article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
study participants came from the study of osteoporotic fractures (sof) (26). the sof sample included 9,704 women who were at least 65 years old and were recruited between 1986 and 1988 from population - based listings in four areas of the united states : baltimore county, maryland ; minneapolis, minnesota ; portland, oregon ; and the monongahela valley, pennsylvania. women were excluded if they could not walk without help or had a history of bilateral hip replacement. although african american women were initially excluded, 662 african american women with similar characteristics were enrolled in 19961997. participants in caregiver - sof included members of the original and african american cohorts who participated in the sixth biennial sof examination that was conducted between 1997 and 1999. the study sample was identified in two phases, described elsewhere (27). the first phase consisted of administering a caregiver screening questionnaire to 5,952 sof participants who had their sixth biennial examination at their home or sof clinic and were not cognitively impaired, or living in long - term care facilities (figure 1). the questionnaire asked sof participants if they currently helped a relative or friend with each of seven instrumental activities of daily living (adl) and seven basic adl tasks (28) because that person was physically, cognitively, or mentally unable to perform that task independently. caregivers were sof participants who helped someone with at least one instrumental activity of daily living (iadl) or adl task ; noncaregivers did not help anyone with these tasks. flow chart of creation of caregiver - sof sample, and sample for current analyses. notes : cg = caregiver ; ncg = noncaregiver. the second phase occurred from 1999 to 2001. we readministered this questionnaire by telephone to 841 caregivers and 1,872 noncaregivers identified in the first phase. respondents who had stopped caregiving (n = 493) were excluded. for each participating caregiver, we matched one or two noncaregivers on sof site, age, race, and zip code. face - to - face interviews were conducted in respondents homes within 2 weeks of the telephone reevaluation (ie, caregiver - sof baseline interview) and 1 year later. this study was approved by the institutional review boards at each sof site and at the boston university medical center. respondents were classified as caregivers or noncaregivers based on whether they assisted someone with any iadl / adl tasks, as described above, at the caregiver - sof baseline interview. long - term caregivers were respondents who had been caregiving for 4 years or more ; short - term caregivers had been caregiving from several months to less than 4 years. dementia caregivers were caregivers whose main care recipient had been diagnosed with ad or dementia ; other caregivers were classified as nondementia caregivers. hypertension, diabetes, and high cholesterol were considered present if the respondent reported being told by a physician or health care provider that she had the condition or used a medication for that condition in the past month. these names were coded according to indication using the physicians desk reference and online prescription databases, and cross - checked for reliability. body mass index (kg / m) was based on the respondent 's height at her baseline sof visit and her weight, measured at the baseline caregiver - sof interview. respondents with body mass index (bmi) of 30 or more were classified as high bmi, consistent with the cutpoint used in the world health organization definition of metabolic syndrome (23). we calculated the total number of these four indicators. because few respondents had all indicators present, we combined respondents with three or four indicators (possible values ranged from 0 to 3). at the caregiver - sof baseline and follow - up interviews, respondents were timed on the number of seconds it took to walk a 2-m or 3-m course at their usual pace (29). after a trial walk respondents who used canes or walkers performed timed walks if the interviewer and respondent felt it was safe. change in walking speed was calculated as the difference between average walking speeds at follow - up and baseline. sociodemographic variables included the respondent s self - report of age, race (white or black), highest level of education (dichotomized at college or more), and current marital status. leisure time exercise was determined by a positive response to one of two questions : do you usually walk for exercise (walk one block or more without stopping) ? (30), and do you usually engage in any regular exercise other than walking at least once a week, such as stretching or strengthening exercises, swimming or any other exercise ? limitations in iadls and adls were based on the respondent s self - report of her ability to perform each of seven iadls and seven adls independently. the iadls were use the telephone, get to places out of walking distance, shop, prepare meals, manage medications, manage finances, and do heavy housework (31). the adls included walk across a room, groom, transfer from bed to chair, eat, dress, bathe, and use the toilet. separate variables were constructed for the total number of adl (07) and iadl (07) limitations. this 14-item scale measures general stress experienced in the past month, with higher scores indicating more stress, and possible values ranging from 056. caregivers reported if they were the care recipient 's spouse versus another relative or other friend, if they lived with the care recipient, and the number of adl tasks (07) and iadl tasks (07) with which they helped the care recipient. we compared the baseline characteristics of respondents across the caregiver status categories using anovas for continuous variables and chi - square tests for categorical variables. we conducted separate multiple linear regression analyses for the two stressful caregiving situations (ie, caregiving) on change in walking speed from baseline to the first follow - up interview. individual covariables that were associated with both caregiving and change in walking speed were considered as potential confounders. these variables were included in the baseline regression model and were eliminated one at a time if they were not statistically significant (p.10) and their exclusion did not markedly change the association between caregiving and change in walking speed. to determine whether number of indicators of metabolic syndrome modified this association, we evaluated the statistical significance of the interaction term, caregiving metabolic risk composite score, in regression models containing independent variables for these terms, baseline walking speed and confounders. we also evaluated whether increasing number of metabolic syndrome indicators was associated with greater decline in walking speed by conducting tests for linear trend of the metabolic risk composite score within the total sample and within each caregiving subgroup. study participants came from the study of osteoporotic fractures (sof) (26). the sof sample included 9,704 women who were at least 65 years old and were recruited between 1986 and 1988 from population - based listings in four areas of the united states : baltimore county, maryland ; minneapolis, minnesota ; portland, oregon ; and the monongahela valley, pennsylvania. women were excluded if they could not walk without help or had a history of bilateral hip replacement. although african american women were initially excluded, 662 african american women with similar characteristics were enrolled in 19961997. participants in caregiver - sof included members of the original and african american cohorts who participated in the sixth biennial sof examination that was conducted between 1997 and 1999. the study sample was identified in two phases, described elsewhere (27). the first phase consisted of administering a caregiver screening questionnaire to 5,952 sof participants who had their sixth biennial examination at their home or sof clinic and were not cognitively impaired, or living in long - term care facilities (figure 1). the questionnaire asked sof participants if they currently helped a relative or friend with each of seven instrumental activities of daily living (adl) and seven basic adl tasks (28) because that person was physically, cognitively, or mentally unable to perform that task independently. caregivers were sof participants who helped someone with at least one instrumental activity of daily living (iadl) or adl task ; noncaregivers did not help anyone with these tasks. flow chart of creation of caregiver - sof sample, and sample for current analyses. notes : cg = caregiver ; ncg = noncaregiver. the second phase occurred from 1999 to 2001. we readministered this questionnaire by telephone to 841 caregivers and 1,872 noncaregivers identified in the first phase. respondents who had stopped caregiving (n = 493) were excluded. for each participating caregiver, we matched one or two noncaregivers on sof site, age, race, and zip code. the study sample was identified in two phases, described elsewhere (27). the first phase consisted of administering a caregiver screening questionnaire to 5,952 sof participants who had their sixth biennial examination at their home or sof clinic and were not cognitively impaired, or living in long - term care facilities (figure 1). the questionnaire asked sof participants if they currently helped a relative or friend with each of seven instrumental activities of daily living (adl) and seven basic adl tasks (28) because that person was physically, cognitively, or mentally unable to perform that task independently. caregivers were sof participants who helped someone with at least one instrumental activity of daily living (iadl) or adl task ; noncaregivers did not help anyone with these tasks. flow chart of creation of caregiver - sof sample, and sample for current analyses. we readministered this questionnaire by telephone to 841 caregivers and 1,872 noncaregivers identified in the first phase. respondents who had stopped caregiving (n = 493) were excluded. for each participating caregiver, we matched one or two noncaregivers on sof site, age, race, and zip code. face - to - face interviews were conducted in respondents homes within 2 weeks of the telephone reevaluation (ie, caregiver - sof baseline interview) and 1 year later. this study was approved by the institutional review boards at each sof site and at the boston university medical center. respondents were classified as caregivers or noncaregivers based on whether they assisted someone with any iadl / adl tasks, as described above, at the caregiver - sof baseline interview. long - term caregivers were respondents who had been caregiving for 4 years or more ; short - term caregivers had been caregiving from several months to less than 4 years. dementia caregivers were caregivers whose main care recipient had been diagnosed with ad or dementia ; other caregivers were classified as nondementia caregivers. hypertension, diabetes, and high cholesterol were considered present if the respondent reported being told by a physician or health care provider that she had the condition or used a medication for that condition in the past month. these names were coded according to indication using the physicians desk reference and online prescription databases, and cross - checked for reliability. body mass index (kg / m) was based on the respondent 's height at her baseline sof visit and her weight, measured at the baseline caregiver - sof interview. respondents with body mass index (bmi) of 30 or more were classified as consistent with the cutpoint used in the world health organization definition of metabolic syndrome (23). we calculated the total number of these four indicators. because few respondents had all indicators present, we combined respondents with three or four indicators (possible values ranged from 0 to 3) respondents were classified as caregivers or noncaregivers based on whether they assisted someone with any iadl / adl tasks, as described above, at the caregiver - sof baseline interview. long - term caregivers were respondents who had been caregiving for 4 years or more ; short - term caregivers had been caregiving from several months to less than 4 years. dementia caregivers were caregivers whose main care recipient had been diagnosed with ad or dementia ; other caregivers were classified as nondementia caregivers. hypertension, diabetes, and high cholesterol were considered present if the respondent reported being told by a physician or health care provider that she had the condition or used a medication for that condition in the past month. these names were coded according to indication using the physicians desk reference and online prescription databases, and cross - checked for reliability. body mass index (kg / m) was based on the respondent 's height at her baseline sof visit and her weight, measured at the baseline caregiver - sof interview. respondents with body mass index (bmi) of 30 or more were classified as consistent with the cutpoint used in the world health organization definition of metabolic syndrome (23). we calculated the total number of these four indicators. because few respondents had all indicators present, we combined respondents with three or four indicators (possible values ranged from 0 to 3) at the caregiver - sof baseline and follow - up interviews, respondents were timed on the number of seconds it took to walk a 2-m or 3-m course at their usual pace (29). after a trial walk respondents who used canes or walkers performed timed walks if the interviewer and respondent felt it was safe. change in walking speed was calculated as the difference between average walking speeds at follow - up and baseline. at the caregiver - sof baseline and follow - up interviews, respondents were timed on the number of seconds it took to walk a 2-m or 3-m course at their usual pace (29). after a trial walk respondents who used canes or walkers performed timed walks if the interviewer and respondent felt it was safe. change in walking speed was calculated as the difference between average walking speeds at follow - up and baseline. sociodemographic variables included the respondent s self - report of age, race (white or black), highest level of education (dichotomized at college or more), and current marital status. leisure time exercise was determined by a positive response to one of two questions : do you usually walk for exercise (walk one block or more without stopping) ? (30), and do you usually engage in any regular exercise other than walking at least once a week, such as stretching or strengthening exercises, swimming or any other exercise ? limitations in iadls and adls were based on the respondent s self - report of her ability to perform each of seven iadls and seven adls independently. the iadls were use the telephone, get to places out of walking distance, shop, prepare meals, manage medications, manage finances, and do heavy housework (31). the adls included walk across a room, groom, transfer from bed to chair, eat, dress, bathe, and use the toilet. separate variables were constructed for the total number of adl (07) and iadl (07) limitations. this 14-item scale measures general stress experienced in the past month, with higher scores indicating more stress, and possible values ranging from 056. caregivers reported if they were the care recipient 's spouse versus another relative or other friend, if they lived with the care recipient, and the number of adl tasks (07) and iadl tasks (07) with which they helped the care recipient. caregivers reported if they were the care recipient 's spouse versus another relative or other friend, if they lived with the care recipient, and the number of adl tasks (07) and iadl tasks (07) with which they helped the care recipient. we compared the baseline characteristics of respondents across the caregiver status categories using anovas for continuous variables and chi - square tests for categorical variables. we conducted separate multiple linear regression analyses for the two stressful caregiving situations (ie, caregiving) on change in walking speed from baseline to the first follow - up interview. individual covariables that were associated with both caregiving and change in walking speed were considered as potential confounders. these variables were included in the baseline regression model and were eliminated one at a time if they were not statistically significant (p.10) and their exclusion did not markedly change the association between caregiving and change in walking speed. to determine whether number of indicators of metabolic syndrome modified this association, we evaluated the statistical significance of the interaction term, caregiving metabolic risk composite score, in regression models containing independent variables for these terms, baseline walking speed and confounders. we also evaluated whether increasing number of metabolic syndrome indicators was associated with greater decline in walking speed by conducting tests for linear trend of the metabolic risk composite score within the total sample and within each caregiving subgroup. the sample included 921 respondents who had walking speed measures at the baseline and follow - up interviews. of these respondents, 583 were noncaregivers, 156 (16.9%) were long - term caregivers, and 90 (27.5% of the caregivers) cared for someone with ad or dementia. compared with respondents included in these analyses, the 148 subjects who were excluded due to lacking follow - up interviews (n = 34) or walking speed measures (n = 114) were significantly older, had more adl and iadl limitations, slower baseline walking speeds, more metabolic indicators, and were more likely to care for a spouse. the mean age of respondents was 81.1 (3.6) years and 88% were white (table 1). caregivers were significantly more likely than noncaregivers to be married and stressed, but had fewer iadl limitations. long - term caregivers had the fastest baseline walking speeds, were younger and better educated than other respondents, and less likely to be caring for a spouse. sample characteristics for the total sample and by length of time caregiving, among 921 caregiver - sof participants notes : cgs = caregivers ; ncgs = noncaregivers. walking speed declined for the total sample over the follow - up period (mean = 1.04 years, 0.16). mean decline, adjusted for baseline speed, was 0.005 m / second (0.16). neither long - term caregiving (=.004, p =.57) nor dementia caregiving (=.0005, p =.95) was associated with change in walking speed, adjusted for confounders. however, stressful caregiving situations combined with multiple metabolic syndrome indicators resulted in greater walking speed decline. in multiple regression analyses, long - term caregivers with 34 metabolic indicators declined more than other respondents : mean = 0.10 m / second ; interaction term p =.039 (table 2 and figure 2). there was a significant linear trend between increasing number of metabolic syndrome indicators and walking speed decline among long - term caregivers (p =.002), but not short - term caregivers (p =.24) or noncaregivers (p =.70). adjusted mean change in walking speed over 1-year by length of time caregiving and metabolic risk composite score combined adjusted for baseline walking speed (=.355, se = 0.029, p <.001), black race (=.034, se = 0.016, p =.04), high school graduate+ (=.018, se = 0.010, p =.08), and iadl limitations (=.024, se = 0.005, p <.001). p value for caregiving metabolic risk composite score interaction term =.039. adjusted mean change in walking speed over 1 year by length of time caregiving and metabolic risk composite score combined. notes : adjusted for baseline walking speed, race, education level, and number of iadl limitations. caregiving metabolic risk composite score interaction, p =.039). similarly, caregivers for persons with dementia who also had 34 metabolic risk indicators experienced more decline in walking speed (0.155 m / second) than other caregivers and noncaregivers. the interaction between dementia caregiving and metabolic risk composite score was borderline statistically significant (p =.057 ; table 3 and figure 3). there was also more of a linear trend between increasing number of metabolic syndrome indicators and walking speed decline among dementia caregivers (p =.004) than nondementia caregivers (p =.09). adjusted mean change in walking speed over 1-year by dementia status and metabolic risk composite score combined adjusted for baseline walking speed (=.359, se = 0.029, p <.001), black race (=.033, se = 0.016, p=.04), high school graduate+ (=.018, se = 0.010, p = 0.077), and iadl limitations (=.024, se = 0.005, p <.001). p value for the caregiving metabolic risk composite score interaction term =.057. adjusted mean change in walking speed over 1 year by dementia versus nondementia caregiving and metabolic risk composite score combined. notes : adjusted for baseline walking speed, race, education level, and number of iadl limitations. caregiving metabolic risk composite score interaction p =.057. in both models, walking speed declined more in respondents who were african american, had less education, and more iadl limitations. the sample included 921 respondents who had walking speed measures at the baseline and follow - up interviews. of these respondents, 583 were noncaregivers, 156 (16.9%) were long - term caregivers, and 90 (27.5% of the caregivers) cared for someone with ad or dementia. compared with respondents included in these analyses, the 148 subjects who were excluded due to lacking follow - up interviews (n = 34) or walking speed measures (n = 114) were significantly older, had more adl and iadl limitations, slower baseline walking speeds, more metabolic indicators, and were more likely to care for a spouse. the mean age of respondents was 81.1 (3.6) years and 88% were white (table 1). caregivers were significantly more likely than noncaregivers to be married and stressed, but had fewer iadl limitations. long - term caregivers had the fastest baseline walking speeds, were younger and better educated than other respondents, and less likely to be caring for a spouse. sample characteristics for the total sample and by length of time caregiving, among 921 caregiver - sof participants notes : cgs = caregivers ; ncgs = noncaregivers. walking speed declined for the total sample over the follow - up period (mean = 1.04 years, 0.16). mean decline, adjusted for baseline speed, was 0.005 m / second (0.16). neither long - term caregiving (=.004, p =.57) nor dementia caregiving (=.0005, p =.95) was associated with change in walking speed, adjusted for confounders. however, stressful caregiving situations combined with multiple metabolic syndrome indicators resulted in greater walking speed decline. in multiple regression analyses, long - term caregivers with 34 metabolic indicators declined more than other respondents : mean = 0.10 m / second ; interaction term p =.039 (table 2 and figure 2). there was a significant linear trend between increasing number of metabolic syndrome indicators and walking speed decline among long - term caregivers (p =.002), but not short - term caregivers (p =.24) or noncaregivers (p =.70). adjusted mean change in walking speed over 1-year by length of time caregiving and metabolic risk composite score combined adjusted for baseline walking speed (=.355, se = 0.029, p <.001), black race (=.034, se = 0.016, p =.04), high school graduate+ (=.018, se = 0.010, p =.08), and iadl limitations (=.024, se = 0.005, p <.001). p value for caregiving metabolic risk composite score interaction term =.039. adjusted mean change in walking speed over 1 year by length of time caregiving and metabolic risk composite score combined. notes : adjusted for baseline walking speed, race, education level, and number of iadl limitations. caregiving metabolic risk composite score interaction, p =.039). similarly, caregivers for persons with dementia who also had 34 metabolic risk indicators experienced more decline in walking speed (0.155 m / second) than other caregivers and noncaregivers. the interaction between dementia caregiving and metabolic risk composite score was borderline statistically significant (p =.057 ; table 3 and figure 3). there was also more of a linear trend between increasing number of metabolic syndrome indicators and walking speed decline among dementia caregivers (p =.004) than nondementia caregivers (p =.09). adjusted mean change in walking speed over 1-year by dementia status and metabolic risk composite score combined adjusted for baseline walking speed (=.359, se = 0.029, p <.001), black race (=.033, se = 0.016, p=.04), high school graduate+ (=.018, se = 0.010, p = 0.077), and iadl limitations (=.024, se = 0.005, p <.001). p value for the caregiving metabolic risk composite score interaction term =.057. adjusted mean change in walking speed over 1 year by dementia versus nondementia caregiving and metabolic risk composite score combined. notes : adjusted for baseline walking speed, race, education level, and number of iadl limitations. caregiving metabolic risk composite score interaction p =.057. in both models, walking speed declined more in respondents who were african american, had less education, and more iadl limitations. walking speed declined for the total sample over the follow - up period (mean = 1.04 years, 0.16). mean decline, adjusted for baseline speed, was 0.005 m / second (0.16). neither long - term caregiving (=.004, p =.57) nor dementia caregiving (=.0005, p =.95) was associated with change in walking speed, adjusted for confounders. however, stressful caregiving situations combined with multiple metabolic syndrome indicators resulted in greater walking speed decline. in multiple regression analyses, long - term caregivers with 34 metabolic indicators declined more than other respondents : mean = 0.10 m / second ; interaction term p =.039 (table 2 and figure 2). there was a significant linear trend between increasing number of metabolic syndrome indicators and walking speed decline among long - term caregivers (p =.002), but not short - term caregivers (p =.24) or noncaregivers (p =.70). adjusted mean change in walking speed over 1-year by length of time caregiving and metabolic risk composite score combined adjusted for baseline walking speed (=.355, se = 0.029, p <.001), black race (=.034, se = 0.016, p =.04), high school graduate+ (=.018, se = 0.010, p =.08), and iadl limitations (=.024, se = 0.005, p <.001). p value for caregiving metabolic risk composite score interaction term =.039. adjusted mean change in walking speed over 1 year by length of time caregiving and metabolic risk composite score combined. notes : adjusted for baseline walking speed, race, education level, and number of iadl limitations. caregiving metabolic risk composite score interaction, p =.039). similarly, caregivers for persons with dementia who also had 34 metabolic risk indicators experienced more decline in walking speed (0.155 m / second) than other caregivers and noncaregivers. the interaction between dementia caregiving and metabolic risk composite score was borderline statistically significant (p =.057 ; table 3 and figure 3). there was also more of a linear trend between increasing number of metabolic syndrome indicators and walking speed decline among dementia caregivers (p =.004) than nondementia caregivers (p =.09). adjusted mean change in walking speed over 1-year by dementia status and metabolic risk composite score combined adjusted for baseline walking speed (=.359, se = 0.029, p <.001), black race (=.033, se = 0.016, p=.04), high school graduate+ (=.018, se = 0.010, p = 0.077), and iadl limitations (=.024, se = 0.005, p <.001). p value for the caregiving metabolic risk composite score interaction term =.057. adjusted mean change in walking speed over 1 year by dementia versus nondementia caregiving and metabolic risk composite score combined. notes : adjusted for baseline walking speed, race, education level, and number of iadl limitations. caregiving metabolic risk composite score interaction p =.057. in both models, walking speed declined more in respondents who were african american, had less education, and more iadl limitations. this study found that older women who were caregivers for 4 years or more and who also had 34 metabolic syndrome indicators declined more in walking speed than other respondents. older women who cared for a person with dementia and who had more metabolic syndrome indicators showed a borderline significant trend toward more decline in walking speed. these results support our hypothesis and corroborate previous observations of poorer health outcomes in ad caregivers than other caregivers (17). they are consistent with studies that found that older adults (8,9,11) and adults with peripheral arterial disease (10) who also had metabolic syndrome had a higher risk of incident mobility limitations (11), decline in adls (8,9), mobility - related adls (9), and walking speed (10). they are also consistent with studies that found linear trends between increasing number of metabolic syndrome components and poorer outcomes in mobility (11) and cognitive functioning (33)., even small declines increase the risk of mortality (25). moreover, if translated into distance walked over 30 seconds (the time often allotted to cross a street), then long - term and dementia caregivers with 34 metabolic syndrome indicators would walk 3.0 and 4.7 m less in 30 seconds at 1-year follow - up than at baseline (figures 2 and 3). this change may affect caregivers quality of life and ability to provide optimal care for the care recipient. there are several pathways by which chronic caregiving stress combined with multiple metabolic syndrome indicators may lead to a decline in walking speed. first, the presence of both conditions may exacerbate their individual effects, such as reduced walking speed in obese persons (34) or in depressed adults resulting from chronic stress (35). second, there may be indirect effects through disruptions in cytokine activity, notably interleukin-6 (il-6). both ad caregivers (20,36) and adults with metabolic syndrome (5) have higher levels of il-6. older adults with elevated il-6 levels have greater risk of mobility impairment (37). third, chronic stress may create a cascade of disruptions in multiple physiological systems (1,3). caregivers with more metabolic syndrome indicators may experience more decline because they are further along this pathway toward health decline than other caregivers. the metabolic risk composite score differed from atp - iii defined metabolic syndrome, which is based on waist circumference and a combination of clinical assessments and medications for identifying hypertension, dyslipidemia, and elevated glucose (23), whereas our measure used bmi instead of waist circumference and a combination of self - report and medications for the other components. however, various measures of metabolic syndrome exist for clinical (23) and research purposes (33,38). previous studies of caregivers used a metabolic risk composite that did not include high - density lipoprotein or triglyceride levels (15) and other modifications of metabolic variables (14), and other studies also substituted bmi for waist circumference (33). additionally, our measure did not include prevalent cardiovascular disease, but when terms for heart disease and stroke were added to multivariable models, they were not statistically significant. other potential limitations were that long - term caregivers did not have higher perceived stress than short - term caregivers. caregivers in this sample reported being in this role from less than 1 year to 53 years. thus, long - term caregivers had the longest exposure to caregiving - related stressors. the fact that we found a significant, dose response association between higher metabolic risk composite score and walking speed decline in long - term caregivers supports our hypothesis. however, interpretation of these results should consider the small number of respondents in subgroups of respondents with 34 metabolic indicators who were also in stressful caregiving subgroups (12 long - term caregivers and 7 dementia caregivers) as well as the possibility of regression to the mean because this group had the fastest baseline walking speed. we also lacked measures of physical activity and diet, risk factors for metabolic syndrome (23), and mobility limitations. (39) although residual confounding may be a concern, our results were consistent with studies that adjusted for physical activity, suggesting that this was not a major limitation. additionally, the sample was comprised of older women who were mainly white and high functioning, raising the question of generalizability of these results. however, as most caregivers in the united states are older women (40), these results apply to the majority of caregivers. nonetheless, this study 's strengths included its large, multisite community - based sample of older women. caregivers and noncaregivers came from the same source population, thus reducing possible biases that may result from recruiting caregivers from patient registries and noncaregivers from other sources. the inclusion criteria required that caregivers were helping the care recipient with at least one iadl / adl at baseline, so misclassification of caregiver status was unlikely. in summary, these results add to studies of the combined effects of caregiving and metabolic risk factors (1315), and are the first, to our knowledge, to compare different caregiving situations. additional studies are needed to replicate these findings, including studies with longer follow - up periods, larger samples, and alternative health and functioning outcomes. given the increasing population of older caregivers, such studies will provide important information for identifying subgroups of older caregivers that may be at risk of health decline. ag18037, ag05407, ar35582, ag05394, ar35584, and ar35583. an earlier version of this manuscript was presented at the 59th annual meeting of the gerontological society of america, dallas, texas, 2006. | background.chronic stress may lead to health decline through metabolic syndrome. thus, persons in stressful caregiving situations who also have more indicators of metabolic syndrome may experience more decline than other caregivers or noncaregivers.methods.the sample included 921 women (338 caregivers and 583 noncaregivers) from the caregiver - study of osteoporotic fractures study. participants had home - based baseline and 1-year follow - up interviews between 1999 and 2003. at baseline, caregivers were categorized as long term (4 years) versus short term (< 4 years), and caring for someone with alzheimer 's disease / dementia or not. a metabolic risk composite score was the sum of four indicators : body mass index 30, and diagnosis or using medications for hypertension, diabetes, or high cholesterol. walking speed (m / second) was measured at both interviews.results.walking speed declined for the total sample (adjusted mean = 0.005 m / second, 0.16) over an average of 1.04 years (0.16). overall, caregiving was not associated with decline. increasing metabolic risk score was associated with greater decline for the total sample and long - term and dementia caregivers, but not other caregivers or noncaregivers. metabolic risk score modified the adjusted associations between years of caregiving and dementia caregiving with walking speed decline (p values for interaction terms were 0.039 and 0.057, respectively). the biggest declines were in long - term caregivers and dementia caregivers who also had 34 metabolic indicators (0.10 m / second and 0.155 m / second, respectively).conclusions.walking speed declined the most among older women who had both stressful caregiving situations and more metabolic syndrome indicators, suggesting these caregiver subgroups may have increased risk of health decline. |
we describe a case of paraneoplastic neurologic syndrome, namely n - methyl - d - aspartic acid receptor antibody associated limbic encephalitis, a rare cause of altered mental status in the young. a 28 year old caucasian female nurse presented with acute onset difficulty with word finding and increasing confusion and agitation. workup including blood, imaging and regular cerebrospinal fluid (csf) studies was unremarkable. computerized tomography scan of chest / abdomen / pelvis revealed a dermoid cyst of the left ovary and csf n - methyl - d - aspartic acid receptor antibody returned positive confirming the diagnosis of paraneoplastic nmda receptor antibody associated limbic encephalitis. she was treated with methylprednisolone therapy along with plasmapheresis and a left salpingo - opherectomy was performed. the patient showed significant improvement with respect to her cognitive function and had no more seizures. n - methyl - d - aspartic acid receptor antibody associated limbic encephalitis is a rare paraneoplastic neurologic syndrome with symptoms including psychiatric manifestations, seizures, language disturbances and autonomic instability. it develops due to antibody induced decrease in n - methyl - d - aspartic acid receptors. paraneoplastic neurologic syndromes are a group of rare neurologic disorders associated with systemic cancers which affect any part of the nervous system. we describe one such rare case of paraneoplastic neurologic syndrome, namely n - methyl - d - aspartic acid (nmda) receptor antibody associated limbic encephalitis. a 28 year old caucasian female nurse, s. p., with past medical history significant for right ovarian teratoma status post removal 4 years prior to admission, presented to an outside facility with chief complaint of acute onset difficulty with word articulation. the patient, without any known past psychiatric history, was noted by observers to be increasingly confused and agitated with aggressive physical behavior for which she was admitted to a psychiatric unit with a diagnosis of acute psychosis. at the time of psychiatric admission, the patient displayed visual hallucinations, transient episodes of unresponsiveness, and lingual dyskinesias. workup including complete blood count, comprehensive metabolic panel, thyroid studies, blood cultures, erythrocyte sedimentation rate, venereal disease research laboratory test (vdrl) screening test were within normal limits except for a creatinine phosphokinase (cpk) level of 19,000. upon transfer to our facility, the patient was noted to be mute except for occasional echolalia. examination revealed glasgow coma scale of 10 (e4, v2, m4), brisk reflexes, increased muscle tone with intermittent dystonic posturing of the extremities. cerebrospinal fluid analysis revealed glucose of 80, protein 28, red blood cell count 6, herpes simplex virus polymerase chain reaction negative, oligoclonal bands and myelin basic protein negative. autoimmune etiologies, lupus cerebritis and porphyria were excluded. a ct scan of chest / abdomen / pelvis revealed a 2.1 2.27 2.43 cm dermoid cyst of the left ovary. following plasmapheresis, the patient showed significant improvement with respect to language and cognitive function.following therapy, she developed right wrist drop and left foot drop. on follow up, the patient continued to have short term memory impairment, however there was complete resolution of wrist drop and partial resolution of foot drop and no further seizure episodes were noted. nmda receptor antibody associated limbic encephalitis is a rare paraneoplastic neurologic syndrome with symptoms including psychiatric manifestations (agitation, hallucinations and incongruous behavior), stupor with catatonic features, seizures, language disturbances such as mutism and echolalia, frequent dyskinesias, and autonomic instability. differential diagnosis includes primary psychiatric disorders, malignant catatonia, neuroleptic malignant syndrome, viral encephalitis, and encephalitis lethargica. evaluation includes csf analysis which may be normal or show lymphocytic pleocytosis, eeg showing frequent slow disorganized activity, mri brain which is often normal. diagnosis of nmdar encephalitis is confirmed by detection of antibodies to nr1/nr2 heteromers of the nmdar in serum or csf. according to dalmau, these antibodies cause a titer - dependent, reversible decrease of synaptic nmdar by a mechanism of cross linking and internalization. on the basis of models of pharmacological or genetic disruption of nmdar, these antibody effects reveal a probable pathogenic relation between the depletion of receptors and the clinical features of anti - nmda receptor encephalitis. also have uni / bilateral ovarian teratomas while in males, rarely a teratoma can be found in association. patients who do not improve with these first line therapies may improve with rituximab and cyclophosphamide. relapse occurs in 15 - 20% cases and is often associated with occult or relapsing teratoma. | context : we describe a case of paraneoplastic neurologic syndrome, namely n - methyl - d - aspartic acid receptor antibody associated limbic encephalitis, a rare cause of altered mental status in the young.case report : a 28 year old caucasian female nurse presented with acute onset difficulty with word finding and increasing confusion and agitation. she also had visual hallucinations, transient episodes of unresponsiveness, and lingual dyskinesias. workup including blood, imaging and regular cerebrospinal fluid (csf) studies was unremarkable. she subsequently developed complex partial seizures. computerized tomography scan of chest / abdomen / pelvis revealed a dermoid cyst of the left ovary and csf n - methyl - d - aspartic acid receptor antibody returned positive confirming the diagnosis of paraneoplastic nmda receptor antibody associated limbic encephalitis. she was treated with methylprednisolone therapy along with plasmapheresis and a left salpingo - opherectomy was performed. the patient showed significant improvement with respect to her cognitive function and had no more seizures.conclusion:n-methyl-d-aspartic acid receptor antibody associated limbic encephalitis is a rare paraneoplastic neurologic syndrome with symptoms including psychiatric manifestations, seizures, language disturbances and autonomic instability. it develops due to antibody induced decrease in n - methyl - d - aspartic acid receptors. there is a significant association with ovarian teratoma in > 50% female cases. treatment includes resection of tumor, glucocorticoids, plasmapheresis and intravenous immunoglobulin therapy. |
this study compared the efficacy and safety between 120-w thulium : yttrium - aluminum - garnet (tm : yag) vapoenucleation of prostates (thuvep) and holmium laser enucleation of prostates (holep) for patients with lower urinary tract symptoms (luts) due to benign prostatic hyperplasia (bph). a retrospective analysis of 88 consecutive patients with symptomatic bph was carried out, who underwent either 120-w thuvep or holep nonrandomly. patient demographics and peri - operative and 12-month follow - up data were analyzed with the international prostate symptom score (ipss), quality of life (qol) score, maximum flow rate (qmax), postvoid residual urine volume (pvr), and rates of peri - operative and late complications. the patients in each group showed no significant difference in preoperative parameters. compared with the holep group, patients in the 120-w thuvep group required significantly shorter time for laser enucleation (58.3 12.8 min vs. 70.5 22.3 min, p = 0.003), and resulted in a significant superiority in laser efficiency (resected prostate weight / laser enucleation time) for 120-w tm : yag laser compared to holmium : yag laser (0.69 0.18 vs. 0.61 0.19, p = 0.048). during 1, 6, and 12 months of follow - ups, the procedures did not demonstrate a significant difference in ipss, qol score, qmax, or pvr (p > 0.05). mean peri - operative decrease of hemoglobin in the holep group was similar to the thuvep group (17.1 12.0 g / l vs. 15.2 10.1 g / l, p = 0.415). early and late incidences of complications were low and did not differ significantly between the two groups of 120-w thuvep and holep patients (p > 0.05). 120-w thuvep and holep are potent, safe and efficient modalities of minimally invasive surgeries for patients with luts due to bph. compared with holep, 120-w thuvep offers advantages of reduction of laser enucleation time and improvement of laser efficiency. benign prostatic hyperplasia (bph) is one of the most frequent diseases in aging males and is also the major etiology of lower urinary tract symptoms (luts) with a negative impact on quality of life (qol). for decades, transurethral resection of prostates (turp) has been considered as the most established surgical treatment for luts secondary to bph at most urological practices. while the status of turp as gold standard has not been threatened, especially in most developing countries, there are still concerns regarding peri - operative morbidity such as severe bleeding, risk of fluid volume absorption, and prolonged recovery. an ideal treatment is the one that removes a significant amount of prostatic adenoma efficiently and has minimal peri - operative morbidity while providing equivalent and durable patient outcomes. the holmium : yttrium - aluminum - garnet (ho : yag) laser was the initial energy source used for the procedure of enucleating prostatic adenoma from the capsule. by the time of this study, the holmium laser enucleation of the prostate (holep) has been investigated in multiple randomized trials and proved to be an alternative to size independent endourological treatments for luts due to bph. in recent years, thulium : yag (tm : yag) laser prostatectomy has been introduced into the treatment of bph at four technical approaches as following : tm : yag vaporization, tm : yag vaporesection, tm : yag enucleation and tm : yag laser vapoenucleation of the prostate (thuvep). among those approaches, thuvep has been rigorously analyzed and represents a minimally invasive, size independent, and efficacious laser prostatectomy with promising long - term outcomes and low complication rates. both holep and thuvep appear to be likely candidates for a new standard for the surgical treatments of bph replacing the traditional turp. however, few studies have compared these two vaporizing enucleation technologies. therefore, through this study, we were committed to evaluate the efficiency, safety, and clinical effects of thuvep compared with holep. from august 2012 to june 2013, 88 symptomatic bph patients were retrospectively enrolled in the study, who underwent transurethral laser prostatectomy and met our inclusion criteria. among these patients, 46 accepted holep group, and 42 accepted 120-w thuvep group. before the surgery, detailed urological examinations, including a digital rectal examination (dre), transrectal ultrasound, assessment of the international prostate symptom score (ipss), and qol score, were carried out. postvoid residual urine (pvr) and urinary peak flow rate (qmax) were reviewed. workup included urine analysis, blood tests (including hemoglobin), and the measurement of serum prostate - specific antigen (psa), which was carried out before dre and instrumentation. in patients with abnormal psa values or suspect dres, a 12-core needle biopsy of the prostate was carried out. oral anticoagulation and platelet inhibition was terminated prior to the surgery and bridged with low molecular weight heparin, it was indicated by the patient. the study inclusion criteria included the followings : maximum urinary flow rate (qmax) was 7 pointsall patients were previously treated with conservative medical therapy using -blockers and/or 5-reductase inhibitors, which did not result in significant improvement in lutsexcluded criteria in this study were : patients with severe pulmonary disease or heart disease, bladder calculus, urodynamically diagnosed neurogenic bladder dysfunction, prostate cancer, previous prostatic or urethral surgery. maximum urinary flow rate (qmax) was < 15 ml per second all patients were previously treated with conservative medical therapy using -blockers and/or 5-reductase inhibitors, which did not result in significant improvement in luts excluded criteria in this study were : patients with severe pulmonary disease or heart disease, bladder calculus, urodynamically diagnosed neurogenic bladder dysfunction, prostate cancer, previous prostatic or urethral surgery. in all cases, spinal anesthesia was applied in the most patients except those who failed spinal anesthesia, in which case general anesthesia was used. as for equipment, it was selected as following : for holep, the energy source was an 100-w ho : yag laser (versapulse, lumenis inc., santa clara, ca, usa), delivered through a 550-nm end - firing fiber (slimlinetm 550, lumenis inc.). for thuvep, the energy source was the 120-w 2-m continuous - wave tm : yag laser (revolix, lisa laser products, katlenburg, germany), delivered through a 550-nm optical core bare - ended, re - usable laser fiber (rigifib, lisa laser products). both groups proceeded with a 26f continuous - flow laser resectoscope with a video system in combination with a mechanical tissue morcellator (piranha tur - set, richard wolf, knittlingen, germany). the holep procedure was performed as three - lobe technique. in brief, after marking of the distal resection border close to the apex of the prostate, a turner - warwick - like incision was made at the 5 and 7 oclock positions down to the surgical capsule. and then the lateral lobes were respectively enucleated by dissecting the prostatic adenoma from the peripheral zone at the layer of the surgical capsule. the holep procedure was performed at a laser setting of 2 j and 50 hz for enucleation, and 0.5 j and 40 hz defocused laser for hemostasis when bleeding vessels were encountered. after finishing the above procedures, a three - way foley catheter (20f or 22f) was placed into the bladder, and continuous irrigation is provided overnight. after the surgery, hemoglobin levels were measured within 1 day. operation time, laser enucleation time, morcellation time, resected prostatic weight, hemoglobin decrease, and peri - operative complications were recorded. follow - up was assessed at 1, 6, and 12 months after surgery. postoperative assessments during the follow - ups consisted of ipss, qol score and qmax at the 1, 6 and 12 months ; pvr volume and late complications at the 12 months. between the groups, baseline characteristics, as well as peri- and post - operative outcome parameters, including ipss, qol score, qmax, and pvr volume, were compared using the student 's t - test and are presented as the mean standard deviation. postoperative adverse events were evaluated using the two - tailed chi - square test, and fisher 's exact tests when appropriate. for repeated measures, two - way analysis of variance was used to compare the pre- and post - operative luts parameters within each group, including ipss, qol score, qmax, and pvr volume. statistical tests were performed with the statistical package for social sciences, version 13.0 for windows (spss, chicago, il, usa). the baseline characteristics between the two groups were comparable regarding the patient 's age, the prostate adenoma volume, psa levels, ipss, qol score, qmax, and pvr [table 1 ]. although the operation time in the thuvep group (90.6 17.8 min) was shorter than the holep group (98.2 26.0 min), no statistical significance was found in the difference (p = 0.109). despite the overall operation time, the time on laser enucleation by thuvep was shorter than the holmium laser significantly (58.3 12.8 min vs. 70.5 22.3 min, p = 0.003). moreover, results showed a significant superiority in laser efficiency for the 120-w tm : yag laser compared to the ho : yag laser (0.69 0.18 vs. 0.61 0.19, p = 0.048). the results did not show a significant difference between the two groups in mean values of resected prostate weight, enucleation ratio, morcellation time, or morcellation efficiency. baseline characteristics of patients in holep and thuvep groups results are shown as the mean sd (range). sd : standard deviation ; holep : holmium laser enucleation of prostates ; thuvep : thulium : yttrium - aluminum - garnet vapoenucleation of prostates ; psa : prostate - specific antigen ; ipss : international prostate symptom score ; qol : quality of life ; pvr : postvoid residual. peri - operative outcomes between holep and thuvep groups results are shown as the mean sd (range). holep : holmium laser enucleation of prostates ; thuvep : thulium : yttrium - aluminum - garnet vapoenucleation of prostates ; sd : standard deviation. mean peri - operative decrease of hemoglobin in the holep group was similar to the thuvep group (17.1 12.0 g / l vs. 15.2 10.1 g / l, p = 0.415). three in the holep group and two in the thuvep group showed decreased hemoglobin concentration of more than 40, 2.4% of cases (1/42) found capsular perforation in the thuvep group, comparable with 2.2% (1/46) in the holep group (p = 0.948). the results also demonstrated similar rates of blood transfusion in the holep group (2/46, 4.3%) and in the thuvep group (1/42, 2.4%) (p = 0.612). both groups required similar mean time for catheterization and hospital stay as listed in table 2. in the table, there were three patients in the holep and thuvep groups respectively, using prolonged postoperative catheterization because of continuous gross hematuria. peri - operative symptomatic urinary tract infection occurred in five patients, consisting of two in the holep group and three in the thuvep group, which did not show a significant difference between the two groups (4.3% vs. 7.1%, p = 0.917). no findings of other early complications were reported including transurethral resection syndrome, clot retention, hemorrhage requiring cystoscopy for coagulation, ureteric orifice injury, bladder injury during morcellation, or incomplete morcellation. no patient was lost during the 12-month follow - up except one patient who accepted two reoperations at the 1.5 and 5 months after holep respectively because of bladder neck contracture. both the holep and the thuvep groups were comparable on ipss, qol score, qmax, and pvr volume at the 1, 6 and 12 months follow - up [table 3 ]. these parameters were significantly improved at every follow - up point in each group compared with the baseline values (p = 0.000). complications within 12 months were reported. at the 1 month follow - up, five patients complained urge incontinence (5/46, 10.9%) and two had slight stress incontinence (2/46, 4.3%) in the holep group. there is no significant difference in the thuvep group, either for urge incontinence (2/42, 4.8%, p = 0.507) or for slight stress incontinence (1/42, 2.4%, p = 0.612). no patients had persistent irritative urinary symptoms or incontinence, urethral stricture requiring reoperation, or sub - meatal / meatal stenosis. comparison of outcomes between holep and thuvep groups results are shown as the mean sd (range). in holep group, n = 45 at 6 and 12 months follow - up ; student s t - test. holep : holmium laser enucleation of prostates ; thuvep : thulium : yttrium - aluminum - garnet vapoenucleation of prostates ; sd : standard deviation ; ipss : international prostate symptom score ; qol : quality of life ; pvr : postvoid residual. for many years, turp was referred as the gold standard surgical therapy for patients with bph. recently while major drawbacks of contemporary turp remain, such as intraoperative and peri - operative complications, many new endoscopic technologies have been introduced to treat bph. in fact, there is great competition among the various modalities of endoscopic treatment for bph in a race for minimal invasiveness, decreasing surgical morbidity, and long - term efficacy. from our point of view, laser - based transurethral prostatectomy has been proven to these criteria and, therefore, may offer a treatment option. the holep is the first technique using an end - firing laser fiber to enter the native anatomical plane between the prostatic lobe and surgical capsule and then to enucleate the prostate adenoma from the capsule. a series of clinical studies have proven the efficacy and safety of holep. a recent systematic review and meta - analysis revealed superiority with holep in the improvement of luts parameters in both the intermediate and the long - term results with a low rate of morbidity, compared with contemporary mono - polar turp. however, it also showed holep, including enucleation and morcellation, was associated with longer operation time than turp. recently introduced tm : yag laser vapoenucleation (thuvep) has been reported as a minimally invasive, size - independent treatment modality for bph with promising intermediate and long - term follow - up outcomes. thuvep has the similar retrograde approach to holep, but very few data had been available for the comparison between these two techniques. in fact, neglecting the significant difference between these laser techniques in terms of laser - tissue effects may confuse the evaluation of the roles with different laser methods in the treatment of luts due to bph. in the present study, not surprisingly, both procedures removed prostatic adenoma with high efficacy and safety, and obtained satisfactory outcomes in relief of luts. at the 12-month follow - up, the mean ipss decreased about 70% and the mean qol score was improved five - fold in both groups. compared with the baseline parameters, those patients available for the follow - up showed better durability in pvr improvement and sufficient increases in qmax in both groups. at assessment points of the follow - up, no significant difference was found in voiding parameters or symptom scores between the thuvep and holep groups. it is expected that the amount of tissue removal will result in urodynamic improvement with regards to increased uroflowmetry, obstruction relief, and reduced pvr urine. following a holep - like approach, thuvep has been proved capable of reducing the volume of the prostate more than 80%, which confirmed the adequate removal of the prostatic adenoma and corresponded with published series on holep. we did not find any significant superiority in total operation time comparing thuvep to holep in this study. 120-w tm : yag laser provided shorter laser enucleation time and higher enucleation efficacy than ho : yag laser, to a level of statistical significance. zhang. compared the efficacy and safety between thulium and holep, and longer operation time was observed in the thulep group. but in his study, the enucleation was done by blunt lifting the prostate adenoma in the direction of the bladder neck, which is materially different from the technique in thuvep. in addition, a 70-w tm : yag laser system was used instead in zhang. 's study. it has been proved that the more powerful tm : yag laser resulted in an increased rate of tissue ablation but without apparently increased risks of complications. in an ex vivo evaluation of tm : yag laser treatment for bph, bach. observed the tissue ablation rate was improved by nearly 70% (from 9.80 g/10 min to 16.41 g/10 min) when the power output increased from 70 w to 120 w. also, netsch. reported 120-w tm : yag laser system enhanced the effectiveness of thuvep compared with the 70-w tm : yag device, regarding enucleation and overall operation efficiency. the difference in enucleation efficacy between thuvep and holep may be attributed to the physical properties of the laser itself. with a chromophore of targeting water and a wavelength around 2000 nm, tm : yag laser can vaporize prostate tissues efficiently in a shallow optical penetration of approximately 0.2 mm. the continuous mode of radiation emission supports tm : yag laser to perform efficient resection and vaporization simultaneously with optimal coagulation and hemostasis effects. therefore, due to the excellent ablation capacity, the tm : yag laser can vaporize prostate tissue easily upon the surgical capsule in a nearly non - bleeding surgical environment. on the contrary, ho : yag laser is emitted in a pulsed mode and uses several kilowatt pulse peak power. during the enucleation, high - energy concentration can be achieved with each short high - peak power laser pulse, resulting in vigorous expanding and collapsing steam bubbles, which create disruptions of prostatic tissue through the surgical plane between the adenoma and the capsule. under a relatively high power ho : yag laser, these disruptions may make hemostasis more challenging at the time of enucleating. so the holep operator has to take adequate time to adjust energy density by reducing the radiation energy and pulse rates, or by increasing the distance from the tip of the laser to the target bleeding vessels. in our series, the mean blood loss was low in both groups, due to the peri - operative hemoglobin decrease and the transfusion rate. five patients, three by holep and two by thuvep, decreased the hemoglobin concentration of more than 40 the increased surface area of the prostatic capsule along with more vascular density can influence and achieve hemostasis despite the ablation efficiency of the laser. it is worth noting that capsular perforation occurred in only one patient with 120-w thuvep, and this incidence (2.4%) appears comparable to those reported previously (1.43.2%) in series of both 70- and 120-w thuvep studies. satisfactory control of unintended collateral tissue damage was achieved and contributed to the shallow penetration depth of the tm : yag laser, which produced a coagulation zone in a stable extent even with high - powered laser devices. overall, holep and thuvep showed a low incidence rate of late complications at the 12-month follow - up in our study. bladder neck contracture requiring surgical treatment occurred in 2.2% (1/46) of the patients with holep, which is comparable to the previous series of studies (0.63.0%). by contrast, none of the 42 patients in thuvep group occurred bladder neck contracture. previously, the incidences of bladder neck contracture reported after thuvep were < 2%, and even absent in large prostate volume series and in patients on anticoagulant therapy. besides, transient urge / stress urinary incontinence to a certain degree was present in both groups, and the incidence rates had no significant difference, in which cases the patients recovered within 6 months. transient stress incontinence is a well - known problem after holep, developing in up to 44% of patients. in contrast after thuvep, previous reports on incidences of urge urinary incontinence ranged from 0.8% to 5.4%, and those on stress incontinence presented in 1.711.5%. from the experience with holep, the surgical technique is an important factor contributing to the risk of postoperative incontinence. in the same way, extra caution should be taken to avoid injury to the sphincter when treating the apical tissue, as well as to the superficial bladder during morcellating. the continuous vaporizing performance of the tm : yag laser offers a potential advantage over holep to obtain an optimal view with less bleeding, which means more uncomplicated correction of the anatomical layer and less coagulation in bladder neck tissues. the major limitations of our study lie within the nonrandomized retrospective study design, the possible bias when reporting own complications, and the fact that this series was conducted at a single institution. moreover, another limitation of this study may be the small sample size, which limited the power of the analysis. a much larger initial trial would have been required to maintain high numbers at a long - term duration of follow - up. however, strength of this work may be summarized as the first direct comparison of efficacy and safety between 120-w thuvep and holep, and our data suggested that thuvep offers a significant superiority in efficiency of laser enucleation during the procedure. both 120-w thuvep and holep are safe and efficient and minimally invasive treatment modalities for patients with luts due to bph. compared with holep, 120-w thuvep offers advantages in reducing laser enucleation time and improving laser efficiency. assessment at the 12-month follow - up showed no difference in urinary parameters and morbidity incidences. however, well - designed randomized trials with extended follow - up and larger sample sizes, may be needed to draw final conclusions about the long - term efficacy of these procedures. | background : this study compared the efficacy and safety between 120-w thulium : yttrium - aluminum - garnet (tm : yag) vapoenucleation of prostates (thuvep) and holmium laser enucleation of prostates (holep) for patients with lower urinary tract symptoms (luts) due to benign prostatic hyperplasia (bph).methods : a retrospective analysis of 88 consecutive patients with symptomatic bph was carried out, who underwent either 120-w thuvep or holep nonrandomly. patient demographics and peri - operative and 12-month follow - up data were analyzed with the international prostate symptom score (ipss), quality of life (qol) score, maximum flow rate (qmax), postvoid residual urine volume (pvr), and rates of peri - operative and late complications.results:the patients in each group showed no significant difference in preoperative parameters. compared with the holep group, patients in the 120-w thuvep group required significantly shorter time for laser enucleation (58.3 12.8 min vs. 70.5 22.3 min, p = 0.003), and resulted in a significant superiority in laser efficiency (resected prostate weight / laser enucleation time) for 120-w tm : yag laser compared to holmium : yag laser (0.69 0.18 vs. 0.61 0.19, p = 0.048). during 1, 6, and 12 months of follow - ups, the procedures did not demonstrate a significant difference in ipss, qol score, qmax, or pvr (p > 0.05). mean peri - operative decrease of hemoglobin in the holep group was similar to the thuvep group (17.1 12.0 g / l vs. 15.2 10.1 g / l, p = 0.415). early and late incidences of complications were low and did not differ significantly between the two groups of 120-w thuvep and holep patients (p > 0.05).conclusions:120-w thuvep and holep are potent, safe and efficient modalities of minimally invasive surgeries for patients with luts due to bph. compared with holep, 120-w thuvep offers advantages of reduction of laser enucleation time and improvement of laser efficiency. |
the pandemic of type 2 diabetes mellitus (t2 dm) and cardiometabolic risk has led to concerns over the future population burden of chronic heart and kidney disease. because of the very tight relationships between heart and kidney regulation, function, and codependence, changes in the operational parameters of one organ system affect the other on a multitude of levels. there has been considerable progress in the areas of preventive cardiology including smoking cessation, lipid reduction, and blood pressure and glycemic control which have resulted in reductions of myocardial infarction and heart failure ; however, patients with chronic kidney disease (ckd) remain as a concern given the narrow therapeutic window for most management strategies including procedures, devices, and medications.1 for example, in patients admitted with acute decompensated heart failure, approximately 25% develop type 1 cardiorenal syndrome and a sequential decline in renal filtration function which prolongs hospitalization, complicates management, and in some cases, leads to death.2 conversely, in patients with ckd, death from cardiac causes is a larger clinical threat than the development of end - stage renal disease requiring renal replacement therapy.3 while conventional cardiac and renal therapeutic targets are of principal concern to practitioners today, the search for common cellular processes that may serve as therapeutic targets has led to promising new approaches.4 thus, the interest and enthusiasm for new therapeutic agents that can favorably affect the function of one or both organs and lead to considerable improvement in measurable clinical outcomes is piqued in this renascent era of cardiorenal medicine.5 the filtration barrier within the renal glomerulus has been the subject of investigation for decades. as blood moves from the renal arterioles into the preglomerular afferents and the tortuous glomerular tufts, a critical hydrostatic and oncotic pressure head is maintained.6 the filtration barrier from endovascular to urinary that is traversed by water and solute includes the negatively charged endothelial glycocalyx, fenestrated endothelium, gelatinous basement membrane, and slit diaphragm created by the foot processes of podocytes. pathobiologic changes occur at the level of the endothelium and the podocyte in all patients with t2 dm that lead to the eventual decline in glomerular filtration function and loss of blood proteins in the urine ; which in turn, accelerate disease progression in other nephron units and in aggregate contribute to the global development of diabetic ckd, where there is obvious histological damage to these structures in approximately two thirds of patients.7,8 thus, in patients with t2 dm with optimal blood pressure and glycemic control, early preservation of normal glomerular function and use of agents that antagonize the renin angiotensin system has been a principal approach to reducing the microvascular complications of t2 dm including diabetic nephropathy. thus, progress in the prevention or delay of the progression of diabetic nephropathy has led to the following question : what fundamental cellular pathobiologic processes can be modified to reverse dysfunction before there is cell death, loss of nephron architecture, and organ fibrosis ? all cells in the body have fundamental metabolic functions for energy production and utilization, respiration, protein synthesis, storage, communication, and defense. understanding of host cell defense mechanisms presumably to guard against infectious agents has led to the concept of innate immunity. innate immunity means that each cell has a fundamental set of functions it can operationalize to defend a direct attack in the absence of traditional host defense systems including the traditional components of inflammation : white blood cells, cytokines, antibodies, and complement. mediated through a variety of conjectured mechanisms (glycated proteins, metabolic signals, insulin, adiponectin, and others), and cytokines, endothelial cells and podocytes can activate a variety of pathways used for innate immunity including intracellular production of reactive oxygen species that, in the absence of an infectious attack, work to promote cellular dysfunction and eventual death. counter - regulation of this process offers the opportunity to reverse cellular dysfunction and potentially improve organ function. transcription factor nf - e2-related factor 2, or nrf-2 is a key regulator of antioxidant, anti - inflammatory and detoxification pathways within cells presumably endothelial cells and podocytes (figure 1).913 in t2 dm, nrf-2 is modestly upregulated, presumably in response to the oxidative stress environment with cells. keap-1 (kelch - like ech - associated protein 1) represses the function of nrf-2 and contributes to a regulatory balance over hundreds of genes that control oxidation/ antioxidation and detoxification within cells.14,15 bardoxolone methyl (bard) is a small molecule activator of nrf-2, which works to push cellular metabolic balance in favor of antioxidation and detoxification and relatively overpowers keap-1. these molecules include sulforaphane derived from the cabbage family (broccoli, watercress, brussels sprouts, cabbage and cauliflower), diallyl sulfides (from garlic, onion and chives), curcumin (from turmeric), quercetin (from tea, berries, apples and onions), astaxanthin (from krill, microalgae), resveratrol (from grapes, knotweed), and caffeic acid phenethyl ester (found in bee hives).16 of note, gold has also been shown to induce nrf-2, and thus, may derive its anti - inflammatory properties from this mechanism. most of the nrf-2 activators have been shown to have some modest anti - inflammatory or antioxidant effects. thus, the rationale for a powerful nrf-2 activator such as bard is supported from a broad base of molecular research. originally tested as an anticancer agent, bard was found to be protective against cisplatin - induced renal toxicity and improve renal filtration function in animals.17 others had found that induction of nrf-2 by other methods also appeared to be renally protective by enhancing the cytoprotective antioxidant function of normal cells.18 thus, bard was brought forward as a possible agent in the use of t2 dm ckd where there is considerable evidence for loss of control over oxidative and inflammatory processes within vascular and glomerular endothelial cells, podocytes, mesangial cells, and proximal tubules.19,20 the majority of studies evaluating bard in humans are in abstract form and presented in table 1. because transcription factor - kappa b and signal transducer and activator of transcription 3 are activated in many tumors and promote proliferation, angiogenesis, metastasis, and tumor survival, hong and coworkers intended to leverage the keap-1 binding and nrf-2 inhibition with bard 900 mg per oral four times daily (po qd) as part of a 21 day/28 cycle treatment of multidrug chemotherapy in patients with a variety of primary cancers (melanoma, renal, thyroid, and others) for up to 12 months.21 bardoxolone methyl appeared to reduce tumor cell variability, signal transducer and activator of transcription 3, and transcription factor - kappa b expression by immunohistochemistry in subjects with repeated biopsies. in addition, the drug was well tolerated in these patients with advanced tumor burden. the first paper incorporating these patients as well as another group of phase i subjects was presented in 2009 and demonstrated within 21 days, in patients with baseline serum creatinine levels and estimated glomerular filtration rate (egfr) of 1.00 mg / dl and 79.9 ml / min/1.73 m, respectively, 82% (49/60) of bard - treated patients experienced a mean decrease in serum creatinine levels of 19.3%, corresponding to a mean 20.9% increase in egfr. of note, the egfr improvements were more pronounced in a subset (n = 13) of patients with established ckd (egfr 300 mg / g. at 56 weeks, the mean and median egfr rose by 7.2 and 5.5 ml / kg/1.73 m respectively, p < 0.0001. those with the lowest baseline egfr values tended to have the greatest increases with bard (figure 1). of note, there was a minor increase in 24 hour urine creatinine (1272.1 452.7 to 1333.5 440.6, p = 0.47) and an increase in a urinary marker of renal damage, neutrophil gelatinase - associated lipocalin (ngal) from 79.0 98.8 to 93.2 112.5, p = 0.93. thus, there were questions over real changes in renal filtration function and whether or not bard influenced constitutive production of ngal, a marker of chronic renal damage in diabetic nephropathy.24 the most common adverse effect reported was skeletal muscle spasms in 35% of subjects. of note, schwartz and colleagues observed that glycemic control improved in patients with t2 dm as given in table 1.25 these observations were the basis for a phase ii double - blind placebo controlled trial of bard at three doses (25, 75, 150 mg) versus placebo in 227 t2 dm patients with an egfr 20 to 45 ml / min/1.73 m (stages 3 and 4 ckd).26 the primary and secondary outcomes were the change from baseline in egfr at 24 and 52 weeks, respectively. the mean egfr was 32 ml / min/1.73 m. the albumin : creatinine ratio was less than 30 (normoalbuminuria) in 37% of patients, 30 to 300 (microalbuminuria) in 29%, and more than 300 (macroalbuminuria) in 34%. the rise in egfr for each group treated with bard peaked at 12 weeks. the greatest mean increase in egfr was observed in the bard 75 mg group, 11.4 ml / min/1.73 m from a baseline of 33.0 (36% increase). increases in all three groups were sustained out to 52 weeks (figure 3). again the most common adverse event reported with bard was muscle spasms which occurred in 42% of the 25 mg group, 61% of the 75 mg group, and 59% of the 150-mg group. the muscle spasms were most common in the calf muscles of the lower leg. additionally, hypomagnesemia occurred in 21%, 25%, and 32% of the bard 25, 75, and 150 mg groups, respectively. a total of 18 patients (11%) had transient alanine aminotransferase elevation of more than three times the upper limit of the normal range, but there was evidence of cholestasis or hepatic failure. the synthesis of clinical information to date with bard on the kidneys is mixed. while there is improvement in egfr, elimination of urinary creatinine was not impressive and there was no salutary signal seen with ngal, a reliable proteomic measure of renal health both in chronic and acute kidney disease.27 there have been no studies on the influence of bard on microalbuminuria or proteinuria. because bard has been associated with a reduction in body weight, of which ~25% is usually muscle mass, it is possible that a portion of the improvement in egfr is attributable to a reduction in creatinine production.28 while bard may improve renal filtration by a variety of effects on the filtration barrier, it is possible that it also has a hemodynamic effect and result in elevation of intraglomerular pressure. as a result of either mechanism, there is considerable translational evidence that increasing glomerular filtration in the setting of a reduced nephron mass is due to hyperfiltration of the remaining nephrons. hyperfiltration, while in the short - term lowers serum creatinine, ultimately leads to greater losses of nephrons and ultimately a hastened progression of kidney disease in many models.29 as with potential salutary effects on the podocyte and other participating line lines involved in glomerular filtration, it is possible that bard may impact the myocardium. the consistent effect of bard on skeletal muscle suggests it influences either transit of electrolytes across the cell membrane and sarcoplasmic reticulum or contractile elements more directly as a result of its many influences on the nucleus. lower blood magnesium levels are common with bard and it is possible that a relative deficiency of cellular and plasma magnesium could lead to myocyte and dysfunction and arrhythmias.30,31 in addition, hypomagnesemia has been associated with renal tubular inflammation via activation of nuclear factor kappa beta and a more progressive course to end - stage renal disease in patients with diabetic nephropathy.32,33 it has been shown that nrf-2 upregulates the mrna, protein, and activity of the antioxidant enzyme heme - oxygenase-1 as well as mrna and protein for nuclear respiratory factor-1 (nrf-1) in cardiac myocytes.34 heme- oxygenase-1 directs a feedback loop involving the generation of intracellular carbon monoxide and hydrogen peroxide to amplify the expression of the gene for nrf-1 and the accumulation of nuclear nrf-1 protein leads to gene activation for mitochondrial biogenesis, which opposes apoptosis and necrosis in experimental models anthracycline - induced cardiac injury. however, mitochondrial biogenesis can also be induced by peroxisome proliferator - activated receptor (ppar) gamma co - activator-1 alpha.35 in both animal models and clinical trials, stimulation of ppar - gamma therapeutically over time leads to salt and water retention and heart failure.36 changes in myocyte mitochondrial biogenesis may link future observations with bard in both the skeletal muscles and the heart. thus, a biphasic response can be seen with early improvement and later decline reflected by the increase and later decrease in the number of mitochondria within the cells.37 we recognize this line of deduction concerning intracellular processes and the effects of bard is highly speculative at this point, however, if blood pressure is found to increase or if impaired left ventricular function is observed in future trials with bard, this chain of logic should be considered. in summary, bard could induce overall favorable effects on the heart via its improvement in egfr ; however, at a cellular and tissue level, chronic exposure to bard theoretically could lead to adverse changes that contribute either directly or indirectly to cardiomyopathy, pump failure, and arrhythmias. this review has summarized the cellular and clinical effects of bard to date as they relate to the heart and kidneys. while there is great hope for an agent that improves renal filtration function, we reserve caution with respect to adverse organ toxicity over time to both the glomerulus and the myocardium. only large, prospective randomized trials with carefully collected and adjudicated clinical outcomes will inform the research community on the therapeutic risks and benefits of this important new agent. | the intracellular and tissue balance of oxidant and antioxidant forces is a potential therapeutic target for a variety of agents in the treatment of complications due to chronic disease including diabetes mellitus and hypertension. there are a myriad of processes controlled at the level of genes, transcription factors, and protein messages that work to control the normal use of oxidative reactions within cells. loss of control of these processes may lead to reversible dysfunction in many cell lines including the podocyte, renal tubular cells, and cardiac myocytes. bardoxolone methyl is a novel nuclear regulator factor (nrf-2) activator which works to tip the balance of effects towards antioxidation and as an observation made serendipitously, improves renal filtration function in humans after approximately 12 weeks of therapy. the improvement in estimated glomerular filtration can be up to 30% in those with stage 3 and 4 chronic kidney disease. however, experimental evidence suggests there may be a consequence of relative hyperfiltration in diseased kidneys as well as potential adverse effects on skeletal and cardiac myocytes. only large, prospective randomized trials with carefully collected and adjudicated clinical outcomes will inform the research community on the therapeutic risks and benefits of this important new agent. |
the presence of circulating tumor cells (ctcs) serves as a prognostic marker and indicator of disease relapse, as well as a means of evaluating treatment efficacy in human and canine lymphoma patients. as an extension of our previous study for the construction of clinically useful genescan system, we utilized the genescan system for detecting ctcs in canine lymphoma patients. samples from the primary lesion and peripheral blood mononuclear cells (pbmcs) were obtained from 32 dogs with lymphoma at initial diagnosis. all samples were subjected to polymerase chain reaction (pcr) for antigen receptor gene rearrangements (parr) followed by genescan analysis. common clonal rearrangements with identical amplified fragments were detected in both the primary lesion and pbmcs in 19 of the 32 dogs (59.4%). however, the detection rate of ctcs varied among the anatomical classification of lymphoma studied. genescan analysis following parr would facilitate studies on determining the clinical significance of ctcs in canine lymphoma patients. |
|
the kansas idea network of biomedical research excellence (k - inbre, originally designated the kansas - biomedical research infrastructure network) program is a national institutes of health (nih)-funded program to develop biomedical infrastructure and research in the state of kansas (http://www.kumc.edu/kinbre/). the aim of the k - inbre undergraduate program is to enhance the undergraduate educational experience by providing funding to undergraduate students, the next generation of biomedical scientists, to do research at the 10 participating institutions in the states of kansas and oklahoma. the lead university is the university of kansas medical center (ku - mc), which has a comprehensive medical school and offers many doctoral programs leading to the phd. the k - inbre also has two comprehensive undergraduate and graduate phd - granting institutions : the university of kansas - lawrence (ku - l) and kansas state university (ksu). the program also has five predominantly undergraduate institutions (puis) that award masters level degrees : emporia state university (esu), fort hays state university (fhsu), pittsburg state university (psu), washburn university (wu), and wichita state university (wsu). the k - inbre also includes two predominantly undergraduate institutions that serve mainly minority students haskell indian nations university (hinu) and langston university (lu). the breadth of missions among k - inbre campuses requires that the k - inbre have a flexible vision for how each institution achieves its mission as it fulfills the k - inbre s goals. therefore, the execution and design of activities on each campus are unique to each site because it is recognized that programs that are appropriate at one institution may not be appropriate at another. nevertheless, the major focus for each institution s program is to introduce undergraduate students to biomedical research. the k - inbre has continuously monitored students initial placement after graduation for the last 10 years. however, we wanted additional feedback about program perceptions and career choices and outcomes beyond the initial tracking after graduation. programs such as this often lose touch with their participants after the students initial postgraduation placement. therefore, the survey was intended to provide additional feedback about student perceptions of the program and subsequent career outcomes and help us test the hypothesis that student enrollment in post - baccalaureate programs will be better if they participate in high - quality undergraduate research experiences compared with other undergraduates. this paper presents outcomes of k - inbre participants since 2002 and the results of a survey sent to participants in the program through november 2011. the goal of the k - inbre undergraduate program is to introduce undergraduate students to biomedical research. each campus is provided funding ($ 28,000) to enrich undergraduate participation in research. activities considered for the program include : research scholarships for undergraduates, research mini - grants for faculty working with students, summer research programs for high school students, support for gatherings of k - inbre participants to share information and experiences, and support to create informational / recruitment brochures to increase participation and awareness of the k - inbre program. other appropriate activities include : student travel support, sponsorship of symposia for student oral / poster presentations, support for the implementation of formal course credit for the research experience, funding for programs for undergraduate access to primary research literature on - line, support for programs to incorporate new technologies into existing classes to better prepare students for graduate research, funding for invited speaker travel, and mini - grants to help update equipment for undergraduate student research. the programs that had k - inbre support, and which campuses participated in them, are summarized in table 1. for this program, students are selected on each campus by the on - campus faculty. in general, at our k - inbre institutions, faculty have very close interactions with the students. criteria such as motivation, class standing (e.g., fr. vs. sr.), and a faculty member s experience with the student are often included as selection criteria. grades, previous research experience, letters of recommendation, enrollment in a research class, mini - grants outlining the project, and postgraduate interests are used for selection in various combinations., hinu ; kansas state univ., ksu ; kansas university - lawrence, ku - l ; kansas university - medical center, ku - mc ; langston univ. in addition to individual campus programs, the k - inbre also funds approximately 30 summer / semester scholarships each year ($ 4,000/student), which are independent of the campus funding (http://www.kumc.edu/kinbre/summer_scholar_recipients.html). these applications are reviewed for project quality and student qualifications by the k - inbre incentives and awards committee. the students supply transcripts, letters of recommendation, a biosketch, and a one - page research project outline. the mentor, who will supervise the student s research, is also required to supply an nih biosketch. the committee uses all of this information to select high - quality students and mentors into the program. the funding allows students to participate in research either during the summer, during the academic year, or both. this program selects outstanding junior students who have already shown strong research potential to receive a $ 7,500 stipend during their senior year (http://www.kumc.edu/kinbre/star_trainee_recipients.html), and the faculty mentor s lab receives $ 2,500 for supplies. star trainees also have $ 10,000 applied to their graduate stipend if they enroll in a graduate program in the state of kansas. applications are reviewed for project quality and student qualifications by the k - inbre incentives and awards committee using the same information that is used for summer / semester scholars. from 20102012, the k - inbre received additional scholarship money from the american recovery and restoration act (arra). this program allowed students to receive funding for one year at a level of $ 5,000 per student. the same selection requirements used for the summer / semester scholars were used for the arra scholars and accounted for a 5% increase in the number of students who were funded by the k - inbre (table 2). summer / semester scholars, arra scholars and star trainees were reviewed and awarded state - wide by the k - inbre incentives and awards committee. percent of students in each of the four k - inbre undergraduate programs (may 2002may 2012). in addition to laboratory research, all k - inbre students are asked to participate in at least six intra - campus k - inbre scholar meetings per year to share student progress and learn from mentor experiences as part of the program. campuses are provided with $ 200 per year for refreshments for these meetings from the k - inbre undergraduate office. the k - inbre also holds an annual, program - wide symposium to allow students to present research posters, with some of the students asked to present orally along with national and regional faculty speakers. the one - and - a - half day symposium has grown from an initial participation of 25 student abstracts with 75 faculty and student participants in january 2003, to 108 student abstracts and 255 faculty and student participants in january 2012 (http://www.kumc.edu/kinbre/symposium_schedule.html). students are also encouraged to participate in individual campus research forums and national professional meetings. to assess student outcomes, each campus coordinator recorded the number of students falling into the following categories : funded as summer / semester scholars, funded by regular k - inbre campus funding, matriculated into graduate school, matriculated into medical school, matriculated into an md / phd program, pursued other medical professional programs, other outcomes, funded in the star trainee program, star trainee program participants who enter graduate school, and undergraduates currently in the program (table 2). the survey was administered using surveymonkey (http://www.surveymonkey.com/), and consisted of 20 questions inquiring about participation, research, outcomes, careers, program impact, social media, and the demographics of the students (appendix 1). most of the questions were multiple - choice with areas to add comments or expand on answers. some of the questions were developed based on previous undergraduate assessments (11, 12) to allow for comparative analyses. at the time of the survey, 659 students had participated in the k - inbre over the approximate 10-year period at our 10 participating campuses. contact information was available for 569 out of 659 current and former students as of october 2011. surveys were sent out via surveymonkey to the e - mail addresses after two notifications indicating that the k - inbre would be doing the assessment and the importance of the survey. the survey was open for approximately 2.5 months (october 17december 31) with 11 follow - up e - mail reminders, including one from the campus coordinators at the schools that the students attended. in addition, as incentive for participation, we announced that respondents could elect to be eligible for a draw for an ipod. forty - one of the e - mail addresses to which the survey was sent bounced back, leaving us with 528 possible survey responders. two of the students opted out of the survey and future communication from k - inbre. two hundred twenty - four students responded to the survey, a 42% response rate (table 3). 224 students responded out of 528 students who were e - mailed requests to participate in surveys based on deliverable e - mail addresses. the goal of the k - inbre undergraduate program is to introduce undergraduate students to biomedical research. each campus is provided funding ($ 28,000) to enrich undergraduate participation in research. activities considered for the program include : research scholarships for undergraduates, research mini - grants for faculty working with students, summer research programs for high school students, support for gatherings of k - inbre participants to share information and experiences, and support to create informational / recruitment brochures to increase participation and awareness of the k - inbre program. other appropriate activities include : student travel support, sponsorship of symposia for student oral / poster presentations, support for the implementation of formal course credit for the research experience, funding for programs for undergraduate access to primary research literature on - line, support for programs to incorporate new technologies into existing classes to better prepare students for graduate research, funding for invited speaker travel, and mini - grants to help update equipment for undergraduate student research. the programs that had k - inbre support, and which campuses participated in them, are summarized in table 1. for this program, students are selected on each campus by the on - campus faculty. in general, at our k - inbre institutions, faculty have very close interactions with the students. criteria such as motivation, class standing (e.g., fr. vs. sr.), and a faculty member s experience with the student are often included as selection criteria. grades, previous research experience, letters of recommendation, enrollment in a research class, mini - grants outlining the project, and postgraduate interests are used for selection in various combinations., hinu ; kansas state univ., ksu ; kansas university - lawrence, ku - l ; kansas university - medical center, ku - mc ; langston univ. in addition to individual campus programs, the k - inbre also funds approximately 30 summer / semester scholarships each year ($ 4,000/student), which are independent of the campus funding (http://www.kumc.edu/kinbre/summer_scholar_recipients.html). these applications are reviewed for project quality and student qualifications by the k - inbre incentives and awards committee. the students supply transcripts, letters of recommendation, a biosketch, and a one - page research project outline. the mentor, who will supervise the student s research, is also required to supply an nih biosketch. the committee uses all of this information to select high - quality students and mentors into the program. the funding allows students to participate in research either during the summer, during the academic year, or both. this program selects outstanding junior students who have already shown strong research potential to receive a $ 7,500 stipend during their senior year (http://www.kumc.edu/kinbre/star_trainee_recipients.html), and the faculty mentor s lab receives $ 2,500 for supplies. star trainees also have $ 10,000 applied to their graduate stipend if they enroll in a graduate program in the state of kansas. applications are reviewed for project quality and student qualifications by the k - inbre incentives and awards committee using the same information that is used for summer / semester scholars. from 20102012, the k - inbre received additional scholarship money from the american recovery and restoration act (arra). this program allowed students to receive funding for one year at a level of $ 5,000 per student. the same selection requirements used for the summer / semester scholars were used for the arra scholars and accounted for a 5% increase in the number of students who were funded by the k - inbre (table 2). summer / semester scholars, arra scholars and star trainees were reviewed and awarded state - wide by the k - inbre incentives and awards committee. percent of students in each of the four k - inbre undergraduate programs (may 2002may 2012). in addition to laboratory research, all k - inbre students are asked to participate in at least six intra - campus k - inbre scholar meetings per year to share student progress and learn from mentor experiences as part of the program. campuses are provided with $ 200 per year for refreshments for these meetings from the k - inbre undergraduate office. the k - inbre also holds an annual, program - wide symposium to allow students to present research posters, with some of the students asked to present orally along with national and regional faculty speakers. the one - and - a - half day symposium has grown from an initial participation of 25 student abstracts with 75 faculty and student participants in january 2003, to 108 student abstracts and 255 faculty and student participants in january 2012 (http://www.kumc.edu/kinbre/symposium_schedule.html). students are also encouraged to participate in individual campus research forums and national professional meetings. to assess student outcomes, each campus coordinator recorded the number of students falling into the following categories : funded as summer / semester scholars, funded by regular k - inbre campus funding, matriculated into graduate school, matriculated into medical school, matriculated into an md / phd program, pursued other medical professional programs, other outcomes, funded in the star trainee program, star trainee program participants who enter graduate school, and undergraduates currently in the program (table 2). the survey was administered using surveymonkey (http://www.surveymonkey.com/), and consisted of 20 questions inquiring about participation, research, outcomes, careers, program impact, social media, and the demographics of the students (appendix 1). most of the questions were multiple - choice with areas to add comments or expand on answers. some of the questions were developed based on previous undergraduate assessments (11, 12) to allow for comparative analyses. at the time of the survey, 659 students had participated in the k - inbre over the approximate 10-year period at our 10 participating campuses. contact information was available for 569 out of 659 current and former students as of october 2011. surveys were sent out via surveymonkey to the e - mail addresses after two notifications indicating that the k - inbre would be doing the assessment and the importance of the survey. the survey was open for approximately 2.5 months (october 17december 31) with 11 follow - up e - mail reminders, including one from the campus coordinators at the schools that the students attended. in addition, as incentive for participation, we announced that respondents could elect to be eligible for a draw for an ipod. forty - one of the e - mail addresses to which the survey was sent bounced back, leaving us with 528 possible survey responders. two of the students opted out of the survey and future communication from k - inbre. two hundred twenty - four students responded to the survey, a 42% response rate (table 3). 224 students responded out of 528 students who were e - mailed requests to participate in surveys based on deliverable e - mail addresses. there was a 42% response to the k - inbre survey by students who had participated or were currently participating in the k - inbre program based on successful e - mail notifications. survey respondents represented all but one (hinu) of our k - inbre campuses and the distribution of respondents was not statistically different (p = 0.15, test) from the distribution of student participants throughout the entire length of the program (table 3). the absence of respondents from hinu reflects that hinu was the campus with the smallest number of students that participated in formal research (table 3), and possibly the general hesitancy of native americans to participate in assessments (4). the survey participants were fairly evenly distributed based on when they graduated (baccalaureate degree) and when they started postgraduate studies (i.e. medical or graduate school) (table 4). the experience of the survey participants exceeded that of the general k - inbre student population based on the number of semesters that a student was funded by the k - inbre (table 5). there was a higher percentage of students who had more than two semesters of funding among the survey respondents (47%) compared with the overall statistics compiled by the k - inbre from 20022012 (23% ; p = 0.03, test). perhaps more experienced students felt a greater obligation to respond to our inquiry or they were more motivated because they had a good experience in the program. regardless, the number of students who participated for two semesters was the largest group for both our survey respondents and total k - inbre participants from 20022012 (table 5). the pattern was also true for students who participated one semester (second highest), four semesters (third highest), three semesters (fourth highest), and five semesters (fifth highest). four respondents did not answer and one received a dvm without obtaining a baccalaureate degree. year respondent entered medical or graduate school, 39 answered n / a and 62 skipped the question. the gender of the survey respondents closely paralleled the gender distribution of student participants throughout the entire program s life (p = 0.54, test) (table 6). the higher percentage of female participants reflects the growing trend of more females receiving bachelor s degrees than males (7) and the gender distribution of participating students reported by other undergraduate research programs (8, 11). the racial distribution of the survey respondents was 71% white, 8% black, 9% asian, and < 1% american indian, native hawaiian, or pacific islander (table 7). five percent of our survey respondents indicated that they were of hispanic, latino, or spanish origin. this is consistent with the distribution of students in other undergraduate research surveys (8, 11) and approximates the general participation of students in our program from 20022012. however, because ethnic distribution was only informally tracked in our program until recently, we did not attempt to do a statistical analysis on this demographic. 5% of the respondents indicated they were of hispanic, latino, or spanish origin, regardless of race, 92% indicated they were not, 3% indicated that they would rather not answer. to evaluate the k - inbre impact, we asked a series of questions about working independently and formulating ideas, being motivated, learning, analyzing and interpreting data, understanding the scientific process, overcoming obstacles, and increasing one s self - confidence (table 8). average scores for k - inbre participants were high, ranging from 4.144.52 (table 8). these scores equaled or exceeded the mean scores for similar assessments of non - k - inbre - funded undergraduates doing research reported in 2004, 2007 (11, 12), and 2010 (8). for example, when asked if the k - inbre improved my understanding of how knowledge is constructed and how scientists work on real problems, the average k - inbre score was 4.52/5.00 (table 8). in the analysis of surveys of undergraduate research experiences (sure) (11, 12), which included students from many different kinds of colleges and universities across the united states, similar inquiries about growth experienced by students funded by the howard hughes medical institute (hhmi) or by students who changed to graduate education in science (ges students) scored 4.10/5.00 and 4.20/5.00, respectively. when asked if the k - inbre improved my ability to integrate theory and practice, a similar question scored 3.85/5.00 for hhmi - funded students and 4.13/5.00 for ges students (11). when asked if the k - inbre gave me tolerance for obstacles faced in the research process, the average k - inbre score was 4.46/5.00. in the sure assessment, the same question scored 4.10/5.00 for hhmi - funded students and 4.18/5.00 for ges students. tolerance for obstacles to that of students in the undergraduate research program at emory university (8). the average k - inbre scores exceeded the scores of the emory university students (4.00/5.00) (8). moreover, when k - inbre students were asked to rank the statement, it increased my self - confidence, the response averaged 4.14/5.00 (table 8). in the sure assessment, a similar question scored 3.59/5.00 for hhmi - funded students and 4.03/5.00 for ges student respondents (11). self confidence scores for all students reported in both the 2004 and 2007 sure analyses were 3.50/5.00 (11, 12) and 3.7 at emory (8). therefore, in all the assessments summarized in table 8, the students scored the k - inbre program equal to or higher than students participating in research experiences assessed in the sure or at emory university. the sample size of the k - inbre assessment was smaller than the sure assessment (224 vs. 1135) (11, 12) or the undergraduate assessment done at emory university (822). however, since the k - inbre survey respondents appeared to reflect the general experience, demography, and campus distribution of the total k - inbre student participation pool, it is likely that similar data would be obtained with a larger sample size. however, it is possible that whatever motivated students to respond to the survey may have also affected their opinion. it is important to note that the k - inbre survey also included students who worked on research during the academic year, so the student populations may not always be directly comparable to the sure survey (11), which only analyzed students in summer research programs. student research experience : to what extent did your research experience change you ? 220 out of 224 students responded to these questions. students could strongly agree (5), agree (4), neither agree nor disagree (3), disagree (2) or strongly disagree (1). one recurring theme among the student comments was how the k - inbre program provided experience and confidence (appendix 2). for example, one student indicated, it gave me the confidence to pursue an independent graduate studies program, the master s international program through the peace corps... without my k - inbre experience, i would not have had the confidence to participate in this program k - inbre gave me a chance to explore science and help me decide that i wanted to be a scientist it gave me confidence that i never had, it let me believe that ordinary people like me can make scientific discoveries. if it is not for this program, i would never believe i could give a talk in front of a hundred people (appendix 1, comment 70). we assessed the types of scientific presentations made by k - inbre survey respondents (table 9). over 70% of k - inbre students were able to present a poster off campus or at a conference or professional meeting. over 27% were authors on a manuscript intended for publication in a professional journal (table 9). lopatto reported that 27.9% of undergraduates participating in research presented posters at conferences or professional meetings, and that 19.7% were authors on a manuscript intended for a professional journal (10). nearly 21% of the k - inbre students surveyed were able to give a talk off campus at a conference or professional meeting. lopatto reported that 12.9% of the students surveyed in his assessments gave a talk or colloquium at a conference or professional meeting (10). almost 68% of k - inbre students surveyed were able to make a poster presentation on campus (table 9). therefore, k - inbre students had excellent opportunities to develop communication skills and had opportunities to present their research at levels comparable to, or better than, those seen in other undergraduate research programs. we attribute part of this outstanding participation metric on the annual k - inbre symposium..perhaps the most important impact is attending the general meeting each january and realizing that i am part of a very large and very intelligent community of people who are interested in the same things as i am and who are willing to collaborate and share ideas and information. coming from a small institution, it is not always possible to look around and realize my peers are there. more than one choice was allowed ; therefore, the numbers will not add up to 100%. the k - inbre survey inquired about students impressions of their research experience (table 10), whether they would recommend the program to future students (table 11), and whether they thought the k - inbre program should be continued (table 12). over 90% of the k - inbre students indicated that they had a positive experience and that they learned a lot and would do it again, with over 27% of those students indicating that their research project was fantastic (table 10). the overall student impression was 4.16/5.00, and over 98% of the students surveyed agreed with the statement, the k - inbre made a big impact on my life and i recommend that other students participate in the program one hundred percent of the students agreed or strongly agreed that the k - inbre program is an important program for student development and should be continued in kansas (table 12). the positive k - inbre impact is consistent with the general positive influence undergraduate research has on student academic development (10), especially for students at puis (16). this is also consistent with the finding that over 90% of k - inbre survey respondents agreed or strongly agreed that the participation in the k - inbre program helped in the student s career choice (table 13). even when students indicated that research was not a career outcome, they felt that the k - inbre research program provided a positive learning experience. i learned a little more about science, how to contribute to science, how to interpret / read literature, how to formulate experiments, how to get frustrated, how to gain resilience... we also assessed k - inbre participants experience with the k - inbre s electronic presence. only one - third of the survey respondents had visited the k - inbre website in the last year and less than 20% were friends of k - inbre on facebook or had visited the k - inbre facebook page (table 14). as part of the k - inbre survey we assessed the career choices of survey respondents (table 15). almost 40% of former k - inbre participants who graduated went on to attend graduate school. just under 28% eight percent of the respondents attended md / phd programs, and another 11% entered other medical professional programs. the k - inbre supported 723 students at our 10 participating institutions from 2002 to 2012, including our star trainees, arra scholars, and our summer / semester scholars (table 2). thirty - eight percent of our students entered into graduate programs (including md / phd programs). twenty percent of our students went to medical school (including md / phd programs) and 12% went into other biomedical professions (table 2). these numbers closely parallel the career choices of the survey respondents, although a higher percentage of md / phd students responded to the survey compared with our overall student population (8% vs. 1% ; tables 2 and 15). our star trainee program is one that allows promising undergraduate students to get extensive science and laboratory training as undergraduates, and by helping support them their first year in graduate school we make them attractive graduate student candidates. forty - three star trainees have participated in the program since its inception in 2003, and 81% of those who completed their undergraduate degrees went into graduate programs (table 2). n / a, not applicable. according to the national center for education statistics, which has published several long - term cohort studies of individuals who received their bachelor s degrees, in the 19921993 cohort, 29.8% enrolled in graduate school by 1997 (13). twenty - four percent of those students were enrolled in the life or physical sciences (13). importantly, of the 29.8%, only about half (49% of the 29.8% = 14.6%) were enrolled within 1 year of graduation (13), which is the temporal metric the k - inbre has been using as an outcome. therefore, the k - inbre overall post graduate success of 69% entering some kind of graduate, medical, or professional program is two to four times higher than the national average for the 1992 cohort, depending on which population is used as a comparison (total in four years that go on to post - baccalaureate degrees or within one year after graduation, respectively). in similar types of analyses, in the summary of 19992000 bachelor s degree recipients (3), 22% went to graduate school or professional school. of those who graduated with degrees in life science of those with degrees in a health field, 24.2% went on to graduate or professional school. similarly, in the 200809 baccalaureate and beyond longitudinal study (7), based on post - baccalaureate enrollment data (table 5), 42.4% of students receive master s degrees, doctoral degrees, or at least one professional degree. therefore, the k - inbre overall postgraduate success of 69% entering some kind of postgraduate, medical, or professional program ranges from 1.7 to 3.1 times higher than these national estimates depending on which cohort group is used as a comparison (fig. 1). comparison of k - inbre student post - baccalaureate success to other national metrics. percent of k - inbre students entering post - baccalaureate programs compared to the national center for education statistics (nces) bachelor s degree recipients 1 year later 19921993 cohort (13), the nces 19992000 cohort (3), the nces baccalaureate and beyond longitudinal study 20082009 cohort (7), national science foundation statistics (14), the council of graduate schools (cgs) survey 2002010 (2), and the 2009 college senior survey (5). the number of science bachelor s degrees awarded in 2008 was 426,260 in the usa (14 ; table 218). there were 99,501 first - time, full - time graduate students in those same fields in 2009 (14 ; table 223). therefore, based on the statistics of the nsf, approximately 23.3% of the graduates in agricultural, biological, and physical sciences went to graduate school. according to the council of graduate schools, 30.2% of the applications to biological and agricultural sciences were accepted in the usa (2). the 2009 college senior survey (css) indicates that 28.9% of 2009 college graduates will attend graduate - professional school (5). therefore, the k - inbre success in graduate school placement (3) exceeds these national statistics by over two times (fig. 1). in assessing students in the k - inbre who go on to medical school, according to the association of american medical colleges, 19,230 people were accepted into medical school in the united states in 2011 (1). therefore, the percentage of science baccalaureate recipients who went to medical school in 2011, based on nsf 2009 science bachelor s degrees (434,835) (14 ; table 218), is just under 5% (19,230/434,835 = 0.044). according to the css, 6% of students go to medical or dental school (5). therefore, it is difficult to know which population of students should be used to calculate the percentage of bachelor s degree recipients who go on to medical school. if one uses just natural science graduates (14 ; table 218), that percentage rises to 11% (19,230/181,914 = 0.106). regardless of the population used for comparisons, the percent of k - inbre students going to medical school exceeds national estimates. the k - inbre student attitude and success in entering postgraduate studies were mirrored by the results of a national survey conducted between 2003 and 2005 (15). the russell report indicated that involving students in undergraduate research led to better student understanding of research, more self - confidence, and higher awareness of what to look for in graduate programs. thirty percent of russell report respondents said that being involved in research increased their interest a lot in a career in a science, technology, engineering, or a math field (15). ninety percent of k - inbre survey respondents indicated that participation in the program helped them in their career choices. moreover, just bringing undergraduates into laboratories is not the only thing that makes for a successful program. according to the chronicle of higher education s report on undergraduate research, undergraduates learn and grow significantly from their research experiences, but require a strong mentor relationship to do so a long - term study, conducted at indiana university, indicates that undergraduates do better when their mentors make it clear how important the student projects are (9). the k - inbre s strong survey scores in helping students work independently (4.35/5.00), making them more active learners (4.32/5.00), improving their ability to integrate theory and practice (4.32/5.00), and increasing their ability to work in a team (3.92/5.00) all indicate that there must be strong mentorship in the program and that they are active participants in the research process. students gain more from a research experience if they are involved in assessment and literature review, and not just collecting data (9). over 27% of our k - inbre survey respondents indicated that they were co - authors on a manuscript intended for publication in a professional journal (table 9), and a recurring theme among the student comments (appendix 2) was about the available mentoring and how it influenced them. i have also been give[n ] the chance to engage with fellow research partners and learn from an influential mentor. k - inbre piqued my interest in biomedical research, which ultimately drove me to attend graduate school. i actually pursued graduate studies with my k - inbre mentor, since i had such a fantastic research experience as an undergraduate indeed, bad mentoring did lead to a bad student experience in our program as well. i was denied the opportunity to see the project through from conception through synthesis of the final [product ] (appendix 2, comment 152). in conclusion, for participants in the k - inbre program, the percentage of students who go on to post - baccalaureate programs (e.g., medical, graduate, or professional) equals (using some conservative estimates), or exceeds (using several different measures), national estimates (fig. perhaps the flexibility of our individual campus faculty to select some students on less objective measures (i.e. motivation, faculty student interactions) along with more traditional selection processes (i.e. summer / semester scholar selection) allows us to identify strong students who fit traditional norms as well as ones who do not. based on the information collected from our survey, the k - inbre program is a positive experience for most of the participants (appendix 2). additionally, most students continued to pursue careers in the biomedical field beyond their undergraduate education. indeed, we discovered that 47% of the students who responded to the survey who initially took jobs eventually went to graduate or medical school. in total, these data suggest that the student undergraduate training program is meeting the goals and objectives of the kansas inbre. the survey was limited by the ability to contact all past participants and reinforced that we need to find ways to keep better contact with our students. we did not have contact information for everyone who had participated in the program because it has been difficult to keep information updated when people move and change jobs. we had hoped that our use of social media (e.g., facebook) would help link us to former students. the data suggest that additional efforts will be needed by the k - inbre program to improve this communication medium. there was a 42% response to the k - inbre survey by students who had participated or were currently participating in the k - inbre program based on successful e - mail notifications. survey respondents represented all but one (hinu) of our k - inbre campuses and the distribution of respondents was not statistically different (p = 0.15, test) from the distribution of student participants throughout the entire length of the program (table 3). the absence of respondents from hinu reflects that hinu was the campus with the smallest number of students that participated in formal research (table 3), and possibly the general hesitancy of native americans to participate in assessments (4). the survey participants were fairly evenly distributed based on when they graduated (baccalaureate degree) and when they started postgraduate studies (i.e. medical or graduate school) (table 4). the experience of the survey participants exceeded that of the general k - inbre student population based on the number of semesters that a student was funded by the k - inbre (table 5). there was a higher percentage of students who had more than two semesters of funding among the survey respondents (47%) compared with the overall statistics compiled by the k - inbre from 20022012 (23% ; p = 0.03, test). perhaps more experienced students felt a greater obligation to respond to our inquiry or they were more motivated because they had a good experience in the program. regardless, the number of students who participated for two semesters was the largest group for both our survey respondents and total k - inbre participants from 20022012 (table 5). the pattern was also true for students who participated one semester (second highest), four semesters (third highest), three semesters (fourth highest), and five semesters (fifth highest). four respondents did not answer and one received a dvm without obtaining a baccalaureate degree. year respondent entered medical or graduate school, 39 answered n / a and 62 skipped the question. the gender of the survey respondents closely paralleled the gender distribution of student participants throughout the entire program s life (p = 0.54, test) (table 6). the higher percentage of female participants reflects the growing trend of more females receiving bachelor s degrees than males (7) and the gender distribution of participating students reported by other undergraduate research programs (8, 11). the racial distribution of the survey respondents was 71% white, 8% black, 9% asian, and < 1% american indian, native hawaiian, or pacific islander (table 7). five percent of our survey respondents indicated that they were of hispanic, latino, or spanish origin. this is consistent with the distribution of students in other undergraduate research surveys (8, 11) and approximates the general participation of students in our program from 20022012. however, because ethnic distribution was only informally tracked in our program until recently, we did not attempt to do a statistical analysis on this demographic. 5% of the respondents indicated they were of hispanic, latino, or spanish origin, regardless of race, 92% indicated they were not, 3% indicated that they would rather not answer. to evaluate the k - inbre impact, we asked a series of questions about working independently and formulating ideas, being motivated, learning, analyzing and interpreting data, understanding the scientific process, overcoming obstacles, and increasing one s self - confidence (table 8). average scores for k - inbre participants were high, ranging from 4.144.52 (table 8). these scores equaled or exceeded the mean scores for similar assessments of non - k - inbre - funded undergraduates doing research reported in 2004, 2007 (11, 12), and 2010 (8). for example, when asked if the k - inbre improved my understanding of how knowledge is constructed and how scientists work on real problems, the average k - inbre score was 4.52/5.00 (table 8). in the analysis of surveys of undergraduate research experiences (sure) (11, 12), which included students from many different kinds of colleges and universities across the united states, similar inquiries about growth experienced by students funded by the howard hughes medical institute (hhmi) or by students who changed to graduate education in science (ges students) scored 4.10/5.00 and 4.20/5.00, respectively. when asked if the k - inbre improved my ability to integrate theory and practice, a similar question scored 3.85/5.00 for hhmi - funded students and 4.13/5.00 for ges students (11). when asked if the k - inbre gave me tolerance for obstacles faced in the research process, the average k - inbre score was 4.46/5.00. in the sure assessment, the same question scored 4.10/5.00 for hhmi - funded students and 4.18/5.00 for ges students. tolerance for obstacles to that of students in the undergraduate research program at emory university (8). the average k - inbre scores exceeded the scores of the emory university students (4.00/5.00) (8). moreover, when k - inbre students were asked to rank the statement, it increased my self - confidence, the response averaged 4.14/5.00 (table 8). in the sure assessment, a similar question scored 3.59/5.00 for hhmi - funded students and 4.03/5.00 for ges student respondents (11). self confidence scores for all students reported in both the 2004 and 2007 sure analyses were 3.50/5.00 (11, 12) and 3.7 at emory (8). therefore, in all the assessments summarized in table 8, the students scored the k - inbre program equal to or higher than students participating in research experiences assessed in the sure or at emory university. the sample size of the k - inbre assessment was smaller than the sure assessment (224 vs. 1135) (11, 12) or the undergraduate assessment done at emory university (822). however, since the k - inbre survey respondents appeared to reflect the general experience, demography, and campus distribution of the total k - inbre student participation pool, it is likely that similar data would be obtained with a larger sample size. however, it is possible that whatever motivated students to respond to the survey may have also affected their opinion. it is important to note that the k - inbre survey also included students who worked on research during the academic year, so the student populations may not always be directly comparable to the sure survey (11), which only analyzed students in summer research programs. student research experience : to what extent did your research experience change you ? 220 out of 224 students responded to these questions. students could strongly agree (5), agree (4), neither agree nor disagree (3), disagree (2) or strongly disagree (1). one recurring theme among the student comments was how the k - inbre program provided experience and confidence (appendix 2). for example, one student indicated, it gave me the confidence to pursue an independent graduate studies program, the master s international program through the peace corps... without my k - inbre experience, i would not have had the confidence to participate in this program k - inbre gave me a chance to explore science and help me decide that i wanted to be a scientist it gave me confidence that i never had, it let me believe that ordinary people like me can make scientific discoveries. if it is not for this program, i would never believe i could give a talk in front of a hundred people (appendix 1, comment 70). we assessed the types of scientific presentations made by k - inbre survey respondents (table 9). over 70% of k - inbre students were able to present a poster off campus or at a conference or professional meeting. over 27% were authors on a manuscript intended for publication in a professional journal (table 9). lopatto reported that 27.9% of undergraduates participating in research presented posters at conferences or professional meetings, and that 19.7% were authors on a manuscript intended for a professional journal (10). nearly 21% of the k - inbre students surveyed were able to give a talk off campus at a conference or professional meeting. lopatto reported that 12.9% of the students surveyed in his assessments gave a talk or colloquium at a conference or professional meeting (10). almost 68% of k - inbre students surveyed were able to make a poster presentation on campus (table 9). therefore, k - inbre students had excellent opportunities to develop communication skills and had opportunities to present their research at levels comparable to, or better than, those seen in other undergraduate research programs. we attribute part of this outstanding participation metric on the annual k - inbre symposium..perhaps the most important impact is attending the general meeting each january and realizing that i am part of a very large and very intelligent community of people who are interested in the same things as i am and who are willing to collaborate and share ideas and information. coming from a small institution, it is not always possible to look around and realize my peers are there. more than one choice was allowed ; therefore, the numbers will not add up to 100%. the k - inbre survey inquired about students impressions of their research experience (table 10), whether they would recommend the program to future students (table 11), and whether they thought the k - inbre program should be continued (table 12). over 90% of the k - inbre students indicated that they had a positive experience and that they learned a lot and would do it again, with over 27% of those students indicating that their research project was fantastic (table 10). the overall student impression was 4.16/5.00, and over 98% of the students surveyed agreed with the statement, the k - inbre made a big impact on my life and i recommend that other students participate in the program one hundred percent of the students agreed or strongly agreed that the k - inbre program is an important program for student development and should be continued in kansas (table 12). the positive k - inbre impact is consistent with the general positive influence undergraduate research has on student academic development (10), especially for students at puis (16). this is also consistent with the finding that over 90% of k - inbre survey respondents agreed or strongly agreed that the participation in the k - inbre program helped in the student s career choice (table 13). even when students indicated that research was not a career outcome, they felt that the k - inbre research program provided a positive learning experience. i learned a little more about science, how to contribute to science, how to interpret / read literature, how to formulate experiments, how to get frustrated, how to gain resilience... we also assessed k - inbre participants experience with the k - inbre s electronic presence. only one - third of the survey respondents had visited the k - inbre website in the last year and less than 20% were friends of k - inbre on facebook or had visited the k - inbre facebook page (table 14). as part of the k - inbre survey we assessed the career choices of survey respondents (table 15). almost 40% of former k - inbre participants who graduated went on to attend graduate school. just under 28% eight percent of the respondents attended md / phd programs, and another 11% entered other medical professional programs. the k - inbre supported 723 students at our 10 participating institutions from 2002 to 2012, including our star trainees, arra scholars, and our summer / semester scholars (table 2). thirty - eight percent of our students entered into graduate programs (including md / phd programs). twenty percent of our students went to medical school (including md / phd programs) and 12% went into other biomedical professions (table 2). these numbers closely parallel the career choices of the survey respondents, although a higher percentage of md / phd students responded to the survey compared with our overall student population (8% vs. 1% ; tables 2 and 15). our star trainee program is one that allows promising undergraduate students to get extensive science and laboratory training as undergraduates, and by helping support them their first year in graduate school we make them attractive graduate student candidates. forty - three star trainees have participated in the program since its inception in 2003, and 81% of those who completed their undergraduate degrees went into graduate programs (table 2). n / a, not applicable. according to the national center for education statistics, which has published several long - term cohort studies of individuals who received their bachelor s degrees, in the 19921993 cohort, 29.8% enrolled in graduate school by 1997 (13). twenty - four percent of those students were enrolled in the life or physical sciences (13). importantly, of the 29.8%, only about half (49% of the 29.8% = 14.6%) were enrolled within 1 year of graduation (13), which is the temporal metric the k - inbre has been using as an outcome. therefore, the k - inbre overall post graduate success of 69% entering some kind of graduate, medical, or professional program is two to four times higher than the national average for the 1992 cohort, depending on which population is used as a comparison (total in four years that go on to post - baccalaureate degrees or within one year after graduation, respectively). in similar types of analyses, in the summary of 19992000 bachelor s degree recipients (3), 22% went to graduate school or professional school. of those who graduated with degrees in life science, 38.1% went on to graduate or professional school. of those with degrees in a health field, 24.2% went on to graduate or professional school. similarly, in the 200809 baccalaureate and beyond longitudinal study (7), based on post - baccalaureate enrollment data (table 5), 42.4% of students receive master s degrees, doctoral degrees, or at least one professional degree. therefore, the k - inbre overall postgraduate success of 69% entering some kind of postgraduate, medical, or professional program ranges from 1.7 to 3.1 times higher than these national estimates depending on which cohort group is used as a comparison (fig. 1). comparison of k - inbre student post - baccalaureate success to other national metrics. percent of k - inbre students entering post - baccalaureate programs compared to the national center for education statistics (nces) bachelor s degree recipients 1 year later 19921993 cohort (13), the nces 19992000 cohort (3), the nces baccalaureate and beyond longitudinal study 20082009 cohort (7), national science foundation statistics (14), the council of graduate schools (cgs) survey 2002010 (2), and the 2009 college senior survey (5). the number of science bachelor s degrees awarded in 2008 was 426,260 in the usa (14 ; table 218). there were 99,501 first - time, full - time graduate students in those same fields in 2009 (14 ; table 223). therefore, based on the statistics of the nsf, approximately 23.3% of the graduates in agricultural, biological, and physical sciences went to graduate school. according to the council of graduate schools, 30.2% of the applications to biological and agricultural sciences were accepted in the usa (2). the 2009 college senior survey (css) indicates that 28.9% of 2009 college graduates will attend graduate - professional school (5). therefore, the k - inbre success in graduate school placement (3) exceeds these national statistics by over two times (fig. 1). in assessing students in the k - inbre who go on to medical school, according to the association of american medical colleges, 19,230 people were accepted into medical school in the united states in 2011 (1). therefore, the percentage of science baccalaureate recipients who went to medical school in 2011, based on nsf 2009 science bachelor s degrees (434,835) (14 ; table 218), is just under 5% (19,230/434,835 = 0.044). according to the css, 6% of students go to medical or dental school (5). therefore, it is difficult to know which population of students should be used to calculate the percentage of bachelor s degree recipients who go on to medical school. if one uses just natural science graduates (14 ; table 218), that percentage rises to 11% (19,230/181,914 = 0.106). regardless of the population used for comparisons, the percent of k - inbre students going to medical school exceeds national estimates. the k - inbre student attitude and success in entering postgraduate studies were mirrored by the results of a national survey conducted between 2003 and 2005 (15). the russell report indicated that involving students in undergraduate research led to better student understanding of research, more self - confidence, and higher awareness of what to look for in graduate programs. thirty percent of russell report respondents said that being involved in research increased their interest a lot in a career in a science, technology, engineering, or a math field (15). ninety percent of k - inbre survey respondents indicated that participation in the program helped them in their career choices. moreover, just bringing undergraduates into laboratories is not the only thing that makes for a successful program. according to the chronicle of higher education s report on undergraduate research, undergraduates learn and grow significantly from their research experiences, but require a strong mentor relationship to do so a long - term study, conducted at indiana university, indicates that undergraduates do better when their mentors make it clear how important the student projects are (9). the k - inbre s strong survey scores in helping students work independently (4.35/5.00), making them more active learners (4.32/5.00), improving their ability to integrate theory and practice (4.32/5.00), and increasing their ability to work in a team (3.92/5.00) all indicate that there must be strong mentorship in the program and that they are active participants in the research process. students gain more from a research experience if they are involved in assessment and literature review, and not just collecting data (9). over 27% of our k - inbre survey respondents indicated that they were co - authors on a manuscript intended for publication in a professional journal (table 9), and a recurring theme among the student comments (appendix 2) was about the available mentoring and how it influenced them. i have also been give[n ] the chance to engage with fellow research partners and learn from an influential mentor. k - inbre piqued my interest in biomedical research, which ultimately drove me to attend graduate school. i actually pursued graduate studies with my k - inbre mentor, since i had such a fantastic research experience as an undergraduate indeed, bad mentoring did lead to a bad student experience in our program as well. i was denied the opportunity to see the project through from conception through synthesis of the final [product ] (appendix 2, comment 152). in conclusion, for participants in the k - inbre program, the percentage of students who go on to post - baccalaureate programs (e.g., medical, graduate, or professional) equals (using some conservative estimates), or exceeds (using several different measures), national estimates (fig. perhaps the flexibility of our individual campus faculty to select some students on less objective measures (i.e. motivation, faculty student interactions) along with more traditional selection processes (i.e. summer / semester scholar selection) allows us to identify strong students who fit based on the information collected from our survey, the k - inbre program is a positive experience for most of the participants (appendix 2). additionally, most students continued to pursue careers in the biomedical field beyond their undergraduate education. indeed, we discovered that 47% of the students who responded to the survey who initially took jobs eventually went to graduate or medical school. in total, these data suggest that the student undergraduate training program is meeting the goals and objectives of the kansas inbre. the survey was limited by the ability to contact all past participants and reinforced that we need to find ways to keep better contact with our students. we did not have contact information for everyone who had participated in the program because it has been difficult to keep information updated when people move and change jobs. we had hoped that our use of social media (e.g., facebook) would help link us to former students. the data suggest that additional efforts will be needed by the k - inbre program to improve this communication medium. appendix 1 : k - inbre scholar survey appendix 2 : written comments by respondents to the k - inbre scholar survey | the kansas idea network of biomedical research excellence (k - inbre) was established in 2001 and is a network of 10 higher - education institutions in kansas and northern oklahoma. the program is funded by the institutional development award (idea) program of the national institutes of health (nih). as part of the program s goal to enhance the research infrastructure in kansas, a training program was developed to encourage undergraduates to participate in biomedical research. from september 2002 to may 2012, the k - inbre supported 731 students at 10 institutions. although 16% of student participants in the program are still undergraduates, 323 of our students have gone into biomedical graduate school or medical school programs. thirty - seven percent of all the completed students have matriculated into graduate programs and 19% of our completed students went to medical school. moreover, 12% have gone into other health - related professions. one percent of our students who went into medical school programs are in highly prestigious md / phd programs. in the fall of 2011, we surveyed participants from the last 10 years about career choices and the impact of the k - inbre program on those students. two hundred twenty - four former and current students responded to the survey with a consensus of high impact of the k - inbre program on student training, career choices, and perceptions about research. |
the fungal genus ceratocystis (microascales, sordariomycetes, ascomycota) includes numerous important plant pathogens, some of considerable economic importance. species in the c. fimbriata complex include c. platani that causes a serious wilt of platanus trees in europe (ocasio - morales. 2007), c. manginecans, causal agent of mango wilt disease (van wyk. 2007), and c. fimbriata sensu stricto, a pathogen of sweet potato (baker. 2003). the genus also encompasses several other species complexes that include economically important species (e.g. the thielaviopsis morph, punja & sun 1999), agents of blue stain in timber (e.g. c. polonica, christiansen 1985) and saprophytes. these fungi all have intriguing and little - understood associations with insects (seifert. recent studies on ceratocystis species have focused on species delimitation (van wyk. 2010), reproductive strategies (harrington & mcnew 1997, witthuhn. 2000) and links between pathogenicity and host range (ferreira. 2011). although genome sequence information represents an invaluable resource for such studies, whole genome sequences have not yet been determined for ceratocystis species or other members of the microascales. in this study, we report the availability of the nuclear genome sequence for an isolate of c. fimbriata. this ceratocystis species was chosen for sequencing because it is the type species of the genus (seifert. ex ipomoea batatas (sweet potato), december 1998, d. mcnew (cbs 114723, cmw 14799). the whole genome shotgun project of the ceratocystis fimbriata genome has been deposited in ddbj / embl / genbank under the accession apwk00000000. dna was extracted and subjected to 454 pyrosequencing (roche diagnostics, mannheim, germany) at inqaba biotechnology (pretoria, south africa). the resulting reads were assembled into a draft genome consisting of 3 668 contigs by using the newbler v. 2.3 genome assembler. the create detailed mapping report command of the clc genomics workbench package v. 5.0.1 (clc bio, aarhus, denmark) was used to produce statistics for the draft sequence. the draft genome had an estimated size of 29 410 862 bp (as calculated by summation of all the contig sizes), 20 average coverage, n50 contig size of 42 879 bases and an estimated gc content of 48.06 %. all contigs with a length of > 199 bp were submitted to ncbi s genome database. to assess the completeness of the genome, contigs of size 500 bp (2641 contigs) were analysed with the cegma pipeline (parra. although we did not produce a complete annotation for the c. fimbriata genome, analysis with augustus (stanke. 2006) identified 7 266 putative orfs at a gene density of 246 orfs / mb. of the putative protein coding genes, the majority (97 %) had 100 or more amino acids. the c. fimbriata genome is relatively small (29.4 mb) and harbours fewer genes than other fungal species such as fusarium graminearum (36.1 mb, 11 640 genes) (cuomo. 2007) and neurospora crassa (39.9 mb, 10 082 genes) (galagan. 2003). whether this difference is linked to the different lifestyles of these fungi requires further research. the availability of this ceratocystis genome sequence will contribute to our understanding of the molecular and cellular mechanisms underlying the biology of these and other fungi. | the draft nuclear genome of ceratocystis fimbriata, the type species of ceratocystis, is comprised of 29 410 862 bp. de novo gene prediction produced 7 266 genes, which is low for an ascomycete fungus. the availability of the genome provides opportunities to study aspects of the biology of this and other ceratocystis species. |
sepsis is an emergency condition associated with significant mortality and excessive inflammation [15 ]. sepsis caused by bacteremia arises from the host response to infection. currently, the diagnosis of sepsis caused by bacteremia relies on culture - based pathogen detection and physiological criteria, including changes in the body temperature and heart / respiration rates. while these clinical diagnostic criteria are simple and clear, novel sepsis biomarkers that can lead to a more reliable early diagnosis and therapeutic decision - making are urgently needed. until now, a number of molecules have been proposed as candidate sepsis biomarkers ; however, there are currently few useful predictive biomarkers for the severity and prognosis of sepsis available in clinical practice. recently, it was reported that the circulating free dna (cf - dna) levels in the blood are increased in various infectious diseases, including sepsis [7, 8 ]. accordingly, cf - dna has been suggested as a potential predictive biomarker for several different conditions, including cancer and injury [9, 10 ] ; moreover, one study of sepsis patients reported that greatly elevated plasma dna and nucleosome levels (> 800 ng / ml) were associated with a poorer outcome. furthermore, recent studies have reported that cf - dna is associated with neutrophil extracellular traps (nets) [7, 8, 10 ]. these are fibrous mesh - like structures that can rapidly trap and kill microbial pathogens. in activated neutrophils, a mixture of chromosomal dna and intracellular contents is extruded to the extracellular space as a fibrous structure upon a variety of proinflammatory stimuli [1315 ]. moreover, citrullinated histone h3 has been reported as a characteristic molecule involved in net formation in vitro, with citrullination of histone h3 by peptidylarginine deiminase 4 playing a pivotal role in chromatin decondensation during netosis [15, 16 ]. in terms of the contribution of nets to the host defense, it has been reported that depletion of nets can lead to hypersusceptibility to polymicrobial sepsis in mice. taken together, these previous findings suggest a potential relationship between cf - dna and nets in various aspects. however, it should be noted that most of the previous studies on cf - dna were conducted using only human samples, and whether cf - dna is indeed derived from nets remains unclear. in this study, using a mouse cecal ligation and puncture (clp) sepsis model, we confirmed the elevation of the cf - dna levels during sepsis and investigated whether the source of this cf - dna was neutrophils, with particular focus on the nets, or not. the clp model for polymicrobial sepsis developed by chaudry. was established as previously described, with some modifications. in brief, 7 - 8-week - old c57bl/6j mice were used for the clp operation ; these were housed under specific pathogen - free conditions with free access to standard rodent food and water. we used five c57bl/6j mice per group for each experiment, except for the experiment shown in figure 2(a), for which 13 mice in each group were used. under general anesthesia, midline laparotomy was performed and the cecum was exposed and ligated distal to the ileocecal valve to prevent bowel obstruction, and the distal part of the cecum was punctured with a 22-gauge needle. a small amount of cecal content was manually extruded from the punctured cecum into the abdominal cavity. in all studies, after returning the cecum into the abdomen, 1 ml of phosphate - buffered saline (pbs) for fluid resuscitation was administered to create a more clinically relevant sepsis model as the standard care for human operations. the sham mice were treated identically as the operated mice with the exception of the ligation and puncture of the gut. under these conditions, all clp mice showed signs of severe illness within 24 hours after the operation and high lethality after 48 hours. all animal experiments were conducted in accordance with the institutional animal care and use committee guidelines of osaka university. whole blood was collected from each mouse by cardiac puncture under anesthesia and transferred into ethylenediaminetetraacetic acid-2na tubes. the plasma was separated by centrifugation at 800 g for 10 minutes and immediately frozen at 80c. in order to explore the dynamics of cf - dna under septic conditions, plasma was collected at 6 and 24 hours after the clp operation from all mice, and the amount of cf - dna in the plasma at each time point was quantified directly using the quant - it picogreen dsdna quantification reagent kit (molecular probes, leiden, the netherlands) and a fluorescence microplate reader (sh-9000 lab, hitachi high - technologies, tokyo, japan) according to the manufacturers ' instructions. picogreen specifically binds dsdna, and after excitation at 485 nm, the dsdna / picogreen fluorescence complex can be detected at 538 nm. the plasma il-6 levels were measured by enzyme - linked immunosorbent assay (quantikine mouse il-6 immunoassay kit ; r&d systems, wiesbaden, germany) according to the manufacturer 's instructions. bacteremia in the clp mouse model was confirmed through analysis of whole blood immediately obtained by cardiac puncture. the local bacterial load in the clp mice was determined by 10-fold serial dilution to a maximum of 10. all samples were plated on sheep blood agar plates and incubated overnight at 37c under aerobic conditions. the numbers of bacteria were determined by manual counting of the colonies on the plates. dna was purified from the mouse plasma using the qiaamp blood dna midi kit (qiagen, venlo, the netherlands) in accordance with the manufacturer 's instructions. to quantify the estimated amount of dna in the plasma, 16s rdna and mouse -2-microglobulin (b2 m) were selected as representative targets of bacterial dna and mouse - derived dna, respectively, and taqman quantitative polymerase chain reaction (qpcr) assay of the purified dna was subsequently performed using an abi 7900ht real - time pcr machine (applied biosystems, foster city, ca, usa). amplification of each target was performed using the kapa sybr fast qpcr kit (kapa biosystems, inc., woburn, ma, usa) with the following primers : 16s - forward primer (1055f : 5-atggctgtcgtcagct-3), 16s - reverse primer (1392r : 5-acgggcggtgtgtac-3), b2m - forward primer (b2 m exon4-f ; 5-cttttggtaaagcaaagaggcc-3), and b2m - reverse primer (b2 m exon4-r ; 5-ttgggggtgagaattgctaag-3). the reaction mixture (8 l) contained 5 l of kapa sybr qpcr master mix, 0.2 l of distilled water, 0.4 l of each 5 m primer, and 2 l of sample dna. pcr was performed at 95c for 60 seconds, followed by 40 cycles of 95c for 15 seconds, 60c for 60 seconds, and final extension at 72c for 15 seconds. a standard curve was determined based on the concentration gradient of the purified dna from mouse whole blood for mice b2 m and the purified dna from streptococcus pneumoniae for 16s rdna. for each mouse, 20 l of blood was analyzed to count the number of white blood cells (wbcs) using the celltac hematology analyzer (mek-6308 ; nihon kohden, tokyo, japan). for neutrophil isolation, blood was collected from each mouse followed by separation with centrifugation for 20 minutes at 800 g using histopaque-1119 (sigma - aldrich, st. the neutrophil - rich phase was collected, washed in pbs, and separated by discontinuous density - gradient centrifugation in percoll (ge healthcare, buckinghamshire, uk), as previously described. subsequently, the neutrophils were collected from the 7075% layer of the percoll gradient and washed with pbs ; after hypotonic lysis with 0.2% and 1.6% nacl solutions to remove residual erythrocytes, the cells were resuspended in rpmi-1640 (invitrogen, waltham, ma, usa). purity and viability were routinely assessed using diff - quik stain (sysmex, kobe, japan) and trypan blue stain (wako pure chemical industries, osaka, japan), respectively, under a microscope. for flow cytometric analyses, isolated neutrophils were fixed in 2% paraformaldehyde for 5 minutes and washed three times in pbs with 3% fetal bovine serum (fbs). intracellular citrullinated histone h3 staining was carried out as follows : fixed neutrophils were incubated (10 cells / ml) in rpmi-1640 (sigma - aldrich) with 1% fbs for 30 minutes in the presence of 0.5% saponin. after washing with pbs, the cells were incubated with alexa488-conjugated rabbit citrullinated histone h3 antibody (ab5103 ; abcam, cambridge, uk) using the alexa fluor 488 monoclonal antibody labeling kit (invitrogen) or isotype control antibody (sc-45068 ; santa cruz biotechnology inc., santa cruz, ca, usa) for 20 minutes and then washed in pbs with 3% fbs. the cells were analyzed using fluorescence - activated cell sorting (facs) calibur with cellquest software (bd biosciences, san jose, ca, usa). for western blotting, cell lysates of percoll gradient - purified neutrophils were subjected to sds - page and transferred to a pvdf membrane blocked with can get signal blocking buffer (toyobo, osaka, japan) and incubated with goat polyclonal anti - histone h3 antibody (ab5103, abcam ; 1 : 1000 in tris - buffered saline - tween 20 [tbst ]) or rabbit polyclonal anti - citrullinated histone h3 antibody (ab12079 ; abcam ; 1 : 1000 in tbst) for 1 hour at room temperature. the proteins were detected upon incubation with horseradish peroxidase - conjugated anti - goat or anti - rabbit igg (1 : 10,000) for 15 minutes using ecl western blotting reagent (ge healthcare). the mice were intraperitoneally injected with 1 mg of isotype control rat igg or rat monoclonal anti - ly6 g antibody (1a8 ; bioxcell, lebanon, nh, usa) 2 days before and on the day of clp operation. subsequently, the mice were sacrificed and the whole blood and intraperitoneal wash from each mouse were subjected to cell counting at 6 and 24 hours after the operation. neutrophil depletion was confirmed by morphology using diff - quik stain and by cell counts using the celltac hematology analyzer. statistical analyses were performed using graphpad prism (version 5.02 ; graphpad software, san diego, ca, usa). data obtained from multiple groups were tested using the nonparametric kruskal - wallis test followed by post hoc dunn 's multiple comparison tests. data were considered to be statistically significant at p < 0.05. in the figures 1, 2, and 4, for each experiment, clp or sham operation was performed in five c57bl/6j mice each, and blood samples were collected at 6 and 24 hours after the operation. in the clp mice, the plasma il-6 levels were found to be increased 6 and 24 hours after clp. in contrast, plasma obtained from the sham - operated mice and nave mice contained extremely low levels of il-6 (figure 1(a)). likewise, no local bacterial load was detected from any of the blood cultures from these mice. on the other hand, for the clp mice, 2 out of 5 blood cultures were positive at 6 hours, and these contained approximately 1 10 cfu / ml ; at 24 hours, all samples (5/5) were positive for bacterial growth (approximately 1 10 cfu / ml ; figure 1(b)). these results confirmed that clp mice at 6 and 24 hours after clp operation are under septic conditions and can be used as a septic model for further analyses. the amount of cf - dna gradually increased at 6 hours after the clp operation and peaked at 24 hours. in contrast, the cf - dna levels were not elevated in the sham - operated mice and nave mice (figure 2(a)). as the elevation of the cf - dna amount may have been caused by bacteremia, the origin of the cf - dna was determined by qpcr of the plasma cf - dna using organism - specific primers (mouse b2 m and bacterial 16s rdna). the amount of 16s rdna was slightly increased in the plasma from the clp group at 6 hours after clp (figure 2(b)), whereas the amount of b2 m was significantly increased in the plasma from the clp group at 6 and 24 hours after clp (figure 2(c)). similar increments in the amount of b2 m were observed in each clp group, with the amount of 16s rdna being only approximately 1% of that of mouse b2 m at each time point. these results suggested that, even under septic conditions, the cf - dna was mainly derived from the host cells. it has been proposed that neutrophils contribute to the elevation of cf - dna in the blood ; however, it has not been demonstrated whether neutrophils, or more precisely nets, correlate with increased cf - dna levels under septic conditions. recently, it was reported that citrullinated histone h3 represents a likely hallmark of net formation via peptidylarginine deiminase 4. to test this hypothesis, whole blood was collected from the clp mice, and the neutrophils were isolated and subjected to western blotting and facs analysis using anti - citrullinated histone h3 as a net marker. compared with the neutrophils of nave mice, minimal differences in terms of the size of the anti - citrullinated histone h3 antibody bands were observed upon western blotting (figure 3(a)). similarly, facs analysis also revealed no shifts of the fluorescent peaks of citrullinated histone h3 between sham - operated and clp mice as compared with nave mice (figure 3(b)). to assess the involvement of neutrophils, the neutrophils were depleted by injection of anti - ly6 g antibodies. when the anti - ly6 g antibody was injected to the sham - operated group, their wbc numbers in the blood decreased, with less than 2% neutrophils observed in the wbc at 6 and 24 hours by diff - quik stain of the blood smear, confirming successful depletion of neutrophils. using the same protocol of neutrophil depletion, the neutrophil - depleted clp - operated mice showed significantly lower numbers of wbcs in the blood than those of the sham - operated mice. however, the clp - operated group treated with the control antibody showed similar low numbers of wbcs in the blood, which may have resulted from the consumption of the wbcs in the circulation at inflammation sites under septic condition (figure 4(a)). on the other hand, the wbc counts in the ascites from the clp - operated group with neutrophil depletion showed lower cell counts than those of the clp - operated group treated with the control antibody (figure 4(b)). along with the wbc counts, the bacterial load was also examined and indicated that neutrophil depletion had no effect on the bacterial load in the blood and ascites with versus without neutrophils (figures 4(c) and 4(d)). finally, the amount of cf - dna in each group was measured and revealed that the neutrophil depletion did not affect the amount of cf - dna in the blood under septic conditions (figure 4(e)). taken together, these results suggested that the increasing levels of cf - dna in the blood under septic conditions were derived from host cells other than neutrophils, which have been reported as a likely source of cf - dna by net formation. the presence of abnormally high levels of cf - dna in the plasma of patients with malignant diseases was first described in the 1970s. however, it is only recently that cf - dna has attracted attention in terms of its potential use as a diagnostic or prognostic marker [6, 9 ]. in this study, in vivo experiments using a clp mouse model of sepsis showed that the cf - dna levels increased in a time - dependent manner after the onset of sepsis (figure 2(a)). this finding confirmed the conclusion of previous clinical studies reporting that cf - dna correlated with the severity of the clinical outcome of sepsis [7, 8 ]. cf - dna is found in many pathophysiological conditions, including infection and cancer [7, 9, 2527 ]. these conditions generally involve apoptosis and/or necrosis ; therefore, it is reasonable to consider apoptosis and necrosis as sources for the presence of cf - dna. to date, cf - dna has been evaluated primarily as a biomarker of septic condition, whereas the potential function of cf - dna has not been investigated in detail. our results indicate that the sepsis model used in this study, the clp mouse model, is sufficient as an evaluation model for cf - dna. as another important result, we found that the increase in cf - dna in clp mice contained mostly host cf - dna and only negligibly amounts of bacterial dna. this finding suggests that the cf - dna was mainly derived from the host cells even under septic / bacteremic conditions. further, our study investigated whether net formation occurred during sepsis in our model, using citrullination of histone h3, a known net marker. interestingly, two independent experiments (western blotting and facs analysis) showed that citrullinated histone h3 was barely increased under septic conditions. as mentioned, citrullinated histone h3 has been reported as a characteristic feature of net formation and has been specifically implicated in the decondensation of the nucleus [16, 29 ]. therefore, our results suggested that, under septic conditions, the increase of cf - dna might not be derived from the nets produced by neutrophils, but rather from other types of host cells. although the relationship between citrullinated histone h3 and net formation was recently demonstrated in vitro, it has been suggested that the presence of citrullinated histone h3 is not an ultimate prerequisite for the formation of nets within individual neutrophils and the absence of an increase in the amount of citrullinated histone h3 in neutrophils observed in the present study implies a lack of involvement of nets in cf - dna production under in vivo septic conditions. although we originally hypothesized that neutrophils were the main source of cf - dna, as the citrullination of histone did not increase even under septic conditions, this hypothesis was refuted. previously, our group observed the presence of nets in circulating blood under systemic inflammatory response syndrome conditions, including sepsis, using fluorescent immunohistochemical analysis of blood smears, and several other studies have reported similar findings, hence suggesting a potential relationship between nets and cf - dna [7, 8, 10, 17 ]. therefore, the results acquired in the present study were surprising for us, as we expected that the cf - dna would comprise mainly net - derived dna. the exact mechanism of cf - dna production in the blood is still not understood ; although our experiments did not reveal the cells of cf - dna origin, our findings do indicate that nets do not participate in the production of cf - dna, at least not under severe bacteremic conditions. this discrepancy in terms of the source of cf - dna will need to be examined and confirmed by further experiments in the future. nonetheless, we speculate that a potential source of cf - dna might be necrotic tissue or apoptotic cells at the infection site, or, more specifically, endothelial cells. in fact, a relationship between cf - dna and plasma levels of typical cellular apoptotic markers has been described in lung cancer patients. moreover, an association between net - related endothelial damage and platelets has also been described. to study the innate immune mechanisms, host - derived and bacterial dna must be distinguished. in addition to citrullinated histone h3 used in this study, other mechanisms to accurately recognize host dna, including nets, such as detection of specific proteins like toll - like receptor-9 or detection of ds - dna or the cpg motif, may prove useful in future experiments. in innate immune mechanism, it is strictly controlled to distinguish between host - derived dna and bacterial dna. it would be possible to find out another unknown mechanism to recognize host dna including nets by specific protein such as cit - h3, besides toll - like receptor-9 to detect ds - dna of cpg motif. from our results and those of the previous reports on the topic, we believe that cf - dna shows potential as a noninvasive, useful biomarker of sepsis and bacteremia. however, the significance of cf - dna under sepsis has not yet been fully investigated. our experiments indicated that the clp mouse model is a promising model for studying the significance of cf - dna. in the future, using this model along with different animal models of sepsis, the mechanism of cf - dna production should be clarified to confirm the utility of cf - dna as a biomarker for sepsis, and clinical research on the relationship between cf - dna and clinical manifestations should be performed. in conclusion, our study using clp mice revealed that the cf - dna levels were elevated in the early phase of septic condition, implying a potential of cf - dna to reflect the severity of sepsis and indicating its usefulness as a biomarker for the early detection of septic conditions. unexpectedly, under septic conditions, it was moreover observed that cf - dna was not derived from nets produced by neutrophils, but mainly from host cells other than neutrophils. we hypothesize that the main source of cf - dna might be dead tissue particles, such as necrotic cells. this may change the pathophysiological concept of cf - dna formation during sepsis, at least in part, and further studies are needed to confirm this hypothesis. | recently, it has been reported that circulating free dna (cf - dna) in the blood is increased in various infectious diseases, including sepsis. moreover, a relationship between cf - dna and neutrophil extracellular traps (nets) has been suggested. however, it is still unclear what the source and physiological role of cf - dna in sepsis are. in this study, we examined the source of cf - dna by detecting citrullinated histone h3, a characteristic feature of net formation, in cecal ligation and puncture- (clp-)operated mice. in addition, neutrophil depletion using anti - ly6 g antibodies was performed to assess the association between neutrophils and cf - dna. increased cf - dna levels were observed only in clp mice and not in the control groups ; the qpcr findings revealed that the cf - dna was mainly host - derived, even in bacteremic conditions. citrullinated histone h3 was not increased in the neutrophils upon clp, and the depletion of neutrophils showed limited effects on decreasing the amount of cf - dna. taken together, these results suggested that elevated cf - dna levels during early - phase sepsis may represent a candidate biomarker for the severity of sepsis and that, contrary to previous findings, cf - dna is not derived from neutrophils or nets. |
this is due to prolonged resistance to the internationally sponsored campaign in the northern part of the country, where resistance to the polio immunization campaign is high. media reports generally attribute the resistance to muslims in the region, while studies confirms that the resistance was partly caused by fears that the polio vaccine is contaminated with anti - fertility hormone and hiv virus and aimed at depopulating muslims around the world. there are equally those who are apprehensive of the risks of having their children vaccinated, for reasons of lack of trust in the government ; discontentment with the top - down vertical nature of the health intervention in which the beneficiaries have no say ; and memories of the drug scandal of 1996 in which an untested antibiotic, trovan (trovafloxacin mesylate) developed by pfizer inc., that was given free of charge in kano state during the 1996 cerebrospinal meningitis (csm) epidemic, killed 11 children and left 200 other children disabled. these apprehensions, according to the bbc have been reinforced by a suggestion that the administration of polio vaccine in east africa in the late 1950s correlates with early cases of hiv infection in africa : it had been suggested that hiv was initially transmitted to humans in the late 1950s through the use of an oral polio vaccine. the polio vaccine was given to at least one million people in the former belgian congo and what are now rwanda and burundi. the site of the 28-vaccination projects correlate closely with the earliest cases of hiv infection. the continued resistance to polio immunization campaign in northern nigeria may be due to failure of the aggregate campaign strategy or its limited success in the region. however, studies and reports have linked the variability of the campaign resistance and acceptance in the region to the influences of mass media and interpersonal sources of information on the immunization. these studies and reports tended to have over - generalized the role communication played in the pattern of acceptance of the campaign in northern nigeria, thereby leaving incomplete evidence regarding the influence of communication sources on the responses of the local communities to the immunization campaign particularly in high - risk (wpv - endemic) areas. this study therefore aims to provide evidence from zaria local government area on how communication influenced community responses within the following main questions : i) what is the degree of acceptance and resistance of the polio immunization campaign in zaria local government area ; ii) how did mass media and interpersonal communication sources comparatively influenced acceptance of polio immunization campaign in zaria local government area ; iii) which is the most influential of mass media and interpersonal communication sources in the campaign acceptance and resistance decision of individuals in zaria local government area ? survey is appropriate in asking respondents to report on their behaviours, and enables researcher generate quantitative data with relative ease. the study is located in zaria local government area of kaduna state in northern nigeria, being one of the high - risk (wpv - endemic) areas in northern nigeria, where resistance to the polio immunization campaign is high. the local government area comprises of thirteen wards, namely : anguwan - fatika ; anguwan - juma ; dambo ; dutsen - abba ; gyallesu ; kaura ; kufena ; kwarbai - a ; kwarbai - b ; limancin - kona ; tudun - wada ; tukur - tukur ; wuciciri. like most parts of northern nigeria, the predominant indigenous population in zaria local government area is hausa, who are mainly of the islamic faith. the 2006 national census figures in nigeria put the local government area population at 434,745. for the purpose of this study, populations include adult male and female parents and caregivers in selected locations, regardless of religious and ethnic or tribal denomination. based on availability of the 2008 immunization monitoring data in zaria local government area, eight out of thirteen wards in the local government were purposively sampled for the study, using proportional representation method. the wards are anguwan - fatika ; anguwan - juma ; kaura ; kwarbai - a ; kwarbai - b ; tudun - wada ; limancin - kona ; tukur - tukur. the total population of the sampled wards is 287,125 people, representing approximately 62% of the entire population of zaria local government area. for the purpose of sampling accuracy, 10% of the population of the eight wards i.e. however, to avoid voluminous and unmanageable data, a sample of ten per cent (10%) was further drawn from the 28,712 respondents, resulting in approximately 2868 respondents sampled for the study. again since the population distribution in the eight wards are not the same, to ensure that the sample from each ward is fairly representative of the population of the ward, 10% of the sample from each ward was taken for administration of questionnaire. the questionnaires were administered casually on respondents who were available at the point of data gathering. data was collected structurally in the order of listing of the wards, coded and analyzed using descriptive statistical method, aided with computer based statistical package for social sciences (spss). the study is located in zaria local government area of kaduna state in northern nigeria, being one of the high - risk (wpv - endemic) areas in northern nigeria, where resistance to the polio immunization campaign is high. the local government area comprises of thirteen wards, namely : anguwan - fatika ; anguwan - juma ; dambo ; dutsen - abba ; gyallesu ; kaura ; kufena ; kwarbai - a ; kwarbai - b ; limancin - kona ; tudun - wada ; tukur - tukur ; wuciciri. like most parts of northern nigeria, the predominant indigenous population in zaria local government area is hausa, who are mainly of the islamic faith. the 2006 national census figures in nigeria put the local government area population at 434,745. for the purpose of this study, populations include adult male and female parents and caregivers in selected locations, regardless of religious and ethnic or tribal denomination. based on availability of the 2008 immunization monitoring data in zaria local government area, eight out of thirteen wards in the local government were purposively sampled for the study, using proportional representation method. the wards are anguwan - fatika ; anguwan - juma ; kaura ; kwarbai - a ; kwarbai - b ; tudun - wada ; limancin - kona ; tukur - tukur. the total population of the sampled wards is 287,125 people, representing approximately 62% of the entire population of zaria local government area. for the purpose of sampling accuracy, 10% of the population of the eight wards i.e. however, to avoid voluminous and unmanageable data, a sample of ten per cent (10%) was further drawn from the 28,712 respondents, resulting in approximately 2868 respondents sampled for the study. again since the population distribution in the eight wards are not the same, to ensure that the sample from each ward is fairly representative of the population of the ward, 10% of the sample from each ward was taken for administration of questionnaire. the questionnaires were administered casually on respondents who were available at the point of data gathering. data was collected structurally in the order of listing of the wards, coded and analyzed using descriptive statistical method, aided with computer based statistical package for social sciences (spss). out of 2868 questionnaires distributed among target populations, only 2253 could be retrieved for analysis. this puts the response rate at approximately 78.6%. in relation to the research questions, the principal findings of the study are as follows : 55.1% of the people of zaria local government area currently accept polio immunization campaign, while 44.9% currently resist the polio immunization campaign (table 1). interpersonal sources were significantly more influential than the mass media in both campaign acceptance and resistance decisions in the local communities. the influence of interpersonal communication sources is 55.4% greater than that of mass media in the campaign acceptance mobilization, and also 79.4% greater than mass media in campaign resistance mobilization in zaria local government area (table 2). friends and relations are the most influential of interpersonal sources in the campaign acceptance and resistance decision of individuals in the local communities (table 3). newspapers and magazines are the major mass media sources through which the resistance to the polio immunization campaign in zaria local government area was influenced (table 4). table 1campaign acceptance and resistance pattern in zaria local government area.wardsaccept campaignresist campaigntotalanguwan - fatika175 (7.8%)135 (6.0%)310 (13.8%)anguwan - juma110 (4.9%)89 (4.0%)199 (8.8%)kaura48 (2.1%)31 (1.4%)79 (3.5%)kwarbai - a198 (8.8%)118 (5.2%)316 (14.0%)kwarbai - b188 (8.3%)124 (5.5%)312 (13.8%)limancin - kona293 (13.0%)201 (8.9%)494 (22.0%)tudun - wada88 (3.9%)104 (4.6%)192 (8.5%)tukur - tukur141 (6.3%)210 (9.3%)351 (15.6%)total1241 (55.1%)1012 (44.9 %) 2253 (100.0%) table 2campaign acceptance and resistance by source of influence.accept campaign : source of influenceresist campaign : source of influencewardsmass mediaiterpersonal comm.totalmass mediainterpersonal comm.totalanguwan-fatika34 (2.7%)141 (11.4%)175 (14.1%)12 (1.2%)123 (12.1%)135 (13.3%)anguwan - juma30 (2.4%)80 (6.5%)110 (8.9%)8 (0.8%)81 (8.0%)89 (8.8%)kaura38 (3.1%)10 (0.8%)48 (3.9%)5 (0.5%)26 (2.6%)31 (3.1%)kwarbai - a20 (1.6%)178 (14.3%)198 (15.9%)10 (1.0%)108 (10.7%)118 (11.7%)kwarbai - b52 (4.2%)136 (11.0%)188 (15.1%)17 (1.7%)107 (10.5%)124 (12.2%)limancin - kona32 (2.6%)261 (21.0%)293 (23.6%)15 (1.5%)186 (18.4%)201 (19.9%)tudun - wada36 (2.9%)52 (4.2%)88 (7.1%)12 (1.2%)92 (9.1%)104 (10.3%)tukur - tukur35 (2.8%)106 (8.5%)141 (11.4%)25 (2.4%)185 (18.3%)210 (20.7%)total277 (22.3%)964 (77.7%)1241 (100.0 %) 104 (10.3%)908 (89.7%)1012 (100.0%) table 3campaign most influential interpersonal source of information.accept : most influential interpersonal sourceresist : most influential interpersonal sourcewardstrad. ruler / ward headanguwan - fatika22 (2.3%)41 (4.2%)60 (6.2%)14 (1.5%)4 (0.4%)5 (0.5%)36 (4.2%)63 (6.2%)14 (1.5%)5 (0.4%)123 (13.5%)5 (0.5%)anguwan - juma9 (0.9%)24 (2.5%)38 (3.9%)7 (0.7%)2 (0.2%)3 (0.3%)27 (2.5%)45 (3.9%)6 (0.7%)0 (0.2%)81 (8.9%)3 (0.3%)kaura1 (0.1%)4 (0.4%)3 (0.3%)2 (0.2%)0 (0.0%)1 (0.1%)4 (0.4%)10 (0.3%)7 (0.2%)4 (0.0%)26 (2.9%)1 (0.1%)kwarbai - a19 (2.0%)51 (5.3%)81 (8.4%)15 (1.6%)12 (1.3%)4 (0.4%)13 (5.3%)68 (8.4%)13 (1.6%)10 (1.3%)108 (11.9%)4 (0.4%)kwarbai - b20 (2.1%)42 (4.4%)49 (5.1%)10 (1.0%)15 (1.6%)8 (0.9%)25 (4.4%)53 (5.1%)9 (1.0%)12 (1.6%)107 (11.8%)8 (0.9%)limancin - kona40 (4.1%)61 (6.3%)105 (10.9%)23 (2.4%)32 (3.3%)10 (1.1%)33(6.3%)110 (10.9%)12 (2.4%)21 (3.3%)186 (20.5%)10 (1.1%)tudun - wada6 (0.6%)12 (1.3%)19 (2.0%)5 (0.5%)10 (1.0%)4 (0.4%)22 (1.3%)28 (2.0%)11 (0.5%)27 (1.0%)92 (10.1%)4 (0.4%)tukur - tukur15 (1.6%)28 (2.9%)42 (4.4%)17 (1.7%)4 (0.4%)6 (0.7%)53 (2.9%)85 (4.4%)26 (1.7%)15 (0.4%)185 (20.4%)6 (0.7%)total132 (13.7%)263 (27.3%)397 (41.2%)93 (9.6%)79 (8.2%)41 (4.5%)213 (23.5%)462 (50.9%)98 (10.8%)94 (10.3%)908(100.0%)41 (4.5%) table 4campaign most influential media source of information.accept : most influential media sourcesresist : most influential media sourceswardstelevisionradioprinttown criertotaltelevisionradioprinttown criertotalanguwan - fatika10 (3.6%)18 (6.5%)5 (1.8%)1 (0.4%)34(12.3%)1 (1.0%)4 (3.9%)7 (6.7%)0 (0.0%)12 (11.6%)anguwan - juma6 (2.2%)19 (6.9%)5 (1.8%)0 (0.0%)30 (10.8%)0 (0.0%)3 (2.9%)5(4.8%)0 (0.0%)8 (7.7%)kaura31 (11.2%)5 (1.8%)2 (0.7%)0 (0.0%)38 (13.7%)0 (0.0%)3 (2.9%)2 (1.9%)0 (0.0%)5 (4.8%)kwarbai - a4 (1.4%)14 (5.0%)1 (0.4%)1 (0.4%)20 (7.2%)1 (1.0%)3 (2.9%)6 (5.8%)0 (0.0%)10 (9.6%)kwarbai - b12 (4.3%)36 (13.0%)4 (1.4%)0 (0.0%)52 (18.8%)3 (2.9%)5 (4.8%)9 (8.6%)0 (0.0%)17 (16.3%)limancin - kona8 (2.9%)21 (7.6%)2 (0.7%)1 (0.4%)32 (11.6%)1 (1.0%)3 (2.9%)11 (10.6%)0 (0.0%)15 (14.4%)tudun - wada7 (2.5%)24 (8.7%)5 (1.8%)0 (0.0%)36 (13.0%)2 (1.9%)4 (3.9%)6 (5.8%)0 (0.0%)12 (11.6%)tukur - tukur17 (6.1%)14 (5.0%)3 (1.1%)1 (0.4%)35 (12.6%)5 (4.8%)7 (6.7%)13 (12.5%)0 (0.0%)25 (24.0%)total95 (34.2%)151 (54.5%)27 (9.7%)4 (1.6%)277 (100.0%)13 (12.5%)32 (30.8%)59 (56.7%)0 (0.0%)104 (100.0%) the preponderance of interpersonal sources of influence in the campaign acceptance and resistance decision of the individuals in the local communities, as shown by the results, is supported in the basic premise of the two - step flow theory that interpersonal contacts produce more influence than mass media in persuasive campaigns. this theory, which forms the basic premise of this study, emphasizes that when mass media and interpersonal communication sources are compared or are in conflict, interpersonal sources wields greater influence. such influence displayed by interpersonal sources over mass media in this study may be connected in relative degrees to the risks perceived to be associated with the mass media sources, particularly because in nigeria mass media tends to be perceived to be sympathetic with the government. however, this can not be certain until a risk perception analysis of the campaign resistance is carried out. again, this finding is relevant in clarifying the debate on declaration of universal superiority of interpersonal communication over mass media in persuasive campaign, which was left unchallenged until a research on measles immunization campaign conducted in the philippine proved that the influence of interpersonal communication in persuasive campaign is relative to the community where it is used and the quality of development of the media in such community. it is equally not surprising that newspapers and magazines are found in this study as most influential media sources in the resistance to the polio immunization campaign in zaria. most of the indigenous television networks are not accessible by the local communities in zaria, being a predominantly rural location. however, the nigeria television authority (nta) recently established a transmission station in zaria. this has provided access to government 's most advocative television network in zaria. as can be seen in the results of this study, this is probably because the most accessible network (nta) is commonly known to be pro - government, and therefore most probably unable to secure significant trust in the communities. this also calls for a reflection on the question of trust in information sources in the polio campaign. as shown by this study results, friends and relationships are the most influential source of interpersonal communication in both campaign acceptance and resistance decisions of individuals in the local communities. this is a significant departure from the widespread belief that traditional rulers were the greatest source of interpersonal influence in community acceptance of the campaign, and perhaps more importantly a support to obadare 's argument that people in northern nigeria genuinely resist the polio campaign due to a lack of trust in the government or better still, political leadership. concerning the levels of acceptance and resistance to the polio immunization campaign in zaria, the findings of this study show a very narrow difference. only 55.1% of the populations currently accept the campaign, while 44.9% resist the campaign. the narrow gap of 10.2% between the levels of campaign acceptance and resistance is indicative of the difficulties still faced in the polio eradication in northern nigeria. it must be pointed out that data gathering process in this study was inhibited by some cultural beliefs that limited researcher 's access to women. this affected the gender representativeness of the data. against this backdrop, and based on the findings of this study, the researcher concludes that a polio eradication campaign, backed with competent and sufficient communication expertise utilizing knowledge - based indigenous interpersonal communication strategies will likely result in greater community acceptance in northern nigeria. the applicability of this conclusion may however depend largely on the following recommendations : further research : a risk perception study should be undertaken to analyze the dimensions and degree of risks associated with the resistance to the polio immunization campaign in northern nigeria. health campaigns 1 : polio immunization and similar health interventions campaigns should factor in commonly held attitudes, norms and practices of the people pertaining to health. indeed, understanding the cultural backgrounds, religious beliefs, group identities and life experiences of communities and their individuals who shape the reception of messages will enhance a knowledge - based communication intervention in public health campaigns. health campaigns 2 : the campaign should explore more of interpersonal communication strategies in reaching target populations, since it has been proven to be more efficient in persuasive campaigns of this nature. ethics : affected communities should be encouraged to participate directly in determining their health priorities and designing health communication campaigns in their communities. | this study is premised on the increasing global concerns over the widespread resistance to polio eradication campaign in northern nigeria. it aims to determine the level of campaign acceptance and compare the influences of mass media and interpersonal communication sources in zaria local government area, being one of the high - risk (wpv - endemic) areas in northern nigeria, where campaign resistance is known to be high. by way of quantitative survey, the study utilized 10% sample of the populations of eight out of the thirteen wards in zaria local government area, with a response rate of 78.6%. findings reveal close ranks between campaign acceptance and resistance in the local government area, thus further confirming the difficulties still faced in polio eradication campaign in the region. this study also indicates higher performance of interpersonal than mass media sources in influencing campaign acceptance and resistance in the local communities. contact with friends and relations was rated the most influential interpersonal sources in the acceptance and resistance decision of individuals, while newspapers and magazines were rated most influential media sources that influenced campaign resistance in the local communities. the study concludes that a polio eradication campaign, backed with competent and sufficient communication expertise that utilizes knowledge - based indigenous interpersonal communication strategies will likely result in greater community acceptance in northern nigeria. |
