculated for each transcript were converted into fold change using affymetrix recommended formula. the results of comparison of the wt and two pbx1 mutant clones were cross - compared, and 117 transcripts were consistently deregulated in both mutant clones selected (seeelectronic supplementary material). 1a) was electroporated into a 129/ola background e14 es cell line and cultured on the embryonic fibroblast feeder layers, in the presence of lif, according to standard protocol (wasserman. 1993). this strategy was chosen to create both es cells for differentiation and generate transgenic knockout mice with the same approach. following positive selection in g418, homologous recombinant clones were identified by southern blot analysis using hindiii digest and the 5 external southern blot probe (fig. this probe hybridizes to the 8-kb fragment of the wild - type allele and the 16-kb fragment of a correctly targeted allele (fig. the homologous recombination events, detected by southern blot, were confirmed by pcr amplification of the 5 and 3 ends of the targeting vector, with one primer based on the sequence inside and one external to the vector sequence (fig. two homologous recombination positive clones were expanded and electroporated with 20 g of cmv - cre expression vector (kind gift of dr. two recombinant clones with the excised selection cassette and exon-6 sequences were selected in a pcr - based screen from each of the es cell sub - lines (data not shown). a single clone of cre - treated cells, from which both the target sequence containing exon-6 and flanking intronic regions (700 bp upstream and 280 bp downstream from exon-6) of pbx1 and the selection cassette had been removed, was subjected to a second gene copy targeting procedure (fig. the targeted sequence was removed from the pbx1 vector through bamhi digest and re - ligation. this pbx1 plasmid allowed for direct inactivation of the second copy of the pbx1 gene (fig. recombinants were selected in g418 and screened using the same 5 external southern probe as in the first allele targeting. a shift of the 8 kb wt band to the properly targeted, 14.5 kb, second allele band was detected (fig. the effect of targeting both alleles was assessed at the mrna and protein expression level in the differentiated pbx1 cells (see following subsection). in vitro the pbx1 cells, cultured on mitomycin - c - pretreated embryonic fibroblasts in the standard medium supplemented with lif, retained morphological features of undifferentiated es cells. furthermore, all analyzed sub - lines expressed the oct3/4 gene, indicating their undifferentiated state (fig. aggregation in the media supplemented with 1% fetal calf serum and ra was employed in order to induce neuro - ectodermal differentiation, as described in materials and methods. wt and pbx1 cells cultured in the non - adhesive bacterial grade dishes formed embryoid bodies (fig. 3e f), which, stimulated by ra, differentiated into morphologically distinguishable cell types (fig. wild - type cells grew densely and acquired predominantly bead - like forms structured into grainy nests (fig. most of the differentiated pbx1 and pbx1 cells had a flat morphology, resembling mesenchymal cells (fig. 3h). figure 3.morphology of the wild - type e14, mutant pbx1, and pbx1 es cells growing undifferentiated on the embryonic fibroblast and differentiating upon aggregation in the presence of ra. (a, b) low - magnification digital images of the colonies of undifferentiated wt and pbx1 embryonic stem cells. (c, d) the same colonies photographed at higher magnification. wt and mutant cells grow in sharp - bordered colonies characteristic of undifferentiated es cells. (e, f) embryoid bodies formed by each of the es cell clones as a result of aggregation in non - adhesive dishes followed by ra induction. (g, h) morphology of differentiated es cells 9 d after reattachment to the adhesive media. the pbx1 cells have a flattened appearance as they spread in the surroundings of the reattached aggregates.targeted deletion of exon-6 and flanking intronic regions results in the expression of (280 - 370)pbx1 mutant protein. in order to determine the effect of targeting both alleles on mrna and protein expression, we performed rt - pcr, real - time pcr, and western blot analysis of differentiated cells. as expected, in the rt - pcr where one of the primers was designed to recognize pbx1 exon-6 region, no product could be detected in the pbx1 cells (fig. 1a, electronic supplementary material).reactions with primers designed to amplify the coding sequence of pbx1 resulted in a single band corresponding to mutant cdna (fig. 1b, electronic supplementary material). subsequent cloning and sequencing of the transcript revealed lack of the sequences encoded by exon-6 and exon-7. observed exon-7 skipping and loss of alternative splicing of exon-8 resulted from deletion of intronic splicing regulatory sequences (fig. 2, electronic supplementary material).since the lack of the exon-6 and exon-7 sequences does not result in a frame shift, the mutant cdna encodes a protein lacking amino acids 280370, termed here (280370)pbx1 (for the cdna evidence, see fig. 2 of electronic supplementary material). the c - terminal 70 aa remains in the ppbx1 translated protein. since the antibody we used is directed against the c terminus of all three paralogues, pbx1/2/3, in western blot, we detected expression of the (280370)pbx1 mutant protein in pbx1 and pbx1 cells (fig. 4). (a) western blot analysis of pbx1/2/3 expression in the differentiated wt, pbx1, and pbx1 cells on the ninth day after reattachment to adhesive cell culture dishes. immunodetection of actin served as the loading control and was carried out on the same blots following pbx antibody striping. (b) real - time pcr quantification of pbx2 and pbx3 transcripts in differentiated wt cells and two pbx1 clones on the ninth day after reattachment to adhesive cell culture dishes.interestingly, western blot revealed a large amount of full - length pbx1/2/3 protein (band above the 49-kda marker) detected by the pbx1/2/3 antibody. in order to further explain this observation, we quantified pbx2 and pbx3 transcripts in mutant cells. their expression was upregulated almost twofold and more than 5-fold in pbx1 cells compared with wt cells, respectively. therefore, a high level of wt pbx protein expression in the differentiated pbx1 cells correlates with relative abundance of pbx3 transcripts (fig. 4). morphology of the wild - type e14, mutant pbx1, and pbx1 es cells growing undifferentiated on the embryonic fibroblast and differentiating upon aggregation in the presence of ra. (a, b) low - magnification digital images of the colonies of undifferentiated wt and pbx1 embryonic stem cells. (c, d) the same colonies photographed at higher magnification. wt and mutant cells grow in sharp - bordered colonies characteristic of undifferentiated es cells. (e, f) embryoid bodies formed by each of the es cell clones as a result of aggregation in non - adhesive dishes followed by ra induction. (g, h) morphology of differentiated es cells 9 d after reattachment to the adhesive media. the pbx1 cells have a flattened appearance as they spread in the surroundings of the reattached aggregates. (a) western blot analysis of pbx1/2/3 expression in the differentiated wt, pbx1, and pbx1 cells on the ninth day after reattachment to adhesive cell culture dishes. immunodetection of actin served as the loading control and was carried out on the same blots following pbx antibody striping. (b) real - time pcr quantification of pbx2 and pbx3 transcripts in differentiated wt cells and two pbx1 clones on the ninth day after reattachment to adhesive cell culture dishes. total rna from differentiated, ra - induced, day 9 post - attachment wt and pbx1 cell populations (one clone of wild - type cell and two clones of pbx1 cells) was hybridized to the affymetrix mu_u94av2 microarray. a total of 680 genes for the first pbx1 clone and 473 genes for the second pbx1 clone were differentially expressed (two - fold or more difference) in comparison to the wt cells. out of those, 117 commonly regulated genes were identified in both analyzed clones.a selection of the 117 gene regulations is presented in fig. 5 and the complete list is accessible at tables 1, 2, and 3 of electronic supplementary material (ms excel format available). figure 5.the microarray - based comparative gene expression profiling of differentiated pbx1 and wt cells. represented upper and lower bars represent values of gene deregulation in pbx1 clone-1 and pbx1 clone-2, respectively, as compared to the wt cells. fold change values are depicted next to the bars. the microarray - based comparative gene expression profiling of differentiated pbx1 and wt cells. represented upper and lower bars represent values of gene deregulation in pbx1 clone-1 and pbx1 clone-2, respectively, as compared to the wt cells. 5a) specific genes were consistently upregulated in both clones of pbx1 cells. among those, expression of striated smooth and cardiac - muscle - specific actin isoforms indicated that the pbx1 cells had acquired a muscle phenotype.interestingly, expression of reelin, a gene known to play an important role both in brain development and neuromuscular junction formation, was upregulated in both differentiated pbx1 clones (quattrocchi. expression of two egf - related growth factors, amphiregulin (l41352) and nell2 (u59230), reported to function as potent mitogens for the neural stem cells in vitro (falk and frisen 2002 ; aihara. other neural genes, upregulated in differentiated pbx1 cells, play roles in such processes as : cell adhesion : catenin alpha-2 (d25281 ; uchida. 1995a, b) andcytoskeleton regulation : neuronal intermediate filament protein (l27220), microtubule - associated protein tau (m18775 ; lee. 1988), mouse brain h5 (x61452 ; kato 1992).a slight increase of n - cam and 3.7-fold increase of gfap expression was observed (table 1, electronic supplementary material).not only the neuron - specific genes but also genes for skeletal muscle like alpha1-actin, for cardiac muscle like myosin - heavy polypeptide 7, and for smooth muscles like h2-calponin were upregulated (table 3, electronic supplementary material) cell adhesion : catenin alpha-2 (d25281 ; uchida. 1995a, b) and cytoskeleton regulation : neuronal intermediate filament protein (l27220), microtubule - associated protein tau (m18775 ; lee. 1988), mouse brain h5 (x61452 ; kato 1992). decreased expression of trophectoderm and endothelial marker genes. in addition, we detected pronounced differences in trophectodermal marker gene expression between differentiated wt and pbx1 cells. trophoblast giant - cell - specific placental lactogen - ii (m85067), and proliferin (k03235 ; adamson. 2002) were downregulated (fig. similarly, genes demarcating epithelial cells derived from endoderm and mesoderm, e.g., vascular - specific endothelial - specific receptor tyrosine kinase (x71426) were downregulated (fig. 5c 1993).aquaporin1/chip28 (l02914), which is expressed predominantly in endothelium of kidney, lung, trachea, and heart, but also in placental syncytial trophoblast cells (hasegawa. 1994), and colipase (aa710635), expressed in pancreas, stomach, and colon (dagostino. 2002), also showed decreased expression. since colipase exhibited the strongest downregulation within this group of genes, we have further confirmed its deregulation in northern blot, which revealed that whereas expression of colipase was strongly induced during wt es cells differentiation, it remained silent in pbx1 and pbx1 cells (fig. furthermore, deregulations of aquaporin1/chip28 (l02914) and endothelial - specific receptor tyrosine kinase (x71426) were confirmed by real - time pcr (fig. 3, electronic supplementary material). figure 6.differentiated pbx1 and pbx1 cells do not express igf2, igf2r, and colipase genes. total rna (15 g / lane) isolated from undifferentiated (0) and differentiated (9) wt, pbx1, and pbx1 embryonic stem cells was used in the northern blot as described in genotypes and stages of differentiation are assigned above the panel : (0) = undifferentiated, (9) = ninth day post - attachment of embryoid bodies to adhesive culture dishes. efficiency of blotting was controlled by staining rna on the membrane with ethidium bromide (top of the panel). differentiated pbx1 and pbx1 cells total rna (15 g / lane) isolated from undifferentiated (0) and differentiated (9) wt, pbx1, and pbx1 embryonic stem cells was used in the northern blot as described in genotypes and stages of differentiation are assigned above the panel : (0) = undifferentiated, (9) = ninth day post - attachment of embryoid bodies to adhesive culture dishes. efficiency of blotting was controlled by staining rna on the membrane with ethidium bromide (top of the panel). deregulation of imprinted genes : igf2, igf2r, h19, dlk-1, gtl-1, and neuronatin. interestingly, the microarray experiments resulted in the discovery of the striking downregulation of insulin growth factor 2 (x71922) as well as its receptor (u04710) in pbx1 cells (fig. 5d).consistently, northern blot analysis revealed that igf2 was expressed only in differentiated wild - type cells (fig. the igf2 receptor was expressed in all undifferentiated cells and differentiated wt cells, whereas in differentiated pbx and pbx1 cells, its expression was barely detectable. this igf2 deregulation prompted us to check the expression of another imprinted gene, h19, known to share common regulatory sequences with igf2 (srivastava. northern blot revealed h19 expression to be intensified in pbx1 and both pbx1 cells (fig. 6).similarly, h19, igf1, and igf1r were also slightly upregulated in the differentiated knockout cells (fig. interestingly, three other imprinted genes, gtl-2 (y13832), dlk-1 (z12171), and neuronatin (x83569), were also deregulated (fig. gtl-2, like h19, is expressed from the maternal allele (schmidt. the paternally expressed dlk-1 gene encodes a homologue of the notch - delta family of developmental regulated signaling molecules (laborda 2000) and is co - regulated with gtl-2. the gene is normally transcribed from the unmethylated paternal allele in neural tissue and cd34-positive blood cell progenitors (kuerbitz. 3, electronic supplementary material). expansion of neural cell lineage in differentiating pbx1 es cells. the presence of neurons in the populations of differentiated wt and pbx1 cells was confirmed by cytoimmunochemical staining with antibody against a post - mitotic neural marker beta - iii - tubulin (tuj1 ; mann and chan 1996). we observed outgrowths of neural processes in the surroundings of differentiated aggregates of both wt and pbx1 mutant cells ; it was, however, most pronounced in the mutant cell cultures (fig. subsequently, the neural cell populations were quantified by fluorescence - activated cell sorting (facs) of anti--iii - tubulin - stained cells (fig. a marked increase (~5%) in tuj1-positive cell numbers was detected in cultures of differentiated pbx1 cells as compared with wt cells. (a, b) confocal microscopy images of differentiated wt and pbx1 embryonic stem cells on the ninth day post - reattachment of embryoid bodies to adhesive media. (c, d) expression of neuron - specific class iii beta - tubulin (red) and extracellular signal - regulated kinases 1 (erk1, green) were visualized by indirect immunofluorescence. (e, f) facs - based quantification of the beta - iii - tubulin - stained, neural cell populations derived in wt (e) and pbx1 (f) cell cultures. (a, b) confocal microscopy images of differentiated wt and pbx1 embryonic stem cells on the ninth day post - reattachment of embryoid bodies to adhesive media. (c, d) expression of neuron - specific class iii beta - tubulin (red) and extracellular signal - regulated kinases 1 (erk1, green) were visualized by indirect immunofluorescence. (e, f) facs - based quantification of the beta - iii - tubulin - stained, neural cell populations derived in wt (e) and pbx1 (f) cell cultures. the relative fold change values of gene expression are stored in the excel file format and can be accessed at http://www.uniklinik-freiburg.de/medizin1/live/permalink/scheele2009.html. overview of the experimental model. utilizing the cre loxp system, we targeted a functionally important part of the homeodomain of pbx1 in es cells. genomic modification resulted in expression of the (280370)pbx1 mutant protein (fig. 4.). region facilitates both pbx1hox and pbx1dna interactions (lu and kamps 1996 ; peltenburg and murre 1997 ; jabet. 1999 ; piper. 1999 ; laronde - leblanc and wolberger 2003).by employing dna microarray technology, we compared transcriptional profiles of in vitro differentiated wt and pbx1 es cells. in the following subsections, cell aggregation and ra treatment in media with low serum content are known to lead to efficient neuroectodermal differentiation of es cells. in the process of differentiation some of them are expressed by undifferentiated es cells (oct4, bmp4 ; niwa. 2000 ; ying. 2003) and others are upregulated during early differentiation (pax6, nestin, otx1 ; okabe. 1996 ; gajovic. 1997), still others during late differentiation (-iii - tubulin, gfap, n - cam ; bain. 1995 ; fraichard. varieties of genes active in this process were revealed by a recent survey of the es cells to neural lineage differentiation transcriptome (ahn. 2004).in the current study, we compared transcriptomes of wt and pbx1 mutant cells. our results indicate that pbx1 mutant cells not only retain the capability to express neural genes in response to ra treatment but also express them at higher levels as compared with wt cells. consistently, facs analysis revealed relative expansion of -iii - tubulin - expressing cell population, correlating with widespread outgrowth of neural processes in cultures of differentiated pbx1 mutant cells (fig. we conclude that a greater proportion of pbx1 mutant cells undergo neural differentiation as compared to wt cells. we hypothesize that the relative abundance of pbx3 transcripts in populations of differentiated pbx1 cells is a direct result of neural population expansion. transcripts of pbx3 were recently found to be upregulated in the es cells differentiating to midbrain and hindbrain neurons (ahn. pbx3 expression in the mid - gestation mouse embryo is restricted to the central nervous system ; pbx3-deficient mice have been shown to die from central respiratory failure due to abnormal activity of inspiratory neurons in the medulla (rhee. furthermore, knoepfler and kamps (1997) have shown that retinoic acid upregulates pbx protein abundance coincident with transcriptional activation of hox genes in p19 embryonal carcinoma cell undergoing neuronal differentiation. using an approach different from double - allele knockout, other investigators applied si - rna technique to eliminate expression of pbx1 and the related pbx2 and pbx3 genes. they could show that pbx proteins are required for ra - induced differentiation of p19 cells (qin. not only in transformed cell lines but also in the rat model did the expression of pbx1 in the subventricular zone precursor cells suggest a role of pbx1 in mammalian neurogenesis (redmond. based on our microarray data, we can hypothesize that mutant cells differentiate into two predominant neural and muscle cell lineages. alternatively, expression of both neural and muscle - specific genes could be attributed to expansion of the common neuromuscular progenitor cell population.mouse es cells, although derived from the epiblast (brook and gardner 1997), which, during gastrulation, does not contribute to the trophectodermal lineage (beddington and robertson 1989), are capable of acquiring trophectodermal phenotypes upon withdrawal of lif (niwa. our results are in agreement with this observation, as the high levels of trophectodermal marker gene expression were detected in differentiated wt es cells. however, differentiated pbx1 cells exhibited decreased expression of trophectoderm markers as well as endoderm - derived epithelial genes, suggesting involvement of pbx1 in the molecular program leading to commitment into those lineages (fig. 5c). interestingly, the microarray experiment resulted in the discovery of very strong downregulation of igf2 and igf2r genes in the knockout cells. whereas in wt cells igf2 and igf2r expression were strongly induced during differentiation, it remained uninduced in differentiating mutant cells. loss of expression of these genes in pbx1 and pbx1 cells could be explained either by their inability to differentiate into igf2- and igf2r - expressing cell populations or by loss of pbx1-mediated transcriptional regulation. a strong argument against the hypothesis of the cell population shift as a major reason for the loss of igf2 expression is delivered by the coordinate upregulation of the h19 gene. it has been shown that expression of these two genes in endoderm and mesoderm relies on a common set of enhancers and is almost identical spatially and temporarily (leighton. interestingly, deregulation of igf2, igf2r, and h19 genes in pbx1280370 mutant expressing cells resembles the situation in the dna - methyltransferase - defficient (dnmt-1) knockout embryos where transcription of igf2 and its receptor is completely abolished and the normally inactive paternal copy of h19 gene becomes activated (li. additionally, two other imprinted genes, gtl-2 and neuronatin, were also found to be deregulated in pbx1 cells (takada. 2002 expression of all these genes is crucially dependent on dna methylation (li. it is therefore tempting to speculate that pbx1 has a function in establishing their methylation patterns. in conclusion, our experimental model yielded the discovery of a variety of new genes whose expression is associated with pbx1 function. identification of possible links between their deregulations and the phenotype of previously described pbx1 knockout mice awaits future investigation. the loss of igf2 expression in differentiated pbx1 cells is especially interesting in the context of decreased cellular proliferation rate in developing bone, pancreas, the hematopioetic system, kidney, and the male genital ridge of pbx1 knockout mice (dimartino. development of most of these organs has been previously linked to the mitogenic function of igf2 (van wyk and smith 1999 ; zumkeller and burdach 1999 ; kido. in particular, the roles of pbx1 and igf2 are well recognized in normal pancreas development (kido. 2002 ; kim. 2002). several studies have demonstrated that exocrine pancreatic development is crucially dependent upon mesenchymal / epithelial interactions, suggesting that exocrine growth factors play an essential role in this process (jonsson. additionally, formation of acinary cell structures in vitro could be rescued in pbx1 explants by wt mesoderm tissue in recombination experiments (kim. 2002). however, pbx1-regulated mesodermal growth factors, capable of rescuing exocrine pancreatic cell differentiation, were not identified. our data open a new possibility whereby pbx1 influences embryonic growth as well as endoderm and trophectoderm differentiation through regulation of the imprinted genes igf2 and igf2r. furthermore, we establish that pbx1 interactions with hox and dna are dispensable for neural gene expression. the last is interesting in the light of a recent report on the permissive role of pbx proteins in ra - induced neural differentiation of p19 carcinoma cell line (qin. still, the possible involvement of the pbx1 n - terminal domain in neural commitment remains to be tested. below is the link to the electronic supplementary material. (a) rt - pcr analysis of the pbx1 and pbx1 expression during differentiation of ra - induced and uninduced wt and pbx1 cells. rna was isolated from three stages of differentiation of ra - induced and non - induced wt and pbx1 cells. (0) represents undifferentiated es cells, (3) and (9) represent days post - attachment of embryoid bodies to adhesive culture dishes. () differentiation in absence of ra induction, (+) differentiation with 100 nm ra. using 5 region - specific primers, pbx1 transcripts were detected in both differentiating wt and mutant cells (second panel from top). rt - pcr reaction with one primer based on the exon-6 sequence allowed detection of the intact transcripts only in the wt and pbx1 cells. (b) the coding sequences of wt pbx1 and pbx1 were amplified in rt - pcr reactions with the primers : pbx1cds - f : 5-atggacgagcagccgaggc-3 ; pbx1cds - b : 5-aagaatccccattgagtgactgc-3 as described in the pbx1 pcr product was isolated from agarose gel with gel extraction kit (qiagen), cloned into pcrii - ta cloning kit (invitrogen), and sequenced (gif 156 kb). the region coding amino acids 280370, absent in the mutant transcript, is highlighted in red (gif 126 kb). real - time pcr transcript quantification of selected genes found to be differentially expressed in differentiated wt and pbx1 cells. the primers used : endothelial - specific rtk - x71426 : gaggtctcagtctcctgccaaa ; tcgcctctcgacttccacata aquaporin1-l02914 : gttctgccctaggcttcaatt ; cagagtagcgatgctcaaacc gtl-2 y13832 : ttgctggccctggagatc ; ggacgatggctaggatttcg neuronatin - x83569 : ccatcaaccagcagaatgga ; ctttctcttctgcaccgagatgt gapdh : gggaagcccatcaccatctt ; cggcctcaccccatttg pbx2 : tccccatttttggcatctct ; tccccaccccacttatatactct pbx3 : ccccggcgctttcc ; tttccttctcctagtgctccaaa (gif 150 kb). comparison of gene expression in differentiated wt and two clones of pbx1 cells using affymetrix array analysis. utilizing techniques described previously, rna was isolated from es cells at day 9 post - attachment to adhesive culture dishes. the array results for each pbx1 clone are compared to the same baseline denominator (rna isolated from wt es cells) and are expressed as fold change (xls 176 kb). comparison of gene expression in differentiated wt and two clones of pbx1 cells using affymetrix array analysis. utilizing techniques described previously, rna was isolated from es cells at day 9 post - attachment to adhesive culture dishes. the array results for each pbx1 clone are compared to the same baseline denominator (rna isolated from wt es cells) and are expressed as fold change (xls 126 kb). selected gene regulations from tables 1 and 2, consistent between two clones of pbx1 cells. genes were categorized based on subcellular localization(s) of the transcript - coded protein, cell lineage(s) demarcated by respective transcripts, as well as their function(s) (xls 233 kb). | experimentation with pbx1 knockout mice has shown that pbx1 is necessary for early embryogenesis. despite broad insight into pbx1 function, little is known about the underlying target gene regulation. utilizing the cre loxp system, we targeted a functionally important part of the homeodomain of pbx1 through homozygous deletion of exon-6 and flanking intronic regions leading to exon 7 skipping in embryonic stem (es) cells. we induced in vitro differentiation of wild - type and pbx1 mutant es cells by aggregation and retinoic acid (ra) treatment and compared their profiles of gene expression at the ninth day post - reattachment to adhesive media. our results indicate that pbx1 interactions with hox proteins and dna are dispensable for ra - induced ability of es to express neural genes and point to a possible involvement of pbx1 in the regulation of imprinted genes.electronic supplementary materialthe online version of this article (doi:10.1007/s11626 - 008 - 9162 - 5) contains supplementary material, which is available to authorized users. |
erythropoietin (epo) and other erythropoiesis stimulating agents (esas) are the main stay for the treatment of anaemia of chronic kidney disease (ckd). the main limitation of epo use in developing countries is cost, making it unavailable to most patients [1, 2 ]. androgens which are relatively cheap were used in the treatment of anaemia in dialysis patients before the advent of epo. however, there are concerns about their efficacy and side effects. the aim of this systematic review and meta - analysis was to examine the efficacy and harms of androgens for the treatment of anaemia of ckd compared to epo from published randomized controlled trials. we searched several databases (medline, embase, the cochrane library, lilacs, ajol, and cinahl) for randomized controlled trials using the key terms anaemia, chronic kidney disease, and androgens, without language restrictions. inclusion criteria are randomized or quasi - randomized controlled trials that directly compared any androgen with epo for the treatment of anaemia of ckd. exclusion criteria were study designs other than rcts or quasi - rcts and studies where androgens were used as adjuvants for the treatment of anaemia. in trials where there is more than two arms of treatment (e.g., androgen versus epo versus androgen plus epo), we extracted data for only androgens and the epo arms. the primary outcome of interest in this paper is the mean haemoglobin at the end of the trials. secondary outcomes include potential side effects in the two treatment arms as reported by the authors of the primary studies. other secondary outcomes include nutritional parameters such as weight gain and change in serum proteins. data were extracted using data extraction forms and analyzed using computer software, review manager 5.1 (cochrane collaboration). we summarized treatment effects as relative risks for dichotomous outcomes and mean differences for continuous outcomes with 95% confidence intervals using a random - effect model. a total of 127 titles were obtained from searches of data bases out of which we identified four eligible trials (figure 1). the four studies [47 ] included in the meta - analysis had a total of 114 participants as summarized in table 1. data was extracted from full text of three studies while one study was only available in an abstract form. overall, majority of the participants (83.33%) were males, mostly over 50 years of age. all the trials had small sample sizes (2430 patients) with a follow - up period of three to six months. methodological qualities of the studies were assessed using the risk of bias table in review manager 5.1 (cochrane collaboration). there is a significant risk of bias since they are all open labelled studies with potential risk of performance bias. eighty - three % of the patients in the studies (95 out of 114) were males (most of them over 50 years of age) while two studies included few females (19 out of 114) and patients younger than 50 years. nandrolone was the only androgen used in all the trials, at the dose of 100200 mg / week intramuscularly. the pooled difference in mean haemoglobin between the androgen and epo arms at the end of the trials was 0.11 (ci 0.80 to 0.58) which was not statistically significant (table 2). although there was significant heterogeneity for the outcome of haemoglobin across studies (i of 82%), all individual effect estimates did not favour epo over androgens (neither clinically meaningful nor statistically significant estimates). three trials reported increase in total serum protein which favours androgens with a mean difference of 0.54 (ci 0.4 to 0.68) which is statistically significant (table 3). there is a trend towards less increase in blood pressure requiring adjustment of blood pressure medications in the androgen arm with a relative risk of 0.17 (ci 0.031.08), p = 0.06, although the difference is not statistically significant (table 4). no liver function abnormalities were encountered in both arms of the treatments in all the trials. only one trial each presented some data on dyslipidemia and virilization, so meta - analysis could not be carried out for these outcomes. in this systematic review and meta - analysis of randomized controlled trials, we found no clinically important or statistically significant difference between androgens (nandrolone) and epo for the treatment of anaemia of ckd especially in men over 50 years. there is a statistically significant increase in serum proteins in the androgen arm of treatment. moreover, nandrolone was associated with a trend to less hypertension events requiring changes in antihypertensive medications. despite the limited available data, our findings have major implications for the care patients with ckd living in countries with limited resources. anaemia is an important complication of ckd which can occur even at early stages of the disease and is important both from the point of view of morbidity and mortality. erythropoietin and other related erythropoiesis stimulating agents (esas) are currently the main stay of the treatment of anaemia of ckd. however, recently there are concerns that the use of esas in the treatment of anaemia in ckd needs to be reevaluated. cost is a major limitation for the routine use of esas in developing countries. in a study from tunisia, only 10.8% of patients on hemodialysis were on epo, while 38% required regular transfusions. in developing countries where patients can not afford epo, anaemia is treated mainly with recurrent blood transfusions with attendant risks of complications such as transfusion transmissible infections, especially in the current pandemic of human immune deficiency virus infection. prior to the advent of epo in the 1980s and subsequently other esas, androgens such as nandrolone were used in the treatment of anaemia of ckd. androgens are thought to correct anaemia of ckd by enhancing the conversion of the pluripotent stem cell to erythroid colony forming and burst forming units. in addition, 5- metabolite of androgens stimulates erythropoiesis by enhancing erythropoietin production by the kidney, while the 5- metabolite stimulates the bone marrow directly. however, there are concerns about their efficacy and potential side effects such as hepatotoxicity, dyslipidemia, virilization, priapism, and hyperglycaemia. in the current era of evidence - based medicine, it is important to study systematically the efficacy and potential side effects of androgens for the treatment of anaemia of ckd before sanctioning or discouraging their use. this is particularly important for many developing countries where patients can not afford to buy esas. androgens are much cheaper than esas being five - times cheaper than epo treatment in the study by aggarwal.. one limitation is the fact that the findings are not generalizable to all patient populations with ckd. two of the four studies included in this meta - analysis had only male patients over the age of 50, likely because response to androgens has previously been shown to be age related and because of the risk of virilization in females. androgens may be more effective in older males because of testosterone deficiency in these patients. therefore, the findings of this study may not be applicable to women or men under 50 years of age. although there are no significant differences in side effects reported in the studies in this meta - analysis, this has to be interpreted with caution. the number of patients in the trials included in this meta - analysis is too small to exclude safety concerns. the trials had follow - up periods of three to six months and therefore may not have been sufficient to detect some of the known side effects of androgens which may take longer to develop. another potential limitation of this meta - analysis is the high degree of heterogeneity for the outcome of haemoglobin at the end of the trials. however, all individual effect estimates did not favour epo over androgens (neither clinically meaningful nor statistically significant estimates). since we found no difference between the 2 groups, the small number of studies found in this meta - analysis is also a limitation as it precluded exploring for publication bias. the cochrane handbook of systematic reviews recommends that as a rule of thumb : the funnel plot for detection of publication bias should not be used unless there are at least 10 studies. other formal tests for publication bias require even a larger number of studies (roughly 30) to reliably detect publication bias. however, although the number of eligible studies found in this meta - analysis is small, other nonradomized trials support the findings of our study. compared nandrolone in hemodialyzed males aged over 50 years with hemodialyzed males and females aged less than 50 years and found no difference in improvement of anemia between the two groups. in a recent study in predialysis patients, paul. concluded that nandrolone, though not equally effective, may be considered as a valid alternative therapy for the treatment of anemia of predialysis diabetic chronic kidney disease. our meta - analysis found a statistically significant advantage of androgens over epo in terms of improvement in serum proteins which could be a marker of better nutrition. this is an additional advantage of nandrolone over epo, which has also been supported by randomized controlled trials that address this and related outcomes [18, 19 ]. in addition to their role in the primary treatment of anaemia of ckd, androgens such as nandrolone have been used as adjuvants to the treatment of anaemia of ckd and for the treatment of erythropoietin - resistant anaemia [20, 21 ]. an ongoing systematic review in the cochrane collaboration will hopefully critically appraise all these aspects of androgen use in anaemia of ckd. we conclude that the results of this meta - analysis revealed no difference between the androgen nandrolone and epo for the treatment of anaemia of ckd in men over 50 years. therefore, androgens can be used for the treatment of anaemia of ckd in this category of patients, in resource - limited countries. however, further studies are needed to determine their long - term safety in men over 50 years old, as well as their effectiveness and safety in females in general, and males less than 50 years of age. | androgens which are relatively cheap were used in the treatment of anaemia in dialysis patients before the advent of erythropoietin (epo). however, there are concerns about their efficacy and side effects. aims. to examine the efficacy and harms of androgens for the treatment of anaemia of chronic kidney disease (ckd) compared to epo. settings and design. a systematic review and meta - analysis using an a priori protocol. methods and materials. we searched several databases for randomized controlled trials using the key terms anaemia, chronic kidney disease, and androgens, without language restrictions. we also searched reference lists of relevant articles. statistical analysis used. data was analyzed using review manger 5 software. we summarized treatment effects as relative risks and mean differences, with 95% confidence intervals using a random - effect model. we tested for heterogeneity with chi2 and the i2 statistics. results. we identified four eligible trials involving 114 participants, majority (83.33%) of whom were males, mostly over 50 years of age. the pooled difference in mean haemoglobin between the nandrolone and epo arms at the end of the trials was 0.11 (ci 0.80 to 0.58) which is not statistically significant. conclusions. this meta - analysis revealed no difference between nandrolone and epo for the treatment of anaemia of ckd in men over 50 years. therefore, nandrolone can be used for the treatment of anaemia of ckd in this category of patients, in resource - limited countries. however, further studies are needed to determine the long - term safety of nandrolone in men over 50 years old, as well as its effectiveness and safety in females in general, and males less than 50 years of age. |