dental resin - based composites are widely used in restorative dentistry since they have been introduced for the first time in the middle of 1960 [15 ]. compared to dental amalgams, they have less safety concerns, have simple usability, and possess better aesthetic properties [6, 7 ]. one of the laboratorial tests widely used to evaluate the mechanical behavior of resin composites is flexural strength test according to the international standard iso 4049. modifications of test parameters are commonly reported in the literature due to the possibility to increase their reproducibility and clinical relevance in oral environment. however, the results obtained from the comparison between different methodologies were shown to be inconsistent, especially when different specimen dimensions are considered [810 ]. for this reason an accurate experimental parameters selection is required in order to analyze the effect on strength related properties which is commonly considered a reliable clinical performance indicator for dental composites. by analyzing the parameters that affect physical, mechanical, and chemical properties of filled composites we should focus on some important concepts. the flexural properties, like flexural strength and modulus, of composites are strongly influenced by the l / h ratio (span length / thickness) ; the ratio can be varied either by changing the support span at constant thickness or by changing the specimens thickness at constant span. this was assumed to be due to shear stress contribution inside the specimen instead of tensile stress which lowers l / h ratios. in addition, adequate polymerization of composite restorative materials is fundamental for obtaining optimal ideal clinical performances. low conversion rates, in fact, affect several important parameters such as flexural strength, fatigue, solubility, discoloration, and biocompatibility, thus limiting the lifespan of the composites [1114 ]. the large bar - shaped specimens, as stipulated in iso 4049, are difficult to prepare without flaws especially with compule packaging. furthermore, several overlapping irradiations [240s (40s 3 2) ] are required as the exit window of all clinical light - cure units is smaller than 25 mm. therefore the resulting polymerization shrinkage of resin composites causes the presence of residual stresses within regions of incomplete polymerization. consequently, the overlapping curing regime of three - point flexure bar - shaped can affect the reliability of fracture strength data compared with specimens fabricated using a more clinical relevant protocol. specimen dimensions, curing time, and layering procedure are fundamental parameters that influence the resin catalysis and consequently the mechanical properties of the final product [1517 ]. for this reason, the aim of this study was to better clarify the controversial information of the scientific community on the mechanical properties of microfilled composites at varying specimen dimensions (length l : 12 mm/25 mm, width w : 2 mm, and thickness s : 1.0, 1.0 + 1.0, and 1.0 + 1.0 + 1.0 mm). in particular the three - point bending test was performed, respectively, at 18.5 mm (ift) and 10.5 mm (mft) span length, through an 1 mm incremental technique. a commercial light - curing resin (quadrant universal lc, supplied by cavex holland bv) was chosen for the tests. it was a bis - gma resin loaded with well - dispersed fillers (ba - al - f - silicate glass, size 0.022.00 m, and dispersed colloidal silica, size from 0.02 to 0.07 m and mean particle size about 0.045 m). this universal microhybrid composite was utilized because of its general use in most anterior and posterior restorations based on its combination of strength and polishability. a customized stainless steel mold was filled with the uncured composite paste, shade a2 ; hence, the two sides of the mold were placed between two glass slides with a polyester film interposed between the glass and the mold. with a 13 mm diameter light cure tip the polymerization for 12 2 1 specimens group can be achieved with a nonoverlapping light - curing procedure (20s 2) while for 25 2 1 group overlapping light - curing exposure is required (20s 3 2). for this reason, in the 25 2 1 group, after the glass slide was removed, the exit window of the visible light unit (optilux-501, kerr, ct, usa) was positioned at the center of the specimen and against the glass slide and then the specimen was irradiated for a polymerization time of 20 s (as recommended by the manufacturers). after the photoactivation of the specimen 's center, the exit window was moved to the section next to the center, overlapping the previous section by half the diameter of the exit window ; the same goes for the section on the other side of the center ; both sides were irradiated as recommended by the manufacturer. therefore, the specimens were stored in distilled water at 37c for 24 h before the testing. preliminary physical parameters, obtained according to astm d 3171, are reported in table 1. three - point bending test was performed using iso 4049 flexural test (ift) and a miniflexural test (mft). the test was performed at room temperature using a universal testing machine (tenso test tt2, 5-gu, lonos test, monza, italy) with a 10 n and 2 kn load - cell with 0.001 n sensitivity. the flexural properties were measured using rectangular bar - shaped samples (length l = 1225 mm, width w = 2 mm, and thickness s = 1.02.03.0 mm). the test was replicated 10 times for the two experimental groups to better identify statically the mechanical performances. the strength and stiffness were determined, respectively, by using the following equations : (1)f3pl2bh2,(2)ef = l348ip, where f is the flexural stress and ef is the apparent modulus of elasticity obtained by flexural test. l is the span length, h and b are, respectively, height and width of beam. i is the moment of inertia and p/ is the slope of load - deflection data. furthermore the three - point bending test was used, according to astm d198, to determine the shear modulus of the restorative composite. during the three - point bending test, a certain extent of displacement measured was dependent on the shear resistance that characterizes the material investigated. this correlation was related to the ratio between the distance of the supports (l) and the thickness of the sample (h). higher shear stresses intervene when the l / h ratio is low ; on the contrary increasing this ratio becomes irrrelevant. by carrying out several three - point bending tests, which differ in the ratio of l / h (with h constant and l variable), and by measuring the apparent elastic modulus, it was possible to separate young 's modulus (e) from the shear modulus (g). consequently, this standard specifies that a beam is tested via center - point loading over multiple spans per specimen. within this procedure, the true modulus of elasticity differs from the apparent modulus of elasticity because it neglects deflection due to shear. in order to determine the true moduli of elasticity, a linear interpolation of the apparent moduli of elasticity and the aspect ratios at which they were measured is requested. the inverse slope of the interpolating straight line, modified by a shape factor, is the shear modulus. the equation used to relate these parameters is the following : (3)1ef=1e+1kghl2, where e is the true modulus of elasticity, g is the modulus of rigidity, and k is a shape factor. microhardness tests were performed by using a future - tech microhardness tester fm-300 (vickers indenter and compressive load 100 g). the degree of conversion is defined as the percentage of reacted c = c double bonds. hardness has been shown to be a good indicator of conversion of double bonds and was therefore used in the present study as an indirect measurement of conversion. polymerization of resin - based composites leads to a highly cross - linked structure, but both steric hindrance and vitrification cause residual unsaturation by pendant methacrylate groups and free monomers. this not fully cured external layer is essential for the chemical bond of further layers. this layer, generally, is removed through polishing fine diamonds, flexible discs, and silicon polishers after clinical composite restoration. for this reason, before performing the microhardness test, this layer was removed by lapping. with the purpose to better clarify the effect of 1 mm layering buildup technique, with a practical 20 s curing time, on the mechanical performances of a microfilled composite, the flexural tests were performed at varying span length, in the range between 18.5 mm (ift) and 10.5 mm (mft). in particular, a miniflexural test was employed to simulate a clinically realistic specimen dimensions whereas the mesiodistal diameter of molars is about 11 mm and the cervicoincisal length of central incisors is around 13 mm. under flexural condition, the principal stresses on the top surfaces are compressive, whereas those on the lower surfaces are tensile. while the tensile and compressive moduli are generally the same for metals, they may differ significantly for polymeric composites. the advantage of flexural modulus for polymeric composites is that it describes the combined effects of compressive and tensile deformation. figure 1 shows the evolution of stress - strain curve at increasing layering steps for the three - point flexural test configuration with 18.5 span length. the analysis of stress - strain pattern evidenced that the mechanical properties of the composite resin increase at each layering step. in particular the monolayer sample was able to carry low stresses with high strains due to its significant plastic behavior. in fact, it could reach high deformation (the maximum deflection for some samples was quite double of the thickness) without the insurgence of critical failure conditions, even if the maximum stresses were relatively low. the neutral axis of a beam curve, which was bent upwards in the device, was moved slightly from the centroid towards the center of curvature, giving a nonlinear distribution of the stresses through the thickness of the beam. for small values of thickness, the beam displacement of the neutral axis was very small and the disturbance to distribution ratio of linear stress was assumed to be negligible. if the maximum deflection was not small compared to the beam depth, linear beam theory can not be employed without an error. west examined large deflections of three - point loaded beams, and from such results a definitive ratio of beam length - to - depth (l / d) ratio can be determined for valid application of simple beam formulas. based on its considerations, the error for beams with large deflection under three - point furthermore, based on roark approach, the error due to low curvature radius can be estimated under 2%. consequently, for our fixture configuration, the data of the analysis differed slightly from the euler - bernoulli theory (small deflections of a beam) and (1) and (2) could be used to compare the mechanical performances of the composite paste. the monolayer sample showed a nonlinear curve with a first elastic region at low deformation. afterward, at increasing deflections, the stress - strain curve exhibits a progressive deviation from linear trend. at about strain 1.5%, the unreacted compounds, characterized by a high mobility, influence significantly the plastic deformation inducing low strength and stiffness on the sample. instead for high layering steps, the stress - strain curve became quite linear. these samples maintained an elastic regime also at high strain, evidencing an elastic - brittle behavior typical for well cross - linked composite resin. in fact, during polymerization, dental resin composites transform from plastic viscous through a rubbery viscoelastic into an elastic glassy stage. during and after the vitrification stage, the major rate of shrinkage stress occurs, due to residual stresses within regions of incomplete polymerization, specially under overlapping irradiations. in fact, to compensate for the polymerization of the central region of the 25 1 2 rectangular specimen, the associated postgel shrinkage stresses were accommodated by deformation of the adjacent, partially irradiated regions. as the adjacent regions of the bar - shaped specimen were irradiated, the polymerization shrinkage stress of the overlapping areas of resin composite placed the cured central portion under tensile stresses. after the gel - point, steric hindrance becomes prominent and the elastic properties are measurable. the elastic modulus increases with increasing conversion reaching its final level at the glassy stage. if the deepest layers of composite restorations are not adequately cured, the elastic modulus at the bottom will be lower than that at the surface ; this can increase the material strain under masticatory forces. during the flexural test, the stresses change direction within the specimen between the top and bottom surfaces, with both stress and strain being zero at the region of change (neutral axis). shear stress is also produced near the supported ends of the specimens but does not play a significant role in the fracture process when the distance between supports is large (i.e., ift). averages of flexural strength and modulus values of the two experimental groups are reported in figure 2. the bending strength and modulus increase with the steps of layering both in ift compared to those in mft. the difference was statistically significant for flexural strength and young 's modulus values in monolayer samples of ift group in comparison with the monolayers in mft group (p < 0.01). for bilayers as well as trilayers higher flexural strength and young 's modulus values were observed in ift (p < 0.01). when the distance between supports is smaller (i.e., mft), flexural properties observed express the combined effects of compressive, tensile, and shear deformation that could induce a premature fracture of the sample. nevertheless, higher specimen dimensions (e.g., ift samples) could evidence cross - linking heterogeneity due to overlapping curing procedure. this leads to residual stresses within region of incomplete polymerization that influence the mechanical performances of the composite paste. on the contrary smaller specimens are more subject to a homogeneous curing distribution than to less defects content [19, 26 ]. with the purpose to minimize this effect, the sample 's irradiation steps were carried out taking into account the distribution of the overlapping areas. furthermore, as described in the following paragraph, we proposed 1 mm layering procedure to obtain a homogenous polymerization between top and bottom surfaces of the sample. this may explain the generally significant increase of the elastic modulus and flexural strength observed with ift compared with mft. in particular, it was confirmed that, by increasing the span length from l = 10.5 to l = 18.5 mm, the apparent elastic modulus ef increases. instead a slight reduction in the flexural strength was observed for mft samples compared with ift ones. this is due to the enhancement of shear strain addition (angular sliding) compared to flexural strength contribution when the distance between the support was reduced. to obtain the effective elastic modulus of this dental material, as value independent from span length, an extrapolation technique was used which allowed to obtain the young 's modulus, by eliminating the shear deformation contribute from the apparent modulus ef, by using the procedure reported in the experimental part. analogously, by the slope of interpolation line, it was possible to determine the shear modulus. the trilayer samples evidenced the highest apparent elastic modulus, e, (consequently the lowest 1/e contribution) in all range of spans. reducing the layering steps, the apparent elastic modulus progressively decreases. interpolating by a linear curve it was possible to extrapolate the elastic and shear stiffness of each specimens group, obtaining a detailed mechanical characterization of the composite paste. the results are summarized in table 2. increasing the number of layers, during the restoration phase, an elastic modulus of about 4400 mpa for 1 mm monolayer was obtained. instead we observe an elastic modulus for trilayer samples about 70% higher than monolayer one. the shear modulus observed for trilayer samples is two times higher than the monolayer one. the mechanical performances of monolayer and bilayer were slightly similar (anyway a significant difference of g modulus was observed). this behaviour plays a main role on the interlaminar stresses, favoring a better interfacial mechanical stability on samples with more high and stable performances. consequently samples obtained with a 1 mm multilayering procedure could be able to provide a better adhesion and interlaminar shear performances. the combined knowledge of the longitudinal and shear elastic properties of resin composites is essential for their correct use in restorative dentistry. in fact, in the oral environment, the dimensions are compatible with the mft, which showed values of stiffness and strength lower than the ift ones. consequently an incorrect evaluation of these parameters can lead to marginal breakdown or fracture of the bulk of the restorations which are subjected to considerable stress - bearing (classes i, ii, and iv restorations) where a high flexural strength is required to withstand biting forces without fracture and also a high modulus or stiffness is necessary during the restoration to maintain its shape under load. a combined ift - mft testing approach can be able to overcome these deficiencies by providing useful information for the prediction of the mechanical behavior of resin composites under realistic conditions of application. with the purpose to evaluate the influence of layering steps on the hardness properties the microhardness value can be considered an affordable parameter to relate with the level of curing of the composite paste [28, 29 ]. in this way, the cross - linking conversion level can be related with the geometrical thickness of the layers. the figure shows how the gap between the layers with a time of cure of 20 sec and 40 sec is more marked (23%) than the gap between the layers cured in 4060 sec (11%). due the multistep layering procedure, the sample exhibits an asymmetrical structure, with a very hard thick region with high microhardness values and a soft superficial region. the latter region, characterized by only 20 s of curing time, has a microhardness value about 40% lower than the hardest layer, characterized by a 60 sec of curing time. this intrinsic anisotropy influences the stress distribution and could increase the interlaminar stresses, favoring debonding or delamination of the restored tooth. this leads to the conclusion that to reduce the differences in hv values and therefore the mechanical properties between the various composite laminae it is necessary either to perform layers of 1 mm thick maintaining the standard cure time of 20 sec, or to raise the layers thickness and consequently the curing time. however, considering that as the thickness of the composite increases, the number of photons available to raise cq to the activated state is limited by absorption and scattering factors associated with the overlying resin. an optimal procedure might be to implement a multistep layering phase with the purpose to minimize the mechanical performances discrepancies between the layers and finally to apply a postcuring treatment with the purpose to homogenize the superficial layer with the underlying ones. similar results were obtained in a number of works present in literature that have addressed the problem of incremental technique, such as kwon. that show how cuspal deflection caused by polymerization shrinkage may be reduced by a 1 mm incremental filling technique in order to obtain a long restoration lifespan. this information may be useful in order to provide a correct procedure of deposition and resin composite curing during dental reconstruction. from the dental point of view, the mechanical behavior of the reconstructed tooth is the result of the combination of the performance of several layers, characterized by different hardness and stiffness. in this sense, a more detailed research will be developed to verify the stress distribution for a dental multilayer system in order to be able to predict the final performance of a real reconstructed tooth. the experimental results evidenced that the iso 4049 flexural test in comparison with miniflexural test limits the physical properties extrapolation of resin composites. in order to provide realistic clinical conditions, our results show how separate the flexural properties are from the shear stress, by carrying out several three - point bending tests, which differ in the ratio of l / h (span length / thickness) and in the incremental technique of specimens. furthermore, the layering procedure, necessary to realize a dental reconstruction, played a key role in the mechanical performances of resin composite. these last trilayer samples evidenced elastic and shear modulus, respectively, two and four times higher than monolayer ones. anyway this configuration evidenced an anisotropic mechanical behavior with a thick hard layer (the first and second depositions have quite similar mechanical performances) and a soft external layer (last deposited layer evidenced very low performances compared with other ones). this last is characterized by a hardness value about 40% lower than the hardest one. to reduce this discrepancy a postcuring step after the multilayering procedure was proposed. | the aim of this study was to evaluate the effect of different specimens dimensions on the mechanical properties of a commercial microfilled resin composite by using a modified iso 4049 standard protocol, that generally provides specimen dimensions of 25 mm length 2 mm width 2 mm height ; these standard dimensions are not clinically realistic considering the teeth diameter and length average. furthermore, the overlapping irradiations required lead to specimens that are not homogeneous with the presence of some flaws due to packaging steps. for this reason, a miniflexural test was employed in this work both to simulate clinically realistic dimensions and to concentrate fewer defects. the flexural tests were performed at varying span length, in the range between 18.5 mm as stated by the iso 4049 flexural test (ift) and 10.5 mm according to the miniflexural test (mft), at the increasing of layers with a 1 mm buildup multilayering technique. the results evidenced the impact of specimen dimensions on mechanical performances and consequently stability of resin - based composite with the formation of an asymmetrical structure which possesses higher stiffness and strength at increasing layering steps. |
pancreatic cancer (pc) is one of the most fatal cancers, with a 5 year survival of less than 5%. an estimated 46 420 new cases of pc are expected in the u.s. in 2014 as well as 39 590 deaths from this disease. a major hurdle toward improving clinical outcome of pc is the lack of diagnostic biomarkers at early stages of the disease. given the high mortality associated with pc, novel and cost - effective biomarkers to improve treatment and survival outcomes of pc patients are urgently needed. to date, the only treatment that provides significant survival benefit is surgical resection, but only 2025% of patients are diagnosed at early disease stages when resection is appropriate. the clinical symptoms of pc are usually vague and nonspecific until progression to advanced stages has occurred. attempts to reduce pc deaths have therefore relied greatly on early cancer detection and treatment, generally through imaging examination, such as magnetic resonance imaging (mri), computed tomography, endoscopic retrograde cholangiopancreatography (ercp), or endoscopic ultrasound (eu). however, the specificity and sensitivity of these modalities are not adequate for tumors of less than 2 cm in diameter. the traditional tumor marker ca19 - 9, the sensitivity of which can reach 80% for pc, is unsuitable for early detection of pc due to low sensitivity for patients at resectable stages and especially because of its weak specificity. numerous efforts have been made in the search for pc biomarkers during recent decades, and, as a result, tumor - specific growth factor (tsgf), ca242, mic-1, platelet factor 4, peanut agglutinin (pna)-binding glycoprotein, cell adhesion molecule 17.1, and serum immune signatures found by affinity proteomics have been identified as candidate biomarkers. unfortunately, these biomarkers display low sensitivity for resectable disease, and their accuracy for detecting resectable stage cancer has not been evaluated. metabonomics, a new member of omics technologies that quantitatively measures altered metabolites resulting from pathophysiological changes, is rapidly becoming a discovery tool for new diagnostic and prognostic biomarkers of human diseases. we have previously shown the use of metabonomics for diagnosis and evaluation of pathologic conditions of various cancers. recently, metabonomics studies of pc have identified biomarkers in plasma or tissue that differentiate pc from controls. however, these studies have had relatively small sample sizes and a small number of early stage or resectable cancers. in this study, we used a combination of liquid chromatography time - of - flight mass spectrometry (lc tofms) and gas chromatography time - of - flight mass spectrometry (gc tofms) to profile plasma metabolites of pc patients and controls from the u.s. and china. the aim of this study was to identify plasma metabolites as potential markers for early detection of pc and to test the diagnostic performance of these markers. blood samples used in this study were from 100 pc patients and 100 age- and gender - matched population controls in connecticut (ct), usa, and from 100 pc patients and 100 similarly matched population controls from shanghai (sh), china (table 1). the pc patients were newly diagnosed with pancreatic ductal adenocarcinoma and were not recurrent or on any medication prior to sample collection. patient characteristics, staging of the disease, and other parameters are shown in table 1. these studies were approved by the state of connecticut department of public health as well as by the institutional review boards of 30 connecticut hospitals (ct), the institutional human subjects review board of the shanghai cancer institute (sh), and the human investigation committee of yale university (ct) and shanghai cancer institute (sh). blood specimens were collected from all participants and returned on ice to our laboratories within 2 h of collection for blood processing. tofms were used for the metabonomic profiling of all samples in the study. the profiling procedure (sample preparation, metabolite separation and detection, metabonomic data preprocessing, metabolite annotation, and statistical analysis for biomarker identification) was performed following our previously published protocols with minor modifications. quality control (qc) samples, which were prepared by mixing equal amounts of plasma from all subject samples, were used to control intra- and interbatch variability. details of plasma sample preparation and lc / gc ms analysis are provided in the supporting information. the metabonomic data obtained were normalized using internal standard p - chlorophenylalanine and calibrated using qc samples. tofms and lc tofms data sets were combined and exported to simca - p+ 12.0 software (umetrics, ume, sweden) for multivariate statistical analysis. orthogonal partial least squares - discriminant analysis (opls - da) were performed to discriminate between pc patients and controls. on the basis of a threshold of variable importance in the projection (vip, value > 1) from the 7-fold cross - validated opls - da model, a panel of metabolites responsible for the difference in the metabolic profiles of patients and controls was obtained. in addition to the multivariate statistical method, student s t - test was also applied to measure the significance of each metabolite. the resultant p values for all metabolites were subsequently adjusted to account for multiple testing by a false discovery rate (fdr) method. metabolites with both multivariate and univariate statistical significance (vip > 1 and p 1) derived from the opls - da model and the p values (p 1 indicates a relatively higher concentration present in the pc group, whereas a value < 1 indicates a relatively lower concentration compared to the control group. the 31 significantly altered plasma metabolites in both ct and sh patients (adjusted p < 0.05, supporting information figure s1a) include amino acids, carbohydrates, lipids, nucleosides, organic acids, aromatic heteropolycyclic compounds, aliphatic acyclic compounds, and aliphatic heteromonocyclic compounds (table 2 and supporting information figure s1a). thirty six metabolic pathways were found to be dysregulated in pc based on the analysis of the qea algorithm of the msea method (bonferroni - corrected p < 0.05, supporting information figure s1b). to evaluate the potential utility of plasma metabolites for the discrimination between pc patients and control subjects, we developed a logistic regression model based on the 31 validated biomarkers from the ct set. through a forward stepwise analysis, we identified glutamate, choline, 1,5-anhydro - d - glucitol, betaine, and methylguanidine as being the best predictors of disease status in the regression model (table 3). using these metabolites, we established a regression model as follows : p values were calculated using the wald test. next, we generated roc curves to assess the potential usefulness of plasma metabolite signatures as noninvasive biomarkers for the diagnosis of pc. our roc analyses revealed that plasma metabolite biomarkers were robust in discriminating patients with pc from controls in ct, with an area under the curve (auc) value of 0.943 (95% ci = 0.9080.977) (figure 2a). using a cutoff value of 0.3598, the sensitivity, specificity, and positive and negative predictive values are given in table 4. (a) roc curve analysis for the predictive power of combined plasma biomarkers for distinguishing pc from controls in the ct set. the final logistic model included five plasma biomarkers : glutamate, choline, 1,5-anhydro - d - glucitol, betaine, and methylguanidine. (b) roc curve analysis for the predictive power of combined plasma biomarkers for distinguishing pc from control in the sh set. at the cutoff value determined in the ct set, plasma metabolite biomarkers yielded an auc value of 0.835 (95% ci, 0.7770.893) with 77.4% sensitivity and 75.8% in discriminating pc from controls. (c) plots of the diagnostic values of the constructed diagnostic model and tumor marker levels in 100 pc patients and 100 controls in the ct set and 100 pc patients and 100 controls in the sh set, according to disease stage. third, the parameters obtained from the ct set were used to predict the probability of pc diagnosis in the sh set. similarly, the roc curve was constructed with the predicted probability for the sh set and is shown in figure 2b. at the same cutoff value of 0.3598, its sensitivity and specificity values were still substantial (table 4). the predictive values obtained from this classification method in the ct and sh samples are also shown in scatter plots in figure 2c. to investigate whether the pc - associated plasma metabolite signatures can differentiate between patients and controls independently of possible confounding risk factors, the pc - associated plasma metabolite signatures remained significant (p < 0.001) after adjustment for bmi and use of tobacco and alcohol (supporting information table s2). genetic alterations enable cancer cells to reprogram metabolism to meet increased energy demands for cell proliferation and to survive in hypoxic and nutrient - deprived tumor microenvironments. in this regard, a better understanding of metabolic dysregulation in pc is important and necessary. metabonomics allows for global assessment of the cellular metabolic state within the context of the immediate environment, taking into account genetic regulation, altered kinetic activity of enzymes, and changes in inflammatory and stress levels. in this study, we used combined lc the combination of different analytical platforms takes advantage of complementary analytical outcomes and, therefore, provides an unrivaled number of identified metabolites for explaining biological variations associated with pathophysiological conditions and obtains cross - validated results as well. we also included two groups of subjects with different ethnic backgrounds, from usa and china, to identify and validate the metabolite biomarkers. although there are ethnic differences in metabonomic profiles between ct and sh subjects (figure 1c), pc patients can still be readily discriminated from the controls. the opls - da models derived from the current metabonomic analysis were able to differentiate between pc and controls in both the ct and sh cohorts, highlighting the diagnostic potential of this noninvasive analytical approach. our results also demonstrated the potential role of metabolite biomarkers in the early detection of pc, which is supported by the markedly high auc values of 0.943 and 0.835 from comparisons between pc patients and controls (sensitivity = 97.7 and 77.4% ; specificity = 83.1 and 75.8%) in the ct and sh cohorts, respectively. even more important for potential early diagnosis of pc, our metabonomics - based diagnostic model was sensitive at detecting early stage pc in the models that were adjusted for bmi and history of smoking and drinking. the pathogenesis of pancreatic disease can cause significant decreases in plasma levels of amino acids, fatty acids, aliphatic acyclic compounds, and aromatic heteropolycyclic compounds (valine, glutamine, proline, tryptophan, monoisobutyl phthalic acid, propionylcarnitine, urea, and uric acid) and increases in glutamic acid and glycocholic acid, which have been demonstrated by other research groups that have found alterations in plasma / serum metabolites similar to ours. it is well - known that uptake and catabolism of amino acids and fatty acids are enhanced to support rapid cell proliferation in cancer tissues and that these changes may be explained as a result of the enhanced usage in tumors (supporting information figures s2 and s3). metabolic pathway analysis also suggests that glycine / serine / threonine / methionine metabolism (supporting information figure s2), glutamate pathway (supporting information figure s3), tyrosine metabolism (supporting information figure s4), tca cycle (supporting information figure s5), choline metabolism (supporting information figures s2 and s6), and bile acid metabolism (supporting information figure s7) are markedly altered. pc may result from a mutation in either the exocrine or endocrine function of the pancreas. therefore, there is a possibility that the decreases in their plasma metabolite levels also reflect malnutrition. consistent with results found by kobayashi and colleagues, we observed that plasma levels of 1,5-anhydro - d - glucitol were significantly reduced in pc patients compared to controls (table 2). 1,5-anhydro - d - glucitol is reported to be a biomarker of short - term glycemic control, and decreased plasma levels of 1,5-anhydro - d - glucitol suggest the presence of hyperglycemia and glycosuria. these results indicate some impairment of glucose tolerance in these patients because of pancreatic insufficiency. glutamate has been implicated in tumorigenesis through activation of alpha - amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (ampa) receptors (ampar), and glutamate concentration plays a key role in pc cell invasion and migration. our observation of a significantly elevated plasma level of glutamate is in accordance with serum analyses of pc by bathe. choline - containing metabolites have already been chosen as biomarkers in various carcinoma studies and have been reported to be decreased in pc. choline deficiency can also produce severe acute pancreatitis in animal models. in our results, reduced betaine enhanced the discrimination of pc from controls. betaine donates methyl groups for remethylation of homocysteine to methionine and dimethylglycine, which support proper liver and pancreatic function, cellular replication, and detoxification reactions. because choline is a precursor of betaine, the depletion of both betaine and choline in pc may be interrelated (supporting information figures s2 and s6). it has been reported that urinary levels of methylguanidine are significantly increased in chronic pancreatitis patients, yet this metabolite has not been studied in pc to date. glycocholic acid was not selected in the panel of markers (glutamate, choline, 1,5-anhydro - d - glucitol, betaine, and methylguanidine) for the prediction of pc using the forward stepwise regression method. because its level is remarkably increased in pc patients (3.65-fold increase in the ct set and 7.35-fold increase in the sh set), we added glycocholic acid manually into the logistic regression model, and as a result, there is no statistical significance for glycocholic acid in the model (p = 0.229) (supporting information table s3). although our current assay may stimulate the development of tools for early diagnosis of pc, there are a number of limitations to consider. first, the identified markers used to build the logistic regression model were selected from both the ct and sh data sets. therefore, the marker panel needs to be further validated with a new independent sample set. we did not have access to subjects with chronic pancreatitis and thus our marker panel needs to be examined in such patients to see how much they differ from pc patients. third, recent metabolomics studies of pc have provided metabolite biomarkers that can differentiate pc patients from controls. however, whether the identified metabolite biomarkers are specific to pc, rather than involving other malignancies or inflammatory disease in general, is not clear. future metabonomics studies need to evaluate the specificity of metabolite biomarkers for pc versus other malignancies. fourth, we observed the impact of only two ethnic backgrounds on the performance of diagnostic markers. a new sample set with more diverse ethnic backgrounds would be useful to increase generalizability. in addition, the sensitivity and specificity of this metabolite panel needs to be compared with the performance of existing markers, such as ca19 - 9, in future studies. in summary, we identified a panel of five plasma metabolite markers of pc and developed a diagnostic model using logistic regression analysis of the biomarker panel. additional studies are still necessary for further evaluation and validation of the biomarkers identified in the current study. however, this novel approach holds potential to improve patient prognosis by early detection of pc, when it may still be at a resectable stage. | patients with pancreatic cancer (pc) are usually diagnosed at late stages, when the disease is nearly incurable. sensitive and specific markers are critical for supporting diagnostic and therapeutic strategies. the aim of this study was to use a metabonomics approach to identify potential plasma biomarkers that can be further developed for early detection of pc. in this study, plasma metabolites of newly diagnosed pc patients (n = 100) and age- and gender - matched controls (n = 100) from connecticut (ct), usa, and the same number of cases and controls from shanghai (sh), china, were profiled using combined gas and liquid chromatography mass spectrometry. the metabolites consistently expressed in both ct and sh samples were used to identify potential markers, and the diagnostic performance of the candidate markers was tested in two sample sets. a diagnostic model was constructed using a panel of five metabolites including glutamate, choline, 1,5-anhydro - d - glucitol, betaine, and methylguanidine, which robustly distinguished pc patients in ct from controls with high sensitivity (97.7%) and specificity (83.1%) (area under the receiver operating characteristic curve [auc ] = 0.943, 95% confidence interval [ci ] = 0.9080.977). this panel of metabolites was then tested with the sh data set, yielding satisfactory accuracy (auc = 0.835 ; 95% ci = 0.7770.893), with a sensitivity of 77.4% and specificity of 75.8%. this model achieved a sensitivity of 84.8% in the pc patients at stages 0, 1, and 2 in ct and 77.4% in the pc patients at stages 1 and 2 in sh. plasma metabolic signatures show promise as biomarkers for early detection of pc. |
molecular recognition in water can not be understood purely in terms of the direct interactions of the two molecules that bind each other. charge interactions, by competing with the solutes for hydrogen - bonding opportunities, and by providing hydrophobic interactions that drive the association of nonpolar parts of the solutes. much is known about the physical principles by which water influences binding, and the effects of water can, to a large extent, be captured in both implicit and explicit representations of water. however, there are also still puzzles and gaps in our understanding of water s role in molecular recognition. for example, although the hydrophobic effect may be reasonably well understood for simple nonpolar surfaces, many solutes, particularly biomolecules like proteins and dna, present surfaces with complicated shapes and complex patterns of polarity, where water might have properties quite different from water at simpler, better understood surfaces. thus, small surface clefts can lead to the formation of water clusters with a reduced set of hydrogen - bond arrangements, making such waters particularly easy to displace into bulk, where they regain many more hydrogen bonding opportunities. classical notions of the hydrophobic effect do not necessarily envision such distinctive cases. in recent years, new computational tools have come online to compute and visualize the structure and thermodynamics of water at complex surfaces, by applying inhomogeneous solvation theory (ist) to simulations of solutes immersed in explicit water. some of these tools, such as watermap, stow, and others gain simplicity by modeling the density distribution of water in terms of discrete hydration sites. alternatively, grid inhomogeneous solvation theory (gist) discretizes water density and thermodynamic contributions onto a three - dimensional grid, in order to gain a more comprehensive and quantitative description of solute hydration. such tools offer insights into the properties and role of surface water and can also be useful in computer - aided drug design, by pointing out regions in a protein binding pocket where a ligand may gain affinity by displacing thermodynamically unfavorable water. implementations of ist have so far concentrated almost entirely on calculating first - order contributions to the entropy of water. the first - order translational entropy reflects, in effect, the bumpiness of the density distribution of water induced by the solute, while the first - order orientational entropy reflects the degree to which the solute reduces the orientational freedom of nearby water. however, it is likely that higher - order terms also contribute significantly to the hydration entropy. water correlations, which certainly exist in bulk water and are expected to be modified by the presence of a solute. note that greater correlation implies lower entropy and that the higher - order entropy terms in the ist series expansion are akin to the mutual information terms in the mutual information expansion which has been used to estimate changes in the configurational entropy of small molecules and proteins, and have been tied to the multibody expansion of ist. indeed, velez - vega. have recently obtained encouraging results for pure water with a novel method that treats water on an atomistic, rather than molecular, basis and is based on the mutual information expansion. water correlations to hydration entropy. an early work used ist to study the contributions of water water correlations to the hydration entropy of methane, modeled as a single lennard - jones atom, for which numerical convergence is facilitated by exploitation of spherical symmetry. water translational and orientational terms were found to be negative (increased correlation relative to bulk water) at room temperature but found to become positive at high temperature, whereas the first order terms remained negative at all temperatures considered. this study also tested an approximation in which the water water correlation function near the solute was approximated by the bulk water water correlation function ; however, the resulting entropies were found to deviate substantially from those computed without the approximation. nonetheless, small molecule hydration free energies computed with this approximation were shown to agree reasonably well with corresponding values obtained by a reference free energy perturbation method, and the same approximation was used to estimate water two other studies have taken an alternative approach to obtaining these numerically challenging terms for water near small molecules and protein binding sites : instead of computing the water water terms from actual correlation data, they were instead heuristically set as proportional to the first order entropy, where the constant of proportionality is on the order of 0.3 to 0.5 water correlations obtained from simulations of the system of interest, rather than of bulk water, to compute the contributions of these correlations to the hydration entropy contributions of pairs of waters buried in protein cavities. the water water correlation contribution was found to be negligible, however, apparently because the waters were tightly bound to the protein and hence had minimal fluctuations available to correlate with each other. thus, considerable work has already been done to study or estimate the contributions of water however, correlations computed from simulations have not yet been used to quantify or visualize second order terms for water at well - hydrated, complex surfaces, such as the binding sites of host guest systems and proteins. the present paper addresses this challenge with a three - dimensional grid formulation of the second - order translational entropy of water, which is related to the two - point spatial correlation function of water density. rewriting the second order translational entropy in terms of a conditional density, instead of a two - point density, leads to an intuitively interpretable form of this term and also facilitates spatial mapping and visualization. the present method also makes use of the efficient nearest - neighbor entropy - estimation approach. we present an evaluation of the numerical properties of the method and analyses of the second - order translational entropy of water in and around the synthetic host molecule cucurbituril and the blood clotting cascade enzyme factor xa (fxa). these second order results are placed in the context of the first - order translational and orientational entropy around these solutes, and visualization is used to understand the spatial distribution of the second order term, including molecular features that generate particularly high water here, we express the second order (or pairwise) translational entropy, sww, in terms of conditional distribution functions, then show how the resulting integrals can be estimated from simulation data by using a three - dimensional grid to discretize space and then estimating water densities with either a histogram or a nearest neighbor method. we also review how the first order (or single - body) translational entropy, ssw, can be estimated with the nearest neighbor method, as this offers numerical advantages over the histogram approach used previously. the solvation entropy of a flexible solute may be written as1where sol(q) is the equilibrium probability distribution function of the solute over its internal coordinates q when it is in solution and vac(q) is the corresponding function for the solute in vacuo, ssol(q) is the solvation entropy the solute would have if it were constrained in conformation q, and kb is boltzmann s constant. the first term in eq 1 is the solvation entropy averaged over the boltzmann ensemble of solute configurations, and the second term is the change in solute configurational entropy on being transferred from a vacuum to solvent. here, as in prior applications of ist, we consider the solvation of a solute in a given conformation, q, or in a narrow range of conformations, although one could, at some computational cost, explore solvation over a range of conformations by applying ist to each one separately and appropriately weighting each conformation. for simplicity, we will refer to ssol(q) as the solvation entropy and write ssol instead of ssol(q). for solvation in water, inhomogeneous solvation theory (ist) provides an expansion of ssol in terms of one - water, two - water, and higher order terms. the one - water term, ssw, accounts for the patterning of water density around the solute, while the two - water term, sww, accounts for the difference between the two - point, water water correlations around the solute and those in bulk ; subsequent terms capture still higher - order correlations. thus, neglecting terms above pairwise leads to the following approximation:2the one - water term has been considered in some detail in prior studies (see introduction) and is considered here only in relation to its calculation via a nearest - neighbor (nn) method (section 2.5). the pairwise term, which is of primary interest here, may be broken down further into orientational and translational parts:3the present study focuses exclusively on the translational part, swwtrans, which accounts for the solute - induced change in the two - point correlation of water density, without reference to the spatial orientation of the waters. using a form provided by morita and hiroike and clearly rendered in eq 12 of a subsequent paper by lazaridis, one may write this quantity as4the first equation of eq 4 writes swwtrans as the difference between the pairwise translational entropy of the solute - perturbed water from the pairwise translational entropy of unperturbed (bulk) water. the second and third equations provide expressions for the solute - perturbed system and bulk water. here, is the number density of bulk water, g(r) is the unitless ratio of the number density of water at r in the presence of the solute to the bulk density,, and g(r, r) is the two - point correlation function in the presence of the solute,, where (r, r) is the two - point number density of water at locations r and r. the solute is considered to be immobilized in the lab frame of reference, so that coordinates r and r represent both lab - frame coordinates and solute - frame coordinates. the integrals range over the whole system or, at any rate, to points r and r far enough from the solute to effectively capture the entire effect of the solute on the solvent distribution. the expression in line three for the pairwise translational entropy of pure water uses the corresponding distribution functions, g(r), g(r), and g(r, r) for unperturbed bulk water. note, however, that in the absence of the perturbing solute (or, in the terms of morita and hiroike, in the absence of an external field), g(r) = g(r) = 1. we include these terms here to make clear that derivations and algorithms which apply in the presence of a solute fixed in the lab frame are equally applicable to pure water, where no solute is present. we now develop an expression for swwtrans in terms of conditional densities. as noted in the prior subsection, the same derivation carries through in the case of pure water, so the pure water case is not included explicitly. the resulting formulation enables an informative spatial decomposition and provides a convenient basis for evaluating this correlation term with nearest - neighbor or histogram methods. we first use the definitions in the prior paragraph to write the starting expression in terms of number densities:5because, in the canonical ensemble, (r) dr = n and (r, r) dr dr = n(n 1), where n is the number of water molecules, the second line in eq 5, which we call the nonlogarithmic term, reduces to. for the sake of brevity, this simple term will be omitted from subsequent expressions, except as otherwise noted. we now use the fact that the two - point density may be written in terms of either of the conditional two - point densities, (r, r) = (r|r) (r) = (r|r) (r), to rewrite swwtrans, without the nonlogarithmic term, as6intuitively, the first term in the last line of eq 6 reports how the presence of a water at r influences the entropy of the water in the system as a whole, while the second term essentially subtracts out the entropy of the water for the distribution not conditioned on the presence of water at r. in the absence of any correlation between the density of water at r and at r, then (r|r) = (r) and (r|r) = (r), so the integrands of both terms in the last line of eq 6 become equal, and the volume elements at these locations will make zero contribution to the pairwise entropy. the nearest neighbor entropy estimation method provides averages of the form ln, so it is of interest to express eq 6 in a form which uses such averages. we use the facts that (r) dr = n and (r|r) dr = n 1, to recognize that and are normalized probability density functions and hence can be cast as probability weighting factors of the corresponding logarithm terms in eq 6. multiplying and dividing the first and second terms in the last two lines of eq 6 by the respective normalization constants (n 1) and n and integrating the second term over r to obtain a factor of n the integrals in the equations above range over the entire system, but in practice we will often be most interested in the region of solvent near the solute. for one thing, such a region may have particular functional importance, such as binding of a ligand by the solute, if it is a receptor. furthermore, the influence of the solute on the solvent distribution functions dies off with distance from the solute, so distant regions contribute little, and ignoring distant regions can make calculations more tractable without introducing much error. accordingly, it is useful to restrict the integrals over r to a local region of interest, k, such as a receptor binding site. furthermore, the contribution of the water at r to swwtrans is directly connected with the conditional density function (r|r), which reports on the perturbation of water density at r by the presence of a water at r, and this perturbation also dies off with the distance of r from r. as a consequence, it is often reasonable to restrict the integrals over r to finite regions centered on r, which will be termed lr. with these localizing approximations, eq 6 may be written in either of the following equivalent forms:8 in physical terms, eq 8 provides the contribution to the total pairwise entropy from the degree to which the water density in regions lr is modified by conditioning on the presence of a water at each location r in k. note that eq 6 is recovered when the k and l regions span the entire system. following the existing first - order gist approach, we use a three - dimensional grid to compute the spatial distribution of the second - order translational entropy from explicit - water simulations for a region of interest, such as a protein binding site. thus, we discretize eq 8 by breaking space into cubic voxels of side - length rvox and volume vvox = rvox3, which are assumed to be small enough that a voxel can contain at most one water molecule. (here, the translational coordinates of a water molecule are identified with those of its oxygen atom.) as a matter of notation, location r maps to voxel index k, and the region k corresponds to a grid in the region of interest, such as a binding site (figure 1), while r maps to voxel index l and the regions lr, which are centered around r, map to regions lk, which are centered around voxels k k ; see figure 1. the following subsections describe a histogram method and a nearest - neighbor method of using this discretization to estimate sww, kltrans through analysis of nf frames, or snapshots, from a molecular dynamics (md) simulation of explicit water molecules around the solute ; an additional subsection explains how the nonlogarithmic term in eq 5 is computed. diagram of a receptor (green) in a water - filled simulation box (blue), with grid corresponding to region k in pale pink and two examples of regions lk in yellow (orange where overlapping with k). in each case, the lk grid is centered in one k - grid voxel, k, which is highlighted in pink. the histogram method uses md data to estimate the various densities in the first line of eq 8 by counting the instances of water molecules in voxels:9here, nl and nk are the numbers of md frames for which a water is found in voxels l and k, respectively, and nk|l = nl|k are the numbers of md frames for which a water is found in both voxels k and l. note that this approximation treats the water densities as constant over the volume of each voxel, and, as noted above, we have assumed that the voxels are small enough that at most one water molecule can occupy a voxel. in going from a double integral to a double sum over voxels, two factors of the volume element vvox appear. thus, the histogram method estimates sww, kltrans as10here, the contribution of regions k and l to the pairwise translational part of the solvation entropy is estimated in terms of the quantities summed over voxels k k. the contribution of voxel k, vvox(skcond, hist skhist), which is the product of the voxel volume, vvox, and the difference between the conditional and unconditional entropy densities, is computed as the probability of finding a water in voxel k,, multiplied by the per water normalized quantity skcond, norm, hist writing the pairwise translational entropy in terms of a sum over voxels, in this manner, allows a spatial decomposition of this term which is useful for generating graphical representations. in practice, the expressions in eq 10 are evaluated by analyzing the nf available md frames to determine nk, the number of frames with a water in voxel k ; nl, the number of frames with a water in voxel l ; and nl|k, the number of frames with a water in both voxels l and k, where voxels k and l are required to reside in regions k and l, respectively. starting with the final expression in eq 8, we multiply and divide the first term by, which is the mean number of waters on the lr grid given a water in the k voxel, and we multiply and divide the second term by nlr = lr (r) dr, which is the mean number of waters on the lr grid without any condition, in order to convert the corresponding number density functions into probability density functions, much as previously done in deriving eq 7. the present expression for nlr|k is an approximation, due to the discretization of r into voxels, we obtain11here, lr indicates an average over the volume of the lr grid. these integrals are now discretized via the approximations in eq 9:12here, (r|k) represents the number density of water at r conditioned on the presence of a water in voxel k, and lk is the l region associated with, and typically centered on, voxel k. this may be put into a form analogous to the histogram formulation in eq 10, as follows:13both average log terms inside eq 13 can be found using the nn method, with the gamma correction for the bias, as follows:14here, the index i runs over water instances and rinn is the distance between water instance i and its nearest - neighbor water instance. the water instances are defined as follows. for the second expression in eq 14, the water coordinates found in all nf md frames are merged into one superframe, containing nnf sets of water coordinates, so that each of the n water molecules in the system appears nf times, each time with a different set of coordinates ; each resulting set of water coordinates in the superframe is considered one instance of a water. the symbol ilk indicates a sum over the nlknf water instances falling within the lk grid, but the nearest neighbors of these water instances may be water instances which fall just outside the lk grid. for the conditional term in the first line of eq 14, the water coordinates in all nk frames for which a water molecule is found in k are merged into one superframe, which is now conditioned on the presence of a water at k, and each set of water coordinates in this conditional superframe is considered one instance of a water. the symbol (i|k)lk indicates a sum over the water instances in this superframe which fall within the lk grid ; again, the nearest neighbors of these conditional water instances may be conditional water instances which fall just outside the lk grid. the nonlogarithmic term in eq 5 may readily be computed for regions k and l, within the grid approach. thus,15wherethis term reflects the difference between the two - point density of water around the solute and the product of the corresponding one - point densities. as detailed in the results section, once referenced to bulk, its contribution becomes negligible, at least for the cases analyzed here. as explained in section 2.1.1, the derivation and algorithms described above for water in the presence of a solute fixed in the lab frame are equally applicable to pure water. in order to reference the entropy of water in the presence of solute to pure water values matched numerically to those computed in the presence of the solute, we analyze a simulation of neat water with a small k grid near the center of the simulation box and use the same grid spacing and l - grid parameters as used to analyze water in the presence of the solute to compute the value of tsww, bulktrans for the water on the k grid. this quantity is then normalized by the mean number of water molecules on the k grid, for the pure - water calculation, to obtain sww, bulktrans, norm, the mean pairwise translational entropy per water in bulk. note that the dimensions of the pure water k grid need not be matched to the one used in the presence of solute : every voxel k is equivalent to every other, for the pure water case, so there is no need to cover any particular region. now, if the k region in the presence of solute contains an average of nk waters, again in the presence of solute, then one obtains the net pairwise entropy difference of the waters in the presence of solute versus in bulk from the following expression:16 in the formulations detailed above, each voxel k on the k grid is associated with an entropy density. for example, for the nearest neighbor approach, this quantity is obtained from eq 13 as skcond, nn sknn. this density may be referenced to bulk by subtracting the corresponding entropy density for bulk water ; when the nonlogarithmic term is also included, the resulting entropy difference density is. these voxel quantities may be visualized in terms of three - dimensional contours, as illustrated in the results section. the applicability of the present methods to pure water provides an opportunity to validate them by comparing their results with those obtained by an independent computational approach. we use the fact that the second order translational entropy of a homogeneous liquid may be obtained from the one - dimensional radial distribution function (rdf) centered on a given water in the pure liquid:17formally, the upper limit of the integral, r, corresponds to the size of the entire system, but far smaller values of r yield good approximations, because water water correlations decay quickly with values of r on the scale of the mean water, g(r), the radial correlation function between water molecules, is estimated from nf md frames as18where n is the number of water instances in the spherical shell of thickness r between r r/2 and r + r/2. in practice, we maximize statistical convergence by averaging the values of g(r) over all n waters in a simulation of pure water. the result from eq 17 was compared with that obtained by the grid methods as described in the prior subsection. the first order translational entropy of the water around a solute is given by19the contribution of region k to sswtrans may, for the sake of visualization and analysis, be decomposed into contributions from voxels k k, as follows:20where is the mean number of waters in voxel k, so that, and ln (r)k, the mean log density of water in voxel k, may be computed by the nearest neighbor method as21 the k and l regions used for both the histogram and nn entropy calculations were sized to fit within the simulation boxes (see details below), and the grid spacings were 0.5, except as otherwise noted. the efficient ann algorithm was used to find nearest neighbors of water instances. because the difference between the unconditional density and the density conditioned on a water in voxel k diminishes rapidly with distance from k, each voxel k was assigned its own cubic l grid, centered around k, in order to efficiently capture the local contributions of these differences to the overall second - order entropy. the side - length of the l grid was set to twice the desired cutoff distance within which correlations would be captured. for example, a cutoff distance of 5 leads to a 10 l grid. the first - order orientational entropy was computed with the previously described gist nn method, and the first order translational entropy was computed by the nn method described in the subsection above. the pure water calculations used in section 3.1 were carried out in cubic simulation boxes with side lengths of about 32 and periodic boundary conditions. the temperature was maintained at 300 k with the langevin thermostat and a collision frequency of 2.0 ps ; pressure was maintained at 1 atm by isotropic position scaling with a pressure relaxation time of 0.5 ps. a 9 cutoff distance was employed for all nonbonded interactions in the pairlist, and the particle - mesh ewald method was used to account for long ranged electrostatic interactions. the simulations were run for 1.5 s on a single gpu, with the pmemd.cuda component of amber 12 or amber 14, with a 2 fs time step. the shake algorithm was used to constrain the lengths of all bonds involving hydrogen atoms. parameters were assigned to cucurbituril (cb7) with the gaff force field and resp with the hf 6 - 31 g basis set. the starting structure was solvated with 1096 water molecules, resulting in a 10 buffer of water surrounding the solute, using the program tleap in ambertools. the system was then briefly energy - minimized with cartesian positional restraints on cb7, with force constants of 10 kcal / mol/. the minimization comprised 1500 steps of the steepest descents algorithm, followed by a maximum of 2000 steps of the conjugate gradient method. the crystal structure of fxa complexed with the inhibitor zk-807834 (alternatively called ci-1031), from protein data bank entry 1fjs, was prepared and simulated as described previously ; the ligand was deleted to leave an empty binding site, and two ions observed in the crystal structure (ca and cl) were included as part of the solute and hence were restrained along with the protein atoms, as detailed below. tip3p water molecules were added to solvate the protein using the program tleap, and the amber99sb force field was used to assign the atomic parameters. the final system comprised 29 338 atoms, including the 8557 water molecules. the md simulation started with an energy minimization of 1500 steps by the steepest descents algorithm, followed by conjugate gradient energy minimization for a maximum of 2000 steps. during the initial minimization, all protein atoms were harmonically restrained to their initial positions with a force constant of 100 kcal / mol /. the second minimization further relaxed the system by keeping only non - hydrogen protein atoms restrained with the same force constant. the energy - minimized systems were heated in increments of 50 k lasting 20 ps each, at constant volume and temperature. after the system reached 300 k, it was then equilibrated for 10 ns at a constant temperature and constant pressure of 1 atm. the equilibrated system was further run for an additional 5 ns at constant volume, and data were then collected at nvt. during the heating process and thereafter, all solute atoms were harmonically restrained to their energy - minimized positions with a force constant of 100 kcal / mol / for fxa and 10 kcal / mol / for cb7. other simulation parameters were the same as for the pure water simulations described above. a 400 ns production simulation was run for fxa, with coordinates saved every 1 ps, for a total of 400 000 snapshots. for cb7, the production run was 600-ns - long, with coordinates saved every 0.5 ps, for a total of 1 200 000 snapshots. here, we study the second order translational entropy of pure water, for which the rdf method is available for reference. (it is worth noting that the rdf method is not applicable to the solute - water systems, for which the grid methods were developed.) first, as a verification of the present methodology, we used the rdf method, with spherical shells of thickness r = 0.01, and 200 000 md frames, to estimate swwtrans, rdf for the tip3p, tip4p, tip4pew, and spc / e water models ; the results all agree with prior calculations to within 0.5%, with the exception of tip3p, for which the difference was 1.9%. (a replicate tip3p simulation yielded the same result.) no significant changes were observed on extending any of the simulations to 400 000 frames. we then examined the rdf results as a function of the two numerical parameters r, the upper limit of the integral in eq 17, and r, the width of the spherical shells in eq 16. as detailed in figure 2 (left panel), for the tip3p water model, the entropy from the rdf method converges quickly as the upper limit of the integral increases, changing by less than 0.3% when r increases from 4 to 10. this observation supports the use of local l(k) grids (section 2.2) of modest size. the rdf result also depends on the width of the spherical shell, closely approaching its presumed asymptote for values less than or equal to 0.1 (figure 2, right panel). intuitively, the entropy falls as the shells become thinner and thereby reveal finer structure in the water distribution. this result suggests that voxels larger than about 0.1 in linear dimension are likely to overestimate the entropy somewhat, due to smoothing of the density distributions. water entropy, provided as a free energy contribution ts (kcal / mol), computed for pure tip3p water with the rdf method. left : entropy as a function of the distance cutoff, r in eq 17, for a spherical shell thickness, r in eq 16, of 0.001. right : entropy as a function of spherical shell thickness, for a distance cutoff of 10 ; the two right - most points are for shell thicknesses of 0.25 and 0.5. these calculations used 50 000 md frames ; extending to 200 000 frames changes the results by only a few thousandths of a percent. the grid methods, both histogram and nn, were used to compute the same quantity, by defining region k as a cube of side length 1.5, centered in a pure water simulation box and divided into cubic voxels k, each of side length rvox. each voxel k was associated with its own cubic region lk (see figure 1) centered on k and extending a fixed distance rl from k along each grid axis, so that the side of each region lk was of length 2rl. for the histogram method, the cubic l regions were divided into voxels l of side - length rvox, and the k and l grids were registered so that each k voxel was also an l voxel. however, not every l voxel was a k voxel, because l extended outside k. the agreement of the grid method with the rdf method is examined below, as a function of the voxel size, rvox, and the size of the l grids, rl. dependence of second order pure water entropy on grid spacing. left : nn results for grid spacings (rvox) of 0.25 (green), 0.5 (red), and 0.75 (blue), with the reference rdf result (dashed line ; computed with r = 15, r = 0.01, and 200 000 md frames). error bars for the 0.5 results indicate the standard deviations across all 27 k voxels in this k region. right : analogous results from the histogram method ; results for a grid spacing of 0.25 were computed but are below the scale of the graph. all calculations used l regions with rl = 8, and all entropies are reported as free energy contributions, ts, in kcal / mol. the nn method provides reasonably well - converged results within 12 million md frames, for voxel sizes, rvox, of 0.75 and 0.5. thus, as shown in figure 3 (left), the mean of tsww across all 27 k voxels (solid lines) changes little with increasing simulation time for both of these grid spacings. in addition, for 0.5 voxels (red), the standard deviation of tsww across the 27 k voxels falls to 0.066 kcal / mol at 1 million frames and 0.05 kcal / mol at 2.3 million frames (red error bars). for 0.75 voxels (blue), the standard deviation is 0.042 kcal / mol at 1 million frames (data not shown). however, calculations with these grid spacings converge to values that overestimate the reference rdf result somewhat, particularly for a grid spacing of 0.75 (figure 3, blue). because the nn method does not make use of the discretization of the l grid into voxels l, these systematic errors are attributed to the fact that larger k voxels lead to greater smoothing of the conditional probability density functions over the corresponding regions lk. going to a finer grid spacing, rvox, of 0.25 yields ultimately a closer approach to the reference rdf result (figure 3, green), but convergence is notably slower. the histogram method converges slowly with the number of md frames (figure 3, right). this is evident even for the relatively coarse 0.75 grid spacing, and our 0.25 results are below the scale of the graph. in addition, it is evident that the 0.75 result is converging to a result that is further from the reference rdf result than the nn 0.75 result. this difference presumably results from further smearing of the conditional density functions, due to the added discretization of the lk regions, which is not required for the nn method. dependence of second order pure water entropy on size of l regions. left : comparison of nn results, for l regions with rl of 410, with the reference rdf result (dashed line ; r = 15, r = 0.01, and 200 000 md frames). all results are for a grid spacing of 0.5, and all entropies are reported as free energy contributions, ts, in kcal / mol. as detailed in the appendix, further comparison of the nn and histogram methods, with grid spacings down to 0.15, highlights the advantage of nn over the histogram method, in terms of the rate of convergence and the amount of sampling required to reach the reference rdf result. the graphs in the appendix suggest that the rdf result would be closely approximated by the nn method at a grid spacing of 0.15, given about 4 10 snapshots, whereas the histogram method would require far more sampling. the present calculations depend not only on the grid spacing, but also on the size of the lk region, in which the perturbation of water density by a water in each voxel k is evaluated. it is thus appropriate to evaluate the sensitivity of the second order entropy calculations to the size of the lk regions. based on the rdf study (figure 2, left), one may anticipate that rl 4 should suffice to capture most of the second - order entropy for the tip3p water model examined here. this expectation is borne out by the insensitivity of the nn results to rl, over a range of 410 (figure 4, left) ; in addition, good numerical convergence is observed over this range. it is worth noting that, because the l regions are cubic, a value of rl equal to 5, for example, includes locations as far as from the center of voxel k. on the other hand, the poor convergence of the histogram method (figure 4, right) makes it difficult to assess the sensitivity of its results to the value of rl. on the basis of this analysis of calculations for pure water, we selected a grid spacing of 0.5 as a good working compromise between speed and accuracy for the cucurbituril and protein calculations described below, and we set rl, the size of the lk regions, to 5. the bulk value used to compute the change in the second order entropy is taken from a pure water calculation under the same conditions and with 2 000 000 md frames. in addition, given the poor convergence of the histogram method, the following calculations use only the nn method for the second order calculations. figure 5 visualizes the spatial distribution of the second - order translation entropy, relative to bulk, in and around the synthetic host molecule cb7, which we previously studied to first order in entropy. as shown in the left panel, there is a large region of water with reduced second order entropy density, relative to bulk, centered around the symmetry axis of cb7 (yellow), with particular enhancement in two toroids (pink) roughly level with the upper and lower nitrogen carbon rings of the host. these are regions where more highly correlated water (hence reduced second - order entropy relative to bulk) is present at relatively high number density, leading to notably negative pairwise entropy density relative to bulk. on the other hand, small loci of water with positive pairwise entropy density relative to bulk (i.e., less correlated than bulk) are present at seven symmetry - related sites around the relatively apolar exterior of the host (green), and also at symmetry - related sites between the carbonyl oxygens at the upper and lower portals of the host (green). it is of interest to compare this distribution of pairwise entropy density with the simple number density of water, which is contoured in gray and magenta in the middle and right - hand panels of figure 5. whereas the number density is highest in the central torus (magenta, middle panel), the absence of a central torus in the entropy contours of the left - hand panel indicates that the water molecules in the central torus are not especially correlated with other water molecules. in contrast, water molecules present at intermediate density in the upper and lower tori (middle panel) are highly correlated and therefore appear prominently in the entropy map (pink in the left - hand panel). similarly, the regions of elevated pairwise entropy (green) appear as a subset of the high number - density regions contoured in gray (middle and right - hand panels). spatial maps of second order translational entropy density of water, relative to bulk, in and around host cb7, based on 1 200 000 md frames. left : entropy contoured at 0.02 kcal / mol / (pink), 0.01 kcal / mol / (transparent orange), and + 0.005 kcal / mol / (green). middle : same, but omitting the contour at 0.01 kcal / mol / and additionally showing water number density contoured at 0.1 waters / (gray) and 0.175 waters / (magenta). right : rotated view, showing only entropy density contours at 0.02 and 0.005 kcal / mol / and number density contour at 0.01 waters /, with the same colors. these and all other molecular graphics in this paper were generated with the program vmd. further insight may be obtained by examining the pairwise entropy on a per - water - molecule basis, rather than on the basis of entropy density, as shown in figure 6. the contours are more irregular than those in figure 5, because, unlike the density - weighted entropies there, here the contours involve voxels where the number density is low, so the numerical convergence is worse. nonetheless, it is interesting to observe that the most correlated water molecules are those at the centers of the two portals, as highlighted in the pink and clear orange contours. in contrast, the water in the center of the host is not especially correlated, as indicated by the lack of contouring there. this result is consistent with the absence of a torus of entropy density in the left - hand panel of figure 5. spatial map of second order translational water entropy per water molecule, relative to bulk, in and around host cb7. no significant positive regions were observed after setting aside voxels with inadequate sampling, e.g., those with number densities less than 0.001 water molecules /. the strongly negative pairwise entropy of water molecules at the centers of the portals (pink in figure 6) suggests that the density distribution of water is strongly influenced by the presence of a water at these locations, as discussed in section 2.1.2. put differently, the density conditioned on the presence of water in the middle of the portal should be quite different from the unconditioned density., the left - hand panel shows the baseline density distribution of water, with a strong central torus and a few other small loci of high density, while the right - hand panel shows water density conditioned on the presence of a water at the center of the portal (star in figure), contoured at the same level as in the left - hand panel. despite some noise in the conditional contours, which results from a reduction in the number of md frames available for averaging, due to the condition, one can clearly see a dramatic increase in water structure, with the appearance of an additional torus below the star and a more jagged ring of density above it. this increase in structure gives a conditional entropy lower than the baseline unconditional entropy and hence a negative contribution to the overall pairwise translational entropy from the voxel corresponding to the star. number density of water, contoured at 0.15 water molecules /, in and around cb7. left : standard number density derived directly from simulation. right : number density conditioned on the presence of a water molecule at the location marked by a star. binding of guest molecules to the cb7 host leads to displacement of water molecules to the bulk from regions in and near the binding cavity. the resulting change in water thermodynamics makes a contribution to the overall thermodynamics of binding, so it is of interest to examine the magnitude and sign of these contributions. in a previous study, we used the histogram method to study the first - order translational entropy, and the nn method to study the orientational entropy, of water in the cb7 binding cavity. here, we report the second - order translational entropy for regions of interest in and around cb7 and consider it in the context of the first - order terms. we also compare the present nn implementation of the first order translational entropy (section 2.5) with the prior histogram method. three regions are considered (figure 8) : the cavity (blue), which comprises the complete interior of the host (including the torus, below), with upper and lower cutoffs positioned at a trough in water density near the level of the host s carbonyl oxygens ; the torus (red), which is a subset of the cavity region holding only the central torus of high - density water ; and the portals (cyan), which extend 2 above and below the upper and lower borders, respectively, of the cavity region and hold regions of increased water density above the upper and lower rings of carbonyl oxygens. it should be noted that the geometric definitions of the cavity and torus regions used here have been refined, relative to those used previously, so the first - order thermodynamic results for them differ somewhat. in particular, the cavity is somewhat taller, to reach the troughs in water density at the portals, and the torus is slightly shorter, to capture only its peak density. the results (table 1) are reported as regional integrals, as indicated by the superscript r in each case, and also on a per - water - molecule basis, which provides information on the average properties of water in each region. regions of interest in and around the cb7 host, shown in side (left) and top (right) views, with the host (stick diagram, omitting hydrogen atoms), and water density contoured at 0.10 water molecules / (gray). for all three regions cavity, torus, and portal the net second - order translational entropy has the same sign as the first - order translational and orientational entropy terms. thus, the second - order term always reinforces, rather than partly cancels, the first order term. this result contrasts with the heuristic assumption that the second - order term tends to partly cancel the first - order one. although the second - order contribution is substantially smaller than the first order terms (table 1), at 58% of their sum, it is large enough to substantially influence the thermodynamics of hydration and of guest - binding to this synthetic host molecule. it is worth noting that the nonlogarithmic term contributes minimally to these second order terms, 0.08, 0.04, and 0.12 kcal / mol, for the cavity, torus, and portal regions, respectively. it is also of interest that the first - order orientational term is about equal to the first - order translational term for the cavity and torus regions, but it is about double the first - order translational term for the portal. presumably, waters at the portal are particularly well - ordered because they form hydrogen bonds with the carbonyl oxygens of the host. the entropic properties of water molecules in the three regions may be characterized by correcting for the mean number of waters in each region, as done in the last three columns of table 1. the most correlated waters, based on the value of the second - order translational entropy per water, are found in the cavity region. the degree of correlation within the torus is smaller, and similar to that in the portal region. since the torus is a subset of the cavity, the high second - order entropy of the cavity water as a whole clearly reflects the particularly high correlation of water above and below the central torus, which is evident in the left panel of figure 5. the fact that the first - order translational entropy per water of water in the torus is lower (0.86 kcal / mol / water) than that for the cavity as a whole is simply a reflection of the fact that water is present at higher density in the torus (left panel, figure 7). the least correlated waters are in the portal region, although the difference relative to the torus is small. the first three entropy columns (kcal / mol) are sums over the respective regions ; the second three entropy columns (kcal / mol / water molecule) are normalized by the numbers of waters in the respective regions and thus report on the average property of water in each region. the results are based on k and l grids with a 0.5 spacing and l grids with rl = 5, as noted in the text. the second - order translational entropy is based on a six - dimensional probability distribution function, the two - point water density (r, r), and thus can require long simulations to achieve acceptable convergence. reasonably good convergence is obtained here for the various regions in and around cb7 (figure 9, left), though the portal graph, in particular, still has a visible trend after 600 ns of simulation time (1 200 000 frames). finally, it is worth commenting here on the nn implementation of the first order translational entropy (section 2.5), a term we previously computed with the histogram method. for the cavity region, both the nn and histogram method with a 0.5 grid spacing converge well (figure 9, right), but the histogram result is higher than the nn result. in general, the nn method yields entropies for the three regions 1322% lower than those provided by the histogram method (results not shown). this is because, unlike the nn method, the histogram method approximates the water density as uniform within each voxel. convergence of second - order translational entropy of water in and around host cb7 as a function of md frames (left), and of first order translational entropy for the cavity region, by the nn and histogram methods (right). water in and near the active site of the enzyme fxa adopts a complicated distribution of increased and decreased translational correlation, as manifest in contours of the second - order translational entropy density, relative to bulk, shown in figure 10 (left panel). (note that, although the simulations analyzed here placed the protein in a large box of explicit solvent with period boundary conditions, the k grid covered only part of the surface, so the contours are localized.) indeed, every hollow in the surface of the enzyme is occupied by contours of negative (pink) or positive (green) entropy density (figure 10, left), relative to bulk, whereas water at more convex regions of the surface shows fewer entropic features. the tendency of this entropy term to be perturbed in enclosed regions of the fxa surface is consistent with the fact that, for cb7, the greatest perturbations also occurred within the binding cavity. water properties in the active site of enzyme fxa. left : second - order translational entropy density of water, scaled by t to yield kcal / mol /, contoured at 0.02 (pink) and + 0.005 (green) kcal / mol /), with molecular surface uniformly colored. middle : water number density contoured at 0.175 waters /, with protein surface colored by element ; blue - gray, carbon ; blue, nitrogen ; red, oxygen ; hydrogens not show. right : second - order entropy per water molecule (kcal / mol / water), contoured at 0.5 kcal / mol / water (pink) and + 0.16 kcal / mol / water (green). note that the number density contours were computed for a somewhat larger region than the entropy density contours, especially toward the bottom and right of the active site. all simulations represented here are 400 ns long, with frames analyzed every 1 ps. this patterning may be considered in the context of the polarity of the enzyme s surface and the number density of water (figure 10, middle). for example, a large, nonpolar pocket without a strong elevation of number density (red arrow, figure 10, middle) nonetheless has a substantial increase in second - order translational entropy density (figure 10, left), indicating reduced water accordingly, the water molecules in this have a notable increase in the corresponding per water entropy (figure 10, right). further examination of the figure may suggest a tendency for elevated water water entropy (decreased correlation) at other patches of hydrophobic surface too, and a tendency for decreased water water entropy (increased correlation) in more polar clefts. on the other hand, water in the relatively hydrophobic interior of cb7 showed reduced, rather than increased, water water translational entropy, so any connection between hydrophobicity of the surface and reduced water concentration of negative second - order translational entropy at the entry of a deep, water - filled pocket in fxa. left : second order translational entropy per water molecule contoured at 2 kcal / mol / water. right : second order translational entropy density, contoured at 0.1 kcal / mol / a. in the case of cb7, water at the center of the portal to the binding - site cavity was found to have particularly low second - order translational entropy per water molecule, implying a high degree of water water correlation (section 3.2.1). a similar phenomenon, though more pronounced, is also observed in the case of fxa, as the entryway to a deep, water - filled cavity is occupied by water with even lower values of the second - order translational entropy than seen in the case of cb7, on a per water basis (figure 11, left), and in terms of entropy density (figure 11, right). presumably water at such locations is in a particularly good position to influence the density distribution within the nearby cavity or cleft. this was seen previously for cb7 (figure 7) and maybe also be observed in the case of fxa. thus, the number density distribution of water in the deep cleft of fxa is very different when conditioned on the presence of a water molecule in an entryway site of strongly negative translational entropy per water (3.5 kcal / mol / water, red) than when it is unconditioned (figure 12, pink conditioned vs blue unconditioned density contours). the red site here is at the center of one of the green regions in figure 11. comparison of unconditional (blue) number density distribution of water with number density distribution conditioned on the presence of a water at the red site (pink), in the active site cleft of fxa. this is a side view, relative to the other fxa representations ; front and rear clipping and a transparent protein surface allow visualization of density contours deep in the cleft. the water densities are contoured at 0.1 water molecules / ; the red contour of second order translational entropy is contoured at 3 kcal / mol / water molecule. prior studies have considered the role of the first - order entropy of water in the binding site of fxa to the binding affinity of drugs and drug - like ligands to this enzyme. the present methodology now allows examination of the second - order translational entropy of water in this region. we focus on the water displaced by the ligand (pdb het i d z34) present in the binding site of fxa in the pdb entry studied here, 1jfs. this ligand occupies part of the complicated active site region (figure 13, left) and displaces water from the deep cleft that contains the most correlated water (figures 11, 12, and 13, right). fxa with cocrystallized ligand (pdb het i d z34, inchi key npnsvngqjgrsnr - uhfffaoysa - n) seen from outside of active site (left) and in a rotated view with transparent, z - clipped protein surface to show penetration of the ligand into the deep active site cleft also shown in figure 12. at nearly 5 kcal / mol (table 1), the integrated water water translational entropy in the region occupied by this ligand is large enough to have a major impact on the ligand affinity. this value is substantially greater than the corresponding result for the largest regional integral of the pairwise entropy for cb7, which is about 2 kcal / mol, for the portal region (table 1), even though the number of waters in the portal region is larger. accordingly, the second - order entropy per water is about 3-fold larger (more negative) in the binding site than in or around cb7. the first order entropy terms are also greater (more negative) for fxa than for cb7, on both a regional and a per water basis (table 1), but not by as large a factor as the second - order term. as observed in the case of cb7, the nonlogarithmic contribution to the second - order entropy is minimal, at 0.20 kcal / mol. also, again as for cb7, the second - order term contributes with the same, negative, sign as the first - order term, thus reinforcing it rather than balancing it. water entropy for region overlapped by ligand z34 in the binding site of fxa, reported in kcal / mol. two potentially balancing sources of error in the second order term should be noted. on one hand, this quantity is not fully converged, as shown in figure 14, and a longer simulation would apparently lead to a somewhat less negative value. on the other hand, as discussed in section 2.3, the use of a 0.5 grid leads to smoothing of the conditional water densities, and the use of a finer grid, if numerically practical, would lead to a somewhat more negative value. thus, the combination of a finer grid and a much longer simulation might shift the final result either up or down a bit, and the result in table 1 is likely a reasonably good estimate of the desired quantity. we have described a grid - based methodology, which uses inhomogeneous solvation theory to estimate and regionally map the two - body translational contribution to the hydration entropy of a solute of interest, using the data from a simulation of the solute immersed in explicit water molecules. the present formulation shows that the contribution to this two - body term associated with location r tells the degree to which the first - order translational entropy of water is changed when it is computed from a density distribution conditioned on the presence of a water molecule at r. this contribution must also be weighted by the density of water at r. integrating over r then yields the total second order translational entropy, which may be referenced to the corresponding quantity for bulk water. our implementation of this idea combines a gridded discretization of r with a nearest neighbor method that efficiently computes the required conditional translational entropies. evaluating this second order entropy term is substantially more computationally demanding than evaluating the first order translational and orientational terms, but the numerical convergence obtained, both in terms of grid spacing and simulation length, appears good enough to provide at least semiquantitative information and intuition about how water it is worth emphasizing that the nn method used here yields efficiency and accuracy far beyond that afforded by a simple histogram - based method. the present method has several methodological parameters that affect the trade - off between accuracy and the amount of data needed to achieve a given level of numerical convergence. on the basis of the rdf study, one would ideally use a grid spacing of about 0.1 to achieve highly accurate correlation results. however, very long simulations would be required to converge these calculations, so we have used a grid spacing of 0.5, which seems to afford a reasonable balance between accuracy and convergence, based on the rdf study. however, it will be of interest to press for further refinement, via either improved algorithms or brute - force increases in simulation lengths. another relevant parameter is the size of the lk grid positioned around each k voxel to capture the effects of a water at k on the local water density distribution. for the tip3p water model used here, we obtained reasonable results with an l grid of about 10 side length, which hence extends a minimum of 5 in all directions from voxel k. however, the rdf of tip3p water reaches bulk density at a rather short distance, and other water models, whose rdf deviates from bulk at longer distances, may require a larger l grid. we find that this second order term contributes only 58% of the first order terms to the hydration entropy associated with regions of interest in and around the synthetic host molecule cb7 and in the active site region of the enzyme fxa. interestingly, the second - order term is more significant for fxa, with its more polar and geometrically complex binding site, than for cb7. indeed, for fxa, the integral of the second order term over the region occupied by a high - affinity, small molecule inhibitor is about 5 kcal / mol, which is substantial on the scale of the free energies of ligand - protein binding. hence, the second - order translational term probably makes a substantial contribution to the change in hydration entropy on protein ligand binding. it is also worth remarking that the second order term contributes with the same, negative, sign as the first order terms, in the cases studied here ; intuitively, the presence of the solute increases water water correlations and further decreases the entropy. this result appears to be consistent with the room temperature results previously obtained in a study of methane hydration, but less so with prior heuristic estimations in which the water water term is assumed to increase, rather than decrease, the hydration entropy. three - dimensional mapping of the second order entropy contribution in and around cb7 and fxa suggests that this local quantity depends not only on whether the nearby solute surface is polar or nonpolar, but also on overall shape of the nearby surface. in particular, the entryways to deep binding cavities have particularly low values of tsww, trans, indicating a high degree of correlation with other waters. this makes intuitive sense, as these are locations where the presence or absence of a water can strongly effect how other waters are able to pack and fill the nearby cavity, making for a large difference in the baseline and conditional translational entropy of water. we anticipate that this entryway effect will be important in many other systems as well, such as at the entryways of nanotubes and of other deep protein binding sites, like the active site gorge of the enzyme acetylcholinesterase. displacement of water from such locations, if the density is significant there, is expected to be thermodynamically favorable. of course, it will be important to consider such second - order contributions in the context of other contributions to the thermodynamics, both entropic and enthalpic. the present methodology opens new possibilities for exploring the thermodynamic properties of water at molecular surfaces and thus has potential to deepen our understanding of molecular recognition and to find practical application in various aspects of molecular design, including drug design., it will be of interest to seek enhanced convergence with respect to both grid spacing and simulation duration. in addition, it will be of interest to extend these studies to the entropic consequences of water water orientational correlations, which may be substantial, due to the cooperative formation of various different hydrogen - bonded configurations of water molecules. the use of strong numerical methods, like nearest - neighbor entropy estimation, combined with growing computer power, should make for continued progress along these lines. | a number of computational tools available today compute the thermodynamic properties of water at surfaces and in binding pockets by using inhomogeneous solvation theory (ist) to analyze explicit - solvent simulations. such methods enable qualitative spatial mappings of both energy and entropy around a solute of interest and can also be applied quantitatively. however, the entropy estimates of existing methods have, to date, been almost entirely limited to the first - order terms in the ist s entropy expansion. these first - order terms account for localization and orientation of water molecules in the field of the solute but not for the modification of water water correlations by the solute. here, we present an extension of the grid inhomogeneous solvation theory (gist) approach which accounts for water water translational correlations. the method involves rewriting the two - point density of water in terms of a conditional density and utilizes the efficient nearest - neighbor entropy estimation approach. spatial maps of this second order term, for water in and around the synthetic host cucurbit[7]uril and in the binding pocket of the enzyme factor xa, reveal mainly negative contributions, indicating solute - induced water water correlations relative to bulk water ; particularly strong signals are obtained for sites at the entrances of cavities or pockets. this second - order term thus enters with the same, negative, sign as the first order translational and orientational terms. numerical and convergence properties of the methodology are examined. |
peritonitis and exit site infection are common and serious complications in patients undergoing peritoneal dialysis that can cause significant morbidity. the organisms that are commonly isolated in such patients are gram - positive and aerobic gram - negative bacteria we report the case of a patient who experienced two consecutive episodes of peritonitis while undergoing peritoneal dialysis, caused by brevibacterium and pantoea agglomerans. to date a 52-year - old man undergoing continuous ambulatory peritoneal dialysis (capd) with no prior peritonitis presented with abdominal discomfort and cloudy peritoneal fluid that had persisted for 7 day. he had a history of hypertension and liver cirrhosis, and had been maintained on capd since june 2009. the presence of turbid peritoneal fluid with a white blood cell (wbc) count of 11000 cells / mm (86% neutrophils) indicated capd peritonitis. a 50-ml sample of peritoneal fluid was centrifuged at 3000 g for 15 minutes, followed by resuspension of the sediment in 35 ml of sterile saline and inoculation on solid culture medium. immediately after sampling, the patient was treated empirically with intraperitoneal cefazolin (1 g / day) and ceftazidime (1 g / day) on an outpatient basis, as per his request. after 72 hours of aerobic incubation on blood agar, pigmented colonies with a white - gray appearance were detected. the organism was identified as brevibacterium, which was resistant to clindamycin, erythromycin, penicillin and vancomycin, and sensitive to chloramphenicol, ciprofloxacin, gentamicin, tetracycline, and trimethoprim sulfamethoxazole. after the patient returned home, the peritonitis quickly responded to treatment within 2 day ; the patient 's clinical state improved and the dialysate became clear. he continued antibiotic treatment for 2 weeks and recovered completely from peritonitis, which was confirmed in the outpatient clinic by dialysate analysis. five weeks later, the patient visited the emergency department, presenting with colicky abdominal pain and vomiting that had persisted for 3 day. laboratory data showed peripheral leukopenia, with a wbc count of 3200 cells / mm (87.3% neutrophils). serum c - reactive protein (crp) was 5.3 mg / dl. the dialysate fluid was cloudy and analysis of peritoneal fluid demonstrated a high wbc count (5940 cells / mm), consisting mainly of neutrophils (91%). samples of dialysate effluent were obtained using an aseptic technique and processed using the same method as that for the first peritonitis episode. the patient was immediately started on intraperitoneal antibiotic treatment with cefazolin (1 g / day) and gentamicin (40 mg / day) on admission. his serum crp level increased to 9.3 mg / dl after admission. by 48 hours after inoculation of peritoneal samples on blood agar, gram - negative bacteria belonging to the enterobacteriaceae family were isolated. the bacteria were sensitive to all antibiotics tested, including ampicillin, ceftazidime, cefoxitin, ciprofloxacin, gentamicin, tetracycline, imipenem, and piperacillin. on the basis of these results, cefazolin was discontinued after 3 day, whereas gentamicin treatment was continued. the patient 's abdominal pain improved and the peritoneal fluid became clear by the third day of treatment. his crp level dropped to 1.35 mg / dl on hospital day 7, and analysis of peritoneal fluid revealed steady improvements in peritonitis, as evidenced by a reduction in peritoneal fluid wbc count (190 and 30 cells / mm on hospital days 7 and 14, respectively). the patient experienced two consecutive episodes of peritonitis in a relatively short period of time, both of which were caused by environmental organisms. these organisms have rarely been reported as being responsible for clinically significant infections in humans. are gram - positive, irregular, rod - shaped, non - acid - fast bacteria that resemble corynebacteria. the main habitat of brevibacterium is dairy products, in which the bacteria contribute to the aroma and color of the product ; they are also found on human skin surfaces and genital hair, and have been associated with otorrhea,,. a few cases of brevibacterium - induced disease have been reported, but little is known about the optimal choice of antibiotics or treatment duration for such infections,. although we did not identify the specific brevibacterium strain in the present patient, our results suggest that brevibacterium - associated peritonitis may be susceptible to cephalosporin antibiotics. pantoea agglomerans (formerly enterobacter agglomerans) is a gram - negative aerobic bacillus belonging to the enterobacteriaceae family. it is ubiquitous and is found in human and animal feces, and especially in plants, fruits, and vegetables. recently, cases of p. agglomerans - associated peritonitis in peritoneal dialysis patients have been increasingly reported,,. plant - associated thorn injury was the most common etiology. however, reported cases of p. agglomerans - associated peritonitis in patients without plant injury suggest that gastrointestinal transformation is a possible source of infection,. in the present case, our patient was not involved in gardening and reported that he had not received of any plant - associated injuries such as from a rose thorn. we found no signs of any significant skin trauma at the time of p. agglomerans - associated peritonitis. instead, it is likely that the patient was prone to infection because of his immunocompromised state. in fact, he suffered from liver cirrhosis and had recently received antibiotic therapy due to the prior brevibacterium - associated peritonitis episode. considering the preceding occurrence of diarrhea, translocation of bacteria from the gastrointestinal tract may have been responsible for this second episode of peritonitis. the degree of severity was comparable between the two consecutive peritonitis episodes in the present patient. brevibacterium - associated peritonitis showed more favorable clinical symptoms, whereas p. agglomerans - associated peritonitis was associated with more severe symptoms and higher crp levels. our findings are in line with previous findings suggesting that pantoea - associated peritonitis is relatively more symptomatic, accompanied by fever, nausea, vomiting, and severe abdominal pain,. however, it has been reported that peritonitis associated with p. agglomerans shows good response to antibiotics such as ciprofloxacin and aminoglycoside,,. the second episode of peritonitis responded well to gentamicin treatment in the present patient. in summary, we report two consecutive episodes of unusual peritonitis caused by different environmental organisms in a patient undergoing peritoneal dialysis. the patient was successfully treated with a 2-week course of cefazolin and ceftazidime for the brevibacterium - associated peritonitis, and a 3-week course of gentamicin for the p. agglomerans - associated peritonitis. although these organisms are rarely responsible for human infections, it is important to view them as pathogens rather than contaminants when isolated in patients undergoing peritoneal dialysis. plant - associated thorn injuries should be assessed in patients with p. agglomerans - associated peritonitis ; less frequently, translocation of bacteria from the gastrointestinal tract should be considered as the source of infection. | a 52-year - old man undergoing continuous ambulatory peritoneal dialysis presented with two consecutive episodes of peritonitis caused by unusual organisms, namely, brevibacterium and pantoea agglomerans. the patient was successfully treated with a 2-week course of cefazolin and ceftazidime for the brevibacterium - associated peritonitis, and a 3-week course of gentamicin for the p. agglomerans - associated peritonitis. although these environmental organisms are rarely responsible for human infection, the number of reported cases of human infection by these unusual organisms has increased. this report emphasizes the potential for infection by environmental organisms in patients undergoing peritoneal dialysis. |
syphilis, although significantly reduced in the period after world war ii by means of penicillin, has reappeared as a worldwide problem, with approximately 12 million new cases annually. the widespread and at times indiscriminate use of antibiotics in recent years has considerably modified the forms and stages of syphilis and, subsequently, the clinical features of neurosyphilis. headache is part of the clinical forms of neurosyphilis but its appearance as a single symptom is extremely rare, especially when, at least, the skin symptoms of syphilis have not developed and when there is total absence of the characteristic clinical picture [3, 4 ]. we describe a case that initially presented as persistent and untreatable migraine, which was subsequently diagnosed as neurosyphilis during the clinical evaluation. a 38-year - old male, a sailor by profession, presented with a 6 years history of sustained undiagnosed headache. initially, the pain was relatively mild, continuous, and diffuses into both hemispheres, but located primarily at the frontal region. at the time there were no other definite neurological signs and the whole incident was attributed to stress. there were some episodes of headache associated with symptoms of migraine such as nausea, vomiting, sensitivity to light and sound, but with mild frequency (every 1215 days). the headaches gradually became daily and of longer duration and at the time acquired the characteristics of migraine, without aura. the pain located unilaterally, near the eye and the right temporal site and then spread to both the hemispheres, pulsating with moderate to severe intensity and associated with nausea, vomiting, phonophobia and photophobia. six years after the initiation of the headache the patient was admitted in the hospital presenting a severe episode of probable migraine with vertigo. the patient underwent a new brain mri, ent evaluation, auditory - evoked potentials and electronystagmograph and all results were normal. bradipsychism and mild impairment of cognitive function (mmse : 25) were noted during hospitalization, without any other neurological signs. visual field examination and direct ophthalmoscopy were normal. in laboratory testing, he was found positive for syphilis infection (vdrl+++, fta+) ; and negative for hiv infection. due to these laboratory results, a subsequent lumbar puncture took place and it yielded positive results for antibodies against spirochete treponema pallidum (positive csf fta - abs and csf vdrl tests, and tpha was 1/2560). after this, the patient was treated with intravenous penicillin g, to which he responded very well with significant improvement of headaches. syphilis is a chronic infection which is mainly sexually transmitted and which is caused by the spirochete treponema pallidum. the progress of the disease consists of different stages : primary, secondary, latency and tertiary. the first stage involves skin symptoms, with the primary lesion to develop at the site of inoculation 26 weeks after infection. the second stage is characterized by a wide range of clinical signs and symptoms, including malaise, low grade fever, headache, rash, generalized lymphadenopathy, etc., resulting from the multiplication and dissemination of treponemes throughout the body. syphilitic meningitis may occur at a rate of 12% alongside the classic symptoms even at the second stage. the typical manifestations will present mainly in the tertiary stage, during which treponemes invade the cns, cardiovascular system, eyes, skin, and other internal organs, causing damage as a result of their invasive properties and inflammation. replication of treponemes in the wall of the aorta may lead to aneurysm, aortitis or aortic endocarditis. neurosyphilis includes syphilitic meningitis, meningovascular syphilis and parenchymal syphilis, which, in turn, are differentiated in tabes dorsalis and general paralysis neurosyphilis. in recent years, the use of antibiotics and especially of penicillin has led to a significant decline in the incidence of neurosyphilis in greece [2, 7 ]. furthermore, the widespread use of antibiotics for any infection in conjunction with the inadequate treatment of syphilis in its early stages seems to have considerably changed the clinical picture of syphilis. the classic forms (general paralysis and tabes dorsalis) are rarely encountered in everyday clinical practice and they have been replaced by other atypical clinical forms, where the usual symptoms of syphilis are absent. more specifically, the early and correct diagnosis of the second stage of syphilis, which simulates a wide range of infections and autoimmune diseases, is particularly challenging to the physician. however, a carefully taken medical and family history of the patient could provide useful pieces of indications, such immigration from high - prevalence country, infected family members, sexual orientation and sexual contacts with infected individuals. according to the international bibliography, there is a significant increase in the incidence of syphilis worldwide in the last years, not only in the developing countries, but also in the economically developed countries [7, 8 ]. quite often, the indiscriminate use of antibiotics for all kinds of infections, together with the inefficient treatment of syphilis in its first stages, seems to have altered the clinical manifestation of neurosyphilis. on the other hand, male patients are affected at a higher rate than female patients (3.6 times more often). this fact can possibly be explained by the prevalence of primary infection in populations where men are more than women (homosexuals, seamen and drug addicts) [7, 9 ]. headache is a common clinical finding in neurosyphilis, especially in the presence of syphilitic meningitis. the headache may be manifested in a variety of characteristics, thus preventing a clear clinical point indicative of neurosyphilis. in the case described, the headache was originally the only symptom ; moreover, it exhibited clear migraine characteristics, a fact that misled clinical thinking. also, normal brain imaging and the normal laboratory monitoring until the last hospitalization supported the diagnosis of migraine. after 6 years of disease with no skin signs or other characteristic symptom of syphilis, the occurrence of mild bradipsychism and the deduction of cognitive function, considering his profession, led to the suspicion of syphilis. the link between neurosyphilis and migraine was made due to the patient s response to the medication, the regression of bradipsychism and migraine, and the improvement of his cognitive functions. this is particularly interesting, because the brain imaging showed no evidence of meningeal infection which is the usual cause of headaches. in addition, the occurrence of neurosyphilis with the unique clinical manifestation of migraine is very rare. in the literature, the possibility of neurosyphilis should be taken into account in the differential diagnosis of a persistent headache which does not respond to medication (even if it could easily be attributed to migraine), as the condition is fairly common in developing countries. | we describe a case which initially presented as persistent and untreatable probable migraine, which was subsequently diagnosed as neurosyphilis during the clinical evaluation. all symptoms regressed after appropriate treatment. we suggest that the possibility of neurosyphilis should be taken into account in the differential diagnosis of a persistent headache which does not respond to medication. |
historically, gynecologic cancers have been treated with multimodal therapy including radical surgery combined with radiation and chemotherapy based on the stage and type of disease. although this approach has resulted in a substantial improvement in outcomes, it has come at the cost of significant patient morbidity. in the last 15 years, laparoscopic approaches for many gynecologic surgical procedures for cancer have been developed, resulting in a reduction in postoperative morbidity and emerging evidence of outcomes that appear to match those of laparotomy. complete staging procedures including abdominal exploration, hysterectomy, pelvic and para - aortic lymphadenectomy, omentectomy, and peritoneal biopsies can be performed in a minimally invasive setting with laparoscopy. limitations to the conventional laparoscopic approach to gynecologic oncology surgery include lack of depth perception due to 2-dimensional imaging, instruments with limited range of motion, poor ergonomics for the surgical team including unstable camera images and awkward operating positions, and a lengthy training interval to attain laparoscopic competence. despite these pitfalls, a number of manuscripts have been published demonstrating the feasibility and applicability of the laparoscopic approach to gynecologic oncology surgery. the da vinci telerobotic laparoscopic system is an innovative technology that addresses many of the current limitations of laparoscopy, including development of a 3-dimensional vision system for the surgeon, and laparoscopic instruments with a wrist - like mechanism, allowing full replication of the range of motion of the surgeon 's hand with an 8-mm instrument. the first component is the surgeon 's console, located away from the patient bedside. the surgeon sits at the surgeon 's console and uses a stereoscopic viewer in addition to hand manipulators (masters) and foot pedals that translate coordinated hand and foot movements into identical movement of the instruments within the patient (figure 2). the second component of the da vinci robotic surgical system is the insite vision system that provides a 3-dimensional image through a 12-mm endoscope containing stereoscopic cameras and dual optical channels. the third component of the da vinci robotic surgical system is the patient - side cart with telerobotic arms and endowrist instruments. one of the arms holds the laparoscope while the other 2 to 3 arms hold the various laparoscopic surgical instruments. these endowrist instruments are unique in that they possess a mechanical wrist that allows 7 degrees of freedom of motion, thereby replicating the full range of motion of the surgeon 's hand. movement is intuitive, and therefore the fulcrum effect seen with conventional laparoscopy is eliminated. a series of endowrist instruments can be interchanged on either of the lateral robotic arms. photograph of the da vinci robotic surgical system. from left to right : surgeon 's console, patient - side surgical cart, and insite vision tower.. photograph of the da vinci master controls showing translation of surgeon hand movement to the endowrist instruments attached to the robotic arms recent publications have illustrated the applicability of robot - assisted (telerobotic) laparoscopy for heart surgery, fallopian tube reanastomosis, ovarian transposition, bowel resection and anastomosis, hysterectomy, and pelvic lymphadenectomy. as yet, no publications in the peer review literature describe the technique and outcomes for many gynecologic procedures that are currently approached with conventional laparoscopic instrumentation, such as gynecologic oncology staging procedures, or myomectomy. in november 2001, the university of michigan department of obstetrics and gynecology began a structured robot - assisted laparoscopy program. to date, 83 patients have undergone gynecologic procedures in this program, including the 7 cancer staging procedures to be reported here. this report will outline the technique and initial results of gynecologic oncology staging procedures using the da vinci telerobotic laparoscopy surgical system. we performed a review of data collected from the initiation of our robot - assisted surgery program, after obtaining approval from our institutional review board (irb # 2003 0763). all robot - assisted laparoscopic staging procedures attempted at the university of michigan medical center between august 2002 and may 2004 were analyzed based on the intent to treat. all patients were placed in the low dorsal lithotomy position with arms padded and tucked after general anesthesia was administered. for patients with an intact uterus, a rumi uterine manipulator was placed in conjunction with a koh colpotomy ring and vaginal pneumo - occluder balloon (figure 3). a 12-mm camera port was placed either at or above the umbilicus, depending on the size of the uterus (figure 4). two 8-mm ports that mount directly to the operating arms on the patient - side cart were placed in the left and right lower quadrants, respectively. a fourth port served as an accessory port and was placed between the camera port and the right lower quadrant port. this was typically a 12-mm port to facilitate introduction of suture and instruments for assisting with exposure in addition to specimen removal. rumi uterine manipulator is used to manipulate the uterus during surgery, and the koh colpotomy ring is used to provide an insulated backstop for the colpotomy incision. the vaginal pneumo - occluder balloon maintains the pneumoperitoneum once the colpotomy incision is made. (cooper surgical inc., trumbull, ct) port placement. (a) the 12-mm camera port was placed in the umbilicus or above, depending on the size of the uterus. (b) the 8-mm lateral ports for robotic instruments mount directly to the robotic arms and were placed 2 cm to 3 cm medial and superior to the anterior superior ileac spine with modification based on size of the uterus. (c) the assist port was placed between the camera port and the right lower quadrant port. this was typically a 12-mm port, used to facilitate introduction of suture and suction / irrigation instruments. once all 4 ports were in place, the patient was placed in a steep trendelenburg position, and the patient - side cart was brought between the patient 's legs and docked, meaning that each port was attached to the assigned robotic arm with the exception of the accessory port. the assisting surgeon, at the right side of the patient, was responsible for endowrist instrument exchanges and for use of the assist port to aid in traction and exposure or removal of specimens. endowrist instruments used included cadiere (fenestrated) forceps, debakey forceps, round - tip scissors, needle driver, monopolar electrocautery using a hook tip, and bipolar cautery forceps. the retroperitoneum was opened by incising lateral and parallel to the infundibulopelvic ligament from the pelvic brim to the round ligament. perito - neal edges were elevated and underlying connective tissues were bluntly separated with careful opposing traction parallel to the vessels to open the retroperitoneal space by using the cadiere and monopolar hook instruments. once pelvic vessels and ureters were identified, lymph nodes were isolated and removed by incising tissues lateral and parallel to the external iliac artery extending from the bifurcation of the common iliac artery to the crossover of the deep circumflex iliac vein over the external iliac artery. the lymphatic bundle was retracted medially and dissected from the external iliac artery and vein. the obturator space was exposed by lateral retraction of the external iliac vein and lymphatic tissues were dissected free from posterior attachment to the external iliac vein and lateral attachment to the pelvic sidewall. care was taken to identify the obturator nerve, which was stripped free of attachment to the lymphatic tissues. common iliac and para - aortic nodes up to the level of the inferior mesenteric artery were obtained with the same port and patient - side cart placements. common iliac nodes were obtained by extending the peritoneal incision above the pelvic brim and reflecting the peritoneum medially to expose the common iliac vessels. low para - aortic nodes were obtained by incising peritoneum over the right common iliac artery and extending along the aorta. paraaortic nodes above the inferior mesenteric artery are difficult to obtain without redocking the patient - side cart due to limitation in the range of motion of the joints in the robotic arms. to attain high para - aortic nodes, the patient - side cart is undocked from the patient, and the operating room table is rotated 180 degrees such that the surgical tower is brought in over the patient 's head and shoulders., the upper para - aortic nodes can be removed by undocking the robot and using the laparoscope and ports in a conventional laparoscopic approach. the approach to hysterectomy was consistent with the american association of gynecologic laparoscopists (aagl) type i ve laparoscopic hysterectomy. peritoneum overlying the vessico - uterine fold was incised using the monopolar hook after elevating peritoneum and using the uterine manipulator to deflect the uterus. infundibulopelvic ligaments were doubly ligated with 0-vicryl suture tied intracorporeally with the endowrist debakey and needle driver. the uterine vessels were then suture ligated using 0-vicryl suture placed using the endowrist needle driver. the monopolar hook was utilized to develop the colpotomy incision overlying the koh colpotomy ring. the vaginal vault was closed with interrupted figure of eight stitches made by using 0-vicryl suture on ct-2 needles. in cases where omentectomy was required for staging, the omentum was placed on gentle traction, elevating from the transverse colon, and the underlying vascular tissues were divided using endowrist harmonic shears, which, unlike the other endowrist instruments, have 4 degrees of freedom rather than 7 degrees of freedom, resulting in a decreased ability to manipulate the instrument optimally. the omentum was cut into strips for removal through the accessory port. upon completion of the staging procedure, the pelvis was irrigated, and a low pressure check was performed to ensure hemostasis. all ports larger than 8 mm in diameter were closed with interrupted 0-vicryl suture on the fascia. four patients underwent a total laparoscopic hysterectomy (aagl type i ve) and 2 patients previously had undergone hysterectomy for various indications. one of the 4 patients who underwent laparoscopic hysterectomies had undergone a recent da vinci robot - assisted procedure performed for a benign indication after which an occult fallopian tube carcinoma was detected. she underwent a second da vinci robot - assisted procedure for staging that is reported in this series as patient # 2 (tables 1 and 2). four patients underwent staging for endometrial cancer : 2 were staged for ovarian cancer, and 1 was staged for fallopian tube cancer. six patients underwent pelvic and para - aortic lymphadenectomy, and 1 patient underwent pelvic lymph node sampling. omentectomy and peritoneal staging biopsies were performed for the patients with ovarian and fallopian cancers. most of these patients had prior abdominal or pelvic surgery and were therefore thought to have a significantly higher risk for adhesions (table 1). preoperative and intraoperative data bso = bilateral salpingo - oophorectomy ; pln = pelvic lymphadenectomy ; plns = pelvic lymph node sampling ; pan = paraaortic lymphadenectomy ; tlh = total laparoscopic hysterectomy, aagl class iv - e. lmp = ovarian tumor of low malignant potential ; ned = no evidence of disease. the mean body mass index was 27 kg / m (range, 22 to 39.6). the median number of lymph nodes removed in patients undergoing lymphadenectomy was 15 (range, 4 to 29) (table 1). the node count provided by our pathology department uses only macroscopic lymph nodes with an identifiable capsule and does not count microscopic nodes or lymphoid aggregates in the specimen. figure 5 demonstrates the endowrist instruments in use for the pelvic lymphadenectomy, and figure 6 illustrates the level of completeness of the lymphadenectomy. endowrist debakey and monoploar hook instruments are used to dissect out the obturator nerve. in the right frame, an endowrist bipolar forceps is used to remove a node bundle from the external iliac vein. photographs of the right pelvic lymphadenectomy. in the left frame, an endowrist debakey is elevating a node from the underlying ureter and internal iliac artery. in the right frame, the pelvic node dissection has been completed, showing the skeletonized external iliac artery (1) and vein (2), ischial periosteum (3), anterior division of the hypogastric artery (4), obturator nerve (5), genitofemoral nerve (6), and psoas muscle (7). estimated blood loss (ebl) was calculated by noting the difference between the volumes of aspirated and irrigated fluids. operative time was counted from the initial examination with the patient under anesthesia until the dressing was applied. the median hospital stay for all patients in our series was 2 days (range, 1 to 6). all stages were defined by using international federation of gynecology and obstetrics (figo) rules. adjuvant therapy, such as radiation or chemotherapy, was chosen based on tumor type, grade, and stage. all patients were alive and without evidence of recurrent disease at the time this series was reported. duration of follow - up ranged between 4 months and 25 months (table 2). one patient (# 5) has subsequently conceived and is nearing term with a pregnancy that has proceeded normally. the only complication in this series was sinusitis in 1 patient that developed postoperatively and was felt to be a complication of anesthesia. current staging and surgical treatment of early - stage endometrial cancer include cytologic washings of the peritoneum, hysterectomy, and bilateral salpingo - oophorectomy. selective pelvic and para - aortic lymphadenectomy is usually performed based on risk factors, such as tumor grade and depth of myometrial invasion. a recent study by eltabbakh reports on 90 women with clinical stage i disease. in this series, 90% of patients underwent complete laparoscopic staging. among women who underwent laparoscopy, 5.8% required conversion to laparotomy. the authors found that laparoscopic patients had significantly smaller body mass indices, longer surgical times, more pelvic lymph nodes retrieved, a smaller change in postoperative hematocrit, lower pain medication requirements, and shorter hospital stays compared with patients who had the same procedure via laparotomy. a recent, randomized, prospective comparison of laparoscopy versus laparotomy for treatment of 70 women with endometrial cancer revealed no difference in recurrence rate or duration of survival. the power of the study was low due to the small sample size of the 2 groups. the gynecologic oncology group is currently accruing patients into a large phase iii, randomized trial of laparoscopic versus laparotomy surgery for endometrial carcinoma. the primary objectives of this study are to compare complications, length of stay, quality of life, and cancer outcome. the accepted approach for treatment of ovarian cancer is surgical staging and debulking followed in most cases by adjuvant chemotherapy based on tumor type and stage of disease. epithelial ovarian cancers are the most common type, with malignant germ cell and stromal tumors each accounting for about 5% of the total. epithelial cancers are most common in perimenopausal women and are most often detected in advanced stages, whereas germ cell and stromal malignancies are usually unilateral and occur predominately in young, reproductive - age women. for example, a young woman presenting with a unilateral germ cell malignancy would more likely be treated with a unilateral salpingo - oophorectomy and staging procedure with preservation of fertility as an option and would be a good candidate for laparoscopic staging. on the other hand, a postmenopausal woman presenting with a disseminated ovarian epithelial carcinoma would require a radical debulking procedure for which laparoscopy is ill suited. in the last 13 years, many small, retrospective series have been published, demonstrating the feasibility of laparoscopic staging for ovarian cancer. in an early series by surwit and childers, 138 patients underwent laparoscopic staging for ovarian cancer. laparoscopic detection of abdominal and lymphatic metastases was equivalent to historical controls for staging by laparotomy. eight percent were converted to laparotomy and 50% were able to be fully staged laparoscopically. all were able to be laparoscopically staged with a mean operative time of 165 minutes ; a 7% major complication rate and a 2.7-day mean length of stay. as yet, no, prospective, randomized comparisons of laparoscopy to laparotomy for staging and treatment of ovarian cancer have been published. our hypothesis is that two of the most significant reasons that laparoscopy is not used for more patients with ovarian and endometrial cancer are the relative paucity of outcomes data as discussed above, in addition to technical limitations of laparoscopy. patient - specific limitations include issues like obesity, the presence of a large mass, or ascites. technique - specific limitations include lack of depth perception due to 2-dimensional imaging ; instruments with a limited range of motion due to fixed, straight shafts with a fulcrum effect ; cancer - associated issues like port - site metastases ; and the increased importance of training and experience for laparoscopy compared with laparotomy. the fulcrum effect, where the motion of the instrument tip is opposite to the direction of movement of the operator 's hand, occurs because the instrument pivots across the fulcrum of the abdominal wall. compensation for this counterintuitive motion lengthens the laparoscopy learning curve. obesity is a major impediment to the completion of laparoscopic procedures. because obesity is one of the major predisposing risk factors for developing endometrial cancer, many patients who ultimately need surgical staging are well above their ideal body weight. in one study, 42 women with endometrial cancer and a body mass index (bmi) 28.0 were offered laparoscopic staging and were compared with a group of matched controls who underwent abdominal procedures. the bmi of patients in this series was as high as 39.6 kg / m. obesity has thus far not proven to be a contraindication to robot - assisted laparoscopic staging. although no absolute upper limit exists for the size of the mass for laparoscopy, laparotomy is indicated if the size and position of the mass precludes safe placement of ports. masses with a significant solid component or multiple septations are not amenable to removal through a laparoscopic port because they can not be readily reduced in size without likely spillage into the peritoneal cavity. no patient in this series had a large or predominantly solid mass, ascites, or fixation to adjacent organs. port - site metastasis is reported to occur in 1% to 2% of cases and may be associated with implantations caused by surgical technique ; positive intraabdominal pressure, causing leakage around port sites (chimney effect) ; and pneumoperitoneum effects on local immune reactions and tumor cells. none of the patients reported in this series has had a port - site metastasis. first, it is well documented that operative laparoscopy has a lengthy learning curve before competence is high and complication rates are reduced. training and credentialing for advanced operative laparoscopy should be a high priority to maximize patient safety. second, several published reports document increased accuracy of surgical staging, increased likelihood of optimal debulking, and prolongation of survival for ovarian cancer patients who are staged by a gynecologic oncologist. this resulted in a recommendation by the national cancer institute that women with masses having a significant risk of malignancy should be given the opportunity to have surgery performed by a gynecologic oncologist. despite improvements in endoscopic technology and increasing application of the laparoscopic approach, laparoscopic hysterectomy procedures remain in the minority of all hysterectomies performed. a report on the rate of laparoscopic hysterectomy in 23 french medical centers revealed that only 9 centers carried out total laparoscopic hysterectomies and that training was found to be a major factor in the choice of technique. when access to surgical training is available, the learning curve for conventional laparoscopy and prevention of associated complications are still significant limitations to widespread application. although no absolute contraindications exist for laparoscopic hysterectomy and staging, a surgeon 's experience and the pathology encountered remain the limiting factors for performing laparoscopic hysterectomy. a recent publication from finland revealed an equivalent complication rate for laparoscopic hysterectomy compared with abdominal hysterectomy, once the surgeon passes a learning threshold of the first 30 procedures in a prospective, randomized italian study, it was shown that total laparoscopic hysterectomy could be effectively performed within reasonable time limits and that operating times are comparable with those of abdominal hysterectomy, provided that operators are experienced surgeons. the strengths of the da vinci robotic surgical system include 3-dimensional depth perception for the operating surgeon and coordinated, complex movements of the endowrist instruments that mimic the surgeon 's hands. tasks like instrument tying and suturing can be performed with the same fluidity, ease, and rapidity of an open surgical procedure. the use of robotic technology to facilitate laparoscopic procedures has increased dramatically. in numerous studies, it has been shown to be a safe and effective alternative to conventional laparoscopic surgery in a variety of surgical disciplines. in the gynecology literature, reports exist of robot - assisted laparoscopy for tubal reanastomosis and hysterectomy. one of our hypotheses is that the use of robot - assisted laparoscopy may rapidly bridge the gap between assimilation of technique and the actual application of the procedure. a recent study confirmed this principle : the impact of robotics on surgical skills was assessed by comparing conventional laparoscopy with the da vinci robotic surgical system in the performance of 4 training drills. most importantly, the study concluded that the playing field between novice and expert laparoscopic surgeons was leveled with the use of the robotic system. the cases in our series could have been completed by conventional laparoscopy, but we believe completion of these complex cases was facilitated by the robotic system. as seen in table 1, 4 of the 7 patients had one or more prior pelvic surgical procedures that resulted in scarring or partial obliteration of the cul de sac in all 4 patients. the mechanical - wrist instruments of the da vinci surgical system allowed improved dexterity that readily overcame these difficulties. a limitation of the system in its current form is the lack of tactile feedback for the operating surgeon. consequently, it is easy to break sutures or to apply excessive force to tissues until the operating surgeon learns to recognize force applied by visual cues, such as tissue blanching or deflection of soft tissue structures. in addition, the assistant does not have the advantage of a 3-dimensional view and must work around bulky equipment when the robotic surgical tower is docked. operative times were much longer than those reported in most published studies of conventional laparoscopic staging. first, we measured operative time starting with the examination with the patient under anesthesia rather than only the time for use of the robot. we felt this was the most realistic method for estimation of operating room time and resources. second, published reports do not use a standardized definition of operative time, and many authors report only the laparoscopic time. the operative times reported in this manuscript are therefore longer than times in many other reports because of this definition. in our institution, a comparison of laparoscopic staging of gynecologic malignancies by using conventional laparoscopic technology versus robot - assisted staging reveals less than 30 additional minutes for robot - assisted procedures (unpublished data). we expect to see substantial improvement as our experience increases. despite longer operative times with the robot - assisted approach, the length of hospital stay was comparable to that reported for other studies of laparoscopic staging procedures and better than those for abdominal staging procedures. lymph node count in our institution is based on identifying macroscopic nodes with a discreet capsule rather than microscopic nodes or lymphoid aggregates without a capsule. the surgical procedure performed at our institution is complete lymphadenectomy rather than lymph node sampling, regardless of surgical approach (laparotomy versus conventional laparoscopy versus robot - assisted laparoscopy). no differences existed between lymph node count as a function of the surgical approach at our institution (unpublished data). this complication was not felt to be attributable to the use of a robot - assist device. a frequent criticism of laparoscopic surgery is the high surgical cost due to prolonged operative time, complex equipment, and expensive disposable instruments. spirtos compared cost and quality of life associated with surgical treatment of early stage endometrial cancers treated with laparoscopy versus laparotomy in 30 women. patients undergoing laparoscopy had higher operating room and anesthesia costs but were noted to have a significant reduction in their overall medical costs ($ 13,809 compared to $ 19,158) and improved quality of life. the cost of using a robot - assist device is substantially higher than the cost of conventional laparoscopy. we are tracking cost data, but will need a substantially larger series to provide a comparison of benefit versus cost. this is the first series to report technique and outcome for robot - assisted laparoscopic staging of gynecologic malignancies. based on our early experience, the use of robot - assisted technology like the da vinci surgical system is feasible for total hysterectomy and staging of gynecologic malignancies. as our experience evolves, a more accurate comparison of robot - assisted to conventional laparoscopic staging outcomes can be developed to assess relative advantages and disadvantages of this new technology. the evolving literature on robot - assisted surgery suggests that surgical limitations of conventional laparos - copy can be overcome and that the skill level of the surgeon may be enhanced independently of prior laparoscopic experience. although the first - generation da vinci robotic surgical system provides improved imaging and instrumentation, the absence of tactile feedback and the high cost of the technology remain limitations. future areas of study will include improvement of technique, and evaluation of robotic technology on surgical training and competence, in addition to development of cost reduction strategies. | objective : to evaluate the feasibility of integrating robot - assisted technology in the performance of laparoscopic staging of gynecologic malignancies.methods:seven patients underwent robot - assisted laparoscopic staging procedures for gynecologic cancers. data were collected and analyzed as a retrospective case series analysis.results:we attempted 7 robot - assisted laparoscopic staging procedures with no conversions to laparotomy. the median lymph node count for lymphadenectomy was 15 (range, 4 to 29). mean operating time was 257 minutes (range, 174 to 345). the average estimated blood loss was 50 ml. one patient developed sinusitis and required intravenous antibiotics. the median hospital stay was 2 days.conclusion:robot-assisted laparoscopic staging is a feasible technique that may overcome the surgical limitations of conventional laparoscopy. |
vitamin d (vitd) is an essential nutrient with hormone - like activity that regulates calcium and bone metabolism throughout life. reduced intestinal calcium and phosphate absorption and increased bone resorption might happen when the levels of vitd are too low. furthermore, vitd insufficiency not only influences the bone formation of children, but it is also related to many other diseases, including respiratory infection, nocturnal enuresis, diabetes, and asthma in children. the serum concentration of 25-hydroxy vitamin d (25(oh)d) has been routinely used to assess the vitd status of children because it is the primary form that exists in the circulation. however, the serum concentration of 25(oh)d has also been reported to be related to parathyroid hormone (pth), calcium, phosphorus, and alkaline phosphatase (alp). to keep the adequate serum levels of 25(oh)d, the us endocrine committee has suggested the intake of 4001000 u / d under 1 year of age and 6001000 u / d from 1 to 18 years of age. however, most parents are not aware of vitd supplementation because of a lack of information with the high rates of reported suboptimal vitd levels among children. hence, vitd insufficiency or deficiency remains as an important public health problem in children, with a reported prevalence of 15%80% worldwide. many studies observing the vitd status of young children have been conducted in the developed countries. similarly, in the developing countries, almost all studies have been conducted in major cities where the living standard and socio - economic status are as high as developed countries. however, few studies investigated the vitd status of young children in poor rural areas where less or no vitd supplementation were given to children. vitd status of young children and the potential factors related to vitd status in rural areas remain unclear. the vitd status of young children without vitd supplementation in the poor rural area has been investigated in xichou, which is a poor county in a rural area of yunnan province, southwest china (located at 10441e, 2325n). the average altitude of this area is higher than 1000 m, and this area receives adequate sunlight. the participants enrolled in this study were all from the countryside and not given any vitd supplements. the serum concentrations of 25(oh)d, calcium, phosphorus, pth, and alp were measured to explore the vitd nutritional status of 18-month - old children in the rural southwestern china. we also investigated the seasonal variation of vitd status and its relationship with biochemical indices and anthropometric data. this study is a part of our large study entitled development and health of rural chinese children fed meat as a daily complementary food from 6 to 18 months of age, which was conducted in yunnan province. this is a cross - sectional study conducted in xichou county, yunnan province of china, from may 2010 to april 2011. the eligibility criteria for infants were as following : healthy - term singleton infants, 1719-month - old, a birth weight over 2500 g born between 37 and 42 weeks of gestational age, no metabolic or physical problems, breastfeeding for at least 6 months, living in xichou county, and a willingness to follow the study protocol. the exclusion criteria included any preterm / low birth weight infant, use of vitd supplements, or medication that might affect vitd metabolism. the study protocol was approved by the ethics committee of xinhua hospital, shanghai jiao tong university school of medicine. according to the prevalence of vitd deficiency reported in domestic studies and the following equation, where, u is the statistic of confidence level ; p0 is the estimated prevalence of vitd deficiency (22%) ; and d is the investigation error (20%). nonfasting blood samples (5 ml) were obtained using venipuncture by a medical doctor. serum 25(oh)d was measured using high - performance liquid chromatography - tandem mass spectrometry (ab sciex, usa). the serum concentration of pth was assayed with a chemiluminescence assay (automatic chemiluminescence analyzer, siemens, germany). serum concentrations of calcium, phosphorous, and alp were determined using the ortho - cresolphthalein complexone, phosphomolybdic acid ultraviolet (uv), and french society for clinical biochemistry (sfbc) rate method, respectively. height and weight were measured with a standard clinical seca stadiometer (seca, germany) to the nearest 0.1 cm and a standard body electronic measuring scale (seca) to the nearest 0.005 kg, respectively, without shoes and in light clothing. body weight was measured twice consecutively ; if the difference between the two measurements was less than 0.01 kg, the first measurement was recorded. height was also measured twice consecutively, if the difference between the two measurements was 30 ng / ml. the distributions of all variables were checked for normality. among the variables with normality, differences between two groups were examined using the independent samples t - test. when more than two groups were considered, one - way analysis of variance (anova) was used. pearson correlation coefficients were calculated to investigate the correlations between vitd status and other normal variables. a significance level of 0.05 (p value) was selected for the test. statistical analyses were performed using spss 17.0 software (ibm corp., chicago, il, usa). this study is a part of our large study entitled development and health of rural chinese children fed meat as a daily complementary food from 6 to 18 months of age, which was conducted in yunnan province. this is a cross - sectional study conducted in xichou county, yunnan province of china, from may 2010 to april 2011. the eligibility criteria for infants were as following : healthy - term singleton infants, 1719-month - old, a birth weight over 2500 g born between 37 and 42 weeks of gestational age, no metabolic or physical problems, breastfeeding for at least 6 months, living in xichou county, and a willingness to follow the study protocol. the exclusion criteria included any preterm / low birth weight infant, use of vitd supplements, or medication that might affect vitd metabolism. the study protocol was approved by the ethics committee of xinhua hospital, shanghai jiao tong university school of medicine. according to the prevalence of vitd deficiency reported in domestic studies and the following equation, where, u is the statistic of confidence level ; p0 is the estimated prevalence of vitd deficiency (22%) ; and d is the investigation error (20%). nonfasting blood samples (5 ml) were obtained using venipuncture by a medical doctor. serum 25(oh)d was measured using high - performance liquid chromatography - tandem mass spectrometry (ab sciex, usa). the serum concentration of pth was assayed with a chemiluminescence assay (automatic chemiluminescence analyzer, siemens, germany). serum concentrations of calcium, phosphorous, and alp were determined using the ortho - cresolphthalein complexone, phosphomolybdic acid ultraviolet (uv), and french society for clinical biochemistry (sfbc) rate method, respectively. all anthropometric measurements were carried out by two well - trained researchers. height and weight were measured with a standard clinical seca stadiometer (seca, germany) to the nearest 0.1 cm and a standard body electronic measuring scale (seca) to the nearest 0.005 kg, respectively, without shoes and in light clothing. body weight was measured twice consecutively ; if the difference between the two measurements was less than 0.01 kg, the first measurement was recorded. height was also measured twice consecutively, if the difference between the two measurements was 30 ng / ml., differences between two groups were examined using the independent samples t - test. when more than two groups were considered, one - way analysis of variance (anova) was used. pearson correlation coefficients were calculated to investigate the correlations between vitd status and other normal variables. statistical analyses were performed using spss 17.0 software (ibm corp., chicago, il, usa). one hundred and eighty - four young children were enrolled in this study. among these children, the participants included 85 boys (48.0%) and 92 girls (52.0%) with a mean age of 18.0 months (range : 17.8 18.1 months). the mean time of outdoor activities for all children was 21.3 h / week, and there was no significant difference between boys and girls (p > 0.05). according to the who child growth standards, there were 57 children (32.2%) exhibiting signs of stunting (laz 0.05) [table 1 ]. according to different blood collection times, the subjects were divided into four groups : spring (march to may), summer (june to august), autumn (september to november), and winter (december to february). the serum 25(oh)d concentration was 25.28 7.14 ng / ml, 26.71 6.47 ng / ml, 28.51 8.38 ng / ml, and 25.99 6.43 ng / ml in spring, summer, autumn and winter, respectively. there was no significant difference of 25(oh)d concentrations among these four seasons (p > 0.05). mmol / l, 1.75 0.25 mmol / l, 219.14 70.03 u / l, and 16.34 9.32 pg / ml, respectively. there was no significant difference in the serum pth levels between boys and girls (p > 0.05), and neither were the differences of calcium, alp, or phosphorus between the two genders (p > 0.05 for all). the correlation coefficients between the 25(oh)d concentration and biochemical variables are presented in detail in table 2. there was a significant difference among the concentration of pth in different 25(oh)d status (p 0.05 for both). no significant correlation was found between the 25(oh)d concentration and several anthropometric variables (waz, whz, laz, and bmi) (p > 0.05 for all) [table 2 ]. correlation between 25(oh)d concentration and several variables by pearson correlation test 25(oh)d : 25-hydroxy vitamin d ; pth : parathyroid hormone ; alp : alkaline phosphatase ; waz : weight - for - age z - score ; whz : weight - for - height z - score ; laz : length - for - age z - score. serum parathyroid hormone (pth) concentration among different levels of 25-hydroxy vitamin d concentration. the relationship between 25-hydroxy vitamin d (25(oh)d) concentration and serum parathyroid hormone (pth) concentration by pearson correlation test. the relationship between 25-hydroxy vitamin d (25(oh)d) concentration and calcium concentration by pearson correlation test. one hundred and eighty - four young children were enrolled in this study. among these children, the participants included 85 boys (48.0%) and 92 girls (52.0%) with a mean age of 18.0 months (range : 17.8 18.1 months). the mean time of outdoor activities for all children was 21.3 h / week, and there was no significant difference between boys and girls (p > 0.05). according to the who child growth standards, there were 57 children (32.2%) exhibiting signs of stunting (laz 0.05) [table 1 ]. according to different blood collection times, the subjects were divided into four groups : spring (march to may), summer (june to august), autumn (september to november), and winter (december to february). the serum 25(oh)d concentration was 25.28 7.14 ng / ml, 26.71 6.47 ng / ml, 28.51 8.38 ng / ml, and 25.99 6.43 ng / ml in spring, summer, autumn and winter, respectively. there was no significant difference of 25(oh)d concentrations among these four seasons (p > 0.05). the concentrations of calcium, phosphorus, alp, and pth were 2.40 0.11 mmol / l, 1.75 0.25 mmol / l, 219.14 70.03 u / l, and 16.34 9.32 pg / ml, respectively. there was no significant difference in the serum pth levels between boys and girls (p > 0.05), and neither were the differences of calcium, alp, or phosphorus between the two genders (p > 0.05 for all). the correlation coefficients between the 25(oh)d concentration and biochemical variables are presented in detail in table 2. there was a significant difference among the concentration of pth in different 25(oh)d status (p 0.05 for both). no significant correlation was found between the 25(oh)d concentration and several anthropometric variables (waz, whz, laz, and bmi) (p > 0.05 for all) [table 2 ]. correlation between 25(oh)d concentration and several variables by pearson correlation test 25(oh)d : 25-hydroxy vitamin d ; pth : parathyroid hormone ; alp : alkaline phosphatase ; waz : weight - for - age z - score ; whz : weight - for - height z - score ; laz : length - for - age z - score. serum parathyroid hormone (pth) concentration among different levels of 25-hydroxy vitamin d concentration. the relationship between 25-hydroxy vitamin d (25(oh)d) concentration and serum parathyroid hormone (pth) concentration by pearson correlation test. the relationship between 25-hydroxy vitamin d (25(oh)d) concentration and calcium concentration by pearson correlation test. vitd deficiency is regarded as the most common nutritional deficiency and also one of the most common undiagnosed medical conditions worldwide. though the optimal level of vitd is still controversial, it has been widely adopted in the clinic that vitd insufficiency is defined as a serum 25(oh)d level < 30 ng / ml and deficiency is defined as serum levels of 25-(oh)d < 20 ng / ml. the prevalence of vitd deficiency varies among different populations and regions. in this study, 70.6% (125 subjects) of all the participants were observed to have vitd insufficiency and 16.4% (29 subjects) with vitd deficiency. compared with domestic studies, the children in our study had a much lower prevalence of vitd deficiency (89.2% in beijing, 58.6% in shanghai, and 22% in hangzhou). in our study, 29 (16.4%) children presented with 25(oh)d concentration < 20 ng / ml, which was similar to the study performed by saintonge. however, in the study performed in britain, 35% of all subjects had serum 25(oh)d concentration < 20 ng / ml, so were the studies conducted in belgian and tehran. several factors might account for the relatively lower prevalence rate of vitd deficiency in this study. the present study was conducted in xichou county, which is at a lower latitude (2325n) and higher altitude (more than 1000 m). children living in this area are exposed to uv irradiation with stronger uv intensity for the latitude- and altitude - influenced solar exposure. furthermore, participants in our study had long time of outdoor activities with a mean time of 21.25 h. the children were not given proper protection from the sun exposure due to lack of awareness. thus, the sunlight - induced vitd synthesis was higher among our participants compared with that in other reports. besides that it is worth noting that the prevalence of vitd insufficiency is still higher compared with other studies in which the children received vitd - fortified diets. one source is the cutaneous synthesis of vitd (mainly vitd3) and the other source is dietary intake (mainly vitd2)., the children took no vitd supplements, and the vitd intake from diet was rare. the lack of vitd supplementation might be the reason for the high prevalence of vitd insufficiency in this rural area, even though the latitude of this area is low and the solar exposure is ample. in this study, no significant difference in the serum 25(oh)d concentrations among the four seasons was found. however, kemp. reported that the serum 25-oh - d concentrations in summer were significantly higher than those in winter. xichou county, where the present study was conducted, is located at 2325n, within the plateau area. however, the level of vitd in this plateau area is still varied in the four seasons. in summer, children were exposed to uvr with less clothes. therefore, the serum 25(oh)d concentration in autumn reached to the peak after accumulation during summer. in winter, children wore more and exposed less to uvr for the coldness. it is worthwhile noting that although the level of 25(oh)d in autumn was the highest among the four seasons, the mean 25(oh)d concentration was still insufficient (28.51 8.38 ng / ml), which implies that insufficient vitd status is common in this area. the anthropometric characteristics of the participants demonstrated that the growth and development status of the children in this study are lower than the who standard. this lower status is mainly because our subjects were all from one rural area in southwest china where socio - economic levels are low. razzaghy - azar and shakiba reported that the 25(oh)d level in males is significantly greater than that in females. however, significant difference in the 25(oh)d concentrations between boys and girls was not observed in this study. this discrepancy might be caused by the age differences of the subjects recruited in the studies. this study enrolled a much younger population with a mean age of 18 months. whereas, some subjects recruited in other studies were in puberty, which exerts significant differences in development between boys and girls. furthermore, compared with boys, adolescent girls are more reluctant to bask in the sun. vitd is more easily deposited and stored in the fat. however, in this study, there was no difference in the time of outdoor activities between the boys and girls. however, the absorption efficiency of dietary calcium in the small intestine is 30% on average if the person has sufficient vitd, increasing to as high as 80% during growth, lactation, and pregnancy. in the present study, a positive correlation was found between the serum concentration of calcium and 25(oh)d, revealing that vitd deficiency can reduce the absorption of calcium. vitd supplement is required for children in this rural area to increase the calcium absorption. vitd has also been reported to promote the absorption of phosphorous in the gastrointestinal tract. however, no significant associations of the 25(oh)d concentration with the levels of phosphorous or alp was found in this study. the result was consistent with other studies conducted in new zealand, tehran, or california. meanwhile, the decrease in serum calcium concentration promotes the secretion of pth to maintain the calcium concentration. the negative correlation between the concentration of 25(oh)d and pth was found in this study, which is consistent with previous studies. have estimated the 25(oh)d concentration required for maximal suppression of pth in children and adolescents according to the inverse relationship between 25(oh)d and pth. the inverse relationship between serum 25(oh)d and pth concentration reveals that a poor vitd status can be defined as the 25(oh)d concentration below which the pth concentration will rise. it is presumed that at this concentration of 25(oh)d, the supply of substrate for 1,25(oh)2d production is inadequate to meet its requirements for function in the parathyroid gland. a high serum concentration of pth may have adverse effects on bone health. there are some limitations in this study : the sample size in this study was relatively small ; however, to the best of our knowledge, it is larger than other studies conducted in this rural area of southwestern china to assess vitd status. the optimal 25(oh)d concentration for the children in this area was not determined in this study. great caution should be noted when interpreting the seasonal variation of 25(oh)d because this is a cross - sectional study, where each participant only had one observation. in conclusion, the majority of young children in the rural southwest china had vitd insufficiency regardless of the season. vitd supplementation might still be essential to young children in this rural area because ample solar exposure alone does not enable children to maintain vitd sufficiency. this study was supported by grants from shanghai key laboratory of pediatric gastroenterology and nutrition (no. 11dz2260500), national natural science foundation of china (no. 81172686), and shanghai science and technology commission pujiang talent program of china (no. 08pj14082). this study was supported by grants from shanghai key laboratory of pediatric gastroenterology and nutrition (no. 11dz2260500), national natural science foundation of china (no. 81172686), and shanghai science and technology commission pujiang talent program of china (no. 08pj14082). | background : with recognition of the important roles of vitamin d (vitd) in various physiological processes, increasing attention has been drawn to the status of vitd in early life. however, the vitd status of young children and the related factors in rural areas of southwestern china remain unclear. this study aimed to explore vitd status and its seasonal variation in 18-month - old children living in rural southwestern china. the association of vitd with biochemical and anthropometric variables was also investigated.methods:a total of 177 18-month - old children in a rural area of yunnan province, southwestern china, were enrolled. serum concentrations of 25-hydroxy vitamin d (25(oh)d) were measured through high - performance liquid chromatogram - tandem mass spectrometry. parathyroid hormone (pth) levels were measured with a chemiluminescence assay. serum concentrations of calcium, phosphorus, and alkaline phosphatase (alp) were also measured. anthropometric data and the outdoor activity time of each participant were collected.results:the serum 25(oh)d concentration was 26.61 7.26 ng / ml ; concentrations lower than 30 ng / ml accounted for 70.6% of the participants and concentrations lower than 20 ng / ml accounted for 16.4%. the level of serum 25(oh)d was not significantly different among four seasons (p > 0.05). a positive relationship was found between 25(oh)d concentration and the time of outdoor activities (r = 0.168, p < 0.05). serum pth concentration was negatively correlated with 25(oh)d concentration (r = 0.163, p < 0.05). a positive relationship was found between the serum concentrations of 25(oh)d and calcium (r = 0.154, p < 0.05). no significant association was observed between 25(oh)d and alp, phosphorus, or anthropometric variables.conclusions:the prevalence of vitd insufficiency is high among young children in the rural southwestern china regardless of the seasons. vitd supplementation is still essential to maintain vitd sufficiency for children living in rural area. |
world health organization (who) reported about 16 million pertussis cases worldwide in 2008, in which 95% of cases occurred in developing countries and more than 100000 children died from this disease. pertussis still remains endemic despite the introduction of vaccination program in 1974. during 20032007, there were 43482 cases or an incidence of 4.1 per 100000 people reported from 20 european countries. in the united states, the incidence of pertussis also increased from 3.53 in year 2007 to 5.54 in year 2009. although pertussis is always classified as infants and children disease, an increasing number of cases in adolescents and adults group were also observed [2, 5 ]. according to the vaccination schedule of malaysia, every citizen should be given vaccination at 2, 3, and 5 months old and a booster at 18 months old. although there are two types of vaccines available, whole cell or acellular vaccine, the whole cell pertussis vaccine is the most widely used vaccine against pertussis. the incidence of pertussis has been less than 1 per 100000 people from 1989 to 2010. the clinical pertussis is defined by cough illness which last 2 weeks or more, with at least one of the symptoms of paroxysms of coughing, characteristic inspiratory whoop, and posttussive vomiting without apparent cause. however, pertussis in adults and adolescents are rarely recognized because they normally have atypical course or asymptomatic. hence, they become the reservoir of the disease and may transmit the infection to infants [2, 12 ]. pertussis may also result in many complications such as pneumonia, apnoea, encephalopathy, death, loss of weight, convulsion, loss of bladder control, and rib fractures. culture was the gold standard for the diagnosis of pertussis due to its specificity ; however, it is slow and not sensitive. detection by real - time polymerase chain reaction has been carried out by many laboratories and was found to be useful in the diagnosis of b. pertussis infection [1618 ]. however, this method of detection requires the use of expensive instrument. therefore, we applied end - point pcr technique and compared it with culture method to detect b. pertussis from suspected clinical samples. these samples were obtained from suspected pertussis cases as diagnosed by clinicians and sent to our laboratory for b. pertussis culture and end - point pcr detection. the samples received were nasopharyngeal aspirates, nasopharyngeal swabs, tracheal aspirates, throat swabs, pernasal swabs, and endotracheal tube swabs. the swab samples were transported in regan - lowe medium, amies, stuart, or without any transport medium. regan - lowe charcoal agar plates were prepared from dehydrated powder obtained from oxoid and 23 g ml cephalexin, and 15% v / v defibrinated horse blood were added to the medium. for nasopharyngeal and tracheal aspirates, approximately 0.1 ml of the fluid was inoculated onto the regan - lowe charcoal agar plates. any suspected colony was identified using b. pertussis - specific antisera (difco, sparks, md, usa). the same swab samples were transferred into 1.5 ml eppendorf tubes containing phosphate buffered saline (pbs) (ph 7.4) and vortexed for 60 s to release cellular material into fluid. dna extraction was performed using qiaamp dna blood mini kit (qiagen), following the manufacturer 's instructions. the dna was first screened for the presence of is481 using bp1 and bp2 primers. amplification was performed using biometra tpersonal version 2.0 (biometra gmbh, goettingen, germany) with the following parameters : predenaturation at 95c for 5 min, followed by 30 cycles of denaturation at 95c for 1 min, annealing at 57c for 1 min, extension at 72c for 1 min with a final extension at 72c for 5 min. the expected end - point pcr product size for fragment of is481 is 151 bp. if the screening test was positive, the extracted dna was then subjected to end - point pcr amplification of pertussis toxin (pt) promoter using bptox f and bptox r primers. the parameters used were as follows : predenaturation at 95c for 5 min, followed by 30 cycles of denaturation at 95c for 1 min, annealing at 60c for 1 min, extension at 72c at 1 min with a final extension at 72c for 5 min. the expected end - point pcr product size of fragment of pt promoter is 190 bp. the internal control primers hg1 and hg2 were used in both screening and confirmatory test to target a region of human hemoglobin gene as described by. the expected end - point pcr product size for internal control is 268 bp. the end - point pcr products were visualized by 1.5% agarose gel electrophoresis stained with redsafe tm nucleic acid staining solution (intron biotechnology inc., sungnam, kyungki - do, republic of korea) and documented with a chemidoc xrs+ system (bio - rad, hercules, ca, usa). the end - point pcr result was considered positive if both target and internal control bands or target band alone was obtained. four cases were detected by culture method alone, 6 were detected by both end - point pcr and culture methods, and another 265 were detected by end - point pcr alone. overall, 454 samples were positive in is481 screening test and only 271 samples (60%) were positive in pt promoter confirmatory test. for those negative in confirmatory test (183 samples), the cases were recognized as bordetella spp. most of the positive cases were obtained from nasopharyngeal aspirates (40.9%), followed by nasopharyngeal swab (35.6%), pernasal swab (33.3%), tracheal aspirate (28.6%), and throat swab (14.3%) and none from endotracheal tube swab (table 2). the majority of positive cases were from kedah (42/275), terengganu (39/275), and selangor (35/275). the lowest number of pertussis cases was found in kuala lumpur with 2 cases only. positive cases were highest among patients aged 3 months old (212/275) followed by patients with aged 412 months old (37/275). however, there were also 12 cases detected from individuals between 13 to 24 months old and 14 cases in individuals more than 24 months old (table 3). the end - point pcr assay has been used to detect b. pertussis in the routine work. it was shown to be rapid and highly sensitive compared to culture which is slow and has low sensitivity. although culture has high specificity, it can be affected by several factors such as specimen transport condition, illness duration, and antibiotic treatment [21, 22 ]. in this study, we screened the samples for the presence of is481 and proceeded to the detection of pertussis toxin when is481 screening was positive. the repetitive insertion sequence is481 was shown to be present in b. pertussis with 200 copy numbers [23, 24 ]. however, it was not specific enough as it is also present in b. holmesii and b. bronchiseptica. the other major virulent determinant is pertussis toxin promoter region which is present as a single - copy gene. single - target testing using is481 may miss up to 20% of true positive cases. therefore, we used dual - target pcr assay targeting is481 and pertussis toxin promoter region as practiced by other researchers to increase the sensitivity of the test [19, 26 ]. the internal control was introduced into the assay to differentiate between false negative and true negative results. there were four cases that were culture positive but undetectable by our end - point pcr assay. we believe this could be due to the inhibitory substances which may be present in the specimens as described by douglas.. mattoo and cherry have suggested treating the specimens with mucolytic agent to remove the inhibitory substances prior to the end - point pcr. many of the samples were not received on the same day of specimen collection except from the states of selangor, kuala lumpur, and putrajaya, which are geographically near our laboratory. besides, we found that some of the swabs were not transported in the proper transport media, namely, regan - lowe medium, as suggested by who. prior antibiotic treatment before collection of samples could also affect the growth of b. pertussis [31, 32 ]. most of the patients had been on antibiotic treatment before their samples were collected and this could contribute to the inability to recover viable bacteria by culture method. there was no significant association between the types of samples collected and end - point pcr results (p > 0.05) (chi - square test by software spss 16). however, nasopharyngeal aspirate samples had the highest number of positive end - point pcr results (40.3%) compared to nasopharyngeal swab (35.6%) and others (21.6%). douglas. described that the low detection in the swab specimens was because of the insufficient cells found on the swabs. obtained high percentage of end - point pcr positive from throat swab specimens in their study. the detection from throat swab in our study was low, that is, 0.4% and 10% from end - point pcr and culture, respectively. the small number of throat swab samples in this study could also contribute to the low number of positive results. in our study, infant aged 3 months old was the highest group to be infected by b. pertussis. the proportion of those in the age group 3 months old (45.3%) with positive result was significantly higher than that in the age group > 3 months old (26.4%) (p < 0.001) (chi - square test by software spss 16). this could be due to the direct transmission from their parents, relatives, or guardians who may be the reservoir for the bacteria. this idea was supported by kenneth. who stated that immunity against pertussis vaccination will wane after 10-year - vaccination, and the transmission rate to infant by household caretaker ranged between 3040%. hence, booster immunizations of adolescents in 1019 years old are strongly suggested to reduce disease burden, healthcare setting cost and increase work productivity [33, 34 ]. in conclusion, our study showed that more pertussis cases were detected by end - point pcr compared with culture method. most of the positive samples were from nasopharyngeal aspirates. however, there is no significant association between the type of specimens and the end - point pcr results. most of the cases involved 3 months old patients who had not completed the scheduled vaccinations. | pertussis or whooping cough is a highly infectious respiratory disease caused by bordetella pertussis. in vaccinating countries, infants, adolescents, and adults are relevant patients groups. a total of 707 clinical specimens were received from major hospitals in malaysia in year 2011. these specimens were cultured on regan - lowe charcoal agar and subjected to end - point pcr, which amplified the repetitive insertion sequence is481 and pertussis toxin promoter gene. out of these specimens, 275 were positive : 4 by culture only, 6 by both end - point pcr and culture, and 265 by end - point pcr only. the majority of the positive cases were from 3 months old patients (77.1%) (p 0.05). our study showed that the end - point pcr technique was able to pick up more positive cases compared to culture method. |
allergic rhinitis (ar) is well accepted to be a symptomatic disease of the nasal mucosa caused by an ige - mediated allergic inflammation, and characterized by nasal itching, sneezing, water rhinorrhea, and nasal obstruction, which makes breathing through the nose difficult. these clinical symptoms are also well known to be mediated by several factors such as histamine, prostaglandins, and other inflammatory mediators (e.g., inflammatory cytokines) secreted from activated inflammatory cells including eosinophils, mast cells, and t cells in the local of inflammation. in addition to these classical immune responses, structural changes within the nasal walls these structural changes include epithelial disruption, mucus gland hypertrophy, mucosal myofibroblast transformation, and increased matrix protein deposition [2, 3 ]. these cellular changes are now called tissue remodeling and two groups of proteins matrix metalloproteinases (mmps) and their counter - regulatory inhibitors, timps, are generally accepted to be important factors for tissue remodeling. recently, there is increasing evidence that angiogenesis plays an important role in both the development of inflammation and in the pathophysiology of tissue remodeling during allergic responses [2, 5, 6 ]. numerous numbers of inducers of angiogenesis have been identified, including vascular endothelial growth factor (vegf), angiogenin, transforming growth factor (tgf), tumor necrosis factor- (tnf) and interleukin (il)-8, and others [6, 7 ]. some experimental evidence strongly suggests that in inflammation, infiltrating inflammatory cells and some resident cells are the producers of the angiogenic factors. human neutrophils and t - lymphocytes synthesize and secret the angiogenic factors such as vegf and il-8. peripheral blood eosinophils were found to secrete the factors when stimulated with granulocyte - macrophage colony stimulating factor and il-5 in vitro. fibroblasts, as resident cells, are also a demonstrated rich source of the angiogenic factors. among these cells, mast cells and eosinophils have been highlighted as the effector cells in angiogenesis during allergic inflammation [7, 12 ]. although recent researches have focused on the ability of antihistamines, which are the most important agent in the treatment of allergic diseases including ar, to modulate the release of inflammatory cytokines from mast cells and eosinophils, there is little information regarding the effects of antihistamines on angiogenesis. the present study, therefore, was undertaken to examine the influence of epinastine hydrochloride (ep), the most famous antihistamine in japan, on keratinocyte - derived chemokine (kc), tnf, and vegf that are known to be major factors affecting angiogenesis in murine mast cells in ige - dependent manner. specific pathogen - free balb / c male mice were purchased from charles river japan inc., st louis, mo, usa) supplemented with 10% heat inactivated fetal calf serum from gibco brl (gaithersburg, md, usa ; rpmi - fcs) at a concentration of 10 mg / ml, sterilized by passing through 0.2 m filter and then diluted with rpmi - fcs at appropriate concentrations for experiments. balb / c mice were injected intraperitoneally twice with a 2-week interval with 5.0 mg of ovalbumin from wako pure chemicals (ova ; osaka, japan) absorbed with 0.5 mg of alum in a volume of 0.5 ml. after one week, blood was obtained by cardiac puncture and ova specific ige was purified with kaptiv - ae from tecnogen s.c.p.a. the protein concentration of the extracted solution was measured with protein assay kit from bio - rad laboratories (hercules, calif, usa) and adjusted to 1.0 mg / ml with rpmi - fcs. the peritoneal cavity was rinsed with 10 ml of heparinized (10 iu / ml) calcium and magnesium - free hank 's solution (hbss). the fluid was collected, centrifuged at 150 g for 15 minutes at 4c. the pelleted cells were resuspended in hbss containing 0.1% bovine serum albumin and submitted to a continuous isotonic percoll gradient (72%) for mast cell isolation. the cell purity (> 96%) and viability (> 98%) were evaluated by alcian blue and trypan blue exclusion staining, respectively. to sensitize mast cells with ige, 1 10, cells were incubated with 500 ng / ml of ova - specific ige for 30 minutes at 37c, washed, and resuspended in rpmi - fcs. the sensitized mast cells (5 10 cells / ml) were stimulated with 10 ng / ml ova for 4 hours in the presence of various concentrations of ep in a total volume of 2.0 ml. the culture supernatants were collected after centrifugation of cell suspension at 150 g for 15 minutes at 4c and stored at 40c prior to assay for factors. to obtain water - soluble intracellular contents, the pelleted cells suspended in 2.0 ml hbss were then sonically disrupted in an ice cold water bath for 5 minutes and centrifuged at 3000 g for 30 minutes at 4c. the supernatants were obtained and stored at 40c until used. in cases of examining mrna expression, mast cells sensitized ige were stimulated with ova in a similar manner for 4 hours and stored at 80c until used. in all experiments, ep was added to cell cultures one hour before starting antigenic stimulation and cells were cultured in triplicate. kc, tnf, and vegf levels in culture supernatants were assayed using commercially available mouse elisa test kits (r & d systems, minneapolis, minn, usa) according to manufacturer 's recommendation. mrna was extracted from mast cells using macs mrna isolation kits from miltenyi biotec gmbh (bergisch gladbach, germany) according to the manufacturer 's instructions. the first - strand complementary dna (cdna) synthesis from 1.0 g mrna was performed using the superscript preamplification system for cdna synthesis from gibco brl (gaithersburg, md, usa). pcr was then carried out using a geneamp 5700 sequence detection system from applied biosystems (foster city, calif, usa). pcr mixture consisted of 2.0 l of sample cdna solution (10.0 ng / ml), 25.0 l of sybr - green mastermix (applied biosystems), 0.3 l of both sense and antisense primers, and distilled water to give a final volume of 50.0 l. the reaction was conducted as follows : 4 minutes at 95c, followed by 40 cycles of 15 seconds at 95c, and 60 seconds at 60c. mrna levels were calculated by using the comparative parameter threshold cycle (ct) and normalized to -actin. oligonucleotide sequences of the primers used are as follows : for kc, 5-gcgcctatcgccaatgag-3 (sense) and 5-agggcaacaccttcaagctct-3 (antisense) ; for vegf, 5-cagctattgccgtccgattgaga-3 (sense) and 5-tgctggctttgggaggtttgat- 3 (antisense) ; for tnf, 5-cctgtagcccacgtcgtagc-3 and 5-ttgacctcagcgctgagttg-3 ; for -actin, 5-acccacacttgtgcccatcta-3 (sense) and 5-cggaaccgctcattgcc-3 (antisense). the statistical significance of the data between the control and experimental groups was analyzed by anova followed by fisher 's plsd test. the first set of experiments was undertaken to examine the influence of ep on kc, tnf and vegf production from mast cells induced by antigenic stimulation in vitro. mast cells (5 10 cells / ml) sensitized with ova specific ige were stimulated with ova in the presence of 0, 10, 20, 25, 30, and 40 ng / ml ep for 4 hours. factor levels in culture supernatants were assayed by elisa. as shown in figures 1(a) and 1(b), treatment of cells with ep at quantities lower than 20 ng / ml did not cause the suppression of the release of both kc and tnf, which was increased by antigenic stimulation. however, ep significantly suppressed the ability of cells to release both kc and tnf after antigenic stimulation, when the agent was added to cell cultures at 25 ng / ml and higher (figures 1(a) and 1(b)). the data in figure 1(c) also showed the suppressive effect of ep on vegf release from mast cells induced by antigenic stimulation ; treatment of mast cells with ep at more than 30 ng / ml significantly suppressed increase in vegf levels induced by antigenic stimulation. we then examined factor levels in water - soluble intracellular extracts by elisa. as shown in figures 2(a), 2(b), and 2(c), treatment of mast cells with ep did not cause the prevention of factor release from cells ; the levels of factors (kc, tnf, and vegf) in extracts from cells treated with ep at 40 ng / ml are nearly identical (not significant) to that in stimulated but nontreated control (ova + ige). the second group of experiments were undertaken to examine the influence of ep on mrna expression for kc, tnf, and vegf after ova stimulation. mast cells (5 10 cells / ml) sensitized with ova specific ige were stimulated with ova in the presence of 0, 10, 20, 25, 30, and 40 ng / ml ep for 4 hours. mrna expression was examined by semiquantitative rt - pcr. as shown in figures 3(a), 3(b), and 3(c), treatment of mast cells with ep suppressed mrna expression for factors examined, which was increased by ova stimulation. the minimum concentration of the agent, which caused significant suppression, was 25 to 30 ng / ml. ep is a selective and potent h1-receptor antagonist with no anticholinergic and sedative effect [17, 18 ]. our previous work clearly showed that ep could suppress thymus and activation - regulated chemokine (tarc) production from human peripheral blood t cells induced by il-4 and costimulatory molecule stimulation. it is also observed that ep could antagonize against il-4-mediated t cell cytokine imbalance in vitro. these reports strongly suggest that the modulation of ep on both cytokine and chemokine production, which are responsible for the development of allergic immune responses, consists, in part, of a therapeutic mode of action of the agent on allergic diseases. the structural changes in the airway walls including epithelium, submucosa, smooth muscle, and vasculature are referred to as airway remodeling, which is mainly induced by several types of mmps, in allergic diseases such as asthma and allergic rhinitis [4, 21, 22 ]. furthermore, there is accumulated evidence that allergic inflammation causes structural changes in the nasal wall, which is characterized by angiogenesis and subepithelial basement membrane hypertrophy [2, 3, 23, 24 ]. angiogenesis involves destruction of the basement membrane by mmps, migration and proliferation of endothelial cells, and transformation of endothelial cells to form tubes. this process is mediated by numerous inducers, including members of fibroblast growth factor family, vegf, angiogenin, transforming growth factor, tnf, interleukins and chemokines [7, 26 ]. among them, vegf is the most potent regulator of angiogenesis and induces the enhancement of proliferation, migration, and tube formation of endothelial cells [7, 26 ]. vegf promotes secretion of mmp-1 and the expression of chemokines, as well as intracellular adhesion molecule and e - selectin. vegf also causes vasodilation, which is responsible for edema, inflammatory cell infiltration and increase in nasal secretions, through the induction of the endothelial nitric oxide synthase and the subsequent increase in nitric oxide production [7, 26 ]. furthermore, vegf stimulates monocyte chemotaxis and contributes to the recruitment of bone - marrow - derived endothelial cells in angiogenesis. together with the present results, showing the suppressive activity of ep on vegf production may be interpreted as meaning that some of therapeutic effects of ep in ar depend on its suppression of vegf production from mast cells. in addition to vegf, tnf is considered to be a multifunctional proinflammatory cytokine that plays a central role in the initiation and maintenance of many inflammatory diseases, including asthma and allergic rhinitis. although tnf is associated predominantly with th1-dependent inflammation, recent reports indicate that tnf is essential for the production of the th2 type cytokines and for infiltration of th2 t cells into the site of allergic inflammation. tnf is produced by a variety of inflammatory cells, especially mast cells and macrophages through ige - dependent mechanisms and also enhanced the effect of both il-4 and il-10 on antigen - specific ige production [27, 28 ]. furthermore, tnf increased the expression of mrna for endothelial - leukocyte adhesion molecule-1 (elam-1) and vascular cell adhesion molecule-1 (vcam-1), which are essential for eosinophil migration into allergic inflammatory site, in nasal mucosa after ovalbumin sensitization in mice, suggesting that inhibition of tnf production from mast cells through ige - dependent mechanisms may also partially account for the therapeutic mechanisms of the agent on allergic diseases. kc (murine homolog of il-8), a member of cxc subfamily, is produced by several types of immune cells, including epithelial cells, macrophages, mast cells, and lymphocytes after immunological and nonimmunological stimulation. although several reports clearly showed that the presence of large amount of il-8, chemoattractants for neutrophils and eosinophils, in nasal lavage fluid obtained from allergic rhinitis [3032 ], the role of this chemokine is limited in granulocyte infiltration into inflammatory sites of allergic rhinitis. on the other hand, addition of il-8 into human microvascular endothelial cells cultured on the surface of a three - dimensional collagen gel - caused - tube - like structure formation it is also reported that administration of anti - il-8 into rabbit corneas significantly inhibits newly vessel formation (angiogenesis) induced by implantation with ethylene vinyl acetate pellets containing tnf, indicating that il-8 plays an essential role in tnf - mediated angiogenesis. from these reports, the inhibitory action of ep on kc production from mast cells by ige - dependent mechanisms may also have important therapeutic implications for allergic diseases. although the present results clearly show the inhibitory action of ep on the production of proangiogenic factors from mast cells by antigenic stimulation through the suppression of mrna expression, the precise mechanisms by which ep could inhibit the production of proangiogenic factors from mast cells are not clear at present. the major stimulus for mast cell activation is the aggregation of the high affinity receptor for ige so - called fcri. crosslinking of fcri - bound ige - molecules with specific allergen activates the receptor - associated tyrosine kinases and the initiation of further phosphorylation of downstream molecules such as syk, phosphatidyl - inositol-3-oh - kinase, and phospholipase c. these proximal signaling events activate protein kinase c that ultimately initiates mast cell effector functions such as degranulation and cytokine production. the activation of these kinases is also reported to require ca, which is increased by crosslinking of ige with allergen on mast cell surface. it has been reported that ep at more than 10 m could inhibit ca influx and ca release from the intracellular calcium store of mast cells exposed to compound 48/80 and substance p [36, 37 ]. judging from these reports, it is strongly suggested that ep inhibits the changes in ca concentration in cytosole induced by antigenic stimulation and results in suppression of angiogenic factor production from mast cells. in addition to these signaling pathways, transcription factor nf-b regulates the expression of inflammatory gene products in many different cell lineages. in mast cells, the expression of tnf, il-6, and il-8 gene after fcri ligation strictly depends on the activation of nf-b [34, 35 ]. nf-b is a ubiquitous protein transcription factor and normally resides in an inactive state in cytoplasm. however, when activated it translocates to the nucleus, binds the dna, and activates genes. activation of nf-b is induced by degradation and dissociation of ib, an endogenous inhibitor of nf-b, through ca - dependent and -independent mechanisms. together with the present results, there is also possibility that ep inhibits nf-b activation through ca - independent mechanisms and results in suppression of angiogenic factor production from mast cells. pharmacological studies have revealed that, after oral administration of ep into patients with allergic diseases at a single dose of 20 mg, plasma concentration of this agent was gradually increased and attains a plateau at 26.9 9.1 ng / ml, suggesting that the findings of the present in vitro study may reflect the biological function of ep in vivo. in conclusion, the present results demonstrate that the inhibitory action of ep on angiogenic factor production consists, in part, of a therapeutic mode of action of the agent on allergic diseases, including atopic allergy and pollinosis. | angiogenesis is an important event both in the development of allergic inflammatory responses and in the pathophysiology of tissue remodeling in allergic diseases. in the present study, therefore, we examined the influence of antihistamines on angiogenesis through the choice of epinastine hydrochloride (ep) and murine mast cells in vitro. mast cells (5 105 cells / ml) presensitized with murine ige specific for ovalbumin (ova) were stimulated with 10 ng / ml ova in the presence of various concentrations of ep for 4 hours. the levels of angiogenesis factors, keratinocyte - derived chemokine (kc), tumor necrosis factor- (tnf), and vascular endothelial growth factor (vegf) in culture supernatants, were examined by elisa. we also examined mrna expression for the angiogenesis factors by rt - pcr. ep significantly inhibited the production of kc, tnf, and vegf induced by ige - dependent mechanism at more than 25 ng / ml. semiquantitative analysis using rt - pcr showed that ep also significantly reduced mrna expressions for kc, tnf, and vegf. these results strongly suggest that ep suppresses angiogenesis factor production through the inhibition of mrna expression in mast cells and results in favorable modification of clinical conditions of allergic diseases. |
one of the most studied noncanonical dna motifs is the g - quadruplex, where four guanines are paired through their watson - crick and hoogsteen sides [13 ]. these structures are receiving substantial attention in research areas ranging from molecular biology to structural and analytical chemistry [46 ]. it has been suggested that g - quadruplexes play a role in several biological processes, such as telomere integrity, genetic recombination, transcription, or replication. in addition, they are attractive targets for drug design, especially in cancer chemotherapy [711 ]. g - quadruplexes can fold in many ways that differ in their chain number and orientation. whereas single gn tracks arrange in parallel structures, multiple gn repeats fold with different topologies that are influenced mainly by the nucleotide sequence between gn repeats as well as by the kind of counterion. in occasions, different topologies have been found for the same oligonucleotide in solid and solution studies. on the other hand, cyclic oligonucleotides have emerged as interesting molecules in research for diagnosis and as therapeutic agents due to their increased nuclease resistance relative to their linear analogues [15, 16 ]. these molecules are also interesting for structural studies since the conformational constraint induced by cyclization of the chain may increase the relative stability of the structure of interest [1721 ]. g - quadruplexes have been used as templates for enhancing the efficiency of the synthesis of cyclic oligonucleotides. this approach takes advantage of the proximity between the two oligonucleotide termini in some quadruplex topologies to improve phosphodiester ligation [2224 ]. for example, these nuclease resistant oligonucleotides can be very useful probes to study g - quadruplex interacting proteins. however, the conformational constraint induced by cyclization affects the range of structures that a g - quadruplex can adopt. for example, diagonal loops or double - chain - reversal loops are not possible in quadruplexes formed by cyclic oligonucleotides. to gain insight on the effect of cyclization on the structure of g - quadruplexes, we have studied the structure and stability of the cyclic dodecamer d, containing two copies of the human telomeric repeat. the analogous linear oligonucleotide d(tagggttagggt) forms two interconverting dimeric structures in solution : a parallel quadruplex with double - chain - reversal loops, and an antiparallel quadruplex with edgewise loops. on the other hand, the same sequence forms a parallel quadruplex with double - chain - reversal loops in the crystal (in presence of k). a similar structural diversity has also been observed in an oligonucleotide containing four copies of the human telomeric repeat, which in k forms an intramolecular parallel quadruplex in the crystal and an antiparallel quadruplex with a diagonal and two edgewise loops in na - containing solution. other quadruplex topologies have been observed in a variety of oligonucleotides containing different number of telomeric repeats [2831 ] (see for a recent review on these studies). samples for nmr experiments were prepared in 100 mm nacl, 25 mm sodium phosphate buffer ph 7, with an oligonucleotide concentration ranging from 60 to 600 m. nmr spectra were acquired in a bruker avance spectrometer operating at 600 mhz and equipped with a cryoprobe. two - dimensional experiments (noesy, tocsy, and dqf - cosy) were carried out at 5c in either d2o or in h2o / d2o 9:1. noesy spectra were acquired with mixing times of 50, 100, and 200 ms, and tocsy spectra were recorded with standard mlev-17 spin - lock sequence, and 80 ms mixing time. noesy spectra in h2o were acquired with 50 and 150 ms mixing times. in 2d experiments in h2o, water suppression was achieved by including a watergate module in the pulse sequence prior to acquisition. cd spectra were obtained following the change of ellipticity from 220 nm to 320 nm at different temperatures on a jasco spectropolarimeter equipped with a peltier temperature control used to set the temperature between 5c and 90c. the changes in ellipticity versus temperatures were plotted and used to obtain the melting temperature. only six h6/h8 aromatic signals are detected (as a logical consequence of the repetitive sequence), and the exchangeable proton spectrum is very broad (see figure 1). however, at high oligonucleotide concentration the exchangeable proton spectra shows 12 narrow signals between 10.0 and 12.0 ppm, and 24 aromatic signals (corresponding to h6/h8 protons) are observed in the non - exchangeable proton spectrum (see figure 2). two fragments of the noesy spectra in d2o are shown in figures 2 and 3. the nmr spectrum in these conditions exhibits narrow and well dispersed signals, which indicates that the oligonucleotide adopt a well - defined structure. however, the nmr spectra of this molecule could not be unambiguously assigned due to its highly repetitive sequence. in spite of this, many structural features can be spotted from this spectrum. first, the cross - peaks of the imino and amino protons are consistent with the presence of three g - tetrads. secondly, as shown in figure 3, six strong h1-h8 cross - peaks are observed, indicating that the glycosidic angle of the corresponding guanines is in a syn conformation (gs). moreover, the occurrence of four steps gs - ga can be established from the sequential h1h8 noes steps. finally, no ga - ga steps are present in this structure since no sequential noes are observed between guanines in anti. all these data, together with symmetry considerations, led us to suggest a model for this structure in which two cyclic dodecamers self - associate forming an antiparallel quadruplex with three g - tetrads (figure 4). the two macrocycles are arranged in a parallel way. overall, the structure is similar to antiparallel quadruplexes resulting from a head - to - head association of two hairpins with edgewise it is interesting to compare these results with other structures of quadruplexes formed by linear oligonucleotides containing repeats of the human telomeric sequence. different groups have shown that linear oligonucleotides containing two repeats tend to adopt antiparallel quadruplex structures in sodium buffer [25, 36 ]. in the case of d(uagggtuagggt) the structure is an asymmetric dimer, but the relative orientation of the two molecules is different than in the dimeric structure of d. the distribution of syn and anti guanines is also different in both cases. in the presence of k, linear oligonucleotides containing two repeats of the human telomere have the propensity to adopt parallel - stranded structures [25, 36 ], which are obviously impossible in the case of the cyclic analogues. we must conclude that the conformational constraint induced by cyclization of the phosphodiester chain affects the topology of the quadruplex. this result is not surprising since cyclization is formally equivalent to introducing an additional nonnative loop in the sequence. the effect of loop variations in the structure and topology of quadruplex has been extensively studied by several groups [3739 ]. since many oligonucleotides containing human telomeric repeats tend to adopt different structures in presence of k or na cations, we tackled the study of the effect of these two cations on the structure of d. the profile of the cd spectra in na buffer was consistent with an antiparallel g - quartet architecture characterized by a positive band at 248 nm, a positive maximum at 295 nm, and a negative maximum at 265 nm (figure 5(a)). however, in presence of k the cd spectra of d changes dramatically (figure 5(b)). the negative band at 265 nm disappears, and the minimum around 235 nm is more pronounced. in these experimental conditions the cd spectrum is not consistent with a pure antiparallel or parallel g - quadruplex, the latter presenting a characteristic positive maximum at 265 nm. nmr spectra conducted at 500 m oligonucleotide concentration in k buffer exhibit very broad signals (data not shown), in agreement with the occurrence of multiple conformations or aggregation. this result is not unexpected since it is well documented that k cations favour the parallel - stranded structures, which in this case are impeded by the cyclization of the phosphodiester chain. cd spectra of d in na are characteristic of antiparallel quadruplexes (see figure 5). melting curves were recorded at different oligonucleotide concentrations, and thermodynamic parameters were obtained from the variation of the melting temperature with the concentration. thermodynamic parameters for dimer formation in 100 mm nacl buffer solution are h = 35 kcal / mol, s = 92 cal / mol, and g298 = 8 kcal / mol. it is interesting to compare these parameters with the values for the unimolecular quadruplex formed by analogous linear oligonucleotides containing four repeats of the human telomere. for example, the thermodynamic parameters for d(agggttagggttagggttaggg), under the same buffer conditions, are h = 54 kcal / mol, s = 163 cal / mol, and g298 = 5.4 kcal / mol. interestingly, formation - free energy is lower for the quadruplex formed by two cyclic oligonucleotides than for the quadruplex formed by the the lower formation enthalpy in the dimer is probably a consequence of the constraint in the loops induced by the cyclization. however, the entropic cost of forming the quadruplex through the self - association of two cyclic oligonucleotides with two repeats is lower than in the case of the folding of a linear oligonucleotide with four telomere repeats. in summary, we have shown that guanine - rich cyclic oligonucleotides can form dimeric quadruplex structures. the conformational constraint induced by cyclization of the chain does not prevent quadruplex formation but has a profound influence in the global topology and stability of the structure. such effect must be taken into account in the potential application of cyclic g - quadruplex as molecular probes. | we have studied the structure and stability of the cyclic dodecamer d, containing two copies of the human telomeric repeat. in the presence of sodium, nmr data are consistent with a dimeric structure of the molecule in which two cycles self - associate forming a quadruplex with three guanine tetrads connected by edgewise loops. the two macrocycles are arranged in a parallel way, and the dimeric structure exhibits a high melting temperature. these results indicate that cyclization of the phosphodiester chain does not prevent quadruplex formation, although it affects the global topology of the quadruplex. |
older adults experience increasingly frequent reminders of mortality due to their own declining health and the deaths of friends and family members. does this psychological proximity to death increase anxiety and defensiveness among older individuals, or serve as the impetus to develop greater comfort with and acceptance of their mortality ? research examining self - reported fear of death across the lifespan has produced mixed results. younger adults consistently report higher fear of death than older adults [1, 2 ], yet it remains unclear whether mortality - related concerns continue to decrease or remain stable in later life. however, a meta - analysis of this research concluded that fear of death declines from middle age to old age, but among older adults, age no longer reliably predicts self - reported fear of death. cicirelli reported that individuals in mid - old age (7584) reported greater fears concerning loss of the body (e.g. cremation or bodily decay after death) than those in young - old age (6074), but the two groups did not differ in reported fears concerning the unknown (e.g. what constitutes the afterlife ; what it means to cease existing). research available to date thus provides an incomplete and somewhat puzzling picture of older persons ' concerns about death. terror management theory (tmt) [6, 7 ] provides an alternative approach to the study of death anxiety. the theory posits that humankind 's capacity for awareness of their inevitable death creates the potential for devastating anxiety that is managed by an anxiety - buffering system consisting of a cultural worldview, self - esteem, and close relationships. the cultural worldview provides a conception of reality and a set of guidelines for valued behavior shared by the culture 's inhabitants. following these guidelines provides structure within an otherwise chaotic world, a sense of belongingness, and literal immortality (e.g. entry into heaven, reincarnation, or other form of afterlife) and/or symbolic immortality (e.g., job promotions, having a park or building named after one 's family). meeting or exceeding culturally constructed standards of value gives the individual self - esteem, the feeling that one is a valuable contributor to a meaningful universe. close relationships harken back to the security provided by early attachments to one 's parents and are essential for the maintenance of both self - esteem and faith in one 's worldview. together, cultural worldview, self - esteem, and close relationships provide a protective shield against the potential for anxiety that results from awareness of the inevitability of death. support for tmt comes from a large body of research showing that when people are reminded of death (mortality salience, ms), they show increased commitment to and defense of their worldviews, self - esteem, and close relationships (see for a recent review). for example ms has been shown to lead to more positive reactions toward those who praise one 's worldview and more negative reactions toward those who criticize it, more self - esteem striving, and greater reports of attraction to romantic partners. a recent meta - analysis by burke and colleagues found that ms effects are highly reliable and yield moderate - to - large effects (r =.35, d =.75) on a wide range of attitudinal, behavioral, and cognitive dependent variables. the pursuit of faith in one 's worldview, self - esteem, and close relationships are referred to as distal defenses because they bear no direct or logical connection to the problem of death, but rather, provide protection by enabling people to construe themselves as valued contributors to a meaningful universe. proximal defenses, on the other hand, refer to defensive responses that deal with the problem of death in a direct and seemingly logical way. research has shown that reminders of death also increase proximal defenses, such as increasing one 's interest in exercise and believing that one possesses characteristics associated with a long life expectancy. as people age, it is likely that they become less able to meet many of the standards that previously provided them with self - esteem. this is particularly problematic within western culture, where many central achievements include success in the areas of career, finances, and physical appearance, all of which are more difficult to accomplish in later life. with advancing age, people are also likely to witness changes in mainstream cultural worldviews, which could result in decreased consensual validation of older adults ' cultural worldview, providing fewer opportunities for boosting self - esteem and resulting in drastic changes in the anxiety - buffering system. see mccoy. for a theoretical exploration of tmt and aging. in contrast to the suggestion of psychological deterioration and struggle in later life, there is abundant empirical support for the idea that older adults developed methods for adapting to the changes inherent in later life. a growing body of research suggests that older adults are increasingly focused on positive information and experiences, while attending less to negative information. as noted above, the literature [14 ] also suggests that older adults generally report lower levels of death anxiety than younger adults, although the details of this pattern are not yet completely clear. although many people report that they do not fear death, research suggests that younger adults ' self - reported fear of death is not predictive of responses to ms inductions in terror management studies. this raises the possibility that even though older persons report lower fear of death on explicit measures, they may still experience death anxiety and respond defensively to reminders of death. because tmt posits that individuals with poorly functioning anxiety - buffering systems would be especially susceptible to the influence of mortality reminders, one might expect that older adults would be an especially vulnerable group. initial tmt research with older adults indicates that older adults do not respond to reminders of death with the same distal defenses that younger persons use. specifically, following an ms induction, younger adults were more punitive towards individuals breaking social norms, whereas older participants were more lenient towards moral transgressors. however, this effect only emerged reliably when the reminder of death was very subtle. in other studies, older adults did not show the increased tendency to structure social information in a simplistic manner as displayed by younger adults reminded of death but did show increased generativity striving which was not found in younger adults. in studies of proximal defensiveness, older participants indicated decreased interest in health promoting behavior when death was in focal attention, in direct contrast to younger and middle - aged adults who showed more interest in health information after death reminders. conversely, when thoughts of death were no longer in focal attention, older adults with low self - esteem reported increased intention to engage in health behaviors after ms but those with high self - esteem were not influenced by ms. however, it should be noted that older adults in these last two studies ranged in age from 51 to 65 years, providing an incomplete picture of terror management processes in later life. the present study assessed the effect of reminders of death on older adults ' use of what is perhaps the most direct and simple form of proximal defense simply believing that death is far away and that one has many remaining years to live. an older adult who has come to accept mortality would be more likely to provide a realistic estimate of his or her lifespan, whereas someone who remains fearful of, or uncomfortable with, death would most likely engage in the proximal defense of denying the event via longer life expectancy estimates. indeed, it appears that people of all ages are generally accurate in their life expectancy estimates [22, 23 ]. however, it seems likely that logical awareness of one 's likely lifespan would differ from desired lifespan. consistent with this notion, cicirelli had participants report the number of years they thought they would live and number of years they would like to live. results indicated that mid - old adults (7584), although probabilistically closer to death, reported a greater discrepancy between the two estimates, suggesting they wanted to live longer than they expected, compared to a young - old (6074) group asked to make the same estimates. although this study did not include reminders of mortality, the assessments of both expected and desired life expectancy provide an indication of the contrast existing between real and ideal remaining years in life. terror management research has shown that some people are better able to deal with death than others. one predictor of responses to reminders of death is neuroticism, a general sensitivity toward fear and anxiety, a trait which may leave highly neurotic individuals less capable of effectively defending against death - related anxiety. indeed, persons high in neuroticism exhibit exaggerated responses to ms, distancing themselves from the physical body [24, 25 ] and bodily sensations. greater defensiveness in response to reminders of death among highly neurotic individuals is perhaps not surprising given research suggesting that neuroticism is associated with greater immediate and longer - term emotional reactivity, poorer coping skills, increased susceptibility to a variety of psychological disorders, and greater death - related anxiety. it is believed that the traits associated with neuroticism leave this group less equipped to manage death - related anxiety. in addition to the role of neuroticism in terror management processes, this personality trait has also been associated with poorer perceived health among older adults ; it was therefore hypothesized that neuroticism would be related to older individuals ' subjective life expectancy estimates and responses to increased awareness of mortality. the present study examined effects of death reminders on older adults ' subjective life expectancy estimates and the potential moderating roles of age and neuroticism. bearing in mind erikson 's proposition that the final stages of life are distinctively different from early and midlife, we considered the possibility that old - old participants ' (73 to 87 years old) responses to ms would differ compared with young - old participants (5772 years old). aside from the intuitive prediction that young - old would expect to live longer than old - old participants, we had no strong expectations about age groups ' reactions to ms, but suspected that old - old persons are more accepting of death and would therefore be less likely to respond to ms with longer life expectancy estimates. based on findings indicating that highly neurotic individuals show exaggerated defensiveness following reminders of morality [2426 ], we predicted that participants reporting higher levels of neuroticism would be more likely to respond to ms by distancing themselves from death via longer predicted life expectancies because their anxiety - buffering systems are typically weaker than individuals low in neuroticism, and highly neurotic individuals are more likely to use avoidance - oriented coping mechanisms [34, 35 ]. a between - subjects design was used, with two groups : the ms condition and a control condition. random assignment to condition allowed for distribution of individual difference variables and pre - existing differences in life expectancy beliefs across study conditions. although having baseline data of participant life expectancy could be useful, it was not assessed because multiple measurement in a short time period could motivate participants to appear consistent or tip them off to the purpose of the study. participants were recruited from an annual mature adults ' minicollege lecture series at a liberal arts college. participants ranged in age from 57 to 87 years old (m = 71.44, sd = 6.77). the sample included 26 men and 108 women. men (m = 70.88, sd = 6.69) and women (m = 71.57, sd = 6.81) did not differ in age, p =.64. (inclusion of participant sex did not alter analyses reported ; there was no main effect for sex, nor did this variable interact with prime, age, and neuroticism, ps >.11 for life expectancy estimates, positive affect, negative affect, and self - esteem.) see table 1 for sample characteristics. to prevent participants from speculating about the purpose of the study, they were told the study concerned the personality and attitudes of older adults. participants were randomly assigned to either the ms (n = 73) or pain conditions (n = 61) ; groups did not differ in age (p =.46) or gender (p =.42). participants indicated agreement with a variety of statements (e.g., would you call yourself tense or yes responses were scored as 1, and no responses scored as 0, for a possible range of scores from 0 to 23 ; higher scores indicate greater neuroticism (m = 7.88, sd = 4.92). this measure (=.85) served the dual purpose of assessing the hypothesized moderating variable as well as supporting the cover story. ms participants responded to the questions please briefly describe the emotions that the thought of your own death arouses in you and jot down, as specifically as you can, what you think will happen to you as you physically die and once you are physically dead. control participants responded to parallel questions (please briefly describe the emotions that the thought of experiencing intense physical pain arouse in you and jot down, as specifically as you can, what you think will happen to you as you experience intense physical pain). physical pain was selected as a control because it is a negative experience that does not involve death. these questions increase the accessibility of, or prime, thoughts related to mortality or the experience of physical pain. indeed, previous research reveals that ms questions have reliably proven to increase death - thought accessibility as well as defensive responses, whereas questions regarding pain have not [11, 37 ]. participants then completed the 60-item expanded positive and negative affect schedule (panas - x), indicating on a scale of 1 (very slightly or not at all) to 5 (extremely), the extent to which they were experiencing listed emotions (e.g., interested, ashamed) at the present moment. scales of both positive (=.78) and negative affect (=.85) had acceptable reliability. they also completed the 20-item state self - esteem scale, indicating on a scale of 1 (not at all) to 5 (extremely) the extent to which they agreed with 20 statements relating to self - esteem (e.g. i feel that others respect and admire me. ; =.89). mean scores were calculated for affect and self - esteem, with resulting possible scores ranging from 1 to 5. although affect and self - esteem are not typically affected by ms in studies with younger adults, we included these measures because little is known about ms effects among older adults. further, because life expectancy estimation has not been used as a dependent variable in tmt research, assessments of affect and self - esteem allowed us to examine its relationship to these variables. the two measures also provided a delay and distraction before the dependent variable to reduce the likelihood of participants making an explicit connection between the ms induction and dependent measure. lastly, for our primary dependent variable, participants were asked to indicate to what age do you expect to live ? they then attended a lecture given as a portion of the course they were enrolled in, which included a debriefing and discussion of the study. the primary dependent variable, remaining life expectancy, was created by subtracting current age from estimated life expectancy. for example, a 65-year - old estimating she will live to 85 would receive a score of 20. life expectancy served as a dependent variable in hierarchical regression analyses with ms condition, age, neuroticism, and resulting two- and three - way interactions as predictors. following aiken and west 's methods, the ms variable was dummy - coded, and continuous variables, age and neuroticism were centered at the mean. main effects were entered in step 1 (r =.39, p.50. among young - old, there was a tendency for higher neuroticism to predict shorter life expectancy (p =.06), and the predicted ms neuroticism interaction was significant, b =.61, se =.32, t = 4.42, p <.01 (partialr =.22). thus old - old participants ' life expectancy estimates were not affected by ms or neuroticism ; see figure 1. among young - old participants, high neuroticism was associated with lower life expectancies : in the control condition this relationship was statistically significant, b =.94, se =.18, t = 5.15, p <.01, but in the ms condition it fell short of significance, b =.45, se =.26, t = 1.72, p =.09. to test our primary hypotheses about the effect of ms on high and low neurotics, we assessed the effect of ms separately at 1 sd above and 1 sd below the neuroticism mean. among low neurotic young - old individuals, ms decreased life expectancy estimates, b = 5.80, se = 2.02, t = 2.87, p <.01. however, consistent with our primary hypothesis, among high neurotic young - old participants, ms leads to longer life expectancy estimates, b = 7.93, se = 2.24, t = 3.55, p <.01, see figure 2. the finding that neuroticism was generally associated with reporting lower life expectancies appears consistent with previous findings that neuroticism is associated with poorer perceived health among older adults. however, the finding that high neurotic young - old participants were the only group to respond to ms with increased life expectancy estimates suggests that they are also especially defensive in this regard when thoughts of death are primed. looked at differently, young - old participants reported greater life expectancies than old - old participants in all but one condition (ps <.01), high neuroticism control (p =.15). reminders of death seemed to counteract this tendency by activating death - denying responses that elevated young - old high neurotics ' life expectancy estimates above those of old - old high neurotic participants, p <.01, but still not to the level of low neurotic young - old participants, p =.09. one - way analysis of variance was used to test for possible effects of ms on positive and negative affect and self - esteem, and revealed no ms effects on positive affect (p =.97) or self - esteem (p =.74). participants in the ms condition tended to report higher negative affect (p =.06). treating positive and negative affect and self - esteem as covariates in regression analyses did not significantly influence the reported results concerning life expectancy ; the three way interaction remained significant, p =.02. positive affect was positively related to life expectancy estimates, b =.28, se =.94, t = 3.42, p <.01, while negative affect was negatively related to these estimates, b =.19, se = 1.46, t = 2.19, p <.05. the present results suggest that the way older adults cope with increased proximity to death depends on both age and neuroticism. except for those in the high neurotic control group, old - old participants predicted fewer remaining years of life than young - old participants. young - old participants with lower levels of neuroticism responded to death reminders with lower estimates of life expectancy. among young - old adults, this arguably more adaptive personality type seems to allow for less defensive responses to reminders of mortality. on the other hand, young - old adults who were high in neuroticism responded to ms with longer life expectancy estimates. this is consistent with research linking high levels of neuroticism to the use of avoidance as a defense mechanism [34, 35 ] and especially defensive responses to reminders of mortality among younger adults [2426 ]. neuroticism predicts both poorer perceived health and greater susceptibility to anxiety disorders among older adults. this is likely reflected in the control condition, in which more neurotic participants generally reported a lower life expectancy. with poorer perceived health and more anxieties, a lower life expectancy may be expected for highly neurotic individuals. for the young - old, this difference between low and high neurotics was eliminated because the high neurotics increased their life expectancy estimate after ms. these findings are consistent with our interpretation of the ms - induced increase in life expectancy among young - old participants in the present study being a proximal terror management defense to avoid the problem of death. as predicted, high neurotic young - old adults increased their life expectancy estimates in the present study, presumably because they lack adequate anxiety - buffering mechanisms. the present results suggest that, generally speaking, high neurotic young - old adults have lower subjective life expectancy than their less neurotic counterparts ; however, reminders of mortality activate the defensive reaction of increasing their life expectancy estimates. interestingly, old - old participants did not show this defensive response to ms, regardless of neuroticism level. it is certainly easy to imagine a well - adjusted (i.e., low neurotic) old - old individual accepting the reality of mortality and being less impacted by reminders of it, as found among young - old low neurotic participants in this study. the fact that highly neurotic old - old participants in the present study were also unaffected by reminders of death suggests that with highly advanced age, people may become increasingly accepting of their mortality and thus less likely to engage in defensive denial. it may also be that increasing life expectancy was simply implausible for persons of this age group. taken as a whole, the present results suggest that the process of aging and the associated more frequent reminders of mortality provide motivation for young - old adults low in neuroticism to strive for death acceptance, or at the very least, sober realism, as reflected in their shorter estimates of life expectancy following ms. however, those in the young - old range with higher levels of neuroticism may lack similar psychological resources and therefore attempt to distance themselves from death via longer life expectancy ratings. yet among old - old individuals, neuroticism was no longer predictive of defensive reactions to ms. this could reflect a relinquishing of efforts to defend, or perhaps with highly advanced age, neurotic individuals develop different, untapped methods for coping with death - related anxiety. additional research will be needed to determine whether the present results reflect acceptance of death or a switch to other types of defenses. erikson suggested that in later life, people contemplate the fundamental nature of their existence. he maintained that in the eighth stage of development, people enter a period characterized by either ego integrity or despair. he described ego integrity as an acceptance of the life led and awareness that death is a natural part of life ; these individuals would presumably respond less defensively to reminders of mortality. others may experience despair, characterized by fearfulness that life is coming to a close and an inability to identify a coherent sense of purpose and/or achievement in their lives. although a direct measurement of erikson 's concepts of ego integrity and despair was not included in the present study, persons with high levels of neuroticism seem less likely to achieve ego integrity. erikson 's suggestion that despair is characterized by fearfulness, some of which is specific to death, and research linking neuroticism to the fear of death, are consistent with the possibility that a lack of ego integrity among high neurotics might play a role in the present results. indeed, young - old participants high in neuroticism displayed defensive distancing from death that might reflect what erikson identified as a lack of ego integrity. conversely, people with lower levels of neuroticism predicted shorter life spans following reminders of death, implying the potential acceptance of life 's end. the present findings suggest that with truly advanced age, such as the old - old participants in the present study, neuroticism no longer predicts responses to ms. joan erikson 's subsequent addition of a ninth stage may help explain this diminishing role of neuroticism toward the end of life. in the proposed ninth stage, which emerges in very old age, individuals must cope with the extreme physical changes experienced in the late 80s and beyond. during this stage, people consider the larger meaning of life, rather than focusing on one 's own individual life. erikson described this as a time involving serious reflection on personal death, which may include acute awareness of the likely causes of one 's own passing. it may be that at this point in development, even neurotic individuals move toward greater acceptance of death. it is important to point out, though, that the old - old group in the present study was largely composed of individuals slightly younger than those expected to be in the ninth stage as defined by erikson (20 participants were 80 and older, and 4 were 85 and older). it seems likely, though, that the transition toward this ninth stage of death acceptance is a gradual process that begins before the late 80s ; indeed, erikson was clear that the ages specified were general guidelines, that varied across persons, and that the process of moving from stage to stage is a gradual process rather than a discrete transition. the present finding that neuroticism predicts defensive responses to ms in young - old but not old - old adults, suggests that advancing age may encourage changes in coping even among neurotic persons who were resistant to such changes in their younger years. due to the fact that the study was conducted in a large group as part of an educational program, we were unable to conduct cognitive screens. it would be helpful to be able to link participants ' results to their level of cognitive functioning, or at least have definitive information showing that cognitive functioning was not playing a role in the present results. health information could also be of interest regarding its impact on life expectancy estimates, as subjective health ratings have been shown to predict desired length of life expectancy. we feel confident that the individuals participating in this study were highly functioning and healthy older adults, as all were participating in a lecture series involving transportation to campus and attendance at three lectures a day, one day per week, over the course of 6 weeks. participants also initiated participation in the study and were actively engaged in the educational program at which they were recruited. indeed, the high functioning nature of our sample most likely offers a picture of healthy aging processes, which may limit the generalizability of our results to less healthy older adults. any variability in functioning or health would likely be distributed evenly across conditions due to random assignment. ideally, we would also have more demographic and personal information, allowing assessment of whether variables such as socioeconomic status, health, and religious beliefs affect responses to ms. however, the homogeneous nature of the participant pool and their overall high level of functioning suggest there were likely to be relatively little variability on these dimensions. further, in previous tmt studies with older adults, we have not found socioeconomic status, health, or religious beliefs to have significant impact on results [1820 ]. although research with younger adults indicates that priming thoughts of physical pain produces effects similar to that of neutral primes [11, 37 ], it may be that thinking about the experience of physical pain is different for older, compared to younger adults, because they are more likely to have health problems that involve physical pain. if their physical pain is associated with a debilitating or potentially fatal disease process, thinking of this pain may subsequently elicit reminders of death. however, a content analysis of participants ' responses to the pain salience induction found that only six participants mentioned death - related problems or concepts, and these were no more frequent among old - old neurotic participants than the other groups. future studies should include a wider variety of control inductions to identify the most appropriate one for older age groups. despite these limitations, the present results offer insight into older adults ' responses to reminders of death and experience of existential anxiety. it appears that older individuals low in neuroticism develop some level of acceptance of their mortality, and as a result they are less likely to respond to ms with significantly longer life expectancy estimates. this may also be the case for old - old individuals regardless of level of neuroticism, whose responses are not significantly affected by ms. however, young - old adults with high neuroticism apparently continue to be motivated to view death as part of the distant future. this suggests that in the early stages of older adulthood, personality variables may be an important determinant of the types of reactions used when reminded of mortality, but that increasingly advanced age promotes less individual differences in these responses. | research has shown that reminders of mortality lead people to engage in defenses to minimize the anxiety such thoughts could arouse. in accord with this notion, younger adults reminded of mortality engage in behaviors aimed at denying vulnerability to death. however, little is known about the effects of mortality reminders on older adults. the present study examined the effect of reminders of death on older adults ' subjective life expectancy. mortality reminders did not significantly impact the life expectancy estimates of old - old adults. reminders of death did however lead to shorter life expectancy estimates among young - old participants low in neuroticism but longer life expectancy estimates among young - old participants high in neuroticism, suggesting that this group was most defensive in response to reminders of death. |
since the 1960s, the chemistry of nitroxides has been widely investigated due to their unique physical and chemical properties. nitroxide radicals have been commonly utilized for spin trapping and spin labeling applications in electron paramagnetic resonance (epr) spectroscopy and for monitoring cellular redox processes. nitroxides are also effective antioxidants in biological systems due to their ability to react with superoxide radicals. superoxide, one of the main reactive oxygen species produced in the cell, is a significant contributor to cellular levels of oxidative stress, a term which describes an imbalance in the concentrations of pro- and antioxidants. oxidative stress results in cellular damage due to the generation of peroxides and free radicals and has been implicated in cardiovascular aging, parkinson s disease, and alzheimer s disease. nitroxides have shown significant potential as small molecule antioxidants in mammalian cells due to their broad distribution and ability to react with and detoxify harmful radical species. as a result of their reactivity toward biologically relevant radicals, nitroxides profluorescent nitroxides, which contain a fluorophore closely linked to a nitroxide moiety, display significantly reduced fluorescence due to efficient quenching of the excited electronic state of the fluorophore by the nitroxide radical. upon reduction, oxidation, or radical trapping, however, normal fluorophore emission is enabled, making these compounds very sensitive probes for the detection of free radical species. profluorescent nitroxides have been utilized as probes for the detection of the biologically relevant reductant ascorbic acid and the biologically important radical superoxide. glutathionyl radicals have also been detected by an associated fluorescence increase of acridine nitroxide profluorescent probes in cells. more recently, a fluorescein - based nitroxide probe was combined with flow cytometry to highlight the difference between healthy cells and those undergoing oxidative stress. depending on the chromophore moiety present within the profluorescent nitroxide species, the absorption and emission wavelengths of these probes can be tuned to match specific applications, such as cellular imaging. thus, profluorescent nitroxides are extremely useful tools for monitoring and imaging changes in the redox status of the cellular environment ; however, their use as probes for two - photon fluorescence microscopy imaging has previously not been investigated. two - photon fluorescence microscopy is a three - dimensional imaging technique involving the nonlinear excitation of fluorophores. the application of two - photon excitation to fluorescence microscopy offers several advantages over conventional imaging techniques. it facilitates deep tissue penetration with unparalleled spatial resolution and also dramatically reduces fluorophore photobleaching, which is a common drawback of fluorescence microscopy. chang and cho. have demonstrated the power of employing two - photon imaging of reactive oxygen species by developing the first two - photon probe for h2o2. using a carbamate detection mechanism, h2o2 was imaged in live cells and in living tissue at depths ranging from 90 to 180 m. the use of two - photon imaging enabled detection of the probe with single cell resolution at a depth of 120 m. considering the inherent advantages associated with two - photon imaging as showcased by chang and cho. and the demonstrated ability of nitroxides to detect reactive oxygen species, we report here the first examples of two - photon profluorescent nitroxides for the detection and imaging of reactive oxygen species. the paramagnetic nitroxide present in these probes behaves as a two - photon fluorescence off on switch for detection of ros. herein, we report a range of novel profluorescent nitroxides along with their photophysical properties and examine their applicability as powerful tools to probe the cellular redox environment using two - photon fluorescence microscopy (2pfm) imaging. the two - photon measurements reported here demonstrate the potential use of these probes for imaging the redox environment in living tissues and provide insights into the role of oxidative stress in a range of complex disease states such as cancer, inflammation, and neurodegenerative disorders. the dansyl - linked nitroxides 9, 11, 13, and 15 were prepared from dansyl chloride and the corresponding amino- or hydroxy - substituted nitroxide using standard coupling techniques, and the corresponding methoxyamines 10, 12, 14, and 16 were prepared by reaction of the appropriate nitroxide with methyl radicals formed using fenton chemistry. the perylene diimide - linked dinitroxide 17 was prepared from 3,4,9,10-perylenetetracarboxylic dianhydride and 5-amino-1,1,3,3-tetramethylisoindolin-2-yloxyl, and the methoxyamine derivative 18 was prepared using fenton chemistry from nitroxide 17 using established procedures. the novel tetraethyl fluorescein nitroxide 19 was synthesized using a method similar to that reported for the synthesis of its tetramethyl analogue. the synthesis and corresponding characterization data are reported in the supporting information for each new compound (920). linear absorption was measured with an agilent 8453 uv vis spectrophotometer. fluorescence emission and excitation spectra were measured using a pti quantamaster spectrofluorimeter equipped with a hamamatsu r928 photomultiplier tube (pmt). emission spectra were measured in cyclohexane, ch2cl2, or water, depending on the solubility of the compound. excitation anisotropy spectra were measured with two glan - thomson polarizers in an l - format method in high viscosity solvent (glycerol, acros) to avoid reorientation, and in low concentration solutions (c 10 m) to avoid reabsorption. fluorescence quantum yields for compounds 18 were obtained from measurements at five different concentrations in cyclohexane using the following equation : where abs and f denote the absorbance and fluorescence intensity, respectively, and f denotes the peak area of the fluorescence spectra, calculated by summation of the fluorescence intensity. anthracene (f = 0.36) was used as a standard, and excitation was performed at 340 nm. lifetime measurements were performed using a tunable ti : sapphire laser system (coherent verdi - v10 and mira 900, pulse duration 200 fs / pulse (fwhm), and repetition rate 76 mhz) coupled with a second harmonic generator. the polarization of the excitation beam was linear and oriented by the magic angle to avoid molecular reorientation effects. a broad band - pass filter (400 to 600 nm, or 500 to 700 nm, depending on the emission range of a compound) was placed in front of an avalanche photodiode detector (apd, picoquant gmbh, lsm_spad). data was acquired with a picoquant time - correlated single photon counting system, picoharp300 (see the supporting information). the optical density of all the solutions did not exceed 0.12 at the excitation wavelength to avoid reabsorption. two - photon absorption (2pa) measurements were performed using a coherent legend elite system (amplified ti : sapphire system) and an optical parametric generator / amplifier (coherent opera solo), providing laser pulses of 100 fs (fwhm) duration with 1 khz repetition rate (see the supporting information). the 2pa spectrum was determined over a broad spectral region from 580 to 1020 nm by the two - photon induced fluorescence method using 10 m c 10 m concentration. solutions were in a 10 mm quartz cuvette at room temperature relative to rhodamine b. all linear and nonlinear measurements were carried out in spectroscopic grade solvents. a concentrated micelle stock solution was prepared using 1 mg / ml of the dye by using a small amount of ch2cl2 to dissolve the dye. water was added with 2 wt % of surfactant (pluronic f 127 prill, basf corporation) and stirred overnight. the concentration of the micelle - encapsulated probe stock solution was determined via uv vis spectrophotometry using the molar absorptivity. chinese hamster ovary (cho) cells were purchased from america type culture collection (atcc, manassas, va). all cells were incubated at 37 c in a 95% humidified atmosphere containing 5% co2 in cell media (rpmi medium with 10% fetal bovine serum, 1% pen strep (penicillin streptomycin, invitrogen, carlsbad, ca), and 0.75 g of sodium bicarbonate). cho cells were prepared for cell viability studies in 96-well plates (4 10 cells per well that were incubated in 90 l). the cells were incubated for an additional 20 h with dyes encapsulated in micelles (7 and 8) and aqueous solution (17 and 18) in different concentrations. subsequently, 10 l of mts assay (celltiter 96 aqueous one solution reagent) was added into each well, followed by further incubation for 4 h at 37 c. the relative viability of the cells incubated with dyes to untreated cells was determined by measuring the mts - formazan absorbance on a microplate reader (spectra max m5, molecular devices) at 538 nm with subtraction of the absorbance of the cell - free blank volume at 538 nm. cho cells were placed onto poly - d - lysine - coated glass coverslips (12 mm, # 1) in 24-well plates, 3 10 cells per well (0.5 ml), and the cells were incubated for 48 h before further use. diluted hydrogen peroxide (0.1 ml, 6% solution, fisher scientific, diluted with pbs buffer) was added to induce oxidative stress (to generate free radical species), and the cells were incubated for 1 h and then washed twice with pbs. the filtered stock solution of the probe was then diluted with growth medium, rpmi-1640 with 1% pen strep and 0.75 g of sodium bicarbonate (0.5 ml), and then incubated for 1.5 h. the cells were incubated for additional 30 min for staining with commercial dyes individually. the stains used were 5 g / ml of hoechst 33285 (see supporting information) and 5 m cellrox deep red reagent. after incubation, the cells were washed with phosphate - buffered solution (pbs) five times and fixed using 3.7% formaldehyde solution for 15 min at 37 c. then freshly prepared nabh4 (1 mg / ml) solution in pbs (pbs ph = 7.4, with a couple of drops of 0.1 m naoh = ph 8) was added to each well (0.5 ml / well) for 15 min and washed with pbs (3), and this procedure was repeated once more. the plates were then washed with pbs (2) and water (1). nabh4 was added to reduce autofluorescence (a general protocol) of the fixing medium. no fluorescence was observed in controls in which no h2o2 was added, only incubation with the nitroxide probe, see, e.g., figures 6a and 7a. results using rpmi or rpmi with serum media were essentially the same. finally, the glass coverslips were mounted using prolong gold mounting media (invitrogen) for microscopy. a leica tcs sp5mp confocal microscope system coupled to coherent chameleon vision s ti : sapphire laser (70 fs (fwhm), 90 mhz repetition rate) was used for one - photon fluorescence microscopy (1pfm) and 2pfm imaging with a 63 water immersion objective (leica 506279). visible lasers in the tcs sp5 system were employed for 1pfm while the coherent chameleon system was used for 2pfm imaging. the excitation wavelength for nitroxides 7 and 17 was 458 nm using an argon laser, while emission was collected from 500 to 600 nm. a hene laser (633 nm) was used for exciting the commercial cellrox deep red probe while collecting the emission between 650 and 750 nm. the nitroxide probes were prepared by the reaction of dansyl chloride with the appropriate amino nitroxide in dcm in the presence of base to give the desired dansyl - linked nitroxides 9, 11, 13, and 15 in good yield (6585%). the methyl ether analogues 10, 12, 14, and 16 were obtained using fenton chemistry by the reaction of the nitroxides 9, 11, 13, and 15 with methyl radicals generated from dimethyl sulfoxide and hydrogen peroxide. the absorbance spectra and extinction coefficients of the prepared compounds were characteristic of the dansyl fluorophore (table 1). a comparison of the fluorescence of the nitroxides and their corresponding methoxyamine analogues revealed a substantial fluorescence suppression (1023 fold) arising from the presence of the nitroxide radical. this effect was confirmed by the measured quantum yields shown in table 1. a relatively comprehensive investigation of the linear photophysical properties (table 1) of 10 pairs of nitroxide radicals and their corresponding methoxyamine analogues (figure 1) was conducted. most compounds were soluble in cyclohexane (chx) and dichloromethane (ch2cl2). because of their water solubility, measurements of the fluorescein derivatives 19 and 20 were carried out in water. the photophysical properties for diphenylanthracene derivatives (14) and bis(phenylethynyl) derivatives (58) have been previously reported. herein, further investigation was performed to determine their feasibility as probes for bioimaging. 410 and 430 nm in chx and ch2cl2, respectively (see supporting information for absorption and emission spectra). as expected, there was a large stokes shift (up to 55 nm) in the more polar solvent. bis(phenylethynyl) derivatives 58 had absorption maxima of 452 and 465 nm in chx and ch2cl2, respectively. emission maxima were 475 and 480 nm in chx and ch2cl2, respectively. two types of dansyl derivatives were prepared ; dansyl sulfonamides 912 and dansyl sulfonates 1316. 340 and 470 nm, respectively, in chx, and 350 and 510 nm, respectively, in ch2cl2. the absorption and emission maxima of the perylene derivatives 17 and 18 were 526 and 534 nm in ch2cl2, respectively, while those for the fluorescein derivatives 19 and 20 were at 490 and ca. the fluorescence quantum yields (fl) of nitroxides (table 1) were low, starting from as little as 0.009 (17) and reaching 0.126 (13), while the fl of the nonradical methoxyamine (nome) derivatives were higher starting from 0.25 (18) and reaching 1.0 (2). the ratio of fl for the nitroxides and their corresponding nonradical methoxyamines was relatively large for the diphenylanthracene derivatives (14) and for the bis(phenylethynyl) derivatives (58) displaying > 50-fold increase in brightness (i.e., 7 and 8, fl = 0.011 and 0.75, respectively, giving a 68 fold increase, and for 3 and 4, the ratio was 57). the fl ratio of the nitroxide compared to the nonradical methoxyamine derivative models the relative fluorescence increase that would occur when a nitroxide reacts with reactive oxygen species generated in the cell. dansyl sulfonamides 912 and dansyl sulfonates 1316 exhibited up to 25-fold increase (i.e., 11 and 12, fl = 0.022 and 0.58, respectively, fl(nome / no) = 26). because the fluorescence lifetime () is proportional to fl, the nitroxides display a significantly shorter than the nome derivatives (e.g., for 1 and 2 in dichloromethane = 0.05 and 5.44 ns, respectively). as a result, the trends for the pairs of nitroxide radical and methoxyamine derivatives were as follows : (1) the fluorescence quantum yield of the methoxyamines were up to almost 70-fold higher than the corresponding nitroxide (see, e.g., 7 vs 8 and 5 vs 6), and (2) the measured fluorescence lifetimes correlated well with the calculated fluorescence quantum yields. notably, the lifetimes of the methoxyamines were up to 2 orders of magnitude greater than the corresponding nitroxide, (e.g., 1 and 2). paramagnetic species are recognized as fluorescence quenchers with the decrease in fluorescence arising from rapid excited - state intersystem conversion allowed by changes in the spin multiplicity of the electronic states followed by nonradiative energy loss. however, once this paramagnetic character is removed, i.e., through conversion to the methoxyamine derivative, high fluorescence efficiency is restored as demonstrated by the large fluorescence quantum yields for the nonradical alkylated analogues. the diphenylanthracene 14 and dansyl derivatives 916 possess not only short wavelength absorption bands, but also exhibit low two - photon absorptivity. perylene derivatives 17 and 18 possess a longer wavelength absorption maximum, and the fl(nome / no) ratio is relatively high. however, the fluorescence quantum yield of the corresponding methoxyamine derivative 18 was lower than that observed for other methoxyamines. of the bis(phenylethynyl) derivatives, compounds nitroxide 7 was selected because the monofunctionality simplifies analyses relative to dinitroxide 5, and its fl(8 nome/7 no) ratio was high (70 fold). though the fl(20 nome/19 no) ratio for fluorescein derivatives 19 and 20 was only 6.6, their absorption and emission were at relatively long wavelengths, and they were also water - soluble, making them reasonable candidates for bioimaging. therefore, due to their high fluorescence quantum yields along with 2pa spectra and cross sections, bis(phenylethynyl) derivative 7 and the fluorescein derivative 19 were examined as potential probes for two - photon fluorescence bioimaging. abs and abs refer to absorption and emission maximum, respectively, denotes the stokes shift, fl denotes fluorescence quantum yield, fl (ns) is fluorescence lifetime, refers to correlation coefficient fl, (nome / no) is the fluorescence quantum yield ratio of the methoxy (nome) to nitroxide (no), and r is fluorescence excitation anisotropy. when exposed to free radical species, such as the products of oxidative damage in cells, nitroxides may trap other free radicals, typically forming alkoxyamine (nor) species. they may also be metabolized to nonradical hydroxylamines (i.e., r = h) at rates reflecting the oxidative status of the cell. figure 2 shows the potential transformations of nitroxides in biological systems.fluorophore nitroxide compounds typically possess very low fluorescence quantum yields. on the other hand, their related diamagnetic adducts (r2nor) fluoresce normally. thus, the presence of the nitroxide can serve as a switch for the fluorophore, turning off the fluorescence. switching on the fluorescence would occur following the reaction of the nitroxide with another radical species or alternatively through redox chemistry (oxidation / reduction) to give diamagnetic, nonquenching species. therefore, although the profluorescent nitroxide is incubated with cells, the methoxyamine derivative is also very useful, as it serves as a model of the fluorescent reaction products that are detected. consequently, it is important to examine the two - photon absorption spectra of the methoxyamine derivatives, as this provides insight into the behavior of switched - on probe molecules. figure 3 displays four different spectra : absorption (black line, normalized spectra), emission (blue, normalized spectra), anisotropy (green), and two - photon absorption (2pa) cross section (half - filled red circle). the 2pa cross section unit of measure is a value referred to as a gm unit (1 gm (gppert meyer) = 10 cm s / photon). the 2pa spectra were recorded in 20 nm increments from 590 to 1030 nm corresponding to the top x - axis and right y - axis. the 2pa cross sections of methoxyamine derivatives 8 and 20 were measured using a coherent legend elite system (an amplified ti : sapphire laser system) coupled with an opera solo optical parametric amplifier (100 fs (fwhm), 1 khz repetition rate). the equation used for calculation of the 2pa cross section calculation iswhere the subscripts r and s refer to the reference and sample, respectively, is the fluorescence quantum yield, c is the concentration, f is the integrated area of the main fluorescent band, n is the refractive index of the solvent, and p is the incident power of the laser. the experimental fluorescence excitation and detection were measured under conditions with negligible reabsorption (close to the cuvette wall). excitation anisotropy is correlated with the spectral position of various electronic transitions, and can be a very useful tool to estimate the position of 2pa allowed transitions. the one - photon allowed s0s1 electronic transition (the maximum of the linear of absorption spectrum) is formally two - photon forbidden according to quantum mechanical selection rules and vice versa. in the case of the bis(phenylethynyl) derivative 8, the anisotropy spectrum is well correlated with the 2pa cross section data as shown in figure 3a. 320 and 440 nm in figure 3a indicate two possible electronic transitions. the lower energy two - photon transition is formally forbidden (see discussion below), with 2pa less than that of the higher energy two - photon allowed transition (500 gm at 670 nm in chx). formally, one - photon allowed transitions are two - photon forbidden according to quantum mechanical selction rules. however, this is predicated on a centrosymmetric system. thus, for large organic molecules, two - photon absorption into the one - photon allowed transition that is formally two - photon forbidden often occurs due to the relaxed symmetry of the molecule. such is the case for 8 and 20 due to their low molecular symmetry. the highest 2pa cross section for 20 was 400 gm at 970 nm in water (ph 8, adjusted with naoh). even though the 2pa cross section value of 20 is lower than that of compound 8, it is still significant due to the desirably long wavelength that can afford deep tissue penetration for ex vivo and in vivo imaging. (a) linear and nonlinear optical spectra of compound 8 and (b) linear and nonlinear optical spectra of compound 20. in each graph, the linear absorption spectrum is a black line, the emission spectrum is a blue line, fluorescence anisotropy is green, and two - photon absorption (2pa) cross sections are shown as half - filled red circles, respectively. a chinese hamster ovary (cho) cell line was used for cell viability estimation based on measuring the mts - formazan absorbance on a plate reader. the mts - formazan absorbance wavelength was observed at 538 nm (not the typical 490 nm) due to overlap with the absorbance of the sample. since the concentration of hydrogen peroxide is critical in cell viability, the cytotoxicity of hydrogen peroxide was measured, as shown in figure 4. cell viability was reasonable until 100 m h2o2, and the damage increased rapidly, consistent with a previous report. when the concentration of h2o2 reached 500 m, the cell viability was less than 10%. compounds 7 and 8 were used to prepare micelle mixtures using 2 wt % of surfactant (pluronic f 127 prill) for solubility and biocompatibility. cell viability in the presence of h2o2 using micelle mixtures of 7 and 8 can be seen in figure 5a and was above 90% at concentrations up to 50 m. at concentrations of 5, 10, and 20 m, nitroxide 7 induces modest enhancement of cell viability, reflecting a potential beneficial antioxidant action at these lower doses. the use of the nitroxide compounds 7 and 19 as oxidative stress probes was then investigated. hydrogen peroxide was added just prior to incubation with the nitroxide probe to generate free radical species. thus, the probe reacts with reactive oxygen species (free radicals) generated by the hydrogen peroxide incubation. the interaction of a nitroxide with hydrogen peroxide does not affect the spin, and so the fluorescence is not switched on by exposure to h2o2, as demonstrated by control reactions for nitroxides 7 and 19 in the presence of 200 m h2o2 with no change observed in the uv vis absorption spectrum after 4 h. so fluorescence generation from the probes in the cells treated by hydrogen peroxide reflects impacts on the cellular redox status by the peroxide and ros generated from the cells by the peroxide. after oxidative stress was generated by incubation of the cells with 100 m h2o2 for 1 h, washing twice with pbs, and the incubation with nitroxide 7 dissolved in rpmi-1640 for 1.5 h, cell viability was determined. at the highest dose (50 m), cell viability decreased by 25% compared to cells which were not treated with compound 7. however, at doses below 50 m, at least 80% of the cells remained viable, and at doses of 20 m or less, cell viability was unchanged or even enhanced. consequently, at lower doses cell viability does not appear to be an issue for compound 7, although the optimal concentration for this probe was not determined. compounds 19 and 20 were used after dissolving in ultrapure water followed by filtration. nitroxide 19 exhibited a trend similar to that for 7, in which the cell viability remained high and even boosted the cell growth at low concentrations of nitroxide. the therapeutic limit for 19 and 20 appeared to be reached with the use of 100 m h2o2 to generate oxidative stress. above the threshold, the two compounds exhibited a synergistic effect to destroy cells such that the apparent toxicity increased up to 50%. from these experiments, it was determined that 20 m 19 and 100 m h2o2 can be used for cell culture (to maintain 80% cell viability within experimental error range). compound 20, the methoxyamine analogue of 19, was relatively toxic to the cho cells. hence, only 5 m dye was utilized to decrease any possible toxicity from the fluorescent radical adducts arising from 19. comparative cell viability of (a) nitroxide 7, 7 + 100 m h2o2, and methoxyamine analogue 8, and (b) nitroxide 19, 19 + 100 m h2o2, and methoxyamine analogue 20. on the basis of the cell viability results described above along with luminescence quantum yields and 2pa cross sections, 5 m and 10 m concentrations of both nitroxides 7 and 19 were selected for investigation as potential two - photon fluorescent oxidative stress indicators. nitroxides 7 and 19 were incubated in cho cells for 2 h. figure 6 shows the one - photon fluorescence microscopy (1pfm) images of cho cells incubated with nitroxide 7. the first row is the comparison of (a) the control (0 m 7) vs (b) 5 m 7, none of which had any h2o2 added, and increasing concentrations of oxidative stress inducer ((c) 100 m h2o2 and (d) 200 m h2o2). the second row shows the structure of the compound, (e) a combination of increased probe concentration and (f and g) increasing concentrations of oxidative stress inducer (h2o2). as anticipated, increases in fluorescence were observed for increases either in the concentration of the probe and h2o2. in figure 6, panels b d, a 5 m concentration of the probe was used while for panels e g, the probe concentration was 10 m. the fluoresecence increased with increasing probe concentration (compare (b) 5 m and (e) 10 m). also, when the concentration of the h2o2 was increased from (c) 100 m to (d) 200 m, while maintaining constant probe concentration, an increase in fluorescence was observed. this indicates that the nitroxide probe exhibits brighter fluorescence as a function of concentration (i.e., it is sensitive for the quantity of the probe), and brighter fluorescence is observed at higher oxidative stress levels (i.e., it exhibits sensitivity for oxidative stress). these results support the reaction of species, generated by the action of h2o2 on cells, with profluorescent nitroxide probe 7, and thereby generating fluorescent nor analogues (similar to 8) that may be visualized by 1pfm. therefore, the result shows that nitroxides 7 and 19 are good oxidative stress indicators. 1pfm image using nitroxide 7 and cho cells : (a) 0 m 7 + 0 m h2o2 (control), (b) 5 m 7 + 0 m h2o2, (c) 5 m 7 + 100 m h2o2, (d) 5 m 7 + 200 m h2o2, (e) 10 m 7 + 0 m h2o2, (f) 10 m 7 + 100 m h2o2, and (g) 10 m 7 + 200 m h2o2. the response observed for nitroxide 7 was also seen with nitroxide 19, as shown in figure 7. the fluorescence intensity increased at higher probe concentration and higher levels of oxidative stress induced through the addition of h2o2. notably previous studies with profluorescent nitroxides have shown that there is no direct interaction between h2o2 and the nitroxide at these concentrations, implicating a cellular response mediating this fluorescence increase. even though the fluorescence quantum yield of nitroxide 19 is significantly higher than nitroxide 7, the difference in the fluorescence quantum yields of nitroxide 19 and the corresponding nome analogue 20 is sufficient and clearly evident in figure 7 (compare panel b with panels c and d, or panel e with panels f and g) and is related to the h2o2 stress - inducer concentration. 1pfm imaging with nitroxide 19 and cho cells : (a) 0 m 19 + 0 m h2o2 (control), (b) 5 m 19 + 0 m h2o2, (c) 5 m 19 + 100 m h2o2, (d) 5 m 19 + 200 m h2o2, (e) 10 m 19 + 0 m h2o2, (f) 10 m 19 + 100 m h2o2, and (g) 10 m 19 + 200 m h2o2. to further support the oxidative stress detection ability of nitroxide 7, a colocalization study was conducted with commercially available oxidative stress probe cellrox deep red reagent. 1pfm images of cho cells costained with cellrox deep red and nitroxide 7 (figure 8) demonstrated good spatial overlap of the fluorescence from the nonradical nor derivatives of 7 and cellrox deep red (see figure 8d). the excitation wavelength for imaging of the nor analogues of 7 was 458 nm while emission was collected from 500600 nm. for cellrox deep red, the excitation wavelength was 561 nm and emission was collected from 580 to 650 nm. colocalization study in cho cells using probe 7 with commercial oxidative stress probe cellrox deep red (nor analogues of 7 : ex 458 nm / em 500600 nm, cellrox deep red : ex 561/em 580650 nm) : (a) differential interference contrast (dic) image, (b) cells incubated with 10 m 7, (c) cells then incubated with 5 m cellrox deep red, and (d) overlaid images of panels a, b, and c. a similar colocalization study was performed for nitroxide 19 and cellrox deep red, as shown in figure 9. these results indicate good colocalization, supporting the utility of nitroxide 19 as an oxidative stress probe. for a more quantitative comparison, the colocalization coefficient was calculated with imagej software (mander s overlap coefficient). colocalization study of nitroxide 19 in cho cells with commercial oxidative stress probe cellrox deep red (sample : ex 458 nm / em 500600 nm, cellrox deep red : ex 561/em 580650 nm) : (a) dic, (b) incubated with 20 m 19, (c) then incubated with 5 m cellrox deep red, and (d) overlaid image of panels a, b, and c. the nome analogues of 7 and 19 (8 and 20, respectively) had reasonable 2pa cross sections at 900 nm, a good wavelength for 2pfm due to the generally high transparency of biological materials in this region. 2pfm in vitro cell imaging was performed by incubating cho cells with nitroxide probe 7 or 19 after inducing oxidative stress with h2o2 to demonstrate the potential utility of these new probes for 2pfm oxidative stress imaging, as shown in figure 10. 2pfm images from femtosecond excitation at 900 nm of cho cells incubated with 10 m 7 and 200 m h2o2 of (a) dic, (b) one 2pfm xy optical slice, (c) 2pfm 3d reconstructed image, and incubated with 20 m 19 and 200 m h2o2 : (d) dic, (e) one 2pfm xy optical slice, (f and g) 2pfm 3d reconstructed image. ten pairs of nitroxides and their nonradical - containing methoxyamine derivatives were examined for their linear and nonlinear photophysical properties. the nitroxides exhibited profluorescent behavior, i.e., their fluorescence quantum yield was significantly higher for the nome analogues, while several displayed reasonably high 2pa cross section values above 800 nm, making them good candidates as two - photon fluorescent oxidative stress indicators. because of their linear absorption, nonlinear absorption, and fluorescence properties, nitroxides 7 and 19 cytotoxicity assays indicated that the probes were benign at concentrations suitable for fluorescence microscopy imaging. colocalization experiments in cho cells after induction of oxidative stress with h2o2 using a commercial indicator of cellular oxidative stress, cellrox deep red, demonstrated high colocalization coincidence (96%), supporting the role of the nitroxide probe as a suitable indicator of oxidative stress (and concomitant damage) in vitro. 2pfm imaging was conducted for the first time with a nitroxide oxidative stress probe using probes 7 and 19. the results from this study provide impetus for the further development of this important class of materials as 2pfm oxidative stress probes and may lead to a new nir 2pa probe for investigating oxidative stress. | a range of varying chromophore nitroxide free radicals and their nonradical methoxyamine analogues were synthesized and their linear photophysical properties examined. the presence of the proximate free radical masks the chromophore s usual fluorescence emission, and these species are described as profluorescent. two nitroxides incorporating anthracene and fluorescein chromophores (compounds 7 and 19, respectively) exhibited two - photon absorption (2pa) cross sections of approximately 400 g.m. when excited at wavelengths greater than 800 nm. both of these profluorescent nitroxides demonstrated low cytotoxicity toward chinese hamster ovary (cho) cells. imaging colocalization experiments with the commercially available cellrox deep red oxidative stress monitor demonstrated good cellular uptake of the nitroxide probes. sensitivity of the nitroxide probes to h2o2-induced damage was also demonstrated by both one- and two - photon fluorescence microscopy. these profluorescent nitroxide probes are potentially powerful tools for imaging oxidative stress in biological systems, and they essentially light up in the presence of certain species generated from oxidative stress. the high ratio of the fluorescence quantum yield between the profluorescent nitroxide species and their nonradical adducts provides the sensitivity required for measuring a range of cellular redox environments. furthermore, their reasonable 2pa cross sections provide for the option of using two - photon fluorescence microscopy, which circumvents commonly encountered disadvantages associated with one - photon imaging such as photobleaching and poor tissue penetration. |
saffron contains various forms of flavonoids, glycosides, and anthocyanin compounds that are proven to have anti - inflammatory and antioxidant effects. this study evaluates the anti - inflammatory effects of saffron stigma on gingival indices in patients with marginal generalized plaque - induced gingivitis. patients were randomly divided into two equal groups of test and placebo. in each group the pocket depth index (pd), gingival index (gi), plaque index (pi) and bleeding of probing index (bop) were measured before and one month after use. independent t - test, mann whitney test and wilcoxon test were used for statistical analysis (p0.05). in this study, it was found that using aqueous extract of saffron stigma flower containing toothpaste might have a positive effect on some gingival indices in patients with gingivitis. | background : gingivitis is an inflammatory disease involving the gums. saffron contains various forms of flavonoids, glycosides, and anthocyanin compounds that are proven to have anti - inflammatory and antioxidant effects. this study evaluates the anti - inflammatory effects of saffron stigma on gingival indices in patients with marginal generalized plaque - induced gingivitis.methods:for this study, we used toothpaste containing aqueous extract of saffron stigma. twenty - two patients with generalized marginal gingivitis were selected. patients were randomly divided into two equal groups of test and placebo. in each group the pocket depth index (pd), gingival index (gi), plaque index (pi) and bleeding of probing index (bop) were measured before and one month after use. independent t - test, mann whitney test and wilcoxon test were used for statistical analysis (p0.05).conclusion : in this study, it was found that using aqueous extract of saffron stigma flower containing toothpaste might have a positive effect on some gingival indices in patients with gingivitis. |
laparoscopic surgery is as safe as open colorectal surgery, and laparoscopic colorectal cancer surgery is possible but should be performed within clinical studies and at surgical centers that have sufficient experience with laparoscopic colorectal surgery for benign diseases. in addition to the ongoing discussion about the oncologic safety of this approach, it is not yet clear whether the laparoscopic approach offers significant immunological advantages over the conventional approach. some have suggested that the differences in cytokine and immune response noted after laparoscopic colorectal surgery are related to the extent of abdominal wall trauma, and thus one would anticipate less marked differences following laparoscopic - assisted colectomy. the intestinal epithelium undergoes a process of continuous renewal and consist of cells in various stages of differentiation. the integrity of the intestinal epithelium is critical to health and any damage to the cells can influence the proliferation and differentiation, leading to altered cell population and functional changes in the intestine. the intestine acts as a barrier to the luminal contents, which include bacteria and endotoxins. the gut barrier is altered in some pathological conditions such as shock, trauma, or surgical stress, resulting in bacterial and/or endotoxin translocation from the gut lumen into the systemic circulation. this has been implicated in postoperative complications, such as systemic inflammatory response syndrome (sirs) and multiorgan failure (mof). as laparoscopic colorectal surgery is recognized as a mini - invasive surgery ; in this prospective randomized study, we investigated the effect of surgical intervention on intestinal permeability (ip), and endotoxemia in patients undergoing elective colectomy for colon cancer comparing laparoscopic with open approach. from march 2007 to february 2015, we studied, in a prospective randomized study, 123 patients (pts) consecutively (73 men and 47 women ; mean age, 69.4 years) with colon cancer [table 1 ]. patients were randomly assigned to be treated with laparoscopic or open approach, according to a computer - generated table of random numbers. the patient and the surgeon were informed about the type of approach just before the intervention. the ethical committee of faculty of medicine of the university of l'aquila approved the study protocol, and informed consent was obtained for every patient. colon cancer : open (group1) and laparoscopic resection (group 2) patients with a known immune dysfunction (advanced liver disease, human immunodeficiency virus (hiv) infection, hepatitis c virus infection) and cardiac or pulmonary insufficiency were excluded for the study. patients were also excluded if they had evidence of intraperitoneal sepsis or peritoneal contamination and if they had received antibiotics whitin 2 weeks prior to surgery. during hospitalization, patients were not given antispastic drugs, steroids, or nonsteroidal anti - inflammatory drugs (nsaids). the patients were classified according to the american society of anesthesiologists (asa) grading system as grade i, ii, or iii [table 1 ]. thirty - six patients had primary adenocarcinoma of the colon and 50 of the sigmoid colon. open resection (or) was performed on 61 patients, while laparoscopic resection (lr) was adopted for 62 patients [table 1 ]. minimally - invasive colorectal surgery was performed as a laparoscopic - assisted procedure with removal of the resected specimen method by a horizontal minilaparotomy (mean 5.8 cm : range 5 - 8 cm) just above the mons pubis. laparoscopic surgery was performed using a 4-trocar technique with 1 trocar (10 mm) inserted through a paraumbilical incision (camera port). two additional (5- or 10 mm) trocars were inserted in the right and left of lower abdomen, and one trocar (12 mm) was inserted in the midline just above the mons pubis (the site of the minilaparotomy). after removal of the resected specimen and preparation of the stapler anastomosis, we closed the minilaparotomy and reintroduced the pneumoperitoneum. conventional colorectal surgery was performed through a vertical midline incision ranging from 5 to 10 cm above the umbilicus to the mons pubis. after removing the resected specimen all operations were performed by a single surgeon (gianfranco amicucci, m.d.). the tnm system is the most widely used means for classifying the extent of cancer spread : 40 patients, stage i ; 50 patients, stage ii ; 30 patients, stage iii ; and 3 patients, stage iv. all these patients did not receive any neoadjuvant therapy. as shown in table 1, age, sex, asa grades, body mass index (bmi), blood transfusions, time of anesthesia, and operation were comparable in the two groups, except, obviously, for incision length. pre - anesthesia was accomplished using atropine (0.01 mg / kg) plus promethazine (0.5 mg / kg), with the addition of sodium thiopental (5 mg / kg) and atracurium (0.5 mg / kg) and tracheal intubation and assisted ventilation using nitrogen dioxide (no2)/oxygen (o) 2:1. after intubation, anesthesia was maintained with oxygen in air, sevoflurane and remifentanil (0.25 mg / kg / min). serial venous blood samples were taken at pre - induction (0), intraoperatively (30, 60, 90, 120, and 180 min) and at 12, 24, and 48 h after surgery. blood was stored in pyrogen - free tubes an centrifuged at 4 c and 2000 rpm for 10 min and divided into sterile cryotubes (nunc 36341, intermed, denmark) and stored at 80 c until analysis for subsequent determination of endotoxin. intestinal permeability was assessed preoperatively and at day 1 and 3 after surgery, using the lactulose / mannitol differential absorption test. this test is nontoxic, non - invasive, simple to perform, relatively inexpensive, and reproducible. a pretest sample of urine was collected after 6 h of fasting to measured the baseline sugar in the urinary tract. after the pretest sample was obtained, patients were given 10 g of lactulose and 5 g of mannitol dissolved in 100 ml of water orally or via nasogastric tube. urine was collected for 6 h, divided, and stored at -20 c until assayed. mannitol excretion was corrected by subtraction of baseline values determined in the pre - test samples, and the lactulose / mannitol excretion ratios (l / m ratio) were calculated. endotoxin was quantified in duplicates using a modified chromogenic limus amoebocyte lysate assay (quadratech, epsom, uk.). plasma samples and standard test were diluted in 1:10 pyrogen - free water and heated to 75 c for 10 min to remove plasma inhibitors. the concentration of endotoxin in the sample was taken as the average of the duplicates calculated from standard curve. the assay has a sensitive of 8 pg / ml and is linear in the range 8 - 100 pg / ml. each aliquot was assayed for endotoxin only once. if the assay gave poor duplicates or very high values, indicating a possible contamination, a fresh portion of the same sample was retested. statistical analysis was performed using the mann - whitney u test or spearman 's rank - correlation coefficient (rs) where appropriate with revelance taken at the 5% level. serial venous blood samples were taken at pre - induction (0), intraoperatively (30, 60, 90, 120, and 180 min) and at 12, 24, and 48 h after surgery. blood was stored in pyrogen - free tubes an centrifuged at 4 c and 2000 rpm for 10 min and divided into sterile cryotubes (nunc 36341, intermed, denmark) and stored at 80 c until analysis for subsequent determination of endotoxin. intestinal permeability was assessed preoperatively and at day 1 and 3 after surgery, using the lactulose / mannitol differential absorption test. this test is nontoxic, non - invasive, simple to perform, relatively inexpensive, and reproducible. a pretest sample of urine was collected after 6 h of fasting to measured the baseline sugar in the urinary tract. after the pretest sample was obtained, patients were given 10 g of lactulose and 5 g of mannitol dissolved in 100 ml of water orally or via nasogastric tube. urine was collected for 6 h, divided, and stored at -20 c until assayed. mannitol excretion was corrected by subtraction of baseline values determined in the pre - test samples, and the lactulose / mannitol excretion ratios (l / m ratio) were calculated. endotoxin was quantified in duplicates using a modified chromogenic limus amoebocyte lysate assay (quadratech, epsom, uk.). plasma samples and standard test were diluted in 1:10 pyrogen - free water and heated to 75 c for 10 min to remove plasma inhibitors. the concentration of endotoxin in the sample was taken as the average of the duplicates calculated from standard curve. the assay has a sensitive of 8 pg / ml and is linear in the range 8 - 100 pg / ml. each aliquot was assayed for endotoxin only once. if the assay gave poor duplicates or very high values, indicating a possible contamination, a fresh portion of the same sample was retested. statistical analysis was performed using the mann - whitney u test or spearman 's rank - correlation coefficient (rs) where appropriate with revelance taken at the 5% level. the lr required almost the same operating time of the or [table 1 ]. hospitalization was shorter for lr, but was not statistically significant [table 1 ]. in the laparoscopic group, the intention - to - treat analysis was performed, and these 5 patients were included in the analysis : 3 patients with left colon cancer and 2 patients with right colon cancer were converted to the open procedure. no difference was observed in the preoperative l / m ratios in the two groups of patients [figure 1 ]. intestinal permeability measured by lactulose / mannitol excretion ratio (l : m ratio), p < 0.05 versus pre - operative. no difference between open and laparoscopic group the l / m ratio was significantly increased in the open and closed group the first day (0.130 0.004 and 0.128 0.004, respectively) compared with the preoperative level (0.022 0.006 ; p < 0.05), but no differences were found between laparoscopic and open surgery group [figure 1 ]. the systemic endotoxin concentration rose significantly, in both groups, during the course of surgery and returned to near baseline by day 2. a significant correlation was observed between the maximum systemic endotoxin concentration and intestinal permeability measured at d1 (rs = 0.917 ; p = 0.001) in the open group [figure 3a ] and in the laparoscopic group (rs = 0.926 ; p = 0.001) ; [figure 3b ]. systemic endotoxin concentration (mean sem), p < 0.05 versus preoperative. no difference between open and laparoscopic group correlation between systemic endotoxin concentration and intestinal permeability measured as lactulose / mannitol excretion ratio (l / m ratio) in the open group. (rs = 0.917 ; p = 0.001) correlation between systemic endotoxin concentration and intestinal permeability measured as lactulose / mannitol excretion ratio (l / m ratio) in the laparoscopic group. (rs = 0.926 ; p = 0.001) five patients (8%) underwent conversion from laparoscopic to open procedure [table 1 ]. these patients had intestinal permeability parameters, and systemic endotoxin concentration value similar in the open and closed group. for these patients, intestinal permeability parameters, and systemic endotoxin concentration value are similar to the group they belong to. no difference was observed in the preoperative l / m ratios in the two groups of patients [figure 1 ]. intestinal permeability measured by lactulose / mannitol excretion ratio (l : m ratio), p < 0.05 versus pre - operative. no difference between open and laparoscopic group the l / m ratio was significantly increased in the open and closed group the first day (0.130 0.004 and 0.128 0.004, respectively) compared with the preoperative level (0.022 0.006 ; p < 0.05), but no differences were found between laparoscopic and open surgery group [figure 1 ]. the systemic endotoxin concentration rose significantly, in both groups, during the course of surgery and returned to near baseline by day 2. a significant correlation was observed between the maximum systemic endotoxin concentration and intestinal permeability measured at d1 (rs = 0.917 ; p = 0.001) in the open group [figure 3a ] and in the laparoscopic group (rs = 0.926 ; p = 0.001) ; [figure 3b ]. systemic endotoxin concentration (mean sem), p < 0.05 versus preoperative. no difference between open and laparoscopic group correlation between systemic endotoxin concentration and intestinal permeability measured as lactulose / mannitol excretion ratio (l / m ratio) in the open group. (rs = 0.917 ; p = 0.001) correlation between systemic endotoxin concentration and intestinal permeability measured as lactulose / mannitol excretion ratio (l / m ratio) in the laparoscopic group. five patients (8%) underwent conversion from laparoscopic to open procedure [table 1 ]. these patients had intestinal permeability parameters, and systemic endotoxin concentration value similar in the open and closed group. complications are reported in tables 1 and 2. for these patients, intestinal permeability parameters, and systemic endotoxin concentration value until now, it has been reported that the degree of post - operative inflammation is reduced after laparoscopic surgery. other groups also observed significantly better preservation of lymphocytes subpopulations, neutrophil function, and cell - mediated immunity after laparoscopic versus open colorectal surgery. furthermore, it has been observed that cell - mediated immunity, as assessed by delayed - type hypersensitivity testing in humans, is better preserved after laparoscopic vs open colorectal resection. this lesser degree of operative stress was also confirmed by experimental animal studies by kuntz. one group of investigators, in single center randomized trials, have reported that patients with colon carcinoma (stage iii) undergoing laparoscopic colectomy had a significantly higher disease - free survival rate with mean follow - up of 43 months than patients treated by conventional open approaches. laurent also reported a better survival rate in patients with stage iii tumors. in a rct trial in patients with mid and low rectal cancer and by morino. in a prospective comparative study which focused on patients with extraperitoneal rectal cancer treated with laparoscopic or open surgery more recently, law. reported in a comparative monocenter series with a median follow - up of 34 months in patients with stage ii and iii rectal cancer, a 5-year actuarial survival of 71% in the laparoscopic group compared to 59% survival rate in the open - group, also identifying laparoscopy as one of the independent significant factors associated with better survival at the multivariate analysis. supporting evidence of the beneficial oncological role of laparoscopy includes its impact on surgical stress response, cellular immunity, cytokine relase, intraoperative tumor manipulation, and blood transfusion. moreover, during the early postoperative period, laparoscopic patients seem to display decreased levels of pro - inflammatory and vascular endothelial growth factor (vegf) compared to open. however, in additional to ongoing discussion about the oncologic safety of laparoscopic approach it is still not completely clear whether this approach offers significant immunological advantages over the conventional open approach. reported in a prospective comparative study that in patients with stage iii colorectal cancer, the cellular immune factors were significantly decreased ; however there was no significant difference between the laparoscopic and open groups except for the mhla - dr : monocyte human leukocyte antigen - dr that was affected less by the laparoscopic group compared to the open group. the intestinal epithelium is a self - renewing arising from stem cell located at or near the base of the crypts. anup., using a rat model, showed that laparotomy with mild intestinal handling can result in permeability alterations and oxidative stress in the enterocytes, mainly as a results of activation of xanthine oxidase, and the damage is reversible with time. we have proved the change of intestinal permeability only in patients undergoing open cholecystectomy, with no change occurring in the laparoscopic group. in the open technique, the peritoneum is manipulated, the small intestine handled, and the mesentery placed under traction, while in the laparoscopic cholecystectomy, these are absent or minimized. in this study (gut barrier function, and systemic endotoxemia after laparotomic or laparoscopic resection for colon cancer), a change of intestinal permeability was demonstrated both in patients undergoing open colorectal surgery and in patients undergoing laparoscopic colorectal surgery. the l : m ratio was significantly increased in the both groups at day 1 compared with the preoperative level, but no difference were found between laparoscopic and open surgery group. since the since groups were similar, the greatest factor in difference between the groups of patients may be effect of surgical approach on intestinal manipulation. these factors (manipulation of peritoneum, etc.), which are integral parts of the open approach, evidently are also involved in laparoscopic colo - rectal approach. laparoscopic - assisted colorectal resections, on the other hand, require an incision substantially larger than that typically required for other advanced laparoscopic procedures, such as gastric bypass or antireflux procedures. in our opinion, no difference, in intestinal permeability, noted after laparoscopic operations, as regards to the open group, is related to the extent of abdominal wall trauma. furthermore, in regards to colectomy, there is a wide variation in the size of the incision, needed to extract the specimen and facilitate the anastomosis, dependent on body habitus, the size of the specimen and the surgeon. in our study, the size of the minilaparotomy changed from 5 to 8 cm (mean 5.8 cm). unfortunately, a substantial proportion of colectomy studies do not provide detailed information regarding incision length. in addition, there is no consensus amongst surgeons as to what constitutes a laparoscopic - assisted procedure or conversion. other variables that may impact the results of intestinal permeability studies include blood transfusion and the extent and location (right versus left) of the bowel resection performed. therefore, when evaluating the intestinal permeability, the colectomy population is much more heterogenous in regards to procedure performed and abdominal wall trauma induced than other advanced procedures. the surgical approach on intestinal manipulation may lead to the production of vasoactive agents that can cause both local and systemic hemodynamic changes. there is evidence to support the role of prostaglandins is causing these hemodynamic responses, even though the exact mechanism leading to their generation is not fully understood. the mucosa of the intestine and the endothelium of blood vessels contain enzymes capable of synthesizing prostaglandins, production of which may be initiated by neural, ischemic, toxic, or mechanical stimuli. the generation of these vasoactive prostaglandins can therefore induce splanchnic ischemia with subsequent disruption of mucosal integrity and increased intestinal permeability. therefore, intestinal manipulation may lead to the endotoxemia detected in the systemic circulation, in patients undergoing colorectal surgery. the results of the present study concur with this suggestion, as endotoxine was found in the systemic circulation in the open and laparoscopic groups of patients. the systemic endotoxin concentration rose significantly, in the both groups, during the course of surgery but returned to near baseline by day 2 and no difference were found between laparoscopic an open surgery group. this implies that mere manipulation of the intestine may have a deleterious effect on intestinal mucosa. regardless of the etiology of impaired mucosal barrier function, permeation of luminal contents across the bowel wall does occur and results in the endotoxemia. endotoxin is a potent stimulator of release of cytokines, such as interleukin-6 and tumor necrosis factor. these inflammatory mediators play an important role in the pathogenesis of systemic inflammatory response syndrome and multiple - organ dysfunction syndrome. however, the significance of the correlation between systemic endotoxin concentration and increased intestinal permeability remains unclear. in our study, the endotoxemia was detected mainly during the intraoperative period, but the increased intestinal permeability was observed only 24 h after surgery. although it would be easy to suggest that endotoxemia was due to an increase in bowel permeability, one may develop independently of the other. indeed, endotoxemia is known to reduce splanchnic blood flow and cause disruption of mucosal barrier function. furthermore, exposing the peritoneal cavity to the atmosphere may in it self lead to endotoxemia. in some cases, intestinal permeability, and endotoxemia was detected somewhat higher in the laparoscopic than the open surgery, although such data are not statistically significant. in ten patients including five with rectosigmoid cancer, and five from the splenic flexure cancer, the operation went beyond 4 h ; three of these cases were part of the initial laparoscopic experience. this study confirms our preliminary data, but further prospective randomized studies are required, especially in advanced laparoscopic procedures (carcinoma of the middle and low rectum), also considering whether the surgeon 's experience provides an additional biological and metabolic advantage for the patients. in this study (gut barrier function, and systemic endotoxemia after laparotomic or laparoscopic resection for colon cancer), a change of intestinal permeability was demonstrated both in patients undergoing open colorectal surgery and in patients undergoing laparoscopic colorectal surgery. the l : m ratio was significantly increased in the both groups at day 1 compared with the preoperative level, but no difference were found between laparoscopic and open surgery group. since the since groups were similar, the greatest factor in difference between the groups of patients may be effect of surgical approach on intestinal manipulation. these factors (manipulation of peritoneum, etc.), which are integral parts of the open approach, evidently are also involved in laparoscopic colo - rectal approach. laparoscopic - assisted colorectal resections, on the other hand, require an incision substantially larger than that typically required for other advanced laparoscopic procedures, such as gastric bypass or antireflux procedures. in our opinion, no difference, in intestinal permeability, noted after laparoscopic operations, as regards to the open group, is related to the extent of abdominal wall trauma. furthermore, in regards to colectomy, there is a wide variation in the size of the incision, needed to extract the specimen and facilitate the anastomosis, dependent on body habitus, the size of the specimen and the surgeon. in our study, the size of the minilaparotomy changed from 5 to 8 cm (mean 5.8 cm). unfortunately, a substantial proportion of colectomy studies do not provide detailed information regarding incision length. in addition, there is no consensus amongst surgeons as to what constitutes a laparoscopic - assisted procedure or conversion. other variables that may impact the results of intestinal permeability studies include blood transfusion and the extent and location (right versus left) of the bowel resection performed. therefore, when evaluating the intestinal permeability, the colectomy population is much more heterogenous in regards to procedure performed and abdominal wall trauma induced than other advanced procedures. the surgical approach on intestinal manipulation may lead to the production of vasoactive agents that can cause both local and systemic hemodynamic changes. there is evidence to support the role of prostaglandins is causing these hemodynamic responses, even though the exact mechanism leading to their generation is not fully understood. the mucosa of the intestine and the endothelium of blood vessels contain enzymes capable of synthesizing prostaglandins, production of which may be initiated by neural, ischemic, toxic, or mechanical stimuli. the generation of these vasoactive prostaglandins can therefore induce splanchnic ischemia with subsequent disruption of mucosal integrity and increased intestinal permeability. therefore, intestinal manipulation may lead to the endotoxemia detected in the systemic circulation, in patients undergoing colorectal surgery. the results of the present study concur with this suggestion, as endotoxine was found in the systemic circulation in the open and laparoscopic groups of patients. the systemic endotoxin concentration rose significantly, in the both groups, during the course of surgery but returned to near baseline by day 2 and no difference were found between laparoscopic an open surgery group. this implies that mere manipulation of the intestine may have a deleterious effect on intestinal mucosa. regardless of the etiology of impaired mucosal barrier function, permeation of luminal contents across the bowel wall does occur and results in the endotoxemia. endotoxin is a potent stimulator of release of cytokines, such as interleukin-6 and tumor necrosis factor. these inflammatory mediators play an important role in the pathogenesis of systemic inflammatory response syndrome and multiple - organ dysfunction syndrome. however, the significance of the correlation between systemic endotoxin concentration and increased intestinal permeability remains unclear. in our study, the endotoxemia was detected mainly during the intraoperative period, but the increased intestinal permeability was observed only 24 h after surgery. although it would be easy to suggest that endotoxemia was due to an increase in bowel permeability, one may develop independently of the other. indeed, endotoxemia is known to reduce splanchnic blood flow and cause disruption of mucosal barrier function. furthermore, exposing the peritoneal cavity to the atmosphere may in it self lead to endotoxemia. in some cases, intestinal permeability, and endotoxemia was detected somewhat higher in the laparoscopic than the open surgery, although such data are not statistically significant. in ten patients including five with rectosigmoid cancer, and five from the splenic flexure cancer, the operation went beyond 4 h ; three of these cases were part of the initial laparoscopic experience. this study confirms our preliminary data, but further prospective randomized studies are required, especially in advanced laparoscopic procedures (carcinoma of the middle and low rectum), also considering whether the surgeon 's experience provides an additional biological and metabolic advantage for the patients. in conclusion, during laparoscopic colorectal procedure : a wide variation in the size of the incision was needed to extract the specimen and facilitate anastomosis.subsequent manipulation of peritoneum and the intestine handled. a wide variation in the size of the incision was needed to extract the specimen and facilitate anastomosis. this might explain why no differences were observed, in regards to the intestinal permeability and endotoxin concentration versus the open procedure. | purpose : the gut barrier is altered in certain pathologic conditions (shock, trauma, or surgical stress), resulting in bacterial and/or endotoxin translocation from the gut lumen into the systemic circulation. in this prospective randomized study, we investigated the effect of surgery on intestinal permeability (ip) and endotoxemia in patients undergoing elective colectomy for colon cancer by comparing the laparoscopic with the open approach.patients and methods : a hundred twenty - three consecutive patients underwent colectomy for colon cancer : 61 cases were open resection (or) and 62 cases were laparoscopic resection (lr). ip was measured preoperatively and at days 1 and 3 after surgery. serial venous blood sample were taken at 0, 30, 60, 90, 120, and 180 min, and at 12, 24, and 48 h after surgery for endotoxin measurement.results:ip was significantly increased in the open and closed group at day 1 compared with the preoperative level (p < 0.05), but no difference was found between laparoscopic and open surgery group. the concentration endotoxin systemic increased significantly in the both groups during the course of surgery and returned to baseline levels at the second day. no difference was found between laparoscopic and open surgery. a significant correlation was observed between the maximum systemic endotoxin concentration and ip measured at day 1 in the open group and in the laparoscopic group.conclusion:an increase in ip, and systemic endotoxemia were observed during the open and laparoscopic resection for colon cancer, without significant statistically difference between the two groups. |
technological advancement in treatment planning enables us to tailor the dose to fit the target with minimal dose to critical organs. nevertheless, the actual dose delivery to patient may not be same like planned one because of various associated uncertainties in radiotherapy treatment chain ; and one of the major sources of uncertainties is respiration induced target motion. this respiratory motion is an obstacle for delivering highly conformal dose to the target in upper abdomen and thoracic regions. further, the respiratory motion would produce interplay effect in dynamic treatment deliveries such as imrt ; which may cause cold or hot spots in the treatment region. and the effect of respiratory motion in various treatment techniques of photon beams had been extensively studied by either using phantom experiments or planning studies. the maximum dose deviation was observed for large amplitude and short breathing period and the dose deviation was also directly proportional to plan complexity. most of the studies concluded that the effect is considerable for single field or fraction and averaged out over entire course of radiotherapy. bortfeld., showed that the effect of respiratory motion in an imrt delivery is negligible when considering entire course of treatment that is 30 fractions and this effect is independent of delivery techniques such as dynamic and step - shot imrt., showed that the maximum dose deviation was up to 30% and 18% for single field and fraction ; this was reduced to less than 12% after 30 fractions. though the respiratory motion effect is negligible in conventional fractionation treatments ; it could be a concern in fewer fraction high dose treatments such as stereotactic body radiation therapy. various techniques such as motion encompassing, breath - hold, gating and tracking are available for managing the respiratory motion. motion encompassing method includes more normal tissues and is not a favorable solution in the era of conformal radiotherapy. the breath - hold method would not be applicable for all especially for pulmonary compromised patients. the other viable solution is to gate the beam at appropriate phase / amplitude of respiratory motion. the electron beam is extensively used in postmastectomy chest wall irradiation because of its finite range of penetration ; it also reduces cardiac and lung toxicity. further, modulated electron radiation therapy (mert) has been proposed for delivering highly conformal dose to targets while sparing normal tissues., used the mert for planning the breast cancer treatments and it was shown that the mert was superior to photon imrt in reducing the lung and heart dose. in mert, the lateral conformity and uniformity may be achieved by intensity modulation and conformity in depth direction may be improved by energy modulation. observations revealed that chest wall moves due to respiration and this may degrade the dose distribution. unlike photons the electron beam could be more susceptible to respiratory motion ; hence electron treatments in the thoracic regions may need to incorporate respiratory motion management. this would decrease the internal target volume and reduce the dosimetric uncertainties of respiratory motion. ramsey., emphasized that the dosimetric performance of any gated delivery should be evaluated and compared with non - gated operation before clinical implementation. the comparisons of dosimetric characteristics of gated photon beams with nongated beams were reported earlier and no clinically significant dosimetric deviations were observed ; this ensured the accuracy of x - ray photon beam gating. similar comparisons should be carried out for electron gated treatments to understand its dosimetric accuracy. to the best of our knowledge, there is not a single study available at present for electron beam gated treatments. therefore, the aim of this study was to compare the gated electron beam dosimetric characteristics such as beam output, symmetry and flatness with the non - gated electron beams. the electron beam gated delivery was performed in a medical linear accelerator (cl2100cd, varian medical systems, palo alto, ca). the linac is equipped with five electron energies (4, 6, 9, 12 and 16 mev) and dual x - ray photon energies (6 and 15 mv). the point doses and dose profiles (in - plane and cross - plane) of all electron energies were measured for total monitor unit of 100 mu under gated operation for three dose rates (100 mu / min, 300 mu / min and 600 mu / min), two respiratory motions (breathing period of 4 s and 8 s). gated treatments were performed using real - time position management (rpm) system (varian medical systems, palo alto, ca). the rpm system consists of six dot passive marker block which was placed over the moving chest wall of quasar phantom. a wall mounted infra - red camera captures the motion of marker block for producing the motion pattern of quasar phantom. flatness and symmetry values of gated electron beam deliveries were measured using imatrixx 2d ion chamber array device (scanditronix wellhfer, freiberg, germany) which was sandwiched between perspex slab phantoms. this 2d array was placed over the quasar motion platform which was programed to move in the cranio - caudal direction (along the gun - target direction) for simulating the respiratory motion. the respiratory motion considered in this study was having breathing period of 4 s and 8 s with a peak to peak amplitude of 2 cm. the 2d fluence measurements were carried out for 20 20 cm applicator at respective reference depths (zref). experimental setup : (a) dose profile measurement using imatrix 2d array placed over quasar motion platform, (b) beam output measurement using markus plane parallel ionchamber placed over motion platform the point dose measurements were carried out using plane parallel ion chamber (markus, ptw, germany) which was placed in appropriate slab phantom holder. the whole phantom system was placed over motion platform which was programed to mimic the above assumed respiratory pattern. the point dose measurements were carried out for 10 10 cm applicator at respective reference depths (zref). the accuracy of gated electron beam deliveries was determined by comparing the gated delivery dosimetric characteristics with corresponding non - gating (no phantom motion) deliveries. it was shown that the beam output of gated delivery of photon beam was deviated larger with respect to non - gated delivery when delivering low number of mu (2 mu) in the gating window. hence, we have experimented effect of low mu settings in the electron gated delivery. 2d profile and point doses were also measured for a total 10 mu with the gating duty cycle 10%, dose rate 300 mu / min and breathing period 4 s. dosimetric characteristics of gated (25% duty cycle) and non - gated electron beam treatments were compared for three different dose rates (100 mu / min, 300 mu / min and 600 mu / min) and two breathing periods (4 s and 8 s). figure 2a and b show in - plane and cross - plane dose profiles of 9 mev electron beam at a dose rate of 300 mu / min and breathing period 4s for gated and non - gated deliveries. table 1a and b show the variation in beam flatness and symmetry values for all electron energies and various dose rates at 4 s breathing period. similarly the table 2a and b show the beam flatness and symmetry values for 8 s breathing period. comparison of dose profiles for gated (25% duty cycle) and non - gated delivery of 9 mev electron beam (a) in - pane and (b) cross - plane. these profiles were measured at a depth of zref using the applicator 2020 cm percentage deviation in beam symmetry for the breathing period of 4s percentage deviation in beam flatness for the breathing period of 4s percentage deviation in beam symmetry for the breathing period of 8s percentage deviation in beam flatness for the breathing period of 8s it was observed that the dose profiles of gated delivery are in good agreement (< 0.7%) with the corresponding non - gated delivery [refer tables 1 and 2 ]. the maximum deviation of 0.7% was observed in flatness for the electron energy 6 mev at a dose rate of 100 mu / min and breathing period of 4 s. similarly the maximum symmetry deviation was 0.7% for the electron energy 12 mev at a dose rate of 100 mu / min and breathing period of 8s. the dose profiles (table 4a) of low mu setting was also in good agreement with corresponding non - gated delivery. the percentage deviations of beam output of gated delivery were calculated with respect to corresponding non - gated deliveries. table 3 shows the beam output deviations for all electron energies, dose rates and breathing periods. similar to 2d profile results, the beam outputs of gated deliveries were also similar to corresponding non - gated deliveries except for 16 mev. the gated output deviation with respect to non - gated delivery was within 0.6% for all electron energies except for 16 mev ; which had the deviation of 1.4% for the dose rate of 600 mu / min. further, it was observed that the beam output deviations of low mu setting (table 4b) was also less (< 0.5%). percentage deviation in beam output percentage deviation in beam symmetry and flatness when low number of mu used in a gating window percentage deviation in beam output when low number of mu used in a gating window the dosimetric accuracy of gated electron beam deliveries was evaluated for various dose rates and respiratory motion periods in a medical linear accelerator. the 2d dose profiles and point doses of gated delivery were compared with corresponding non - gated deliveries. the results of this study indicate that the linac is well suitable for non - dynamic electron gated deliveries. in this study, the maximum point dose deviation was observed for the electron energy 16 mev and this could be due to the temperature rise in the linac system during high energy electron beam delivery. in addition, the gating on the 16 mev electron beam further increased the temperature and internal water temperature during measurement was around 43c. whereas for other electron energies, the internal water temperature was ~40c ; hence we could not observe any dose deviation. to substantiate this, initially, a point dose was measured for 100 mu with a dose rate of 600 mu / min at an internal water temperature of 40.5c and this was considered as reference. the linac was programed to deliver around 3500 mu continuously to rise the internal water temperature to ~45c. the beam output percentage deviations were calculated with respect to reference dose (that is at 40.5c) and the figure 3 shows the results. it was observed that the dose deviation between 45c and 40.5c was -2.7%. this showed that the dosimetric characteristics of electron beam depend on the temperature of the linac components ; hence the energy dissipation and temperature of linac components should be maintained constant. in this study, we have not evaluated the temperature effect for other energies ; because for other low energies the cooling system of linac was able to maintain the temperature with gated delivery. shows beam output variation of 16 mev electron beam at various internal water temperatures of linac system. these values were measured at a depth of zref using the applicator 10 10 cm gating in electron beam would be a standard method in near future when we use highly conformal electron treatments such as mert. the gating process with electron imrt would further complicate the process. a separate study is required to evaluate the electron gating with dynamic treatments. in addition, the imatrixx has finite resolution of 7.62 mm (ion - chamber center to center distance) ; hence using a film may have advantage (especially for mert) for the measurement of electron dose blurring accurately. the dosimetric characteristics of gated electron beam delivery were evaluated for various dose rates and respiration periods. the flatness and symmetry of all the evaluated electron energies did not differ by more than 0.7% with respect to corresponding non - gated deliveries. the output variation of gated electron beam was less than 0.6% for all electron energies except for 16 mev (1.4%). the results of this study indicate that the varian cl2100cd is well - suitable for gated delivery of non - dynamic electron beams. | the purpose of this study was to compare the dosimetric characteristics ; such as beam output, symmetry and flatness between gated and non - gated electron beams. dosimetric verification of gated delivery was carried for all electron beams available on varian cl 2100cd medical linear accelerator. measurements were conducted for three dose rates (100 mu / min, 300 mu / min and 600 mu / min) and two respiratory motions (breathing period of 4s and 8s). real - time position management (rpm) system was used for the gated deliveries. flatness and symmetry values were measured using imatrixx 2d ion chamber array device and the beam output was measured using plane parallel ion chamber. these detector systems were placed over quasar motion platform which was programmed to simulate the respiratory motion of target. the dosimetric characteristics of gated deliveries were compared with non - gated deliveries. the flatness and symmetry of all the evaluated electron energies did not differ by more than 0.7 % with respect to corresponding non - gated deliveries. the beam output variation of gated electron beam was less than 0.6 % for all electron energies except for 16 mev (1.4 %). based on the results of this study, it can be concluded that varian cl2100 cd is well suitable for gated delivery of non - dynamic electron beams. |
the international classification of sleep disorders (icsd1 lists stress as the main aethiologicial factor behind primary (psychophysiological) insomnia. a relationship between sleep and stress is also supported by cross - sectional questionnaire studies2, 3 as well as by prospective studies4, 5. with regard to polysomnography (psg electroencephalography, electro - oculography, and electromyography) and stress the state of knowledge is less clear. some early studies involving unpleasant films before sleep did not show much effect other than intensifying rapid eye movement (rem) sleep6,7,8. among studies of real life stress, the effect of losing a life partner involved increased rem intensity9, an impending exam resulted in reduced tst10, 11 (and sws in the latter study) or increased rem12 and an impending coronary by - pass operation led to increased sleep fragmentation13. beaumaster.14, on the other hand, found no effect on psg variables in unexperienced sky divers the night before the first jump. for example, it has been shown that marine officers being on call (on nights without actual calls to duty) have reduced sws and increased stage 2 as compared to being off duty15. in another study the latter was related to self - rated apprehension of the early awakening (measured at bedtime)16, 17. in a field study in a real life setting a day with moderately increased stress ratings showed reduced sleep efficiency, and increased stage 0, and latency to stage 318. in a similar real life study a week with moderately increased work stress (compared to a low stress week) showed decreased sleep efficiency19. all available studies thus far have focused on effects of acute stress, whereas the stress behind the diagnosis of insomnia refers to extended periods of stress. thus, it seems necessary to investigate whether individuals that report stress across a longer period of time also exhibit indications of impaired sleep. the present study was designed to provide such information on real life stress and sleep and focused on three home psg recordings over a period of six weeks and stress ratings daily across the same weeks. to the best of our knowledge, a total of 52 subjects were approached, 46 accepted to participate and 33 subjects completed the full protocol. the loss of the 13 subjects were mainly due to not completing the polysomnographic recordings because of minor disease, travel, work schedules, technological problems, etc that interfered with participation. every participant filled in a self - administered questionnaire which included questions about social and demographic background, working / not working, smoking (yes / no), alcohol consumtion (no, occasionally, 24 times / month, 24 times per week or more, scored 03), use of pain killers / fever reducing medication (never almost every day, range 04), physical activity (almost never, seldom, light physical activity, heavy training, competition level training, range 04), subjectively rated health (srh) range 15, very poor excellent)20. no participant used sedatives / hypnotics or antidepressants while four used anti - hypertensive medication. they also filled out the hospital anxiety / depression scale21, which is a less clinically oriented scale than other similar scales, and better suited for normal populations. was also included a rating scale for habitual (last 6 weeks) work stress and home stress on a scale from 15 (from none to very stressful). in addition, the well - established work demand scale of karasek and theorell22 was used. the latter included questions on having too much to do, having to exert too much effort at work, etc. the mean age was 44 years (range 2869), 75% worked (the remainder were students or retired), 87% were married / cohabiting and 28% had small children (30 minutes is a reasonable indicator of disturbed sleep31, 32. it is not clear if there is a critical level of the amount of stage 1, but the level is increased in many situations of disturbed sleep33. it should be emphasized that momentary stress was also related to more stage 0 during sleep (or waso) in the univariate analysis. it is thus possible that stage 0 is an equally interesting sleep variable in relation to stress as is stage 1. in our previous study comparing high and low stress nights, wake after sleep onset (waso, which corresponds to the amount of stage 0) and was significantly increased, and sleep efficiency decreased, on the stressed night18. however, there is a possibility that disturbed sleep could cause an increased perception of stress34. however, the direction of causality was not possible to address with the present design. sws was not related to stress in the present study, nor in the two previous studies18, 19. another observation is that rem sleep was positively correlated with stress in the univaariate analysis but was not strong enough to enter the multiple regression. total sleep time (tst) did not enter the multiple regression, but the initial correlation with momentary stress was rather high. this seems to be in conflict with the common notion that stress reduces sleep duration. thus, dahlgren.24 found increased during a week of increased stress, presumably, reflecting a need for sleep. horne.35 found increased levels of sws after a day of visual and mental stimulation. it may also be of interest to consider the results of meerlo.36 who demonstrated increased high intensity kripke.37 have argued that increased sleep duration is an indicator of problems or disease, whereas short sleep may be the opposite. this seems to suggest that the increased tst in the present study could be a compensatory response to stress, and its resulting impairment of sleep. however, one could also argue that the increased amounts of stage 1 (and stage 0) could result from an attempt to extend sleep beyond its natural limits. this might be true since such an extension would result in difficulties maintaining sleep, thus resulting in the appearance of superficial sleep, awakenings etc. one should remember that the setting was naturalistic and that the subjects could regulate their sleep duration at will, at least within the confines of work and other commitments. the modest signs of disturbed sleep in this study may be due to the stress levels in the present population being rather moderate, and hence only having limited effects on sleep. as discussed previously, there is no well - established method of quantifying stress in absolute terms and there are no criteria for what levels of stress that might result in sleep impairment. this is probably in the nature of naturalistic studies ; to be allowed into individuals homes in periods of intense work stress (or other stress) may not be practically or ethically feasible. however, it has been demonstrated that being sick listed after long periods of work stress is associated with similar, but stronger sleep impairment28. possibly, modest increases of reported work stress or disturbed sleep can be used as warning signals by employers. one limitation of the present study is the modest number of participants and the study needs replication in a larger sample. another problem is its cross - sectional character, which makes it impossible to infer causation. however, important factors like age, gender, anxiety, depression, physical activity, bmi, srh, use of alcohol, smoking, and use of pain killers were controlled for or left out because of non - significant correlations with the dependent variable. interestingly, baseline had anxiety added to the prediction of mean momentary stress of the sleep variables, without forcing them out of the regression. thus, traitlike anxiety at the start of the study was not involved in the psg relation to momentary stress. habitual stress at the start of the study had a significant correlation with mean momentary stress, which was expected, and explained 25% of the variance. furthermore it was only related to one psg variable (awaknenings / h) and rather weakly. thus, it seems unlikely that mean momentary stress represents trait - like stress, but rather temporary stress during a certain time period. and, levels during this time period seem to reflect physiological sleep impairment during the same time span. the present study used a sample of convenience and is probably not representative of the average individual. however, care was taken to include a reasonable age range, both genders and to use no restrictions with respect to other background factors. real - life studies of the present type will always require a compromise between feasibility and representativeness.. there might be other confounders not accounted for, but the results leave the impression that a state of (moderate) stress during a certain time period is associated with impaired physiological sleep during that same period. causation can not be determined with the present design but studies comparing sleep physiology between a single day with low stress with a day with moderate stress show similar impairment due to stress18, 19. in summary, the present study has shown that higher average stress across a 6-week period was related to a longer sleep latency, an increased amounts of stage 0 and stage 1 sleep, and a slight increase of total sleep time. thus, a modest increase of stress is related to a mild sleep impairment. longitudinal studies are, however needed in order to describe the effect of varying periods of stress on sleep. | despite the common notion that stress impairs sleep there is little published data showing that sleep (polysomnography (psg)) is impaired across several sleep episodes in individuals who complain of daily stress during the same period. the present paper aimed at investigating such a connection. 33 subjects had 3 sleeps recorded with psg at home across 6 weeks and kept a sleep / wake diary each day, including 3-hourly ratings of stress (scale 19). the stress ratings and the conventional psg parameters were averaged across time. a stepwise multiple regression analysis showed that the best predictors of stress were stage 1 sleep (beta = 0.49), latency to stage 1 sleep (0.47) (adjusted for anxiety and age). other sleep continuity variables had significant correlations with stress (reversed) but did not enter the multiple regression analysis. the correlation between stress before the start of the study and psg data was not significant. it was concluded that moderately increased stress over a longer period of time is related to moderate signs of disturbed sleep during that period. this may be of importance when considering stress as a work environment problem. |
in the past, the treatment for spinal disease was focused on regional problem, as a neural decompression and obtaining a bony fusion. as spinal surgery techniques have developed, a concept about whole spinal alignment has been emphasized as important for managing spinal disease. spinopelvic (lumbosacral pelvic junction) alignment is very important in understanding the overall alignment of the spine. and sagittal alignment of the spine has been investigated in many studies, primarily in the normal population8,20). in the normal population, the correlation between pelvic incidences, sacral slope and lumbar lordosis have been well documented3,11,19). also, several studies have reported sagittal alignment in populations of patients with low back pain7 - 9), degenerative spondylolisthesis (dspl)1,12,20), and isthmic spondylolisthesis (ispl)6,14). dspl and ispl are commonly seen by clinicians and require fusion surgery to be considered for sagittal spinopelvic alignment. thus, understanding the characteristics of the spinopelvic parameters of dspl and ispl are very important for spine surgeons. the interesting thing is that the characteristics of the spinopelvic parameters of dspl and ispl are different although the overall same spondylolisthesis. most studies have reported the spinopelvic parameters of the dspl and ispl population as compared with the normal population, separately. the purpose of this study was to demonstrate the differences in spinopelvic parameters between the dspl and ispl population. and we assessed 53 spondylolisthesis patients who were treated with lumbar interbody fusion in our hospital from january 2008 to september 2010 ; 34 patients with dspl and 19 patients with ispl. the dspl group consisted of 6 men and 28 women, and the ispl group consisted of 3 men and 16 women. the mean age was 65.7 years (range, 45 - 80 years) and 54.0 (range, 36 - 71 years) in the dspl and ispl group, respectively. according to the meyerding 's classification13), 25 dspls were grade i (5 - 25%) and 9 were grade ii (25 - 50%) ; and 15 ispls were grade i and 4 were grade ii. the involved levels for the dspls were l3 - 4 in 4 patients (11.8%), l4 - 5 in 22 patients (64.7%), and l3 - 4 and l4 - 5 in 8 (23.5%). those for ispls were l4 - 5 in 9 (47.3%), and l5-s1 in 10 (52.6%) (table 1). patients were excluded from the study if they had one or more of the following criteria, according to clinical and/or radiological data : history of any spinal surgery, including a lumbar discectomy ; pathologic spinal disease (trauma or tumor) ; scoliosis ; femoral pathology. normal asymptomatic adults who were in a recently published study were set as the control population14). the control populations had no history of severe back pain or spine trauma, and consisted of 17 males and 13 females with an average age of 34.3 years (range, 28 - 42 years). spinopelvic parameters were measured on a whole spine lateral radiograph (1436 inch) with the hips and knees extended in a standing position after at least 5 minutes of walking. the following radiographic parameters were measured : pelvic incidence (pi), sacral slope (ss), pelvic tilt (pt), lumbar lordosis (ll), and sagittal vertical axis from c7 plumb line (sva). pi is defined as the angle between the perpendicular to the upper sacral endplate at its midpoint and the line connecting this point to the femoral head axis. this is a morphologic parameter, considered as a constant, independent of the spatial orientation of the pelvis. the ss is defined as the angle between the horizontal and the upper sacral endplate. the pt is defined by the angle between the vertical and the line through the midpoint of the sacral plate to the femoral head axis ; this is also a positional parameter. ll is defined as the angle between the upper l1 endplate and the upper sacral endplate. the sva is defined as the horizontal offset from the postero - superior corner of s1 to the c7 plumb line (fig. statistical analysis was performed using spss software (version 12.0 ; 2003 ; spss, inc., the mann - whitney u test was employed for analysis differences in non - categorical variables between the two groups. the overall differences of sagittal spinopelvic parameters between the dspl and ispl groups were statistically analyzed. and, subgroups were divided in each of the groups according to the pi value (normal pi ; 40<pi<60, high pi ; pi60), and sva value we assessed 53 spondylolisthesis patients who were treated with lumbar interbody fusion in our hospital from january 2008 to september 2010 ; 34 patients with dspl and 19 patients with ispl. the dspl group consisted of 6 men and 28 women, and the ispl group consisted of 3 men and 16 women. the mean age was 65.7 years (range, 45 - 80 years) and 54.0 (range, 36 - 71 years) in the dspl and ispl group, respectively. according to the meyerding 's classification13), 25 dspls were grade i (5 - 25%) and 9 were grade ii (25 - 50%) ; and 15 ispls were grade i and 4 were grade ii. the involved levels for the dspls were l3 - 4 in 4 patients (11.8%), l4 - 5 in 22 patients (64.7%), and l3 - 4 and l4 - 5 in 8 (23.5%). those for ispls were l4 - 5 in 9 (47.3%), and l5-s1 in 10 (52.6%) (table 1). patients were excluded from the study if they had one or more of the following criteria, according to clinical and/or radiological data : history of any spinal surgery, including a lumbar discectomy ; pathologic spinal disease (trauma or tumor) ; scoliosis ; femoral pathology. normal asymptomatic adults who were in a recently published study were set as the control population14). the control populations had no history of severe back pain or spine trauma, and consisted of 17 males and 13 females with an average age of 34.3 years (range, 28 - 42 years). spinopelvic parameters were measured on a whole spine lateral radiograph (1436 inch) with the hips and knees extended in a standing position after at least 5 minutes of walking. the following radiographic parameters were measured : pelvic incidence (pi), sacral slope (ss), pelvic tilt (pt), lumbar lordosis (ll), and sagittal vertical axis from c7 plumb line (sva). pi is defined as the angle between the perpendicular to the upper sacral endplate at its midpoint and the line connecting this point to the femoral head axis. this is a morphologic parameter, considered as a constant, independent of the spatial orientation of the pelvis. the ss is defined as the angle between the horizontal and the upper sacral endplate. the pt is defined by the angle between the vertical and the line through the midpoint of the sacral plate to the femoral head axis ; this is also a positional parameter. ll is defined as the angle between the upper l1 endplate and the upper sacral endplate. the sva is defined as the horizontal offset from the postero - superior corner of s1 to the c7 plumb line (fig. statistical analysis was performed using spss software (version 12.0 ; 2003 ; spss, inc., the mann - whitney u test was employed for analysis differences in non - categorical variables between the two groups. the overall differences of sagittal spinopelvic parameters between the dspl and ispl groups were statistically analyzed. and, subgroups were divided in each of the groups according to the pi value (normal pi ; 40<pi<60, high pi ; pi60), and sva value two spinopelvic parameters had significant statistical differences between the dspl and ispl group ; ll (p=0.004) and sva (p=0.005). the ll of dspl group (4213) was significantly lower than that of the ispl group (556). the sva of the dspl group (5749 mm) was significantly greater than that of the ispl group (2122 mm) (fig. the pi was significantly greater for patients with dspl (599) and ispl (5913) compared with a control group, respectively (499) (p=0.000). the ss was significantly lower for patients with dspl (347) than that of the control group (387) (p=0.023). the pt of dspl (247) and ispl (217) was significantly greater than that of the control group (116 ; p=0.000). the ll of dspl (4213) was significantly lower than that of the control group (4811 ; p=0.029), but that of ispl (556) was significantly greater than the control group (p=0.004). the sva of dspl (5549 mm) was greater than that of the control group (< 40 mm), but that of ispl (2122 mm) was within 40 mm of that of the control group (table 2). the dspl group was divided 16 high pi (666) and 18 normal pi (524) populations according to the pi value (p=0.000). the ss (p=0.001) and pt (p=0.006) of the high pi group was significantly greater than that of the normal pi group (table 3). the dspl group was divided into 16 normal sva and 18 high sva populations according to the sva value (p=0.000). the pt (p=0.037) of the high sva group was significantly greater than that of normal the sva group, and the ll (p=0.016) of the high sva group was significantly lower than the normal sva group (table 4). the ispl group was divided into 9 high pi and 10 normal pi populations according to the pi value (p=0.000). the pt (p=0.001) of the high pi group was significantly greater than that of the normal pi group (table 5). the ispl group was divided into 16 normal sva and 3 high sva populations according to the sva value (p=0.007). the pi (p=0.018) and ss (p=0.014) of the high sva group was significantly greater than that of the normal sva group (table 6). recently, it has been recognized that the orientation of the lumbosacral pelvic junction plays a critical role in the overall alignment of the spine, and that sagittal spinopelvic balance is made from spinal and pelvic parameters. pi is an important anatomic parameter that describes the anatomic configuration of the pelvis and greatly influences the sagittal configuration of the spine4,10,11). thereafter, pi increases significantly during adolescence until reaching its maximum value in adulthood10). it is not affected by posture or the pelvic position, and is considered to be invariable at the end of growth2). pi represents the algebraic sum of the ss and the pt : pi = ss+pt. thus, if we consider the pi of any subject, when the sacral slope increases, the pelvic tilt decreases, and vice versa. it is commonly reported as a compensatory mechanism : when the trunk inclines anteriorly (e.g., age related change, sagittal imbalance, loss of lordosis, increase of kyphosis) a subject will try his / her best to maintain an economic posture and keep the spine balanced. also, the morphology of the pelvis as quantified by pi is a strong determinant of the spatial position of the pelvis in a standing position : as the pi increases, so does the ss, pt or both. legaye.11) and vaz.19) have demonstrated a correlation between pi and ll in normal subjects ; a low pi is usually associated with a low lumbar lordosis, whereas a high pi is usually associated with a high lumbar lordosis. also, the correlation between ll and ss has been reported in normal populations ; ll increases linearly with the ss18). in the present study, patients with dspl had a significant greater pi (59) than the asymptomatic control populations (49) (table 2). it suggests that the shape of the pelvis, characterized by pi, is a predisposing factor for dspl. in an asymptomatic normal population, it was demonstrated that patients with high pi had a high ll, and those with low pi had a low ll11,19). but, we observed that patients with dspl demonstrated a low ll (42), a low ss (34), a high pt (24) (pelvic retroversion), and a high sva (57 mm) (anterior sagittal unbalance), compared with the control group. also, analyzing between the high pi and the normal pi subgroup in the dspl group, the ss and pt of the high pi subgroup was significantly greater than that of the normal pi subgroup, as a greater pi has a greater ss, pt. in spite of high pi, there was no significant difference in ll between high and normal pi subgroups. additionally, the sva (72 mm) of the high pi subgroup was greater than that (42 mm) of the normal pi subgroup, but, there was no significant difference (table 3). for the analysis between the high sva and normal sva subgroup in the dspl group, the pt (27) of the high sva subgroup was significantly greater than that (22) of the normal sva subgroup ; the ll (37) of the high sva subgroup is significantly lower than that (48) of the normal sva subgroup (table 4). it seems that the sagittal imbalance populations (high sva subgroup) processed pelvic retroversion (increase of pt) as a compensatory mechanism, but did not overcome sagittal imbalance owing to the loss of lumbar lordosis (fig. initially, the patients with high pi would have had a high lordosis and high sacral slope. as time goes on, these mechanical stresses on posterior facets cause and accelerate facet arthrosis. the posterior facets arthrosis associated with a significant inclination of the sacral slope predispose slipping. the slippage progresses to disc degeneration and collapse, and results in a loss of lordosis. this loss of lordosis induces a significant anterior displacement of the c7 plumbline and center of gravity. thereafter, as a compensatory mechanism, patients with dspl generate a decrease of ss associated with an increase of pt (pelvic retroversion)12) (fig. dspl populations characterized by a high pi can have a greater potential to compensate global sagittal imbalance than populations with a low pi. but, as the loss of lumbar lordosis is even worse, sagittal imbalance can be more severe because of the limitation of compensation in pelvic retroversion. labelle.10) described that pi is significantly correlated with the degree of ispl. rajnics.15) noted that the ss, pt and pi in ispl populations were significantly higher than those values in the normal populations. moreover, hanson.6) reported that as the degree of spondylolisthesis increased, the ll, pi and pt increased as well. in the present study, patients with ispl also had a significantly greater pi (59) than the asymptomatic control populations (49), in the same way as dspl. however, unlike the dspl population, the ispl population demonstrated a high ll (55), a normal ss (38), a high pt (21), and the maintenance of a global sagittal balance within the normal range of sva (21 mm), as compared to the control group. in an analysis between the high pi and the normal pi subgroup in the ispl group the ll and sva (57, 28 mm) of the high pi subgroup was greater than those (53, 15 mm) of the normal pi subgroup, but there were no significant differences (table 5). a comparison between the high sva and normal sva subgroup in ispl group revealed that the high sva subgroup, as sagittal imbalance group, was only 3 populations, most (16 populations) of ispl populations maintained the sagittal balance. the pi and ss (76, 48) of the high sva subgroup was significantly greater than those (56, 36) of the normal sva subgroup (table 6). generally, the ispl group seems to maintain a sagittal balance, which can be caused by the maintenance of lumbar lordosis and is different from dspl populations and mild pelvic retroversion (fig. but, there were few studies for these differences of spinopelvic parameters between the dspl and ispl population. in our analysis between the dspl and ispl population, there were two statistically significant parameters ; ll (p<0.05) and sva (p<0.001) (fig., the ll can be a considerable factor, because the sva is a dependent variable. we can suggest that the characteristics of the spinopelvic parameters of ispl that differ from dspl are described as the following phases. initially, the patients with high pi have a high lordosis and high sacral slope, which is same as dspl. a high lordosis causes a high shear stress at the pars interarticularis, it develops spondylolysis and ispl. to sum up, if mechanical stresses on the posterior column (pars interarticularis, facet joint) due to a high lordosis cause the defect of pars interarticularis (spondylolysis), ispl can develop. after ispl develops, lordosis is maintained or hyperlordosis is generated as a compensatory mechanism to maintain a global sagittal balance. because mechanical stress is concentrated on the defect of pars interarticularis as a definite weak point, facet arthrosis and discopathy can relatively be less progressed than dspl. in the analysis between but, the pt of the ispl population was less than those of the dspl population (fig. 2, table 2). also, mild pelvic retroversion is generated as a compensatory mechanism (fig. first, it was difficult to evaluate a statistical significance due to a small number of cases and non - age, sex matched analysis. third, the thoracic kyphosis of population was not evaluated in this study. nonetheless, the results of this study are meaningful because the differences of sagittal spinopelvic alignments between dspl and ispl were investigated. but, we recognize that a prospective, larger and longitudinal study is necessary to clearly establish the spinopelvic alignments of dspl and ispl. recently, it has been recognized that the orientation of the lumbosacral pelvic junction plays a critical role in the overall alignment of the spine, and that sagittal spinopelvic balance is made from spinal and pelvic parameters. pi is an important anatomic parameter that describes the anatomic configuration of the pelvis and greatly influences the sagittal configuration of the spine4,10,11). thereafter, pi increases significantly during adolescence until reaching its maximum value in adulthood10). it is not affected by posture or the pelvic position, and is considered to be invariable at the end of growth2). pi represents the algebraic sum of the ss and the pt : pi = ss+pt. thus, if we consider the pi of any subject, when the sacral slope increases, the pelvic tilt decreases, and vice versa. it is commonly reported as a compensatory mechanism : when the trunk inclines anteriorly (e.g., age related change, sagittal imbalance, loss of lordosis, increase of kyphosis) a subject will try his / her best to maintain an economic posture and keep the spine balanced. also, the morphology of the pelvis as quantified by pi is a strong determinant of the spatial position of the pelvis in a standing position : as the pi increases, so does the ss, pt or both. legaye.11) and vaz.19) have demonstrated a correlation between pi and ll in normal subjects ; a low pi is usually associated with a low lumbar lordosis, whereas a high pi is usually associated with a high lumbar lordosis. also, the correlation between ll and ss has been reported in normal populations ; ll increases linearly with the ss18). in the present study, patients with dspl had a significant greater pi (59) than the asymptomatic control populations (49) (table 2). it suggests that the shape of the pelvis, characterized by pi, is a predisposing factor for dspl. in an asymptomatic normal population, it was demonstrated that patients with high pi had a high ll, and those with low pi had a low ll11,19). but, we observed that patients with dspl demonstrated a low ll (42), a low ss (34), a high pt (24) (pelvic retroversion), and a high sva (57 mm) (anterior sagittal unbalance), compared with the control group. also, analyzing between the high pi and the normal pi subgroup in the dspl group, the ss and pt of the high pi subgroup was significantly greater than that of the normal pi subgroup, as a greater pi has a greater ss, pt. in spite of high pi, there was no significant difference in ll between high and normal pi subgroups. additionally, the sva (72 mm) of the high pi subgroup was greater than that (42 mm) of the normal pi subgroup, but, there was no significant difference (table 3). for the analysis between the high sva and normal sva subgroup in the dspl group, the pt (27) of the high sva subgroup was significantly greater than that (22) of the normal sva subgroup ; the ll (37) of the high sva subgroup is significantly lower than that (48) of the normal sva subgroup (table 4). it seems that the sagittal imbalance populations (high sva subgroup) processed pelvic retroversion (increase of pt) as a compensatory mechanism, but did not overcome sagittal imbalance owing to the loss of lumbar lordosis (fig. initially, the patients with high pi would have had a high lordosis and high sacral slope. as time goes on, these mechanical stresses on posterior facets cause and accelerate facet arthrosis. the posterior facets arthrosis associated with a significant inclination of the sacral slope predispose slipping. the slippage progresses to disc degeneration and collapse, and results in a loss of lordosis. this loss of lordosis induces a significant anterior displacement of the c7 plumbline and center of gravity. thereafter, as a compensatory mechanism, patients with dspl generate a decrease of ss associated with an increase of pt (pelvic retroversion)12) (fig. dspl populations characterized by a high pi can have a greater potential to compensate global sagittal imbalance than populations with a low pi. but, as the loss of lumbar lordosis is even worse, sagittal imbalance can be more severe because of the limitation of compensation in pelvic retroversion. labelle.10) described that pi is significantly correlated with the degree of ispl. rajnics.15) noted that the ss, pt and pi in ispl populations were significantly higher than those values in the normal populations. moreover, hanson.6) reported that as the degree of spondylolisthesis increased, the ll, pi and pt increased as well. in the present study, patients with ispl also had a significantly greater pi (59) than the asymptomatic control populations (49), in the same way as dspl. however, unlike the dspl population, the ispl population demonstrated a high ll (55), a normal ss (38), a high pt (21), and the maintenance of a global sagittal balance within the normal range of sva (21 mm), as compared to the control group. in an analysis between the high pi and the normal pi subgroup in the ispl group the ll and sva (57, 28 mm) of the high pi subgroup was greater than those (53, 15 mm) of the normal pi subgroup, but there were no significant differences (table 5). a comparison between the high sva and normal sva subgroup in ispl group revealed that the high sva subgroup, as sagittal imbalance group, was only 3 populations, most (16 populations) of ispl populations maintained the sagittal balance. the pi and ss (76, 48) of the high sva subgroup was significantly greater than those (56, 36) of the normal sva subgroup (table 6). generally, the ispl group seems to maintain a sagittal balance, which can be caused by the maintenance of lumbar lordosis and is different from dspl populations and mild pelvic retroversion (fig. but, there were few studies for these differences of spinopelvic parameters between the dspl and ispl population. in our analysis between the dspl and ispl population, there were two statistically significant parameters ; ll (p<0.05) and sva (p<0.001) (fig., the ll can be a considerable factor, because the sva is a dependent variable. we can suggest that the characteristics of the spinopelvic parameters of ispl that differ from dspl are described as the following phases. initially, the patients with high pi have a high lordosis and high sacral slope, which is same as dspl. a high lordosis causes a high shear stress at the pars interarticularis, it develops spondylolysis and ispl. to sum up, if mechanical stresses on the posterior column (pars interarticularis, facet joint) due to a high lordosis cause the defect of pars interarticularis (spondylolysis) after ispl develops, lordosis is maintained or hyperlordosis is generated as a compensatory mechanism to maintain a global sagittal balance. because mechanical stress is concentrated on the defect of pars interarticularis as a definite weak point, facet arthrosis and discopathy can relatively be less progressed than dspl. in the analysis between but, the pt of the ispl population was less than those of the dspl population (fig. first, it was difficult to evaluate a statistical significance due to a small number of cases and non - age, sex matched analysis. third, the thoracic kyphosis of population was not evaluated in this study. nonetheless, the results of this study are meaningful because the differences of sagittal spinopelvic alignments between dspl and ispl were investigated. but, we recognize that a prospective, larger and longitudinal study is necessary to clearly establish the spinopelvic alignments of dspl and ispl. the pelvic incidence of both symptomatic dspl and ispl patients was greater than that of the asymptomatic control group. the dspl population is characterized by a high sagittal vertical axis from the c7 plumb line, a loss of lumbar lordosis and high pelvic tilt (pelvic retroversion). on the contrary, the ispl population has a high lumbar lordosis, normal sagittal vertical axis from c7 plumb line, and a mild increase of pt. in conclusion, dspl populations are likely to be global sagittal imbalance compared with ispl populations because of the difference of lumbar lordosis between two groups. | objectivethe purpose of this study was to analyze the differences of spinopelvic parameters between degenerative spondylolisthesis (dspl) and isthmic spondylolisthesis (ispl) patients.methodsthirty-four patients with dspl and 19 patients with ispl were included in this study. spinopelvic parameters were evaluated on whole spine x - rays in a standing position. the following spinopelvic parameters were measured : pelvic incidence (pi), sacral slope, pelvic tilt (pt), lumbar lordosis (ll), and sagittal vertical axis from c7 plumb line (sva). the population of patients was compared with a control population of 30 normal and asymptomatic adults.resultsthere were statistically significant differences in ll (p=0.004) and sva (p=0.005) between the dspl and ispl group. the ll of dspl (4213) was significantly lower than that of the control group (4811 ; p=0.029), but that of ispl (556) was significantly greater than a control group (p=0.004). the sva of dspl (5549 mm) was greater than that of a control group (< 40 mm), but that of ispl (2122 mm) was within 40 mm as that of a control group. the pt of dspl (247) and ispl (217) was significantly greater than that of a control group (116 ; p=0.000).conclusionboth symptomatic dspl and ispl patients had a greater pi than that of the asymptomatic control group. in conclusion, dspl populations are likely to have global sagittal imbalance (high sva) compared with ispl populations because of the difference of lumbar lordosis between two groups. |
diabetes and hypertension are very common diseases in republic of korea as well as in other developed countries, on average, around 8.0% of koreans reported that they had diabetes in 2007, and around 28% of koreans reported that they had hypertension [25 ]. in addition, the prevalence for both diseases is increasing [5, 6 ]. although diabetes and hypertension are not among the top leading causes of death, such as cancer and stroke, these two diseases draw attention from the public due to their increasing trends, while cancer and stroke are declining. even diabetes has been ranked the 6th leading cause of death and is known as costly disease. given the fast pace of population aging in republic of korea, one can assume that their prevalence will continue to rise. in addition, these two diseases have been known for their high comorbidity [1013 ]. it has been estimated that 20%60% or even more of diabetic complications can be attributed to hypertension [11, 13 ]. also, the prevalence of hypertension in diabetic individuals appears to be 1.5 to 3 times higher than in nondiabetic age - matched groups [11, 13 ]. although diabetes is associated with considerably increased cardiovascular risk, the presence of hypertension in the diabetic individual markedly increases morbidity and mortality. people with both diabetes and hypertension have approximately twice the risk of cardiovascular disease as nondiabetic people with hypertension [12, 14 ]. generally, both diseases are more common among males, the aged, and unmarried, and those who are less educated, and earn less are also at higher risk [10, 1517 ]. it is not clear as to whether the place of residence is associated with diabetes and hypertension in combination. despite the clinical importance of the coexistence of diabetes and hypertension as comorbid conditions, there are not many studies done on these two diseases taken together in republic of korea. furthermore, although the relationship between socioeconomic status (ses) and health has been well documented, there is a lack of clear understanding about the combined impact of different ses measures, for example, education and income. although these two variables have often been analyzed independently, they are interrelated each other at an individual level in reality. min had used these two variables as one composite variable and reported the supportive roles between education and income in hawaii. a person with lower income but has higher education is still less likely to have both diseases ; a person with lower education but has higher income is still less likely to have both diseases. therefore, the goal of this paper is to examine the relationship between the education - income composite ses variable with these two diseases. it is hoped that the findings of this study will contribute to the current body of knowledge by elucidating to the socioeconomic status that is associated with diabetes and hypertension, particularly among the korean adult population and help policymakers, program planners, and other agencies to create more effective interventions. the data used in this paper were obtained from the 2005 korea national health and nutrition examination survey (knhnes). the knhnes survey instrument is modeled after the national household interview survey (nhis) conducted by the national center for health statistics (nchs), and all survey respondents are adult residents of republic of korea and supply information on all members of the household. the stratified sampling process was employed ; a whole nation was divided 13 geographical regions following the census criteria ; stratified again by 600 smaller administrative units ; and then, 2026 households were selected including the alternative households in case some households reject to participate in the survey. as a result, a total of 25,215 households ' information was collected out of 25,487 sampled households ; in other words, 98.9% of the sample was completed. the principle objective of the survey is to provide nationwide estimates of population parameters that describe (1) the current health status of the population ; (2) the current physical status of health ; (3) the nutrition status ; (4) the distribution of the population by age, sex, and other fundamental demographic characteristics. as described before, several sociodemographic factors, such as age, sex, marital status, education, and income have been known as risk factors [10, 1517 ]. special attention, however, is given to the ses, which is the focus of this study. the ses is defined as a measure of an individual or family 's relative economic and social ranking, which is often measured by education, income, occupation, and so on [2123 ]. prior studies have reported their positive relationship on health ; for example, the more educated, the better health status [5, 1517, 21, 24 ]. but this study would create the composite variable of ses by combining education and income to gauge the complexity of ses. in other words, we do know both education and income positively affect on health, but we do not know how the relationship would turn out when we consider two variables at once. as min found their study, may a person, who does not have a higher level of education but has adequate financial resources, have lower likelihood of having these two diseases ? may a person, who lacks adequate financial resources but has a higher level of education, have lower likelihood of having these two diseases ? in addition, there exist two possible statistical reasons to use these two variables as a composite variable. one is multicollinearity ; more education level usually brings higher income, which implies a high correlation between two variables. thus, to avoid multicollinearity and gauge ses more accurately, the two variables were combined into one, which was done successfully in other study. to do the analysis, two dependent variables, diabetes and hypertension, were combined first as a single variable, and then this new variable was constructed as four categories : diabetes alone, hypertension alone, both diabetes and hypertension, and either diabetes or hypertension. in other words, persons with diabetes were divided in two groups, those who had diabetes but not hypertension and those who had both diabetes and hypertension. this process was also followed for those with hypertension ; then this new variable was automatically constructed as the four categories as described above. both diabetes and hypertension were measured by the respondents ' answers for their household members : questions were have you ever been diagnosed as having diabetes by doctors ? and have you ever been diagnosed as having hypertension by doctors ? the four categories in the dependent variable were then created as four dummy variables, and four logistic regression models were conducted accordingly to handle the binary dependent variable. there were seven independent variables was used to predict diabetes and hypertension, including age, sex, marital status, socioeconomic status (ses), and place of residence. all variables except age were coded in the following manners : female (0 = male, 1 = female), marital status (0 = unmarried, 1 = married), high school education - higher income, college education - lower income, college education - higher income (with high school education - lower income used as a reference group), and rural residence (urban area = 0, rural area = 1). as for ses, education and income variables were coded as a dummy variable : whether a person completed some college or more (yes = 1) and whether a person 's household income per month is over 2,000,000 won, the median household income in these data, in korean currency (around $ 1,800), the higher household income category (yes = 1). the two variables are combined in four categories and then recoded as four dummy variables, namely, high school education with lower household income (under 2,000,000 won), high school education with higher household income (over 2,000,000 won), college education (including some college) with lower household income, and college education with higher household income. median household income has been used here to gauge the income that lies in the exact 50th percentile. by doing this, we can divide a population into two categories ; earns more than that of the 50th percentile and earns less than that of the 50th percentile. median household income compared to average household income is not affected much by the extreme categories like millionaires and billionaires. only 2.9% of republic of korea reported that they had diabetes alone, 11.9% of them had hypertension alone, 3.0% of them had both diseases together, and 17.8% of them had either diabetes or hypertension. it is important to note that actual diabetes patients were 5.9% (= 2.9% + 3.0%) and hypertension patients were 14.9% (= 11.9% + 3.0%), because both means respondents had diabetes and hypertension at once. in other words, 51% of diabetes patients had both diseases (3.0/(2.9 + 3.0) 100 = 51), and 20% of hypertension patients had both (3.0/(11.9 + 3.0) 100 = 20). it implies that diabetes patients are more prone to have both diseases compared to hypertension patients. thus, the extent of comorbidity between two diseases is more serious in diabetes, as min found. table 1 presents the demographic characteristics of seven independent variables for the weighed 36,378,489 respondents in the knhnes. it indicates that the average years of age for the koreans is 43.2, half of them are females (50%), around two thirds of them are married (65%). on ses, only 31% of them have high school education with higher household income, 13% of them have college education with lower household income, and 26% of them have college education with higher household income.. the first column of table 2 presents the analysis of the log odds of having diabetes and hypertension together. the first logit coefficient shown in the first column of table 2 is 0.07 for age. this means that for every year 's increase in age there is an increase of 0.07 in the log odds of having diabetes and hypertension. the estimated parameter effects are more straightforwardly interpreted when converted into odds ratios, which is done by exponentiation of the coefficients. sometimes odds ratios in logistic regression model are referred to as relative risk ratios ; that is, the relative risk, or the odds, of being in the dependent variable category of interest (i.e., dummy independent variable) and not being in the contrast or reference category of the dependent variable. the odds ratio for age is e = 1.07, which means that the odds of a person having both diabetes and hypertension must be multiplied by 1.07 as being an old, which means that the odds increase with age. we can determine the percentage amount of change in the odds by subtracting 1 from the odds ratio and multiplying the difference by 100. thus, we arrive at (1.071) 100 = 7, indicating that the odds of having both diseases increases 7% more with additional increase of age. the next is for the ses variables, which is our focus variable. among all the ses variables, only the highest ses category, college education with higher income, provided consistent advantages over these two diseases ; 57% less for both diseases, 38% less for diabetes alone, 18% less for hypertension alone, 24% less for either one, respectively. college education and lower income is only significant at hypertension alone and either one, 27% less and 22% less, respectively. lower education and higher income is only significant at both diseases, 19% less likely to have both diabetes and hypertension. conclusively, higher education seemed to work well with both lower and higher income only in hypertension alone and either one, not other models. meanwhile, higher income seemed to work well only in both diabetes and hypertension, but not for the other three models. for diabetes alone model, thus, education seemed the largest impact of the highest ses on having both diseases which means that this category is the most vulnerable on ses. this means that female koreans are 40% less likely to have diabetes alone as compared to their male counterparts. this negative pattern for female also can be found in other models except hypertension alone. married adults, as compared to unmarried ones, show a higher likelihood of having diabetes alone (48% more), hypertension alone (25% more), and diabetes or hypertension (28% more), but not in both diseases. it appears to be that being unmarried confers an advantage for these two diseases, which is against the common expectation. interestingly, rural dwellers show an advantage over these diseases except diabetes alone ; for instance, people who lived in rural area are 24% less likely to have diabetes and hypertension ; 13% less for hypertension alone and either diabetes or hypertension, respectively. the goal of this paper was to examine the relationships between ses and diabetes and hypertension in republic of korea. as expected, the combined dependent variable of diabetes and hypertension shows a considerable amount of comorbidity, particularly in diabetes ; more than 50% of people diagnosed as having diabetes also have hypertension, on the contrary, only 20% of people with hypertension also have diabetes. the comorbidity is a serious concern because people with both diseases have mortality rates that are two or three times higher than patients with diabetes alone [11, 13 ]. another concern is population aging in republic of korea : due to republic of korea 's very low fertility rate, longer life expectancy and low mortality, the pace of population aging is one of the fastest in the world [29, 30 ]. thus, considering this population aging in republic of korea with the fact of the growing patterns of diabetes and hypertension, one can expect that this problem will be more pervasive. as described before, no direct study has been made on this diabetes and hypertension comorbidity taken together in republic of korea. the results showed that the socioeconomic status indeed played an important role in these two diseases in republic of korea as in min 's study, but with limitation. for instance, a person with a higher level of education and a higher income was less likely to have these diseases in all four models. in addition, a person who had a higher level of education but with a lower income was less likely to have hypertension alone and either one, not both diseases and diabetes alone. in addition, a person who had a higher income but had a lower level of education was less likely to have both diseases alone, but this relationship was not significant with other models. education and income in republic of korea did compensate each other to avoid having these two diseases, but not as strong as in hawaii population. in short, people who are socioeconomically disadvantaged are the most vulnerable in having both diseases ; but the compensational effect between education and income to avoid having these diseases can not be seen in all categories. in other words, the compensational effect is weaker in republic of korea compared to that of hawaii. also, we may conclude that a person with a higher education and a higher income only can be benefited in republic of korea. the associations between dependent and independent variables also showed as expected ways except marital status and rural residence. a person is more likely to have these diseases with an increase of age ; females are less likely to have these diseases. married person, however, showed a positive relationship with these diseases. to see if a married person is really vulnerable on these two diseases, this study conducted an additional analysis by creating an interaction variable ; sex and marital status. the results showed that the sex and marital status interaction variable was only significant in the diabetes or hypertension model, not others. one can not conclude that marital status is a real contributing factor on having these diseases. otherwise, considering the close relationship between age and marital status ; the age, the more likely to be married because marital status variable is used as a controlling one, however, the results of further analysis on these variables were not shown in this report. as described before, we do not have a clear understanding of rural / urban residence. this study, however, showed a positive relationship between rural residence and these two diseases only except diabetes alone. it may also relate to the lifestyles and diet of rural korean dwellers : more physical activities, healthier natural environment, less fast food, and more vegetables. accordingly, the policy and intervention programs for the reduction of diabetes and hypertension in republic of korea should include ses. as seen in table 2, a person who had both a higher level of education and a higher income is the most benefited ; the compensating effect between education and income is not as strong as in other countrios. people who are soecioeconomically disadvantaged and who lack financial resources and/or education, which is expected to convert to have better or more knowledge on health, need more attention. in addition, given the fact that these diseases increase with age and the fast pace of population aging in republic of korea [29, 30 ], age, in particular the elderly, should be taken into account as one of the important contributing factors on diabetes and hypertension. therefore, public policy and intervention programs should focus on individuals matching these sociodemographic characteristics. | this study examined the relationships between ses and diabetes and hypertension for korean adults using the korean national health and nutritional examination survey. to handle the four dummy dependent variables : diabetes and hypertension, diabetes alone, hypertension alone, and diabetes or hypertension, four different logistic models were conducted. the descriptive statistics showed a considerable amount of comorbidity between the combined dependent variable of diabetes and hypertension. to gauge more realistic measures of ses, education and income were combined together as four dummy categories. the ses factor indeed had significant impacts on diabetes and hypertension. socioeconomically disadvantaged groups demonstrated to have increased likelihood of having these diseases. however, we could not find the strong compensating effect between education and income ; the higher level of education but lower income variable was only significant in having both diseases, and the higher income but lower level of education variable was only significant in having hypertension alone and either one of the diseases. only the highest ses one, the one with a higher level of education and a higher income, was significantly lowering the likelihood of having these diseases in all models. therefore, public policy and intervention programs should focus on individuals matching these socioeconomic characteristics. |
anorectal malformations (arm) are one of the most frequent congenital defects with reported incidence between 1/1500 and 1/5000 live births. arm presents with a wide panorama of defects, ranging from relatively simple low malformations to very complex cloacal anomalies. over the past three to four decades, the posterior sagittal anorectoplasty (psarp) has emerged as procedure of choice for the management of these anomalies. the advances in management have piloted these patients to excellent functional outcome and virtually no postoperative mortality except patients with other major congenital anomalies. one such association is arm along with esophageal atresia (ea) with or without tracheoesophageal fistula (tef). although the survival of these patients has reached to about 80%90% in western countries, in developing countries, the mortality rates are still high. the prime reasons for high mortality are low birth weight and delayed presentation (with pneumonitis) because of late referrals. the resulting regurgitation of gastric contents into lungs leads to rapid deterioration of these patients. the resulting progressive distension of bowel pushes up the diaphragm leading to ever increasing ventilatory demand. our previous experience with single - stage repair of arm and its distinctive advantages in our setup prompted us to treat the patients of arm with ea + tef in single stage. since then, we have been treating the patients of arm with ea + tef in a staged manner as well as single - staged simultaneous repair of both the disorders. we undertook this study with an aim to appraise the advantages and disadvantages of single - staged simultaneous repair of both anomalies versus staged repair of these disorders. we executed this retrospective review of cases with arm and associated ea with tef managed over a period of 5 years from july 2010 to june 2015. male patients with perineal fistula and female cases with common cloaca were excluded from the study. patients who were lost to follow - up for at least 1 year were excluded from the study. patients were split into two groups based on whether they underwent staged repair (group a) or single - staged simultaneous repair of arm with tef (group b). the main factors which decided single - stage repair were birth weight at presentation (> 2.02.5 kg), economic background of parents, and their unwillingness regarding staged procedures. patient 's records were analyzed for demography, weight, gestational age, associated anomaly, preoperative and postoperative sepsis screen results, early and late postoperative complications (at least up to 1 year of age). group a patients underwent babygram in erect posture with k-91 catheter in upper esophageal pouch, cross - table lateral view in prone position for arm, and echocardiography. all these cases were subjected to single - stage, single - layer primary esophageal anastomosis using absorbable suture after ligation of fistula with diversion colostomy for arm. they were subjected to single - stage, single - layer primary esophageal anastomosis using absorbable suture after ligation of fistula as well as single - stage repair of arm, i.e., psarp or abdomino - psarp depending on the site of fistula. all our arm patients are assessed for functional outcome at age of 3 year or more. patients were divided into three groups according to the score : group 1 - good (score 56), group 2 - fair (score 34), and group 3 - poor (score 02). data are presented in the form of number and percentage for qualitative variables and mean, standard deviation, and range in case of quantitative variables. during the study period, 956 neonates of arm and 365 neonates of ea tef were admitted. 17 were managed with staged procedure for arm (group a), whereas 11 underwent simultaneous single - stage repair of arm with tef (group b). mean age at presentation in group a and b was 3.18 1.07 days and 2.91 0.83 days, respectively (p = 0.437). mean weight at presentation in group a and b was 2.21 0.22 kg and 2.38 0.09 kg, respectively (p = 0.02). mean age at last follow - up in group a was 3.56 1.22 years and in group b was 4.22 1.98 years. mean weight and height at last follow - up in group a were 12.45 2.98 kg and 91.56 6.98 cm, respectively, whereas in group b, it was 13.24 1.78 kg and 95.67 8.82 cm, respectively. in group a, out of 17 patients, 9 (52.9%) had severe cardiac anomaly, 4 (23.5%) had no anomaly, and other 4 (23.5%) could not be screened. on the other hand, in group b, out of 11 patients, 2 (18.2%) had severe cardiac anomaly, 6 (54.5%) had no anomaly, and other 3 (27.3%) could not be screened (p = 0.14). most common anomalies were ventricular septal defects, atrial septal defects followed by combination of complex cardiac anomalies preoperative sepsis screen were positive in 10 (58.8%) of group a cases and 5 (45.5%) of group b cases (p = 0.48). mean operating time in group a and b was 90.45 10.23 min and 115 13.23 min (p = 0.63). postoperative ventilatory time, inotropic support, and anastomotic leak among group a and b have been highlighted in table 1. postoperative ventilatory requirement, inotropic support, and anastomotic leak among groups a and b types of arm in group a and b have given in table 2. mean age at psarp in group a was 4.24 1.23 months and mean age at colostomy closure was 9.45 2.33 months. female patients with vestibular fistula underwent anterior sagittal anorectoplasty and patients with rectovaginal fistula were managed by psarp. type of anorectal malformations among groups a and b five patients (29.4%) in group a died at first admission, whereas the mortality at first admission in group b was 4 (36.4%). at 1-year follow - up, another 4 patients of group a (23.5%) died, three - due to colostomy diarrhea, dehydration, and delayed presentation, and one after psarp due to pneumonitis and septicemia. overall mortality in group a at 1-year follow - up was 52.9%, whereas in group b, one (9%) patient died due to pneumonia and sepsis in follow - up resulting in an overall mortality of 43.4% at 1 year. long - term complication in the form of esophageal stricture developed in 3 (25%) patients out of 12 who were discharged after 1 surgery in group a and 2 (28%) out of 7 in group b (p = 0.55). two patients of group a could not undergo staged psarp at the age of 1 year because of monetary problems. out of 14 patients (group a : 8 and group b : 6), 10 completed follow - up of 3 years or more. these patients (group a : 4 and group b : 6) were evaluated for continence. no difference was observed in outcome between the two groups (p = 0.96). during the study period, 956 neonates of arm and 365 neonates of ea tef were admitted. 17 were managed with staged procedure for arm (group a), whereas 11 underwent simultaneous single - stage repair of arm with tef (group b). mean age at presentation in group a and b was 3.18 1.07 days and 2.91 0.83 days, respectively (p = 0.437). mean weight at presentation in group a and b was 2.21 0.22 kg and 2.38 0.09 kg, respectively (p = 0.02). mean age at last follow - up in group a was 3.56 1.22 years and in group b was 4.22 1.98 years. mean weight and height at last follow - up in group a were 12.45 2.98 kg and 91.56 6.98 cm, respectively, whereas in group b, it was 13.24 1.78 kg and 95.67 8.82 cm, respectively. in group a, out of 17 patients, 9 (52.9%) had severe cardiac anomaly, 4 (23.5%) had no anomaly, and other 4 (23.5%) could not be screened. on the other hand, in group b, out of 11 patients, 2 (18.2%) had severe cardiac anomaly, 6 (54.5%) had no anomaly, and other 3 (27.3%) could not be screened (p = 0.14). most common anomalies were ventricular septal defects, atrial septal defects followed by combination of complex cardiac anomalies preoperative sepsis screen were positive in 10 (58.8%) of group a cases and 5 (45.5%) of group b cases (p = 0.48). mean operating time in group a and b was 90.45 10.23 min and 115 13.23 min (p = 0.63). postoperative ventilatory time, inotropic support, and anastomotic leak among group a and b have been highlighted in table 1. postoperative ventilatory requirement, inotropic support, and anastomotic leak among groups a and b types of arm in group a and b have given in table 2. mean age at psarp in group a was 4.24 1.23 months and mean age at colostomy closure was 9.45 2.33 months. female patients with vestibular fistula underwent anterior sagittal anorectoplasty and patients with rectovaginal fistula were managed by psarp. five patients (29.4%) in group a died at first admission, whereas the mortality at first admission in group b was 4 (36.4%). at 1-year follow - up, another 4 patients of group a (23.5%) died, three - due to colostomy diarrhea, dehydration, and delayed presentation, and one after psarp due to pneumonitis and septicemia. overall mortality in group a at 1-year follow - up was 52.9%, whereas in group b, one (9%) patient died due to pneumonia and sepsis in follow - up resulting in an overall mortality of 43.4% at 1 year. long - term complication in the form of esophageal stricture developed in 3 (25%) patients out of 12 who were discharged after 1 surgery in group a and 2 (28%) out of 7 in group b (p = 0.55). two patients of group a could not undergo staged psarp at the age of 1 year because of monetary problems. out of 14 patients (group a : 8 and group b : 6), 10 completed follow - up of 3 years or more. these patients (group a : 4 and group b : 6) were evaluated for continence. no difference was observed in outcome between the two groups (p = 0.96). the management of arm has seen a sea change over the past three decades. improved neonatal care and nutritional support have shifted priority from survival in these patients to better long - term structural and functional outcome. operative procedures have shifted from classical procedures to psarp, and now to minimal invasive procedures. furthermore, now, single - stage neonatal repair has been advocated by different authors across the globe with excellent early outcome. primary neonatal repair has also achieved equivalent long - term functional outcome when compared to stage procedure. genitourinary tract anomalies (40%50%) are most commonly reported followed by cardiovascular disorders (30%35%), spinal cord tethering (25%30%), gastrointestinal anomalies (5%10%), and vacterl (4%9%) anomalies. the mortality of children with arm is now mostly limited to group of patients associated with severe cardiac anomalies. the patients of arm with ea have higher risk of mortality because of higher incidence of associated other congenital anomalies. byun. have reported a mortality rate of 24.1% in patients with arm with ea tef in spite of excellent survival of patients with ea tef alone. excellent survival rates of children with ea tef have also been reported from our country. the improved outcomes are mainly due to advances in better antenatal care, neonatal intensive care, nutritional support, and improvement of anesthetic and surgical techniques. along with these advances, different authors have reported that only severe cardiac disorders and extremely low birth weight to an extent are predictors of higher mortality rates in these patients. however, different studies from various centers of our country have proposed that other factors are also important for the final outcome of these patients. factors such as delayed presentation and pneumonitis at presentation may be implicated for poor prognosis. most of our patients are of low birth weight, have pneumonitis, and present late at tertiary center. hence, the much higher rates of mortality of children in both the groups at first admission in our study may be explained by the interplay of higher incidence of complex heart disease with other factors mentioned above. changing the position of the baby after ea and tef repair to the prone jackknife position requires team effort and vigilant staff to take care of the endotracheal tube, transanastomotic tube, and central line. once patient is stabilized in the standard jackknife position, free abdominal movement is critical. in one patient, there was dislodgment of transanastomotic tube while repositioning. further, the mortality rates in our study are also high in follow - up. this can be mainly implicated to the poor postoperative care given to our patients at home once they are discharged. poor feeding practices may be a causative factor for higher incidences of diarrhea and recurrent aspiration pneumonitis, especially lack of propped up nursing. the reported incidence of anastomotic leakage of esophagusranges from 15% to 20%. in our study, the incidence of leak was 17%18% in both the groups. minor leak resolved spontaneously with conservative management, i.e., chest tube drainage, appropriate antibiotic coverage, and total parental nutrition. anastomotic stricture is the most common complication following the surgical repair of ea and observed in 20%40% after successful repair. the incidence of esophageal stricture was 25%30% in the present series which was comparable to other series. analysis of data in the present study has shown that the early and short - term results of both the groups were comparable. various study from our center and all across the world have proven the advantages of single - staged repair of arm not only in short - term but also in regard to long - term continence of these patients. the long - term problems of staged repair such as colostomy associated complications, risk of repeated surgical interventions and above all, the financial burden over the family provides distinct advantage of simultaneous single - staged repair in our setup. arm associated with ea and tef poses special therapeutic challenge. simultaneous single - staged primary repair of both the anomalies has similar immediate and early outcome of these patients in our setup. we acknowledge the limitations of our study with small number of cases and also retrospective nature of the study. larger multiinstitutional prospective study from our country is required to formulate the guidelines for management of this special group of children. | introduction : anorectal malformation (arm) associated esophageal atresia (ea) with tracheoesophageal fistula (tef) spawns special therapeutic propositions. the outcome of these patients banks on numerous factors. we performed this study with an aim to compare the outcome of single - staged simultaneous primary repair of both anomalies versus staged repair of these disorders.materials and methods : retrospective review of cases with arm and associated ea with tef managed over a period of 5 years from july 2010 to june 2015 after ethical approval was undertaken. patients were split into two groups based on whether they underwent staged repair (group a) or single - staged simultaneous primary repair of arm with tef (group b). patient 's records were analyzed for demography, weight, gestational age, associated anomaly, preoperative and postoperative sepsis screen results, early and late postoperative complications (at least up to 1 year of age). patient 's kelly score for continence at the age of 3 years or more was compared.observation:a total of 28 were included in the study. among these, 17 were managed with staged procedure for arm (group a), whereas 11 underwent simultaneous single - stage repair of arm with tef (group b). no difference in continence score was observed in outcome between the two groups (p = 0.96). overall mortality in group a at 1-year follow - up was 52.9% and in group b was 43.4%.conclusion : the simultaneous single - staged primary repairs result in better long - term outcome in our setup. |