congestive heart failure (chf) remains a major health problem worldwide, despite considerable progress in its management. the incidence and prevalence of this disease continues to increase due to an aging population, which, in part, is related to the use of new pharmacologic and non pharmacologic therapies. an estimated 67 million people have chf in the united states and europe, and approximately 1 million patients are diagnosed with chf every year (1, 2). the cost involved in the management of this problem is enormous and continues to climb. despite a progressive prognosis improvement thanks to the therapy with ace - inhibitors (3, 4), beta - blockers (5) and spironolactone (6), the quality of life in patients with advanced heart failure remains poor and mortality, due to risks for ventricular arrhythmias and sudden cardiac death, can increase. patients with advanced heart failure frequently have conduction disturbances (atrioventricular, inter- or intraventricular conduction delay with qrs interval > 120 ms) that play an important role in worsening cardiac systolic function and in increasing risk of death (7, 8). in recent years a new therapeutic approach, biventricular pacing (bivp), has been introduced as an adjunctive therapy to pharmacological treatment in patients with severe chf and intraventricular conduction delay. biventricular pacing stimulates the right atrium and both the ventricles simultaneously to resynchronize their action. many studies have demonstrated that bivp in patients with advanced chf significantly improves ventricular hemodynamics, quality of life, exercise capacity and reduces mortality and hospitalization rates (911). little is known yet about the influence of cardiac resynchronization therapy on the heterogeneity of ventricular repolarization (11, 12), which represents the arrhythmogenic substrate of dilatative cardiomyopathy and is identified on the electrocardiogram by qt dispersion (qtd), jt dispersion (jtd) and transmural dispersion of repolarization (tdr). the aim of our study was to evaluate the effect of biventricular pacing on electrocardiographic parameters of heterogeneity of ventricular repolarization, both spatial (qtd, jtd) and transmural (tdr). the study population consisted of fifty patients (43 male, 7 female, aged 60.2 3.1 years) suffering from congestive heart failure (n = 39 nyha class iii ; n = 11 nyha class iv) as a result of coronary artery disease (n = 19) or of dilated cardiomyopathy (n = 31). all patients were in sinus rhythm and demonstrated a left bundle branch block (qrs duration > 130 ms ; mean qrs duration > 156 21 ms) in the standard 12-lead electrocardiogram. all patients included in the evaluation showed an ejection fraction 55 mm. all patients were taking heart failure medications (ace - inhibitors, beta - blockers, diuretics, spironolactone), which remained unchanged during the previous six weeks before the permanent biventricular dddr pacemaker implantation. the atrial lead was placed high in the right atrium, the right ventricular lead was placed in the right ventricular apical endocardium, and the left ventricular lead was placed in an epicardial posterolateral vein via coronary sinus access similar to the methods described by daubert (13). the pacemakers were triple - output devices that made use of standard dualchamber technology, with built - in adapters to synchronize the pacing of the two ventricles. results of the implantations were assessed from the positions of the leads on chest x - ray films and from changes in the width of the qrs interval on 12-lead surface electrocardiogram. each patient underwent a twelve - lead surface electrocardiogram, recorded at a speed of 50 mm / sec and performed before pacemaker implantation and at the end of follow - up period, twelve months after the procedure. the ecg recording was performed during sinus rhythm (sr), right ventricular endocardial pacing (rvendop), left ventricular epicardial pacing (lvepip) and biventricular pacing (bivp). special attention was paid to eliminate all correctable causes of noise, such as muscle tremor, and to minimize electromagnetic frequency interference generated by electrical sources next to lead array. the pacing sequences were randomly switched between the patients and no effects on the results were observed. the study was approved by the local ethics committee and written informed consent was obtained from all patients prior to enrolment. twelve - lead body surface electrocardiograms were recorded at a speed of 50 mm / sec. qrs duration, qt interval, jt interval and tpeak - end interval measurements were performed with the use of computer software (configurable measurement system) using digitizer 34180 (calcomp, anaheim, california). the standard correlation was 95% (95% confidence intervals 6.73 to 6.01). in each electrocardiogram the leads were excluded from analysis when the end of the t - wave was not clearly distinguishable or the signal quality was too poor for analysis. the qrs interval was measured from the start of the q wave or, in absence of the q wave, from the start of r wave to the end of s, that is to its return to the isoelectric line. the qt interval was measured from the initial deflection of the qrs complex to the end of t wave, that is, to the point where t wave returned to the isoelectric line. in case there was a u wave, the qt interval was measured to the lowest part of the curve between the t and u waves. the tpeak - end interval was defined as the interval from the maximum t - wave amplitude to the end of the t - wave (14). qt dispersion (qtd) was the difference between the maximal and the minimal qt value in all leads (15). the difference between the maximal and the minimal jt value in all leads was defined jt dispersion. the transmural dispersion of repolarization (tdr) was defined as the interval between the peak to the end of the t wave (16, 17), which for our analysis we have considered the mean value. statistical analysis was done using student s t test for paired data and one - way analysis of variance (ano - va) coupled with fisher s lsd test among three or more groups. the study population consisted of fifty patients (43 male, 7 female, aged 60.2 3.1 years) suffering from congestive heart failure (n = 39 nyha class iii ; n = 11 nyha class iv) as a result of coronary artery disease (n = 19) or of dilated cardiomyopathy (n = 31). all patients were in sinus rhythm and demonstrated a left bundle branch block (qrs duration > 130 ms ; mean qrs duration > 156 21 ms) in the standard 12-lead electrocardiogram. all patients included in the evaluation showed an ejection fraction 55 mm. all patients were taking heart failure medications (ace - inhibitors, beta - blockers, diuretics, spironolactone), which remained unchanged during the previous six weeks before the permanent biventricular dddr pacemaker implantation. the atrial lead was placed high in the right atrium, the right ventricular lead was placed in the right ventricular apical endocardium, and the left ventricular lead was placed in an epicardial posterolateral vein via coronary sinus access similar to the methods described by daubert (13). the pacemakers were triple - output devices that made use of standard dualchamber technology, with built - in adapters to synchronize the pacing of the two ventricles. results of the implantations were assessed from the positions of the leads on chest x - ray films and from changes in the width of the qrs interval on 12-lead surface electrocardiogram. each patient underwent a twelve - lead surface electrocardiogram, recorded at a speed of 50 mm / sec and performed before pacemaker implantation and at the end of follow - up period, twelve months after the procedure. the ecg recording was performed during sinus rhythm (sr), right ventricular endocardial pacing (rvendop), left ventricular epicardial pacing (lvepip) and biventricular pacing (bivp). special attention was paid to eliminate all correctable causes of noise, such as muscle tremor, and to minimize electromagnetic frequency interference generated by electrical sources next to lead array. the pacing sequences were randomly switched between the patients and no effects on the results were observed. the study was approved by the local ethics committee and written informed consent was obtained from all patients prior to enrolment. twelve - lead body surface electrocardiograms were recorded at a speed of 50 mm / sec. qrs duration, qt interval, jt interval and tpeak - end interval measurements were performed with the use of computer software (configurable measurement system) using digitizer 34180 (calcomp, anaheim, california). the standard correlation was 95% (95% confidence intervals 6.73 to 6.01). in each electrocardiogram the leads were excluded from analysis when the end of the t - wave was not clearly distinguishable or the signal quality was too poor for analysis. the qrs interval was measured from the start of the q wave or, in absence of the q wave, from the start of r wave to the end of s, that is to its return to the isoelectric line. the qt interval was measured from the initial deflection of the qrs complex to the end of t wave, that is, to the point where t wave returned to the isoelectric line. in case there was a u wave, the qt interval was measured to the lowest part of the curve between the t and u waves. the tpeak - end interval was defined as the interval from the maximum t - wave amplitude to the end of the t - wave (14). qt dispersion (qtd) was the difference between the maximal and the minimal qt value in all leads (15). the difference between the maximal and the minimal jt value in all leads was defined jt dispersion. the transmural dispersion of repolarization (tdr) was defined as the interval between the peak to the end of the t wave (16, 17), which for our analysis we have considered the mean value. statistical analysis was done using student s t test for paired data and one - way analysis of variance (ano - va) coupled with fisher s lsd test among three or more groups. biventricular pacing resulted in a statistically significant reduction in patient qrs duration (132 16 ms during bivp versus 156 21 ms at baseline, n = 50, p = 0.02). right ventricular endocardial pacing and left ventricular epicardial pacing, on the other hand, led to a marked prolongation in ventricular activation time (183 12.3 ms during rvendop ; 190 15 ms during lvepip versus 156 21 ms at baseline, p<0.05) (fig. 1qrs duration at baseline rhythm (15621 ms) and during left ventricular epicardial pacing (lvepip ; 19015 ms, p<0.05), right ventricular endocardial pacing (rvendop ; 18312.3 ms, p<0.05) and biventricular pacing (bivp ; 13216 ms, p<0.02). qrs duration at baseline rhythm (15621 ms) and during left ventricular epicardial pacing (lvepip ; 19015 ms, p<0.05), right ventricular endocardial pacing (rvendop ; 18312.3 ms, p<0.05) and biventricular pacing (bivp ; 13216 ms, p<0.02). biventricular pacing significantly reduced qt dispersion, compared to sinus rhythm (73.93 19.4 ms during bivp vs 91 36.7 at sinus rhythm, n = 50, p = 0.004). right ventricular endocardial pacing and left ventricular epicardial pacing both caused a significant increase in qtd value (rvendop 94 51 ms, p<0.03 ; lvepip 116 71 ms, p<0.02). (9136.7 ms) right ventricular endocardial pacing (rvendop, 9451 ms, p<0.03), left ventricular epicardial pacing (lvepip ; 11671 ms, p<0.02), and biventricular pacing (bivp 73.9319.4 ms ; p=0.004). (9136.7 ms) right ventricular endocardial pacing (rvendop, 9451 ms, p<0.03), left ventricular epicardial pacing (lvepip ; 11671 ms, p<0.02), and biventricular pacing (bivp 73.9319.4 ms ; p=0.004). there was no statistically significant effect on jt dispersion during rvendop and lvepip as compared to sinus rhythm, whereas biventricular pacing significantly decreased the jt dispersion (73.18 17.16 ms during bivp vs 100.72 39.04 at baseline n = 50, p = 0.003 ; fig. (100.7239.04 ms), right ventricular endocardial pacing (rvendop ; 79.1830.83 ms ; p= ns), left ventricular epicardial pacing (lvepip ; 89.9543.60 ms ; p = ns), and biventricular pacing (bivp 73.1817.16 ms ; p=0.003). (100.7239.04 ms), right ventricular endocardial pacing (rvendop ; 79.1830.83 ms ; p= ns), left ventricular epicardial pacing (lvepip ; 89.9543.60 ms ; p = ns), and biventricular pacing (bivp 73.1817.16 ms ; p=0.003). the transmural dispersion of repolarization (tdr) was significantly increased during rvendop (108.1319.94 ms ; p<0.002) and lvepip (114.71 26.1 ms ; p<0.05), whereas biventricular pacing significantly decreased the transmural dispersion of repolarization (93.16 15.60 ms ; p<0.004), as compared to sinus rhythm (101.55 19.08 ms ; fig. 4pacing site dependent changes in transmural dispersion of repolarization (tdr) values during sinus rhythm (101.5519.08 ms), right ventricular endocardial pacing (rvendop ; 108.1319.94 ms ; p<0.002), left ventricular epicardial pacing (lvepip ; 114.7126.1 ms ; p<0.05), and biventricular pacing (bivp, 93.16 15.60 ms ; p<0.004). pacing site dependent changes in transmural dispersion of repolarization (tdr) values during sinus rhythm (101.5519.08 ms), right ventricular endocardial pacing (rvendop ; 108.1319.94 ms ; p<0.002), left ventricular epicardial pacing (lvepip ; 114.7126.1 ms ; p<0.05), and biventricular pacing (bivp, 93.16 15.60 ms ; p<0.004). in our study, we evaluated the pacing - site dependent change in markers of ventricular repolarization heterogeneity in a population of fifty patients with congestive heart failure. the ventricular repolarization heterogeneity is an expression of regional (qtd, jtd) and transmural (tdr) differences in cellular action potential duration and in ventricular recovery time. in heart failure patients, the preferential prolongation of the m cell action potential results in the development of a transmural dispersion of repolarization (tdr), which can be estimated from the electrocardiogram as the interval between the peak and the end of the t wave (18). previous electrophysiological studies (1921), have highlighted the role of ventricular repolarization heterogeneity on the genesis of ventricular malignant arrhythmias in heart failure patients. in failing myocardium, the enhancement of qtd, jtd and tdr values increases the risk for development of malignant ventricular arrhythmias, probably via two mechanisms. first, it facilitates transmural differences early after depolarization propagation ; second, it could cause intramural functional conduction blocks that predispose to re - entrant polymorphic ventricular tachyarrhythmia (22). several studies suggested that tdr and jtd are clinically useful in assessing arrhythmia risk (23, 24), because they are parameters less dependent on ventricular depolarization and reflect better than qtd the ventricular repolarization heterogeneities in patients with intraventricular conduction abnormalities (25, 26). medina - ravell and coworkers in a recent experimental study have suggested (12) a potentially harmful influence of cardiac resynchronization therapy on ventricular repolarization. the authors found that biventricular pacing or left ventricular epicardial pacing prolong qt interval, increase transmural dispersion of repolarization, and may be a potential risk for development of torsade de pointes in a subset of patients. nevertheless, abraham wt and bristow mr in two distinct prospective, randomized studies (28, 29) did not find any excess mortality due to sudden death in a population with chronic heart failure and biventricular pacing. however, in the study of medina - ravell, qtd, jtd and tpeak - end was not estimated at baseline and during biventricular pacing. in our opinion, this information is really important. in our study, differences in various parameters of ventricular repolarization heterogeneity (qtd, jtd, tdr) during right endocardial ventricular, left epicardial ventricular and biventricular pacing in heart failure patients have been obtained using a standard 12-lead ecg. our data, in contrast to medina - ravell s findings, showed that biventricular pacing reduced the qtd, jtd and tdr and, with them, the relative risk of malignant ventricular arrhythmias. nevertheless, in accordance with medina - ravell findings and those of fish, epicardial pacing of left ventricle has been shown to increase the ventricular heterogeneity of repolarization, probably because the physiological ventricular activation was reversed. normally, ventricular activation starts with endocardium via subendocardial purkinje network and spreads across the ventricular wall. although the epicardium is activated last, it repolarizes first, producing a repolarization sequence opposite to activation (14). furthermore, our data showed that sole right endocardial ventricular pacing increased qtd and tdr less than left epicardial ventricular stimulation. qt interval and tpeak - end measurements were conducted in 12-lead ecgs, with the use of computer software and digitizer by an experienced observer. despite all that, the reliability of the measurements remains uncertain to the extent that the lack of a consensus has as a consequence the absence of indisputable, generally accepted criteria for the definition of the end of t interval. biventricular pacing causes a stastically significant reduction of all parameters proposed to estimate the heterogeneity of ventricular repolarization (qtd, jtd, tdr), as compared to sinus rhythm, whereas both right ventricular endocardial and left ventricular epicardial pacing cause an increment of heterogeneity of ventricular repolarization. in conclusion our data show that cardiac resynchronization therapy could have an electrophysiologic antiarrhythmic influence on arrhythmogenic substrate of dilatative cardiomyopathy. further long - term studies have to asses the utility of surrogate parameters of ventricular dispersion of repolarization. | objective : the aim of our study was to evaluate the effect of cardiac resyncronization therapy (crt) on qt dispersion (qtd), jt dispersion (jtd) and transmural dispersion of re - polarization (tdr), markers of heterogeneity of ventricular repolarization in a study population with severe heart failure.methods and results : fifty patients (43 male, 7 female, aged 60.2 3.1 years) suffering from congestive heart failure (n = 39 nyha class iii ; n = 11 nyha class iv) as a result of coronary artery disease (n = 19) or of dilated cardiomyopathy (n = 31), sinus rhythm, qrs duration > 130 ms (mean qrs duration > 156 21 ms), an ejection fraction 55 mm, underwent permanent biventricular dddr pacemaker implantation. a 12-lead standard electrocardiogram was performed at baseline, during right-, left-, and biventricular pacing and qtd, jtd and tdr were assessed. biventricular pacing significantly reduced qtd (73.93 19.4 ms during bivp vs 91 6.7 ms at sinus rhythm, p = 0.004), jtd (73.18 17.16 ms during bivp vs 100.72 39.04 at baseline p = 0.003), tdr (93.16 15.60 vs 101.55 19.08 at baseline ; p<0.004), as compared to sinus rhythm. right ventricular endocardial pacing and left ventricular epicardial pacing both enhanced qtd (rvendop 94 51 ms, p<0.03 ; lvepip 116 71 ms, p<0.02) and tdr (rvendop 108.13 19.94 ms ; p<0.002 ; lvepip 114.71 26.1 ; p<0.05).there was no effect on jtd during right and left ventricular stimulation.conclusions:biventricular pacing causes a statistically significant reduction of ventricular heterogeneity of ripolarization and has an electrophysiological antiarrhythmic influence on arrhythmogenic substrate of dilatative cardiomiopathy. |
human ability to independently move the upper extremity is the result of the combined movement of many musculoskeletal structures and of the increased freedom of movement allowed by the necessary decreased stability1, 2. the shoulder girdle is the main link of the upper extremity to the trunk, and it plays an important role in the movement quality, while providing anatomical and functional cooperation of the shoulder and scapula - thoracic joints as necessary. scapular upward rotation is an essential component of any lifting of the upper extremity, in combination with humeral elevation at the glenohumeral joint. these involve force couples formed by the upper (ut) and lower (lt) trapezius with the serratus anterior (sa) muscles. the result of these combined contractions is upward scapular rotation without any displacement of the scapula in the superior or inferior directions due to cooperation of the ut and lt muscles. at the same time, combined action of the whole trapezius muscle and the sa prevents any displacement of the scapula in the side - to - side direction3, 4. as a result, a variety of dysfunctions with pathological or clinical symptoms might develop and need to be assessed and addressed by therapists1, 5. consequently, rehabilitation protocols aim for the activation or improvement of muscular cooperation, balance, proprioception, power and strength of the main muscle stabilizers of the scapula3, 5. exercises contributing to the achievement of therapeutic targets are closed kinetic, and they force the whole upper extremity to function as a unit and in a more harmonic manner during daily life6. these exercises are recognized as therapeutic tools and have great variety and many levels of difficulty during their performance6, 7. one of the exercises that is used by therapists, and thus, is an object of study, is the push - up plus (pup). in the pup exercise, the rest of the body forms a straight line from the head to the ankles and with the torso lying near the floor but without touching it. from this starting position, where the elbows are almost in the fully flexed position, the subject raises the body upwards as far as possible by extending the elbows and protracting the scapulae. thus, pup includes two phases : (1) the push - up (pu) phase that involves the first part of the pup which ends at the point of completion of elbow extension without scapular protraction, and (2) the plus (p) phase that is the remaining part of the pup which starts with completion of elbow movement and continues until the end of the scapular protraction. pup is performed in a closed kinetic chain presupposing muscle cooperation without requiring special equipment. it elicits high activation of the trapezius and serratus anterior muscles which varies even with small performance alterations7. characteristically, during the pup exercise, muscle activation and force response increase significantly with increasing levels of exercise difficulty within safe limits3, 7. different studies have examined the effect of single factors, such as the support surface7, 9 or the hand orientation on muscular activity during the pup10,11,12,13. due to the complexity of the exercise performance, it is a closed - kinetic activity of the whole body, the effect of different parameters acting simultaneously on the muscle activity must be investigated. consequently, this study examined the effect of stable and unstable support surfaces, using three different hand positions, on the activities of the trapezius and serratus anterior muscles during the different phases of the push - up plus exercise (pu and p). thirteen healthy male right - handed subjects who led a sedentary life (aged 20.5 1.0 years, body weight 79.2 12.3 kgr and height 178.8 7.2 cm) participated in this study. the tested population was recruited from the department of physiotherapy through requests for volunteers and represented a population of young students. none of the subjects were professional athletes or were exercising more than five hours per week. the selection criteria for the sample were to be healthy without a history of neck, back or shoulder pain, injury or operation in these areas (determined by a self - completed questionnaire). the study was conducted in accordance with the principles of the declaration of helsinki and approved by the department of physiotherapy human ethics committee (approval number 124/2013). confidentiality and anonymity of the participants were maintained at all times, and written informed consent was obtained from all the participants prior to their participation. the experimental set - up was developed at the human performance & rehabilitation laboratory of the physiotherapy department where the whole procedure was carried out. data were collected from the dominant arm and all measurements were recorded in a single session. initially, the subjects were familiarized with the experimental set - up and the protocol while all exercises were completed in a slow, controlled manner with the aid of a metronome set at a tempo of 60 beats / min. activities of the ut, lt and sa muscles were recorded using surface electromyography. a laboratory system, the datalink (type nosdlk900 with software version 7.5, biometrics ltd, uk), was used. three active emg sensors sx230 and a twin axis goniometer (biometrics ltd) were employed for the measurements. emg electrodes were placed on the appropriate locations, using double - sided die - cut tapes provided by the manufacturer, in order to record the activities of the ut, lt and sa muscles according to the recommendations of seniam14. a goniometer was placed on the elbow joint following the manufacturer s guidelines to record the motion of the joint at the same time as the emg recording. a custom - made stop switch was used to determine the end of the exercise. this was triggered when the maximum distance from the floor was reached by the posterior part of the subject s thoracic spine. all emg signals were amplified and sampled at 1,000 hz. before testing, anthropometric characteristics were measured and a standardized warm - up procedure13 was used including movement of both arms, such as circumduction and oscillation in the sagittal plane, as well as stretching exercises of the rotator muscles. subjects then adopted the push - up position by supporting their weight on both hands and feet. the distance between both hands was equal to 120% of the distance between both the acromions, and the hands were placed at the level of the shoulder joints. the distance between the hands and feet was equal to that measured in the upright position with the shoulders flexed at 90. the measured task was performed on a surface that was parallel to the floor. the hands and feet were always in contact with the support surface while the body formed a straight line from the head to the ankles. the subjects performed the pup exercise by placing their hands on a stable wooden surface or on an unstable one that was constructed by adding a wobble board (rocking side - to - side at a maximum of 16) under the stable wooden surface. they had to balance on those surfaces and not to rock side - to - side during the measured exercise. the feet of the participants were always placed on a stable wooden surface adjusted to the level of the surface used for the hand placement. subjects were also asked to perform the exercise with the upper limbs in three different orientations, as follows : position 1 (p1) : the index fingers were placed parallel to each other on the support surface and each arm was allowed to adopt a self - selected position ; position 2 (p2) : the index fingers were placed parallel to each other on the support surface while each arm was kept in contact with the trunk of the subject ; and position 3 (p3) : the index fingers were placed at 45 of internal rotation compared to p1 and each arm was kept at 90 of abduction at the shoulder joint. participants were asked to perform 3 successful repetitions of the tested trials while a rest period of 1 min was allowed between repetitions to avoid fatigue. each volunteer performed 18 successful repetitions of pup exercises, that is : [3 trials ] [2 surfaces (stable vs unstable) ] [3 hand positions (p1, p2 & p3) ]. finally, three successful trials of the maximum voluntary isometric contraction (mvic) of each measured muscle were recorded following a muscle testing procedure suggested by previous research15. during data collection, the raw emg recordings were the monitored, full - wave rectified and processed using a root mean square (rms) algorithm with a 3-ms moving window. measurements were expressed in millivolts and the mean value of the three trials for each muscle was used for the estimation of the activation of each tested muscle. finally, the emg activity values of each measured muscle during the pup exercise were expressed as a percentage of the emg values produced by the muscle during the muscle testing performance, % mvic. the signal of the goniometer was used to monitor the start and the end of the elbow movement and at the same time to mark the start and the end of the push - up phase of the pup exercise. the signal of the back - stop was used to monitor the end of the pup exercise. consequently, those two signals were the discriminating landmarks of the two phases of the measured pup exercise, that is the pu and the p phase. the intraclass correlation coefficient (icc) was used to determine the same day test - retest reliability of the three emg recordings. in order to determine if there were significant differences in the emg activities of ut, lt, sa, as well as in the ut / lt activity rations among the different phases of the exercise, hand positioning and support surfaces, analysis of variance (anova) was performed. a least squares difference (lsd) pairwise multiple comparison analysis was performed to determine the significance of the differences between pairs of means. statistical analysis was performed using spss 20.00 software and significance was accepted in all statistical tests for values of p0.05 and f=1.2). more specifically, the differences between the pu phase (30.2 13.6%mvic) and p phase (24.1 8.5%mvic), as well as between the hand positions of p1 (25.1 8.8%mvic) and p2 (29.5 12.6%mvic) were statistically significant. similar to the ut, the overall activation of lt was also significantly altered by the phase of the exercise (p0.05 and f=6.4). more specifically, the differences between the pu phase (49.2 17.9%mvic) and p phase (75.9 16.1%mvic) as well as between the hand positions of p2 (59.6 17.6%mvic) and p3 (66.3 22.3%mvic), and finally between the stable (65.9 21.8%mvic) and unstable (59.9 17.3%mvic) support surfaces, were statistically significant. finally, the ut / lt activity ratio was significantly affected by the phase of the exercise (p<0.05 and f=5.7), and the p phase (8.1 4.3) was significantly different from the pu phase (6.0 4.5). table 1 table 1.the emg activities (mean values sd) of the measured muscles (ut, lt and sa) as a percent of maximum voluntary isometric contraction (% mvic) and the ut / lt ratio during the phases of the push - up plus exercise (push - up and plus) on stable and unstable supporting surfaces with three different hand positions (p1, p2 and p3) shows the emg activities (mean sd) of the measured muscles (ut, lt & sa) under the tested experimental conditions with the statistical significance of the differences. the pup exercise is an important tool for therapists, aiming to deal with problems of the upper extremity and specifically to improve the stability of the scapula - thoracic joint by increasing muscular cooperation1, 13. such a demanding task requires well - documented supervision and guidance during its performance resulting from the extensive study of the effect of different parameters on muscle activation8. so, the study of the muscle performance, during pup and the simultaneous effect of different conditions to overcome them can be crucial. in the present study an effort was made to identify the effects elicited by the support surface, hand positions, and phase of the pup exercise. different phases of the exercise require different muscle activation with a variety of activation levels, due to different movements taking place and the different ranges of movement used8. the pu phase mainly involves elevation of the upper arm with associated movement of the scapula resulting from the activation of the ut and lt. in contrast, the p phase only involves movement of the scapula leading to activation mainly of the sa. at the same time, cooperation of ut and lt this muscle cooperation can be explained by the present findings which are in agreement with the results of similar studies4, 6. statistically significant differences were recorded for ut, lt and the ut / lt ratio during the pu phase and for sa during the p phase. the stability of the supporting surface alters the stability of the human body and it is an important factor demanding different patterns of muscular cooperation5, 6. consequently, stable and unstable supports were used in an attempt to identify their effects on muscular activity and the resulting movement patterns. when subjects tried to avoid rocking side - to - side on the unstable surface, they introduced abduction - adduction to the shoulder joints leading to abduction - adduction of the scapula, altering the muscle involvement. the present results suggest that an unstable support surface only has a significant effect on the activity of sa, with the stable surface increasing sa muscular activity. these findings can be explained by the fact that abduction - adduction of the scapula is involved ; therefor the sa must be activated. why is the sa activity on an unstable supporting surface less than that on a stable one ? one possible explanation is that there is a decrease in the pu phase of the task resulting from a fear of falling or the mobilization of other muscles such as the horizontal adductors of the shoulder. pup is a demanding task that requires activation of the whole body and is difficult to supervise and consequently perform properly. a possible solution to this problem might be the use of optoelectronic techniques to record movement in 3d. pup on unstable surfaces has been found to increase sa muscle activity4, 7, 9, or sa in combination with ut, and to increase the activity of the trapezius while decrease the activity of sa16. considering that the unstable surface had a low level of instability (rocking of 16), and only in one direction (side - to - side), the effect of instability on muscular activity needs to be investigated further. the hand position in pup changes the degree of arm elevation in the frontal plane, altering the range of arm movement as well as the movement itsself10,11,12. flexion, abduction or horizontal abduction is required at the shoulder joint, leading respectively, to upward rotation with retraction, or adduction of the scapula. ut and lt demonstrated the same activity patterns in response to hand positioning, and axially showed statistically significant increased involvement in hand position p2. as this position elicits shoulder flexion during the pup, and consequently upward rotation and protraction of the scapular, increased movement and stability of the scapula was needed in the frontal plane. in contrast, sa showed significant increase in activity in hand position p3, that is when scapular adduction occurred, replacing scapular movement in the frontal plane. nevertheless, scapular stability in this plane was nt necessary. the present findings suggest that different phases of the pup exercise require different muscle activities and co - operation. similarly, the type of supporting surface and the positioning of the hands affect muscle activities in a manner that is dependent on the phase of the exercise making its prescription a highly demanding therapeutic task. the data was obtained from a small group of young, healthy male adults and only their dominant right hand was measured. therefore, the extrapolation of the findings to patients or to the general population should be performed with caution. | [purpose ] the appropriate exercise prescription is crucial for achieving scapular stability and providing successful rehabilitation, and the push - up plus (pup) exercise has an important role in shoulder rehabilitation. consequently, this study examined the effect of support surface stability, hand positioning, and phase of exercise, on the trapezius and serratus anterior muscle contractions as well as on the emg ratio of the upper / lower trapezius. [subjects and methods ] thirteen healthy male volunteers participated in this study. the subjects performed the pup exercise on stable and unstable supporting surfaces with three different hand orientations. during the pup exercise, the muscle activities of the upper (ut) and lower (lt) trapezius, as well as the serratus anterior (sa) were measured and expressed as percentages of maximum voluntary isometric contraction (% mvic). [results ] the emg activities of ut and lt were statistically greater during the push - up phase compared to the plus phase of the exercise. the contrary was recorded for the activity of the sa. sa was affected by the support surface as well as by the hand positioning. [conclusion ] the results suggest that different phases of the pup exercise require different muscle stability actions with corresponding activations of appropriate muscle fibers. a detailed prescription of the required phase of the exercise can more effectively activate the scapula - thoracic musculature. |
digoxin is widely used in the treatment of various heart conditions, namely artial fibrillation, artial flutter and sometimes heart failure that can not be controlled by other medication (chao., 1992). several epidemiological studies indicated that breast cancer cells obtained from women on digitalis therapy (for congestive heart failure) were characterized by a series of more benign features compared with cancer cells from control patients (stenkvist 1999 ; stenkvist. the growth inhibitory effects of cardiac glycosides such as digoxin in the several cancer cell lines have been reported (haux 1999 ; johansson., 2001 ; lindholm., 2002 ; lpez - lzaro., 2005 ; svensson., 2005 ; prassas and diamandis 2008). taken together, it is very probable that digoxin has effect(s) on dna and chromosomes. considering that there is no published data about effect of digoxin on induction of chromosomal aberrations, the present study was carried out. the aim of the present study was to assess the effect of digoxin on chromatid and chromosomal aberrations on chinese hamster ovary (cho) cells. in the present study, experiments were carried out using the chinese hamster ovary (cho) cell line. the cells were maintained in rpmi-1640 medium (from gibco) supplemented with 10% inactivated fetal calf serum (from gibco), 2 mm l - glutamine and with the addition of penicillin (100 u / ml) and stereptomycin (100 mg / ml). for the present experiment we used lanoxin (a trade name of digoxin, a liquid form, 0.25 mg / ml ; kern company). cells were seeded into 96-well plates at 2 10cells / well in 100 l complete medium. after the cells clung to plates, the cells were treated with various concentration of digoxin (2.5, 5, 10, 15, 20, 25, 30, 35 g / ml) for 24 h. final volume in each well was 200 l. subsequently, the cell viability was measured by mtt dye reduction assay (mosmann, 1983 ; liu., 1997). the formazan dye was measured by elisa reader. after obtaining the absorption, percentage inhibition of cell growth the ic50 is defined as the cytotoxicity index that reduces the cell number to 50 % compared with untreated - control cho cells. mitomycin - c (0.06 g / ml) and sodium arsenite (1 gm) were used as positive controls (mahata., 2004 ; celikler., 2008 ; samuel., 2011 ; sulaiman, 2012 ; sedigh - ardakani., 2013). the cho cells were seeded at the density of 1.8 10 cells / petridish in the volume of 10 ml. after 48 h, the cells were treated with different doses of digoxin (5, 10, 15 and 20 g / ml) in rpmi-1640 for 24 h. chromosomes were conventionally stained with giemsa. chromosome aberrations were classified to chromatid breaks and polyploidy. to determine the mitotic index (percentage of cells in mitosis), 1000 cells in each slide were observed. in each slide all experiments (for determining either cytotoxiciy or chromosomal breakage) were performed in triplicate. the level of the chromatid and chromosome breaks and also polyploidy, cells with aberrations and mitotic index are presented as mean + standard deviation (sd). comparisons of the mean values of the studied indices were done using one way analysis of variance. statistical analysis was performed using spss statistical software package (version 11.5) for windows (spss inc., in the present study, experiments were carried out using the chinese hamster ovary (cho) cell line. the cells were maintained in rpmi-1640 medium (from gibco) supplemented with 10% inactivated fetal calf serum (from gibco), 2 mm l - glutamine and with the addition of penicillin (100 u / ml) and stereptomycin (100 mg / ml). for the present experiment we used lanoxin (a trade name of digoxin, a liquid form, 0.25 mg / ml ; kern company). cells were seeded into 96-well plates at 2 10cells / well in 100 l complete medium. after the cells clung to plates, the cells were treated with various concentration of digoxin (2.5, 5, 10, 15, 20, 25, 30, 35 g / ml) for 24 h. final volume in each well was 200 l. subsequently, the cell viability was measured by mtt dye reduction assay (mosmann, 1983 ; liu., 1997). the formazan dye was measured by elisa reader. after obtaining the absorption, percentage inhibition of cell growth the ic50 is defined as the cytotoxicity index that reduces the cell number to 50 % compared with untreated - control cho cells. mitomycin - c (0.06 g / ml) and sodium arsenite (1 gm) were used as positive controls (mahata., 2004 ; celikler., 2008 ; samuel., 2011 ; sulaiman, 2012 ; sedigh - ardakani., 2013). the cho cells were seeded at the density of 1.8 10 cells / petridish in the volume of 10 ml. after 48 h, the cells were treated with different doses of digoxin (5, 10, 15 and 20 g / ml) in rpmi-1640 for 24 h. chromosomes were conventionally stained with giemsa. chromosome aberrations were classified to chromatid breaks and polyploidy. to determine the mitotic index (percentage of cells in mitosis), 1000 cells in each slide were observed. in each slide all experiments (for determining either cytotoxiciy or chromosomal breakage) were performed in triplicate. the level of the chromatid and chromosome breaks and also polyploidy, cells with aberrations and mitotic index are presented as mean + standard deviation (sd). comparisons of the mean values of the studied indices were done using one way analysis of variance. statistical analysis was performed using spss statistical software package (version 11.5) for windows (spss inc., effect of digoxin on proliferation of cho cells was investigated. after 24 h treatment of cho cells with 2.5, 5, 10, 15, 20, 25, 30, 35 g / ml of digoxin, the percent of cell inhibition were 4.5, 9.4, 19.4, 28.3, 39.9, 60.8, 83, and 97, respectively (figure 1(fig. 1)). percent of growth inhibition rate increased as a function of digoxin concentration (r = -0.980, df = 25, p < 0.001). the ic50 for digoxin was estimated 22.5 0.81 g / ml. the results of chromosome aberration test were presented in table 1(tab. 1). there were significant difference between positive controls and negative control for frequencies of chromatid breaks and polyploidy (for all comparisons p - values were less than 0.01). digoxin at final concentration of 25 g / ml results very low metaphases, therefore, the analysis did not perform. all of the study aberrations and frequency of aberrant cells significantly increased as a function of digoxin concentration (for chromatid breaks : r = 0.881, df = 13, p < 0.001 ; for polyploidy : r = 0.777, df = 13, p = 0.001 ; for cells with aberrations : r = 0.926, df = 13, p < 0.001). however, the mitotic index negatively correlated with the concentration of digoxin (r = -0.978, df = 13, p < 0.001). based on more than a thousand published scientific articles, it is well established that using in vitro system, cardiac glycosides showed anti - cancer properties (prassas and diamandis, 2008). although the molecular mechanisms under lying the increased susceptibility to cancer cells to cardiac glycosides are not fully elucidated, some mechanisms such as alterations in homeostasis of k, na, and ca, inhibition of tumor necroses factor and nuclear factor b, increased production of reactive oxygen species, inhibition of toposiomerase ii, etc, might be involved (mcconkey., 2000 ; prassas and diamandis, 2008). considering that digoxin increased the frequency of chromatid and chromosome breaks, it is suggested that digoxin may interact with dna and subsequently inhibits cell division. the peak serum digoxin concentration (5 - 20 ng / ml) was much lower than concentrations we used in the present experiments (marcinkowska - krlewicz and feldmann, 1998 ; tayrouz., 2003 ; kothare., 2005). based on the results of the present study, all concentrations that cause chromosomal aberrations are in the cytotoxic range of digoxin. therefore, it is possible that digoxin shows different patterns level of toxicity depended to cell type. on the other hand patients are exposed for longer periods compared to our cell culture system. taken together, it is necessary to evaluate the chromatid breaks, micronuclei, and sister chromatid exchange in lymphocytes of patients who received digoxin. finally it should be mentioned that digoxin must be used cautiously in generally and particularly in children and pregnant women. | digoxin is a cardiac glycoside that has been reported to inhibit growth of multiple tumor cell types in vitro. the present study was assessing the cytogenetic effects of this drug on chinese hamster ovary (cho) cells. all experiments were performed in triplicate. the ic50 was 22.5 0.8 g / ml. to investigate the clastogenic effects of drug, chromosomal aberration in metaphase cells were analyzed. chromatid breaks and polyploidy were the main types of aberration. mitomycin - c and sodium arsenite were used as positive controls. cho cells were exposed to different concentration of drug (5, 10, 15, 20 g / ml) in 24 hours. all of the study aberrations and frequency of aberrant cells significantly increased as a function of digoxin concentration (for chromatid breaks : r = 0.881, df = 13, p < 0.001 ; for polyploidy : r = 0.777, df = 13, p = 0.001 ; for cells with aberrations : r = 0.926, df = 13, p < 0.001). the mitotic index negatively correlated with the concentration of digoxin (r = -0.978, df = 13, p < 0.001). all concentrations that cause chromosomal aberrations are in the cytotoxic range of the drug. the peak serum digoxin concentration (5 - 20 ng / ml) was very lower than concentrations we used in the present experiments. further studies on valuation of chromatid breaks, micronuclei, and sister chromatid exchange in lymphocytes of patients who received digoxin, were recommended. |
single excitation configuration interaction (cis),(1) time - dependent hartree fock (tdhf), and linear response time - dependent density functional theory (tddft) are widely used for ab initio calculations of electronic excited states of large molecules (more than 50 atoms, thousands of basis functions) because these single - reference methods are computationally efficient and straightforward to apply. although highly correlated and/or multireference methods, such as multireference configuration interaction (mrci),(10) multireference perturbation theory (mrmp(11) and caspt2), (12)and equation - of - motion coupled cluster methods (sac - ci(13) and eom - cc), allow for more reliably accurate treatment of excited states, including those with double excitation character, these are generally too computationally demanding for large molecules. cis / tdhf is essentially the excited - state corollary of the ground - state hartree fock (hf) method and thus similarly suffers from a lack of electron correlation. because of this, cis / tdhf excitation energies are consistently overestimated, often by 1 ev.(8) the tddft method includes dynamic correlation through the exchange correlation functional, but standard nonhybrid tddft exchange correlation functionals generally underestimate excitation energies, particularly for rydberg and charge - transfer states.(5) the problem in charge - transfer excitation energies is due to the lack of the correct 1/r coulombic attraction between the separated charges of the excited electron and hole.(16) charge - transfer excitation energies are generally improved with hybrid functionals and also with range separated functionals that separate the exchange portion of the dft functional into long- and short - range contributions. neither cis nor tddft (with present - day functionals) properly includes the effects of dispersion but promising results have been obtained with an empirical correction to standard dft functionals, and there are continued efforts to include dispersion directly in the exchange correlation functional. both the cis and tddft(26) single reference methods lack double excitations and are unable to model conical intersections or excitations in molecules that have multireference character. in spite of these limitations, the cis and tddft methods can be generally expected to reproduce trends for one - electron valence excitations, which are a majority of the transitions of photochemical interest. tddft using hybrid density functionals, which include some percentage of hf exact exchange, has been particularly successful in modeling the optical absorption of large molecules. furthermore, the development of new dft functionals and methods is an avid area of research, with many new functionals introduced each year. thus it is a virtual certainty that the quality of the results available from tddft will continue to increase. a summary of the accuracy currently available for vertical excitation energies is available in a recent study by jacquemin. which compares tddft results using 29 functionals for 500 molecules.(29) although cis and tddft are the most tractable methods for excited states of large molecules, their computational cost still prevents application to many systems of photochemical interest. thus, there is considerable interest in extending the capabilities of cis / tddft to even larger molecules, beyond hundreds of atoms. quantum mechanics / molecular mechanics (qm / mm) schemes provide a way to model the environment of a photophysically interesting molecule by treating the molecule with qm and the surrounding environment with mm force fields. however, it is difficult to know when the mm approximations break down and when a fully qm approach is necessary. with fast, large - scale cis / tddft calculations, all residues of a photoactive protein could be treated quantum mechanically to explore the origin of spectral tuning, for example. explicit effects of solvent chromophore interactions, including hydrogen bonding, charge transfer, and polarization, could be fully included at the ab initio level in order to model solvatochromic shifts. one potential route to large scale cis and tddft calculations is through exploitation of the stream processing architectures(35) now widely available in the form of graphical processing units (gpus). the introduction of the compute unified device architecture(36) (cuda) as an extension to the c language has greatly simplified gpu programming, making it more easily accessible for scientific programming. gpus have already been applied to achieve speed - ups of orders of magnitude in ground - state electronic structure, ab initio molecular dynamics(41) and empirical force field - based molecular dynamics calculations. in this article we extend our implementation of gpu quantum chemistry in the newly developed terachem program(46) beyond our previous two - electron integral evaluation(47) and ground - state self - consistent field, geometry optimization, and dynamics calculations(41) to also include the calculation of excited electronic states. we use gpus to accelerate both the matrix multiplications within the cis / tddft procedure and also the integral evaluation (these steps comprise most of the effort in the calculation). the computational efficiency that arises from the use of redesigned quantum chemistry algorithms on gpu hardware to evaluate electron repulsion integrals (eris) allows full qm treatment of the excited states of very large systems both large chromophores and chromophores in which the environment plays a critical role and should be treated with qm. dancoff approximation using gpus to drastically speed up the bottleneck two - electron integral evaluation, density functional quadrature, and matrix multiplication steps. this results in cis calculations over 400 times faster than those achieved running on a comparable cpu platform. the linear response formalism of tdhf and tddft has been thoroughly presented in review articles. only the equations relevant for this work are presented here, and real orbitals are assumed throughout. the tdhf / tddft working equation for determining the excitation energies and corresponding x and y transition amplitudes iswhere for tdhf (neglecting spin indices for simplicity):and for tddft : the two electron integrals (eris) are defined asand within the adiabatic approximation of density functional theory, in which the explicit time dependence of the exchange correlation functional is neglected : the i, j and a, b indices represent occupied and virtual molecular orbitals (mos), respectively, in the hf / kohn sham (ks) ground - state determinant. setting the b matrix to zero within tdhf results in the cis equation, while in tddft this same neglect yields the equation known as the tamm dancoff approximation (tda):in part because dft virtual orbitals provide a better starting approximation to the excited state than hf orbitals, the tda generally gives results that are very close to the full linear response tddft results for nonhybrid dft functionals at equilibrium geometries. furthermore, previous work has shown that a large contribution from the b matrix in tddft (and to a lesser extent also in tdhf) is often indicative of a poor description of the ground state, either due to singlet triplet instabilities or multireference character.(52) casida and co - workers have examined the breakdown of tddft in modeling photochemical pathways(52) and have come to the conclusion that the tda gives better results than does conventional tddft when it comes to excited - state potential energy surfaces in situations where bond breaking occurs. thus, if there is substantial deviation between the full tddft and tda - tddft excitation energies, then the tda results will often be more accurate. a standard iterative davidson algorithm(53) has been implemented to solve the cis / tda - tddft equations. as each ax matrix vector product is formed, the required two - electron integrals are calculated over primitive basis functions within the atomic orbital (ao) basis directly on the gpu. within cis, the ax matrix vector product is calculated ashere greek indices represent ao basis functions, ci is the ground - state mo coefficient of the hf / ks determinant, and t is a nonsymmetric transition density matrix. for very small matrices, there is no time savings with gpu computation of the matrix multiplication steps in eqs 10 and 12. for matrices of dimension less than 300 the linear algebra is performed on the gpu using calls to the nvidia cublas library, a cuda implementation of the blas library.(54) in quantum chemistry the ao basis functions are generally a linear combination of primitive atom - centered gaussian basis functions. for a linear combination of m primitive basis functions centered at a nucleus, the contracted ao basis function isthus the two - electron integrals in the contracted ao basis that need to be evaluated for eq 11 above are given bywhere parentheses indicate integrals over contracted basis functions and square brackets indicate integrals over primitive functions. while transfer of matrix multiplication from the cpu to the gpu provides some speedup, the gpu acceleration of the computation of the eris delivers a much more significant reduction in computer time. details of our gpu algorithms for two - electron integrals in the j and k matrices (coulomb and exchange operators, respectively) have been previously published, so we only briefly highlight information relevant to our excited - state implementation, which uses these algorithms. the gpu evaluates the j and k matrices over primitives, and these are contracted on the cpu. initially pairs of primitive atomic orbital functions are combined using the gaussian product rule into a set of bra- and ket- pairs. a prescreening threshold is used to remove negligible pairs, and the remaining pairs are sorted by angular momentum class and by their [bra| or |ket ] contribution to the total [bra|ket ] schwarz bounds, respectively.(55) all data needed to calculate the [bra|ket ] integrals (e.g., exponents, contraction coefficients, atomic coordinates, etc.) are then distributed among the gpus. the coulomb j matrix and exchange k matrix are calculated separately, with both algorithms designed to minimize interthread communication by ensuring that each gpu has all necessary data for its share of integrals. the [bra| and |ket ] pairs are processed in order of decreasing bound, and execution is terminated once the combined [bra|ket ] bound falls below a predetermined threshold. because the ground - state density matrix is symmetric, both the ground - state j and k matrices are also symmetric, and thus only the upper triangle of each needs to be computed. the coulomb j matrix elements are given bywithin our j matrix algorithm, one gpu thread evaluates one primitive two - electron integral using the hermite gaussian formulation as in the mcmurchie davidson algorithm, which then must be contracted into the final j matrix element as given in eq 15. j matrix computation uses the and symmetry and eliminates duplicates within the bra and ket primitive hermite product lists, reducing the number of integrals calculated from o(n) to o(n/4). a different gpu subroutine (or gpu kernel) is called for each angular momentum class, leading to nine gpu kernel calls for all s- and p- combinations : [ss|ss ], [ss|sp ], [ss|pp ], [sp|ss ], [sp|sp ], [sp|pp ], [pp|ss ], [pp|sp ], and [pp|pp ]. many integrals are calculated twice because [bra|ket ] [ket|bra ] symmetry is not taken into account. this is intentional it is often faster to carry out more (but simpler) computations on the gpu (compared to an algorithm that minimizes the number of floating point operations) in order to avoid bookkeeping overhead and/or memory access bottlenecks. this may be viewed as a continuation of a trend that began already on cpus and has been discussed in that context previously.(58) the maximum density matrix element of all angular momentum components weights the ket contribution to the schwarz upper bound. this allows the jmatrix algorithm to take complete advantage of sparsity in the density matrix, since there is a one - to - one mapping between ket pairs and density matrix elements. also, because density matrix elements are packed together with the j matrix ket integral data, its memory access pattern is contiguous, i.e., neighboring threads access neighboring memory addresses. in general, the exchange kmatrix elements are given bywithin our k matrix algorithm, one block of gpu threads evaluates one k matrix element and thereby avoids any communication with other thread blocks. because the integrals (bra|) and (bra|) are paired with different density matrix elements, the k matrix algorithm does not take into account the and symmetry. on the other hand, [bra|ket ] [ket|bra ] symmetry is used, leading to o(n/2) integrals computed to form the final k matrix. in addition to having to compute more integrals than is required for the j matrix computation, the k matrix computation is slowed relative to j matrix computation by two additional issues. the first is that unlike the j matrix gpu implementation, the k matrix algorithm can not map the density matrix elements onto the ket integral data, since the density index now spans both bra and ket indices. the second issue facing k matrix computation is that because the sparsity of the density can not be included in the presorting of ket pairs, the sorted integral bounds can not be guaranteed to be strictly decreasing, and a more stringent cutoff threshold (still based on the product of the density matrix element and the schwarz upper bound) must be applied for k kernels, meaning that k computation does not take as much advantage of density matrix sparsity as j computation. as a result of these drawbacks, the exchange matrix takes longer to calculate than its coulomb counterpart. based solely on the number of integrals required, the k / j timing ratio for ground - state scf calculations should be 2. in practice, with the memory access and the thresholding issues, values of 35 are more common. in our excited - state calculations, we use the same j and k matrix gpu algorithms, adjusted for the fact that the nonsymmetric transition density matrix t replaces the symmetric ground - state density matrix p. the portion of the f matrix from the product of t with the first integral in eq 11 is computed with the j matrix algorithm. the portion of the f matrix from the product of t with the second integral in eq 11 is computed with the k matrix algorithm. while the j matrix remains symmetric we must thus calculate both the upper and lower triangle contributions for the cis / tddft k matrix, resulting in two calls to the k matrix algorithm and computation of up to o(n) integrals. in addition to an increased number of integrals in the excited state, the k / j timing discrepancy (comparing cis / tddft to ground - state scf calculations) is also increased due to the sparseness of the transition density compared to the ground - state density. evaluation of the exchange correlation functional contribution from eq 7 needed for tddft excited states(7) is performed using numerical quadrature on a three - dimensional grid, which maps efficiently onto massively parallel architectures, such as the gpu. this was recently demonstrated for ground - state dft, for both gpu and related(59) architectures. the expensive steps are evaluating the electron density / gradient at the grid quadrature points to numerically determine the necessary functional derivatives and summing the values on the grid to assemble the matrix elements of eq 7. we use a becke - type quadrature scheme(60) with lebedev angular(61) and euler, we generate the second functional derivative of the exchange correlation functional only once, saving its value at each quadrature point in memory. then, for each davidson iteration, the appropriate integrals are evaluated, paired with the saved functional derivative values, and summed into matrix elements. we evaluate the performance of our gpu - based cis / tddft algorithm on a variety of test systems : 6,6-bis(2-(1-triphenyl)-4-phenylquinoline (b3ppq), an oligoquinoline recently synthesized and characterized by the jenekhe group for use in oled devices(63) and characterized theoretically by tao and tretiak;(64) four generations of oligothiophene dendrimers that are being studied for their interesting photophysical properties ; the entire photoactive yellow protein (pyp)(68) solvated by tip3p(69) water molecules ; and deprotonated trans - thiophenyl - p - coumarate, an analogue of the pyp chromophore(70) that takes into account the covalent cysteine linkage, solvated with an increasing number of qm waters. we use the 6 - 31 g basis set for all computations, since we do not yet have gpu integral routines implemented for d - functions. this limits the quality of the excited - state energies, as polarization functions can give improved accuracy relative to experimental values and are often necessary for metals and hypervalent atoms, such as sulfur and phosphorus. benchmark structures are shown in figures 1 and 2 along with the number of atoms and basis functions for a 6 - 31 g basis set. for the solvated pyp chromophore, only three structures are shown in figure 2, but benchmark calculations are presented for 15 systems with increasing solvation, starting from the chromophore in vacuum and adding water molecules up to a 16 solvation shell, which corresponds to 900 water molecules. structures, number of atoms, and basis functions (fns) using the 6 - 31 g basis set for four generations of oligothiophene dendrimers, s1s4. structures, number of atoms, and basis functions (fns) for the 6 - 31 g basis for benchmark systems photoactive yellow protein (pyp), the solvated pyp chromophore, and oligoquinoline b3ppq. for pyp, carbon, nitrogen, oxygen, and sulfur atoms are green, blue, red, and yellow, respectively. for the other molecules, atom coloration is as given in figure 1, with additional red and blue coloration for oxygen and nitrogen atoms, respectively. for our benchmark tddft calculations, we use the generalized gradient approximation with becke s exchange functional(71) combined with the lee, yang, and parr correlation functional(72) (blyp), as well as the hybrid b3lyp functional. during the scf procedure for the ground - state wave function, we use two different dft grids. a sparse grid of 1000 grid points / atom is used to converge the wave function until the diis error reaches a value of 0.01, followed by a more dense grid of 3000 grid points / atom until the ground - state wave function is fully converged. this denser grid is also used for the excited - state tddft timings reported herein, unless otherwise noted. an integral screening threshold value of 1 10 atomic units is used by default unless otherwise noted. within terachem, this means that coulomb integrals with products of the density element and schwarz bound below the integral screening threshold are not computed, and exchange integrals with products of the density element and schwarz bound below the threshold value times a guard factor of 0.001 are not computed. the initial n pair quantities list is also pruned, with a default pruning value of 10 for removing pairs from integral computation. the pair quantity pruning value is set to the smaller of 10 and 0.01 the integral screening threshold. the timings reported herein were obtained on a desktop workstation using dual quad - core intel xeon x5570 cpus, 72 gb ram, and 8 tesla c1060 gpus. all cpu operations are performed in full double precision arithmetic, including one - electron integral evaluation, integral postprocessing and contraction, and diagonalization of the subspace matrix of a. to minimize numerical error, integral accumulation also uses double precision. calculations carried out on the gpu (coulomb and exchange operator construction and dft quadrature) use mixed precision unless otherwise noted. the mixed precision integral evaluation is a hybrid of 32- and 64-bit arithmetic. in this case, integrals with schwarz bounds larger than 0.001 au are computed in full double precision, and all others are computed in single precision. the potential advantages of mixed precision arithmetic in quantum chemistry have been discussed in the context of gpu architectures by several groups and stem in part from the fact that there are often fewer double precision floating point units on a gpu than single precision floating point units. to study the effects of using single precision on excited - state calculations, we have run the same cis calculations using both single and double precision integral evaluation for many of our benchmark systems. in general we find that mixed (and often even single) precision arithmetic on the gpu is more than adequate for cis / tddft. in most cases we find that the convergence behavior is nearly identical for single and double precision until the residual vector is quite small. figure 3 shows the typical single and double precision convergence behavior as represented by the cis residual vector norm convergence for b3ppq, the first and third generations of oligothiophene dendrimers s1 and s3, and a snapshot of the pyp chromophore surrounded by 14 waters. the convergence criterion of the residual norm, which is 10 au, is shown with a straight black line. note that for the examples in figure 3, we are not using mixed precision all two - electron integrals on the gpu are done in single precision (with double precision accumulation as described previously).(39) this is therefore an extreme example (other calculations detailed in this paper used mixed precision where large integrals and quadrature contributions are calculated in double precision) and serves to show that cis and tddft are generally quite robust, irrespective of the precision used in the calculation. nevertheless, a few problematic cases have been found in which single precision integral evaluation is not adequate and where double precision is needed to achieve convergence.(75) during the course of hundreds of cis calculations performed on snapshots of the dynamics of the pyp chromophore solvated by various numbers of water molecules, a small number (1.0) using td - b3lyp within the tda to the full td - b3lyp and experimental results. results within the tda are comparable to those from full td - b3lyp, for both energies and transition dipole moments. our results for s4 show the continuing trend of decreasing excitation energy and increasing transition dipole moment with increasing dendrimer generation. we have implemented ab initio cis and tddft calculations within the terachem software package, designed from inception for execution on gpus. the numerical accuracy of the excitation energies is shown to be excellent using mixed precision integral evaluation. the ability to use lower precision in much of the cis and tddft calculation is reminiscent of the ability to use coarse grids when calculating correlation energies, as shown previously for pseudospectral methods. recently, it has also been shown(86) that single precision can be adequate for computing correlation energies with cholesky decomposition methods which are closely related to pseudospectral methods.(87) both quadrature and precision errors generally behave as relative errors, while chemical accuracy is an absolute standard (often taken to be 1 kcal / mol). thus, coarser grids and/or lower precision can be safely used when the quantity being evaluated is itself small (and therefore less relative accuracy is required), as is the case for correlation and/or excitation energies. for some of the smaller benchmark systems, we present speedups as compared to the gamess quantum chemistry package running over eight processor cores. the speedups obtained for cis calculations range from 9 to 461 times, with increasing speedups with increasing system size. these speedup figures are not necessarily normative (other quantum chemistry packages might be more efficient), but we feel they give a good sense of the degree to which redesign of quantum algorithms for gpus may be useful. the increased size of the molecules that can be treated using our gpu - based algorithms exposes some failings of dft and tddft. specifically, the charge - transfer problem(16) of tddft and the delocalization problem(88) of dft both seem to become more severe as the molecules become larger, especially for the case of hydrated chromophores with large numbers of surrounding quantum mechanical water molecules. it remains to be seen whether range - separated hybrid functionals can solve these problems for large molecules, and we are currently working to implement these. | excited - state calculations are implemented in a development version of the gpu - based terachem software package using the configuration interaction singles (cis) and adiabatic linear response tamm dancoff time - dependent density functional theory (tda - tddft) methods. the speedup of the cis and tddft methods using gpu - based electron repulsion integrals and density functional quadrature integration allows full ab initio excited - state calculations on molecules of unprecedented size. cis/6 - 31 g and td - blyp/6 - 31 g benchmark timings are presented for a range of systems, including four generations of oligothiophene dendrimers, photoactive yellow protein (pyp), and the pyp chromophore solvated with 900 quantum mechanical water molecules. the effects of double and single precision integration are discussed, and mixed precision gpu integration is shown to give extremely good numerical accuracy for both cis and tddft excitation energies (excitation energies within 0.0005 ev of extended double precision cpu results). |
research in the authors laboratory is supported by funding from the association for international cancer research, the associazione italiana ricerca sul cancro, fondazione cariplo, fondazione telethon, and the italian ministry of health. | the neural adhesion molecule l1 is involved in development and plasticity of the nervous system. we recently reported aberrant expression of l1 in the vasculature of various human tumor types. genetic and functional inactivation of endothelial l1 in a mouse tumor model resulted in decreased tumor angiogenesis and promoted vascular normalization. thus, endothelial l1 might represent a novel therapeutic target for vessel - targeted treatments of solid tumors. |
prostate cancer is the second most common cancer among men and the second leading cause of cancer- related death in men in the united states. most prostate cancers (93%) are found when the disease is confined to the prostate and nearby organs, is indolent, and has a good prognosis. however, the 5-year survival rate sharply declines from 90% for localized prostate cancer to 28% for metastatic prostate cancer. in fact, homing of metastatic prostate cancer cells to bone tissue is associated with the presence and activity of osteoblast lineage cells. the process of metastasis is known to be the result of several necessary sequential steps - including the survival of tumor cells at distant locations and adaption to the foreign microenvironment, thereby facilitating cell proliferation and the formation of a metastatic lesion. the aggressive and highly metastatic capacity makes the treatment of advanced prostate cancer a major challenge. the therapeutic options currently available (local radiation, cytotoxics, vaccine therapy, and hormonal therapies) are palliative and can not control disease progression. despite the clinical significance of bone metastatic prostate cancer, chemokines are a family of small (8 to 12 kda) peptides that function as chemo - attractant cytokines that mediate and regulate cell activation, differentiation and trafficking. chemokines are known to interact with a superfamily of 20 c - c or c - x - c trans - membrane domain heterotrimeric g protein - coupled receptors (gpcr). the stromal - derived factor 1 alpha (sdf1), also referred to as cxcl12, binds and initiates signaling through its receptors c - x - c chemokine receptor type 4 (cxcr4) and c - x - c chemokine receptor type 7 (cxcr7). the sdf1/cxcr4 signaling has been recognized as a critical pathway for the homing and tissue retention of hematopoietic progenitor / stem cells in the bone marrow microenvironment. several studies have shown that cxcr4 plays a crucial and pleiotropic role in malignant tumor progression, including prostate cancer, particularly in the metastatic spread of the disease. high levels of the chemokine receptor cxcr4 induce a more aggressive phenotype in prostate cancer cells. interestingly, the bone environment - in which sdf1 is particularly highly expressed - is also the most common metastatic site of prostate cancer. moreover, metastatic prostate cancer cells localized in the bone metastatic lesions express higher sdf1/cxcr4 levels relative to the cells present in primary tumors and lymph node metastatic lesions. these findings suggest that the activation of the sdf1/cxcr4 pathway may play a pivotal role in prostate cancer bone metastases. this review focuses primarily on the sdf1/cxcr4 axis regulation, on the pre - clinical observations made in bone metastatic prostate cancer metastases, and their implication for development of more effective treatment strategies in the future. sdf1 signaling can be activated via cxcr4 in prostate cancer cells driven by the loss of phosphatase and tensin homolog (pten) and subsequent activation of pi3k / akt pathway. moreover, silencing of cxcr4 can lead to a significant down - regulation in the secretion of vascular endothelial growth factor (vegf) and matrix metalloproteinase 9 (mmp-9), to a delay in primary tumor growth and to inhibition of the incidence of prostate cancer bone metastases. sdf1 is also produced by the bone marrow stromal cells of mesenchymal origin, including osteoblasts, and by vascular endothelial cells. sdf1a transiently regulates the number and affinity of v 3 receptors by prostate cancer cells, and increases the expression of the 3 subunit to enhance their metastatic behavior by increasing adhesiveness and invasiveness in bone marrow. additionally, sdf1 induces the expression of cd164 and blockade of cd164 in prostate cancer cell lines decreases the ability of these cells to adhere to human bone marrow endothelial cells. this suggests that activation and increased expression of cd164 and v 3 may be important in the metastatic spread of prostate cancer cells to the skeleton. in addition, inhibition of cxcr4 activity alters the homing of quiescent prostate cancer cells to bone. these cells have more potential to form bone metastases than rapidly proliferating prostate cancer cells. higher levels of cxcr4 are associated with mitotic dormancy that facilitates tumor cell colonization of the bone marrow in prostate cancer. these dormant or slow - cycling disseminated prostate cancer cells in bone marrow are more resistant to conventional therapies. it was shown that these cells predominantly express transforming growth factor - beta 2 (tgf-2) to maintain sdf1/cxcr4 overexpression. several studies showed that metastatic prostate cancers recruit mesenchymal stem cells, which are converted into cancer - associated fibroblasts and facilitate metastasis. in prostate tumors, cxcl16, a ligand for cxcr6, stimulates the differentiation of mesenchymal stem cells into cancer - associated fibroblasts, which secrete higher levels of sdf1. sdf1 binds to cxcr4 on prostate cancer cells and induces an epithelial - to - mesenchymal transition (emt). inhibition of the sdf1/cxcr4 axis leads to suppression of the bone marrow mesenchymal stem cell - induced prostate cancer stem cell population increase, and to downregulation of the expression of mmp-9, zeb-1, cd133 and cxcr4. accumulating evidence suggests that activated hypoxia - inducible factors, hif-1 and hif-2, may induce the expression of emt program - associated molecules, including snail, twist, cxcr4 and angiogenic factors such as vegf. interestingly, in an osteosarcoma study, hypoxia - induced cxcr4 expression persisted even after cultured cells were returned to normoxic conditions, suggesting more persistent phenotypic changes. in summary, activation of the sdf1/cxcr4 pathway may play a critical role via multiple mechanisms : by promoting prostate tumor growth, homing of prostate cancer cells to bone, and facilitating interactions among cancer cells and bone environment (fig. sdf-1/cxcr4 axis activation in prostate cancer cells could be driven by oncogenic events (e.g., the loss of pten and subsequent activation of pi3k / akt pathway), or by microenvironmental factors (e.g., hypoxia, fibrosis, inflammation). when cxcr4 is inhibited, it could lead to inhibition of vegf and mmp-9 expression, a delay in tumor growth and reduction in metastasis. sdf1 can induce cd164 expression in prostate cancer cells and there by increase their ability to adhere to human bone marrow endothelial cells. in bone metastases, cxcl16 (a ligand for cxcr6) can stimulate the differentiation of mesenchymal stem / stromal cells (mscs) into cancer - associated fibroblasts (cafs), which secrete high levels of sdf1. sdf1 could also be locally produced by osteoblasts. sdf1 and cxcr4 overexpression could also be stimulated by tgf-2, which is expressed by dormant disseminated prostate cancer cells in bone marrow. finally, hypoxia - induced factor (hif)-1a and hif-2a may induce the expression of epithelial - to mesenchymal - transition (emt)-associated molecules snail and twist. in turn, inhibition of sdf-1 could lead to downregulation of the expression of mmp-9, zeb-1, cd133 and cxcr4 in bone metastatic prostate tumors. as summarized above, a large amount of data strongly suggest a key role of the sdf1/cxcr4 pathway in bone metastases from prostate cancer patients. however, the evidence for the involvement of this pathway in other frequent bone metastatic cancers, such as breast cancer, is very limited. same as in prostate cancer, high levels of cxcr4 expression in breast cancer are associated with early distant and bone metastases. in various bone metastatic breast models, sdf1 expression was regulated by cytokines such as interleukin (il)-17a, il-6, macrophage colony - stimulating factor (m - csf), liver - enriched inhibitory protein (lip), neuregulin 1 (nrg1), smad4, hif-1, bach1 and mmp-1. since tumor - stroma interactions involving the sdf1/cxcr4 are likely to be equally important in these settings, further understanding in this area may have important implications for understanding bone metastasis in general. moreover, this improved understanding could potentially allow the development of novel strategies to reduce morbidity and mortality in bone metastatic cancer patients. the increasing evidence that sdf1/cxcr4 signaling may contribute to prostate cancer progression and relapse warrants studies of sdf1/cxcr4 inhibition to target both primary or metastatic lesions. the most stu- died sdf1/cxcr4 inhibitor is the cxcr4 antagonist amd3100, an fda - approved drug known as plerixafor or mozobil and used for hematopoietic stem cell mobilization by bolus injection. amd3100 has been shown to inhibit primary tumor growth and decrease the incidence of metastases in multiple animal models. however, the safety of chronic treatment with a chemokine receptor antagonist remains to be confirmed in patients, given the obvious concerns related to hematologic toxicities. an alternative approach would be to inhibit the expression of sdf1/cxcr4 in primary and metastatic prostate cancers, without directly inhibiting cxcr4 signaling. in this respect, it is critical to identify the mechanism by which cxcr4 expression is activated in prostate cancer bone metastases, in particular by hypoxia induced by tumor growth or by therapeutic interventions. moreover, multiple molecular pathways are likely required to work in concert with the sdf1/cxcr4 pathway for the homing of metastatic prostate cancer cells to the bone. many of the interactions among prostate cancer cells and the bone environment remain to be characterized. finally, sustained responses in this disease, same as in other cancers, will most likely require the development of efficacious immunotherapies. the currently available vaccine has only limited efficacy, and checkpoint inhibitors have failed so far to show promising efficacy in advanced prostate cancer patients. combining cxcr4 inhibition with checkpoint blockade, with or without radiation therapy, may be a potential strategy to achieve synergy. once this improved understanding is achieved, preclinical and clinical studies should translate this knowledge into real benefits for bone metastatic prostate cancer patients. | abstractmetastatic prostate cancer is one of the leading causes of cancer - related death in men. the primary site of metastasis from prostate cancers is the bone. during the last decade, multiple studies have pointed to the role of the stromal cell - derived factor 1 alpha (sdf1)/cxcr4 axis in the metastatic spread of the disease, but the mechanisms that underlie this effect are still incompletely understood. in this review, we summarize the current understanding of the role of the sdf1/cxcr4 pathway in bone metastatic prostate cancer. we also discuss the therapeutic potential of disrupting the interaction between prostate tumor cells and bone environment with focus on the sdf1 pathway. |
calcium hydroxide has been widely accepted as the most frequently used intra - canal medicament owning to its antimicrobial properties, inhibition of osteoclast activities and favorable tissue repair response. all interappointment dressing placed inside the root canal have shown that remnant calcium hydroxide hinder the penetration of sealers into dentinal tubules, hinder the bonding of resin sealer adhesion to the dentin, interact with zinc oxide eugenol sealers, increase the apical leakage of root canal treated teeth. hence, calcium hydroxide should be removed completely from the root canal system. the elimination may be obtained by the mechanical action of instruments in reaming motion and the chemical and physical action of irrigants. several studies have been done to assess the efficacy of various devices or techniques in removal of intra - canal dressing. however, conflicting results exist regarding the effectiveness of these techniques in removing the calcium hydroxide. recently, a new technology for root canal irrigation, which produces hydrodynamic activation based on the pressure - suction technology, has been presented to the market, which is called rinsendo system. one study reported an enhanced penetration depth of a dye marked irrigant with rinsendo into the dentinal tubules of the root canal and a superior efficacy in terms of tissue removal compared with manual irrigation. vivan. evaluated the debris removal efficacy of the rinsendo system and the conventional irrigating method. methods of measuring residual material have included direct visualization, digital microscopy and scanning electron microscopy (sem) with or without staining. the purpose of the present study was to compare the amount of calcium hydroxide remaining with the rinsendo device and passive ultrasonic irrigation (pui) in the every third of the root canal by stereomicroscope. fifty extracted single - canal anterior teeth with completely formed roots that had been stored in 10% formalin solution were used in the study. after immersion for 48 h in 5.25% sodium hypochlorite (naocl), access cavity was prepared in a standardized manner, using diamond burs 114 hl (dentsply / maillefer, ballaiguss, switzerland). working length was established 1 mm short of the length where the k file (dentsply / maillefer, ballaigues, switzerland) exited the apical foramen. canals were prepared by preflaring using gates glidden burs no. 2 - 3 (maillefer, ballaigues, switzerland) followed by a crown - down technique with 0.06 rotary file flexmaster (tulsa dentsply, tulsa, ok, usa) system to a master apical file (maf) size of no. 30. between each file, canals were irrigated with 2 ml naocl (3%) delivered by a syringe and a 30-gauge needle (navitip : ultra - dent, south jordan, ut, usa). after preparation, root canals were irrigated with a sequence of 5 ml ethylenediaminetetraacetic acid (17%) and 5 ml naocl (3%) and then dried with paper points., yamaguchi, japan) water - based paste calcium hydroxide was injected into the canals and radiographs were taken to ensure that canals were completely filled with calcium hydroxide. for positive control group, five teeth received calcium hydroxide placement but no subsequent removal, to assure that calcium hydroxide was uniformly present throughout the length of the canals and that the amount initially placed was significantly different from any amount remaining after irrigation. for negative control, five teeth did not receive any calcium hydroxide placement to ensure that analysis of clean canals did not yield false positive of remaining debris. access cavities were sealed temporarily with a cotton pellet and cavit (espe dental, seefeld, germany). after 7 days, the crowns of teeth were separated from roots at cementoenamel junction level using a diamond disc (bego, berman, germany). the remaining samples were randomly divided into two experimental groups of 20 teeth each, according to the irrigation method employed. in 1 group (n = 20), the root canals were irrigated with rinsendo system (drr dental gmbh and co kg, bietig heim - bissingen, germany) connected to a 30 g needle (drr dental gmbh and co., kg) supplied with the system. the system presents an opening for insertion of the suction needle during irrigation and suction procedures. in 2 group (n = 20) pui was performed with a stainless steel k - type file size 15 (deutsply / maillefer, ballaigues, switzerland) driven by an ultrasonic device (piezen master 400) with its power set at the of the scale. after irrigation was completed, two slots were prepared in buccal and lingual parts of the roots using diamond disk (bego, berman, germany). segments were divided into 3 thirds : apical, middle and coronal and each third were individually evaluated under stereomicroscope (mjc io, moscow, russia) (30 magnification). remaining calcium hydroxide was measured in apical, middle and coronal part of the root according to calibrated stereomicroscope. the remaining calcium hydroxide was calculated for each 20 experimental group in three segments of the each root (coronal, middle, and apical) by using a four grade scoring system : 0 = the surface was not covered with calcium hydroxide. data were analyzed using the kruskal - wallis and mann - whitney tests (p < 0.05). table 1 show the means values of residual calcium hydroxide remaining after two removal techniques. positive and negative controls were found to be statistically different from all other remaining debris scores. there was no significant difference between rinsendo and pui in the removal of calcium hydroxide from the root canal in cervical (p = 0.67), middle (p = 0.51), and apical (p = 0.75) part of the canal. all intra - canal interappointment dressing should be removed from the root canal walls prior to obturation. it has been reported that residual medicaments interact with the penetration of sealers into dentinal tubules, compromising the microleakage of the obturation. however, calcium hydroxide pastes are not easily removed from the root canal walls. some factors that can influence removing the medicaments from root canal include final apical instrumentation size, the size of the needle used for irrigant delivery, the length of time devoted to irrigation, and the system that is used for canal irrigation. different irrigation methods have been introduced to improve the irrigation efficacy of calcium hydroxide removal or remaining debris from root canal such as canal brush, ultrasonic, manual technique, rotary instrument, endoactivator, endovac, and rinsendo. studies showed that the recapitulation of maf in combination with irrigants removed more calcium hydroxide than irrigants flush alone. another study showed that maf in combination with irrigants removed more calcium hydroxide than the canal brush system. several studies have evaluated the effectiveness of rinsendo in comparison with ultrasonic and manual irrigation for canal irrigation, smear layer removal, and debris removal. hauser. showed that irrigation with rinsendo resulted in a significantly higher penetration depth of a dye marker into the root canal dentine in comparison with syringe irrigation demonstrating the efficacy of the oscillation in distribution of the irrigant. in addition, mcgill. found that automated - dynamic irrigation with the rinsendo was significantly more effective in removing a bio - molecular collagen film than static syringe irrigation. caron. examined the effect of different irrigant activation protocols on smear layer removal in curved root canals. they compared manual - static and manual - dynamic techniques, a sonic device (endoactivator ; advanced endodontics, santa barbara, ca, usa) and rinsendo. for the middle and apical third, smear layer removal was significantly more effective in the activation groups in comparison with manual irrigation without activation. in the apical third, manual - dynamic activation and in a sem analysis compared the efficacy of rinsendo system and conventional irrigation for debris removal and they found there was no difference in the cleaning ability of the rinsendo system and conventional irrigation. in present study, we tried to equalize type, volume and temperature of irrigant solution in all groups (naocl 3%, 14c) to omit any interfering factors. furthermore, all of the teeth were single rooted without any apical curve and were prepared with a rotary system (flexmaster to size 30, 0.06 taper) in all groups to unify the effect of size and shape of canal on effectiveness of technique. compared the effectiveness of rinsendo and ultrasonic irrigation for removal of calcium hydroxide and ledermix paste from root canal. they split the teeth longitudinally and prepared a groove in the apical part of one segment and then all root halves were reassembled. there was no significant differences between rinsendo and ultrasonic in the removal of calcium hydroxide and ledermix from root canal. compared the removal efficiency of calcium hydroxide dressing from the root canal with rinsendo, ultrasonic and syringe. they found no statistically significant difference among the irrigation techniques in the whole canal, which are in agreement with those of the present study. study, when mixed powder was used, rinsendo and ultrasonics were the most effective in cleaning the apical third of the canal. this difference may be because of the different size of apical preparation and the type of calcium hydroxide used in their study. this study showed no significant difference between rinsendo and pui in the removal of calcium hydroxide at any third of the canal. within the limitation of the study, neither ultrasonic nor rinsendo system was able to remove calcium hydroxide from the root canal effectively. | background : different techniques have been introduced to improve removing the calcium hydroxide intra - canal dressing. the purpose of this study was to compare the efficiency of passive ultrasonic irrigation (pui) and rinsendo system in the removal of calcium hydroxide from root canal system.materials and methods : access cavities were prepared in 50 single - rooted anterior teeth. cleaning and shaping were done using the flexmaster rotary system up to size no. 30, 6%. the canals were filled with injectable calcium hydroxide (calcipex). after 7 days, the calcium hydroxide were retrieved using rinsendo system in group 1 (n = 20), with pui system in group 2 (n = 20). in positive control group (n = 5), no irrigation was performed. in negative control group (n = 5), root canals were not filled with any medicament. following the removal of the calcium hydroxide with these two systems, teeth were split buccolingually into two sections and every third of the root canals was evaluated under stereomicroscope (30) to analyze the residual medicament in each segment. data were analyzed using the kruskal - wallis and mann - whitney tests (p < 0.05).results : there was no significant difference in the removal of calcium hydroxide between rinsendo and pui at cervical (p = 0.67), middle (p = 0.51) and apical (p = 0.75) part of the root canals.conclusion:none of the irrigation techniques was able to completely remove calcium hydroxide from the root canal system. |