patients undergoing hepatic resection can experience blood loss between 700 and 1,200 ml leading to a 2040% likelihood of receiving a transfusion. these high blood loss and transfusion rates are associated with increased postoperative complications, increased rates of relaparotomy, prolonged hospital inpatient stay, increased likelihood of tumor recurrence [5, 6 ], decreased time to tumor reoccurrence, and greater likelihood of in - hospital mortality [3, 8 ]. overall, blood loss is uniformly accepted as a predictor of patient outcome following hepatic resection, where lower blood loss has improved outcomes [4, 8, 9 ]. bleeding in these patients is expected as the liver synthesizes and eliminates pro- and anticoagulation proteins [10, 11 ]. acute and chronic hepatic disease leads to impaired synthesis of coagulation proteins (i.e., factors v, vii, and x xii, fibrinogen, and prothrombin), thrombocytopenia, and excessive fibrinolysis [11, 12 ]. as a result, several different techniques are used during dissection and transection of hepatic parenchyma to minimize tissue perfusion and damage (e.g., pringle maneuver, portal hypotension, surgical staplers, etc.). inevitably, these methods have a transient or incomplete effect, which require treatment with a topical hemostatic agent [13, 14 ]. there are many options to treat the broad oozing surface of a hepatectomy, hepatic segmentectomy or hepatic sectionectomy, of which fibrin sealants have been preferred. more recently, however, hemostatic pads are becoming the preference for open surgical procedures [17, 18 ]. the early adoption of hemostatic pads is limited in laparoscopic surgery due to unfavorable handling [18, 19 ]. as such, the need for versatile and effective hemostatic agents is well established and continues to evolve given the economic demands on healthcare professionals and systems. therefore, this study investigates the effectiveness of a new sealing hemostat in a nonheparinized leporine hepatic segmentectomy surgical model and a heparinized porcine hepatic abrasion surgical model. the objective of this study was to compare the hemostatic effectiveness of a new polyethylene glycol - coated collagen pad (pcc) and a fibrinogen and thrombin - coated collagen pad (ftc) in two models of hepatic surgery. the alternative hypothesis tested was that pcc will have greater and more sustained hemostatic effectiveness than ftc. the bovine collagen patch coated with a protein reactive pentaerythritol polyethylene glycol ether tera - succinimidyl glutarate (nhs - peg) is hemopatch (baxter ag, vienna, austria) (pcc) (figure 1(a)). when in contact with tissue, nhs - peg forms covalent bonds between the collagen pad and tissue proteins, which seals the tissue and induces hemostasis in open and laparoscopic procedures. in both surgical models the equine collagen pad coated with human - derived fibrinogen (5.5 mg / cm) and thrombin (2.0 iu / cm) is tachosil (takeda pharmaceutical company, osaka - shi, osk, japan) (ftc) (figure 1(b)). when wetted or in contact with tissue, thrombin cleaves fibrinogen forming a fibrin seal between the collagen pad and tissue surface. in both surgical models, ftc was approximated to tissue for 3 min according to the product insert. two hepatic surgical models were used to compare the hemostatic effectiveness of the hemostatic pads. a nonheparinized leporine hepatic segmentectomy surgical model mimicked the cut surface of a hepatectomy, sectionectomy, and segmentectomy, and a heparinized porcine hepatic abrasion surgical model mimicked a capsular tear during surgery. all animal activities were performed according to the guide for the care and use of laboratory animals and the united states animal welfare act or austrian laws governing animal experimentation in aaalac accredited institutions following animal care and use committee approval. the nonheparinized leporine hepatic segmentectomy model was performed by excising the distal tip of the medial hepatic lobe accessed through a celiotomy. the cut surface was treated according to a randomization scheme not seen by the surgeon until the time of application. a single surgeon created and treated the lesions. a total of twenty male new zealand white rabbits weighing 2.9 to 3.6 kg were used to create and treat 10 lesions / group. the hemostatic pads extended the length of the cut surface and overlapped onto noninjured tissue by at least 1 cm. hemostatic success was evaluated every 15 s after removing the gauze, every 30 s after 4.5 min, and then every 60 s after 7 min up to 15 min after application. if hemostatic success was not achieved within 15 min of application, the animal was removed from study. if hemostatic success was achieved within 15 min, the animal was recovered for 24 h. at 24 h, the lesion was assessed for rebleeding and presence of a hematoma and migration of the hemostatic pad. the heparinized porcine hepatic abrasion model was performed by using a hand - drill (robert bosch tool corporation, mt. prospect, il, usa) fixed with medium grade sandpaper (3 m, st. each 1 cm diameter, 34 mm deep abrasion was then treated according to a predefined, randomized scheme. hemostatic pads (3 cm 3 cm) were centered on the abrasion, applied dry, and approximated using gauze in pairs. a total of 42 abrasions / group were performed across six male pigs weighing between 31 and 38 kg. a single surgeon, who created and treated the abrasions, was blinded to the randomization scheme until time of application. at 3, 5, 7, and 10 min after application, the severity of bleeding was graded and the rate of blood loss was calculated in ml / min. severity of bleeding was graded using an accepted grading scale [21, 22 ], where hemostatic success was predefined as no bleeding. each animal was heparinized to 1.52x their baseline activated clotting time to mimic the coagulopathy secondary to hepatic disease [1012 ]. time to hemostasis was summarized using percentages of animals that experienced hemostasis within a specific time interval per group and displayed using kaplan - meier plots. two - sided 95% confidence intervals (cis) for the percentages of animals that experienced hemostasis within a specific time interval were also presented and calculated by the wilson score method. the incidence of hematoma at 15 min and 24 h after application is reported descriptively. hemostatic success, difference in bleeding rate, and hematoma incidence were measured in this preclinical model. a generalized linear mixed model was used to analyze the probability of hemostatic success (i.e. bleeding scores of zero) after application over time, and a linear mixed model was used to analyze the bleeding rates in ml / min after application over time. both models consisted of fixed effects covariates : (1) hemostatic pad, (2) time after application in minutes, (3) interaction of item time to account for differences in hemostatic effectiveness over time between items, and (4) pretreatment bleeding rate in ml / min and an animal - specific intercept and an abrasion - specific intercept nested in animal as random effects. additionally, the linear mixed model used for the bleeding rates consisted of an item - specific slope for modeling the time effect nested in abrasion and animal as random effect. the generalized linear mixed model was performed using r function glmer [with option family = binomial ] of r package lme4. differences in hemostatic success between pcc and ftc within 3 to 10 min after application were assessed using model - estimated odds ratios, corresponding two - sided 95% wald - type cis, and two - sided p values. differences in bleeding rates between pcc and ftc within 3 to 10 min after application were assessed using model - estimated differences, corresponding two - sided 95% wald - type cis, and two - sided p values. the two - sided p values were calculated based on markov chain monte carlo (mcmc) simulations using r function pvals.fnc of r package languager. nine of ten excisions treated with ftc achieved hemostasis within 15 min of application. the remaining nineteen animals, ten in the pcc group and nine in the ftc group, survived for 24 h. pcc - treated excisions had a greater percentage in achieving immediate hemostasis than ftc - treated excisions (100%, 95% ci : 72.3 to 100% within 2 min versus 80%, 49.0 to 94.3% within 3 min). at 15 min, pcc - treated excisions had 100% hemostasis, while ftc - treated excisions had 90% (figure 2). furthermore, pcc - treated animals had a 0% incidence of hematoma 15 min after application, whereas ftc - treated animals had 11.1%. the difference in hematoma increased at 24 h, where pcc - treated animals had a 20.0% incidence and ftc - treated animals had 66.7%. the calculated probabilities for hemostatic success for a median pretreatment bleeding rate of 2 ml / min were 96.1%, 95.3%, 94.3%, and 92.4% with pcc at 3, 5, 7, and 10 minutes after application. with ftc, these probabilities were 50.2%, 23.4%, 8.49%, and 1.53% (figure 3). the odds ratio of hemostatic success indicates a statistically significant superiority of pcc to ftc at every time point after controlling the differences of pretreatment bleeding rates (figure 4). pcc was 24.8 (95% ci : 8.86 to 69.2) times more likely to be effective at 3 min than ftc and 777.6 (95% ci : 148.2 to 4078) times more likely to be effective at 10 min (table 1). though not included in the study, the hemostatic performance of ftc improved after 10 min. the greater hemostatic success of pcc corresponded with a lower rate of blood loss, which was also statistically significant (figure 5). pcc - treated abrasions had a bleeding rate of 0.32 ml / min (95% ci : 0.47 to 0.17) less than ftc at 3 min and 1.14 ml / min (95% ci : 1.49 to 0.79) less at 10 min (table 1). pcc - treated abrasions also had a lower incidence of hematoma than ftc - treated abrasions (14.3 versus 42.9%). this study investigated hemostatic success, rate of blood loss, and hematoma incidence of hepatic lesions treated with hemostatic pads. pcc provided and maintained greater and faster hemostatic success with a lower rate of blood loss and incidence of hematoma than ftc. while the two surgical models are not absolutely predictive of clinical use, the models do allow a standardized comparison of hemostatic effectiveness. in the hepatic segmentectomy model, the time to hemostasis was censored to not less than 2 min for pcc and not less than 3 min for ftc due to the different approximation times for each pad. the different approximation times mimicked the clinical use as described in the product insert and instructions for use. despite the lower approximation time, pcc - treated lesions had a greater percentage of immediate hemostasis compared to ftc. since ftc relies on the conversion of fibrinogen to fibrin, additional time and approximation are likely required to achieve hemostasis. hence, fibrin polymerization of ftc was slower and less consistent than the synthetic nhs - peg polymerization of pcc in both models. in the hepatic abrasion model, the hemostatic success of ftc rapidly decreased over time from 50.2% at 3 min to 1.53% at 10 min after application due to its slower adherence, whereas hemostatic success of pcc was 96.1% at 3 min and 92.4% at 10 min after application. furthermore, the lower hematoma incidence and blood loss with pcc demonstrate the advantage of its adherence properties. pcc rapidly forms covalent bonds between the collagen pad and injured tissue to stop bleeding independent of the patient 's coagulation cascade, whereas ftc is dependent on the patient 's ability to clot. the effect of the coagulopathic state of the patient was observed in our models as well, wherein ftc performed better in the nonheparinized model. the faster adherence of pcc obviated ongoing blood loss and reduced hematoma formation that caused ftc to fail. while these models replicated two clinical uses of the advanced hemostatic pads, they do not represent all bleeding scenarios. therefore, additional studies are needed to compare these hemostatic agents in other surgical settings (e.g., cardiac, vascular, urological, etc.). in doing so, the utility of these agents in minimally invasive approaches should also be investigated. hepatic laparoscopic surgery is limited to small segmental resections due to fear of significant blood loss secondary to an inability for manual compression and of gas embolisms secondary to incomplete hemostasis of hepatic veins. pcc is pliable and supple, which can allow appropriate manipulations for use in endoscopic procedures. once applied to tissue the reactive nhs - peg seals the collagen pad to tissue, which then activates platelets. the benefit of combining these properties hemostasis and sealing is extremely favorable for endoscopic surgery. similar to pcc the conversion of fibrinogen to fibrin by thrombin seals the collagen pad to tissue and the collagen pad stimulates platelet activation. however, the sealing affect requires greater time and the collagen construct of ftc lacks the pliability and suppleness for efficient endoscopic use. the liver is extremely vascularized due to its sinusoidal structure, which lacks smooth muscle capable of vasoconstriction. therefore, hepatic resections, trauma, and lacerations create wide, raw surfaces with multiple bleeds that can not be sutured or ligated. furthermore, liver disease has the sequelae of coagulopathy due to reduced capability of synthesizing procoagulant proteins [1012 ]. the leporine hepatectomy model replicated the wide, raw surfaces of bleeding, and the porcine hepatic abrasion model replicated the tissue damage and coagulopathy secondary to liver disease. while both pcc and ftc have hemostasis and sealing abilities, pcc provided greater hemostasis faster than ftc with a lower blood loss and incidence of hematoma in both models. the beneficial effects of topical hemostatic agents are conferred in the scientific literature, which suggest that these agents reduce time to hemostasis and lower rates of perioperative rbc transfusions. these findings directly result in cost savings for payers and healthcare systems. a 2005 publication estimated the cost of operating time to be 51/min ($ 66/min) and a 2008 publication estimated the cost of a rbc transfusion to be 1069/patient ($ 1388/patient). the reduced time to hemostasis and the greater hemostatic success of pcc are then likely to have added benefit for healthcare systems. further, the improved effectiveness of pcc relative to ftc benefits patients undergoing hepatic resections, as lower intraoperative blood loss, is associated with improved outcomes [4, 8, 9 ]. though these hemostatic pads have not been compared in human patients, this data indicates that the novel sealing hemostat (pcc) provides faster and more sustained hemostasis, less blood loss, and lower hematoma formation than a fibrin sealant pad (ftc). the difference in efficacy is due to the rapid sealing and hemostatic action of pcc, which establishes it as a next generation advanced hemostatic pad. | blood loss during hepatic surgery leads to poor patient outcomes. this study investigates the hemostatic efficacy of a novel sealing hemostatic pad (polyethylene glycol - coated collagen, pcc) and a fibrin sealant pad (fibrin - thrombin coated collagen, ftc) in a leporine hepatic segmentectomy and a porcine hepatic abrasion model. a segmentectomy was used to compare hemostatic success and hematoma incidence in 20 rabbits (10/group). hepatic abrasions were used to compare hemostatic success up to 10 min after application in six pigs (42 lesions / group). in the segmentectomy model, pcc achieved 100% hemostatic success within 2 min (95% ci : 72.3% to 100%) and ftc achieved 80% hemostatic success within 3 min (49.0% to 94.3%). pcc had lower hematoma incidence at 15 min (0.0 versus 11.1%) and 24 h (20.0 versus 66.7%). in the abrasion model, pcc provided superior hemostatic success at 3 (odds ratio : 24.8, 95% ci : 8.86 to 69.2, p < 0.001), 5 (66.3, 28.5 to 153.9, p < 0.001), 7 (177.5, 64.4 to 489.1, p < 0.001), and 10 min (777.6, 148.2 to 4078, p < 0.001) leading to statistically significant less blood loss. the novel sealing hemostat provides faster and more sustained hemostasis than a fibrin sealant pad in a leporine hepatic segmentectomy and a porcine hepatic abrasion model of hepatic surgery. |
breast cancer is one of the most frequent malignant tumors worldwide and the second leading cause of cancer death in women (1). research showed that significant percentage of breast cancer patients experienced a delayed treatment because of their misconceptions about breast cancer (2). as cases of breast cancer are increasing year by year although, there are many possible factors contributing to the cause, development, and prognosis of breast cancer (3), genetic factors have an extremely important influence on the risk of breast cancer (4). in addition, many studies have shown that the snps in some genes can affect the susceptibility to breast cancer (5, 6). as is well known, the endothelium plays an important role in maintaining vascular homeostasis. the endothelial cells proliferate, migrate and interact with other cells such as stromal cells to form new capillaries during the cancer angiogenesis. therefore, to a certain extent, the inhibition of endothelial cell proliferation can suppress the angiopoiesis of cancer cells. however, some studies have indicated that vegi, also known as tnfsf15 or tnf ligand - related molecule, can inhibit the proliferation of endothelial cells and exert an anti - angiogenic effect on the endothelial cells (7). vegi-192, an isoform of vegi, has been reported to be able to eliminate the endothelial cells in tumors and suppress the development of tumors (8). vegi always acts as a co - stimulator to induce t cell proliferation and cytokine secretion (9, 10). many studies have shown that vegi is related to various diseases including bowel disease (11), lung cancer (12), prostate cancer (13), and breast cancer (14). except for its ability to inhibit the endothelial cells, vegi could influence the development of diseases through participating in various pathways. research results indicated that vegi plays an essential role in activating the transcription factor b and caspase-3, leading to parp cleavage (15). moreover, vegi was also involved in immune response by inducing the secretion of gm - csf and ifn- (10). in cancers or wounds, other studies have demonstrated that vegi is mediated by dr3 to inhibit the growth and migration of tumor cells (17). studies that involved cell cycle suggested that vegi maintained early g1 arrest in the g0/g1 cells and induced the programmed death in the endothelial cell cycle (7). it is mainly produced by vessel endothelial cells and also expressed on antigen - presenting cells and lymphocytes such as t cells and dendritic cells. vegi gene polymorphisms have exhibited a connection with certain inflammatory and autoimmune diseases, such as crohn 's disease (18), inflammatory bowel disease (19), and psoriatic arthritis (20). however, the association between vegi gene polymorphisms and breast cancer in chinese people has never been studied. the purpose of this paper is to discuss the association of vegi gene polymorphism with breast cancer in northeast china. we selected four snps located at the vegi gene (rs4263839, rs6478106, rs4979462, rs7848647) that had been reported before and examined whether these snps are associated with the development of breast cancer in chinese han women. the cases and controls are all females and age matched (cases, 50.029.80 years old ; controls, 49.329.56 years old). we used chi - squared test and independent - samples t test to detect the difference between the ages of cases and controls and p>0.05. blood samples of breast cancer patients were obtained from the third affiliated hospital of harbin medical university. diagnostic indicators including tumor size, human epidermal growth factor receptor 2 (her-2), p53, estrogen receptor (er), progestrogen receptor (pr), and lymph node (ln) metastasis the ihc scores of 3 + or 2 + were considered positive for her-2 (0, negative ; 1 +, 50%). blood samples of healthy controls were collected from neighborhood volunteers without a history of cancer or autoimmune diseases. clinical features of breast cancer patients this study was conducted at the department of immunology in harbin medical university. the patients and healthy volunteers were not genetically related. before recruitment, a written informed consent was signed by each participant and the study was approved by the institutional ethical review board. three - milliliter blood samples were taken from the third affiliated hospital to the laboratory, the blood samples were mixed with anticoagulant and stored at -20. the lymphocytes were obtained through centrifugation. we used the universal genomic dna extraction kit ver. 3.0 (takara, japan) to extract dna according to the manufacturer 's protocol. genotyping was conducted using the polymerase chain reaction - restriction fragment length polymorphism (pcr - rflp) assay. the primers were designed by using gene runner software, and the primer sequences of each snp were : rs6478106 (f : 5-acttcatccacttctcctc-3, r : 5-agacgttctgactactattcc-3), rs4264839 (f : 5-ggaccctgattgctacatg-3, r : 5-gttacagaccagggaggatc-3), rs4979462 (f : 5-aagggctctcagacatcatc-3, r : 5-tcaaagcatagacaccacaag-3), rs7848647 (f : 5-acagaggagctaggaagatg-3, r : 5-tcctggctctaccacttg-3). the pcr reaction mixture contained 0.4 g dna, 2.5 mm dntp mix (takara, japan), 2.5 l 10 pcr reaction buffer including 10 mm tris - hcl, 50 nm kcl and 2.5 nm mgcl2 (takara, japan), 4 m primers (invitrogen, china), 2.5 u taq dna polymerase (takara, japan), and added sterile double distilled water to a final volume of 25 l. the pcr program consisted of an initial melting step at 94 for 15 minutes, 35 cycles of 30 seconds at 94, 30 seconds at annealing temperatures, 1 minute at 72, and a terminal step at 72 for 5 minutes. the annealing temperatures for each snp were rs6478106 (56.0), rs4263839 (57.0), rs4979462 (56.5), and rs7848647 (57.2). the pcr products contained the snp sites and were examined in 2% agarose gel electrophoresis. the rflp was conducted in a final volume of 10 l, including 5 l pcr products, 1 neb buffer (50 mm, tris - hcl, 100 mm nacl, 10 mm mgcl2, 1 mm dithiothreitol), and 0.25 l restriction enzyme (neb, uk). the reaction mix was incubated in water bath according to the optimal temperature for each restriction enzyme for 4 - 6 hours, and the digested fragments were separated by 2% (rs4263839, rs4979462, rs7848647) or 3% (rs6478106) agarose gel electrophoresis as the difference in length among the restricted fragments was smaller than other three snps. the restriction enzymes for each snp were as follows : rs6478106 (eco53ki), rs4263839 (apoi), rs4979462 (msci), and rs7848647 (cviqi). the digested fragments were 105 bp and 151 bp with t allele and 256 bp with c allele in rs6478106, 132 bp and 213 bp with a allele and 345 bp with g allele in rs4263839, 101 bp and 306 bp with c allele and 407 bp with t allele in rs4979462, 120 bp and 296 bp with c allele, and 416 bp with t allele in rs7848647. the results of pcr - rflp products for each snp is shown in the figures s1-s8. direct sequencing of random samples was conducted to verify the accuracy of the genotyping results. about 10% of our samples were tested by direct sequencing and the results were in accord with our pcr - rflp analysis results. lane 1 is dna marker ; lanes 4, 21 are tt homozygote ; lanes 6, 8, 11,12, 15, 19, 22 - 24 are cc homozygote ; lanes 2, 3, 5, 7, 9, 10, 13, 14, 16 - 18, 20, 25 are ct heterozygote. lane 1 is dna marker ; lanes 2, 10, 14, 17, 18, 20, 24, 25 are gg homozygote ; lanes 5, 13, 15, 16, 22 are aa homozygote ; lanes 3, 4, 6 - 9, 11, 12, 19, 21, 23 are ga heterozygote. lane 1 is dna marker ; lanes 7, 18 are tt homozygote ; lanes 6, 9, 10, 12, 13, 16, 17, 21, 22, 25 are cc homozygote ; lanes 2 - 5, 8, 11, 14, 15, 19, 20, 23, 24 are ct heterozygote. lane 1 is dna marker ; lanes 2, 4 - 7, 12, 19, 20, 23, 25, 33 are tt homozygote ; lanes 9, 10, 13, 14, 17, 18, 24 are cc homozygote ; lanes 3, 8, 11, 15, 16, 21, 22, 26 - 32, 34 are tc heterozygote. we tested the genotype frequencies of these snps for hardy weinberg equilibrium (hwe) among healthy controls. the genotype frequencies in the breast cancer cases and healthy controls were analyzed in different genetic models (codominant model, dominant model, and recessive model) using the chi - squared test or fishers test. in the codominant model, the major allele homozygotes were used as the reference group, and the heterozygotes and minor allele homozygotes were compared to the reference group, respectively. the dominant model was the combination of minor homozygotes and heterozygotes compared to the major allele homozygotes. in the recessive model, the minor homozygotes the p value, estimated odds ratios (ors) and 95% confidence intervals (95% cis) were all calculated using the statistical software spss version 18.0 and haploview 4.1 (http://www.broad.mit.edu / mpg / haploview/) was used to tag all the common haplotypes and their frequencies in the breast cancer cases and healthy controls. haplotypes were constructed based on d values using our own data. the linkage disequilibrium (ld) was constructed by d ' and r 2. the statistical significance was set at p0.05. blood samples of breast cancer patients were obtained from the third affiliated hospital of harbin medical university. diagnostic indicators including tumor size, human epidermal growth factor receptor 2 (her-2), p53, estrogen receptor (er), progestrogen receptor (pr), and lymph node (ln) metastasis the ihc scores of 3 + or 2 + were considered positive for her-2 (0, negative ; 1 +, 50%). blood samples of healthy controls were collected from neighborhood volunteers without a history of cancer or autoimmune diseases. the patients and healthy volunteers were not genetically related. before recruitment, a written informed consent was signed by each participant and the study was approved by the institutional ethical review board. three - milliliter blood samples were taken from the third affiliated hospital to the laboratory, the blood samples were mixed with anticoagulant and stored at -20. the lymphocytes were obtained through centrifugation. we used the universal genomic dna extraction kit ver. 3.0 (takara, japan) to extract dna according to the manufacturer 's protocol. genotyping was conducted using the polymerase chain reaction - restriction fragment length polymorphism (pcr - rflp) assay. the primers were designed by using gene runner software, and the primer sequences of each snp were : rs6478106 (f : 5-acttcatccacttctcctc-3, r : 5-agacgttctgactactattcc-3), rs4264839 (f : 5-ggaccctgattgctacatg-3, r : 5-gttacagaccagggaggatc-3), rs4979462 (f : 5-aagggctctcagacatcatc-3, r : 5-tcaaagcatagacaccacaag-3), rs7848647 (f : 5-acagaggagctaggaagatg-3, r : 5-tcctggctctaccacttg-3). the pcr reaction mixture contained 0.4 g dna, 2.5 mm dntp mix (takara, japan), 2.5 l 10 pcr reaction buffer including 10 mm tris - hcl, 50 nm kcl and 2.5 nm mgcl2 (takara, japan), 4 m primers (invitrogen, china), 2.5 u taq dna polymerase (takara, japan), and added sterile double distilled water to a final volume of 25 l. the pcr program consisted of an initial melting step at 94 for 15 minutes, 35 cycles of 30 seconds at 94, 30 seconds at annealing temperatures, 1 minute at 72, and a terminal step at 72 for 5 minutes. the annealing temperatures for each snp were rs6478106 (56.0), rs4263839 (57.0), rs4979462 (56.5), and rs7848647 (57.2). the pcr products contained the snp sites and were examined in 2% agarose gel electrophoresis. the rflp was conducted in a final volume of 10 l, including 5 l pcr products, 1 neb buffer (50 mm, tris - hcl, 100 mm nacl, 10 mm mgcl2, 1 mm dithiothreitol), and 0.25 l restriction enzyme (neb, uk). the reaction mix was incubated in water bath according to the optimal temperature for each restriction enzyme for 4 - 6 hours, and the digested fragments were separated by 2% (rs4263839, rs4979462, rs7848647) or 3% (rs6478106) agarose gel electrophoresis as the difference in length among the restricted fragments was smaller than other three snps. the restriction enzymes for each snp were as follows : rs6478106 (eco53ki), rs4263839 (apoi), rs4979462 (msci), and rs7848647 (cviqi). the digested fragments were 105 bp and 151 bp with t allele and 256 bp with c allele in rs6478106, 132 bp and 213 bp with a allele and 345 bp with g allele in rs4263839, 101 bp and 306 bp with c allele and 407 bp with t allele in rs4979462, 120 bp and 296 bp with c allele, and 416 bp with t allele in rs7848647. the results of pcr - rflp products for each snp is shown in the figures s1-s8. direct sequencing of random samples was conducted to verify the accuracy of the genotyping results. about 10% of our samples were tested by direct sequencing and the results were in accord with our pcr - rflp analysis results. lane 1 is dna marker ; lanes 4, 21 are tt homozygote ; lanes 6, 8, 11,12, 15, 19, 22 - 24 are cc homozygote ; lanes 2, 3, 5, 7, 9, 10, 13, 14, 16 - 18, 20, 25 are ct heterozygote. lane 1 is dna marker ; lanes 2, 10, 14, 17, 18, 20, 24, 25 are gg homozygote ; lanes 5, 13, 15, 16, 22 are aa homozygote ; lanes 3, 4, 6 - 9, 11, 12, 19, 21, 23 are ga heterozygote. lane 1 is dna marker ; lanes 7, 18 are tt homozygote ; lanes 6, 9, 10, 12, 13, 16, 17, 21, 22, 25 are cc homozygote ; lanes 2 - 5, 8, 11, 14, 15, 19, 20, 23, 24 are ct heterozygote. lane 1 is dna marker ; lanes 2, 4 - 7, 12, 19, 20, 23, 25, 33 are tt homozygote ; lanes 9, 10, 13, 14, 17, 18, 24 are cc homozygote ; lanes 3, 8, 11, 15, 16, 21, 22, 26 - 32, 34 are tc heterozygote. we tested the genotype frequencies of these snps for hardy weinberg equilibrium (hwe) among healthy controls. the genotype frequencies in the breast cancer cases and healthy controls were analyzed in different genetic models (codominant model, dominant model, and recessive model) using the chi - squared test or fishers test. in the codominant model, the major allele homozygotes were used as the reference group, and the heterozygotes and minor allele homozygotes were compared to the reference group, respectively. the dominant model was the combination of minor homozygotes and heterozygotes compared to the major allele homozygotes. in the recessive model, the p value, estimated odds ratios (ors) and 95% confidence intervals (95% cis) were all calculated using the statistical software spss version 18.0 and haploview 4.1 (http://www.broad.mit.edu / mpg / haploview/) was used to tag all the common haplotypes and their frequencies in the breast cancer cases and healthy controls. haplotypes were constructed based on d values using our own data. the linkage disequilibrium (ld) was constructed by d ' and r 2. the statistical significance was set at p<0.05, and 10, 000 permutations were run to evaluate the p values using haploview 4.1 to verify the correctness of the significance. we have chosen four snps at vegi gene to test the association between vegi gene polymorphisms and breast cancer risk. the distributions of genotypes of these four snps we selected were in hardy weinberg equilibrium in healthy control group. based on the data, in rs6478106, compared to the cc genotype, the ct genotype was related to an increased risk in breast cancer (p=0.001, or=1.438, 95% ci, 1.153 - 1.793). there was also a significant difference in genotype distribution in rs6478106 under dominant model (p=0.001, or=1.437, 95% ci, 1.161 - 1.777). furthermore, compared with the c allele, the t allele of rs6478106 also increased the risk of breast cancer (table 3). the genotype frequencies of vegi gene polymorphisms in cases and controls the allele frequencies of vegi gene polymorphisms in cases and controls the association between the haplotype and breast cancer risk was analyzed using haploview 4.1 version software. block 1 contained rs6478106 and rs4263839, and there were four haplotypes in this block (crs6478106ars4263839, trs6478106grs4263839, crs6478106grs4263839 and trs6478106ars4263839). we found that the crs6478106grs4263839 haplotype got a higher frequency in breast cancer patients (p=0.0136). the trs6478106grs4263839 haplotype and trs6478106ars4263839 haplotype had lower frequencies in cases (p=0.0244 ; p=0.0184). however, after correcting the p value for multiple testing, significant differences were only found for the crs6478106grs4263839 haplotype (p=0.0488). both rs4979462 and rs7848647 belonged to block2 and constructed four haplotypes (crs4979462trs7848647, trs4979462crs7848647, crs4979462crs7848647 and trs4979462trs7848647), and they were not associated with the risk of breast cancer (table 4). the haplotype frequencies of vegi gene in cases and controls the association between vegi gene polymorphisms and the clinical features of breast cancer including er, pr, p53, her-2, ln metastasis and triple negative breast cancer (tnbc) status were also analyzed in our study. we found an association only between vegi gene polymorphisms and her-2 status. in comparison with the cc genotype, patients with the tt genotype of rs6478106 may exhibit increased expression of her-2 (p=0.004, or=2.522, 95% ci, 1.320 - 4.818), and this association was also significant in the recessive model (p=0.004, or=2.397, 95% ci, 1.302 - 4.411). moreover, compared to the cc genotype of rs4979462, the tt genotype had higher frequencies in her-2 positive patients (p=0.002, or=2.835, 95% ci, 1.455 - 5.523), and in the recessive model, the distribution of the genotype of rs4979462 was also associated with her-2 expression (p=0.001, or=2.835, 95% ci, 1.489 - 3.397). the t allele of rs6478106 and the t allele of rs4979462 appeared more frequently in her-2 positive cases (p=0.0356, p=0.0354), but after correcting the p value for multiple testing, no significant difference was found. genotype and allele frequencies of vegi gene polymorphisms and her-2 status the analysis results of the association between the haplotypes and the clinical features did not show a significant difference (tables s6-s11). genotype and allele frequencies of vegi gene polymorphisms and ln metastasis status genotype and allele frequencies of vegi gene polymorphisms and er status genotype and allele frequencies of vegi gene polymorphisms and pr status genotype and allele frequencies of vegi gene polymorphisms and p53 status genotype and allele frequencies of vegi gene polymorphisms and tnbc status the haplotype of the vegi gene polymorphisms and the er status the haplotype of the vegi gene polymorphisms and the pr status the haplotype of the vegi gene polymorphisms and the p53 status the haplotype of the vegi gene polymorphisms and the her-2 status the haplotype of the vegi gene polymorphisms and the ln metastasis status the haplotype of the vegi gene polymorphisms and the tnbc status we have chosen four snps at vegi gene to test the association between vegi gene polymorphisms and breast cancer risk. the distributions of genotypes of these four snps we selected were in hardy weinberg equilibrium in healthy control group. based on the data, in rs6478106, compared to the cc genotype, the ct genotype was related to an increased risk in breast cancer (p=0.001, or=1.438, 95% ci, 1.153 - 1.793). there was also a significant difference in genotype distribution in rs6478106 under dominant model (p=0.001, or=1.437, 95% ci, 1.161 - 1.777). furthermore, compared with the c allele, the t allele of rs6478106 also increased the risk of breast cancer (table 3). the genotype frequencies of vegi gene polymorphisms in cases and controls the allele frequencies of vegi gene polymorphisms in cases and controls the association between the haplotype and breast cancer risk was analyzed using haploview 4.1 version software. block 1 contained rs6478106 and rs4263839, and there were four haplotypes in this block (crs6478106ars4263839, trs6478106grs4263839, crs6478106grs4263839 and trs6478106ars4263839). we found that the crs6478106grs4263839 haplotype got a higher frequency in breast cancer patients (p=0.0136). the trs6478106grs4263839 haplotype and trs6478106ars4263839 haplotype had lower frequencies in cases (p=0.0244 ; p=0.0184). however, after correcting the p value for multiple testing, significant differences were only found for the crs6478106grs4263839 haplotype (p=0.0488). both rs4979462 and rs7848647 belonged to block2 and constructed four haplotypes (crs4979462trs7848647, trs4979462crs7848647, crs4979462crs7848647 and trs4979462trs7848647), and they were not associated with the risk of breast cancer (table 4). the association between vegi gene polymorphisms and the clinical features of breast cancer including er, pr, p53, her-2, ln metastasis and triple negative breast cancer (tnbc) status were also analyzed in our study. we found an association only between vegi gene polymorphisms and her-2 status. in comparison with the cc genotype, patients with the tt genotype of rs6478106 may exhibit increased expression of her-2 (p=0.004, or=2.522, 95% ci, 1.320 - 4.818), and this association was also significant in the recessive model (p=0.004, or=2.397, 95% ci, 1.302 - 4.411). moreover, compared to the cc genotype of rs4979462, the tt genotype had higher frequencies in her-2 positive patients (p=0.002, or=2.835, 95% ci, 1.455 - 5.523), and in the recessive model, the distribution of the genotype of rs4979462 was also associated with her-2 expression (p=0.001, or=2.835, 95% ci, 1.489 - 3.397). the t allele of rs6478106 and the t allele of rs4979462 appeared more frequently in her-2 positive cases (p=0.0356, p=0.0354), but after correcting the p value for multiple testing, no significant difference was found. the analysis results of the association between the haplotypes and the clinical features did not show a significant difference (tables s6-s11). genotype and allele frequencies of vegi gene polymorphisms and ln metastasis status genotype and allele frequencies of vegi gene polymorphisms and er status genotype and allele frequencies of vegi gene polymorphisms and pr status genotype and allele frequencies of vegi gene polymorphisms and p53 status genotype and allele frequencies of vegi gene polymorphisms and tnbc status the haplotype of the vegi gene polymorphisms and the er status the haplotype of the vegi gene polymorphisms and the pr status the haplotype of the vegi gene polymorphisms and the p53 status the haplotype of the vegi gene polymorphisms and the her-2 status the haplotype of the vegi gene polymorphisms and the ln metastasis status the haplotype of the vegi gene polymorphisms and the tnbc status the growth and development of tumors rely on many factors, and the growth of new vessels in tumors is extremely important. the nutrients and oxygen that tumor cells need are transported by blood vessels, and the spread of cancer cells also depends on blood vessels. therefore, the suppression of vessel formation can act as a potential therapeutic target in cancers. in recent research, vegi has been identified as an inhibitory protein that inhibits the growth of vascular endothelial cells in cancers (21). vegi is mediated by dr3 and modulates neovascularization and inflammation (22, 23). vegf receptor 1 could also be regulated by vegi to inhibit the angiogenesis (24). decreased expression of vegi recent studies showed that tumor vasculature could be suppressed by a new ngr - vegi fusion protein (26). in addition to its ability to inhibit neovascularization, vegi can play an important role in immune response. vegi can induce dendritic cell maturation (27), and the interaction between vegi and dr3 can modulate the adaptive immune response by suppressing the proliferation of human activated b cells (28). in crohn 's disease, vegi has been shown to down - regulate the activation of t helper-1 cells and t helper-17 cells (29). the expression of vegi can affect the vessel formation of breast tumor (30). the mrna and protein levels of vegi in breast cancer patients were lower compared to the controls and patients with breast cancer who expressed more vegi protein had a more favorable prognosis than patients who expressed less vegi protein (14). thus, the gene variants of vegi may play a very important role in the development of breast cancer. our study indicates that some snps in the vegi gene may affect the development of breast cancer in chinese han women. our data indicates that rs6478106 is related to the risk of breast cancer in chinese han women. the ct genotype and t allele of rs6478106 were related to an increased risk of breast cancer. in the crohn 's disease, it is noteworthy that rs6478106 is located in the 3'-flanking region of the vegi gene, and the 3 ' flanking region of gene often contains sequences that can influence the formation of 3 ' end of the message. thus, the genetic variants in these regions may affect the transcription of the gene. the t allele of rs6478106 can be treated as a potential marker to inform the prognosis of breast cancer patients. in addition, breast cancer patients have a higher frequency of expression of crs6478106grs4263839 than healthy controls, indicating that the crs6478106grs4263839 haplotype might also have potential to predict breast cancer development. the intron 1 of gene contains many splicing control elements and regulatory elements that can affect the expression of genes., no significant difference was found in the genotype distribution of rs4979462 between healthy controls and breast cancer patients. however, based on the analysis of the association between gene polymorphisms in vegi and the clinical features of breast cancer patients, we found that rs4979462 and rs6478106 are related to the expression of her-2. the tt genotype of rs4979462 and rs6478106 was more frequent in the her-2 (+) patients. according to researches involved her-2 indicated that her-2 could regulate cell growth and proliferation through many pathways in different diseases (32). it acts as a key marker in diagnosis and predicts the prognosis of cancers (33). the tt genotype in rs6478106 and rs4979462 may be a potential indicator to predict the prognosis of breast cancer patients. in summary, we have found an association between vegi gene polymorphisms and the risk of breast cancer and the clinical pathologic features of breast cancer in chinese han women. our study indicates that vegi gene polymorphisms may be associated with the risk of breast cancer in chinese han women in northeast china. our results show an association between vegi gene polymorphisms and the her-2 status of breast cancer patients as well. this analysis was the first to involve vegi gene polymorphisms and breast cancer risk in chinese han women. however, further functional studies need to be conducted in our subsequent research. | objective the inhibition of the neovascularization in tumors is a potential therapeutic target of cancer. vascular endothelial growth inhibitor (vegi) is a member of the tnf superfamily which has the ability to suppress the formation of new vessels in tumors. in order to study the association between vegi gene polymorphisms and breast cancer risk, a case - control study was conducted in chinese han women in northeast china. methods our study involved 708 female breast cancer patients and 685 healthy volunteers. four snps of vegi gene were analyzed through the polymerase chain reaction - restriction fragment length polymorphism (pcr - rflp) method. the association between vegi gene polymorphisms and breast cancer risk was analyzed in our study. the relation between vegi gene variants and clinical features of breast cancer including lymph node (ln) metastasis, estrogen receptor (er), progestrogen receptor (pr), tumor protein 53 (p53), human epidermal growth factor receptor 2 (her-2) and triple negative (er-/pr-/her-2-) status was analyzed as well.results we found that the ct genotype and t allele of rs6478106 were more frequent in patients than in controls. there was also a statistical difference in the distribution of crs6478106grs4263839 haplotype between patients and controls. in addition, snp rs6478106 and rs4979462 were related with the her-2 status. conclusions our results suggest that vegi gene variants may be related to the breast cancer risk and the clinical features of breast cancer in chinese han women in northeast china. |
following the first laparoscopic nephrectomy in 1990, this procedure rapidly became an accepted alternative for the surgical management of t1 renal tumors. at present, laparoscopic radical nephrectomy (lrn) is considered the standard of care for management of t1 renal cell carcinoma (rcc) not amenable to nephron - sparing surgery. over time, minimally invasive approaches have been extended towards treatment of larger lesions with several groups reporting equivalent oncologic outcomes for stage t2 and even t3 lesions. intraoperative blood loss, length of hospital stay, analgesic requirements, and time of convalescence have all been shown to be lower for laparoscopic surgery, without sacrificing oncologic efficacy. for these reasons, lrn has become the standard of care for renal masses 10 cm, bmi>30, or both of these. of the 3 intraoperative conversions, one was needed to milk back tumor thrombus in a patient with pt3b disease suspected preoperatively, one was for t4 disease where a posterior plane behind the right kidney could not be developed (due to tumor invasion into the psoas muscle), and one was for a 9-cm left - sided lesion with dense adhesions to the tail of the pancreas. unfortunately, the study size was too small to accurately provide preoperative predictors for halrn conversion. however, we hope these added details will facilitate the decision - making process prior to surgery. as discussed above, this case required conversion to halrn in order to milk the thrombus towards the specimen side of the resection prior to firing the gia stapler. this was not suspected until final pathologic reading and was managed by the standard procedure. a regional lymphadenectomy (left nephrectomy = hilar and para - aortic nodes ; right nephrectomy = hilar and paracaval nodes) was performed in cases of preoperative lymphadenopathy (n=4 cases) or intraoperative findings of suspicious lymph nodes (n=2 cases). in total, 6 patients underwent lymphadenectomy with an average yield of 5 lymph nodes (range, 2 to 10). the one patient with t4 disease had positive lymph nodes ; the remaining cases were negative. from a technical perspective to create more working space, the laparoscopic ports were placed inferiorly and medially in comparison with the approach for smaller lesions. furthermore, several cases required placement of a hand - assist device to aid in mobilization of the kidney and to facilitate extraction of the specimen. these include technical feasibility issues (visibility, working space), increased surgical morbidity, completeness of resection, increased vascularity of larger lesions, and the possibility of tumor seeding. others will not be answered until we have much longer follow - up data for these patients. first, our 2-surgeon group did not have a contemporary open radical nephrectomy series to which we might compare our laparoscopic results. the most notable limitations, however, are that our study is a retrospective, single - institution study with small patient numbers and limited follow - up. a larger, prospective study would not only increase our sample size, but also enable us to draw more meaningful conclusions about the relative perioperative benefits of laparoscopic surgery for management of larger renal masses. longer follow - up would allow us to more accurately determine whether laparoscopic nephrectomy has the same long - term oncologic benefit as open radical nephrectomy. unfortunately, the data we have available provide a mean follow - up time of only 2.5 years. nevertheless, we have elected to include patients with shorter follow - up to emphasize the feasibility of the laparoscopic operative approach for such advanced renal tumors. our goal was to provide data on both successful completion of the procedure as well as oncologic outcomes. as such, our mean follow - up is shorter than follow - up in several of the other studies. laparoscopic radical nephrectomy for large tumors is a technically challenging operation. however, in experienced hands, lrn is a reasonable therapeutic option for the management of large, advanced rcc lesions. patients experience benefits of less blood loss, shorter hospitalization, and a more rapid convalescence. patients who undergo laparoscopic nephrectomy still suffer from recurrences of rcc, though at a similar rate and distribution as those who underwent open surgical resection. thus, it appears that individual tumor biology rather than the surgical approach best determines the chances of cure. | objective : to report our operative experience and oncologic outcomes for the laparoscopic management of large renal tumors.methods:all laparoscopic and hand - assisted laparoscopic radical nephrectomies performed at our institution were reviewed. thirty patients with tumors 7 cm and a pathologic diagnosis of renal cell carcinoma were included.results:mean operative time was 175.724.5 minutes, and mean estimated blood loss was 275.5165.8 ml. no case required conversion to open radical nephrectomy. the mean hospital stay was 2.41.6 days. four patients (13%) had minor complications. of the 30 tumors, 18 were pathologic stage t2, 9 were stage t3a, 2 were stage t3b, and one was stage t4. at a mean follow - up of 30 months (range, 10 to 70), 22 patients (73%) were alive without evidence of recurrence, and 5 patients (17%) were alive with disease. one patient (3%) died of complications related to renal cell carcinoma, and 2 patients (7%) died from other causes. overall survival was 90%, cancer - specific survival was 97%, and recurrence - free survival was 80%.conclusion : laparoscopic radical nephrectomy for large tumors is a technically challenging operation. however, in experienced hands, it is a reasonable therapeutic option for the management of larger rcc neoplasms. |
. it can be re - canalized by surgical thrombectomy, thrombolysis, balloon angioplasty, aspiration thrombectomy as well as by a mechanical thrombectomy with dedicated devices or a combination of these methods (1 - 5). among them, the mechanical thrombectomy is a method where a variety of tools is utilized with the intention to fragment or cleave and thereafter to remove or aspirate the thrombus. the arrow - trerotola percutaneous thrombolytic device (ptd ; arrow, reading, pa, usa) is known to be a useful tool to remove a thrombus (3 - 5). although the ptd procedure is simple and effective in the most cases, we have experienced the disconnection of the soft rubber tip from the basket of the ptd. between january 2006 and december 2012, 1964 sessions of endovascular intervention were performed in 908 patients because of malfunctioning hemodialysis accesses in our institution. a mechanical thrombectomy using ptd was primarily performed in patients with a thrombosed hemodialysis access in our institution. in 453 out of 1964 sessions, a mechanical thrombectomy using ptd was performed for thrombosed hemodialysis grafts (n = 407) and thrombosed native fistulas (n = 46). in five (1.1%) of 453 sessions, the soft rubber tip was disconnected from the ptd catheter. the described patients group consisted of two men and three women and ranged in age from 49 to 75 years (mean age 65 years). the soft rubber tip was disconnected in all cases when the basket of ptd was rotating to break the thrombus. disconnection of the soft rubber tip occurred at the arteriovenous anastomosis in 4 patients with native fistulas, with an acute angulation in 2 patients (fig. 1), in 1 patient at the acute angulated transitional zone between the aneurysm like dilated segment and the normal segment and in 1 patient at the junction of the subclavian and innominate veins with an indwelled stent in the innominate vein. in 1 patient with a graft, the disconnection of the soft rubber tip developed at the mid portion of the graft. in all cases the soft rubber tip was removed in three patients using the 5 - 10 mm snare catheter and was swept away into the pulmonary artery in two patients. after that, the ptd thrombectomy was resumed with the use of another ptd device and an angioplasty for the underlying stenosis was performed. no additional medical management such as antibiotics treatment was administered in the patients with the soft rubber tip migration to the pulmonary artery. the duration of follow - up ranged from 9 to 21 months (median 16 months). there were no subjective or objective symptoms associated with the soft rubber tip lodged in the pulmonary artery. arterial embolization has been reported as a possible complication of the ptd before (5), but the disconnection of the soft rubber tip has not been previously reported. possible causes may be a knotting of the catheter due to twisting at the level of tortuous vascular structure (6) or a disconnection because of pinch - off syndrome (7) and others. the device tip is made of soft and flexible rubber which can be easily maneuvered through vessels. our speculation is the soft rubber tip can be disconnected from the ptd when it is located at an acute angle within thrombosed veins or grafts because the basket is rotating at a high speed (3000 rpm). in the present study, the disconnection of the soft rubber tip occurred in 4 out of 46 patients with thrombosed native fistula. the authors presume the acute angulation as the cause of this complication in three patients. therefore, the use of ptd for the removal of a thrombus at an acute angulation is not recommended. in this situation a balloon angioplasty or an aspiration thrombectomy could be a better alternative. in one patient with an indwelling stent in the innominate vein, the tip of the ptd was caught at the end of the stent strut so that a disconnection developed. so, the ptd device should not be activated within the stent. in the present study, a disconnection of the soft rubber tip occurred in one out of 407 patients with hemodialysis graft only. in this patient, the ptd device was reused. in this case we speculate the reuse of the ptd device as cause for the disconnection of the soft rubber tip because there is no acute angulation throughout the graft and anastomosis in hemodialysis graft in general. in our institution, the reuse of ptd device after sterilization is uncommon, because the reused ptd device may be weakened and fragile. in the literature a snare - loop wire or its modification, the wire - balloon technique, a nitinol goose - neck snare, grasping forceps and fogarty balloon catheters are methods to remove intravascular foreign bodies (8 - 10). we also used a snare catheter to remove the rubber tip if the soft rubber tip was disconnected from the basket of the ptd. although we failed to remove the rubber tip in two patients, no symptoms were developed during the follow - up period. in conclusion, the rubber tip of the ptd can be disconnected during the procedure when the ptd is working in an acute angulated vessel particularly. | a rubber tip disconnection of arrow - trerotola percutaneous thrombolytic device (ptd) may occur occasionally. we experienced 5 cases of a rubber tip disconnection among 453 mechanical thrombectomy sessions with the use of ptd. we present a report about these five cases and suggest possible causes for the occurrences. |
hypertrophic pulmonary osteoarthropathy (hpoa) is often associated with lung carcinoma, but other intrathoracic tumors or nonmalignant diseases including hepatopulmonary syndrome of advanced liver or cirrhosis, cyanotic heart diseases may also associated with this clinical condition. radiologically, periostitis presents as new bone formation and appearance of a smooth layer to the bones. bone scintigraphy is a highly sensitive method for the diagnosis of hpoa and the typical scintigraphic presentation is a diffuse, symmetrically increased uptake in the diaphysis and metaphysis of tubular bones, with a distinctive double stripe or parallel track sign. in addition, diffuse moderately increased fluorodeoxyglucose (fdg) uptake in the periostea of long bones had been reported. here, we present a lung cancer patient who demonstrated findings consistent with hpoa on bone scintigraphy and fdg positron emission tomography / computed tomography (pet / ct) imaging. a 54-year - old male patient complaining of cough, generalized bone pain and weakness was referred to our hospital. ct of the thorax demonstrated 5 cm 6 cm mass lesion with speculated margins in the upper lobe of the right lung. the patient was referred nuclear medicine department for bone scintigraphy and 18f - fdg pet / ct. bone scintigraphy was performed 3 h after intravenous injection of 20 mci (740 mbq) methylene diphosphonate (mdp). it demonstrated no osseous metastases but revealed increased periosteal activity in the long bones of the legs corresponding to hypertrophic osteoarthropathy [figure 1 ]. pet / ct images were acquired 60 min after intravenous injection of 7 mci (259 mbq) fdg an integrated pet / ct camera. maximum intensity projection and transaxial images showed increased fdg accumulation in the primary tumor (suvmax : 17), mediastinal lymph nodes (suvmax : 3.3) and mild, symmetrical periosteal fdg uptake along both femuri and tibias (suvmax : 2.43.0) [figure 2 ]. three - hour whole body tc-99 m methylene diphosphonate images shows intense periosteal uptake in the long bones of the legs maximal intensity projection (a) transaxial positron emission tomography (pet) (b) transaxial fusion of lower extremities (c) and transaxial fusion of thorax (d) pet / computed tomography imaging show increased fluorodeoxyglucose accumulation in the primary tumor and mediastinal lymph nodes as well as along periosteum of long bones of legs in a symmetrical fashion with an suvmax 2.43.0 hypertrophic pulmonary osteoarthropathy is a commonly seen paraneoplastic manifestation of lung cancer or some nonmalignant diseases. incidences of hpoa of 0.217% in lung cancer patients have been reported. in a study, analyzed lung cancer patients with hpoa and were found to have more often hpoa in males, adenocarcinoma subtype, heavy smokers and stage iiib and v diseases. our patient 's diagnosis was adenocarcinoma, and he was the current smoker. in published reports, involvement of vascular endothelial growth factor (vegf), platelet - derived growth factor (pdgf), and platelets in the pathogenesis of hpoa has been indicated in some publications. they found that plasma vegf and pdgf levels were significantly higher in patients with hpoa compared with healthy controls. hypertrophic pulmonary osteoarthropathy is diagnosed based on clinical symptoms such as continuous pain and edema in the extremities and imaging findings. periostitis is the hallmark of hpoa and bone radiography reveals periosteal membrane thickening and periosteal new bone formation. magnetic resonance imaging findings in patients with hpoa were described in a number of cases and observed soft - tissue changes and periostitis. the findings consisted of the muscular and septal edema associated with extensive soft - tissue swelling that surrounded the femur and the attached cortex. the typical scintigraphic presentation is a diffuse symmetrically increased uptake in the diaphysis and metaphysis of tubular bones with a distinctive double stripe or parallel track sign.. also showed mild hyperemia surrounding the long bones of the legs at blood pool images and intense tc-99 m mdp uptake in the periostea at delayed bone scan imaging. recently, increased fdg uptake along the periosteum of long bones at pet / ct imaging was shown in some reports. in this case, increased fdg uptake was observed concordant with the inflammatory reaction in the periostea of the lower extremities. bone scintigraphy and fdg pet show increased metabolic activity in the long bones of patients with hpoa. physicians interpreting pet / ct images should be aware of these findings especially in patients with lung cancer. correct interpretation of bone scan as well as pet / ct findings is important to make proper treatment decisions. hence, nuclear medicine physicians should be aware and familiar with these findings and avoid reporting them as bone metastases. | hypertrophic pulmonary osteoarthropathy (hpoa) is not an uncommon paraneoplastic syndrome that is frequently associated with lung cancer. a 54-year - old male patient with lung adenocarcinoma underwent bone scintigraphy and fluorodeoxyglucose (fdg) positron emission tomography / computed tomography (pet / ct) scanning for initial staging. bone scintigraphy revealed increased periosteal activity in lower extremities. fdg pet / ct revealed hypermetabolic right lung mass, mediastinal lymph nodes, and mildly increased periosteal fdg uptake in both femurs and tibias. the findings in lower extremities on bone scan and fdg pet / ct were interpreted as hpoa. |
the strong heart study (shs) is a longitudinal population - based survey of cardiovascular risk factors and disease in american indians from 13 communities in arizona, oklahoma, and south and north dakota (7). the fourth shs examination, conducted between 2001 and 2003, enrolled members of large three - generation families (the strong heart family study) (8,9) including 1,944 under 40 years old. during this examination for the purposes of the current study, 33 participants were excluded because of prevalent cardiovascular disease : 2 with history of heart failure, 11 with prevalent coronary artery disease, 6 with previous stroke, 1 who had underwent previous valve replacement, and 13 with echocardiographic evidence of significant valve disease (aortic or mitral stenosis or regurgitation more than mild). in addition, 287 participants were also excluded because of missing information on dm status. accordingly, we analyzed data from 1,624 adolescents and young - adult participants (57% female ; age range 1439 years, mean age 26.6 7.7 years) free of prevalent cardiovascular disease. participants (or a parent or guardian in the case of minors) gave written informed consent under protocols approved by all participating communities and institutional review boards. clinical examinations, including a personal interview, physical exam, and morning blood sample collection after a 12-h fast, were performed at local community settings and indian health service clinics by the study staff. a detailed description of the study design and methods of the shs have previously been reported (4,79). percent body fat was estimated by bioelectric impedance analysis (model b14101 ; rjl equipment, detroit, mi). bmi - for - age charts, developed by the national center for health statistics, were used in participants 38.5 g / m for female and > 40.7 g / m for male participants up to 20 years old ; lvmi > 46.7 g / m for women and > 49.2 g / m for men over 20 years old, respectively) (9,19). relative wall thickness (rwt) was calculated as myocardial thickness (posterior wall plus septum) divided by left ventricular internal dimension and normalized for age (arwt) (20). stroke volume (sv) was computed as the difference between end diastolic and end systolic volumes by the z - derived method (21) and was normalized to height to the power of 2.04 (22). ejection fraction (ef) was obtained by the ratio of sv to end diastolic volume. the ratio between pulse pressure and sv (pp / sv) was used as a raw indicator of total arterial stiffness. stroke work, a measure of cardiac workload, was calculated multiplying systolic blood pressure (pressure load) sv (volume load) 0.014 (23). to establish whether increased lvm was compensatory for increased cardiac workload or, instead, was inappropriately high, we calculated the individual theoretical ideal value of lvm (lvmp), using age - specific equations generated by stroke work, sex, and height to the power of 2.7 (9,23). the value of lvm directly measured from echocardiograms was divided by lvmp and expressed as percent of predicted value (%lvm). inappropriately high lvm was defined as %lvm > 109% up to age 20 years and %lvm > 128% above age 20 years (9,23). to generate estimates of left ventricular systolic function independent of myocardial afterload, we evaluated left ventricular minor axis fractional shortening (fs) at either endocardial or midwall levels in relation to circumferential end systolic stress (stress - corrected endocardial fs [sc - efs ] and stress - corrected midwall fs [sc - mfs ]). sc - mfs is a measure of wall mechanics that reflects myocardial contractility independently of left ventricular geometry, whereas ef and sc - efs are more influenced by left ventricular geometry (24). left ventricular diastolic function was assessed by doppler interrogation of transmitral velocity at early (e) and late (a) left ventricular filling, their ratio, the deceleration time (dt) of early diastolic left ventricular filling, and the atrial filling fraction. isovolumic relaxation time (ivrt), a raw index of active left ventricular relaxation, was measured between aortic valve closure and mitral valve opening. data were analyzed using spss 12.0 software (spss, chicago, il) and expressed as means 1 sd. variables without normal distribution are presented as median and interquartile range, and their logarithmic values were used for parametric statistics. indicator variables were included in all multivariate analyses for the three different field centers (arizona and oklahoma vs. north / south dakota). anova (with ryan - einot - gabriel - welsch f post hoc test), and statistics were used for descriptive statistics. differences between groups were, therefore, assessed by binary logistic regression analysis or ancova, adjusting for significant confounders (with sidak correction of main effects). the impact of relatedness was considered by using standard kinship coefficients (0.25 for parent / offspring, 0.25 for full siblings, 0.125 for half siblings, and 0 for no consanguinity). in multiple linear regression analysis of echocardiographic parameters of left ventricular geometry and function, kinship coefficient was first entered together with filed center, age, and sex. in a second block, we included a stepwise selection of the following variables : systolic blood pressure, heart rate, percentage of body fat, hdl and ldl cholesterol, triglycerides, gfr, ualb / crea, and antihypertensive treatment with renin - angiotensin system antagonists (anti - ras), including ace inhibitors or at1 receptor antagonists. dm status was, therefore, forced into the model to verify whether an independent effect remained on left ventricular geometry or function. finally, in the last block attention was paid to avoid substantial multicollinearity by setting the greatest tolerable variance inflation factor to 2.5. clinical examinations, including a personal interview, physical exam, and morning blood sample collection after a 12-h fast, were performed at local community settings and indian health service clinics by the study staff. a detailed description of the study design and methods of the shs percent body fat was estimated by bioelectric impedance analysis (model b14101 ; rjl equipment, detroit, mi). bmi - for - age charts, developed by the national center for health statistics, were used in participants 38.5 g / m for female and > 40.7 g / m for male participants up to 20 years old ; lvmi > 46.7 g / m for women and > 49.2 g / m for men over 20 years old, respectively) (9,19). relative wall thickness (rwt) was calculated as myocardial thickness (posterior wall plus septum) divided by left ventricular internal dimension and normalized for age (arwt) (20). stroke volume (sv) was computed as the difference between end diastolic and end systolic volumes by the z - derived method (21) and was normalized to height to the power of 2.04 (22). ejection fraction (ef) was obtained by the ratio of sv to end diastolic volume. the ratio between pulse pressure and sv (pp / sv) was used as a raw indicator of total arterial stiffness. stroke work, a measure of cardiac workload, was calculated multiplying systolic blood pressure (pressure load) sv (volume load) 0.014 (23). to establish whether increased lvm was compensatory for increased cardiac workload or, instead, was inappropriately high, we calculated the individual theoretical ideal value of lvm (lvmp), using age - specific equations generated by stroke work, sex, and height to the power of 2.7 (9,23). the value of lvm directly measured from echocardiograms was divided by lvmp and expressed as percent of predicted value (%lvm). inappropriately high lvm was defined as %lvm > 109% up to age 20 years and %lvm > 128% above age 20 years (9,23). to generate estimates of left ventricular systolic function independent of myocardial afterload, we evaluated left ventricular minor axis fractional shortening (fs) at either endocardial or midwall levels in relation to circumferential end systolic stress (stress - corrected endocardial fs [sc - efs ] and stress - corrected midwall fs [sc - mfs ]). sc - mfs is a measure of wall mechanics that reflects myocardial contractility independently of left ventricular geometry, whereas ef and sc - efs are more influenced by left ventricular geometry (24). left ventricular diastolic function was assessed by doppler interrogation of transmitral velocity at early (e) and late (a) left ventricular filling, their ratio, the deceleration time (dt) of early diastolic left ventricular filling, and the atrial filling fraction. isovolumic relaxation time (ivrt), a raw index of active left ventricular relaxation, was measured between aortic valve closure and mitral valve opening. data were analyzed using spss 12.0 software (spss, chicago, il) and expressed as means 1 sd. variables without normal distribution are presented as median and interquartile range, and their logarithmic values were used for parametric statistics. indicator variables were included in all multivariate analyses for the three different field centers (arizona and oklahoma vs. north / south dakota). anova (with ryan - einot - gabriel - welsch f post hoc test), and statistics were used for descriptive statistics. differences between groups were, therefore, assessed by binary logistic regression analysis or ancova, adjusting for significant confounders (with sidak correction of main effects). the impact of relatedness was considered by using standard kinship coefficients (0.25 for parent / offspring, 0.25 for full siblings, 0.125 for half siblings, and 0 for no consanguinity). in multiple linear regression analysis of echocardiographic parameters of left ventricular geometry and function, kinship coefficient was first entered together with filed center, age, and sex. in a second block, we included a stepwise selection of the following variables : systolic blood pressure, heart rate, percentage of body fat, hdl and ldl cholesterol, triglycerides, gfr, ualb / crea, and antihypertensive treatment with renin - angiotensin system antagonists (anti - ras), including ace inhibitors or at1 receptor antagonists. dm status was, therefore, forced into the model to verify whether an independent effect remained on left ventricular geometry or function. finally, in the last block attention was paid to avoid substantial multicollinearity by setting the greatest tolerable variance inflation factor to 2.5. among the 1,624 adolescents and young - adult participants without reported prevalent cardiovascular disease, 1,146 (71%) had nfg, 299 (18%) had ifg, and 179 (11%) had dm. insulin treatment was reported in 43 dm participants (24%), while 95 participants (53%) were on oral antidiabetic therapy. table 1 shows that age, bmi, body fat, waist girth, and whr progressively increased from nfg to dm. ifg and dm participants had similar prevalence of obesity and mean values of blood pressure, both of which were significantly higher than nfg. participants with dm had a higher heart rate than the other groups (all p 0.05). adjusted p 0.05). adjusted p 0.05). adjusted p < 0.0001. when fasting plasma glucose was forced into the model, a significant effect of dm remained only for lvmi (= 0.10 ; p < 0.05), whereas high glucose was associated with low ef (= 0.13 ; p < 0.01), low sc - mfs (= 0.10 ; p < 0.05), and prolonged ivrt (= 0.12 ; p < 0.01). in subanalyses performed selectively in participants without dm, high homeostasis model assessment index was independently related to high lvmi, increased rwt, and lower sc - mfs (all adjusted p < 0.05). in dm, hba1c and duration of dm were not independently related to left ventricular geometry and function. the increasing incidence of obesity and, subsequently, dm in youth in different countries represents a major public health concern because of the risk of cardiovascular complications (1,3). the current study provides the first comprehensive comparison of left ventricular structure and function between dm, prediabetic, and normoglycemic members of a large population - based sample of adolescents and young adults with high prevalence of obesity but free from prevalent cardiovascular disease. our findings demonstrate that despite the young age, participants with dm exhibit features associated with increased cardiovascular risk, including lvh, concentric left ventricular geometry, and preclinical systolic and diastolic dysfunction. moreover, participants with prediabetes (measured by ifg) also had a significantly higher prevalence of lvh than participants with nfg, reflecting important target organ damage already present at an early phase of alteration of glucose metabolism. this observation is important in view of the strong relation between lvh and adverse cardiovascular outcomes (25) and provides a strong rationale for targeting prevention strategies in this subpopulation. although participants with dm and ifg were more often obese and hypertensive, these two conditions were not sufficient to explain the identified cardiovascular abnormalities associated with dm, which remained an independent correlate of increased left ventricular mass, reduced left ventricular systolic function, and abnormal left ventricular relaxation. thus, our results suggest that dm augments the already demonstrated adverse impact of obesity and hypertension on cardiovascular phenotype in the young participants of the shs (8,9). accordingly, in dm, the level of increased lvm substantially exceeds the need to compensate for cardiac workload, resulting in a markedly higher prevalence of inappropriate lvm. this finding also reinforces the view that in dm, lvh may not only be a response to substantially increased hemodynamic load, related to obesity or hypertension, but may also reflect neurohormonal and metabolic stimuli to left ventricular growth. another characteristic of the emerging cardiovascular phenotype in dm in youth is the presence of geometry - related left ventricular functional alterations, also identified in prediabetes. early left ventricular systolic dysfunction, associated with dm and ifg, could be detected by sc - mfs but not by measures of left ventricular systolic function taken at the chamber level, substantially influenced by the abnormalities in left ventricular geometry, documented by the progressive increase in rwt (24). the slight reduction in ef found in ifg was not confirmed by sc - efs, demonstrating an afterload mismatch (higher systolic blood pressure without adequate compensation in left ventricular geometry) in this subgroup. abnormality in left ventricular filling, characterized by active, energy - consuming relaxation (low e - to - a ratio and prolonged ivrt), was also evident, independent of major covariates. these findings are particularly notable because these alterations might mediate, at least in part, the documented increased risk of heart failure associated with dm, also in the absence of myocardial infarction (6). thus, the cardiovascular phenotype emerging from our analysis is similar to that reported in the description of the so - called diabetic cardiomyopathy in elderly adults (4,5) : increased left ventricular mass with tendency to concentric left ventricular geometry together with subtle systolic and diastolic dysfunction. we can hypothesize that several mechanisms related to dm (e.g., stress damage, interstitial accumulation of advanced glycated end products) might contribute to development and progression of these alterations. exposure over time to high levels of insulin, related to increased central fat distribution, might also have an important pathophysiological role. unfortunately, in this shs cohort, hba1c was measured only in dm participants and could not be analyzed in the whole population. in the subanalyses performed in the dm participants, however, fasting plasma glucose could be used in the whole population as a surrogate of metabolic control of glucose homeostasis, providing a wider range of variability. under this assumption, the final model of the multiple regression analysis strongly suggests that at least a part of the subtle left ventricular systolic and diastolic dysfunction detected in the young dm shs participants is related to their metabolic control. despite their young age, dm participants exhibited dyslipidemia and kidney function alterations, including a tendency to glomerular hyperfiltration and early proteinuria. these metabolic alterations are independently associated with left ventricular geometry and function parameters and, thus, might also contribute to the adverse cardiovascular phenotype found in dm through mechanisms that might involve microvascular changes, inflammation, early atherosclerotic disease, and hormonal dysregulation., the number of participants with dm is relatively small because of the young average age of this cohort. incidence of dm, which requires a number of years of insulin resistance and resultant pancreatic overstimulation, peaks in the fourth decade of life in the shs population (26). the shs is a population of american indians with high prevalence of obesity and dm that at the beginning of the study was greater than in the general u.s. however, results of the shs are increasingly applicable to other populations of different ethnicities in which there are rising epidemics of obesity, dm, and other metabolic abnormalities (27). american indian participants of the shs have been extensively documented to have high prevalence of obesity and type 2 dm, but we could not completely exclude possible misclassification of participants with type 1 dm and concomitant obesity because we did not measure antibodies or c - peptide levels. however, when we compared the 37 dm participants with reported insulin therapy with those without insulin treatment, we did not find any significant differences, and results of this study were all confirmed after exclusion of dm participants under insulin treatment. in conclusion, we found that in a population - based cohort of adolescents and young adults, dm and ifg are associated with early signs of structural and functional left ventricular alterations. early identification of myocardial manifestations of dm is of major importance because myocardial abnormalities predict cardiovascular disease. further studies are warranted to elucidate pathophysiological mechanisms and to determine to what extent the early abnormalities we have identified in dm contribute to the risk of cardiovascular disease. | objectivethe aim of this study was to evaluate whether diabetes (dm) and impaired fasting glucose (ifg) were associated with early alterations in left ventricular geometry and function in a large population of adolescents and young adults independently of major confounders.research design and methodswe analyzed echocardiographic data of 1,624 14- to 39-year - old participants (mean age 26.6 7.7 years ; 57% female) without prevalent cardiovascular disease from the fourth strong heart study examination ; 179 (11%) participants had dm and 299 (18%) had ifg.resultsparticipants with dm and ifg were older and more often obese and hypertensive than participants with normal fasting glucose (nfg) (all p < 0.05). after adjustment for age, sex, systolic blood pressure, and body fat, diabetic and ifg participants had higher left ventricular mass index than those with nfg (41.5 8.7 and 39.6 9.2 vs. 35.6 7.8 g / m2.7) and reduced stress - corrected midwall shortening (98 8.6 and 99 7.5 vs. 101 8.5% ; all p < 0.05). the prevalence of left ventricular hypertrophy was higher in dm (20%) and ifg (17%) than in nfg participants (12% ; p < 0.05). compared with the other groups, dm was also associated with higher prevalence of inappropriate left ventricular mass, concentric geometry, and more diastolic abnormalities independently of covariates (all p < 0.05).conclusionsin a population of adolescents and young adults, dm is independently associated with early unfavorable cardiovascular phenotype characterized by increased left ventricular mass, concentric geometry, and early preclinical systolic and diastolic dysfunction ; early cardiovascular alterations are also present in participants with prediabetes. |
cardia is a multicenter community - based longitudinal cohort study of the development and determinants of cardiovascular disease over time in 5,115 young adults initially aged 1830 years in 1985 to 1986. black and white adults were recruited from four cities in the united states (birmingham, al ; chicago, il ; minneapolis, mn ; and oakland, ca) with population - based samples approximately balanced within center by sex, age (1824 years and 2530 years), race (white and black), and education (high school graduate or less, greater than high school graduate). to date, participants have been re - examined 2, 5, 7, 10, 15, 20, and 25 years after baseline, and retention rates across examinations were 91, 86, 81, 79, 74, 72, and 72%, respectively. all participants provided written informed consent at each examination, and institutional review boards from each field center and the coordinating center approved the study annually. of the 5,115 participants, we excluded those who had diabetes or an unknown diabetes status at baseline (n = 240), were abdominally obese [> 102 cm in men and > 88 cm in women (20) ] or missing wc at baseline (n = 387), were pregnant during any examination (n = 206), had bariatric surgery during follow - up (n = 33), were transgender (n = 2), or were missing the measurement of wc during follow - up (n = 155). participants were asked to fast for at least 12 h before each examination and to avoid smoking or engaging in heavy physical activity for at least 2 h. wc was measured with a tape in duplicate to the nearest 0.5 cm around the minimal abdominal girth identified laterally midway between the iliac crest and the lowest portion of the rib cage and anteriorly midway between the xiphoid process and the umbilicus. body weight was measured to the nearest 0.2 kg with a calibrated balance - beam scale. the sum of years spent abdominally obese during the 25-year follow - up was calculated for participants without abdominal obesity at baseline. onset of abdominal obesity was considered to be the time between the examination first measured as abdominally obese and the prior examination year. the algorithm accounted for fluctuations in wc above and below the threshold of abdominal obesity during follow - up. for participants who developed diabetes, the number of years spent abdominally obese were determined up until the examination when incident diabetes was identified. for those who did not develop diabetes, years of abdominal obesity the age at first appearance of abdominal obesity was defined as the age at the examination year prior to the examination at which abdominal obesity was identified. blood was drawn by venipuncture and processed at the central laboratory according to a standard protocol. glucose was assayed at baseline (i.e., year 0) using the hexokinase ultraviolet method by american bio - science laboratories (van nuys, ca) and at years 7, 10, 15, 20, and 25 using hexokinase coupled to glucose-6-phosphate dehydrogenase by linco research (st. glycated hemoglobin a1c was measured using the tosoh g7 high - performance liquid chromatography method (tosoh bioscience) at years 20 and 25. diabetes was determined based on a combination of measured fasting glucose levels (7.0 mmol / l, 126 mg / dl) at examination years 7, 10, 15, 20, or 25 ; self - report of oral hypoglycemic medications or insulin (all examinations) ; a 2-h postload glucose 11.1 mmol / l (200 mg / dl) at examination years 10, 20, and 25 ; or a glycated hemoglobin a1c 6.5% at years 20 and 25 (21). the incidence of diabetes over 25 years was determined among participants who did not have diabetes at baseline based on fasting glucose levels and report of medications. standard questionnaires were used to maintain consistency in the assessment of demographic (age, sex, race, and education) and behavioral (physical activity, cigarette smoking, and alcohol use) information across all cardia examination visits. the cardia physical activity history questionnaire was used to query the amount of time per week spent in 13 categories of leisure, occupational, and household physical activities over the past 12 months (22). activity was expressed in exercise units ; a total activity score of 300 exercise units approximates department of health and human services recommendations of 150 min of moderate - intensity activity per week. cigarette smoking status was classified as ever or never based upon information collected at each examination. energy intake was measured with the interviewer - administered, validated cardia dietary history at years 0, 7, and 20 (23). extreme values of energy intake (high : > 8,000 kcal / day in men and > 6,000 kcal / day in women ; low : 20 years). analyses were adjusted for baseline age, maximum years of education, family history of diabetes (yes / no), cardia field center, and the following time - dependent covariates : wc (cm), energy intake (average kcal), smoking status (never / ever), alcohol use (average ml / day), physical activity (average exercise units), and, among women in models stratified by race, number of pregnancies and postmenopausal status (yes / no). to test for the presence of a quadratic trend, we added a squared duration of abdominal obesity term to the multivariable models that also included a linear term. potential effect modification by race in sex - stratified models was evaluated by testing the statistical significance of a multiplicative interaction term including race and duration of abdominal obesity as a categorical variable in models that also included lower - order terms. we also performed a sensitivity analysis to determine the influence of missing wc values (18.8% of all measurements) on the association between the duration of abdominal obesity and incident diabetes. multiple imputation was used to impute missing wc using the sequential regression imputation approach that is implemented in the software package iveware (24). five datasets were generated using all available wc data on the sample of 4,092 participants. each data set was analyzed separately, and results from the five analyses were combined using rubin 's rules (25). tests of statistical significance were two - tailed, with an level of 0.05. a type 1 error rate of 0.10 was set for tests of multiplicative interaction. sas version 9.2 (sas institute, cary, nc) was used to perform all analyses. cardia is a multicenter community - based longitudinal cohort study of the development and determinants of cardiovascular disease over time in 5,115 young adults initially aged 1830 years in 1985 to 1986. black and white adults were recruited from four cities in the united states (birmingham, al ; chicago, il ; minneapolis, mn ; and oakland, ca) with population - based samples approximately balanced within center by sex, age (1824 years and 2530 years), race (white and black), and education (high school graduate or less, greater than high school graduate). to date, participants have been re - examined 2, 5, 7, 10, 15, 20, and 25 years after baseline, and retention rates across examinations were 91, 86, 81, 79, 74, 72, and 72%, respectively. all participants provided written informed consent at each examination, and institutional review boards from each field center and the coordinating center approved the study annually. of the 5,115 participants, we excluded those who had diabetes or an unknown diabetes status at baseline (n = 240), were abdominally obese [> 102 cm in men and > 88 cm in women (20) ] or missing wc at baseline (n = 387), were pregnant during any examination (n = 206), had bariatric surgery during follow - up (n = 33), were transgender (n = 2), or were missing the measurement of wc during follow - up (n = 155). participants were asked to fast for at least 12 h before each examination and to avoid smoking or engaging in heavy physical activity for at least 2 h. wc was measured with a tape in duplicate to the nearest 0.5 cm around the minimal abdominal girth identified laterally midway between the iliac crest and the lowest portion of the rib cage and anteriorly midway between the xiphoid process and the umbilicus. body weight was measured to the nearest 0.2 kg with a calibrated balance - beam scale. the sum of years spent abdominally obese during the 25-year follow - up was calculated for participants without abdominal obesity at baseline. onset of abdominal obesity was considered to be the time between the examination first measured as abdominally obese and the prior examination year. the algorithm accounted for fluctuations in wc above and below the threshold of abdominal obesity during follow - up. for participants who developed diabetes, the number of years spent abdominally obese were determined up until the examination when incident diabetes was identified. for those who did not develop diabetes, years of abdominal obesity the age at first appearance of abdominal obesity was defined as the age at the examination year prior to the examination at which abdominal obesity was identified. blood was drawn by venipuncture and processed at the central laboratory according to a standard protocol. glucose was assayed at baseline (i.e., year 0) using the hexokinase ultraviolet method by american bio - science laboratories (van nuys, ca) and at years 7, 10, 15, 20, and 25 using hexokinase coupled to glucose-6-phosphate dehydrogenase by linco research (st. glycated hemoglobin a1c was measured using the tosoh g7 high - performance liquid chromatography method (tosoh bioscience) at years 20 and 25. diabetes was determined based on a combination of measured fasting glucose levels (7.0 mmol / l, 126 mg / dl) at examination years 7, 10, 15, 20, or 25 ; self - report of oral hypoglycemic medications or insulin (all examinations) ; a 2-h postload glucose 11.1 mmol / l (200 mg / dl) at examination years 10, 20, and 25 ; or a glycated hemoglobin a1c 6.5% at years 20 and 25 (21). the incidence of diabetes over 25 years was determined among participants who did not have diabetes at baseline based on fasting glucose levels and report of medications. standard questionnaires were used to maintain consistency in the assessment of demographic (age, sex, race, and education) and behavioral (physical activity, cigarette smoking, and alcohol use) information across all cardia examination visits. the cardia physical activity history questionnaire was used to query the amount of time per week spent in 13 categories of leisure, occupational, and household physical activities over the past 12 months (22). activity was expressed in exercise units ; a total activity score of 300 exercise units approximates department of health and human services recommendations of 150 min of moderate - intensity activity per week. cigarette smoking status was classified as ever or never based upon information collected at each examination. energy intake was measured with the interviewer - administered, validated cardia dietary history at years 0, 7, and 20 (23). extreme values of energy intake (high : > 8,000 kcal / day in men and > 6,000 kcal / day in women ; low : 20 years). analyses were adjusted for baseline age, maximum years of education, family history of diabetes (yes / no), cardia field center, and the following time - dependent covariates : wc (cm), energy intake (average kcal), smoking status (never / ever), alcohol use (average ml / day), physical activity (average exercise units), and, among women in models stratified by race, number of pregnancies and postmenopausal status (yes / no). to test for the presence of a quadratic trend, we added a squared duration of abdominal obesity term to the multivariable models that also included a linear term. potential effect modification by race in sex - stratified models was evaluated by testing the statistical significance of a multiplicative interaction term including race and duration of abdominal obesity as a categorical variable in models that also included lower - order terms. we also performed a sensitivity analysis to determine the influence of missing wc values (18.8% of all measurements) on the association between the duration of abdominal obesity and incident diabetes. multiple imputation was used to impute missing wc using the sequential regression imputation approach that is implemented in the software package iveware (24). five datasets were generated using all available wc data on the sample of 4,092 participants. each data set was analyzed separately, and results from the five analyses were combined using rubin 's rules (25). tests of statistical significance were two - tailed, with an level of 0.05. a type 1 error rate of 0.10 was set for tests of multiplicative interaction. sas version 9.2 (sas institute, cary, nc) was used to perform all analyses. of the 4,092 eligible participants without abdominal obesity or diabetes at baseline, 48.8% were black, and 50.0% were women. the characteristics of participants overall and according to race and sex group are shown in table 1. at baseline, mean values of glucose were well below the therapeutic threshold across all race - sex groups. about one - third of participants had a family history of diabetes with a slightly higher proportion observed among black as compared with white adults. characteristics of 4,092 participants included in the current study overall and according to race and sex : the cardia study the percentage of participants who developed abdominal obesity, mean age at onset, mean duration, and the proportion of participants in each 5-year category of abdominal obesity overall and according to race and sex are shown in table 2. the occurrence of abdominal obesity during follow - up was significantly higher among black women (57.5%) than all other race - sex groups (p 20 years for white women. adjusted hrs and 95% ci for incident diabetes according to duration of abdominal obesity during follow - up overall and according to race and sex : the cardia study incidence of diabetes (per 1,000 person - years) according to duration of abdominal obesity in 5-year increments through year 25 (2010 to 2011) overall and according to race and sex : the cardia study.. a longer duration of exposure to abdominal obesity was associated with incident diabetes (table 3). overall, with each additional year of abdominal obesity, the multivariable adjusted hr for diabetes was 4% higher [hr 1.04 (95% ci : 1.021.07) ] and was similar when a lower cut point was used to define abdominal obesity (94 cm for men and 80 cm for women) [1.04 (1.011.06) ]. similar results were also observed in a sensitivity analysis that imputed missing values using all available measures of wc during follow - up on the sample of 4,092 participants [1.03 (1.011.06) ]. however, we found that a quadratic model best represented the risk for diabetes associated with the duration of abdominal obesity. compared with those who did not develop abdominal obesity (zero years of abdominal obesity), each 5-year higher category of abdominal obesity was associated with a substantially higher risk for diabetes that peaked at 1115 years of abdominal obesity (table 3). wc was also associated with diabetes risk [1.04 (1.031.05/cm) ]. in general, a quadratic trend in the risk for diabetes associated with the duration of abdominal obesity that peaked at 1115 years was observed in all race - sex groups except white women, in whom a significant linear trend was noted (table 3). with each additional year of abdominal obesity, an 8% higher risk for diabetes was observed in white women [hr 1.08 (95% ci 1.021.15) ]. these associations did not vary significantly between white and black men or women (p - interaction > 0.2 and 0.1, respectively). in this multicenter, community - based, longitudinal cohort study of adults recruited and followed largely during the obesity epidemic over the last three decades in the united states, we found the duration of abdominal obesity starting in young adulthood and into middle age to be an important predictor of new - onset diabetes independent of the degree of abdominal adiposity, physical activity, energy intake, family history of diabetes, and a number of other potential confounding factors. overall, each additional year of abdominal obesity was associated with a 4% higher risk of developing diabetes later in life. however, we found this risk appeared to peak with 1115 years of abdominal obesity, but remained elevated for > 20 years. this finding suggests that the longer duration of exposure to excess abdominal adiposity as a result of the obesity epidemic and an earlier age at onset will have important implications on diabetes incidence rates in the united states. to the best of our knowledge, the current study is the first to determine whether the duration of abdominal obesity is associated with the development of diabetes. previous studies examining the influence of the duration of excess adiposity on diabetes risk have measured only overall obesity (815). in order to quantify the duration of obesity, most of these studies have relied upon the recall of body weight at previous ages or the self - reported duration of obesity, methods that may be susceptible to a considerable amount of measurement error (9,10,1315). however, in the current study, we used repeated assessments of wc collected every 25 years for a maximum of 25 years beginning early in adulthood to objectively determine the duration of abdominal obesity during follow - up. we found the duration of abdominal obesity was associated with the development of diabetes independent of the degree of abdominal adiposity. thus, we suggest that future studies interested in estimating the cumulative exposure to excess abdominal adiposity over the life course measure not only the degree of abdominal adiposity, but also its duration. in the present long - term study, we found the frequency of developing abdominal obesity was highest among black women. in addition, on average, black women developed abdominal obesity 2 years earlier than black men and 3 to 4 years earlier than white men and women. as a result, black women experienced the longest duration of exposure to abdominal obesity of all race - sex groups. in contrast, men, either black or white, generally tended to have the lowest rates of abdominal obesity. these findings are consistent with recent data from the national health and nutrition examination survey showing a substantially higher prevalence of abdominal obesity among black women in the united states (5). despite a longer duration of abdominal obesity and a higher incidence of diabetes among black women, we found little to no difference in the association between the duration of abdominal obesity and risk for diabetes between white and black men and women. future studies are needed to confirm that black men and women do not have a smaller relative risk for diabetes associated with abdominal obesity than their white counterparts. overall, we found the risk for diabetes appeared to peak during the first 1115 years of abdominal obesity, but remained elevated for > 20 years. in general, this quadratic trend was confirmed in all race - sex groups except white women, among whom the risk for diabetes peaked with > 20 years of abdominal obesity. this finding suggests that the adverse metabolic effects of excess abdominal adiposity on diabetes risk, although elevated over the course of two decades, may begin to plateau after 1115 years. although the suspected mechanism to support this finding remains elusive, it may be possible that the number of individuals susceptible to the metabolic derangements of prolonged abdominal obesity decreases after approximately the first decade. a portion of the remaining abdominally obese individuals may be able to avoid hyperglycemia in the face of prolonged obesity by being either less responsive to the secretions of excess adipose tissue or their adipose tissue may not possess the same secretory properties of those abdominally obese individuals who develop diabetes. it is generally well - accepted that excess adiposity, particularly abdominal adiposity, can have deleterious metabolic effects, thereby increasing the risk of developing diabetes. expanded fat stores, a hallmark of obesity, results in enhanced lipolysis, leading to increased circulating free fatty acids, and promotes peripheral and hepatic insulin resistance (26). the normal pancreatic -cell response to obesity - associated insulin resistance is compensatory insulin hypersecretion in order to maintain normoglycemia (27). over time with prolonged obesity, -cell dysfunction results in low insulin response and an inability to maintain glycemia near normal (28). thus, the early stages of abdominal obesity may be largely characterized by the development of insulin resistance, whereas a prolonged duration of abdominal obesity may promote progressive deterioration in -cell function, leading to the development of overt diabetes. additional mechanisms that may explain, at least in part, the association between a longer duration of abdominal obesity and the development of diabetes, include sustained expression and secretion of hormones, cytokines, and adipokines from intra - abdominal fat located in close proximity to the portal circulation (29). strengths of our study include a community - based sampling method ; a biracial cohort ; extensive data on potential confounders ; a large sample size well balanced with respect to age, sex, race, and education that increased precision and permitted simultaneous adjustment and stratification by multiple variables ; repeat assessments of wc, glycemia, and potential confounding factors over a long follow - up period ; a high retention rate ; and the standardized data collection protocols and rigorous quality control of the cardia study. first, wc was used as an estimate of central obesity even though it does not distinguish between subcutaneous and visceral fat. nevertheless, wc has been shown to be strongly correlated with visceral fat and offers widespread appeal due to its relative ease of measurement (30). second, our estimation of the duration of abdominal obesity during follow - up was based on the measurement of wc every 25 years. it is likely that a more frequent number of assessments would have led to a more accurate estimation of the duration of abdominal obesity during follow - up ; however, to the extent that there was random misclassification due to this assessment schedule, we may have underestimated the true association between the duration of abdominal obesity and diabetes risk in our cohort. third, since our study collected data over a 25-year period, some participants were missing at least one eligible measurement of wc. however, we noted similar results between our multiple imputed datasets and our primary dataset that did not account for missing wc values. in conclusion, our findings indicate that a longer duration of abdominal obesity is associated with a substantially higher risk for diabetes in adults independent of the degree of abdominal adiposity. this information is critical to understanding the consequences of a greater prevalence and cumulative exposure to excess adiposity over the life course. our findings suggest that preventing or at least delaying the onset of abdominal obesity in young adulthood may substantially reduce the risk of developing diabetes into middle age. | objectiveto examine whether the duration of abdominal obesity determined prospectively using measured waist circumference (wc) is associated with the development of new - onset diabetes independent of the degree of abdominal adiposity.research design and methodsthe coronary artery risk development in young adults study is a multicenter, community - based, longitudinal cohort study of 5,115 white and black adults aged 1830 years in 1985 to 1986. years spent abdominally obese were calculated for participants without abdominal obesity (wc > 102 cm in men and > 88 cm in women) or diabetes at baseline (n = 4,092) and was based upon repeat measurements conducted 2, 5, 7, 10, 15, 20, and 25 years later.resultsover 25 years, 392 participants developed incident diabetes. overall, following adjustment for demographics, family history of diabetes, study center, and time varying wc, energy intake, physical activity, smoking, and alcohol, each additional year of abdominal obesity was associated with a 4% higher risk of developing diabetes [hazard ratio (hr) 1.04 (95% ci 1.021.07) ]. however, a quadratic model best represented the data. hrs for 0, 15, 610, 1115, 1620, and > 20 years of abdominal obesity were 1.00 (referent), 2.06 (1.432.98), 3.45 (2.285.22), 3.43 (2.285.22), 2.80 (1.734.54), and 2.91 (1.605.29), respectively ; p - quadratic < 0.001.conclusionslonger duration of abdominal obesity was associated with substantially higher risk for diabetes independent of the degree of abdominal adiposity. preventing or at least delaying the onset of abdominal obesity in young adulthood may lower the risk of developing diabetes through middle age. |
during recent decades, with improving living standards, changing lifestyles, and aging population, metabolic syndrome (ms) has become a major public health challenge worldwide. the china health and nutrition survey in 2009 showed that the overall age - standardized prevalence estimate of ms was 10.5% based on the chinese diabetes society criteria. studies have shown that ms can cause cardiovascular disease, reduce quality of life, and increase mortality [35 ]. there is an urgent need to take measures to prevent and treat chronic diseases such as hypertension and metabolic syndrome. currently, lifestyle interventions focused on physical activity, diet, and other health behaviors are often adopted as the main method of ms intervention, using a web - based platform or cooperating with home - care providers or general practitioners [611 ]. these interventions can improve the patient s lifestyle to some extent, but they are mostly offered to urban community residents. kunshan is located inside the yangtze river delta economic area, one of the fastest growing regions in china. the population density in kunshan was 646 persons / km in 2002. with population and economic growth, since the population of the rural community has grown so large, with a large transient population, it is more difficult technically and politically to carry out standardized ms interventions and management in rural communities in kunshan. medical literature, clinical practice and basic research had proved that tcm can effectively lower blood pressure, blood lipids, blood glucose, and treat the complications of diabetes [1317 ]. since the cause and pathogenesis of ms varies and people with ms are at higher risk of diabetes, coronary heart disease, and other cardiovascular diseases, it is more effective to intervene in ms using tcm - appropriate technology on the basis of western medicine, with emphasis on integrity, systemic, dialectic, and tian ren he yi (a theory that man is an integral part of nature). therefore, we put forward a novel community - based intervention, using integrated traditional chinese and western medicine on the basis of community health service, carrying out a study by the intervention and management of ms in rural residents. this study was conducted by the health care institutions of zhoushi (a town in kunshan) and our team. we did ms intervention from 2011 to 2013 for the rural community resident population aged 45 years and above in zhoushi. 1964 persons were ms patients, and among them 630 agreed to participate in the intervention. in the end, 598 persons had the health examination and health behavior questionnaire before and after the intervention. participants with ms (based on the chinese diabetes society 2004 criteria) ; participants aged 45 years and above. inability to exercise ; healthy life self - help program since the main working methods are health education, health guidance, and health intervention, people in the program can take part in activities like regularly self - help health examination, health knowledge lecture, prevention measure guide, and early disease screening, which can help residents adopt a healthy lifestyle, make early health interventions, lead people to self - involvement and self - management, and improve the quality of life. details were as follows : diagnostic equipment such as a food quantitative model, automatic arm tube type blood pressure monitor, automatic height and weight measurement instrument, blood glucose meter, body fat meter, and rehabilitation activities equipment are furnished in the program for the subjects. with the food quantitative model, patients could make diet choices more intuitively, feeling the weight, size, and thickness of food by looking and touching. with other equipment we measured height, weight, blood pressure, blood glucose, and body fat for the subjects. all the measures above are free so we can constantly monitor different factors of the subjects, and we can also help the subjects strengthen the sense of self - management. lectures and on - site consultation were held for the subjects, during which physicians and nurses would give lectures about basic knowledge of diabetes, diet therapy, exercise therapy, medication, and so on. other activities aimed to develop self - management skills and establish confidence in improving health for the subjects, such as training on blood glucose monitoring and insulin injection. we identified the tcm constitution of the subjects using the software named tcm constitution evaluation system. on the basis of the evaluation results, we used acupuncture, massage, daoyin, tai chi, and meridian flap to mobilize the residents body s natural balance fully. at the same time, we used diet and medication to complement the vigor of the residents, which can improve the body s resistance to disease inside and outside. details were as follows : give different dietary suggestions to different subjects according to their tcm constitution so as to keep the balance of yin and yang. eat less starch products like chinese yam, less oily foods like peanuts, less high - cholesterol foods like yolk. so we took tcm treatments respectively depending on the subjects tcm constitution, which can improve the body s internal environment. at the same time, we took treatments of tonifying to avoid the liver and kidney damage because of the long - term use of western medicine, took traditional massage and medicinal food diet to delay the complications of ms. training in tai chi was held for the subjects every week. according to the theory of yin and yang, 5 elements and viscera meridian of tcm, teaching the ms patients special exercises such as baduanjin qigong, to help them establish the coordination of body and mind. we used methods like tai chi, health qigong, massage, acupoint pressure, and meridian flap to dredge the meridian and adjust the qixue of the ms patients. warm - up before exercise and cool - down after exercise are also essential to keep the balance of yin and yang. this was a 2-year before - after study, conducting health physically examination at baseline and 2 years later, including the measurement of height, weight, systolic blood pressure (sbp), diastolic blood pressure (dbp), fasting blood glucose (fbg), triglycerides (tg), and high - density lipoprotein cholesterol (hdl - c). in addition, we researched the health behaviors (including exercise, smoking, and alcohol drinking) of the intervention subjects using the self - response questionnaire at the beginning and the end of the project. evaluation indexes were the changes of ms and its components (body weight, blood pressure, blood glucose, blood lipids) and the stage of change in health behaviors. all analyses were performed on persons who completed the ms intervention and had the health examination and health behavior test at baseline and 2 years. mean and standard deviation (sd), frequency, and ratio were used to describe the basic situation of the indicators. paired t - test, mcnemar test, and wilcoxon paired rank - sum test participants with ms (based on the chinese diabetes society 2004 criteria) ; participants aged 45 years and above. inability to exercise ; healthy life self - help program was run by the community health services center. since the main working methods are health education, health guidance, and health intervention, people in the program can take part in activities like regularly self - help health examination, health knowledge lecture, prevention measure guide, and early disease screening, which can help residents adopt a healthy lifestyle, make early health interventions, lead people to self - involvement and self - management, and improve the quality of life. details were as follows : diagnostic equipment such as a food quantitative model, automatic arm tube type blood pressure monitor, automatic height and weight measurement instrument, blood glucose meter, body fat meter, and rehabilitation activities equipment are furnished in the program for the subjects. with the food quantitative model, patients could make diet choices more intuitively, feeling the weight, size, and thickness of food by looking and touching. with other equipment we measured height, all the measures above are free so we can constantly monitor different factors of the subjects, and we can also help the subjects strengthen the sense of self - management. lectures and on - site consultation were held for the subjects, during which physicians and nurses would give lectures about basic knowledge of diabetes, diet therapy, exercise therapy, medication, and so on. other activities aimed to develop self - management skills and establish confidence in improving health for the subjects, such as training on blood glucose monitoring and insulin injection. we identified the tcm constitution of the subjects using the software named tcm constitution evaluation system. on the basis of the evaluation results, we used acupuncture, massage, daoyin, tai chi, and meridian flap to mobilize the residents body s natural balance fully. at the same time, we used diet and medication to complement the vigor of the residents, which can improve the body s resistance to disease inside and outside. details were as follows : give different dietary suggestions to different subjects according to their tcm constitution so as to keep the balance of yin and yang. eat less starch products like chinese yam, less oily foods like peanuts, less high - cholesterol foods like yolk. so we took tcm treatments respectively depending on the subjects tcm constitution, which can improve the body s internal environment. at the same time, we took treatments of tonifying to avoid the liver and kidney damage because of the long - term use of western medicine, took traditional massage and medicinal food diet to delay the complications of ms. training in tai chi was held for the subjects every week. according to the theory of yin and yang, 5 elements and viscera meridian of tcm, teaching the ms patients special exercises such as baduanjin qigong, to help them establish the coordination of body and mind. we used methods like tai chi, health qigong, massage, acupoint pressure, and meridian flap to dredge the meridian and adjust the qixue of the ms patients. warm - up before exercise and cool - down after exercise are also essential to keep the balance of yin and yang. healthy life self - help program was run by the community health services center. since the main working methods are health education, health guidance, and health intervention, people in the program can take part in activities like regularly self - help health examination, health knowledge lecture, prevention measure guide, and early disease screening, which can help residents adopt a healthy lifestyle, make early health interventions, lead people to self - involvement and self - management, and improve the quality of life. details were as follows : diagnostic equipment such as a food quantitative model, automatic arm tube type blood pressure monitor, automatic height and weight measurement instrument, blood glucose meter, body fat meter, and rehabilitation activities equipment are furnished in the program for the subjects. with the food quantitative model, patients could make diet choices more intuitively, feeling the weight, size, and thickness of food by looking and touching. with other equipment we measured height, all the measures above are free so we can constantly monitor different factors of the subjects, and we can also help the subjects strengthen the sense of self - management. lectures and on - site consultation were held for the subjects, during which physicians and nurses would give lectures about basic knowledge of diabetes, diet therapy, exercise therapy, medication, and so on. other activities aimed to develop self - management skills and establish confidence in improving health for the subjects, such as training on blood glucose monitoring and insulin injection. we identified the tcm constitution of the subjects using the software named tcm constitution evaluation system. on the basis of the evaluation results, we used acupuncture, massage, daoyin, tai chi, and meridian flap to mobilize the residents body s natural balance fully. at the same time, we used diet and medication to complement the vigor of the residents, which can improve the body s resistance to disease inside and outside. details were as follows : give different dietary suggestions to different subjects according to their tcm constitution so as to keep the balance of yin and yang. eat less starch products like chinese yam, less oily foods like peanuts, less high - cholesterol foods like yolk. so we took tcm treatments respectively depending on the subjects tcm constitution, which can improve the body s internal environment. at the same time, we took treatments of tonifying to avoid the liver and kidney damage because of the long - term use of western medicine, took traditional massage and medicinal food diet to delay the complications of ms. training in tai chi was held for the subjects every week. according to the theory of yin and yang, 5 elements and viscera meridian of tcm, teaching the ms patients special exercises such as baduanjin qigong, to help them establish the coordination of body and mind. we used methods like tai chi, health qigong, massage, acupoint pressure, and meridian flap to dredge the meridian and adjust the qixue of the ms patients. warm - up before exercise and cool - down after exercise are also essential to keep the balance of yin and yang. this was a 2-year before - after study, conducting health physically examination at baseline and 2 years later, including the measurement of height, weight, systolic blood pressure (sbp), diastolic blood pressure (dbp), fasting blood glucose (fbg), triglycerides (tg), and high - density lipoprotein cholesterol (hdl - c). in addition, we researched the health behaviors (including exercise, smoking, and alcohol drinking) of the intervention subjects using the self - response questionnaire at the beginning and the end of the project. evaluation indexes were the changes of ms and its components (body weight, blood pressure, blood glucose, blood lipids) and the stage of change in health behaviors. all analyses were performed on persons who completed the ms intervention and had the health examination and health behavior test at baseline and 2 years. mean and standard deviation (sd), frequency, and ratio were used to describe the basic situation of the indicators. paired t - test, mcnemar test, and wilcoxon paired rank - sum test figure 1 is the flow chart of the study population. there were 13 912 people who participated in our research at baseline and 1334 of them were ms patients. among the patients, 598 people accepted the intervention and had health examination and health behavior questionnaire after intervention 56.5% of the 598 people were women ; 52.8% were 60 years old and above ; 60.9% of them were postgraduate ; 0.3% of them were unmarried ; 77.3% of them had joined the basic medical insurance for urban workers, and 21.4% of them had participated in the basic medical insurance for urban residents. after 2 years of intervention, 57.0% (341 persons) of the subjects no longer had ms. there were 3.8% (23 persons) of the subjects with zero components of ms, 16.2% (97 persons) of the subjects were had 1, and 37.0% (221 persons) of the subjects had 2 components. figure 2 shows the change of the abnormal rate in ms components between baseline and 2 years later. there were statistically significant reductions in the abnormal rate in bmi (=100.744, p<0.001), blood pressure (= 192.604, p<0.001), fbg (=38.837, p<0.001), and tg (=92.263, p<0.001). there was a reduction in hdl - c, but the reduction was not statistically significant. there were reductions in bmi, sbp, dbp, fbg, and tg and the reductions were statistically significant (p<0.05). after 2 years of comprehensive intervention, among those 553 persons who were overweight or obese, 122 of them recovered to normal weight, and the recovery rate was 22.1% (122/553). the recovery rate of blood pressure, fbg, tg, and hdl - c were 40.5%, 37.9%, 32.8%, and 62.4%, respectively. table 3 shows the 598 subjects change in health behaviors at baseline and 2 years later. wilcoxon paired rank - sum test showed that there was a statistically significant of change in exercise (p<0.001) between baseline and 2 years later 72.9% (422 persons) of the 579 persons who did nt do any exercise at baseline began to participate in physical exercise 2 years later and 15.8% (3 persons) of the 19 persons who did exercise at baseline did nt carry on 2 years later. the difference of rate in smoking was statistically significant (p<0.001) 34.8% (55 persons) of the 158 smokers at baseline had quitted smoking 2 years later and 15.5% (68 persons) of the 440 non - smokers began to smoke. 34.5% (50 persons) of the 145 persons who drink alcohol quitted drinking 2 years later and 19.4% (88 persons) of the 453 persons who did nt drink alcohol became drinkers. figure 1 is the flow chart of the study population. there were 13 912 people who participated in our research at baseline and 1334 of them were ms patients. among the patients, 598 people accepted the intervention and had health examination and health behavior questionnaire after intervention 56.5% of the 598 people were women ; 52.8% were 60 years old and above ; 60.9% of them were postgraduate ; 0.3% of them were unmarried ; 77.3% of them had joined the basic medical insurance for urban workers, and 21.4% of them had participated in the basic medical insurance for urban residents. after 2 years of intervention, 57.0% (341 persons) of the subjects no longer had ms. there were 3.8% (23 persons) of the subjects with zero components of ms, 16.2% (97 persons) of the subjects were had 1, and 37.0% (221 persons) of the subjects had 2 components. figure 2 shows the change of the abnormal rate in ms components between baseline and 2 years later. there were statistically significant reductions in the abnormal rate in bmi (=100.744, p<0.001), blood pressure (= 192.604, p<0.001), fbg (=38.837, p<0.001), and tg (=92.263, p<0.001). there was a reduction in hdl - c, but the reduction was not statistically significant. there were reductions in bmi, sbp, dbp, fbg, and tg and the reductions were statistically significant (p<0.05). after 2 years of comprehensive intervention, among those 553 persons who were overweight or obese, 122 of them recovered to normal weight, and the recovery rate was 22.1% (122/553). the recovery rate of blood pressure, fbg, tg, and hdl - c were 40.5%, 37.9%, 32.8%, and 62.4%, respectively. table 3 shows the 598 subjects change in health behaviors at baseline and 2 years later. wilcoxon paired rank - sum test showed that there was a statistically significant of change in exercise (p<0.001) between baseline and 2 years later 72.9% (422 persons) of the 579 persons who did nt do any exercise at baseline began to participate in physical exercise 2 years later and 15.8% (3 persons) of the 19 persons who did exercise at baseline did nt carry on 2 years later. 34.8% (55 persons) of the 158 smokers at baseline had quitted smoking 2 years later and 15.5% (68 persons) of the 440 non - smokers began to smoke. 34.5% (50 persons) of the 145 persons who drink alcohol quitted drinking 2 years later and 19.4% (88 persons) of the 453 persons who did nt drink alcohol became drinkers. after 2 years of the intervention, 57.0% (341 persons) of the subjects no longer suffered from ms. there were statistically significant reductions in the abnormal rate and value of bmi, blood pressure, fbg and tg. compared with the results of the network platform health behavior intervention in south korea in 2014, our intervention seems to be more effective and consistent in reducing sbg (from 132.0315.27 to 129.2117.80) and dbg (from 84.7913.07 to 86.968.91). in addition, there were different degrees of improvement in ms components (recovery rate of bmi, blood pressure, fbg, tg and hdl - c were 22.1%, 40.5%, 37.9%, 32.8%, and 62.4%, respectively), which is similar with the results of the 2012 health behavior intervention project in south korean (recovery rate of blood pressure, fbg, tg, hdl - c were 46.4%, 29.8%, 51.2%, and 59.4%, respectively). after the intervention, the health behaviors of the intervention subjects had improved, too. there were statistically significant differences in exercise, smoking, and alcohol drinking between baseline and 2 years later 72.9% of the 579 persons who did nt do any exercise began to participate in physical exercise 2 years later, and the participation rate of physical activity had increased from 3.2% at baseline to 73.2% 2 years later. compared with the geneva (switzerland) research result that behavioral intervention increased the participation rate of physical activity by 3.4% (p<0.05), this intervention seemed to have a better effect in that it could motivate more ms patients to do exercise. this may be because the subjects in our intervention were all rural residents who had little health knowledge and lack of health consciousness before the intervention. the ms interventions conduct an intense training of tai chi for the patients with ms in the community every week. after a period of study, it activated subjects body and soul, and it increased the enthusiasm of the subjects to participate in the exercise. it provides symptomatic treatment to patients with hypertension, hyperglycemia, or hyperlipidemia according to their physical characteristics, so as to improve the environment of the body and relieve symptoms effectively. it can also protect those patients from liver and kidney damage under the condition that they take medicine through tonifying adjustment. in addition, with traditional massage, medicated diet, and other therapies, it can relieve the complications caused by diabetes or hypertension. for different people, tcm will adopt different therapies to help patients keep fit, strengthen vital qi to eliminate pathogenic factors, and consequently improve living quality. using integrated traditional chinese and western medicine technology on the basis of community health service, carrying out the intervention, and management of ms to rural residents can both take advantage of traditional chinese medicine and adapt to the specific characteristics of rural communities so that it can be popularized and used in similar regions. 15.8% of the 19 persons who did exercise at baseline did nt carry on 2 years later and 15.5% of the 440 non - smokers began to smoke at 2 years, and 19.4% of the 453 persons who did nt drink alcohol became drinkers at 2 years. the intervention implementers tended to pay more attention to those with bad health behaviors so that these people would have more motivation to reduce bad behavior. in contrast, those subjects without bad health behaviors had less health awareness and were reluctant to participate in the intervention. this phenomenon reminds us that during the process of behavior intervention, it s not enough to only aim at the high risk group, it s more important to aim at the general population. this means that we can not conclude that the improvement in ms was due to our intervention alone. there may be other factors such as participation, which may promote ms patients to pay more attention to their health, which could also affect the attitude to health and the health behaviors of the ms patients. another limitation is the selection of the subjects of study. in the process of the intervention, and many people left the project. only studying people who insisted on the intervention and health examination could overlook the characteristics of the group that quit midway. moreover, information bias could have partly influenced our results because the staff and instrument used in the 2 health examinations were different. therefore, it is necessary to design randomized controlled trials to better evaluate the effect of the integrated traditional chinese medicine and western medicine ms intervention. the main advantage of this study is the application and practice of the integrated traditional chinese and western medicine ms intervention in rural communities. our integrated traditional chinese and western medicine ms intervention was effective in deceasing most of the parameters of the syndrome, especially blood pressure, and it helped people to do more exercise. further studies of ms interventions in rural communities should focus on how to solve the problem of compliance to improve the effect of the intervention. | backgroundto explore the feasibility and efficiency of community - based integrated traditional chinese medicine (tcm) and western medicine metabolic syndrome (ms) intervention in rural residents.material/methodsthe ms intervention was administered to 598 rural community residents aged 45 years and older in zhoushi from 2011 to 2013. subjects completed a health examination and health behavior questionnaire before and after the intervention. in the intervention, we designed a healthy life self - help program using tcm appropriate technologies for the subjects.resultsafter 2 years of intervention by means of integrated traditional chinese and western medicine, 57.0% (341 persons) of the subjects no longer suffered from ms. the recovery rate of bmi, blood pressure, fbg, tg, and hdl - c were 22.1%, 40.5%, 37.9%, 32.8%, and 62.4%, respectively. there were statistically significant differences in exercise, smoking, and alcohol drinking between baseline and 2 years later.conclusionsthe integrated traditional chinese and western medicine ms intervention was effective in deceasing most of the parameters of ms, especially blood pressure, and helping people to do more exercise. the program would be useful to implement in other similar populations. |
gingival recession, which is a popular finding in different societies even among people with a good oral hygiene, refers to the apical movement of the gingival margin under the cement enamel junction (cej) followed by the exposure of root surfaces. gingival recession is influenced by age ; with an 8% prevalence among children and a 100% prevalence in the older than 50 years age group. the most important etiologic factors resulting in gingival recession would be tooth malposition, traumatic tooth brushing, increasing brushing frequencies, tooth mobility, alveolar bone dehiscence, inadequate attached gingiva, high frenum and mascular attachments and iatrogenic factors related to the location of restoration margin and periodontal treatment procedure. recession rarely leads to tooth loss but due to its consequences such as heat and tactile sensitivity, esthetic problems and increased root caries potential, root coverage seems necessary. different root coverage techniques have been already suggested ; namely, free soft tissue graft, sliding flaps, double papilla graft, coronally positioned flap, subpedicle connective tissue graft, connective tissue graft and pedicle, connective tissue graft and pouch and guided tissue regeneration. although subepithelial connective tissue graft (sctg), known as the golden standard, provides us with a higher rate of predictability and an acceptable aesthetic with a mean of 89% root coverage, its limitation such as the limited amount of available graft and the existence of two surgical sites leads to more inconvenience, pain and bleeding for the patient. recently, use of an acellular dermal matrix allograft (adma) has been proposed as a technique to obtain root coverage [1723 ]. alloderm (adma) is derived from the human skin ; the epiderm and all dermal cells are eliminated through chemical procedures and the bioactive matrix is preserved and freeze - dried. through cell elimination, infection resources, disease transfer and immunologic responses are deleted. as a result, the integrity of acellular matrix is preserved and the inflammatory responses are prevented [2426 ]. using alloderm, acceptable results of sctg could be achieved without the need to obtain a connective tissue graft from the palate.the amount of root coverage in some short - term studies (612 months) through sctg and adma have been mentioned as 97.8%95.9%, 64.9%66.5%, 88.7%89.1%, 70.12%72.08% and 69.05%85.42%, respectively. considering the differences in root coverage, the goal of the present study was to compare the amount of root coverage resulting from adma and sctg associated with coronally advanced flap among patients referred to the periodontics department of the dental branch of the islamic azad university, tehran. after the approval of the ethical committee by number 15044, this split - mouth randomized clinical trial was performed on 5 patients (2 males-3 females) with the mean age of 37.68.26 years (range, 2647), with a bilateral miller s class i and ii gingival recession greater than 2 mm on 3 canines and 15 premolars. the subjects were excluded from the study in case of any systemic and autoimmune diseases, smoking, history of periodontal surgery during the last 6 months on the mentioned area, taking medicine such as nifedipine, phenytoin and cyclosporine, pregnancy, the presence of any buccal caries or fillings on the intended teeth, negative response to cold test and presence of movable partial prosthesis. the patients were informed of the type of rendered treatment, agreed to the study protocol, and signed an informed consent prior to treatment. scaling and root planing were performed and the plaque index was measured through the oleary method. after two weeks, the patients were revaluated and the those with good oral hygiene (plaque index<15%) were selected. periodontal parameters included probing depth (pd), recession height (rh) from cej to gingival margin, recession width (rw) mesiodistal recession at cej, clinical attachment level (cal) and keratinized gingiva (kg). to determine the width of the keratinized gingiva, the role test was used. prior to and 6 months after surgery were recorded in millimeters using williams probe (hu - friedy) and rounded to the nearest 0.5 mm. all surgeries were performed by one person. following local anesthesia (2% lidocaine with 1:80000 epinephrine) two short horizontal incisions on both sides of the receded root the upper part of the papillae was de - epithelialized and then two vertical incisions were made and extended apically 2 mm beyond the mucogingival junction. the partial thickness flap was elevated and root planing using gracy s 3/4 curettes was performed. sctg and adma were randomly (toss of coin) applied for the control and test groups. alloderm (lifecell, biohorizen, birmangham, al.) at a thickness of 0.891.65 mm following rehydration in two saline bowls, according to the company instruction, was trimmed and placed from the basement membrane toward the tooth and periosteum. for the controls, the palatal connective tissue was grafted. all grafts were sutured to the surrounding tissue with two 5 - 0 silk in the mesial and distal corner through the interrupted technique and covered using the coronally advanced flap and fixed with the sling suture. amoxicillin, 500 mg 3 times a day for 7 days and ibuprofen, 400 mg twice a day for 3 days were prescribed. the patients were explained not to brush the area for 3 weeks and avoid any kind of pressure and trauma. the patients were instructed to clean the surgical area with a cotton pellet soaked in chlorhexidine solution twice a day for 30 days. clinical examinations and prophylaxis were practiced in recall sessions (at 2, 4 and 6 months post surgery) and rh, rw, kg, cal, pd were measured and recorded at both sides. the wilcoxon signed rank test was used to analyze whether clinical measurements differed before and after treatment. the number of 9 pairs of miller s class i and ii gingival recessions in 5 patients (2 males and 3 females) with the mean age of 37.68.26 were treated applying sctg and adma. all patients were investigated at 2, 4 and 6 months and the oral hygiene was controlled during this period showing no special problem except for one patient having 4 pairs of recessions. the investigated parameters including : rh, rw, kg, cal and pd are shown in table 1 displaying similar results for both groups at the baseline. the recession heights in sctg and adma groups reduced from 2.661.11 mm to 0.440.52 mm and from 2.661.00 mm to 0.881.05 mm, respectively, revealing significant changes. comparing the two groups, rh did not show any significant difference after 6 months (table 1). the changes in rh, rw, kg and cal were meaningful after 6 months and comparing the groups, the parameter differences were not significant (table 2). pd was the only parameter displaying no significant change, which due to its first normal value would be an acceptable result. the amount of root coverage is shown in table 3 revealing no significant difference between the two techniques ; 85.74% and 71.11% in control and test groups, respectively. in the sctg group, 55.55% of the samples showed 100% root coverage and in the adma group, 44.44% of the sites had 100% root coverage. the results of this study showed that sctg and adma were effective on root coverage leading to 86% and 71% root coverage in a 6-month period, respectively. the amount of rh, rw, kg and cal showed significant differences after 6 months in both groups ; however, that of pd did not display any change. the average root coverage resulted from using alloderm in several short - term studies (612 months) were reported as 63.9% and 79%, 95.9%, 66.5%, 86%, 83.2%, 89.1%, 72% and 85.42%. the amount of root coverage reported from long - term studies (1848 months) reduced from 91.7% (12th week) to 87% (18th month) and from 93.4% (619 weeks) to 65.8% (48th month). therefore, the results gained from this study (71% for adma) and (86% for sctg) matched with those of other studies. moreover, these results could be compared with 89% root coverage of the sctg technique, namely the golden standard. it should be noted that these results were influenced by one of the patients possessing 4 pairs of gingival recessions whose healing stages were not satisfactorily due to alloderm exposure during the several first weeks. if this patient was excluded from the study, the amount of rh reduction would be 2 mm and 1.8 mm in the test and control groups, respectively, resulting in 90% root coverage for both groups. such a significant difference is mostly related to alloderm group, because sctg, despite its exposure is able to survive. so if it is not covered no problem exists, however, due to the invitality of alloderm, its revascularization happens only in contact with vital tissues. barros proved that through applying the new technique transferring the vertical incisions to the neighbouring teeth caused a 79% root coverage as compared with the controls (63%). however, the measured root coverage, in the present study, would be 71% as average in the adma group which is more than that of barros s control group. therefore, it is suggested that mesiodiastal flap extension may have no special effect on the results. rahmani obtained 70% and 72% root coverage in sctg and alloderm groups, respectively, although harris revealed a 97.4% root coverage using sctg and double pedicle graft. in rahmani s study, 55% of the recessions were on premolars while this figure was 16% in harris s study. in the present study, none of the 9 pairs of recessions were incisors, whereas 83% were on premolars and 17% on canines. although applying sctg on various widths leads to successful results, it sounds that the increased recession width influences the rate of adma success. the recession height in the alloderm group was 2.66 mm, 1.55 mm, 1.33 mm and 0.88 mm at baseline, 2 months, 4 months and 6 months, respectively. the differences in rh between the groups were partially significant at 4 months, however, no statistically significant difference was shown at 6 months between the two groups displaying that both techniques could be effective in root coverage. in this study, reduction in the recession height at 4 to 6 months in the alloderm group could be attributed to the coronal movement of the gingival margin on the denuded roots following tissue grafts. creeping attachment starting at one month after graft up to one year, has been referred in several studies. harris referred to 0.85 mm creeping attachment through sctg following one year and piniprato referred to 0.43 mm through the coronally advanced flap. whereas, woodyard (from 2 to 6 months) and henderson (from 2 to 12 months) using alloderm did not show any creeping attachment indicating a high amount of coverage at the beginning with no more healing after 2 months. although there is no report of creeping attachment using alloderm in other studies, the only reason of the increase in root coverage in this research maybe should be linked to creeping attachment. karring pointed out that following the insertion of sctg under the coronal flap, the connective tissue would be able to induce epithelial cells for keratinization but alloderm keratinization is not clear. in fact, alloderm is totally incorporated inside the tissue with no absorption or exfoliation. novaes referred that alloderm could just exist physically under the gingival tissue and could be felt clinically without any keratinization after 6 months. in most studies, for example tal showed 107% and 36% increase of kg in the sctg and adma groups, respectively. barros, novaes, rahmani proved no significant changes in kg between the groups after 6 months. in the present study, kg differences after 6 months in alloderm and connective tissue groups would be 2 mm and 1.4 mm, respectively, which are both significant and with no significant difference between the two groups, the results were the same as barros, novaes and rahmani results. although harris s short - term study showed kg increase as 1 mm and 2.6 mm for alloderm and sctg groups, respectively, revealing a significant increase only for sctg group, it should be noted that the mentioned study was not a blind type and sctg was used for cases with less keratinized tissue. anyway, evaluation of the results based on probe measurement and rounded figure can definitely yield errors. in order to explain less amount of kg in the alloderm group compared to the sctg group, wei, in their histologic investigation of two techniques, mentioned that adma is not able to induce an appropriate keratinization in the epithelial cells. according to shin and mahajan studies, the iodine test has not been used to evaluate kg in this research. the distance between mucogingival junction and gingival margin has been measured and recorded visually. in cases which specifying mucogingival junction seemed difficult, it is possible that with an increase in the amount of attached tissue and measuring it between 46 months in the alloderm group, the amount of kg has also been soared. in the present study, the alloderm basement membrane, in correspondence with the study of barros, novaes, harris, tal and mahjan the most important reason according to tal would be that the connective tissue matrix of alloderm is placed toward the connective tissue of the covering flap causing vascularization in this way, although henderson claimed that a root coverage of 93% could be achieved apart from alloderm direction. in some studies reporting less root coverage, such as those by novaes, the direction of the connective matrix was toward flap ; while, in the study by aichelman its direction was toward the root. in the present study, root planing was the only technique applied for the reduction of root convexities, using this technique, hirsch displayed 95.9% and 97.8% root coverages by alloderm and sctg, respectively and rahmani in the same way showed 72% and 70% root coverage. different techniques are available for root surface preparation. in some studies, use of chemical solutions such as tetracycline and edta are also suggested for root planing. tal showed 89.1% and 88.7% root coverage in adma and sctg groups, respectively through tetracycline application for root conditioning. barros obtained a 63.9%79% root coverage through the conventional and modified technique, respectively using edta for root conditioning along with adma. it should be mentioned that none of these studies are able to prove the priority of the chemical solution for root conditioning. due to the importance of surgeon experience, it should be noted that all surgical procedures were performed by one skillful surgeon based on similar techniques. the type of suture was (5 - 0) silk 16 mm which was applied according to single interrupted and sling sutures. the type of suture based on the absorbable type, may play an important role in other studies [2224 ], but regarding 100% coverage in 50% of the samples in both groups, the suture type may not play an important effect. it may be concluded that alloderm is able to yield acceptable results compared to sctg in treating shallow to moderate gingival recessions, simplifying the surgery, eliminating the need for a second surgical site and permitting the one - stage treatment of an unlimited number of defects. | objective : different surgical procedures have been proposed for the treatment of gingival recessions. the goal of this study was to compare the clinical results of gingival recession treatment using subepithelial connective tissue graft and an acellular dermal matrix allograft.materials and methods : the present study was performed on 5 patients with 9 bilateral miller s class i or ii gingival recessions. this included 15 premolars and 3 canines. in each patient the teeth were randomly divided in two groups of test (adma) and control (sctg). clinical parameters including recession height (rh), recession width (rw), keratinized gingiva (kg), clinical attachment level (cal) and probing depth (pd) were measured at baseline, 2, 4 and 6 months after surgery and data analysis was performed using the wilcoxon signed rank test.results:the mean changes (mm) from baseline to 6 months in sctg and adma were 2.220.83 and 1.770.66 decrease in rh, 2.550.88 and 2.330.86 decrease in rw, 1.440.88 and 2.01.11 increase in kg, 2.331.22 and 2.110.6 decrease in cal and finally 0.220.66 and 0.330.7 decrease in pd, respectively. the differences in mean changes were not significant between the two groups in any of the parameters. the percentage of root coverage was 85.7% and 71.1% for the control and test group, respectively. the changes from baseline to the 6 month visit were significant for both groups in all parameters but pd.conclusion:alloderm may be suggested as an acceptable substitute for connective tissue graft considering the root coverage effect and kg width increase. |
a 66-year - old man presented to the out patient department with a painless swelling on the medial half of the right lower lid. it was of insidious onset, gradually increasing in size over the past eight years. fine needle aspiration cytological examination of the lesion yielded only blood and diagnosis could not be established. he was a known diabetic and hypertensive, on treatment for the past eight years. examination of the lids and adnexa of the right eye revealed a single, soft, non - tender swelling measuring 21.91 cm [fig. 1 ] with a lobulated surface, arising from the medial half of the lower lid. the mass was causing a cosmetic deformity and so microsurgical excision with reconstruction of the lower lid was planned under local anesthesia. a pentagon full - thickness resection of the tumor mass with microscopically clear margins on all sides was done and the tissue sent for histopathology examination. the defect created by this resection was a little less than half of the eyelid. since the lower lid tissues were already stretched by the presence of the tumor, lid repair was possible with lateral cantholysis alone. the lid defect was closed in layers using 6 - 0 polyglactin sutures and the lids were apposed using a frost suture. routine postoperative care was given to the patient and the frost sutures were removed after 48 h. the patient on serial follow - up was normal at six months with no evidence of recurrence. 3b ] arranged in small fascicles in an alcian blue positive myxoid stroma. in each nodule, fine wavy bundles and swirling whorls of collagen (highlighted by reticulin silver stain) enclosing the elongated schwann cells and mast cells were observed. immunostatin for neurofilament revealed occasional clusters of axons while the cells in the lesion were not immunolabeled for antibodies to desmin and cytokeratin. the features were characteristic of neurothekeoma - myxoid variant. the presence of axons and absence of entrapment of adnexal structures with s-100 positivity of the cells differentiated this lesion from superficial angiomyxoma which was a very close histological differential diagnosis. myxoid neurothekeoma or nerve sheath myxoma is a rare benign neoplasm of putative peripheral nerve sheath origin first described in 1969 by harkin and reed6 and subsequently termed neurothekeoma by gallager and helwig in 1980.1 it often affects the skin with predilection for the face and extremities of young adults. they are often solitary and may be either asymptomatic or may present as a painful, raised, skin - colored, well - circumscribed dome - shaped nodule less than 3 cm in diameter. the tumor occurs in a myxoid or classic variant, cellular variant and an intermediate (mixed) variant,7 the myxoid variant being relatively common. this lesion forms an important differential diagnosis for myxoid soft tissue tumors, especially the benign ones. although excision is the mode of treatment for these benign myxoid tumors, proper histopathological typing is needed as some of these tumors like superficial angiomyxoma show tendencies towards local recurrence and may be associated with syndrome complex like association of superficial angiomyxoma with carney complex,8 an autosomal dominant syndrome complex comprising myxomas of heart and skin, hyperpigmentation of the skin (lentiginosis) and endocrine overactivity.9 the myxoid neurothekeoma lesions are consistently positive for s-100 proteins. they are also known to be positive for vimentin but negative for cytokeratin, desmin, cd34, sma (smooth muscle actin). these lesions can also sometimes show multinucleate cells, focal nuclear atypia, foci of ossification and cartilaginous metaplasia. this case was unique in that the patient was a male in the elderly age group. although neurothekeoma is rare, the clinician should consider this entity in the differential diagnosis of solitary nodule of the eyelid, as it is imperative to distinguish it from malignant lesions so that aggressive therapy can be avoided. the treatment of choice is excision with clear margins and no recurrences have been reported. | the purpose of this article is to describe a rare benign tumor of nerve sheath origin arising from the eyelid in an elderly male. local excision was done and histopathological examination revealed a neurothekeoma. six months later the patient was doing well with no recurrence. the case was unique in that the patient was an elderly male while neurothekeoma is commonly seen on the face of young adults, especially females. |
the various reconstructive options available for resurfacing of this region range from split thickness skin grafts and ultrathin flaps to local or free flaps. in the facial region, one has to take account of the aesthetic units and provide an appropriately thin flap to restore both form and function. a locoregional flap should also leave a minimum of donor site morbidity and preferably be hidden beneath the clothing. according to gillies ' concept, the more adjacent the donor site is, the better the skin will match the recipient site (1). regional muscle flaps namely pectoralis major myocutaneous flap owing to its bulk is difficult to handle and inset into a 3 diemensional defect ; additionally in females the bulk due to breast tissue complicates intraoperative handling and insetting. further the resultant breast deformity is a source of concern to young women. in males this is a relatively less hairy zone than the anterior chest in males and can therefore be exploited for interior mucosal lining. free flaps need special microvascular expertise, added operating time in patients and increase costs due to prolonged hospital stay and operating theater time. the need of the hour is a flap which has the advantages of both regional flap (reliable and easy to harvest) and free flap (thin, pliable good colour match). supraclavicular artery flap is a fasciocutaneous flap based on supraclavicular artery, a branch of the transverse cervical artery, less frequently it arises from, the suprascapular artery, though reliable, is not a very large vessel. venous drainage is usually accompanied by transverse cervical vein which should be identified at its upper extent by carefully preserving external jugular vein which drains the distal portion of the flap. in this study (2011 - 2012) we recount our experience with respect the utility of supraclavicular artery flap in head and neck oncologic defects in 11 consecutive cases done by senior author (ams). after taking informed consent from patients, this report is a prospective study of cases who underwent supraclavicular artery flap between 2011 and 2012 of which 5 were males and 6 females. cases included 8 mucosal lining reconstruction, namely, resection palate (1case), inferior alveolus after marginal mandibulectomy (1), buccal mucsa resurfacing following composite resection for buccoalveolar cancer (1), full tubed hypopharyngeal defect after circular pharyngectomy (2), partial hypopharyngeal defect with near total laryngectomy (2), and 4 cervicofacial skin defects (2 from parotid composite defects, 1 after post auricular skin reconstruction following temporal bone and 1 cheek defect post oral cancer). almost all reconstructions were executed on untreated malignant tumors except 1 which was a salvage case for through and through cheek defect following radical radiotherapy. the skin island was designed to fit the resultant defect and was based on the transclavicular vascular pedicle in all cases and almost all donor sites could be closed primarily after undermining. the flap design was as follows : the outline of the flap was centered over the deltoid - acromial prominence with the size of the defect being designed lateral to the anterior border of the trapezius muscle ; the pedicle length which decided arc of transposition is calculated from this point. all the patients were counseled preoperatively about a visible scar over the donor site and the possibility of stretching of the scar postoperatively was explained. patient was placed in supine position with bags under shoulder and ipsilateral hand is extended. it is important to ascertain absence of metastasis at level 4 and lower level 5 at the end of the resection or by preoperative evaluation. provided that there are no nodes in supraclavicular and posterior triangle, (which is bound anteriorly by posterior border of sternocledomastoid, posteriorly by anterior border of trapezius and inferiorly by the clavicle is marked) (figure 1). pedicle of supraclavicular artery flap lies in this triangle deep to the belly of the omohyoid parallel to the clavicle. in the present study, flap outline is marked posteriorly 2 cm anterior to spine of scapula, anteriorly a line parallel to posterior line in front of clavicle, while lateral margin can be extended 2 cms lateral to deltopectoral groove. the communicating perforators from the deltoid branch of the thoraco - acromial axis and posterior circumflex humeral artery are sacrificed. the flap is raised at a subfascial level just superficial to deltoid muscle by sharp knife dissection (avoid monopolar cautery / hot knife to reduce thermal damage) taking care to continuously irrigate with saline as it is elevated proximal towards its pedicle which is visualised all along the anterior border at trapezius. in the upper neck above the apex of posterior triangle plane of elevation is subplatysmal, but this is better avoided in lower part of the neck overlying the triangle. extreme caution must be exercised not to raise the fibrofatty pedicle in which lie the vessels an ascending branch that traverses upwards parallel to anterior border trapezius and deep branch which pierces deep to the trapezius parallel to the lateral third of the clavicle. the flap is free to be transposed into the defect which can range from the lateral skull base for subtotal temporal bone defects to intraoral defects. special care is taken not to elevate the pedicle with its fatty adipose tissues from the floor of posterior triangle (figure 2). near the point of exit of the supraclavicular vessels, the dissection is done preserving a fascial pedicle of about 35 cm in width. the raised flaps are observed for bleeding from the distal end to ensure intraoperative flap viability. the length of the subcutaneous pedicle depends on distance from the medial edge of the defect medial to the lateral third of clavicle where muscle of trapezius insert. the area of the pedicle that has to be buried under skin flaps are de - epithelized preserving the subcutaneous over the superficial aspect of the fat flap in entirety. arc of rotation can be increased by excising carefully the epithelial component sans subcutaneous fat paddle between anterior edge of the trapezius, posterior edge of the sternocleidomastoid and reflecting the clavicular periosteal lining by a freer elevator on its anterior, superior, and inferior aspects which are then cross - hatched to gain 3 cms additional length ; if still there is need for additional mobility then one can transect the sternal and clavicular heads of the sternocleidomastoid muscle flush with the clavicle and manubrium elevating it as a fasioareolar pedicle flap whose base in the triangle is left undisturbed to confer protection to the vessels from tension / torsion. such a fully mobilized flap is transposed into defect ; intervening skin not needed for closure of defect is de - epithelized. the inset is done in two layers : subcutaneous with absorbable 3 - 0 polygalactin 910 (vicryl) and skin with nonabsorbable 3 - 0 nylon (ethilon) sutures. a suction drain was used to drain the flap and the donor site, which was removed by the third postoperative day. primary closure of donor site is done after undermining the chest and skin over scapula both anteriorly and posteriorly, respectively. if there is difficulty in approximating the flaps over acromion closure by split skin grafting is done. postoperatively flap was monitored for complications such as flap viability, hematoma, avoiding constricting skin bridges, constricting bandages to prevent vessel compression, and finally avoidance of excessive low temperature in the intensive care unit as well as hypotension. a 28-year - old female with adenoid cystic carcinoma of parotid with skin infiltration under parotdiectomy had defect measuring 4 cm 6 cm. underwent supraclavicular flap reconstruction for skin cover and to prevent retromandibular hollow (figure 4). a 50-year - old female with carcinoma of junction of hard and soft palate underwent wide local excision via lower cheek flap and midface degloving resulting in a palatal defect of 5 cm 6 cm defect was closed with supraclavicular flap tunneled under mandible (figure 5). a 50-year - old male with carcinoma pyriform fossa after resection had defect of 4 cm 6 cm underwent pharyngoplasty with supraclavicular artery flap. eleven cases underwent supraclavicular artery flap between 2011 and 2012 of which 5 were males and 6 females (table 1). the surgical defect size ranged from 15 cms to 85 cm (pharynx was lined in 8 and cervicofacial skin in 3 with 1 failure in each group 1 total and 1 partial loss). mean flap dimension was 7 cm 12 cm (flaps needed for circular pharyngectomy defects figure 3approximately 15 cms (length) 7 - 8 cms below at esophageal stump and 1215 ms at oropharynx stump were distinctly larger than those lined pharynx by 20 sq cms). de - epithelization of intervening pedicle was undertaken in all those resurfaced oral - pharyngeal cavity and 1 of the 3 that were used for skin defects. mean harvesting time was 50 mintues (range 4062 minutes) and in - setting time took from 20 minutes in small defects to 70 minutes in full pharyngeal tubing. nine donor sites were closed primarily and 2 required split skin grafting. in the absence of complications the hospital stay ranged from 5 days (skin) to 9 days (inner lining). we encountered one complete flap loss (parotid region) which was debrided and resurfaced with split thickness graft. two patients developed pharyngocutaneous fistula out of 3 patients who underwent pharyngoplasty with the island skin remaining viable and dehiscence prevailing at mucosa - skin junction. one required formal repair with a pmmf flap for outer cover as well nearly 3 weeks after the failed flap - mucosa dehiscence while the second was managed by secondary suturing with successful outcome. other minor complications encountered were prolonged serous (lymphatic) discharge from neck wound (1) and epidermolysis and partial failure of flap that resurfaced palate (figures 5 and 7) (1). toldt, an anatomist, in an article cited by gillies 1923 was the first to illustrate and name the vessel arteria cervicalis superficialis which originated as a branch of thyrocervical trunk. in 1949, the first clinical application of a flap from the shoulder (charretera or acromial flap) was performed by kazanjian and converse. charretera, in spanish, means the shoulder area where honors are bestowed on military personnel. in 1979, the first anatomical studies were performed by mathes and vasconez, who described the vascular territory and clinical applications in head and neck reconstruction. he correctly described the supraclavicular artery as a perforator that arises from the transverse cervical artery in 93% of cases or from the suprascapular artery in 7% of cases. in the beginning of 1990s, pallua. rediscovered this flap and popularized its use by performing detailed anatomical studies examining the vascularity of what is known today as the supraclavicular island flap [57 ]. mean harvest time of supraclavicular artery flap was 50 minutes in our study, similar to that seen in chiu. which was less than 1 hour. mean harvest time in radial free forearm flap is 76 min and additional time for microvascular anastomosis prolongs surgery compared to supraclavicular artery flap. no handheld doppler was used to trace vascular pedicle. when there is nodal neck metastasis at level 4 and 5, this procedure may not be warranted in interest of oncologic safety especially when the primary lesion is located in the hypopharynx. the pedicle should not be tunneled under constricting bands of overlying neck skin when it is used to resurface defects above the mandible. these 2 factors were responsible for the one and only total flap loss for a post - parotidectomy defect. pharyngeal fistula after closure of pharyngeal defects was observed in 2 out of 3 patients, one was minor and was managed conservatively, while the other required a formal pmmf, shah. described the increased loss of cutaneous paddle and leak rates whenever the pmmf flap is inset for inner mucosal defects. fistula rates after radial free forearm flap have been reported to be 32% and pectoral major myocutaneous flap has been 1363% [10, 11 ]. so with similar fistula rates supraclavicular artery flap avoids need of specialized microvascular expertise and associated ease of insetting to resurface both mucosal defects and outer cutaneous defects due to its pliable nature (with respect to bulkiness of pectoral major flap especially in women and growth of hair when taken in the males). epidermolysis and partial flap failure was seen in one patient who was asthmatic and was on steroid treatment postoperatively for her asthmatic condition. donor site morbidity of supraclavicular artery flap in our study was minimal except for 2 patients requiring split skin grafting. while chiu. reported 2 cases of shoulder cellulitis and 1 shoulder wound dehiscence, its to be noted that chiu. did not use routine drain placement below the flap. in our study, as there is extensive undermining of flaps anteriorly and posteriorly there is increased chances of seroma formation postoperatively ; suction drains prevent and help in reducing wound complications. donor site morbidity of pectoral major flap includes loss of anterior axillary fold, distortion of breast form in females, and minor functional deficit due to loss of muscle. donor site morbidity of radial free forearm flap includes need of skin graft to close donor area, tendon injuries, reduced strength of grip power, and sensory disturbances. supraclavicular artery flap has no major cosmetic or functional morbidity compared to traditional pectoral major or radial free forarm flap while concealing donor site by indian type of dressing especially in females. now with reports of including middle supraclavicular nerve with flap a sensate flap can be constructed which may add to growing popularity in use of flap. this should be balanced against recent experience of senior author of 2 instances of dysesthesia in a series of 6 total tubing after circular hypopharyngectomy which will feature in an update of a larger series (ams). supraclavicular artery flap is a thin and pliable, versatile, reliable, and easy to harvest, with good cosmetic and functional outcome at both recipient and donor sites for one stage reconstruction of complex head and neck oncologic defects. it is an excellent alternative to traditional regional and free flaps and has great potential for becoming the gold standard for reconstruction of soft tissue defects in head and neck. | aim. head and neck oncologic resections often leave complex defects which are challenging to reconstruct. the need of the hour is a versatile flap which has the advantages of both a regional flap (viz. reliable and easy to harvest) and a free flap (thin, pliable with good colour match). in this a study we assessed the usefulness of the supraclavicular artery flap in head and neck oncologic defects. materials and method. the flap was used as a pedicled fasciocutanous and was based on the transverse supraclavicular artery. we assessed this reconstructive option for complications as well as its and functional out comes. results. eleven cases underwent supraclavicular artery flap between 20011 - 2012 of which 5 were males and 6 females. mean defect size was 5 cm 6 cm. nine donor sites were closed primarily and 1 required split skin grafting. we encountered one complete flap loss which was attributed to a band of constricting skin bridge over the vascular pedicle in a defect involving lateral third of midface. two patient developed pharyngeocutaneous fistula (without flap loss) out of 3 patients who underwent augmentation pharyngoplasty post near total laryngectomy. conclusion. supra clavicular artery flap is a thin versatile, reliable, easy to harvest, with good cosmetic and functional outcome at both ends (recipient and donor) for reconstructing head and neck oncologic defects. |
this study was approved by the committee of laboratory animal welfare and ethics, peking university health science center. in 2012, we obtained 146 spf rhesus monkeys (macaca mulatta) and cynomolgus monkeys (m. fascicularis) from a commercial institute of biologic resources in beijing, china. during 20122015, we obtained 332 spf rabbits from 2 qualified vendors in china : supplier a (new zealand white rabbits) and supplier b (japanese white rabbits). we also obtained 6 spf bama miniature pigs from supplier b (table 1). bmp, bama miniature pig (sus scrofa domestica) ; cm, cynomolgus monkey (macaca fascicularis) ; hev, hepatitis e virus ; jw, japanese white rabbit (oryctolagus cuniculus) ; na, not applicable ; nzw, new zealand white rabbit (oryctolagus cuniculus) ; rm, rhesus monkey (macaca mulatta). animals had negative results for pcr or antibodies against hev at week 1, but results became positive for samples collected in subsequent weeks. an animal was considered acceptable for the hev study when all test results remained negative for 4 consecutive weeks. all animals were bred in china and housed in polycarbonate individual ventilated cages or mini pig stainless steel cages (suhang, jiangsu, china). paired serum and fecal samples were collected weekly from each animal for 4 consecutive weeks. serum samples from monkeys were tested by using human anti - hev igm and human anti - hev igg elisa kits (wantai, beijing, china) (6). serum samples from rabbits and pigs were tested by using an anti - hev total antibodies elisa kit (wantai) and hev e2 antigen (aa 394606 of open reading frame 2) (7). signal - to - cutoff values were calculated, and values > 1 were considered positive. virus rna was extracted from 100 l of serum or 50% fecal suspensions by using trizol reagent (invitrogen, burlington, ontario, canada). hev - positive samples were sequenced and submitted to genbank (accession nos. ku217460ku217473 and ku218407ku218408). a phylogenetic tree was constructed by using mega 6.0 software (8). a more detailed description of the complete protocol has been previously published (4). we detected antibodies against hev in 25 (7.5%) of 332 spf rabbits and 5 (83.3%) of 6 spf bama miniature pigs. the hev igm positive rate was 0% (0/146), and the hev igg positive rate was 18.5% (27/146) for spf monkeys (table 2). among all antibody - positive animals, the hev antibody positive rate for spf rabbits in china was lower than that for farmed and wild rabbits in other studies (technical appendix table 2). bmp, bama miniature pig (sus scrofa domestica) ; cm, cynomolgus monkey (macaca fascicularis) ; hev, hepatitis e virus ; jw, japanese white rabbit (oryctolagus cuniculus) ; na, not applicable ; nzw, new zealand white rabbit (oryctolagus cuniculus) ; rm, rhesus monkey (macaca mulatta). 16) was viremic and shed virus in feces ; the other 15 rabbits (supplier b, sequence nos. phylogenetic analysis confirmed that all strains isolated from the spf rabbits belong to genotype 3 and are in 3 clusters for reported rabbit hev strains (figure). phylogenetic analysis of hepatitis e virus (hev) isolates from specific pathogen - free (spf) rabbits, china, 20122015. the phylogenetic tree was constructed by using the neighbor - joining method, a partial nucleotide sequence of the open reading frame 2 region, and reported hev sequences in genbank as references. one thousand resamplings of the data were used to calculate percentages (values along branches) of tree branches obtained. genbank accession numbers of all reference sequences (in parentheses) are fj906895 (gdc9), ab740222 (rbim004), jx565469 (cmc-1), ab740221 (rbim022), gu937805 (ch - bj - n1), jx121233 (chn - bj - r14), jq013793 (tls-18516), jq013792 (w7 - 57), af455784 (osh-205), af060668 (us1), ay115488 (swarkell), ab189070 (jboar-1hyo04), ap003430 (jra1), jf309217 (gs - nj-10), ay723745 (ind - sw-00 - 01), ab097812 (he - ja1), m74506 (mexican), ay204877 (t3-chad), and af459438 (yam67). latency was defined as detection of hev rna or antibodies against hev after negative results were observed during the first week in 4-week observation period. in batch 10, we found that 5, 3, and 1 spf rabbits began excretion of hev in stool during the second, third, and fourth weeks, respectively. in our survey of 3 types of spf laboratory animals commonly used for hev studies in china, we detected previous hev infection in all 3 types of animals, despite having purchased these animals from qualified vendors. we also detected hev rna in spf rabbits, which suggested ongoing virus circulation in these animals. these findings emphasize the need for hev screening of laboratory animals, not only for persons studying hev but also for persons studying other pathogens, because the effects of co - infection are unknown. before experiments are conducted, laboratory animals should be monitored for > 2 weeks to ensure that no latent hev infection is present. hev-3 and hev-4 infect humans and other animals, and rabbit hev-3 can infect cynomolgus macaques (4) and possibly humans (5). therefore, safety of any research personnel who handle laboratory rabbits or pigs is a primary concern. hev 239 vaccine is available in china, and studies have shown that this vaccine provided sustained protection against hepatitis e for < 4.5 years (9,10). thus, persons in china who have occupational exposure to hev might benefit from vaccination. second, seroprevalence of antibodies against hev was not determined for personnel who have close contact with these laboratory animals. this screening will ensure experimental accuracy and prevent possibly zoonotic transmission of hev to research personnel. additional information on hepatitis e virus in 3 types of laboratory animals, china, 20122015. | we found seroprevalences for hepatitis e virus (hev) of 7.5%, 18.5%, and 83.3% in specific pathogen - free (spf) laboratory rabbits, monkeys, and pigs, respectively, in china. hev rna was detected in 4.8% of spf rabbits, and 11 rabbits had latent infections. screening for hev in spf animals before relevant experiments are conducted is recommended. |
this report highlights a rare case of concurrent hepatitis b and liver fluke infection with hepatocellular carcinoma, presenting clinically as a diagnostic and surgical challenge. a 50 year old male from thailand presented complaining of right upper quadrant abdominal pain, jaundice, 4 kg weight loss over 2 months and hepatomegaly. his abdominal pain was sharp and intermittent, exacerbated by deep inspiration, although did not radiate and was not associated with eating. he did not experience nausea, diarrhoea and was able to pass brown stool and clear urine. he did not have a significant past medical or surgical history, however, his father had died from cholangiocarcinoma. the patient stated he often travelled to north thailand where he ate raw fish physical examination revealed a jaundiced, alert and ambulant patient with no signs of wasting. abdominal examination revealed tenderness, guarding at right hypochondrium with palpable hepatomegaly and positive murphy s sign. he was found to be hepatitis b surface antigen positive with moderate to high viral load given by virus dna levels of 523 277iu / ml. he was positive for hepatitis b core antibody and hepatitis be antibody, hepatitis be antigen negative, implying chronic infection. the man had deranged liver function tests including total bilirubin 95mol / l, alp 256u / l, alt 267u / l ; ast 289u / l, -gt 985u / l but normal albumin (32g / l) and prothrombin time (13.1sec). full blood count revealed mild anaemia, elevated wcc, neutrophils = 8.910/l, eosinophils = 9.110/l and abdominal ultrasound displayed biliary sludge although no gallstones with normal thin - walled gall - bladder. abdominal ct - scan with contrast revealed a right liver mass involving segments v to viii measuring 10.6cm6 cm axially and 10 cm craniocaudally with mild caudate lobe hypertrophy suggesting underlying cirrhosis ; intra - hepatic bile duct dilation, subcapsular fluid and lymphadenopathy (figure 1). initial abdominal ct findings ; axial and coronal views tumour markers revealed elevated carbohydrate - antigen 19 - 9 at 807ku / l (normal < 40ku / l) suggesting bile - duct disease (1) whilst -fetoprotein was 4ku / l, within normal range. magnetic resonance cholangiopancreatography (mrcp) indicated filling defects in right and left bile ducts (figure 2) and portal vein thrombosis. mrcp indicating filling defects in left & right hepatic ducts the mass had mild hyperintense signal on t2-weighted images and capsule retraction, suggesting a scirrhous lesion (figure 3) ; possibly cholangiocarcinoma. ercp histopathology specimens revealed necrotic tissue with eosinophils, although no ova / parasites were visualised. stool samples did not identify ova so blood samples were taken for serology testing including clonorchiasis andopisthorchiasis (results pending at time of publication). total quantitative immunoglobulins revealed elevated iga (7.05g / l) and total ige (874 iu / ml), consistent with a parasitic infection and/or neoplasia. the patient was given 3 doses of 75mg / kg praziquantel for parasites ; ciprofloxacin and metronidazole for cholangitis and initiated on warfarin for portal vein thrombosis. three weeks later his symptoms resolved and stent was removed, ercp indicating drainage and dead flukes. despite radiological findings suggesting neoplasia, possibility of a decision was made not to perform liver biopsy, due to potential for peritoneal tumour seeding if the mass was neoplastic and instead he was monitored on an outpatient basis. over the next few months, the man was admitted for repeated cholangitis episodes. ercp now indicated intra - hepatic duct filling defects (figure 4) and sediment was removed with new stents placed. repeat abdominal - ct scans indicated the mass was similar in size. following these presentations, ercp indicating filing defects in the left hepatic duct system core biopsies microscopically showed a tumour with vague trabecular architecture, bands of fibroblastic stroma and focal necrosis. immunoperoxidase staining was positive for cam 5.2, hep par-1, and cea, indicating the lesion was most likely hepatocellular carcinoma. right hemihepatectomy was performed one week later ; the patient recovered with no recurrent episodes of cholangitis. the major problem encountered in establishing diagnosis and surgical management in this case was the potential risk of needle - track tumour seeding following percutaneous hepatic biopsy, with a reported likelihood estimated as high as 1% (2). facilities were not available to perform transjugular hepatic biopsy so it was decided to undertake laparoscopic biopsy. since the patient had chronic hepatitis b infection, there was also risk that he may have underlying cirrhosis and hence hepatectomy was delayed until biopsy could be obtained to ascertain the nature of the lesion. this case also presented diagnostic challenges since liver fluke infections can cause liver abscesses, cholangiocarcinoma and recurrent cholangitis (3) whilst hepatocellular carcinoma incidence is ~100 fold higher in patients with chronic hepatitis b. common human liver flukes include clonorchis sinensis, opisthorchis viverrini, fasciola hepatica and schistosoma species. schistosomiasis usually causes other features including urticaria, cough / wheeze, diarrhoea and urinary symptoms. opisthorchis andclonorchis infection is endemic in south - east asia, with prevalence up to 80% in some areaa (4) with infection being caused by ingestion of improperly cooked fish, part of the diet in these regions. cholangiocarcinoma has been linked to c. senesis infection in china and o. viverrini in north thailand (5,6). it is also known that in thailand ~70 - 90% of the population are infected with hepatitis b before age 40, with chronic infection prevalence being 8 - 15% (7). these findings indicate concurrent hepatitis b and liver fluke infection with both being associated with the patient s presentation. this case illustrated both a diagnostic and surgical dilemma, which was solved through imaging and biopsy findings allowing correct surgical management. | hepatocellular carcinoma can is often associated with hepatitis b infection. with localised tumours, liver resection can result in a cure. this case presents an unusual finding of concurrent hepatitis b and liver fluke infection with hepatocellular carcinoma in a 50 year old man from thailand. the discussion illustrates difficulties of arriving at a diagnosis and ensuring appropriate surgical management. |
hypertrophic cardiomyopathy (hcm) is a heterogeneous genetic disease characterized by the development of left ventricular hypertrophy (lvh) in the absence of abnormal loading conditions that could explain it. it is one of the most common monogenic diseases, affecting 1 in 500 adults in the general population. early diagnosis and risk stratification are mandatory in hcm because this disease is the most frequent cause of sudden death in young adults and sportsmen and women. multiple sudden death risk factors have been identified, including the presence of family history of sudden death, severe lvh (maximal lv wall thickness 30 mm), non - sustained ventricular tachycardia, unexplained syncope, and abnormal blood pressure response on exercise. in addition, severe lvh is one of the main risk factors for disease progression in hcm. cardiotrophin-1 (ct-1) is a protein member of the il-6 family of cytokines that signals via leukaemia inhibitory factor receptor gp130-dependent pathways and was originally characterized as a factor that induces cardiomyocyte growth and survival. recent studies have confirmed an active role for ct-1 in promoting myocardial structural changes, thereby participating in the progression of lv remodelling, which results in lv failure typical of cardiac diseases such as hypertensive heart disease, aortic stenosis, coronary artery disease, and dilated cardiomyopathy. in addition, ct-1 plasma levels have been reported to be elevated in patients with these conditions, and they are also correlated with the severity of the disease and heart failure. in particular, some recent experimental and clinical observations suggest that ct-1 may contribute to lv growth in hypertension. experimental data show that increased myocardial expression of ct-1 is associated with cardiomyocyte hypertrophy and development of lvh in spontaneously hypertensive rats. clinical data show that plasma ct-1 levels are elevated in hypertensive patients, namely in those with lvh. and that an association exists between plasma ct-1 concentration and lv mass index, as well as between the reduction of plasma ct-1 and the regression of lvh in treated hypertensive patients. we have hypothesized that ct-1 may be involved in lvh in hcm, therefore, our objectives were to analyse the potential associations between plasma ct-1 levels and the parameters assessing lvh in patients with hcm. all subjects gave written informed consent to participate in the study, and the locally appointed ethics committee approved the research protocol. the study conformed to the principles of the helsinki declaration the population consisted of 124 consecutive patients with hcm recruited in the complejo hospitalario universitario in a corua. all patients were followed up in a specialized clinic and were periodically evaluated with a protocol that includes personal and familial anamnesis, clinical evaluation, echocardiogram, holter monitoring, and exercise testing. hypertrophic cardiomyopathy was diagnosed by the presence of a non - dilated and hypertrophied left ventricle (lv maximal wall thickness 15 mm) in the absence of another cardiac or systemic disease capable of producing the hypertrophy observed, or on the presence of unexplained electrocardiographic abnormalities in relatives of patients with unequivocal disease. as hypertension has a high prevalence in the general population, the presence of hypertension was not considered exclusion criteria for the diagnosis of hcm when hypertension was mild and did not explain the severity of the lvh. a group of 29 subjects with the same age and sex distribution of the study group recruited in the university clinic in pamplona were used as control subjects for plasma ct-1 studies, comparing the ct-1 levels of the 124 hcm patients with those of the 29 controls. the presence of arterial hypertension, diabetes, coronary artery disease, aortic stenosis, and hcm was excluded after complete clinical and cardiac examination of these control subjects. standard measurements, including doppler parameters, were obtained using an ultrasound system equipped with second harmonic imaging (either acuson - siemens sequoia c512, mountain view, ca, usa, or sonos 5500, philips medical systems, andover, ma, usa). all measurements were analysed offline by the same reader (l.m.) to minimize the variability of the measurements, following the guidelines of the american society of echocardiography. left ventricle wall thickness was measured at 14 lv segments using paraesternal short views at mitral, papillary, and apical levels, paraesternal long - axis and apical 4, 3, and 2 chambers views. at the mitral and papillary muscles level, lv thickness was measured at anterior, anterior septum, posterior septum, posterior, and lateral walls. at the apical level lv wall thickness was measured at anterior, posterior, septal, and lateral walls. the lv hypertrophy score proposed by spirito and maron was calculated as the sum of the following measurements : maximal wall thickness of anterior septum (either basal or mid - ventricular level), maximal wall thickness of posterior septum (basal or mid - ventricular), maximal wall thickness of the posterior wall (basal or mid - ventricular), and maximal wall thickness of the anterolateral wall (basal or mid - ventricular). lv ejection fraction (ef) was calculated with the simpson biplane method and systolic dysfunction was defined by the presence of an ef < 50%. left ventricle outflow tract velocities were measured using continuous wave doppler, and lv outflow tract gradients were calculated using the modified bernoulli equation [lv outflow tract gradient = 4 (lv outflow tract velocity) ]. non - sustained ventricular tachycardia was defined as three or more consecutive ventricular beats at a rate of 120beats / min, lasting for < 30 s. symptom - limited exercise was performed on a treadmill using the bruce protocol. blood pressure was measured at rest, every minute during exercise and for the first 5min of recovery. blood pressure response to exercise was considered abnormal when systolic blood pressure failed to increase by more than 25 mmhg from baseline, or when there was a decrease of more than 10 mmhg from the maximum blood pressure during exercise. venous blood samples were taken at 08:30 h with all the subjects being in fasting conditions. plasma ct-1 was measured by an enzyme - linked immunosorbent assay (elisa) as previously reported. the inter - assay and intra - assay coefficients of variation were 6.9 and 7.4%, respectively. the upper limit of normality for plasma ct-1 values measured in the control population was of 41 fmol / ml. the statistical analysis was done using the statistical package spss 16.0 (spss, inc., categorical variables are presented as percentages and continuous variables are presented as mean value standard deviation. cardiotrophin-1 levels were compared between two groups using the student t - test for unpaired data once normality was demonstrated (shapiro wilk test) ; otherwise, a non - parametric test (mann whitney 's u test) was used. the correlation between continuous variables was tested calculating pearson correlation coefficient and, when applicable, spearman correlation coefficient. categorical variables were analysed by the chi - square () or fisher exact test. for all the analyses a bilateral p - value of < 0.05 was considered statistically significant. all subjects gave written informed consent to participate in the study, and the locally appointed ethics committee approved the research protocol. the study conformed to the principles of the helsinki declaration the population consisted of 124 consecutive patients with hcm recruited in the complejo hospitalario universitario in a corua. all patients were followed up in a specialized clinic and were periodically evaluated with a protocol that includes personal and familial anamnesis, clinical evaluation, echocardiogram, holter monitoring, and exercise testing. hypertrophic cardiomyopathy was diagnosed by the presence of a non - dilated and hypertrophied left ventricle (lv maximal wall thickness 15 mm) in the absence of another cardiac or systemic disease capable of producing the hypertrophy observed, or on the presence of unexplained electrocardiographic abnormalities in relatives of patients with unequivocal disease. as hypertension has a high prevalence in the general population, the presence of hypertension was not considered exclusion criteria for the diagnosis of hcm when hypertension was mild and did not explain the severity of the lvh. a group of 29 subjects with the same age and sex distribution of the study group recruited in the university clinic in pamplona were used as control subjects for plasma ct-1 studies, comparing the ct-1 levels of the 124 hcm patients with those of the 29 controls. the presence of arterial hypertension, diabetes, coronary artery disease, aortic stenosis, and hcm was excluded after complete clinical and cardiac examination of these control subjects. standard measurements, including doppler parameters, were obtained using an ultrasound system equipped with second harmonic imaging (either acuson - siemens sequoia c512, mountain view, ca, usa, or sonos 5500, philips medical systems, andover, ma, usa). all measurements were analysed offline by the same reader (l.m.) to minimize the variability of the measurements, following the guidelines of the american society of echocardiography. left ventricle wall thickness was measured at 14 lv segments using paraesternal short views at mitral, papillary, and apical levels, paraesternal long - axis and apical 4, 3, and 2 chambers views. at the mitral and papillary muscles level, lv thickness was measured at anterior, anterior septum, posterior septum, posterior, and lateral walls. at the apical level lv wall thickness was measured at anterior, posterior, septal, and lateral walls. the lv hypertrophy score proposed by spirito and maron was calculated as the sum of the following measurements : maximal wall thickness of anterior septum (either basal or mid - ventricular level), maximal wall thickness of posterior septum (basal or mid - ventricular), maximal wall thickness of the posterior wall (basal or mid - ventricular), and maximal wall thickness of the anterolateral wall (basal or mid - ventricular). lv ejection fraction (ef) was calculated with the simpson biplane method and systolic dysfunction was defined by the presence of an ef < 50%. left ventricle outflow tract velocities were measured using continuous wave doppler, and lv outflow tract gradients were calculated using the modified bernoulli equation [lv outflow tract gradient = 4 (lv outflow tract velocity) ]. non - sustained ventricular tachycardia was defined as three or more consecutive ventricular beats at a rate of 120beats / min, lasting for < 30 s. symptom - limited exercise was performed on a treadmill using the bruce protocol. blood pressure was measured at rest, every minute during exercise and for the first 5min of recovery. blood pressure response to exercise was considered abnormal when systolic blood pressure failed to increase by more than 25 mmhg from baseline, or when there was a decrease of more than 10 mmhg from the maximum blood pressure during exercise. non - sustained ventricular tachycardia was defined as three or more consecutive ventricular beats at a rate of 120beats / min, lasting for < 30 s. blood pressure was measured at rest, every minute during exercise and for the first 5min of recovery. blood pressure response to exercise was considered abnormal when systolic blood pressure failed to increase by more than 25 mmhg from baseline, or when there was a decrease of more than 10 mmhg from the maximum blood pressure during exercise. venous blood samples were taken at 08:30 h with all the subjects being in fasting conditions. plasma ct-1 was measured by an enzyme - linked immunosorbent assay (elisa) as previously reported. the inter - assay and intra - assay coefficients of variation were 6.9 and 7.4%, respectively. the upper limit of normality for plasma ct-1 values measured in the control population was of 41 fmol / ml. the statistical analysis was done using the statistical package spss 16.0 (spss, inc., categorical variables are presented as percentages and continuous variables are presented as mean value standard deviation. cardiotrophin-1 levels were compared between two groups using the student t - test for unpaired data once normality was demonstrated (shapiro wilk test) ; otherwise, a non - parametric test (mann whitney 's u test) was used. the correlation between continuous variables was tested calculating pearson correlation coefficient and, when applicable, spearman correlation coefficient. categorical variables were analysed by the chi - square () or fisher exact test. for all the analyses a bilateral p - value of < 0.05 was considered statistically significant. we studied 78 males (63%) and 46 females (37%) from 101 different families. age at diagnosis of hcm was 51 16 years (range 1583) and at the first evaluation in our clinic it was 53 15 years (range 1683). the main clinical and echocardiographic variables of the study group, including sudden death risk factors, are summarized in tables 1 and 2. table 1clinical and echocardiographic characteristics of the study groupvariablenumber (%) males / females78 (63)/46 (37)family history of sudden death20 (16)family history of hcm51 (41)severe hypertrophy (30 mm)13 (11)previous syncope18 (15)non - sustained ventricular tachycardia29 (23)abnormal blood pressure response on exercise test31 (25)previous angina56 (45)obstructive (dynamic gradient 30 mmhg)33 (27)systolic dysfunction7 (6)previous atrial fibrillation42 (34)nyha functional class nyha i41 (33) nyha ii69 (56) nyha iii13 (11) nyha iv1 (1)number of sudden death risk factors 0 risk factors48 (38) 1 risk factors51 (41) 2 risk factors16 (13) 3 risk factors8 (7) 4 risk factors1 (1)sudden death risk factors included : family history of sudden death, severe hypertrophy, previous syncope, abnormal blood pressure response on exercise test, and non - sustained ventricular tachycardia on holter monitoring. table 2correlations between cardiotrophin-1 levels and echocardiographic measurementsvariablemean value sdcorrelation rp - valuebasal anterior wall15 50.3290.007basal anterior septum19 60.2690.003basal posterior septum17 60.2780.005basal posterior wall11 20.2290.011basal lateral wall13 4 mm0.3710.001maximum basal wall thickness20 6 mm0.2500.005mid - ventricular anterior wall15 4 mm0.1590.217mid - ventricular anterior septum18 6 mm0.1680.107mid - ventricular posterior septum18 7 mm0.2160.056mid - ventricular posterior wall13 3 mm0.2860.009mid - ventricular lateral wall13 3 mm0.2920.017maximum mid - ventricular wall thickness19 7 mm0.2410.018apical anterior wall15 5 mm0.2230.054apical septal wall14 5 mm0.2560.060apical posterior wall13 4 mm0.0550.644apical lateral wall14 5 mm0.4430.001maximum apical wall thickness16 5 mm0.3250.002lv end - diastolic diameter44 6 mm0.2880.001lv end - diastolic diameter / body surface area24 4 mm / m20.310<0.001lv end - systolic diameter26 7 mm0.1840.043lv end - systolic diameter / body surface area14 4 mm / m20.2190.015lv ejection fraction70 12%-0.0280.760left atrial diameter45 9 mm0.2050.023left atrial diameter / body surface area25 5 mm / m20.2550.004aortic root diameter34 4 mm0.0560.541lv outflow tract gradient28 37 mmhg0.0290.754lv, left ventricular.values in bold represent statistical significance. clinical and echocardiographic characteristics of the study group sudden death risk factors included : family history of sudden death, severe hypertrophy, previous syncope, abnormal blood pressure response on exercise test, and non - sustained ventricular tachycardia on holter monitoring. mean maximal lv wall thickness was 21.3 6.1 mm (median 20, range 942 mm, interquartile range 7). spirito 's score was 66 17 mm (median 64, range 36118 mm, intercuartile range 17.5). left atrial diameter was 45 9 mm (median 45, range 2596 mm, interquartile range 11). thirty - three patients (27%) had an lv outflow tract gradient 30 mmhg (obstructive hcm) and 12 (10%) had severe obstruction with a gradient 90 mmhg. mean ef was 70 12% (median 71, range 3294%, interquartile range 17) and systolic dysfunction was present in six cases (5%). as shown in figure 1, plasma ct-1 was increased (p < 0.001) in patients with hcm (136.28 72.01 fmol / ml) compared with healthy controls (17.92 12.03 fmol / ml). the range of ct-1 values in patients was from 43 to 362 fmol / ml, with all patients exhibiting values above the upper limit of normality of the control population (mean + 1.96 sd). plasma ct-1 levels were not influenced by the presence of hypertension or antihypertensive therapy. figure 1plasma concentration of cardiotrophin-1 (ct-1) measured in 29 control subjects and in 124 patients with hypertrophic cardiomyopathy (hcm). plasma concentration of cardiotrophin-1 (ct-1) measured in 29 control subjects and in 124 patients with hypertrophic cardiomyopathy (hcm). cardiotrophin-1 was higher (p = 0.02) in patients with severe lvh (maximal lv wall thickness 30 mm) than in patients with mild o moderate lvh (maximal lv wall thickness < 30 mm ; figure 2). direct correlations were found between ct-1 and maximal lv wall thickness (r = 0.284, p = 0.001 ; figure 3a), and spirito 's score (r = 0.287, p = 0.006 ; figure 3b). in addition, ct-1 was directly correlated with wall thickness in 9 out of the 14 lv segments evaluated and with the maximal thickness at basal, mid - ventricular, and apical levels, as well as with lv and left atrial dimensions (table 2). the associations of ct-1 with maximal lv wall thickness and spirito 's score remained significant when we adjusted for the influence of these echocardiographic confounding factors. no significant correlations were found between ct-1 levels and sex, presence of non - sustained ventricular tachycardia, left ventricular outflow tract obstruction, previous syncope, abnormal blood pressure response on exercise test, or previous atrial fibrillation. cardiotrophin-1 values were non - significantly higher in patients with more sudden death risk factors, which could be explained by the association of ct-1 values with the presence of severe hypertrophy. the group of six patients with left ventricular systolic dysfunction showed also higher ct-1 values than patients without systolic dysfunction, but this difference was not statistically significant (table 3). figure 2plasma concentration of cardiotrophin-1 (ct-1) in patients with hypertrophic cardiomyopathy classified according to maximal left ventricular (lv) wall thickness. figure 3(a) direct correlation between plasma ct-1 and maximal left ventricular (lv) wall thickness (y = 0.024x + 18.05) in patients with hypertrophic cardiomyopathy. (b) direct correlation between plasma cardiotrophin-1 (ct-1) and spirito 's lv hypertrophy score (y = 0.067x + 56.91) in patients with hcm. table 3relation between cardiotrophin-1 levels and categorical clinical variablesvariablenumber (%) of patients with / without the variablemean sd ct-1 levels in patients with the variablemean sd ct-1 levels in patients without the variablep - valuemale sex78 (63)/46 (37)136 70137 760.853non - sustained ventricular tachycardia29 (23)/95 (77)153 83129 680.119family history of hcm51 (41)/73 (59)129 66141 760.357maximum wall thickness 30 mm13 (10)/111 (90)200 103129 640.031obstruction (gradient 30 mmhg)33 (27)/91 (73)137 74136 720.928systolic dysfunction6 (5)/118 (95)162 49134 720.342previous syncope18 (15)/106 (85)133 56137 750.817family history of sudden death20 (16)/104 (84)124 68139 730.398abnormal blood pressures response31 (25)/93 (75)142 77135 750.660previous angina56 (45)/68 (55)133 74139 710.648atrial fibrillation ever42 (34)/82 (66)143 69133 740.446number of sudden death risk factors0.07 0 risk factors48 (38)123 651 risk factor51 (41)140 702 risk factors16 (13)178 833 or more risk factors9 (8)126 84p - value for linear association.values in bold represent statistical significance. plasma concentration of cardiotrophin-1 (ct-1) in patients with hypertrophic cardiomyopathy classified according to maximal left ventricular (lv) wall thickness. (a) direct correlation between plasma ct-1 and maximal left ventricular (lv) wall thickness (y = 0.024x + 18.05) in patients with hypertrophic cardiomyopathy. (b) direct correlation between plasma cardiotrophin-1 (ct-1) and spirito 's lv hypertrophy score (y = 0.067x + 56.91) in patients with hcm. relation between cardiotrophin-1 levels and categorical clinical variables p - value for linear association. we studied 78 males (63%) and 46 females (37%) from 101 different families. age at diagnosis of hcm was 51 16 years (range 1583) and at the first evaluation in our clinic it was 53 15 years (range 1683). the main clinical and echocardiographic variables of the study group, including sudden death risk factors, are summarized in tables 1 and 2. table 1clinical and echocardiographic characteristics of the study groupvariablenumber (%) males / females78 (63)/46 (37)family history of sudden death20 (16)family history of hcm51 (41)severe hypertrophy (30 mm)13 (11)previous syncope18 (15)non - sustained ventricular tachycardia29 (23)abnormal blood pressure response on exercise test31 (25)previous angina56 (45)obstructive (dynamic gradient 30 mmhg)33 (27)systolic dysfunction7 (6)previous atrial fibrillation42 (34)nyha functional class nyha i41 (33) nyha ii69 (56) nyha iii13 (11) nyha iv1 (1)number of sudden death risk factors 0 risk factors48 (38) 1 risk factors51 (41) 2 risk factors16 (13) 3 risk factors8 (7) 4 risk factors1 (1)sudden death risk factors included : family history of sudden death, severe hypertrophy, previous syncope, abnormal blood pressure response on exercise test, and non - sustained ventricular tachycardia on holter monitoring. table 2correlations between cardiotrophin-1 levels and echocardiographic measurementsvariablemean value sdcorrelation rp - valuebasal anterior wall15 50.3290.007basal anterior septum19 60.2690.003basal posterior septum17 60.2780.005basal posterior wall11 20.2290.011basal lateral wall13 4 mm0.3710.001maximum basal wall thickness20 6 mm0.2500.005mid - ventricular anterior wall15 4 mm0.1590.217mid - ventricular anterior septum18 6 mm0.1680.107mid - ventricular posterior septum18 7 mm0.2160.056mid - ventricular posterior wall13 3 mm0.2860.009mid - ventricular lateral wall13 3 mm0.2920.017maximum mid - ventricular wall thickness19 7 mm0.2410.018apical anterior wall15 5 mm0.2230.054apical septal wall14 5 mm0.2560.060apical posterior wall13 4 mm0.0550.644apical lateral wall14 5 mm0.4430.001maximum apical wall thickness16 5 mm0.3250.002lv end - diastolic diameter44 6 mm0.2880.001lv end - diastolic diameter / body surface area24 4 mm / m20.310<0.001lv end - systolic diameter26 7 mm0.1840.043lv end - systolic diameter / body surface area14 4 mm / m20.2190.015lv ejection fraction70 12%-0.0280.760left atrial diameter45 9 mm0.2050.023left atrial diameter / body surface area25 5 mm / m20.2550.004aortic root diameter34 4 mm0.0560.541lv outflow tract gradient28 37 mmhg0.0290.754lv, left ventricular.values in bold represent statistical significance. clinical and echocardiographic characteristics of the study group sudden death risk factors included : family history of sudden death, severe hypertrophy, previous syncope, abnormal blood pressure response on exercise test, and non - sustained ventricular tachycardia on holter monitoring. mean maximal lv wall thickness was 21.3 6.1 mm (median 20, range 942 mm, interquartile range 7). table 2 summarizes the wall thickness measurements in the different lv segments. spirito 's score was 66 17 mm (median 64, range 36118 mm, intercuartile range 17.5). left atrial diameter was 45 9 mm (median 45, range 2596 mm, interquartile range 11). thirty - three patients (27%) had an lv outflow tract gradient 30 mmhg (obstructive hcm) and 12 (10%) had severe obstruction with a gradient 90 mmhg. mean ef was 70 12% (median 71, range 3294%, interquartile range 17) and systolic dysfunction was present in six cases (5%). as shown in figure 1, plasma ct-1 was increased (p < 0.001) in patients with hcm (136.28 72.01 fmol / ml) compared with healthy controls (17.92 12.03 fmol / ml). the range of ct-1 values in patients was from 43 to 362 fmol / ml, with all patients exhibiting values above the upper limit of normality of the control population (mean + 1.96 sd). plasma ct-1 levels were not influenced by the presence of hypertension or antihypertensive therapy. figure 1plasma concentration of cardiotrophin-1 (ct-1) measured in 29 control subjects and in 124 patients with hypertrophic cardiomyopathy (hcm). plasma concentration of cardiotrophin-1 (ct-1) measured in 29 control subjects and in 124 patients with hypertrophic cardiomyopathy (hcm). cardiotrophin-1 was higher (p = 0.02) in patients with severe lvh (maximal lv wall thickness 30 mm) than in patients with mild o moderate lvh (maximal lv wall thickness < 30 mm ; figure 2). direct correlations were found between ct-1 and maximal lv wall thickness (r = 0.284, p = 0.001 ; figure 3a), and spirito 's score (r = 0.287, p = 0.006 ; figure 3b). in addition, ct-1 was directly correlated with wall thickness in 9 out of the 14 lv segments evaluated and with the maximal thickness at basal, mid - ventricular, and apical levels, as well as with lv and left atrial dimensions (table 2). the associations of ct-1 with maximal lv wall thickness and spirito 's score remained significant when we adjusted for the influence of these echocardiographic confounding factors. no significant correlations were found between ct-1 levels and sex, presence of non - sustained ventricular tachycardia, left ventricular outflow tract obstruction, previous syncope, abnormal blood pressure response on exercise test, or previous atrial fibrillation. cardiotrophin-1 values were non - significantly higher in patients with more sudden death risk factors, which could be explained by the association of ct-1 values with the presence of severe hypertrophy. the group of six patients with left ventricular systolic dysfunction showed also higher ct-1 values than patients without systolic dysfunction, but this difference was not statistically significant (table 3). figure 2plasma concentration of cardiotrophin-1 (ct-1) in patients with hypertrophic cardiomyopathy classified according to maximal left ventricular (lv) wall thickness. figure 3(a) direct correlation between plasma ct-1 and maximal left ventricular (lv) wall thickness (y = 0.024x + 18.05) in patients with hypertrophic cardiomyopathy. (b) direct correlation between plasma cardiotrophin-1 (ct-1) and spirito 's lv hypertrophy score (y = 0.067x + 56.91) in patients with hcm. table 3relation between cardiotrophin-1 levels and categorical clinical variablesvariablenumber (%) of patients with / without the variablemean sd ct-1 levels in patients with the variablemean sd ct-1 levels in patients without the variablep - valuemale sex78 (63)/46 (37)136 70137 760.853non - sustained ventricular tachycardia29 (23)/95 (77)153 83129 680.119family history of hcm51 (41)/73 (59)129 66141 760.357maximum wall thickness 30 mm13 (10)/111 (90)200 103129 640.031obstruction (gradient 30 mmhg)33 (27)/91 (73)137 74136 720.928systolic dysfunction6 (5)/118 (95)162 49134 720.342previous syncope18 (15)/106 (85)133 56137 750.817family history of sudden death20 (16)/104 (84)124 68139 730.398abnormal blood pressures response31 (25)/93 (75)142 77135 750.660previous angina56 (45)/68 (55)133 74139 710.648atrial fibrillation ever42 (34)/82 (66)143 69133 740.446number of sudden death risk factors0.07 0 risk factors48 (38)123 651 risk factor51 (41)140 702 risk factors16 (13)178 833 or more risk factors9 (8)126 84p - value for linear association.values in bold represent statistical significance. plasma concentration of cardiotrophin-1 (ct-1) in patients with hypertrophic cardiomyopathy classified according to maximal left ventricular (lv) wall thickness. (a) direct correlation between plasma ct-1 and maximal left ventricular (lv) wall thickness (y = 0.024x + 18.05) in patients with hypertrophic cardiomyopathy. (b) direct correlation between plasma cardiotrophin-1 (ct-1) and spirito 's lv hypertrophy score (y = 0.067x + 56.91) in patients with hcm. relation between cardiotrophin-1 levels and categorical clinical variables p - value for linear association. the main findings of this study are as follows : (i) plasma ct-1 levels are increased in patients with hcm ; and (ii) plasma ct-1 is associated with the severity of lvh in patients with hcm. the observation that plasma ct-1 was abnormally increased in patients with hcm expands previous findings in patients with cardiac pathologies who present lvh due to pressure overload such as hypertensive patients and patients with aortic stenosis. since it has been reported that the human heart secretes ct-1 via the coronary sinus into the peripheral circulation and that plasma ct-1 is directly correlated with myocardial expression of ct-1, increased plasma levels of ct-1 seen in patients with hcm may reflect cardiac over - spilling of this cytokine. the question arises about the factors determining the exaggerated cardiac production of ct-1 in patients with hcm. since the dynamic outflow gradient represents a pressure load for the left ventricle in patients with obstructive hcm, a mechanical factor may be involved in up - regulation of ct-1 in some of these patients (those with obstructive forms of the disease). in support of this possibility, it has been reported that in patients with aortic valve stenosis plasma ct-1 levels correlate with trans - valvular aortic pressure gradients. furthermore, ventricular stretch of langendorff perfused rat hearts resulted in significant release of ct-1. however, only 27% of our patients had lv obstruction, and no difference was found in the ct-1 levels between patients with and without obstruction. this means that ct-1 levels are more likely associated with the presence of lvh than with the presence of obstruction. our finding that plasma ct-1 correlates with parameters assessing lv growth is in accordance with previous findings showing similar correlations in hypertensive patients and in patients with dilated cardiomyopathy, thus suggesting that this cytokine may also contribute to the development of lvh in hcm. furthermore, we also found that ct-1 levels are associated with the severity of lvh, suggesting that up - regulation of this cytokine may be involved in the progression of lvh in patients with hcm. moreover, our results also suggest a potential association between ct-1 levels and the development of systolic dysfunction in hcm, even thought the number of patients with systolic dysfunction included in this study was not sufficient to validate this hypothesis. up to 10% of the patients with hcm evolve to a so - called burn - out phase of the disease, characterized by the development of progressive wall thinning, lv dilatation and systolic dysfunction. this evolution is more frequent in patients with early expression of the disease and higher degrees of lvh. it is associated with a higher incidence of ventricular arrhythmias, atrial fibrillation, symptomatic heart failure and sudden death, and requires therapeutic adjustments. it would be interesting to evaluate in prospective studies whether ct-1 levels could be early predictors of this evolution. the stratification of the severity of lvh in patients with hcm is highly relevant because morbidity, mortality, and sudden death risk in these patients are associated with the severity of hypertrophy. in addition, the same wall thickness or lv mass correspond to different severity of hypertrophy in patients with different body surface area, sex or height and this is not usually considered when analysing the prognostic significance of lvh in individual patients. even thought the associations found between ct-1 levels and maximal wall thickness and spirito 's score were statistically significant, they presented modest correlation coefficients (r = 0.284 and r = 0.287). this means that ct-1 levels do not provide the same information as the other parameters. the associations here reported between plasma ct-1 and maximal lv wall thickness and the spirito 's lvh score, as well as with the different lv segments and with the lv end - diastolic diameter suggest that the plasma level of this cytokine may be of potential usefulness as indicators of global left ventricular remodelling in patients with hcm., it has been reported that increased plasma ct-1 behaves as a prognostic marker of mortality in patients with chronic hf. the potential mechanisms linking ct-1 with poor prognosis are unclear, however, it has been reported that ct-1 induces cardiomyocyte dysfunction in reconstituted cardiac tissue and an association has been found between plasma ct-1 and the impairment of systolic function in hypertensive patients with stage congestive heart failure. additionally, ct-1 may be also involved in the development of myocardial fibrosis, an important component of myocardial remodelling, since ct-1 induces extracellular matrix protein synthesis in cardiac fibroblasts. both the severity of lvh and the presence of systolic dysfunction are associated with an increased risk of sudden death in hcm and appear to be associated with ct-1 levels. therefore, the possibility that ct-1 may be related to prognosis in hcm deserves further investigation. in our study ct-1 levels did not show association with other well - established sudden death risk factors, such as family history of sudden death, presence of non - sustained ventricular tachycardia, abnormal blood pressure response on exercise, or previous syncope. the explanation for this lack of associations may be the limited power of the study to detect modest associations. cardiotrophin-1 levels could also have a prognostic significance independent of these factors ; however, this aspect has not been evaluated in the present study. further work is necessary to assess whether this cytokine may add prognostic information in patients with hcm first of all, due to the limitations of echocardiography for an accurate assessment of lv mass in hcm, magnetic resonance imaging would have provided a better estimate of the lv mass, but it was not available in a high number of cases. second, there was no one to one matching between healthy controls and patients with hcm, and this imbalance precluded paired analysis. third, although it has been shown that the human heart secretes ct-1 via the coronary sinus into the peripheral circulation, given the earlier evidence showing that ct-1 mrna is expressed in other organs, potential additional sources of circulating ct-1 can not be excluded in patients with hcm. for the first time, we show that ct-1 plasma levels are increased in patients with hcm. in addition, we report that plasma levels of this cytokine are associated with the severity of lvh in patients with hcm. thus, the measurement of plasma ct-1 could provide incremental value in the assessment of lvh severity in these patients. nevertheless, further large - scale prospective studies are necessary to definitively validate this approach and to evaluate the potential prognostic implications of ct-1 levels in patients with hcm. this work was supported by the agreement between the foundation for applied medical research (fima) and ute project cima, the red temtica de investigacin cooperativa en enfermedades cardiovasculares (recava) from the instituto de salud carlos iii, ministry of health, spain (grant rd06/0014/0008), and the instituto de salud carlos iii, ministry of science and innovation (grant ps09/02234). funding to pay the open access publication charges for this article was provided by fundacin del complejo hospitalario universitario de a corua. | aimscardiotrophin-1 (ct-1) is a cytokine that induces hypertrophy in cardiomyocytes and is associated with left ventricular hypertrophy (lvh) in hypertensive patients. the objective of this study was to evaluate whether plasma ct-1 is associated with hypertrophic cardiomyopathy (hcm).methods and resultsthe study was performed in 124 patients with hcm. all patients underwent a full clinical evaluation and an echocardiogram. left ventricular hypertrophy was evaluated by the measurement of the maximal lv wall thickness and the spirito 's lvh score. plasma ct-1 was measured by an enzyme - linked immunosorbent assay. compared with controls, patients with hcm exhibited higher (p < 0.001) plasma ct-1 levels. significant correlations were found between ct-1 and maximal lv wall thickness (r = 0.284, p = 0.001) and the spirito 's lvh score (r = 0.287, p = 0.006) in hcm patients. in addition, the levels of ct-1 were higher (p = 0.02) in patients with severe lvh (maximal lv wall thickness 30 mm) than in patients with mild or moderate lvh (maximal lv wall thickness < 30 mm).conclusionsthese findings show that plasma ct-1 is associated with the severity of lvh in patients with hcm. further studies are required to ascertain whether ct-1 is a diagnostic biomarker of this cardiomyopathy. |
successful treatment of melanoma, by surgical removal, is reliant on the early detection of the lesion. the challenge is to diagnose and remove all malignant lesions at an early stage while minimising the unnecessary removal of benign lesions. visual inspection with the naked eye has a relatively low sensitivity in detecting early melanoma [1 - 3 ]. in this context, several non - invasive diagnostic modalities, such as dermoscopy, total body photography, and reflectance confocal microscopy (rcm), have emerged in recent years that are aimed at increasing diagnostic accuracy and raising the threshold for surgical procedures. dermoscopy (also known as dermatoscopy or epiluminescence microscopy) allows for the visualization of anatomical structures within the epidermis and papillary dermis that would otherwise not be able to be visualised by the naked eye. this is achieved with the use of a hand held dermatoscope to magnify the skin surface and reduce the refraction of light by the corneal layer. various diagnostic algorithms (pattern analysis, abcd rule, menzies method, seven - point checklist, and three - point check list) have been proposed to help assess the structures and patterns seen in dermoscopy. recently, criteria for amelanotic / hypomelanotic melanoma have been described (table 1). for more details on dermoscopic diagnosis, including abcd rule and pattern analysis, see. there are two different types of dermatoscopes : the original, non - polarised version requires an immersion medium (oil, alcohol) and is superior in visualising blue - white areas (often associated with regression), milia - like cysts, and comedo - like openings (features of seborrheic keratosis). the alternative dermatoscope uses polarised light and has been found to be better for assessing vascular structures and shiny white streaks that could be a sign of fibrosis. it has been proposed that using the two different dermatoscopes in conjunction with each other may help to increase the sensitivity and specificity of detecting melanoma. various studies and three meta - analyses of the literature have validated the ability of dermoscopy to increase diagnostic accuracy. dermoscopy was shown to be superior to naked - eye examination performed by specialists in two meta - analyses. recently, a meta - analysis by vestergaard., which focused exclusively on trials that were performed in a clinical setting, found that the relative diagnostic odds ratio was 15.6 for the use of dermoscopy to diagnose melanoma compared with naked - eye examination. furthermore, it has been reported that dermoscopic training for primary care physicians can improve their ability to correctly refer individuals with suspicious lesions and decrease the rate of excision or referral in benign skin lesions [7 - 9 ]. haenssle and colleagues performed a prospective long - term study with patients at high risk for melanoma in a real - life clinical setting using the seven - point checklist to dermoscopically score melanocytic lesions. a sensitivity of 62% for lesions scoring more than 3 points and specificity of 97% was found. of the melanomas that were false negatives on dermoscopic evaluation, 25% were detected by dermoscopic follow - up and 13% by complementary patient history and the regression pattern, radial streaming, and atypical vascular pattern were found to be the criteria associated with the highest relative risk for melanoma. overall, there is strong scientific evidence that clinical examination, including detailed anamnesis for identifying melanoma risk factors (family and personal history of melanoma, total number of nevi, including number of atypical nevi, skin type, presence of ephelides, hair and eye colour, non - melanoma skin cancer history, history of intermittent sun exposure), and full body clinical inspection with detection of any lesions that are dissimilar to the rest (ugly ducklings) aided by dermoscopy, is the gold - standard in non - invasive diagnosis of melanoma. photography enables documentation of lesions and has the ability to track and compare any changes over time. macroscopic digital pictures of standardised body positions and digital dermoscopic images of lesions of concern enable nearly the entire body surface to be recorded and referred to in follow - up examinations. this technique is particularly helpful in the surveillance of individuals with numerous nevi with a family history of melanoma (so - called dysplastic nevus syndrome). photographic monitoring aids in identifying stable lesions and early detection of any concerning changes. theoretically, any photographic equipment can be used for total body photography but there are now specific digital skin photography systems available. digital dermoscopic (and clinical) images are taken and linked to the body site via a computer. at follow - up visits the same lesion is re - photographed for comparison. this method has helped to detect a subgroup of slow - growing melanomas that lack suspicious features at baseline examination but exhibit detectable changes on follow - up. however, due to the increased time expenditure and cost of follow - up for every melanocytic lesion in a given patient, there is a need to correctly identify those that benefit most from digital dermoscopic follow - up. performed a prospective long - term study including patients at risk for development of melanoma to identify those who benefit most from sequential dermoscopy follow - up. according to the results, the authors suggested a follow - up plan as follows : (a) short - term follow - up of 3 months for patients with familial atypical mole and melanoma syndrome and (b) long - term follow - up of 6 - 12 months for those with atypical mole syndrome. patients with multiple common nevi and no additional risk factors were found to have low benefit from sequential digital dermoscopy. some of the drawbacks of sequential dermoscopy include the potential for loss to follow - up. only preselected lesions are dermoscopically monitored and changes in a previously unsuspicious lesion or a de novo lesion might therefore be missed. of note, suspicious nodular lesions should be excised immediately rather than observed over time as they are at higher risk of rapid change and spread if malignant. teledermoscopy is defined as the transmission of digital dermoscopic images over a distance for specialist consultation, allowing primary care physicians to forward dermoscopic images to dermatologists for second opinion. good interobserver agreement between face - to - face diagnosis and diagnosis based on digital images has been demonstrated in several studies. furthermore, digital dermoscopic and clinical still images with complementary clinical data have been shown to increase confidence and interobserver agreement. the feasibility of teledermoscopy using mobile devices has been recently demonstrated, highlighting the potential of mobile teledermoscopy as a screening and triage tool. teledermoscopy is particularly useful in remote areas where referral to a specialist is financially demanding and time consuming for the patient. rcm is a non - invasive imaging technique that uses a near infrared laser beam to create black and white images in a horizontal plane. the images are able to define cellular structures and morphology and can obtain images, with good resolution, of the epidermis, dermoepidermal junction, and the superficial dermis. melanin and melanosomes are strongly reflective, making rcm a suitable modality for examining melanocytic lesions. several recent studies have identified rcm features of melanoma and nevi and have found key differences between the two. in short, features most suggestive of melanoma as found by pellacani. gerger and colleagues developed a decision tree analysis based on three rcm features (monomorphic melanocytic cells, keratinocyte borders, and polymorphic melanocytic cells). segura and colleagues recently presented a two - step algorithm for differentiation between melanocytic lesions and non - melanocytic lesions in the first step and between nevi and melanoma in the second step. a recent focus of interest is the value of rcm in diagnosis and pre - operative mapping of surgical margins in lentigo maligna (melanoma in situ in severely sun - damaged skin). a recently developed algorithm for diagnosis of lentigo maligna of the face is displayed in table 2. rcm is a promising potential clinical tool ; however, large - scale clinical studies are required to be able to determine the entirety of its benefit. the algorithm for melanoma diagnosis displayed above has been described by pellacani. and other non - invasive diagnostic techniques currently in the process of being developed include multispectral image analysis, multiphoton laser scanning microscopy (mpm), optical coherence tomography, high frequency ultrasound, computer - assisted diagnosis, and molecular profiling. multispectral image analysis relies on the principle that different wavelengths of light penetrate the skin to different depths, enabling computer - aided visualization of criteria invisible to macroscopic and dermoscopic techniques. it can be used, however, as a tool for assessing tumour thickness and vascularity, which can assist in planning management preoperatively. optical coherence tomography is comparable to ultrasound but uses light instead of sound waves ; it reaches a lower depth, providing a better resolution than ultrasound, but does not reach the resolution capabilities of rcm. although there are studies regarding the various features of skin cancer, reports of diagnostic accuracy are lacking. mpm utilizes non - linear excitation by a near - infrared laser source. like rcm, the mpm allows imaging of horizontal sections of the skin, allowing visualization of cellular and subcellular structures. computer - assisted diagnosis uses automated diagnostic systems that extract and analyse criteria of skin lesions to provide a diagnosis without subjective human interpretation bias. it has been shown to reach levels of diagnostic accuracy similar to that of expert dermatologists. however, in order not to miss a melanoma, there is a tendency for these tools to overdiagnose melanoma. a recent meta - analysis showed a slightly higher sensitivity for computer - aided dermoscopic diagnosis compared to expert diagnosis, but significantly lower specificity. to date, a few fully automated systems are available, some of which are integrated in the software of videodermoscopy devices. melafind uses multispectral imaging and the db - mips system extracts information from dermoscopic images. the melafind system is currently in the final stages of being granted us food and drug administration approval. a method that uses rna acquired from the cornified layer of a lesion gathered by tape stripping is currently being investigated. dermoscopy (also known as dermatoscopy or epiluminescence microscopy) allows for the visualization of anatomical structures within the epidermis and papillary dermis that would otherwise not be able to be visualised by the naked eye. this is achieved with the use of a hand held dermatoscope to magnify the skin surface and reduce the refraction of light by the corneal layer. various diagnostic algorithms (pattern analysis, abcd rule, menzies method, seven - point checklist, and three - point check list) have been proposed to help assess the structures and patterns seen in dermoscopy. recently, criteria for amelanotic / hypomelanotic melanoma have been described (table 1). for more details on dermoscopic diagnosis, including abcd rule and pattern analysis, see. there are two different types of dermatoscopes : the original, non - polarised version requires an immersion medium (oil, alcohol) and is superior in visualising blue - white areas (often associated with regression), milia - like cysts, and comedo - like openings (features of seborrheic keratosis). the alternative dermatoscope uses polarised light and has been found to be better for assessing vascular structures and shiny white streaks that could be a sign of fibrosis. it has been proposed that using the two different dermatoscopes in conjunction with each other may help to increase the sensitivity and specificity of detecting melanoma. various studies and three meta - analyses of the literature have validated the ability of dermoscopy to increase diagnostic accuracy. dermoscopy was shown to be superior to naked - eye examination performed by specialists in two meta - analyses. recently, a meta - analysis by vestergaard., which focused exclusively on trials that were performed in a clinical setting, found that the relative diagnostic odds ratio was 15.6 for the use of dermoscopy to diagnose melanoma compared with naked - eye examination. furthermore, it has been reported that dermoscopic training for primary care physicians can improve their ability to correctly refer individuals with suspicious lesions and decrease the rate of excision or referral in benign skin lesions [7 - 9 ]. haenssle and colleagues performed a prospective long - term study with patients at high risk for melanoma in a real - life clinical setting using the seven - point checklist to dermoscopically score melanocytic lesions. a sensitivity of 62% for lesions scoring more than 3 points and specificity of 97% was found. of the melanomas that were false negatives on dermoscopic evaluation, 25% were detected by dermoscopic follow - up and 13% by complementary patient history and the regression pattern, radial streaming, and atypical vascular pattern were found to be the criteria associated with the highest relative risk for melanoma. overall, there is strong scientific evidence that clinical examination, including detailed anamnesis for identifying melanoma risk factors (family and personal history of melanoma, total number of nevi, including number of atypical nevi, skin type, presence of ephelides, hair and eye colour, non - melanoma skin cancer history, history of intermittent sun exposure), and full body clinical inspection with detection of any lesions that are dissimilar to the rest (ugly ducklings) aided by dermoscopy, is the gold - standard in non - invasive diagnosis of melanoma. photography enables documentation of lesions and has the ability to track and compare any changes over time. macroscopic digital pictures of standardised body positions and digital dermoscopic images of lesions of concern enable nearly the entire body surface to be recorded and referred to in follow - up examinations. this technique is particularly helpful in the surveillance of individuals with numerous nevi with a family history of melanoma (so - called dysplastic nevus syndrome). photographic monitoring aids in identifying stable lesions and early detection of any concerning changes. theoretically, any photographic equipment can be used for total body photography but there are now specific digital skin photography systems available. digital dermoscopic (and clinical) images are taken and linked to the body site via a computer. at follow - up visits the same lesion is re - photographed for comparison. this method has helped to detect a subgroup of slow - growing melanomas that lack suspicious features at baseline examination but exhibit detectable changes on follow - up. however, due to the increased time expenditure and cost of follow - up for every melanocytic lesion in a given patient, there is a need to correctly identify those that benefit most from digital dermoscopic follow - up. performed a prospective long - term study including patients at risk for development of melanoma to identify those who benefit most from sequential dermoscopy follow - up. according to the results, the authors suggested a follow - up plan as follows : (a) short - term follow - up of 3 months for patients with familial atypical mole and melanoma syndrome and (b) long - term follow - up of 6 - 12 months for those with atypical mole syndrome. patients with multiple common nevi and no additional risk factors were found to have low benefit from sequential digital dermoscopy. some of the drawbacks of sequential dermoscopy include the potential for loss to follow - up. only preselected lesions are dermoscopically monitored and changes in a previously unsuspicious lesion or a de novo lesion might therefore be missed. of note, suspicious nodular lesions should be excised immediately rather than observed over time as they are at higher risk of rapid change and spread if malignant. the use of digital imaging has the added benefit of enabling teledermatologic applications. teledermoscopy is defined as the transmission of digital dermoscopic images over a distance for specialist consultation, allowing primary care physicians to forward dermoscopic images to dermatologists for second opinion. good interobserver agreement between face - to - face diagnosis and diagnosis based on digital images has been demonstrated in several studies. furthermore, digital dermoscopic and clinical still images with complementary clinical data have been shown to increase confidence and interobserver agreement. the feasibility of teledermoscopy using mobile devices has been recently demonstrated, highlighting the potential of mobile teledermoscopy as a screening and triage tool. teledermoscopy is particularly useful in remote areas where referral to a specialist is financially demanding and time consuming for the patient. rcm is a non - invasive imaging technique that uses a near infrared laser beam to create black and white images in a horizontal plane. the images are able to define cellular structures and morphology and can obtain images, with good resolution, of the epidermis, dermoepidermal junction, and the superficial dermis. melanin and melanosomes are strongly reflective, making rcm a suitable modality for examining melanocytic lesions. several recent studies have identified rcm features of melanoma and nevi and have found key differences between the two. in short, features most suggestive of melanoma as found by pellacani. gerger and colleagues developed a decision tree analysis based on three rcm features (monomorphic melanocytic cells, keratinocyte borders, and polymorphic melanocytic cells). segura and colleagues recently presented a two - step algorithm for differentiation between melanocytic lesions and non - melanocytic lesions in the first step and between nevi and melanoma in the second step. a recent focus of interest is the value of rcm in diagnosis and pre - operative mapping of surgical margins in lentigo maligna (melanoma in situ in severely sun - damaged skin). a recently developed algorithm for diagnosis of lentigo maligna of the face is displayed in table 2. rcm is a promising potential clinical tool ; however, large - scale clinical studies are required to be able to determine the entirety of its benefit. the algorithm for melanoma diagnosis displayed above has been described by pellacani. and other non - invasive diagnostic techniques currently in the process of being developed include multispectral image analysis, multiphoton laser scanning microscopy (mpm), optical coherence tomography, high frequency ultrasound, computer - assisted diagnosis, and molecular profiling. multispectral image analysis relies on the principle that different wavelengths of light penetrate the skin to different depths, enabling computer - aided visualization of criteria invisible to macroscopic and dermoscopic techniques. it can be used, however, as a tool for assessing tumour thickness and vascularity, which can assist in planning management preoperatively. optical coherence tomography is comparable to ultrasound but uses light instead of sound waves ; it reaches a lower depth, providing a better resolution than ultrasound, but does not reach the resolution capabilities of rcm. although there are studies regarding the various features of skin cancer, reports of diagnostic accuracy are lacking. mpm utilizes non - linear excitation by a near - infrared laser source. like rcm, the mpm allows imaging of horizontal sections of the skin, allowing visualization of cellular and subcellular structures. computer - assisted diagnosis uses automated diagnostic systems that extract and analyse criteria of skin lesions to provide a diagnosis without subjective human interpretation bias. it has been shown to reach levels of diagnostic accuracy similar to that of expert dermatologists. however, in order not to miss a melanoma, there is a tendency for these tools to overdiagnose melanoma. a recent meta - analysis showed a slightly higher sensitivity for computer - aided dermoscopic diagnosis compared to expert diagnosis, but significantly lower specificity. to date, a few fully automated systems are available, some of which are integrated in the software of videodermoscopy devices. melafind uses multispectral imaging and the db - mips system extracts information from dermoscopic images. the melafind system is currently in the final stages of being granted us food and drug administration approval. a method that uses rna acquired from the cornified layer of a lesion gathered by tape stripping is currently being investigated. to date, the current standard method for melanoma diagnosis is naked - eye inspection with closer dermoscopic examination of suspicious lesions to determine which should be excised and sent for histopathological confirmation. the use of digital photography to track changes has been shown to be effective and is now integrated into practice. it is difficult to predict how clinical practice will be affected and if the new emerging imaging modalities, such as rcm, mpm, and computer - assisted diagnosis, will prevail, or if molecular analysis will substitute morphology. it remains crucial to evaluate lesions in the context of the examination of the individual patient. only those lesions that are considered suspicious can be further evaluated due to time expenditure, and, therefore, careful clinical examination and pre - selection is still irreplaceable. hps is co - founder and share holder of e - derm - consult gmbh, a spin - off company of the medical university of graz (graz, austria) with emphasis on holistic solutions for teledermatology. he is also share - holder and consultant for molemap australia by dermatologists pty ltd. | early detection of lesions while minimising the unnecessary removal of benign lesions is the clinical aim in melanoma diagnosis. in this context, several non - invasive diagnostic modalities, such as dermoscopy, total body photography, and reflectance confocal microscopy have emerged in recent years aiming at increasing diagnostic accuracy. the main developments in this field are the integration of dermoscopy and digital photography into clinical practice. |
osteoarthritis (oa), the most common type of arthritis, is characterized by gradual wear and loss of cartilage in the joints resulting in friction between the bones, which leads to pain and swelling. it was long thought that only the cartilage is affected. however, it is now known that the underlying bone, as well as the synovium, also undergoes changes [13 ]. it can occur in any joint, but predominates in weight - bearing joints, such as the knee and hip. in germany, the prevalence of diagnosed osteoarthritis (all age groups combined) in at least one joint is 27%, and more than 50% of the population over 60 suffer from oa in at least one joint. in the united states of america, oa is responsible for total joint replacement in half a million americans each year, indicating that oa is not only a burden to the patients, but also a financial burden on society. common oa therapy focuses mainly on the treatment of symptoms, such as pain reduction, but does not treat the cause. however, the main goal of oa therapy should be to delay cartilage degeneration and even help to regenerate the cartilage structure. one approach in this direction is the treatment with chondroprotectives, differentiated in symptomatic slow - acting drugs in oa (sysadoa) or structure - modifying oa drugs (smoad). this paper will focus on the ability of such chondroprotectives to retard the degenerative process of cartilage destruction and will discuss the evidence of symptomatic and structure - modifying effects of this nutritional approach. furthermore, the role of inflammation and especially obesity in the process of osteoarthritis and how this process could be addressed will be discussed. the nature of the initiating event is often unknown, although many processes involved in the progression of oa are known. due to disruption of the cartilage collagen matrix, the water content of the cartilage increases. this is followed by a progressive loss of cartilage and the formation of osteophytes and calcium deposits. oa progression is associated with synovial inflammation, joint swelling, stiffness and pain, leading to progressive functional impairment [5, 6 ]. one of the primary risk factor for oa is age [3, 7 ]. during aging, the ability to remodel and repair the cartilage extracellular matrix (ecm) decreases with age. furthermore, changes are due to the structural organization of the ecm [9, 10 ]. during aging, cross - linking of collagen fibers aging also leads to reduced muscle mass and strength, which in turn reduces joint stability and leads to misalignment. a recent meta - analysis addressed the incidence of comorbidity related to overweight and obesity. it was able to show that overweight and obesity lead to a significantly higher oa risk. a number of studies demonstrated that there are strong genetic determinants for oa (for review see [14, 15 ]). a classic twin study in which twins were radiologically screened for oa, showed a clear genetic influence on hand and knee oa in women. several genetic abnormalities have been identified that are responsible for the onset and progression of oa. these gene variations result in defects or variability of cartilage and ecm composition and metabolism [14, 17, 18 ]. patients with developmental dysplasia of joints, such as hip dysplasia, develop oa much earlier than normal individuals. misalignment leads to a reduced contact area within the joint resulting in locally elevated pressure on the cartilage. this is related to the progression and onset of oa [20, 21 ]. injuries involving the joint surface, injured ligaments, or meniscectomy, are also associated with the development of oa. injuries can often cause joint movement beyond the physiological range which leads to uneven load distribution in the joint. despite the difference in the primary causes of oa, they all lead to similar clinical symptoms, cartilage destruction, bone remodeling, osteophyte formation, inflammation of the synovial membrane, pain, and immobility. to understand the structure - modifying effect of different nutrients and how they can support the process of cartilage regeneration, it is important to know the composition of cartilage and the metabolic mechanisms involved in normal turnover. cartilage is classified into three different types, based on the collagen type used and the relative amount of the main components, that is, elastic cartilage, hyaline cartilage, and fibrocartilage. unlike other tissue it is not innervated and does not contain blood vessels or lymphatic structures. there are only a small number of chondrocytes within the cartilage and they only account for 15% of the cartilage volume. they produce this extracellular matrix composed of collagen and elastin fibers, as well as proteoglycans. hyaline cartilage, found in joints, is characterized by its high elasticity and pressure resistance. in contrast to bone and muscle, it does not increase its tissue mass postnatally due to mechanical stimulation. it is composed of four different zones : the superficial tangential zone, the middle or transitional zone, the deep or radial zone, and the calcified cartilage zone [23, 24 ]. proteoglycans are intertwined with the collagen network. due to the net negative charge of the proteoglycans, the water content is important for the resilience and elasticity of the tissue, as well as for lubrication of the joint system. the proteoglycans of the articular cartilage are large supramolecular complexes, composed of a central hyaluronic acid (ha) filament, to which aggrecan molecules composed of chondroitin sulfate and keratan sulfate are attached by a link protein in a brush - like configuration (see figure 1). the amino sugar glucosamine is a necessary component for the synthesis of many of these proteoglycans, which include hyaluronic acid, heparan sulfate, and keratan sulfate. the production of glucosamine is one of the rate - limiting steps in proteoglycan production. the ability of the articular cartilage to regenerate or adapt to mechanical changes is very limited. it has been postulated that this inability to adapt to mechanical changes is related to its inability to repair after mechanical or other damage. one reason is the avascular nature of this tissue, which makes it difficult to move progenitor cells to lesion sites. in in vivo models of rabbits and goats, it has been shown that lesions smaller than 3 mm in diameter can heal (chondral or subchondral zone) while defects larger than 6 mm in diameter rarely if ever heal and lead to progressive degeneration (for review see). due to the lack of blood vessels, the chondrocytes within the cartilage receive nutrients only by diffusion from the surrounding tissue. the viscous synovial fluid is composed of hyaluronic acid (hyaluronan), lubricin (a large, water - soluble glycoprotein), glucose, and water. hyaluronan is synthesized by the synovial membrane and released into the joint cavity. as shown above, glucosamine, hyaluronic acid, and chondroitin sulfate they are naturally formed by the body, but can also be provided in the diet. supplementation of such basic components may be beneficial, especially when there is a disturbed balance between catabolic and anabolic processes, such as in osteoarthritis. during oa progression, the chondrocytes are no longer able to fully compensate for the loss of collagen type ii fibers and proteoglycans, even at increased synthesis rates. it has been shown in many in vitro and in vivo trials and in numerous clinical studies that these smoad can modify, stabilize, retard, or even reverse the pathology of oa. it is synthesized from glucose in almost every human tissue and is most abundant in connective tissue and cartilage. glucosamine can be extracted from chitin, found primarily in the exoskeleton of crustaceans (crabs, prawns, and lobsters), as well as in the cell membranes of mushrooms. it is an important precursor of the glycoprotein and glycosaminoglycan (gag) synthesis. within cartilage, it is most important for the formation of hyaluronic acid, chondroitin sulfate as well as keratan sulfate, which are aside from the collagen fibers the most important components of the extracellular matrix of the articular cartilage and the synovial fluid (for review see [6, 44, 45 ]). glucosamine production is the rate - limiting step in gag synthesis, and glucosamine supplementation may overcome this bottleneck. due to its basic role in cartilage and synovial fluid synthesis, glucosamine administered as glucosamine sulfate (glcns) or hydrochloride (glcnhcl)has been tested in numerous clinical oa trials and the effects have been summarized in reviews and meta - analyses [6, 33, 34, 37, 38, 4450 ]. a recent comprehensive review published in 2010, summarized, on the basis of peer - reviewed publications, the currently available chemical and pharmacokinetic data of glcn salts, and their role in the treatment of clinical oa. an important aspect of glcn is the structure of various oral glcn compounds : regardless of the nature of the salt, glcnhcl or glcns, the organic component glucosamine is structurally identical. glcnhcl dissociates completely in the stomach to glcn and hcl, and glcns dissociates to glcn, hcl, sodium sulfate, and sulfuric acid. investigators have claimed in favor of the glcn sulfate salt that the sulfate anion would stimulate the chondroitin sulfate synthesis, however, to achieve this serum concentrations of 50 times the serum sulfate concentration would be necessary. in horse studies (see e.g.,) cmax was about 10 m at 2 h, and here also, the sulfate and chloride salts of glcn were essentially identical. in human volunteers cmax was determined to be between 1 and 4 hours after ingestion of a dose of 20 mg glcns per kg body weight (for a typical adult with a body weight of 75 kg, this corresponds to a daily dose of 1500 mg). in four pharmacokinetic studies in humans, maximum serum levels were between 9 and 11 m, and in one group of oa patients, mean cmax was 7 m. were the first to demonstrate that free glcn can be detected in synovial fluid after administration (cited in). they found that the synovial fluid concentrations of glcn remained elevated in most animals even at 12 h after administration. this is in contrast to the nearly complete clearance of glcn in serum 6 hours after dosing. in vitro studies in vitro studies on isolated chondrocytes, or cartilage explants from healthy or oa patients, provide much evidence for the proposed mechanisms regarding how glucosamine supports joint health. it has been shown that glucosamine enhances the production of cartilage matrix components in chondrocyte culture, such as aggrecan and collagen type ii [54, 55 ]. further experiments have shown that glucosamine prevents collagen degeneration in chondrocytes by inhibiting lipoxidation reactions and protein oxidation. mmps (matrix metalloproteinases) and aggrecanases are the predominant cleavage enzymes in the cartilage. these enzymes are responsible for cleavage preferentially in the interglobular domain of the aggrecan molecule, which leads to loss of aggrecan function. glucosamine is able to inhibit the mmp synthesis, and further proteoglycan degeneration is therefore prevented [58, 59 ]. inflammatory processes, which are also responsible for degeneration of the cartilage, are inhibited by glucosamine. these mechanisms will be explained in section 4. in vitro studies on isolated chondrocytes, or cartilage explants from healthy or oa patients, provide much evidence for the proposed mechanisms regarding how glucosamine supports joint health. it has been shown that glucosamine enhances the production of cartilage matrix components in chondrocyte culture, such as aggrecan and collagen type ii [54, 55 ]. further experiments have shown that glucosamine prevents collagen degeneration in chondrocytes by inhibiting lipoxidation reactions and protein oxidation. mmps (matrix metalloproteinases) and aggrecanases are the predominant cleavage enzymes in the cartilage. these enzymes are responsible for cleavage preferentially in the interglobular domain of the aggrecan molecule, which leads to loss of aggrecan function. glucosamine is able to inhibit the mmp synthesis, and further proteoglycan degeneration is therefore prevented [58, 59 ]. inflammatory processes, which are also responsible for degeneration of the cartilage, are inhibited by glucosamine. selected clinical trialsthe summarized data of major clinical trials (rcts) between 2001 and 2007 with form of glucosamine used, active reference agents, patient characteristics, outcome measure, and results are listed in table 1.the positive effects of glucosamine on the progression of knee oa was not shown in patients suffering from hip oa. in a recent clinical trial, glcns (1500 mg / day) was not able to show superiority over placebo, even when a subgroup analysis of the available data was made. oa, is unclear.furthermore, it is not understood why many trials stated that there was a significant superiority of glcns over placebo or nsaids (e.g., qiu.), whereas others did not. the heterogeneity of the subjects was also a possible reason, as well as bias due to industry funding. the opinions on this differ and have recently caused much debate [35, 64, 65 ]. the summarized data of major clinical trials (rcts) between 2001 and 2007 with form of glucosamine used, active reference agents, patient characteristics, outcome measure, and results are listed in table 1. the positive effects of glucosamine on the progression of knee oa was not shown in patients suffering from hip oa. in a recent clinical trial, glcns (1500 mg / day) was not able to show superiority over placebo, even when a subgroup analysis of the available data was made. the reason why glcns is effective for knee oa, but not for hip oa, is unclear. furthermore, it is not understood why many trials stated that there was a significant superiority of glcns over placebo or nsaids (e.g., qiu.), whereas others did not. the heterogeneity of the subjects was also a possible reason, as well as bias due to industry funding. the opinions on this differ and have recently caused much debate [35, 64, 65 ]. selected reviews and meta - analysesthe quality of evidence was recently evaluated by comparing data from clinical studies, meta - analyses, and reviews (published between 1950 and 2007) on the effect of sysadoa, including glucosamine sulfate. using a specialized rating method (grade), 5 meta - analyses and one comprehensive review were identified which were included in the evaluation of glucosamine sulfate. based on this data, it was concluded that glucosamine sulfate, among others, has demonstrated pain reduction and physical function improvement with very low toxicity, with moderate to high quality evidence. were included in their evaluation.the summarized data of selected systematic reviews / meta - analyses, published between 2005 and 2008 with their conclusions are listed in table 2.in most trials, dosages of 1500 mg / day were used ; the dose was as safe as placebo and was tolerated better than nsaids.from the clinical trials, it can be concluded that long - term treatment with glucosamine : reduces pain, improves function / mobility of the joint, reduces oa progression, reduces risk of total joint replacement.the european league against rheumatism (eular) came to similar conclusions and rated glcns in their guidelines for knee oa with the highest level of evidence, 1a, and recommended its use with an a.the results of all these studies demonstrate that glucosamine has many favorable effects on cartilage. furthermore, it inhibits by means of several anti - inflammatory and antioxidant mechanisms, the catabolic cartilage degenerating reactions observed in oa (see section 4). this can delay cartilage degeneration in oa which leads to a reduction in pain and swelling as well as to increased mobility of the affected joint. the quality of evidence was recently evaluated by comparing data from clinical studies, meta - analyses, and reviews (published between 1950 and 2007) on the effect of sysadoa, including glucosamine sulfate. using a specialized rating method (grade), 5 meta - analyses and one comprehensive review were identified which were included in the evaluation of glucosamine sulfate. based on this data, it was concluded that glucosamine sulfate, among others, has demonstrated pain reduction and physical function improvement with very low toxicity, with moderate to high quality evidence. the summarized data of selected systematic reviews / meta - analyses, published between 2005 and 2008 with their conclusions are listed in table 2. in most trials, dosages of 1500 mg / day were used ; the dose was as safe as placebo and was tolerated better than nsaids. from the clinical trials, it can be concluded that long - term treatment with glucosamine : reduces pain, improves function / mobility of the joint, reduces oa progression, reduces risk of total joint replacement. improves function / mobility of the joint, reduces oa progression, reduces risk of total joint replacement. the european league against rheumatism (eular) came to similar conclusions and rated glcns in their guidelines for knee oa with the highest level of evidence, 1a, and recommended its use with an a. the results of all these studies demonstrate that glucosamine has many favorable effects on cartilage. furthermore, it inhibits by means of several anti - inflammatory and antioxidant mechanisms, the catabolic cartilage degenerating reactions observed in oa (see section 4). this can delay cartilage degeneration in oa which leads to a reduction in pain and swelling as well as to increased mobility of the affected joint. chondroitin sulfate (cs) is one of the natural glycosaminglycans (gag) composed of the alternating sugars d - glucuronic acid (glca) and n - acetyl - d - galactosamine (galnac). cs is the most frequent gag in the aggrecan molecule of the cartilage. due to the negative charge of cs, it is responsible for the water retention of the cartilage, which is important for pressure resistance. it can be extracted from the cartilaginous tissue of cows, pigs, birds, and fish (sharks) and is ingested in the diet. in the european league against rheumatism (eular) recommendation concerning knee oa, they gave cs both the highest evidence grade and the highest recommendation strength, 1a and a, respectively. the first effects of sysadoa treatments, other than analgesics and nsaids, become noticeable after 2 to 3 weeks of regular intake and has a prolonged effect that remains for up to several months. cs influences the symptoms of oa such as pain and inflammation, but also acts as a structure - modifying drug in oa (smoad). it may retard oa progression and could modify the course of oa (for review see ; details from this systematic review on the clinical use of oral cs in oa is provided in table 3). the ability of cs to slow down the development of oa has been demonstrated in several clinical trials [43, 67, 68 ]. these results were confirmed in a recent long - term study (see also table 3 for trial data ;). with this study, the authors were able to confirm the results of a study performed previously (see table 3 ;). the positive impact of cs on oa was also confirmed by meta - analyses, which all showed a significant favorable effect of cs over placebo [33, 40, 41 ]. these authors listed 39 clinical studies or meta - analyses in which cs was used to treat oa. most of these studies came to the conclusion that cs has a significant positive effect on oa patients. one of the studies without a significant effect was the gait study (see table 1 for further details). in that study, intake of cs resulted in only a 5.3% higher responder rate than placebo, which was not statistically significant. however, treatment with cs led to a statistically significant improvement in knee joint swelling. the statistical nonsuperiority of cs in pain reduction can probably be explained by the unexpectedly high placebo effect in this study (61% responder). all of the studies and meta - analyses [37, 40, 41, 70 ] gave cs an excellent safety profile, therefore there are no safety concerns for long - term use. similar to the gait study, many clinical studies tested chondroitin sulfate together with glucosamine [6, 47, 7274 ]. this synergistic effect was also proposed by various in vivo and in vitro studies [55, 7578 ]. cs increases the hyaluronan production by human synovial cells, which has a beneficial effect on maintaining viscosity in the synovial fluid. it has been shown that cs stimulates the chondrocyte metabolism, leading to the synthesis of collagen and proteoglycan, the basic components of new cartilage. furthermore, cs inhibits the enzymes leukocyte elastase and hyaluronidase, which are found in high concentration in the synovial fluid of patients with rheumatic diseases. cs also increases the production of hyaluronic acid by synovial cells, which subsequently improves the viscosity and the synovial fluid levels. in general, cs inhibits cartilage destruction processes and stimulates the anabolic processes involved in new cartilage formation (for review see [6, 69 ]). in addition, cs, when added to chondrocyte cultures, produces a dose - dependent increase in cell proliferation. several mechanisms are discussed which lead to the positive impact of cs on oa patients. pharmacokinetic studies were able to show that orally ingested chondroitin sulfate is absorbed as a high molecular mass polysaccharide and can be detected in plasma, together with derivatives, resulting from partial depolymerization and/or desulfation. a pharmacokinetic study (1990) in rats and dogs tested the distribution of tritiated cs orally and intramuscularly. plasma levels showed a rapid increase after oral administration, followed by a large plateau with a maximum after 14 or 28 hours in rats and dogs, respectively. in the years after the publication of the gait study, using a combination of glcnhcl and cs, new pharmacokinetic data in humans, for both chondroprotectives became available. jackson. tried to assess the pharmacokinetic behavior of oral glcn and cseither separately or combined. first they found that the basal levels of glcn in plasma were at any time below the detection limit, while with cs plasma levels were approximately. 20 g / ml and did not show any circadian variation. in a second trial phase, they examined the pharmacokinetics of 1500 mg of glcnhcl, 1200 mg cs, or a combination of both substances. in a third phase, they selected a group of patients with symptomatic knee oa (as part of gait) who had already received 1500 mg glcnhcl, 1200 mg cs, or a combination of both for more than 3 months every day. the main finding was that none of the experimental procedures led to alterations in the endogenous plasma cs concentration. the basal glcn levels in plasma which had not been detectable before increased, but with combined administration together with cs were significantly reduced. the authors concluded that the clinical improvement of oa symptoms which was obvious in the numerous clinical trials (also for a subgroup of the gait patient population,) is not caused by a synergistic effect of both agents during intestinal absorption, but that there may be indirect effects of these two agents on joint health. they hypothesize that the favorable clinical effects of both compounds may result from changes in cellular activities in the gut lining or in the liver, where concentrations of ingested cs, or its breakdown products, could be substantially elevated following oral ingestion. in summary, all the information from these in vitro and in vivo studies, the clinical trials, as well as meta - analyses lead to the conclusion that there is sufficient data to support the use of oral cs in oa. the findings show that cs reduces pain, improves function / mobility of the joint, and reduces the progression of oa by its structure - modifying effects. in addition to the combination glcns + cs, other related substances, for example, hyaluronic acid (ha, hyaluronan) and collagen hydrolysate, have been used in oa patients. regarding therapeutical use of ha, the backbone of a proteoglycan aggregate within the ecm, not all clinical trials reported the same positive result. it seems that higher - molecular - weight hyaluronic acid may be more effective than lower molecular - weight ha. intra - articular treatment with ha has been accepted and is widely used as oa therapy. however, there is a controversy over the efficacy of orally administered ha. based on basic pharmacokinetic research it has been found that orally administered high - molecular - weight ha also reached the joint, which provides a rationale for the oral supplementation of ha. authors of a clinical pilot study concluded that ha enhances several aspects of quality of life in adults with knee oa. a larger sample size would be necessary to confirm this result. in a recent review in which the sysadoa treatment was analyzed using the grade system, experts came to the conclusion that in addition to chondroitin sulfate or glucosamine sulfate also hyaluronic acid has demonstrated pain reduction and physical function improvement with very low toxicity, with moderate to high quality evidence. in summary, the described effects justify the use of these three cartilage components in patients suffering from oa. for collagen hydrolysate, from the available in vitro and in vivo studies as well as clinical trials [85, 86 ], it may be concluded that collagen hydrolysate is absorbed by the gastrointestinal tract and incorporated into the joint cartilage. while oa is not synonymous with inflammatory arthropathy, new results indicate that inflammation is not only a secondary event, it is involved in the development of oa from the very beginning [8789 ]. many inflammatory mediators are expressed in the cartilage and synovial tissue in early oa stages. the findings of benito indicate that inflammatory mediators and nuclear transcription factors involved in the inflammatory cascade are significantly higher in early - stage oa patients, when compared to late - stage oa. many studies have identified overweight (bmi 2529.9 kg / m) and obesity (bmi > 29.9 hart and spector showed that a bmi increase of 2 units will increase the risk of knee oa manifestation by 36%. this is not only due to the additional weight and mechanical stress on the joints, as nonweight - bearing joints such as the hands are significantly more affected in patients with high bmi, due to metabolic reactions. these include increased inflammation, induced by leptin and other adipocytokines, and dietary lipids or lipid peroxidation, which can lead to cartilage destruction. therefore, oa is not induced by biomechanical factors and age alone, and several metabolic factors are also involved [98106 ]. leptin is overexpressed in obese patients and is present in the synovial fluid, as well as articular chondrocytes., leptin stimulates the synthesis of insulin - like growth factor 1 (igf-1) and transforming growth factor beta (tgfb-1), two mediators important for proliferation of chondrocyte and extracellular matrix synthesis, by binding to the leptin receptor [103, 104 ]. these two factors appear to have a positive anabolic impact on the joint by increasing the cartilage matrix production. excessive and pathological concentrations of leptin, however, like those found in obese patients, have an opposite effect on chondrocytes, cartilage, and bone, leading to osteophyte formation and cartilage degeneration. osteophytes in the joints usually limit joint movement and thus provoke pain. in vitro experiments have elucidated several mechanisms by which excessive amounts of adipokines lead to the destruction of articular joints. in cartilage derived from human oa patients, leptin enhances the synthesis of several proinflammatory mediators, such as no, pge2, il-6, and il-8, via inducible nitric oxide synthase (inos) pathways. by inhibiting the inos activity, furthermore, membrane bound prostaglandin e synthase 1 (mpges-1) and cox-2 enzyme are overexpressed in the cartilage of such patients. cox-2 this overexpression can be induced by il-1 and tnf - alpha, factors released by adipose tissue. pge2 overproduction enhances no - induced cell death of oa chondrocytes. when il-1 acts together with leptin, they can activate nitric oxide synthase type ii, which increases no production in chondrocytes. elevated no levels lead to various catabolic processes in the cartilage, such as the loss of chondrocyte phenotype, thereby reducing production of ecm, and to chondrocyte apoptosis, and ecm degradation [113, 114 ]. leptin induces the synthesis of matrix metalloproteinases (mmp), especially mmp9 and mmp13 [115117 ], via il-1 and tnf - alpha. mmps are a large family of enzymes that degrade different components of collagen and proteoglycans. both mmp9 (gelatinase) and mmp13 (collagenase) mmp13 is produced by chondrocytes and cleaves collagen type ii (the main collagen type in articular cartilage) and the proteoglycan molecule aggrecan, leading to structural damage of the cartilage tissue. these experiments clearly show that obesity, mediated by leptin, exerts a proinflammatory and catabolic effect on cartilage, leading to apoptosis of chondrocytes and the degradation of the extracellular matrix. resitin and visfatin, together with leptin, increase the inflammatory status by means of various mechanisms, which together with mechanical overload leads to phenotype loss and apoptosis of chondrocytes, as well as cartilage matrix degeneration [99, 101 ]. thus, overweight and obesity play an important role in the genesis of knee and hip joint oa not only as a result of mechanical overload but also by the complex combined action of genetic, metabolic, neuroendocrine, and biomechanical factors and represent a significant modifiable risk factor not least for this reason. it was shown that mechanical stress induced cox-2 expression and that mpges-1 mrna (pge synthase 1) and protein are increased in cartilage explants. mpges-1 and cox-2 have also been found to be stimulated by il-1 in chondrocytes. traumatic injury to the joints results in activation of many genes, including inflammatory mediators, cartilage degrading proteinases, and stress response factors. investigators were able to show that these fragments stimulate the expression of inflammatory cytokines and chemokines, such as il-8, il6, and il-1, indicating that cartilage damage can result in further progressive cartilage degradation. the stimulation of the cytokines by fn - f is mediated by the nf-b pathway. it was further shown that fn - f stimulates mmps in chondrocytes, which breaks down the cartilage [121, 122 ]. mmp13, for example, destroys type ii collagen, the main collagen component of the hyaline cartilage [123, 124 ]. regardless of the source, increased concentrations of inflammatory mediators activate specific aggrecanases (adamts-4/-5), which cleave the aggrecan molecule in a specific region and thereby destroy the activity of this important cartilage structure molecule. the complex relationship between obesity and oa shows that overweight certainly represents the most significant modifiable risk factor for avoiding knee or hip joint oa. weight reduction and weight stabilization on the basis of a balanced diet with low energy density is crucial in manifest oa. but also the metabolic processes can be influenced by a dietary therapy which mainly includes chondroprotectives, such as glucosamine and chondroitin sulfate or omega-3 fatty acids. an alternative treatment to the common nsaid therapy for oa is the use of so - called nutraceuticals, such as glucosamine, chondroitin sulfate, hyaluronic acid, hydrolyzed collagen, and omega-3 fatty acids and various vitamins and minerals. in addition to cartilage metabolism stimulation and thereby cartilage regeneration, many of them possess mechanisms which modulate the inflammatory events and oxidative processes involved in oa. as they are components of natural foods, they have far fewer adverse effects in long - term use than nsaids or cox-2 inhibitors, as shown in many clinical trials (see above). they interfere with the inflammatory scenario, illustrated above, at various points (see also figure 2). the glucosamine and chondroitin sulfate combination suppresses il-1-induced gene expression of inos, cox-2, mpges, and nf-b in cartilage explants. this leads to reduced production of no and pge2, two mediators responsible for the cell death of chondrocytes and inflammatory reactions [128, 129 ]. there are several ways by which glucosamine or chondroitin sulfate reduce synthesis of the cox-2 enzyme. inhibition of the il-1 beta induced nf-b pathway by glucosamine sulfate results in reduced synthesis of the cox-2 enzyme [130133 ]. another manner in which glucosamine hydrochloride inhibits cox-2 activity is the prevention of cox-2 co - translational n - glycosylation and the facilitation of cox-2 protein turnover. cs alone diminishes the nuclear translocation of nf-b, which reduces the formation of proinflammatory cytokines il-1beta and tnf - alpha and proinflammatory enzymes such as cyclooxygenase 2 (cox-2) and nitric oxide synthase-2 (nos-2) (for review see). the anti - inflammatory capability of cs was also tested in a rabbit atherosclerosis model. in that model, cs reduced the proinflammatory molecules c - reactive protein and il-6 in serum, as well as the expression of mcp-1 and cox-2 in the peripheral blood mononuclear cells. it also influenced nf-b that is responsible for the induction of inflammatory processes. the mrna expression of such enzymes (mmp-13 and aggrecanases (adamts-5)) was reduced in cartilage explants incubated with glcns and cs. in the same study, the tissue inhibitor of metalloproteinase-3 (timp-3), a potent inhibitor of adamts, was upregulated. glucosamine sulfate alone was shown to inhibit the activation process of mmp-2 and mmp-9 expression, via downregulation of the nf-b pathway. experiments with rat chondrocytes have shown that il-1 inhibits the expression of the enzyme galactose--1,3-glucuronosyltransferase i (glcat - i), a key enzyme in the biosynthesis of cartilage gag chains. in addition to their anti - inflammatory action, glucosamine and chondroitin sulfate exhibit an antioxidant action which leads to a significant reduction in inos expression and activity [138, 139 ]. this is one explanation why glucosamine and chondroitin reduce the otherwise no - induced cell death of chondrocytes. in comparison to glucosamine and cs, hyaluronic acid exerted a very minor anti - inflammatory and antiapoptotic effect, while it significantly reduced no levels. the reactive oxygen species (ros), produced by the body are neutralized by the body 's antioxidant defense system, such as peroxidase, superoxide dismutase, or catalase. under disease conditions, however, the increased amount of ros can no longer be managed by the natural defense system. arthropathies such as osteoarthritis and rheumatoid arthritis are characterized by the increased formation of free radicals [98, 102, 140 ]. ros, which are extensively expressed during oa [92, 93, 141, 142 ], are involved in matrix and cartilage degeneration, inhibition of matrix synthesis, cell death, and apoptosis of chondrocytes. in vitro experiments confirmed that mechanical shear stress increases the production of oxidants in cartilage explants. in a study, serum samples of 29 patients with knee oa and 26 healthy controls were analyzed for their oxidative status. total antioxidant capacity (tac) and, in addition, the oxidative stress index (osi index) were determined as antioxidant parameters. the oxidative stress was measured based on total peroxide (tp) content and lipid hydroperoxide and the osi index was calculated from the tp / tac ratio. compared with the healthy controls, the oa patients had a significantly higher osi index, whereas all the markers for antioxidant activity were lower. prolidase activity (collagen synthesis marker) was also significantly lower in the oa patients. moreover, the enzyme activity correlated positively with the antioxidant concentration (tac) and negatively with oxidative stress (os) conversely, oxidative stress was associated with impaired cartilage metabolism.a working group showed that oa patients have a significantly reduced concentration of antioxidants (vitamins c and e) and increased oxidative stress. oxidative stress was measured on the basis of the malondialdehyde (mda) concentration.therefore, oa treatment should not only focus on regeneration and anti - inflammatory processes but also on the reduction of oxidative stress in these patients. positive effects on oa have been found for a number of vitamins and minerals (for review see [143, 144 ]). vitamin c, for example, stimulates collagen synthesis, and to a lesser extent the synthesis of aggrecan. proteoglycan synthesis is increased in chondrocyte cultures (for review see [143, 146 ]). similar results were reported for vitamin e, which is known for its strong antioxidant effects, its protection against ros, and enhancement of chondrocyte growth. patients treated with vitamin e displayed a significant reduction in pain when compared to placebo, and comparable effects to diclofenac (for review see). this enzyme is involved in the process of glycosaminoglycan synthesis, which is important for the cartilage matrix. in a double - blind, placebo - controlled study, the combination of selenium and vitamins a, c, and e, had a positive but nonsignificant effect that tends to improve pain and stiffness in oa patients, compared to placebo. manganese is a component of glycosal and xylosyltransferase enzyme which are responsible for the glycosidic binding and thus for the glycosaminoglycan synthesis. manganese is also involved in the cross - linking of collagen fibrils and inhibits elastin - degrading elastases. copper, an essential component of lysyl oxidase, contributes to the cross - linking of collagen and elastin in cartilage and bone tissue, and molybdenum is a cofactor of sulfitoxidase enzyme producing sulfates which are important for proteoglycan synthesis. the reactive oxygen species (ros), produced by the body are neutralized by the body 's antioxidant defense system, such as peroxidase, superoxide dismutase, or catalase. under disease conditions, however, the increased amount of ros can no longer be managed by the natural defense system. arthropathies such as osteoarthritis and rheumatoid arthritis are characterized by the increased formation of free radicals [98, 102, 140 ]. ros, which are extensively expressed during oa [92, 93, 141, 142 ], are involved in matrix and cartilage degeneration, inhibition of matrix synthesis, cell death, and apoptosis of chondrocytes. in vitro experiments confirmed that mechanical shear stress increases the production of oxidants in cartilage explants. in a study, serum samples of 29 patients with knee oa and 26 healthy controls were analyzed for their oxidative status. total antioxidant capacity (tac) and, in addition, the oxidative stress index (osi index) were determined as antioxidant parameters. the oxidative stress was measured based on total peroxide (tp) content and lipid hydroperoxide and the osi index was calculated from the tp / tac ratio. compared with the healthy controls, the oa patients had a significantly higher osi index, whereas all the markers for antioxidant activity were lower. prolidase activity (collagen synthesis marker) was also significantly lower in the oa patients. moreover, the enzyme activity correlated positively with the antioxidant concentration (tac) and negatively with oxidative stress (os). a working group showed that oa patients have a significantly reduced concentration of antioxidants (vitamins c and e) and increased oxidative stress. therefore, oa treatment should not only focus on regeneration and anti - inflammatory processes but also on the reduction of oxidative stress in these patients. positive effects on oa have been found for a number of vitamins and minerals (for review see [143, 144 ]). vitamin c, for example, stimulates collagen synthesis, and to a lesser extent the synthesis of aggrecan. proteoglycan synthesis is increased in chondrocyte cultures (for review see [143, 146 ]). similar results were reported for vitamin e, which is known for its strong antioxidant effects, its protection against ros, and enhancement of chondrocyte growth. patients treated with vitamin e displayed a significant reduction in pain when compared to placebo, and comparable effects to diclofenac (for review see). this enzyme is involved in the process of glycosaminoglycan synthesis, which is important for the cartilage matrix. in a double - blind, placebo - controlled study, the combination of selenium and vitamins a, c, and e, had a positive but nonsignificant effect that tends to improve pain and stiffness in oa patients, compared to placebo. manganese is a component of glycosal and xylosyltransferase enzyme which are responsible for the glycosidic binding and thus for the glycosaminoglycan synthesis. manganese is also involved in the cross - linking of collagen fibrils and inhibits elastin - degrading elastases. copper, an essential component of lysyl oxidase, contributes to the cross - linking of collagen and elastin in cartilage and bone tissue, and molybdenum is a cofactor of sulfitoxidase enzyme producing sulfates which are important for proteoglycan synthesis. synergistic action of chondroprotectives, omega-3 fatty acids, and other nutrients omega-3 polyunsaturated fatty acids (pufas), such as linolenic acid and eicosapentaenoic acid (epa), are found in walnut, flaxseed, and fish oils. they are known for their anti - inflammatory actions, which has been shown in several studies (see [144, 147, 151 ]). they have been successfully used in clinical trials, mainly to treat rheumatoid arthritis [152154 ]. in vitro studies showed that omega-3 fatty acids increase collagen synthesis and decrease the inflammation mediator pge2. epa, when oxygenated, results in the bioactive product resolving e1 (rve1). by activation of a specific receptor, chemr23, rve1 dramatically reduces inflammatory processes by inhibiting the nf-b pathway that is responsible for many of these processes. omega-3 fatty acids decrease il-1-induced aggrecanase and collagenase activity and reduce mrna expression of adamts-4, cox-2, il-1, and tnf-. furthermore, they decrease the protein levels of several mmps (for review see). they are generated to an increased extent in oa and are involved in cartilage degeneration (99,152), but also promote inflammatory processes in the body quite generally. numerous studies have dealt with the anti - inflammatory effects of the polyunsaturated fatty acids eicosapentaenoic acid (epa) and docosahexaenoic acid (dha) and their role in cartilage metabolism.a recent study was able to demonstrate that the combined administration of epa and dha in a glucosamine therapy markedly alleviated the discomfort of knee and hip joint oa patients. in this randomized study, 177 patients suffering from moderate to severe oa of the knee or hip joint were subdivided in two groups. one group took a combination of 1,500 mg of glucosamine sulfate plus the omega-3 fatty acids epa and dha as well as vitamins a, d, and e every day for 26 weeks. the other group was given a preparation without epa and dha. at baseline and at weeks 13 and 26 the subjects were examined and their complaints were documented based on the western ontario and mcmaster universities osteoarthritis - index (womac). both groups showed an improvement as a result of the therapy demonstrated by a reduction in the womac pain score of 20% or more. if the criterion of therapy success was greater, for example, 80%, a significantly greater number of patients in the combination group (52.2%) reached this aim as compared to the group taking the preparation without epa and dha (37.9% ; p = 0.044 ; figure 3). in addition, typical oa symptoms such as joint stiffness or joint pain had already decreased at week 13 and towards the end of the trial continued to decrease by 48.5% to 55.5% in the epa and dha group as compared to 41.7% to 55.3% in the control group.the results of these in vivo and in vitro experiments clearly demonstrate an anti - inflammatory action for glucosamine, chondroitin sulfate, hyaluronic acid, and omega-3 fatty acids. due to these abilities, omega-3 polyunsaturated fatty acids (pufas), such as linolenic acid and eicosapentaenoic acid (epa), are found in walnut, flaxseed, and fish oils. they are known for their anti - inflammatory actions, which has been shown in several studies (see [144, 147, 151 ]). they have been successfully used in clinical trials, mainly to treat rheumatoid arthritis [152154 ]. in vitro studies showed that omega-3 fatty acids increase collagen synthesis and decrease the inflammation mediator pge2. epa, when oxygenated, results in the bioactive product resolving e1 (rve1). by activation of a specific receptor, chemr23, rve1 dramatically reduces inflammatory processes by inhibiting the nf-b pathway that is responsible for many of these processes. omega-3 fatty acids decrease il-1-induced aggrecanase and collagenase activity and reduce mrna expression of adamts-4, cox-2, il-1, and tnf-. furthermore, they decrease the protein levels of several mmps (for review see). they are generated to an increased extent in oa and are involved in cartilage degeneration (99,152), but also promote inflammatory processes in the body quite generally. numerous studies have dealt with the anti - inflammatory effects of the polyunsaturated fatty acids eicosapentaenoic acid (epa) and docosahexaenoic acid (dha) and their role in cartilage metabolism. a recent study was able to demonstrate that the combined administration of epa and dha in a glucosamine therapy markedly alleviated the discomfort of knee and hip joint oa patients. in this randomized study, 177 patients suffering from moderate to severe oa of the knee or hip joint were subdivided in two groups. one group took a combination of 1,500 mg of glucosamine sulfate plus the omega-3 fatty acids epa and dha as well as vitamins a, d, and e every day for 26 weeks. the other group was given a preparation without epa and dha. at baseline and at weeks 13 and 26 the subjects were examined and their complaints were documented based on the western ontario and mcmaster universities osteoarthritis - index (womac). both groups showed an improvement as a result of the therapy demonstrated by a reduction in the womac pain score of 20% or more. if the criterion of therapy success was greater, for example, 80%, a significantly greater number of patients in the combination group (52.2%) reached this aim as compared to the group taking the preparation without epa and dha (37.9% ; p = 0.044 ; figure 3). in addition, typical oa symptoms such as joint stiffness or joint pain had already decreased at week 13 and towards the end of the trial continued to decrease by 48.5% to 55.5% in the epa and dha group as compared to 41.7% to 55.3% in the control group. the results of these in vivo and in vitro experiments clearly demonstrate an anti - inflammatory action for glucosamine, chondroitin sulfate, hyaluronic acid, and omega-3 fatty acids. due to these abilities, based on the preclinical and clinical data, it is obvious that chondroprotectives such as glucosamine, chondroitin sulfate, and other nutrients, such as antioxidants and pufas, can modulate osteoarthritis. in long - term use they exhibit, in contrast to nsaids, an excellent safety profile, with as few adverse events as placebo. the chondroprotectives are essential components of the cartilage metabolism and stimulate important cartilage regeneration processes, thereby adjusting the imbalance of catabolic and anabolic processes in osteoarthritis. newer data point out that inflammation and oxidative stress are characteristics of all stages of the disease. they defend chondrocytes against oxidative stress - induced apoptosis, reduce the inflammatory mediator - induced joint cartilage degeneration, and reactivate the inflammation - reduced anabolic processes of extracellular matrix components. this leads to reduced inflammation, swelling, and pain, and to an increased mobility of the affected joints. especially when used in combination with other nutrients, such as antioxidants and omega-3 fatty acids, these substances are able to exert synergistic effects on the osteoarthritic joints. recently new study results were published that demonstrate promising effects of further food substances or phytochemicals, such as contained in ginger extracts, showing various antiosteoarthritic actions and, for example, even intra - articular resveratrol showing chondroprotective effects in a rat animal model. in summary, future nutraceutical approaches to oa most likely will have to be more complex and should include glucosamine sulfate (and/or chondroitin sulfate) together with hyaluronic acid, collagen hydrolysate, and several other nutrients which were shown to have promising actions on joint cartilage, synovial fluid, and overall clinical outcome in oa patients. | osteoarthritis (oa) is a degenerative joint disease that is characterized by increasing loss of cartilage, remodeling of the periarticular bone, and inflammation of the synovial membrane. besides the common oa therapy with nonsteroidal anti - inflammatory drugs (nsaids), the treatment with chondroprotectives, such as glucosamine sulfate, chondroitin sulfate, hyaluronic acid, collagen hydrolysate, or nutrients, such as antioxidants and omega-3 fatty acids is a promising therapeutic approach. numerous clinical studies have demonstrated that the targeted administration of selected micronutrients leads to a more effective reduction of oa symptoms, with less adverse events. their chondroprotective action can be explained by a dual mechanism : (1) as basic components of cartilage and synovial fluid, they stimulate the anabolic process of the cartilage metabolism ; (2) their anti - inflammatory action can delay many inflammation - induced catabolic processes in the cartilage. these two mechanisms are able to slow the progression of cartilage destruction and may help to regenerate the joint structure, leading to reduced pain and increased mobility of the affected joint. |
the author of this article disclose the following potential conflicts of interests : sven blte receives royalties for the german version of the social responsiveness scale (skala zur erfassung sozialer reaktivitt) from hans huber publishers. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. | the social responsiveness scale (srs) is a tool for quantitative autism assessment in children and adolescents. the srs - a addresses social responsiveness in adulthood. reliability and validity using the german adaptation of the srs - a was examined in 20 adults with autism spectrum disorder (asd), 62 with other mental disorders (clin) and 163 typically developing (td) participants. cronbach s alpha ranged from.71 (td) to.89 (asd). a srs - a total score of 67 had a sensitivity of.85, and a specificity of.83 for asd versus clin / td. correlations with established autism scales (ados, aq, scq) were moderate to high (r =.25.83). results provide adequate preliminary support for the application of the srs - a. |
during october 27november 5, 2014, ridoh s center for acute infectious disease epidemiology was notified of 3 l. monocytogenes infected persons residing in the same city. the 3 case - patients were all non - hispanic white persons > 60 years of age ; 2 had an immunocompromising condition. interviews conducted by the center for acute infectious disease epidemiology identified a single common restaurant visited by the 3 patients. center for food protection performed inspections and collected food and environmental samples at the establishment. pfge analysis showed that clinical l. monocytogenes isolates from the 3 case - patients shared an identical, common pfge pattern (figure). to determine the relationship between the isolates, ridoh collaborated with federal partners to conduct wgs. results of wgmlst showed that the isolates were closely related (05 allelic differences) (figure) and a close genetic match (median allelic differences 4) to a clinical isolate from a 2013 patient, who was reinterviewed and reported eating at the same restaurant. a sliced prosciutto sample from the restaurant tested positive for l. monocytogenes, and pfge patterns for this isolate matched those for isolates from the 2013 and 2014 case - patients. results of wgmlst showed that the isolate from the prosciutto differed by 05 alleles (median 3) from the 2014 clinical samples and by 011 alleles (median 4) from the 2013 clinical sample (figure). sequences for the isolates were uploaded to genbank (7) (clinical isolates : accession nos. samn03218571). median (minimum maximum) allele differences and pulsed - field gel electrophoresis (pfge) patterns for listeria monocytogenes isolates from clinical and food samples associated with a 2014 cluster of listeriosis cases and a 2013 listeriosis case, rhode island, usa. allele differences were determined by whole - genome multilocus sequence typing (wgmlst). adapted from data provided by the enteric diseases laboratory branch, national center for emerging and zoonotic infectious diseases, centers for disease control and prevention (atlanta, ga, usa). a total of 10 food and environmental food samples were initially collected from the restaurant. swab samples were obtained from the food slicer, preparation tables, and walk - in cooler. environmental investigation of the restaurant identified issues related to control of l. monocytogenes : the temperature of the refrigerated unit that held sliced meat and other food items was elevated (52f [11c ]), and cleanliness issues were observed with the preparation tables and slicer. an additional 19 environmental samples were later collected from the establishment ; however, the refrigerated unit and preparation tables had been replaced, so additional swab samples could not be collected from those surfaces. the sample of sliced prosciutto was the only l. monocytogenes positive sample identified at the restaurant ; however, just 1 of the 2014 case - patients reported eating prosciutto (in an antipasto salad) at the restaurant. ridoh tested a sample of prosciutto from an unopened package from the establishment and collaborated with the food safety and inspection service to see if the processing plant had recently tested positive for l. monocytogenes. the sample tested negative, and no positive tests had been reported at the plant in at least 1 year. epidemiologic, environmental, and laboratory investigation results implicated a restaurant with sanitation issues and improper sliced meat storage as the likely source of a multiyear listeriosis outbreak. a long incubation period makes wgs an effective technology to use during listeriosis outbreak investigations and to identify outbreak - associated cases originally believed to be sporadic cases. this technology can help overcome difficulties associated with investigating listeriosis cases and can be useful for the investigation of other pathogens. in this investigation, wgs (wgmlst) helped link the 2013 listeriosis case, which was originally believed to be a sporadic case, to the 2014 outbreak. furthermore, given that the 4 isolates had a common pfge pattern, this technology increased confidence that the restaurant, which was the only common restaurant among the 4 patients, was the source of the outbreak. the allelic differences observed are consistent with slow, spontaneous mutation occurring over a long period due to persistent contamination. there is no set number of allelic differences used to determine whether clusters of cases are part of actual outbreaks (8). thus, wgs is not sufficient by itself to identify outbreaks and must be performed in conjunction with epidemiologic, laboratory, and environmental investigations (8,9). in the investigation the close relationship that wgs showed between the clinical isolates and the isolate from meat provides additional evidence that the restaurant was the likely source of contamination for the cases in 2013 and 2014. our findings support the need to control l. monocytogenes at retail food establishments. storing meat at < 41f (5c) can prevent 9% of listeriosis cases (2). in addition, retail delicatessens and food establishments can prevent l. monocytogenes associated illnesses among customers by controlling cross - contamination, cleaning and sanitizing food contact surfaces, and eliminating environmental niches. | in november 2014, the rhode island department of health investigated a cluster of 3 listeriosis cases. using whole - genome sequencing to support epidemiologic, laboratory, and environmental investigations, the department identified 1 restaurant as the likely source of the outbreak and also linked the establishment to a listeriosis case that occurred in 2013. |
we report the use of inhaled nitric oxide (ino) as a rescue treatment in a patient with acute the right heart syndrome (arhs) secondary to chronic pulmonary artery hypertension (pah) decompensated by multifactorial causes. a 39-year - old female, diagnosed case of chronic kidney disease on maintenance hemodialysis (hd) for the past 9 years with severe pah secondary to chronic pulmonary thromboembolism (pte) presented with the complaints of progressive breathlessness and abdominal distension for the past 1 week. there was no history of fever or cough ; blood pressure [bp ] 92/46 mmhg, pulse rate [pr ] 96/min, respiratory rate [rr ] 36/min). considering her non - tolerance to hd, it was planned to start her on peritoneal dialysis (pd). during the first cycle of pd she was then shifted to intensive care unit (icu) for further management. at presentation to the icu, she was drowsy, sluggishly responding to verbal commands. her abdomen was soft, mildly distended with evidence of free fluid and palpable liver (bp : 70/40 mmhg, pr : 102/min, rr : 30/min, spo2 : 99% on high flow o2 via non - rebreathing mask) her labs were : hemoglobin 12.3 g / dl, total leucocyte count 8600/l, serum sodium 138 meq / l, serum potassium 6 meq / l, blood urea nitrogen 63 mg / dl, creatinine 6.0 mg / dl. arterial blood gas (abg) revealed hypoxia and hypercarbia with mixed acidosis (ph : 7.189, paco2 : 60.3 mmhg, po2 : 52.7 mmhg, hco3 : 22.5 mmol / l, be : 6.54 mmol / l, serum lactate 1.92 mmol / l). an echocardiogram revealed markedly dilated right ventricle (rv)/right atrial / inferior vena cava (ivc) ; moderate tricuspid regurgitation (tr), severe pulmonary arterial hypertension (pah) with (pulmonary artery systolic pressure [pasp ] = 93 mmhg paradoxical septal motion ; decreased right ventricular (rv) function and reduced left ventricular (lv) compliance. work - up for sepsis and acute myocardial ischemia was carried out and was ruled out. considering her critically ill state, she was not subjected to any radiological investigation to rule out acute pulmonary embolus. on day 1 of icu admission, she was managed with high dose inotropes and vasopressors : infusion nor - adrenaline (1 mcg / kg / min) and infusion dopamine (20 mcg / kg / min), empiric broad spectrum antibiotics, low molecular weight heparin and sustained low efficiency dialysis. by day 2, her vasopressor requirement increased and infusion vasopressin (0.04 units / min) was added. in view of her poor sensorium, her pre - intubation abg was ph : 7.18, paco2 : 60 mmhg, po2 : 66.6 mmhg, hco3 : 21.9 mmol / l, be : 7.1 mmol / l while post - intubation abg was ph : 7.29, paco2 : 36.7 mmhg, po2 : 80.4 mmhg, hco3 : 17.3 mmol / l, be : 8.3 mmol / l. on day 3, echocardiography revealed findings similar to day 1 echocardiography (pasp 95 mmhg). in view of her refractory pulmonary hypertension ino was started (day 3) through nitric oxide blender (noxbox, ben font scientific ltd. by 12 h (icu day 4) of ino, vasopressors were tapered down. pd was restarted on day 5 with cumulative negative balance of 2 l (approx). blood gasses on day 5 revealed ph : 7.45, paco2 : 28.4 mmhg, po2 : 136.2 mmhg, hco3 : 20 mmol / l, be : 5.3 mmol / l and lactates 1.61 mmol / l. her follow - up echocardiography showed a significant reduction in pa pressures with pasp measuring 73 mmhg at 48 h and 63 mmhg at 72 h of ino initiation [figure 1 ]. gradually, her vasopressor were weaned off completely and no was withdrawn after 72 h (day 6). she was extubated the next day and subsequently was maintained on non - invasive ventilation with inspiratory positive airway pressure of 12 mmhg, expiratory positive airway pressure of 4 mmhg. stay the methemoglobin levels were < 1%, as measured by the co - oximetry test. pulmonary artery systolic pressure in mmhg on echocardiography before and after use of inhaled nitric oxide arhs is defined as a sudden deterioration in rv function that may result in systemic hypoperfusion. this syndrome is secondary to an increase in pulmonary vascular resistance (pvr) and hence rv afterload usually precipitated by exacerbations of chronic lung disease with pah (e.g., hypoxic pulmonary vasoconstriction in chronic obstructive pulmonary disease), acute massive lung disease (e.g., acute respiratory distress syndrome [ards ] or pulmonary embolism), high positive end expiratory pressure or acute rv infarction. acute increase in rv afterload results in increased rv end - systolic volume and a decreased rv ejection fraction. severe rv dysfunction may decrease lv end - diastolic volume, thus reducing lv stroke volume and cardiac output. this paragraph enumerates all the possible multiple conditions that might have caused an imbalance and led to decompensation. we postulate that a fresh episode of pte resulted in an increase in rv afterload, which might have caused an imbalance in her then compensated hemodynamic state. non - tolerance to her regular hd sessions resulted in fluid overload, pulmonary edema and metabolic acidosis. pd fluid inflow into the peritoneal cavity caused upward displacement of the diaphragm resulting in further respiratory compromise, ventilation / perfusion mismatch and hypoxia. finally, the mechanical compression of the ivc by the peritoneal fluid caused a decrease in rv preload. supportive therapies are based on reducing pvr, which include improving oxygenation, avoiding respiratory acidosis, correction of metabolic acidosis, avoiding over inflation of the lung alveoli etc., though theoretically promising, substantial improvements in cardiovascular function has not been uniformly demonstrated with the use of vasoactive drugs when administered systemically because of systemic hypotension to an undesirable degree. ino preferentially vasodilates the pulmonary vasculature with its effects limited to ventilated areas of the lung. ino attenuates hypoxic pulmonary vasoconstriction, decrease pulmonary artery pressures and improve oxygenation in several pulmonary diseases, including persistent pulmonary hypertension in neonates, ards, primary pulmonary hypertension, pre - operative and post - operative cardiac surgery. mechanisms of the right ventricle dysfunction in critically ill patients with therapeutic interventions aimed at improving rv function we report the use of ino as a rescue treatment in patient with arhs. our patient demonstrated a substantial improvement in hemodynamic parameters characterized by decreased vasopressor requirement, decrease in pasp and successful weaning. this is likely of clinical significance in terms of acute management of her hypoperfused state. | acute right heart syndrome is a common occurrence in intensive care units and is associated with a poor prognosis. there is lack of understanding of the involved pathophysiology, standard diagnostic protocols and treatment guidelines. management goals include ensuring adequate right ventricle (rv) filling, maximizing rv contraction and reducing rv afterload. we describe a 39-year - old female with acute decompensated right heart failure secondary to multiple causes. she was managed with inhaled nitric oxide. her condition improved, which was evident by a decrease in her pulmonary artery systolic pressure on serial echocardiography, decreased requirement of vasopressors and successful weaning from the ventilator. |
in the 1 century ad aurelius cornelius celsus described cancer in chronic ulcers for the first time (1). in 1828, jean - nicolas marjolin from paris university wrote a section on ulcers that appeared in dictionnaire de medicine, where he described four examples of a type of ulcer under the designation of " ulcre verruqueux ". the description, about half a page, did not say that the ulcers were malignant, nor did it associate them with scars or pre - existing chronic ulcers (2). in 1903 john chalmers dacosta, professor of surgery at jefferson medical college, exemplified two cases of carcinomatous change in chronic varicose ulcers of the leg. he wrote : ' the characterization of this condition as marjolin 's ulcer i think to be proper, because it was first carefully studied and accurately described by professor marjolin, of paris, over fifty years ago. ' (3). in 1907, fordyce also used the meaning of marjolin 's ulcer and later, dacosta extended the definition to include malignancy arising in sinuses as well as malignancy in scars and chronic ulcers (4). it was dupuytren in 1839 who first observed that de novo malignancy could arise in chronic wounds by observing this phenomenon in a belgian man who was treated for a cancer which arose from a burn scar sustained from sulphuric acid (5,6). in 1930, treves and pack reported the first, now landmark and classic, review of cancer in burn scars (5). today, the term marjolin s ulcer is used to describe malignant degeneration in burn scars, chronic venous insufficiency ulcers (7), pressure ulcers (8), vaccination sites, urinary fistulas (6), frostbite (9), snakebites (10), osteomyelitis (11), pilonidal abscesses (12), hydradenitis suppurativa (13), herpes zoster (14), skin graft donor sites (15), dog bites, knife wounds, and gunshot wounds (16). although a rare condition, marjolin 's ulcer is an aggressive disease that tends to spread widely in its course. in this article, we present 83 cases of marjolin 's ulcer. this retrospective report is not only one of the large single series of marjolin 's ulcer appeared so far in english literature, but also features some rare occurrences that have been impetus for some authors to publish separate manuscripts as case reports. we have focused our attention on description of patients ' demography, type of original skin insult, time interval between original lesion and cancer, cancer histology, and lymph node involvement. issues regarding treatment and survival were not included in this report, as they could make the report too voluminous and therefore, could be best treated in another article. retrospectively, records of the patients who underwent surgery with a clinical diagnosis of marjolin 's ulcer between 1995 and 2012 in imam khomeini hospital and cancer institute (affiliated to tehran university of medical sciences) were retrieved using the surgical registry. patients with the pathologic diagnosis of malignancy (marjolin s ulcer) were entered into the study and the rest including patients with benign skin lesion or records with other diagnosis except for majolin s ulcer were excluded. based on the contents of the records, each patient 's age, gender, original cause of skin lesion and its time of onset, location of the primary skin lesion, presence of palpable regional lymph node(s), and tumor pathology and its grade (differentiation) were recorded. tumor differentiation was obtained as stated in the pathology report sheets and classified based on a three - grade scale (well differentiated, moderately differentiated, and poorly differentiated). not all pathology reports contained notes on tumor differentiation. statistical analysis : all data were recorded using a standard data form and then analyzed by spss 17. quantitative values were compared using t - test for independent none, and for categorical data, chi - squared and fisher 's exact tests were also applied. the mean age of the patients was 55.30 (sd=16.83) years, the youngest 21 and the oldest 90 years old. the mean age of males was 50.88 (sd=17.38) years and that of females was 57.18 (sd=15.38) years old (p = 0.058). table 1 shows the frequency of the sites of the primary (and of course, the site of marjolin 's lesion). foot was the most prevalent site of primary skin lesion (49.4%) followed by scalp (15.6%). in table 2, the conditions leading to the skin lesion upon which marjolin 's ulcer developed are summarized. burns following contact with hot objects or flame were the most common cause (fig., there was marjolin 's ulcer on surgical scar, bite scar, and bed sore. marjolin 's ulcer on a lower limb burn scar table 3 depicts prevalence of different time intervals from the time the primary skin lesion was made and the time when the patient sought medical treatment for the newly developed lesion. some patients could not remember the exact date of the primary lesion when the lesion developed in a remote time, and mentioned ' infancy ' or ' childhood '. the scc was the most common diagnosis, and well - differentiated most of the time. our youngest patient was a 21-year - old man who sustained a burn on his right sole when he was 2 years old. since 8 years prior to surgery our oldest patient was a 90-year - old man with a burn on his right hand one year prior to surgery. he had positive axillary lymph nodes, and the pathology report indicated a well differentiated scc. interval between the time of original injury and the subsequent malignancy was less than 1 year in 6 patients and between 1 and 5 years in another 6 patients. table 5 shows data specifically for these none. in table 6, data concerning unusual forms of marjolin 's ulcer, as well as poorly differentiated scc are summarized. in a classic report by treves and pack, more than 2,000 patients with skin cancer were evaluated ; and it was revealed that 2% of all squamous cell carcinomas and 0.3% of basal cell carcinomas resulted from burn scar conversion. similar to findings in our report, in a series by esther (18), the male to female ratio was 3:1, with the average age of patients being over 50 years. reports by gl and kili (19) and lefebvre (20) also indicated similar ratios. malignant changes in burn scars can be observed at any age. in literature, the average age at diagnosis ranged between 53 and 56 years. the scc originating in burn scars manifests 2040 years after the original burn (17,21). lefebvre found the mean age as 65.14 in their study (20). in another study, the mean age was found as 53.5 for acute burn carcinoma and 56 years for chronic burn carcinoma (22). perhaps the most comprehensive review of burn scar neoplasms so farwas conducted by kowal - vern and criswekll (23), who reviewed 412 cases from 146 articles between 1923 and 2004. in their article, the mean ages at tumor diagnosis was 50 and 20 years for the mean age at the time of burn injury, and the latency period was 31 years, with a 2:1 male : female distribution. while the scc and sarcoma were equally distributed, but bcc and other neoplasms were more frequent in males, and melanoma was more frequent in females. fleming (24) state that over 90% of marjolin s ulcers degenerate into malignancies of epidermoid origin, such as sccs, basal cell carcinomas and malignant melanomas. most burn scar carcinomas are scc, whereas most arising in areas of radiation dermatitis are basal cell carcinoma (1). the most common histological type of malignancy originated from chronic wounds is the squamous cell carcinoma, and the second - most common one is the basal cell carcinoma. other types of malignancies such as malignant melanoma, liposarcoma, osteosarcoma, adenocarcinoma and fibrosarcoma can also be seen, though very rare (25,26). in kowal - vern and criswell report (23), 71% (293 cases) of the tumors were scc, 12% (48 cases) bcc, 6% (23 cases) melanoma, 2% (6 cases) scc bcc, 1% (5 cases) scc melanoma, 5% (21 cases) sarcoma, and 4% (16 cases) other neoplasms. of the 21 sarcomas, malignant fibrous histiocytoma (mfh) (8 cases), fibrosarcoma (3 cases), liposarcoma (2 cases), dermatofibrosarcoma protuberans (2 cases) were the most common types. cultures that encouraged chronic exposure to thermal skin injuries had historically been associated with skin neoplasms : the kangri burn cancer in india, the kairo of the japanese and the kang cancer of north - west china, the british reports of erythema ab igne, and the algerian charcoal heaters (5,27 - 30). these tumors are characteristically slow growing initially, but very aggressive following local surgical therapy. experiment performed by arons on rats (31) suggested a pattern of malignant change in trauma starting with acanthosis, going through stages of basal cell hyperplasia and pseudo - epitheliomatous hyperplasia with atypical basal cell changes, and finally ending with epidermoid carcinoma. the healed burn injury, especially if the skin healed by secondary intention is at risk for continued injury during the course of daily activities because it no longer has the accoutrements of skin such as a normal dermis, nerves, vessels, and adnexa, but is rather a less elastic covering, more easily injured, ripped, and ulcerated compared to normal skin (23). in order to explain rarity of neoplasm other than scc and bcc in burn scar, fleming and rezek suggested, perhaps those connective tissue tumors occur much less frequently than epidermal malignancies because the deeper tissue is subjected to less trauma and undergoes less tissue regeneration than the superficial, more vulnerable, epidermis (24). in treves and pack report (5), tissue toxins released by the burn eschar through autolysis and poor vascularization of scar tissue that predisposes it to ulceration, acting as a protective barrier against metastases were proposed to explain emergence of cancer in burn scar. since then, various other factors have been implicated : immunological factors, cocarcinogens (32), and miscellaneous factors such as irritation, poor lymphatic regeneration, antibodies, dna mutations and local toxins (33). bostwick (34) suggested that cancers that develop within chronic scars may do so within an immunologically privileged site. dense scars surrounding these lesions may obliterate afferent lymphatics, preventing antigens specific for the tumor from being recognized by usual immune - surveillance mechanisms. although the precise pathogenesis of burn scar carcinoma remains unknown, it is mostly believed that malignant degeneration is caused by repeated ulcers and healings. poor lymphatic regeneration, undernourished state of the burn scar, thickness, and degree of contraction in scars are the other factors that predispose burns to develop carcinoma (17,21,22,35) recent advances at the molecular level have shown that burn scar with the scc condition have mutation in fas gene which controls apoptosis hence it, may contribute to neoplastic proliferations in burn scars (36,37). it suggests that the burn or injury, while not in itself carcinogenic, may cause the wound tissue to be more susceptible to other carcinogens such as ultraviolet light or radiation (38). encompassing all burn scars, prevailing theories today depict the burn as an immunologically privileged site, with the scar hindering natural immune - surveillance. crawley emphasized that patients with a lymphocytic infiltrate around the tumor were more likely to survive since they had mounted an immunologic attack on the tumor and limited the spread (39). heredity may play a role as evidenced by recent findings that hla dr4 could be associated with the development of cancer (40). hayashi (41) and harland (42) independently reported on the abnormalities in the p53 gene in patients with burn scar carcinoma. in kowal - vern and criswell review (23), the major risk factors for the development of post - burn neoplasms have been healing by secondary intention, non - healing wounds, and fragile scars that ulcerated and were easily traumatized. for example, in a report by asuquo from nigeria (43), chronic traumatic ulcer was the leading problem, found in 83.3% of patients, followed by burns. the latency period (18.5 years) was somewhat less than the previously reports (range of 2050 years) ; and the histologic diagnosis in all the cases were squamous cell carcinoma. in another report (44) from nigeria, marjolin s ulcers represent up to 30% of primary skin cancers, and the predisposing lesion has not been burns. marjolin s ulcer tends to be more aggressive than other types of skin cancer, and has a higher regional metastasis and fatality rate. although most sccs have a metastasis rate of 0.53.0%, those originating from a burn scar have a metastasis rate averaging approximately 30% (45,46). the most significant prognostic factor predicting recurrence is tumor graded histologically, with grade ii (moderately differentiated scc) having a propensity for rapid spread to lymph nodes. grade i was less likely to spread and was slower if it did spread (47). in kewal - vern and criswell report (23), regional lymph node involvement was seen in 22% of the cases. this was much lower than rate of lymph node involvement in our study. in a report by copcu (48) 31 cases of marjolin 's ulcer were reviewed, with the majority of ulcers located on the extremities (18 of 31 ; 58%). however, enlarged lymph nodes were found in six (19%) patients, three of whom had a tumor on the leg. the other three patients had a tumor on the hand and axillary lymph node enlargement. (49).it is important to note that marjolin s ulcers have been shown to behave differently, depending on their location. novick (1), in a review of 46 patients from m.d. anderson hospital, reported a metastatic rate from lower extremity lesions that was twice as high as rates in any other part of the body. the scc is frequently seen at the head / neck localization, whereas those arising on burn scars is mostly localized on lower extremities (20). most lesions of marjolin s ulcer occur on the extremities (60%), especially flexion creases, where blood supply is decreased and trauma is increased, with the head and face occurring less frequently (30%) and those on the trunk the least frequent at 10% (5,32). this pattern of distribution was also observed among our patients. in kewal - vern and criswell report (23), of 396 cases, the lower extremities were most frequently affected 132 (33%), followed by the head (face, scalp, neck areas) 118 (30%), upper extremities 73 (19%). of interest, bcc was not seen on the lower extremities. in a recent study by gl (19), 20 of 36 sccs developing on burn scars were localized on lower extremities (55.55%), with the head / neck occurring less frequently (22.22%) and those upper extremities (11.11%) and trunk (11.11%) the least frequent. (figure 2) marjolin 's ulcer located on the stump of a knee amputation development of malignancy tends to be slow. multiple authors have reported case series with an average lag period between injury and onset of cancer between 19 and 36 years. average age at the time of tumor onset is the fifth or sixth decade of life (1,10,18,21,38,48,50,51). treves and pack (5) reported that malignant degeneration within a burn scar can very rarely be acute, occurring within 12 months, or more commonly chronic, occurring after 12 months. when acute, it is more often a basal cell carcinoma and associated with more superficial burn scars. when acute malignant degeneration to squamous cell carcinoma does occur, it more frequently presents in the older age group, over 50, with keratotic skin. cases with acute onset have been reported to emerge within weeks (15,52). a case of well - differentiated scc has been reported to appear in a 14-year - old boy 6 weeks postburn (52). regarding the age of the patient and of the burn scar, in 1952, lawrence (53) hypothesized that a patient s age at the time of the burn is inversely proportional to the interval to formation of cancer. in kewal - vern and criswell report (23), that while the majority of the patients were burned in childhood, those who developed bcc had their burn injury when they were significantly older (43 - 21 years) compared to patients with the other tumor types (20 - 19 years). the neoplastic latency period was significantly shorter for patients with bcc (19 - 22 years) compared to those with scc (32 - 18 years) and sarcoma (35 - 18 years) none. in their review, only 19 (4.6%) of the tumors had a latency period of less than 1 year. younger patients (40 - 19 years old) were more likely to have a latency period of less than 1 year compared to patients (50 - 18 years old) with a latency period greater than 1 year. fibrosarcoma is the most common type of sarcoma in the scar, perhaps because precursor cells of fibrosarcoma (fibroblasts) exist in abundance in the skin scar tissues. in addition, it is suggested that the histogenesis of both fibrosarcoma and malignant fibrous histiocytoma which are the most common two burn scar sarcoma types, is the same ; they originate from undifferentiated mesenchymal cells (54 - 56). in burn scar sarcomas, the mean time between the burn injury and diagnosis of the tumor was 35.7 years with a range 3 - 71 years, comparable with the average latent period of burn scar carcinomas (53,57,58). unlike burn scar carcinomas, acute onset of a malignancy was not reported in burn scar sarcomas. malignant fibrous histiocytoma (mfh) is the most common soft tissue sarcoma (59). although there is controversy regarding the exact number of reported mfh arising in burn scar, this entity is definitely a rare occurrence. ycel (60) in 2000 reported two cases of mfh developing in burn scar, indicating that there were only 3 cases reported before hand. in general, the origin of primary cutaneous leiomyosarcoma is from the erector muscles of hair and muscles of sweat glands (61). to the best of our knowledge, the patient was a 22-year - old male complaining of non - healing scalp ulcer in the pre - existing burn scar. this scar was caused by a burn injury when he was 2 years old (57). marjolin 's ulcer, once related only to burn scar and known to be of limited histologic variety, is now better identified and its association with virtually any chronic, and even acute or subacute, skin condition and astonishing histologic diversity better understood. we presented a relatively large series of patients with marjolin ' ulcer with significant range of both underlying skin conditions and histology, as well as latent periods. for the sake of brevity, we did not include discussion on some rare features like surgical and bite site as the underlying skin derangement, as well as some histologies like verrucous carcinoma., some data could not be accurately recorded (latent periods), and some data were not available (metastasis). vigilance on the part of caring physicians in combination with close surveillance and patient education may help identify emergence of marjolin 's ulcer as early as possible to provide the best possible treatment for this aggressive, violent disease. | background marjolin 's ulcer is a rare, aggressive condition that arises on chronic skin lesions and diseases. inthis article, we will report 83 cases of this disease.methods retrospectively, we retrieved 83 records of patients with cancer arising from chronic skin conditions.data concerning demography, type of original skin insult, time interval between original lesion and cancer, cancer histology, and lymph node involvement were recorded.results the mean age was 55.30 years (range : 21 - 90). there were 51 males (61.5%) and 32 females (38.5%).foot was the most prevalent site of primary skin lesion (49.4%) followed by scalp (15.6%). original skin insultswere burn (87.9%), osteomyelitis (2.4%), radiation (2.4%), electrical burn (1.2%), surgical scar (2.4%),pemphigus (1.2%), bite (1.2%), and bed sore (1.2%). histologic diagnosis were well differentiated scc(38.6%), scc, differentiation not reported (24.1%), moderately differentiated scc (13.2%), bcc (9.6%), poorlydifferentiated scc (6.0%), melanoma (2.4%), verrucous carcinoma (2.4%), mfh (1.2%), mucoepidermoidcarcinoma (1.2%), and leiomyosarcoma (1.2%). most of the cases occurred more than 20 years after the initialskin insult. there were 6 (7.2%) cases that developed within 1 year (acute marjolin 's ulcer). forty three patients(69.3%) had palpable regional lymph nodes. conclusiondata in this series were in confirmation with many other reports. marjoln 's ulcer should be consideredas a significant post - skin injury complication. |
individuals are exposed to volatile compounds present in tap water by ingestion, inhalation, and dermal absorption. traditional risk assessments for water often only consider ingestion exposure to toxic chemicals, even though showering has been shown to increase the body burden of certain chemicals due to inhalation exposure and dermal absorption. we collected and analyzed time - series samples of expired alveolar breath to evaluate changes in concentrations of volatile organic compounds being expired, which reflects the rate of change in the bloodstream due to expiration, metabolism, and absorption into tissues. analysis of chloroform and trichloethene in expired breath, compounds regulated in water, was also used to determine uptake from tap water by each route (inhalation, ingestion, or absorption). each route of exposure contributed to the total exposure of these compounds from daily water use. further, the ingestion dose was completely metabolized before entering the bloodstream, whereas the dose from the other routes was dispersed throughout the body. thus, differences in potential biologically effective doses depend on route, target organ, and whether the contaminant or metabolite is the biologically active agent.imagesfigure 1. afigure 1. bfigure 1. cfigure 2. afigure 2. b |
|
the human insulin receptor is a heterotetramer consisting of two extracellular subunits and two transmembranous and intracellular subunits. the subunits mediate insulin binding and subunits have tyrosine kinase activity (1). insulin binds to the subunit of the receptor and stimulates autophosphorylation and kinase activity of the subunit (2). the human insulin receptor is coded by the gene insr, and insr mutations result in insulin resistance (3). one, referred to as type a, includes insulin resistance, acanthosis nigricans, hirsutism, and polycystic ovarian disease in a patient who is usually not obese. the second syndrome is leprechaunism, which presents with severe hyperglycemia due to insulin resistance, hyperinsulinemia, acanthosis nigricans, hirsutism, thick skin with lack of subcutaneous fat, distended abdomen, enlarged genitalia in the male, dysmorphic features (elfin - like face, lowset ears, promitent eyes, thick lips), and growth retardation (4, 5). children afflicted with leprechaunism die within the first 2 yr of life (6). the last one is rabson - mendenhall syndrome (rms), which is manifested with severe insulin resistance with hyperinsulinemia, acanthosis nigricans, tooth and nail dysplasia, growth retardation, and pineal hyperplasia. although patients with rms usually survive beyond 1 year of age, they develop constant hyperglycemia followed by diabetic ketoacidosis and death. here, we describe clinical findings in the first korean rms patient and report two novel mutations of insr, which were confirmed by clinical, biochemical, and molecular findings. the male patient was admitted to the hospital at the age of 8 months due to pigmentations on skin - folded areas, gingival hyperplasia, and hirsutism, on 28 december 1999. he was born as the first child to healthy non - consanguineous korean parents at 38 weeks of gestation ; birth weight and length were 2,450 g (10 - 25th percentile) and 47 cm (25 - 50th percentile). neonatal screening tests including length and body weight were within the 5 - 10th percentile at 8 months old. initial laboratory tests showed normal fasting glucose, 69 mg / dl (reference range ; rr, 60 - 100 mg / dl). fasting insulin level was severely elevated, up to 554.6 iu / ml (rr, 7 - 24 iu / ml), and c - peptide level was increased, up to 13.81 ng / ml (rr, 0.4 - 2.2 ng / ml). however, the percent of glycosylated hemoglobin (hba1c) was within normal range ; 4.8% (rr, 4.5%-6.5%). ast and alt were slightly elevated, to 51 u / l (rr, 15 - 55 u / l) and 49 u / l (rr, 5 - 45 u / l). glucose and insulin level were normal ; 57 mg / dl, 3.7 iu / ml. after iv administration of glucose (0.3 g / kg), rapid increase of glucose level up to 204 mg / dl was observed after 2 min, and insulin level was extremely elevated up to 2,508 iu / ml. maximal elevation of insulin level was 3,300 iu / ml after 4 min, which suggested extreme hyperinsulinemia to glucose load. old, his fasting glucose was checked, up to 128 mg / dl with glucosuria (+ + +) ; therefore, a low - sugar diet and oral hypoglycemic agent (metformin 250 mg / day) therapy were started. at the age of 18 months, he started growth hormone therapy due to poor height gain and low igf-1 level of 14.3 ng / ml (rr, 31 - 160 ng / ml). however, we stopped growth hormone therapy after 3 months, due to minimal effect and hyperglycemia. at the age of nine years old, he was admitted to our hospital due to poor glycemic control (hba1c 11.0%), thereafter, additional oral hypoglycemic agents (metformin 500 mg bid, glimepiride 2 mg bid, and voglibose 0.2 mg tid) have been administered until now, with hba1c less than 8%. severe growth retardation has not been demonstrated ; weight of 5 - 10th percentile and height of 10 - 25th percentile. recent laboratory tests performed at the age of 10 yr still showed increased insulin resistance and subsequent hyperglycemia ; insulin 364.1 iu / ml (rr, 7 - 24 iu / ml), c - peptide, 4.30 ng / ml (rr, 0.4 - 2.2 ng / ml), hb a1c 7.6%. hyperandrogenism was not demonstrated ; testosterone, 0.08 ng / ml (rr, 0.03 - 0.1 ng / ml). he has not experienced diabetic ketotic acidosis, and has had no complications until now. for identification of the underlying genetic defect, we performed molecular genetic testing for the insr gene. genomic dna was isolated from peripheral blood leukocytes using the wizard genomic dna purification kit (promega, madison, wi, usa). primers designed by the authors were used for amplification of all coding exons and their flanking intronic sequences of the insr gene by polymerase chain reaction using a thermal cycler (model 9700 ; applied biosystems, foster city, ca, usa). direct sequencing was performed using the same primer sets and the bigdye terminator cycle sequencing ready reaction kit (applied biosystems, rotkreuz, switzerland) on the abi prism 3130xl genetic analyzer (applied biosystems, foster city, ca, usa). in result, 2). one is a c to a transversion at nucleotide position 90 (c.90c > a) in exon 1, replacing tyrosine to a premature stop codon at codon 30 (p.tyr30x). the other is a g to a transition at the nucleotide position 712 (c.712 g > a) in exon 3, replacing glutamic acid with lysine at codon 238 (p.glu238lys). mutations in the insr cause a spectrum of inherited insulin - resistance syndromes ranging from leprechaunism, in which afflicted children die in infancy, to type a insulin resistance, usually evident after puberty. cells from most patients with leprechaunism show absent or severely impaired insulin binding to insulin receptor, whereas cells from patients with rms retain some insulin binding capacity (7). therefore, the severity of the phenotype seems to be determined by the degree of insulin resistance and that residual insulin binding capacity correlates with survival (8). in this patient, several pieces of evidence, including hyperinsulinemia with insulin resistance, acanthosis nigricans, hirsutism, abnormal dental findings, and peculiar morphology suggested leuprechaunism or rms. our patient had showed relatively mild phenotype and lived longer than 2 yr, therefore he was diagnosed as rms. in most cases, nonsense mutations cause leprechaunism phenotype by reduction of insulin binding activity (8). patients with leprechaunism had subunit mutations or homozygosity in subunit mutations, which tend to predict a more severe clinical course (9). most patients with type a syndrome had heterozygous mutations in the subunit, which affect kinase activity and result in a mild decrease in insulin binding capacity (8, 10). reported mutations of rms, located within the subunit of the insr gene, were homozygous mutations, including c284y / c284y (11), s323l / s323l (12), and heterozygous mutations including n15k / r1000x(subunit) (13), c159f / r229c (7), and h209r/359s (14). reported mutations of rms, located within the subunit of the insr gene, were heterozygous mutations, including i1131 t (10), r1131w (10), p970 t (8), i1115 t (10), i1116 t (8), r1174w (8), and r1000x / n15k (subunit) (13). previously, we cultured fibroblast cells from skin in this case and suggested the possible mechanism of insulin resistance at the molecular level ; however, at that time, we failed to identify the mutation in the patient (6). now, we have determined that this patient had one novel nonsense mutation (p.y30x) and another novel missense mutation (p.e238k) within the subunit of the insr. tyrosine 30 is in the extracellular l1 domain ; however, the exact function of this region is unknown. glutamic acid 238 is in the extracellular furin - like cystein - rich domain of subunits. some of these cysteines are thought to participate in maintenance of the structure of the insulin - binding site through establishment of disulfide bonds between subunits (15). however, the cystein - rich domain does not appear to contain direct insulin / insulin receptor contact sites (16). characterization of the naturally occurring point mutations p193l (17), h209r (18), and l233p (19) also suggests that this domain is important for insulin receptor processing and transport to the cell surface. in particular, close proximity to our p.e238k mutation, a missense mutation at amino acid position 233 in exon 3 (p.l233p), has previously been shown to completely block processing and transport of insulin receptor to the cell surface (19, 20), which would not alter qualitative insulin binding activities in vitro (7). as described above, it is reported that only missense mutations were within subunit of the insr gene in rms, and nonsense mutations in subunits have only been found in leprechaunism. in conclusion, we report a case of two novel mutations in subunit of the insr ; which is the first case of rms where a nonsense mutation is located within the subunit of the insr. | rabson - mendenhall syndrome (rms) is a rare syndrome manifested by extreme insulin resistance with hyperinsulinemia, acanthosis nigricans, tooth dysplasia and growth retardation. our patient was first noted at the age of 8 months due to pigmentations on skin - folded areas. initial laboratory tests showed normal fasting glucose (69 mg / dl). fasting insulin level was severely elevated, up to 554.6 iu / ml, and c - peptide level was increased, up to 13.81 ng / ml. however, hemoglobin a1c was within normal range (4.8%). he is now 11 yr old. his growth development followed the 5 - 10th percentile and oral hypoglycemic agents are being administered. the last laboratory results showed insulin 364.1 iu / ml, c - peptide 4.30 ng / ml, and hemoglobin a1c 7.6%. the boy was a compound heterozygote for the c.90c > a and c.712 g > a mutations of the insulin receptor gene, insr, which are nonsense and missense mutations. in summary, we report the first korean case of rms, which was confirmed by two novel mutations of the insr. |
these stages include angiogenesis, focal invasion through the basement membrane, connection with vascular endothelium and target organ, and tumor cells removal from the inner part of the tissue. simultaneous with these proceedings, matrix metalloproteinase (mmps) are secreted by tumor cells. for example, bone metastasis occurs in 70% of patients with breast and prostate cancer and it is also found in 85% of patients who die of breast and prostate cancer, whilst the occurrence of bone metastasis in patients with gastrointestinal cancer is reported between 3% and 15%. for this reason, the patients are at the risk of developing skeletal symptoms and complications including pain, decrease in activities, high blood calcium level, high blood pressure, and damage to nervous system such as spinal cord compression and fracture. therefore, early detection of patients who are at risk and appropriate treatment can lead to improvement in patients quality of life, reduction in treatment costs, the prevention of patients disability and the prevention of life threatening complications. a large number of bone metastases have no symptoms and are often found accidentally during first examinations or during patients follow up. in the symptomatic cases, standard techniques for detection of bone metastases are using imaging modalities including radiography and (99 m) tc - mdp bone scintigraphy. current treatment for bone metastasis includes analgesics to control the pain, radiation therapy (local or systematic), bisphosphonates and surgery. since these patients are finally referred to radiation oncology centers, examining patients who referred to the shahid ramezanzadeh radiotherapy center as the only center of radiotherapy - oncology in yazd and centers of excellence in treating patients with cancer in south of iran can give us an index of demographic and clinicopathological characteristics in patients with bone metastasis in above - mentioned region. detection of these characteristics enables physicians to search for proper treatment protocols and to provide the appropriate facilities for improving diagnosis and treatment of complications promoted by them. this study was approved by the ethics committee of shahid sadoughi university of medical sciences. the current study was a cross - sectional study in which the target populations were the patients with bone metastasis who referred to shahid ramezanzadeh radiation oncology center in yazd in the years between 2007 and 2012. the study 's inclusion criterion was the evidence of bone metastasis in radioisotope scan and/or cross sectional radiological studies. data were collected using the questionnaire based on the intended goals and it was done by the researcher using the information in patients records. then, according to his / her requirement, the patient underwent radiotherapy and/or systemic therapy according to the oncologists decision. radiation therapy was performed by using cobalt 60 machine or 9mv photon of nepton linear accelerator. all of them were treated with a two - dimensional technique and most of them with two parallel apposed fields. for 93 patients the dose of 30 gray (gy) in 10 daily fractions was given. thirty one patients received the dose of less than 30 gy (25 patients received the dose 20 gy in 5 daily fractions and 6 patients received the dose 8 gy in one day). forty three patients received doses above 30 gy (3750 cgy in 15 daily fractions). except in fewer than 5 percent of the patients, this modality was used when more than 3 months had past from the previous course of radiation therapy and the disease was under control in other sites, however the patients complained of bone pain. if the patient had been given the dose of 8 gy in one fraction this time he (she) received 30 gy in 10 daily fractions. overall survival was calculated from the day of diagnosis of bone metastasis (according to radioisotope scan and/or radiological studies) to death or last visit. through coordination with the health center of the province, data on mortality demographics of patients was obtained, however information regarding other provinces was gathered through telephone contacts. the mean age of examining patients was 57.91 15.19 years and the age limit was 27 to 87, and most of the patients were in the 66 to 87 age range. of 167 patients who were studied, 89 persons were men (53.3%) and 78 persons were women (46.7%). of these 167 patients with bone metastasis, 39 patients suffered from breast cancer, 37 patients had prostate cancer, 24 patients suffered from lung cancer and 67 patients were with other cancers (figure 1). of these 89 men, 37 (41%) were determined to be prostate cancer patients, 17 (19%) were diagnosed to be lung cancer patients and 7 (7/8%) were found to be gastrointestinal cancer patients. and of 78 women, 37 (47%) were determined with breast cancer, 11 (14%) were diagnosed with gastrointestinal cancer and 7 (8%) suffered from lung cancer. pain was the first manifestation in 145 of the whole 167 patients with bone metastasis ; neurologic symptoms were the earliest in 14 patients ; and in 8 patients, pathologic fracture happened first. of 167 patients who referred to this radiation oncology center and who were studied, 51 were determined with lumbar vertebrae involvement, 24 patients with thoracic vertebral involvement, 25 patients with pelvic involvement, 28 patients with lumbar and thoracic vertebral involvement, 16 patients with upper extremity involvement, 8 patients with lower extremity involvement and 15 patients with other parts of the skeletal involvement. in most patients (136), the disease was diagnosed by isotope bone scan, it was diagnosed by mri in 27 patients and just in 4 patients the disease was detected by ct scan. of 161 patients with bone metastasis, 31 patients received less than 30 gy radiation dose in their first admission, whereas 93 patients received 30 gy, and 37 patients received more than 30 gy radiation dose. (the number of samples was reduced from 167 to 161 because the patients with a different survival from others were considered as outliers and were excluded from the data set). according to the patients declaration, pain was reduced by applied treatments. in the years between 2007 and 2012, of 167 patients with bone metastasis 102 persons (61.1%) died and 65 persons were part of censored data, i.e. the data which have not achieved the intended event (by event we mean the death). the results of log - rank test showed that there was no meaningful relationship between the age of patients and their survival (figure 2), whereas there was a significant difference between the gender of patients and their survival rate. the results of log - rank test also showed a significant difference between the type of cancer and the patients survival (figure 3). in this study, cox regression was used to examine the ratio of risk of death to types of cancer, taking account of age and in the absence of taking account of age. in the absence of taking account of age, prostate cancer and lung cancer increased the risk of death in patients compared with breast cancer. since we added the age variable to this study, type of cancer lost its impact, and there was no significant difference between prostate cancer and lung cancer compared with breast cancer (figure 4). the results of log - rank test indicated that there was a significant difference between the dosage of radiation and patients survival (figure 5). the results of log - rank test also showed that there was no significant difference between the first manifestation of the disease and patients survival. the results of log - rank test demonstrated that there was no significant difference between anatomical site involved and patients survival. our study was not designed to investigate the relationship between survival and applied systemic treatments. the mean survival in breast cancer patients was 31.1 months, it was 12.9 months in patients with prostate cancer and it was 13.7 months in lung cancer patients. it was found that the mean survival was 22.5 months in patients with bone metastasis in general. frequency of type of primary malignant neoplasm in patients with bone metastases overall survival in patients with bone metastasis according to age. overall survival in patients with bone metastasis according to the type of cancer (taking account of age). at the present time, the incidence rate for all cancers is increasing in our society. methods of diagnosis and treatment for cancers are changing and developing constantly in a way that some of these cancers are even able to be cured in early stages. the burden of medical expenses on a cancer patient, his / her relatives and the society is incomparable with other disease. so the related medical staffs are required to have a comprehensive knowledge about demographic, clinical, and pathological characteristics of cancer patients in order to take through the basic steps of planning for diagnosis, treatment, and rehabilitation processes. therefore, according to the high prevalence of bone metastasis, particularly in breast, prostate, and lung cancers, and according to the importance of early detection of patients at risk, demographic, and clinicopathological characteristics and survival of patients with bone metastasis, who referred to shahid ramezanzadeh radiation oncology center in yazd, iran between 2007 and 2012, were examined in this study. in the current study, the prevalence of bone metastasis in males was a little more than that in females though it was not considerable. this study also indicated that most patients with bone metastasis were older than 66 years old. kim conducted a study in korea ; 84 patients with bone metastasis of unknown primary cancer were selected ; they consisted of 56 men and 28 women ; a mean age of 59.1 years was reported. the results of the current study brought out some similarities to the results of above - mentioned research. in the current study, the frequency of cancer types was also evaluated, with the result that breast, prostate, and lung cancers were the most common cancer types in patients with bone metastasis. bollen revealed that of 1043 patients with bone metastasis, 299 patients suffered from breast cancer, 250 patients were with lung cancer, and 215 patients suffered from prostate cancer. in a research by chen. in the uk, the most common solid tumors, which led to bone metastasis, were breast, lung, prostate, thyroid, and renal carcinomas. moreover, kassa in a prospective study reported that in 376 patients, who had been recruited, 38% were found with prostate cancer, 30% were determined to be breast cancer patients, and 11% had lung cancer, respectively. considering previous studies, three most common cancers, which metastasize to bones are breast, prostate, and lung. the order of these cancers is different because of certain confounding variables such as the difference in the dominant sex of the target population and the environmental factors (cigarette, air pollution, and others). in the present study the initial manifestation of the disease in most patients was pain and it was neurologic complication and pathologic fracture in a few patients. the study by farrel also reported that pain was the most common manifestation of bone metastasis, which is compatible with the results of this study. the current study demonstrated that the disease was diagnosed by isotope bone scan in most patients and the diagnosis was made by mri in certain patients. rybak and rosenthal stated that although there are various procedures and the process of mri is fast, isotope bone scan plays the most significant role in the diagnosis of bone metastasis. and study the evaluation of survival rate in patients with bone metastasis, showed that more than half of these patients died in the years between 2007 and 2012 and the other half survived or had an unknown state. the survival rate for patients with breast cancer was the highest (31.1 months) compared with other cancers ; lung cancer and prostate cancer ranked second and third, in order. we should make it clear that there is no uro - oncologist in our province and patients with urologic malignancies are managed inadequately. therefore, we think metastatic prostate cancers were diagnosed (by using isotope scan and/or cross sectional imaging) very late and because in this study the initial point for calculating overall survival was just at the time of diagnosis of bone metastasis, it is not surprising that these patients had a lower survival period than patients with lung cancer. in a retrospective study completed by domchek, 718 women who referred to massachusetts hospital between 1981 and 1991 and diagnosed with metastatic breast carcinoma, greater than 50% of those with breast cancer developed skeletal complications and 37% of those were diagnosed with bone metastasis. mean survival in group with bone metastasis was reported 26 months. and in a study by farrel mean survival in breast cancer patients with bone metastasis sugiura conducted a study on predictors of survival in patients with bone metastasis of lung cancer in 2008 in japan. in germany, 303 patients with 868 osteolytic metastases who were treated with radiotherapy between 2000 and 2012 were examined. overall survival at 6 months was 76.7% and it was 47.2% in 12 months. in a study carried out in 2008 by chen. it was shown that the mean survival of patients was 38.4 months, which was longer than that in western men and similar to that in japanese men. the reason for the difference in survival of breast, lung and prostate cancer patients, in previous studies and the current study, can be dependent on patients different ethnic groups, at what age the disease is diagnosed and the radiation dose that they received. overall factors maybe contribute to racial disparities in mortality include differences in exposure to underlying risk factors and access to high - quality and timely diagnosis and treatment. in this study, the anatomic area which is involved with bone metastasis was also evaluated and the results showed that the metastasis in most patients involved lumbar vertebrae. the evaluation of common cancers in men and women with bone metastases also demonstrated that prostate, lung, and gastrointestinal cancers in men, and breast, gastrointestinal, and lung cancers in women were the most prevalent. jemal in a research on cancer statics in 2005 in america estimated that the most commonly diagnosed cancers among men were prostate, lung, and colon. the most common cancers among women were cancers of breast, lung, and colon. the results of the current study support this research results. in addition, in the present study, the correlation between the life status in patients, and various demographic variables (age, sex, type of cancer, the amount of radiation dose absorbed in the first visit, the initial manifestation of the disease, and involved anatomic area) were assessed. based on the obtained results of log - rank test, there was only a meaningful correlation between demographic variables sex, type of cancer and radiation dose and the life status in patients. in this study, the correlation between the type of cancer and patients survival was also calculated using cox regression test based on the age of the patients. without considering the age, prostate and lung cancers increased the risk of death compared with breast cancer. since we added the age variable to this study, type of cancer lost its effect, and there was no significant difference between prostate cancer and lung cancer compared with breast cancer. when we adjusted the effect of age, we found that the age variable was more effective than the variable of cancer type in survival of patients with bone metastasis who had referred to this oncology center. in conclusion, the patients referred to this center while they were complaining of pain as the first symptom of the disease and their lumbar vertebrae were involved more than the other parts of the body. the mortality rate was high in these patients and it equated with more than half of the patients with bone metastasis. great numbers of men who referred to this oncology center were found to be prostate cancer patients and the breast cancer was the most frequent in women with bone metastasis, considering this fact that most of these patients were diagnosed by radioisotope bone scan. according to the results of this study, it seems that for increasing the survival of patients, who are at high risk for cancer, particularly the patients with a history of certain cancers such as prostate and breast in the family, it is required to widely use the screening strategies. the information should be publicly available and people and physicians should be aware of the necessity of screening tests. in addition patients with bone metastasis should be referred to medical centers that have a multidisciplinary team of cancer specialists with experience treating them. considering these points enable us to provide early diagnosis of the disease and improve the quality of life in patients. | abstractto evaluate the clinico - pathological and survival characteristics in patients with bone metastasis.this cross - sectional study was conducted on patients with bone metastasis who referred to shahid ramezanzadeh radiation oncology center. for all of the patients studied, demographic and survival information was recorded. spss was used to analyze the data.in this study, 89 men (53.3%) and 78 women (46.7%) with bone metastasis were examined. most of the patients were in the 66 to 87 age range. breast cancer was the most common type of cancer in women and prostate cancer was the commonest in men. in most patients, pain was the first manifestation of the disease, and the spine has been most frequently involved areas. the disease was diagnosed by isotope bone scan in the most cases. the mean survival was 31.1 months for patients with breast cancer, 12.9 months for patients with prostate cancer, 13.7 months for patients with lung cancer and the overall survival was 22.5. there was only a meaningful correlation between sex, type of cancer, radiation dose, and survival in patients. we found that age was more effective than the variable of cancer type in survival of patients with bone metastasis.the prognosis of patients with bone metastasis in our center is fair. there was a significant correlation between sex, type of cancer, radiation dose, and survival. cox proportional hazards model showed that age was a predictor of death. |
postweaning multisystemic wasting syndrome (pmws) is an important disease in weaned pigs worldwide. pmws was first described in canada in 1991 as a chronic disease with progressive weight loss in pigs from 416 weeks of age. since then, the disease has been diagnosed in many countries in north america, asia, and europe including denmark [2, 3 ]. the clinical signs of pmws comprise unthriftiness / wasting, paleness of the skin, enlarged lymph nodes, and occasionally jaundice, respiratory symptoms, or diarrhoea [1, 3, 4 ]. affected pigs have lesions in lymphoid organs characterized by lymphoid depletion and the presence of giant cells and inclusion bodies [47 ]. pcv2 has proved to be necessary but not sufficient for development of pmws, since the virus is present in both affected and pmws - free pigs and herds [4, 8 ]. the pcv2 virus is transmitted between pigs by the oro - fecal and/or respiratory routes [9, 10 ] and vertical transmission has also been documented [4, 11 ]. the high prevalence of pcv2 in almost all herds of all pig - producing countries indicates that the transmission of pcv2 is very effective [1215 ]. in contrast, only a few studies have been performed on the transmission of the pcv2-associated disease complexes (pcvds), that is, whether pmws can be a study performed in new zealand demonstrated disease development in healthy pigs in direct or indirect contact with pmws - affected pigs when they were mingled at 4 weeks of age but not when they were mingled at 12 weeks of age. spatial analysis carried out in denmark and great britain concluded the existence of significant spatiotemporal clusters, suggesting the spread of an infectious agent from farm to farm [17, 18 ]. descriptive epidemiology in sweden also showed a clear tendency of the epidemic to move slowly from south to north. previously we have shown that pmws can be transmitted from pig to pig by close contact and pcv2 has been found in air samples collected in pcv2-positive herds, but it still remained unclear if pmws can be transmitted through air. the purpose of the present studies was to examine the possibility of airborne transmission of pmws in a controlled semiexperimental setup. (unit a, unit b, and unit c). units a and b were placed one meter apart and connected by pipes (tables 24). in unit a, air pressure was increased by a ventilator mounted in the gable that blew fresh air into the room through four adjustable valves. b, air pressure was decreased by a ventilator mounted in a stack in the roof that controlled exhaust air to the outside. thus, air pressure in unit a was always higher than the air pressure in unit b, resulting in air transfer from unit a to unit b through the pipes. the volume of air transferred through the pipes depended on the number and diameter of the pipes as well as the pressure difference between the units. thus, to maintain a particular rate of air transfer, the pipes diameter could be adjusted with orifices. the ventilation system, the opening valves, and the pipes were all calibrated before the beginning of the studies. air pressure differences were measured every 10 min in order to calculate the amount of air transferred. the amount of air transferred from unit a to unit b, expressed as percent of ventilation intake, was on average 83% (s.d. units a and b were 2.5 9.5 meter each and consisted of two rooms. personnel entered through the first room (2.5 2.5 meter) and changed clothes there. the pigs were housed in the second room which was 17.5 m and had slatted plastic floor. units a and b were placed at research facility 1, 2.2 km from other pig herds. unit c was placed at research facility 2 approximately 3.1 km from unit a and unit b, with no pigs within a range of 2.3 km from the unit. the unit was 18 m and consisted of one room with slatted plastic floor and a two - climate system with coverings and straw bedding. the pigs (danish landrace / duroc crossbred), 812 weeks of age, were obtained from three different herds that were all pcv2 infected and pcv2 unvaccinated, verified by serological reactions. two of the herds were pmws affected (pmws-1 and pmws-2) and one was pmws - free (pmws - free). the pmws diagnosis within the pmws - affected herds were based on high prevalence of unthrifty pigs, high mortality among weaners (5 - 6% and 15%), and a positive histopathological examination of lymphoid tissue together with detection of pcv2 antigens according to the eu definition (http://www.pcvd.org/). the pmws - free herd was characterized by low mortality among weaners (2 - 3%). the pmws-1 and the pmws - free herds were infected with prrsv - eu and pmws-2 with a. pleuropneumoniae serotype 2, toxigenic pasteurella multocida, and prrsv - us. a vaccine against porcine parvovirus was used in sows in all three herds. the pmws - affected herds were visited by the veterinarian 3 - 4 days before the start of each of the studies at which time 25 (31 for study ii) pigs with clinical symptoms of pmws among weaners were selected and ear tagged. the same veterinarian visited the pmws - free herd one week before the study and started to make sure that no clinical signs of pmws were present. from the pmws - free herd, the pigs from the pmws - nonaffected herd were randomly assigned to unit a, unit b, and unit c. approximately half of the pigs in unit a and all the pigs in unit b and c originated from the pmws - free herd in both studies. the remaining pigs in unit a originated from the pmws - affected herd pmws-1 in study i and pmws-2 in study ii (table 1). on the day of arrival (day 1), all the pigs were marked with individual ear tags and weighed. water and feed without antibiotics were offered ad libitum throughout the study period. to prevent diarrhoea 2500 ppm zinc oxide was used in the feed the first 10 days after arrival in both studies. transmission of pathogens by personnel was prevented through biosecurity measures (changing clothes before entering units, using disposable gloves and masks covering hair, nose, and mouth). a twelve - hour pig contact quarantine was established before entering the units, within which a shower had to be taken and clothes changed. the pigs were handled in the same order every day : first unit c, then unit b, and finally unit a. transmission by insects was prevented by a fly net at the air inlet in unit b. the duration of both studies was 69 days. the pigs were monitored for clinical signs of pmws three times weekly by the veterinarian. all the pigs that demonstrated severe clinical disease were euthanized during the study. at the end of the study, a tissue sample was taken from the inguinal lymph node, the mesenterical lymph nodes, and the spleen and fixed by immersion into 4% paraformaldehyde at 22c for histopathological examination. sections of paraffin - embedded paraformaldehyde - fixed tissue were stained with hematoxylin and eosin for histomorphological evaluation and immunohistochemistry for pcv2 by specific monoclonal antibodies as previously described. the individual pigs were diagnosed with pmws if they showed clinical signs together with characteristic histopathological lesions in lymphoid tissue (lymphocyte depletion together with histiocytic infiltration and/or giant cells and/or inclusion bodies) and detection of moderate or massive amounts of pcv2 antigen by immunofluorescence. additional blood samples were collected from the pigs before euthanization or at termination of the study. the serum samples were tested for prrsv antibodies using immunoperoxidase monolayer assay (ipma) as previously described. the ipma was carried out as a double test using marc-145 cells infected with a danish field strain of prrsv and with an american vaccine strain (ingelvac prrs mlv, boehringer ingelheim), respectively. antibodies against pcv-2 were measured by an in - house developed elisa. tests for antibodies against pcv2, prrs (types i and ii), and pcv2 quantification were only carried out on samples from study ii. the geometric mean was calculated for each group and sampling in study ii as the exponential of the arithmetic mean of the log - transformed titer values (> 0) (table 4). the proportion of samples with a titer value above 0 was also determined (table 4). in study ii, pcv2 was quantified by real - time pcr on serum samples from selected pigs from the pmws - affected herd in unit a and from all pigs in unit b at arrival and, when blood was rescued, at death or at termination of the study. the pcv2 genome of selected samples was pcr amplified in three overlapping reactions and sequenced as previously described [15, 26 ]. the mean weight of the pigs at arrival is listed in table 1. in study i, one of the pigs in unit b died on day 2 after the beginning of the study due to diarrhea and one of the pigs was euthanized due to lameness four weeks after the beginning of the study. no other clinical signs were seen among the pigs from the pmws - free herd in the three units. fourteen of the pigs from the pmws - affected herd in unit a were necropsied. nine of these pigs were diagnosed with pmws according to the eu definition (table 2). in study ii, the pigs from the pmws - free herd in unit a started to show clinical signs of pmws two weeks after mingling with the pigs from the pmws - affected herd. in unit b, receiving air from unit a, the clinical signs were seen three weeks after the start of the study. many pigs had enlarged bronchial and inguinal lymph nodes and some had enlarged mesenteric lymph nodes (table 2). fourteen of the pigs from the pmws - affected herds in unit a were necropsied, and three of these were diagnosed with pmws. ten of the pigs from the pmws - free herd in unit a were necropsied, and three of these were diagnosed with pmws (table 3). of the pigs in unit b, 20 were necropsied and 13 of these were diagnosed with pmws. in both units approximately one - third of the pigs died or were euthanized due to evident wasting. none of the pigs in unit c showed any signs of wasting or any other clinical symptoms of disease. eight of the healthy pigs from unit c were euthanized and necropsied and showed no signs of pmws. the blood samples from study i were not analyzed due to lack of clinical signs and confirmed pmws diagnosis in pigs from the pmws - free herd. the serological profiles of the different groups at arrival and at termination of study ii are shown in table 4. the pigs from both the pmws - free and the pmws - affected herds had antibodies against pcv2 at arrival. the levels of antibodies in the pigs from the pmws - affected herd were significantly higher than the levels in the pigs from the pmws - free herd. a marked increase in the level of pcv2 antibodies was seen in all the pigs in units a and b in contrast to a decrease in the level of pcv2 antibodies seen in the pigs in unit c at facility 2. the pigs from the pmws - affected herd had high levels of antibodies against prrsv type ii (us) at arrival and the level remained high until the end of the study. the pigs from the pmws - free herd had no antibodies against prrsv type ii at arrival. pigs from this herd placed in units a and b showed a marked increase in the level of antibodies towards prrsv type ii from the start to the end of the study in contrast to pigs placed in unit c at facility 2 which did not develop antibodies against prrsv (table 4). apart from the low level in some pigs, all pigs were free from antibodies to prrsv type i (eu) at arrival. the blood samples from study i were not analyzed due to lack of clinical signs and confirmed pmws diagnosis in pigs from the pmws - free herd. in study ii, from unit a 11 of the pigs from the pmws - affected herd that were necropsied the three pigs that got a confirmed pmws diagnosis had pcv2 titers of 1,5e + 10 ; 8,7e + 10 ; and 6,5e + 07, respectively, at the start of the experiment (data not shown). blood was only rescued from one of these pigs at necropsy showing 4,0e + 11 copies of pcv2 pr. the pmws diagnosis could not be confirmed for the remaining eight pigs and these pigs had pcv2 titers at 7,3e + 07 copies of pcv2 pr. ml serum or lower at necropsy, which was slightly lower than at the start of the experiment. from unit b, 38 pigs were tested for pcv2 dna by quantitative pcr at arrival and at necropsy or at termination of the study (figure 1). at the start of the experiment, pcv2 was either undetectable (35 pigs) or very low (three pigs). at the end of the experiment, they all developed high pcv2 titers ranging from 2,8e + 04 to 6,4e + 10 copies of pcv2 pr. eight of the pigs had more than 6,7e + 07 copies of pcv2 pr. additionally four of the pigs analyzed with quantitative pcr were examined histologically due to clinical signs of pmws but did not fulfil the histopathological criteria for pmws diagnosis and they had lower pcv2 titers in the sera (from 3,9e + 04 to 4,1e + 06 copies pr. ml) (figure 1). pcv2 rescued from serum of six pigs from the pmws - affected herd in unit a at arrival and from tissue collected at necropsy from two of the pigs from the pmws - free herd which developed pmws in unit b was sequenced. all sequenced isolates belonged to the genotype 2b and were closely related to circulating danish pcv2 isolates (data not shown). the positions of the few base differences identified in pcv2 genomes isolated from the pigs from units a and b are shown in table 5. two variants of pcv2 were isolated from pigs from the pmws - affected herd in unit a on arrival. one of these variants was also found in both of the pigs that developed pmws in unit b. to our knowledge this is the first controlled study that documents that pmws can be induced in pigs from pmws - free herds exclusively by receiving air from a unit harbouring pigs with clinical pmws. previously, we have shown that pmws can be induced in healthy pigs from pmws - free herds by direct or indirect contact with pigs from pmws - affected herds and others have induced pmws after mingling of pigs inoculated with pcv2 and nave pigs under experimental conditions [13, 14, 27 ]. none of the pigs from pmws - free herds developed clinical signs of pmws after transportation alone. the fact that the pigs from the pmws - free herds in units a and b but not in c had a marked increase in pcv2 titer in serum and an increase in antibodies against pcv2 that coincided with the subsequent development of clinical signs typical of pmws further supported the view that the pigs developed pmws. the pmws diagnosis could not be confirmed by laboratory investigations in a proportion of the pigs with severe clinical signs of pmws. this has previously been reported from field cases and probably represents end - stage pigs in which the virus level in tissues is low because of massive destruction of cells. the pigs from the pmws - free herd developed clinical signs of pmws two weeks after arrival and mixing if they had direct contact with the pmws - positive pigs (unit a) whereas the pigs in unit b which had no direct contact with the pmws pigs developed clinical signs of pmws three weeks after the start of the study. previous studies with experimental pcv2 infection in nave pigs have shown that the transmission of pcv2 is influenced by the contact structure and that direct contact between pigs was more efficient in transmission compared to indirect contact (10 cm distance). furthermore, the same authors found that the mean disease generation time was 18.4 days following contact with a diseased pig. accordingly, we have previously shown that disease was induced in pmws - free pigs 3 - 4 weeks following mingling with pigs from herds with clinical signs of pmws and that close contact was more efficient compared to indirect contact. thus, the finding that the pigs in the present study developed clinical signs of pmws 2 - 3 weeks after arrival indicates that the disease generation times in pcv2-positive pigs are comparable to the situation in nave pigs and that airborne transmission does not delay development of clinical signs. the viral dna sequences found in two of the pigs that developed pmws in unit b were identical and also identical to one of the isolates found in pmws - affected pigs at arrival. it was not possible to sequence the pcv2 virus from the pmws - free herd at arrival ; however the sequencing results support that the pcv2 virus was transmitted from the pmws - affected pigs to the pigs from the pmws - free herds. this is in accordance with our finding in an earlier study on transmission of pmws by direct and indirect contact. the low levels of antibodies to prrsv type i (eu) in the pigs from the prrsv type ii (us) positive herd probably reflect cross - reaction to prrsv type ii and the low levels in the remaining pigs probably reflect residue of maternal antibodies. the increase in levels towards prrsv type i encountered in some of the pigs at termination of the study probably reflects cross - reaction to prrsv type ii since these levels were only detected in pigs with very high levels of antibodies against prrsv us. these results strongly indicate that pigs from the pmws - free herd in units a and b were infected by prrsv us during the study period and that the source was pigs from the pmws - affected herd. prrsv is a well - known infectious trigger of clinical pmws and vice versa [2832 ] and we have previously shown that prrsv can be transmitted by air. thus, the finding that most of the pigs that developed pmws had increased antibody titers against prrsv type ii suggested that this virus contributed to the clinical manifestation seen in study ii. the clinical signs were, however, more in accordance with typical findings in pmws - affected pigs rather than what is typically seen in pigs acutely infected with prrsv. in addition to the role of prrsv, factors such as differences in pcv2 strain, the dose of pcv2 virus excreted by the donor pigs, or even transmission of other unidentified infectious agents from the pmws - affected pigs to the pmws - free pigs may have played a role. in conclusion, the present study showed that pmws can be induced in pigs from a pmws - free herd by airborne contact with pigs from a pmws - affected herd. | the objective of these studies was to investigate if porcine postweaning multisystemic wasting syndrome (pmws) could be induced in healthy pigs following contact with air from pigs with clinical signs of pmws. the pigs were housed in different units. either 31 (study i) or 25 (study ii) pigs with clinical symptoms of pmws from a pmws - affected herd and 25 healthy pigs from a pmws - free, but pcv2-positive, herd were housed in unit a. fifty pigs from a pmws - free herd were housed in unit b, which were connected by pipes to unit a. in unit c, 30 pigs from a pmws - free herd were housed as controls. in study ii, the pigs in units a and b from the pmws - free herd developed clinical signs of pmws 2 - 3 weeks after arrival. pmws was confirmed at necropsy and the diseased pigs had increased pcv2 load and increased antibody titers against pcv2 in serum that coincided with the development of clinical signs typical of pmws. sequence analysis revealed that the pcv2 isolate belonged to genotype 2b. in conclusion, the present study showed that pmws can be induced in pigs from a pmws - free herd by airborne contact with pigs from a pmws - affected herd. |
we observed that myo1c is present at the plasma membrane and also on dynamic raft - enriched tubular carriers emanating from the perinuclear recycling compartment. this dual localization opens the possibility that myo1c performs one or more functions during lipid raft exocytosis (fig. 1) : figure 1. model outlining the possible molecular roles of myo1c in lipid raft recycling. (a) myo1c could mediate cargo sorting at the endocytic recycling compartment (erc), a process that is crucial for the correct recycling of proteins by distinct pathways. by linking lipid raft membranes and cargo proteins associated with these microdomains to adjacent actin filaments (b) myo1c might initiate the generation of recycling tubules at the erc by membrane deformation. by anchoring the membrane to surrounding actin filaments myo1c motor activity could generate a force to deform the membrane for nascent tubular carriers. through its atp - driven powerstroke thereby myo1c might prime the formation of tubule precursers, which may then be elongated toward the plasma membrane by microtubule - associated kinesin motors. (c) myo1c could also be involved in the final stages of exocytosis, where it might propell cargo transport through the dense cortical actin filament network. it is also plausible that myo1c together with its binding partner rala and the exocyst complex mediates the docking and fusion of lipid raft enriched recycling carriers with the plasma membrane. these proposed activities are not mutually exclusive and it is possible that each might contribute to myo1c function in lipid raft exocytosis. a) first of all, myo1c could be involved in cargo sorting at the endocytic recycling compartment (erc) (see fig. at least two distinct pathways recycle cargo from a perinuclear erc back to the plasma membrane ; one of which transports lipid raft - associated cargo, while a separate pathway recycles cargoes internalized via clathrin - dependent endocytosis. the sorting of distinct cargoes at the perinuclear recycling compartment is key to the recycling process and this may be facilitated by the myo1c motor protein, which could link raft microdomains to the actin cytoskeleton primed for cargo transport along actin filaments. b) in addition, myo1c could promote the generation of tubular carriers in the perinuclear region by anchoring and pulling specific membranes along actin filaments to form tubules extending from the lipid raft - enriched recycling compartment (fig. class i myosins are single - headed motors (contain a single motor domain) that have been proposed to act as molecular force sensors, which upon increase of their cellular cargo load remain attached to actin filaments for longer periods, enabling them to generate and maintain tension for extended periods of time. these mechanochemical properties support a role for myo1c in controlling membrane tension and in promoting membrane deformation underlying the initial stages of tubule formation. most likely these tubule precursors are then elongated and transported toward the plasma membrane by microtubule - associated motor proteins such as kinesins, which have previously been observed to accumulate at the tip of tubular membrane carriers and to actively drive tubule extension. intriguingly, another myosin class i member, myo1b, has recently been shown to promote tubule formation at the tgn. myo1b was found to initiate the tubulation of post - golgi carriers by regulating actin assembly and remodeling tgn membranes. c) like its function in transport of glut4-positive vesicles in adipocytes, myo1c could also mediate the final steps of exocytosis through the cortical actin network beneath the plasma membrane, where it might promote, together with its binding partner the gtpase rala and the exocyst complex, the delivery and fusion of lipid raft - containing membranes with the plasma membrane (fig. a role for myo1c in the final stages of exocytosis is supported by the observation that myo1c is required during the regulated exocytosis of cortical granules (cgs) in xenopus laevis oocytes. to block polyspermy egg fertilization induces an increase of intracellular ca, which triggers the stimulated exocytosis of cgs, a process that is driven by the compression of the actin filament coat surrounding the cgs. myo1c is recruited to secretory cgs and disruption of its function resulted in suppressed exocytosis. in this process during the final stages of cg secretion myo1c is believed to link and regulate actin filament polymerisation on the surface of cg and so mediate force production. the severe defect in lipid raft targeting to the cell surface in myo1c depleted cells has a profound impact on cellular processes that require the dynamic remodelling and expansion of the plasma membrane. this defect was found to impair leading edge protrusion, underlying cell spreading, migration and cholesterol - dependent salmonella invasion. in summary, these novel roles for myo1c suggest that it may act as a general regulator of stimulated exocytosis by utilizing its ability to link lipid raft microdomains, actin filaments and the rala - mediated exocytic machinery for cargo delivery. myo1c does indeed facilitate the transport of diverse raft - associated cargoes including glut4, aquaporin-2 and neph1 to the cell surface. moreover, rala and the exocyst complex are also involved in the translocation of vesicles containing the glut4 transporter and aquaporin-2, suggesting that myo1c, rala and the exocyst complex are part of the core machinery required for raft exocytosis. what are the lipid raft - associated cargoes of myo1c that might regulate cell spreading, migration and bacterial invasion ? the central cytoskeletal regulators rac1 and cdc42 localize to raft microdomains, which are known to modulate small gtpase targeting and activation. importantly, defective lipid raft trafficking was observed to mislocalize rac1, which blocked cell spreading, migration and salmonella - induced macropinocytosis. in addition, myo1c may supply membranes to influence cell plasticity, as there is recent evidence that the exocytosis of lipid rafts not only delivers key protein components to the plasma membrane, but also provides the extra membrane required for cell surface expansion. this would be consistent with myo1c - dependent formation of raft - enriched membrane - tubules, which emanate from a previously defined membrane - storage compartment. thus the diverse lipid and protein composition of raft microdomains is reflected in the array of pathways in which they participate, indicating a pivotal role for myo1c in a range of cellular processes. | lipid rafts are highly dynamic membrane subdomains enriched in specific protein and lipid components that create specialized organizing platforms essential for an array of important cellular functions. the role of lipid rafts in membrane trafficking involves the constant remodelling of the plasma membrane through membrane uptake and balanced exocytosis of intracellular membranes. our lab has identified the first motor protein, myosin 1c (myo1c) involved in driving the recycling of lipid - raft enriched membranes from the perinuclear recycling compartment to the cell surface. this newly discovered role for myo1c in lipid raft exocytosis is crucial for cell spreading, migration and pathogen entry ; key cellular processes that require cell surface expansion and plasticity. here we present a model suggesting myo1c s possible molecular functions in lipid raft recycling and discuss its wider implications for important cellular functions. |