oral health is an essential and vital component of overall health and is much more than just healthy teeth. despite adequate advancements in global oral health, problems still persist in many communities around the world, particularly among the underprivileged. however, the dietary changes in the 18 century, primarily, increased refinement of foods, lifestyle, and the greater availability of sugar, was found to be responsible for the modern pattern of dental caries. periodontal disease is the most prevalent dental disease affecting the adult population throughout the world, varying only in degree from mild to severe depending on a host of factors. numerous studies have been conducted across the world on the tribal populace, and in reference to oral health, to name a few, the paniya tribes of wayanad and kalpetta, kerala, the santal tribals of west bengal, the tribals of the eastern ghats, the orao tribals in rangpur district, bangladesh, and the xukuru ethnic group of pesqueira, brazil. the santhals are predominant in jharkhand state in santhal paragana, singhbhum, dhanbad, hazaribagh, giridih, and ranchi districts. the study population consisted of tribals of santhal origin in the topchanchi block of dhanbad district, jharkhand. the study was carried out in villages of dhangi (dhangi panchayat ; 2274 participants), and telodih (singhdaha panchayath ; 334 participants) on 863 (37.95%) and 78 (23.35%) santhals, respectively. a cross - sectional household survey of santhals in the villages of dhangi and telodih was conducted in the months of july to september 2009. one out of 9 blocks in dhanbad district was randomly selected (topchanchi block with 28 panchayats). further, dhangi and singhdaha panchayats were randomly selected, with five and four villages, respectively, and further, one village each was selected. the sample size was calculated using the formula : n = z pq / d, where n is sample size, p prevalence of disease, q free from disease, d allowable error, and z is point on the normal deviation. upon calculating, however, all the tribals were included in the study and the sample size thus arrived at was 921 participants. the ethical clearance was obtained from the ethical committee at rama dental college hospital and research centre (rdch and rc), kanpur. the permission to conduct the study was obtained from the department of health, medical education and family welfare, government of jharkhand, ranchi. a written informed consent was obtained from all the subjects who were willing to participate in the study. a modified world health organization (who) oral health assessment form (1997) proforma, oral hygiene practice, dietary habits, and the deleterious habits of alcohol consumption and tobacco chewing were also recorded. a single examiner was trained and calibrated in the department of public health dentistry, rdch and rc, kanpur to prevent any diagnostic variability among the study participants. the oral health examination of participants was conducted according to the who methodology, using the community periodontal index (cpi) probe and a plane mouth mirror. all the participants who were present on the day of examination were included in the study. the recorded data were compiled and entered into a spreadsheet computer program (microsoft excel 2007) and analyzed using the statistical package for the social sciences version 15 (spss inc., the statistical tests applied for the analysis were student 's t - test and one way analysis of variance. for all the statistical tests, the confidence level and the level of significance were set at 95% and 5%, respectively. the study population consisted of tribals of santhal origin in the topchanchi block of dhanbad district, jharkhand. the study was carried out in villages of dhangi (dhangi panchayat ; 2274 participants), and telodih (singhdaha panchayath ; 334 participants) on 863 (37.95%) and 78 (23.35%) santhals, respectively. a cross - sectional household survey of santhals in the villages of dhangi and telodih was conducted in the months of july to september 2009. one out of 9 blocks in dhanbad district was randomly selected (topchanchi block with 28 panchayats). further, dhangi and singhdaha panchayats were randomly selected, with five and four villages, respectively, and further, one village each was selected. the sample size was calculated using the formula : n = z pq / d, where n is sample size, p prevalence of disease, q free from disease, d allowable error, and z is point on the normal deviation. upon calculating, however, all the tribals were included in the study and the sample size thus arrived at was 921 participants. the ethical clearance was obtained from the ethical committee at rama dental college hospital and research centre (rdch and rc), kanpur. the permission to conduct the study was obtained from the department of health, medical education and family welfare, government of jharkhand, ranchi. a written informed consent was obtained from all the subjects who were willing to participate in the study. a modified world health organization (who) oral health assessment form (1997) was utilized to record the information related to oral health. in this proforma, oral hygiene practice, dietary habits, and the deleterious habits of alcohol consumption and tobacco chewing were also recorded. a single examiner was trained and calibrated in the department of public health dentistry, rdch and rc, kanpur to prevent any diagnostic variability among the study participants. the oral health examination of participants was conducted according to the who methodology, using the community periodontal index (cpi) probe and a plane mouth mirror. all the participants who were present on the day of examination were included in the study. the recorded data were compiled and entered into a spreadsheet computer program (microsoft excel 2007) and analyzed using the statistical package for the social sciences version 15 (spss inc., the statistical tests applied for the analysis were student 's t - test and one way analysis of variance. for all the statistical tests, the confidence level and the level of significance were set at 95% and 5%, respectively. a total of 921 participants were examined in the study. among them, 560 were males and 361 were females with age ranging from 274 years. based on the occupation, it was seen that 620 (67.3%) participants practiced agriculture and 206 (22.4%) worked as laborers. a total of 684 (74.3%) and 164 (17.8%) participants were using a twig and a toothbrush to clean their teeth, respectively [table 1 ]. characteristics of the study group when examined for oral mucosal lesions, it was found that 784 (85.1%) participants were quite healthy and had no abnormal conditions. approximately 25 (2.7%) subjects had leukoplakia, 48 (5.2%) suffered from ulceration, and 51 (5.5%) had abscesses [figure 1 ]. distribution oral mucosal lesions in the study group the mean decayed, missing, and filled tooth (dmft) score was 3.56 1.93 in 25-year - old participants, and in the higher age groups of 3544 years and 6574 years, the scores were 5.21 2.34 and 7.42 4.29 teeth, respectively. a statistically significant association was found between the various age groups, except for the 6574 age group [table 2 ]. distribution of mean dmft scores across the age groups the mean number of sextants with periodontal disease conditions, as scored by cpi, is shown in table 3. participants with bleeding gums were predominantly seen in the age group of 3544 years (0.91 0.08). the participants with shallow pockets were more commonly seen in the age group of 3544 years (1.65 0.62). statistically highly significant differences were observed across all the age groups (p < 0.001). mean number of sextants as scored by cpi across the age groups when the study group was examined for the periodontal loss of attachment (loa), it was found that 205 (89.1%) participants in the 1315 year age group had an loa 03 mm. a total of 25 (9.8%) and 9 (12%) participants had an loa of 68 mm in the age groups of 3574 and6574 years, respectively [figure 2 ]. prevalence of loss attachment across the age groups table 4 depicts the distribution of the study group according to the treatment needs. in the 25-year - old age group, 1.23 0.64 teeth needed one surface filling and 0.17 0.06 teeth needed crowns for different reasons. in the 1315 year age group, 0.72 0.39 teeth needed one surface filling and 0.14 0.05 teeth needed two surfaces fillings. the highest need for other care was found in the 3544 year age group with a mean of 4.47 1.24 teeth. distribution of the study group according to treatment needs table 5 shows the distribution of the study participants according to the prosthetic need. a total of 118 (12.8%) participants needed one - unit prosthesis in the upper jaw. there were 18 (2.0%) participants each, requiring full prosthesis in both the jaws. the tribal people are often characterized by their own language, heritage, love for freedom, and self - identity, and this holds true for the santhals too. a systematic review of the studies pertaining to the tribal population is scarce and no comprehensive data is available ; this study would add to the existing knowledge about these native people. the present study was carried out on santhals residing in the topchanchi block of dhanbad district, jharkhand. the sample size was 921 participants divided into five age groups, that is, 25, 612, 1315, 3544, and 6574 years. the present study evidently showed that a majority (74.2%) of santhali tribals routinely used twigs of sakhua trees (shorearobusta) to clean their mouth. the results of the present study are in agreement with the studies conducted by mandal., vaish., bhowate., varenne., abdul - kadir yassin, vaish, and john. bhowate. in their study found a lower use of the toothpaste and tooth brush in comparison to other materials used for cleaning the teeth. vaish. in their study found that all the kandha tribals used datum twigs to clean their teeth. ikeda. in their study found a total of 71 oral mucosal lesions among 64 (4.9%) study participants. the present study showed that a majority of the santhals suffered from various forms of periodontal disease. this finding was comparable to the findings of the study carried out by peterson and razanamihaja on malagasy tribes in madagascar. the traditional habit of chewing betel quid in the region might be a factor for the abundance of periodontal disease in the study group. the findings of the present study are in accordance with the findings of the study conducted by varenne. and naheeda. the mean number of sextants in the age groups of 1315 years and above affected by bleeding gums were 0.64, 0.91, and 0.17 sextants, respectively. similarly, the mean number of sextants affected by dental calculus was 3.15, 1.93, and 1.33 sextants, respectively. deep pockets (6 mm or more) were seen only in the 3544 year (0.84) and 6574 year (0.65) age groups, and this was in agreement with the findings of the study conducted by kumar. and singh. in the study by kumar 3544 and 4554 years, it was found that the mean number of sextants with dental calculus were 1.71 and 0.47 sextants, respectively. spalj and plancak in their study among individuals aged 15 years and older found that the mean number of healthy sextants varied from 35 and the mean number of sextants with bleeding gums or dental calculus varied from 13. schamschula. in their study observed that the mean scores for periodontal involvement increased from 1.7 sextants at 20 years to 4.8 sextants at 43 years and above. it was interesting to note that the tribals ' relegation of oral health to general health might have contributed to the existing burden of periodontal disease. to combat such a situation, education and motivation of the laity is required to improve their oral health. efforts directed in curtailing them from the harmful habits of alcohol consumption, smoking, pan chewing, and the use of smokeless tobacco would go a long way in ensuring good oral health for these masses. in the present study, high dental caries prevalence was seen among the study participants, and this finding is consistent with the study findings conducted by maurya. and lang., where the mean dmft scores were quite high. however, this was in disagreement with the study findings of jayashantha and johnson. vaish in his study demonstrated that the caries prevalence in the 610 year age group was 32% followed by 24% in the age group of 1115 years. schamschula. showed that the prevalence of dental caries increased from 17.1 teeth at 20 years to 20.7 teeth at 35 years. it might be hypothesized that the increase in caries prevalence might be due to the ill effects of lifestyle due to increased access to cariogenic foods and beverages. conducted a study on tribal children aged 613 years, living in the villages of mandu in dhar district, madhya pradesh, and showed that nearly 30% of the children needed some sort of conservative care. conducted a study of children aged 68, 12, and 15 years and found that 77% of the children had a need for some form of treatment, and the most frequently occurring need was for dental fillings. this might be because of the fact that dental treatment is usually expensive and remains inaccessible to most of the tribal people. in addition, the remoteness of these tribal clusters from the nearest care provider adds to the difficulty in seeking regular dental care. the main limitation of this study is that it is a cross - sectional study and the findings can not be extrapolated to the other development blocks in the district because of the vast differences in the sociodemographic factors. however, this limitation can be overcome by a larger sample size drawn from across the district and undertaking studies of a longitudinal nature. the results of this study could form a baseline data for the health administrators for planning suitable programs for the betterment of oral health among the tribals in the district of dhanbad, as well as across the state of jharkhand. the present study was conducted to assess the oral health status and treatment needs of santhali tribals residing in dhanbad district, jharkhand. the study showed that a majority (74.2%) of santhals used twigs of sakhua tree to routinely clean their teeth. there was a lower use of the toothpaste and tooth brush in comparison to other materials used for cleaning the teeth. in the present study, high dental caries and periodontal disease prevalence was seen among the study participants. a state - wide study would be required to obtain a realistic picture of the oral health status and treatment needs of the santhals. | aims and objectives : india has an assortment of tribal population living in isolated pockets, and the santhals are numerically predominant in jharkhand. this study was aimed at assessing the oral health status and treatment needs of santhals residing in dhanbad, jharkhand.materials and methods : a cross - sectional survey of 921 santhals of topchanchi block was conducted. a modified world health organization (who) oral health assessment form (1997) was utilized and examined according to the who methodology (1997). the recorded data was statistically analyzed using the statistical package for the social sciences version 15.results:based on the occupation, it was seen that 620 (67.3%) participants practiced agriculture and 206 (22.4%) worked as laborers. the mean decayed missing filled tooth (score was 3.56 1.93 in 25-year - old participants. in the higher age groups of 3544 and 6574 years, the scores were 5.21 2.34 and 7.42 4.29, respectively. participants with bleeding gums were predominantly seen in the age group of 3544 years (0.91 0.08). approximately 138 (54.1%) participants had a loss of attachment of 45 mm in the 3544 year age group. in the 1315-year - old age group, 0.14 0.05 teeth needed two surfaces fillings. a total of 118 (12.8%) participants needed one - unit prosthesis in the upper jaw.conclusion:this study showed that a majority of santhal tribals used twigs to routinely clean their teeth. poor oral hygiene and periodontal status was seen among the tribes. |
down s syndrome (ds) or trisomy 21 is the most common form of intellectual disability with an overall prevalence of 1.42/1000 that increases significantly with maternal age (bray., 1998). immunological abnormalities like functional impairments in fagocytes with low chemotactic ability as well as the depressed production of cytokines are intrinsic to the chromosomal disorder and result in an increased morbidity and mortality from infectious diseases (ugazio., 1990). in addition, ds is associated with hypothyroidism in 2040% of the patients and with neuropsychiatric disorders of which depression and alzheimer - type dementia are the most frequent (lovell and reiss, 1993 ; prasher, 1999 ; bush and beail, 2004). since the activity of the enzyme cystathionine -synthase (cbs), which is encoded on chromosome 21 (21q22.3), is associated with the level of intelligence and with neuropsychiatric disorders (abbott., 1987 ; barbaux., 2000), the concentration of cbs was recently investigated in postmortem brains of ds persons (ichinohe., 2005). it was found that the concentration of cbs was three times higher as compared to brain levels of normal individuals. the latter dipeptide is further metabolized into the amino acids cysteine and eventually to taurine. in humans, the sole source of homocysteine is through dietary intake of the essential amino acid methionine (selhub., 1999 ; thus, the over - expression of cbs in persons with ds may alter homocysteine metabolism resulting in a metabolic imbalance such that folate - dependent resynthesis of methionine is compromised, and may be in favour of the transsulfuration pathway, leading eventually to increased levels of taurine (huxtable, 1992). due to the dosage effect of cbs, a decrease in plasma concentration of serine in addition, an increase in plasma lysine, which was explained by generalized premature aging in ds, was observed (mircher., 1997). another amino acid abnormality is a decrease of systemic glutamate uptake as assessed by measuring glutamate uptake in platelets and fibroblasts from ds persons (begni., 2003). the authors suggest the use of this peripheral model as a biochemical ex vivo marker of a central glutamatergic dysfunction. excessive glutamatergic stimulation as a consequence of glutamate uptake deficits could be responsible for neuronal suffering, excitoxicity and cell death, and may play a key role in the pathophysiology of neuropsychiatric disorders (review : van der heijden., 2004). apart from the abovementioned amino acid abnormalities, impaired immunological function in ds persons results in increased serum neopterin levels (mehta., 2005). neopterin is not only an immune activator for the cell - mediated immune response, but also induces or enhances cytotoxicity and exhibits antioxidant properties (hamerlinck, 1999). this observation is consistent with the increased susceptibility of ds persons to bacterial and viral infections (cossarizza., no studies have been reported on the measurement of peripheral precursors or metabolites of the neurotransmitters serotonin and dopamine in ds. since serotonin is involved in brain growth and maturation, and experimentally induced high dopamine turnover may give rise to toxic metabolites and neurodegeneration (ogawa. 2001), measurement of peripheral correlates of central serotonin and dopamine metabolism is also warranted. since at least 40% of circulating homovanillic acid (hva) originates form the brain, the plasma hva concentration is thought to be a fairly good indicator of the changes in dopamine metabolism in the brain (kendler., 1982). in addition, plasma 5-hydroxyindoleacetic acid (5-hiaa) is suggested to be an indicator of brain serotonergic activity (meltzer, 1989). the present study was designed to investigate peripheral parameters that reflect changes in homocysteine metabolism, immune function and monoaminergic neurotransmission in a group older non - demented healthy persons with ds. to this end, especially the sulphur containing amino acids methionine and taurine as well as serine, glycine, glutamate, lysine, tryptophan and the other large neutral amino acids (lnaa) were measured. the ratio of tryptophan to lnaa is a fairly good indicator of central serotonin synthesis. concentrations of the dopamine and serotonin metabolites hva and 5-hiaa were determined as well as the levels of the immune activation marker neopterin. over a period of 4 years a community based sample of 505 ds persons aged 45 year and older from the southern and the south - western parts of the netherlands was collected. the study protocol was approved by the medical ethetical committee of the erasmus university medical centre in rotterdam, the netherlands (protocol number : mec 185.974/1999/202). details of the study population and the used screening instruments are presented elsewhere (coppus., 2006). for the present study persons were excluded in case of any relevant somatic comorbidity, including hypothyroidism and epilepsy, or the presence of a depressive disorder and signs of dementia. all persons were free of medication, including the use of folic acid, and did not smoke. the study group comprised 48 persons with ds (female : 11 ; male : 37 ; mean age : 50 4.8 years) of whom 2 had to be excluded because of laboratory problems, and was compared to a group of 48 age and sex matched healthy controls (female : 16 ; male : 32 ; mean age : 50.2 9.1 years). plasma amino acids are analyzed by high - performance liquid chromatography (hplc) using pre - column derivatization with o - phthaldialdehyde (fekkes., 1995). the tryptophan - ratio (trp - ratio) is calculated by dividing the total tryptophan level by the sum of the other large neutral amino acids (lnaa), i.e. valine, isoleucine, leucine, tyrosine and phenylalanine, which compete for the transport of tryptophan through the blood- brain barrier. the tyrosine - ratio (tyr - ratio) is calculated in the same manner by substituting tryptophan for tyrosine. the concentrations of the monoamine metabolites 5-hiaa and hva are analyzed by hplc and electrochemical detection (fekkes., 1997). the concentration of neopterin in plasma is determined as previously described (hoekstra., 2001). for statistical comparisons between persons with ds and controls, the unpaired t - test was used because all data sets showed a normal distribution. a value of p<0.05 was considered to be statistically significant. in case of finding statistically significant values for biochemical parameters, discriminant analysis was performed in order to assess the potential for further differentiating ds persons from controls, and to establish their relative contribution to the group difference. over a period of 4 years a community based sample of 505 ds persons aged 45 year and older from the southern and the south - western parts of the netherlands was collected. the study protocol was approved by the medical ethetical committee of the erasmus university medical centre in rotterdam, the netherlands (protocol number : mec 185.974/1999/202). details of the study population and the used screening instruments are presented elsewhere (coppus., 2006). for the present study persons were excluded in case of any relevant somatic comorbidity, including hypothyroidism and epilepsy, or the presence of a depressive disorder and signs of dementia. all persons were free of medication, including the use of folic acid, and did not smoke. the study group comprised 48 persons with ds (female : 11 ; male : 37 ; mean age : 50 4.8 years) of whom 2 had to be excluded because of laboratory problems, and was compared to a group of 48 age and sex matched healthy controls (female : 16 ; male : 32 ; mean age : 50.2 9.1 years). plasma amino acids are analyzed by high - performance liquid chromatography (hplc) using pre - column derivatization with o - phthaldialdehyde (fekkes., 1995). the tryptophan - ratio (trp - ratio) is calculated by dividing the total tryptophan level by the sum of the other large neutral amino acids (lnaa), i.e. valine, isoleucine, leucine, tyrosine and phenylalanine, which compete for the transport of tryptophan through the blood- brain barrier. the tyrosine - ratio (tyr - ratio) is calculated in the same manner by substituting tryptophan for tyrosine. the concentrations of the monoamine metabolites 5-hiaa and hva are analyzed by hplc and electrochemical detection (fekkes., 1997). the concentration of neopterin in plasma is determined as previously described (hoekstra., 2001). for statistical comparisons between persons with ds and controls, the unpaired t - test was used because all data sets showed a normal distribution. a value of p<0.05 was considered to be statistically significant. in case of finding statistically significant values for biochemical parameters, discriminant analysis was performed in order to assess the potential for further differentiating ds persons from controls, and to establish their relative contribution to the group difference. as can be inferred from table 1, the concentrations of methionine, glutamate and all lnaa are significantly decreased in the ds group as compared to the control group. of the lnaa, tryptophan shows the lowest significance. the concentrations of taurine and glycine are significantly increased in ds persons as compared to controls, whereas the level of glutamate is significantly decreased. in addition, the trp - ratio but not the tyr - ratio, is significantly higher in the ds group compared to the controls. table 1plasma levels (mean sd) of biochemical parameters in ds persons and controlsbiochemical parameterds patients (n)healthy controls (n)significancetryptophan (mol/1)47.1 6.1 (46)50.4 9.0 (48)p = 0.040tyrosine (mol/1)61.9 12.6 (46)71.0 17.3 (48)p = 0.004valine (mol/1)226.5 42.8 (46)286.2 59.7 (48)p<0.000phenylalanine (mol/1)58.0 8.5 (46)63.1 10.0(48)p = 0.010isoleucine (mol/1)61.2 11.7 (46)82.7 24.1 (48)p<0.000leucine (mol/1)122.6 20.9 (46)148.5 31.8 (48)p<0.000methionine (mol/1)25.6 4.7 (46)32.0 6.5 (48)p<0.000taurine (mol/1)53.9 11.8 (46)42.9 7.6 (48)p<0.000serine (mol/1)103.7 17.3 (46)109.8 19.1 (48)p = 0.106lysine (mol/1)199.3 31.8 (46)186.3 35.7 (48)p = 0.065glycine (mol/1)244.6 48.7 (46)213.0 43.5 (48)p = 0.001glutamate (mol/1)37.4 22.5 (46)47.7 20.3 (48)p = 0.021trp - ratio9.0 1.5 (46)7.9 1.5 (48)p < 0.000tyr - ratio12.2 3.3 (46)11.3 2.1 (48)p = 0.113neopterin (nmol/1)20.4 5.8 (43)17.4 3.7 (28)p = 0.008hva (nmol / l)64.1 16.5 (45)53.2 12.9 (41)p = 0.0015-hi (nmol / l)43.5 9.0 (45)41.5 12.9 (42)p = 0.405 hva homovanillic acid. 5-hiaa 5-hydroxyindoleacetic acid. plasma levels (mean sd) of biochemical parameters in ds persons and controls hva homovanillic acid. 5-hiaa 5-hydroxyindoleacetic acid. with respect to neopterin, values in the ds group are significantly increased as compared to the control group. furthermore, plasma hva concentrations are significantly higher in the ds group, whereas no differences are found regarding 5-hiaa concentrations. finally, discriminant analysis (stepwise method) of the biochemical parameters with p - values < 0.001 (valine, isoleucine, leucine, methionine, taurine and trp - ratio) results in a discriminant function with valine, methionine and taurine as major predictors. classification results are good : 84.8% of the ds persons were correctly classified as were 83.3% of the controls. as a whole 16% was wrongly classified. in the present study biochemical parameters related to neurotransmission and immunological function were investigated in a group of older persons with down s syndrome. it was found that the spectrum of amino acids shows widespread differences in the ds group as compared to controls. more specific, the amino acids valine, methionine and taurine were demonstrated to differentiate persons with ds from controls. nearly all values of amino acids are lower in the ds group, which can not be explained from dietary effects since all persons were provided with well balanced meals. besides, ciaccio. (2003) reported that dietary measures over one year have an only marginal influence on the plasma concentration of amino acids in children with ds. with respect to the cbs - related parameters, plasma methionine was found to be significantly lower, while taurine was higher. these observations are in accordance with an over - expression of the cbs - gene in ds (chadefaux., 1985 ; progribna., 2001 ; review : chango., 2002) and are also in line with results concerning serine and taurine plasma concentrations as reported by mircher. although homocysteine was unfortunately not measured in this primarily epidemiological study, these data corroborate an altered homocysteine metabolism in persons with ds and are as such in line with the lowered plasma concentration of homocysteine reported by pogribna. other investigators, however, reported increased concentrations of homocysteine (brattstrom., 1989 ; guant., 2005 (2004), the sulphur containing amino acids methionine, homocysteine and taurine are involved in the maintenance and integrity of cellular systems by influencing cellular redox state and cellular capacity to detoxify toxic compounds, free radicals and reactive oxygen species. an imbalance of these amino acids in ds persons may indicate neuropathological changes in this group. the increased trp - ratio in the ds group suggests an enhanced availability of tryptophan for the synthesis of serotonin in the central nervous system. whether central serotonergic neurotransmission is increased in ds persons can not be concluded from this study, especially since the plasma concentration of 5-hiaa is not changed. the latter parameter, however, is only a very weak and indirect measure of central serotonergic activity (lambert., 1995). on the other hand, plasma hva concentrations are signifi- cantly increased, which is an indication of a higher turnover of dopamine that was reported previously also in cerebrospinal fluid studies in persons with ds (kay., 1987 ; (2005) who additionally reported that increase of neopterin is not correlated with age and sex. high concentrations of neopterin as seen in ds is consistent with the impaired immune function that was reported in persons with ds (nespoli., 1993 ; park., 2000). in conclusion, in the present study of persons with ds without any signs of dementia, somatic and/or neuropsychiatric comorbidity and free of any medication, extensive biochemical abnormalities are found suggesting a compromised homocysteine metabolism, an activated cellmediated immune response and an enhanced turnover of dopamine. interestingly, a few peripheral biochemical parameters appeared to have a marked potential to differentiate between ds persons from controls. | summaryin persons with down s syndrome (ds) immunological abnormalities as well as hypothyroidism and alzheimer type dementia are frequently observed. in addition, the activity of the enzyme cystathionine beta - synthase (cbs) is over - expressed which results in an altered homocysteine metabolism.in the present study, 48 older healthy ds persons without signs of dementia, psychiatric or somatic comorbidity and free of medication were analyzed for plasma levels of amino acids, neopterin and monoaminergic metabolites. data were compared with those obtained from age and sex matched healthy controls.it was found that the spectrum of amino acids showed widespread differences in that levels of nearly all essential amino acids were lower in ds patients as compared to healthy controls. in addition, a significantly lower methionine and higher taurine concentration were observed which is in accordance with a disturbed homocysteine metabolism. with respect to the monoamine metabolites, the concentration of 5-hydroxyindoleacetic acid was not altered whereas that of homovanillic acid was significantly increased. finally, the concentration of the immune activation marker neopterin was increased in persons with ds.it is concluded that healthy ds persons of older age show extensive biochemical abnormalities suggesting a compromised homocysteine metabolism, an activated cell - mediated immune response and an enhanced turnover of dopamine. |
generally, the majority of patients with acute ischemic stroke (ais) tends to improve about 23 days after symptom onset. however, 5% to 40% patients have a chance of neurologic deterioration, so - called early neurological deterioration (end), regardless of the definition used end27). major causes of end include symptomatic intracranial hemorrhage, malignant edema, seizure, recurrent or early progression infarction (epi) stroke and end without a clear pathological mechanism. thrombus migration from the occlusion site or through hemodynamic instability is reported to be the cause of recurrences or epi in patients with middle cerebral artery (mca) occlusion. although perfusion abnormalities are likely to play a critical role in epi in acute stroke, there is still uncertainty whether epi is related to perfusion deficit1). although widely used in clinical practice, time - domain perfusion metrics, such as the time to peak (ttp) or the mean transit time (mtt), do not indicate the actual status of collateral flow because of indirect measurement of brain perfusion. in contrast, regional cerebral blood volume (rcbv) on perfusion magnetic resonance imaging (mri) reveals that where collateral flow is insufficient to sustain tissue viability and represent " tissue at risk " after an acute ischemic stroke41418). however, there are few report on the relationship between epi and this perfusion mri parameter in patients with occluded mca ischemic stroke who have missed the therapeutic window for intravenous tissue plasminogen activator (t - pa) or intra - arterial thrombolysis. therefore, in this study, we evaluated useful mri perfusion parameters to identify the useful predictor of epi in patients with mild neurologic symptoms but who subsequently developed an acute, large cerebral artery occlusion within a few days of admission. we retrospectively collected data from all ischemic stroke patients admitted to our hospital between january 2013 and december 2014. the inclusion criteria for this study were as follows : 1) suspicion of an acute hemispheric infarction involving the mca territory and confirmed mca infarction by mr diffusion weighted image (dwi) ; 2) confirmation of acute occlusion of the mca main trunk with or without internal carotid artery (ica) occlusion ; 3) hospital arrival between 6 and 24 hours after symptom onset ; and 4) diffusion / perfusion mismatch in the mca territory. exclusion criteria were as follows : 1) lacunar, posterior circulation or unclassified infarction ; 2) intravenous t - pa administration or mechanical thromboectomy procedure for any reason ; 3) infarct volume more than 50% in mca territory at the initial evaluation ; 4) severe stroke [national institutes of health stroke scale (nihss) score 16 ] ; 5) concurrent with other vascular territory infarctions ; 6) patients who failed to complete a mri within 12 hours after admission ; 7) comorbidities that could influence neurological status such as seizure or acute respiratory distress syndrome ; 8) cerebral edema or hemorrhagic conversion. all patients were admitted to the stroke unit of the stroke center and treated according to standard protocols. demographic characteristics, vascular risk factors, baseline laboratory results on the day of admission (blood cell counts, glucose, and c - reactive protein) were obtained from the electric medical record (emr) database. the severity of the patients ' neurological deficits was evaluated according to the nihss score immediately after hospital arrival. in the event of neurological deterioration or deterioration of consciousness, the epi group was classified as those individuals experiencing neurological deterioration (nihss score increased by more than 2 points during 24 hours)7,17,31). in addition, mr diffusion images showed an aggravated infarction compared with the initial image. the other individuals who had no change were classified as the static (non - epi) group. mr perfusion was performed on a 3.0-t achieva scanner (philips medical systems, best, the netherlands). cbv, cerebral blood flow (cbf), and mtt maps were generated using the processing software (the extended mr workspace). a signal - time curve was obtained by capturing the first pass of gadolinium. from this curve, a ttp map was generated by calculating the difference of the arrival time of the contrast material, and the timing of the maximum contrast agent concentration following its injection. the regions of interest (roi) were placed in the affected mca distribution at the supraganglionic level. the mirrored positions to roi in the normal contralateral hemisphere were used as control roi. both roi and the control roi (in the contralateral regions) were determined manually. therefore, the relative [regional cerebral blood flow (rcbf), rcbv, regional mean transit time (rmtt), regional time to peak (rttp) ] ratios were calculated as the ratio of the affected roi values to control roi values (ipsilateral value / contralateral value) (fig. an rcbv ratio of 1.0 indicated that normal blood flow was nearly maintained in the ischemic lesion. however, an rcbv ratio 1.15 (table 2). from the multivariate analysis, two parameters were identified as valuable predictive factors for epi : dm (or, 6.1 ; 95% ci, 1.5524.2 ; p=0.01) and rcbv 0.15 ; or, 1.96 ; 95% ci, 0.9311.5 ; p=0.74). generally time - based parameters such as mtt or ttp have been considered the most reliable methods for ischemic stroke. it is an indirect measurement of brain perfusion and easily contaminated by the severe arterial occlusive states such as chronic occlusion, which leads to an overestimation of the true extent of hemodynamic compromise in acute ischemic stroke22,34). our study also support that rcbv map is superior to time - based perfusion maps (ttp) for predicting the tissue at risk of epi. although the rttp ratio increases, and rcbv ratio > 1, the risk of epi may be low because of early collateral build up. in contrast, the rcbv ratio < 0.85 and increasing rttp ratio represent poor collateral circulation and are associated with high risk of epi (fig. it is important to provide appropriate treatment for patients with epi despite intention to provide full medical treatment, as well as prediction of epi. extracranial - intracranial (ec - ic) bypass surgery is considered beneficial in selective patients with symptomatic ica occlusion and concomitant hemodynamic instability, despite full medical therapy. however, there are somewhat controversy with use of sta - mca anastomosis as an urgent treatment. furthermore, there is no current consensus on the optimal timing of bypass surgery, particularly in patients with progressive infarction accompanied by hemodynamic instability, which does not respond to the best available treatment. a small case series recently reported that urgent sta - mca bypass stabilized the progression of ischemia and/or reversed the symptoms in majority of the cases. thus, it may be possible to prevent an ongoing ischemic event thereby stopping and/or reversing neurological symptoms. firstly, this study was conducted with a retrospective design and was not a randomized trial. secondly, this study included a small number of patients at a single institution, the validity of our results can not be absolutely confirmed. nevertheless, the results of this study could raise the clinical attention to predict epi using perfusion mri. a multi - center study including multimodal radiologic imaging with a larger sample size is required to confirm our results. our study proved that the rcbv ratio assessed by perfusion mri can be used to predict epi in patients with acute ischemic stroke combined with mca occlusion. it may useful for early prediction of epi development as well as the ability to select patients in need of urgent ec - ic bypass surgery, such as sta - mca. further large and prospective studies are necessary to establish correlations with clinical findings and multimodal neuro - imagings. | objectiveearly progressive infarction (epi) is frequently observed and related to poor functional outcome in patients with middle cerebral artery (mca) infarction caused by mca occlusion. we evaluated the perfusion parameters of magnetic resonance imaging (mri) as a predictor of epi.methodswe retrospectively analyzed patients with acute mca territory infarction caused by mca occlusion. epi was defined as a national institutes of health stroke scale increment 2 points during 24 hours despite receiving standard treatment. regional parameter ratios, such as cerebral blood flow and volume (rcbv) ratio (ipsilateral value / contralateral value) on perfusion mri were analyzed to investigate the association with epi.resultssixty-four patients were enrolled in total. epi was present in 18 (28%) subjects and all epi occurred within 3 days after hospitalization. diabetes mellitus, rcbv ratio and regional time to peak (rttp) ratio showed statically significant differences in both groups. multi - variate analysis indicated that history of diabetes mellitus [odds ratio (or), 6.13 ; 95% confidence interval (ci), 1.5524.24 ] and a low rcbv ratio (rcbv, < 0.85 ; or, 6.57 ; 95% ci, 1.430.27) was significantly correlated with epi.conclusionthe incidence of epi is considerable in patients with acute mca territory infarction caused by mca occlusion. we suggest that rcbv ratio is a useful neuro - imaging parameter to predict epi. |
an 86-year - old filipino man presented to the emergency room for dyspnea at rest. his shortness of breath had worsened over the previous 2 days, and was associated with substernal dull chest pain and hemoptysis. patient also reported a decrease in urine output and bilateral ankle swelling that had been worsening over the past 2 weeks. past medical history is significant for hypertension, chronic kidney disease stage iii, gout, and copd. he had quit smoking 9 years ago, did not drink alcohol or use illicit drugs. the patient was hospitalized for pneumonia 3 weeks before presentation, and was treated with intravenous cefazolin for 2 weeks for methicillin - sensitive staphylococcus aureus bacteremia. on examination, the patient was tachypneic (respiratory rate 25/min), temperature 97.6f, blood pressure 155/71, pulse 109 bpm, with a saturation of 99% on 3 liters via nasal cannula. there were bibasilar rales in the lungs and bilateral lower extremity pitting edema 2 + ; the remainder of the examination was normal. blood work was significant for hemoglobin of 8.3 g / dl (baseline 10), creatinine of 9.2 mg / dl (baseline of 1.67 gfr 39 ml / min/1.73 m), troponin of 0.6 and albumin 2.6 g / dl. lower extremity duplex study showed right peroneal deep vein thrombosis and heparin infusion was initiated for possible pulmonary embolism and non - st elevation myocardial infarction (nstemi). in addition, broad - spectrum antibiotics (vancomycin and meropenem) were initiated empirically. urinalysis showed large blood, and red blood cell (rbc) casts were seen on light microscopy. transthoracic echocardiogram revealed a left ventricular ejection fraction of 55%, with moderate mitral regurgitation and a small pericardial effusion. the right kidney was measured to be 10 cm in length by 4.4 cm in width by 4.4 cm anteroposterior diameter. the left kidney measured 9.3 cm by 4.6 cm by 4.9 cm. serology workup for rapidly progressive glomerulonephritis (rpgn) was sent. on day 2 of the hospitalization, the patient became more tachypneic and fatigued necessitating oxygen supplementation with bi - level positive airway pressure. he was anuric (urine output 100 cc/24 hours) and was started on hemodialysis for hypervolemia ; blood and urine cultures were negative. the patient had acute drop in hemoglobin (7 g / dl) ; heparin was stopped and he remained on acetylsalicylic acid and clopidogrel. on day 4, the patient was started on pulse steroids solu - medrol 1 g daily for 3 days. patient s condition and thrombocytopenia had precluded kidney biopsy up to this point. on day 6, hematological and immunological workup was normal including antinuclear antibody, anti - dna, anti - glomerular basement membrane antibody, anticardiolipin igg and igm, cryoglobulin, anti - neutrophil cytoplasmic antibody (proteinase-3 ab < 1.0, myeloperox ab < 1.0), c3 and c4. serum protein electrophoresis showed polyclonal gammopathy (gamma fraction 2.2 g). rheumatoid factor titers were elevated 45 h (< 14) ; elevated free kappa and lambda serum with normal ratio (1) (free kappa serum 205.8 mg / l [3.319.4 ], free lambda serum 205.0 mg / l [5.726.3 ]). on day 7, the patient was intubated for impending respiratory failure and put on mechanical ventilation. bronchoscopic examination revealed blood in both bronchial trees and alveolar hemorrhage and the patient was started on total plasma exchange with fresh frozen plasma on a daily basis (total of seven sessions) ; bronchoalveolar lavage cultures grew streptococcus bovis and aspergillus fumigatus and antifungal were added to meropenem. on day 13, renal biopsy and staining with hematoxylin and eosin stain, periodic acid schiff stain, and jones methionine silver stain revealed core of renal cortex contains 19 glomeruli, 18 of which are globally sclerotic and one of which has ischemic tuft retraction associated with tubular atrophy, interstitial fibrosis and a moderate chronic inflammatory infiltrate. the glomeruli appear enlarged with diffuse and global mild to moderate mesangial sclerosis forming segmental nodules. (figure 1a) superimposed on this nodular sclerosis, there is mild to moderate mesangial hypercellularity and segmental to global endocapillary proliferation (figure 1b) including infiltrating neutrophils. (figure 1c) there is endocapillary and focal extracapillary proliferative and exudative features : cellular / fibrocellular crescents ; arteries and arterioles are narrowed by moderately severe intimal sclerosis ; (figure 1d) rbc casts (figure 1e) and focal acute tubular injury. figure 1f ; the immunofluorescence (if) findings of granular global mesangial and starry - sky pattern of glomerular capillary wall positivity for iga and c3 (figure 1 g and h) support iga - dominant post - infectious glomerulonephritis (iga - pign) with endocapillary and focal extracapillary proliferative and exudative features associated with staphylococcal infection. smoking - related moderate nodular glomerulosclerosis, (associated with longstanding smoking and copd), focal subcapsular cortical scar with ischemic glomerulosclerosis, consistent with hypertensive arterionephrosclerosis, and moderately severe arteriosclerosis were also noted. on electronic microscopy the patient expired on day 18 secondary to respiratory failure, hypoxia, and cardiac arrest. pign is an entity well known to occur in childhood following streptococcal upper respiratory tract or skin infections. during the past 3 decades although, a major shift has occurred in the epidemiology, characteristics, and outcomes of this disease. it is recognized increasingly more in the adult population, and can occur after streptococcal and more commonly staphylococcal infections from various sites.17 both post - streptococcal and staphylococcal infectious rpgn share identical histopathological appearance, with diffuse endocapillary proliferative and exudative rpgn on light microscopy, glomerular immune deposits that stain for either igg and c3 or c3 only on if, and hump - shaped subepithelial deposits on electron microscopy. more recently, several cases of acute post - infectious glomerulonephritis (apign) have been identified with intense deposits of iga as the sole or dominant ig on if, and mesangial and subepithelial deposits on em, characterizing a new entity named iga - dominant apign.16 to signify the ongoing infection at the time of diagnosis, the term iga dominant infection - related glomerulonephritis (irgn) is employed.4 codominance of iga and igg staining can lead to a diagnostic dilemma in terms of distinguishing iga dominant irgn from iga nephropathy. classically, iga nephropathy is associated with a stronger c3 staining in a starry - sky appearance. in addition, staphylococcal associated apign is associated with hypocomplementemia in 69% of the cases.1,3,5,6 on average, it takes 4 weeks from the time of infection to kidney injury. epidemiologically, the mean age of diagnosis is 60 years of age, with a male to female predominance of nearly 4:1. it has never been reported in children, and is most commonly associated with diabetes mellitus (55%). fifty - one percentage of the cases (in which an infection site was identified) were due to cellulitis, and staphylococcus is the most commonly associated pathogen, but there are also reports indicating occurrence in patients with urinary tract infections.16,8,9 the clinical manifestations include acute nephritic syndrome with severe renal failure (acute or rapidly progressive), new onset of gross hematuria with or without rbc casts (25% of the cases), nephrotic and non - nephrotic range proteinuria, edema, and hypertension (75% at presentation). eighty - four percentage of the cases result in chronic kidney disease, nearly half of which progress to end stage renal disease requiring renal replacement therapy. interestingly, and perhaps not surprisingly, two - thirds of the patients progressing to end stage renal disease have underlying diabetic glomerulosclerosis.1,3,5,6 iga dominant apign has a broad spectrum of glomerular injury, which can not be precisely specified. it mainly presents as diffuse (53%) or focal (28%) endocapillary proliferative and exudative, but also as pure mesangial proliferative rpgn (13%), membranoproliferative rpgn, or