recent transcriptome studies have revealed that a large number of transcripts in mammals and other organisms do not encode proteins but function as noncoding rnas (ncrnas) instead. in vivo experiments have demonstrated important biological roles of noncoding rnas, including regulation of transcription and translation, rna modification and epigenetic modification of chromatin structure (13). there is immense interest within the biological community to identify and study new noncoding rnas. as millions of transcripts are generated by large - scale cdna and est sequencing projects every year, there is a need for automatic methods to accurately and quickly distinguish protein - coding rnas from noncoding rnas. since to date no web server and few standalone tools have been designed for this purpose, researchers sometimes used tools developed for other purposes such as cdna annotation and functionally domain identification (412). however these methods showed varied performance on different datasets (12,13). recently a new algorithm and standalone software named conc was published that classifies transcripts as coding or however, conc is slow for large datasets and does not have a web - server interface, limiting its usefulness. it works well with high - quality transcripts but may suffer from errors such as frameshifts which are common in ests and even occur occasionally in full - length cdnas (11). new tools are desired that are more accurate, run faster, and have a more user - friendly web - based interface. to assess a transcript 's coding potential, we extract six features from the transcript 's nucleotide sequence. a true protein - coding transcript is more likely to have a long and high - quality open reading frame (orf) compared with a non - coding transcript. thus, our first three features assess the extent and quality of the orf in a transcript. we use the framefinder software (14) to identify the longest reading frame in the three forward frames. known for its error tolerance, framefinder can identify most correct orfs even when the input transcripts contain sequencing errors such as point mutations, indels and truncations (14,15). we extract the log - odds score and the coverage of the predicted orf as the first two features by parsing the framefinder raw output with perl scripts (available for download from the web site). the log - odds score is an indicator of the quality of a predicted orf and the higher the score, the higher the quality. a large coverage of the predicted orf is also an indicator of good orf quality (14). we add a third binary feature, the integrity of the predicted orf, that indicates whether an orf begins with a start codon and ends with an in - frame stop codon. the large and rapidly growing protein sequence databases provide a wealth of information for the identification of protein - coding transcript. we derive another three features from parsing the output of blastx (16) search (using the transcript as query, e - value cutoff 1e-10) against uniprot reference clusters (uniref90) which was developed as a nonredundant protein database with a 90% sequence identity threshold (17). first, a true protein - coding transcript is likely to have more hits with known proteins than a non - coding transcript does. second, for a true protein - coding transcript the hits are also likely to have higher quality ; i.e. the hsps (high - scoring segment pairs) overall tend to have lower e - value. thus we define feature hit score as follows : where eij is the e - value of the j - th hsp in frame i, si measures the average quality of the hsps in frame i and hit score is the average of si across three frames. the higher the hit score, the better the overall quality of the hits and the more likely the transcript is protein - coding. thirdly, for a true protein - coding transcript most of the hits are likely to reside within one frame, whereas for a true non - coding transcript, even if it matches certain known protein sequence segments by chance, these chance hits are likely to scatter in any of the three frames. thus, we define feature frame score to measure the distribution of the hsps among three reading frames : the higher the frame score, the more concentrated the hits are and the more likely the transcript is protein - coding. we incorporate these six features into a support vector machine (svm) machine learning classifier (18). mapping the input features onto a high - dimensional feature space via a proper kernel function, svm constructs a classification hyper - plane (maximum margin hyper - plane) to separate the transformed data (18). known for its high accuracy and good performance, svm is a widely used classification tool in bioinformatics analysis such as microarray - based cancer classification (19,20), prediction of protein function (21,22) and prediction of subcellular localization (23,24). we employed the libsvm package (25) to train a svm model using the standard radial basis function kernel (rbf kernel). the c and gamma parameters were determined by grid - search in the training dataset. we trained the svm model using the same training data set as conc used (13), containing 5610 protein - coding cdnas and 2670 noncoding rnas. we evaluated our method, named coding potential calculator (cpc), by 10-fold cross - validation on the training data sets. for further evaluation we tested cpc on three large datasets including two non - coding rna datasets from the rfam 7.0 database (26) and rnadb databank (27), respectively, and a protein - coding rna dataset from the embl nucleotide databank based on cross - links to the uniprot / swissprot protein knowledgebase (17,28). we recorded the accuracy and computation time of cpc in table 1, and compared it with conc (version 1.01 downloaded from the authors website http://cubic.bioc.columbia.edu/~liu/conc/ and installed locally). both cpc and conc were run in a linux box with intel xeon 3.0 g cpu and 4 g ram. overall, cpc showed better accuracy on all three datasets with an order - of - magnitude faster speed (table 1). for more stringent evaluations we removed those sequences in the three test datasets that were similar to one or more sequences in the training set (blastn e - value cutoff 1e-2) and tested cpc on the remaining sequences. we also tested cpc on new entries in the latest uniref90 release (version 10.1) which were not included in the previous release used to train cpc (version 9.4). in both cases the accuracy of cpc remained high (see section more stringent evaluation and table s1 in supplementary data). table 1.evaluation of accuracy and cpu time of cpc and conc on three datasetsdatasetdataset typedataset sizeaccuracytime (min)cpcconccpcconcrfamnoncoding30 77098.62%97.12%351346 376rnadbnoncoding399691.50%85.44%5987322embl cdscoding121 91499.08%98.70%69 116826 210conc focuses on sequences with at least 80 nucleotides and assumes shorter sequences unlikely to have coding potential. cpc does not make this assumption and has similar performance on shorter sequences, but to make a direct comparison here we shows results only on sequences with at least 80 nucleotides.because the required cpu time is long, the dataset was split and run on 24 nodes in parallel. evaluation of accuracy and cpu time of cpc and conc on three datasets conc focuses on sequences with at least 80 nucleotides and assumes shorter sequences unlikely to have coding potential. cpc does not make this assumption and has similar performance on shorter sequences, but to make a direct comparison here we shows results only on sequences with at least 80 nucleotides. because the required cpu time is long, the dataset was split and run on 24 nodes in parallel. we then compared cpc with other prediction algorithms following the same evaluation strategy proposed by frith. the results showed that cpc had the highest consistency with expert curation and performed well for the six challenging cases hand - picked by frith. comparison with other protein - prediction algorithms following frith. and table s2 in supplementary data). cpc was also able to accurately predict 92% of the 2,849 short peptides with less than 100 amino acids (see section the cpc web server accepts a set of nucleotide fasta sequences as input (allowing symbols the sequences can be pasted directly into the input box or uploaded from a local sequence file. by default, the cpc server runs in interactive mode in that results will be shown in the browser once the computation is finished. for a large set of sequences the user can input an email address to run his / her job in batch mode. the server will send a notice to the user 's mailbox upon completion of the job. a unique users can use tid to track the job progress and retrieve the results which are saved on the server for 1 week. the columns show the sequence i d, the coding / noncoding classification, the svm score (the distance to the svm classification hyper - plane in the features space), and a details link (as described later). in general, the farther away the score is from zero, the more reliable the prediction is. as a rule of thumb from our experience, weak coding. results in the summary table can be sorted interactively by sequence i d, coding / noncoding classification, and svm score ; they can also be filtered by coding / noncoding classification, and svm score. (a) results are summarized in a table view. (b) sequence features and additional annotations of an input transcript are shown in an evidence page. (a) results are summarized in a table view. (b) sequence features and additional annotations of an input transcript are shown in an evidence page. the current version of cpc can not accurately discriminate transcripts falling entirely within utr regions from true non - coding transcripts, because neither of them produces amino acid sequences. to handle this limitation, cpc provides the users the option to search database of known utr sequences, utrdb (32), using blast (see section recognizing potential utr regions and figure s1 in supplementary data). to explain why a transcript is classified as coding or noncoding, cpc server provides detailed supporting evidence and other related sequence features of the input transcript in an evidence page (figure 1b). the evidence page shows the six features of the transcript, color coded for better visualization. the evidence page also provides options for querying the input transcript against well - annotated database, such as the functional domain database pfam (29), smart (30) and superfamily (31), utrdb (32) and ncrna database rnadb (27). we developed the cpc web server on a java platform using jsp to render the dynamic html pages and apache / tomcat as the j2ee container. the web site is in compliance with w3c xhtml 1.0 strict specification and works in both the microsoft internet explorer and mozilla firefox browsers. a standalone version of the software is freely available for download on the web site, distributed under gnu gpl. with the rapidly increasing amount of data generated by large - scale transcriptome sequencing and intensifying attention on the study of noncoding rnas, methods that can discriminate noncoding rnas from protein - coding ones with high reliability and fast speed are important. integrating multiple sequence features with biological significance, cpc is shown to have good accuracy in both cross - validation and several test datasets. it also runs an order - of - magnitude faster than the previous state - of - the - art tool, and thus is more suitable for high - throughput analysis. cpc uses far fewer features than conc does (6 versus 180) but achieved comparable, even better, performance in the evaluation. the results demonstrated that the sequence features used by cpc have powerful discriminating power and may reflect the intrinsic properties of coding transcript. using fewer, sequence - based features also significantly reduced computing cost, thus removing a hurdle for a web server to be developed. additional information such as potential functional domains and similarity to known utr regions or ncrna is useful to users. this and other supplementary information is available in the evidence pages of cpc, making the results of cpc more easily interpretable and biology - meaningful. | recent transcriptome studies have revealed that a large number of transcripts in mammals and other organisms do not encode proteins but function as noncoding rnas (ncrnas) instead. as millions of transcripts are generated by large - scale cdna and est sequencing projects every year, there is a need for automatic methods to distinguish protein - coding rnas from noncoding rnas accurately and quickly. we developed a support vector machine - based classifier, named coding potential calculator (cpc), to assess the protein - coding potential of a transcript based on six biologically meaningful sequence features. tenfold cross - validation on the training dataset and further testing on several large datasets showed that cpc can discriminate coding from noncoding transcripts with high accuracy. furthermore, cpc also runs an order - of - magnitude faster than a previous state - of - the - art tool and has higher accuracy. we developed a user - friendly web - based interface of cpc at http://cpc.cbi.pku.edu.cn. in addition to predicting the coding potential of the input transcripts, the cpc web server also graphically displays detailed sequence features and additional annotations of the transcript that may facilitate users further investigation. |
the thyroid is the organ with the highest selenium (se) concentrations per gram among all tissue [1, 2 ]. se is the only trace element to be specified in the genetic code and the main structure of it is selenoproteins, including glutathione peroxidase (gpxs), thioredoxin reductases (trs), and iodothyronine deiodinases (dio) [3, 4 ], which have been functionally characterized as having reduction of dna damage, antioxidant processes, and hormone metabolism. se deficiency has been associated with many conditions, such as increased thyrocytes damage, infections, and the incidence of cancer. some studies have reported that se deficiency causes a decline in gpxs and dio enzymes activity and the concentrations of hydrogen peroxide (h2o2), which will eternally result in impairing the synthesis of thyroid hormones. autoimmune thyroiditis (ait) is the most common human organ - specific autoimmune disease. the incidence of this disease is approximately 1% in the general population, and women are ten times more often affected than men. the tendency is even more obvious at the postmenopausal period [8, 9 ]. thyroglobulin antibody (tgab) and thyroid peroxidase autoantibody (tpoab) are the main antibodies detected in ait. tgab is present in high titers in sera of patients with ait (40%70%), and tpoab is present in the majority of ait (> 80%). currently, several factors were reported to be associated with ait including gene, environment, diet, and diseases. however, it is still unknown whether se deficiency was an important condition for ait or marker for increased ait incidence. several papers have maintained that it had no evidences on the effects of se supplementation, while the others suggested that there was beneficial evidence for se supplementation, including the decrease of tpoab and tgab titers [1214 ]. therefore, we performed this systematic review and meta - analysis of all currently available randomized controlled trials (rcts) to determine whether se supplementation is an effective treatment for ait. medline, embase, the cochrane central register of controlled trial, chinese biomedical literature database, national knowledge infrastructure, wanfang, and vip database were searched until 31 march 2014. sodium selenite, thyroid, thyroiditis, aitd, autoimmune thyroiditis, and hashimoto thyroiditis, with no language restriction. two investigators (yaofu fan and huifeng zhang) independently screened all titles and abstracts to identify articles for full review. any discrepancy was solved by discussion and consensus reached through a third author (shuhang xu). only published studies with full - text articles were included in our meta - analysis. only the studies that met the following criteria were included : (1) rct study sign ; (2) all participants were ait patients ; (3) one group was treated with se supplementation compared with the other groups receiving only placebo or no treatment ; (4) the main outcome measures were tpoab titers and tgab titers. two authors (yaofu fan and huifeng zhang) independently evaluated the quality of all included rcts by jadad scale in the following domains : randomization, blinding, and description of withdrawals and dropouts. a cut score of 3 was used to indicate high quality studies as it has been reported to be sufficient to determine high quality versus low quality in previous studies. two authors (yaofu fan and huifeng zhang) independently extracted data based on a predesigned data extraction form. information was extracted on baseline characteristics (the first author, publication date, sample size, age range, and sex), therapeutic interventions, and results (tpoab and tgab titers at baseline and at endpoint). if the extracted data had any divergences, these could be assessed by a third author (shuhang xu). all meta - analyses were performed using stata statistical software (stata version se-10.1 ; stata corporation, college station, tx). for each eligible study, the continuous data were presented as standardized mean difference (smd) and 95% confidence intervals (ci). when heterogeneity was confirmed (p 50%), the random - effect method was used ; otherwise, the fix - effect model was adopted. funnel plots, egger 's test, and begg 's test were used to evaluate publication bias. 40 articles were discarded, because they were reviews, case reports, redundant publications, letters, or irrelevant studies. the full texts of the remaining 21 articles were reviewed ; only 9 rcts were eligible, and 12 articles were excluded due to two studies were non - rct, four studies did n't have a placebo - control group or a treatment control group, three studies were meta - analyses, two studies did not state the treatment strategy, one study was not intervention study. 419 ait patients were included in the se supplementation group and 368 ait patients in the placebo or no treatment group. the characteristics of the retained rcts and the jadad scores are shown in table 1. the quality scores ranged from 2 to 4 points out of a theoretical maximum of 5 points. all articles adopted random assignment of patients, and 7 rcts did not state the detailed randomized method [12, 14, 1618, 20, 21 ]. the double - blinded study was performed in only 1 rct. all rcts had defined inclusion and exclusion criteria for patients and provided clear definitions of the treatment responses. six studies reported serum tpoab titers at 3 months of treatment [12, 14, 16, 19, 20 ]. patients who received se supplementation showed no change in tpoab titers compared with controls (smd, 0.243 ; 95% ci 0.630 to 0.144 ; p = 0.218). but three studies after 6 months of treatment [16, 17, 21 ] and two studies after 12 months of treatment [15, 18 ] had different result, which showed significant lower tpoab titers when compared with controls (6 months, smd, 1.516 ; 95% ci 2.823 to 0.210 ; p = 0.023 ; and 12 months, smd, 4.940 ; 95% ci 5.887 to 3.992 ; p < 0.001) (figure 2). no significant difference in tgab titers after 3 months or 6 months of treatment was detected (four studies, 3 months, smd, 0.310 ; 95% ci 0.938 to 0.319 ; p = 0.334 ; and three studies, 6 months, smd, 2.068 ; 95% ci 4.218 to 0.081 ; p = 0.059). as compared with the control group, se supplementation after 12 months of treatment showed significant effects on declining the tgab titers (two studies, 12 months, smd, 2.210 ; 95% ci 2.956 to 1.464 ; p < 0.001) (figure 3). patients after se supplementation had a higher chance in improving the mood or well - being compared with controls (39/52 versus 18/49, rr = 1.61 ; 95% ci 1.01 to 2.57 ; p = 0.045) (figure 4). no evidence of publication bias was found on tpoab and tgab titers after se supplementation treatment, but the funnel plots for tpoab and tgab titers at different course of treatment were performed including a small subset of rcts. the sensitivity analysis showed that the association between the tpoab titers and se supplementation treatment of 10 studies (including all cases and controls) was vulnerable : when someone study was omitted at a time, the 95% ci of the model would include 1.0 (figure 5). further, the sensitivity analysis showed that the association between the tgab titers and se supplementation treatment was also vulnerable (figure 6). se may catalyze the extrathyroid production of t3 from t4, and se deficiency can increase thyroid necrosis and reduce compensatory epithelial regeneration. a lot of studies have reported that se is important for antioxidant defense and adjuvant supplementation with se may be beneficial to ait patients ' inflammatory and immune responses. huang. reported that se status could affect t cell differentiation and se deficiency is associated with th2 cells / markers. some articles suggested that increased se intake may compound in ait patients, and adequate se status can prevent postpartum thyroiditis development [1, 27, 28 ]. it is well known that the pregnant women with ait have more risk of miscarriage, preterm delivery, and development of postpartum thyroid dysfunction. some studies showed that the pregnant women taking 200 g se during and after pregnancy were less possible of emerging some diseases when compared with untreated group. however, karanikas. found no immunological changes in peripheral t cells after a short period of se supplementation ; this discrepancy is probably due to the immunological processes occurring in the thyroid gland in ait. our meta - analysis found that se supplementation with duration of 6 months or 12 months significantly reduced the tpoab titers in patients with ait ; meanwhile, se supplementation with duration of 12 months could decrease the tgab titers in ait individuals. after treatment, mood improvement was found in se supplementation group when compared with the controls. no serious adverse effects were recorded after se supplementation, except mild gastric discomfort. comparing with other systematic reviews, we updated some studies about se supplementation for ait from 2007 to 2013 [1721 ]. jin. conducted a review including 7 rcts and had a general conclusion that se therapy for ait is effective and safe, though there was no change in tgab titers. however, the quantitative systematic review and meta - analysis performed by toulis. reported that se supplementation is associated with a significant decrease in tpoab titers at 3 months (wmd : 271.09 ; 95% ci 421.98 to 120.19 ; p < 0.0001), and this result is different from our conclusion. grtner. reported that the mean tpoab titers were significantly lower in the se supplementation group than those in the control group after 3 months (p = 0.013). when the authors followed up some of the patients for 6 months, the results have no change (p = 0.004), but nine patients ceased this treatment and found a significant increase in their tpoab titers. the experiment carried out by karanikas. in 2008 found no statistical decrease in tpoab titers after 3 months. it is possible that longer follow - up periods are needed for revealing better endpoints. these rcts were limited by the small sample size and some studies were not double - blinded, so the results would have more bias. secondly, we tried our best to search complete rcts of se supplementation for ait, but it was affected by many uncertain factors, such as language barrier, limited retrieving resources, and publication bias. thirdly, all studies included did not discuss the disease - process, the degree of ait, and the forms of se. with the aggravation of the disease, the degree of thyroid injury was getting worse steadily, and this aspect would reduce the absorption rate and the effect of se. meanwhile, the absorption in different forms varied. last but not least, only one study has discussed the tpoab titers. due to their correlation with t - lymphocyte cytokine production patterns, so we assume that the different tpoab titers were one of the reasons of the high heterogeneity and we will pay close attention to them. we tried to acquire data about two rcts for all antibodies values [31, 32 ], but we were not able to do so. in this review, we tried to analyze the efficacy after the different follow - up time points. there were only five studies that were followed up for 3 months, three studies for 6 months, and two studies for 12 months, so it was difficult to interpret the results of publication bias due to a smaller subset of studies. only two studies reported the adverse events after se supplementation and two studies included the effects of se supplementation on mood, so the definite conclusions were not possible and it should be studied in the future by higher rcts with different follow - up time points. in conclusion, this systematic review found the positive evidence that se supplementation is associated with a significant decrease in tpoab titers at 6 and 12 months ; meanwhile, the tgab titers can be dropped at 12 months. patients after se supplementation had a higher chance in improving the mood or well - being. more high - quality, well - designed, long term, randomized controlled, multicenter trials that are adequately powered are still needed to evaluate the real beneficial effects of the se supplementation in ait patients. | many studies have reported that selenium (se) has a close relationship with autoimmune thyroiditis (ait). the therapeutic effect of se supplementation in ait treatment remains unclear. the objective of the present study was to determine the efficacy of se supplementation for the treatment of ait. a structured literature search was undertaken to identify all randomized controlled trials conducted in patients with ait receiving se supplementation or placebo. nine studies enrolling a total of 787 patients were included. the results showed that se supplementation with duration 6 months significantly dropped the tpoab titers but did not decrease the tgab titers. patients assigned to se supplementation for 12-month duration showed significantly lower tpoab titers and tgab titers. patients after se supplementation had a higher chance to improve the mood or well - being compared with controls. se supplementation is associated with a significant decrease in tpoab titers at 6 and 12 months ; meanwhile, the tgab titers can be dropped at 12 months. after se supplementation treatment, patients had a higher chance to improve the mood without significant adverse events. |
ectopic thyroid is a developmental defect of thyroid gland that leads to presence of thyroid tissue at sites other than its normal cervical location. it is very rare to have two ectopic foci of thyroid tissue, and only a very few cases of dual ectopia have been reported in the world literature. in 70% of cases of ectopic thyroid, it is extremely rare to have dual ectopic thyroid with a normally located thyroid gland. a 13-year - old boy presented with stunted growth and poor school performance. a thorough clinical history revealed that initial motor and social developments as a child were within limits. an ultrasonogram (usg) of the neck was performed which showed atrophic orthotopic thyroid gland. technetium thyroid scan [figure 1 ] was performed to evaluate the functional status of the orthotopic thyroid gland. planar image anterior view (a) and face turned to the right (b) shows 2 foci of tracer uptake in the upper part of the neck. spect ct showed atrophic thyroid gland without any technetium uptake (c) and localized the ectopic thyroid tissues (ett) to the sub - hyoid location (d) and suprahyoid locations (e). planar image anterior view (a) and face turned to the right (b) show 2 foci of tracer uptake in the upper part of the neck. spect ct showed atrophic thyroid gland without any technetium uptake (c) and localized the ectopic thyroid tissues to the sub - hyoid location (d) and suprahyoid locations (e) thyroid gland is a derivative of forgeut and its original position is marked by the foramen cecum at the junction of anterior two - thirds and posterior one - third of the tongue. an evagination appears between the first and second pharyngeal pouches at about 4 weeks of gestational age. this evagination forms a tube, descends inferiorly and anteriorly to pass anterior to the hyoid bone descends and forms the lateral lobes of thyroid. the thyroglossal duct marks the pathway from the pharynx to the anterior neck. simultaneous presence of multiple ett is highly unusual. ectopic thyroid tissue may be present in variety of locations : sublingual region, high cervical, mediastinal, or intracardiac locations. hybrid spect / ct is useful in cases of multiple ectopia of thyroid gland for accurate localization. chronic inflammation due to auto - antibodies gradually destroys the thyroid follicles and lead to hypothyroidism. | ectopic thyroid tissue (ett) refers to all cases in which the thyroid gland is present at a location other than its usual site. the prevalence of ett is approximately one per 100,000 to 300,000 persons and is reported to occur in one in 4,000 to 8,000 patients with thyroid disease. multiple ectopia of thyroid is extremely rare. multiple ectopia in the presence of orthotopic thyroid gland is extremely rare. we report a 13-year - old boy with stunted growth and developmental delay caused due to acquired hypothyroidism. technetium scan performed as per management protocol identified dual ectopia of thyroid. the role of hybrid single - photon emission computed tomography / computed tomography (spect / ct) in the localization of the sites of ett is also highlighted. |
potential issues with biceps tenotomy include biceps muscle weakness or discomfort in addition to cosmetic concerns. proximal biceps tenodesis has been shown to be a reliable treatment for tears, subluxation, and synovitis of the lhb. tenodesis is preferred for managing lhb pathology in younger, more active patients and in those whom cosmetic deformity is a concern. several techniques have been described for lhb tenodesis including arthroscopic and open techniques in both the suprapectoral and subpectoral regions. advantages of the subpectoral tenodesis technique include the removal of the lhb from the bicipital groove potentially limiting the development of postoperative pain secondary to residual tenosynovitis within the biceps sheath. subpectoral tenodesis (below the pectoralis major tendon) has been shown to provide excellent pain relief and functional improvement with limited residual biceps tendon symptoms. while complications of biceps tenodesis in other locations have been studied extensively, limited data exist on the complications of a tenodesis in the subpectoral region. several methods of fixation have been described for a subpectoral tenodesis including interference screws, suture anchors, and bone tunnels. several authors have performed biomechanical studies comparing interference screw fixation and suture anchor fixation for a proximal biceps tenodesis in both the suprapectoral and subpectoral regions. subpectoral tenodesis utilizing a single - suture anchors has been shown to have inferior initial biomechanical properties (ultimate load - to - failure and stiffness) when compared to an interference screw construct. have recommended the use of an interference screw instead of suture anchors for subpectoral tenodesis fixation. we have recently shown that a dual suture anchor tenodesis and interference screw tenodesis have equivalent biomechanical strength when performed in the subpectoral region. clinically, outcomes of subpectoral proximal biceps tenodeses using interference screw fixation have been reported with excellent outcomes and rupture rates between 0.6% and 2%. limited data exist on the outcomes after subpectoral biceps tenodesis utilizing a suture anchor technique. the purpose of the present study is to evaluate the early postoperative complications of open subpectoral biceps tenodesis using a dual suture anchor technique. our hypothesis is that the early complication rates after dual suture anchor fixation will be equivalent to those reported for interference screw fixation for a subpectoral tenodesis. all surgical cases from one surgeon (rzt) were reviewed from 12/2009 to 12/2012. we utilized the surgeon 's personal surgical log to identify all patients who underwent an open subpectoral biceps tenodesis utilizing a dual suture anchor repair technique during the study period. any patient between the ages of 18 and 80 years who underwent an open subpectoral biceps tenodesis utilizing a dual suture anchor fixation technique by the primary surgeon (rzt) between 12/09 and 12/12 was eligible for inclusion in the study. exclusion criteria included all patients undergoing a biceps tenotomy or tenodesis utilizing another technique besides the dual suture anchor subpectoral technique. preoperative imaging included shoulder radiographs (ap, true ap, scapular y and axillary views) and a shoulder magnetic resonance imaging (mri) of every patient undergoing a biceps tenodesis. the decision to treat patients was based upon preoperative history and physical examination, mri findings, and an arthroscopic evaluation. in the group of patients treated for biceps tendonitis, the decision to treat was made preoperatively based upon a history of bicipital pain and tenderness on physical examination independent of the mri or arthroscopic findings. in the group treated for superior labral tears, the decision to treat was made at the time of surgery based upon a clinical history consistent with a superior labral tear (traumatic onset), positive physical exam findings (positive active compression test), an mri confirming type ii, iii, or iv superior labral tear, and an arthroscopic evaluation consistent with a type ii, iii, or iv superior labral tear. in the group of patients treated for biceps tendon partial tears, the decision to treat was made at the time of surgery where a tenodesis was performed if there was a partial tear greater than 25% of the biceps tendon. finally, in the group treated for a failed proximal biceps tenodesis, the decision to treat was made preoperatively based upon proximal biceps groove pain and tenderness after a proximal tenodesis. no arthroscopy was performed prior to these surgical cases rather the biceps was cut proximally through the subpectoral tenodesis site surgical exposure and then tenodesed in the same wound. a glenohumeral arthroscopy was initially performed on all patients at which time the biceps tendon was evaluated as well as the labrum, glenohumeral cartilage, and rotator cuff. after the arthroscopy, the scope instruments were removed and a 3- to 4-cm longitudinal incision is made centered over the inferior border of the pectoralis major tendon. the pectoralis major is retracted laterally, the conjoint tendon is retracted medially, and the previously cut biceps tendon is delivered into the wound. the biceps groove is removed of soft tissue and periosteum down to bleeding cortical bone using a currette and two drill holes are created for placement of two mitek g4 suture anchors (mitek, norwood, ma). the superior drill hole is placed 3 cm proximal to the inferior border of the pectoralis tendon and the inferior hole is placed 1 cm proximal to the inferior border of the pectoralis tendon. two mitek g4 suture anchors (mitek, norwood, ma) are each loaded with a single no 2 fiberwire (arthrex, naples, fl) stitch. the biceps tendon is then re - cut 20 mm proximal to the musculotendinous junction. a no. 2 fiberwire (arthrex, naples, fl) suture from one anchor is then placed in the distal 15 mm of the proximal biceps tendon from proximal to distal using krackow technique. the second suture on the other anchor is placed in the same region of the biceps tendon from distal to proximal using bunnell technique. the krackow stitch anchor is then impacted into the proximal hole and the bunnell stitch anchor is impacted into the distal hole. the sutures from each anchor are then tied using 2 half hitches followed by a reverse half hitch, followed by 3 half hitches on opposite posts thrown in opposite directions after each hitch [figure 1 ]. the electronic medical record for all patients was retrospectively reviewed for early postoperative complications within the first 12 months of surgery including wound infection, hematoma, wound dehiscence, rupture, hardware failure, and requirement for re - operation. patient demographics recorded included age, sex, hand dominance, surgical side, associated surgical procedures, biceps tendon diagnosis, and diagnoses requiring other surgical procedures. dual suture anchor biceps tenodesis construct (two mitek g4 suture anchors (mitek, norwood, ma) each loaded with a no. 2 fiberwire (arthrex, naples, fl) suture with one in krackow stitch pattern and the other in a bunnell stitch pattern) a total of 103 open subpectoral biceps tenodeses were performed utilizing the same dual suture anchor technique by the primary surgeon (rzt) during the study period. tenodeses were performed for five diagnoses : biceps tendonitis (60), superior labral tears (21), biceps subluxation (8), biceps partial tears (12), and revision of prior tenodesis (2). other surgical procedures performed at the time of tenodesis included arthroscopic subacromial / glenohumeral debridement (40), arthroscopic rotator cuff repair (40), and distal clavicle excision (8). the average length of follow - up was 7 months (range, 1 to 45 months). there were a total of 7 complications (7%). there were 4 superficial wound infections (stitch abscesses) (4%) of which 2 were treated with oral antibiotics alone and 2 required superficial debridement in the operating room and oral antibiotics. one patient had persistent numbness of her ear and a second patient had a temporary phrenic nerve palsy resulting in respiratory dysfunction and hospital admission. one patient with no prior history of prior thrombosis and no overt risk factors for hypercoagulability developed a pulmonary embolism requiring hospital admission and anticoagulation. looking at the subgroup of patients with at least 6 months follow - up, there were a total of 41 patients. in this sub - group of patients with longer follow - up, there was only a single complication (superficial wound infection treated with oral antibiotics). open subpectoral biceps tenodesis utilizing a dual suture anchor technique has a low early complication rate. superficial wound infection and interscalene block - related complications were the only significant surgery - related complications within 6 months of the surgical procedure. we reported no deep infections, hematomas, peripheral nerve injuries, fractures, or ruptures utilizing this technique. complication rates are equivalent to those previously reported for interference screw fixation and should be considered as a reasonable alternative. various fixation techniques have been utilized for proximal biceps tenodeses with varying, but in general, low failure rates. koh. reported on 43 patients undergoing proximal biceps tenodesis using suture anchors and noted 7% of patients had a clinically apparent traumatic failure. performed 27 proximal biceps tenodeses using a suture anchor and evaluated the repair integrity with an mri. they reported that 35% of patients had a failure of the tenodesis followed by an autotenodesis more distally in the groove. are the only authors who have reported the results of subpectoral tenodesis utilizing a suture anchor technique. 89% of patients in this series had a single anchor tenodesis, while 11% had a two anchor tenodesis. our series is the largest group of patients reported undergoing a suture anchor subpectoral tenodesis. mazzocca. reported a 2% failure rate in his initial series of 50 patients after subpectoral interference screw biceps tenodesis. koch. reported a case series of 3 patients who sustained a rupture after proximal biceps tenodesis utilizing an interference screw resulting in an 8% failure rate. the authors reported a 2% complication rate with 0.57% rupture rate, 0.28% deep infection rate, 0.28% peripheral nerve palsy rate, and a.028% reflex sympathetic dystrophy rate. reported on 2 patients who sustained a humeral shaft fracture after subpectoral tenodesis utilizing an interference screw. while our series is not as large as the series by nho., we did not have any failures, deep infections, fractures, or neurologic injuries. one potential reason for the absence of clinically evident early failures in our series compared to previously reported series using interference screws may be the lack of a sharp transition in stress at the site of fixation with the suture anchor construct compared with the tenodesis screw. we previously identified, in a biomechanical study, that fixation using an interference screw has significantly increased stiffness compared with a suture anchor construct. while the increased stiffness prevents any minor elongations in the construct as it heals, it may place the construct at more risk for catastrophic failure. the risk for fracture is also likely lower with the suture anchor technique as the drill holes made in the humerus are only 1 - 2 mm compared to the much smaller 7 - 8 mm drill hole commonly required for an interference screw. the incidence of wound infections is higher than expected and may be secondary to the location of the incision relatively close to the axilla. we utilize vicryl suture to close the subcutaneous layer and this may have precipitated an increased superficial infection rate. one limitation of this study is that this is a retrospective review of a large number of patients and a prospective evaluation was not performed. another potential limitation is that only early complications were evaluated and it is likely that some re - ruptures were missed. nevertheless, most patients after a subpectoral tenodesis are allowed to return to all activities without restriction at 3 months if a concomitant rotator cuff repair was not performed and 6 months if a rotator cuff repair was performed. consequently, it is likely that most traumatic failures would occur within the first 6 months as has been shown in other series. looking specifically at the sub - group with greater than 6 month follow - up, we found no increased incidence of complications, specifically re - rupture. there was only one superficial wound infection in this sub - group with an overall complication rate of 2%. finally, healing data was not obtained and we are therefore unable to confirm that no sub - clinical ruptures occurred. dual suture anchor subpectoral biceps tenodesis leads to a low early complication rate with no deep wound infections, neurologic injuries, or clinically evident ruptures although follow - up in this series is very short. dual suture anchor subpectoral tenodesis should be considered as a safe and reliable alternative to interference screw fixation with a low overall risk for the development of major postoperative complications although longer follow - up outcome studies are needed to confirm the results. | purpose : a variety of fixation techniques for subpectoral biceps tenodeses have been described including interference screw and suture anchor fixation. biomechanical data suggests that dual suture anchor fixation has equivalent strength compared to interference screw fixation. the purpose of the study is to determine the early complication rate after subpectoral biceps tenodesis utilizing a dual suture anchor technique.materials and methods : a total of 103 open subpectoral biceps tenodeses were performed over a 3-year period using a dual suture anchor technique. there were 72 male and 31 female shoulders. the average age at the time of tenodesis was 45.5 years. 41 patients had a minimum of 6 months clinical follow - up (range, 6 to 45 months). the tenodesis was performed for biceps tendonitis, superior labral tears, biceps tendon subluxation, biceps tendon partial tears, and revisions of prior tenodeses.results:there were a total of 7 complications (7%) in the entire group. there were 4 superficial wound infections (4%). there were 2 temporary nerve palsies (2%) resulting from the interscalene block. one patient had persistent numbness of the ear and a second patient had a temporary phrenic nerve palsy resulting in respiratory dysfunction and hospital admission. one patient developed a pulmonary embolism requiring hospital admission and anticoagulation. there were no hematomas, wound dehiscences, peripheral nerve injuries, or ruptures. in the sub - group of patients with a minimum of 6 months clinical follow - up, the only complication was a single wound infection treated with oral antibiotics.conclusions:subpectoral biceps tenodesis utilizing a dual suture anchor technique has a low early complication rate with no ruptures or deep infections. the complication rate is comparable to those previously reported for interference screw subpectoral tenodesis and should be considered as a reasonable alternative to interference screw fixation.level of evidence : level iv - retrospective case series |
homologous recombination (hr) is a highly conserved mechanism for the repair of dna double - strand breaks and stalled replication forks. the central reactions of hr are catalyzed by the rad51 recombinase when it is assembled on single - stranded (ss)dna as helical rad-51-ssdna nucleoprotein filaments, which search for and invade homologous double - stranded (ds)dna to form joint molecules. repair dna synthesis from the 3 end of the invading strand then copies the correct sequence information from the intact duplex, before resolution of the joint molecules completes repair (chapman., 2012, san filippo., 2008). failure to efficiently execute hr repair is associated with genome instability and cancer development, as well as the severe congenital disorder fanconi anemia (krejci., 2012). hr is positively regulated by various rad51 accessory factors to ensure its timely completion (san filippo., hr mediators, such as brca2, promote rad51 filament assembly on ssdna coated with the ssdna binding protein rpa (jensen. 2010), while rad54 promotes rad51 dissociation from dsdna after strand invasion (solinger., 2002). these activities ultimately allow these proteins to stimulate strand exchange by rad51 in vitro (jensen., 2010,, 2002, thorslund., 2010) and promote hr and dna damage resistance in vivo (johnson and jasin, 2001). another class of proteins that stimulate hr is the rad51 paralogs (chun., 2013, french., 2002, johnson., 1999, although these proteins share significant sequence and/or structural homology with rad51, they do not exhibit intrinsic recombinase activity, but can stimulate strand exchange by rad51 (gaines., the mechanism of action of this group of hr regulators was unknown due to the biochemical intractability of recombinant rad51 paralogs. recently, we discovered a heterodimeric rad51 paralog complex from c. elegans, rfs-1/rip-1, which stimulates the strand exchange activity of c. elegans rad-51 and promotes its accumulation / stabilization at stalled replication forks (taylor. rfs-1/rip-1 promotes hr by binding to the pre - synaptic filament and converting it to a stabilized conformation in which the ssdna is more accessible to degradation by nucleases and the overall flexibility of the filament is increased. this represents a previously unknown hr stimulatory mechanism, which we named filament remodeling. rfs-1 mutants defective in remodeling fail to stimulate rad-51 strand invasion activity (taylor., 2015), defining remodeling as a critical mechanism of hr stimulation by rfs-1/rip-1. in this study, we sought to better understand the mechanism by which rad51 paralogs execute rad51 filament remodeling and stabilization. we present evidence that rfs-1/rip-1 binds to the 5 end of individual rad-51-ssdna filaments and mediates remodeling in a 53 direction, in a manner dependent on atp binding, but not hydrolysis by the complex. this blocks the turnover of rad-51 from ssdna, thus stabilizing the pre - synaptic filament in an active state. together, these data define the mechanism of rad51 filament remodeling and hr enhancement by rad51 paralogs. to investigate the mechanism by which rad51 paralogs stabilize pre - synaptic filaments, we monitored the stability of rad-51 filaments assembled on long (approximately 50 kb) ssdna curtains using the rebinding of fluorescently labeled yeast rpa to naked ssdna (scrpa - egfp, hereafter abbreviated to rpa) (figures 1a and 1b) (gibb., rpa binds ssdna with high affinity (wold, 1997), and a molar of excess rfs-1/rip-1 (1 m) was unable to outcompete rpa binding to ssdna curtains (figure 1c), consistent with the low ssdna affinity of rfs-1/rip-1 (taylor., 2015). like yeast rad51 (qi., 2015), 1 m rad-51 effectively displaced rpa from the ssdna, as observed by the loss of egfp fluorescence signal from ssdna curtains (figure 1d). the rate of rpa displacement was increased at 2 m rad-51 (figure 1e), which was used for subsequent experiments to ensure rapid and complete filament formation., 2014b, qi., 2015), rad-51-ssdna filaments remained stable when free rad-51 was removed and replaced by rpa as long as atp was maintained in the buffer (figures 1e and 1f). in contrast, transfer into buffer without nucleotide co - factors drove the rapid disassembly of rad-51 filaments and re - establishment of the fluorescent rpa signal (figures 1e and 1 g). next, rad-51 filaments formed in the presence of atp were incubated with 1 m rfs-1/rip-1, while maintaining atp in the buffer. buffer with rpa, but without atp, was then flowed onto the curtains while maintaining 1 m rfs-1/rip-1 in free solution to maintain its association from filaments. in contrast to rad-51 alone, we observed a striking stabilization of the filaments induced by rfs-1/rip-1, which persisted for over an hour (figures 1f and 1 g). this result demonstrates that rfs-1/rip-1 shuts down rad-51 turnover from ssdna even when atp is removed from the buffer (figure 1h). this also suggests that rfs-1/rip-1-mediated filament remodeling locks rad-51 onto ssdna by reducing its dissociation rate (koff). we previously employed immuno - gold labeling with electron microscopy to show that rfs-1/rip-1 preferentially binds to the ends of rad-51-ssdna filaments compared to the filament body, which was only ever observed at one end and never both (taylor., 2015). ssdna molecules are intrinsically 53 polar with respect to the sugar - phosphate backbone, and crystal structures of the yeast rad51 (conway., 2004) and bacterial reca (homolog of rad51) (chen., 2008) filaments assembled on ssdna have also revealed a structural polarity in the filament with respect to the underlying dna. we therefore considered the possibility that rfs-1/rip-1 recognizes the intrinsic polarity of the ssdna and/or rad-51-ssdna filament and binds at an interface exposed on one end, but not the other. intriguingly, rfs-1/rip-1 drives a reduction in the fluorescence of rad-51-ssdna filaments formed on a 5-cy3-labeled 43-mer oligonucleotide in a stopped - flow system, representing an alteration in the biophysical properties of the rad-51-ssdna filament (taylor., 2015). we reasoned this fluorescence reduction may reflect the binding of rfs-1/rip-1 at the 5 end, and that if the end binding observed in electron microscopy was random with respect to the underlying dna polarity, then an equivalent fluorescence reduction should be observed on an oligonucleotide cy3-labeled at the 3 end. however, mixing rfs-1/rip-1 with rad-51-ssdna filaments formed on dna labeled with cy3 at the 3 end in stopped flow conferred no such reduction in fluorescence (figures 2a and 2b), suggesting rfs-1/rip-1 specifically binds the 5 end. we also monitored the effect of rfs-1/rip-1 on the fluorescence of rad-51 filaments formed on internally cy3-labeled oligonucleotides, in which the cy3 was placed after the 11 or 22 nucleotide (int(11)-cy3 and int(22)-cy3, respectively) from the 5 end. the fluorescence of these filaments was also unaffected by rfs-1/rip-1 (figures 2a and 2b), confirming that rfs-1/rip-1 is likely to predominantly engage with the filament end compared with the filament body. we verified that all four oligonucleotides exhibit an increase in cy3 fluorescence upon mixing with rad-51 in stopped flow, corresponding to rad-51 nucleation on dna (figures s1a and s1b), and directly confirmed rad-51 filament formation occurred with similar efficiency on all four oligonucleotides by electrophoretic mobility shift assay (emsa) (figure s1d). intriguingly, we observed that the rate of ssdna binding was reduced for rad-51 binding near the 3 label, but was faster on the other three constructs (figure s1c). these data are consistent with rad-51 filament extension displaying either a unidirectional polarity for the 53 direction or bidirectional extension that occurs faster in the 35 direction than 53. notably, similar differences in the rate of fluorescence increase when monitoring 5 and 3 cy3 labels have also been observed for the assembly of yeast rad51 on dna in ensemble stopped - flow (antony., 2009) and single molecule protein - induced fluorescence enhancement (pife) studies (hwang and myong, 2014, qiu., 2013). our results therefore support a conserved preference in directionality of filament extension on naked ssdna between yeast rad51 and nematode rad-51. however, the kinetic profiles of filament formation for both proteins display several phases suggesting further complexities in this process (antony., 2009). the reduction in fluorescence induced by rfs-1/rip-1 on rad-51 filaments pre - formed on 5 cy3-labeled ssdna could represent binding of rfs-1/rip-1 to the 5 end or the conformational change in the remodeled filament (taylor., 2015). to investigate this, we first expanded the tested range of labeled oligonucleotides to those in which the cy3 was placed after the second, third, fifth, or seventh nucleotide (int(2)-cy3, int(3)-cy3, int(5)-cy3, and int(7)-cy3, respectively) in the same stopped - flow experimental setup. we observed a clear length dependency in the magnitude of fluorescence reduction conferred by rfs-1/rip-1 (figures 2c and 2d). significantly, there was a linear relationship between magnitude of fluorescence reduction and label position for the cy3 labels between 05 nucleotides from the 5 end (figure 2d). this is consistent with the fluorescence reduction reflecting rfs-1/rip-1 binding at the 5 end, such that increasing distances away from the 5 end renders the fluorophore less sensitive to changes in the environment induced by rfs-1/rip-1 binding. we previously demonstrated in stopped - flow experiments that at equilibrium, the final fluorescence of rad-51-ssdna in the presence of rfs-1/rip-1 is intermediate to naked 5 cy3 - 43-mer ssdna and rad-51-ssdna alone (taylor., 2015). the mechanism of fluorescence reduction due to rfs-1/rip-1 binding to the 5 end of the filament may represent a modulation of the efficiency of rad-51-induced pife, such that the overall equilibrium pife of 5 cy3-labeled ssdna for the rad-51/rfs-1/rip-1 complex is lower than that for rad-51 alone. recent evidence suggests that cy3 pife arises due to decreased photoisomerization of the dye to the non - fluorescent cis when sterically constrained by protein (stennett., 2015). indeed, our single molecule fluorescence resonance energy transfer (fret) studies also established that rfs-1/rip-1 converts rad-51-ssdna filaments to a more flexible conformation (taylor., 2015). as such, the rfs-1/rip-1-bound filament is expected to be less sterically constrained nearby the 5 cy3 dye, accounting for rapider photoisomerization and reduced pife. furthermore, pife exhibits a strong and linear sensitivity to distance between the protein binding site and label, with significant effects induced in the 030 range (hwang. given that the average rise per nucleotide along the axis of ssdna within the rad51 filaments is 5.1 (yu., 2001), one would predict modulation of rad-51 pife due to rfs-1/rip-1 filament association at the 5 end should be detectable up to 56 nucleotides (25.530.6) from the 5 end, but no further and decline linearly with distance, which is in very good agreement with our experimental data (figure 2d). notably, the ssdna conformation in reca - ssdna filaments is non - uniform : for any given triplet, the first two nucleotides exhibit a rise similar to b - dna, but the third is greatly stretched (chen., 2008). this might be expected to result in a non - linear dependency between pife modulation and distance from the rfs-1/rip-1 binding site within the 030 range. however, the register of one filament relative to another is likely to be random and therefore in the population of filaments monitored in stopped - flow measurements, this nuance is lost due to averaging. we next examined if rfs-1/rip-1 binding to the 5 end of the filament requires a free 5 dna end or if the filament end defined by the terminal rad-51 protomer is sufficient. to test this, we analyzed rfs-1/rip-1 binding to rad-51 filaments formed on circular ssdna, which lacks dna ends, by immuno - gold labeling and electron microscopy. filaments formed on circular ssdna tended to clump together more on the grid (figure s1e) compared to filaments on linear ssdna (figure s1f), consistent with the constrained path of closed ssdna molecules. using anti - flag-20-nm gold conjugates directed against the flag tag on rip-1, we observed rfs-1/rip-1 binding to filaments assembled on both linear and circular ssdna (figures 2e2 g and s1e s1j). this suggests rfs-1/rip-1 primarily recognizes the 5 filament end rather than the underlying 5 dna end. furthermore, the ssdna curtains used to demonstrate rad-51-ssdna filament stabilization by rfs-1/rip-1 (figure 1) are anchored to the flow cell at both ends and are therefore effectively endless. together, these observations suggest that the 5 end of ssdna is not a major determinant of the structure recognized by rfs-1/rip-1. in addition, the likely substrate for rfs-1/rip-1 in vivo is a rad-51 filament loaded at a ssdna gap or 3 overhang ssdna at resected double strand breaks, which lack naked 5 ssdna ends. rather than representing 5 filament end binding, an alternative interpretation of the stopped - flow data in figure 2 is that the fluorescence reduction induced by rfs-1/rip-1 reflects the altered conformation of the remodeled rad-51-ssdna filament, with remodeling restricted to a short section of the filament extending 57 nucleotides from the 5 end. we also previously demonstrated dnasei sensitization by rfs-1/rip-1 on filaments formed on 5 fluorescently labeled oligonucleotides (taylor., 2015), which could formally represent a localized conformational change at the 5 filament end, since only cleavage products retaining the 5 fluorescent label are detectable. similarly, we previously only tested filament stabilization by rfs-1/rip-1 using 5 labeled oligonucleotides. to distinguish between these possibilities, we sought to determine if these properties of remodeling propagate beyond this restricted region close to the 5 filament end. we first performed nuclease protection assays on a 61-mer substrate fluorescently labeled at either the 5 or 3 end (figure 3a). interestingly, in the presence of rad-51, both substrates were protected to a similar extent (figure 3a), but the pattern of degradation products was different (figure s2). longer degradation products were enriched for the 5 construct and shorter products enriched for the 3 construct, suggesting dnasei exhibits a degree of sequence preference in its cleavage of ssdna, as for dsdna (herrera and chaires, 1994), and that cleavage events nearer the 3 end of this oligonucleotide predominate. importantly, in the presence of rfs-1/rip-1, ssdna degradation and formation of all cleavage products, regardless of length, was enhanced on both constructs (figures 3a and s2). this suggests that the dnasei sensitization induced by rfs-1/rip-1 reflects filament remodeling, rather than 5 end binding, since the effect also propagates along the filament to cleavage sites closer to the 3 end than the 5 end. initially, we compared the stability of filaments formed on the 5-cy3, int(11)-cy3, and 3-cy3 constructs used in figure 2 to unlabeled competitor dna (figures 3b3e). in the absence of rfs-1/rip-1, the magnitude of fluorescence reduction induced by mixing rad-51 filaments with 100-fold excess of unlabeled competitor dna corresponding to rad-51 dissociation was smallest for the 5 cy3 labeled dna (figure 3b) and larger, but roughly equivalent, for the int(11)-cy3 and 3-cy3 constructs (figures 3c and 3d). this observation is consistent with the fact that the fluorophores in these positions fluoresce more intensely upon rad-51 binding than cy3 at the 5 position (figures s1a and s1b) and therefore would be expected to exhibit a larger fluorescence reduction to return to the intensity associated with naked dna. in the presence of rfs-1/rip-1, strong, concentration - dependent stabilization against filament disruption by competitor dna was observed for the 5-cy3 construct, with 50 nm rfs-1/rip-1 sufficient to almost completely stabilize the filament as previously reported (figure 3b) (taylor., 2015). however, no significant stabilization was observed when monitoring the 3 cy3-labeled oligonucleotide (figure 3d). in contrast, the int(11)-cy3 oligonucleotide exhibited a clear, concentration - dependent stabilization, but the extent of stabilization at both concentrations of rfs-1/rip-1 was smaller than for the 5-cy3 construct (figure 3c). given that rfs-1/rip-1 did not induce a fluorescence reduction in filaments formed on the int(11)-cy3 construct (figure 2a), these data support the view that the fluorescence reduction reported in figure 2 represents the binding of rfs-1/rip-1 to the 5 end, which only induces a change in the biophysical properties of the cy3 label when it is in close proximity (approximately 57 nucleotides) to the 5 end and not the remodeling of the filament. however, rfs-1/rip-1 induces a remodeled conformation that propagates along the filament at least as far as 11 nucleotides from the 5 end, since the filament exhibits partial stabilization at this position. these results raised the possibility that filament remodeling and stabilization could be propagated through the filament from the 5 end with a 53 polarity following rfs-1/rip-1 binding, such that rad-51 protomers nearer the 5 end are more significantly stabilized. this model is supported by the fact that the magnitude of stabilization observed on the int(11)-cy3 construct is intermediate to that on the 5-cy3 construct, whereas the 3-cy3 construct exhibited no stabilization (figure 3e). to monitor possible stabilization propagation further, we expanded the competition experiments to the other internally labeled constructs used in figure 2. we also quantified the extent of stabilization observed with rfs-1/rip-1 relative to rad-51 alone (figures 3f and 3 g), rather than analyzing the absolute fluorescence reduction (figure 3e). this normalization accounts for the inherent difference in the magnitude of cy3 fluorescence changes associated with rad-51 binding (figures s1a and s1b) and dissociation (figures 3b3d and s3) from the different constructs, allowing exclusive analysis of the position - dependency of stabilization with respect to 5 filament end binding of rfs-1/rip-1. if the 5 end propagation model is true, we predicted that there would be a direct relationship between cy3 label position and the extent of filament stabilization by a fixed concentration of rfs-1/rip-1, analogous to that observed in figure 2d. strikingly, in two independent experiments (figures 3f, 3 g, and s3), we failed to detect a strong correlation between the extent of filament stabilization and cy3 label position within the first 21 nucleotides. as before, 50 nm rfs-1/rip-1 was sufficient to completely stabilize the filament when monitoring the 5 end, whereas no stabilization was observed at the 3 end. in contrast, all internal labels tested showed a concentration - dependent (figures 3 g and s3g s3n), but intermediate stabilization effect, even as close as two nucleotides from the 5 end (figures 3f and 3 g). these results may be explained by a model in which rfs-1/rip-1 exhibits two distinct modes of filament stabilization. first, rfs-1/rip-1 binding to the 5 end may sterically impair rad-51 dissociation from the dna entirely, accounting for the dramatic stabilization exhibited by 50 nm rfs-1/rip-1 at the 5 end. second, rfs-1/rip-1-induced filament remodeling may also alter the biophysical properties of the filament, which slows the rate of rad-51 dissociation from the dna internally, and this propagates along the filament at least as far as 21 nucleotides from the 5 end. this would account for the intermediate stabilization effect exhibited at cy3 label positions from 221 nucleotides from the 5 end. to further test the 5 end propagation model, we tested if stabilization declined between 21 nucleotides and the 3 end by expanding the range of oligonucleotides analyzed to include those labeled after the 33, 38, or 41 nucleotide (int(33)-cy3, int(38)-cy3, and int(41)-cy3, respectively), as well as the 5-cy3, int(21)-cy3 and 3-cy3 constructs (figures 4a4 g). we compared the stability of rad-51 in the presence or absence of 50 nm rfs-1/rip-1 on these constructs and observed a profound length - dependent decline in the magnitude of stabilization (figure 4 g). specifically, a similar magnitude of stabilization was observed on the int(21)-cy3 construct in the presence of rfs-1/rip-1 to previous experiments (figures 3f, 3 g, s3e, s3 m, 4b, and 4 g), with a fluorescence reduction of approximately 40%50% of that for rad-51 only. as the cy3 dye position was moved toward the 3 end, this fluorescence reduction relative to rad-51 increased progressively (int(33)-cy3 : 61% ; int(38)-cy3 : 68% ; int(41)-cy3 : 82% ; and 3-cy3 [43 nucleotides ] : 99%). therefore, the cutoff point where significant stabilization was no longer detectable occurs approximately 40 nucleotides from the 5 end (figure 4 g). these results demonstrate filament stabilization propagates a significant distance through the length of the filament from the 5 end with 53 polarity. next, we wished to verify that the failure of rfs-1/rip-1 to stabilize the filament at a 3 end and confer weak stabilization at the int(38)-cy3 and int(41)-cy3 labels was due to termination of remodeling propagation rather than the influence of possible additional biophysical properties of the 3 filament end that could drive faster rad-51 turnover in this locality. to this end, we monitored filament stability on 5 and 3 cy3-labeled 23-mer oligo(dt) constructs (figures 4h4j). as previously reported, rfs-1/rip-1 almost completely stabilizes the 5 end of this construct (figure 4h) (taylor., 2015). notably, the same concentration (50 nm) of rfs-1/rip-1 that was used in the above experiments on 43-mer constructs was also able to induce a striking stabilization at the 3 end of the 23-mer construct (figure 4i). the magnitude of fluorescence reduction relative to rad-51 alone was 41.9% 1.4% (figure 4j), which is comparable to that observed on the int(21)-cy3 43-mer construct (figures 3f, 3 g, and 4 g), which is labeled at a similar position downstream of the 5 end. notably, this is in complete contrast to the effect observed at the 3 end of the 43-mer (figures 3d3 g, s3f, s3n, 4f, and 4 g). this result reinforces the above evidence that stabilization propagates approximately 40 nucleotides and is not antagonized by unique properties of the 3 filament end. together, these data demonstrate that rfs-1/rip-1 binding at the 5 filament end is able to induce a conformational change in the filament beyond the locality of its binding site, which manifests in dnasei sensitization and stabilization against competitor dna. the stopped - flow stability assays reveal in high resolution the magnitude and 53 polarity of the propagation of remodeling. rfs-1/rip-1 contains atp binding walker motifs (walker., 1982), and the walker a and b boxes of rfs-1 are required for rad-51-ssdna filament remodeling and stimulation of strand exchange activity (taylor., 2015). we considered the possibility that a defect in atp binding or hydrolysis underlies the failure of these mutants to mediate filament remodeling. to test this, we monitored the ability of wild - type rfs-1/rip-1 pre - incubated with different concentrations of atp to induce a fluorescence reduction in rad-51 filaments pre - formed on 5 cy3 labeled ssdna in the presence of 2 mm atp. strikingly, we observed a strong concentration - dependent effect of atp on the magnitude of fluorescence reduction, with no fluorescence reduction seen when rfs-1/rip-1 was not pre - incubated with atp (figures 5a and 5b), suggesting rfs-1/rip-1 must be nucleotide - bound to associate with rad-51-ssdna filaments. the lack of response of rfs-1/rip-1 not pre - incubated with atp in this assay is surprising since rfs-1/rip-1 encounters 1 mm atp contributed from the rad-51-ssdna filament syringe upon mixing in stopped flow. in addition, the atp concentration dependency of the filament response to rfs-1/rip-1 occurs at relatively high atp concentrations. to test if rfs-1/rip-1 binds atp weakly and slowly, we compared rad-51 and rfs-1/rip-1 binding to a fixed concentration of the fluorescent atp analog tnp - atp. rad-51 has a high affinity for tnp - atp (kd 3.5 m), whereas rfs-1/rip-1 exhibited a weak response and failed to achieve saturation within the testable concentration range (figures s4a and s4b). we also monitored rad-51 and rfs-1/rip-1 binding to 0.5 m mant - atp, an atp analog that becomes fluorescent upon binding to protein, by stopped flow. both proteins exhibited a concentration - dependent binding of mant - atp to the protein in the testable range (08 m), and rad-51 exhibited a much stronger mant - atp binding response than rfs-1/rip-1 (figure s4e). rad-51 also binds mant - atp rapidly, causing a strong increase in fluorescence (figure s4c), whereas rfs-1/rip-1 binds much more slowly, causing a very small fluorescence response before the onset of mant - atp photobleaching (figure s4d). together, these results indicate that rfs-1/rip-1 has a low nucleotide affinity, which is in part due to a slow nucleotide binding rate (kon). therefore, when rfs-1/rip-1 mixes with 1 mm atp from the rad-51-ssdna syringe (figure 5a), its slow and weak atp binding does not allow sufficient active complex to assemble within the 60 s timescale of the stopped - flow experiment to undergo detectable filament binding. we also validated that rfs-1/rip-1 does not become inactivated by prolonged incubation in the absence of nucleotide, since the filament binding response is rescued by introducing atp to the rfs-1/rip-1 syringe after initial pre - incubation in the absence of nucleotide (figures s4f and s4 g). to determine the nucleotide requirements of rfs-1/rip-1 activity, we performed similar experiments in which rfs-1/rip-1 was pre - incubated with adp (figures 5c and 5d), the product of atp hydrolysis, or atps (figures 5e and 5f), a non - hydrolysable atp analog. both nucleotides induced an equivalent magnitude of fluorescence reduction in the stopped - flow assay compared to that observed in the presence of atp (cy3 fluorescence = 0.08 to 0.09, 50 nm rfs-1/rip-1) (figures 5d and 5f), suggesting that rfs-1/rip-1 requires nucleotide binding, but not hydrolysis for normal 5 filament end association. next, we wanted to test if rad-51-ssdna filaments remodeled by adp- or atps - bound rfs-1/rip-1 become as efficiently stabilized as those remodeled by atp - bound rfs-1/rip-1. to test this, we employed the ssdna curtains system, which allows for multiple buffer exchanges. as before (figure 1), rad-51-ssdna filaments were first assembled on ssdna curtains in the presence of atp, while rfs-1/rip-1 was pre - incubated in buffer supplemented with adp or atps. after filament assembly, rad-51 and atp were removed and rfs-1/rip-1 injected with adp or atps buffer and incubated for 10 min to bind filaments. excess protein and nucleotide was washed away for 2 min with a buffer lacking nucleotide, before injecting rfs-1/rip-1 and rpa in the same buffer to assess stability in the same way as in figure 1. we observed rfs-1/rip-1 incubated with either adp (figure 6b) or atps (figure 6c) are able to stabilize rad-51 filaments as effectively as in the presence of atp (figures 6a and 6d). together, these results demonstrate that nucleotide binding is necessary and sufficient to activate the 5 filament end binding and remodeling activities of rfs-1/rip-1, whereas nucleotide hydrolysis by the complex is dispensable for these functions. the walker box mutants of rfs-1 also fail to induce a fluorescence reduction on pre - formed rad-51-ssdna filaments, which mimics the situation observed for nucleotide - free rfs-1/rip-1 (figures 5a and 5b). these data therefore suggest that the walker box mutants of rfs-1 are likely to be defective for atp binding, which could explain their overall failure to remodel rad-51-ssdna filaments (taylor., 2015). our previous work revealed a function for rad51 paralogs in remodeling rad51 pre - synaptic filaments to a relaxed and stable structure, which is more proficient for strand invasion (taylor., despite these insights, important mechanistic questions remained unresolved, particularly in relation to the precise nature of filament stabilization, how the rad51 paralogs engage with the pre - synaptic filament, and the role of nucleotide co - factors in this process. we establish here that rad51 paralogs act by capping the 5 end of the pre - synaptic filament in a nucleotide - dependent manner, which induces a conformational transition that propagates along the filament in a 53 direction. this extends up to 40 nucleotides away from the 5 end of the filament and shuts down the dissociation of rad-51 from ssdna (figure 7a). a major question arising from our work is how rfs-1/rip-1 engages with the 5 filament end. interestingly, modeling of the crystal structure of psy3-csm2 from the budding yeast shu complex, which contains divergent rad51 paralogs, revealed that it could be specifically docked onto the 5 end of the yeast rad51 filament crystal structure (conway. in contrast, docking to the 3 end was associated with steric clashes rendering such an association less plausible (sasanuma., 2013). our study provides experimental evidence that rad51 paralogs recognize an intrinsic polarity within the rad51 filament and bind specifically to the 5 end. given that rfs-1 mutants that abolish the ability of rfs-1/rip-1 to drive the fluorescence reduction associated with 5 filament end binding also fail to mediate remodeling and stabilization (taylor., 2015), we propose that normal 5 filament end binding is a pre - requisite for initiation of remodeling. in the future, it will be important to establish tractable methods to obtain atomic resolution structural models of rad51 paralogs bound to rad51 filaments, to better understand the intricacies underlying filament capping and remodeling. docking of the yeast csm2-psy3 heterodimer and rad51-ssdna filament crystal structures was achieved by modeling the complex as a direct extension of the filament (sasanuma., 2013), consistent with the fact that the fundamental repetitive units of the yeast rad51 filament are rad51 homodimers, which assemble in tandem with a distinctive interface to that between the two monomers of each homodimer pair (conway., 2004). both protomer - protomer interfaces involve the atp binding pockets of adjacent protomers and bound atp co - factor (conway., 2004), similar to that observed in the reca - ssdna crystal structure (chen., 2008). csm2-psy3 may be a good model for rfs-1/rip-1 since psy3, like rip-1, only contains a walker b box (martn., 2006), while csm2, despite lacking sequence homology with rad51, adopts a rad51-like fold (sasanuma., 2013, she., 2012, tao., accordingly, csm2 is proposed to dock directly to the 5 filament end, while psy3 is distal (sasanuma., 2013), consistent with the fact that rfs-1, but not rip-1, interacts with rad-51 in yeast two hybrid (taylor., 2015). in addition, recent work identified a homolog of the swim domain - containing protein of the shu complex (yeast shu2 or human sws1) (liu. 2006) in c. elegans, sws-1 (godin., 2015, mcclendon., 2016). sws-1 interacts with rip-1, but not rfs-1, in a manner dependent on the rip-1 walker b box aspartic acid residue 131 (mcclendon., 2016) notably, the same d131a mutation in rip-1 does not dramatically interfere with the rfs-1/rip-1 interaction in yeast two hybrid (taylor., 2015), consistent with this residue exhibiting greater functional importance in maintaining a rip-1/sws-1 interface. saxs data also indicate that shu2 associates with psy3 rather than csm2 (she., 2012) and, by deduction, distal to the 5 filament end. together, these observations support a model in which rfs-1 directly contacts rad-51 at the 5 filament end and rip-1 is positioned distally, allowing it to interact with sws-1 (figures 7b and 7c). another key question is how do nucleotide co - factors contribute to 5 filament end recognition ? since the rfs-1/rad-51 interaction is highly sensitive to mutations in their walker boxes (taylor., 2015) and rfs-1/rip-1 must be nucleotide - bound to mediate normal 5 filament end binding, a nucleotide co - factor may sit at the proposed rad-51/rfs-1 interaction interface, but nucleotide binding may also be required between rfs-1 and rip-1 to allow them to adopt an active form. rfs-1/rip-1 bound to adp was equally efficient as atp in 5 filament end binding, raising the question of exactly which nucleotide binds each of these proposed interfaces physiologically. em experiments on circular ssdna revealed filament binding is independent of a 5 dna end. this is supported by the fact filament binding by rfs-1/rip-1 is detectable in stopped flow even when the native 5 dna end is modified by the cy3 dye. notably, rfs-1/rip-1 also readily stabilizes the rad-51 filaments in the ssdna curtain assays, even though the long ssdna molecules have no accessible 5 ends. in these assays, it is likely that rfs-1/rip-1 binds to the 5 filament termini located between filament discontinuities (figure 7a). rfs-1/rip-1 binds ssdna very weakly, but strongly enriches equilibrium protein - ssdna complex levels in the presence of rad-51 (taylor., 2015). thus, rfs-1/rip-1 could contact ssdna with higher affinity in the context of a pre - established rad-51 filament. both rad-51 and ssdna contacts by rfs-1/rip-1 could therefore be required for its filament capping activity. in contrast to psy2-csm3, the crystal structure of a fragment of human brca2 fused to rad51 can be modeled as binding the 3 end of the yeast rad51 filament (pellegrini., 2002, this is consistent with electron microscopy studies demonstrating 3 filament end binding of full - length brca2, suggesting brca2 promotes filament growth with 35 polarity, at least on naked ssdna (shahid., our data on spontaneous assembly of rad-51 filaments are consistent with unidirectional filament extension in the 53 direction, as has also been interpreted for yeast rad51 (antony., 2009, hwang and myong, 2014, qiu., 2013) or bidirectional assembly occurring more rapidly 35 than 53. brca2 may restrict filament extension polarity to 35, which importantly would leave the 5 end of the extending filament free for binding by rad51 paralogs. given the distinct filament binding polarity exhibited by brca2 and rfs-1/rip-1, it will be interesting to analyze the interplay between the nematode brca2 ortholog, brc-2, and rfs-1/rip-1 during filament assembly and remodeling, since these proteins may synergize in these processes on naked and/or rpa - bound ssdna. indeed, it was recently shown that although the yeast rad51 paralog complex rad55-rad57 and the shu complex do not stimulate rad51 binding to rpa - coated ssdna, they significantly synergize with rad52 in this process (gaines., 2015). we have also observed that rfs-1/rip-1 stimulates filament formation in the presence of atp (taylor., 2015), so it is possible this activity may synergize with brc-2. in addition, by capping opposing ends of filaments, brc-2 and rfs-1/rip-1 may even exhibit a degree of allostery in mediating filament remodeling and stability. in the case of the 2-adrenergic and -opioid g protein coupled receptors, binding of agonists is not sufficient to drive the complete establishment of the active conformation of the receptor and full activation requires heterotrimeric g protein engagement (manglik., 2015, sounier., 2015). as such, anchoring of the 3 filament end by brc-2 could co - operatively enhance filament remodeling by rfs-1/rip-1 to allow propagation beyond the 40 nucleotide threshold defined in this study. another critical structural question is exactly how rfs-1/rip-1 propagates a biophysical change along the filament to a point considerably distal to its binding site, manifested as stabilization and nuclease - sensitization of the filament beyond the region in immediate proximity to the 5 filament end where rfs-1/rip-1 binds. one possible mechanism is that the binding of rfs-1/rip-1 induces a conformational change in the proximal rad-51 protomer in the filament. this in turn could modulate the interface between this rad-51 molecule and an adjacent, distal rad-51 protomer, ultimately propagating remodeling with 53 polarity through allosteric communication between adjacent rad-51 monomers within the filament, up to 40 nucleotides (1314 rad-51 protomers) from the end. such long - range conformational propagation in response to a binding event by proteins and/or small molecule ligands is well established for signal transduction by membrane receptors, such as g protein coupled receptors upon agonist and heterotrimeric g protein binding (manglik., 2015, it is therefore conceivable that long ranging organizational changes could occur throughout rad51 filaments in response to terminal binding events by rad51 paralogs. in conclusion, our study provides insights into the molecular mechanism of rad51-ssdna filament remodeling by rad51 paralogs, paving the way for future structural studies of this process, and interplay with other hr mediators. equal volumes of the indicated components were rapidly mixed and cy3 fluorescence monitored for 1 min. raw data sets were normalized as follows : for rad-51 ssdna binding (figure s1) and rfs-1/rip-1 filament binding experiments (figures 2 and 5), normalized to the starting value for cy3 fluorescence ; for competition experiments (figures 3, 4, and s3), normalized to the value for cy3 fluorescence at the 2.01998 s time point and truncated before this. ssdna curtains were prepared by rolling circle amplification of an m13mp18 single - strand plasmid, tethered at both ends in a flow cell, and visualized by binding of scrpa - egfp. rad-51 filaments were assembled by flushing out scrpa - egfp and flowing in rad-51 in the presence of atp. filaments were equilibrated with buffer containing the indicated nucleotide before incubation with rfs-1/rip-1. to assess filament stability, rad-51 was removed and replaced with scrpa - egfp in the absence of atp, while maintaining rfs-1/rip-1 in the buffer. for quantification, the fluorescence intensity of individual kymograms was adjusted to the background and normalized to the starting value. immuno - gold em was performed by incubating proteins (1 m rad-51 and 0.1 m rfs-1/rip-1) and circular p8064 ssdna or linearized phix ssdna, then incubating with anti - flag antibody conjugated to 20-nm gold particles, staining with uranyl acetate, and imaging. for nuclease protection assays, protein - dna complexes were assembled on 5 or 3 fluorescently labeled 61-mer ssdna before challenging with dnasei, deproteinizing, and resolving dna products by page. | summarycentral to homologous recombination in eukaryotes is the rad51 recombinase, which forms helical nucleoprotein filaments on single - stranded dna (ssdna) and catalyzes strand invasion with homologous duplex dna. various regulatory proteins assist this reaction including the rad51 paralogs. we recently discovered that a rad51 paralog complex from c. elegans, rfs-1/rip-1, functions predominantly downstream of filament assembly by binding and remodeling rad-51-ssdna filaments to a conformation more proficient for strand exchange. here, we demonstrate that rfs-1/rip-1 acts by shutting down rad-51 dissociation from ssdna. using stopped - flow experiments, we show that rfs-1/rip-1 confers this dramatic stabilization by capping the 5 end of rad-51-ssdna filaments. filament end capping propagates a stabilizing effect with a 53 polarity approximately 40 nucleotides along individual filaments. finally, we discover that filament capping and stabilization are dependent on nucleotide binding, but not hydrolysis by rfs-1/rip-1. these data define the mechanism of rad51 filament remodeling by rad51 paralogs. |
serotonin toxicity (or serotonin syndrome) is the result of excessive serotonin activity caused by the administration of selective serotonin reuptake inhibitors (ssris), often in combination with serotonin receptor agonists.1 serotonin toxicity is characterized by myoclonus, hyperreflexia, autonomic nervous symptoms, and changes in mental status.1 given that an altered mental status, which includes agitation and anxiety, is common in depression, patients treated with ssris should be carefully examined for the presence of hyperreflexia. two serotonin receptor subtypes are candidates for the underlying pathophysiology of serotonin toxicity.1 however, the different effects of the stimulation of the 5-hydroxytryptamine (5-ht)1a and 5-ht2a receptors on the clinical exacerbation of serotonin toxicity have not yet been elucidated. in the present report, we suggest the possible involvement of the 5-ht1a receptor in mild serotonin toxicity without hyperthermia. a 64-year - old woman who experienced auditory hallucinations and insomnia, was treated with hypnotic benzodiazepines and perospirone (8 mg / day ; figure 1a). she had developed chronic renal failure, which had continued for several years, with high serum levels of creatinine and blood urea nitrogen (figure 1a). she also experienced depressed mood, diminished interest, and anhedonia ; therefore, she was treated with paroxetine (10 mg / day). eighteen hours after paroxetine was added to her ongoing perospirone treatment, she exhibited finger tremors, sweating, coarse shivering, hyperactive knee jerks, vomiting, diarrhea, tachycardia, and psychomotor agitation. an 81-year - old woman who experienced persecutory delusions with mild dementia, was treated with neuroleptics (figure 1b). she was admitted to a psychiatric unit, owing to increased hostility and aggression related to her delusions. the results of brain imaging tests revealed mild brain atrophy in the frontotemporal and hippocampal regions with no cerebrovascular lesions. after successful treatment of her paranoid state, the patient developed depressive symptoms, which were treated with 10 mg / day of paroxetine. the final neuroleptic dose was 8 mg / day of perospirone that had been administered for 3 weeks. fourteen hours after the addition of paroxetine to the patient s ongoing perospirone treatment, she exhibited tachycardia, finger tremors, prominent anxiety and agitation, and hyperactive knee jerks. the symptoms continued for days (ie, for as long as perospirone and paroxetine were coadministered), and they disappeared 3 days after the discontinuation of both drugs. a 64-year - old woman who experienced auditory hallucinations and insomnia, was treated with hypnotic benzodiazepines and perospirone (8 mg / day ; figure 1a). she had developed chronic renal failure, which had continued for several years, with high serum levels of creatinine and blood urea nitrogen (figure 1a). she also experienced depressed mood, diminished interest, and anhedonia ; therefore, she was treated with paroxetine (10 mg / day). eighteen hours after paroxetine was added to her ongoing perospirone treatment, she exhibited finger tremors, sweating, coarse shivering, hyperactive knee jerks, vomiting, diarrhea, tachycardia, and psychomotor agitation. an 81-year - old woman who experienced persecutory delusions with mild dementia, was treated with neuroleptics (figure 1b). she was admitted to a psychiatric unit, owing to increased hostility and aggression related to her delusions. the results of brain imaging tests revealed mild brain atrophy in the frontotemporal and hippocampal regions with no cerebrovascular lesions. after successful treatment of her paranoid state, the patient developed depressive symptoms, which were treated with 10 mg / day of paroxetine. the final neuroleptic dose was 8 mg / day of perospirone that had been administered for 3 weeks. fourteen hours after the addition of paroxetine to the patient s ongoing perospirone treatment, she exhibited tachycardia, finger tremors, prominent anxiety and agitation, and hyperactive knee jerks. the symptoms continued for days (ie, for as long as perospirone and paroxetine were coadministered), and they disappeared 3 days after the discontinuation of both drugs. in the present report, both patients were diagnosed as having serotonin toxicity because of the existence of tremor and hyperreflexia,2 and they presented without symptoms of muscle rigidity or hyperthermia.1 the possibility of neuroleptic malignant syndrome was not taken into consideration as a differential diagnosis, because the symptoms appeared just after adding paroxetine ; moreover, the present cases did not exhibit severe muscle rigidity and hyperthermia.3 in addition, there was no elevation of serum creatine phosphokinase in case 1. the autonomic symptoms, neuromuscular hyperactivity, and altered mental status occurred upon initiation of the serotonergic drugs, and they ceased promptly after the treatment s discontinuation ; this is characteristic of serotonin toxicity.4 paroxetine is metabolized by cytochrome p450 oxidase (cyp)2d6 in the liver and excreted in the urine. patients with renal failure are considered to be at an increased risk of developing side effects associated with a high serum concentration of paroxetine.5 the psychiatric diagnosis of case 1 was psychotic disorder not otherwise specified, and there was no evidence of a relationship between her renal insufficiency and her psychiatric symptoms or her serotonin toxicity symptoms. case 2 was diagnosed as having dementia with psychotic symptoms, including persecutory delusions, anxiety, and depressive symptoms. in this case, the serotonin toxicity persisted for days because of the unfortunate oversight of a possible serotonin toxicity induced by the administered psychotropics. the increased anxiety and agitation were believed to be derived from the behavioral and psychological symptoms of dementia. tachycardia was misdiagnosed as a result of the increased motor activity associated with her anxiety and agitation. serum paroxetine concentrations were not evaluated in either case presented here, and the possibility remains that the paroxetine concentration was sufficiently elevated in both cases. we considered that vulnerability induced by perospirone pretreatment is most likely to have exaggerated the mild serotonin toxicity in both cases. perospirone is a serotonin dopamine antagonist with unique agonistic effects on the 5-ht1a receptors,6 and is metabolized by cyp3a4.7 it was the second serotonin the receptor binding profiles of perospirone (excluding 5-ht1a receptor binding) and its pharmacological properties targeting the positive and negative symptoms of schizophrenia resemble those of risperidone.7 the ki values of perospirone for the dopamine receptor d2, as well as for the 5-ht2a and 5-ht1a receptors are 1.4 nm, 0.6 nm, and 2.9 nm, respectively,7 whereas those of risperidone are 3.3 nm, 0.16 nm, and 250 nm, respectively.8 data on the ki values measured from various tissue sources can be viewed in the national institute of mental health psychoactive drug screening program ki database (http://pdsp.med.unc.edu/pdsp.php) by choosing a psychotropic drug for the test ligand. the 5-ht1a agonist activity of neuroleptics is expected to improve mood9 and cognition10 in schizophrenia. perospirone has also shown efficacy in reducing aggressive behavior in dementia patients.11 to treat the symptoms of aggression and anxiety exhibited by case 2, previously administered olanzapine was switched to perospirone 10 days before the addition of paroxetine. when experimental animals were administered a 5-ht1a agonist, they developed tremors, forepaw treading, head - weaving and twitches, flattened body posture, hind limb abduction, the straub tail reaction, hyperhidrosis, and defecation.12 the similarities noted between the alterations in animal behavior and the symptoms of human serotonin toxicity suggest that the 5-ht1a receptor may be involved in the pathogenesis of serotonin toxicity. in another experimental animal model of serotonin toxicity, the activation of neuronal 5-ht2a receptors was identified as the cause of life - threatening hyperthermia.13 furthermore, the serotonin system has been implicated in a biphasic mechanism that controls thermoregulation. studies in experimental animals have indicated that a slight elevation of serotonin levels decreases body temperature through neural transmission involving the 5-ht1a receptors, whereas the considerable elevation of serotonin levels induces high body temperature through 5-ht2a neural transmission.14,15 therefore, it could be hypothesized that while a slight excess of serotonin causes side effects by activating the 5-ht1a receptor, a significant increase in serotonin levels can induce lethal side effects with hyperthermia, which can cause severe brain damage16 through the activation of the 5-ht2a receptor. the early observation17 that the affinity of endogenous serotonin for the 5-ht1a receptors (ki = 5.1 nm) is much higher than its affinity for 5-ht2a receptors (ki = 420 nm) supports this hypothesis. vulnerabilities to serotonin toxicity are increased by a polymorphism in the serotonin transporter or cyp, a competitive substrate of the cyp enzyme,18 and by coadministered monoamine oxidase inhibitors or lithium.19 the present cases underscore the importance of preventing the development of serotonin toxicity after the combined use of ssris and 5-ht1a agonistic drugs, even when a small amount of ssri is administered. several case studies have reported the development of serotonin toxicity by the combined use of ssris and 5-ht1a agonist anxiolytics;20,21 however, high body temperatures were not observed in these studies. the exacerbation of serotonin toxicity in the present cases by adding small doses of paroxetine while administering perospirone acting both as a 5-ht1a receptor agonist and a 5-ht2a receptor antagonist clearly indicates the involvement of the 5-ht1a receptor in mild forms of serotonin toxicity. although the involvement of both 5-ht1a and 5-ht2a receptors in the pathogenesis of serotonin toxicity has often been indicated,22 we considered it worthwhile to pay attention to serotonin toxicity profiles under the situation of an antagonistic blockade of 5-ht2a receptors in human subjects. taken together, the coadministration of ssris and neuroleptics, like risperidone, with a potent 5-ht2a antagonistic function and a scarce 5-ht1a agonistic function would produce a lower incidence of serotonin toxicity. a recent clinical trial23 indicated the effectiveness of adding a 5-ht1a partial agonist for the treatment of patients with depression who are resistant to citalopram. mirtazapine, which acts as a 5-ht1a agonist in addition to its norepinephrine - releasing function, has been proposed to enhance the clinical effectiveness of ssris.24 furthermore, aripiprazole, which acts as a 5-ht1a agonist, is used to augment the clinical effectiveness of ssri treatment.25 considering that recently available ssris, including vilazodone26 and vortioxetine,27 have considerable 5-ht1a agonistic function, more caution is needed to detect serotonin toxicity in depression treatments. in conclusion, the possible development of serotonin toxicity should be considered when neuromuscular toxicities including tremor, myoclonus, and hyperreflexia in the extremities are observed during the combined use of ssris and psychotropics with 5-ht1a agonistic properties, or during the use of ssris with 5-ht1a agonistic properties. | we propose the possibility of 5-hydroxytryptamine (5-ht)1a receptor involvement in mild serotonin toxicity. a 64-year - old woman who experienced hallucinations was treated with perospirone (8 mg / day). she also complained of depressed mood and was prescribed paroxetine (10 mg / day). she exhibited finger tremors, sweating, coarse shivering, hyperactive knee jerks, vomiting, diarrhea, tachycardia, and psychomotor agitation. after the discontinuation of paroxetine and perospirone, the symptoms disappeared. another 81-year - old woman, who experienced delusions, was treated with perospirone (8 mg / day). depressive symptoms appeared and paroxetine (10 mg / day) was added. she exhibited tachycardia, finger tremors, anxiety, agitation, and hyperactive knee jerks. the symptoms disappeared after the cessation of paroxetine and perospirone. recently, the effectiveness of coadministrating 5-ht1a agonistic psychotropics with selective serotonin reuptake inhibitors (ssris) has been reported, and ssris with 5-ht1a agonistic activity have been newly approved in the treatment of depression. perospirone is a serotonin dopamine antagonist and agonistic on the 5-ht1a receptors. animal studies have indicated that mild serotonin excess induces low body temperature through 5-ht1a, whereas severe serotonin excess induces high body temperature through 5-ht2a activation. therefore, it could be hypothesized that mild serotonin excess induces side effects through 5-ht1a, and severe serotonin excess induces lethal side effects with hyperthermia through 5-ht2a. serotonin toxicity via a low dose of paroxetine that is coadministered with perospirone, which acts agonistically on the 5-ht1a receptor and antagonistically on the 5-ht2a receptor, clearly indicated 5-ht1a receptor involvement in mild serotonin toxicity. careful measures should be adopted to avoid serotonin toxicity following the combined use of ssris and 5-ht1a agonists. |
the defining event for most infections occurs during the initial phase of the host response to colonisation by a pathogen or commensal organism. in studying host responses there is a tendency to focus on the cell types that comprise the biological barriers to microbes to uncover the host signalling events and virulence traits that are involved in the initial phase of disease. cell culture models can compartmentalize and define the broad range of molecular mechanisms that underlie strategies of microbial virulence such as host receptor ligand binding and can afford critical insight in what drives host defence strategies. many diverse, sometimes intricate, epithelial cell culture models based on the use of single lineages of cells, also known as monocultures, have been characterized under carefully optimized in vitro conditions. these have provided the basis for our current understanding of many host - pathogen interactions such as those involving herpes and hepatitis viruses [3, 4 ], the malaria parasite [5, 6 ], and leading bacterial pathogens including haemophilus influenzae and campylobacter jejuni [7, 8 ]. monocultures have also provided much of our current understanding of how m cells sample bacteria from the lumen of mucosal sites that initiates innate immune defence [911 ]. in studying host responses to microorganisms as well as the virulence traits employed during host - pathogen interactions the limitations in extrapolating functional mechanisms in cell culture models that are based on only single cell types most evidently, these limitations reflect the inherent inability of single lineage monoculture systems to model the complex biological processes that occur in tissues in vivo. these processes comprise multiple cell types that often necessarily interact to mediate effective antimicrobial defence [12, 13 ] and inflammatory reactions [14, 15 ]. widespread use of monolayers and suspensions of single cell types in vitro was driven in part by difficulties in identifying discrete functional pathways using in vivo models. the main advantage of in vitro models based on single cell types lies in their ability to provide key information on a particular cell type 's reaction to an infectious microbe. monocultures provide an efficient and economical means of teasing apart a wide range of experimental variables given the versatility of homogeneous cell populations in vitro versus the economic and ethical constraints of in vivo models. however, cell culture models consisting of one cell type reflect few biological host systems, given the multiple intercellular communication networks that exist in organs and the vasculature and lymphatics. monocultures are unable to replicate critical processes that drive immune responses to pathogens such as antigen - presenting cell - lymphocyte communication. monocyte - derived dendritic cells challenged with burkholderia pseudomallei, for example, require contact with other cell types to generate immune responses. seropositive t cells combined with dendritic cells mediate gamma interferon production in cd4 t cells and granzyme b in cd8 t cells in this case. thus, despite their widespread use and noted benefits monoculture systems are not an ideal foundation for in vitro modelling of infectious processes. an in vitro alternative to monoculture is coculture of multiple cell types including most commonly epithelial cells. this approach is being used with increasing frequency as a solution to bridge the gap between overly simplistic single lineage in vitro models and the dynamic biological processes that occur in vivo. coculturing epithelial cells with other cell types in proportional levels approximated to known tissue constituency have been used to mimic the in situ interactions of various body systems. such models have been used to study immune defence and have highlighted the effects of neutrophils, eosinophils, monocytes, and lymphocytes on epithelial cell function. these effects appear to occur predominantly through the paracrine signalling actions of cytokines and other chemical mediators. contact - dependent juxtacrine events may also impact coculture phenotypes ; however, reports of these have been rarely reported in comparison. epithelial cell coculture models have recently been extended to primary cells to define epithelial cell function in immune reactivity to microorganisms. a coculture model of alveolar epithelial cells with monocyte - derived macrophages and dendritic cells, for example, has been used to model alveolar epithelial barriers to microorganisms. expansion of cocultures through the use of structurally distinct 3d organotypic systems [20, 21 ] is another area of intense research gaining popularity. these systems utilize free flowing media and complex scaffolds in radial - flow or rotating wall bioreactors. this approach more closely replicates in vivo biology beyond basic coculturing of different cell types with rearrangement of cells into proto - organic structures [20, 21 ]. moreover, recent data indicate that these systems offer new ways to study signalling events and drug interactions. stationary 3d models have also been used to study dynamics of cell migration through cell layers and suspensions. highly complex organotypic rotating models that incorporate synthetic surfaces and matrices have also been used to explore permeability properties. however, nonscaffolded cocultures provide a compromise in terms of advantages and limitations because they are technically uncomplicated but provide capacity to model intercellular interactions. an overview of nonscaffolded epithelial cell coculture models that have been described in the literature is illustrated in figure 1. many tend to incorporate epithelial cells lines in short - term assays (less than 24 h) to replicate biological barriers and interactions with membranous surfaces, or immune responses and host defence. one benefit of coculture compared to monoculture is its capacity to better reflect the in vivo biology of cytokines, growth factors, and transcriptional regulators activated or repressed in response to disease. for example, a study of inflammatory mechanisms underlying colon cancer revealed monocyte - derived il-10 directly effects intestinal epithelial cell il-6 synthesis. this was thought to contribute to disease progression through mucin production and cell migration. in terms of wound repair during disease and regeneration of biological barriers coculture models investigations of the epithelium in epidermal tissue showed that laminin-5 anchors basal epithelial cells to the extra cellular matrix (ecm) but requires fibroblasts to mediate cleavage of the mature peptide. cocultures analysing cell types for epithelial regeneration have also indicated that fibroblasts stimulate repair of a caco2 monolayer more efficiently than a monolayer alone after damage to the cells. collectively, this illustrates the contributions of fibroblasts in epithelial barrier regeneration and underscores the benefits of cocultures for study of wound repair. in addition to wound repair, an area where coculture models have led to major advances is embryotrophic coculturing. these models have reconstructed uterine tissue in vitro by using primary and immortalized cell lines and conditional media to host embryonic development. in nonscaffolded models reductive effects of fibroblasts, epithelial cells and other uterine cell types have been demonstrated to confer benefits on embryo maturation. this appears to occur through removal of defined media components and concentrations of byproducts such as oxidants, free radicals, and cytokines. beneficial effects through the provision of various proteins and growth factors were reported to enhance viability in this model. a noted limitation in these studies, however, was the use of serum, which negatively influenced embryonic outcomes. this led to multiphase coculture systems that utilized chambers between sections within cocultures to minimize the impact of media components. serum - free media was identified as a possible alternative to address the divergent nutritional requirements of the different cells in this system. shifts in concentrations of media components such as glucose, amino acids, serum, and vitamins can occur more rapidly in cocultures than monocultures due to increased metabolism and byproduct accumulation. for example, lactic acid, which lowers ph and inhibits key glycosylating enzymes, inhibits cell growth. modifying media by alternative carbohydrates can stabilize ph and, when combined with bicarbonate - co2 buffering, can minimize the impact of increased metabolism. increased metabolism of infected cocultures is also important to consider, particularly for receptor and glycosylated microbial - binding target studies. for example, nutrient consumption and byproduct accumulation decreases protein glycosylation but glycan structures of glycoproteins on host cells can be important for microbe binding. where glycoproteins act as ligands for microbe adherence such as for h. pylori, deregulated metabolism and modified glycoprotein availability may introduce model artefacts. secretion of basal signalling factors leads to their accumulation in coculture more rapidly and this can also affect the function of certain cell types. metabolic breakdown of glutamine to ammonia, for example, inhibits cell growth at high ph, and can decrease sialylation and change glycan structure. accumulation of byproducts and depletion of glutamine would occur more rapidly where the microorganisms under study proactively utilize glutamine for metabolism. finally, microbial respiration may also affect the biology of epithelial cell cocultures ; dissolved oxygen, for example, influences galactosylation and microbial adherence can be affected by the level of dissolved oxygen in culture media. where epithelial cell lines are studied in longer - term assays (more than 24 h) the impact of media requirements is even more important. it is notable that coculture systems may limit the movements of molecules over time when studied under organotypic conditions. a limitation of most cocultures described to date is the effects of continuous cell lines, which often display phenotypes not observed in primary cells. an example is varied expression of cytokines and cell surface markers [40, 41 ]. murine gastric epithelial cells show different levels of expression of cathepsin - x, a cell marker with a putative immunological interaction with macrophages, depending on whether the gastric epithelial cells are primarily derived or immortalized. strong cathepsin - x expression in primary cells contrasts with undetectable levels in immortalised cells, which leads to lesser attachment of h. pylori. this has a major effect on the outcome of host - pathogen interactions in this model. another well - characterized phenotypic disconnect between primary and continuous epithelial cells is bladder uroepithelial cells. while primary mammalian uroepithelial cells express uroplakin proteins such as upia, upib, upii, and upiii on their surface [42, 43 ], commonly used carcinoma - derived immortalized uroepithelial cell lines used to study adherence of and inflammatory reactions to uropathogenic escherichia coli [44, 45 ] and streptococci mostly do not express these proteins [4750 ]. e - cadherin and cingulin expression also differs in monolayers versus primary cells. despite these known artefacts of continuous epithelial cell lines, most epithelial cell lines are robust, are easily propagated, and they may be preferable for long - term assays where temporal continuity and avoidance of repeated collection of primary cells are important. they are more suited to studies where isolation of primary cells is technically demanding or time consuming. the risk of cross - contamination between cell lines is, however, increased with concurrent use of multiple cell lines for coculture as demonstrated for hela epithelial cells. thus, regular maintenance of multiple cell lines demands increased adherence to strict work - flow practices, and regular quality control checks to ensure the integrity of continuous cell lines. finally, the maintenance of cell lines for coculture requires repeated passaging, and this routine activity can introduce artefacts in coculture. trypsin protease, for example, used to detach cells, causes physiological changes including upregulation of protein production, membrane protein and sialic acid modification, proliferation, and activation of membrane channels. application of golgi - blockers such as brefeldin a in coculture to retain intracellular products such as cytokines can disrupt other cellular functions by prohibiting exocytosis of vital proteins and may even cause cell death. thus, treatment agents used for the regular maintenance of cells lines for coculture and their treatment and analysis need to be carefully selected so that experimental artefacts in coculture systems are minimized. coculturing of epithelial cells in an immunological context has provided key information on the influence of individual cell types towards others in proximity. for example, exposure of cells to pathogen - associated molecular patterns has yielded responses in transcription and translation that are distinct in coculture versus monoculture [59, 60 ]. in the context of cytokine production and t cell proliferation, coculturing has yielded intriguing results in side - by - side comparisons with monoculture. for example, use of a tlr7/8-specific oligonucleotide agonist mediates a stimulatory effect on cd4 + t cell proliferation. however, when cocultured with the agonist and peripheral blood mononuclear cells the proliferation signal for t cells is overridden and coculture causes suppression effects via an unknown mechanism thought to involve monocyte - expressed tlr8. in a separate system of lung epithelial cells, exposure of nanoparticles in a coculture with monocyte - derived macrophages and dendritic cells showed a synergistic effect in comparison to monocultures ; whereas monocultures showed minor responses to inflammatory stress cocultures exhibited reduced oxidative stress and increased proinflammatory responses in this model. epithelial cell cocultures have also been used to simulate differentiation and reassortment of cells into tissue - like arrangements. these 3d organotypic models have emerged in recent decades through the usage of bioreactors and matrix gels. two types of bioreactors, namely, rotating wall models and radial flow models have been characterized and function through the use of cylindrical chambers with a central core to mediate perfusion [23, 61 ]. the rotating wall bioreactor makes use of the central core to permit gas exchange while the cylinder horizontally rotates with cocultured cells and collagen - coated porous beads to initiate 3d architecture. in contrast, the radial flow model utilizes the cylinder in a stationary fashion to permit media perfusion from the external membrane of the cylinder into the coculture and outwards through the membrane of the central core. a 3d rotating wall bioreactor coculture of alveolar epithelial cells with macrophages was shown to mediate differentiation of monocytes into macrophage - like cells, and cause macrophages to migrate towards the epithelial layer. here, the effects of monocytes, macrophages and epithelial cells yielded a unique synergistic phenotype that afforded better protection from cytotoxin - induced apoptosis. apoptosis modelling with infected epithelial and other cell types is relevant for cocultures since apoptosis is a key response of many cell types to bacteria [6466 ]. approaches towards replicating organotypic tissues with a focus on complete synthetic organ recreation are also providing glimpses into the future of organ replacement. in studies focused on liver, the use of immortalized hepatic and sinusoidal cell lines was combined in a radial flow bioreactor to replicate part of a lobe. studies of byproducts from these synthetic liver organoids have yielded varying results but so far indicate some key synergistic effects for drug metabolism, albumin, and urea production [20, 61, 62, 67 ]. these take advantage of harvesting cell lines to resuspend in collagen solutions with gelatine to form a basic 3d architecture. using this architecture, the proximity of different cell types can be assayed for morphological changes to cell structure, or migration of cells. in dentistry, the study of early tooth germ cell structure has been observed through the use of 3d and layered cultures that utilise dental tooth pulp and enamel epithelial cells suspended in layers that are then floated in media. this resulted in a cuboidal morphology of enamel epithelial cells, which correlates with developmental effects in vivo. here, the result would have been a simple monolayer if the epithelial cells were studied in monoculture. matrix gel models in particular have been applied to intestinal studies. in one study, suspension of monocytes and intestinal fibroblasts in a collagen gel with intestinal epithelial cells led to the formation of epithelial monolayers that promoted monocyte migration and differentiation into macrophages. thus, coculture affected not only cell - cell adhesion but also terminal cell differentiation. synergies like these probably reflect elevated growth factor production in the media that mediates coculture - dependent cell maturation. these models are typically based on cocultures of two host cell types and subsequent challenge with a microbial component such as membrane proteins, lps, or cytotoxins to study virulence and pathogenesis. whole bacteria, viruses, and parasites are also often used to challenge cocultures although this approach may be limited by microbial overgrowth. lymphocytes, monocytes, macrophages, and natural killer cells play pivotal roles in host responses to infection, and many coculture studies have investigated the interactions of these cell types with epithelial cells. epithelial cell - macrophage cocultures are particularly useful where there is known in situ proximity of these two cell types in vivo such as in the bladder. different roles between macrophages and epithelial cells in tissues such as the kidneys, intestinal epithelium [7174 ], and urogenital tissues have been highlighted through different responses to cytotoxic and infectious agents. these studies have indicated the important combination of matured mononuclear cells and the surrounding epithelial cell layer in vivo in the primary response to infection (table 1). contrasting results between coculture models and monocultures of macrophages or epithelial cells in infectious conditions have been shown through the use of adenoviral vectors [76, 77 ]. these vectors are used as vehicles for gene delivery in experimental and preclinical protocols, and encounter mixed immunological responses depending on the in vivo or in vitro setting [76, 77 ]. infection of macrophage - epithelial cell cocultures with an adenoviral vector is capable of stimulating closer in vivo - like immune responses than with macrophage or epithelial cells alone. these responses, which follow proinflammatory stimulation, have been demonstrated via elevated levels of nitric oxide, reactive oxygen species, and chemokine profiles. here, il-6 and nitric oxide responses of the coculture were reduced by nf - kb and tyrosine kinase inhibitors, highlighting their role as inflammatory mediators. thus, epithelial cell - mononuclear cell coculture models have provided insight into immune responses to gene delivery vectors that could not be gained through the use of monocultures. additionally, they have provided key data on cell signalling effects through distinct cytokine profiles in response to infectious stimuli. for example, an intestinal coculture demonstrated more limited cytokine reactivity compared to monocultures. a lower response to challenge in coculture may reflect synergistic suppressive effects that occur in vivo. on the other hand, the use of epithelial cells in coculture with macrophages leads to a synergistic effect on il-10 production after infection with escherichia coli (b duell. the successful application of coculture models in infection studies is the effect of microbial viability on host cell viability. viable microbes can rapidly influence the viability of host cells through necrosis, apoptosis, and pyroptosis. as a consequence, survival rates of the cocultured cells can decrease rapidly. while cell death is inevitable as culture media becomes spent, the input of antibiotics can kill the microbe or induce a nonreplicative viable form that can enable cocultures to be studied longer term. in coculture models where pathogen viability is a consideration, preserving microbial cell structure is best addressed by the use of gamma - irradiation to inactivate the microbial cells. this represents a better alternative to heat killing or uv irradiation, since both techniques denature microbial cell structures that may be important for host cell interactions [82, 83 ]. whilst all of these approaches compromise the advantages of a viable pathogen in coculture, they do provide modelling conditions not possible with the use of viable microbes where microbial overgrowth occurs. for example, the use of virosomes in cocultures of macrophages, epithelial cells, and dendritic cells to model lung tissue has revealed alternate cell entry mechanisms with potential applications to clinical therapies and viral pathogenesis. systems based on the use of microbial components have useful applications for studying vectors and can simulate responses to microbial epitopes without compromising viability of host cells. epithelial cell coculture models have significant benefits over monocultures, particularly in the study of infectious diseases. these models provide an important step in informing the experimental approach towards in vivo experimentation. the synergistic effects of epithelial cells with multiple cell types combined in culture can be partnered with microbial infection of cocultures to drive clinically relevant host responses. incubation of epithelial cells with other cell types affects how the cells synthesize cytokines, induce signalling events, and differentiate. careful selection of the cell types to use in coculture with epithelial cells and appropriate maintenance of cells is vital for suitability of coculture models. a central feature of coculture is applicability across a broad range of biological systems in addition to infectious diseases. for infection studies cocultures are essential to replicate host responses to foreign molecules, cell signalling molecules, and microbial antigens. increased use of coculture models in the future will be necessary to discover new and more accurate in vitro synergies to unlock the complexity of in vivo biology. these models will eventually provide a more complete range of in vitro tools for experimentation, formulating the basis for translational studies with downstream clinical applications. | countless in vitro cell culture models based on the use of epithelial cell types of single lineages have been characterized and have provided insight into the mechanisms of infection for various microbial pathogens. diverse culture models based on disease - relevant mucosal epithelial cell types derived from gastrointestinal, genitourinary, and pulmonary organ systems have delineated many key host - pathogen interactions that underlie viral, parasitic, and bacterial disease pathogenesis. an alternative to single lineage epithelial cell monoculture, which offers more flexibility and can overcome some of the limitations of epithelial cell culture models based on only single cell types, is coculture of epithelial cells with other host cell types. various coculture models have been described, which incorporate epithelial cell types in culture combination with a wide range of other cell types including neutrophils, eosinophils, monocytes, and lymphocytes. this paper will summarize current models of epithelial cell coculture and will discuss the benefits and limitations of epithelial cell coculture for studying host - pathogen dynamics in infectious diseases. |
p values were obtained using the t test for numerical data and chi - square test for categorical data. the results are presented with a 95% confidence interval and a p - value of < 0.05 was considered as statistically significant. all statistical analyses were performed using microsoft excel (version 14.2.5, microsoft, redmond, washington, usa) software. one hundred twenty patients participated in this study and 26 (21.6%) had clinical evidence of an incisional hernia. no significant differences were found between those that had a hernia and the rest of the study population. moreover, there was no significant difference in incidence of incisional hernias between patients with a benign compared to those with a neoplastic condition. the 26 incisional hernias were categorized as midline (n = 18), lateral (n = 5) or midline and lateral (n = 3) using the classification of incisional hernias suggested by the european hernia society. length (cm) and width (cm) were recorded for all hernias. the irreducible hernias were large incisional hernias of more than 10 cm in width or length. baseline and clinical characteristics of the entire study population at the time of index surgery are shown in table 1. baseline and clinical characteristics of study population at the time of index surgery eight of the 26 patients (30.8%) were not aware that they had an incisional hernia. these patients were significantly older (p = 0.003) and had smaller hernias (p = 0.04 ; table 2). an additional 10 patients while aware of a lump recorded no symptoms from their hernia. eight (30.8%) were symptomatic ; symptoms reported were pain (n = 6), discomfort (n = 7), cosmetic complaints (n = 3), and functional disability (n = 4 ; table 3). only 1 patient expressed discomfort as a sole complaint. this patient had undergone 14 operations over 10 years and had a large incisional hernia measuring 25 cm by length and 20 cm by width. patients with a symptomatic hernia were significantly more likely to have an irreducible hernia (table 4). characteristics of patients aware and not aware of an incisional hernia characterization of complaints reported by the symptomatic patients characteristics of symptomatic and asymptomatic patients with an incisional hernia patients with clinical evidence of an incisional hernia have been followed up for a minimum of 2 years. none of the asymptomatic patients have had an operation while 3 (37.5%) of the symptomatic patients went on to have an incisional hernia repair ; the first complained of discomfort and poor cosmetic appearance, the second had pain and discomfort, while the third complained of pain, discomfort, and poor cosmetic appearance. eight of the 26 patients (30.8%) were not aware that they had an incisional hernia. these patients were significantly older (p = 0.003) and had smaller hernias (p = 0.04 ; table 2). an additional 10 patients while aware of a lump recorded no symptoms from their hernia. eight (30.8%) were symptomatic ; symptoms reported were pain (n = 6), discomfort (n = 7), cosmetic complaints (n = 3), and functional disability (n = 4 ; table 3). only 1 patient expressed discomfort as a sole complaint. this patient had undergone 14 operations over 10 years and had a large incisional hernia measuring 25 cm by length and 20 cm by width. patients with a symptomatic hernia were significantly more likely to have an irreducible hernia (table 4). characteristics of patients aware and not aware of an incisional hernia characterization of complaints reported by the symptomatic patients characteristics of symptomatic and asymptomatic patients with an incisional hernia patients with clinical evidence of an incisional hernia have been followed up for a minimum of 2 years. none of the asymptomatic patients have had an operation while 3 (37.5%) of the symptomatic patients went on to have an incisional hernia repair ; the first complained of discomfort and poor cosmetic appearance, the second had pain and discomfort, while the third complained of pain, discomfort, and poor cosmetic appearance. this study demonstrates that up to one third of patients may not be aware that they have an incisional hernia. only half of the patients aware of a hernia were symptomatic. at 2 years or longer follow - up, none of the asymptomatic patients had undergone an operation whereas 37.5 % of the symptomatic patients went on to have an incisional hernia repair. incisional hernias may also affect patient - centered outcomes such as body image and functional status. van ramshorst demonstrated that patients with an incisional hernia had lower mean scores on physical components of health related quality of life and body image. however, the fact that these patients were significantly older and had a significantly higher bmi compared to patients without an incisional hernia may have accounted for these differences. results from their study showed that 84% of the patients with an incisional hernia were symptomatic. furthermore, 68% reported complaints, which is a relatively high proportion compared to similar studies by hesselink and pollock and evans who found that complaints were reported in 53% and 12% of patients, respectively. incisional hernia repair is a common surgical procedure, but remains a challenge for the surgeon due to relatively poor postoperative outcomes. in a nationwide prospective study from denmark, both elective open and laparoscopic repairs were associated with high rates of readmission and reoperation for recurrent incisional hernias. poor early outcomes post - repair were linked to advanced age, open repair, large hernia defect, and vertical incision at the primary surgery. burger have showed that mesh repair is associated with significantly lower rates of recurrence and discomfort postoperatively compared to suture repair. however, the 10-year cumulative recurrence rate was still high for both techniques with 63% for suture repair and 32% for mesh repair. additionally, the complication rate after long - term follow up was 17% in the mesh - repair group versus 8% in the suture - repair group. complications associated with mesh repair, included small bowel obstruction, mesh infection, and enterocutaneous fistula. the study concluded that it is important to justify repair for patients with an incisional hernia to avoid unnecessary surgery. a recent study by lauscher and colleagues assessing benefits of incisional hernia repair for symptomatic patients and those with minimal symptoms concluded that high recurrence rates (13.3% at 18 months) and chronic pain cast doubts on the value of repair in the latter group of patients. it has been our routine practice not to recommend operation for patients with asymptomatic or minimally symptomatic incisional hernias. all patients undergoing cancer surgery, mostly for colorectal cancer or retroperitoneal sarcomas, are followed for life. while we are confident that around 1 in 5 of these will have developed an incisional hernia, to the best of our knowledge we are not aware of anyone from this group with an asymptomatic or minimally symptomatic hernia requiring an operation over this period. this, however, has to be interpreted with caution as up to 20% of patients will be lost to clinical follow - up. moreover the patients main concern is more likely to reside with being disease free from their cancer rather than whether they have an incisional hernia. one of the main strengths of our study was that multiple outcomes such as awareness and symptoms have been investigated. the main limitation of the study is the small sample size of the study population. another limitation is the lack of a standard quality of life assessment such as sf-36 or carolinas comfort scale (ccs). this, however, would only be of value if measured in all patients with or without an incisional hernia. in addition, any comparison between such groups would suffer from other differences that emerge from nonrandomized groups of patients. in the past, randomized controlled trials have suggested that watchful waiting is a viable option for inguinal hernias. similar prospective randomized studies with long follow - up evaluations for incisional hernias are necessary to compare outcomes of watchful waiting versus surgery for minimally symptomatic patients with incisional hernias. more reports on the natural course are also required in order to evaluate and modify the risk factors associated with incisional hernias. | incisional hernia is a common postoperative complication following open abdominal surgery with incidence varying between 3% and 20%.1 approximately half of all incisional hernias are diagnosed within 1 year following surgery. in the united kingdom alone, about 10,000 incisional hernia repairs are performed annually. incisional hernia repairs are generally elective with emergency repair due to incarceration or strangulation constituting about 15% of repairs.1 incisional hernia repair is not a low - risk operation and generally has relatively poor results due to chronic postoperative pain and high recurrence rates.23 little has been published on patients ' awareness of incisional hernia following open abdominal surgery. moreover, there are very few publications on indications for incisional hernia repair and on the natural course of such hernias. the literature suggests that symptoms and complaints usually presented by patients include pain, discomfort, cosmetic complaints, skin problems, incarceration, strangulation, functional disability, and pulmonary dysfunction.46 the aim of this study was to investigate whether patients were aware that they had a hernia. in addition, we sought to determine symptoms for those who knew that they had an incisional hernia. |
hyperbaric oxygen therapy (hbot) is the administration of high concentrations of oxygen within a pressurized chamber. hbot has become the definitive therapy for patients with decompression illness, gas embolism, and severe acute carbon monoxide poisoning. it is now widely accepted in treatment of osteoradionecrosis, soft tissue radionecrosis and delayed wound healing. however, the role of hbot in the treatment of patients with brain injuries is controversial. brain injury can be caused by an external physical force (traumatic brain injury, or tbi) with rapid acceleration or deceleration of the head and bleeding within or around the brain leading to cerebral hypoxia and passage of toxic substances through the blood brain barrier. these result in a temporary or permanent impairment of cognitive, emotional, and/or physical functioning. for brain injury the use of various diagnostic and therapeutic interventions, viz, prehospital intubation, intracranial pressure (icp) monitoring, icp - directed therapy, and brain computed tomography scan utilization vary considerably among different centers. such variation signifies a lack of consensus on clinical effectiveness. predicting the outcome of pediatric brain injury is difficult. prognostic instruments, such as the glasgow coma scale (gcs) for brain injury, are not precise enough to reliably predict an individual patient 's mortality and long - term functional status in pediatric patients. the purpose of this article is to provide a guide to the strengths and limitations of hbot in treating children with brain injury. we studied a total of 54 patients of head injury. out of them 28 received hbot (study group, n = 28). only cases with severe head injury (gcs < 8) with no other associated injury were included in the study group. after an initial period of resuscitation and conservative management (10 days), all were subjected to three sessions of hbot at 1-week interval each. this study group was compared with a matched control group of similar severity of head injury (gcs < 8) selected by randomization. hbot is the inhalation of 100% oxygen inside a hyperbaric chamber pressurized to greater than 1 atmosphere (atm). hbot causes both mechanical and physiologic effects by inducing a state of increased pressure and hyperoxia. hyperbaric oxygen pressure is expressed in multiples of atmospheric pressure at sea level, where 1 atm is about 760 mm hg or 1 kg / cm. the oxygen dissolved in blood at 1 atm (sea level) in room air is 0.3 ml / dl, and this is in addition to hemoglobin - bound oxygen. inhalation of 100% oxygen at 1 atm increases blood oxygenation to 1.5 ml / dl. increasing the pressure to 3 atm increases the blood oxygen (dissolved oxygen, not carried by hemoglobin) to 6 ml / dl. at rest and with good perfusion, tissues require 56 ml / dl of oxygen, whether from dissolved or hemoglobin - bound oxygen. hence, in situations where hemoglobin - bound oxygen is limited (e.g., carbon monoxide poisoning), tissue oxygen needs can be met in this manner. in addition, the increased pressure reduces the volume of gases in the blood by virtue of boyle 's law (in an enclosed space, the volume of a gas is inversely proportionate to the pressure exerted upon it). this very mechanism is relied upon in decompression illness and arterial gas embolism to reduce the size of the gas bubbles and allow replacement of inert gas in the bubbles with oxygen, which can be metabolized by tissues. the monoplace chamber, which we used in our study, serves one patient at a time. the initial cost of setup is less but it provides limited opportunity for patient intervention while in the chamber. these chambers are generally constructed of acrylic or with view ports that allow for patient observation. each patient is given 100% oxygen through a facemask, tight - fitting hood or endotracheal tube. the entire multiplace chamber is pressurized with air, so medical personnel may require a controlled decompression, depending on the duration of exposure to the hyperbaric environment. the duration of an hbot session in common practice is about 90120 minutes, however, the duration, frequency, and cumulative number of sessions have not been standardized. the dose received by the patient may be affected by the type of chamber used. monoplace chambers using face masks or hoods that do not fit snugly may result in dilution of 100% oxygen with room air. the study and the control groups were compared on various clinical, social and functional parameters where study group (receiving hbot) showed distinct advantage over the control group [table 1 ]. comparison of study and control groups on various parameters on contrasting the gcs of both the groups ; observed at the time of admission, after 10 days of conservative management and then at 1-week interval, it was quite evident that patients who recieved hbot showed marked improvement as compared to the study group [figure 1 ]. comparison of improvement in glasgow coma scale in study group (with hyperbaric oxygen therapy) and control group each year, approximately 1.5 million indians sustain traumatic brain injuries, ranging in severity from mild to fatal. the oldest formal scale, the glasgow outcome scale, categorizes patients into five broad categories : good recovery, moderate disability, severe disability, persistent vegetative state, and death. this measure, although convenient and widely used, is insensitive to many cognitive and emotional deficits which strongly affect the quality of life. since the 1970s, the gcs which ranges from 3 to 15 has been the most widely used measure of the severity of an acute brain injury. a gcs between 35 indicates serious injury with grave outcome, while gcs between 13 and 15 represents mild injury with the best prognosis. severe injury is often defined as a gcs score of 8 or less indicating a mortality rate of 50% and high likelihood of suffering from severe long - term disabilities.[811 ] in addition to gcs, factors such as age, associated injuries, intracranial hypertension, and the presence of mass effect are also predictors of mortality and severe disability.[1218 ] preinjury productivity and education also help in predicting the functional outcome in survivors. hypoxia (pao2 less than 60 mm hg, or apnea or cyanosis) and hypotension (systolic blood pressure less than 90 mm hg) are also strong predictors of death and severe disability.[172123 ] in acute tbi, hypoxia and hypotension are independently associated with increased mortality and morbidity. thus, secondary ischemia and oxygen deficiency are thought to be important mechanisms of cell death in tbi. aggressive management of trauma significantly reduces the hypoxic and ischemic episodes, but does not eliminate it. for this reason, there is renewed interest in finding more effective strategies for ensuring adequate oxygenation and redistributing cerebral blood flow (cbf) to injured areas of the brain. the metabolic effects of brain injury are not easily demonstrated and are by no means fully understood. immediately after a brain injury, brain cells can be inactivated temporarily by ischemia and edema which compromise local perfusion. this observation forms part of the rationale for the use of hbot, which increases blood flow to the damaged areas of the brain, as documented by serial single photon emission computed tomography (spect) scans and other techniques.[2528 ] in some experimental models of acute cerebral ischemia and acute carbon monoxide poisoning, hbot prevents cell death. the mechanism is unclear, but effects of oxygen on the cellular and inflammatory response to injury are considered important. recently, in a rat model of focal cerebral ischemia, hbot reduced brain leukocyte myeloperoxidase (mpo) activity, which is produced by white blood cells (polymorphonuclear neutrophils) and is a marker of the degree of inflammation. rats randomized to hbot had reduced infarct size and improved neurological outcomes compared with untreated rats, and the degree of neurologic damage was highly correlated with the level of mpo activity. in a separate model of cardiac arrest and resuscitation, the same investigators found that dogs treated with hbot had better neurological outcomes and, histologically, fewer dying neurons than dogs treated conventionally. the magnitude of neuronal injury correlated well with the neurological outcomes, but was not related to cerebral oxygen delivery or to the rate of oxygen metabolism. another recent study showed that early hbot increases cerebral adenosine 5-triphosphate (atp) production in rats following lateral fluid - percussion injury, offering strong mechanistic support for an o2 delivery hypothesis in tbi. it has also been reported that perilesional neurons have increased vulnerability to mitochondrial impairment, and attempts to augment regional cbf and oxygenation of this tissue may be very beneficial. tolias. reported that early and prolonged hyperoxia improved tbi, which was evident by improvements in microdialysate indices of brain oxidative metabolism and decrease in icp. sarah rockswold and coworkers noted that in severely brain injured patients the cerebral metabolic rate of oxygen (crmo2) is typically reduced by up to 50% and only 45% of patients exhibited normal coupling of cbf and crmo2. in addition to decreased cerebral metabolism, most patients with severe brain injury have increased lactate production. the authors concluded that increased crmo2 and decreased csf lactate levels after hbo treatment indicate a shift toward aerobic metabolism in severely brain injured patients, especially in those with reduced cbf or with ischemia. they also found that hbot promotes blood brain barrier integrity, reducing cerebral edema and hyperemia, which in turn helps to lower elevated icp. the authors also recommended shorter and more frequent hbot sessions to sustain the beneficial effects and avoid elevations in the icp. many brain - injured patients progress spontaneously from coma to consciousness and eventually recover some of the cognitive functions. this phenomenon of spontaneous recovery from brain injury implies that some brain cells that have lost function can regain it, sometimes after long periods of time. several theories of recovery after injury in the central nervous system invoke the concept of temporary, reversible inactivity of brain tissue to explain this phenomenon. the use of hbot for chronic brain injury is based on the theory that, in any brain injury, there are inactive cells that have the potential to recover. according to this theory, these idling neurons exist in the ischemic penumbra, a transition area of dormant neurons between areas of dead tissue and the unaffected healthy tissue.[28293638 ] the oxygen availability to these cells stimulates the cells to function normally, reactivating them metabolically or electrically. in contrast with the cognitive stimulation theory, the idling neuron theory views neuron inactivity denervation as the result of chronic hypoxia and postulates that restoring oxygen stimulates the growth of blood vessels and of new synaptic connections among previously dormant neurons. supporters of the use of hbot in brain injury argue that this theory has a stronger experimental base than the theory underlying restorative cognitive therapies. in contrast to the theoretical effects of cognitive stimulation, the effects of the proposed treatment pressurized oxygen can be observed directly in animal models. as noted above, animal studies have examined hbot 's effects on physiologic and anatomic endpoints, including neuronal death, infarct size, and, in some models, development or preservation of synapses. the physiologic effects of hyperbaric oxygen have also been examined in before - after treatment case studies in humans using spect imaging and markers of cerebral metabolism. adverse events can occur during compression, treatment, and decompression and are related to the increased pressure and the increased oxygen concentration. complications such as pulmonary barotrauma or seizures can occur immediately, but more subtle adverse effects may emerge after a series of treatments. the findings of a recent study of hbot for acute carbon monoxide poisoning (not covered in this report) raise concerns over worse cognitive outcomes in patients receiving hbot compared with normobaric oxygen. in acute tbi, hypoxia and hypotension are independently associated with increased mortality and morbidity. thus, secondary ischemia and oxygen deficiency are thought to be important mechanisms of cell death in tbi. aggressive management of trauma significantly reduces the hypoxic and ischemic episodes, but does not eliminate it. for this reason, there is renewed interest in finding more effective strategies for ensuring adequate oxygenation and redistributing cerebral blood flow (cbf) to injured areas of the brain. the metabolic effects of brain injury are not easily demonstrated and are by no means fully understood. immediately after a brain injury, brain cells can be inactivated temporarily by ischemia and edema which compromise local perfusion. this observation forms part of the rationale for the use of hbot, which increases blood flow to the damaged areas of the brain, as documented by serial single photon emission computed tomography (spect) scans and other techniques.[2528 ] in some experimental models of acute cerebral ischemia and acute carbon monoxide poisoning, hbot prevents cell death. the mechanism is unclear, but effects of oxygen on the cellular and inflammatory response to injury are considered important. recently, in a rat model of focal cerebral ischemia, hbot reduced brain leukocyte myeloperoxidase (mpo) activity, which is produced by white blood cells (polymorphonuclear neutrophils) and is a marker of the degree of inflammation. rats randomized to hbot had reduced infarct size and improved neurological outcomes compared with untreated rats, and the degree of neurologic damage was highly correlated with the level of mpo activity. in a separate model of cardiac arrest and resuscitation, the same investigators found that dogs treated with hbot had better neurological outcomes and, histologically, fewer dying neurons than dogs treated conventionally. the magnitude of neuronal injury correlated well with the neurological outcomes, but was not related to cerebral oxygen delivery or to the rate of oxygen metabolism. another recent study showed that early hbot increases cerebral adenosine 5-triphosphate (atp) production in rats following lateral fluid - percussion injury, offering strong mechanistic support for an o2 delivery hypothesis in tbi. it has also been reported that perilesional neurons have increased vulnerability to mitochondrial impairment, and attempts to augment regional cbf and oxygenation of this tissue may be very beneficial. tolias. reported that early and prolonged hyperoxia improved tbi, which was evident by improvements in microdialysate indices of brain oxidative metabolism and decrease in icp. sarah rockswold and coworkers noted that in severely brain injured patients the cerebral metabolic rate of oxygen (crmo2) is typically reduced by up to 50% and only 45% of patients exhibited normal coupling of cbf and crmo2. in addition to decreased cerebral metabolism, most patients with severe brain injury have increased lactate production. the authors concluded that increased crmo2 and decreased csf lactate levels after hbo treatment indicate a shift toward aerobic metabolism in severely brain injured patients, especially in those with reduced cbf or with ischemia. they also found that hbot promotes blood brain barrier integrity, reducing cerebral edema and hyperemia, which in turn helps to lower elevated icp. the authors also recommended shorter and more frequent hbot sessions to sustain the beneficial effects and avoid elevations in the icp. many brain - injured patients progress spontaneously from coma to consciousness and eventually recover some of the cognitive functions. this phenomenon of spontaneous recovery from brain injury implies that some brain cells that have lost function can regain it, sometimes after long periods of time. several theories of recovery after injury in the central nervous system invoke the concept of temporary, reversible inactivity of brain tissue to explain this phenomenon. the use of hbot for chronic brain injury is based on the theory that, in any brain injury, there are inactive cells that have the potential to recover. according to this theory, these idling neurons exist in the ischemic penumbra, a transition area of dormant neurons between areas of dead tissue and the unaffected healthy tissue.[28293638 ] the oxygen availability to these cells stimulates the cells to function normally, reactivating them metabolically or electrically. in contrast with the cognitive stimulation theory, the idling neuron theory views neuron inactivity denervation as the result of chronic hypoxia and postulates that restoring oxygen stimulates the growth of blood vessels and of new synaptic connections among previously dormant neurons. supporters of the use of hbot in brain injury argue that this theory has a stronger experimental base than the theory underlying restorative cognitive therapies. in contrast to the theoretical effects of cognitive stimulation, the effects of the proposed treatment pressurized oxygen can be observed directly in animal models. as noted above, animal studies have examined hbot 's effects on physiologic and anatomic endpoints, including neuronal death, infarct size, and, in some models, development or preservation of synapses. the physiologic effects of hyperbaric oxygen have also been examined in before - after treatment case studies in humans using spect imaging and markers of cerebral metabolism. adverse events can occur during compression, treatment, and decompression and are related to the increased pressure and the increased oxygen concentration. complications such as pulmonary barotrauma or seizures can occur immediately, but more subtle adverse effects may emerge after a series of treatments. the findings of a recent study of hbot for acute carbon monoxide poisoning (not covered in this report) raise concerns over worse cognitive outcomes in patients receiving hbot compared with normobaric oxygen. in children with tbi, the addition of hbot significantly improved outcome and quality of life and reduced the risk of complications. hbot for brain injury is not likely to gain acceptance in routine clinical use until a clinical method of assessing its effectiveness in the individual patient is validated. specifically, the diagnostic value of spect scans and of other intermediate indicators of the effects of hbot should be examined by large and high - quality studies. a longitudinal cohort study in which all patients undergo proper diagnostic evaluation as well as standardized follow - up tests would be a more prudent and ideal approach. | aim : a brain injury results in a temporary or permanent impairment of cognitive, emotional, and/or physical function. predicting the outcome of pediatric brain injury is difficult. prognostic instruments are not precise enough to reliably predict individual patient 's mortality and long - term functional status. the purpose of this article is to provide a guide to the strengths and limitations of the use of hyperbaric oxygen therapy (hbot) in treating pediatric patients with severe brain injury.materials and methods : we studied total 56 patients of head injury. out of them 28 received hbot. only cases with severe head injury [glasgow coma scale (gcs) < 8 ] with no other associated injury were included in the study group. after an initial period of resuscitation and conservative management (1012 days), all were subjected to three sessions of hbot at 1-week interval. this study group was compared with a control group of similar severity of head injury (gcs < 8).results : the study and control groups were compared in terms of duration of hospitalization, gcs, disability reduction, and social behavior. patients who received hbot were significantly better than the control group on all the parameters with decreased hospital stay, better gcs, and drastic reduction in disability.conclusion:in children with traumatic brain injury, the addition of hbot significantly improved outcome and quality of life and reduced the risk of complications. |
the dpp was a randomized, controlled clinical trial from 1996 to 2001 at 27 sites in the u.s., comparing the effects of intensive lifestyle intervention, metformin, or placebo on the development of diabetes in adults at high risk for the disease. the eligibility criteria, design, and methods of the dpp have been described in detail elsewhere (2). in brief, inclusion criteria included age 25 years, bmi 24 kg / m (22 kg / m in asian americans), fasting plasma glucose between 5.3 and 6.9 mmol / l (95125 mg / dl) (6.9 mmol / l for american indian sites), and plasma glucose between 7.8 and 11 mmol / l (140199 mg / dl) after a 75-g oral glucose tolerance test. the institutional review board at each site approved the protocol, and all participants gave written informed consent. all participants were given standard advice on healthy diet and physical activity before randomization to one of three arms : intensive program of lifestyle modification (aiming to achieve a weight reduction of at least 7% of initial body weight), standard lifestyle recommendations plus metformin, or standard lifestyle recommendations plus placebo (2). the present observational study was conducted among participants randomized to two arms, the intensive lifestyle (n = 1,079) and placebo (standard lifestyle, n = 1,082). the metformin arm was excluded to minimize the cost associated with measurement of 25-hydroxyvitamin d. also, 122 participants were excluded because of lack of consent for ancillary studies (n = 120), or no available specimen for measurement of 25-hydroxyvitamin d at baseline or 6-month follow - up visits (n = 2). after exclusions, 2,039 participants were included in the initial multivariate analyses that included age, sex, and bmi as covariates, and 2,002 participants with complete data for all covariates were included in the additional multivariate analyses. plasma 25-hydroxyvitamin d concentration was measured in samples stored at 70c from the baseline, 6-month, 1-year, 2-year, 3-year, and 4-year follow - up visits. stability of vitamin d metabolites during transport and long - term freezing has been documented previously (25,26). plasma 25-hydroxyvitamin d was measured at the metabolic laboratory at tufts medical center by liquid chromatography, tandem mass spectrometry (lc / ms / ms) (waters acquity uplc with tqd triple quadrupole mass spectrometer), certified through the national institute of standards and technology (nist) vitamin d quality assurance program (27). in the most recent testing, correlation with the nist external standard for total 25-hydroxyvitamin d was 0.994. the primary dpp outcome, development of diabetes, was assessed using strict laboratory criteria, according to the protocol based on oral glucose (75-g) tolerance testing performed annually and fasting plasma glucose performed semiannually or when symptoms consistent with hyperglycemia occurred (2,28). if a participant was started on a diabetes medication by their physician, they were asked to stop the medication and return for glucose testing to confirm the diagnosis of diabetes. the self - reported level of leisure physical activity was assessed annually with the modifiable activity questionnaire and expressed as the average metabolic equivalent (met - hours) per week for the previous year (2). usual daily nutrient intake during the previous year was assessed at baseline and at the 1-year follow - up visits with the use of a modified version of the block food - frequency questionnaire, and calcium intake was estimated as described previously (29). standardized interviewer - administered questionnaires were used annually to obtain self - reported data on personal medical history, smoking, medications, alcohol use, and family medical history. weight was measured using a standard calibrated scale, height was measured with a standard stadiometer, and bmi was calculated (kg / m). measurement methods for hemoglobin a1c, glucose, c - reactive protein, and creatinine have been described previously (2). to adjust for sun exposure variability at each dpp study site, we constructed an ultraviolet index for each site based on the national weather service data on the monthly means of ultraviolet index for each geographic location in 1997 (30). discrete - time proportional hazards models were used to assess the association between plasma 25-hydroxvitamin d (in tertiles) and incident diabetes to account for interval - censored data (data for diabetes status and other variables were available at 6-month intervals) and time - dependent covariates (25-hydroxyvitamin d, bmi, and physical activity). in multivariate models, we adjusted for potential confounders including dpp clinical site location (categorical variable, 127), age (years), sex (male or female), bmi (kg / m), race (white, black, or other), family history of diabetes (yes or no), history of hypertension at baseline (yes or no), smoking status at baseline (never, past, or currently smoking), alcohol and calcium consumption (average of values self - reported at baseline and 1-year follow - up visits [g / day and mg / day, respectively ]), plasma c - reactive protein (average of values at baseline, 6-month, and 1-year follow - up visits [mg / dl ]), glomerular filtration rate using the modification of diet in renal disease estimation (31) (average of values at baseline, 6-month, and 1-year follow - up visits [ml / min/1.73 m ]), and physical activity (met - hours per week). we also adjusted for ultraviolet radiation index at the participant s study site (mean annual in 1997, 90 j / m / h). although adjustment for bmi and physical activity reflect the main effects of the intensive lifestyle intervention, to account for additional unmeasured effects of intervention, all analyses were adjusted for treatment assignment (lifestyle intervention, yes or no). the predictor (25-hydroxyvitamin d) and other variables (bmi and physical activity), whose value was measured at multiple time points, entered the analyses as time - varying lagged covariates. at each successive 6-month time point when the outcome (diabetes) was assessed, the value of these variables was calculated as the mean of the current and most recent available value prior to that visit. for the time - varying variables, if either the current or most recent value was missing, we imputed values using the nonmissing observation (current or most recent). if both current and most recent values were missing, then no value was imputed. plasma 25-hydroxyvitamin d exhibited a normal distribution and entered the multivariate models on a continuous scale. for ease of interpretation, we present results after participants were categorized into three groups using tertiles (33.3rd and 66.7th percentiles) of plasma 25-hydroxyvitamin d concentration, as the mean of the values obtained at baseline and 6-month visits, to account for season differences. the hazard ratio (hr) of diabetes in each of the two highest tertiles was compared with the lowest tertile by extrapolating the per - unit change in estimated hazard from the multivariate model. we repeated analyses using the cut points for plasma 25-hydroxyvitamin d (as the mean of the values obtained at baseline and 6-month visits), recommended for skeletal outcomes by the 2011 iom report, as follows : 30 ng / ml had a lower risk compared with those 0.40) (table 4). risk for incident diabetes by tertiles of plasma 25-hydroxyvitamin d concentration in the lifestyle and placebo arms of the dpp by subgroups at baseline, the average age of the cohort was 51 years and average bmi was 34 kg / m (table 1). the racial distribution was diverse : 57% caucasian and 21% african american, and the remaining participants were hispanic american, asian american or pacific islander, or native american. the mean self - reported calcium intake was 1,106 mg / dl and plasma 25-hydroxyvitamin d concentration was 21.6 ng / ml. based on the 2011 iom report (24), 45% of the cohort had inadequate calcium intake at baseline and approximately half (49%) were at risk for deficiency or inadequacy for vitamin d (defined as 25-hydroxyvitamin d 30 ng / ml had a lower risk compared with those 0.40) (table 4). risk for incident diabetes by tertiles of plasma 25-hydroxyvitamin d concentration in the lifestyle and placebo arms of the dpp by subgroups in this unique cohort of u.s. adults at high risk for diabetes, higher plasma 25-hydroxyvitamin d concentrations, assessed repeatedly during the follow - up period, were associated with lower risk of diabetes, even after adjusting for weight loss and lifestyle interventions (dietary changes and increased physical activity) known to decrease diabetes risk. our results are consistent with those from other observational longitudinal studies that have reported on the association between vitamin d status and risk of developing type 2 diabetes (79,1115,35,36). the association between higher vitamin d levels and lower risk of type 2 diabetes was statistically significant in seven published cohorts (7,9,1113,15,36) and was in the same direction, albeit not statistically significant, in three other cohorts (8,9,35). in one cohort among older postmenopausal women, lower serum 25-hydroxyvitamin d was not associated with increased risk of developing type 2 diabetes (14). our study offers a methodological advantage over previous studies, which assessed vitamin d status (either by self - reported total vitamin d intake, predicted 25-hydroxyvitamin d score, or blood 25-hydroxyvitamin d concentration [9,1214,36 ]) based on a single baseline measurement, which may not reflect long - term vitamin d status. use of repeated measurements and cumulative averages of dietary variables has been shown to yield stronger associations than use of a single baseline measurement (33), and this was the case in our study. the need for repeated measurements is especially true with vitamin d, as single measurements of 25-hydroxyvitamin d may not reflect vitamin d status over time, owing to changes in dietary and other lifestyle changes, weight changes, sun exposure, and other relevant factors that may change during follow - up. measuring 25-hydroxyvitamin d at multiple time points during follow - up allowed us to reduce measurement error and obtain an integrated measure that reflects long - term vitamin d status for each participant, which may be more relevant etiologically than the most remote (baseline) value (33). an alternative explanation of our results may be that plasma 25-hydroxyvitamin d is a marker of the dpp treatment effects from increased physical activity and weight loss ; however, the association remained after we adjusted for the main effects of the dpp intervention (changes in physical activity and weight) during the study period. although the analyses adjusted for these factors, residual confounding can not be excluded. our study has additional strengths, such as the inclusion of a large clinically relevant population at high risk for diabetes with a substantial proportion of nonwhite participants, which improves the external validity of our results because they are directly applicable to people at risk for diabetes who are in need for effective interventions to delay progression to diabetes. also, the diagnosis of diabetes was rigorously evaluated and confirmed based on repeated laboratory measures, which is in contrast with other observational studies that ascertained diabetes by validated self - report (7,8,12,14,35), combination of self - report and laboratory measurement (11), or registry - based data (9,36). furthermore, the method we used to measure 25-hydroxyvitamin d has been validated through the nist vitamin d quality assurance program (27). the results from small clinical trials and post hoc analyses of larger trials on the effect of vitamin d supplementation on glycemia or incident diabetes have been inconsistent (1623,3739). in these studies, vitamin d appears to have beneficial effects only in people at risk for diabetes (17,20,23), which is consistent with the findings of the current study. in contrast, vitamin d supplementation appears to have no effect among those with normal glucose tolerance, or a very small effect that would require a very large sample population to detect (17,18,22,37,39). the studies that have reported on the effect of vitamin d supplementation on glycemia in patients with established type 2 diabetes were underpowered to draw any firm conclusions. the hypothesis that vitamin d may be relevant to prevention of type 2 diabetes is biologically plausible. both insulin resistance and impaired pancreatic -cell function have been reported with vitamin d insufficiency (4). vitamin d may have a direct effect mediated by binding of the active form, 1,25(oh)2d, to the vitamin d receptor expressed in pancreatic -cells. the presence of the vitamin d response element in the human insulin gene promoter and transcriptional activation of the human insulin gene caused by 1,25(oh)2d further support a direct effect of vitamin d on insulin synthesis and secretion. finally, activation of vitamin d may occur within the -cell by 25-ohd-1-hydroxylase (cyp27b1), which is expressed in -cells. although 25-hydroxyvitamin d is a well - established biomarker of exposure for vitamin d due to intake or biosynthesis, there is a lack of clarity regarding the validity of 25-hydroxyvitamin d as a marker of biological effects (24). the 2011 iom dietary reference intakes for calcium and vitamin d report concluded that adequate evidence for setting dietary reference intakes for vitamin d exists only in relation to skeletal outcomes and recommended a 25-hydroxyvitamin d level > 20 ng / ml as sufficient. for nonskeletal outcomes, including diabetes, the iom report concluded that available data are inconclusive and therefore not sufficient for dietary reference intakes development. the report also noted that levels > 30 ng / ml are not consistently associated with increased benefit, whereas a level > 50 ng / ml may be a reason for concern. our results support the hypothesis that higher blood 25-hydroxyvitamin d (> 30 ng / ml) is associated with lower risk of diabetes, and the observed inverse association was linear at all levels of 25-hydroxyvitamin d. although our study included very few participants with very high (50 ng / ml) 25-hydroxyvitamin d levels, potentially limiting interpretation, this group appeared to have the lowest risk of progressing to diabetes, and our modeling of vitamin d levels as a continuous linear variable supports a benefit for this upper tail of the distribution. in subgroup analyses, the inverse associations between plasma 25-hydroxyvitamin d and incident diabetes were consistent, across all subgroups. the association appeared to be stronger among participants randomized to placebo, those older than 50 years, obese people, women, and those with higher calcium intake. it is important to note that the tests for interaction were not statistically significant ; therefore, no firm conclusions can be drawn from these subgroup analyses. of note, the observed inverse association between vitamin d status and incident diabetes did not appear to be affected by race (as a proxy for the altered vitamin d homeostasis in people with dark skin). these data suggest that although there are well - recognized differences in vitamin d metabolism among different race / ethnic groups (40), higher vitamin d status is associated with lower risk of diabetes among all people regardless of skin color. in conclusion, higher vitamin d status, assessed by plasma 25-hydroxyvitamin d concentration measured repeatedly during follow - up, was associated with a lower risk of incident diabetes among people at high risk for the disease. if these results are confirmed in ongoing and planned randomized trials of vitamin d, they will have important public health implications because both of these interventions can be implemented easily and inexpensively to prevent progression of type 2 diabetes among those at high risk. | objectiveto investigate the association between vitamin d status, assessed by plasma 25-hydroxyvitamin d, and risk of incident diabetes.research design and methodsprospective observational study with a mean follow - up of 2.7 years in the diabetes prevention program (dpp), a multicenter trial comparing different strategies for prevention of diabetes in patients with prediabetes. we assessed the association between plasma 25-hydroxyvitamin d, measured repeatedly during follow - up, and incident diabetes in the combined placebo (n = 1,022) and intensive lifestyle (n = 1,017) randomized arms of the dpp. variables measured at multiple study time points (25-hydroxyvitamin d, bmi, and physical activity) entered the analyses as time - varying lagged covariates, as the mean of the previous and current visits at which diabetes status was assessed.resultsafter multivariate adjustment, including for the dpp intervention, participants in the highest tertile of 25-hydroxyvitamin d (median concentration, 30.1 ng / ml) had a hazard ratio of 0.72 (95% ci 0.560.90) for developing diabetes compared with participants in the lowest tertile (median concentration, 12.8 ng / ml). the association was in the same direction in placebo (0.70 ; 0.520.94) versus lifestyle arm (0.80 ; 0.541.17).conclusionshigher plasma 25-hydroxyvitamin d, assessed repeatedly, was associated with lower risk of incident diabetes in high - risk patients, after adjusting for lifestyle interventions (dietary changes, increased physical activity, and weight loss) known to decrease diabetes risk. because of the observational nature of the study, the potential association between vitamin d and diabetes needs to be confirmed in intervention studies. |
empiric antimicrobial therapy of ventilator - associated pneumonia (vap) should possess a high degree of activity against aerobic gram - negative bacilli (gnb). although pseudomonas aeruginosa is not the most common vap pathogen, it is clearly the most virulent gram - negative pathogen. antibiotics with a high degree of p. aeruginosa activity are also effective against other aerobic gnb causing vap, that is, escherichia coli, klebsiella pneumoniae and serratia marcescens. it is as important to know what pathogens should be covered as it is to know which are not. in vap, respiratory secretions are commonly colonized by nosocomial gnb that rarely cause vap, for example, enterobacter species, burkholderia (pseudomonas) cepacia, and sternotropmonas (xanthomonas) maltophilia. in ' early ' vap, streptococcus pneumoniae is a potential pathogen, but in ' late ' vap, gram - positive pathogens are uncommon. many patients with fever, leukocytosis, and pulmonary infiltrates on chest x - ray do not have vap. culture of organisms from respiratory secretions in ventilated patients does not imply a causal relationship to fever, leukocytosis, and pulmonary infiltrates, and is not synonymous or diagnostic of vap [1 - 3 ]. in the critical care unit, ventilated patients are commonly given antibiotics with good gram - negative activity but limited gram - positive activity. for this reason, colonization of respiratory secretions with staphylococcus aureus, either methicillin - susceptible (mssa) or methicillin - resistant (mrsa), is frequent, and the basis of national nosocomial infections surveillance (nnis) vap data. although respiratory secretion colonization with mssa / mrsa is exceedingly common, proven s. aureus vap is uncommon [1 - 3 ]. mssa / mrsa pneumonia is a recognizable clinical syndrome characterized by high fever, cyanosis, and rapid cavitation on chest x - ray 72 hours. recovery of mssa / mrsa from respiratory secretions in ventilated patients with fever / leukocytosis, and infiltrates is not diagnostic of s. aureus vap [1 - 4 ]. besides potent anti - p. aeruginosa activity, the antibiotic selected should have a ' low resistance potential ', that is, resistance not volume / duration related. ' low resistance potential ' antipseudomonal antibiotics, such as cefepime and meropenem, should be used preferentially over ' high resistance potential ' antibiotics, such as ceftazidime and imipenem [5 - 7 ]. combination therapy has been used to increase spectrum, provide synergy, or prevent resistance. given the wide spectrum of available antibiotics, it is rarely necessary to use double drug therapy for increased spectrum. double drug coverage was used when potent gnb antibiotics were limited and combinations were used for potential synergy. possible synergy is not a reason for combination therapy, which may result in increased side effects / interactions. currently, antibiotics for vap have potent p. aeruginosa activity, and synergy is unnecessary. presently, prevention of resistance by combining agents dates from decades past when carbenicillin was combined with gentamicin to prevent the emergence of p. aeruginosa carbenicillin resistance. this exception has been extrapolated / extended into a general concept, which it is not. combination therapy per se does not prevent resistance, and is the exception rather than the rule. if ceftazidime, a ' high resistance potential ' p. aeruginosa antibiotic, is combined with a ' low resistance potential ' antibiotic, for example, amikacin, the high resistance potential of ceftazidime is not diminished / eliminated. the same is true for nearly all other antibiotic combinations using high / low resistance potential antibiotics. if ' low resistance potential ' antibiotic monotherapy is selected for vap, combination therapy provides no additional benefit and needlessly increases antibiotic costs [5 - 7 ]. extensive experience supports carefully selected empiric monotherapy for vap as optimal [9 - 14 ]. de - escalation therapy is a variant of combination therapy, based on the notion that narrowing spectrum after initial empiric broad spectrum therapy, after culture information is reported, decreases resistance. broad spectrum -lactam therapy, for example, ceftriaxone, has been used extensively for decades for pneumococcal pneumonia without resultant ceftriaxone - induced s. pneumoniae resistance. changing to narrower therapy, for example, penicillin after s. pneumoniae is identified, makes little sense and clearly has no effect on resistance. given the clinical difficulties of definitively determining the putative pathogen in vap without lung tissue, narrow spectrum / specific therapy is often based on colonized respiratory secretion cultures, which are often misleading. aeruginosa ' low resistance potential ' mono - therapy eliminates the rationale for de - escalation therapy. as the study by damas and colleagues demonstrates, double drug therapy for vap offers no advantages over monotherapy pharmaco - economic imperatives argue strongly against combination therapy for vap. in an era of limited healthcare resources, double drug therapy initially or for the duration of vap therapy is unnecessary and wasteful. several antibiotics are available for optimal empiric monotherapy of vap, including meropenem, cefepime, piperacillin / tazobactam, levofloxacin, and so on. if clinicians choose wisely, selecting a potent anti - p. aeruginosa agent with a ' low resistance potential ', empiric monotherapy for vap is highly effective with minimal potential for resistance / drug interactions, and is cost effective. gnb = gram - negative bacilli ; mrsa = methicillin - resistant staphylococcus aureus ; mssa = methicillin - susceptible staphylococcus aureus ; vap = ventilator - associated pneumonia. | traditionally, ventilator - associated pneumonia (vap) has been treated either with double drug therapy or with monotherapy. double drug therapy has been used to increase spectrum, for possible synergy, and to decrease the emergence of resistance. vap therapy should be directed primarily against pseudomonas aeruginosa, which also provides aerobic gram - negative coverage, the usual pathogens in vap. the potent anti - p. aeruginosa antibiotics available today have sufficient activity that double drug coverage is unnecessary. double drug therapy does not decrease resistance if a ' high resistance potential ' antibiotic is used in the combination. the study by damas and colleagues in this issue of critical care supports monotherapy for vap. optimal therapy for vap involves selecting a potent anti - p. aeruginosa antibiotic with a ' low resistance potential ' that minimizes drug - drug interactions, minimizes resistance, and is cost effective. monotherapy of vap should be the standard of care. |
here we report awp28, an activity - based probe that can be used to biochemically monitor caspase-1 activation in response to pro - inflammatory stimuli. using awp28 we show that apoptosis is triggered upon bacterial infection in primary murine bone marrow macrophages lacking caspase-1. furthermore we report that upon salmonella infection, inflammasome - mediated caspase-1 activity is required to bypass apoptosis in favor of pro - inflammatory pyroptotic cell death. |
|
intersphincteric resection (isr) to preserve anal sphincter function for low rectal cancer extending into the anal canal was reported by schiessel. in 1994. the feasibility of isr has been demonstrated by surgeons since that time ; it is now technically possible to use isr to remove low rectal cancer with preservation of anal sphincter function with a satisfactory oncologic outcome [2, 3 ]. recently, the clinical outcome of isr as a laparoscopic approach (laparoscopic isr) has been reported, but laparoscopic isr for patients with bulky low rectal cancer remains challenging. particularly for t3 tumors in patients with a narrow pelvis, total mesorectal excision (tme), negative circumferential margin (cfm), and tumor free surgical margin are prerequisites regardless of approach of isr. conversion to open operation in laparoscopic isr may influence prognosis, as is the case in laparoscopic surgery for rectal cancer. we have shown that transanal rectal dissection (tard) performed prior to the abdominal phase of the operation is very useful for an adequate oncologic resection in laparoscopic isr for t3 low rectal cancer in patients with a narrow pelvis. the purpose of this report is to evaluate the safety and feasibility of tard to achieve laparoscopic isr for t3 low rectal cancers in patients with a narrow pelvis. preoperative staging evaluation included digital rectal examination, barium enema, colonofiberscope with biopsy, computed tomography (ct), magnetic resonance imaging (mri), and transanal ultrasound (taus). the patients were excluded when preoperative examination showed the following findings : multiple metastases in distant organs, direct invasion into adjacent organs (clinical t4), involvement of lateral lymph nodes, and invasion into the external anal sphincter or / and levator ani. we studied 20 patients (5 women, 15 men) with a median age of 66 years (range 4277 years) between april 2006 and december 2009. in all patients the tumors were bulky in nature, and narrow pelvic dimensions were expected for laparoscopically assisted pelvic floor dissection on the basis of radiographic findings of barium enema, ct, and mri. preoperative crt was performed in 2 men out of the 20 patients. finally, preoperative tnm staging of the 20 patients was t3 n0 m0 in 8, t3 n1 m0 in 9, t3 n2 m0 in 2, and t3 n3 m1 in one. the patients were observed for a median of 23.6 months (range 12.256.7 months). the operation is performed in the lloyd - davies position. prior to the laparoscopically assisted abdominal phase if taus shows tumor invasion to the external sphincter and/or the levator ani, an abdominoperineal resection (apr) should be chosen as the surgical procedure. the anal canal is exposed with a self - holding retractor (lone star retractor, lone star medical products inc., houston, tx, usa). the distal side at the lower margin of the tumor is then closed with purse - string sutures under direct visualization, followed by irrigation of the anal canal with 5% povidone - iodine. the division of the rectum is then initiated posteriorly at least 2 cm distal to the tumor margin. a circular incision of the rectum is performed by closing the cut end of the rectum with an interrupted suture, and mobilization of the rectum, including the tumor, is continued proximally by exposing the levator ani. invasion of tumor cells on the dissected plane (the external sphincter or / and the levator ani) should be evaluated by microscopic examination of a frozen - section specimen histologically whenever mobilization of the rectum is not easy. if any findings of tumor invasion into the dissected plane are found, the procedure should be immediately converted to abdominoperineal resection (apr). division and mobilization of the rectum, including the mesorectum, is performed until the peritoneal reflection on the anterior side, and up until the sacral promontory beyond the rectosacral ligament, is nearly reached posteriorly. finally, a lap disc mini (hakko group, japan) is adapted to the anal canal to maintain pressure during laparoscopy (figure 1). regarding the laparoscopic procedure, a camera port is inserted in the paraumbilical zone with a trocar, and an operative port in the mid - lower abdominal region, and two additional operative ports in the left and right mc burney 's point are inserted. on routine intra - abdominal exploration, the gauze that is placed on the dissected plane as a landmark can be identified through the peritoneum on the anterior side of the rectum. the sigmoid and descending colon are mobilized completely from the subretroperitoneal fascia to ensure that the subsequent coloanal anastomosis is free of tension. the sigmoid colon and its mesentery are then removed, the lymph nodes around the inferior mesenteric artery are dissected with a harmonic scalpel, and the inferior mesenteric artery is ligated at a high level with an endoclip. it is relatively easy to dissect denonvillier 's fascia and expose the seminal vesicles and prostate gland or the posterior wall of the vagina on the anterior side and to mobilize the lower rectum and mesorectum from the sacrum on the separated plane between the visceral and parietal endopelvic fascia through the anus. the lateral ligaments of the rectum are gradually divided with a harmonic scalpel from the inner limit of the inferior hypogastric nerve fibers, and the rectum, including the total mesorectum, is completely removed from the pelvic floor. the colon and rectum are pulled out of the umbilical wound and are resected. the diverting ileostomy is reversed three to six months after surgery (figure 2). sphincter function was evaluated clinically in 3, 6, and 12 months after stoma closure. the patients were questioned about frequency of bowel movements, ability to defer defecation for 15 minutes (urgency), and satisfaction of defecation status using visual analogue scale (vas). continence status was determined according to the classification of wexner incontinence score (wis). the numbers of patients undergoing partial, subtotal, and total isr were 15, 1, and 4, respectively. the median duration of tard procedure was 83 min (range 43135 min) and was longer in males than in females (81 min versus 89 min). although there were no major complications perioperatively or postoperatively, anastomotic stenosis in two male patients, bowel obstruction in one male patient, and pelvic abscess formation in one female patient occurred postoperatively. morphologically, the median maximum tumor size was 42 mm (1575 mm), and the median circumferential rate of tumor was 66% (27.790.0%). the average distance from the rectal stump was 16 mm (range 740 mm), and circumferential and distal margins were histologically free of tumor cells in all patients. pathological response grading following preoperative crt performed for two patients was grade 2 and grade 1b, respectively. finally, postoperative pathological staging was ypt2n0m0 in one, ypt3n0m0 in one, pt2n0m0 in 4, pt2n1m0 in 2, pt3n0m0 in 7, pt3n1m0 in 2, pt3n2m0 in 2, and pt3n2m1 in one patient. distant organ metastasis developed in 2 patients, but there was no local recurrence. eighteen out of 20 patients received stoma closure excluding one with distant metastasis and one who did not want stoma closure. in this study sphincter function was investigated for twelve out of 18 patients in 3, 6, and 12 months after stoma closure. half ten patients, experienced nine and more bowel movements a day, 8 (80%) complained urgency, and 8 (80%) reported five or less vas in three months after stoma closure. in twelve months after stoma closure, the rate of the patients who experienced nine and more bowel movements a day and reported five or less vas decreased to 20% and 17%, respectively, but nine (75%) complained urgency. regarding continence status, the rate of the patients answered ten and more wis in three months and twelve months after stoma closure were 50% and 33%, respectively (table 2). isr has been shown to preserve anal sphincter function and provide an adequate oncologic resection for low rectal cancers since schiessel 's first report in 1994. the pooled rate of local recurrence was 031%, with an average 5-year survival of 81.5%, in an evaluation of the experience of 13 centers and 612 patients by tilney and tekkis. recently, clinical outcomes of isr as a laparoscopic approach have been reported, but laparoscopic isr for bulky low rectal cancer is challenging, especially for t3 low rectal cancer in patients with a narrow pelvis. laurent. made a comparison between 110 patients undergoing the laparoscopic approach and 65 patients undergoing an open approach and reported a satisfactory outcome of laparoscopic isr, with a 5-year disease - free survival of 70% and a 5-year local recurrence of 5%. fujimoto. also noted the advantages of laparoscopic isr in their evaluation of 35 patients with low rectal cancer. however, in these reports the influence of narrow pelvic dimensions on outcomes of laparoscopic isr was not described. also, akasu. reported that local control for t3 tumors was difficult as compared with t1-t2 tumors. in our study, only patients with t3 low rectal cancer and a narrow pelvis were included in the analysis. with consideration of a good oncologic outcome with a low recurrence rate after surgery for t3 low rectal cancer, some prerequisites are necessary regardless of the isr approach : tme, negative cfm, and tumor - free surgical margins. in most prior studies, pathological tnm stage and t stage in addition, akasu. reported that the resection margin, focal differentiation, and serum ca 19 - 9 level were important risk factors of local recurrence in an evaluation of 120 patients with very low rectal cancer including 46 patients with stage iii disease. in this study, preoperative radiographic examination demonstrated bulky tumor occupying the pelvis in all patients. although preoperative crt in order to decrease the volume of tumor and prevent local recurrence was performed only for two patients secondary to preference, the resection margin including the radial margin was histologically free of tumor in all patients including patients without preoperative crt. conversion to open operation impacted significantly on overall survival except when considering long - term disease - free survival with laparoscopic surgery for colorectal cancer. this subject deserves more than a passing notice, and conversion to open operation should be avoided to prevent local recurrence in laparoscopic isr as well. in general, the following risk factors for conversion to open operation from traditional laparoscopic surgery for rectal cancer were reported : obesity, bulky tumor, and bony pelvis. in laparoscopic isr, these factors may make laparoscopically assisted pelvic dissection even more challenging because these factors further confine the surgical field, hindering visualization and retraction in a deep and narrow pelvis. reported a direct correlation between increasing body mass index and higher conversion rates for laparoscopic colorectal surgery. laparoscopic isr without conversion to open operation was achieved for all patients, with a median body mass index of 25.3 kg / m and a median tumor circumferential rate of 66%. in general, transanal manipulation for dissection of the tumor from the levator ani and external sphincter is performed after the abdominal phase of isr, including the procedure described by schiesel. on the other hand, teramoto. and watanabe. introduced per anum intersphincteric rectal dissection with direct coloanal anastomosis (pidca), a surgical technique for low rectal cancer performed before the abdominal phase. however, long - term outcomes with local recurrence at 31% were not satisfactory, the reasons for which are unclear. although uchikoshi. reported good clinical results with laparoscopic isr combined with transanal manipulation prior to the abdominal phase for two patients with t2 very low rectal cancer and total colectomy for two patients with ulcerative colitis complicated by t1 colorectal cancer ; feasibility for t3 low rectal cancer could not be evaluated due to the small number of patients. we also consider that tard as the transanal procedure performed prior to the laparoscopically assisted abdominal phase is very useful to achieve a good oncologic result with a low local recurrence, when performed with laparoscopic isr for bulky low rectal cancer, especially t3 low rectal cancer in patients with a narrow pelvis. in fact, we experienced neither major complication nor conversion to open operation in this study. for t3 tumors, a high local recurrence rate in patients without radiotherapy was reported by tekkis., but there was no local recurrence in selective patients with a narrow pelvis. however, this study was retrospective and limited by a short postoperative observation period (median 23.6 months). in addition, tard was able to dissect with adequate radial margins around the tumor under direct vision even if the tumor invaded near the levator ani and was considered to be effective for a good oncologic outcome. in this study, preoperative crt decreased the volume of the primary tumor in one patient allowing for laparoscopic isr. however, the other patient had grade 1b cancer, and preoperative crt was not considered to be effective for laparoscopically assisted pelvic floor dissection. while some researchers have reported a good correlation between the volume reduction rate of primary tumor and pathologic tumor response of preoperative crt [18, 19 ], complete pathological response rate was reported to be only from 7% to 34.7% [2022 ]. for some of the nonresponders, a histological reaction (fibrosis and/or edema) may have occurred in the rectum itself, and adjacent organs may have made pelvic dissection around the tumor more difficult. sphincter function after isr impacts on quality of life of patients significantly. in this study, sphincter function was investigated for limited patients in 3, 6, and 12 months after stoma closure. frequency of bowel movements and wis improved gradually, but the fact that 75% of the patients complained urgency in 12 months after stoma closure can hardly be ignored. although preoperative radiation therapy, volume of resected internal sphincter muscle, or gender was reported as poor risk factors of sphincteric dysfunction, these results could not be explained by these factors in this study [2326 ]. in conclusion laparoscopic isr will be widely adopted as an acceptable procedure to preserve anal sphincter function for low rectal cancer extending to the anal canal. laparoscopic isr combined with tard is technically possible for selective t3 low bulky rectal cancer, and a satisfactory clinical outcome was achieved in this series. | purpose. the purpose of this study was to analyze the safety and feasibility of laparoscopic intersphincteric resection (isr) combined with transanal rectal dissection (tard) for t3 low rectal cancer in a narrow pelvis. methods. we studied 20 patients with a narrow pelvis of median body mass index 25.3 (16.931.2). median observation period was 23.6 months (range 12.256.7). results. partial, subtotal, and total isr was performed in 15, 1, and 4 patients, respectively. median duration of tard was 83 min (range 43135). there were no major complications perioperatively or postoperatively. surgical margins were histologically free of tumor cells in all patients, and there was no local recurrence. excluding urgency, frequency of bowel movements, and incontinence status improved gradually after stoma closure. conclusion. laparoscopic isr combined with tard is technically feasible for selective t3 low rectal cancer in patients with a narrow pelvis. |