crescentic rpgn.2 it is differentiated by if and em findings.4 on if, glomerular mesangial and glomerular capillary injury resembling the starry - sky pattern is seen in 69% of the cases. on em, electron dense deposits were present in 92% of the patients and exhibited a hump - shaped appearance, which is a key histopathological finding in terms of diagnosing iga dominant irgn. interestingly, in cases of resolving irgn, the subepithelial deposits were preferentially located at the glomerular basement membrane as opposed to the mesangium. subendothelial deposits tend to be small and infrequent, but are seen in up to 66% of the cases. if for c3 tends to be the strongest, with a starry - sky pattern. however, unlike usual pign, iga is prominent and igg is either weak or absent.2,3 the pathogenesis of the iga predominant deposition is not well known, and is likely to involve specific host - pathogen interactions.1,5 increased serum iga levels in some reported cases suggest activation of selective iga immune responses. koyama,11 suggested that post - methicillin - resistant s. aureus (mrsa) rpgn may be induced by a staphylococcal enterotoxin acting as a superantigen.3 this leads to massive t - cell activation and production of high amounts of proinflammatory cytokines and iga igg immune complex formation.1,5 recently, a s. aureus cell envelope antigen designated as probable adhesion was identified in iga nephropathy, henoch - schonlein purpura, and post - mrsa rpgn, co - localizing with glomerular iga deposits. it appears that s. aureus, a common colonizing bacterium in nasal and oral flora, contributes to the pathogenesis of iga nephropathy, and can result in pign in the setting of disease causing infections. although probable adhesion may be the antigen trigger for iga - dominant pign, it is still unknown if the iga secreted by the host is abnormal as is the case in iga nephropathy.1,4,12 interestingly, diabetic patients develop iga - rich immune responses in circulation when compared to the normal population, especially in the presence of diabetic complications and end organ damage. high serum iga levels in diabetic patients likely represent an immune response to advanced glycosylation end products. the iga - rich environment in diabetics coupled with iga - specific responses to the proposed staphylococcal superantigen may precipitate a unique variant of pign with glomerular iga deposition and explain the predilection for more severe iga dominant irgn in diabetic patients.3,5,8,9 the consensus for diagnosis requires three out of the following five criteria : 1) clinical or laboratory evidence of infection preceding or at the onset of rpgn ; 2) depressed serum complement ; 3) endocapillary proliferative and exudative rpgn ; 4) c3-dominant or codominant glomerular if staining ; and 5) hump - shaped subepithelial deposits shown on electron microscopy.1,13 kidney biopsy is recommended in most adults suspected of having irgn to confirm the diagnosis and rule out other glomerulonephritides that have similar clinical presentations and may require prompt aggressive immunosuppressive therapy, which has not yet been shown to be of utility in irgn. this case represents the first reported case to our knowledge of iga - dominant irgn presenting with pulmonary - renal syndrome. our aim is to advance knowledge of this phenomenon, and hopefully spur a better understanding of the pathogenesis involved, which may lead to new treatment paradigms. iga dominant apign has a broad spectrum of glomerular injury, which can not be precisely specified. it mainly presents as diffuse (53%) or focal (28%) endocapillary proliferative and exudative, but also as pure mesangial proliferative rpgn (13%), membranoproliferative rpgn, or crescentic rpgn.2 it is differentiated by if and em findings.4 on if, glomerular mesangial and glomerular capillary injury resembling the starry - sky pattern is seen in 69% of the cases. on em, electron dense deposits were present in 92% of the patients and exhibited a hump - shaped appearance, which is a key histopathological finding in terms of diagnosing iga dominant irgn. interestingly, in cases of resolving irgn, the subepithelial deposits were preferentially located at the glomerular basement membrane as opposed to the mesangium. subendothelial deposits tend to be small and infrequent, but are seen in up to 66% of the cases. if for c3 tends to be the strongest, with a starry - sky pattern. however, unlike usual pign, iga is prominent and igg is either weak or absent.2,3 the pathogenesis of the iga predominant deposition is not well known, and is likely to involve specific host - pathogen interactions.1,5 increased serum iga levels in some reported cases suggest activation of selective iga immune responses. koyama,11 suggested that post - methicillin - resistant s. aureus (mrsa) rpgn may be induced by a staphylococcal enterotoxin acting as a superantigen.3 this leads to massive t - cell activation and production of high amounts of proinflammatory cytokines and iga igg immune complex formation.1,5 recently, a s. aureus cell envelope antigen designated as probable adhesion was identified in iga nephropathy, henoch - schonlein purpura, and post - mrsa rpgn, co - localizing with glomerular iga deposits. it appears that s. aureus, a common colonizing bacterium in nasal and oral flora, contributes to the pathogenesis of iga nephropathy, and can result in pign in the setting of disease causing infections. although probable adhesion may be the antigen trigger for iga - dominant pign, it is still unknown if the iga secreted by the host is abnormal as is the case in iga nephropathy.1,4,12 interestingly, diabetic patients develop iga - rich immune responses in circulation when compared to the normal population, especially in the presence of diabetic complications and end organ damage. high serum iga levels in diabetic patients likely represent an immune response to advanced glycosylation end products. the iga - rich environment in diabetics coupled with iga - specific responses to the proposed staphylococcal superantigen may precipitate a unique variant of pign with glomerular iga deposition and explain the predilection for more severe iga dominant irgn in diabetic patients.3,5,8,9 the consensus for diagnosis requires three out of the following five criteria : 1) clinical or laboratory evidence of infection preceding or at the onset of rpgn ; 2) depressed serum complement ; 3) endocapillary proliferative and exudative rpgn ; 4) c3-dominant or codominant glomerular if staining ; and 5) hump - shaped subepithelial deposits shown on electron microscopy.1,13 kidney biopsy is recommended in most adults suspected of having irgn to confirm the diagnosis and rule out other glomerulonephritides that have similar clinical presentations and may require prompt aggressive immunosuppressive therapy, which has not yet been shown to be of utility in irgn. this case represents the first reported case to our knowledge of iga - dominant irgn presenting with pulmonary - renal syndrome. our aim is to advance knowledge of this phenomenon, and hopefully spur a better understanding of the pathogenesis involved, which may lead to new treatment paradigms. | over the last decades, post - infectious glomerulonephritis underwent major changes in its epidemiology, pathophysiology, and outcomes. we are reporting a case of iga - dominant post - infectious glomerulonephritis (iga - pign) presenting as a fatal pulmonary - renal syndrome. an 86-year - old filipino man presented with worsening dyspnea, hemoptysis, and decreased urine output over 2 weeks. past medical history is significant for hypertension, chronic kidney disease stage iii, and pneumonia 3 weeks prior treated with intravenous cefazolin for methicillin - sensitive staphylococcus aureus bacteremia. physical examination was remarkable for heart rate of 109/min and respiratory rate of 25/min saturating 99% on 3 liters via nasal cannula. there were bibasilar rales in the lungs and bilateral ankle edema. a chest radiograph showed bibasilar opacifications. blood work was significant for hemoglobin of 8.3 g / dl and creatinine of 9.2 mg / dl (baseline of 1.67). tte showed ef 55%. urinalysis revealed large blood and red blood cell casts. kidney ultrasound showed bilateral echogenicity compatible with renal disease. pulse methylprednisolone therapy and hemodialysis were initiated with patient s condition precluding kidney biopsy. serology workup for rapidly progressive glomerulonephritis was negative. on day 7, the patient required mechanical ventilation ; bronchoscopy showed alveolar hemorrhage and plasmapheresis was initiated. renal biopsy revealed iga - pign with endocapillary and focal extracapillary proliferative and exudative features. iga - pign occurs in diabetic elderly (mean age of 60 years), 016 weeks after an infection mainly by staphylococcus. however, this nondiabetic patient had normal complement iga - pign with fatal pulmonary - renal syndrome. understanding the pathogenesis and identifying the nephrotoxic bacteria species and the aberrant iga molecule will open new insights toward prevention and treatment. |
research has previously demonstrated an inverse association between smoking status and physical activity (pa). less research, however, has examined the specific association between nicotine dependence and pa, which is worth considering as individuals with greater nicotine dependence often have worse health outcomes (e.g., depression). to our knowledge, few studies have examined the association between nicotine dependence and pa. each of these studies showed an inverse association between nicotine dependence and pa, suggesting that smokers with greater nicotine dependence engage in less pa and more sedentary behavior than their counterparts with less nicotine dependence. a limitation of these studies, however, was their exclusive use of self - report pa, which is prone to considerable measurement error. validation studies examining the association between self - report pa and some gold - standard (e.g., accelerometry, indirect calorimetry, and doubly labeled water) typically show a poor correlation in the range of 0.3 - 0.5. validated, self - report questionnaires only account for 9 - 25% of the variance in the outcome parameter, and are therefore likely to result in considerable misclassification. based on this gap in the literature, the purpose of this study was to examine the association between nicotine dependence and accelerometer - determined pa behavior (both light - intensity and moderate - to - vigorous pa (mvpa)) among a national sample of us adult smokers. we also explored the association between nicotine dependence and accelerometer - determined sedentary behavior given the emerging research demonstrating that sedentary behavior, independent of pa, is associated with worse health outcomes (e.g., cardiovascular disease). data for the present study were obtained from the 2003 - 2006 national health and nutrition examination survey (nhanes). nhanes uses a representative sample of noninstitutionalized us civilians, selected by a complex, multistage probability design. the survey consists of two primary components, including participants being interviewed in their homes and subsequently examined in mobile examination centers (mecs). with regard to the study variables, the study was approved by the national center for health statistics ethics review board, with informed consent obtained from all participants prior to data collection. in the 2003 - 2006 nhanes cycles 1,451 provided data on the covariates (e.g., age, gender, race - ethnicity, poverty level, emphysema, bronchitis, hypertension, cotinine, body mass index (bmi)), not including accelerometer wear time. lastly, after excluding those with missing or insufficient accelerometry data (< 4 days of 10 + h / day of monitoring data), 851 adult (20 - 85 years) participants remained, with these individuals constituting the analytic sample. when comparing the analytic sample to the 600 participants that were excluded because of missing or insufficient accelerometry data, there were no differences by race - ethnicity (p = 0.21), bmi (p = 0.07), cotinine (p = 0.15), and bronchitis (p = 0.84) ; however, those excluded were more likely to be female (47.6 vs 39.1% ; p = 0.001), younger (40.4 vs 47.3 years ; p < 0.001), had a lower poverty level score (2.0 vs 2.3 ; p < 0.001), and were less likely to have emphysema (2.8 vs 4.9% ; p = 0.04) or hypertension (22.5 vs 30.4% ; p = 0.001). these are unweighted estimates. using the fagerstrom test for nicotine dependence scale, two self - reported questions were used to assess nicotine dependence : i) on average, how many cigarettes do you now smoke per day ? (responses of 10 or less, 11 - 20, 21 - 30, and 31 +, respectively, were coded as 0, 1, 2, and 3), and ii) how soon after you wake up do you smoke ? (responses : within 5 min, from 6 to 30 min, from more than 30 min to 1 h, and more than 1 h, respectively, were coded as 3, 2, 1, and 0). as a result, this nicotine dependence scale ranged from 0 to 6, with higher scores indicating greater nicotine dependence. at the mec, participants who were not prevented by impairments of walking or wearing an accelerometer were issued an actigraph 7164 accelerometer. participants were asked to wear the accelerometer on the right hip for 7 days following their examination. activity counts between 100 and 2,019 counts per min were used to classify time spent in light - intensity pa ; activity counts between 2,020 and 5,998 counts per min were used to classify time spent at moderate - intensity ; and activity counts at or greater than 5,999 counts per min were used to classify time spent at vigorous - intensity. given that participants spent little time at or above vigorous intensity (mean = 0.62 min / day, standard error (se) = 0.1), moderate and vigorous intensity pa was combined as an estimate of mvpa. for the analyses described here, and to ensure habitual pa patterns were assessed, only those participants with at least 4 days with 10 or more h / day of monitoring data were included in the analyses. nonwear of the accelerometer was defined by a period of a minimum of 60 consecutive min of zero activity counts, with the allowance of 1 - 2 min of activity counts between 0 and 100. covariates included age (continuous), gender (male / female), race - ethnicity (mexican american, other hispanic, non - hispanic white ; non - hispanic black, and other race), poverty level (range = 0 - 5), measured hypertension (140 mmhg(systolic) or 90 mmhg (diastolic) or if they were taking blood pressure lowering medication), physician - diagnosed emphysema, physician - diagnosed bronchitis, measured bmi (kg / m), cotinine (continuous ; ng / ml), and accelerometer wear time (h / day). as a measure of socioeconomic status, poverty level was assessed from the poverty - to - income ratio, with a value below 1 considered below the poverty threshold. the poverty level is calculated by dividing the family income by the poverty guidelines, which is specific to the family size, year assessed, and state of residence. serum cotinine was measured by an isotope dilution - high performance liquid chromatography / atmospheric pressure chemical ionization tandem mass spectrometry. statistical analyses (stata, version 12.0, college station, tx) accounted for the complex survey design used in nhanes. to account for oversampling, nonresponse, noncoverage, and to provide nationally representative estimates, all analyses included the use of survey sample weights, stratum, and primary sampling units. multivariable regression analysis was used to examine the association between nicotine dependence (predictor variable) and pa / sedentary behavior ; models were computed separately for sedentary behavior, light - intensity pa, and mvpa. a negative binomial regression analysis was computed for the mvpa model given that mvpa was considerably skewed. all models were adjusted for age, gender, race - ethnicity, poverty level, hypertension, emphysema, bronchitis, bmi, cotinine, and accelerometer wear time. interaction analyses were first computed to examine if there was an interaction effect of nicotine dependence and age ; nicotine dependence and gender ; and nicotine dependence and race - ethnicity. to examine a potential interaction effect, the cross - product term of nicotine dependence and the demographic variable (i.e., age, gender, or race - ethnicity) was entered into the model, along with the main effect variables and the covariates. these three interaction models (with mvpa as the outcome variable) showed that the interaction variable for nicotine dependence and age was significant (= 0.07 ; p = 0.02) ; however, the models examining an interaction effect for nicotine dependence and gender (= 0.83 ; p = 0.30) and nicotine dependence and race - ethnicity (= 1.06 ; p = 0.13) were not significant. given the nicotine dependence and age interaction effect, the results presented herein are stratified by age group (20 - 29 years, n = 126 ; 30 - 49 years, n = 351 ; and 50 + years, n = 374). more specifically, three multivariable regression analyses were computed that examined the association between nicotine dependence (predictor variable) and mvpa : one for 20 - 29-year - olds ; one for 30 - 49-year - olds ; and one for 50 + year olds. these age groups were chosen based on a visual inspection of a scatter plot (not shown) delineating a nonlinear relationship between age and nicotine dependence. similarly, three separate age - stratified models were computed for light - intensity pa and three separate age - stratified models were computed for sedentary behavior. data for the present study were obtained from the 2003 - 2006 national health and nutrition examination survey (nhanes). nhanes uses a representative sample of noninstitutionalized us civilians, selected by a complex, multistage probability design. the survey consists of two primary components, including participants being interviewed in their homes and subsequently examined in mobile examination centers (mecs). with regard to the study variables, the study was approved by the national center for health statistics ethics review board, with informed consent obtained from all participants prior to data collection. in the 2003 - 2006 nhanes cycles 1,451 provided data on the covariates (e.g., age, gender, race - ethnicity, poverty level, emphysema, bronchitis, hypertension, cotinine, body mass index (bmi)), not including accelerometer wear time. lastly, after excluding those with missing or insufficient accelerometry data (< 4 days of 10 + h / day of monitoring data), 851 adult (20 - 85 years) participants remained, with these individuals constituting the analytic sample. when comparing the analytic sample to the 600 participants that were excluded because of missing or insufficient accelerometry data, there were no differences by race - ethnicity (p = 0.21), bmi (p = 0.07), cotinine (p = 0.15), and bronchitis (p = 0.84) ; however, those excluded were more likely to be female (47.6 vs 39.1% ; p = 0.001), younger (40.4 vs 47.3 years ; p < 0.001), had a lower poverty level score (2.0 vs 2.3 ; p < 0.001), and were less likely to have emphysema (2.8 vs 4.9% ; p = 0.04) or hypertension (22.5 vs 30.4% ; p = 0.001). these are unweighted estimates. using the fagerstrom test for nicotine dependence scale, two self - reported questions were used to assess nicotine dependence : i) on average, how many cigarettes do you now smoke per day ? (responses of 10 or less, 11 - 20, 21 - 30, and 31 +, respectively, were coded as 0, 1, 2, and 3), and ii) how soon after you wake up do you smoke ? (responses : within 5 min, from 6 to 30 min, from more than 30 min to 1 h, and more than 1 h, respectively, were coded as 3, 2, 1, and 0). as a result, this nicotine dependence scale ranged from 0 to 6, with higher scores indicating greater nicotine dependence. at the mec, participants who were not prevented by impairments of walking or wearing an accelerometer were issued an actigraph 7164 accelerometer. participants were asked to wear the accelerometer on the right hip for 7 days following their examination. detailed information on the actigraph accelerometer can be found elsewhere. for the present study, activity counts between 100 and 2,019 counts per min were used to classify time spent in light - intensity pa ; activity counts between 2,020 and 5,998 counts per min were used to classify time spent at moderate - intensity ; and activity counts at or greater than 5,999 counts per min were used to classify time spent at vigorous - intensity. given that participants spent little time at or above vigorous intensity (mean = 0.62 min / day, standard error (se) = 0.1), moderate and vigorous intensity pa was combined as an estimate of mvpa. for the analyses described here, and to ensure habitual pa patterns were assessed, only those participants with at least 4 days with 10 or more h / day of monitoring data were included in the analyses. nonwear of the accelerometer was defined by a period of a minimum of 60 consecutive min of zero activity counts, with the allowance of 1 - 2 min of activity counts between 0 and 100. covariates included age (continuous), gender (male / female), race - ethnicity (mexican american, other hispanic, non - hispanic white ; non - hispanic black, and other race), poverty level (range = 0 - 5), measured hypertension (140 mmhg(systolic) or 90 mmhg (diastolic) or if they were taking blood pressure lowering medication), physician - diagnosed emphysema, physician - diagnosed bronchitis, measured bmi (kg / m), cotinine (continuous ; ng / ml), and accelerometer wear time (h / day). as a measure of socioeconomic status, poverty level was assessed from the poverty - to - income ratio, with a value below 1 considered below the poverty threshold. the poverty level is calculated by dividing the family income by the poverty guidelines, which is specific to the family size, year assessed, and state of residence. serum cotinine was measured by an isotope dilution - high performance liquid chromatography / atmospheric pressure chemical ionization tandem mass spectrometry. statistical analyses (stata, version 12.0, college station, tx) accounted for the complex survey design used in nhanes. to account for oversampling, nonresponse, noncoverage, and to provide nationally representative estimates, all analyses included the use of survey sample weights, stratum, and primary sampling units. multivariable regression analysis was used to examine the association between nicotine dependence (predictor variable) and pa / sedentary behavior ; models were computed separately for sedentary behavior, light - intensity pa, and mvpa. a negative binomial regression analysis was computed for the mvpa model given that mvpa was considerably skewed. all models were adjusted for age, gender, race - ethnicity, poverty level, hypertension, emphysema, bronchitis, bmi, cotinine, and accelerometer wear time. interaction analyses were first computed to examine if there was an interaction effect of nicotine dependence and age ; nicotine dependence and gender ; and nicotine dependence and race - ethnicity. to examine a potential interaction effect, the cross - product term of nicotine dependence and the demographic variable (i.e., age, gender, or race - ethnicity) was entered into the model, along with the main effect variables and the covariates. these three interaction models (with mvpa as the outcome variable) showed that the interaction variable for nicotine dependence and age was significant (= 0.07 ; p = 0.02) ; however, the models examining an interaction effect for nicotine dependence and gender (= 0.83 ; p = 0.30) and nicotine dependence and race - ethnicity (= 1.06 ; p = 0.13) were not significant. given the nicotine dependence and age interaction effect, the results presented herein are stratified by age group (20 - 29 years, n = 126 ; 30 - 49 years, n = 351 ; and 50 + years, n = 374). more specifically, three multivariable regression analyses were computed that examined the association between nicotine dependence (predictor variable) and mvpa : one for 20 - 29-year - olds ; one for 30 - 49-year - olds ; and one for 50 + year olds. these age groups were chosen based on a visual inspection of a scatter plot (not shown) delineating a nonlinear relationship between age and nicotine dependence. similarly, three separate age - stratified models were computed for light - intensity pa and three separate age - stratified models were computed for sedentary behavior. older smokers, compared to younger smokers, had a higher poverty - to - income ratio, higher cotinine value, were more likely to be hypertensive, have emphysema, chronic bronchitis, engaged in more sedentary behavior, and less light - intensity pa and mvpa [table 1 ]. also, older smokers had greater nicotine dependence. weighted characteristics of us smokers across age groups, 2003 - 2006 nhanes (n = 851) multivariable regression analyses showed that there was no association between nicotine dependence and pa / sedentary behavior for the two younger age groups [table 2 ]. however, among smokers 50 + years, those with greater nicotine dependence engaged in more sedentary behavior (= 11.4, p = 0.02) and less light - intensity pa (= 9.6, p = 0.03) and mvpa (= 0.14, p = 0.003). notably, after applying a bonferroni - corrected p - value (i.e., p < 0.005), nicotine dependence was only associated with mvpa. these regression analyses were adjusted for age, gender, race - ethnicity, poverty level, hypertension, emphysema, bronchitis, accelerometer wear time, cotinine, and bmi. when additional covariates (e.g., pack years) were entered in the model, the results were unchanged (data not shown). multivariable regression analysis examining the association between nicotine dependence (independent variable) and physical activity / sedentary behavior, 2003 - 2006 nhanes (n = 851) these findings suggest that nicotine dependence is only associated with pa among older individuals, with older individuals generally having greater nicotine dependence ; nicotine dependence values across the three age groups, respectively, was 2.0, 2.5, and 3.0. further analyses were computed to examine if a particular nicotine dependence threshold influenced the nicotine dependence - pa relationship. when nicotine dependence was divided into tertiles (1.06 ; tertile 1, 3.0, tertile 2 ; and 4.6, tertile 3 (values are means)), there was no association between these nicotine dependence categories and pa. for example, in a multivariable regression model among the entire sample, middle tertile (vs bottom tertile) of nicotine dependence (= 0.03, p = 0.75) was not associated with mvpa nor was the top tertile (vs bottom tertile) (= 0.07, p = 0.47). although a considerable amount of research has demonstrated an inverse association between smoking status and pa, to our knowledge, few studies have examined the association between nicotine dependence and pa. these studies showed that nicotine dependence was inversely associated with self - reported leisure - time pa. the present study adds to the literature by examining this understudied topic, stratifying analyses by age, employing a national sample of us adult smokers, employing an objective measure of pa, and also considering the influence that nicotine dependence may have on sedentary behavior and light - intensity pa. overall, our findings demonstrate an inverse association between nicotine dependence and mvpa, with some evidence of an association between nicotine dependence and light - intensity pa and sedentary behavior. notably, these associations were only observed for adults 50 years and older. a possible explanation for the null findings for the younger age groups may be because of their lower degree of nicotine dependence. nicotine dependence may displace the amount of time to engage in pa and is also associated with other outcomes (e.g., depression) that are associated with physical inactivity. our findings further demonstrate that older adults who are more nicotine dependent engage in less pa (both mvpa and light - intensity) and more sedentary behavior than their less nicotine - dependent counterparts. as a result, older adults with greater nicotine dependence, in particular, are in need of pa promotion. pa promotion may be particularly difficult among this population given the established age- and smoking - induced effects, such as reduced mobility and diminished lung capacity, which may increase exercise intolerance. given the emerging research showing that sedentary behavior and light - intensity pa are independent predictors of health among older adults ; promoting light - intensity pa, at least initially, may be a sensible strategy to increase long - term pa engagement among nicotine dependent smokers. in turn, this may help prevent the development of numerous comorbidities associated with physical inactivity. further, and although speculative, such pa promotion may help to facilitate the cessation of smoking as regular pa engagement has been shown to reduce nicotine dependence through reduced nicotine cravings, more quit attempts, and success in stopping smoking. in conclusion, our findings demonstrate that, among us adults 50 + years of age, nicotine dependence is inversely associated with mvpa and light - intensity pa and positively associated with sedentary behavior. a limitation of this study includes the cross - sectional design, which precludes the ability to render causation. as a result, future research employing an objective measure of pa and utilizing a prospective or experimental study design is warranted. further, the included sample differed from the excluded sample on several parameters, including gender, age, poverty level, and health status. lastly, depression data was not available in both of the evaluated nhanes cycles ; therefore, future research should consider the effects of depression when examining the relationship between nicotine dependence and objectively - measured pa. | background : research has previously demonstrated an inverse association between smoking status and physical activity ; however, few studies have examined the association between nicotine dependence and physical activity or sedentary behavior.aim:this study examined the association between nicotine dependence and accelerometer - determined physical activity and sedentary behavior.materials and methods : data from the 2003 - 2006 national health and nutrition examination survey (nhanes) were used. a total of 851 adult (20 years) smokers wore an accelerometer for 4 days and completed the fagerstrom test for nicotine dependence scale. regression models were used to examine the association between nicotine dependence and physical activity / sedentary behavior.results:after adjusting for age, gender, race - ethnicity, poverty level, hypertension, emphysema, bronchitis, body mass index (bmi), cotinine, and accelerometer wear time, smokers 50 + years of age with greater nicotine dependence engaged in more sedentary behavior (= 11.4, p = 0.02) and less light - intensity physical activity (= 9.6, p = 0.03) and moderate - to - vigorous physical activity (mvpa ; = 0.14, p = 0.003) than their less nicotine dependent counterparts.conclusion:older adults who are more nicotine dependent engage in less physical activity (both mvpa and light - intensity) and more sedentary behavior than their less nicotine dependent counterparts. |
polymorphonuclear leukocytes (pmns) play an important role in host defense against microbial infections. the microbicidal mechanism consists of phagocytosis of pathogens, production and subsequent release of reactive oxygen species (ros) and bactericidal proteins to phagosomes. the process involves activation of nadph oxidase (nox), which catalyzes the reduction of oxygen molecular to o2 at the expense of nadph in phagocytes [13 ]. noxs are a group of plasma membrane - associated multicomponent enzymes consisting of at least two components bound to plasma membrane (gp91 and p22 that together form the flavocytochrome b558), and three cytosolic components (p47, p67, and p40), and a small gtpase rac. in resting pmns, noxs are dormant and their components separately exist in the membrane and in the cytosol. once pmns are primed by appropriate stimuli, noxs are activated to produce o2 by association of these cytosolic components with the plasma or phagosome membrane components [58 ]. besides the bactericidal action as a beneficial effect, the uncontrolled production of ros by phagocytic granulocytes may lead to crippling disorders such as shock and inflammation. phorbol 12-myristate 13-acetate (pma, fig. 1), a potent activator of protein kinase c (pkc), induces the phosphorylation of p47 and subsequent o2 production by the assembled nox components. more in detail, phosphorylation of proteins plays an essential role in the regulation of nox activity, and the activation of pkc with pma promotes the phosphorylation of serine and threonine residues of the p47 and its translocation to the plasma membrane [1113 ]. the respiratory burst is accompanied by tyrosine phosphorylation in cytosolic and membrane proteins, and it is also well known that tyrosine phosphorylation of proteins occurs during priming of pmns. as shown in fig. 1, a side chain group of pma is myristic acid (mya), a 14-carbon, straight chain saturated fatty acid. mya is mainly contained in vegetable oils such as coconut oil and palm oil, and likely affects lipid metabolism such as hypercholesterolemia [1618 ], i.e. mya causes high ldl cholesterol and apob levels and low hdl to ldl ratios in healthy men and women, a positive regression between the plasma cholesterol level and the dietary level of mya was observed in hamsters, and incorporation of trimyristin in the oil resulted in marked rise in serum cholesterol of rats. in term of oxidative metabolism of pmns, it was reported that mya has an ability to stimulate the generation of o2 from human neutrophils. it was reported that mya induces the hydrolysis of phosphatidylcholine leading to generation of arachidonic acid (aa). aa when added with membrane protein separated from bovine pmns can activate nox of bovine pmns. in addition, it was reported that apocynin (a specific inhibitor of nadph oxidase) suppressed this stimuli (including mya) -dependent ros generation of undifferentiated hl-60 cells. thus, mya may prime pmns through two routes, one is nox activated by aa from phosphatidylcholine and the other is direct effect on nox. thus, to assess the effect of mya, when absorbed into the circulation, on ros generation, we need to estimate the potency of aa to generate ros in addition to the potency of mya itself. these findings tempted us to compare the stimulative effect of mya to release ros with that of pma, and to examine the stimulative effect of aa as an indirect effect of mya. in this study, we examined stimuli - dependent ros release from human pmns by applying electron paramagnetic resonance (epr)-spin - trapping method. reagents were purchased from the following sources : dextran, pma, mya and diethylenetriamine - n, n, n',n'',n''-pentaacetic acid (dtpa) from wako pure chemical industries (osaka, japan), aa from icn biomedicals, inc. (costa mesa, ca), superoxide dismutase (sod from bovine erythrocytes) and 4-hydroxyl-2,2,6,6-tetrametylpiperidin-1-oxyl (tempol) from sigma - aldrich (st. lous, mo), ficoll - paque plus from amersham biosciences (buckinghamshire, uk) and 5,5-dimethyl-1-pyrroline - n - oxide (dmpo) from labotec inc. pmns were prepared from the blood by density gradient centrifugation using a ficoll - paque plus (d = 1.077) following dextran sedimentation as previously described. after the pellet of pmns were subjected to rapid hypotonic lysis of erythrocyte, the cells were suspended in hank s balanced salt solution (hbss) to be 1.0 10 cell / ml. pma and mya were dissolved in dimethyl sulfoxide (dmso) to be 0.80 to 4.0 mm. dtpa was dissolved in 0.1 m phosphate buffer solution (pb, ph 7.4) to be 20 mm, sod was to be 5000 u / ml in pb, and dmpo was to be 2.25 m in hbss. one hundred and twenty l of cell suspension was mixed with 16 l of dmpo and 16 l of dtpa solution. after addition of 8 l of pma, mya or aa, the resultant mixture was transferred to a quartz flat epr cell within 40 s. epr spectra of dmpo spin adducts were recorded at given times. the measurement conditions for epr (jes - fa100, jeol, tokyo, japan) were as follows : scan rate, 10 mt / min ; scan field, 335.5 5 mt ; modulation width, 0.1 mt ; modulation frequency, 100 khz ; time constant, 0.03 s ; microwave power, 8 mw ; and microwave frequency, 9.5 ghz. peak areas of epr spectra of dmpo spin adducts, which are compensated by the peak area of mn, were compared with those of the given concentrations of tempol standard. statistical significances between the two mean values of each time point were assessed by student s t test or welch t test following analysis of variance. reagents were purchased from the following sources : dextran, pma, mya and diethylenetriamine - n, n, n',n'',n''-pentaacetic acid (dtpa) from wako pure chemical industries (osaka, japan), aa from icn biomedicals, inc. (costa mesa, ca), superoxide dismutase (sod from bovine erythrocytes) and 4-hydroxyl-2,2,6,6-tetrametylpiperidin-1-oxyl (tempol) from sigma - aldrich (st. lous, mo), ficoll - paque plus from amersham biosciences (buckinghamshire, uk) and 5,5-dimethyl-1-pyrroline - n - oxide (dmpo) from labotec inc. pmns were prepared from the blood by density gradient centrifugation using a ficoll - paque plus (d = 1.077) following dextran sedimentation as previously described. after the pellet of pmns were subjected to rapid hypotonic lysis of erythrocyte, the cells were suspended in hank s balanced salt solution (hbss) to be 1.0 10 cell / ml. pma and mya were dissolved in dimethyl sulfoxide (dmso) to be 0.80 to 4.0 mm. dtpa was dissolved in 0.1 m phosphate buffer solution (pb, ph 7.4) to be 20 mm, sod was to be 5000 u / ml in pb, and dmpo was to be 2.25 m in hbss. one hundred and twenty l of cell suspension was mixed with 16 l of dmpo and 16 l of dtpa solution. after addition of 8 l of pma, mya or aa, the resultant mixture was transferred to a quartz flat epr cell within 40 s. epr spectra of dmpo spin adducts were recorded at given times. the measurement conditions for epr (jes - fa100, jeol, tokyo, japan) were as follows : scan rate, 10 mt / min ; scan field, 335.5 5 mt ; modulation width, 0.1 mt ; modulation frequency, 100 khz ; time constant, 0.03 s ; microwave power, 8 mw ; and microwave frequency, 9.5 ghz. peak areas of epr spectra of dmpo spin adducts, which are compensated by the peak area of mn, were compared with those of the given concentrations of tempol standard. statistical significances between the two mean values of each time point were assessed by student s t test or welch t test following analysis of variance. fig. 2 shows the typical epr spectra of dmpo spin adducts of oxygen radicals generated from human pmns stimulated by pma or mya. as shown in fig. 2a, multiple - lines of epr spectra of human pmns primed by pma were detected. the hyperfine coupling constants (hfcc) of a = 1.48 and a = 1.48 mt (closed circle) at the four - line spectrum were typical dmpo spin adducts of oh (dmpo - oh) [22, 23 ], and those of a = 1.425, a = 1.145 and a = 0.124 (open circle) were dmpo spin aducts of o2 (dmpo - ooh) [21, 22 ]. 2b shows the representative epr spectra obtained from human pmns primed by mya. as is the case with fig. 2a, spin adducts of dmpo - oh and dmpo - ooh were observed, suggesting that mya can stimulate human pmns to release o2 and oh. to confirm that the dmpo - ooh was derived from o2, the pmns were treated with sod, a potent o2 scavenger, prior to pma and mya stimulation. 2c and d show characteristic epr spectra of dmpo - oh obtained from pmns primed with pma and mya following sod treatment, respectively. since the twelve - line spectrum with the hfcc of a = 1.425, a = 1.145 and a = 0.124 (open circle) was completely disappeared in either of fig. 2c and d, these spectra was derived from spin adduct of dmpo and o2. 3a shows time course changes in dmpo - ooh production after the addition of pma, and of mya to be a concentration of 81 m. apparently mya stimulated pmns to produce o2 more strongly than did pma when the same concentrations were added. 3b shows time course changes in dmpo - oh production after the addition of pma, and mya to be a concentration of 81 m, indicating that oh production was time - dependently increased by either pma or mya. similar to the case of o2, mya stimulated pmns to produce oh more strongly than did pma when the same concentrations were added. these results clearly showed that mya has an ability to prime human pmns to produce oxygen radicals such as o2 more potently than pma. it was reported that mya induces chemiluminescence of human promyelocytic leukemia cells with a luminol analogue l-012. however, qualitative analysis of ros has not been conducted yet because chemiluminescence is induced by various ros. on the other hands, the epr spin - trapping method could detect o2 and oh simultaneously as dmpo - spin adducts as shown in our study. 4 shows the typical epr spectra of dmpo - ooh and dmpo - oh by human pmns with 81 m mya, 150 m aa, and 1.5 mm aa. the epr spectra were observed at 8 min after additions of mya or aa. these findings show that aa can also prime human pmns to relerase o2 and oh, even though the potency is weaker than that of mya. as for the mechanism by which aa primes pmns, it was reported that aa activates nox and proton channels of dormant neutrophils. 5. unlike c5a and n - formyl - l - methionyl - l - leucyl - l - phenylalanine, both of which can stimulate pmns to produce o2 by inducing calcium (ca) influx, mya - functions, like pma - functions, bypass ca influx since it has been reported that mya induces o2 production from human neutrophils in the absence of ca and magnesium [19, 26 ]. although the potency of aa to stimulate the release of ros is much weaker than that of mya, the possibility of involvement of aa to the effect of mya when absorbed into the circulation should be considered. our study shows that mya is a more potent activator of pmns than pma, and this fact calls attention that too much intake of mya can lead to crippling effect through uncontrolled production of ros. we found that mya is a stronger inducer of o2 and oh generation by pmns than pma. mya is mainly contained in vegetable oils and likely affects lipid metabolism [1618 ]. too much intake of mya - rich vegetable oil may work as an inducer of pmns activation, which may lead to undesirable conditions of the body. in the future study | myristic acid (mya), which is a saturated fatty acid (c14:0) and a side chain of phorbol 12-myristate 13-acetate (pma), was examined if mya stimulates human polymorphonuclear leukocytes (pmns) to release oxygen radicals comparable to pma by applying electron paramagnetic resonance (epr)-spin - trapping method. when mya was added to isolated human pmns, spin adducts of 5,5-dimethyl-1-pyrroline - n - oxide (dmpo)-oh and dmpo - ooh were time - dependently observed. the amounts of these spin adducts were larger than those of pmns stimulated by pma. these results clearly show that mya is more potent agent to prime human pmns than pma, in a point of view of not only o2 but also oh production. this fact calls attention that too much intake of mya that is known to be contained vegetable oils can lead to crippling effect through uncontrolled production of reactive oxygen species. |
proton pump inhibitors (ppis), which irreversibly inhibit gastric acid pump (h + /k + atpase) function are the most potent gastric acid - suppressing agents in clinical use. ppis are widely used for prevention and treatment of various acid - related diseases including gastrointestinal reflux disease (gerd), duodenal ulcers, peptic ulcers, reflux esophagitis and other hyper acidic conditions. of these, gerd is the frequently reported gastrointestinal disease worldwide causing significant societal and economic burden (shaheen., 2006), auguring treatment with ppis. however, up to 40% of gerd patients report partial or complete lack of relief of their symptoms in response to treatment with ppis. polymorphisms in drug metabolizing enzymes is listed as one of the factors responsible for the demonstrated ppi resistance (cicala, 2013, clarke and pandolfino, 2012), apart from other factors (zerbib., all of the ppis are usually metabolized in the liver involving different isoenzymes of the cytochrome p 450 (cyp) family before their elimination (hagymasi., 2011). genes encoding cyp2c19 and cyp3a4 are extensively polymorphic with 34 variant alleles known for cyp2c19 and > 30 variant alleles for cyp3a4 (http://www.cypalleles.ki.se/cyp2c19.html, 2016, http://www.cypalleles.ki.se/cyp3a4.html, 2016) including both synonymous and non - synonymous variants. earlier studies have classified subjects as extensive and poor metabolizers based on their ability to metabolize ppis (goldstein, 2001, desta., 2002). extensive metabolizers were subjects with wild type allele for the enzyme whereas subjects who carry polymorphisms cyp2c19 2 and cyp2c19 3 were classified as poor metabolizers. these polymorphisms have been studied widely in different populations (goldstein., 1997) with reported frequencies ranging from 6 to 39%. subsequent studies led to identification of other loss of function polymorphisms (cyp2c19 4 to 12) in the same gene, leading to production of a defective enzyme and conferring poor metabolizer phenotype to their carriers (rosemary and adithan, 2007) (table 1). in 2006, a new polymorphism (cyp2c19 17) was identified, which showed gain of function (increased enzyme activity) with a reported frequency of 18% both in swedes and ethiopians and 4% in chinese population (sim., 2006). cyp3a4 1b, reported as a 290a > g substitution in the 5-flanking region of cyp3a4 may result in reduced activity of cyp3a4 enzyme. while few studies have reported a decrease in the activity of the enzyme (min and ellingrod, 2003), few others have shown an increase (rebbeck., 1998) or no effect (westlind., 1999 cyp3a4 has other non - synonymous polymorphisms like 3, 15 and 18 resulting in increased metabolism of vitamin d2 (gupta., 2005), testosterone (dai., 2001) and midazolam (kang., 2008) respectively. cyp3a4 17 reportedly showed decreased metabolism of nifedipine (lee, 2004) and cyp3a4 19 shows activity similar to wild type protein (westlind., 1999) (table 1). pharmacokinetic analysis revealed that the systemic drug exposure (area under curve ; auc) varies widely between groups ; auc for omeprazole, lansoprazole and rabeprazole were found to be 7.5, 4.5 and 4-fold higher in poor metabolizers than in extensive metabolizers (klotz, 2006). since the pharmacodynamic response to ppis is related to their auc, intra - gastric ph is usually more elevated in poor metabolizers (pms) in comparison with other groups. studies with subjects treated with omeprazole and pantoprazole demonstrated that a 17 polymorphism may lead to less acid - inhibition and decreased auc when compared with wild type (hunfeld., 2008). though further studies indicated cyp2c19 17 to be associated with increased enzymatic activity, it is still not clear as to whether carriers of this polymorphism are to be classified as ultra - rapid (urm) metabolizers or rapid metabolizers (rm) (li - wan - po., 2010). though the mechanism of action of all ppis is similar, the physicochemical properties of these drugs result in variations in the degree of acid suppression, as well as the speed of onset of acid inhibition (robinson and horn, 2003). further polymorphisms in drug metabolizing genes result in different genotypes causing inter - individual variation in the rate of metabolism of ppis. in addition, much less is known about polymorphisms of cyp2c19 in indian tribal populations with extensive consanguinity. since such differences may impact the clinical performance of ppis in different populations, we designed the present study to (1) estimate the frequencies of different polymorphisms in cyp2c19 and cyp3a4 in urban and tribal indian populations and (2) study the effect of these polymorphisms on pharmacokinetic and pharmacodynamic properties of commonly administered ppis such as esomeprazole and pantoprazole, (epz and ppz). this is a study involving healthy indian subjects from urban and tribal areas of telangana state. subjects were categorized into five different phenotypes (normal, intermediate, poor, rapid and ultra - rapid metabolizers) of ppis based on their genotype. subjects from each phenotype were also administered ppis (esomeprazole and pantoprazole) under fasting conditions and the plasma ppi levels were measured subsequently. healthy urban and tribal subjects (koya and naik tribes) were recruited for genotyping and for pharmacokinetic and pharmacodynamic analysis. all participants were clinically evaluated and confirmed to be healthy. written informed consent was obtained from all subjects and all protocols used in the study were approved by the institutional ethics committee. peripheral blood (4 ml) dna was isolated from leucocytes using qiaamp dna blood maxi kit (qiagen, netherlands), quantified and stored at 20 c until further use. dna samples were genotyped for all the polymorphisms of cyp2c19 and cyp3a4 mentioned in table 1. genotyping was performed using competitive allele specific pcr system (kaspar) kit obtained from kbiosciences (lcgc genomics, london) using step one real time pcr (life technologies, usa). klustercaller software was used to determine genotypes based on clusters and an online excel based software (version 1.05) was used for haplotype analysis of cyp2c19 alleles (eliades and eliades, 2009). subjects were categorized into 5 groups based on their genotype (normal, intermediate, poor, rapid & ultra - rapid metabolizers) for the pharmacokinetics / dynamics (http://www.cypalleles.ki.se/cyp2c19.html, 2016, goldstein., 1997). volunteers from each category were orally administered individual ppis (esomeprazole and pantoprazole ; 40 mg / day with 240 ml of water at 9.00 am) for 5 days. blood samples were collected periodically for the determination of plasma ppi concentration at 0, 1, 2, 4, 6 and 24 h after the dose on first and last day of administration. a mandatory wash out period of two weeks was maintained when more than one drug was administered. (noubarani., 2010) using a waters e2695 alliance hplc system (medford, ma, usa). the maximum plasma concentration (cmax) of each drug and the time to reach cmax (tmax) was determined directly from the individual concentration - time data. the area under the plasma concentration - time curve from time zero to the last sampling time (auc 0-t) was calculated by the trapezoidal rule using pksolver (ver 2.0).(zhang., 2010) intra - gastric ph was recorded on day 1 (baseline prior to taking the ppi) and day 6 (24 h after taking ppi on the 5th day) of the study using the comfortec z ph monitoring unit (sandhill scientific, colorado, usa) equipped with a single channel reference probe introduced per - nasally into the body of the stomach (about 4045 cm beyond the oral cavity). statistically significant differences among pharmacokinetic parameters of different cyp2c19 genotypes were determined using the kruskal student 's t - test and chi square test were used for continuous and categorical variables based on the sample size. the analysis was carried out using the trial version of medcalc for windows, (medcalc software, ostend, belgium) and graph pad quickcalc (graphpad.com, 2015). this is a study involving healthy indian subjects from urban and tribal areas of telangana state. subjects were categorized into five different phenotypes (normal, intermediate, poor, rapid and ultra - rapid metabolizers) of ppis based on their genotype. subjects from each phenotype were also administered ppis (esomeprazole and pantoprazole) under fasting conditions and the plasma ppi levels were measured subsequently. healthy urban and tribal subjects (koya and naik tribes) were recruited for genotyping and for pharmacokinetic and pharmacodynamic analysis. all participants were clinically evaluated and confirmed to be healthy. written informed consent was obtained from all subjects and all protocols used in the study were approved by the institutional ethics committee. peripheral blood (4 ml) was collected from all subjects in edta vaccutainers. dna was isolated from leucocytes using qiaamp dna blood maxi kit (qiagen, netherlands), quantified and stored at 20 c until further use. dna samples were genotyped for all the polymorphisms of cyp2c19 and cyp3a4 mentioned in table 1. genotyping was performed using competitive allele specific pcr system (kaspar) kit obtained from kbiosciences (lcgc genomics, london) using step one real time pcr (life technologies, usa). klustercaller software was used to determine genotypes based on clusters and an online excel based software (version 1.05) was used for haplotype analysis of cyp2c19 alleles (eliades and eliades, 2009). subjects were categorized into 5 groups based on their genotype (normal, intermediate, poor, rapid & ultra - rapid metabolizers) for the pharmacokinetics / dynamics (http://www.cypalleles.ki.se/cyp2c19.html, 2016, goldstein., 1997). volunteers from each category were orally administered individual ppis (esomeprazole and pantoprazole ; 40 mg / day with 240 ml of water at 9.00 am) for 5 days. blood samples were collected periodically for the determination of plasma ppi concentration at 0, 1, 2, 4, 6 and 24 h after the dose on first and last day of administration. a mandatory wash out period of two weeks was maintained when more than one drug was administered. (noubarani., 2010) using a waters e2695 alliance hplc system (medford, ma, usa). the maximum plasma concentration (cmax) of each drug and the time to reach cmax (tmax) was determined directly from the individual concentration - time data. the area under the plasma concentration - time curve from time zero to the last sampling time (auc 0-t) was calculated by the trapezoidal rule using pksolver (ver 2.0).(zhang., 2010) intra - gastric ph was recorded on day 1 (baseline prior to taking the ppi) and day 6 (24 h after taking ppi on the 5th day) of the study using the comfortec z ph monitoring unit (sandhill scientific, colorado, usa) equipped with a single channel reference probe introduced per - nasally into the body of the stomach (about 4045 cm beyond the oral cavity). statistically significant differences among pharmacokinetic parameters of different cyp2c19 genotypes were determined using the kruskal student 's t - test and chi square test were used for continuous and categorical variables based on the sample size. the analysis was carried out using the trial version of medcalc for windows, (medcalc software, ostend, belgium) and graph pad quickcalc (graphpad.com, 2015). healthy urban subjects (n = 400) and tribals (n = 100) from two different tribes (koya n = 56 and naik n = 44) were recruited for the genotyping study apart from the 60 subjects recruited for pharmacokinetic and pharmacodynamics studies. out of the 60 subjects recruited for the latter studies, 23 subjects volunteered for the study with a single drug and 6 volunteered for both drugs. out of these 29 subjects, out of the 17 snps studied in the 560 subjects, only 4 variants (2, 3, 17 in cyp2c19 gene and 1b in cyp3a4 gene) were observed with all the other studied alleles belonging to the wild type. the minor allele frequencies of cyp2c19 2, 3, 17 and cyp3a4 1b were 0.41, 0.01, 0.17 and 0.06 respectively and were found to be in hardy weinberg equilibrium. based on the cyp2c19 genotype, the 560 subjects were divided into five phenotype groups, namely normal (1/1, 2/17, 3/17), poor (2/2, 2/3), intermediate (1/2, 1/3), rapid (1/17) and ultra - rapid metabolizers (17/17) (http://www.cypalleles.ki.se/cyp2c19.html, 2016, goldstein., 1997, furuta., 2005). cyp3a4 1b genotype was not considered for classification of the subjects since it would not influence enzyme expression (westlind., 1999). cyp2c19 2 was the most frequently identified variant allele both in urban and tribal subjects. however, the percentage of subjects in each phenotype group differed among urban and tribal subjects. the percentage of normal, intermediate, rapid and ultra - rapid metabolizers was less in tribal subjects when compared to the urban subjects (table 3). tribal subjects also had a significantly higher number (p = 0.0003) of poor metabolizers (31%) as compared to the urban population (15%). upon estimating plasma drug concentration at different time points, auct, cmax and tmax were calculated to obtain a measure of the pharmacokinetic profile for each drug. in comparison to other ppis, pantoprazole was found to be most effective for poor metabolizers since the drug was found to be absorbed in much lesser time as evidenced by the observed auct and tmax values. there was a significant difference among the groups in auct at day 1 pharmacokinetics of esomeprazole (p = 0.04) and also for tmax (p = 0.035) on day 5 of esomeprazole (table 4). since pantoprazole was found to be more effective as mentioned above, we compared its influence on intra - gastric ph with that of esomeprazole, a preferred frontline ppi in clinical practice. administration of pantoprazole for 5 days resulted in improved gastric acid suppression as compared to esomeprazole in poor and intermediate metabolizers. in normal metabolizers, the change in intra - gastric ph was similar in case of pantoprazole and esomeprazole. interestingly, noteworthy differences could not be observed in the intra - gastric ph at baseline and on day 6 in response to administration of esomeprazole or pantoprazole in rapid and ultra - rapid metabolizers who are carriers of gain of function polymorphism cyp2c19 17 (table 5). several studies have clearly demonstrated an association between polymorphisms in cyp2c19 and cyp3a4 genes and the drug metabolizing enzyme activity (collet., 2009, geisler., 2008, taubert., 2009). in this study we evaluated the frequencies of these polymorphisms in indian population, studied their effect on ppi metabolism and gastric acid suppression apart from obtaining insights into related aspects in tribal populations. we found that 16.5% (76/460) of the urban subjects are rapid metabolizers, 3.2% (15/460) are ultra - rapid metabolizers (table 3), who did not respond to standard dose of ppis (table 5). to our knowledge, this is the first study from india which has comprehensively genotyped the well characterized, non - synonymous variants in the cyp2c19 and cyp3a4 genes. further, most of the earlier studies have focused more on cyp2c19 2 and cyp2c19 3 alleles only but not on other loss of function polymorphisms that have been included in the present study. efforts have also been made to correlate results obtained upon genotyping with ppi metabolism. in view of the importance of cytochrome p450 enzymes in drug metabolism, several studies have earlier been conducted to establish frequency of related gene polymorphisms in different populations. in our study focusing on ppi metabolism, cyp2c19 2 was found to be the most common allele occurring at a higher frequency of 41%, as compared to other asian populations (2830.3%) (he., 2002, sugimoto., 2008) and african americans (25%) (kudzi., 2009). cyp2c19 3 variant allele was also detected at a lesser frequency of 0.8% in our study as opposed to other asian populations (3.410%.) (he. we found cyp2c19 17 genotype (associated with increased enzyme function) to occur at a higher allelic frequency (17%) in comparison 24% reported in other asians (pedersen., 2010). the allelic frequency of cyp3a4 1b, which was not detected earlier in asians like korean, chinese and japanese populations (lee., 2013) was found to be 6% in the present study. in order to correlate the results of genotyping with ppi metabolism studies with pantoprazole showed that poor metabolizers had the highest auc and ultra - rapid metabolizers had the lowest auc on both day i and day v. poor metabolizers had significantly higher values of auc and cmax (p = 0.03 and 0.02 respectively ; unpaired t - test, 2 tailed p value) when compared to normal metabolizers. this data is in consonance with observations made with caucasians (hunfeld., 2010). subjects with cyp2c19 17 polymorphism had lower auc values on both day i and day v when compared to those without detectable polymorphism, akin to findings made with caucasians (hunfeld., 2008). another study conducted on caucasian volunteers after single oral dose of pantoprazole also reported similar results, concluding that the cyp2c19 2 and 17 polymorphisms have significant impact on pantoprazole pharmacokinetics (gawronska - szklarz., 2012). after ascertaining the impact of these polymorphisms on pharmacokinetics of pantoprazole, we studied its effect on intra - gastric ph and observed that pantoprazole showed genotype dependent acid inhibition with less acid inhibition in subjects with 1/1 genotype and stronger acid inhibition in subjects with 1/2 and 2/2 genotype. there were, however, no differences observed in the intra - gastric ph at baseline and on day 6 in subjects with 17/17 genotype. similar studies with esomeprazole showed that normal metabolizers had highest value of auc whereas ultra - rapid metabolizers showed lower value of auc on day v. these results are in contrast to those made with caucasians (hunfeld., 2012) where auc was observed to be maximum in poor metabolizers, indicating differences in the metabolism of esomeprazole. pharmacokinetic parameters were found to be similar between the two genotypes in normal metabolizers, (subjects carrying 1/1 and 2/17). this was further confirmed by unpaired t - test that revealed no significant difference between the two genotypes (p > 0.5, unpaired t - test). the effect of cyp2c19 17 polymorphism was observed only in homozygous condition (17/17). we studied the frequency of these polymorphisms in subjects belonging to two tribal groups from our state which are endogamous populations, ethnically and culturally distinct from the urban population. this difference was replicated in the results obtained, the frequency of cyp2c19 2 polymorphism in tribal subjects (0.49) was more than the urban subjects, whereas the frequency of cyp2c19 17 (0.12) was lesser. the number of poor metabolizers in the tribal subjects was significantly (p = 0.0003) higher than the urban subjects. based on pharmacokinetics data we observed that the effect of cyp2c19 2 polymorphism seems to be more dominant in the studied population, especially in the compound heterozygous condition (2/3 and 2/17). cyp2c19 17 polymorphism was found to be more effective in homozygous mutant condition than heterozygous state. no significant difference (two tailed p value > 0.07 for auct, cmax and tmax ; unpaired t - test) was observed in the pharmacokinetics of rm (1/17) and nm (1/1). carriers of cyp2c19 17 allele did not show much change in intra - gastric ph from baseline to day 6 post ingestion. healthy urban subjects (n = 400) and tribals (n = 100) from two different tribes (koya n = 56 and naik n = 44) were recruited for the genotyping study apart from the 60 subjects recruited for pharmacokinetic and pharmacodynamics studies. out of the 60 subjects recruited for the latter studies, 23 subjects volunteered for the study with a single drug and 6 volunteered for both drugs. out of these 29 subjects, out of the 17 snps studied in the 560 subjects, only 4 variants (2, 3, 17 in cyp2c19 gene and 1b in cyp3a4 gene) were observed with all the other studied alleles belonging to the wild type. the minor allele frequencies of cyp2c19 2, 3, 17 and cyp3a4 1b were 0.41, 0.01, 0.17 and 0.06 respectively and were found to be in hardy weinberg equilibrium. based on the cyp2c19 genotype, the 560 subjects were divided into five phenotype groups, namely normal (1/1, 2/17, 3/17), poor (2/2, 2/3), intermediate (1/2, 1/3), rapid (1/17) and ultra - rapid metabolizers (17/17) (http://www.cypalleles.ki.se/cyp2c19.html, 2016, goldstein., 1997, furuta., 2005). cyp3a4 1b genotype was not considered for classification of the subjects since it would not influence enzyme expression (westlind., 1999). cyp2c19 2 was the most frequently identified variant allele both in urban and tribal subjects. however, the percentage of subjects in each phenotype group differed among urban and tribal subjects. the percentage of normal, intermediate, rapid and ultra - rapid metabolizers was less in tribal subjects when compared to the urban subjects (table 3). tribal subjects also had a significantly higher number (p = 0.0003) of poor metabolizers (31%) as compared to the urban population (15%). upon estimating plasma drug concentration at different time points, auct, cmax and tmax were calculated to obtain a measure of the pharmacokinetic profile for each drug. in comparison to other ppis, pantoprazole was found to be most effective for poor metabolizers since the drug was found to be absorbed in much lesser time as evidenced by the observed auct and tmax values. there was a significant difference among the groups in auct at day 1 pharmacokinetics of esomeprazole (p = 0.04) and also for tmax (p = 0.035) on day 5 of esomeprazole (table 4). no significant difference was observed in any of the parameters for pantoprazole. since pantoprazole was found to be more effective as mentioned above, we compared its influence on intra - gastric ph with that of esomeprazole, a preferred frontline ppi in clinical practice. administration of pantoprazole for 5 days resulted in improved gastric acid suppression as compared to esomeprazole in poor and intermediate metabolizers. in normal metabolizers, the change in intra - gastric ph was similar in case of pantoprazole and esomeprazole. interestingly, noteworthy differences could not be observed in the intra - gastric ph at baseline and on day 6 in response to administration of esomeprazole or pantoprazole in rapid and ultra - rapid metabolizers who are carriers of gain of function polymorphism cyp2c19 17 (table 5). several studies have clearly demonstrated an association between polymorphisms in cyp2c19 and cyp3a4 genes and the drug metabolizing enzyme activity (collet., 2009, geisler., 2008, taubert., 2009). in this study we evaluated the frequencies of these polymorphisms in indian population, studied their effect on ppi metabolism and gastric acid suppression apart from obtaining insights into related aspects in tribal populations. we found that 16.5% (76/460) of the urban subjects are rapid metabolizers, 3.2% (15/460) are ultra - rapid metabolizers (table 3), who did not respond to standard dose of ppis (table 5). to our knowledge, this is the first study from india which has comprehensively genotyped the well characterized, non - synonymous variants in the cyp2c19 and cyp3a4 genes. further, most of the earlier studies have focused more on cyp2c19 2 and cyp2c19 3 alleles only but not on other loss of function polymorphisms that have been included in the present study. efforts have also been made to correlate results obtained upon genotyping with ppi metabolism. in view of the importance of cytochrome p450 enzymes in drug metabolism, several studies have earlier been conducted to establish frequency of related gene polymorphisms in different populations. in our study focusing on ppi metabolism, cyp2c19 2 was found to be the most common allele occurring at a higher frequency of 41%, as compared to other asian populations (2830.3%) (he., 2002, sugimoto., 2008) and african americans (25%) (kudzi., 2009). cyp2c19 3 variant allele was also detected at a lesser frequency of 0.8% in our study as opposed to other asian populations (3.410%.) (he., 2002, we found cyp2c19 17 genotype (associated with increased enzyme function) to occur at a higher allelic frequency (17%) in comparison 24% reported in other asians (pedersen., 2010). the allelic frequency of cyp3a4 1b, which was not detected earlier in asians like korean, chinese and japanese populations (lee., 2013) was found to be 6% in the present study. in order to correlate the results of genotyping with ppi metabolism studies with pantoprazole showed that poor metabolizers had the highest auc and ultra - rapid metabolizers had the lowest auc on both day i and day v. poor metabolizers had significantly higher values of auc and cmax (p = 0.03 and 0.02 respectively ; unpaired t - test, 2 tailed p value) when compared to normal metabolizers. subjects with cyp2c19 17 polymorphism had lower auc values on both day i and day v when compared to those without detectable polymorphism, akin to findings made with caucasians (hunfeld., 2008). another study conducted on caucasian volunteers after single oral dose of pantoprazole also reported similar results, concluding that the cyp2c19 2 and 17 polymorphisms have significant impact on pantoprazole pharmacokinetics (gawronska - szklarz., 2012). after ascertaining the impact of these polymorphisms on pharmacokinetics of pantoprazole, we studied its effect on intra - gastric ph and observed that pantoprazole showed genotype dependent acid inhibition with less acid inhibition in subjects with 1/1 genotype and stronger acid inhibition in subjects with 1/2 and 2/2 genotype. our results are similar to the pharmacodynamics data of caucasians (hunfeld., 2010), where they found similar genotype dependent acid inhibition with pantoprazole. there were, however, no differences observed in the intra - gastric ph at baseline and on day 6 in subjects with 17/17 genotype. similar studies with esomeprazole showed that normal metabolizers had highest value of auc whereas ultra - rapid metabolizers showed lower value of auc on day v. these results are in contrast to those made with caucasians (hunfeld., 2012) where auc was observed to be maximum in poor metabolizers, indicating differences in the metabolism of esomeprazole. pharmacokinetic parameters were found to be similar between the two genotypes in normal metabolizers, (subjects carrying 1/1 and 2/17). this was further confirmed by unpaired t - test that revealed no significant difference between the two genotypes (p > 0.5, unpaired t - test). the effect of cyp2c19 17 polymorphism was observed only in homozygous condition (17/17). we studied the frequency of these polymorphisms in subjects belonging to two tribal groups from our state which are endogamous populations, ethnically and culturally distinct from the urban population. this difference was replicated in the results obtained, the frequency of cyp2c19 2 polymorphism in tribal subjects (0.49) was more than the urban subjects, whereas the frequency of cyp2c19 17 (0.12) was lesser. the number of poor metabolizers in the tribal subjects was significantly (p = 0.0003) higher than the urban subjects. based on pharmacokinetics data we observed that the effect of cyp2c19 2 polymorphism seems to be more dominant in the studied population, especially in the compound heterozygous condition (2/3 and 2/17). cyp2c19 17 polymorphism was found to be more effective in homozygous mutant condition than heterozygous state. no significant difference (two tailed p value > 0.07 for auct, cmax and tmax ; unpaired t - test) was observed in the pharmacokinetics of rm (1/17) and nm (1/1). carriers of cyp2c19 17 allele did not show much change in intra - gastric ph from baseline to day 6 post ingestion. we demonstrate that it is important to identify and optimize appropriate dosage regimen for rapid and ultra - rapid metabolizers, as the standard dosage does not seem to efficiently inhibiting acid secretion. although the sample size for pharmacokinetic and pharmacodynamic studies is a limitation, our study indicates the impact of these polymorphisms not only on ppi metabolism but also on other drugs that are metabolized by cyp2c19. despite limitations, our study has established the impact of various alleles of cyp2c19 on metabolism of ppis in our population. out of the 36.3% variants, 20% are carriers of the cyp2c19 17 allele who did not respond to the standard dose. therefore, we conclude that screening and identification of subjects carrying variant alleles is necessary for personalization of dosage. neha deshpande and sharanya vuddagiri collected samples, performed research, data analysis, data interpretation and drafted the paper. dr. sasikala mitnala contributed to the design of the study and revised the paper. d. nageshwar reddy contributed to the design of the study, data analysis and approval of the final version of the paper. all authors have given their approval for the final version of the paper and the authorship list. | introduction and objectivepolymorphisms in genes encoding drug metabolizing enzymes may lead to varied enzyme activity and inter - individual variability in drug efficacy and/or toxicity. since cyp2c19 and cyp3a4 genes code for enzymes involved in metabolizing wide variety of drugs including proton pump inhibitors, we sought to identify polymorphisms in these genes in order to study their impact on drug metabolism in subjects.methodsdna was isolated from healthy individuals including tribals and genotyped for 11 single nucleotide polymorphisms in cyp2c19 and 6 polymorphisms in cyp3a4. individuals were categorized into different phenotypes based on their drug metabolizing genotype. volunteers from each group were administered proton pump inhibitors (esomeprazole, pantoprazole ; 40 mg / day) for 5 days followed by pharmacokinetic studies and measurement of intra - gastric ph.resultsof the 17 polymorphisms studied, only cyp2c19 2,3,17 and cyp3a4 1b polymorphisms were observed. in comparison to urban individuals, a significantly (p = 0.0003) higher number of poor metabolizers were noted in the tribal individuals. pantoprazole was found to be most effective in poor metabolizers in terms of area under the curve and tmax. no significant difference was observed in the intra - gastric ph at baseline and day 6 in rapid and ultra - rapid metabolizers.conclusionour study has demonstrated that 19.7% of our subjects are carriers of the cyp2c19 17 allele who did not respond to the standard dose of proton pump inhibitors. genetic screening to identify subjects with variant alleles would thus be useful for personalization of therapy with proton pump inhibitors. |
leptomeningeal carcinomatosis results from dissemination of malignant cells to leptomeninges and can be observed in about 5% of patients with malignancies, but it is likely to become more frequent with the increase of life expectancy in cancer patients. neoplastic cells may spread to the subarachnoid space through (1) arterial circulation or, less frequently, through (2) retrograde flow in venous systems or (3) as a direct consequence of preexisting brain metastases or (4) through migration of neoplastic cells from the original tumor along perineural or perivascular spaces [2, 3 ]. clinical manifestations can be highly variable and may affect both central (cns) and peripheral nervous system (pns). cns involvement may lead to generalised symptoms such as seizures, confusion, encephalopathy, or intracranial hypertension as well as, less frequently, to focal neurological symptoms, mainly consisting in hemiparesis or aphasia. ocular symptoms even in the absence of other clinical symptoms may represent the initial manifestation of meningeal carcinomatosis. thus, meningeal carcinomatosis should be considered in the differential diagnosis in selected patients even if making the diagnosis is often challenging. treatment options such as radiation and intrathecal chemotherapy are often palliative with an expected median patient survival of 2 to 6 months. a 52-year old lady was referred to our hospital for acute onset, ten days before hospitalization, of left orbital pain and visual loss associated with mild frontal throbbing headache. as symptoms progressed, she underwent ophthalmological evaluation as outpatient six days after symptoms onset, without evidence of significant visual loss and normal fundus oculi examination. ocular computed tomography performed at that time was unremarkable. on subsequent ophthalmological evaluation five days later a significant visual loss in the left eye was evident with substantially normal fundus oculi examination. she underwent right mastectomy and hormonal therapy (tamoxifen) for infiltrative breast carcinoma in 2007 followed by chemotherapy with ac (cyclophosphamide and doxorubicin) for six months, followed by letrozole. on admission in august 2011 neurological examination was normal except for mild anisocoria (left > right) with detectable markus gunn sign, left eye visual loss, and global reduction of deep tendon reflexes. she underwent contrast - enhanced cerebral mri showing nonspecific signal alteration involving frontal subcortical and periventricular white matter and focal contrast enhancement involving the left optic nerve sheath (see figure 1). vep revealed destructured response, reduced amplitude, and prolonged latency on the left (see figure 2). lumbar puncture revealed increased cell count (50 cells / mmc) with normal glucose and proteins. cytology at that time was negative for neoplastic cells and repeated ophthalmological evaluations revealed further progression to complete visual loss in the left eye. serum antibodies (lac, aca, anti - beta2-glycoprotein ana, anti - ds - dna, ena, c - anca, and p - anca) were negative. a diagnosis of possible inflammatory optic neuropathy was done. she was started on ev steroids followed by oral tapering without improvement. in about two months brainstem auditory - evoked potentials were normal on the left (see figure 2) and audiological evaluation evidenced mild neurosensorial failure more evident on the right. she underwent contrast - enhanced cerebral mri in october 2011 showing increased enhancement of the left optic nerve sheath. repeated ophthalmological evaluation revealed bilateral (left > right) papilledema and she was hospitalized. neurological examination on admission showed total blindness in the left eye with absent pupillary response to direct light stimulation. vep revealed absent response on the left and destructured response with normal amplitude and latency on the right (see figure 2). she underwent repeated lumbar puncture showing further increase of white cell count (105 cells / mmc) and reduced glucose. references for this review were identified through a search of pubmed from 1966 to march 8, 2012 with the terms meningeal carcinomatosis, meningeal carcinomatosis and review, meningeal carcinomatosis and optic neuritis, meningeal carcinomatosis and ocular manifestations, and neoplastic meningitis. reference lists of relevant articles were also reviewed. only articles with ocular manifestation as presenting or associated clinical features we found a total of 34 papers including 33 case reports (34 patients) and 1 case series (7 patients). information about demographic details along with clinical, instrumental, and radiological findings were recorded and summarized in table 1. in details we looked at latency between symptoms onset and diagnosis of meningeal carcinomatosis : the mean time was 4 months, while the mean time between primary tumor diagnosis and carcinomatosis diagnosis was 20 months. ocular symptoms were the presenting clinical feature in 34 out of 41 patients (83%) and were the only manifestation of meningeal carcinomatosis in 3 patients (7%). visual loss was the presenting clinical manifestation in 17 patients (50%) and was the most common ocular symptom (70%). additional ocular manifestations were diplopia (18 patients, presenting manifestation in 16 patients), ptosis (8 patients), papilledema (4), anysocoria (3), exophthalmos (2), orbital pain (2), scotomas (2), hemianopsia (1), and nystagmus (1). other common symptoms were headache (24 patients), altered consciousness (10 patients), meningism (8 patients), hemiparesis (7), ataxia (7), dizziness (6), and seizures (4). v (4), vii (6), viii (4), ix and x (2), and xii (1) cranial nerves involvement has also been reported. twenty - three patients underwent enhanced mri which was diagnostic in 8 patients (35%). in 7 patients generalized meningeal enhancement was noted, and in 2 patients meningeal enhancement was associated with optic nerves enhancement, which was bilateral in 1 patient and unilateral in the other one. three patients had cranial nerves enhancement, while isolated optic nerve enhancement was seen in only 1 patient (unilateral on the first mri and bilateral at the second mri). other mri findings included hydrocephalus (1), infarction of basal nuclei (1), and cerebellar enhancement (3). all patients except five underwent csf examination which was normal in 1 patient, and increased cells count was found in 11 patients (range : 9598/mm), increased protein levels were observed in 16 patients (range : 62334 mg / dl), and decreased glucose levels were found in 8 patients (range : 543 mg / dl). the histology of the original tumor was highly variable with solid tumors being more frequently associated with meningeal carcinomatosis. the most common was gastric cancer followed by lymphoma, breast, and lung cancer. 16 patients underwent chemotherapy (see table 1), and the mean life expectancy was 123 days (range 5730 days). the highest leptomeningeal diffusion rate has been reported for small cell lung cancer (11%) and melanoma (20%). neoplastic meningitis is more likely to occur in patients with disseminated cancer, but in, respectively, 20% and 10% of cases it may manifest after a disease - free period or as a first manifestation of systemic tumors. current diagnostic methods are limited and may fail to identify mc early enough to prevent the escalation of neurological damage. thus meningeal carcinomatosis should be included in the differential diagnosis in the presence of multifocal disease but also considered in the evaluation of isolated syndromes such as intracranial hypertension, cauda equine syndrome, or cranial neuropathy. the most common manifestation of cranial nerves involvement is diplopia due to vi cranial nerve palsy, followed by iii and iv involvement. v, viii, and optic nerve may also be affected. diagnostic workup includes csf examination and neuroradiological studies. the presence of malignant cells in the csf is diagnostic, other supportive features are increased opening pressure, pleocytosis, elevated proteins, and decreased glucose levels. csf cytology may be negative in 65% of patients on initial examination, but only in 20% of patients on second lumbar puncture. csf increased levels of vascular endothelial growth factors have been proposed as a promising biomarker with a reported sensitivity of 51100% and a specificity of 73100% for leptomeningeal metastases. gadolinium - enhanced mri is also useful for the diagnosis of meningeal carcinomatosis because enhancement on mri will reveal any irritation of leptomeninges resulting in cranial nerves or intradural extramedullary enhancement on spinal mri. the present report is an updated and systematic review of ocular manifestations of neoplastic meningitis. our data show that ocular symptoms often represent the first clinical manifestation of meningeal carcinomatosis (83%) and the only clinical manifestation in a small proportion of subjects (7%). for this reason it should be considered in the differential diagnosis even in the absence of associated clinical symptoms more suggestive of meningeal carcinomatosis such as headache (58%), altered consciousness (24%), meningism (19%), focal signs (34%), dizziness (15%), seizures (10%), and cranial nerves other than ocular involvement (32%). the most common ocular manifestation was visual loss (70%) followed by diplopia (41%), ptosis (19%), papilledema (10%), anysocoria (7%), exophthalmos (5%), orbital pain (5%), scotomas (5%), hemianopsia (2%) and nystagmus (2%). meningeal enhancement was detected in about one third of patients ; in two of them (25%) it was associated with focal optic nerve enhancement. in one patient (12%) the most common finding was increased proteins level (44%), increased cells count (30%), and decreased glucose (22%). citology was positive in a high proportion of patients (76%) with solid tumors being the more frequent. the first csf examination may be inconclusive, thus if clinical and radiological suspicion persist and cell count is increased, a repeated lumbar puncture is recommended. moreover clinicians should be aware that ocular involvement may mimic different diseases as shown in our case report, where neoplastic optic nerve involvement was indistinguishable from optic neuritis. thus meningeal carcinomatosis should be included in the differential diagnosis of diplopia and visual loss in selected patients because diagnosis is often challenging. | introduction. leptomeningeal carcinomatosis occurs in about 5% of cancer patients. ocular involvement is a common clinical manifestation and often the presenting clinical feature. materials and methods. we report the case of a 52-year old lady with optic neuritis as isolated manifestation of neoplastic meningitis and a review of ocular involvement in neoplastic meningitis. ocular symptoms were the presenting clinical feature in 34 patients (83%) out of 41 included in our review, the unique manifestation of meningeal carcinomatosis in 3 patients (7%). visual loss was the presenting clinical manifestation in 17 patients (50%) and was the most common ocular symptom (70%). other ocular signs were diplopia, ptosis, papilledema, anisocoria, exophthalmos, orbital pain, scotomas, hemianopsia, and nystagmus. associated clinical symptoms were headache, altered consciousness, meningism, limb weakness, ataxia, dizziness, seizures, and other cranial nerves involvement. all patients except five underwent csf examination which was normal in 1 patient, pleocytosis was found in 11 patients, increased protein levels were observed in 16 patients, and decreased glucose levels were found in 8 patients. cytology was positive in 29 patients (76%). conclusion. meningeal carcinomatosis should be considered in patients with ocular symptoms even in the absence of other suggestive clinical symptoms. |
the epidermal growth factor receptor (egfr) tyrosine kinase is implicated in a large number of human cancers. most egfr inhibitors target the extracellular, growth factor - binding domain or the intracellular, atp - binding domain. here we describe molecules that inhibit the kinase activity of egfr in a new way, by competing with formation of an essential intradimer coiled coil containing the juxtamembrane segment from each member of the receptor partnership. the most potent molecules we describe bind egfr directly, decrease the proliferation of wild - type and mutant egfr - dependent cells lines, inhibit phosphorylation of egfr and downstream targets, and block coiled coil formation as judged by bipartite tetracysteine display. potency is directly correlated with the ability to block coiled coil formation within full - length egfr in cells. |
|