all procedures involving animal handling and treatment were approved by the committee for animal use and care of the agricultural ministerial department of mecklenburg - vorpommern, germany. altogether, 12 landrace gilts (9 months old, with mean body weights of 138 kg) were included in the trial. estrus was synchronized in all gilts by 15 days of feeding with regumate (16 mg altrenogest / day / gilt ; msd animal health, unterschleissheim, germany). twenty - four hours after the last regumate feeding (0800 h), each animal received a single intramuscular injection of 850 iu equine chorionic gonadotropin (ecg ; pregmagon, idt biologika, dessau - tornau, germany). ovulation was induced 80 h later by administration of 500 iu human chorionic gonadotropin (hcg ; ovogest, msd animal health, unterschleissheim, germany). laparoscopic intrauterine insemination (liui) into each uterine horn was performed with 20 ml of extended, fresh boar semen (29.510 spermatozoa / ml ; motility 80% ; extender : androstar plus, minitb, tiefenbach, germany). semen was collected from the same proven ai pietrain boar (ai station bvn, malchin, germany)., general anaesthesia in gilts was induced with ketamine (17.25 mg / kg bw, ursotamin, serumwerk dessau, germany) and azaperone (1.2 mg / kg bw, stresnil, elanco animal health, bad homburg, germany) and animals were fixed in a dorsal position. a pneumoperitoneum with co2 was automatically produced (endo tech, munich, germany). thereafter, three trocar cannulas (karl storz, tuttlingen, germany) were inserted into the abdomen for 0 optics (etb, berlin, germany) and grasping forceps (neomed, gutach / bleibach, germany). all laparoscopic handling was observed on a video monitoring system (neomed, gutach / bleibach, germany). for insemination, the uterine horn was carefully fixed with atraumatic forceps, and the uterine wall was punctured approximately 10 cm caudal to the uterotubal junction with a trocar that was 2.5 mm in diameter. under visual control, a 2.2 mm catheter (rsch feeding tube, w. rsch ag, kernen, germany) connected to a 20 ml syringe was inserted through the trocar cannula about 3 cm into the uterine lumen in the direction towards the tip of the uterine horn, and then semen was deposited. liui was performed at three different time points of the estrus cycle, i.e., in the peri - ovulatory (peri ; 31 h post hcg, n=4 gilts) or postovulatory period (post ; 79 h post hcg, n=4) or at mid cycle (mid ; day 9 of the estrus cycle, n=4). seven hours after liui, gilts were subjected to ovariohysterectomy, and the oviducts (n=24) were dissected into three segments : the caudal isthmus and uterotubal junction (utj), cranial isthmus (isth) and ampulla (amp). each section was flushed with 10 ml pbs containing 1.78 mm edta (sigma - aldrich, st. louis, mo, usa). flushed fluids were centrifuged twice at 500 g (for 10 and for 7 min). supernatants were removed, and the volume of sperm pellets was measured with a pipette. from each sample, smears were stained according to the method of eovsk and the total number of spermatozoa was counted from stained smears of each 10 l sample. the total sperm cell number per flushing was determined based on this number and the volume of the sperm pellet, respectively. sperm cell morphology (intact and acrosome and tail aberrations) and acrosome integrity were evaluated by analyzing at least 200 spermatozoa. two replications with six gilts each were performed. calculation of means and standard deviations, as well as of median values and 25th and 75th percentiles was carried out using the software package sigmaplot 11.0 (systat software, san jose, ca, usa). one - way anova followed by tukey s test was used to compare the results. all procedures involving animal handling and treatment were approved by the committee for animal use and care of the agricultural ministerial department of mecklenburg - vorpommern, germany. altogether, 12 landrace gilts (9 months old, with mean body weights of 138 kg) were included in the trial. estrus was synchronized in all gilts by 15 days of feeding with regumate (16 mg altrenogest / day / gilt ; msd animal health, unterschleissheim, germany). twenty - four hours after the last regumate feeding (0800 h), each animal received a single intramuscular injection of 850 iu equine chorionic gonadotropin (ecg ; pregmagon, idt biologika, dessau - tornau, germany). ovulation was induced 80 h later by administration of 500 iu human chorionic gonadotropin (hcg ; ovogest, msd animal health, unterschleissheim, germany). laparoscopic intrauterine insemination (liui) into each uterine horn was performed with 20 ml of extended, fresh boar semen (29.510 spermatozoa / ml ; motility 80% ; extender : androstar plus, minitb, tiefenbach, germany). semen was collected from the same proven ai pietrain boar (ai station bvn, malchin, germany). briefly, general anaesthesia in gilts was induced with ketamine (17.25 mg / kg bw, ursotamin, serumwerk dessau, germany) and azaperone (1.2 mg / kg bw, stresnil, elanco animal health, bad homburg, germany) and animals were fixed in a dorsal position. a pneumoperitoneum with co2 was automatically produced (endo tech, munich, germany). thereafter, three trocar cannulas (karl storz, tuttlingen, germany) were inserted into the abdomen for 0 optics (etb, berlin, germany) and grasping forceps (neomed, gutach / bleibach, germany). all laparoscopic handling was observed on a video monitoring system (neomed, gutach / bleibach, germany). for insemination, the uterine horn was carefully fixed with atraumatic forceps, and the uterine wall was punctured approximately 10 cm caudal to the uterotubal junction with a trocar that was 2.5 mm in diameter. under visual control, a 2.2 mm catheter (rsch feeding tube, w. rsch ag, kernen, germany) connected to a 20 ml syringe was inserted through the trocar cannula about 3 cm into the uterine lumen in the direction towards the tip of the uterine horn, and then semen was deposited. liui was performed at three different time points of the estrus cycle, i.e., in the peri - ovulatory (peri ; 31 h post hcg, n=4 gilts) or postovulatory period (post ; 79 h post hcg, n=4) or at mid cycle (mid ; day 9 of the estrus cycle, n=4). seven hours after liui, gilts were subjected to ovariohysterectomy, and the oviducts (n=24) were dissected into three segments : the caudal isthmus and uterotubal junction (utj), cranial isthmus (isth) and ampulla (amp). each section was flushed with 10 ml pbs containing 1.78 mm edta (sigma - aldrich, st. flushed fluids were centrifuged twice at 500 g (for 10 and for 7 min). supernatants were removed, and the volume of sperm pellets was measured with a pipette. from each sample, smears were stained according to the method of eovsk and the total number of spermatozoa was counted from stained smears of each 10 l sample. the total sperm cell number per flushing was determined based on this number and the volume of the sperm pellet, respectively. sperm cell morphology (intact and acrosome and tail aberrations) and acrosome integrity were evaluated by analyzing at least 200 spermatozoa. calculation of means and standard deviations, as well as of median values and 25th and 75th percentiles was carried out using the software package sigmaplot 11.0 (systat software, san jose, ca, usa). one - way anova followed by tukey s test was used to compare the results. | the uterotubal junction (utj) and caudal isthmus are recognized as a functional pre - ovulatory sperm reservoir (sr). spermatozoa are released from the sr in a complex and concerted action. however, whether this functionality is restricted only to the ovulatory period is still open to debate. our study was aimed to analyze the presence of spermatozoa within the utj (sr), isthmus (isth) and ampulla (amp) after laparoscopic intrauterine insemination (liui) either in the peri- (peri) or post - ovulatory (post) period or at mid cycle (mid). each uterine horn of estrus synchronized gilts (n=12) was inseminated with 20 ml sperm (29.5106 cells / ml). oviducts were recovered 7 h after liui and separated into the utj, isth and amp, and sections were flushed with 10 ml pbs+edta solution. after centrifugation, the sperm pellet was evaluated by eovsk staining. the median sperm numbers in the peri, post and mid groups were 578, 171 and 789 in the utj ; 545, 233 and 713 in the isth ; and 496, 280 and 926 in the amp, respectively, and there were differences between the post and mid groups (p0.05). compared with the mid group, the percent of intact sperm cells was higher (p<0.01) in the peri and post groups (32.8 vs. 66.4 and 76.8%). also, the percentages of aberrations in the acrosome and tail were higher (p<0.05) in the mid group. based on this, it can be assumed that the sperm reservoir is active during different phases of the estrus cycle. however, the mid - cycle oviduct environment considerably impairs sperm cell quality. |
chilaiditi 's sign is an incidental radiographic finding of subdiaphragmatic radiolucency due to the interposition of a bowel segment between the liver and the diaphragm. however, chilaiditi 's syndrome refers to a clinically symptomatic patient along with the presence of the radiographic findings : the symptoms resulting from the interposition itself, which can range from intermittent, mild abdominal pain to acute intestinal obstruction, constipation, chest pain and breathlessness [24 ]., we report a case in which we thought of chilaiditi 's syndrome because of the impression of gas under the diaphragm associated with features of intestinal obstruction, which eventually turned out to be chilaiditi 's sign due to richter 's hernia at the femoral canal. a 60-year - old female of aryan ethnicity presented to our emergency department with history of not passing stool and flatus for 3 days, bilious vomiting and abdominal distension. she was obese, her vitals were relatively stable and her abdomen was distended and tense. her liver dullness was obliterated, and she had a tympanitic note on percussion and mild tenderness all over the abdomen. however, a plain chest radiograph taken in erect position showed radiolucent shadow under the right dome of the diaphragm, first simulating pneumoperitoneum (fig. 1). the impression of free gas under the diaphragm was very much supported by the clinical finding of obliterated liver dullness. however, on careful examination of the radiograph, few semilunar radio - opaque linings could be seen, which could be walls of bowel loops (fig. 2). she was diagnosed as acute intestinal obstruction, probably chilaiditi 's syndrome : we thought of obstruction due to herniation into the hepatodiaphragmatic space. figure 1:a plain erect chest radiograph showing appearance of radiolucency under the right hemidiaphragm (arrows). figure 2:careful examination showing semilunar opaque lines which were walls of small bowel loops (arrows). a plain erect chest radiograph showing appearance of radiolucency under the right hemidiaphragm (arrows). careful examination showing semilunar opaque lines which were walls of small bowel loops (arrows). she underwent an exploratory laparotomy, in which we found distal ileal obstruction due to richter 's type strangulated right - sided femoral hernia, along with proximal multiple distended bowel loops and distal collapsed ileal loops. few distended small bowel (ileal) loops had slided between the liver and the anterior parietal wall to reach below the right dome of the diaphragm (hepatodiaphragmatic space). they were retrieved down, and there were no any adhesions ; the liver was of normal size and anatomy. the strangulated segment was released from the hernia with resection of the gangrenous segment of the ileum ; decompression of the rest of the small bowel was done followed by end - to - end anastomosis and repair of the femoral hernia. she recovered well after the operation without any complications and is well till 1 year of follow - up. the radiographic findings were concluded to be chilaiditi 's sign due to richter 's type femoral hernia and not chilaiditi 's syndrome, because bowel obstruction was not due to the infradiaphragmatic pathology, and it remained an incidental finding. chilaiditi 's sign is defined as the interposition of bowel loop (usually colon, sometimes small bowel) and the liver below the right hemidiaphragm. it is mostly an incidental finding with a rare reported incidence of 0.0250.28% in abdominal or chest radiographs. on the other hand, chilaiditi 's syndrome may involve symptoms such as abdominal pain, chest pain, breathlessness and constipation ; even acute intestinal volvulus due to such pathology has also been reported. the present case features a lady who had presented with obstruction, and based on radiographs was suspected to be due to chilaiditi 's syndrome. however, on laparotomy, the cause was a richter 's type femoral hernia that gave rise to chilaiditi 's sign due to sliding of the small bowel into the hepatodiaphragmatic space. our literature search has revealed only six reports of chilaiditi 's sign involving the small bowel till date [3, 610 ]. an association of chilaiditi 's sign with either richter 's or femoral hernia has never been reported in the literature till date ; and this report is the first of its kind. various predisposing factors for chilaiditi 's sign have been listed, like cirrhosis, chronic obstructive pulmonary disease, pregnancy, mental disorders, obesity, primary lung cancer, diaphragmatic paralysis, postoperative adhesions, right lobe agenesis and significant weight loss [810 ]. the postulated factors are thought to be (i) a redundant bowel with long mesentery and increased mobility ; (ii) an increase in the space between the liver and the diaphragm secondary to long hepatic suspensory ligaments, ascites and pregnancy ; and shrinkage of the liver like in cirrhosis, which leaves adequate space for intrusion of adjacent bowel segments. the present case is unique in that femoral hernia led to obstruction of the small bowel ; probably the distension of the small bowel loops exerted so much pressure that they could not be accommodated in the peritoneal cavity, so they slided between the anterior parietal wall and the liver to lie in the hepatodiaphragmatic space to produce such a radiological picture of chilaiditi 's sign. a femoral hernia as the cause of intestinal obstruction was never thought of preoperatively, probably because she never gave history of any swelling at the femoral region, she was obese, and hence was missed on initial clinical examination. management regarding classical cases of chilaiditi 's syndrome is clear : conservative for all uncomplicated cases, and surgery being indicated in cases associated with colonic volvulus, bowel ischemia, bowel obstruction and persistent pain [4, 8, 9 ]. during surgery, various treatment options have been described, including hepatic extraperitonealization (hepatopexy), transverse colectomy, right hemicolectomy, and colopexy. in our case, chilaiditi 's syndrome and sign are related entities within a spectrum, and to distinguish them can sometimes be very difficult. though the syndrome suggests the pathology in the subdiaphragmatic region, chilaiditi 's sign may point out to a cause that is distant from the obviously evident site, such as a femoral hernia, as in the present case. | chilaiditi 's sign and syndrome seem similar but are actually different entities, difficult to distinguish from each other. a 60-year - old female presented with a clinical scenario of intestinal obstruction, which was thought to be chilaiditi 's syndrome because of the unusual impression of gas under the diaphragm, but was confirmed as chilaiditi 's sign after laparotomy. the interposition of dilated small bowel loops below the diaphragm due to distal obstruction somewhere else can also produce a chilaiditi 's sign. |
staphylococcus aureus and coagulase - negative staphylococci (cons) are well known to most clinicians as a cause of nosocomial and community - associated infections worldwide (1, 2). staphylococci are able to develop resistance to many routinely used antibiotics to which they were susceptible first (1). moreover, this condition has become more complicated because of various factors such as horizontal acquisition of foreign genetic elements and ability to establish persistent infections (e.g. biofilm formation) in the host. nowadays, due to wide spread use of indwelling and prosthetic medical devices, cons have gained much attention as considerable agents involved in nosocomial infections (3). a major part of these infections are caused by the transmission of the bacteria from hospital employees as reservoir to patients. in particular, this situation can lead to serious infections in immunocompromised patients who are hospitalized with underlying diseases (4 - 8). macrolides including erythromycin are the antibiotics used against gram - positive and some gram - negative bacteria. three mechanisms in gram - positive bacteria that result in resistance to erythromycin are as follows : (i) modification in the ribosomal target site, mediated by the methyltransferases encoded by erm (erythromycin resistance methylase) genes, (ii) efflux pump encoded by msra / b (macrolide specific resistance genes) and (iii) erea / b (erythromycin esterases) genes (9 - 12). among these mechanisms, many reported and sequenced erm genes, three major genes of erma, ermb and ermc are present in staphylococci (12, 13). due to the development of resistant strains, epidemiological data on antibiotic susceptibility of staphylococcus strains isolated from nasal carriers in each region can be helpful to select appropriate drugs to eradicate carriage states, control the nosocomial infections and also treat the patients (14, 15). the current study aimed to investigate the antibiotic susceptibility profile and the prevalence of the erma, ermb, ermc and msra genes among staphylococcal strains isolated from the nares of hospital personnel in khorramabad, iran. during this cross - sectional study, a total of 340 volunteers from hospital staff (males and females), employed in various wards of four referral and state hospitals (shohaday - e - ashayer, asalian, shahid madani and taemin ejtemai) in khorramabad city (west of iran) were included and screened for nasal carriage of s. aureus from july 2011 to january 2012.the subjects with a history of any antibiotic consumption for at least ten days at the time of sampling were excluded. the sample size was estimated via formula to calculate the ratio with an accuracy of 0.05 (d = 0.05). to collect samples, three hospitals under study were general (400, 350 and 150 beds) and one hospital was specialized (100 beds). finally 100 adults of both genders (40 males and 60 females) were enrolled. information about variables including gender, work experience and the ward which hospital staff worked was collected by a questionnaire. the samples were collected from both anterior nares of the subjects by rotating a sterile cotton wool swab. the swabs were placed and transported in 3 ml tryptic soy broth (merck, germany) and incubated at 37c. after overnight incubation, a loop full of inoculated broth medium was subcultured on 10% sheep blood agar, mannitol salt agar and nutrient agar (merck, germany) (16). presumptive staphylococcal colonies (growth on mannitol salt agar, gram - positive and catalase - positive cocci) were tested further for the production of coagulase and dnase enzymes according to the standard bacteriological procedures (17). isolates with positive reactions (coagulase - positive and dnase - positive) were identified as s. aureus ; other staphylococcal species with negative test results designated as cons. susceptibility of staphylococcus isolates to antibiotics (mast, merseyside, united kingdom) including erythromycin (15 g), clarithromycin (15 g), azithromycin (15 g), cefoxitin (30 g), penicillin g (10 u), vancomycin (30 g), tetracycline (30 g), clindamycin (2 g), trimethoprim / sulfamethoxazole (1.25/23.75 g) and rifampin (5 g) was determined by the kirby - bauer disk diffusion method on muller - hinton agar, according to the procedures described by the clinical and laboratory standards institute (clsi) (18). total dna (consisting of the chromosomal and the plasmid) of all the isolates was extracted and collected using accuprep genomic dna extraction kit (bioneer, korea) with some modifications. briefly, a 1 ml of luria - bertani broth (lb) bacterial colony of each strain was suspended in 1 ml of lysogeny broth (lb) medium, and incubated at 37c for 18 hours. the bacterial cells were harvested by centrifugation at 7,500 g for 10 minutes and resuspended in 200 l of phosphate - buffered saline (pbs) and mixed well. to ensure adequate cell breakage, 10 l lysostaphin (100 g / ml in sterile deionized water ; sigma) was added to the bacterial mixture and incubated at 37c for 30 minutes (19). then, 10 l of proteinase k (20 mg / ml) was added to the sample and after incubating at 56c for 30 minutes, the process was continued according to the manufacturer 's instructions. the four primer pairs used to amplify the erma, ermb, ermc and msra genes are listed in table 1 (12). in the current study, multiplex polymerase chain reaction (pcr) amplification was performed for erma, ermc and msra genes as previously described by zmantar. (12) in a 25 l reaction mixture consisting of : 1x pcr reaction buffer, 2.5 mm mgcl2, 0.2 mm dntp, 25 pmol of each of the three primer pairs, 1.2 u of taq dna polymerase (fermentas, lithuania) and 200 ng dna template. for ermb gene amplification, the ermb primers (25 pmol) were added in a separate pcr reaction under the same above - mentioned conditions. amplification was carried out using a gradient thermal cycler (bio - rad, my cycler, us) as the following program : five minutes at 94c, 30 cycles of amplification, consisting one minute at 95c, 0.5 minute at 55c and two minutes at 72c, ending with 10 minutes at 72c (final extension). to verify amplification, 5 l of pcr products were subjected to agarose gel electrophoresis (1.5% agarose, 1x tae, 100v). ethidium bromide - stained dna fragments were then visualized on a uv transilluminator at 300 nm in comparison with a 50-bp molecular size standard ladder (fermentas, lithuania). to verify the authenticity of the amplicons, pcr products of three positive samples containing one of the genes of ermb, ermc or msra as representative the resulting sequences were aligned with corresponding sequences in the genbank database using at the national center for biotechnology information (ncbi) blast program (http://blast.ncbi.nlm.nih.gov/blast.cgi ? program = blastn and page - type = blast search and link - loc = blasthome). to minimize the random errors, chi - square test and t - test were used to determine any significant differences between prevalence of the tested genes among s. aureus and cons strains. the study was approved by ethical committee of lorestan university of medical sciences, khorramabad, iran (no. during this cross - sectional study, a total of 340 volunteers from hospital staff (males and females), employed in various wards of four referral and state hospitals (shohaday - e - ashayer, asalian, shahid madani and taemin ejtemai) in khorramabad city (west of iran) were included and screened for nasal carriage of s. aureus from july 2011 to january 2012.the subjects with a history of any antibiotic consumption for at least ten days at the time of sampling were excluded. the sample size was estimated via formula to calculate the ratio with an accuracy of 0.05 (d = 0.05). to collect samples, three hospitals under study were general (400, 350 and 150 beds) and one hospital was specialized (100 beds). finally 100 adults of both genders (40 males and 60 females) were enrolled. information about variables including gender, work experience and the ward which hospital staff worked was collected by a questionnaire. the samples were collected from both anterior nares of the subjects by rotating a sterile cotton wool swab. the swabs were placed and transported in 3 ml tryptic soy broth (merck, germany) and incubated at 37c. after overnight incubation, a loop full of inoculated broth medium was subcultured on 10% sheep blood agar, mannitol salt agar and nutrient agar (merck, germany) (16). presumptive staphylococcal colonies (growth on mannitol salt agar, gram - positive and catalase - positive cocci) were tested further for the production of coagulase and dnase enzymes according to the standard bacteriological procedures (17). isolates with positive reactions (coagulase - positive and dnase - positive) were identified as s. aureus ; other staphylococcal species with negative test results designated as cons. susceptibility of staphylococcus isolates to antibiotics (mast, merseyside, united kingdom) including erythromycin (15 g), clarithromycin (15 g), azithromycin (15 g), cefoxitin (30 g), penicillin g (10 u), vancomycin (30 g), tetracycline (30 g), clindamycin (2 g), trimethoprim / sulfamethoxazole (1.25/23.75 g) and rifampin (5 g) was determined by the kirby - bauer disk diffusion method on muller - hinton agar, according to the procedures described by the clinical and laboratory standards institute (clsi) (18). total dna (consisting of the chromosomal and the plasmid) of all the isolates was extracted and collected using accuprep genomic dna extraction kit (bioneer, korea) with some modifications. briefly, a 1 ml of luria - bertani broth (lb) bacterial colony of each strain was suspended in 1 ml of lysogeny broth (lb) medium, and incubated at 37c for 18 hours. the bacterial cells were harvested by centrifugation at 7,500 g for 10 minutes and resuspended in 200 l of phosphate - buffered saline (pbs) and mixed well. to ensure adequate cell breakage, 10 l lysostaphin (100 g / ml in sterile deionized water ; sigma) was added to the bacterial mixture and incubated at 37c for 30 minutes (19). then, 10 l of proteinase k (20 mg / ml) was added to the sample and after incubating at 56c for 30 minutes, the process was continued according to the manufacturer 's instructions. the four primer pairs used to amplify the erma, ermb, ermc and msra genes are listed in table 1 (12). in the current study, multiplex polymerase chain reaction (pcr) amplification was performed for erma, ermc and msra genes as previously described by zmantar. (12) in a 25 l reaction mixture consisting of : 1x pcr reaction buffer, 2.5 mm mgcl2, 0.2 mm dntp, 25 pmol of each of the three primer pairs, 1.2 u of taq dna polymerase (fermentas, lithuania) and 200 ng dna template. for ermb gene amplification, the ermb primers (25 pmol) were added in a separate pcr reaction under the same above - mentioned conditions. amplification was carried out using a gradient thermal cycler (bio - rad, my cycler, us) as the following program : five minutes at 94c, 30 cycles of amplification, consisting one minute at 95c, 0.5 minute at 55c and two minutes at 72c, ending with 10 minutes at 72c (final extension). to verify amplification, 5 l of pcr products were subjected to agarose gel electrophoresis (1.5% agarose, 1x tae, 100v). ethidium bromide - stained dna fragments were then visualized on a uv transilluminator at 300 nm in comparison with a 50-bp molecular size standard ladder (fermentas, lithuania). to verify the authenticity of the amplicons, pcr products of three positive samples containing one of the genes of ermb, ermc or msra as representative the resulting sequences were aligned with corresponding sequences in the genbank database using at the national center for biotechnology information (ncbi) blast program (http://blast.ncbi.nlm.nih.gov/blast.cgi ? program = blastn and page - type = blast search and link - loc = blasthome). to minimize the random errors, chi - square test and t - test were used to determine any significant differences between prevalence of the tested genes among s. aureus and cons strains. the study was approved by ethical committee of lorestan university of medical sciences, khorramabad, iran (no. a total of 51 s. aureus strains were isolated from anterior nares of the 340 screened subjects (i.e. the nasal carriage rate for s. aureus was 15%). of the 51 s. aureus - carriers, 22 (43.1%) were males and 29 (56.9%) were females. on the other hand, 49 randomly selected cons strains, isolated from nares of non - s. aureus carriers [18 males (36.7%), 31 females (63.3%) ] were also included and tested in the study. there was no statistical difference between the two groups (s. aureus nasal carriers and cons) in terms of gender (p = 0.72). average work experience for cons obtained subjects was 6.4 0.89 years, and within s. aureus - nasal carriers were 4.8 0.68 years. based on the t - test result, difference in the mean of work experience between the two groups was not statistically significant (p = 0.22). the resistance profile for all isolates to macrolides as well as other tested antibiotics is listed in table 2. the majority of isolates expressed resistance to penicillin (96%). no resistance to vancomycin was noted. twenty - nine (29%) isolates were resistant to cefoxitin (eight s. aureus and twenty - one cons). fifty - three (53%) isolates were simultaneously resistant to erythromycin, azithromycin and clarithromycin (cross - resistance) ; while 8 (8%) isolates had various macrolide susceptibility patterns. for example, two isolates were intermediate to erythromycin, while they were resistant to azithromycin and clarithromycin. in addition, two isolates were found susceptible to erythromycin, while they were resistant to clarithromycin. the frequency of resistance to all tested antibiotics between cons and s. aureus isolates were statistically significant (p < 0.001). distribution of susceptibility phenotypes to erythromycin among the isolates of s. aureus and cons according to the gender is shown in table 3. statistical analyses showed that among the s. aureus isolates difference in prevalence of resistance to erythromycin was significant between males and females (p = 0.011) ; while such difference was not significant within cons isolates (p = 0.771). abbreviation : cons, coagulase - negative staphylococci. comparison between isolates performed by using chi - square test, p value < 0.001. all of the isolates were screened for the presence of the four genes erma, ermb, ermc and msra as the main causative agents of resistance to macrolides. as predicted, the positive isolates for the erma, ermb, ermc and msra genes showed 139, 142, 190 and 163 bp bands, respectively (figure 1). the frequency rate of erma, ermb, ermc and msra genes were 3%, 5%, 33% and 20%, respectively ; separately illustrated for s. aureus and cons isolates in figure 2. it was found that among the 53 isolates resistant to erythromycin, 44 (83%) isolates (eight s. aureus and thirty - six cons) carried at least one of the four tested genes. of these erythromycin - resistant isolates, nine (approximately 17%) isolates (one s. aureus and eight cons) harbored genes of ermc and msra, and one (% 1.8) cons isolate also harbored erma and ermc genes simultaneously. however, combination of three or four genes was not found among the tested isolates (table 4). eight (8%) isolates had intermediate phenotype to erythromycin, in which 4 (50%) isolates carried ermb or ermc genes (table 4). in addition, it was found that out of 39 erythromycin - susceptible isolates, 36 (92.3%) isolates did not harbor any of the four antibiotic resistant genes, but the remaining isolates (three isolates) were positive for ermb or ermc genes, while they were still susceptible to erythromycin (table 4). interestingly, of the 29 methicillin - resistant staphylococci, 22 (75.9%) isolates were resistant to erythromycin and 19 (65.5%) isolates harbored at least one of the tested genes. a, multiplex pcr amplification of erma, ermc and msra genes ; source of dna for lanes : 1, negative control strain of erythromycin - sensitive staphylococcus aureus atcc 25923 ; lanes 2, 4 and 7, three different s. aureus isolates (ermc) ; lane 3, a coagulase - negative staphylococci (cons) isolate (erma) ; lanes 5 and 6, two different cons isolates contain ermc and msra genes simultaneously ; lane 8, a cons isolate contains msra gene. b, pcr products resulted from amplification of ermb gene ; lanes 1 and 2, two different s. aureus isolates contain ermb gene ; lane 3, s. aureus atcc 29213 (negative control) ; lanes m, dna molecular size marker (50-bp ladder ; fermentas, lithonia) ; the electrophoresis was run on 1.5% agarose gel, stained with ethidium bromide. nucleotide sequences were submitted to genbank under the accession numbers ab937975, ab937976 and ab937977 for the ermb, ermc and msra genes, respectively. a total of 51 s. aureus strains were isolated from anterior nares of the 340 screened subjects (i.e. the nasal carriage rate for s. aureus was 15%). of the 51 s. aureus - carriers, 22 (43.1%) were males and 29 (56.9%) were females. on the other hand, 49 randomly selected cons strains, isolated from nares of non - s. aureus carriers [18 males (36.7%), 31 females (63.3%) ] were also included and tested in the study. there was no statistical difference between the two groups (s. aureus nasal carriers and cons) in terms of gender (p = 0.72). average work experience for cons obtained subjects was 6.4 0.89 years, and within s. aureus - nasal carriers were 4.8 0.68 years. based on the t - test result, difference in the mean of work experience between the two groups was not statistically significant (p = 0.22). the resistance profile for all isolates to macrolides as well as other tested antibiotics is listed in table 2. the majority of isolates expressed resistance to penicillin (96%). no resistance to vancomycin was noted. twenty - nine (29%) isolates were resistant to cefoxitin (eight s. aureus and twenty - one cons). fifty - three (53%) isolates were simultaneously resistant to erythromycin, azithromycin and clarithromycin (cross - resistance) ; while 8 (8%) isolates had various macrolide susceptibility patterns. for example, two isolates were intermediate to erythromycin, while they were resistant to azithromycin and clarithromycin. in addition, two isolates were found susceptible to erythromycin, while they were resistant to clarithromycin. the frequency of resistance to all tested antibiotics between cons and s. aureus isolates were statistically significant (p < 0.001). distribution of susceptibility phenotypes to erythromycin among the isolates of s. aureus and cons according to the gender is shown in table 3. statistical analyses showed that among the s. aureus isolates difference in prevalence of resistance to erythromycin was significant between males and females (p = 0.011) ; while such difference was not significant within cons isolates (p = 0.771). abbreviation : cons, coagulase - negative staphylococci. comparison between isolates performed by using chi - square test, p value < 0.001. all of the isolates were screened for the presence of the four genes erma, ermb, ermc and msra as the main causative agents of resistance to macrolides. as predicted, the positive isolates for the erma, ermb, ermc and msra genes showed 139, 142, 190 and 163 bp bands, respectively (figure 1). the frequency rate of erma, ermb, ermc and msra genes were 3%, 5%, 33% and 20%, respectively ; separately illustrated for s. aureus and cons isolates in figure 2. it was found that among the 53 isolates resistant to erythromycin, 44 (83%) isolates (eight s. aureus and thirty - six cons) carried at least one of the four tested genes. of these erythromycin - resistant isolates, nine (approximately 17%) isolates (one s. aureus and eight cons) harbored genes of ermc and msra, and one (% 1.8) cons isolate also harbored erma and ermc genes simultaneously. however, combination of three or four genes was not found among the tested isolates (table 4). eight (8%) isolates had intermediate phenotype to erythromycin, in which 4 (50%) isolates carried ermb or ermc genes (table 4). in addition, it was found that out of 39 erythromycin - susceptible isolates, 36 (92.3%) isolates did not harbor any of the four antibiotic resistant genes, but the remaining isolates (three isolates) were positive for ermb or ermc genes, while they were still susceptible to erythromycin (table 4). interestingly, of the 29 methicillin - resistant staphylococci, 22 (75.9%) isolates were resistant to erythromycin and 19 (65.5%) isolates harbored at least one of the tested genes. a, multiplex pcr amplification of erma, ermc and msra genes ; source of dna for lanes : 1, negative control strain of erythromycin - sensitive staphylococcus aureus atcc 25923 ; lanes 2, 4 and 7, three different s. aureus isolates (ermc) ; lane 3, a coagulase - negative staphylococci (cons) isolate (erma) ; lanes 5 and 6, two different cons isolates contain ermc and msra genes simultaneously ; lane 8, a cons isolate contains msra gene. b, pcr products resulted from amplification of ermb gene ; lanes 1 and 2, two different s. aureus isolates contain ermb gene ; lane 3, s. aureus atcc 29213 (negative control) ; lanes m, dna molecular size marker (50-bp ladder ; fermentas, lithonia) ; the electrophoresis was run on 1.5% agarose gel, stained with ethidium bromide. nucleotide sequences were submitted to genbank under the accession numbers ab937975, ab937976 and ab937977 for the ermb, ermc and msra genes, respectively. staphylococcus aureus carrier status can lead to nosocomial infections in hospitalized patients (6, 8). on the other hand, cons are leading cause agents of opportunistic and device - related infections (3). in the current study, in several studies performed in various regions of the world, this carriage status in healthcare workers have been reported ranging ranging from 18.6% to 50% (20). moreover, in iran, the frequency of nasal carriage among hospital employees is reported approximately 12.7% - 45% (21). unfortunately, the results of disk diffusion testing showed that all the evaluated isolates were multidrug - resistant. it is a serious threat when a methicillin - resistant stain is transferred and spread among hospitalized patients (therapeutic failure) (22). it was observed that the frequency of resistance among cons isolates was significantly higher than those among s. aureus isolates ; and this finding was also attributable to resistance to erythromycin and cefoxitin (table 2). while the majority of the erythromycin - resistant strains had cross - resistance to other macrolides ; however eight strains exhibited heterogeneous susceptibility pattern toward macrolide antibiotics (table 2). it is presumed that this discrepancy is due to alterations in the chemical structure of various generations of macrolides. the association between resistance to methicillin and the presence of tested genes was significant (p = 0.031). the simple explanation for this phenomenon is carrying and transmission of the various adjacent resistance genes on genetic elements such as plasmids. several studies concerning the distribution of erm genes and efflux pumps are conducted using southern hybridization and pcr techniques (13, 23, 24). despite previous studies in which have primarily focused on clinical strains of staphylococci (1, 11, 23 - 28), the current study presents the first report on the occurrence of main genes implicated in macrolides- resistance in staphylococcus strains obtained from nares of hospital employees. the obtained pcr results demonstrated that the most prevalent gene in both s. aureus and cons strains was ermc (33%). also, the frequency of this gene (ermc) in erythromycin - resistant s. aureus and cons were 13.7% and 53%, respectively. (25) performed with cons in turkey in which a frequency of 30% for ermc was yielded. martineau. (24) reported an occurrence of 66% for s. epidermidis strains. (9) found that the ermc gene is located on a small plasmid ; therefore, horizontal transmission of this gene from resistant strains to susceptible strains is unavoidable. regarding erma, some studies showed that this gene, as the most prevalent gene among clinical strains of s. aureus, has a frequency of 21% to 67% (1, 24 - 27). similar findings were also published in denmark, where erma was responsible for 80.6% resistance to erythromycin among 428 tested clinical s. aureus strains from 1959 to 1988 (23). in contrast, the current study pcr results demonstrated that erma was not observed in the tested s. aureus strains. it was also found that ermb gene was carried in a minority of s. aureus (7.8%) and cons (2%) strains ; while previous studies revealed that this gene was primarily originated from animal strains and generally its frequency was low (24 - 27). however, zmantar. in two different studies (12, 28) reported that ermb was the most common gene when they evaluated 81 s. aureus strains isolated from human auricular. finally, msra gene, encoding an atp - dependent efflux pump (24), was more prevalent in cons (41.8%) than s. aureus strains (20%). (26) who reported the prevalence of msra gene as 14.6% and 2.1% among cons and s. aureus strains, respectively. similar data were also obtained (41%) from a study conducted by zmantar. some staphylococcal strains in the current study showed discrepancies between the genotype and phenotype. so that, three strains (two s. aureus and one cons) harbored ermb or ermc gene, while they were susceptible to erythromycin. (1) also hypothesized that this phenomenon may be caused by down - regulation or mutation in promoter region of erm gens. on the other hand, martineau. (24) demonstrated that such strains carrying the resistant genes would exhibit phonotypical resistance, upon subculturing in media with increasing gradients of the corresponding antibiotic. moreover, nine staphylococcus isolates were resistant to erythromycin, but did not carry any of the tested erythromycin - resistant genes. authors presume that other variants of erm genes or efflux pump (msrb) involve in this subject, which were not evaluated in the study (1, 24, 29, 30). although the current study is the first report on the occurrence of genetic determinants responsible for macrolide resistance among staphylococcus strains originated from hospital employees ; however, lack of further in vitro investigations, such as determining the minimum inhibitory concentration (mic) for erythromycin, detection of other genes involved in macrolide resistance and limited sample size, were the weakness of the current study. in conclusion, no entire association was found between genotype and phenotype methods to detect macrolides resistance. in addition, distribution of genetically erythromycin - resistant isolates is geographically different among staphylococci. it is recommend controlling s. aureus in nasal carriers by proved approaches such as local or systemic administration of effective antibiotics or bacterial interference. in addition, to prevent cons - associated nosocomial and indwelling medical device infections, it is recommended that healthcare workers wash hands and avoid touching their noses during the patient examination, use sterile masks and gloves and finally, insert prosthetic and catheter devices aseptically. | backgroundepidemiological data on antibiotic susceptibility of staphylococcus strains isolated from nasal carriers in each region can be helpful to select appropriate drugs to eradicate carriage states, control nosocomial infections and also treat patients.objectivesthe current study aimed to investigate the antibiotic resistance profile and the molecular prevalence of the erma, ermb, ermc and msra genes among staphylococcus strains isolated from the anterior nares of hospital employees.patients and methodsin this cross - sectional study, a total of 100 staphylococcus isolates, 51 staphylococcus aureus, 49 coagulase - negative staphylococci (cons) were isolated from the anterior nares of hospital employees in khorramabad, iran. susceptibility pattern to macrolide antibiotics were determined using the disk diffusion method. the polymerase chain reaction (pcr) assay was applied to determine the major erythromycin - resistant genes (erma, ermb, ermc and msra).resultsfifty - three (53%) isolates were simultaneously resistant to erythromycin, azithromycin and clarithromycin (cross - resistance) ; while 8 (8%) isolates had variable macrolide susceptibility pattern. among the s. aureus isolates, the difference in prevalence of resistance to erythromycin between males and females was significant (p = 0.011). the frequency of erma, ermb, ermc, and msra genes were 3%, 5%, 33% and 20%, respectively. it was also found that out of 53 isolates resistant to erythromycin, 44 (83%) isolates (eight s. aureus and thirty - six cons strains) carried at least one of the four tested genes. eight (8%) isolates had intermediate phenotype to erythromycin, in which 4 (50%) isolates carried ermb or ermc genes. in addition, out of 39 erythromycin - susceptible isolates, 3 (7.7%) isolates were positive for ermb or ermc genes.conclusionsno entire association was found between genotype and phenotype methods to detect macrolides - resistant isolates. in addition, distribution of genetically erythromycin - resistant isolates is geographically different among staphylococci. it is recommend removing s. aureus from nasal carriers by proved approaches such as local or systemic administration of effective antibiotics or bacterial interference. |
a 79-year - old male presented to the north shore university hospital emergency department with a three - day history of anorexia, nausea and coffee ground emesis. the symptoms began three days earlier when he awakened at night nauseated and achieved only mild relief by vomiting. in the days leading up to admission, the patient continued vomiting dark, grainy coffee ground emesis at least five times per day with concurrent loss of appetite. his last bowel movement was one day prior to the onset of symptoms, and his overall condition worsened with time. the patient stated that he had increased his intake of nsaid for about one week prior to the initial symptoms due to progressing osteoarthritic pain. he was afebrile with a pulse of 127 bpm, blood pressure of 82/33 torr, and a respiratory rate of 19 breaths per minute. the lung exam revealed poor distant breath sounds at the area of the left lower lobe. the abdomen was mildly distended, but soft, non - tender, without guarding or palpable masses. relevant laboratory results were as follows : hematocrit 39.5%, sodium 136, bicarbonate 30, and bun / creatinine were 77/2.2. the remainder of the electrolytes, liver function tests, and the urinalysis were within normal limits. the chest x - ray showed left basal, possibly lingular atelectasis, while the abdominal x - ray revealed a nonspecific bowel gas pattern with stool in the colon. the past medical history of the patient was significant for osteoarthritis, hypertension and one transient ischemic attack. twenty months prior to the present illness, the patient presented to the emergency room with similar symptoms with mild hematemesis. extensive work - up revealed a paraesophageal hernia and a gastric volvulus along with erosive esophagitis. the patient underwent laparoscopic repair of the crus of the diaphragm and an anterior gastropexy to prevent recurrence of volvulus. based on the history and clinical picture, the initial working diagnosis was that of gastritis secondary to the nsaids and the increased alcohol intake. an upper endoscopic evaluation revealed severe erosive gastritis with a gaping lower esophageal sphincter permitting reflux and causing distal esophagitis. the patient, however, did not improve after several days of medical therapy with propulcid, erythromycin and prilosec, so an upper gi series with small bowel follow - through was performed (figure 1). it revealed that most of the small bowel was displaced to the left upper quadrant with one loop of distal ileum coursing to the right lower quadrant to join a medially displaced cecum. these findings were consistent with an internal hernia around the site of the anterior gastropexy. the small bowel had herniated to the left upper quadrant through the space created between the anterior gastropexy and the falciform ligament. an upper gi with small bowel follow through showing the small intestine in the left upper quadrant and the terminal ileum in the mid abdomen. attempts at laparoscopic reduction of the small bowel (sb) were not successful, so a laparotomy was performed. the defect through which the herniation occurred was closed by suturing the greater curvature of the stomach distal to the gastropexy to the anterior abdominal wall and medially to the falciform. postoperatively, the patient recovered without complications and was discharged home a few days later. gastric volvulus is an uncommon but potentially life - threatening problem. in its acute and complete form patients present with unproductive retching, abdominal distention and inability to pass a nasogastric tube (borchardt 's triad) the pathophysiology is laxity in the ligamentous attachments of the stomach (gastrophrenic, gastrohepatic, gastrosplenic and gastrocolic). this can be seen with age or secondary to gastric distention caused by disorders such as pyloric hypertrophy or stenosis. if the stomach is viable, an anterior gastropexy can be performed with any of the mentioned approaches. however, if there is evidence of gastric necrosis then an emergent gastrectomy is indicated. the techniques differ, however. some suture the fundus to the diaphragm and the greater curvature with one anchoring stitch to the anterior abdominal wall, others have more than one anchoring point to the anterior abdominal wall. a combined laparoscopic and endoscopic approach has been used by newman and koger, whereby one or more endoscopic gastrostomies were part of the anterior gastropexy. laparoscopic - assisted gastropexy using t - fasteners for anchoring the stomach to the anterior abdominal wall has also been described. the adhesions formed in an open procedure will probably prevent any such herniation from happening. with laparoscopic surgery, our patient seems to have had gastritis precipitated by the nsaids and the increased alcohol intake. the doubling over and increased intra - abdominal pressure associated with the vomiting that pursued may have led to the rostral displacement of the small bowel with herniation into the left upper quadrant around the attachment of the stomach to the anterior abdominal wall. review of the laparoscopic literature did not reveal a similar complication. to avoid similar complications, anchoring the stomach along the greater curvature at several sites, or performing a concurrent gastrostomy will help obliterate open spaces and the herniation that may ensue. | gastric volvulus can be a medical emergency with life - threatening complications. early surgical intervention is important to avoid potential ischemic complication that may lead to infarction of the stomach. the condition has been reported in children and in the elderly, but the majority of cases are reported in the fifth decade of life. we present a case of a complication arising from corrective laparoscopic surgery for gastric volvulus, whereby most of the small bowel herniated around the anterior laparoscopically performed gastropexy. the herniation was reduced during a laparotomy, and the space through which the herniation occurred was closed. |
carcinoembryonic antigen (cea) and cytokeratin 19 fragments (cyfra 21 - 1) are the most commonly investigated tumor markers in non - small - cell lung cancer (nsclc). they have been investigated for the purpose of early detection, prognosis stratification, treatment monitoring and selection, and recurrence monitoring. in nsclc, adjuvant platinum - based chemotherapy is considered the standard treatment for stage ii and iii. therefore, a current challenge in nsclc is to identify patients that might benefit from adjuvant treatment. several studies have suggested that cea and cyfra 21 - 1 were independent prognostic factors and good tools for choosing candidates for adjuvant chemotherapy [3 - 10 ]. we postulated that cea and cyfra 21 - 1, which seem to be associated with patient prognosis, might be related to pathologic factors. this study focused on the association between preoperative serum cea and cyfra 21 - 1 levels and pathologic parameters in relation to prognosis in patients with resected nsclc. the records of 982 patients who underwent pulmonary resection of nsclc between january 1999 and december 2006 were reviewed. patients who received preoperative induction therapy and those with histology other than squamous cell, adenocarcinoma, and large cell lung cancer were excluded for the purpose of exact pathologic and histologic correlation. the serum cea level was measured from 1999 and cyfra 21 - 1 was measured from 2004 at severance hospital. the group contained 142 females and 385 males with a median age of 64.0 years (range, 36 to 82 years). the preoperative serum level was measured in 526 patients for cea and 162 for cyfra 21 - 1. patient evaluation before surgery included medical history, physical examination, chest radiography, and blood tests. computed tomography scans of the chest and upper abdomen, abdominal sonography, and bone scintigraphy were routinely performed. the extent of the primary lesion was carefully assessed, and systematic dissection of all hilar and mediastinal lymph nodes was performed in each case. the institutional review board (irb) of the yonsei university college of medicine approved this retrospective study. the need for subsequent individual consent of patients whose records were evaluated was waived because individuals were not identified in this study. blood samples were obtained by peripheral venous puncture on admission to the unit prior to any staging or resection. serum cea or cyfra 21 - 1 levels were measured as part of routine clinical examination. cea was assessed by unicel dxi 800 immunoassay (beckman coulter, brea, ca, usa), and cyfra 21 - 1 by elecsys 2010 system (boehringer mannheim, mannheim, germany) according to the manufacturer 's instructions. serum levels < 5.0 ng / ml were defined as normal for cea and < 3.3 ng / ml for cyfra21 - 1. the mean serum cea and cyfra21 - 1 levels for each variable were compared using a t - test or one - way analyses of variance (anova). the association between serum cea and cyfra 21 - 1 levels was examined for variables that had p - values of less than 0.05 in a t - test or one - way anova using multiple linear regression analysis. the tumor size and cyfra 21 - 1 level were analyzed as continuous variables in multiple linear regression analysis. the records of 982 patients who underwent pulmonary resection of nsclc between january 1999 and december 2006 were reviewed. patients who received preoperative induction therapy and those with histology other than squamous cell, adenocarcinoma, and large cell lung cancer were excluded for the purpose of exact pathologic and histologic correlation. the serum cea level was measured from 1999 and cyfra 21 - 1 was measured from 2004 at severance hospital. the group contained 142 females and 385 males with a median age of 64.0 years (range, 36 to 82 years). the preoperative serum level was measured in 526 patients for cea and 162 for cyfra 21 - 1. patient evaluation before surgery included medical history, physical examination, chest radiography, and blood tests. computed tomography scans of the chest and upper abdomen, abdominal sonography, and bone scintigraphy were routinely performed. the extent of the primary lesion was carefully assessed, and systematic dissection of all hilar and mediastinal lymph nodes was performed in each case. the institutional review board (irb) of the yonsei university college of medicine approved this retrospective study. the need for subsequent individual consent of patients whose records were evaluated was waived because individuals were not identified in this study. blood samples were obtained by peripheral venous puncture on admission to the unit prior to any staging or resection. serum cea or cyfra 21 - 1 levels were measured as part of routine clinical examination. cea was assessed by unicel dxi 800 immunoassay (beckman coulter, brea, ca, usa), and cyfra 21 - 1 by elecsys 2010 system (boehringer mannheim, mannheim, germany) according to the manufacturer 's instructions. serum levels < 5.0 ng / ml were defined as normal for cea and < 3.3 ng / ml for cyfra21 - 1. chicago, il, usa). the mean serum cea and cyfra21 - 1 levels for each variable were compared using a t - test or one - way analyses of variance (anova). the association between serum cea and cyfra 21 - 1 levels was examined for variables that had p - values of less than 0.05 in a t - test or one - way anova using multiple linear regression analysis. the tumor size and cyfra 21 - 1 level were analyzed as continuous variables in multiple linear regression analysis. the mean serum cea and cyfra 21 - 1 levels prior to surgery were 6.823.1 mg / dl (range, 0.01 to 390.8 mg / dl) and 5.412.3 mg / dl (range, 0.65 to 140.2 mg / dl). the serum cea and cyfra 21 - 1 levels were broken down according to clinicopathologic parameters in tables 1 and 2. serum cea levels were associated with tumor (t) stage (t1 vs. t2 vs. t3/4, p=0.032) and n stage (n0 vs. n1 vs. n2/3, p<0.001) and histology (adenocarcinoma vs. squamous cell vs. large cell, p=0.032) but not with sex, age, smoking status, or tumor size. t and n stage and histology were analyzed by multivariate analysis to further assess their association with preoperative serum cea levels. multiple linear regression analysis indicated that t (t3/4 vs. t1 : =8.463, p=0.010) and n stage (n2/3 vs. n0 : =9.208, p<0.001) and histology (adenocarcinoma vs. squamous cell : =6.838, p=0.001) were correlated with preoperative cea levels (table 1). serum cyfra 21 - 1 levels were associated with t stage (t1 vs. t2 vs. t3/4, p=0.010), tumor size (<3 vs. 3, p<0.002), and histology (adenocarcinoma vs. squamous cell vs. large cell, p=0.003). these factors were analyzed by multivariate analysis to further assess their association with preoperative serum cyfra 21 - 1 levels. multiple linear regression analysis indicated that tumor size (=2.579, p<0.001) and histology (squamous cell vs. adenocarcinoma : =4.420, p=0.020) were correlated with preoperative cyfra 21 - 1 levels (table 2). the mean serum cea and cyfra 21 - 1 levels prior to surgery were 6.823.1 mg / dl (range, 0.01 to 390.8 mg / dl) and 5.412.3 mg / dl (range, 0.65 to 140.2 mg / dl). the serum cea and cyfra 21 - 1 levels were broken down according to clinicopathologic parameters in tables 1 and 2. serum cea levels were associated with tumor (t) stage (t1 vs. t2 vs. t3/4, p=0.032) and n stage (n0 vs. n1 vs. n2/3, p<0.001) and histology (adenocarcinoma vs. squamous cell vs. large cell, p=0.032) but not with sex, age, smoking status, or tumor size. t and n stage and histology were analyzed by multivariate analysis to further assess their association with preoperative serum cea levels. multiple linear regression analysis indicated that t (t3/4 vs. t1 : =8.463, p=0.010) and n stage (n2/3 vs. n0 : =9.208, p<0.001) and histology (adenocarcinoma vs. squamous cell : =6.838, p=0.001) were correlated with preoperative cea levels (table 1). serum cyfra 21 - 1 levels were associated with t stage (t1 vs. t2 vs. t3/4, p=0.010), tumor size (<3 vs. 3, p<0.002), and histology (adenocarcinoma vs. squamous cell vs. large cell, p=0.003). these factors were analyzed by multivariate analysis to further assess their association with preoperative serum cyfra 21 - 1 levels. multiple linear regression analysis indicated that tumor size (=2.579, p<0.001) and histology (squamous cell vs. adenocarcinoma : =4.420, p=0.020) were correlated with preoperative cyfra 21 - 1 levels (table 2). cea was mainly elevated in adenocarcinoma and cyfra 21 - 1 in squamous cell carcinoma. tumor markers such as cea and cyfra 21 - 1 have been studied for the purpose of early cancer detection, prognostic stratification, and monitoring of the treatment response and cancer recurrence, although the use of these markers for lung cancer detection or monitoring is not currently recommended or encouraged. the guidelines of the national comprehensive cancer network on nsclc do not include preoperative cea or cyfra 21 - 1 in pretreatment evaluation. adjuvant chemotherapy might be considered the standard treatment in stage ii and iii lung cancer with the evidence that it improves patient survival. stratifying patients who will benefit from adjuvant treatment for stage ib is the current issue. the possible roles of cea and cyfra 21 - 1 in nsclc are expected to stratify the prognosis. several studies have reported that patients with elevated preoperative serum levels of cea and cyfra 21 - 1 had a shorter overall survival compared to those with normal marker concentrations [3 - 10 ]. even more tumor marker index (the square root of cyfra 21 - 1 concentration/3.3 ng / mlcea concentration/5.0 ng / ml) based on cyfra 21 - 1 and cea was suggested as a prognostic factor in nsclc. however, other studies have found that elevated preoperative serum levels of cea and cyfra 21 - 1 were completely lacking in prognostic value [11 - 13 ]. according to our data, elevated cea and cyfra 21 - 1 levels both showed poor prognosis. however, in multivariate analysis, neither had any significance. only well - known prognostic factors such as t and n stage and tumor size were significant (data not shown). based on these findings, we believed that serum levels of cea and cyfra 21 - 1 might be closely correlated with pathologic parameters, which could explain the poor prognosis of elevated cea and cyfra 21 - 1. we found that the serum cea level was correlated with the t and n stage and cyfra 21 - 1 with tumor size. although it is generally accepted that serum cea and cyfra 21 - 1 levels are associated with more advanced stage [6,17 - 20 ], some studies have suggested that these levels are not always related to tnm stage and their prognostic significance might be due to different mechanisms ; accordingly cea and cyfra 21 - 1 were independent prognostic factors and could be used to stratify prognosis [21 - 23 ]. in summary, our results indicate that preoperative serum levels of cea and cyfra 21 - 1 seem to be associated with pathologic parameters. cea was mainly elevated in adenocarcinoma and cyfra 21 - 1 in squamous cell carcinoma. these findings might be helpful in predicting pathologic status in preoperative nsclc but could not provide additional information to predict patient prognosis and develop a treatment plan. | backgroundthis study focused on the association between preoperative serum carcinoembryonic antigen (cea) and cytokeratin 19 fragment (cyfra 21 - 1) levels and pathologic parameters in patients with resected non - small - cell lung cancer (nsclc).materials and methodsthe records of 527 patients who underwent pulmonary resection of nsclc were reviewed. the association between preoperative serum cea and cyfra 21 - 1 levels and variables that had p - values of less than 0.05 in a t - test or one - way analyses of variance was analyzed by multiple linear regression.resultsthe mean serum cea and cyfra 21 - 1 levels prior to surgery were 6.823.1 mg / dl (range, 0.01 to 390.8 mg / dl) and 5.412.3 mg / dl (range, 0.65 to 140.2 mg / dl). the serum cea levels were associated with tumor (t) and lymph node (n) stage and histology. the serum cyfra 21 - 1 levels were associated with t stage, tumor size, and histology. multiple linear regression indicated that serum cea levels were associated with t (t3/4 vs. t1 : =8.463, p=0.010) and n stage (n2/3 vs. n0 : =9.208, p<0.001) and histology (adenocarcinoma vs. squamous cell : =6.838, p=0.001), and serum cyfra 21 - 1 levels were associated with tumor size (=2.579, p<0.001) and histology (squamous cell vs. adenocarcinoma : =4.420, p=0.020).conclusionserum cea level was correlated with t and n stage, and cyfra 21 - 1 with tumor size. cea and cyfra 21 - 1 showed histologic correlation. cea is mainly elevated in adenocarcinoma and cyfra 21 - 1 in squamous cell carcinoma. these results might be helpful for predicting pathologic status in preoperative nsclc. |
after the first seal epidemic occurred in 1988/89, caused by a phocine distemper virus, a network along the coasts of the german federal state schleswig holstein was established to monitor stranded marine mammals. during necropsy of stranded harbour porpoises and harbour seals findings frequently showed nematodes including lungworms otostrongylus circumlitus (crenosomatidae) and parafilaroides gymnurus (filaroididae) of harbour seals (lehnert., 2005, lehnert. o. circumlitus was found in the bronchi, in the right heart chamber, the vena pulmonalis and in the blood vessels of the liver (de bruyn, 1933, onderka, 1989, claussen., 1991, measures, 2001, lehnert., 2007), while p. gymnurus mainly parasitised the alveoles and bronchioles (stroud and dailey, 1978 ; claussen., 1991). varying lungworm prevalence, up to 76%, was reported in harbour seals found in the german wadden sea (claussen., 1991, lehnert., 2007, siebert., 2007). infections were age - related, with most infections occurring in young animals between two and 18 months of age. harbour seals may start acquiring lungworm infections after nursing for four weeks and after a post - weaning fast of 1517 days (muelbert and bowen, 1993, ross., benthic fish were identified as potential intermediate hosts of lungworms (dailey, 1970, bergeron., 1997a, lehnert., 2010) ; however, the complete life cycle is yet unknown. lungworms in harbour seals can cause severe pathological changes, like obstruction of bronchial tubes, and are often accompanied by bacterial infections leading to severe bronchopneumonia and death (measures, 2001, lehnert. clinical symptoms include bronchospasm, anorexia, dehydration, and individual o. circumlitus specimens can be observed in sputum (bergeron. lungworm infections are mainly reported from stranded harbour seals during post mortem examinations (claussen., 1991, siebert., 2007, rijks., 2008), but those data can be biased by different influences such as age, diseases and anthropogenic activities (claussen., 1991, measures, 2001, siebert., 2007). diagnosis in living seals is difficult, as detecting lungworm larvae in faeces has limited sensitivity (schnieder, 1992). collecting harbour seal faeces is logistically challenging and assigning samples to individual free ranging seals is not feasible. due to the difficulties in diagnosing lungworm infections in living seals, prevalence data in the free - ranging harbour seal populations therefore, an existing elisa for immunodiagnosis of the bovine lungworm dictyocaulus viviparus (schnieder, 1992, von holtum., 2008) was adapted to harbour and grey seals with a resulting sensitivity of 98% and a specificity of 100% (ulrich., 2015). the elisa represents a reliable method for diagnosing lungworm antibodies in serum samples of free - ranging harbour seals. recombinant major sperm protein (msp), a protein family occurring in nematode sperm only (klass and hirsh, 1981, ward., 1988) serves as diagnostic antigen. information about the molecular structure of msp from nematodes infecting harbour seals and harbour porpoises is missing. previous phylogenetic analyses within the metastrongyloidea have been performed on the base of large - subunit and small - subunit ribosomal (r)rna (carreno and nadler, 2003), the its-2 region of rdna (lehnert., 2010) and the 18s and 28s rrna (chilton., 2006). those analyses confirmed the close relationship of marine mammal lungworms within their superfamily metastrongyloidea, an evolutionary old group that was derived from the terrestrial ancestors of seals and porpoises (anderson, 1984, carreno and nadler, 2003). the aim of this study was to assess lungworm seroprevalence in free - ranging harbour seals in different age groups. furthermore, consecutive serum samples of harbour seals in rehabilitation were analysed to obtain first information on the persistence of serum anti - lungworm - msp antibodies. additionally, msp genes from different nematodes infecting harbour porpoises and harbour seals were identified and sequenced to explore phylogenetic relationships between marine and terrestrial parasitic nematodes. the approximate age of sampled harbour seals was determined and sorted in age groups, considering sampling date, body - length and body - weight. in young seals, navel and canine development was additionally considered. age group (ag) 1 included harbour seals from birth to six weeks of age, ag 2 harbour seals from six weeks to six months, ag 3 from six to 18 months and ag 4 above 18 months of age. all experimental procedures involving harbour seals were approved by the ministry of energy, agriculture, the environment and rural areas of the federal state schleswig holstein, germany [permit number : v312 - 72241.121 - 19 (70 - 6/07) ], the danish nature agency (sns-3446 - 00054 and sn 2001 - 34461/sn-0005) and the animal welfare division (ministry of justice, denmark, 2005/561 - 976). 141 serum samples were taken in june, one sample in may and two samples in july. as 95% of harbour seals are born in june, and nursing takes four weeks, pups sampled in may and june were considered as not weaned (ross., 1994, the two animals sampled in july had an unknown weaning status and harbour seals captured in september 2014 were designated as weaned because sampling was conducted when the harbour seals had already finished nursing. because of their approximate age, ag 3 and ag 4 animals were considered as weaned regardless of the sampling date. blood was taken with a 1.20 100 mm needle (supra, ehrhardt medizinprodukte, geislingen, germany) from the extradural intervertebral sinus 5 cm cranial to the pelvis (dierauf and gulland, 2001), or from the tarsal sinus of the hind flippers (sanchez contreras, 2014) and filled in tubes containing serum separation gel. serum was obtained by centrifugation at 3000x g for 15 min and stored at 20 c until use. consecutive serum samples were taken for routine diagnostic examinations from six harbour seals at the seal rehabilitation and research center (srrc), pieterburen, the netherlands (table 1). the animals were found between january and june 2015 and were suspected or diagnosed to have lungworm infections. o. circumlitus specimens were found in sputum in three of six individuals, and all six harbour seals showed symptoms like dyspnoe, coughing and a poor body condition. samples were taken on three to five different occasions during a period of about 1219 weeks (fig. 1). statistical significance of differences between body weight and body length and age distribution within the lungworm infected and negative animals was tested using sigmastat (version 3.11, systat software gmbh, erkrath, germany). all sera were tested with the harbour / grey seal adapted recombinant msp - elisa as previously described (ulrich., 2015). all samples were analysed in duplicates and the optical density (od) arithmetic mean of the duplicates was corrected for the blank value. serum samples were assigned as positive or negative considering the evaluated cut - off value of 0.422 od (ulrich., 2015). adult nematodes were collected during necropsies of harbour seals and harbour porpoises and their species identified by stereomicroscopic examination (45x magnification ; olympus sz 61, hamburg, germany). nematodes of harbour seals included lungworms (o. circumlitus, crenosomatidae : metastrongyloidea and p. gymnurus, filaroididae : metastrongyloidea), heartworms (acanthocheilonema spirocauda, onchocercidae : filarioidea), intestinal nematodes (contracaecum osculatum and pseudoterranova decipiens, anisakidae : ascaridoidea) and lungworms of harbour porpoises (pseudalius inflexus, torynurus convolutus, halocercus invaginatus and stenurus minor, pseudaliidae : metastrongyloidea). nematodes were washed with a 0.9% sodium chloride solution and stored at 80 c until use. genomic dna was isolated from female and male individuals using nucleospin tissue kit (macherey nagel, dueren, germany) following the manufacturer 's instructions. degenerated primers spanning the msp gene from the start to the stop codon were designed based on nine known msp sequences [d. viviparus (genbank accession no. ef012201), dictyocaulus arnfieldi (kr267306), dictyocaulus eckerti (kr267310), oesophagostomum dentatum (aj627870), ancylostoma ceylanicum (cb176474), haemonchus contortus (bm138909), nippostrongylus brasiliensis (bu493394), teladorsagia circumcincta (cb037984) and trichostrongylus vitrinus (aj616498) ]. selected primer sequences were msp deg for : 5-atggchwcagttcchcchgghgayatc-3 and msp deg rev : 5-tcadggrttgtaytcratvgg-3. pcr reaction setup was as follows : 16 l deionized h2o, 2.5 l 10 buffer, 0.5 l dntp (10 mm each), 1.25 l forward and reverse primer (10 m each) and 0.5 l perfect taq polymerase (5 u/l, 5 prime gmbh, hilden, germany), respectively were added to 3 l genomic dna as template. pcr cycling (40 cycles) was performed using the following temperature profile : initial denaturing at 95 c for 4 min, denaturing at 95 c for 30 s, annealing primers at 55 c for 1 min, extending primers at 72 c for 1 min, and final extension at 72 c for 10 min. gel electrophoresis [1% agarose gels stained with gel red (biotium, inc., hayward, canada) ] was performed and visible bands were cut out of the gel, ligated into pcr 4-topo vector followed by transformation of escherichia coli one shot top 10 cells (topo ta cloning kit for sequencing ; invitrogen, karlsruhe, germany). plasmid inserts obtained by using the dna nucleospin plasmid kit (macherey nagel, dueren, germany) were sequenced at the seqlab sequence laboratories (gttingen, germany). sequences of the degenerated primers were removed from the received msp sequences before submission to genbank (accession nos. kr267315-kr267323) and phylogenetic analyses. to obtain the full - length msp mrna transcript, gene - specific 3 and 5 race primers were designed based on the obtained o. circumlitus genomic msp sequence with the primerselect program (dnastar, version 5.06 ; gatc biotech, konstanz, germany). designed 3 race primer sequence was 5-atgcgatacgtttgagtatggtcgtgaggacacca-3, the 5 race primer sequence was 5-gtgttgcaccactcaacagtgatacggtcg-3. race experiments were performed using the smart race cdna amplification kit (clontech, heidelberg, germany) following the manufacturer 's recommendations. the full length transcript was generated by overlapping sequences using clone manager 9 (professional edition, scientific and educational software, morrisville, north carolina, usa) and submitted to genbank (accession no. msp nucleotide and deduced amino acid sequences of harbour seal and harbour porpoise nematodes were compared to those of nematodes affecting terrestrial animals. the sequences were aligned with the clustal w method and phylogenetic analyses were performed by bootstrap tests of phylogeny (1000 replicates) using the maximum likelihood method of the software package mega 6.0 (tamura., 2013), respectively. the best fit model was determined comparing maximum likelihood fits of 24 different nucleotide substitution models including general time reversible (gtr), hasegawa - kishino - yano (hky), tamura - nei (tn93), tamura 3-parameter (t92), kimura 2-parameter (k2), jukes - cantor (jc) and maximum likelihood fits of 48 different amino acid substitution models including general time reversible (gtr), jones - taylor - thornton (jtt), general reverse transcriptase (rtrev), general reversible chloroplast (cprev), general reversible mitochondrial (mtrev24). models were determined in consideration of the corrected akaike information criterion (aicc), the bayesian information criterion (bic), the maximum likelihood value (inl) and the number of parameters (including branch lengths) by using the software mega 6.0 (nei and kumar, 2000, tamura., 2013). in all four age groups of habour seals the lungworm seroprevalence was 17.9% (56/313 individuals). separated according to sex, 18.9% male (32/169) and 16.7% female (24/144) harbour seals were seropositive. in ag 1 only one serum sample of the male harbour seal pups sampled in mid - july (unknown weaning status) showed a positive elisa result with 0.582 od (0.7%, table 1). the arithmetic mean od value of all 144 analysed samples of ag 1 was 0.056 od (sd 0.075). within the ag 2 to 4, a lungworm seroprevalence of 32.5% was determined with 55 lungworm - positives out of 169 total samples (table 1). the arithmetic mean of the positive samples was 0.912 od [standard deviation (sd) = 0.51 ], whereas the arithmetic mean of the negative samples was 0.219 od (sd = 0.09). in ag 2, 88.9% of harbour seals were seropositive, 53.6% in ag3 and 24.2% in ag 4 which was significantly less prevalent (p=<0.0001) than in ag 2 and ag 3. a significant decrease in body weight (p = 0.003) and body length (p=<0.001) was determined in lungworm - positive animals of ag 4 (table 2). detailed results on arithmetic means of the positive and negative od values and sd of the different age groups are given in table 2. serum samples of all six investigated individuals (ag 3) showed positive od values on arrival at the seal rehabilitation and research centre, pieterburen, the netherlands (arithmetic mean : 1.345 od ; sd 0.512). three of six animals coughed up lungworms on arrival (individuals 13, fig. 1). one harbour seal showed a negative od (0.339 od) seven days after the first antiparasitic treatment, two more animals turned antibody - negative 60 days after, and a further individual 88 days after the second antiparasitic treatment. two of six individuals still showed positive ods at the final examination before release 71 and 112 days after finishing the antiparasitic treatment scheme (fig. 1). genomic msp sequences of the nine investigated marine mammal nematode species contained intron sequences between 59 and 83 base pairs (bp) in length. the full - length msp mrna of o. circumlitus included 415 bp without poly(a)+ tail. the 5 untranslated region (utr) consisted of 14 bp, the 3 utr of 17 bp. the full coding sequence comprised 381 bp encoding 126 amino acids as well as d. viviparus. sequence comparison showed that o. circumlitus and d. viviparus differed in one amino acid at position 34, at which isoleucine of d. viviparus was substituted by methionine in o. circumlitus. p. gymnurus differed in three amino acids from d. viviparus, most substitutions (six amino acids) were found for p. decipiens (anisakidae, ascaridoidea). phylogenetic trees including 18 msp sequences of marine and terrestrial mammal parasitic nematodes on nucleotide and amino acid level are given in fig. the kimura 2- parameter using a discrete gamma distribution with five rate categories was defined as the best fit nucleotide substitution model with 35 parameters, a bic of 3519,661638, a aicc of 3290,173685 and an inl of 1609,846293. the best fit amino acid substitution model was determined to be jones - taylor - thornton using a discrete gamma distribution with five rate categories with 34 parameters, a bic of 1137,728758, a aicc of 951,1837439 and an inl of 440,9376663. on nucleotide level, d. viviparus, d. arnfieldi and d. eckerti, belonging to the subfamily dictyocaulidae (trichostrongylidea), showed a genetic similarity of 94% and 82% (fig. 4) and were 100% identical on amino acid level (fig. 5). on amino acid level, msp of marine mammal parasites grouped in the same cluster as the dictyocaulidae (trichostrongyloidea). the other included species of the superfamily trichostrongyloidea (n. brasiliensis, t. vitrinus, t. circumcincta, h. contortus), together with the two further terrestrial mammal parasites oesophagostomum dentatum (strongyloidea) and a. ceylanicum (ancylostomatoidea), formed a separate cluster from the dictyocaulidae and marine mammal parasites (fig. 5). in the present study, prevalence of lungworm infection in live free - ranging harbour seal populations was investigated for the first time. assuming lungworm larvae transmission to be dependent on preying upon the intermediate hosts, unweaned seal pups (ag 1) were unlikely to be infected by o. circumlitus and p. gymnurus as they did not consume fish or other potential intermediate hosts (dailey, 1970, bergeron., 1997a, lehnert., 2010). supporting that hypothesis, the one seropositive individual of ag 1 was sampled in mid - july, about six weeks after majority of harbour seals give birth to their offspring (bonner, 1972 ; siebert., 2012). after nursing and the post - weaning fast, which takes approximately six weeks in total (muelbert and bowen, 1993, ross., 1994), the lungworm - positive specimen may have been already preying and developing adult parasites. even though a lungworm - infection in mid - july seems early, it may be explained by early births during the breeding period (measures, 2001). additionally, the measured od value of the seropositive seal pup is 0.582 od, which is relatively close to the cut - off value of 0.422 od and distinctively away from the mean positive od values of ag 2 (1.264 od) and ag 3 (1.019 od). this indicates that the lungworm positive seal pup was in early patency and had just started to develop anti - msp antibodies, which supports the aforementioned aspects on infection time pattern. in ags 2 to 4, 32.5% of the free - ranging harbour seal population in the german wadden sea and danish kattegat was seropositive for lungworm infections. the majority of seropositive animals belonged to ag 2 (88.9%) and ag 3 (53.6%), covering 7 weeks18 months of life, confirming age - related lungworm infection reported previously (onderka, 1989, claussen., 1991, lehnert., 2007, siebert., 2007). ag 3 represents a transition between young seals (ag 2) being infected often by lungworms and adult seals (ag 4) showing a seroprevalence of only 24.2%. in contrast to harbour seals, lungworm infections in harbour porpoises seem to accumulate with age and could possibly have infections throughout their life - time (measures, 2001, lehnert., 2005). this may be due to harbour porpoises being weaned eight to ten months later than harbour seals (lockyer, 2003). they therefore get infected at a later point when they start ingesting prey species (lockyer, 2003). however, transmission of marine lungworm larvae is not completely understood. besides food - borne infection, transplacental transmission in cetaceans has been hypothesised (dailey., 1991) and transmammary infection can not be excluded (conlogue., 1985). another explanation for parasite accumulation in harbour porpoises is the possible lack of protective immunity to lungworm infections in this marine mammal species. because adult harbour seals were observed to be less infected than young seals, a development of a protective immunity has been assumed (claussen., 1991, bergeron., 1997b). such immunity has been described in cattle against the bovine lungworm d. viviparus (jarrett., 1958, jarrett., 1959, 1995), lasting for a period of approximately six to twelve months (michel., 1965). whether seropositive animals of ag 4 are due to a reinfection event after loss of immunity or due to remaining antibodies against a lungworm infection in previous age groups remains unknown to gain first information on the persistence of anti - lungworm antibodies in harbour seals, six individuals were monitored serologically during rehabilitation. animals were treated with anthelmintics after arrival to the rehabilitation center, but this may not have an impact on antibody persistence. for cattle it has been shown that anthelmintic treatment in advanced patency did not influence lungworm antibody titers (fiedor., 2009). the longest seropositivity determined was for an individual that was still positive at release 132 days after arrival. another animal turned seronegative between day 100 (fourth sampling) and day 109 (fifth sampling), and another still, was seropositive at its release on day 92. two animals turned seronegative between day 13 (second sampling) and day 81 (third sampling) after arrival, and one individual was already seronegative 13 days after arrival. as the latter had a very low positive od value on arrival, it may be concluded that this individual was already in the post - patency phase. however, as the time point of infection and the duration of patency in harbour seals is unknown (measures, 2001), it can only be assumed that those harbour seals with longer lasting antibody titers got infected at a later point compared to those whose antibodies decreased earlier. studies on serum persistence of lungworm - antibodies in cattle revealed positive od values until day 41203 post infection (pi) with an overall mean detection period until day 126143 pi (cornelissen., 1997, antibody persistence in harbour seals may be similar, but further studies with a larger sample size or experimental infection studies are needed to confirm this presumption. harbour seals that had never been affected by lungworms or those who had overcome a lungworm infection relatively early, are assumed to be able to dive and prey appropriately to their needs as opposed to infected seals. as a consequence, lungworm infected seals are not able to grow as fast as their healthy conspecifics due to respiratory difficulties and shorter diving and feeding times (onderka, 1989, measures, 2001). this became obvious in ag 4, in which lungworm seropositive harbour seals showed statistically significantly reduced body weights and lengths compared to the sero - negative individuals. lungworm infected harbour seals in ag 3 showed a trend towards reduced body weight (p = 0.051), whereas body length was unaffected. similarly, a negative correlation between infection with o. circumlitus and sternal blubber thickness has been reported for ringed seals (bergeron., 1997b). lungworms, as well as all other nematodes, possess the sperm protein msp, which enables sperm motility (miller. the molecular characteristics of this protein has been described in several terrestrial host species, including the bovine lungworm d. viviparus (strube., 2009), whose msp serves as diagnostic antigen in the cattle as well as harbour seal lungworm elisa (von holtum., 2008, fiedor., 2009, ulrich., 2015) however, no molecular information on msp from nematodes infecting harbour seals and harbour porpoises was available. as msp is essential for nematode reproduction, and thus for conservation of the species, conservation of the protein was expected (klass and hirsh, 1981, miller., 2001, smith, 2014). the phylogenetic analyses revealed that msp sequences of the trichostrongylid dictyocaulidae are more closely related to msp of the metastrongylid lungworms of marine mammals than to trichostrongylid intestinal nematodes of terrestrial hosts, which formed a separate cluster with strongylid and ancylostomatid representatives. this might indicate that dictyocaulid lungworms may belong to the superfamily metastrongyloidea rather than to the trichostrongyloidea. phylogenetic analysis of mitochondrial encoded proteins showed that the dictyocaulidae grouped with the exclusion of the terrestrial metastrongylid lungworms of the genus metastrongylus and angiostrongylus as well as trichostrongylid (h. contortus), strongylid (o. dentatum) and ancylostomatid (ancylostoma caninum) nematodes (gasser., 2012). as the present study was based on one gene, further analyses are necessary to verify or falsify the current taxonomical allocation of the dictyocaulidae to the superfamily trichostrongyloidea. in all age groups of live free - ranging harbour seals an age - related lungworm seroprevalence of 17.5% was found. young seals between six weeks and six months were most often infected with a seroprevalence of 88.9% and seals of six to 18 months had a seroprevalence of 56.5%. analyses on the persistence of lungworm anti - msp antibodies in harbour seals showed that a protective immunity may be assumed and antibody persistence patterns may be similar to that of cattle. the msp - elisa proved to be a valuable method to screen live seals for lungworm infections, providing important data for health surveillance, management and conservation of free - ranging harbour seal populations. moreover, the molecular msp similarity within the superfamily metastrongyloidea provides potential for future development of an elisa for lungworm detection in harbour porpoises. none of the authors of this paper has a financial or personal relationship with other people or organisations that could inappropriately influence or bias the content of the paper. | harbour seals (phoca vitulina) are frequently infected with the lungworms otostrongylus circumlitus and parafilaroides gymnurus. the infection is often accompanied by secondary bacterial infections and can cause severe bronchopneumonia and even death in affected animals. hitherto, the detection of lungworm infections was based on post mortem investigations from animals collected within stranding networks and a valid detection method for live free - ranging harbour seals was not available. recently, an elisa was developed for detecting lungworm antibodies in harbour seal serum, using major sperm protein (msp) of the bovine lungworm, dictyocaulus viviparus as recombinant diagnostic antigen. to determine lungworm seroprevalence in free - ranging harbour seals, serum was taken from four different seal age groups (n = 313) resulting in an overall prevalence of 17.9% (18.9% of males, 16.7% of females). 0.7% of harbour seals up to six weeks of age were seropositive, as were 89% of seals between six weeks and six months, 53.6% between six and 18 months and 24.2% of seals over 18 months of age. in the 18 months and over age group, seropositive animals showed statistically significant reductions in body weight (p = 0.003) and length (p < 0.001). sera from lungworm infected harbour seals in rehabilitation (n = 6) revealed that duration of antibody persistence may be similar to that of lungworm infected cattle, but further studies are needed to confirm this. phylogenetic analyses of msp sequences of different marine and terrestrial mammal parasitic nematodes revealed that lungworm msp of the genus dictyocaulus (superfamily trichostrongyloidea) is more closely related to metastrongylid marine mammal lungworms than to trichostrongylid nematodes of terrestrial hosts. |
the national toxicology program (ntp) database was examined for tumor incidences and chemicals producing tumors in the nasal cavity, larynx, or trachea. slides from appropriate studies were then examined in an attempt to unify terminology and make comparisons between induced and spontaneous tumors and hyperplastic or preneoplastic lesions produced in the upper respiratory system. an attempt was also made to compare the species affected, route of administration, and tumor types produced by different chemicals. the results are not meant to be all inclusive of the ntp database but to be representative of observed trends. general conclusions that emerged from this review were that rats are much more susceptible to epithelial tumors of the nasal cavity than mice ; that only mice have been reported to have chemically induced hemangiomas and hemangiosarcomas of the nasal cavity ; that tumors of the olfactory epithelium and squamous cell tumors of the respiratory epithelium are almost uniformly malignant and invasive, while other tumors of the respiratory epithelium are typically less invasive ; that most chemically induced tumors of the olfactory region, either mesenchymal or epithelial, do not require an inhalation route of exposure but appear to occur by systemic targeting of this region ; and that a uniform nomenclature for tumors of the nasal cavity is needed.imagesplate 1.plate 2.plate 3. aplate 3. bplate 3. cplate 4. aplate 4. bplate 5. aplate 5. bplate 6. aplate 6. bplate 7.plate 8. aplate 8. bplate 8. cplate 9.plate 10. aplate 10. bplate 11.plate 12.plate 13.plate 14.plate 15.plate 16.plate 17.plate 18. aplate 18. bplate 19. aplate 19. b |
|
november 2009, samples of whole blood from 8 febrile horses (h18 ; temperatures 39.5c42c) in israel were collected into edta tubes and analyzed at the koret school of veterinary medicine (hebrew university, rehovot, israel). vero cell (american type culture collection, manassas, va, usa) culture results of blood from h3, h5, and h8 were positive for eev (table 1 ; figure 1). positive cases were confirmed by reverse transcription pcr of dsrna genome segment 10. geographic location of farms in israel with horses showing signs of equine encephalosis virus (eev) infection. total rna was extracted from the fifth and sixth passages of all 3 samples by using the qiaamp viral rna mini kit (qiagen, valencia, ca, usa) to obtain sufficient viral load for the subsequent analyses and replications. rna was reverse transcribed into cdna by using the verso cdna kit (thermo fisher scientific, epsom, uk). pcr amplification of the gene encoding ns3 (seg-10) was performed on the 3 isolates by using gotaq green master mix (promega, madison, wi, usa) with the following primers : 5-gtt aag ttt ctg cgc cat gt-3, 5-gta aca cgt ttc cgc cac g-3. thermal cycling conditions for the pcr were as previously described (9) ; the primer annealing temperature was modified to 53.5c. pcr products were purified by using a cdna purification kit (exosap - it ; usb, cleveland, oh, usa), and sequencing was conducted by bigdye terminator cycle sequencing chemistry (applied biosystems, foster city, ca, usa) in an abi 3700 dna analyzer (applied biosystems) by using abi data collection and sequence analysis software. further analysis of the ns3 sequence was performed with sequencer software, version 4.8 (gene codes corp., ann arbor, mi, usa). hq441245 for h5, hq441246 for h3, and hq441247 for h8. the ns3 genes (seg-10) were compared with those of different eevs (9) and other related orbiviruses (table 2). phylogenic trees were generated by using the neighbor - joining and maximum likelihood methods (phylip inference package version 3.68, seqboot program ; j. felsenstein, university of washington, seattle, wa, usa) to create 100 datasets (bootstrapping) and the dna maximum likelihood program version 3.5 (http://cmgm.stanford.edu/phylip/dnaml.html) to construct the trees. finally, the consense program version 3.5c (http://cmgm.stanford.edu/phylip/consense.html) was used to create a final consensus tree for our dataset. broadhaven virus, a tick - borne orbivirus, was used as the outgroup in the phylogram for the gene encoding ns3. seg, dsrna genome segment ; eev, equine encephalosis virus ; fld, field strain ; ref, reference strain ; n rand, north rand ; ahsv, african horse sickness virus ; brdv, broadhaven virus ; btv, bluetongue virus ; palv, palyam virus ; ehdv, epizootic hemorrhagic disease virus ; h5, h3, h8, horses 5, 3, 8. the phylogenetic analyses of eev seg-10 grouped the israeli isolates with other eev isolates but as a distinct group with no close relation to african horse sickness virus, btv, or epizootic hemorrhagic disease virus. within the eev group, 3 discrete clusters (a, b, c) were recognized ; the israeli isolates formed one of these clusters (c ; figure 2). the israeli isolates have 85%86% nt identity to cluster a and 75%76% nt identity to cluster b. phylogeny of equine encephalosis virus (eev) segment 10 (nonstructural protein 3 gene) isolated from horses in israel in 2009. the phylogenic tree was constructed by using the neighbor - joining method and bootstrapped with 100 replicates. other orbiviruses were included for reference, with broadhaven virus (brdv) selected as the outgroup. the 3 suggested eev clusters are marked green (cluster a), blue (cluster b), and orange (cluster c, representing the isolates from israel). ref, reference ; fld, field strain ; h3, h5, h8, horse 3, 5, and 8 ; ehdv, epizootic hemorrhagic disease virus ; btv, bluetongue virus ; palv, palyam virus ; ahsv, african horse sickness virus. in addition, full - length cdna copies of individual eev (from h3 and h8) genome segments were synthesized and amplified by reverse transcription pcr by using the anchor spacer partial sequences (for the upstream 450 bp) of seg-2 from the different israeli isolates were identical, showing 92.3% nt and 95.7% aa sequence identity with seg-2 and vp2 of the kaalplaas isolate, the reference isolate of eev-3 (genbank accession numbers are listed in table 2). previous phylogenetic comparisons of seg-2/vp2 from different btv types showed a maximum of 71% nt and 78% aa acid identity between serotypes (6), indicating that the isolates from israel also belong to eev type 3. equine encephalosis virus has long been enzootic to southern africa, but it has not been isolated in other parts of the world. analysis of seg-10 (the gene encoding ns3) of different orbiviruses showed 2 clusters of south african eev strains (a and b), in agreement with previously published studies (9). these 2 clusters appear to correlate with the geographic origins of the viruses in south africa, independent of their isolation date. it has been suggested that the 2 eev seg-10 clusters in south africa are related to the distribution of their culicoides spp. however, the eev isolates from israel group as a distinct cluster (c) with similar distances to the 2 south african clusters, raising questions concerning the geographic origin of this virus. a similar finding has been observed in african horse sickness virus seg-10, which also forms into 3 distinct groups (13). the question of how and when the virus was initially introduced to israel remains unanswered. because the clinical manifestations of equine encephalosis are usually mild, it is often overlooked and underdiagnosed. eev could have been introduced to israel before the virus was first isolated in 2009. alternatively, the virus might have been introduced into neighboring countries and transmitted into israel by infected vectors carried by winds, as described for other orbiviruses (14,15). the fact that the israeli strain of eev-3 grouped in a different cluster than the 2 south african strains, supports the idea that it has evolved in this region for a sufficient time to accumulate these changes and most likely was not recently introduced into israel from south africa. | during 20082009 in israel, equine encephalosis virus (eev) caused febrile outbreaks in horses. phylogenetic analysis of segment 10 of the virus strains showed that they form a new cluster ; analysis of segment 2 showed 92% sequence identity to eev-3, the reference isolate. thus, the source of this emerging eev remains uncertain. |
cerebral hypoxia leads to necrosis and apoptosis, in addition to other cellular reactions, such as angiogenesis, which promote recovery from brain injury (bhattacharya. the vascular endothelial growth factor (vegf) family comprises the trophic factors vegf - a, vegf - b, vegf - c, vegf - d, and placental growth factor, and stimulates the growth of new blood vessels (holmes., 2007). vegf is expressed in the central nervous system (cns) after injury (dore - duffy., 2007 ; chaitanya., 2013 ; leonard and gulati, 2013) and is an important regulator of vascular leakage in the brain. hypoxia induces the expression of vegf, leading to the formation of cerebral edema (bauer., 2010 ; baburamani., 2013) vegf can reduce the damage caused by hypoxia / ischemia in a number of ways (shimotake. 2013). during cerebral ischemia, vegf promotes neurogenesis (van rooijen. 2013), neurite outgrowth (cesca., 2012), and the survival of newborn neuronal precursors. it also has an important role in increasing the size of the subventricular zone after injury (gotts and chesselet, 2005). furthermore, inhibition of vegf expression after injury may exacerbate neuronal and glial damage (skold., 2006). however, increased endogenous vegf interacts with its receptors on ischemic vessels, and contributes to the disruption of the blood - brain barrier and subsequent leakage (zhang., 2011). therefore, understanding the relevant signaling pathway of vegf in response to hypoxia / ischemia, and devising ways to modulate it, is essential for the successful treatment of hypoxic / ischemic brain injury. in this review, we provide an overview of the vegf signaling pathway and discuss its role in hypoxic / ischemic brain injury. vegf is an endothelial cell - specific mitogen and a secreted dimeric protein, and as such can induce angiogenesis in a variety of ways (dzietko., 2013 ; morgan., 2007 ; holzer., 2013). the role of vegf in angiogenesis is crucial for the development and regeneration / restoration of tissue, as well as for tumor formation (morgan. rodent models of hypoxia / ischemia have demonstrated that angiogenesis provides the right neurovascular microenvironment for neuronal remodeling (arai., 2009 ; xiong., 2011). lin. (2003) first found that vegf promotes the outgrowth of nerve fibers on cultured major pelvic ganglia in vitro. a large number of studies have suggested that activation of the vegfvegfr signaling pathway is beneficial to neurobehavioral recovery and neurovascular remodeling after hypoxic / ischemic brain injury (shimotake., 2010 ; zhao., 2011 in most mammalian tissues, vegf165 is the most common isoform of vegf, existing as a heparin - binding homodimeric glycoprotein of approximately 45 kda (holzer., 2013). vegf regulates physiological and pathological angiogenesis by binding to and activating the tyrosine kinase receptors vegfr-1 (flt-1) and vegfr-2 (flk-1) (ho., 2012). in vascular endothelial cells, vegf binds to vegfr-1 and (predominantly) vegfr-2, and stimulates angiogenesis in the periphery by triggering mitotic and migratory processes (shibuya and claesson - welsh, 2006). vegfr-2 is considered the major receptor for vegf - mediated activities (zachary and gliki, 2001). vegfr-1 binds to endogenous vegf and transmits the proliferation signal for astrocytes and the vasculature (shih., 2003 ; krum., 2008 ; sato., vegfr-1 is upregulated almost exclusively in reactive astrocytes (krum and khaibullina, 2003 ; khaibullina., 2004), while vegfr-2 is upregulated in neurons. furthermore, it has been shown that vegf stimulates axonal outgrowth by binding to vegfr-2. in situ hybridization and immunocytochemistry in adult mice revealed that vegf promotes axonal outgrowth from dorsal root ganglia, and that the vegfr-2 inhibitor su5416 prevented this process (sondel., 1999 ; olbrich., 2012). these findings provide sound evidence that vegf is necessary for the regeneration of peripheral nerves. hifs are important regulators of the transcriptional response to oxygen deprivation. in the adult hypoxic brain, the nuclear protein complex hif-1 is the most ubiquitously expressed member of the hif family. it is the best - characterized transcription regulator of vegf, and binds to the consensus sequence in target gene promoters. hypoxia induces hif-1 expression (josko and mazurek, 2004 ; dery., 2005). under normoxic conditions, hif-1 is rapidly degraded by the ubiquitin - proteosome system, but remains stable during hypoxia. the expression of hif-1 is increased in different cell types during hypoxia - induced cns injury (jin., 2000). furthermore, marti. (2000) revealed that hif-1 and vegf mrna are coexpressed in a mouse model of focal ischemia, and that the number of newly formed vessels is increased at the marginal zone of the cerebral infarction. the same group also analyzed the expression of vegf and vegfrs in hypoxic cells, observing a significant increase both in vegf in the ischemic region and in vegfrs at the border. these results strongly suggest that the hif-1-vegf - vegfr signaling pathway may be involved in the growth of new vessels after cerebral ischemic injury. in another study, (2004) used immunohistochemistry and in situ hybridization to detect the expression of the hif-1 subunit and vegf in the irradiated rat spinal cord. hif-1 expression was observed in glial cells expressing vegf (sondell., 2000), and vegf expression correlated with hif-1 expression. a number of hif-1-mediated regulators of genes such as vegf and erythropoietin may be relevant in cns injury responses (mu., 2003). in the ischemic or hypoxic brain, astrocytes are one of the main sources of erythropoietin. the pathway by which hif-1 mediates the transcriptional activation of erythropoietin expression may promote the survival of neurons during hypoxia via an astrocytic paracrine - dependent mechanism (fandrey, 2004). by activating the phosphatidylinositol-3-kinase (pi3k)-akt and extracellular signal - regulated kinase 1/2 (erk1/2) signaling pathways, erythropoietin increases the secretion of vegf in neural stem cells (xiong., 2011). upregulation of vegf increases vascular permeability and interstitial fluid pressure, and reduces perfusion and edema. although the precise mechanism by which vegf increases permeability remains unclear, it may involve action on tight junction proteins or adhesion molecules (radisavljevic. interrupting this secondary cycle of damage caused by vegf upregulation may improve neuroprotective strategies against cns radiation injury. above all, vegf may be involved in hypoxic / ischemic brain injury via the hif - erythropoietin - pi3k - akt and erk1/2-vegf pathways. raumatic brain injury (tbi) remains one of the main causes of serious, long - term disability. one of the most prominent pathophysiological changes after tbi is ischemia and hypoxia in the lesion boundary area, and the volume of ischemic tissue in early focal cerebral ischemia after tbi correlates with neurological outcome (coles., following tbi, a substantial increase in angiogenesis occurs, which may provide oxygen and nutrition for cerebral reconstruction (morgan., 2007). tbi - induced angiogenesis and functional recovery in the lesion boundary zone and hippocampus are improved by simvastatin, an effect which may be mediated by activation of the vegfr-2-akt - enos signaling pathway (wu., 2011). in vitro, simvastatin can stimulate endothelial cell tube formation after oxygen - glucose deprivation. simvastatin can also augment the expression of vegfr-2 in brain tissue and cultured rat microvascular endothelial cells, and this effect may be related to simvastatin - induced activation of akt. furthermore, simvastatin can also induce akt - dependent enos phosphorylation in vivo and in vitro (wu., 2011). many of the downstream angiogenic effects of vegf, such as microvascular permeability and endothelial cell proliferation, migration and survival, are mediated by vegfr-2 (hicklin and ellis, 2005). on the surface of endothelial cells, vegf activates intracellular tyrosine kinases by binding to vegfr-2, which triggers multiple downstream signals to stimulate angiogenesis. among these, akt - dependent enos phosphorylation is essential for angiogenesis (kureishi., 2000). phosphorylation of the protein kinase akt plays a crucial role in multiple cellular and physiologic effects (parcellier., the pro - survival effects of akt include anti - apoptosis, angiogenesis, and neuroprotection after brain injury (kilic., 2006 ; shein., 2007). in a tbi study (thau - zuchman., 2010), the effects of vegf on brain recovery and function were examined by infusing ectogenic vegf into the lateral ventricles of mice for 7 days after tbi. vegf had multiple effects, including promotion of neurogenesis and angiogenesis, neuroprotection, and improvement of functional recovery by mediating phospho - akt signaling (thau - zuchman., 2010). enos is a downstream mediator of vegfr-2 and is critical for angiogenesis (fischer., 2002). enos mediates vasodilation after hypoxic / ischemic episodes by increasing blood flow (bolanos and almeida, 1999). nitric oxide is synthesized by enos and is an essential component of the pathological and physiological response to hypoxia / ischemia (kaur and ling, 2008). simvastatin administration can activate akt - gsk-3 and enhance phosphorylation of enos in the tbi model (thau - zuchman., 2010), and phospho - enos in turn induces a series of downstream effects, such as angiogenesis and recruitment of mural cells to immature angiogenic sprouts (kashiwagi., 2005). the pro - angiogenic effects of vegf are thought to be attributed to vegfr-2, and the protective effect of vegf on cerebral cortical neurons may involve vegfr-2 dimerization to form a receptor complex with neuropilin-1 (sato., class ia pi3k and its downstream effector akt are enabled by the activation of vegfr-2 (koch., 2011). the pi3k - akt pathway is crucial for many vegf - dependent effects, including cell survival and migration, and vasopermeability (olsson., 2006). the vegf - pi3k - akt pathway is not only involved in endothelial permeability in vitro (pedram., 2002), but is also attributed to neuroprotection and blood brain barrier permeability in a mouse model of focal cerebral ischemia. furthermore, these effects are dependent on vegfr-2 (hicklin and ellis, 2005). this pathway may contribute to the maintenance of mitochondrial function under conditions of tissue oxygen deficit. akt is activated by phosphorylation of the bcl-2-associated death promoter, which increases the removal of bcl - xl from mitochondria, blocks the formation of the mitochondrial permeability transition pore, and maintains the mitochondrial membrane potential. in addition, bcl - xl depresses the activity of caspases 9 and 3 by blocking the release of cytochrome c from injured mitochondria, thereby restraining dna cleavage (cheng., 2010 ; wu., 2011). the specific mechanism by which vegf - vegfr-2 activates pi3k - akt is still unclear, but a recent report suggested that the receptor tyrosine kinase axl may be responsible for vegf - a - dependent activation of pi3k / akt (ruan and kazlauskas, 2012). the janus kinase (jak) family comprises four non - receptor tyrosine kinases, jak1, jak2, jak3 and tyk2. the first three are widely expressed in various tissues and cells, but tyk3 exists only in the bone marrow and lymph system. the stat family comprises seven latent cytoplasmic transcription factors that are involved in signal transduction mediated by cytokines and growth factors. activation of these cytokine receptors initiates jak phosphorylation and activation, which in turn phosphorylates stat. following tyrosine phosphorylation, stat proteins dimerize through the nuclear membrane into the nucleus, where they combine with genomic regulatory sequences and enhance the transcription of related genes (lai and johnson, 2010). in mammals, the jak - stat pathway is considered to be the major signaling mechanism for a number of growth factors and cytokines (ihle and kerr, 1995), and mediates a wide variety of biological functions in the cns including the regeneration of peripheral nerves (bella., 2006 ; lin., 2006 ; xu., 2009), and may also be involved in axon regeneration and in the proliferation and migration of schwann cells after sciatic nerve injury (xu., 2009). to date, most studies on the interaction between vegf and the jak - stat pathway have focused on tumors (roorda., 2010) and cellular invasiveness. whether vegf can directly activate the jak - stat pathway to promote neurite outgrowth has not been examined. vegf may achieve this by promoting angiogenesis or by binding with jak - stat directly, similarly to combining with neurotrophic factors. however, activation of stat3 can increase vegf expression, which indicates that another signaling pathway may be involved (wang. vegf expression can be induced by latent membrane protein 1 via both the jak - stat and mitogen - activated protein kinase (mapk)-erk pathways (wang., 2010). furthermore, the increased expression of vegf induced by elevated phosphorylation of stat3 after nerve injury may further sensitize the jak - stat pathway (bella., 2007). therefore, vegf may interact directly or indirectly with the jak - stat pathway. further understanding of the interaction between vegf and the jak - stat pathway will be beneficial to develop new therapies for neuronal recovery. the non - receptor tyrosine kinase src is another protein considered to be associated with angiogenesis (theus., 2006 ; tang., 2007) the activity of src kinase increases significantly during transient global ischemia (schlessinger, 2000) and this effect is associated with increased vascular permeability mediated by vegf (paul., 2001 ; mice lacking the src subtype pp60c - src are resistant to this increase in vegf - induced vascular permeability and have smaller infarct volumes after stroke. however, mice lacking pp59c - fyn, another member of the src family, do not show these effects (paul., vegf induces endothelial activation and vascular leak mainly via vegfr-2 (mason., 2004) and src (eliceiri., 1999 src - suppressed c kinase substrate (ssecks) is widely expressed in astrocyte - like, neuron - like and endothelial - like cells (zan., 2011). under ischemic conditions, src and ssecks inhibition of src decreases vegf - induced vascular permeability and infarct volume (bella., 2007) and alleviates brain edema and injury (akiyama., 2004 ; lennmyr., accordingly, inhibitors of vegf or src kinases can reduce the edema and tissue injury following myocardial ischemia injury (weis., 2004). the inhibition of ssecks by src and its regulation of angiogenesis and vascular permeability may be achieved by regulating vegf and tight junction proteins after ischemic brain injury. src and ssecks may have opposing effects on angiogenesis and vascular permeability after focal cerebral ischemia, and angiogenic factors are involved in this process by serving as downstream mediators (paul., furthermore, modulation of angiogenesis and vascular leakage by the src - ssecks pathway helps improve recovery after focal cerebral ischemia (bai., 2014). hypoxic / ischemic brain injury causes severe brain damage, but the specific mechanisms underlying the pathophysiology of such injury, and preventive measures, remain unclear. cerebral hypoxia / ischemia results in widespread responses at the systemic and cellular levels and regulates many physiological and pathological processes. the upregulation of vegf is considered to be a crucial stimulus for these processes. as a hypoxia - induced angiogenic protein, vegf plays a double - edged role in the central nervous system. based on its trophic inuence on neurons and vascular cells, it is a promising candidate for brain injury treatment. accumulating evidence implicates vegf in cerebral hypoxia / ischemia via the hif-1, vegf - r2-pi3k - akt, vegf - r2-akt - enos, jak - stat, and src - ssecks pathways (table 1). thus vegf becomes an attractive target for the treatment of hypoxic / ischemic brain injury. a variety of therapeutic strategies targeting vegf are currently in the research pipeline, but most of them are in the experimental stages. creatinine may be an effective treatment against cerebral hypoxia / ischemia, increasing the expression of vegf and mediating neovascularization in the ischemic zone (pedram., 2002) ; however, the downstream intracellular signaling pathways mediating these effects remain unclear. a better understanding of the vegf signaling pathway will improve therapeutic advances for hypoxic / ischemic brain injury. | cerebral hypoxia or ischemia results in cell death and cerebral edema, as well as other cellular reactions such as angiogenesis and the reestablishment of functional microvasculature to promote recovery from brain injury. vascular endothelial growth factor is expressed in the central nervous system after hypoxic / ischemic brain injury, and is involved in the process of brain repair via the regulation of angiogenesis, neurogenesis, neurite outgrowth, and cerebral edema, which all require vascular endothelial growth factor signaling. in this review, we focus on the role of the vascular endothelial growth factor signaling pathway in the response to hypoxic / ischemic brain injury, and discuss potential therapeutic interventions. |
osteoporosis is a condition of impaired bone strength which leads to increased risk of fracture. the enhanced bone fragility reflects the integration of the amount of bone (bone mass) and bone quality. bone quality depends on its macro- and microarchitecture and on the intrinsic properties of the materials that comprise it (e.g., matrix mineralization, microdamage accumulation, or collagen quality). bone is continually adapting to changes in its mechanical and hormonal environment via the process of bone remodeling. bone remodeling maintains bone structure and its mechanical competence by removing damaged bone and replacing it with new bone and thus restores bone 's material composition, micro-, and macroarchitecture. this process depends on the normal production, work and lifespan of osteoclasts, osteoblasts, and osteocytes. thus, diseases and drugs that have an impact on bone cells and bone remodeling will influence bone 's structure and its resistance to fracture. multiple sclerosis (ms) is a chronic progressive disease affecting the myelin sheath covering of nerve fibers in the brain and spinal cord, leading to functional impairments such as visual impairment, abnormal walking mechanics, poor balance, muscle weakness, fatigue, and progressive immobilization. the disease affects mainly young adults (20 to 40 years) and its incidence is more frequent in women (approximately 2 : 1). impaired mobility or lack of weight - bearing physical activity reduced mechanical stress on bone, which causes a marked imbalance in bone remodeling with a disruption of osteocytes network. management of ms requires long - term disease - modifying therapy, such as glucocorticoids (gcs) with a further negative effect on bone remodeling and bone strength. secondary osteoporosis may develop and low - trauma fractures occurring in patients with ms more frequently than in healthy controls [915 ]. fractures and their sequelae can have important personal as well as (economic) implications for society. therefore, the attention on the issue of bone health among patients with ms is warranted. this paper examines the underlying pathogenic mechanisms of osteoporosis in patients with ms as well as its management. understanding the causes associated with decreased bone strength in patients with ms will help in the optimal therapeutic intervention. the analysis of a registry of 9029 patients with ms in the usa found that 27.2% responders reported low bone mass, and more than 15% of responders reported a history of fracture. most studies in patients with ms evaluated bmd in comparison with the control group of healthy subjects and showed significantly lower bmd in patients with ms than in controls [1116 ]. several of these studies were shown that vertebral bmd is affected to a lesser degree than femoral bmd [11, 12, 16 ]. interestingly, one study in men with ms reported low bmd (osteoporosis) in 37.5% (15 out of 40) and 21% (8 out of 38 patients) had vertebral, rib, or extremities fractures. patients with progressive forms of ms showed a more severe loss of bmd than those with relapsing - remitting ms. cosman group found fracture rates of 22% in patients with ms compared with 2% in controls. it remains unexplained whether all patients with ms are more susceptible to osteoporosis and fractures ; for example, there is evidence that patients with a low expanded disability status scale (edss) score did not show any significant difference in bmd with comparison with healthy control subjects [17, 18 ]. therefore, further elucidation is needed to qualify which risk factors are most responsible for a bone loss in patients with ms. bone remodeling is under way throughout life and maintains bone strength by removing damaged bone and replacing it with new bone and thus restores bone 's micro- and macroarchitecture. this process depends on the normal production, work, and lifespan of osteoclasts, osteoblasts, and osteocytes. chronic diseases, such as ms, may significantly disturb the process of bone modeling and remodeling with resulting bone loss, deterioration of bone 's quality and increased frequency of fractures [20, 21 ]. secondary osteoporosis and low - trauma fractures occur in patients with ms more frequently than in healthy controls [9, 11 ]. the underlying pathogenic mechanisms of the osteoporosis in patients with ms are probably based on the progressive immobilization, long - term gcs treatment, vitamin d deficiency, skeletal muscle atrophy and possibly on the presence of various cytokines involved in the pathogenesis of ms. in addition, chronic use of other drugs, such as antidepressants may contribute to the development of osteoporosis and fractures. the functional impairments also leads to an increased risk of falling that, combined with bone loss and impaired quality of bone mass, can increase the frequency of bone fracture in individuals with ms. increased bone loss in immobilized subjects is well - recognized complication in patients after spinal cord injury with tetraplegia [23, 24 ], in bedridden patients, or in astronauts, whereas localized bone loss is well documented in patients with regional disuse, for example, after fracture itself. immobilization causes an overall progressive bone loss at a similar rate to osteoporosis caused by estrogen deficiency, but at the same amount of induced bone loss, disuse led to more deteriorated bone structure and mechanical properties than estrogen deficiency. the available studies showed that cortical thinning and substantial decline of trabecular bone density account for increased bone fragility [2729 ]. the duration and degree of motor disability appears to be a major contributor to the pathogenesis of secondary osteoporosis in patients with ms. the degree of disability measured by the kurtzke edss score significantly correlated with bmd in patients with ms. specifically, site - specific effects of motor disability were documented in ms patients, and edss correlated mainly with bmd in the hip but not in the lumbar spine. in wheelchair - bound patients, an atrophy of hip muscles affects proximal femur, while bmd of lumbar spine is not decreased because of its adequate mechanical stimulation by the trunk and back muscles in the upright position. also, hemiplegic patients showed a significant loss of bmd in both trabecular and cortical bone at the forearm and at the neck and great trochanter on the paretic hip. higher total body bone mineral content was documented in ambulatory patients (edss score 6.5) compared with nonambulatory patients (edss score 7.0) [12, 13 ]. also, higher prevalence of osteoporosis was found in nonambulatory patients. in male patients, a positive correlation has been observed between bmd and both edss score (correlation with femoral and also vertebral bmd) and bmi (correlation with femoral bmd only). there was shown that also edss score and bmi two years prior to the study could be used as future indicators of low bmd. a reduced mechanical stress on bone causes a marked imbalance in bone remodeling with a transient increase in bone resorption (which occurs initially) and a decrease in bone formation (which is sustained for a longer duration) [25, 33, 34 ] (table 1). the mechanism causing this decrease in bone formation probably lies in the reduction of mechanical stress during immobilization which results in a marked disruption of osteocytes network due to increase of osteocyte apoptosis. osteocytes represent 95% of all bone cells and form a mechanosensory system which is based on a three - dimensional network of tightly interconnected osteocytes entombed in mineralized bone matrix. disruption of this system affects probably several aspects of bone homeostatic system, such as mechanosensitivity, mechanotransduction, and basic multicellular units responsible for bone remodeling. while molecular mechanisms of disuse osteoporosis are not well understood, recent evidence found that mechanical unloading caused upregulation of sost gene in osteocytes and increased levels of sclerostin (product of sost gene). sclerostin is responsible for the inhibition of wnt / beta - catenin signaling in vivo and for the suppressed viability of osteoblasts and osteocytes. interestingly, sclerostin - deficient mice (sost /) were resistant to mechanical unloading - induced bone loss. importantly, the administration of sclerostin neutralizing antibody in experimental model of immobilization resulted in a dramatic increase in bone formation and a decrease in bone resorption that led to increased trabecular and cortical bone mass. osteocytes are also necessary for targeted bone remodeling to avoid microdamage accumulation, which could lead to whole - bone failure. recently, waldorff. showed that osteocyte apoptosis may be insufficient for repair of microdamage without the stimulation provided through physiologic loading. ms affects a wide range of neurological function and most of patients with ms have abnormal muscle strength, impaired balance, and gait control which leads to frequent falls [5, 41 ] that combined with a bone loss increase the frequency of bone fractures. it was demonstrated that changes in postural control in most patients with ms are probably the result of slowed afferent proprioceptive conduction in the spinal cord. disuse, inflammatory changes, as well as gcs treatment or vitamin d deficiency, may also contribute to weakness and loss of muscle strength and thus to frequent falling. gcs are frequently used to control ms relapses. oral gcs treatment in patients with ms may increase the risk of osteoporosis. epidemiological studies showed that fracture risk is increased rapidly after starting oral gcs treatment and is related to the dose and duration of gcs exposure. doses as low as 2.55 mg of prednisolone equivalents per day can be associated with a 2.5-fold increase in vertebral fractures, and the risk is greater with higher doses used for prolonged periods. bone loss due to gcs treatment is steep during the first 12 months and more gradual but continuous in subsequent years. however, the fracture risk returns towards baseline levels after discontinuation of oral gcs treatment. the mechanism of osteoporosis in patients on gc treatment is complex (table 2). however, the contribution of other risk factors, such as vitamin d insufficiency and physical disability confounds the assessment of gcs effects on bone in patients with ms. repeated pulses of high - dose methyprednisolone in ms patients did not result in a subsequent decrease in bmd ; however, the risk of osteoporotic fractures remains slightly increased in patients undergoing cyclic gcs treatment at high doses. high - dose, short - term intravenous gc regimens cause an immediate and persistent decrease in bone formation and a rapid and transient increase of bone resorption. in fact, gcs may increase proresorptive il-6 signaling as well as increase the expression of receptor activator of nf-b ligand (rankl) and decrease the expression of its soluble decoy receptor, osteoprotegerin (opg), in stromal and osteoblastic cells. however, discontinuation of such regimens is followed by a high bone turnover phase. in physically active patients with ms treated with low - dose steroids, the bone turnover markers were not different from controls. addressing the question of whether duration of low - dose gcs use in combination with other immunomodulators in patients with ms increases risk of osteoporosis requires further prospective study by taking into account other risk factors, particularly the level of disability. although no harm effect of low - dose methotrexate was observed in patients with ms, several case reports have described associations between pathological nonvertebral fractures and low - dose methotrexate (mtx) in rheumatoid arthritis (ra) patients. in addition, methotrexate osteopathy, characterized by pain, osteoporosis, and microfractures, has been very rarely observed in patients with low - dose mtx treatment. other immune - modifying drugs, such as interferon - beta or azathioprine, which are used in conjunction with gcs have not been shown to promote bone loss experimentally or clinically. on the contrary, interferon - beta may have favorable effect on bone metabolism in patients with ms, probably due to the inhibitory effect of interferon - beta on osteoclasts development. experimentally, also treatment with the s1p(1) agonist fty720, a new and promising drug for the treatment of ms, relieved ovariectomy - induced osteoporosis in mice by reducing the number of mature osteoclasts attached to the bone surface. however, further investigation with regard to their effects on bone health is needed. the role of vitamin d in bone homeostasis is well understood, and the use of vitamin d to prevent and treat osteoporosis was recently reviewed. there is also evidence from both observational studies and clinical trials that hypovitaminosis d are predisposing conditions for various common chronic diseases. in addition to skeletal disorders, vitamin d deficiency is associated with increase the risk of malignancies, particularly of colon, breast, and prostate gland cancer, of chronic inflammatory and autoimmune diseases (e.g., insulin - dependent diabetes mellitus, inflammatory bowel disease, or multiple sclerosis), as well as of metabolic disorders (metabolic syndrome and hypertension). vitamin d intake, decreasing latitude, increased sun exposure, and high serum vitamin d levels have all been shown to be associated with a decreased risk of ms. patients with ms have more often vitamin d deficiency due to its low intake as well as limited sunlight exposure. mean 25-hydroxyvitamin d3 (25ohd) levels in patients with ms are more often lower (below the level of 20 ng / ml) than in age - matched controls [11, 14 ]. there was no significant correlation between 25(oh)d and bmd in patients with ms [11, 14 ]. thus, while patients with ms are susceptible to low 25ohd levels, the evidence implicating linking levels to reduced bmd and osteoporosis in patients with ms is unclear. only a few studies have investigated this link [11, 12, 14 ]. a low vitamin d state, from inadequate diet intake and decreased exposure to sunlight, contributes to malabsorption of calcium and vitamin d insufficiency in ms patients. secondary hyperparathyroidism may develop, which can contribute to bone remodeling imbalance and bone loss in patients with ms. moreover, patients with ms treated with gcs will be at greater risk for an imbalance between bone formation and bone resorption and, therefore, more susceptible to development of osteoporosis due to vitamin d insufficiency / deficiency. gcs treatment is associated with reduced calcium absorption from the gastrointestinal tract by opposing vitamin d action. in addition, gcs may affect pth secretory dynamic, with a decrease in the tonic release of pth and an increase in pulsatile burst of the hormone. ms is an inflammatory disease of the central nervous system (cns) with a prominent role of immune cells and cytokines in degradation of the myelin sheaths. recent evidence has indicated that a number of additional cell types, such as t cells, play a key role in bone loss. in inflammatory or autoimmune disease states, activated t - cells produce receptor activator of nuclear factor kappab ligand (rankl) and proinflammatory cytokines, such as tnf-, il-1, or il-11, all of which can induce rankl expression in osteoblasts and bone marrow stromal cells. the systemic or local activation of t - cells may, therefore, trigger bone loss via the expression of rankl. osteoprotegerin (opg), a protein member of the tumor necrosis factor (tnf) receptor family and its ligand rankl were identified as a key cytokines that regulate osteoclastogenesis. significantly, higher levels of rankl and opg were found in the patients with ms with low mean edss as compared to the age - matched controls. among other cytokines, osteopontin (opn) has been studied in the shared pathogenesis of ms and osteoporosis. opn is a member of the sibling (small integrin - binding ligand n - binding glycoprotein) family of noncollagenous matricellular proteins. opn was identified as the most abundantly expressed cytokine in ms lesions, and opn levels were found to be increased in cerebrospinal fluid of ms patients [64, 65 ] and in the plasma in patients with relapsing - remitting ms. however, other studies found that opn circulating levels are low in patients with ms. it seems likely that further future studies experiments will uncover the role of opn and additional molecules mediating bone loss in inflammatory diseases, such as ms. meta - analyses have revealed that barbiturate, antidepressant, antipsychotic, and benzodiazepine treatment increases patient 's risk of osteoporosis. more recently, current use of antidepressant drugs with a high affinity for the 5-hydroxytryptamine reuptake transporter (5-htt) was associated with a higher risk of osteoporotic fractures compared to use of antidepressants with a medium or low affinity. bmd was lower among those reporting current selective serotonin reuptake inhibitors (ssri) use but not among users of other antidepressants [72, 73 ]. in vivo studies have found that 5-ht could alter bone architecture and could reduce bone mass and density. the 5-htt has been located in osteoclasts, osteoblasts, and osteocytes, and the the inhibition of 5-htt using a ssri (fluoxetine hydrochloride) had antianabolic skeletal effects in rats. further research is needed to confirm this finding in light of widespread ssri use and potentially important clinical implications. despite the fact that patients with ms can develop osteoporosis and fractures more often than their age - matched healthy controls, many patients with ms are not evaluated for their bone status, and there are no clinical guidelines for prevention and treatment of osteoporosis in patients with ms. patients with ms are also at a higher risk of falls that can increase the frequency of bone fracture combined with bone loss and impaired bone 's quality. clinical evaluation in all patients with ms should include the assessment of the clinical risk factors for osteoporosis and fractures, such as the hereditary disposition of osteoporosis, previous low trauma fractures, and smoking or alcohol habits. the specific risk factors of the osteoporosis in patients with ms are the level of disability (specifically motor disability) and possibly a long - term gcs treatment, vitamin d deficiency, skeletal muscle atrophy, and increased risk of falling. the examination of the motor function using the edss score could provide a useful indicator for further evaluation. cutoff edss 6 represents reasonable end of motor performance of the patient ; 6.5 means only several meters with bilateral support, and 7 is only the ability of transfer to wheelchair from the bed. the edss scores of 6 or greater has been found to correlate well with decreased bmd [12, 15 ], and bmd should be routinely measured in these patients. on the other hand, patients with a good physical activity and low edss score (7580 although a number of drugs have been evaluated for the prevention and treatment of postmenopausal osteoporosis and gio, the evidence of their efficacy in patients with ms, especially in premenopausal women and younger men is less strong. as osteoporosis in ms patients have multiple pathogenesis, medical interventions used in women with postmenopausal osteoporosis may not be similarly efficient. patients requiring long - term gcs treatment and those being immobilized may require pharmacological therapy to prevent excessive bone loss and fractures. options for treatment include antiresorptive drugs, such as estrogen, or aminobisphosphonates, or anabolic agents such as teriparatide. although the use of bps may be appropriate, the etiology of osteoporosis in patients with ms is fundamentally different from the osteoporosis commonly found in the postmenopausal women for whom these drugs were originally developed. as immobilization in patients with ms can cause substantial bone loss and increase in the risk of fractures, bps may be option for treatment for those patients. although bps have not been systematically evaluated in the therapy of these conditions, some studies support the potential benefit of bps in the management of bone loss associated with immobilization [24, 85, 86 ]. in immobilized patients, bps is known to reduce immobilization - induced hypercalcaemia by inhibiting bone resorption of calcium. an immobilization - related elevated serum calcium level may inhibit parathyroid hormone (pth) secretion, and hence renal 1, 25(oh)2d3 production, in disabled long - standing ms patients. if oral therapy of bps can not be tolerated or excluded due to gastroesophageal disease, intravenous route of administration of ibandronate or zolendronate may be applied. however, acute phase reaction with fever, particularly after the first application of bp, may occur. bps (alendronate, risendronate, or zolendronate) were also approved for the treatment of gio. these drugs were shown to improve bmd, whereas the data on fractures were scanty in gio, particularly in premenopausal or younger men. the mechanism by which bps reduce the adverse skeletal effects of gcs have not been elucidated. the disadvantage of long - term bps treatment is that it may lead to a reduction in bone turnover to a level inadequate to support normal bone remodeling. although experimental data showed that bps also prevents osteocyte apoptosis, there is also experimental evidence of increased accumulation of microdamage with long - term bps therapy. also, as bps accumulate in the skeleton (with a long - term residual time), they cross the placenta, accumulate in fetal skeleton, and cause toxic effects in pregnant rats. therefore, bps should be used with caution in women who may become pregnant. drugs, such as bps, that suppress bone resorption have been proposed as interventions for prevention of gio as well as disuse osteoporosis. the disadvantage of this approach is that it may lead to a reduction in bone turnover to a level inadequate to support normal bone remodeling. an alternative approach is to maintain a normal level of bone formation using a bone anabolic agent such as pth. the human recombinant n - terminal parathyroid hormone (pth 134 or teriparatide) is a potent osteoanabolic agent, which decreases osteoblast and osteocyte apoptosis and increases bone formation and bone strength. because of gcs - induced decrease in the number of osteoblasts and rate of bone remodeling, anabolic, and antiapoptotic treatment with teriparatide may directly counteracts the key pathogenetic mechanisms of gcs excess on bone, thus, it may be a more effective treatment than bps. the same rationale applies to immobilization - induced osteoporosis, as progressive immobilization as well as long - term gcs exposure results in osteocyte apoptosis and reduced bone formation. as sclerostin augments osteocyte apoptosis, the antibody - mediated blockade of sclerostin represents a promising new therapeutic approach for the anabolic treatment of immobilization - induced osteoporosis and probably also for gcs - induced osteoporosis. indeed, more recently, experimental data showed that administration of sclerostin neutralizing antibody in rat model of right hindlimb immobilization resulted in a dramatic increase in bone formation and a decrease in bone resorption that led to increased trabecular and cortical bone mass. we have described a spectrum of pathogenetic factors which may contribute to the development of osteoporosis and low - trauma fractures in patients with ms. whilst there is evidence to support an important role for many of the risk factors, the most significant etiology of bone loss in patients with ms seems to be the level of motor disability and reduced bone load within individual patients. other risk factors, such as long - term gcs treatment, hypovitaminosis d, or inflammation, may also play an important part in subset of patients with ms ; however, further examinations in prospective studies are required. with regard to diagnostic as well as therapeutic interventions, there are currently no specific recommendations in patients with ms ; however, identification and treatment of underlying cause should be the goal of therapeutic management. optimally, the patients in a higher risk of osteoporosis should be early identified and preventively promptly treated to avoid the bone loss and fractures. because the long - term disability and long - term gcs are probably two most significant etiologic risk factors for osteoporosis development in the majority of the patients with ms, the interventions which can counteract the osteocyte apoptosis as well as loss of muscle mass and muscle weakness will be promising. | multiple sclerosis (ms) is a gait disorder characterized by acute episodes of neurological defects leading to progressive disability. patients with ms have multiple risk factors for osteoporotic fractures, such as progressive immobilization, long - term glucocorticoids (gcs) treatment or vitamin d deficiency. the duration of motor disability appears to be a major contributor to the reduction of bone strength. the long term immobilization causes a marked imbalance between bone formation and resorption with depressed bone formation and a marked disruption of mechanosensory network of tightly connected osteocytes due to increase of osteocyte apoptosis. patients with higher level of disability have also higher risk of falls that combined with a bone loss increases the frequency of bone fractures. there are currently no recommendations how to best prevent and treat osteoporosis in patients with ms. however, devastating effect of immobilization on the skeleton in patients with ms underscores the importance of adequate mechanical stimuli for maintaining the bone structure and its mechanical competence. the physical as well as pharmacological interventions which can counteract the bone remodeling imbalance, particularly osteocyte apoptosis, will be promising for prevention and treatment of osteoporosis in patients with ms. |
disinfecting and cleaning the root canal system of microbial flora and pulpal tissue are prerequisites for successful root canal treatment. although root canal shaping can be efficiently attained with advanced instrumentation technology, effective cleaning of the entire root canal system still remains a challenge. irrigation plays an indispensable role in removal of tissue remnants and debris from the complicated structure of root canal anatomy. the most favorable features of irrigants are their flushing action, tissue - dissolving ability, antimicrobial effect and low toxicity. sodium hypochlorite is the most commonly used endodontic irrigant because of its well - known antimicrobial and tissue - dissolving activity. but, the disadvantage of using 5.25% naocl as an irrigant is its extreme cytotoxicity. it is mostly used for sewage water disinfection, industrial process water treatment, industrial air treatment, mussel control, foodstuffs production and treatment, industrial waste oxidation and gas sterilization of medical equipment. in most of the previous studies, tissue solubility of various irrigants has been measured using bovine pulp tissue and bovine mucosa. fewer studies have been done on the direct solubilizing effects of various irrigants on human pulp tissue. till date, there has been no study comparing the human pulp tissue dissolving ability of chlorine dioxide, calcium hypochlorite and sodium hypochlorite. therefore the aim of this in vitro study is to compare the human pulp tissue dissolution by different concentrations of chlorine dioxide, calcium hypochlorite and sodium hypochlorite. freshly extracted, intact vital premolars, extracted for orthodontic reasons were collected from the department of oral and maxillofacial surgery. two longitudinal grooves on the proximal surfaces of the teeth were made with round bur. the weight of freshly extracted pulp was standardized to 9.0 mg. in all, seventy samples of standardized weight were taken. distribution of the samples in all, seventy test tubes were taken, ten for each group : in group i 10 test tubes were filled with measured volume (5 ml each) of 2.5% naoclin group ii 10 test tubes were filled with measured volume (5 ml each) of 5% naoclin group iii 10 test tubes were filled with measured volume (5 ml each) of 5% ca(ocl)2 in group iv 10 test tubes were filled with measured volume (5 ml each) of 10% ca(ocl)2 in group v 10 test tubes were filled with measured volume (5 ml each) of 5% clo2 in group vi 10 test tubes were filled with measured volume (5 ml each) of 13% clo2 in group vii 10 test tubes were filled with measured volume (5 ml each) of distilled water in group i 10 test tubes were filled with measured volume (5 ml each) of 2.5% naocl in group ii 10 test tubes were filled with measured volume (5 ml each) of 5% naocl in group iii 10 test tubes were filled with measured volume (5 ml each) of 5% ca(ocl)2 in group iv 10 test tubes were filled with measured volume (5 ml each) of 10% ca(ocl)2 in group v 10 test tubes were filled with measured volume (5 ml each) of 5% clo2 in group vi 10 test tubes were filled with measured volume (5 ml each) of 13% clo2 in group vii 10 test tubes were filled with measured volume (5 ml each) of distilled water all the solutions were freshly prepared. solutions of 2% naocland 5% naoclwereprepared by diluting 10% naocl (avarice laboratories private limited, ghaziabad, india). solutions of 5% ca(ocl)2 and 10% ca(ocl)2 were prepared from calcium hypochlorite powder (central warehouse private limited, baroda, india). solutions of 5% and 13% clo2 were prepared by mixing solutions a and b (rapid oxide, kresko projects private limited, ahmedabad, india) according to the manufacturer 's instructions. each group had 2 subgroups having 5 test tubes each according to different time periods of 30 min and 60 min, respectively, for which the sample was immersed in the irrigant. after the passage of specified time, the solution from each sample test tube was filtered through a wattman filter paper. this was followed by overnight drying of the filter paper which was then measured in an analytical balance. the difference in the weight of the dried filter paper (with residue) and initial filter paper (before filtration) gave the weight of residue left subsequent to filtration, which is the sum of the weight of pulpal residue and irrigating solution residue. irrigating solution (5 ml) was filtered through a pre - weighed filter paper. the difference in the weight of the dried filter paper and initial filter paper (before filtration) gave the dry weight of residue of that irrigating solution. weight of the residual pulp left on the filter paper of each sample was calculated by subtracting the weight of residue of respective irrigating solution from the weight of the total residue on filtration paper, measured earlier. difference in the weight of pulp tissue before immersion and the weight of residual pulp left on the filter paper gave the amount of pulp dissolved by the respective irrigant of that group. thus, by filtration method, the amount of pulp dissolved by various irrigating solution at different time intervals was measured quantitatively [figure 2 ]. flowchart of the methodology the mean dissolution time for pulp tissue by different groups at different time intervals was statistically analyzed by anova and post hoc analysis (tukey hsd) was done for intergroup comparison by using spss version 15.0 statistical analysis software. the mean dissolution time for pulp tissue by different groups at different time intervals was statistically analyzed by anova and post hoc analysis (tukey hsd) was done for intergroup comparison by using spss version 15.0 statistical analysis software. the mean dissolution time for pulp tissue was found to increase with passage of time for all the groups. statistically significant difference was found between all the groups except for subgroups iiia and va, ib and iib, iiib and vb, and, ivb and vib [table 1 ]. therefore, some sort of irrigation / disinfection is necessary to remove tissue from inaccessible areas of the root canal and to kill microorganisms. callahan and grossman demonstrated the importance of the solvent ability of endodontic irrigant. in vital root canal therapy, the presence of pulpal remnants may lead to post - operative pain and also has the potential to form a periapical lesion as suggested by strindberg. the contact time of an irrigant is limited and the vascularity of vital tissue resists the action of certain irrigants. therefore, the speed / time of dissolution of vital tissue by different irrigants is an important factor. a unique feature of the present study is the use of filtration method for determining the dissolution of pulp where the weight of the residue from the irrigant was calculated and subtracted from the total weight of the pulp along with the solution 's residue, so that the exact dissolution of pulp tissue can be calculated. this unique filtration technique helped us to overcome the limitations of other studies where because of the residue of the irrigant, the exact dissolution of pulp tissue could not be calculated. in this study, chlorine dioxide and calcium hypochlorite were chosen as an irrigant and compared with sodium hypochlorite. it does not form chlorinated hydrocarbons, which are carcinogenic, when in contact with organic matter. results from the present study showed that 5% sodium hypochlorite was the most effective pulp tissue solvent among all irrigants at both time intervals. this is because of the ionization of naocl to liberate hypochlorous acid (hocl) and hydroxyl ions in an aqueous environment. when hydroxyl ion levels decrease as a result of the saponification and amino acid neutralization reactions, the ph also decreases, thereby favoring the formation of hocl molecules. the chloramination reaction is then initiated which results in degradation and hydrolysis of amino acids. this result is in agreement with rosenfeld who reported 5% naocl as an effective solvent of human pulp tissue. according to the results of our study 2.5% naocl was less effective than 5% naocl at 30 minutes. previous studies have shown that the tissue - dissolving ability of sodium hypochlorite solution decreases if it is diluted. the results of our study demonstrated that 2.5% and 5% naocl showed no significant difference in pulp dissolution at 60 minutes. this is in accordance with sirtes. who found that 1%, 2.62%, and 5.25% solutions had an unchanged quantity of available chlorine for one hour. mean tissue dissolution with calcium hypochlorite was significantly less as compared with sodium hypochlorite at both concentrations and at both time intervals. this might be because of the release of large amount of hydroxyl ions as a result of dissolution of calcium hypochlorite granules in aqueous solution, which would take longer time to be exhausted. an in vitro study undertaken by dutta and saunders demonstrated that naocl dissolved tissue faster than the ca(ocl)2 solution over the first 35 minutes, but there was no significant differences thereafter. solution of 5% ca(ocl)2 when used for 30 minutes showed less tissue dissolution than 10% at 30 minutes. the hyperosmotic effect of 10% solution might have caused tissue dehydration resulting in more weight loss than 5% solution. solutions of ca(ocl)2 at both 5% and 10% showed more amount of tissue dissolution at 60 minutes because ca(ocl)2 has an initial slower rate of tissue dissolution. the reason for this might also be the low ph of clo2 as compared to high ph (ph = 12) of naocl. in a study by nishikiori, the ph of clo2 was raised upto 12 by using naoh and it was found equivalent to naocl for dissolving bovine pulp tissue. but according to deininger. clo2 exhibits biocidal efficacy only over a ph range of 3 - 9. between ph 4 - 7, chlorine exists predominantly as hclo, the active moiety responsible for bacterial inactivation, whereas above ph 9, ocl predominates. also the addition of naoh will result in making the aqueous solution of clo2 ineffective by breaking it down into sodium chlorate, sodium chlorite and water. among the clo2 group, large amount of mean tissue dissolution was demonstrated by 13% clo2 at 60 minutes.5% clo2 showed lower pulp dissolving capacity at 30 minutes, followed by 5% clo2 at 60 minutes and 13% clo2 at 30 minutes, which were comparable. studies have suggested that lower the ph, more time was needed for solution contact for tissue dissolution. this might be the reason for less effectiveness of clo2 in dissolution of pulp tissue at 30 minutes than at 60 minutes. no significant difference was seen with 13% clo2 at both 30 minutes and 60 minutes. statistically insignificant results were obtained between calcium hypochlorite and chlorine dioxide group at both concentrations. the reason for this is not clear but it may be because of the amount of available chlorine which is nearly same for both the materials. but less tissue dissolution was seen at lower concentrations for both groups, thus indicating that high concentrations for both should be used if the contact time is less. results of our study demonstrated no dissolution of the pulp by distilled water at all time intervals. this is in agreement with the study by gordon. who confirmed that distilled water is an ineffective solvent of vital tooth pulp. naoclmost effectively dissolved the pulp tissue at both concentrations and at both time intervals.ca(ocl)2 at both concentrations dissolved the pulp tissue more effectively at 60 minutes.clo2 was most effective at higher concentration and at 60 minutestissue dissolving ability of clo2 and ca(ocl)2 are comparable at high concentration and at 60 minutes. clo2 was most effective at higher concentration and at 60 minutes tissue dissolving ability of clo2 and ca(ocl)2 are comparable at high concentration and at 60 minutes. | introduction : irrigation plays an indispensable role in removal of tissue remnants and debris from the complicated root canal system. this study compared the human pulp tissue dissolution by different concentrations of chlorine dioxide, calcium hypochlorite and sodium hypochlorite.materials and methods : pulp tissue was standardized to a weight of 9 mg for each sample. in all,60 samples obtained were divided into 6 groups according to the irrigating solution used- 2.5% sodium hypochlorite (naocl), 5.25% naocl, 5% calcium hypochlorite (ca(ocl)2), 10% ca(ocl)2, 5%chlorine dioxide (clo2) and 13% clo2. pulp tissue was placed in each test tube carrying irrigants of measured volume (5ml) according to their specified subgroup time interval : 30 minutes (subgroup a) and 60 minutes (subgroup b). the solution from each sample test tube was filtered and was left for drying overnight. the residual weight was calculated by filtration method.results:mean tissue dissolution increases with increase in time period. results showed 5.25% naocl to be most effective at both time intervals followed by 2.5% naocl at 60 minutes, 10%ca(ocl)2 and 13% clo2 at 60 minutes. least amount of tissue dissolving ability was demonstrated by 5% ca(ocl)2 and 5% clo2 at 30 minutes. distilled water showed no pulp tissue dissolution.conclusion:withinthe limitations of the study, naocl most efficiently dissolved the pulp tissue at both concentrations and at both time intervals. mean tissue dissolution by ca(ocl)2 and clo2 gradually increased with time and with their increase in concentration. |
the intramolecular reaction of dialkyl peroxides with carbanions, generated via chemoselective metal - heteroatom exchange or deprotonation, provides a new approach to cyclic ethers. applied in tandem with c c bond formation, the strategy enables a one - step annelation to form oxaospirocycles. |
|
the prognostic and general severity scoring systems that are used in the intensive care unit (icu) are beneficial in predicting risk of mortality. mortality prediction is important for patient or family information and consent, comparison of icu results, monitoring quality of icu care and can be used to stratify patients for clinical research. several criteria should be taken into consideration when judging the value of any scoring system in clinical practice. validity and reliability are important issues that allow confident use of a scoring system in icu patients with different disease and baseline characteristics. in critically ill patients, acute physiology and chronic health evaluation (apache) ii and iii scores were developed by knause.1, in 1985 and 1991, respectively, and simplified acute physiology score (saps) ii was developed by le gall.2, in 1993.. nevertheless, there are still conflicting data concerning which of them is the best predictor tool. the aim of this study was, therefore, to compare and evaluate the performance of apache ii, apache iii and saps ii as scores in predicting the mortality and morbidity of surgical icu patients. this prospective study included 202 consecutive patients admitted to the surgical icu of university hospital of imam reza - mashhad - iran, during the 6 months, from april 2010 through september 2010. for the purpose of the study, each admission (elective or urgent) was considered as one patient. patients with icu length of study (los) less than 24 hours were excluded from the analysis as saps ii and apache ii and iii can not be calculated in these patients. to calculate the apache ii score, the sum of these values is added to a mark adjusting for chronic health problems (severe organ insufficiency or immune - compromised patients) and a mark adjusting for patient age to achieve the appache ii score. apache iii scores are derived from marks for the extent of abnormality of 17 physiological measurements, adjusts for seven comorbidities that reduce immune function and influence hospital survival, and adjusts for age, and range from 0 to 299. clinical and laboratory data necessary for the saps ii and apache ii and iii systems were recorded on the first day of admission for all patients. the calculation of apache ii and iii and saps ii scores was based on the worst values taken during the first 24 hours after admission. individual relationship of each score (saps ii, apache iii and ii) and length of admission to the risk of death and comparison of score was assessed by t - test and anova, p - value less than 0.05 was significant statistically. discrimination was tested using the receiver operating characteristic (roc) curves and by comparing areas under the curve (auc). the calibration of the systems (prognostic accuracy at different levels of risk) was studied using youden index and hosmer - lemeshow goodness of fit statistics which divides subjects into deciles based on predicted probabilities of death and then computes a chi - square from observed and expected frequencies. lower chi - square values and higher p values (p > 0.5) are associated with a better fit. for the different scoring systems tested, the sensitivity, specificity, positive and negative predictive values were calculated, and the cutoff point giving the best youden index was determined. this cutoff point was also used to calculate the predicted and observed outcome for patients. individual relationship of each score (saps ii, apache iii and ii) and length of admission to the risk of death and comparison of score was assessed by t - test and anova, p - value less than 0.05 was significant statistically. discrimination was tested using the receiver operating characteristic (roc) curves and by comparing areas under the curve (auc). the calibration of the systems (prognostic accuracy at different levels of risk) was studied using youden index and hosmer - lemeshow goodness of fit statistics which divides subjects into deciles based on predicted probabilities of death and then computes a chi - square from observed and expected frequencies. lower chi - square values and higher p values (p > 0.5) are associated with a better fit. for the different scoring systems tested, the sensitivity, specificity, positive and negative predictive values were calculated, and the cutoff point giving the best youden index was determined. this cutoff point was also used to calculate the predicted and observed outcome for patients. during the study period, 202 patients were admitted to the icu which 118 (58.8%) were men and 84 (41.8%) were women. the mean age was 53.1 20.3 years (range 14 - 85 years). elective surgery was performed before admission to the icu in 195 patients and emergency surgery in seven patients. table 1 reports predictive values of the various scoring systems calculated at the cutoff point giving the best youden index, sensitivity, specificity, positive and negative predictive value and overall success rate. comparison of the predictive values of the scoring systems the mean sd saps ii, apache ii and apacheiii score, calculated within 24 h of admission to the icu, were 13.42 6.65, 18.56 7.32 and 23.66 11.50, respectively [table 2 ]. table 3 shows relationship of mortality with scores and there were significant differences in saps ii score, apache ii score and apache iii score between survivors and non - survivors (p < 0.001 at all). mean, standard deviation and range of three scoring comparison of three scoring systems with survivor and non - survivor mean (st deviation) table 4 shows that admission duration correlated with saps ii, apache ii and iii scores and length of admission in icu increased significantly with higher saps ii, apache ii and apache iii scores (p = 0.035, 0.017 and 0.049, respectively). mean (st deviation) calibration measured with hosmer - lemeshow goodness - of - fit tests are shown in table 5. the hosmer - lemeshow statistic was best for apache ii score (p = 0.71). however, for the apache iii and saps ii scores, calibration was poor (p value = 0.392 and 0.379, respectively). hosmer - lemeshow goodness of fit tests for three scoring systems discrimination power evaluated with roc curve and area under curve (auc). auc of apache ii was 0.828 and excellent, while that of apache iii (0.782) and saps ii (0.778) was acceptable. the performance of the prognostic models is evaluated by tow objective measures : calibration and discrimination. calibration refers to how closely the estimated probabilities of mortality correlate with the observed mortality over the entire range of probabilities and can be tested using hosmer - lemeshow goodness - of - fit statistic. discrimination refers to the ability of a prognostic score to classify patients correctly as survivors or non - survivors and is measured by auc. from the individual patient 's point of view, it would be interesting to have perfect discrimination ; however, for clinical trials or comparison of care between icus better calibration is needed. in our study, the discriminative ability of appache ii is excellent. moreover, it has greater discriminative power than apache iii or saps ii in our critically ill patient. apache ii also has a better, more appropriate calibration than apache iii or saps ii, so only apache ii properly predicts mortality risk in our icu. nevertheless, apache ii prediction has been more consistent across a wide range of mortality risks than apache iii or saps ii.23 our results are in agreement with other reports on the performance of the apache scoring system in uk.456 the same pattern was observed in the external validation of the saps ii, apache ii and apache iii models in scottish intensive care patients.7 one study reported good calibration for the apache ii model, but again imperfect calibration for the two other score tested.89 in one study, beck and colleagues validated the saps ii and apache ii and iii prognostic models in 16,646 adult intensive care patients in southern uk. the external validation showed a similar pattern for all three models tested : good discrimination, but imperfect calibration.10 differences in the performance of scoring systems reinforce the need to validate them using data of independent samples from different icus in different countries, due to variation in case mix, structure and organization of acute medical care, lifestyles and genetic makeup between populations.11 adequate discrimination by apache ii previously has been described with an auroc of 0.91 in thailand, 0.88 in hong kong, 0.83 in greece and saudi arabia and 0.79 in portugal.12 its calibration, however, always has been poor, as evidenced by recent studies, primarily due to differences in case mix, data collection and lead - time bias.212 the present study has some limitations. first, as a single - centre study, there may be bias with regard to case mix, quality of icu care and icu policy. second, our relatively small sample size is a limiting factor in stratified analysis of calibration. third, apache ii is based on retrospective data that is available within 24 h of icu admission ; consequently, the sampling rate that is used can influence mortality estimation. a multi - centre study would mitigate the concerns over case mix and benefit from a larger sample size. we found a better calibration of apache ii than apache iii or saps ii such that apache ii improves the ability to predict hospital mortality in comparison with apache iii or saps ii. the discrimination of apache ii is excellent, but of apache iii and saps ii is acceptable. | background : in critically ill patients, several scoring systems have been developed over the last three decades. the acute physiology and chronic health evaluation (apache) and the simplified acute physiology score (saps) are the most widely used scoring systems in the intensive care unit (icu). the aim of this study was to assess the prognostic accuracy of saps ii and apache ii and apache iii scoring systems in predicting short - term hospital mortality of surgical icu patients.materials and methods : prospectively collected data from 202 patients admitted to mashhad university hospital postoperative icu were analyzed. calibration was estimated using the hosmer - lemeshow goodness - of - fit test. discrimination was evaluated by using the receiver operating characteristic (roc) curves and area under a roc curve (auc).result : two hundred and two patients admitted on post - surgical icu were evaluated. the mean saps ii, apache ii, and apache iii scores for survivors were found to be significantly lower than of non - survivors. the calibration was best for apache ii score. discrimination was excellent for apache ii (auc : 0.828) score and acceptable for apache iii (auc : 0.782) and saps ii (auc : 0.778) scores.conclusion:apache ii provided better discrimination than apache iii and saps ii calibration was good at apache ii and poor at apache iii and saps ii. use of apache ii was excellent in this post - surgical icu. |