many post - zygotic reproductive barrier forms have been reported in plants : hybrid weakness, hybrid necrosis, and hybrid chlorosis. the latter has been observed often in the f1 generation from crosses among wheat (triticum aestivum l.) and its relatives [26 ]. research for distribution of these genes contributed greatly to the study of the origin of wheat. hybrid chlorosis in f2 generation has been reported only in rice (oryza sativa l.) and interspecific crosses among melilotus species. sato. incidentally found a case of hybrid chlorosis in the f2 population from a cross between two japanese native cultivars : j-147 and j-321. its first symptom was discoloration of the second or third leaf (figure 1). the phenomenon was caused by a set of mutually independent duplicated recessive genes, named hca-1 and hca-2 by sato and morishima. according to the new gene nomenclature system for rice, we changed our description of the gene symbols, as shown in table 1. (1) the hca2 - 1 gene is widely distributed in native japonica - type cultivars, whereas many indica - type cultivars carry its dominant allele, hca2 - 2. this gene is probably rare because the occurrence of f2 chlorosis has not been reported in crosses between taichung 65, which carries hca2 - 1, and many cultivars except for j-147. the mode of inheritance differs between wheat hybrid chlorosis and that of rice, but the distribution of causal genes is related to varietal differentiation in both cases. we are interested in genes conferring the post - zygotic reproductive barrier in rice, and we have mapped these genes in the rice genome with the aid of dna markers [1114 ]. we produced hybrids from crosses between j-147 and several cultivars to verify the results of sato and morishima. from them, we incidentally found chlorotic plants in the f2 population from the cross between j-147 and a philippine indica - type cultivar ir24. we have never seen chlorotic plants in f2 population from the cross between ir24 and rice cultivars except j-147. moreover, no reports in the literature describe chlorotic plants in an f2 population from the cross with ir24. in general, much dna polymorphism exists between japonica - type and indica - type cultivars. this report describes linkage analysis of hca1 and hca2 using progeny from the f2 population between j-147 and ir24 assisted by dna markers. then the molecular mechanism causing f2 chlorosis, as deduced from the location of the two genes, is discussed. five rice cultivars were used for this study : j-147, akihikari, asominori, milyang 23, and ir24. yoshimichi fukuta of japan international research center for agricultural sciences provided akihikari and milyang 23. akihikari and milyang 23 are the parents of a set of recombinant inbred (ri) lines developed by fukuta.. asominori and ir24 are the parents of another set of ri lines developed by tsunematsu.. no report in the relevant literature describes the appearance of chlorotic plants in progeny from a cross between asominori and ir24, or from a cross between akihikari and milyang 23, although hybrid breakdown phenomena were reported for the cross between asominori and ir24 [17, 18 ], and in the cross between akihikari and milyang 23. j-147, akihikari, and asominori are generally categorized as japonica - type, whereas milyang 23 and ir24 are generally categorized as indica - type. j-147 was crossed with four cultivars : akihikari, asominori, milyang 23, and ir24. chlorotic plants were segregated in the f2 population from the cross between j-147 and ir24 (see section 3). the normal plants were transplanted to a paddy field in the experimental farm of kagoshima university to harvest self - pollinated seeds. approximately 80 plants in each of 16 f3 lines were grown in the nursery for the segregation of chlorotic plants. among them, normal plants in the f3 lines in which chlorotic plants segregated were transplanted in the same way as the f2 generation. approximately 80 plants in each f4 line were also grown in the nursery for segregation of the chlorotic plants. f4 lines in which only hca1 or hca2 gene was expected to segregate were subjected to linkage analysis using dna markers. preliminary analysis using a small number of plants detected the approximate locations of hca1 and hca2. then, we selected the f4 lines segregating chlorotic plants in which one locus is fixed for a recessive chlorosis - causing allele, whereas the other locus is heterozygous and the heterozygous chromosomal region encompasses the locus that is extended most. after the linkage analysis, the f2 populations from the cross between j-147 and ir24 were grown again. dna was extracted from each plant and subject to genotyping of the most closely linked dna markers with hca1 and hca2 loci to verify that hca1 - 1 and hca2 - 1 were sufficient to cause hybrid chlorosis in the f2 population from the cross between j-147 and ir24. figure 2 shows a flow chart depicting the breeding of the plant materials for mapping hca1 and hca2 and for verification that hca1 - 1 and hca2 - 1 were sufficient to cause hybrid chlorosis in the f2 population from the cross between j-147 and ir24. the dna of plant materials except for the f2 population was extracted using the process explained by dellaporta. with some modifications. the dna of the f2 population was extracted according to the experimental protocols of the rice genome project (rgp) (http://rgp.dna.affrc.go.jp/e/rgp/protocols/index.html, written in japanese) with some modifications. the pcr conditions for indel and ssr markers used for this study were 95c for 10 min, 40 cycles of 94c for 30 s, 55c for 30 s, and 72c for 30 s with subsequent final extension of 72c for 1 min. the pcr mixture (5 l) contained 1 l of template dna, 200 mm of each dntp, 0.2 m of primers, 0.25 units of taq polymerase (amplitaq gold ; applied biosystems), and 1 buffer containing mgcl2. the pcr products were analyzed using electrophoresis in 10% (29 : 1) polyacrylamide gel with subsequent ethidium bromide staining details of pcr - based dna marker design were reported in our previous papers [13, 14 ]. the f2 populations of the four cultivars with j-147 all produced both normal plants and chlorotic plants (table 2). the ratios of normal plants and chlorotic plants were fitted to 15 : 1, the expected ratio deduced from the segregation of two independent recessive genes. these results indicated that j-147 carries hca1 - 1 gene and that akihikari, asominori, milyang 23, and ir24 carry the hca2 - 1 gene. indica - type cultivars and japonica - type cultivars have frequently shown dna polymorphism between them. this is true for asominori and ir24, and for akihikari and milyang 23. using the dna polymorphism between the two pair of cultivars, dna marker - based linkage maps were constructed [15, 16 ]. results of our recent study indicated much polymorphism between indica - type cultivars and j-147, and little polymorphism between japonica - type cultivars and j-147. therefore, the progeny from the cross between indica - type cultivars and j-147 were more suitable for mapping genes. we selected the progeny from the cross between ir24 and j-147 as a mapping population for hca1 and hca2 because the linkage map constructed from the cross between asominori and ir24 covered almost the whole genome, whereas that constructed from akihikari and milyang 23 had some large gaps, suggesting that some chromosomal regions exist with no dna polymorphism. seeds of normal plants in the f2 population were harvested to produce the f3 generation. the segregation of chlorotic plants was examined for 16 f3 lines from each f2 plant. chlorotic plants segregated in six lines. in the six lines, the ratios of normal plants : chlorotic plants were all fitted to 15 : 1. in the f3 generation, the expected ratio of lines fixed for normal plants, those showing 3 normal : 1 chlorotic segregation, and others showing a 15 normal : 1 chlorotic segregation, was 7 : 4 : 4. however, no lines showing 3 normal : 1 chlorotic segregation appeared. then, six f3 lines in which segregated chlorotic plants were transplanted to a paddy field, and the seeds of normal plants were harvested to produce f4 generation. the segregation of chlorotic plants was examined for 211 f4 lines from each f3 plant. the line named tf4 27 - 10 was a progeny from an f3 line tf3 27. in tf4 27 - 10, 70 normal plants and 10 chlorotic plants segregated, showing the maximum chlorotic plant ratio among the 10 tf3 27-derived f4 lines tested in our first experiment in the f4 generation and significantly deviated from 15 : 1 ratio. another line named tf4 23 - 5 was the progeny of an f3 line tf3 23. in tf4 23 - 5, 80 normal plants and 7 chlorotic plants segregated, fitted to a 15 : 1 ratio. we performed a preliminary linkage analysis using a bulked dna composed of 20 normal plants from tf4 27 - 10 and another bulked dna composed of 20 normal plants from tf4 23 - 5, and 39 dna marker scattered on all the 12 chromosomes. because of successive self - pollination, the ratio of heterozygous chromosomal region reduced to approximately 0.25 in the f4 generation. hca1 and/or hca2 are expected to be located on heterozygous chromosomal region of the lines in which chlorotic plants segregated. among the dna markers, four showed heterozygosity in both lines possible linkage was observed between chlorosis and kgs1739, a dna marker located on the short arm of chromosome 12 : no homozygotes of ir24 allele were detected. then we analyzed 7 chlorotic plant and 54 normal plants in tf4 27 - 10 line individually. results showed that the cosegregation of hca1 and the more distal marker rm27421 was detected : all 7 chlorotic plants in this line were homozygous for j-147 allele at the rm27421 locus, whereas all 54 normal plants were heterozygous or homozygous for the ir24 allele at the locus. based on rflp - based linkage analysis using the f2 population from the cross between nipponbare and kasalath, nagamura. reported that the distal regions of the short arms of rice chromosomes 11 and 12 are highly conserved as a duplicated chromosomal segment. confirmed the high degree of conservation of duplicated segments in these regions using four other mapping populations. moreover, wu. generated physical maps covering most of the duplicated regions. these experimentally obtained results and the fact that the hybrid chlorosis was controlled by a couple of recessive duplicate genes led us to the idea that hca2 might be located on the distal region of the short arm of chromosome 11. our preliminary analysis using an f4 line named tf4 29 - 30 showed the cosegregation of hca2 and e30794, an sts marker designed by rgp (http://rgp.dna.affrc.go.jp/e/publicdata/caps/index.html), located on the distal region of the short arm of chromosome 11 : all 20 chlorotic plants in this line were homozygous for ir24 allele at the e30794 locus, whereas all 68 normal plants were heterozygous or homozygous for j-147 allele at the locus. to construct linkage maps around the hca1 and hca2 loci, we selected f4 lines in which one locus is fixed for a recessive chlorosis - causing allele and the other locus is on the heterozygous region extending farthest. using these lines (hca1 : tf4 33 - 21, hca2 : tf4 23 - 19, see figure 2), we conducted linkage analysis of each gene using the dna markers shown in table 3. the dna marker sources were the international rice genome sequencing project, rgp, mccouch., chen., monna., and ichitani.. the linkage analysis of hca1 gene and six dna markers using 13 chlorotic plants and 102 normal plants in tf4 33 - 21 showed that hca1 was located at the distal end of the short arm of chromosome 12 and that it cosegregated with rm27404 (figure 3) : all 13 chlorotic plants in this line were homozygous for j-147 allele at the rm27404 locus, whereas all 102 normal plants were heterozygous or homozygous for ir24 allele at the locus. the ratio of 102 : 13 did not fit to the expected ratio 3 : 1. cosegregation of hca1 and rm27404 and distorted segregation of the linked dna markers (table 4) showed that the distorted segregation of hca1 resulted from gametophytic reproductive barrier gene(s), often found in the cross between indica - type and japonica - type (see section 4). the linkage analysis of hca2 gene and seven dna markers using 23 chlorotic plants and 96 normal plants in tf4 23 - 19 showed that hca2 was located at the distal end of the short arm of chromosome 11 and that it cosegregated with rm25969 (figure 3) : all 23 chlorotic plants in this line were homozygous for ir24 allele at the rm25969 locus, whereas 96 normal plants were heterozygous or homozygous for j-147 allele at the locus. the ratio of 23 chlorotic plants : 96 normal plants fitted the expected ratio 1 : 3. the segregation of the tightly linked dna markers of hca2 also fitted the expected ratio 1 : 2 : 1 (table 4). constructed an often - cited restriction fragment length polymorphism (rflp) marker - based high - density linkage map for rice, in which some rflp markers have been sequenced. based on the nipponbare genome sequence, the relation between our linkage map and that by harushima. however, the ratio of normal plants to chlorotic plants was often distorted from the expected one ; that is, the chlorotic plants were often significantly fewer than expected. therefore, we again produced the f2 generation from the cross between j-147 and ir24 to confirm that hca1 - 1 and hca2 - 1 are sufficient to cause chlorosis in f2 generation with the aid of tightly linked dna markers. a total of 503 f2 plants were classified into 481 normal plants and 22 chlorotic plants. the ratio 481 : 22 looked slightly skewed towards normal plants but fitted the expected ratio 15 : 1 (= 3.033, p = 0.08). genotypes at the rm25969 and rm27404 loci were analyzed for all f2 plants (table 5). no homozygotes of j-147 allele at the rm27404 locus and ir24 allele at the rm25969 locus were present in normal plants. in contrast, all chlorotic plants were homozygotes of j-147 allele at rm27404 locus and ir24 allele at the rm25969 locus. this result indicated that hca1 - 1 and hca2 - 1 were sufficient to cause chlorosis in f2 population from the cross between j-147 and ir24. segregation of rm25969 fitted the expected ratio 1 : 2 : 1, although that of rm27404 did not fit the expected ratio : homozygotes of ir24 allele were more numerous than expected, and homozygotes of j-147 allele were much fewer than expected. the distorted segregation of chlorotic plants in f3 generation was thought to result from abnormal segregation at the chromosomal region around the hca1 locus. in this study, hca1 and hca2 were located on the respective distal regions of the short arms of chromosomes 12 and 11. these regions are known to be highly conserved as a duplicated chromosomal segment [2426 ]. according to the rice genome annotation project (http://rice.plantbiology.msu.edu/index.shtml), 30 genes with known functions therefore, hca1 and hca2 are thought to be mutually homoeologous genes, and the loss - of - function mutations of these genes are thought to be the cause of hybrid chlorosis. based on the symptom, the causal genes of hybrid chlorosis should be involved in chlorophyll synthesis or chloroplast metabolism. recently, two papers reported the reciprocal disruption of duplicate genes causing reproductive barrier in interspecific and intraspecific rice crosses. yamagata. reported that the reciprocal loss of duplicated gene encoding mitochondrial ribosomal protein l27 causes hybrid pollen sterility in f1 hybrids of o. sativa and o. glumaepatula. (dpl1) and doppelganger2 (dpl2) causing pollen sterility : independent disruption of dpl1 and dpl2 occurred, respectively, in indica - type and japonica - type. recessive embryo lethality is caused by a disruption of duplicated histidinol - phosphate amino - transferase genes encoding for a protein that catalyzes an important pathway leading to histidine incorporated into proteins. the hybrid chlorosis described in this study might offer a new example of a reproductive barrier caused by disruption of duplicate genes. the segregation of hca2 and its tightly linked dna marker rm27404 was significantly distorted from the expected ratio : the frequencies of japonica - type alleles were smaller than expected. the segregation distortion of the distal end of the short arm of chromosome 12 was reported in the populations derived from the crosses between indica - type cultivars and japonica - type cultivars : ir24 and asominori, and milyang 23 and akihikari. the peak of distortion was at an rflp marker xnpb193 (= g193), and the frequencies of japonica - type alleles were smaller than expected in both crosses. therefore, the segregation distortion observed in this study might result from the same genetic factor(s). carriers of the weakness - inducing allele hwc2 - 1, most of which are categorized as temperate japonica - type, share the same haplotype in the 200 kb region between the two dna markers, kgc4m5 and kgc4m52. the carriers of hwc2 - 2 have different haplotypes, most of which are distinct from those of hwc2 - 1 carriers. these results suggested that hwc2 - 1 diffused in temperate japonica - types, dragging adjacent genes with it. the hca2 - 1 gene is mainly carried by japonica - type cultivars. therefore, the haplotype analysis of hca2 might engender new findings related to japonica - indica differentiation. we are undertaking haplotype analysis of hca2 using a core collection of world rice and a minicollection of japanese rice landrace. before the experiment, we expected that akihikari and asominori, both generally classified as japonica - type, carry hca2 - 1 gene whereas milyang 23 and ir24, both generally classified as indica - type, carry the wild type hca2 - 2. based on that expectation, we produced an experimental design in which j-147 was crossed with a set of ri lines so that linkage between hca2 and dna markers was detectable by combining the genotype of each ri line of dna markers on the whole genome, which had been analyzed by the breeders of the ri lines, and the segregation of chlorotic plants in the f2 population between j-147 and each ri line. the experimental design using ri lines for mapping a reproductive - barrier - related gene was successful in a hybrid weakness gene hwc2. however, contrary to our expectation, all four cultivars carry hca2 - 1 gene. used a 1,536 snp panel genotyped across 395 rice diverse accessions to study genomic - wide pattern of polymorphism, to characterize population structure, and to infer the introgression history, revealing that most accessions exhibit some degree of admixture, with many individuals within a population sharing the same introgressed segment because of artificial selection. therefore, a high probability exists that the hca2 locus and its surrounding chromosomal region of ir24 were introgressed from a japonica - type cultivar. however, another possibility exists : loss - of - function mutation occurred at the hca2 locus independently in indica - type cultivars. ichitani. reported that j-147 shares the same banding patterns of 38 out of 39 pcr - based dna markers scattered on the whole genome with the three cultivars generally classified as temperate japonica - type. a dna marker s1284 (table 3, figure 3), located at 2.2 mbp from distal end of short arm of chromosome 11 (irgsp pseudomolecules build05), clearly discriminates japonica - type and indica - type, and j-147 carries the japonica - type allele. the hca2 - 2 allele of j-147 might also be the result of the introgression of small chromosomal segment of the distal end of the short arm of chromosome 11. to identify the causal genes, we are undertaking closer linkage analysis and linkage disequilibrium analysis of both hca1 and hca2 genes. identification of causal genes will contribute to the study of rice varietal differentiation, gene duplication, and chlorophyll synthesis or chloroplast metabolism. | many postzygotic reproductive barrier forms have been reported in plants : hybrid weakness, hybrid necrosis, and hybrid chlorosis. in this study, linkage analysis of the genes causing hybrid chlorosis in f2 generation in rice, hca1 and hca2, was performed. hca1 and hca2 are located respectively on the distal regions of the short arms of chromosomes 12 and 11. these regions are known to be highly conserved as a duplicated chromosomal segment. the molecular mechanism causing f2 chlorosis deduced from the location of the two genes was discussed. the possibility of the introgression of the chromosomal segments encompassing hca1 and/or hca2 was also discussed from the viewpoint of indica - japonica differentiation. |
to understand early events leading to the replacement of giii viruses by gi viruses in jev - endemic areas, we conducted virologic surveillance using mosquitoes and pig serum specimens collected from pig farms in multiple counties in taiwan during the 2009 and 2010 transmission seasons. eight pig farms were selected as sites for virologic surveillance (figure) : 3 in the central counties of taichung and changhua ; 4 in the southern counties of yulin, chiayi, and tainan ; and 1 in the eastern county of hualien. mosquito pools and swine serum specimens were collected every other week during the jev transmission season from march 2009 through october 2010. the mosquito and swine specimens were subjected to viral rna detection by using a multiplex reverse transcription pcr (rt - pcr). a qiaamp viral rna kit (qiagen, hilden, germany) was used to extract viral rna from pooled ground mosquitoes or from plasma specimens following the manufacturer s protocol. three primer pairs were used in rt - pcr to differentiate gi and giii jev (table). amplifying and sequence primers were used as was done in our previous study (10) to obtain e gene region and the full genomic sequence. the dna fragment of the correct size was excised, purified with a viogene gel extraction kit (viogene, sunnyvale, ca, usa), and sequenced directly by using a prism automated dna sequencing kit (applied biosystems, foster city, ca, usa). jev, japanese encephalitis virus ; gi, genotype i ; giii, genotype iii. a total of 62,266 mosquitoes were collected at multiple sites in taiwan from march 2009 through october 2010. tritaeniorhynchus (n = 59,386). of the 787 mosquito pools collected, 37 pools were jev - positive by multiplex rt - pcr, and all positive pools contained cx. the jev - positive mosquitoes were collected from central (taichung and changhua counties), southern (yulin, chiayi, and tainan counties), and eastern (hualin county) taiwan (figure). unfortunately, jev was not detected from pig serum specimens, but seroconversion, defined by plaque - reduction neutralizing assay at the 50% reduction titer of > 10, was evident among these samples after jev detection in mosquitoes (data not shown). full - length jev sequences, including tc20091, tc200913, and yl20094 (genbank accession nos. jf499788jf499790), were obtained from 3 positive mosquito pools, and a neighbor - joining phylogenetic tree confirmed all 3 viruses belong to gi (data not shown). additionally, the e gene was sequenced from 37 jev - positive mosquito pools (genbank accession nos. the full - length e gene sequence of these isolates was more closely related to the gi k94p05 strain than to the giii nakayama strain ; sequence identities ranged from 97.6% to 98.6%, compared with 87.4% to 88.1%, respectively. the e gene tree supports that all 37 isolates detected in this study belong to gi (figure a1). however, of jev detected by cdc - taiwan in 2008, only tpc0806c and yilan0806f were classified as gi ; all others belonged to giii (9). gi jev can be classified into various subclusters based on phylogeny (8). in this study, 21 of the 37 viruses could be classified as subcluster i and the other 16 as subcluster ii. the tpc0806c and yilan0806f strains, reported by cdc - taiwan, belong to subcluster ii (figure a1) (9). this result indicates that the gi jev introduced into taiwan originated from multiple sources. to understand the origin of the gi jev introduced into taiwan, we selected the k91p55 strain as the root virus and constructed a minimum - spanning tree by using bionumerics software version 5.00 (applied maths ; austin, tx, usa). among the subcluster i jev isolated in taiwan, the most pronounced genetic linkages appeared between viruses isolated in taichung in 2009 and in japan in 2007. the taichung isolates (tc2009 - 2, -5, -6, -8, -9, and -11) were most closely linked to a group of viruses (janar06, 14, 15, and 17) isolated from mosquitoes collected in nagasaki, japan, in 2007. among subcluster ii jev in taiwan, the tc2009 - 3 taichung isolate and the tpc0806c taipei city isolate were most closely related to janar32 - 04, which was isolated from mosquitoes collected in nagasaki, japan, in 2004. in summary, the jev gi isolates from taiwan, most closely related to gi viruses isolated from nagasaki, japan, were introduced at least twice into central and once into northern taiwan. gi jev first appeared in taiwan in 2008 when giii viruses were still the dominant circulating genotype in the region. we conclude, on the basis of molecular evidence, that the dominant jev genotype in taiwan has switched from iii to i. also, our study suggests that 1) the genotype replacement may have been accomplished within 1 year ; 2) the jev ecology remains unchanged, as evidenced by the involvement of cx. tritaeniorhynchus mosquitoes and of swine in maintaining and circulating gi virus ; 3) the introduction of gi jev strains occurred multiple times, resulting in the detection of subcluster i and ii viruses ; and 4) the gi jevs isolated in taiwan were most closely related to gi viruses isolated from nagasaki, japan. thus, the systemic evaluation of the cross - neutralizing activity of vaccinated human, as well as swine, serum specimens should be used to estimate the protective efficacy of giii - based vaccine. | genotype i of japanese encephalitis virus first appeared in taiwan in 2008. phylogenetic analysis of 37 viruses from pig farms in 20092010 classified these viruses into 2 unique subclusters of genotype i viruses and suggested multiple introductions and swift replacement of genotype iii by genotype i virus in taiwan. |
it is well known that full abo - identical grafts have a statistically significant survival advantage.1 nevertheless, due to the shortage of deceased donor liver grafts, minor abo - incompatible liver transplantations are commonly performed. minor abo - incompatibility can be described by the presence of anti - a and/or -b isohemagglutinins in the donor s plasma directed against the recipient s red blood cell antigens.2 in other words, the donor plasma type is incompatible with the recipient s abo type;3 for example, when a patient with blood group a receives an organ from a donor with blood group o, immunocompetent b lymphocytes are transplanted together with the allograft. these so - called passenger lymphocytes are able to produce antibodies against the recipient s red blood cells, causing varying degrees of immune - mediated hemolysis, which is clinically identified as the passenger lymphocyte syndrome (pls). this syndrome is reported to occur in around 40% of minor abo / rhesus (rh)-incompatible liver transplants3,4 and is seldom the result of non - abo / rh antibodies such as jka, kpb, fya and m.510 the antibodies typically appear 1 to 3 weeks after transplantation. pls is characterized by the abrupt onset of immune - mediated hemolysis and the presence of allo - antibodies. usually, the hemolysis is mild and the antibodies spontaneously disappear approximately three months after transplantation. even though pls is a self - limiting disorder and outcomes are generally good, it may be accompanied by graft failure, disseminated intravascular coagulation or even death.3,4 in this retrospective study, we analyzed all minor abo - incompatible liver transplantations performed at the antwerp university hospital in order to identify the incidence of pls, the characteristics of the patients who suffered from this complication, and the applied treatments. a retrospective analysis of the medical records of all patients who underwent a minor abo - incompatible liver transplantation between 2003 and 2015 at the antwerp university hospital was performed. the collected clinical variables included age, sex, underlying liver disease, model for end - stage liver disease (meld) score at time of transplantation, and transplantation date. all patient files were inspected for the donor and recipient s abo blood type and rh status, and for the laboratory data of immune - mediated hemolysis (by interpreting plasma hemoglobin (hb) level, reticulocyte count, serum lactate dehydrogenase level (ldh), indirect bilirubin, haptoglobin level and direct antiglobulin test (dat)). for cases with pls, we recorded all clinical and laboratory findings as well as the applied treatment. the bio - rad ih-1000 automated analyzer system (switzerland) was used to perform the dat, based on principles of column agglutination technology and gel filtration ; the reaction was graded from 1 + to 4 +, which was semi - quantitatively analyzed by a card reader.11 abbreviations : tx, transplantation ; hcc, hepatocellular carcinoma ; dat, direct antiglobulin test ; mmf, mycophenolate mofetil. day after transplantation. as of 2015, the immunosuppressive protocol was changed to basiliximab, with tacrolimus introduction on post - transplant day 5 instead of day 1. non - group o patients (3 in group a, 4 in group b and 1 in group ab) received a group o liver in 8 of the 10 cases (80%). two other patients (20%) with group ab respectively received a group a liver and a group b liver. three rh - negative patients (30%) received a liver from a rh - positive donor, and one rh - positive acceptor (10%) received a liver from a rh - negative donor. the mean age of our patient population was 58 years - old (sd 7.48) with a male to female ratio of 2.3. four patients (numbers 2, 4, 8 and 10) received a liver transplantation because of alcoholic liver cirrhosis, one patient (number 9) because of primary biliary cholangitis, one patient (number 3) because of homozygous alpha 1-antitrypsin deficiency, one patient (number 5) because of hereditary hemochromatosis, one patient (number 7) because of hepatitis b infection and two patients (numbers 1 and 6) because of hepatitis c infection. end - stage liver disease was complicated by a hepatocellular carcinoma (hcc) in 3 of 10 patients and diagnosed according to international criteria. of the two patients with a meld score of 22, one received a liver transplant because of high urgency and the other because of standard exception. five patients (50%) developed a sudden reduction in hb within 2 weeks after the liver transplantation. in four patients (numbers 3, 4, 9 and 10) pls was the cause of this hb reduction, with an average time of 12 (sd 1.71) days after transplantation. the mean nadir hb value of these four patients was 5.93 g / dl (sd 0.68). the clinical and laboratory findings of these four cases are described below, as well as the applied treatment. in patient 6, bleeding from a branch of the hepatic artery patient 3 : in april 2006, an o rh - positive orthotopic liver transplantation was performed on an ab rh - negative 49 year - old male diagnosed with homozygous alpha 1-antitrypsin deficiency that had resulted in liver cirrhosis child - pugh score c. in 2006, the meld score was not yet used as a criterion within the eurotransplant liver allocation system (elas) for assigning a donor. the patient presented with acute - on - chronic liver failure complicated with acute renal failure due to a hepatorenal syndrome, coagulopathy, respiratory failure and coma caused by hepatic encephalopathy. in january 2006, a transjugular intrahepatic portosystemic shunt (tipss) was placed to decrease the hepatic venous pressure gradient. persisting thrombocytopenia, with an average count of 50 10/l platelets, required platelet transfusion prior to the transplantation procedure. two episodes of acute rejection with a rejection activity index (rai) score of 5 occurred, starting 10 days post - transplantation, which was treated with high pulse doses of corticosteroids. platelet transfusion was performed on day 10, prophylactically, prior to a planned liver biopsy. on day 12, a reduction in hb was noticed, from 8.1 g / dl on day 11 to 6.9 g / dl. the highest level of indirect bilirubin was 1.5 mg / dl on day 15, while the ldh level increased to 943 u / l on that same day. haptoglobin was below the limit of detection and the dat tested positive for igg but not for c3d. finally, the eluate turned out to be positive for both type igg anti - a and anti - b antibodies. the patient had already received high - dose corticosteroids to treat the acute rejection, which may have contributed to the resolution of pls. hb levels raised slowly, and 30 days after transplantation a value of 8.8 g / dl was measured. although there was a rh status discordance, this did not contribute to the hemolysis. since, in this case, the donor was rh - positive, the passenger lymphocytes will not produce anti - rh antibodies (fig. (a) patient 3 ; (b) patient 4 ; (c) patient 9 ; (d) patient 10. abbreviations : prbcs, packed red blood cells ; plt, platelet transfusion ; ivig, intravenous immunoglobulin ; 5d, during 5 days. patient 4 : a 57 year - old female with known alcoholic liver cirrhosis, child - pugh score c and blood type a rh - positive underwent a successful orthotopic liver transplantation from an o rh - positive donor in october 2007. the liver cirrhosis was complicated with portal hypertension, and earlier that year she had developed hepatic encephalopathy, variceal bleeding, ascites and spontaneous bacterial peritonitis with escherichia coli. platelet transfusion was required prior to the transplantation because of a low platelet count (60 10/l), which was due to portal hypertension and hypersplenism. seven days after transplantation, the patient developed a fever that was caused by an acute cholangitis associated with enterococcus faecalis bacteremia. treatment with broad spectrum antibiotics (meropenem and vancomycin) was initiated with good results. the hb level dropped from 7.4 g / dl on day 10 to 5 g / dl on day 11. an abdominal ct scan showed a mild and stable postoperative hematoma at the hepatic hilum. the highest level of indirect bilirubin was 0.9 mg / dl, detected on day 12. on day 11, the ldh level increased to 1514 u / l, while this was only 854 u / l on day 10. no schistocytes were found and the haptoglobin level was normal, but there was an increased level of reticulocytes (59 10/l). a polyvalent dat was positive on day 11, with anti - a igg antibodies present in the eluate. multiple blood transfusions, non - compatible with the donor blood type, were given on days 2, 17 and 24. on days 2 and 17, platelet transfusions were also given, prophylactically, prior to pleural punctures. no additive treatment was given, and after day 24 no further blood transfusions were needed. the hb level reached 9 g / dl at 28 days after transplantation (fig. patient 9 : in august 2015, a b rh - positive 64 year - old woman with known liver cirrhosis and child - pugh score b due to primary biliary cirrhosis and complicated by portal hypertension and hcc in segment 6, underwent an o rh - positive orthotopic liver transplantation. the single lesion had a diameter of 23 mm, for which according to the eurotransplant rules for hcc lesions within milan criteria a standard exception meld score was obtained, reaching 22 at the time of transplantation. while the patient was on the waiting list, local control of tumor growth after transplantation, immunosuppression consisted of basiliximab, corticosteroids and mycophenolate, with delayed introduction of tacrolimus on day 5. besides pneumonia, which was diagnosed on day 8, however, 14 days after the transplantation, the patient developed a sudden reduction in hb from 8.8 g / dl on day 11 to 6.2 g / dl, without any evidence of active hemorrhage on abdominal ct scan and by gastroscopy. on day 12, blood analysis showed a high reticulocyte count (344 10/l), a slightly elevated total bilirubin (1.2 mg / dl), ldh of 266 u / l and an haptoglobin level below the limit of the detection. dat tested positive, with an eluate reactive for anti - b igg antibodies, confirming the diagnosis of pls. because no improvement was seen after blood transfusion with 2 u of donor compatible blood cells on days 13 and 14, treatment with intravenous immunoglobulin (ivig) and plasmapheresis was started on day 18 and continued for 5 consecutive days, after which the hemolytic parameters as well as the hb level gradually improved. patient 10 : in september 2015, a 54 year - old man, blood type a rh - positive, underwent an orthotropic liver transplantation from an o rh - positive donor, because of alcoholic liver cirrhosis, child - pugh score c and a meld score of 17. the year before, transplantation was complicated by ascites, spontaneous bacterial peritonitis, thrombocytopenia and portal hypertensive gastropathy. because of pre - existing thrombocytopenia, platelet transfusion was given prior to the transplantation. immunosuppressive therapy consisted of basiliximab, corticosteroids and mycophenolate, with delayed introduction of tacrolimus on day 5. postoperatively, the patient suffered from a urinary tract infection, which was treated with temocillin. besides 1 u of packed red blood cells (prbcs), postoperative platelet transfusions were needed on days 1, 3 and 4. ten days after his transplantation, the hb level decreased from 7.2 g / dl to 6.4 g / dl, without any clinical signs of bleeding. further work - up revealed an indirect bilirubin level of 2.2 mg / dl, ldh of 274 u / l, a haptoglobin level below the limit of detection and a reticulocyte count of 166 10/l. the dat performed on postoperative day 12 turned out positive with presence of type igg anti - a antibodies in the eluate, confirming the diagnosis of allo - immune hemolytic anemia based on pls. despite supportive therapy with donor compatible prbcs transfusions on days 10, 11 and 13, the hb level decreased further to 5.9 g / dl on day 14. on that day, treatment with an immunosuppressive dose (1 mg / kg) of corticosteroids was initiated, leading to improvement of hemolytic parameters. the dose of steroids was tapered from day 19 onwards, without any signs of relapse (fig. in this case series, we describe 4 patients out of 10 who received minor abo - incompatible liver transplants and developed pls within 2 weeks post - transplantation. although transplantation with minor abo - incompatible donors is associated with a slight decrease in survival, it is now frequently performed due to the growing demand for donor organs.3,12,13 pls occurs in 3040% of minor abo - incompatible liver transplantations, with 29% of such resulting in clinically relevant hemolysis. ramsey.7 reported on the first series of unexpected anti - a or anti - b isoagglutinins from minor abo - incompatible donors in kidney allografts in 1980. pls can be regarded as a type of graft - versus - host reaction and most of the time the serum antibodies produced are of type igg, but they may also be igm. because both igg and igm can fix complement, pls is thought to be complement - mediated.4,14 igg antibodies were detected in all of our four affected patients. rarely, non - abo / rh antibodies, such as jka, kpb, fya and m, result in pls.5,6,810 fung described a case report of severe anti - rh - mediated hemolysis in a liver transplantation with a rh - positive recipient and a rh - allo - immunized donor.15 a rh - status discordance was noticed in patient 3. since it concerned a rh - positive donor and a rh - negative acceptor, the passenger lymphocytes will not produce anti - rh antibodies. the antibodies typically occur 1 to 3 weeks after transplantation and usually disappear after approximately 3 months, except for the anti - d antibodies which can remain present for up to 1 year.10 the origin of the antibodies can be confirmed by immunoglobulin allo - typing, flow cytometry and nested polymerase chain reaction.3,4 severity of the hemolysis depends in general upon three factors : the amount of lymphoid tissue transplanted, the titer of red cell isohemagglutinins in the donor s serum, which can be influenced by previous sensitization of the donor, and the kinetics of antibody production after transplantation.14 however, the exact contribution of the antibody titer on subsequent recipient hemolysis remains to be proven, particularly in liver and heart / lung transplants.16 because of the correlation between pls and the transplanted volume of lymphoid tissue, pls is seen more frequently in heart - lung transplants (antibody in 70%, hemolysis in 70%), compared to liver (antibody in 40%, hemolysis in 29%) and kidney transplants (antibody in 17%, hemolysis in 9%). the risk of hemolysis is not influenced by the sex, age, ethnicity and type of the allograft (cadaveric vs. living - related).3,4,10,1518 pls is very heterogeneous in its clinical presentation and does not occur in all minor abo - incompatible organ transplantations. it is proposed that viable donor b - lymphocytes require a trigger after their transfer, such as an infection or a transfusion with stored blood, in order to induce an immune response. this theory is supported by the fact that donor antibodies are not detected in a recipient immediately after transplantation.8,14,18 three of our four patients who were diagnosed with clinically relevant pls developed an infection before the onset. it is hypothesized that immunosuppressive agents that cause deep recipient t - lymphocyte suppression, such as basiliximab and calcineurin inhibitors, relatively spare humoral immunity. this could lead to donor b cell activation and thus enhancement of antibody production.19 only two of our patients received basiliximab and both developed pls. agents noted to reduce b cell antibody production, such as azathioprine and mycophenolate mofetil, may be more beneficial.12,18,19 although pls is a self - limiting often subclinical disorder, complications like graft failure, disseminated intravascular coagulation or even death can occur.3,4 additionally, a sudden reduction in hb may lead to unnecessary investigations and even surgical procedures to rule out underlying hemorrhage. therefore, knowledge of pls and its risk factors is extremely important for transplant physicians. unfortunately, it is not possible to predict which recipients of minor abo - incompatible transplantations will develop pls.17,19 cserti - gazdewich.20 described a variability in pls severity, even in recipients of paired allografts derived from the same previous sensitized donor. therefore, it is not recommended to search for irregular antibodies in recipient and donor tissue before transplantation.14 we propose weekly determinations of isohemagglutinins by dat and other hemolysis markers in the first 4 weeks post - transplantation, as well as in case of a sudden hb reduction in the first 3 months after transplantation. this will help to identify immune hemolysis by pls in a timely manner and to prevent unnecessary diagnostic modalities or severe complications.15 different authors are working towards prevention of pls by transfusion of donor compatible prbcs postoperatively and even during surgery in minor abo - mismatched liver transplants.8,15,21 booth.22 recommend to keep the hb level at least 9 g / dl with donor compatible prbcs in case of minor abo - incompatible allogeneic stem cell transplantation. based on their findings, we suggest that implementation of peri- and postoperative transfusion support with donor compatible blood might be able to prevent the occurrence or limit the extent of hemolysis in patients who received minor abo - incompatible grafts. it has been successfully managed with supportive care and blood transfusions of the donor organ abo blood type to replace susceptible rbcs with cells that will not be hemolyzed. other treatment options consist of immune modulation by corticosteroids, ivig and plasmapheresis to decrease antibody titer or monoclonal antibodies that cause b cell immunosuppression (e.g. rituximab) in severe cases. it is assumed that destroying the passenger b cells with this cd20 monoclonal antibody would prevent further production of antibodies. unfortunately, most current therapeutic options are derived from anecdotal case reports and small case series, but randomized studies are lacking.4,21,2325 usually a combination of the above options is applied, as in patient number 9, who received high doses of corticosteroids, ivig and plasmapheresis. however, in view of the known possible adverse effects of these therapies we suggest withholding of these treatments until regular blood transfusions with the donor s blood type fails. it is likely that the number of minor abo - incompatible organ donations will increase due to the growing demand for donor organs. therefore, knowledge of pls is of great importance. unfortunately, there are no reliable factors to predict which recipients will develop pls. besides a high clinical suspicion, we suggest performing routine screening for hemolysis markers, with emphasis on haptoglobin level and dat, weekly in the first 4 weeks post - transplantation as well as in case of a sudden hb reduction within the first 3 months after transplantation. finally, support with donor compatible blood transfusions peri - operatively as well as in the first 3 months post - transplantation is suggested to prevent the occurrence or limit the extent of hemolysis. | abstractbackground and aims : due to the shortage of donor livers, minor abo - incompatible liver transplantations are commonly performed. together with the allograft, immunocompetent b - lymphocytes, called passenger lymphocytes, are transplanted. in case of minor abo - incompatibility, these passenger lymphocytes produce antibodies directed towards the recipient s red blood cells, which causes immune - mediated hemolysis, also known as the passenger lymphocyte syndrome (pls). although this is a self - limiting disorder, serious complications can occur, including graft failure. retrospectively, we evaluated the role of pls in minor abo - incompatible liver transplantations performed at our center.methods : a retrospective analysis was conducted for all minor abo - incompatible liver transplantations performed at the antwerp university hospital between 2003 and 2015. all patient files were inspected for clinical and laboratory findings. in cases of pls diagnosis, the applied treatment was also studied.results : in total, 10 patients underwent a minor abo - incompatible liver transplantation and 4 showed signs of pls. all 4 pls patients were treated with different therapeutic strategy, corresponding to the severity of hemolysis. in all 4 cases, pls resolved following treatment.conclusion : when performing minor abo - incompatible liver transplantations, knowledge of pls is elemental. next to a high index of clinical suspicion, we suggest routine screening for markers of hemolysis, with emphasis on haptoglobin level and direct antiglobulin test, weekly in the first 4 weeks post - transplantation as well as in case of a sudden hemoglobin drop within the first 3 months after transplantation. peri- and postoperative transfusion support using donor - compatible blood has been suggested to prevent the occurrence or limit the extent of hemolysis. |
osteoarthritis (oa) is a degenerative joint disease characterized by articular cartilage degradation, subchondral bone thickening, and osteophyte formation.1, 2 cartilage cellularity is reduced in oa through chondrocyte death, in which chondrocytes are stimulated by cytokines and growth factors to undergo catabolic and abnormal differentiation, leading to extracellular matrix (ecm) degradation.3, 4, 5, 6 in oa, the medial compartment of the articular cartilage is the most susceptible to degeneration, whereas the lateral compartment remains relatively unaffected.7, 8 differences in mechanical factors underlie the disparity in disease susceptibility between the medial and lateral compartments ; the damaged cartilage regions are usually subjected to mechanical loading, whereas the intact regions are not. the chondrocytes in the damaged cartilage are particularly susceptible to mechanical stress, and the tensile properties of the damaged cartilage are lost because of the destructed collagen network.9, 10 circular rnas (circrnas) are a large class of noncoding rnas that exist ubiquitously in the cytoplasm of eukaryotic cells;11, 12 these endogenous rnas are characterized by stable structure and high tissue - specific expression. compared with linear rnas, circrnas can remarkably undergo non - canonical splicing without a free 3 or 5 end.14, 15 recent reports show that circrnas function as microrna (mirna) sponges that naturally sequester and competitively suppress mirna activity. the involvement of circrnas is demonstrated in the development of several types of diseases, such as atherosclerosis and nervous system disorders.17, 18, 19 however, the role of circrnas in cartilage and their overall contribution to oa pathogenesis are still unknown. the present study identified a small number of up- or downregulated circrnas in different cartilage regions. we specifically identified a new circrna, called mechanical stress - related circrna (circrna - msr), involved in mechanical stress. we demonstrate that circrna - msr controls tumor necrosis factor alpha (tnf-) expression and promotes the degradation of ecm. the cartilage was assessed by histologic examination, and the histologic scores were graded according to a modified mankin scale. the score of 6 represented damaged cartilage. hierarchical clustering revealed the circrna expression in the cartilage samples (figure 1a). the scatter and volcano plots showed varied circrna expressions between the damaged and intact cartilage samples (figures 1b and 1c). we identified 104 differentially expressed circrnas in the damaged cartilage compared to the intact cartilage. of these circrnas, 44 were upregulated and 60 were downregulated in the damaged tissue samples (table s1). to validate the circrna microarray results, we performed qpcr to analyze the changes in expression among the differentially expressed circrnas. the data confirmed that circrna_000598, circrna_103387, circrna_101975, and circrna_100226 (circrnas - msr) were overexpressed in the damaged region compared with the intact region of the cartilage in oa (figure 2a). a total of 89 circrnas and 61 mrnas were noted in the damaged cartilage network, whereas 94 circrnas and 36 mrnas were in the intact cartilage network. in these co - expression networks, circrnas and mrnas were connected by a string, indicating a tight correlation between these genes and a potential regulatory relationship (figures s1 and s2). furthermore, we constructed another network with circrnas, mrnas, and the common binding mirnas. the differentially expressed circrnas were annotated in detail with the mirna interaction information (table s1). we selected cartilage - specific mrnas according to gene ontology (go) and pathway analyses (figures 2b and 2c). we constructed a network of circrnas - mirnas - mrnas, with a total of 45 circrnas, 42 mrnas, and 42 mirnas, by merging the commonly targeted mirnas of circrnas and mrnas (figure 3). this indicated the tight correlation and regulation relationship of these genes in the network. we assumed that circrna - msr was a special cartilage circrna (hsa_circ_100226, i d circ_0005567 in circbase ; http://circbase.org), with its gene located at chr1:51868106 - 51874004 and the symbol of the associated gene being eps15. the circrna - msr was chosen because it is one of the circrnas indicated to be associated with mechanical stress and inflammatory response according to the bioinformatics analysis mentioned above. to investigate the effect of mechanical stress on chondrocytes, the cells were exposed to pre - optimized magnitudes of cyclic tensile strain (cts) using flexcell-5000 (figure 4a). the expression levels of col2a1 and aggrecan were significantly downregulated, whereas the expression levels of tnf- and il-1 were significantly upregulated by cts for 24 hr (figure 4b). moreover, we found that circrna - msr expression paralleled tnf- expression under mechanical stress (figure 4c). therefore, we speculated the co - regulated expression of circrna - msr and tnf- under mechanical stress in vitro conditions. to analyze the effects of circrna - msr on tnf- expression in chondrocyte ecm degradation, we examined the effect of circrna - msr knockdown on damaged chondrocytes. the small interfering rna (sirna) used in this experiment was specific for circrna - msr. as a consequence of this inhibition, the mrna expression for tnf- decreased, whereas the ecm expression significantly rose by si - msr treatment (figure 5a). the immunofluorescence results also showed that ecm proteins were significantly elevated by the si - msr treatment (figures 5b and 5c). circrnas have been reported to function as mirna sponges that naturally sequester and competitively suppress mirna activity. we assumed that circrna - msr functions as a decoy to regulate tnf- expression through the same mechanism. according to the informatics analysis, there were five mirna - binding sites for circrna - msr, and they were mir-138, mir-145, mir-24, mir-620, and mir-875 (figure 6a). the circrna - msr 3 utr sequence matched these mirnas, and the tnf- 3 utr matched mir-875 (figure 6b). thus, we identified a common mirna (mir-875) for circrna - msr and tnf- targets. oa is a multifactorial disease characterized by progressive inflammation, pain, and cartilage destruction in load - bearing surfaces of the knee joints. among various pathogenic factors, aberrant mechanical stimulation results in a physiological imbalance between mechanical stress on the joint and the joint s ability to withstand such stress. chondrocytes are directly exposed to compression force during cartilage loading ; thus, the ecm of chondrocytes tends to stretch the cells during cartilage compression. many studies on oa focused on the epigenetic regulation of its pathogenesis and potential targets for therapy, including mirnas and long noncoding rnas (lncrnas). however, the occurrence of circrnas in cartilage remains largely unknown. this study identified a number of aberrantly expressed circrnas in damaged regions compared with the intact regions of oa. we found that circrna - msr is vital under mechanical stress in loss - of - function experiments and that it regulates the tnf- in the process of ecm degradation in chondrocytes. recent studies showed that numerous exonic transcripts can form circrnas through non - linear reverse splicing or gene rearrangement. the two properties of circrnas are the most important : first, they are highly conserved sequences ; second, they show a high degree of stability in mammalian cells. compared with other noncoding rnas, such as mirnas and lncrnas, these properties provide circrnas with the potential to be used as ideal biomarkers and potential therapy targets. we assumed that circrna - msr functioned as a decoy to regulate tnf- expression through the same mechanism. we found that circrna - msr harbors mirna - binding sites, including mir-138, mir-145, mir-24, mir-620, and mir-875. in addition, mir-875 can bind to the 3 utr of tnf-. however, this study focused on mir-875 as the only mirna that can target both circrna - msr and tnf-. this study demonstrated that circrna - msr regulated tnf- expression and participated in the chondrocyte ecm degradation process. we confirmed that the silencing of circrna - msr by sirna can suppress tnf- expression and increase ecm formation. thus, circrna - msr can be used as a potential target and specific sirnas can be used as therapeutic agents in oa therapy. the most attractive aspect of this therapeutic is the ability to target the gene(s), which may not be possible with small molecules or protein - based drugs. this opens up a whole new therapeutic approach for the treatment of oa by targeting genes that are causally involved in the pathological process. although this approach is promising, several challenges have been identified, including the lack of stability against extracellular and intracellular degradation by nucleases, poor uptake and low potency at target sites of sirnas, and off - target effects. collectively, our data indicate that 104 circrnas were either over- or underexpressed in oa. the observed changes were suggested to have biologic effects and that circrnas are key regulators of gene expression. we confirmed that circrna - msr is the decoy for tnf-. the mechanism needs to be confirmed with further specific studies. deciphering the precise molecular mechanisms of circrna function in oa is critical to understanding oa pathogenesis and exploring new potential therapeutic targets. oa cartilage was isolated from the knee joints of 30 patients undergoing total knee arthroplasty. joint tissue was immediately shock - frozen in liquid nitrogen, and the articular cartilage was isolated within 24 hr from the condyles and tibia plateaus with the use of a surgical blade. the study was approved by the human ethics committee of the peking university third hospital (china). the cartilage was removed and fixed in 4% paraformaldehyde in pbs solution (ph 7.4) for 48 hr at 4c, and then it was demineralized in 15% edta (ph 7.2) in pbs for 2 weeks. the cartilage specimens were dehydrated in a graded series of alcohol and xylene, and then they were embedded in paraffin and cut serially into 5 m sagittal sections. the sections were stained with toluidine blue, safranin - o, and h&e as per routine protocol. scores of 6 points indicated intact and damaged cartilage, respectively. joint tissue was immediately shock - frozen in liquid nitrogen, and then the articular cartilage was isolated from the condyles and tibia plateaus using a surgical blade within 24 hr. afterward, the samples were homogenized in trizol reagent (invitrogen), and the total rna in each sample was quantified using a nanodrop nd-1000. sample preparation and microarray hybridization the total rna from each sample was amplified and transcribed into fluorescent crna utilizing random primers according to the arraystar super rna labeling protocol. the labeled crnas were hybridized onto the arraystar human circrna array (8 15 k). we selected specific mrnas to construct the network according to our previous microarray data and the enrichment analyses of go. co - expression networks were constructed according to the normalized signal intensities of circrnas and mrnas in the original microarray data. pearson s correlation analysis was applied to measure the significance of the correlation of the expressions between each gene pair. when the expression levels of two genes were similar above a preselected threshold in the pearson analysis, they were considered to exhibit a co - expression relationship and would be connected. each gene corresponded to a node, and two genes were connected by a string, indicating a tight correlation. the degree of correlation determined gene importance in the network.30, 31 an mrna - mirna - circrna network was constructed according to the common target mirnas of the circrnas and mrnas. the interactions of circrnas and mrnas with mirnas were predicted with the arraystar mirna target prediction software based on targetscan and miranda.32, 33 donor chondrocytes were isolated as previously described. chondrocytes (5 105/well) were at passage 2 and grown on pronectin f - coated bioflex six - well culture plates (flexcell international) to 80% confluence. our previous study selected the pre - optimized magnitudes of cts, so the chondrocytes were enforced at 10% elongation (0.5 hz) for the indicated times.34, 35 the sirnas targeting circrna - msr (referred to as si - circmsr) were designed and synthesized by ribobio. chondrocytes were transfected with si - circmsr using lipofectamine 3000 (invitrogen) according to the manufacturer s protocol. prior to transfection, the culture medium was replaced with a medium without antibiotics, and the cells were cultured for 24 hr (cyagen biosciences). the rnai lipofectamine 3000 complex was prepared by mixing for 20 min, and the complex was then added to each cell. total rna was isolated from cartilage tissues or monolayer - cultured primary chondrocytes using trizol reagent. homogenized tissue samples were in 1 ml trizol reagent per 50100 mg, and the lysed cells were directly added to 1 ml trizol reagent in a 3.5-cm diameter dish. for mirna qpcr analysis, reverse transcription of specific mirnas was performed with the bulge - loop mirna primer set (ribobio) according to the manufacturer s instructions. for mrna analysis, the mrna expression levels were reported relative to glyceraldehyde 3-phosphate dehydrogenase (gapdh), whereas mirna expression levels were reported relative to u6. the primers used in the present study are as follows : tnf- forward : 5-cctctctctaatcagccctctg-3, reverse : 5-gaggacctgggagtagatgag-3;circrna - msr forward : 5-tccagtctgatccttttgttgg-3, reverse : 5-ctgtttcttgctgtagacggct-3;hsa_circrna_103387 forward : 5-agtctttccaccttggctct-3, reverse : 5-tggacagggtacttctcgttt-3;hsa_circrna_000598 forward : 5-gtcccttccctgtcactacct-3, reverse : 5-tctgttgatgccgccttgg-3;hsa_circrna_101975 forward : 5-gcccaaaccagacctcactt-3, reverse : 5-tccttctcgggctcctga-3 ; andgapdh forward : 5-gggaaactgtggcgtgat-3, reverse : 5-gagtgggtgtcgctgttga-3. tnf- forward : 5-cctctctctaatcagccctctg-3, reverse : 5-gaggacctgggagtagatgag-3 ; circrna - msr forward : 5-tccagtctgatccttttgttgg-3, reverse : 5-ctgtttcttgctgtagacggct-3 ; hsa_circrna_103387 forward : 5-agtctttccaccttggctct-3, reverse : 5-tggacagggtacttctcgttt-3 ; hsa_circrna_000598 forward : 5-gtcccttccctgtcactacct-3, reverse : 5-tctgttgatgccgccttgg-3 ; hsa_circrna_101975 forward : 5-gcccaaaccagacctcactt-3, reverse : 5-tccttctcgggctcctga-3 ; and gapdh forward : 5-gggaaactgtggcgtgat-3, reverse : 5-gagtgggtgtcgctgttga-3. the cultured cells were rinsed in pbs and fixed with 4% paraformaldehyde for 15 min at room temperature. the cultured cells were incubated with anti - col2 (1:200 dilution) and aggrecan (1:200 dilution) at 4c overnight. the cells were subsequently incubated for 1 hr with fluorescein isothiocyanate - conjugated affinipure goat anti - rabbit igg (1:100 dilution). finally, the samples were incubated for 5 min with hoechst 33342 and observed with a confocal microscope (fv 1000 olympus ix-81). the results are reported as the mean sem ; p < 0.05 was considered statistically significant. | circular rnas (circrnas) are involved in the development of various diseases ; however, knowledge on circrnas in osteoarthritis (oa) is limited. this study aims to identify circrna expression in different regions affected by oa and to explore the function of mechanical stress - related circrnas (circrnas - msr) in cartilage. bioinformatics was employed to predict the interaction of circrnas and mrnas in the cartilage. loss - of - function experiments for circrnas - msr were performed in vitro. a total of 104 circrnas were differentially expressed in damaged versus intact cartilage. of these circrnas, 44 and 60 were upregulated and downregulated, respectively, in the damaged tissue. circrna - msr expression increased under mechanical stress in chondrocytes. circrnas - msr were silenced using small interfering rna, and knockdown of circrnas - msr could suppress tumor necrosis factor alpha (tnf-) expression and increase extracellular matrix (ecm) formation. our results demonstrated that circrnas - msr regulated tnf- expression and participated in the chondrocyte ecm degradation process. we propose that the inhibition of circrnas - msr could inhibit the degradation of chondrocyte ecm and knockdown of circrnas - msr could be a potential therapeutic target for oa. |
patients with type 2 diabetes are at high risk of developing cardiovascular diseases, which are also the most common causes of death in these patients. in type 2 diabetes, the prevalence of hypertension is higher than the general population, and hypertension associated with diabetes increases the incidence of cardiovascular disease. thus, treatment of hypertension in addition to glycemic control is important in order to reduce cardiovascular events in patients with type 2 diabetes, as it was emphasized in the seventh report of the joint national committee on prevention, detection, evaluation, and treatment of high blood pressure (jnc7). according to that report, the target clinical arterial blood pressure for hypertensive patients with diabetes mellitus is < 130/80 mmhg and the use of blockers of the renin angiotensin system (ras), either angiotensin ii type i receptor blockers (arb) or angiotensinconverting enzyme (ace) inhibitors, are recommended as the primary antihypertensive drugs. the wide use of arb in the treatment of hypertension is based on their beneficial effects on hypertensionrelated cardiovascular endorgan damage, at least in part, through reduction of oxidative stress and inflammation in addition to their blood pressure lowering effects. in particular, among the clinically available arb, olmesartan has potent blood pressure lowering effects at a regular dose, compared with other agents. however, in the majority of patients, the use of one kind of firstline antihypertensive agent is insufficient to achieve a strict target blood pressure level, and a combination of multiple antihypertensive drugs is required to induce an adequate fall in blood pressure. generally, arb or ace inhibitors are often used in combination with a small dose of thiazide diuretics or calcium channel blockers (ccb). thiazide diuretics are beneficial for patients with hypertension, as they reduce cardiovascular morbidity and mortality. in addition, they are commonly used in combination with arb or ace inhibitors, as they promote na excretion and hence enhance the blood lowering effects of arb or ace inhibitors. however, thiazide diuretics are known to cause various metabolic abnormalities, such as insulin resistance, newonset diabetes mellitus, hypokalemia and hyperuricemia. in contrast, ccb can also reduce cardiovascular events in patients with coronary disease or highrisk hypertensives. furthermore, the combination of ccb with arb or ace inhibitors effectively lowers blood pressure without any metabolic adverse effects. the recent accomplish (avoiding cardiovascular events through combination therapy in patients living with systolic hypertension) trial compared the relative merits of the combination of ace inhibitors with those two types of antihypertensive agents. the results showed that the combination of ccb with ace inhibitors is more effective in reducing cardiovascular events compared to the combination of thiazide diuretics with ace inhibitors in highrisk hypertensive patients. however, the effects of arb combined with ccb or thiazide diuretics have not been fully evaluated in type 2 diabetic patients with hypertension. the present study is an open label crossover trial in hypertensive type 2 diabetic patients treated with a combination of arb (olmesartan 20 mg / day) and azelnidipine or lowdose thiazide diuretic (trichlormethiazide 1 mg / day). blood pressure, pulse rate, various metabolic parameters and renal function were assessed throughout the study. all patients with type 2 diabetes mellitus who visited juntendo university hospital (tokyo, japan), juntendo tokyo koto geriatric medical center (tokyo, japan), juntendo university urayasu hospital (urayasu, japan), juntendo university sizuoka hospital (shizuoka, japan), and juntendo university nerima hospital (tokyo, japan) between january 2008 and march 2010 were invited to participate in the study. the inclusion criteria were patients with type 2 diabetes mellitus and hypertension in whom the target clinic blood pressure (< 130/80 mmhg) could not be achieved despite treatment with olmesartan 20 mg once daily for at least 8 weeks. in addition, patients with severe renal (estimated glomerular filtration rate [egfr ] < 30) or hepatic disease, overt cardiovascular disease and malignancy were excluded. diabetic nephropathy was defined as an albumin to creatinine ratio 30 mg / g creatinine by examination of a spot urine sample. diabetic neuropathy was defined by the recommendation of the japan diabetes society (jds) using sensory symptoms in the bilateral lower limbs including tingling, pain, allodynia or unusual sensations, or bilateral absence of the achilles tendon reflex, or in case of diminished sensitivity. the ethics committees of the participating hospitals approved the study protocol and informed consent was obtained from each subject. an open label crossover design was applied to the present study. at the end of the monotherapy of olmesartan 20 mg oncedaily as the antihypertensive drug, blood pressure was measured and fasting blood samples were collected as baseline data. then, the participants were randomized into one of two treatment groups who received either 16 mg azelnidipine or 1 mg trichlormethiazide once daily in the morning in addition to olmesartan 20 mg / day. after 12 weeks of azelnidipine / olmesartan treatment, blood pressure was again measured and fasting blood samples were collected. then, the subjects on azelnidipine were switched to trichlormethiazide, whereas the subjects on trichlormethiazide were switched to azelnidipine, and each continued the treatment for another 12 weeks, after which blood pressure was measured with fasting blood sampling (figure 1). blood pressure and pulse rate were recorded at the outpatient clinic, and the reported values represented the average of triplicate measurements taken at intervals of 1 min with the cuff on the left arm in a sitting position after a 5min rest. all subjects were advised to consume their usual diet and exercise during the study period. each patient was reviewed as to their general health and compliance with the medication, which was assessed by tablet counts and checking of blood pressure, bodyweight, and diet and exercise status at each visit. during the study period, schematic diagram of the study protocol. blood sampling and blood pressure (bp) measurement blood samples obtained at week 12 and 24 were used for evaluation of the effects of each drug. serum lipids (highdensity lipoprotein cholesterol, lowdensity lipoprotein cholesterol and triglycerides), glucose, hba1c, creatinine, uric acid, sodium and potassium were measured with standard techniques. the value for hba1c (%) is estimated as a national glycohemoglobin standardization program (ngsp) equivalent value (%) calculated by the formula hba1c (%) = hba1c (jds) (%) + 0.4%, considering the relational expression of hba1c (jds) (%) measured by the previous japanese standard substance and measurement methods and hba1c (ngsp). measurement of highly sensitive creactive protein (hscrp) by latex nephelometry was outsourced to a private laboratory (srl laboratory, tokyo, japan). homeostasis model assessment of insulin resistance (homair) represented the product of fasting plasma insulin (u / ml) and fasting plasma glucose levels (mmol / l) divided by 22.5. the egfr was calculated by the formula for japanese patients : egfr (ml / min per 1.73 m) = 194 age serum creatinine (0.739 for females). urinary 8hydroxy2deoxyguanosine (8ohdg) was measured by enzymelinked immunosorbent assay (elisa) using a spot urine sample (srl laboratory), and the results are expressed relative to creatinine (per mg cr). results are presented as mean sd or median (range 2575%). differences between groups were examined for statistical significance using the twotailed paired student s ttest or wilcoxon signedrank test when data did not show normal distribution. all patients with type 2 diabetes mellitus who visited juntendo university hospital (tokyo, japan), juntendo tokyo koto geriatric medical center (tokyo, japan), juntendo university urayasu hospital (urayasu, japan), juntendo university sizuoka hospital (shizuoka, japan), and juntendo university nerima hospital (tokyo, japan) between january 2008 and march 2010 were invited to participate in the study. the inclusion criteria were patients with type 2 diabetes mellitus and hypertension in whom the target clinic blood pressure (< 130/80 mmhg) could not be achieved despite treatment with olmesartan 20 mg once daily for at least 8 weeks. in addition, patients with severe renal (estimated glomerular filtration rate [egfr ] < 30) or hepatic disease, overt cardiovascular disease and malignancy were excluded. diabetic nephropathy was defined as an albumin to creatinine ratio 30 mg / g creatinine by examination of a spot urine sample. diabetic neuropathy was defined by the recommendation of the japan diabetes society (jds) using sensory symptoms in the bilateral lower limbs including tingling, pain, allodynia or unusual sensations, or bilateral absence of the achilles tendon reflex, or in case of diminished sensitivity. the ethics committees of the participating hospitals approved the study protocol and informed consent was obtained from each subject. an open label crossover design was applied to the present study. at the end of the monotherapy of olmesartan 20 mg oncedaily as the antihypertensive drug, blood pressure was measured and fasting blood samples were collected as baseline data. then, the participants were randomized into one of two treatment groups who received either 16 mg azelnidipine or 1 mg trichlormethiazide once daily in the morning in addition to olmesartan 20 mg / day. after 12 weeks of azelnidipine / olmesartan treatment, blood pressure was again measured and fasting blood samples were collected. then, the subjects on azelnidipine were switched to trichlormethiazide, whereas the subjects on trichlormethiazide were switched to azelnidipine, and each continued the treatment for another 12 weeks, after which blood pressure was measured with fasting blood sampling (figure 1). blood pressure and pulse rate were recorded at the outpatient clinic, and the reported values represented the average of triplicate measurements taken at intervals of 1 min with the cuff on the left arm in a sitting position after a 5min rest. all subjects were advised to consume their usual diet and exercise during the study period. each patient was reviewed as to their general health and compliance with the medication, which was assessed by tablet counts and checking of blood pressure, bodyweight, and diet and exercise status at each visit. during the study period, schematic diagram of the study protocol. blood sampling and blood pressure (bp) measurement were carried out at week 0 for basal data. blood samples obtained at week 12 and 24 were used for evaluation of the effects of each drug. serum lipids (highdensity lipoprotein cholesterol, lowdensity lipoprotein cholesterol and triglycerides), glucose, hba1c, creatinine, uric acid, sodium and potassium were measured with standard techniques. the value for hba1c (%) is estimated as a national glycohemoglobin standardization program (ngsp) equivalent value (%) calculated by the formula hba1c (%) = hba1c (jds) (%) + 0.4%, considering the relational expression of hba1c (jds) (%) measured by the previous japanese standard substance and measurement methods and hba1c (ngsp). measurement of highly sensitive creactive protein (hscrp) by latex nephelometry was outsourced to a private laboratory (srl laboratory, tokyo, japan). homeostasis model assessment of insulin resistance (homair) represented the product of fasting plasma insulin (u / ml) and fasting plasma glucose levels (mmol / l) divided by 22.5. the egfr was calculated by the formula for japanese patients : egfr (ml / min per 1.73 m) = 194 age serum creatinine (0.739 for females). urinary 8hydroxy2deoxyguanosine (8ohdg) was measured by enzymelinked immunosorbent assay (elisa) using a spot urine sample (srl laboratory), and the results are expressed relative to creatinine (per mg cr). results are presented as mean sd or median (range 2575%). differences between groups were examined for statistical significance using the twotailed paired student s ttest or wilcoxon signedrank test when data did not show normal distribution. a total of 45 diabetic patients with hypertension were randomly assigned to the azelnidipine administered first group (n = 23) and trichlormethiazide administered first group (n = 22). six patients dropped out because of loss to follow up (n = 3 of the olmesartan / azelnidipine group and n = 2 of the olmesartan / trichlormethiazide group) and poor compliance (n = 1 of the olmesartan / trichlormethiazide group). no serious adverse effects were observed in all study patients including the six dropout cases. the subjects were relatively obese (body mass index 26.0 3.9 kg / m) and their blood glucose, blood pressure and serum lipids were well controlled. the anthropometric data under the administration of olmesartan only were compared with those under olmesartan / azelnizipine and olmesartan / trichlormethiazide. comparison between olmesartan / azelnidipine and olmesartan / trichlormethiazide groups by twotailed paired student s ttest. data are mean sd or median (range 2575%). plasma insulin level and homeostasis model assessment of insulin resistance (homair) were not measured in patients on insulin therapy (n = 5). 8ohdg, 8hydroxy2deoxyguanosine ; egfr, estimated glomerular filtration rate ; hdlc, highdensity lipoprotein cholesterol ; hscrp, highlysensitive creactive protein ; ldlc, lowdensity lipoprotein cholesterol ; ns, not significant. comparison between olmesartan / azelnidipine and olmesartan / trichlormethiazide groups by twotailed student s ttest or wilcoxon signedrank test. table 2 shows clinical blood pressure under treatment with each drug. blood pressure decreased after treatment with olmesartan / azelnidipine and olmesartan / trichlormethiazide. compared with olmesartan / trichlormethiazide treatment, the combination of olmesartan / azelnidipine significantly reduced systolic and diastolic blood pressures by 5.5 and 3.0 mmhg, respectively. the pulse rate tended to be lower during the combination therapy period with olmesartan / azelnidipine than in the monotherapy period. in addition, the pulse rate in the olmesartan / azelnidipine group was significantly lower than that in the olmesartan / trichlormethiazide group. table 3 lists the metabolic markers at baseline and the end of each combination therapy. lipids and serum k did not change significantly with either of the combination therapies. with regard to glucose metabolism, hba1c was significantly lower in the olmesartan / azelnidipine group than the olmesartan / trichlormethiazide group. however, fasting blood glucose, serum insulin and homair were comparable between the two groups. serum uric acid and serum creatinine significantly increased in the olmesartan / trichlormethiazide group, but not in the olmesartan / azelnidipine group. reflecting these changes, egfr was significantly increased after olmesartan / azelnidipine treatment compared with olmesartan / trichlormethiazide treatment. in contrast, urinary 8ohdg, hscrp and adiponectin were comparable between the two treatments. our data showed that the combination therapy of olmesartan with azelnidipine had a more potent blood pressure lowering effect without affecting the metabolic parameters compared to that with trichlormethiazide. the present study showed that clinical systolic and diastolic blood pressures were significantly lower in the olmesartan / azelnidipine group than in the olmesartan / trichlormethiazide group by 5.5 and 3.0 mmhg, respectively. recently, several large trials showed that strict blood pressure control could reduce the onset of cardiovascular diseases in patients with type 2 diabetes. for example, a 4mmhg fall in diastolic blood pressure in the hot study was found to equate with a 51% decrease in the onset of cardiovascular diseases. similarly, a 1.92mmhg decrease in systolic blood pressure in the hope study was found to equate to a 25% reduction in cardiovascular mortality in type 2 diabetic patients. considered together with the aforementioned studies, the fall in arterial pressure recorded in the present study was clinically significant and more than a subtle change. although increasing the dose of trichlormethiazide might achieve further reduction in blood pressure, we only used a low dose of trichlormethiazide, because the adverse effects on metabolism are more common with higher doses of thiazide diuretics. in the present study, the pulse rate in the olmesartan / azelnidipine group was significantly lower than in the olmesartan / trichlormethiazide group, consistent with previous reports. azelnidipine reduces the pulse rate in essential hypertension, unlike other dihydropyridine ccb such as amlodipine, because it inhibits sympathetic nerve activity. in contrast, diuretics are likely to increase pulse rate as a result of their action of reducing plasma volume. epidemiological studies suggest that increased pulse rate is a predictor for cardiovascular disease and a poor prognosis, thus our data point to better beneficial effects for azelnidipine compared with thiazide diuretics. the present study showed that serum uric acid was also significantly higher in the olmesartan / trichlormethiazide group than in the olmesartan / azelnidipine group. recent studies have shown that thiazideinduced hyperuricemia correlates with increased cardiovascular events in hypertensive patients. thus, care should be taken regarding uric acid monitoring during thiazide treatment, even when combined with arb. indeed, we found that hba1c levels were significantly higher in the olmesartan / trichlormethiazide group than in the olmesartan / azelnidipine group. however, we found that the change in hba1c level correlated neither with changes in serum uric acid level nor with serum potassium level (data not shown). further studies are needed to clarify the mechanism of the adverse effects of thiazide diuretic on glucose metabolism. we also found that renal function assessed by serum creatinine and egfr deteriorated in the olmesartan / trichlormethiazide group. although the mechanisms responsible for thiazideassociated renal dysfunction remain unclear, certain mechanisms, such as the chronic effects of thiazides on metabolic abnormalities like hyperuricemia, hyperglycemia or volume depletion, could be considered to impair renal function. in contrast to our findings, the guard (the gauging albuminuria reduction with lotrel in diabetic patients with hypertension) study showed that the treatment using ace with thiazide diuretic resulted in a greater reduction in albuminuria without thiazideassociated renal dysfunction compared with the group using ace and ccb, although the blood pressure reduction was better in the ace and ccb group. we could not show exact reasons for these differences, because we did not evaluate the effect on albuminuria. recent studies have shown that azelnidipine have antiinflammatory and antioxidative stress effects and can increase serum adiponectin levels. we evaluated the effects of azelnidipine and trichlormethiazide on inflammation, oxidative stress markers and serum adiponectin. however, our results showed no differences in these parameters between the two treatment groups. the reason for the lack of effect of azelnidipine on metabolic parameters in the present study is not clear at present. it is possible that a longer duration of drug treatment is required before the appearance of these unique effects of azelnidipine. in the present study, just nine of the olmesartan / azelnidipine group and seven of the olmesartan / trichlormethiazide group achieved the target blood pressure of < 130/80 mmhg. in general, a combination of more than three antihypertensive drugs is needed to achieve this goal. thus, it is important to treat hypertension more intensively with a combination of more than three antihypertensive drugs, including thiazide diuretics, to reduce both diabetic microvascular and macrovascular complications in case of poor control with a combination of arb and ccb. the limitation of the present study is the relatively small number of patients and the crossover design. considering the practical performance with clinical patients in addition, we compared the effect of drugs at only one point, thus timecourse changes in blood pressure and pulse rate during the combination study could not be evaluated. regarding order effects, there were no differences between the azelnidipinetrichlormethiazide group and the trichlormethiazideazelnidipine group by twoway analysis of variance for repeated measurements. in conclusion, our data suggested that compared with the combination of olmesartan and trichlormethiazide, that of olmesartan and azelnidipine had superior blood pressure lowering effects, as well as superior effects on glucose and uric metabolism, and renal function in patients with type 2 diabetes. our results suggest that the combination of olmesartan / azelnidipine can be considered ideal agents to provide better cardiovascular protection than the combination of olmesartan / trichlormethiazide in type 2 diabetic patients with hypertension. | abstractaims / introduction : angiotensin ii type 1 receptor blockers (arb) are regarded as firstline treatment for type 2 diabetes with hypertension. however, lowering blood pressure to the target level often requires more than one antihypertensive agent as recommended by the guideline. in this openlabel, prospective, crossover clinical trial, we compared the effects of combination treatment of arb with a calcium channel blocker (ccb) or with a lowdose thiazide diuretic on blood pressure (bp) and various metabolic parameters in hypertensive patients with type 2 diabetes.materials and methods : a total of 39 japanese type 2 diabetics with hypertension treated with olmesartan (20 mg / day) for at least 8 weeks were recruited to this study. at study entry, treatment was switched to either olmesartan (20 mg / day)/azelnidipine (16 mg / day) or olmesartan (20 mg / day)/trichlormethiazide (1 mg / day) and continued for 12 weeks. then, the drugs were switched and treatment was continued for another 12 weeks. we measured clinical blood pressure and various metabolic parameters before and at the end of each study arm.results : compared with the olmesartan / trichlormethiazide treatment, treatment with olmesartan / azelnidipine achieved superior clinical blood pressure and pulse rate control. in contrast, the treatment with olmesartan / trichlormethiazide resulted in increased hba1c, serum uric acid and worsening of estimated glomerular filtration rate, though there were no differences in other metabolic parameters including urine 8hydroxy2deoxyguanosine, creactive protein and adiponectin between the two treatments.conclusions : our results show that the combination of arb with azelnidipine is more beneficial with regard to blood pressure control and metabolic outcome than the combination of olmesartan with low dose trichlormethiazide. this trial was registered with umin clinical trial registry (no. umin000005064). (j diabetes invest, doi : 10.1111/j.20401124.2011.00135.x, 2011) |
the median survival rate reported for surgically treated patients with brain metastases from melanoma ranges from 5 to 22 months. the most significant factor influencing the survival of patients with brain metastases is the number of their cerebral metastases. surgical treatment of multiple brain metastases is only considered a palliative solution for improving the quality of life. however, recently the performance of multiple resections of brain metastases from melanoma has led to a reconsideration of the surgery s benefits. we report one case of multiple brain metastases from malignant melanoma with two large lesions located in the right frontal and left parietal lobes. this is a case report of simultaneous one - stage resections of distant lesions with two approaches for multiple metastatic malignant melanoma lesions. a 41-year - old woman had a mole in her right ear that grew noticeably, and swelling was detected in her right neck lymph nodes. aspiration biopsy cytology of the neck lymph node was performed, and malignant melanoma was diagnosed. she underwent an operative resection of the ear lesion, right neck lymph nodes and parotid gland with subsequent chemotherapy and radiotherapy. her level of consciousness had deteriorated, and she was transferred to our hospital 6 months after being diagnosed with malignant melanoma. on admission, her glasgow coma scale score was 11 (e2v3m6), and she had a right hemiparesis. additionally, symptoms of gerstmann syndrome such as finger agnosias, right - left disorientation, acalculia and agraphia were noted. computed tomography showed two large lesions in the right frontal lobe and left parietal lobe surrounded with severe brain edema (fig. magnetic resonance (mr) images revealed that the two lesions were strongly enhanced with cystic change (fig. 1b, c, f, g), and a small round lesion was present in the left head of the caudate nucleus (fig. 1i). the subarachnoid space surrounding the left parietal lesion was also enhanced (fig. (18f) fluoro-2-deoxyglucose positron emission tomography ((18f) fdg pet) exhibited high levels of accumulation in the two large lesions (fig. 1d, h), but revealed no signs of metastatic lesions except in the brain. a, e : computed tomography images reveal right frontal and left parietal mass lesions. b, c, f, g : magnetic resonance (mr) images show right frontal and left parietal mass lesions as strongly enhanced on t1-weighted image with gadolinium (b, f), and peripheral edema on the t2-weighted image (c, g). d, h : (18f) fluoro-2-deoxyglucose positron emission tomography images show high accumulations in right frontal and left parietal lesions. i, j : axial (i) and sagittal (j) of t1-weighted images with gadolinium revealed an enhanced, small mass lesion in the left head of the caudate nucleus (i), and enhanced subarachnoid space surrounding the left parietal lesion (j). first, the patient was placed in a prone position. a left parietal craniotomy and a parietal lesion resection were performed. the patient was then turned to a supine position under general anesthesia, after which a right frontal craniotomy and a frontal lesion resection were performed. both frontal and parietal lesions consisted of soft and fragile black tissues. both lesions were resected, but the malignant melanoma tissues in the subarachnoid space were residual (fig. histological examinations showed typical numerous pleomorphic and hyperchromatic cells, which confirmed the diagnosis of metastatic malignant melanoma. a, b, c : intraoperative microscopic views show the black malignant melanoma tissues spread in subarachnoid space (a), the border with normal brain was not clear (b), and tumor tissues of subarachnoid space were residual (c). her consciousness disturbance, right hemiparesis and symptoms of gerstmann syndrome could no longer be seen. she was discharged to her home 10 days after the operation, almost completely free of neurological deficits. following surgery, the patient received a course of whole brain radiation therapy consisting of 30 gy in 10 fractions, and chemotherapy at another hospital. then she presented with pain in her extremities, but there were no signs of bone metastases detected by fdg - pet and bone scintigraphy. mr images showed a mild enlargement of the left head of the caudate nucleus lesion, but no signs of problems around previous surgical resections (fig. spinal mr images revealed a small mass lesion attached to the spinal dura mater at the atlas level (fig. the patient presented with a generalized seizure and was again admitted to a nearby hospital. eventually, she was able to spend time with her family for 3 months at home. a - c : mr t1-weighted images with gadolinium show mild enlargement of the left head of the caudate nucleus lesion 3 months after the operation (a), but not presenting recurrence as mass lesions at left frontal and right parietal lesions (b, c). d - f : spinal mr t1-weighted images with gadolinium revealed a small mass lesion attached to spinal dura mater at the atlas level with no signs of spinal cord compression 3 months after operation. melanomas are the third most common source of intracranial metastases after breast and lung carcinomas. the incidence of central nervous system (cns) metastases in patients with melanomas ranges from 10% to 40% in clinical studies. cns metastasis is the most worrisome feature of malignant melanoma, leading directly to death in the majority of patients. the prognosis for patients with malignant melanoma brain metastasis is poor, with a median survival time ranging between 2 to 10 months. it is noteworthy that only 10% of patients survive more than 1 year after diagnosis. an important factor strongly influencing the therapeutic response of patients is the number of metastases. age, sex, and the time interval from the primary malignant melanoma manifestation to the cerebral metastasis seem not to affect the clinical outcome. prospective randomized trials have demonstrated the benefit of surgery for the treatment of a single metastasis in the brain. surgical therapy is ordinarily used for the majority of patients with a single metastatic lesion, but only a few selected patients with multiple metastases in the brain are treated surgically. recently, konstadoulakis. reported that the median survival time of surgical resection for multiple brain metastases was 8 months. they concluded that performing multiple resections of brain metastases from melanoma is considered a radical approach, especially in young patients with well - controlled systemic disease. the main aim of a simultaneous one - stage resection for multiple metastatic lesions is limited improvement in the quality of the patient s limited remaining life, so the indications are extremely limited. the two preconditions are that the patients are young and have well - controlled systemic disease, and that dramatic improvements of neurological symptoms may be expected following the resections. the surgical options for managing two intracranial lesions are influenced by the presence of another intracranial tumor. when two lesions are contiguous, they may usually be removed using a single approach, but when they are distant from each other, the surgical approach depends upon the type of lesions. when one tumor is malignant and the other is benign, the malignant tumor must be removed first. a second craniotomy may be performed at least 10 to 12 months later, when the benign tumor is large enough and/or symptomatic, or shows a tendency to grow. when the two lesions are malignant, large, or symptomatic tumors, both lesions may require early resection. in such cases, there is no consensus as to the best surgical management. in the present case, therefore, we selected simultaneous one - stage tumor resection with a left parietal craniotomy and a right frontal craniotomy, and found no adverse events associated with the simultaneous one - stage operation. the patient s surgical position must be changed under general anesthesia, and the operation time is longer, and more invasive. nevertheless, the significant reduction of intracranial pressure obtained by surgery may produce immediate and dramatic improvements of the patient s neurological symptoms. the superiority surgical treatment has over radiotherapy for managing multiple metastatic brain tumors is an immediate reduction in intracranial pressure. while our patient s survival period was not extended, her symptomatic improvements enabled her to return home and spend time with her family. because it improves the quality of the patient s limited remaining life, simultaneous one - stage tumor resection using two approaches is a viable option for the surgical management of multiple metastatic brain tumors, especially in young patients with well - controlled systemic disease. | abstracta 41-year - old woman presented with disturbance of consciousness, right hemiparesis, and symptoms of gerstmann syndrome. she had a history of malignant melanoma resections of an ear mole and her right neck lymph nodes and parotid gland, with subsequent chemotherapy and radiotherapy. computed tomography showed two large lesions in the right frontal and left parietal lobes surrounded by severe brain edema. magnetic resonance images revealed that the two lesions were strongly enhanced with cystic change, and a small round lesion was located in the left head of the caudate nucleus. (18f) fluoro-2-deoxyglucose positron emission tomography showed high accumulation in both lesions, and no sign of metastatic lesions except within the brain. the two lesions were large, causing increased intracranial pressure. simultaneous surgical resections were performed using two approaches. the patient s neurological symptoms were greatly improved after surgery, and her karnofsky performance status improved from 20% to 90%. she was discharged to her home almost completely free of neurological deficits. although, simultaneous one - stage tumor resections for multiple metastatic brain tumors do not extend the survival period, they improve the quality of the patient s limited remaining life, and may be a treatment choice for young patients with well - controlled systemic disease. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.