somatostatin (sst) is a cyclic peptide and a notable physiological regulator of neuroendocrine function across multiple organ systems. it is produced by the hypothalamus, throughout the central nervous system (cns), and in different peripheral organs including gastrointestinal tract (git) and pancreas[13 ]. the sst gene is located in chromosome 3q28 and encodes a 116 amino acid preprohormone (preprosomatostatin) which contains the 92 amino acid sst prohormone (prosomatostatin). prosomatostatin is the precursor peptide of the two biologically active sst forms : 14 amino acid long sst-14 and amino - terminus extended sst-28. the biological roles of the two sst isoforms strongly overlap and the relative proportions of sst-14 to sst-28 change between different tissues [6, 7 ]. sst-14 is the predominant form in the brain (including the hypothalamus), whereas sst-28 is the major form in the git, especially the duodenum and jejunum. sst has a broad range of biological actions including inhibition of exocrine secretions (gastric acid production, pancreatic enzyme, bile and colonic fluid secretion) and endocrine secretions in the pituitary (gh, tsh, prolactin), pancreas (insulin, gastrin, glucagon) and git (cholecystokinin, vasoactive intestinal peptide and secretin) [3, 912 ]. in the cns, sst is highly expressed in the cortex, lateral septum, extended amygdala, reticular nucleus of the thalamus, hippocampus and many brain stem nuclei where it acts as a neurotransmitter and neuromodulator [8, 13 ]. the hippocampal sst receptor (sstr)4 modulates memory formation by diminishing hippocampus - based spatial function while enhancing striatum - dependent behaviour. sstr4-mediated regulation of neuronal activity in the hippocampus appears to depend on both competitive and cooperative interactions with sstr2. in a study by craft and colleagues, sst analogue infusion was shown to improve memory in patients with alzheimer disease. moreover, sst is inhibitory on cell survival and angiogenesis and has anti - proliferative activity on normal and neoplastic pituitary cells [16, 17 ], cancer cell lines [18, 19 ] and tumours in experimental animals. there are five sstr subtypes, each encoded by five separate genes on five separate chromosomes : 14, 17, 22, 20 and 16, respectively [4, 10, 12 ]. sstrs belong to the g - protein coupled receptor (gpcr) superfamily and are extensively distributed throughout many tissues ranging from the cns to the pancreas and gut, and also in pituitary, kidney, thyroid, lung and immune cells, besides their presence in various cancer cells. the majority of tumours (and also normal tissues) express sstr2, followed by sstr1, sstr5 and sstr3, whereas sstr4 is the least expressed subtype [19, 21, 22 ]. there are two different isoforms of sstr2 (sstr2a and sstr2b) produced via alternative splicing [23, 24 ] and sstr2b is almost unexpressed in human beings. sstrs bind natural peptides, sst-14 and sst-28, with similar high affinity (nm range). however, sstr5 has a 10-fold higher affinity for sst-28 compared to sstr2a or sstr3, which have a higher affinity to sst-14. investigations on sstr signalling and determining the specific function of each sstr pose difficulty due to various factors in experimental settings. first, the different sstr subtypes can coexist in the same tissue and even on the same cell at different densities, and which type of signalling becomes predominant in the given cell depends on the cell - specific distribution of sstr subtypes and signalling elements. second, experimental studies on sstrs are generally performed in cell lines from different species and the significance of the findings of these studies for normal and malignant human tissues remains to be determined. fortunately, a remarkable degree of structural conservation across species has been reported for sstrs. sstr1 is the most highly conserved, with 97% identity between human beings and rat, whereas the sequence of sstr5 is the most divergent, with 81% identity between human beings and rat. there is 92%, 86% and 89% identity between human and rat sstr2, sstr3 and sstr4, respectively [6, 26 ]. the main structural and functional features of sstrs, including their signalling, endocytosis and recycling, have been extensively characterized using both primary cell cultures and, especially, cell lines stably transfected with different receptors from diverse species, and hence these data need careful interpretation [12, 25 ]. third, it is now evident that gpcr function is highly dependent upon the cellular environment in which gpcrs are expressed, resulting in tissue - specific responses, even those originating from the same gpcr subtype. in recent years, researchers have been obliged to find correlations between recombinant and native receptors and to ascribe specific functions to individual receptor subtypes in their own environment. fourth, although receptor - specific sst analogues have been generated, the discovery of receptor homo- and heterodimerization has added another level of complexity to the understanding of post - receptor events. sstrs can form heterodimers with dopamine receptors, other sstr subtypes, opioid receptors or epidermal growth factor (egf) receptors, which generate receptor oligomers with unique pharmacological profiles. however, it still has not been elucidated whether all these potential interactions do actually occur in the native cell, and, if they occur, what their precise functional relevance and importance are. fifth, it is known that, sstr coupling to a given pathway can be strongly influenced by the ligand used [3436 ], which is due to distinct conformations of the receptor / ligand complexes induced by different sst analogues. sixth and lastly, internalization, desensitization and/or receptor crosstalk [38, 39 ] are all known to occur in sstrs, which may well have an impact on post - receptor signalling events. all these factors might also explain the different downstream effects observed in sstr signalling in different experimental settings. neuroendocrine tumours (nets) are derived from a wide spectrum of different cell population and include, e.g. carcinoids, pituitary tumours, phaeochromocytomas, paragangliomas, medullary thyroid carcinomas and gastroenteropancreatic tumours such as insulinomas, gastrinomas and vipomas. this review will focus on the anti - tumour actions of sst, sstr signalling pathways and the significance of our increasing knowledge on sst tissue receptor biology in terms of imaging and treatment of nets. cortistatin, a natural sstr ligand which has both similar and different actions compared to sst, will not be included in this review (for detailed information regarding roles of cortistatin and sst, the review by gahete. gpcrs are characterized by a core of seven transmembrane a - helices connected by three intra- and three extracellular loops. the effector proteins of gpcr are heterotrimeric g proteins, which are composed of, and subunits. sstrs first activate a g protein which then modulates several downstream second messenger systems after binding. activated g protein depends on the sstr subtype, and three isoforms of the inhibitory g proteins (gi13) are all coupled to the different sstrs. however, using an mrna anti - sense strategy sstr2 was reported to couple to the go2/2/3 complex to control ca channel activity in pituitary cells [44, 45 ], and sstr3 was also identified to couple to go, g14 and 16. recent evidence indicates that, within the gpcr superfamily, there are mechanisms to increase receptor variability involving generation of splicing variants with less than seven transmembrane domains (tmds) [47, 48 ]. such truncated receptors, which may possess their own function or regulate the function of their respective long, canonical receptor isoforms, are frequently associated with tumour pathology [47, 48 ]. the family of sstrs is known to uniquely comprise intronless genes except sstr2. the only sst subtype variants known so far are the long (sstr2a) and short (sstr2b) isoforms of the sstr2 gene, generated due to the presence of a cryptic splice site [49, 50 ]. recently, durn - prado and colleagues have reported the first evidence for the existence of two functional human sstr5 truncated isoforms of five and four tmds, termed sst5tmd5 and sst5tmd4. these isoforms showed a unique expression pattern in normal tissues as well as in different pituitary tumour types, and display distinct functional responses to sst. binding of sst to its corresponding gpcr (sstrs) triggers a cyclical activation and inactivation process in the g protein whereas the signal is transduced intracellularly. receptosomes, which are organized around scaffolding proteins. in this regard, gpcr - interacting proteins (gips), regulators of g - protein signalling (rgs) and gpcr kinases (grks) are the main proteins that are known to effect gpcr signalling after ligand binding. gips are transmembrane or cytosolic proteins which may alter either binding or functional responses of gpcr resulting in an abundance of potential receptor protein connections. rgs proteins have been found to regulate gpcr responses by binding to and stimulating the gtpase activity of the receptor - activated gtp - bound g. although gips and rgs have been found to interact with distinct recombinant sstrs [54, 55 ], the real functional role of these complexes in native systems with respect to signal transduction is still not very well documented. sst binding is known to be rapidly followed by phosphorylation of sstr1, sstr2a and sstr3 by grks [5658 ]. the grk family consists of six serine threonine kinases that specifically bind to and phosphorylate agonist - activated gpcrs [59, 60 ]. grks play key roles in the fundamental pathways leading to phosphorylation - dependent gpcr desensitization, endocytosis, intracellular trafficking and resensitization, as well as in the modulation of important intracellular signalling cascades by gpcr. receptor phosphorylation by grks results in the recruitment of cytoplasmic proteins called arrestins in a receptor subtype - specific manner [6264 ]. arrestins are proteins involved in intracellular vesicle trafficking. in general, binding of arrestins to an activated, phosphorylated gpcr blocks further interaction between the receptors and g proteins, and thus results in the desensitization of g - protein mediated signalling. in addition, arrestins play a key role in directing gpcrs to clathrin - coated vesicles and thus preparing them for endocytosis. the consequent receptor internalization removes gpcrs from the cell surface so that they are no longer available for agonist stimulation. this is a second mechanism for gpcr desensitization, and the concentration of different arrestins as well as grk subtypes influences the extent of receptor internalization. however, not all sstrs internalize equally after agonist binding [67, 68 ]. sstr2, sstr3 and sstr5 are internalized to a much higher extent than sstr1 or sstr4 after stimulation. however, sstr2 is rapidly recycled to the plasma membrane and does not enter any degradative pathway. desensitization and internalization are not induced by sstr2 antagonists, but there is a growing body of evidence on agonist - induced desensitization and/or internalization of the sstr2 subtypes, which have been assessed in several cell lines and tissues [21, 67, 70 ]. after activation and internalization through a clathrin - dependent pathway, sstr3 and sstr5 rapidly dissociate from arrestin and undergo ubiquitin - dependent lysosomal degradation, preventing plasma membrane recycling. arrestins have also been shown to play an important role in g - protein independent gpcr signalling by recruiting cytosolic molecules to the receptor arrestin complex. the precise role of receptor phosphorylation and arrestin binding in the desensitization, trafficking and signalling of different sstr subtypes has not been fully elucidated as yet, but they probably play a critical role in sstr function. as desensitization is known to occur a few minutes after ligand binding, it is expected to have a strong impact in experimental settings in which second messenger systems are being evaluated [56, 72, 73 ]. not only the nature of the sstr subtypes present in a particular cellular environment but also the nature of the agonist is a critical determinant of the tissue response to sst. in gpcrs, including sstr signalling, a classical two - state model was accepted for a long time. the inactive, basal conformation of a receptor to the active conformation by stabilizing the latter [74, 75 ]. according to this model the relative potencies of agonists for inducing any two biological effects from a single receptor would be the same [74, 75 ]. in studies evaluating receptor dynamics, analogue activities were generally retrieved from only one or two measurements ; such as inhibition of hormone secretion or modulation of second messenger production. then these measurements were used to indicate the overall potency and efficacy of the analogues under investigation. however, with this model it was not possible to explain the effect of many agonists which might induce only some of the possible responses following receptor activation, or to activate two effectors with different relative potencies. new terms including functionally selective agonism have been used to describe the idea that agonists can selectively activate different signalling pathways and responses via a single gpcr. described in detail in an elegant review by schonbrunn, such selective signalling is explained by a model in which agonists not only exhibit different affinities for a receptor, but they also stabilize different active receptor conformations. these differentially activated receptor structures determine the interaction of the receptor with the cytoplasmic proteins, including g proteins, kinases and phosphatases, and additionally its regulation by grks or arrestins. thus, this model predicts that in any given cell type, the relative potencies or efficacies of agonists for various biological effects may differ even though their actions are triggered by a single receptor subtype. meanwhile, it is clear that signalling by, and regulation of, sstr2, sstr4 and sstr5, are sensitive to the nature of the specific activating agonist. thus, a basic and simple assumption that all agonists are functionally equivalent and produce the same spectrum of effects at individual sstrs can not be accepted any longer. receptor homodimerization and oligomerization of sstrs are other critical issues, as these processes have been shown to modify some properties of the receptors, such as ligand binding affinity, signal transduction, desensitization and up - regulation [30, 7678 ]. it has been demonstrated that (excepting sstr1) sstrs transfected in different cell lines form homodimers and some form heterodimers with other sstr subtypes and with different families of gpcr [29, 30, 79 ] (table 1). furthermore, gpcr dimerization is also regulated by ligand binding, yet not all receptors function similarly [80, 81 ]. even in the same family, the behaviour of receptors can be opposite, as reported for sstr2 and sstr5, whose dimerization decreases or increases, respectively, after ligand binding [82, 83 ]. interestingly, interactions among sstrs, in other words heterodimerization between each other, seem to be highly selective, as not all the potential combinations occur. nevertheless, not all the possibilities of sstr heterodimers have been explored, because the interactions characterized so far are between murine sstr2 and sstr3, human sstr1 and sstr5, human sstr4 and sstr5 and human sstr2 and sstr5, some being demonstrated under certain conditions. heterodimerization among these sstr subtypes causes both distinct effects on sstr functioning and modifies the endocytic process of these receptors. an example for this may be the interaction between sstr2 and sstr3, which results in both inactivation and impaired internalization of sstr3. cotransfection of human sstr1 and sstr5 in chinese hamster ovary (cho)-k1 cells results in an increased ligand affinity for sst. on the other hand, internalization of this heterodimer is better in response to a specific sstr1 ligand and smaller in response to a specific sstr5 ligand compared to monomer forms of these receptors. stabilization of human sstr2 and sstr5 heterodimers was shown to occur following selective activation of sstr2 but not human sstr5 or their concurrent stimulation. moreover, an increased recycling rate and a greater propensity of sstr2 to signal and induce growth inhibition following its heterodimerization with sstr5 were observed. murine sstr2 has been shown to heterodimerize with the -opioid receptor, mor1, in cotransfected human embryonic kidney (hek)-293 cells. although this interaction does not alter their signalling properties it induces a cross - modulation of the desensitization and internalization of both receptors. another example is heterodimerization of the dopamine receptor 2 (d2r) and sstr5. in the basal state, in the absence of ligands, these receptors do not interact : d2r forms dimers and sstr5 remains monomeric. however, treatment with ligands for any of the receptors dramatically induces heterodimerization and enhanced inhibition of camp formation occurs. binding of quinpirole, a d2r agonist, increases binding affinity of sst by 3000%, whereas a d2r antagonist, sulpiride, decreases binding affinity for the peptide by 80%. an interaction between the d2r and the human sstr2 has been also reported, which does not seem to occur under basal conditions, but is induced by ligand binding. their interaction results in a heterodimer with an increased affinity for dopamine and increased signalling via the d2r receptor. however, sstr2 pharmacology and signalling are not altered by heterodimerization with the d2r, but its endocytic rate is increased as a consequence of this interaction. additionally, heterodimerization of sstrs appears to confer the properties of one receptor subtype onto the dimer ; sstr1 is internalized and up - regulated by octreotide when heterodimerized with sstr5, and the sstr3/sstr2a heterodimer has the pharmacological effects of the sstr2a receptor. however, because of the fact that the dimerization of sstrs has been observed in recombinant systems and experimental settings, it is not clear as to what degree it can be extended to native systems. summary of the studies on receptor oligomerization abbreviations : cho - k1, chinese hamster ovary cells ; d2r, dopamin receptor 2 ; (hek)-293, human embryonic kidney cells ; mor1, m - opioid receptor. there are a number of mechanisms responsible for the anti - tumour actions of sst. these are the direct blockade of cell cycle progression through the activation of phosphotyrosine phosphatases (ptps), the indirect influence on tumour growth mediated by the inhibition of the production of growth factors that sustain tumour development, and an anti - angiogenic effect that involves the regulation of the activity of both endothelial cells and monocytes. some of the key points in direct and indirect anti - tumour actions of sst will be summarized in this section. in general, sstr1, sstr2, sstr4 and sstr5 produce cytostatic effects through similar downstream effector pathways, whereas sstr2 and sstr3 induces pro - apoptotic (cytotoxic) signals when activated [79, 89, 90 ] (table 2) (for detailed information see next section). sst suppresses insulin - like growth factor (igf)-i serum levels through a direct inhibition of its gene expression or through the inhibition of gh secretion from pituitary and the consequent reduction of the gh - stimulated igf-1 production in liver. moreover, sst analogues inhibit the secretion of autocrine / paracrine effectors of tumour cell survival such as the igf-1 and -2, egf, interleukin-6 and the transforming growth factor family. the attenuation of secretion of such survival factors in the tumour microenvironment accordingly establishes an autocrine / paracrine anti - proliferative effect. summary of sst action stable transfection of pancreatic cancer cell lines with human sstr2a was reported to induce an overexpression of the connexins 26 and 43, which resulted in formation of functional intercellular gap junctions and hence restored contact inhibition of cell proliferation. during the initial stages of metastatic development, malignant cells must enter the lymphatic and systemic circulation by detaching from adjacent cells and then attaching to and disrupting the endothelial basement membrane [92, 93 ]. sst has been shown to reduce the adhesion of carcino - sarcoma cells to blood vessels and thus attenuate the metastatic potential of these tumours. for the anti - angiogenic activity of sstrs, three signal pathways were identified : inhibition of endothelial cell activity (proliferation, migration and invasion), inhibition of the synthesis and secretion of pro - angiogenic factors such as vascular endothelial growth factor and basic fibroblast growth factor, and inhibition of monocyte activation. very recently, thrombospondin-1 was defined as a critical effector of the inhibitory role of sstr2 on the neoangiogenesis and oncogenesis induced by pancreatic cancer cells. studies in the signal transduction field have demonstrated that native sst inhibits the secretion and proliferation of both normal and neoplastic pituitary cells by inducing several intracellular pathways, depending on receptor subtype and target tissue. the mechanisms whereby sstrs transduce agonist induced messages into intracellular responses under different conditions and in different cells are complex. the signalling pathways used by each receptor have not been fully elucidated yet, as different tissues and cells express different subtypes of receptors and most cells have more than one subtype of receptor. besides, the modulated intracellular cascades may vary depending on the sst analogue, the sstr subtype and most importantly according to the cell type used in that experiment [6, 68, 79, 97 ]. although there are a number of specific receptor agonists, some agonists used in experimental settings can activate two receptors at the same time with different levels of affinities, which makes it difficult to clarify receptor - specific effects. when sstrs are activated by sst, the receptor interacts with heterotrimeric g protein which consists of, and subunits. when an agonist activates gpcr, the gdp - bound gb heterotrimer interacts with the receptor and the subunit decreases the affinity for gdp. as the gtp concentration is higher in the cytoplasm, thereafter, g protein dissociates both from the receptor and subunits and both modulate the activity of several intracellular pathways. among these there are several key enzymes, including ptps, adenylyl cyclase (ac) and pathways including mitogen - activated protein kinase (mapk) and phosphoinositol-3-kinase (pi3k)/akt, which are modulated along with reduction of the ca influx through voltage sensitive channels and the activation of k channels. in the human genome around 107 ptps classical ptps with an elevated specificity for phosphotyrosines. in studies using cells transfected with individual sstr subtypes, all the five members of this receptor subfamily have been shown to couple to a number of ptps, including the sh2 domain - containing cytosolic tyrosine phosphatases (shp-1 and shp-2), and the density - enhanced protein - tyrosine phosphatase-1 (dep-1/ptp) [38, 100 ]. sst also couples to protein - serine / threonine phosphatases (pp), including pp2a and pp2b (calcineurin). the anti - proliferative action of sst - activated ptps depends on altered growth factor signalling through the selective dephosphorylation and inactivation of their receptors, plus inhibition of one of the most important mapk pathways for cell proliferation, namely the extracellular signal - regulated protein kinase 1/2 (erk 1/2) pathway (fig. 1), and control of the activity of another important downstream signalling pathway, pi3k / akt (fig. the inhibition of the erk 1/2 pathway can occur either indirectly via the inhibition of the growth factor tyrosine kinase receptors or directly by dephosphorylating erk 1/2 or by hyperactivation of erk 1/2 (see below) [102, 103 ]. such altered growth factor signalling through the selective dephosphorylation and inactivation of their receptors have been reported for shp-1 with the insulin receptor, for shp-2 with the insulin, egf and platelet - derived growth factor (pdgf) receptor [104107 ], for dep-1 with pdgf and the vascular endothelial growth factor receptor [108, 109 ] and for ptp1b with the egf receptor. a simplified diagram of the ras / erk pathway and sst effects through ptps, shp-1 and shp-2. note shp-1 and shp-2 inhibition of growth factor receptors, shp-1 inhibition of erk 1/2, shp-2 inhibition of raf kinase shown in blue lines. shp-1 and shp-2 lead the cells to accumulate in g1 phase and inhibit entry in the s phase of the cell cycle. abbreviations : atf1, activating transcription factor ; ccnd1, cyclin d1 ; creb, camp responsive element binding protein ; erk, extracellular signal - regulated protein kinase ; gap, gtpase - activating protein ; gef, guanine nucleotide exchange factor ; grb2, growth factor receptor binding protein 2 ; ksr, kinase suppressor of ras ; mtor, mammalian target of rapamycin ; mek, mitogen - activated protein / extracellular signal - regulated kinase (erk) kinase ; msk, mitogen and stress activated kinase ; nf-b, nuclear factor-b ; p90rsk, p90 ribosomal s6 kinase ; rtk, receptor tyrosine kinase ; src, cytosolic tyrosine kinase ; shp-1, sh-2 domain containing cytosolic tyrosine phosphatase 1 ; shp-2, sh-2 domain containing cytosolic tyrosine phosphatase 2 ; sos, mammalian son - of - sevenless ; sst, somatostatin ; sstr, somatostatin receptor. a simplified diagram of pi3k / akt pathway and sst effects through ptp shp-1. arrowheads show activation, bold lines with rounded heads show inhibition of the corresponding protein. note direct inhibition of growth factor receptor and p85 regulatory subunit of pi3k, and indirect inhibition of akt pathway by shp-1 shown in dotted lines. as a result, shp-1 cause up - regulation of p21 and p and the tumour suppressor gene zac1 and activation of caspase 8 and pro - apoptotic protein bax. for simplicity abbreviations : bad, bcl2-antagonist of death ; ccnd1, cyclin d1 ; ccne, cyclin e ; erk, extracellular signal - regulated protein kinases ; hdm2, human homolog of murine double minute ubiquitin ligase ; gsk-3, glycogen synthase kinase-3 ; ikk, ib kinase ; mtor, mammalian target of rapamycin ; nf-b, nuclear factor-b ; p21, cyclin dependent kinase inhibitor p21 ; p27, cyclin dependent kinase inhibitor p27 ; pdk1, phosphoinositide - dependent kinase 1 ; rtk, receptor tyrosine kinase ; shp-1, sh-2 domain containing cytosolic tyrosine phosphatase 1 ; sst, somatostatin ; sstr, somatostatin receptor. sstr activation of shp-1 was reported to induce arrest of cell proliferation in human pituitary adenomas, gh3 rat pituitary tumour cells, in different tumour cell lines derived from pancreatic cancers (mia - paca-2, panc-1, pc-1) and from thyroid medullary carcinoma, among others [79, 101, 113115 ]. shp-1 activation is the critical step for sstr2-mediated anti - proliferative signalling [101, 116 ]. tyrosine phosphorylated sstr2 interacts with and activates shp-2 and src, a cytosolic tyrosine kinase, inducing consequent shp-1 recruitment and activation (fig., sst - activated shp-1 rapidly associates to the insulin receptor causing a tyrosine dephosphorylation of both the receptor itself and its substrates (i.e. irs-1, shc) leading to a negative modulation of insulin mitogenic signalling. additionally, shp-1 inhibits the erk 1/2 pathway by directly or indirectly dephosphorylating erk 1/2, causes overexpression of the cyclin - dependent kinase inhibitor p and an increase in hypophosphorylated retinoblastoma gene product (rb) which, taken together, leads to inhibition of the entry in the s phase of the cell cycle and accumulation of the cells in g1. in pancreatic and pituitary tumour cells sstr2 activation of shp-1 additionally, a completely novel mechanism was identified in nih3t3 (nih swiss mouse embryonic fibroblast cell line) cells in which the activation of shp-1 by sstr2 activates the transcription factor nuclear factor-b causing an inhibition of the anti - apoptotic effects of the map kinase, jun n - terminal kinase and, in turn, hyperactivation of caspase 8 and apoptosis. of interest in this regard is the finding that sstr2 also affects the apoptosis induced by death receptors, sensitizing the cells to tumour necrosis factor (tnf)-- and trail - mediated responses through the up - regulation of their receptors : death receptor 4 and tnfr1. in essence, shp-1 activity was also involved in sstr3-dependent apoptosis in transfected cho cells, but this time by involving the induction of p53 and the subsequent activation of the pro - apoptotic protein bax. in gh3 cells, sstr2-induced activation of shp-1 causes the dephosphorylation of p85 and hence the inhibition of pi3k activity. as would be expected, inhibition of pi3k activity causes inhibition of pdk1 and akt activities, which in turn results in the activation of the glycogen synthase kinase-3 (gsk-3) (fig. 2). theodoropoulou and colleagues have reported that the enhanced gsk-3 activity up - regulated the expression of zac1 gene, which ultimately induced growth arrest. zac1 is highly expressed in normal pituitary, mammary and ovarian glands but is down - regulated in pituitary, breast and ovarian tumours, suggesting that it might act as a tumour suppressor gene. their further study investigating the immunoreactivity of zac1 protein in tumour tissues of patients treated with sst analogues prior to surgery has also revealed a significantly positive correlation between strong zac1 immunoreactivity and igf - i normalization and the presence of tumour shrinkage after sst analogue treatment. in left, besides shp-1 and shp- 2 activity, another delayed and long - lasting ptp activity was also induced following sst treatment. as opposed to shp-1 and shp-2 which are cytosolic, non - membrane ptps, one of these ptps was identified in a receptor like ptp named dep-1 in human beings (ptp in rats), whose tumour suppressor role had already been established. it was suggested that, in endothelial cells, dep-1/ptp represents a possible effector of sstr to inhibit tumoral angiogenesis and the activity of dep-1 seems fundamental in blocking endothelial cell migration and proliferation [109, 131, 132 ] ; the in vivo and in vitro anti - angiogenic activity of sst was dependent on the activation of ptps [133, 134 ]. sstr1-activated dep-1 was shown to inhibit erk 1/2 in pc c13 thyroid cells and sstr1-, sstr2- and sstr5-activated dep-1 was shown to inhibit erk 1/2 in glioma cells. in cho - k1 cells expressing sstr1, a large multimeric protein aggregation composed of the g protein, jak2, shp-2, src and dep-1 dep-1 activation required the sequential activation of jak2 (g - protein mediated), which phosphoryated shp-2. when phosphorylated, shp-2 shows increased activity, dissociates from the receptor and dephosphorylates the inhibitory tyrosine on src which, activated this way, in turn, phosphorylate dep-1 causing the sustained activity of this ptp to inactivate erk 1/2. as activation of similar multieffector cascades by sstr1 and sstr2 involving a similar interaction of kinases and ptps (jak2, shp-2, src) leads to final ptp activation (shp-1 or dep-1), it has been suggested that this multieffector pathway could represent a common modular mechanism by which cytostatic mechanisms are induced by sst [117, 136 ]. the right ptp, shp-2, was involved in the anti - proliferative activity of sst following sstr1 [102, 125 ], sstr2, sstr3 and sstr4 activation. besides dephosphorylating and inactivating the tyrosine kinase receptors for insulin and egf [104, 107 ], shp-2 is involved in cell growth arrest (fig. it is known that the effects of erk 1/2 on cell proliferation are also related to the duration and intensity of erk 1/2 activation, and hyperactivation of the erk 1/2 pathway can also cause cell cycle arrest. in light of this knowledge, it is now known that the activation of both sstr1 and sstr2 induces cell cycle arrest via the hyperactivation of erk 1/2 and the up - regulation of p21 and p27, respectively [102, 103 ]. in particular, the activation of sstr1-induced erk 1/2 pathway involved src / shp-2/pi3k / ras / raf-1/mek (mitogen - activated protein), the sstr2-regulated pathway involved shp-1/shp-2/pi3k / rap1 and ras / b - raf / mek while, on the contrary, sstr3 activation caused raf-1 inactivation and blockade of the erk 1/2 cascade [128, 129 ]. the inhibitory effects of sst on camp production, and its effects on k and ca currents, are mainly involved in the regulation of hormone secretion in different endocrine cells. decreased intracellular camp and ca levels and increased outward k currents all lead to decreased hormone secretion. starting with camp, the negative modulation of ac activity leads to the regulation of camp production. this also has a negative impact on various downstream elements, in particular, protein kinase a, which is the major target for camp in the cell. the inhibition of ac by sst has been demonstrated in many different systems, including human pituitary adenomas. all sstr subtypes inhibit ac via the pertussis toxin - sensitive g - protein family, gi / go. specifically, sstr2 decreased ac activity / camp accumulation in bon-1 (pancreatic net cell line) and sh - sy5y (neuroblastoma cell line) cells [138, 139 ] and in pituitary cells. the stimulation of sstr3 in cho and hek-293 cells decreases ac activity [141, 142 ]. sstr5 decreased camp levels in human sh - sy5y and bon-1 cells [138, 139 ] and in att-20 mouse pituitary corticotroph cells [34, 143145 ]. sstrs have been shown to directly (via g - protein activation of the k channel) or indirectly (via g - protein activation of second messenger pathways, which ultimately lead to activation of the k channel) activate a number of different k channels and increase k currents, leading to cell membrane hyperpolarization and a reduction in action potential frequency and duration [13, 68, 146, 147 ]. specifically, sstr2 (more efficiently than the other subtypes), sstr3, sstr4 and sstr5 were shown to activate the g - protein gated inward - rectifier k channels. however, in rat gh3 cells, sstr1, sstr2, sstr4 and sstr5 are all involved in the activation of delayed rectifying and transient outward k channels, although sstr2 and sstr4 were suggested to mediate the full activation of k current caused by sst. there is a general agreement that sstrs are linked to the direct inhibition of voltage - dependent ca channels. the sstr1 inhibits ca current in gh12c1 (rat pituitary tumour cell line) and rat insulinoma 104638 cells, but not in gh3 cells. the sstr2 inhibits voltage - dependent ca channels in certain cells, like gh12c1, rinm5f (rat insulinoma cell line), att-20 (a pituitary cell line) and gh3 cells [149152 ] and again sstr5 was shown to be coupled negatively to a ca current in att-20. following the evidence showing sst - induced increase of inositol 1,4,5-trisphosphate (ip3) in bovine adrenal medullary cells, it is now widely accepted that sstrs may affect the activity of phospholipase c (plc) in native systems and, hence, modulate intracellular levels of ip3 and/or the activity of plc - dependent protein kinase (pkc). sstr1 was shown to mediate phospholipase plc activation and ip3 production in cho cells [154, 155 ]. sstr2 mediates the activation of plc in gh4c1 (rat pituitary tumour cell line) and f4c1 (rat pituitary cell line) cells [150, 154, 156 ]. activation of plc and ip3 production by sstr4 was also observed in transfected cos (monkey kidney cell line) cells. phospholipase a2 (pla2) is a cytoplasmic enzyme that hydrolyses triglycerol to form arachidonic acid, the metabolites of which have been shown to regulate different physiological and pathological functions [158, 159 ]. sst coupling negatively to arachidonate release has been shown in the rat anterior pituitary gland. in contrast, sst has been suggested to generate arachidonic acid metabolites in rat gh4c1 cells, through pertussis toxin - sensitive g proteins. nevertheless, in a few cases sst was reported to induce cell proliferation through sstr4 activation, which was observed to increase erk 1/2 activity and, in turn, regulate pla2 activation. moreover, also other mapks, more frequently associated to the induction of cell growth arrest, are regulated by sst : p38 is activated by sstr2 and sstr4 in cho - k1 cells and jun n - terminal kinase is activated by sstr5. sst was reported to regulate nitric oxide generation through the activation of both the endothelial and neuronal nitric oxide synthases (enos and nnos, respectively). however, sst has been shown to have a dual effect on the release of nitric oxide. in different paradigms it has been shown to increase or inhibit nitric oxide levels via the involvement of different receptor subtypes and intracellular pathways. sstr2 caused a shp-1-dependent dephosphorylation and activation of nnos in mouse pancreas acini cells, which leads to increased nitric oxide production. guanylyl cyclase converts gtp to cyclic nucleotide guanosine monophosphate (cgmp), which is a regulatory mediator of cell proliferation. the increased nitric oxide production in these cells results in activation of cgmp levels which is believed to be instrumental in growth arrest [164, 165 ]. cgmp exerts its effects via modulation of cgmp - dependent protein kinase (pkg), cgmp - gated ionic channels and cyclic nucleotide phosphodiesterases [167, 168 ]. conversely, in a study by cordelier and colleagues, inhibition of nnos activity and a reduction in intracellular cgmp formation which resulted in cell growth arrest was observed in cho cells expressing sstr5. it was noted in this study that sstr5 inhibits cell proliferation through sstr5-mediated src activation and subsequent nnos tyrosine phosphorylation and inactivation, leading to a decrease of cgmp production and subsequent mapk inhibition [166, 169 ]. sst - induced negative regulation of nitric oxide was also shown to be implicated in the inhibition of tumour angiogenesis and growth via the sstr3-mediated negative regulation of enos. the inhibition of na - h (nhe1) exchanger activity is responsible for anti - proliferative effects of sst in enteric endocrine cells and hepatic cells. interestingly, the inhibition of nhe1 is the only intracellular signalling regulated by sstrs that was reported to be pertussis toxin insensitive. involvement of serine threonine phophatase in sst action was also implied in a study by grozinsky - glasberg and colleagues. in this study in ins-1 rat insulinoma cell line, both octreotide and the mtor inhibitor everolimus (rad001, novartis, basel, switzerland) were shown inhibit cell proliferation and dephosphorylate tuberous sclerosis 2 (tsc2), which could imply activation of a serine threonine phosphatase by these agents. we have also shown that in the ins-1 cell line, the presence of a serine- threonine phosphatase inhibitor (okadaic acid) significantly reversed the anti - proliferative effect of octreotide (m. cakir and a. grossman, unpublished observations). this implies that blockade of activation of a serine threonine phosphatase is a necessary component to the anti - proliferative activity of octreotide in this system. in the human genome around 107 ptps have been identified, which includes 38 so - called classical ptps with an elevated specificity for phosphotyrosines. in studies using cells transfected with individual sstr subtypes, all the five members of this receptor subfamily have been shown to couple to a number of ptps, including the sh2 domain - containing cytosolic tyrosine phosphatases (shp-1 and shp-2), and the density - enhanced protein - tyrosine phosphatase-1 (dep-1/ptp) [38, 100 ]. sst also couples to protein - serine / threonine phosphatases (pp), including pp2a and pp2b (calcineurin). the anti - proliferative action of sst - activated ptps depends on altered growth factor signalling through the selective dephosphorylation and inactivation of their receptors, plus inhibition of one of the most important mapk pathways for cell proliferation, namely the extracellular signal - regulated protein kinase 1/2 (erk 1/2) pathway (fig. 1), and control of the activity of another important downstream signalling pathway, pi3k / akt (fig. the inhibition of the erk 1/2 pathway can occur either indirectly via the inhibition of the growth factor tyrosine kinase receptors or directly by dephosphorylating erk 1/2 or by hyperactivation of erk 1/2 (see below) [102, 103 ]. such altered growth factor signalling through the selective dephosphorylation and inactivation of their receptors have been reported for shp-1 with the insulin receptor, for shp-2 with the insulin, egf and platelet - derived growth factor (pdgf) receptor [104107 ], for dep-1 with pdgf and the vascular endothelial growth factor receptor [108, 109 ] and for ptp1b with the egf receptor. a simplified diagram of the ras / erk pathway and sst effects through ptps, shp-1 and shp-2. note shp-1 and shp-2 inhibition of growth factor receptors, shp-1 inhibition of erk 1/2, shp-2 inhibition of raf kinase shown in blue lines. shp-1 and shp-2 lead the cells to accumulate in g1 phase and inhibit entry in the s phase of the cell cycle. for simplicity abbreviations : atf1, activating transcription factor ; ccnd1, cyclin d1 ; creb, camp responsive element binding protein ; erk, extracellular signal - regulated protein kinase ; gap, gtpase - activating protein ; gef, guanine nucleotide exchange factor ; grb2, growth factor receptor binding protein 2 ; ksr, kinase suppressor of ras ; mtor, mammalian target of rapamycin ; mek, mitogen - activated protein / extracellular signal - regulated kinase (erk) kinase ; msk, mitogen and stress activated kinase ; nf-b, nuclear factor-b ; p90rsk, p90 ribosomal s6 kinase ; rtk, receptor tyrosine kinase ; src, cytosolic tyrosine kinase ; shp-1, sh-2 domain containing cytosolic tyrosine phosphatase 1 ; shp-2, sh-2 domain containing cytosolic tyrosine phosphatase 2 ; sos, mammalian son - of - sevenless ; sst, somatostatin ; sstr, somatostatin receptor. a simplified diagram of pi3k / akt pathway and sst effects through ptp shp-1. arrowheads show activation, bold lines with rounded heads show inhibition of the corresponding protein. note direct inhibition of growth factor receptor and p85 regulatory subunit of pi3k, and indirect inhibition of akt pathway by shp-1 shown in dotted lines. as a result, shp-1 cause up - regulation of p21 and p and the tumour suppressor gene zac1 and activation of caspase 8 and pro - apoptotic protein bax. abbreviations : bad, bcl2-antagonist of death ; ccnd1, cyclin d1 ; ccne, cyclin e ; erk, extracellular signal - regulated protein kinases ; hdm2, human homolog of murine double minute ubiquitin ligase ; gsk-3, glycogen synthase kinase-3 ; ikk, ib kinase ; mtor, mammalian target of rapamycin ; nf-b, nuclear factor-b ; p21, cyclin dependent kinase inhibitor p21 ; p27, cyclin dependent kinase inhibitor p27 ; pdk1, phosphoinositide - dependent kinase 1 ; rtk, receptor tyrosine kinase ; shp-1, sh-2 domain containing cytosolic tyrosine phosphatase 1 ; sst, somatostatin ; sstr, somatostatin receptor. sstr activation of shp-1 was reported to induce arrest of cell proliferation in human pituitary adenomas, gh3 rat pituitary tumour cells, in different tumour cell lines derived from pancreatic cancers (mia - paca-2, panc-1, pc-1) and from thyroid medullary carcinoma, among others [79, 101, 113115 ]. shp-1 activation is the critical step for sstr2-mediated anti - proliferative signalling [101, 116 ]. tyrosine phosphorylated sstr2 interacts with and activates shp-2 and src, a cytosolic tyrosine kinase, inducing consequent shp-1 recruitment and activation (fig. sst - activated shp-1 rapidly associates to the insulin receptor causing a tyrosine dephosphorylation of both the receptor itself and its substrates (i.e. irs-1, shc) leading to a negative modulation of insulin mitogenic signalling. additionally, shp-1 inhibits the erk 1/2 pathway by directly or indirectly dephosphorylating erk 1/2, causes overexpression of the cyclin - dependent kinase inhibitor p and an increase in hypophosphorylated retinoblastoma gene product (rb) which, taken together, leads to inhibition of the entry in the s phase of the cell cycle and accumulation of the cells in g1. in pancreatic and pituitary tumour cells sstr2 activation of shp-1 additionally, a completely novel mechanism was identified in nih3t3 (nih swiss mouse embryonic fibroblast cell line) cells in which the activation of shp-1 by sstr2 activates the transcription factor nuclear factor-b causing an inhibition of the anti - apoptotic effects of the map kinase, jun n - terminal kinase and, in turn, hyperactivation of caspase 8 and apoptosis. of interest in this regard is the finding that sstr2 also affects the apoptosis induced by death receptors, sensitizing the cells to tumour necrosis factor (tnf)-- and trail - mediated responses through the up - regulation of their receptors : death receptor 4 and tnfr1. in essence, shp-1 activity was also involved in sstr3-dependent apoptosis in transfected cho cells, but this time by involving the induction of p53 and the subsequent activation of the pro - apoptotic protein bax. in gh3 cells, sstr2-induced activation of shp-1 causes the dephosphorylation of p85 and hence the inhibition of pi3k activity. as would be expected, inhibition of pi3k activity causes inhibition of pdk1 and akt activities, which in turn results in the activation of the glycogen synthase kinase-3 (gsk-3) (fig. 2). theodoropoulou and colleagues have reported that the enhanced gsk-3 activity up - regulated the expression of zac1 gene, which ultimately induced growth arrest. zac1 is highly expressed in normal pituitary, mammary and ovarian glands but is down - regulated in pituitary, breast and ovarian tumours, suggesting that it might act as a tumour suppressor gene. their further study investigating the immunoreactivity of zac1 protein in tumour tissues of patients treated with sst analogues prior to surgery has also revealed a significantly positive correlation between strong zac1 immunoreactivity and igf - i normalization and the presence of tumour shrinkage after sst analogue treatment. in left, besides shp-1 and shp- 2 activity, another delayed and long - lasting ptp activity was also induced following sst treatment. as opposed to shp-1 and shp-2 which are cytosolic, non - membrane ptps, one of these ptps was identified in a receptor like ptp named dep-1 in human beings (ptp in rats), whose tumour suppressor role had already been established. it was suggested that, in endothelial cells, dep-1/ptp represents a possible effector of sstr to inhibit tumoral angiogenesis and the activity of dep-1 seems fundamental in blocking endothelial cell migration and proliferation [109, 131, 132 ] ; the in vivo and in vitro anti - angiogenic activity of sst was dependent on the activation of ptps [133, 134 ]. sstr1-activated dep-1 was shown to inhibit erk 1/2 in pc c13 thyroid cells and sstr1-, sstr2- and sstr5-activated dep-1 was shown to inhibit erk 1/2 in glioma cells. in cho - k1 cells expressing sstr1, a large multimeric protein aggregation composed of the g protein, jak2, shp-2, src and dep-1 dep-1 activation required the sequential activation of jak2 (g - protein mediated), which phosphoryated shp-2. when phosphorylated, shp-2 shows increased activity, dissociates from the receptor and dephosphorylates the inhibitory tyrosine on src which, activated this way, in turn, phosphorylate dep-1 causing the sustained activity of this ptp to inactivate erk 1/2. as activation of similar multieffector cascades by sstr1 and sstr2 involving a similar interaction of kinases and ptps (jak2, shp-2, src) leads to final ptp activation (shp-1 or dep-1), it has been suggested that this multieffector pathway could represent a common modular mechanism by which cytostatic mechanisms are induced by sst [117, 136 ]. the right ptp, shp-2, was involved in the anti - proliferative activity of sst following sstr1 [102, 125 ], sstr2, sstr3 and sstr4 activation. besides dephosphorylating and inactivating the tyrosine kinase receptors for insulin and egf [104, 107 ], it is known that the effects of erk 1/2 on cell proliferation are also related to the duration and intensity of erk 1/2 activation, and hyperactivation of the erk 1/2 pathway can also cause cell cycle arrest. in light of this knowledge, it is now known that the activation of both sstr1 and sstr2 induces cell cycle arrest via the hyperactivation of erk 1/2 and the up - regulation of p21 and p27, respectively [102, 103 ]. in particular, the activation of sstr1-induced erk 1/2 pathway involved src / shp-2/pi3k / ras / raf-1/mek (mitogen - activated protein), the sstr2-regulated pathway involved shp-1/shp-2/pi3k / rap1 and ras / b - raf / mek while, on the contrary, sstr3 activation caused raf-1 inactivation and blockade of the erk 1/2 cascade [128, 129 ]. the inhibitory effects of sst on camp production, and its effects on k and ca currents, are mainly involved in the regulation of hormone secretion in different endocrine cells. decreased intracellular camp and ca levels and increased outward k currents all lead to decreased hormone secretion. starting with camp, the negative modulation of ac activity leads to the regulation of camp production. this also has a negative impact on various downstream elements, in particular, protein kinase a, which is the major target for camp in the cell. the inhibition of ac by sst has been demonstrated in many different systems, including human pituitary adenomas. all sstr subtypes inhibit ac via the pertussis toxin - sensitive g - protein family, gi / go. specifically, sstr2 decreased ac activity / camp accumulation in bon-1 (pancreatic net cell line) and sh - sy5y (neuroblastoma cell line) cells [138, 139 ] and in pituitary cells. the stimulation of sstr3 in cho and hek-293 cells decreases ac activity [141, 142 ]. sstr5 decreased camp levels in human sh - sy5y and bon-1 cells [138, 139 ] and in att-20 mouse pituitary corticotroph cells [34, 143145 ]. sstrs have been shown to directly (via g - protein activation of the k channel) or indirectly (via g - protein activation of second messenger pathways, which ultimately lead to activation of the k channel) activate a number of different k channels and increase k currents, leading to cell membrane hyperpolarization and a reduction in action potential frequency and duration [13, 68, 146, 147 ]. specifically, sstr2 (more efficiently than the other subtypes), sstr3, sstr4 and sstr5 were shown to activate the g - protein gated inward - rectifier k channels. however, in rat gh3 cells, sstr1, sstr2, sstr4 and sstr5 are all involved in the activation of delayed rectifying and transient outward k channels, although sstr2 and sstr4 were suggested to mediate the full activation of k current caused by sst. there is a general agreement that sstrs are linked to the direct inhibition of voltage - dependent ca channels. the sstr1 inhibits ca current in gh12c1 (rat pituitary tumour cell line) and rat insulinoma 104638 cells, but not in gh3 cells. the sstr2 inhibits voltage - dependent ca channels in certain cells, like gh12c1, rinm5f (rat insulinoma cell line), att-20 (a pituitary cell line) and gh3 cells [149152 ] and again sstr5 was shown to be coupled negatively to a ca current in att-20. following the evidence showing sst - induced increase of inositol 1,4,5-trisphosphate (ip3) in bovine adrenal medullary cells, it is now widely accepted that sstrs may affect the activity of phospholipase c (plc) in native systems and, hence, modulate intracellular levels of ip3 and/or the activity of plc - dependent protein kinase (pkc). sstr1 was shown to mediate phospholipase plc activation and ip3 production in cho cells [154, 155 ]. sstr2 mediates the activation of plc in gh4c1 (rat pituitary tumour cell line) and f4c1 (rat pituitary cell line) cells [150, 154, 156 ]. activation of plc and ip3 production by sstr4 was also observed in transfected cos (monkey kidney cell line) cells. phospholipase a2 (pla2) is a cytoplasmic enzyme that hydrolyses triglycerol to form arachidonic acid, the metabolites of which have been shown to regulate different physiological and pathological functions [158, 159 ]. sst coupling negatively to arachidonate release has been shown in the rat anterior pituitary gland. in contrast, sst has been suggested to generate arachidonic acid metabolites in rat gh4c1 cells, through pertussis toxin - sensitive g proteins. nevertheless, in a few cases sst was reported to induce cell proliferation through sstr4 activation, which was observed to increase erk 1/2 activity and, in turn, regulate pla2 activation. moreover, also other mapks, more frequently associated to the induction of cell growth arrest, are regulated by sst : p38 is activated by sstr2 and sstr4 in cho - k1 cells and jun n - terminal kinase is activated by sstr5. sst was reported to regulate nitric oxide generation through the activation of both the endothelial and neuronal nitric oxide synthases (enos and nnos, respectively). however, sst has been shown to have a dual effect on the release of nitric oxide. in different paradigms it has been shown to increase or inhibit nitric oxide levels via the involvement of different receptor subtypes and intracellular pathways. sstr2 caused a shp-1-dependent dephosphorylation and activation of nnos in mouse pancreas acini cells, which leads to increased nitric oxide production. guanylyl cyclase converts gtp to cyclic nucleotide guanosine monophosphate (cgmp), which is a regulatory mediator of cell proliferation. the increased nitric oxide production in these cells results in activation of cgmp levels which is believed to be instrumental in growth arrest [164, 165 ]. cgmp exerts its effects via modulation of cgmp - dependent protein kinase (pkg), cgmp - gated ionic channels and cyclic nucleotide phosphodiesterases [167, 168 ]. conversely, in a study by cordelier and colleagues, inhibition of nnos activity and a reduction in intracellular cgmp formation which resulted in cell growth arrest was observed in cho cells expressing sstr5. it was noted in this study that sstr5 inhibits cell proliferation through sstr5-mediated src activation and subsequent nnos tyrosine phosphorylation and inactivation, leading to a decrease of cgmp production and subsequent mapk inhibition [166, 169 ]. sst - induced negative regulation of nitric oxide was also shown to be implicated in the inhibition of tumour angiogenesis and growth via the sstr3-mediated negative regulation of enos. the inhibition of na - h (nhe1) exchanger activity is responsible for anti - proliferative effects of sst in enteric endocrine cells and hepatic cells. interestingly, the inhibition of nhe1 is the only intracellular signalling regulated by sstrs that was reported to be pertussis toxin insensitive. involvement of serine threonine phophatase in sst action was also implied in a study by grozinsky - glasberg and colleagues. in this study in ins-1 rat insulinoma cell line, both octreotide and the mtor inhibitor everolimus (rad001, novartis, basel, switzerland) were shown inhibit cell proliferation and dephosphorylate tuberous sclerosis 2 (tsc2), which could imply activation of a serine threonine phosphatase by these agents. we have also shown that in the ins-1 cell line, the presence of a serine- threonine phosphatase inhibitor (okadaic acid) significantly reversed the anti - proliferative effect of octreotide (m. cakir and a. grossman, unpublished observations). this implies that blockade of activation of a serine threonine phosphatase is a necessary component to the anti - proliferative activity of octreotide in this system. | abstractneuroendocrine tumours (nets) may occur at many sites in the body although the majority occur within the gastroenteropancreatic axis. non - gastroenteropancreatic nets encompass phaeochromocytomas and paragangliomas, medullary thyroid carcinoma, anterior pituitary tumour, broncho - pulmonary nets and parathyroid tumours. like most endocrine tumours, nets also express somatostatin (sst) receptors (subtypes 15) whose ligand sst is known to inhibit endocrine and exocrine secretions and have anti - tumour effects. in the light of this knowledge, the idea of using sst analogues in the treatment of nets has become increasingly popular and new studies have centred upon the development of new sst analogues. we attempt to review sst receptor (sstr) biology primarily in neuroendocrine tissues, focusing on pituitary tumours. a full data search was performed through pubmed over the years 20002009 with keywords somatostatin, molecular biology, somatostatin receptors, somatostatin signalling, net, pituitary and all relevant publications have been included, together with selected publications prior to that date. sstr signalling in non - neuroendocrine solid tumours is beyond the scope of this review. sst is a potent anti - proliferative and anti - secretory agent for some nets. the successful therapeutic use of sst analogues in the treatment of these tumours depends on a thorough understanding of the diverse effects of sstr subtypes in different tissues and cell types. further studies will focus on critical points of sstr biology such as homo- and heterodimerization of sstrs and the differences between post - receptor signalling pathways of sstr subtypes. |
electrocardiogram (ecg) signal which is the recording of the cardiac electrical activity provides the important information about heart 's condition. detection of ecg arrhythmias is necessary for the treatment of patients for diagnosing the heart disease at the early stage. it is very difficult for doctors to analyze long ecg records in the short period of time and also human eye is poorly suited to detect the morphological variation of ecg signal, hence imposing the need for an effective computer aided diagnostic (cad) system. the automatic ecg signal analysis faces a difficult problem due to large variation in morphological and temporal characteristics of ecg waveforms of different patients as well as the same patients. the ecg waveforms may differ for the same patient at different time and may be similar for different patients having different types of beats. for this reason, most of the ecg beats classification methods perform well on the training data but provide poor performance on the ecg waveforms of different patients. in the last decade, a number of researchers have reported the different automatic ecg classification techniques [28 ]. an efficient system for recognition of the premature ventricular contraction from the normal beats and other heart diseases is reported in and achieved accuracy of 97.14% using twelve files from mit - bih database for ecg classification. the ecg beat classification system based on higher order statistics of subband components and a feed forward back propagation neural network is described in the literature and achieved the classification accuracy of 96.34%. in, a combination method based on the complementary features of mixture of experts and negative correlation learning methods is introduced for classifying the normal heartbeats, premature ventricular contraction (pvc) arrhythmias, and other abnormalities and achieved accuracy of 96.02%. the multilayer perceptron neural network classifier is used to classify the four types of ecg beats (normal beat, congestive heart failure beat, ventricular tachyarrhythmia beat, and atrial fibrillation beat) using lyapunov exponents, wavelet coefficients, and the power levels of power spectral density (psd) values obtained by eigenvector methods of the ecg signals as feature set and achieved average accuracy of 93.89%. in, six types of beats including normal beat, pvc, fusion of ventricular and normal beat, atrial premature beat (a), right bundle branch block beat, and fusion of paced and normal beat obtained from the mit - bih arrhythmia database, are classified using particle swarm optimization and radial basis function neural network. two classifiers are combined together using mixture of experts where the local classifier requires a cardiologist to annotate a segment of patient specific ecg and achieved accuracy of 94.0% for distinguishing the two classes using mixture of expert classifiers. in, the morphological and temporal features are extracted to classify the five classes of ecg signal using linear discriminant classifier and achieved lower average accuracy of 85.9%. method is that the fixed classification method does not take any variation in ecg pattern caused by personal or environmental differences. in, jiang and kong have used the hermite transform coefficients and time intervals between two neighboring r - peaks of ecg signals based features and block based neural network as a classifier and classified five types of ecg beat with an accuracy of 96.6%. in this method, there are around 1015 parameters / thresholds which are set empirically with respect to the dataset used. another problem of this method is that the reported block - based neural networks (bbnn) require equal sizes for input and output layers. (i) in general, all these methods have not performed well due to their inconsistent performance when classifying new patients ecg waveform. (ii) most of these techniques were tested only on limited ecg data base. (iii) despite many ecg classification methods offered in the earlier literature, only few have employed a standard classification scheme for ecg arrhythmia such as ansi / aami ec57:1998. (iv) most of them use either time or frequency domain representation of the ecg signals as features though both time and frequency are equally important to consider morphological variation of ecg beats. in this paper, a novel approach is proposed to patient adaptation while avoiding the above limitations., significant features are extracted using s - transform (st) and wavelet transform (wt) due to their time - frequency localization properties. the st has unique properties such as (i) frequency invariant amplitude response, (ii) progressive resolution, and (iii) absolutely referenced phase information which means that the phase information given by the st refers to the argument of the cosinusoid at zero time. besides, the interpretation of the important signal information in the st is apparent which will be beneficial to extract the important features from the ecg signal. on the other hand, wt is an efficient tool for analyzing nonstationary ecg signals. it is also used to decompose an ecg signal which effectively isolates the relevant properties of the ecg signal morphology from the noise, baseline drift, and amplitude variation of the ecg signal. earlier researcher has used the wt coefficients at the appropriate scales as morphological feature vectors rather than the original signal time series and achieved good classification performance. therefore, the two feature extraction techniques are combined depending on their properties and advantages which could help to select the features more effectively than using them independently. mlp - nn is normally used as a classifier to discriminate the ecg signal using these features. in this paper, we have used the mlp - nn classifier because (i) it can be used to generate likelihood - like scores that are discriminative in the state level, (ii) it can be easily applied in hardware platform for its simple structure, (iii) it has the ability to approximate functions and automatic similarity based generalization property, and (iv) complex class distributed features can be easily mapped by neural network. the proposed methods classify the five classes of ecg beat recommended by the aami standard and experimental results are compared with the other existing feature extraction techniques. this paper proposes effective feature extraction methods which exhibit highest ecg classification sensitivity for large database. in this study, ecg data of mit - bih arrhythmia data base are used for performance evaluation of the proposed ecg beat classification technique. this database contains 48 ecg recordings, each containing 30 min segment selected from 24 hrs recordings of 48 individuals. each ecg signal is passed through a band pass filter at 0.1100 hz and sampled at 360 hz. the 44 records from mit - bih arrhythmia database are used for performance assessment. according to the aami recommended practice the 4 paced beats are excluded in this experimental evaluation process because these beats do not retain sufficient signal quality for reliable processing. this database contains different types of arrhythmias. in this paper, the normal and arrhythmia beats the aami convention is used to combine the beats into five classes of interest : normal beat, left bundle branch block (lbbb), right bundle branch block (rbbb), and atrial escape and nodal junction escape beats belong to class n category ; class v contains premature ventricular contraction (pvc) and ventricular escape beats, class s contains atrial premature (ap), aberrated premature (aap), nodal junction premature (np), and supraventricular premature (sp) beats, class f contains only fusion of ventricular and normal (fvn) beats, and class q which is known as unknown beat contains paced beat (p), fusion of paced and normal (fpn) beats, and unclassified beats. the block diagram of the ecg classification technique is shown in figure 3. in this context, the proposed classification techniques consist of three main stages such as (i) preprocessing and qrs detection, (ii) feature extraction, and (iii) classifier. the preprocessing stage involves the following two substages : (i) normalize the amplitude of ecg signals to zero mean ; this reduces the dc offset and eliminates the amplitude variance file to file ; (ii) the bandpass filter (320 hz) is used to contain most of qrs complex energy and least amount of high frequency noise and low - frequency baseline wander. figures 2(a) and 2(b) show the frequency and phase spectrum of bandpass filter, respectively, and figures 2(c) and 2(d) show the ecg signal before and after the use of bandpass filter. the proposed technique follows qrs complex detection as reported in pan tompkins ' qrs detection algorithm. this paper proposes feature extraction techniques based on st and mixture of st and wt based feature set. feature is a distinctive or characteristic measurement, transform, structural component extracted from a signal of a pattern. a feature extractor should reduce the pattern vector (i.e., the original waveform) to a lower dimension, which contains most of the important information from the original vector. generally, two types of features are extracted from one ecg cardiac cycle : (a) morphological features and (b) temporal features. four temporal features are extracted directly from rr - intervals of the preprocessed ecg signal. the following are the four ways to extract the temporal features : (i) pre - rr - interval : rr - interval between a given heartbeat and the previous heartbeat ; (ii) post - rr - intervals : the rr - interval between a given heartbeat and the following heartbeat ; (iii) average rr - intervals : the mean of the rr - intervals for a recording and is considered as the same value for all heartbeats in a recording ; (iv) local average rr - interval : averaging the rr - intervals of ten rr - intervals surrounding a heartbeat. thus, four temporal features are obtained from each ecg heart beat which is shown in figure 4(c). in this paper, three types of morphological features are used to classify the ecg beats : (a) st based morphological features, (b) wt based morphological features, and (c) combined morphological feature of st and wt. 180 samples are extracted from one ecg cardiac cycle by selecting a window of 250 ms to + 250 ms around the r - peak. figure 4(a) indicates the time domain and time - frequency domain ecg signal, respectively. the st is used to obtain the time - frequency representation of a time domain noisy ecg signal. the continuous st s(, f) of a noisy ecg signal h(t) at time t = and frequency f is defined as (1)s(,f)=h(t)|f|2e(t)2f2/2ei2ftdt. a voice s(, fo) is defined as a one - dimensional function of time for a constant frequency fo, which shows how the amplitude and phase for this exact frequency change over time. if the time series h(t) is windowed (or multiplied point by point) with a window function (gaussian function) g(t), then the resulting spectrum is (2)h(f)=h(t)g(t)ei2ftdt, where generalized gaussian function is (3)g(t)=12et2/22 and then allowing the gaussian to be a function of translation and dilation (or window width), (4)s(,f,)=h(t)12e(t)2/22ei2ftdt. this is a special case of the multiresolution fourier transform because there are three independent variables in it ; it is also impractical as a tool for analysis. simplification can be achieved by adding the constraint restricting the width of the window to which is proportional to the period (or inverse of the frequency) : (5)(f)=1|f|. the reasons for taking gaussian window are as follows : (i) it is symmetric in time and frequency ; the fourier transform (ft) of a gaussian is gaussian, (ii) there are no side lobes in a gaussian function, and (iii) it uniquely minimizes the quadratic time frequency moment about a time frequency point. the discrete st of the ecg signal h[kt ] is given by (6)s[jt, nnt]=m=0n1h[m+nnt]e22m2/n2ei2mj / n, where h[n / nt ] is the ft of the n point time series h[kt ] and j, m, n = 0,1,, (n 1). the output of st is a complex valued matrix whose rows indicate the frequency and column indicates the time. the st - amplitude, which is used to analyze the ecg signal, is defined as (7)a(kt, f)=|s[kt, nnt]|. the proposed feature extraction technique st is applied to the selected portion of ecg signal. features are extracted by applying standard statistical techniques to the contours of the st - matrix as well as directly on the st - matrix. these features are very useful for detection, classification, and quantification of relevant parameters of ecg signals. eight features are extracted from the st output, four from the time - frequency contour (tf - contour) and remaining four from the time maximum amplitude plot (tma - plot). feature extraction from tf - contour : s1 : standard deviation of the tf - contour having the largest frequency amplitude of tf - contour;s2 : mean of contour having largest frequency amplitude of tf - contour;s3 : the energy of contour having largest frequency amplitude of tf - contour. feature extraction from tf - contour : s1 : standard deviation of the tf - contour having the largest frequency amplitude of tf - contour;s2 : mean of contour having largest frequency amplitude of tf - contour;s3 : the energy of contour having largest frequency amplitude of tf - contour. s1 : standard deviation of the tf - contour having the largest frequency amplitude of tf - contour ; s2 : mean of contour having largest frequency amplitude of tf - contour ; s3 : the energy of contour having largest frequency amplitude of tf - contour. case 2. extraction of features from tma - plot:(4)s4 : maximum value of tma - plot;(5)s5 : minimum value of tma - plot;(6)s6 : mean value of the tma - plot;(7)s7 : standard deviation of tma - plot;(8)s8 : maximum energy of tma-plot.thus, eight morphological features are obtained by applying standard statistical techniques to the contours of the st - matrix as well as directly on the st - matrix which is shown in figure 4(d). table 2 represents one way anova results for different types of classes based on different types of features. if the p value (significance level) in table 2 is less than 0.05, there is a significant difference between the groups with a confidence level of 95%. this rule indicates that performances of s - transform based feature set of ecg signal are significantly different from each other. extraction of features from tma - plot:(4)s4 : maximum value of tma - plot;(5)s5 : minimum value of tma - plot;(6)s6 : mean value of the tma - plot;(7)s7 : standard deviation of tma - plot;(8)s8 : maximum energy of tma-plot.thus, eight morphological features are obtained by applying standard statistical techniques to the contours of the st - matrix as well as directly on the st - matrix which is shown in figure 4(d). table 2 represents one way anova results for different types of classes based on different types of features. if the p value (significance level) in table 2 is less than 0.05, there is a significant difference between the groups with a confidence level of 95%. this rule indicates that performances of s - transform based feature set of ecg signal are significantly different from each other. s4 : maximum value of tma - plot ; s5 : minimum value of tma - plot ; s6 : mean value of the tma - plot ; s7 : standard deviation of tma - plot ; s8 : maximum energy of tma - plot. the choice of appropriate wavelet and the number of decomposition levels are very important section on analysis of ecg signals using wavelet transform (wt). the levels are taken such that those parts of the signal correlate well with the wavelet coefficients. in this paper, the number of decomposition levels is taken to be 4, i.e., ecg signals are decomposed into the details d1d4 and one approximation coefficient a4 which is shown in figure 5. the daubechies wavelet of order 2 (db2) is chosen due to its similar morphological structure with the ecg signals. the wavelet coefficients give a compact representation of the signal that indicates the distribution of signal energy in time and frequency. the computed detail and approximation wavelet coefficients of the ecg signals of each record are used as the feature vectors representing the ecg signal. for extracting the statistical features, 180 samples of ecg signal are taken from one ecg cardiac cycle by selecting a window of 250 ms to + 250 ms around the r - peak. for each ecg beat, the detail coefficients at the first, second, third, and fourth levels (91, 47, 25, and 14 coefficients, resp.) and the approximation coefficients (14 coefficients) of fourth level decomposition are computed. then, the total 191 wavelet coefficients are obtained from each ecg beat. in order to reduce the dimensionality of the extracted features, statistics over the set of the wavelet coefficients the following statistical features are extracted using wt to represent the time - frequency distribution of the ecg signal : f1 : maximum value of the wavelet coefficients in each subband, f2 : mean value of the wavelet coefficients in each subband, f3 : minimum value of the wavelet coefficients in each subband, f4 : standard deviation of the wavelet coefficients in each subband, where f1, f2, f3, and f4 are the feature of each subband. therefore, 20 features are extracted from the selected subband of wt which is depicted in figure 4(e). f1 : maximum value of the wavelet coefficients in each subband, f2 : mean value of the wavelet coefficients in each subband, f3 : minimum value of the wavelet coefficients in each subband, f4 : standard deviation of the wavelet coefficients in each subband, (3) proposed combined features of st and wt. the proposed combined feature set is formed by appending the four temporal features, twenty wt based features, and eight st based features. the input of mlp - nn is driven separately by the wt along with temporal based feature set and proposed feature sets. the output layer has five neurons, which is equal to the number of ecg beat types to be classified. the back propagation training with generalized delta learning rule is an iterative gradient algorithm designed to minimize the root mean square error between the actual output of a multilayered feed - forward, neural network and a desired output. the weight and bias values in the mlp - nn are updated with a learning rate of 0.5 which is chosen empirically. the smaller we make the learning rate parameter, the smaller the changes to the synaptic weights in the network will be from one iteration to the next and the smoother the trajectory in weight space will be. on the other hand, we make the learning rate parameter too large in order to speed up the rate of learning ; the resulting large changes in the synaptic weights assume such a form that the network may become unstable (i.e., oscillatory). in order to achieve faster convergence with minimum oscillation classification experiments are performed using 44 records of the mit - bih arrhythmia database. in this work, a common training data set is constructed using first 20 records of mit - bih database (picked from the range 100124, i.e., 100, 101, 103, 105, 106, 108, 109, 111, 112, 113, 114, 115, 116, 117, 118, 119, 121, 122, 123, and 124) which contains 80 from type - n, 75 from s, and 80 from v beat, and all (13) type f and all (7) type q beats. in this technique, patient specific classifier is trained with a total of 255 common training beats and 5 mins of each patient specific record (picked from the range 200234, i.e., 200, 201, 202, 203, 205, 207, 208, 209, 210, 212, 213, 214, 215, 219, 220, 221, 222, 223, 228, 230, 231, 232, 233, and 234). the remaining 25 mins of each record is used in testing purpose for classification evaluation. for second set of training, the classifier is trained with a total of 255 common training beats and next 5 mins of each patient specific record (picked from the range 200234) and the remaining 25 mins of each corresponding record is used for testing. the process is repeated six times so that classifier is trained with 255 common training data plus 5 mins of each patient specific record and remaining 25 mins of each corresponding data is used for testing. the formation of each training and testing data set used for mlp - nn classifier is shown in figure 6 using tree diagram. the performance of the nn classifier mostly depends on the selection of hidden nodes. however, there are no such techniques to select the number of hidden nodes for better performance of the classifier. hidden nodes in the hidden layer are selected empirically. as an example, for record no. 200, the variation of the classification performance with respect to hidden nodes is shown in figure 7. in this study, 6-set cross validation techniques are used for training and testing of the mlp - nn classifier. the overall performance of the classifier is evaluated by taking the average of six sets. in this paper, classification performances the first approach uses the wt based features combined with temporal features, the second approach uses the st based features along with temporal features, whereas the third approach uses the mixture of st and wt based features along with temporal feature set. the first method is indicated as wt based feature extraction method, second method is represented as proposed-1 method, and third method is called proposed-2 method. the correct classification or misclassification is quantified using four metrics such as true positive (tp), true negative (tn), false positive (fp), and false negative (fn). the classification sensitivity (sen) and accuracy (acc) classification accuracy is defined as the ratio of the number of correctly classified patterns (tp and tn) to the total number of patterns classified : (8)acc = tp+tntn+fn+tp+fp. sensitivity is the rate of correctly classified events among all events : (9)sen = tptp+fn. figures 8, 9, 10, 11, and 12 show the sensitivity of n, s, f, v, and q class during each set of the classification using wt based feature extraction method, proposed-1 and proposed-2 methods, respectively. it can be depicted from the figures that the proposed-2 method shows the best performance compared the other techniques. the average performance from each of the classifiers is tabulated in table 3. in wt based feature extraction method, the average sensitivity of n, s, f, v, and q classes are 92.67%, 73.60%, 34.42%, 83.29%, and 2.08%, respectively, using 24 records whereas the proposed-1 gives an average sensitivity of n, s, f, v, and q class with 94.55%, 74.82%, 37.01%, 88.55%, and 20.00%, respectively, using the same records. on the other hand, the proposed-2 shows an average sensitivity of n, s, f, v, and q class with 95.70%, 78.05%, 49.60%, 89.68%, and 33.89%, respectively. the average sensitivity of all classes using three techniques is shown in figure 13 using bar diagram. the average accuracy of n, s, f, v, and q is 94.45%, 97.68%, 99.11%, 96.42%, and 99.63%, respectively, using proposed-2 method whereas the proposed-1 method yields that the accuracy of the n, s, f, v, and q are 93.16%, 96.92%, 98.84%, 95.98%, and 99.58%, respectively. on the other hand, wt based feature extraction method provides an accuracy of n, s, f, v, and q are 91.29%, 95.17%, 98.80%, 95.36%, and 99.49% respectively. the wt based feature extraction method shows less average performance accuracy compared to proposed-1 and proposed-2 methods. this paper discusses the ecg beat classification using three feature extraction based techniques with mlp - nn classifier. from table 3, it is seen that the sensitivities of f and q are comparatively less than other classes because f beats are misclassified as n and v. f beats are difficult to distinguish from n and v beats because f beats are the union of ventricular and normal beats and their morphology and timing information closely resemble n and v beats. the performances of the proposed-1 and proposed-2 methods in detecting class q beats are worse because q beats are less compared to other class in the training data and, hence, more q beats are misclassified as other beats. on the other hand, the reason is that the qrs complex associated with an atrial premature beat in the s class has normal qrs duration and the same morphology as that of the sinus beat. table 4 yields a summary of studies on automated classification of ecg beats using the data obtained from mit - bih arrhythmia database. it is seen from the table that the average detection accuracy of the s - transform based feature extraction technique shows best performance compared to other existing techniques in the literature. in this work, the classification performance is compared with wt based feature extraction method, proposed-1 and proposed-2 methods. the wt based feature extraction method provides classification performance with average accuracy of 96.0% whereas proposed-1 yields classification performance with 96.9% average accuracy. on the other hand, the proposed-2 method shows the best performance with 97.5% average accuracy compared to other methods. the detection sensitivity of f and q are comparably very less than the other classes. the reason for the worse classification performance in detecting the f and q are that both classes are underrepresented in the training data, and, hence, more f and q are misclassified as other classes. it is worthy that the less number of training beats are used for each patient 's classifier which is approximately 2% of all beats in the training dataset. the proposed methods achieve better performances over other existing method for all the metrics used in five class detections. it is seen from table 1 that the ecg arrhythmia is divided into five types of ecg class according to aami standards. for real time application, for example, a patient has left bundle branch block (lbbb) arrhythmia but our algorithm detects it as aami n class. the relationship between sensitivity and specificity are described by the receiver operating characteristic (roc) curve which alleviates improved analysis in terms of the classification performance of a diagnostic technique. figure 14 is marked as a roc curve of n, s, f, v, and q classes detection for 44 ecg records where the x - axis represents the false positive rate (fpr) and the y - axis represents the true positive rate (tpr). for accurate classification, tpr = 1 and fpr = 0 correspond to the upper left corner of the roc curve. therefore, the combination of tpr - fpr is considered better when it is more near to the upper left corner. it is observed that, for five types of aami class detection, proposed features provide higher tpr but lower fpr compared to wavelet based features. in this work, st based feature extraction and combination of st and wt based feature extraction method are proposed separately to classify the ecg beats for each patient individually. in the proposed technique, the st is effectively employed to extract the significant features which are combined with temporal features whereas the combined feature set is formed using the combination of wt, st, and four temporal (pre - rr, post - rr, local rr, and avg rr) based features. the interpretation of the important signal information in the st is apparent which will be beneficial to extract the important features from the ecg signal. on the other hand, wt is used to decompose an ecg signal according to the scale which effectively isolates the relevant properties of the ecg signal morphology from the noise, baseline drift, and amplitude variation of the ecg signal. these features are very useful for detection, classification, and quantification of relevant parameters of ecg signals. experimental results demonstrate that the proposed features provide better detection sensitivity than wt based features. the overall results of the proposed extracted feature methods also show an effective and efficient approach in computer - aided diagnosis of heart diseases based on ecg signals. the proposed system can be used as follows : (i) automated systems provide clinicians with the tools to be alerted in real time if life threatening conditions surface in their patients. as a result, automatic detection and classification of cardiac electrophysiology using biomedical signal processing techniques | classification of electrocardiogram (ecg) signals plays an important role in clinical diagnosis of heart disease. this paper proposes the design of an efficient system for classification of the normal beat (n), ventricular ectopic beat (v), supraventricular ectopic beat (s), fusion beat (f), and unknown beat (q) using a mixture of features. in this paper, two different feature extraction methods are proposed for classification of ecg beats : (i) s - transform based features along with temporal features and (ii) mixture of st and wt based features along with temporal features. the extracted feature set is independently classified using multilayer perceptron neural network (mlpnn). the performances are evaluated on several normal and abnormal ecg signals from 44 recordings of the mit - bih arrhythmia database. in this work, the performances of three feature extraction techniques with mlp - nn classifier are compared using five classes of ecg beat recommended by aami (association for the advancement of medical instrumentation) standards. the average sensitivity performances of the proposed feature extraction technique for n, s, f, v, and q are 95.70%, 78.05%, 49.60%, 89.68%, and 33.89%, respectively. the experimental results demonstrate that the proposed feature extraction techniques show better performances compared to other existing features extraction techniques. |
chronic burn scar developing into a malignant neoplasm is a well known complication.most of these tumors are squamous cell carcinomas followed by basal cell carcinoma, melanoma and sarcoma. we report the first occurrence of the combination of squamous cell carcinoma and epithelioid sarcoma arising in a burn scar. metastatic spread to the inguinal lymphnodes, lungs and breast was also seen in this case. a 29-year - old female presented with an exophytic tumor mass at left ankle since 3 months. she gave history of burns at the same site 9 years back, for which skin grafting had been done. bilateral axillary and right inguinal lymphnodes were palpable apart from a right thigh soft tissue mass. computed tomography (ct) scan examination of thorax and abdomen showed metastatic nodules in bilateral lungs, both breasts and right adrenal gland. gross examination revealed an exophytic mass at ankle measuring 11 9 9 cm, which was whitish and friable with areas of hemorrhage and necrosis on cut surface. exophytic mass at the ankle histopathologic examination of this thick plaque showed features of well - differentiated squamous cell carcinoma (scc) [figure 2 ]. however, the exophytic growth showed large round to polygonal tumor cells arranged in islands and nests with large areas of necrosis and nuclear debris in the center [figure 3 ]. individual cells had moderate eosinophilic cytoplasm, and round to oval enlarged vesicular nuclei with prominent nucleoli [figure 4 ]. tumor cells were positive for vimentin [inset of figure 4 ] and pancytokeratin on immunohistochemistry. the cells were negative for s-100 protein, hmb 45, desmin, ema, cd 34, lca and myo d1, thereby favoring epithelioid sarcoma. fine needle aspiration cytology performed on breast mass, pulmonary nodule (under ct guidance) and axillary lymphnodes revealed metastasis of a sarcoma with a cell morphology resembling that of exophytic mass. epithelioid sarcoma is known to have a high rate of recurrence and metastasis predominantly to the lymphnodes, lungs and scalp. the patient self - discharged against medical advice and was lost to follow - up. well - differentiated scc (h and e, 100) large round to polygonal tumor cells arranged in islands and nests with large areas of necrosis and nuclear debris in the centre (100 h and e) individual cells had moderate eosinophilic cytoplasm, round to oval enlarged vesicular nuclei with prominent nucleoli. tumor cells were positive for vimentin on immunohistochemistry (inset) (h and e, 200) in a large review of burn scar neoplasms, kowal vern reported scc as commonest neoplasms in up to 7%, followed by basal cell carcinoma (bcc ; 12%), melanoma (6%) and sarcoma (5%). double tumors comprising scc and bcc (2%) and scc with melanoma (1%) have also been reported. literature reports only two cases of epithelioid sarcoma in a burn scar and the present case is the first case report of epithelioid sarcoma along with scc in a burn scar. the overall histopathologic and immunohistochemical features were consistent with a diagnosis of epithelioid sarcoma in addition to the metastatic spread to the inguinal lymphnodes, lungs and breast. prognosis is primarily related to the local extent of the disease, its anatomical location and the presence or absence of lymphnode metastasis. | development of a malignant tumor is a well known complication of a chronic burn scar. most of these tumors are squamous cell carcinomas and only 28 cases of burn scar sarcomas have been reported in literature. we report the first occurrence of the combination of squamous cell carcinoma and epithelioid sarcoma arising in a burn scar. |
palladium - catalyzed c - c cross - coupling reactions, which were acknowledged by the award of the nobel prize in chemistry in december 2010, nowadays belong to an indispensable tool for the target oriented synthesis of complex organic molecules across all research fields and industrial segments. the mizoroki - heck reaction for example, allows the coupling of olefins with aryl halides in the presence of a base and is nowadays the most popular method for the preparation of vinylbenzenes (figure 1). the heck reaction has been demonstrated to find wide utility in both, total syntheses of natural products in academia and synthesis in pharmaceutical and agrochemical industry. taxol, a mitotic inhibitor used in cancer chemotherapy, singulair, an asthma drug and the herbicide prosulfuron as well as cyclotene, a monomer for high performance electronic resins are examples that have been successfully prepared including a heck - mizoroki cross - coupling step in their syntheses (figure 2). examples of industrially relevant organic compounds involving a palladium - catalyzed heck cross - coupling reaction as key step in their synthesis. click here to view larger image. even though recent developments have considerably increased the activity of heck catalysts, a typical reaction protocol with aryl bromides as substrates still requires high reaction temperatures (140 c), catalyst loadings in the range of 1 mol% and reaction times of up to 24 hr. moreover, modified reaction conditions, including the reaction temperature, catalyst loadings, bases, solvents, and additives, e.g. are often reported, implying that these protocols will rarely find their application in organic syntheses due to lack of generality. furthermore, most catalysts require multiple reaction steps for their synthesis and hence, are time - consuming and low - yielding. additionally, inert - atmosphere techniques and expensive starting materials of poor stability are often used for their preparation. this refers to the need of new and improved, cheap and easy accessible, stable and green but reactive and general applicable heck catalysts with high functional group tolerance that efficiently and reliably operates at low catalyst loadings with general applicable reaction protocols. dichloro - bis(aminophosphine) complexes of palladium were recently introduced as easy accessible, cheap and air stable but highly active c - c cross - coupling catalysts with excellent functional group tolerance, of which dichloro{bis[1,1',1''-(phosphinetriyl)tripiperidine]}palladium [(p(nc5h10)3)2pd(cl)2 ] (1) proved to be a highly efficient, reliable, and versatile heck catalyst that efficiently operates at 100 c. 1 was quantitatively prepared within only a few minutes by treatment of thf suspensions of [pd(cl)2(cod) ] (cod = cycloocta-1,5-diene) with 1,1',1''-(phosphinetriyl)tripiperidine under air atmosphere at 25 c. 1,1',1''-(phosphinetriyl)tripiperidine, the respective ligand system was achieved in one step by the dropwise addition of an excess of piperidine to cooled diethyl ether solutions of pcl3. the substrate costs for the preparation of 1,1',1''-(phosphinetriyl)tripiperidine for 1 g of palladium precursor is less than 1 (estimated from catalogue prices of a chemical supplier) and hence, very cheap. moreover, despite the simple and cheap synthesis of 1 and its excellent catalytic performance, the addition of aqueous hydrochloric acid (work - up conditions), lead to a rapid and complete catalyst degradation, accompanied by the formation of phosphonate, piperidinium salt, and insoluble palladium - containing decomposition products, which are easily separated from the coupling products. this is an often ignored, but very important issue to be considered (from ecologic and economic points of view) and is of particular importance for the preparation of pharmaceutically relevant compounds. add 150 ml of dry diethyl ether and 5 ml of phosphorous trichloride (57.3 mmol) in an oven - dried 500 ml round bottomed flask. put a stir bar in the round bottomed flask and attach a 250 ml dropping funnel and cover the flask with septa. cool down the solution to 0 c by placing the round - bottomed flask in an ice bath. rel. to pcl3) and 100 ml of diethyl ether and add this solution slowly via the dropping funnel into the stirred diethyl ether solution, containing phosphorous trichloride. after complete addition, warm up the reaction mixture to rt. in order to ensure full conversion, stir the solution for additional 30 min at rt. filter the reaction mixture over a glass frit and collect the filtrate in a 500 ml round bottomed flask. in order to increase the yield of 1,1',1''-(phosphinetriyl)tripiperidine wash the filter cake with additional 100 ml of dry diethyl ether. evaporate the solvent of the filtrate on a rotary evaporator to obtain the pure ligand (1,1',1''-(phosphinetriyl)tripiperidine) in > 80% yield as an off - white oil, which solidifies with time. check the product purity by p{h } nmr spectroscopy (at 117.3 ppm in c6d6). weigh out [pd(cod)cl2 ] (0.35 mmol, 100 mg) and add to a clean, oven - dried 50 ml round bottomed flask containing 10 ml of dry thf. add a stir bar, cover the flask with a septum and stir the suspension. weigh out 1,1',1''-(phosphinetriyl)tripiperidine (0.875 mmol, 248 mg) and add to a clean, dry vial containing 10 ml of dry thf. add the 1,1',1''-(phosphinetriyl)tripiperidine solution via a syringe through the septum to the thf suspension of [pd(cod)cl2 ]. the suspension turns immediately into a dark yellow solution while addition, indicating completion of the reaction. in order to remove insoluble solids pass the reaction mixture quickly through an oven - dried glass frit and collect the filtrate in a 25 ml round bottomed flask. remove the volatiles under reduced pressure. wash the palladium complex three times with 5 ml of pentane. remove the pentane by decantation. dry the yellow powder under reduced pressure to quantitatively obtain the analytically pure palladium complex [(p(c5h10n)3)2pdcl2 ] (1). check the purity of 1 by p{h } nmr spectroscopy (at 92.5 ppm in c6d6). weight out [(p(c5h10n)3)2pdcl2 ] (0.05 mmol, 37.15 mg) and add to an oven - dried 25 ml schlenk. add 10 ml of dry and degassed thf via syringe through the septum into the flask. weight out tetrabutylammonium bromide (1.0 mmol, 322.4 mg) and potassium carbonate (20 mmol, 2.77 g) and add them in a clean, oven - dried 25 ml round - bottomed schlenk flask. add 20 ml of n - methyl-2-pyrrolidone (nmp) through a syringe into the schlenk flask. add a stir bar and cover the flask with septa. evacuate and backfill the schlenk flask with dinitrogen. dissolve 1-bromo-4-phenoxybenzene (10 mmol, 1.75 ml) and styrene (15 mmol, 1.72 ml) in 5 ml of nmp and add this solution via syringe into the schlenk flask. connect the reflux condenser with an oil bubbler and set a slight overpressure of dinitrogen. heat up the reaction solution to 100 c and stir the solution for 5 min on this temperature. add the catalyst solution (0.05 mol%, 0.005 mmol, 1 ml of thf) to the hot reaction mixture via syringe and stir it vigorously for the indicated time (3 hr in this example). check the product formation by gc / ms. remove the schlenk from the oil bath, expose the reaction mixture to air and quench with 50 ml of 1 m hydrochloric acid. add the cooled reaction mixture into a 500 ml separation funnel and add ethyl acetate (50 ml). separate the heck product by extraction and combine all organic phases in an erlenmeyer flask. add magnesium sulfate to soak up any last amount of water present in the solution. separate the heck product via column chromatography, using a mixture of hexane and diethyl ether (5:1) as eluent. add 150 ml of dry diethyl ether and 5 ml of phosphorous trichloride (57.3 mmol) in an oven - dried 500 ml round bottomed flask. put a stir bar in the round bottomed flask and attach a 250 ml dropping funnel and cover the flask with septa. cool down the solution to 0 c by placing the round - bottomed flask in an ice bath. rel. to pcl3) and 100 ml of diethyl ether and add this solution slowly via the dropping funnel into the stirred diethyl ether solution, containing phosphorous trichloride. after complete addition, warm up the reaction mixture to rt. in order to ensure full conversion, stir the solution for additional 30 min at rt. filter the reaction mixture over a glass frit and collect the filtrate in a 500 ml round bottomed flask. in order to increase the yield of 1,1',1''-(phosphinetriyl)tripiperidine wash the filter cake with additional 100 ml of dry diethyl ether. evaporate the solvent of the filtrate on a rotary evaporator to obtain the pure ligand (1,1',1''-(phosphinetriyl)tripiperidine) in > 80% yield as an off - white oil, which solidifies with time. check the product purity by p{h } nmr spectroscopy (at 117.3 ppm in c6d6). weigh out [pd(cod)cl2 ] (0.35 mmol, 100 mg) and add to a clean, oven - dried 50 ml round bottomed flask containing 10 ml of dry thf. add a stir bar, cover the flask with a septum and stir the suspension. weigh out 1,1',1''-(phosphinetriyl)tripiperidine (0.875 mmol, 248 mg) and add to a clean, dry vial containing 10 ml of dry thf. add the 1,1',1''-(phosphinetriyl)tripiperidine solution via a syringe through the septum to the thf suspension of [pd(cod)cl2 ]. the suspension turns immediately into a dark yellow solution while addition, indicating completion of the reaction. in order to remove insoluble solids pass the reaction mixture quickly through an oven - dried glass frit and collect the filtrate in a 25 ml round bottomed flask. remove the volatiles under reduced pressure. wash the palladium complex three times with 5 ml of pentane. remove the pentane by decantation. dry the yellow powder under reduced pressure to quantitatively obtain the analytically pure palladium complex [(p(c5h10n)3)2pdcl2 ] (1). check the purity of 1 by p{h } nmr spectroscopy (at 92.5 ppm in c6d6). weight out [(p(c5h10n)3)2pdcl2 ] (0.05 mmol, 37.15 mg) and add to an oven - dried 25 ml schlenk. add 10 ml of dry and degassed thf via syringe through the septum into the flask. weight out tetrabutylammonium bromide (1.0 mmol, 322.4 mg) and potassium carbonate (20 mmol, 2.77 g) and add them in a clean, oven - dried 25 ml round - bottomed schlenk flask. add 20 ml of n - methyl-2-pyrrolidone (nmp) through a syringe into the schlenk flask. add a stir bar and cover the flask with septa. evacuate and backfill the schlenk flask with dinitrogen. dissolve 1-bromo-4-phenoxybenzene (10 mmol, 1.75 ml) and styrene (15 mmol, 1.72 ml) in 5 ml of nmp and add this solution via syringe into the schlenk flask. connect the reflux condenser with an oil bubbler and set a slight overpressure of dinitrogen. heat up the reaction solution to 100 c and stir the solution for 5 min on this temperature. add the catalyst solution (0.05 mol%, 0.005 mmol, 1 ml of thf) to the hot reaction mixture via syringe and stir it vigorously for the indicated time (3 hr in this example). check the product formation by gc / ms. remove the schlenk from the oil bath, expose the reaction mixture to air and quench with 50 ml of 1 m hydrochloric acid. add the cooled reaction mixture into a 500 ml separation funnel and add ethyl acetate (50 ml). separate the heck product by extraction and combine all organic phases in an erlenmeyer flask. add magnesium sulfate to soak up any last amount of water present in the solution. filter the combined organic layers over a paper filter into a round bottomed flask. wash the filter cake with additional 50 ml ethyl acetate. separate the heck product via column chromatography, using a mixture of hexane and diethyl ether (5:1) as eluent. the above described reaction protocol was successfully applied with styrene (a), 1-ethenyl-3-nitrobenzene (b), 1-chloro-3-ethenylbenzene (c), 1-ethenyl-4-methoxybenzene (d) and 4-ethenylpyridine (e) as well as n, n - dimethylacrylamide (f), 4-acryloylmorpholine (g), and butyl acrylate (h) as coupling partners. table 1 shows a selection of recently prepared cross - coupling products and gives an impression about the scope of this protocol. the coupling products are cleanly formed (figure 4) and typically obtained in excellent yields within reasonable reaction times. gas chromatograms recorded from reaction mixtures of the heck reaction of ethyl 4-bromobenzoate and styrene at 100 c in dmf in the presence of ~10 mol% of tetrabutylammonium bromide and 0.05 mol% of catalyst, showing the time - dependent product formation. note that the reaction time is slightly prolonged when compared to the data given in table 1. click here to view larger image. accordingly, 1 is a cheap, easy accessible and green, stable and hence, convenient but highly reactive heck catalyst with high functional group tolerance, which efficiently and reliably operates at low catalyst loadings (0.05 mol%) with an easy adaptable and robust reaction protocol. heck cross - coupling products derived by reactions between aryl bromides and different olefins, catalyzed by 1. reaction conditions : 1.0 mmol aryl bromide, 1.5 mmol olefin, 2.0 mmol k2co3, 2.5 ml nmp, tetrabutylammonium bromide (10 mol%), catalyst (0.05 mol%) added in solution (thf), reaction performed at 100 c under n2 atmosphere. the conversions and product ratios (trans / gem / cis) are determined by gc / ms and are based on aryl bromide. [a ] dmf was used as solvent. click here to view larger image. hence, increasing amounts of catalyst do not improve but can lower the catalyst s performance due to formation of inactive palladium black. tetrabutylammonium bromide is known to stabilize nanoparticles and was (in contrast to the heck reactions performed at 140 c) found to be essential as additive for the reliable conversion of the substrates into the cross - coupling products with 1 at 100 c. best results were achieved with dmf when electronically activated or nonactivated aryl bromides were applied to give a2, a5, a6, a7, a13, a17, a18, b1, and h4, for example (table 1). nmp, however, was found to be the solvent of choice when electronically deactivated and sterically hindered or heterocyclic aryl bromides were coupled with alkenes. examples include the preparation of a9, a12, a14, c3, d3, d4,e2, e3, f2, f4, g3, g4, h5, and h6 (table 1). dichloro{bis[1,1',1''-(phosphinetriyl)tripiperidine]}palladium (1) is a very cheap and easy accessible, air stable and highly active heck catalyst with an excellent functional group tolerance that efficiently operates under mild reaction conditions to give the coupling products cleanly in very high yields. the excellent catalytic activity (and general applicability) of 1 is due to the unique properties of aminophosphines : while the steric bulk as well as the -donor strength of aminophosphines is essentially the same when compared to their phosphine - based analogues, comparable levels of activity were found for complexes of type [(p{(nc5h10)3-n(c6h11)n})2pd(cl)2 ] (where n = 0 - 3 ; figure 3) in cross - coupling reactions where molecular mechanisms are operative. on the other hand, the labile character of p - n bonds in aminophosphines (sensitivity towards protons ; in form of water e.g.) offers the possibility to effectively control the formation of palladium nanoparticles : increasing numbers of p - n bonds in the ligands successively eases their water - induced degradation and consequently the formation of nanoparticles from the respective complexes. accordingly, since palladium nanoparticles are the catalytically active form of 1 in the heck reaction, as indicated by sigmoidal - shaped kineticsor the efficient inhibition of catalysis after addition of a large excess of metallic mercury to reaction mixtures of aryl bromide, olefin and catalyst, for example, as well as their detection by analysis of reaction mixtures of exemplary heck cross - coupling reactions by a transmission electron microscopy (tem) equipped with an energy dispersive x - ray (edx) analysator, substitution of 1,1',1''-(phosphinetriyl)tripiperidine by 1,1'-(cyclohexylphosphinediyl)dipiperidine), 1-(dicyclohexylphosphinyl)piperidine) or tricyclohexylphosphine, which successively increases the complex stability and hence, retards the (water - induced) formation of nanoparticles thereof. as a consequence, while dichloro - bis(1-(dicyclohexylphosphinyl)piperidine)palladium, is the catalyst of choice in the heck reaction performed at 140 c, the highest catalytic activity was obtained for dichloro{bis[1,1',1''-(phosphinetriyl)tripiperidine]}palladium [(p(nc5h10)3)2pd(cl)2 ] (1) at 100 c, the least stable complex within this series. the effect of ligand composition of dichloro{bis(aminophosphine)}palladium with the general formula of [(p{(nc5h10)3-n(c6h11)n})2pd(cl)2 ] (where n = 0 - 2) on the complex stability and hence, on the ease of (water - induced) nanoparticle formation and hence, their catalytic performance under mild reaction conditions in the heck cross - coupling reaction. click here to view larger image. even though the above described syntheses as well as the heck reaction protocols are straight forward, some of the common troubleshooting procedures are : (a) make sure that the tetrabutylammonium bromide is newly purchased or properly stored (tetrabutylammonium bromide is hygroscopic), (b) make sure that dry solvents are used for the ligand synthesis when small amounts of ligand were prepared, (c) make sure that 1 is either freshly prepared or stored under an inert atmosphere, (d) make sure that the nmp or dmf are newly purchased, (e) make sure that the chemicals are either newly purchased or properly stored, (f) oven - dry all glassware and cool under vacuum. | dichloro - bis(aminophosphine) complexes of palladium with the general formula of [(p{(nc5h10)3-n(c6h11)n})2pd(cl)2 ] (where n = 0 - 2), belong to a new family of easy accessible, very cheap, and air stable, but highly active and universally applicable c - c cross - coupling catalysts with an excellent functional group tolerance. dichloro{bis[1,1',1''-(phosphinetriyl)tripiperidine]}palladium [(p(nc5h10)3)2pd(cl)2 ] (1), the least stable complex within this series towards protons ; e.g. in the form of water, allows an eased nanoparticle formation and hence, proved to be the most active heck catalyst within this series at 100 c and is a very rare example of an effective and versatile catalyst system that efficiently operates under mild reaction conditions. rapid and complete catalyst degradation under work - up conditions into phosphonates, piperidinium salts and other, palladium - containing decomposition products assure an easy separation of the coupling products from catalyst and ligands. the facile, cheap, and rapid synthesis of 1,1',1"-(phosphinetriyl)tripiperidine and 1 respectively, the simple and convenient use as well as its excellent catalytic performance in the heck reaction at 100 c make 1 to one of the most attractive and greenest heck catalysts available.we provide here the visualized protocols for the ligand and catalyst syntheses as well as the reaction protocol for heck reactions performed at 10 mmol scale at 100 c and show that this catalyst is suitable for its use in organic syntheses. |
upper gastrointestinal bleeding is a major public health problem, its prevalence being 100170:100,000 population. mortality due to upper gastrointestinal bleeding remained unchanged over the past 30 years, in spite of the modern methods of diagnosis and treatment and it is about 10%. in cirrhotic patients, bleeding from esophageal varices is only 511% of all gastrointestinal hemorrhage cases. in the u.s. for this reason, the present paper aims to analyze the etiology of non - variceal bleeding in patients with cirrhosis. this prospective study was conducted in the period 11.200412.2006 in the regional institute of gastroenterology and hepatology of cluj - napoca. it included 2,446 patients with liver cirrhosis who were selected from the endoscopy records based on their having esophageal varices. patients who met the clinical, biochemical, endoscopic and ultrasound criteria of liver cirrhosis, as shown in the patient s observation chart. in the follow - up period the etiology of bleeding, bleeding relapses, the relationship with the gravity of cirrhosis and of the esofageal varices staging were also kept under observation ; the number and cause of deaths of cirrhotic patients with upper gastrointestinal bleeding were also observed. 1,284 patients met the selection and inclusion criteria the results of the study were processed using the excel program the quantitative data were expressed as mediands. the average age of patients was 56.76 years, the youngest and the oldest being 16 years and 86 years respectively (figure i). in terms of gender distribution of patients, 795 were male patients (61.91%) and 489 were female patients (38.09%). out of the 1,284 patients included in the study, the dominant etiology was variceal hemorrhage which was present in 217 cases (73%), while 80 patients had non - variceal upper gastrointestinal bleeding (27%). of the cases with variceal bleeding 199 (91.7%) were from esophageal varices while 18 (8.3%) were from gastric varices. duodenal ulcer was the main cause of non - variceal upper gastrointestinal bleeding in the patients included in the study (33.75%), followed by gastric ulcer (21.25%), portal hypertensive gastric disease (17.5%), acute erosive gastritis (11.25%), mallory - weiss syndrome (6.25%), esophageal ulcer (5%), antral vascular ectasia (1.25%), duodenal polyps (1.25%) and exulcerated gastric tumor (1.25%) (figure ii). the predominant clinical form of the upper gastrointestinal hemorrhageon admission was the hematemesis and melena (84.17%), melena (14.81%) and hematochesia (1.01%). bleeding relapses represented 45.16% of all variceal upper gastrointestinal bleeding. fourteen cases of recurrence of bleeding within 7 days from the first episode of bleeding were found, 24 cases in the first month, 28 cases after 6 months and 32 cases after the first year. twenty - three post - sclerotherapy relapses and 34 post - ligature relapses were found in our study. mention must be made that most patients with variceal gastrointestinal bleeding in this situation were treated by ligation. the rupture of esophageal varices depends on the grade of the varices and it is more commonly found in patients with grade ii and iii varices. thus our study reported 10 patients with bleeding from esophageal varices grade i (8%), 98 (45%) patients with bleeding from esophageal varices grade ii and 93 (42%) of grade iii varices. also gastric varices bleeding was found in 18 patients (5%) (figure iii). this study also recorded 8 deaths which occurred in the group of patients with variceal bleeding. out of these cases, death occurred in one patient with child class a cirrhosis, in 3 patients with child class b and in 4 patients with child class c. consequently, this shows that the mortality of patients with variceal hemorrhage is closely related to the severity of the liver disease. the results of our study show that out of the 1284 studied patients, a proportion of 23.13% (297) had upper gastrointestinal bleeding. the most frequent etiology was that of variceal bleeding (73%), the results being similar and keeping in with those reported in literature. peptic ulcer (gastric and duodenal ulcer) is dominant (55%) in the etiology of non - variceal upper gastrointestinal bleeding and its frequency rate is about the same as that found in the speciality literature. bleeding relapses in the group of patients with variceal upper gastrointestinal hemorrhage were frequent (45.16%) and brought up special problems related to the type of treatment (sclerotherapy or ligation), the eradication treatment for esophageal varices, the use of adjuvant therapy for portal hypertension (beta - blockers) or the invasive methods of treating portal hypertension (tips) or liver cirrhosis (liver transplantation). given the significant number of non - variceal upper gastrointestinal hemorrhage in cirrhotic patients, prevention of upper gastrointestinal bleeding in these patients becomes of great importance including : avoidance of nsaids, treatment with proton pump inhibitors in patients with known ulcer or in those who have ulcer symptoms, and complete endoscopic exploration of patients with liver cirrhosis. mortality because of upper gastrointestinal bleeding was of 2.69% in the study group, all the deaths having occurred following variceal bleeding. our study showed that in about 27% of the cirrhotic patients with upper gastrointestinal hemorrhage the bleeding occurred from non - variceal sources, of which the most frequent one was ulcer. the hemorrhage with variceal etiology is more severe and has higher mortality than the non - variceal one. the large number of non - variceal bleeding in cirrhotic patients shows the importance of upper gastrointestinal endoscopy for specifying the etiology of upper gastrointestinal bleeding and for establishing the appropriate therapy. | aimsto investigate the etiology of upper digestive hemorrhage in cirrhotic patients.patients and methodsfrom november 2004 to december 2006, we performed a prospective study at the regional institute of gastroenterology and hepatology o. fodor cluj - napoca. the study was performed on 1,284 patients with esophageal varices from the endoscopy records, diagnosed with liver cirrhosis based on clinical, biochemical and endoscopic information, documented from the observation sheet. during the periodical examinations, we observed and monitored the patients variceal and non - variceal bleedings.resultsout of the 1,284 patients included in this study, there were 297 cases of upper digestive hemorrhage, the dominant etiology being the variceal bleeding (217 cases - 73%), and 80 (27%) cases of upper non - variceal digestive hemorrhage. duodenal ulcer was the main cause for upper non - variceal digestive hemorrhage in case of cirrhotic patients considered for this study (33.75%), followed by gastric ulcer (21.25%), portal hypertensive gastropathy (17.5%), acute erosive gastritis (11.25%), mallory - weiss syndrome (6.25%), esophageal ulcer (5%), antral vascular ectasia (1.25%), duodenal polyps (1.25%) and exulcerated gastric tumor (1.25%). we also observed the cases of hemorrhagic relapse in the group of patients with variceal hemorrhages. variceal bleedings are predominant in each child - pugh clinical category, but one must mention that the risk of variceal rupture increases with the severity of the hepatic disease. there were 8 deaths, all caused by esophageal variceal hemorrhages.conclusionsin our study, almost 27% of cirrhotic patients with upper gastrointestinal hemorrhage had bleeding from a non - variceal source, the most common etiology being peptic ulcer. variceal bleeding is more severe and bears a higher mortality rate than non - variceal bleeding. |
the research approach covers three phases described in a previously published health workforce model developed by segal, dalziel, and bolton (22) : 1) a competency and skill - based needs analysis, 2) estimation of a local health service and health workforce requirement, and 3) exploration of policy implications. in this article, we report on the application of the workforce model to diabetes, with a specific focus on phases 1 and 2. the needs analysis has previously been described in detail (23). in brief, it consists of three tasks. identification of patient attributes that require unique primary care team competencies : twenty - six patient attributes were identified across three levels (stage of diabetes, complications, and threats to self - care). the levels and patient attributes are described in the workforce evidence - based (web) planning model for diabetes (fig. 1), a unique conceptual model developed for this project. the web model contains more than one million possible combinations of attributes or subpopulations.figure 1web planning model for diabetes. number of persons by attribute per 1,000 persons with diabetes (reflects the australian population [modified from segal and leach, 2011, ref. level 1 : excluded, as workforce estimation restricted to persons with diagnosed diabetes. newly diagnosed or established. t1 dm, type 1 diabetes mellitus ; t2 dm, type 2 diabetes mellitus. web planning model for diabetes. number of persons by attribute per 1,000 persons with diabetes (reflects the australian population [modified from segal and leach, 2011, ref. 23 ]). level 1 : excluded, as workforce estimation restricted to persons with diagnosed diabetes. newly diagnosed or established. t1 dm, type 1 diabetes mellitus ; t2 dm, type 2 diabetes mellitus. estimation of population prevalence by attribute in the study region : pertinent datasets were interrogated to populate the web model. the numbers for thirteen attributes were drawn from the australian bureau of statistics (abs) national health survey (1) and the australian national hospital morbidity database (24), with the other attributes based on international surveys of persons with diabetes (23). the estimated number of persons with diabetes with each of the twenty - six attributes is reported in fig. 1. defining best - practice care : best - practice care objectives were defined for each of the 26 patient attributes described in levels 24 of the web model, based on the most comprehensive published clinical practice guidelines for diabetes (2527). these objectives were brought to three clinical expert panels, and with use of a modified nominal group technique, clinical care protocols were derived to deliver the care objectives. the clinical panels comprised twenty clinicians, covering fifteen disciplines (community nursing, dentistry, diabetes education, dietetics, endocrinology, exercise physiology, general practice, occupational therapy, pharmacy, physiotherapy, podiatry, practice nursing, psychology, public health, and social work). the clinical panel members were chosen to cover the eighteen competencies listed in table 1 that underscored diabetes management. distinct competency areas for delivering best - practice diabetes care in the primary care setting the outputs of this process were clinical protocols described in terms of number of consultations per year by length across eighteen core competency fields, listed in table 1, for each of the 26 patient attributes captured in the web model. competencies were used in this exercise rather than occupations to enhance the flexibility of the model and its value for workforce planning, service delivery planning, and discussion about primary care team composition. the output of this activity (one page for each of the 26 patient attributes) is available through the health economics and social policy group web site (28). the second phase of the project was estimation, by competency, of the local or regional health service / health workforce requirements for the delivery of best - practice diabetes care. the output of this phase was the composition of the primary care clinical team, defined by competencies, for the delivery of best - practice management of people with diabetes. for this application, we used population attributes for australia as a whole, thus determining the primary care team requirements for a patient catchment with attributes similar to those of the australian population with diabetes. this research activity combined the results of the individual - level needs analysis for each attribute with the estimated number of persons with each attribute. rather than simply adding total clinical input across all patient attributes, it was necessary to devise a logical approach to summation that recognized the ability of clinicians to deal with issues related to more than one attribute in the consult. we developed a six - step process to sum annual competency hours across attributes and people as follows : where individual linked data were available (as was the case for thirteen attributes reported in the 20072008 abs national health survey), we adopted the conservative position of searching by individual, within levels 24, for the attribute that attracted the highest value consultation time per year for each competency and using that as the estimated annual time input for the competency at that level. for example, if an individual presented with poor mental well - being and major social issues (e.g., death of a family member, marriage break up, victim of violence, eviction, loss of job) as the only two threats to self - care in level 4 of the web model, and the total annual consultation time for these attributes for the competency area social support is 240 min to manage major social issues and 210 min for poor mental well - being ; 240 min would be selected from level 4 for that individual. for persons identified with poor english - language proficiency (4.4% from the abs national health survey), 10% was added to the total consultation time for each competency to allow extra time associated with the use of interpreters. the estimated consultation time for each competency by level for each person was then summed across levels (as each level deals with distinct types of needs) to yield the total annual clinical requirement for each person with diabetes for the thirteen attributes with linked data. for the remaining (thirteen) attributes for which individual linked data were not available, annual consultation times for each competency were simply multiplied by the estimated prevalence, assuming prevalence consistent with the best australian or international evidence. total of required contact hours for each competency for a regional / local population with diabetes was obtained by summing across individuals for the thirteen attributes for which linked data were available and adding to this the estimates for the other thirteen attributes derived from survey data. for example, in the case of neuropathy this was assumed to affect 10% of people with diabetes (29), who would then require 210 min / year of lower - limb care (based on our needs analysis), thus adding a mean 21 min / year of competency in lower - limb care across all people with diabetes. the final step involved a downward adjustment in relation to the nonlinked attributes for which adjustment at the individual level for expected efficiencies of dealing with more than one attribute - related set of issues in the one consult was not possible. this was not an issue for level 2 attributes : either they are mutually exclusive or clinician input is strictly additive (as for pregnancy in people with type 1 or type 2 diabetes). this leaves eight attributes for which possible efficiencies in management might be an issue, seven of which sit at level 3. however, of these, three relate to an event (e.g., cardiac event) that requires management at the time, leaving only four with possible overlap. we considered each of these and the potential for efficiencies by competency and adjusted consultation time down by 20% for lower - limb care, dietary advice, diabetes education, exercise prescription, and clinical medical care in level 3. this method was used to derive an estimate of the primary care team required to deliver best - practice diabetes care to a hypothetical 1,000 persons with diabetes, with the same mix of attributes as the australian population (as reported in the abs national health survey and selected international datasets). the total consultation requirements by competency developed through this process were then reviewed by the same cross - disciplinary expert panel who informed the needs analysis, revisiting the assumptions driving the results. these assumptions were either confirmed or adjusted by consensus using a modified nominal group technique, with disagreements resolved by discussion. the requirement in hours by competency for 1,000 patients with diabetes was then recalculated. hours were translated into full - time - equivalent (fte) positions for each competency, based on 1,530 h consultation time per fte position. (this presumes a 40-h week 45 weeks per year, allowing 4 weeks annual leave, 2 weeks public holidays, 1 week family leave, and 15% for nonclinical activities such as administration and professional development). finally, we mapped competencies onto occupations to illustrate the implication of model outputs for possible membership of the primary care team by occupation and to estimate the cost of delivering best - practice diabetes care. for this task, we mapped competencies reflecting current practice, defined as the occupation holding the highest level of competency, based on the educational objectives of undergraduate training in the current (2012) australian clinical education and training environment. the needs analysis has previously been described in detail (23). in brief, it consists of three tasks. identification of patient attributes that require unique primary care team competencies : twenty - six patient attributes were identified across three levels (stage of diabetes, complications, and threats to self - care). the levels and patient attributes are described in the workforce evidence - based (web) planning model for diabetes (fig. the web model contains more than one million possible combinations of attributes or subpopulations.figure 1web planning model for diabetes. number of persons by attribute per 1,000 persons with diabetes (reflects the australian population [modified from segal and leach, 2011, ref. level 1 : excluded, as workforce estimation restricted to persons with diagnosed diabetes. newly diagnosed or established. t1 dm, type 1 diabetes mellitus ; t2 dm, type 2 diabetes mellitus. number of persons by attribute per 1,000 persons with diabetes (reflects the australian population [modified from segal and leach, 2011, ref. level 1 : excluded, as workforce estimation restricted to persons with diagnosed diabetes. t1 dm, type 1 diabetes mellitus ; t2 dm, type 2 diabetes mellitus. estimation of population prevalence by attribute in the study region : pertinent datasets were interrogated to populate the web model. the numbers for thirteen attributes were drawn from the australian bureau of statistics (abs) national health survey (1) and the australian national hospital morbidity database (24), with the other attributes based on international surveys of persons with diabetes (23). the estimated number of persons with diabetes with each of the twenty - six attributes is reported in fig. 1. defining best - practice care : best - practice care objectives were defined for each of the 26 patient attributes described in levels 24 of the web model, based on the most comprehensive published clinical practice guidelines for diabetes (2527). these objectives were brought to three clinical expert panels, and with use of a modified nominal group technique, clinical care protocols were derived to deliver the care objectives. the clinical panels comprised twenty clinicians, covering fifteen disciplines (community nursing, dentistry, diabetes education, dietetics, endocrinology, exercise physiology, general practice, occupational therapy, pharmacy, physiotherapy, podiatry, practice nursing, psychology, public health, and social work). the clinical panel members were chosen to cover the eighteen competencies listed in table 1 that underscored diabetes management. distinct competency areas for delivering best - practice diabetes care in the primary care setting the outputs of this process were clinical protocols described in terms of number of consultations per year by length across eighteen core competency fields, listed in table 1, for each of the 26 patient attributes captured in the web model. competencies were used in this exercise rather than occupations to enhance the flexibility of the model and its value for workforce planning, service delivery planning, and discussion about primary care team composition. the output of this activity (one page for each of the 26 patient attributes) is available through the health economics and social policy group web site (28). the second phase of the project was estimation, by competency, of the local or regional health service / health workforce requirements for the delivery of best - practice diabetes care. the output of this phase was the composition of the primary care clinical team, defined by competencies, for the delivery of best - practice management of people with diabetes. for this application, we used population attributes for australia as a whole, thus determining the primary care team requirements for a patient catchment with attributes similar to those of the australian population with diabetes. this research activity combined the results of the individual - level needs analysis for each attribute with the estimated number of persons with each attribute. rather than simply adding total clinical input across all patient attributes, it was necessary to devise a logical approach to summation that recognized the ability of clinicians to deal with issues related to more than one attribute in the consult. we developed a six - step process to sum annual competency hours across attributes and people as follows : where individual linked data were available (as was the case for thirteen attributes reported in the 20072008 abs national health survey), we adopted the conservative position of searching by individual, within levels 24, for the attribute that attracted the highest value consultation time per year for each competency and using that as the estimated annual time input for the competency at that level. for example, if an individual presented with poor mental well - being and major social issues (e.g., death of a family member, marriage break up, victim of violence, eviction, loss of job) as the only two threats to self - care in level 4 of the web model, and the total annual consultation time for these attributes for the competency area social support is 240 min to manage major social issues and 210 min for poor mental well - being ; 240 min would be selected from level 4 for that individual. for persons identified with poor english - language proficiency (4.4% from the abs national health survey), 10% was added to the total consultation time for each competency to allow extra time associated with the use of interpreters. the estimated consultation time for each competency by level for each person was then summed across levels (as each level deals with distinct types of needs) to yield the total annual clinical requirement for each person with diabetes for the thirteen attributes with linked data. for the remaining (thirteen) attributes for which individual linked data were not available, annual consultation times for each competency were simply multiplied by the estimated prevalence, assuming prevalence consistent with the best australian or international evidence. total of required contact hours for each competency for a regional / local population with diabetes was obtained by summing across individuals for the thirteen attributes for which linked data were available and adding to this the estimates for the other thirteen attributes derived from survey data. for example, in the case of neuropathy this was assumed to affect 10% of people with diabetes (29), who would then require 210 min / year of lower - limb care (based on our needs analysis), thus adding a mean 21 min / year of competency in lower - limb care across all people with diabetes. the final step involved a downward adjustment in relation to the nonlinked attributes for which adjustment at the individual level for expected efficiencies of dealing with more than one attribute - related set of issues in the one consult was not possible. this was not an issue for level 2 attributes : either they are mutually exclusive or clinician input is strictly additive (as for pregnancy in people with type 1 or type 2 diabetes). this leaves eight attributes for which possible efficiencies in management might be an issue, seven of which sit at level 3. however, of these, three relate to an event (e.g., cardiac event) that requires management at the time, leaving only four with possible overlap. we considered each of these and the potential for efficiencies by competency and adjusted consultation time down by 20% for lower - limb care, dietary advice, diabetes education, exercise prescription, and clinical medical care in level 3. this method was used to derive an estimate of the primary care team required to deliver best - practice diabetes care to a hypothetical 1,000 persons with diabetes, with the same mix of attributes as the australian population (as reported in the abs national health survey and selected international datasets). the total consultation requirements by competency developed through this process were then reviewed by the same cross - disciplinary expert panel who informed the needs analysis, revisiting the assumptions driving the results. these assumptions were either confirmed or adjusted by consensus using a modified nominal group technique, with disagreements resolved by discussion. hours were translated into full - time - equivalent (fte) positions for each competency, based on 1,530 h consultation time per fte position. (this presumes a 40-h week 45 weeks per year, allowing 4 weeks annual leave, 2 weeks public holidays, 1 week family leave, and 15% for nonclinical activities such as administration and professional development). finally, we mapped competencies onto occupations to illustrate the implication of model outputs for possible membership of the primary care team by occupation and to estimate the cost of delivering best - practice diabetes care. for this task, we mapped competencies reflecting current practice, defined as the occupation holding the highest level of competency, based on the educational objectives of undergraduate training in the current (2012) australian clinical education and training environment. the delivery of best - practice diabetes care in the primary and community care setting to a catchment of 1,000 persons with diabetes is estimated to require a multidisciplinary team that can collectively demonstrate competency across 18 areas and be able to deliver 33,780 clinical contact hours per annum. this is equivalent to a mean 33.75 contact hours per person with diabetes per year across all clinical areas or just under 40 min per person per week. for example, a person with type 1 diabetes experiencing major life stresses (e.g., recently widowed) and needing assistance with medications (e.g., because of cognitive impairment) requires an estimated 135 min per week, while a person with established type 2 diabetes but no complications or threats to self - care requires an estimated 13 min of clinician time per week on average. total contact hours per competency per annum required to deliver best - practice diabetes care in the primary care setting to 1,000 persons with diabetes the competency areas that required the greatest clinical contact times in mean hours per person per year were dietary advice and management (5 h), home nursing (4.8 h), diabetes education (4.2 h), preventative care and surveillance (3.1 h), psychological care (3.0 h), and exercise prescription and management (2.9 h) (table 2). (level 2), 23% to the management of complications (level 3), and 37% to addressing threats to self - care (level 4). across the three levels of the web model, the required clinical contact time varied for each competency (table 2). for level 2, clinical demand associated with basic diabetes management was, as expected, dietary management, preventative care and surveillance, diabetes education, case management and care coordination, exercise prescription and management, and specialist pharmacy management. total contact time for medical care was not high, despite high numbers of consultations, owing to short consultation time. for level 3, diabetes complications or events, highest competency requirements related to psychological care, home nursing, lower - limb care, diabetes education, and exercise prescription and management. for level 4, which addresses factors impacting on self - care capacity, the greatest demand was for competency in home nursing (predominantly related to wound management and medication support), dietary advice and management, social support, exercise prescription and management (associated with physical disability), and psychological care. the estimated total contact hours imply just over 22 fte clinical positions for 1,000 persons with diabetes or 1 clinician/46 people with diabetes. what this might mean for the composition of the primary care team is reported in table 3, based on mapping of competencies onto occupations, reflecting the highest competency level implied by the educational objectives of current undergraduate training in australia. the results, in terms of primary care team composition, are reported in table 3 and the budget implications in table 4. number of fte positions by occupation to deliver best - practice diabetes care in the primary and community care setting to 1,000 persons with diabetes salary cost of primary and community care team for delivery of best - practice diabetes care to 1,000 persons with diabetes (aud in 2012) it was found that half of the multidisciplinary primary care team positions would be taken up by just two occupations : nursing at 7.9 fte (3.15 fte for district nursing, 2.75 fte for diabetes education, and 2.03 fte for practice nursing) and dietetics at 3.4 fte (see table 3). for district nurses, most of the workload was attributed to the management of impaired cognitive ability (primarily for medication management) and diabetic foot disorder (for wound management). the workload of diabetes educators was largely taken up in the management of established type 1 and type 2 diabetes but was also taken up in addressing diabetes self - care issues that arise in the context of major social insults (such as death of a partner) and in advice on sexual dysfunction (the most common complication of diabetes). much of the workload of practice nurses was attributed to the preventive care and surveillance role. medical care provided by the general practitioner (gp) (or primary care physician) was estimated to account for 1.75 fte positions, which for 1,000 persons represents a caseload of 570 persons with diabetes per gp. the gp was identified as contributing 8% of the total time of the care team but a higher percentage of consultations and cost. psychosocial care, in this example assumed to be delivered by a psychologist or social worker (but might also be delivered by other professionals with relevant competencies), was identified with 3.5 fte positions, making up ~15% of the care team. the cost of delivering diabetes care by the multidisciplinary primary and community care team identified in table 3 was estimated at 2.052 million australian dollars (aud) per annum (2012). this equates to 2,052 aud (2,145 usd) per person with diabetes (table 4). over half of the salary cost was attributed to four occupations : gps, nurses (i.e., district nurses, diabetes education, and practice nurses), and dietitians. gps accounted for 18.6% of the estimated salary cost, though making up just 8% of the diabetes primary health care workforce owing to considerably higher salaries. the annual primary care cost at just over 2,000 aud per person seems modest relative to the mean cost of 1 day in hospital at 1,625 aud (30) (adjusted to 2012 values using the health component of the consumer price index) or 15 months supply of two common medications for people with diabetes (a cholesterol - lowering drug plus an antidiabetes agent) (31). the application of an original health workforce planning model to diabetes has demonstrated the feasibility of implementing an evidence - informed needs - based health workforce model, drawing predominantly on existing datasets. this represents a major advance over commonly used clinician - to - population ratios for health workforce and health services planning. the composition of the multidisciplinary care team required to support best - practice care derived by the model is 50% clinical diabetes care (medical / nursing, pharmacy, podiatry, and dental), 25% to support more healthy lifestyle behaviors (predominantly dietetics and exercise physiology), and 25% to deliver psychosocial care. the model estimates a required primary care team of 22 fte for 1,000 persons with diabetes at a mean estimated cost per person for 12 months of 2,000 aud (2,090 usd), which is equivalent to the cost of 1.25 days in hospital or 15 months supply of two common medications for this population (an antidiabetes agent and a cholesterol - lowering drug). the breadth of the proposed skill base of the primary care team and especially the inclusion of psychosocial capability should better address the diversity of clinic populations and improve outcomes, particularly in more disadvantaged populations. it reflects a population and its health status and other attributes at a particular point of time (most inputs were from 2006) and best - practice care as described in 2011 by our clinical experts, also drawing on earlier published guidelines. however, we note that a change in clinical best practice does not necessarily mean a change in the desirable competencies of the primary care team. while we have used a rolling clinical panel with a diverse membership and a delphi technique to elicit consensus and informed the deliberations with the best published guideline evidence, it is possible that another expert group would have arrived at a somewhat different set of care protocols. in publishing the model, we would invite other constituencies to replicate the application to reflect the characteristics of their own populations and perhaps a different understanding about the translation of best - practice care objectives into number and length of consultations for each competency. however, a number of members of the clinical panel did have diabetes and brought their experience as patients to the discussion. this research supports the need for a multidisciplinary team that covers a wide range of competencies for the delivery of diabetes care. the proposed team is not dissimilar to that which can be inferred from published clinical practice guidelines for diabetes, which suggests a core primary care team of 310 members across the disciplines of diabetes education, dietetics, exercise therapy, medicine, nursing, dentistry, optometry, pharmacy, podiatry, and mental health (2527). guidelines also mention the need for indigenous or ethnicity - specific health workers, depending on the clinic population. the major professional areas left out relate to competencies for addressing threats to aspects of self - care capacity, notably social work. while it might be argued that the competencies we have included in the primary care team could be covered through referral, this is not consistent with a quality multidisciplinary team model, which ideally includes all those involved in patient care (at the primary care level). this should include social work, occupational therapy, and all other allied disciplines not just the core medical / nursing team both to develop a special understanding of the particular issues facing people with diabetes (or related chronic conditions) and to provide for a close working relationship between all members of the care team. further, as this analysis suggests, the required input from the psychosocial disciplines is considerable ; their membership as part of the core team simply makes sense. a focus on the medical care team would undoubtedly leave the quality of care for certain subpopulations with diabetes, particularly those experiencing challenging social issues, poor mental health and well - being, and physical or intellectual disabilities, with inadequate quality care and poorer outcomes than necessary. these factors impact on glycemic control (16,17,19), the effectiveness of clinical care, and disease progression, as well as health - related quality of life (32). incorporating into the diabetes team health professionals with demonstrable competency in delivering psychosocial care is fundamental if optimal outcomes are to be achieved, especially in people with diabetes with multiple disadvantages that constitute threats to self - care. for example, 42% of adult australians with diabetes report medium, high, or very high levels of psychological distress (33). if the considerable disparity in health outcomes observed between persons from higher and lower socioeconomic status is to be redressed, ensuring that the primary care team has the competencies to deal with threats to self - care will be critical. the structure of the model makes it possible to incorporate local data that capture the health status and other attributes of a local community. in australia, the widespread use of information technology based clinical care systems results in a high capacity to populate the model with local data. in translating competencies into occupations, however, in identifying the core competencies and broad skill areas that need to be covered within the care team, the model may also highlight specific training needs. the model parameters could also be modified to take into account different delivery modes, such as the use of internet - based care options or group delivery of care. a comparison between our estimate of need with workforce supply for the management of diabetes in australia could not be completed because of limitations with published workforce data (11). given the strong medical focus of primary care in australia, modified in recent years to fund greater access to allied health and psychology services and practice nursing, it is almost certain that there will be a considerable gap in access to other members of the care team, especially social work, dietetics, diabetes education, dental, and pharmacy. these services are predominantly funded by state governments, with funded places and thus access limited by prescribed budget caps, contrasting with open - ended funding by the australian government of gps through the medicare benefits schedule plus extensive funding for practice nursing and psychology. however, the funding model being largely fee for service for individual practitioners does not encourage genuine multidisciplinary team care. the competencies identified through this research match many of those seen in the chronic disease self - management literature (34,35). these models encourage health professionals to become coaches and facilitators of self - management rather than treatment providers. a challenge in preparing the future workforce of health professionals is to ensure that principles of interdisciplinary team care and chronic disease self - management are incorporated into health professional education and embedded within contemporary curricula. but support through appropriate models of primary care funding is also critical if the primary care is to be allowed to achieve the right balance. the ideal funding model is through a needs - adjusted capitation formula with services purchased / delivered through a fundholder with community and patient input to priorities (36,37). this research could be used to inform the educational objectives of possible new cross - disciplinary health professionals for working with clients with chronic disease to reflect competencies identified in the web model. for example, rosenthal. (38) discuss the community health worker as an emerging concept to consider in redefining and redesigning primary care services. the competencies described in the web model could inform the set of competencies and skills for a community health worker to work more effectively with people with chronic disease, especially those with multiple disadvantage. training workers who can competently cover more than one competency would enable a reduction in the number of members of the multidisciplinary team required to deliver best - practice care. this would be an advantage in terms of level of coordination required and would be more convenient for the patient. many practitioners from different occupations may have the knowledge, skills, and experience to support clients with diabetes. the web model, with its description of patient attributes and associated competency requirement, opens the way for workforce development to address these attributes through appropriate skills and competences rather than simply considering professional labels. the onus is on the practitioner to demonstrate skill and capacity to manage selected patient attributes rather than presumed by virtue of professional designation. for example, a social worker, psychologist, nurse, or occupational therapist may have the skills to support clients with issues related to psychosocial insults, and so, rather than identifying the profession in recruitment materials, the area of management of psychosocial issues becomes the focus. it is then up to the practitioner to provide evidence of skills and knowledge in that area, rather than relying on assumptions that the professional label provides that evidence. the web model s articulation of competencies required for chronic disease care reflecting particularly on self - care capacity is timely, given the shift in focus of health care policy from a disease and occupational service model to a patient - centered care approach (39). this allows the development of care teams around the patient s needs rather than the professions need to specialize. flexibility of team construction is also useful to reflect changing workforce and population composition over time (40,41). the web model supports examination of the competencies required from a patient - centered approach that better reflects the extreme diversity in clinic populations. it also demonstrates the advantage of using competencies to define the team, rather than starting with professions or occupations. if family members or others have the competencies and preparedness to deliver needed care (such as medication support), this could potentially substitute for a clinician in the primary care team. in implementing the model in a specific local area, the primary care team mix defined by the model would need to be carefully monitored against actual demand. demand for services will reflect, for instance, the extent to which the target population chooses to access services and mode of service delivery. patients may find the estimated schedule of consultations too onerous or simply consider the suggested level of consultations unnecessary. if this is the case, understanding why will be important. for example, the provision of group consultations or extensive use of internet / phone - based care would change the optimal team configuration. in applying the model in a particular service delivery context, where mode of delivery can be described, adjustment to reflect however, it is important to distinguish when an alternate service model reflects best - practice care and when it represents a compromise imposed by limited funding. the delivery of best - practice diabetes care requires a broad multidisciplinary health care team, with the necessary skills and competencies to effectively address the biopsychosocial needs of the population with diabetes. these include not just medical care requirements but also the competencies to address the many factors that impact on self - care capacity. we argue that one reason quality of diabetes care is often observed to be poor with failure to achieve clinical targets, especially in more disadvantaged groups, is the narrowness of the multidisciplinary team. while the composition of the primary care team does not guarantee the delivery of best - practice care, which in addition requires a sound clinical quality - assurance system, appropriate funding, and well - trained clinicians, the achievement of good chronic disease outcomes for patients will remain elusive in the absence of a primary care team with the appropriate mix of competencies. application of the web model to other conditions is a possible extension of this research and could be used to define global primary and community care workforce needs. discussions with health workforce planning agencies have confirmed the value and originality of the model for those seeking an evidence - based approach to health workforce and health services planning. the application of an original health workforce planning model to diabetes has demonstrated the feasibility of implementing an evidence - informed needs - based health workforce model, drawing predominantly on existing datasets. this represents a major advance over commonly used clinician - to - population ratios for health workforce and health services planning. the composition of the multidisciplinary care team required to support best - practice care derived by the model is 50% clinical diabetes care (medical / nursing, pharmacy, podiatry, and dental), 25% to support more healthy lifestyle behaviors (predominantly dietetics and exercise physiology), and 25% to deliver psychosocial care. the model estimates a required primary care team of 22 fte for 1,000 persons with diabetes at a mean estimated cost per person for 12 months of 2,000 aud (2,090 usd), which is equivalent to the cost of 1.25 days in hospital or 15 months supply of two common medications for this population (an antidiabetes agent and a cholesterol - lowering drug). the breadth of the proposed skill base of the primary care team and especially the inclusion of psychosocial capability should better address the diversity of clinic populations and improve outcomes, particularly in more disadvantaged populations. it reflects a population and its health status and other attributes at a particular point of time (most inputs were from 2006) and best - practice care as described in 2011 by our clinical experts, also drawing on earlier published guidelines. however, we note that a change in clinical best practice does not necessarily mean a change in the desirable competencies of the primary care team. while we have used a rolling clinical panel with a diverse membership and a delphi technique to elicit consensus and informed the deliberations with the best published guideline evidence, it is possible that another expert group would have arrived at a somewhat different set of care protocols. in publishing the model, we would invite other constituencies to replicate the application to reflect the characteristics of their own populations and perhaps a different understanding about the translation of best - practice care objectives into number and length of consultations for each competency. however, a number of members of the clinical panel did have diabetes and brought their experience as patients to the discussion. this research supports the need for a multidisciplinary team that covers a wide range of competencies for the delivery of diabetes care. the proposed team is not dissimilar to that which can be inferred from published clinical practice guidelines for diabetes, which suggests a core primary care team of 310 members across the disciplines of diabetes education, dietetics, exercise therapy, medicine, nursing, dentistry, optometry, pharmacy, podiatry, and mental health (2527). guidelines also mention the need for indigenous or ethnicity - specific health workers, depending on the clinic population. the major professional areas left out relate to competencies for addressing threats to aspects of self - care capacity, notably social work. while it might be argued that the competencies we have included in the primary care team could be covered through referral, this is not consistent with a quality multidisciplinary team model, which ideally includes all those involved in patient care (at the primary care level). this should include social work, occupational therapy, and all other allied disciplines not just the core medical / nursing team both to develop a special understanding of the particular issues facing people with diabetes (or related chronic conditions) and to provide for a close working relationship between all members of the care team. further, as this analysis suggests, the required input from the psychosocial disciplines is considerable ; their membership as part of the core team simply makes sense. a focus on the medical care team would undoubtedly leave the quality of care for certain subpopulations with diabetes, particularly those experiencing challenging social issues, poor mental health and well - being, and physical or intellectual disabilities, with inadequate quality care and poorer outcomes than necessary. these factors impact on glycemic control (16,17,19), the effectiveness of clinical care, and disease progression, as well as health - related quality of life (32). incorporating into the diabetes team health professionals with demonstrable competency in delivering psychosocial care is fundamental if optimal outcomes are to be achieved, especially in people with diabetes with multiple disadvantages that constitute threats to self - care. for example, 42% of adult australians with diabetes report medium, high, or very high levels of psychological distress (33). if the considerable disparity in health outcomes observed between persons from higher and lower socioeconomic status is to be redressed, ensuring that the primary care team has the competencies to deal with threats to self - care will be critical. the structure of the model makes it possible to incorporate local data that capture the health status and other attributes of a local community. in australia, the widespread use of information technology based clinical care systems results in a high capacity to populate the model with local data. in translating competencies into occupations, however, in identifying the core competencies and broad skill areas that need to be covered within the care team, the model may also highlight specific training needs. the model parameters could also be modified to take into account different delivery modes, such as the use of internet - based care options or group delivery of care. a comparison between our estimate of need with workforce supply for the management of diabetes in australia could not be completed because of limitations with published workforce data (11). given the strong medical focus of primary care in australia, modified in recent years to fund greater access to allied health and psychology services and practice nursing, it is almost certain that there will be a considerable gap in access to other members of the care team, especially social work, dietetics, diabetes education, dental, and pharmacy. these services are predominantly funded by state governments, with funded places and thus access limited by prescribed budget caps, contrasting with open - ended funding by the australian government of gps through the medicare benefits schedule plus extensive funding for practice nursing and psychology. however, the funding model being largely fee for service for individual practitioners does not encourage genuine multidisciplinary team care. the competencies identified through this research match many of those seen in the chronic disease self - management literature (34,35). these models encourage health professionals to become coaches and facilitators of self - management rather than treatment providers. a challenge in preparing the future workforce of health professionals is to ensure that principles of interdisciplinary team care and chronic disease self - management are incorporated into health professional education and embedded within contemporary curricula. but support through appropriate models of primary care funding is also critical if the primary care is to be allowed to achieve the right balance. the ideal funding model is through a needs - adjusted capitation formula with services purchased / delivered through a fundholder with community and patient input to priorities (36,37). this research could be used to inform the educational objectives of possible new cross - disciplinary health professionals for working with clients with chronic disease to reflect competencies identified in the web model. for example, rosenthal. (38) discuss the community health worker as an emerging concept to consider in redefining and redesigning primary care services. the competencies described in the web model could inform the set of competencies and skills for a community health worker to work more effectively with people with chronic disease, especially those with multiple disadvantage. training workers who can competently cover more than one competency would enable a reduction in the number of members of the multidisciplinary team required to deliver best - practice care. this would be an advantage in terms of level of coordination required and would be more convenient for the patient. many practitioners from different occupations may have the knowledge, skills, and experience to support clients with diabetes. the web model, with its description of patient attributes and associated competency requirement, opens the way for workforce development to address these attributes through appropriate skills and competences rather than simply considering professional labels. the onus is on the practitioner to demonstrate skill and capacity to manage selected patient attributes rather than presumed by virtue of professional designation. for example, a social worker, psychologist, nurse, or occupational therapist may have the skills to support clients with issues related to psychosocial insults, and so, rather than identifying the profession in recruitment materials, the area of management of psychosocial issues becomes the focus. it is then up to the practitioner to provide evidence of skills and knowledge in that area, rather than relying on assumptions that the professional label provides that evidence. the web model s articulation of competencies required for chronic disease care reflecting particularly on self - care capacity is timely, given the shift in focus of health care policy from a disease and occupational service model to a patient - centered care approach (39). this allows the development of care teams around the patient s needs rather than the professions need to specialize. flexibility of team construction is also useful to reflect changing workforce and population composition over time (40,41). the web model supports examination of the competencies required from a patient - centered approach that better reflects the extreme diversity in clinic populations. it also demonstrates the advantage of using competencies to define the team, rather than starting with professions or occupations. if family members or others have the competencies and preparedness to deliver needed care (such as medication support), this could potentially substitute for a clinician in the primary care team. in implementing the model in a specific local area, the primary care team mix defined by the model would need to be carefully monitored against actual demand. demand for services will reflect, for instance, the extent to which the target population chooses to access services and mode of service delivery. patients may find the estimated schedule of consultations too onerous or simply consider the suggested level of consultations unnecessary. for example, the provision of group consultations or extensive use of internet / phone - based care would change the optimal team configuration. in applying the model in a particular service delivery context, where mode of delivery can be described, adjustment to reflect however, it is important to distinguish when an alternate service model reflects best - practice care and when it represents a compromise imposed by limited funding. the delivery of best - practice diabetes care requires a broad multidisciplinary health care team, with the necessary skills and competencies to effectively address the biopsychosocial needs of the population with diabetes. these include not just medical care requirements but also the competencies to address the many factors that impact on self - care capacity. we argue that one reason quality of diabetes care is often observed to be poor with failure to achieve clinical targets, especially in more disadvantaged groups, is the narrowness of the multidisciplinary team. while the composition of the primary care team does not guarantee the delivery of best - practice care, which in addition requires a sound clinical quality - assurance system, appropriate funding, and well - trained clinicians, the achievement of good chronic disease outcomes for patients will remain elusive in the absence of a primary care team with the appropriate mix of competencies. application of the web model to other conditions is a possible extension of this research and could be used to define global primary and community care workforce needs. discussions with health workforce planning agencies have confirmed the value and originality of the model for those seeking an evidence - based approach to health workforce and health services planning. | objectivebest - practice diabetes care can reduce the burden of diabetes and associated health care costs. but this requires access to a multidisciplinary team with the right skill mix. we applied a needs - driven evidence - based health workforce model to describe the primary care team required to support best - practice diabetes care, paying particular attention to diverse clinic populations.research design and methodscare protocols, by number and duration of consultations, were derived for twenty distinct competencies based on clinical practice guidelines and structured input from a multidisciplinary clinical panel. this was combined with a previously estimated population profile of persons across 26 patient attributes (i.e., type of diabetes, complications, and threats to self - care) to estimate clinician contact hours by competency required to deliver best - practice care in the study region.resultsa primary care team of 22.1 full - time - equivalent (fte) positions was needed to deliver best - practice primary care to a catchment of 1,000 persons with diabetes with the attributes of the australian population. competencies requiring greatest contact time were psychosocial issues and dietary advice at 3.5 and 3.3 fte, respectively (1 fte/300 persons) ; home (district) nursing at 3.2 fte ; and diabetes education at 2.8 fte. the annual cost of delivering care was estimated at just over 2,000 australian dollars (2,090 usd) (2012) per person with diabetes.conclusionsa needs - driven approach to primary care service planning identified a wider range of competencies in the diabetes primary and community care team than typically described. access to psychosocial competences as well as medical management is required if clinical targets are to be met, especially in disadvantaged groups. |
vascular adhesion protein-1 (vap-1) is a homodimeric sialylated glycoprotein originally discovered in inflamed synovial vessels by salmi and jalkanen in 1992. vap-1 is a multifunctional molecule that possesses enzymatic activity known as semicarbazide - sensitive amine oxidase (ssao) and is involved in the leukocyte recruitment cascade. the vap-1 molecule consists of an extracellular part, which harbors the catalytic site, a transmembrane segment, and a short intracellular n - terminal tail [2, 3 ]. on the plasma membrane vap-1 has a relatively narrow substrate channel formed by domains d4 and d3, and a key leucine (469 in human) guards the entry of substrates. the large d4 domains, from each subunit, form the dimer interface and each also contains a catalytic site, buried at the base of a deep cleft. vap-1 is expressed on the endothelium of human tissues such as skin, brain, lung, liver, and heart under both normal and inflamed conditions [48 ]. in the ocular tissues of humans and rats, vap-1 is localized on the endothelial cells of retinal and choroidal vessels [912 ]. vap-1 labeling showed the highest intensity in both arteries and veins of neuronal tissues : retina and optic nerve, the moderate intensity in scleral and choroidal vessels, and the lowest intensity in the iris vasculature. moreover, vap-1 intensity was significantly higher in the arteries compared to veins. under normal conditions, vap-1 is mainly absent from the endothelial cell surface and is stored within intracellular granules, while on inflammation, it is rapidly translocated to the endothelial cell surface and facilitates the recruitment of leukocytes into the inflamed tissues together with other leukocyte adhesion molecules (figure 1). in fact, previous studies have elucidated that vap-1 is involved in the molecular mechanisms of acute ocular inflammation, inflammation - associated ocular angiogenesis, and leukostasis under diabetic conditions. indeed, vap-1 inhibition may be a novel and potent therapeutic strategy in the treatment of ocular inflammatory diseases. notably, ssao / vap-1 contributes to inflammation not only through its role as an adhesion molecule but also through its function as an enzyme by causing the formation of cytotoxic molecules such as hydrogen peroxide, aldehyde, and ammonia. these molecules are involved in the pathophysiology of ocular inflammation [15, 16 ], and their inhibition, for instance, through antioxidants, recovers the integrity of the blood - aqueous barrier in endotoxin - induced uveitis (eiu) animals. here we give an overview on the new research progresses of vap-1 in the ocular diseases including uveitis, age - related macular degeneration (amd), diabetic retinopathy (dr), and ocular tumor. the connection between vap-1 and ocular diseases will be elucidated and may provide a new research direction for the diagnosis and treatment of these ocular diseases. complications such as cystoid macular edema, glaucoma, vascular occlusion, and proliferative vitreoretinopathy are common causes of permanent vision loss [1821 ]. eiu is one of animal models to establish new therapeutic targets for treating human uveitis, which is marked by a vasodilatation of the iris and vascular changes in the ciliary body, accompanied by an increased vascular permeability and breakdown of the blood - aqueous barrier [2224 ]. the leukocytes infiltrate into the anterior chamber, vitreous cavity, and retina from ciliary body and iris in conjunction with protein extravasation into the aqueous humor. as part of this inflammatory response for example, endothelial p - selectin, which mediates the first step of the leukocyte recruitment, the tethering, and rolling, is upregulated in retinal vessels of eiu animals [25, 26 ]. furthermore, intercellular adhesion molecule-1 (icam-1), which mediates the subsequent step of firm leukocyte adhesion to the vascular endothelium, is increased in the retina of eiu animals [27, 28 ]. functional inhibition of p - selectin or icam-1 prevents the infiltration of leukocytes into the inflamed ocular tissues during eiu, and thus attenuates the inflammatory response at the early stages of rolling and firm adhesion. in 2008, noda. vap-1 is constitutively expressed in the normal retina, and its expression is elevated together with ssao activity during eiu. their data also indicate that vap-1 inhibition substantially suppresses retinal inflammation during eiu on a molecular, cellular, and organ level. for example, vap-1 inhibition in eiu animals significantly suppressed leukocytes recruitment to the anterior chamber, vitreous, and retina, as well as retinal endothelial p - selectin expression. the diameter of the retinal veins and arteries of eiu animals, 24 h after lps injection, was significantly larger than the corresponding retinal vessels in normal animals. however, vap-1 inhibition reduced the diameter of corresponding retinal veins and arteries 24 h after lps injection, compared with vehicle - treated rats even though the difference did not reach statistical significance. to sum up, vap-1 is crucially involved in leukocyte infiltration into ocular tissues during acute inflammation of eiu. vap-1 inhibition may even prevent leukocyte recruitment at the early stage of rolling and become a novel strategy in the treatment of uveitis (table 1). choroidal neovascularization (cnv) is the main cause of severe vision loss in patients with age - related macular degeneration (amd). inflammation plays a critical role in the formation of cnv lesions and may contribute to the pathogenesis of both the nonexudative and exudative forms of amd [31, 32 ]. for example, inflammatory cells are found in surgically excised cnv lesions from amd patients [3336 ] and in autopsied eyes with cnv [3739 ]. in particular, macrophages have been implicated in the pathogenesis of amd due to their spatiotemporal distribution in the proximity of the cnv lesions in experimental models and humans [4042 ]. macrophages are a source of proangiogenic and inflammatory cytokines, such as vascular endothelial growth factor (vegf) and tumor necrosis factor (tnf)-, both of which significantly contribute to the pathogenesis of cnv [45, 46 ]. furthermore, druse which has proven to be one of the earliest signs of amd contains many inflammatory molecules [47, 48 ]. some inflammatory molecules such as the complement components c3a and c5a are proinflammatory and can induce vegf. as an endothelial adhesion molecule involved in leukocyte recruitment under inflammatory conditions, vap-1 was recently showed to contribute to the recruitment of macrophages to cnv lesions in a rat laser - induced amd model and had a novel link with angiogenesis. in their study, vap-1 was found to be expressed in the choroid and retina, exclusively in the vessels, and localized in the vessels of the cnv lesions. inhibition of vap-1 significantly decreased cnv size, fluorescein angiography leakage, and the accumulation of macrophages in cnv lesions. furthermore, vap-1 blockade significantly reduced the expression of inflammation - associated molecules such as tumor necrosis factor (tnf)-, monocyte chemoattractant protein (mcp)-1, and intercellular adhesion molecule (icam)-1. most recently, in a mouse laser - induced cnv model, vap-1 inhibition significantly attenuated cnv formation in a dose - dependent manner and reduced macrophage infiltration into cnv lesions. furthermore, vap-1 blockade decreased the expression of icam-1 and mcp-1, both of which played a pivotal role in macrophage recruitment. thus, vap-1 blockade reduced macrophage recruitment into cnv lesion indirectly via suppression of other adhesion molecules. previous studies have demonstrated that marked suppression of vegf is crucial for the suppression of cnv formation in the laser - induced cnv model [51, 52 ]. however, in this study vap-1 blockade showed weak inhibitory effects on vegf, a key molecule for angiogenesis, whereas cnv formation was significantly suppressed. it may indicate that vap-1 inhibition ameliorates ocular angiogenesis through mechanism(s) the current data suggest that vap-1 may be an attractive molecular target in the treatment of cnv formation of amd (table 1). diabetic retinopathy (dr) is one of the main microvascular complications of diabetes and a leading cause of adult vision loss [53, 54 ]. recent studies have elucidated that chronic, low - grade inflammation underlies much of the vascular complications of dr [55, 56 ]. many molecular and functional changes that are characteristics of inflammation have been detected in dr. the recruitment of leukocytes has been found to be significantly increased in retinas of diabetic animals [5759 ] and might contribute to the capillary nonperfusion of diabetic retinopathy. leukocytes firmly adhering to capillary endothelial cells via adhesion molecules induce apoptotic changes in retinal endothelial cells. as demonstrated through several lines of evidence, vap-1 seems to be a key player in the inflammation associated with dr. in 2009, noda. investigated the role of vap-1 in dr. contrastively, retinal vap-1 expression was higher in diabetic animals compared to the normal controls ; however, the difference did not reach statistical significance. their results also suggested that vap-1 principally regulated the step of leukocyte transmigration, with little influence on the preceding step of firm adhesion. this provides a clear distinction between the role of vap-1 in acute and chronic inflammation. during acute inflammation vap-1 regulates both firm adhesion and transmigration, while in chronic low - grade inflammation, such as found during diabetes, vap-1 may only regulate transmigration. in conclusion vap-1 also exists as a soluble form in serum which retains its enzymatic function. like other soluble adhesion molecules, svap-1 modulates lymphocyte adherence. much attention has recently been paid to the elevated serum concentration of svap-1 in patients with type 1 and type 2 diabetes [61, 62 ]. in type 2 diabetes, svap-1 even serves as an independent prognostic marker for the diabetic complications and predicts the risk for cardiovascular and cancer mortality in these patients. moreover, patients with dr display significantly higher plasma ssao activities compared to patients without dr (table 1). in a recent clinical study, murata. demonstrated that svap-1 is increased and correlated with oxidative stress in the vitreous fluid of patients with pdr. furthermore, retinal capillary endothelial cells produce the membrane - bound form of vap-1 and release svap-1 when stimulated with high glucose or inflammatory cytokines such as tnf- and il-1. mmp-2 (matrix metalloproteinases-2) and mmp-9 can degrade type iv collagen, laminin, and fibronectin, the main constituents of the basement membrane ; thereby, mmps play a crucial role in the degradation of basement membrane during angiogenesis [65, 66 ]. mmp-2 and mmp-9 are the proteinases predominantly responsible for vap-1 shedding from retinal capillary endothelial cells. the present data provide evidence on the link between svap-1 and type iv collagenases in the pathogenesis of pdr. therefore, further studies are needed to clarify the relationship between svap-1 and other ocular diseases. it has been demonstrated that the 5-year survival of melanoma patients with low vap-1 protein expression in intratumoral blood vessels was lower than that of those patients with high vap-1 expression. strong expression of vap-1 on tumor endothelium could distinguish human hepatocellular carcinoma from colorectal hepatic metastases. furthermore, some studies indicate that patients with low svap-1 levels have significantly worse prognosis of colorectal cancer and that svap-1 is an independent marker of hepatic and lymph node metastasis in these patients. a similar correlation with low svap-1 and poor prognosis was reported in gastric cancer. lately, fukuhara. examined the immunolocalization of vap-1 in pyogenic granuloma and extranodal marginal zone b - cell lymphoma (emzl) as common human conjunctival tumors. they showed strong expression of vap-1 protein in intratumoral blood vessels of pyogenic granuloma, a benign inflammatory conjunctival tumor, and relatively lower expression in emzl, a malignant inflammatory tumor. moreover, the microvessel density was high in pyogenic granuloma compared to that in emzl. their data suggest that vap-1 plays an important role in the pathogenesis and development of conjunctival inflammatory diseases such as pyogenic granulomas, whereas the relatively lower expression of vap-1 in intratumoral microvessels might be correlated with the progression of conjunctival lymphoma. furthermore, vap-1 is involved in angiogenesis and tumor growth via controlling the migration of gr-1+cd11b+ myeloid cells, which comprise immature macrophages and dendritic cells playing a pivotal role in tumor angiogenesis. deficient mice melanoma and lymphoma tumors grew more slowly than in wild - type animals. the tumors in vap-1/ host had defective angiogenesis and impaired recruitment of myeloid - derived suppressor cells (mdscs). notably, if the mdscs were ablated from the mice, vap-1 deficiency no longer protected the animals. moreover, genetic experiments with transgenic mice expressing an enzymatically inactive mutant of vap-1 showed that the effects on mdsc accumulation were dependent on the oxidase activity of vap-1. therefore, vap-1 enhances local malignant lymphoma growth by increasing the recruitment of myeloid leukocytes into the tumors. since tumor cells utilize the catalytic activity of vap-1 to recruit myeloid cells into tumors, and to support tumor progression, small - molecule vap-1 inhibitors could be an effective immunotherapy for the inhibition of tumor progression. currently salmi and jalkanen hypothesize that the vap-1 expressing in neoangiogenic vessels of the tumor bind mdsc. as a consequence, the intratumoral numbers of this particular protumorigenic leukocyte subtype are selectively increased, with a concomitant stimulation of the neoangiogenesis and enhancement of the immunosuppressing gene signature of the tumor microenvironment. in conclusions, vap-1 may be an alternative therapeutic target in ocular tumors (table 1). the special structure of the eye provides a unique opportunity for noninvasive light - based imaging of fundus vasculature. using adhesion - molecule - conjugated fluorescent microspheres (mss) in live animals, researchers showed early endothelial changes in ocular microvessels at an early stage, which were previously detectable only by the most sensitive in vitro techniques, such as immunohistochemistry or pcr. this novel method also allows evaluation of leukocyte - endothelial interaction in the retinal and choroidal capillaries flow or identification of specific molecular changes during disease. molecular imaging is defined as the ability to visualize and quantitatively measure the function of biological and cellular processes in vivo [76, 77 ]. in vivo molecular imaging has a great potential to impact medicine by detecting diseases or screening diseases in early stages, identifying extent of disease, selecting disease- and patient - specific therapeutic treatment, applying a directed or targeted therapy, and measuring molecular - specific effects of treatment. inflammation and tracing of inflammatory cells have been a key topic in molecular imaging in recent years. an ideal target for in vivo imaging of inflammation would be a molecule that is normally absent from the endothelium of healthy tissues but is induced at the onset of inflammation. according to our previous summarization, vap-1 may be suitable as an imaging target in the diagnosis and treatment of ocular inflammatory diseases. a recent paper using the technique of in vivo molecular imaging showed that vap-1 was expressed in the resting and angiogenic corneal blood vessel endothelial cells but not in lymphatic vessels. moreover, the study demonstrated a higher vap-1 expression in angiogenic than normal blood vessels, which revealed the key role of vap-1 in angiogenesis - related diseases. in the study, il-1induced m2 macrophage infiltration as well as lymph - and angiogenesis were blocked by vap-1 inhibition, whereas vegf - a - induced lymph- and angiogenesis were unaffected by vap-1 inhibition. these results indicate a critical role for vap-1 in lymph- and angiogenesis - related macrophage recruitment. to sum up, vap-1 might become a new target for the treatment of inflammatory lymph- and angiogenic diseases, including cancer. the proof of concept regarding the use of vap-1 as an imaging target was also obtained with iodinated monoclonal antibodies against vap-1. currently, vap-1 was investigated as a potential target for in vivo imaging of inflammation by means of pet. panning of phage display libraries with recombinant vap-1 has led to the identification of the first cellular counter - receptors of vap-1. these experiments showed that vap-1 binds to siglec-9 and siglec-10 proteins both in cell free protein - protein interaction assays and in different cell - based models [8083 ]. siglecs belong to a family of lectin molecules, which bind to sialic acids and mediate various adhesive and signaling events both within the immune system and elsewhere in the body. the cellular distributions of siglec-9 and -10 are very different : siglec-9 is expressed on all granulocytes, whereas siglec-10 is present mainly on b - cells. based on molecular modeling, it is plausible that both siglecs can present specific arginine residues into the enzymatic cavity of vap-1. although the side chain of arginine terminates in a complex guanidinium structure rather than in normal primary amine, the arginine 293 of siglec-10 has been experimentally demonstrated to function as a substrate of vap-1. siglec - vap-1 interaction can be utilized for the imaging of inflammation and cancer in vivo. short synthetic siglec-9 peptides (containing the vap-1 interacting core sequence) localize selectively to sites of inflammation in vivo in vap-1 expressing transgenic mice but not in vap-1 deficient mice. from the clinical point of view, a vap-1-specific imaging agent could be valuable for the detection of infection / inflammation during its early stages. as a diagnostic tool, the method could differentiate between inflammation and cancerous growth or bacterial infection from sterile inflammation. therefore, molecules responsible for the harmful traffic are theoretically excellent targets to prevent inflammations. vap-1 acts via direct interactions with its counter - receptors, and more importantly, exerts its effects via the end - products of its enzymatic activity. the inhibitors of vap-1 may be anti - inflammatory and antiangiogenic agents to decrease the inflammation in ophthalmological diseases. the end - products of vap-1 are proinflammatory, so they would be beneficial to suppress vap-1 and alleviate inflammatory reactions. in comparison to other trafficking - associated molecules, vap-1 provides pharmaceutical industry with unique targets for the design of novel molecule - targeted therapies of inflammatory diseases. the in vivo imaging of inflammation using vap-1 as a target molecule is a novel approach with a potential for early detection and characterization of inflammatory diseases and has obvious clinical significance. based on the properties and results obtained so far from preclinical and clinical studies, vap-1 may provide a novel research direction or a potent therapeutic strategy for ophthalmological diseases, including inflammatory lymph- and angiogenic diseases, including cancer. | semicarbazide - sensitive amine oxidase / vascular adhesion protein-1 (ssao / vap-1), a dual - function molecule with adhesive and enzymatic properties, is expressed on the surface of vascular endothelial cells of mammals. it also exists as a soluble form (svap-1), which is implicated in oxidative stress via its enzymatic activity and can be a prognostic biomarker. recent evidence suggests that vap-1 is an important therapeutic target for several inflammation - related ocular diseases, such as uveitis, age - related macular degeneration (amd), and diabetic retinopathy (dr), by involving in the recruitment of leukocytes at sites of inflammation. furthermore, vap-1 plays an important role in the pathogenesis of conjunctival inflammatory diseases such as pyogenic granulomas and the progression of conjunctival lymphoma. vap-1 may be an alternative therapeutic target in ocular diseases. the in vivo imaging of inflammation using vap-1 as a target molecule is a novel approach with a potential for early detection and characterization of inflammatory diseases. this paper reviews the critical roles of vap-1 in ophthalmological diseases which may provide a novel research direction or a potent therapeutic strategy. |
the principle and practice of birth preparedness and complication readiness (bp / cr) in a third world setting where there is prevailing illiteracy, inefficient infrastructure, poor transport system, and unpredictable access to skilled care provider have the potential of reducing the existing high maternal and neonatal morbidity and mortality rates. bp / cr promotes skilled care for all births and encourages decision making before the onset of labor. the bp / cr matrix raises awareness of danger signs, thereby improving problem recognition and reducing delay in deciding to seek care. it provides information on appropriate sources of care (promoters and facilities) making the care - seeking process more efficient. it also encourages households and communities to set aside money for transport and service fees, avoiding delays in reaching care caused by the search for funds. however, antenatal care in nigeria is provided along the lines of the traditional approach based on risk assessment and not on the goal - oriented interventions of focused antenatal care, which include bp / cr. the study is a needs assessment designed to determine the level of awareness, attitude and behavior of women to birth preparedness, and complication readiness. this cross - sectional, multicentric descriptive study was carried out in calabar and biase local government areas of cross river state, nigeria. it is made up of two local government areas (lgas) and 22 geopolitical wards. the total population for this area is 418,652 with majority of the workforce being in government employment or involved in small - scale business ventures. the area hosts a teaching hospital, one general hospital, several maternal and child health centers, and several private hospitals. biase local government area has an area of 1,310 km and a population of 169,183. apart from akpet central, which is the local government headquarters, the rest of the area is rural. a cross - sectional survey of 800 women, who gave birth between 1st january and 31st december 2008, attending two urban (calabar) and two rural (biase local government area) maternal and child health clinics in cross river state, nigeria, was undertaken between january and april, 2009. informed oral consent was sought and obtained from participants before inclusion in the study. after due explanation of the study and necessary clarifications of issues raised, the women were assured of confidentiality and that their names will not be published in the report. the self - administered structured questionnaires were retrieved after two weeks at each study center by field assistants. the study design fulfilled the requirements set by the ethics committee of the cross river state ministry of health. the number of questionnaires returned was 776, giving a survey response rate of 97%. data obtained were analyzed using epi info 2002 software, with logistic regression / test of association performed. information obtained included sociodemographic characteristics ; history of last confinement ; danger signs in last pregnancy ; awareness of birth preparedness and key danger signs ; intention of service use ; and knowledge of available community support systems. knowledge of key danger signs and available community support system were assessed according to the proportion of women who correctly answered the relevant questions as follows : excellent : > 80% ; good : 60% to 30% but < 60% ; very poor : < 30%. for clarity, birth preparedness and complication readiness (bp / cr) is the process of planning for normal birth and anticipating the actions needed in case of an emergency. bp / cr matrix delineates the roles (plans / actions) of policymakers, facility managers, care providers, communities, families, and women in ensuring that women and newborns receive timely appropriate and effective care. skilled care provider / attendant is a professional caregiver who has the knowledge and skills to manage labor, childbirth, and postpartum period ; recognize complications ; diagnose, manage, or refer woman or newborn to a higher level of care if complications occur that require interventions beyond current caregiver 's competence. postpartum period is defined as beginning after delivery of the placenta to 6 weeks after birth. newborn / neonatal period refers to the first 7 days of the newborn 's life. risk factor is defined as one link in a chain of associations leading to an illness or an indicator of link ; and is identifiable prior to the event it predicts. community emergency response mechanism the community is defined as having an emergency response mechanism if all of the following systems are in place : identification of pregnant women, finance, transportation, blood donation, and at least one contact person responsible for linking these systems to the women in need. table 1 the sociodemographic profile of women surveyed showed that 79.4% were aged 2039 years ; 78.9% were married ; 54.8% had secondary education ; 61.9% were para 24. the sociodemographic profile of women surveyed showed that 79.4% were aged 2039 years ; 78.9% were married ; 54.8% had secondary education ; 61.9% were para 24. tables 2 and 3the proportion of women residing in the rural area was 55.1%. hospital delivery was recorded in 48.8%. the commonest danger signs experienced were as follows : in last pregnancy, prolonged labor (22.4%) ; in the baby, stillbirth (5.2%) ; after delivery, severe vaginal bleeding (19.1%). log regression data showed that residence was a good predictor of the place of last confinement. women who resided in urban areas were more likely to deliver in the hospital than those who resided in rural areas (= 24.038 ; p < 0.0001). women who were in labor for more than 24 hours were more likely to undergo caesarean section than those who were in labor for less than 12 hours ; however, this difference was not statistically significant (= 4.5440 ; p = 0.3374). women who were in labor for more than 24 hours were more likely to notice difficult / fast breathing in their babies than those who were in labor for 12 to 24 hours ; however, this difference was not statistically significant (= 1.4217 ; p = 0.4912). the commonest danger signs experienced were as follows : in last pregnancy, prolonged labor (22.4%) ; in the baby, stillbirth (5.2%) ; after delivery, severe vaginal bleeding (19.1%). log regression data showed that residence was a good predictor of the place of last confinement. women who resided in urban areas were more likely to deliver in the hospital than those who resided in rural areas (= 24.038 ; p < 0.0001). women who were in labor for more than 24 hours were more likely to undergo caesarean section than those who were in labor for less than 12 hours ; however, this difference was not statistically significant (= 4.5440 ; p = 0.3374). women who were in labor for more than 24 hours were more likely to notice difficult / fast breathing in their babies than those who were in labor for 12 to 24 hours ; however, this difference was not statistically significant (= 1.4217 ; p = 0.4912). table 4 although awareness of the concept of birth preparedness was high (70.6%), knowledge of specific key danger signs was poor. logistic regression analysis showed that of the four variables, age, educational status, marital status, and parity, educational status was the best predictor of awareness of the concept of birth preparedness (p = 0.5477 ; 0.0029 ; 0.6455 ; 0.4433, resp.). the place of residence, urban or rural, was not a good predictor of awareness of birth preparedness (= 0.3316 ; p = 0.5646). parity was a better predictor of knowledge of severe vaginal bleeding as a key danger sign during pregnancy than educational level (p = 0.0009 and p = 0.3849, resp.). although awareness of the concept of birth preparedness was high (70.6%), knowledge of specific key danger signs was poor. logistic regression analysis showed that of the four variables, age, educational status, marital status, and parity, educational status was the best predictor of awareness of the concept of birth preparedness (p = 0.5477 ; 0.0029 ; 0.6455 ; 0.4433, resp.). the place of residence, urban or rural, was not a good predictor of awareness of birth preparedness (= 0.3316 ; p = 0.5646). parity was a better predictor of knowledge of severe vaginal bleeding as a key danger sign during pregnancy than educational level (p = 0.0009 and p = 0.3849, resp.). table 5 intention and behavior as regards plan to use maternity services during pregnancy and access skilled attendance in childbirth was generally positive (ranging from 69.5% to 83.5%). however, log regression analysis showed that educational level, marital status and parity were not good predictors of intention and behavior, especially regarding plan to attend at least four antenatal clinic (anc) visits with a skilled provider (p = 0.449 ; 0.1286 and 0.9765, resp.). those who were aware of birth preparedness were more likely to plan to identify mode of transport to the place of childbirth than those who were not aware. this difference was not statistically significant (= 0.3255 ; p = 0.5683). when planning to save money for childbirth was regressed on marital status, educational level, awareness of birth preparedness, and parity, it was observed that parity was a highly significant predictor (p = 0.0089) of planning to save money followed by awareness of birth preparedness (p = 0.0101). marital status and level of education were not good predictors of planning to save money for childbirth (p = 0.2394, 0.2013, resp.). women who planned to save money for child birth were more aware of community financial support system than those who did not plan to save money. this difference was not statistically significant (= 0.8602 ; p = 0.3536). intention and behavior as regards plan to use maternity services during pregnancy and access skilled attendance in childbirth was generally positive (ranging from 69.5% to 83.5%). however, log regression analysis showed that educational level, marital status and parity were not good predictors of intention and behavior, especially regarding plan to attend at least four antenatal clinic (anc) visits with a skilled provider (p = 0.449 ; 0.1286 and 0.9765, resp.). those who were aware of birth preparedness were more likely to plan to identify mode of transport to the place of childbirth than those who were not aware. this difference was not statistically significant (= 0.3255 ; p = 0.5683). when planning to save money for childbirth was regressed on marital status, educational level, awareness of birth preparedness, and parity, it was observed that parity was a highly significant predictor (p = 0.0089) of planning to save money followed by awareness of birth preparedness (p = 0.0101). marital status and level of education were not good predictors of planning to save money for childbirth (p = 0.2394, 0.2013, resp.). women who planned to save money for child birth were more aware of community financial support system than those who did not plan to save money. this difference was not statistically significant (= 0.8602 ; p = 0.3536). birth preparedness and complication readiness (bp / cr) is the process of planning for normal birth and anticipating the actions needed in case of an emergency. responsibility for bp / cr must be shared among all safe motherhood stakeholders policymakers, facility managers, providers, communities, families, and women because a coordinated effort is needed to reduce the delays that contribute to maternal and newborn deaths. women and newborns need timely access to skilled care during pregnancy, childbirth, and the postpartum / newborn period. delays in deciding to seek care, delays in reaching care, and delays in receiving care. these delays have many causes, including logistical and financial concerns, unsupportive policies, and gaps in services, as well as inadequate community and family awareness and knowledge about maternal and newborn health issues. this study focuses on the individual woman 's awareness of bp / cr and her intention / behavior toward eliminating delay when deciding to seek care. women who resided in urban areas were more likely to deliver in the hospital than those who resided in rural areas (p < 0.0001). provision of social amenities, including medical care, is concentrated in urban centers. according to the nigeria demographic and health survey this is a dangerous trend that needs urgent attention, if the prevailing high maternal mortality and morbidity in the country is to be reversed. none of the women who delivered outside the hospital, in this study, received skilled attention. as seen in this study, women experienced emergency situations in the last pregnancy from reported danger signs that needed skilled intervention, such as prolonged labor, stillbirths, and severe vaginal bleeding after delivery. maternal mortality resulting from the reported danger signs is beyond the scope of this study. women who were in labor for more than 24 hours were more likely to undergo caesarean section than those who were in labor for less than 12 hours. also, women who were in labor for more than 24 hours were more likely to notice difficult / fast breathing in their babies than those who were in labor for 12 to 24 hours. these were situations needing skilled attendance, so as to reduce morbidity and mortality in mother and baby. distance was an issue in seeking skilled attention, with up to half of the women having to travel up to 2 km or more to reach the nearest hospital. in a nigerian study, 41% of the mothers who did not deliver in hospital explained that they could not afford the hospital bill, and 31% said they had transportation challenges. we have shown in a previous study that this is a dangerous means of transportation for pregnant women, because the risk of serious morbidity following an accident is high. a study from nepal showed that a distance of more than one hour to the maternity hospital was statistically associated with an increased risk of home delivery. this is because the goal - oriented interventions of focused antenatal care, which include bp / cr, are yet to be implemented in the cross river state maternity services. pregnant women are cared for on the basis of risk assessment in the traditional approach to antenatal care. they are not usually counseled on the importance of recognizing danger signs, saving money for childbirth, and identifying a means of transport before delivery, among other issues of bp / cr matrix. that is why there is a disparity between awareness of the concept of birth preparedness and knowledge of specific danger signs in pregnancy, labor, and after childbirth. logistic regression analysis showed that educational status was the best predictor of awareness of the concept of birth preparedness. however, there was no association between awareness of birth preparedness and place of residence. contrary to expectation, place of residence (urban or rural) was not a good predictor of awareness of birth preparedness. this is because educational status was the best predictor of awareness of birth preparedness, and the more educated women usually reside in the urban areas. parity was a better predictor of knowledge of severe vaginal bleeding as a key danger sign during pregnancy than educational level. this can be explained by the fact that severe vaginal bleeding was a reported danger sign by women in the last pregnancy, and this experience was related more to parity than educational status. in order for awareness of bp / cr to result in improved access to skilled attendance the type of action plan undertaken by women in preparation for childbirth will depend on right intention and appropriate behavior. although this study showed that intention and plan to use maternity services were positive ; educational level, marital status and parity were not good predictors of intention and behavior, especially regarding plan to attend at least four anc visits with a skilled provider. this is an unfortunate finding as studies have shown that women who attend anc are more likely to deliver in hospital. also, about 20% of women in this study experienced emergency situations in the last confinement that needed skilled intervention. however, none of the demographic variables analyzed was associated with a significant intention to seek skilled attendance in future pregnancies. awareness of birth preparedness was associated with a plan to identify a mode of transport to the place of childbirth before onset of labor. transportation is a challenge in nigeria, especially to pregnant women [10, 11 ]. road networks are poor in many urban areas and virtually nonexistent in rural areas. in addition, the transport system is inefficient and not always available when needed. that is why the establishment of a community support system with regard to transportation is a desirable measure to assist pregnant women, especially when an emergency arises. financial constraint in nigeria is a major obstacle to accessing skilled attendance in pregnancy [10, 14 ]. it is therefore appropriate for pregnant women to save money for childbirth and to be able to access emergency funds when needed. parity was a highly significant predictor of planning to save money followed by awareness of birth preparedness. this finding may be related to past experience of danger signs in pregnancy and childbirth. also, intention to save money was associated with knowledge of community financial support system. the existence of community - level systems to provide emergency funds, transport, and blood donors, is vital in promoting maternal and newborn survival. community leadership therefore has an important role to play in removing barriers in deciding to seek care and improving access to a skilled care provider / attendant for women and their newborn babies. an emergency response system must be put in place and made known to the public. if women living in a community are ignorant of the existence of these emergency response systems, then they are unlikely to use and benefit from them. also a system of identifying pregnant women through community - based health promoters will ensure that support / help is given when needed. although awareness of the concept of birth preparedness was high, recognition of key danger signs in pregnancy was poor. educational level, marital status, and parity were not good predictors of intention to attend at least four anc visits with a skilled provider. the knowledge of available community support systems was very poor. based on these findings, it is recommended that birth preparedness and complication readiness should be made an integral part of maternal and child health services in the state, to enable women to recognize danger signs and access a skilled caregiver in pregnancy ; an emergency response system at the community level to provide emergency funds, transport, and blood donors must be put in place and made known to the public. it is believed that with the removal of delays in decision to seek care and timely access to skilled attendance, the prevailing high maternal / infant morbidity and mortality in nigeria can be reduced to acceptable limits. | the aims of this study are to assess the awareness and intention to use maternity services. this was a multicentric study involving 800 women. educational status was the best predictor of awareness of birth preparedness (p = 0.0029), but not a good predictor of intention to attend four antenatal clinic sessions (p = 0.449). parity was a better predictor of knowledge of severe vaginal bleeding as a key danger sign during pregnancy than educational level (p = 0.0009 and p = 0.3849, resp.). plan to identify a means of transport to the place of childbirth was related to greater awareness of birth preparedness (2 = 0.3255 ; p = 0.5683). parity was a highly significant predictor (p = 0.0089) of planning to save money. planning to save money for childbirth was associated with greater awareness of community financial support system (2 = 0.8602 ; p = 0.3536). access to skilled birth attendance should be promoted. |
plasmablastic lymphoma (pbl) is an uncommon malignancy, described almost exclusively as an aids - related lymphoma. the recent who classification of lymphoid neoplasms addresses pbl under a separate entity, a neoplasm that shows diffuse proliferation of large neoplastic cells, most of which resemble b - immunoblasts and have immunophenotype of plasma cells. pbl was originally described as a rare variant of diffuse large b - cell lymphoma (dlbcl) involving the oral cavity and occurring in the clinical setting of human immunodeficiency virus (hiv) and latent epstein - barr virus (ebv) infection. till date, only 2 cases of pbl of the testis in hiv - positive individuals have been documented in literature. we herein add a third case of primary bilateral pbl of the testis presenting as aids - related malignancy. a 44-year - old border security forces personnel, presented with a history of a progressive painful bilateral scrotal swelling of 1-year duration. he had high - grade intermittent fever associated with weakness, loss of weight, and appetite. on examination, he had pallor. general physical examination was unremarkable, with no palpable lymphadenopathy or hepatosplenomegaly except for visible bilateral testicular enlargement [figure 1a ]. he was diagnosed as hiv + by elisa method. in the initial appearance of testicular ultrasound of the scrotum showed bilaterally enlarged testes of heterogenous echotexture and bilateral hydrocoele with enhancement on computerized tomography (ct) scan [figure 1b ]. fine - needle aspiration cytology of both the testes was done and cytological smears showed atypical large lymphoid cells showing plasmacytoid and immunoblastic differentiation, having basophilic cell cytoplasm, eccentric nuclei with 12 prominent nucleoli [figure 2a ]. the possibility of large cell non - hodgkin 's lymphoma (nhl) with plasmablastic differentiation was suggested. radiological evaluation with ct scan of chest and abdomen further evaluation, that is, bone marrow biopsy was done to exclude plasma cell dyscrasias, which was normal with no marrow infiltration. serum and urine protein electrophoresis were normal. based on progressive symptoms and increased size of the lesion, the patient underwent bilateral orchiectomy. grossly the testes weighed 220 g and measured 8 cm 5 cm 3 cm and 6 cm 4 cm 2 cm with a large, white, fleshy, soft, slightly tan mass replacing almost the entire cut surface with no evident necrosis or hemorrhage [figure 1c ]. microscopic examination showed diffuse sheets of highly atypical cells having large round nuclei, coarse chromatin, and 1 or 2 prominent nucleoli [figure 2b ]. on immunohistochemistry, (ihc) tumor cells showed positivity for cd38 [figure 2c ], cd138 [figure 2d ], vimentin, and epithelial membrane antigen. immunostains for cd45, cd20, alk, plap, cytokeratin, and ebv were negative. the patient was diagnosed as having an extramedullary plasmablastic tumor most consistent with plasmablastic nhl. the patient was planned for chemotherapy, but because of his deteriorating functional status and low cd4 + counts, he died 1 month after diagnosis. (a) bilateral testicular enlargement (b) computed tomography scan showing bilateral enlarged testes of heterogenous echotexture (c) gross appearance of tumor, large grey white fleshy mass (a) cytological smear showing atypical lymphoid cells with plasmablastic differentiation (mgg, 400) (b) microphotograph showing diffuse sheets of highly atypical cells having large round nuclei, coarse chromatin, and 1 or 2 prominent nucleoli (h and e, 400) (c) tumor cells showing immunopositivity for cd38 and (d) cd138 (ihc, 400) plasmablastic lymphoma, originally described in 1997 by delecluse., is an aggressive variant of diffuse large b - cell nhl seen predominantly in a setting of aids and nearly always in extranodal sites. risk factors for the development of nhl in hiv include a low cd4 + t - cell count, high viral load, increased age, and male gender. pbl usually develops in middle - aged adults, with the age at onset in one large series varying from 35 to 55 years. it is characterized by immunoblastic morphology and plasma cell phenotype. in other words, plasmablasts are lymphoid cells that morphologically resemble b - cell immunoblasts but have acquired a plasma cell immunophenotype (i.e., loss of b - cell markers and surface immunoglobulin with the acquisition of plasma cell surface markers). main differential diagnoses include the plasmablastic variant of multiple myeloma and dlbcl with plasmacytic differentiation. absence of monoclonal serum protein with no radiological evidence of lytic bony lesions favours the diagnosis of pbl. however, both of these markers are generally negative to weakly positive in pbl. other morphological differential diagnoses which can be ruled out on the basis of ihc include burkitt 's lymphoma, lymphoblastic lymphoma, poorly differentiated carcinoma, and melanoma. to the best of our knowledge, only two cases of pbl of testis in hiv positive individuals have been documented in literature. our patient was diagnosed to be hiv infected before his diagnosis of lymphoma and his cd4 + count was 103/mm at the time of presentation. the unique features of our case were its bilateral testicular involvement without any appreciable lymphadenopathy. in the setting of hiv infection, these lymphomas tend to occur at a younger age, with higher histologic grade and apparent worse prognosis. they tend to occur at a younger age and are associated with immunosuppression and low cd4 + count. | human immunodeficiency virus (hiv)-related lymphomas are predominantly aggressive b - cells lymphomas. the most prevalent of the hiv - related lymphomas are diffuse large b - cell non - hodgkin 's lymphoma (nhl), which includes primary central nervous system lymphoma, and burkitt lymphoma, whereas primary effusion lymphoma, plasmablastic lymphoma (pbl), and classic hodgkin lymphoma are far less frequent. of these, pbl is relatively uncommon and displays a distinct predilection for presentation in the oral cavity. in this manuscript, we report a primary testicular form of pbl in 44 year - old border security hiv positive patient who presented with bilateral testicular swelling of 1-year duration. on cytopathological and subsequent histopathological examination, the diagnosis of bilateral plasmablastic nhl was made. extensive systemic work - up failed to reveal any disease outside the testes. immune suppression rather than hiv itself is implicated in the pathogenesis of lymphomas. herein, we report a case of pbl as aids - related malignancy presenting in testes and its correlation with cd4 + count. |
in teleosts, the sex differentiation pattern may be classified as synchronous hermaphroditism (protandrous and protogynous) or gonochorism (undifferentiated and differrentiated) (yamamoto, 1969). both genetic and environmental factors can significantly impact the sex determination of fish (devlin & nagahama, 2002). the physicochemical factors relevant to the sex determination of fish include the water temperature, salinity, and ph (baroiller., 1999), while the related chemical factors include polychorinated biphenyls (psbs), nonylphenol, bisphenol, and dioxin by endocrine disruptor (gray & metcalf, 1997). to improve the economics of aquaculture, these parameters may be used to render fish populations artificially mono - sexual (e.g., by adjusting the water temperature, controlling the ph, or applying hormone treatments). the korean rose bitterling, rhodeus uyekii, is an indigenous species in korea. falling within the cypriniformes, cyprinidae, and rhodeus, these fish live on the muddy floor at the edges of reservoirs, plant - filled and/or slow - moving streams, and ponds. they are distributed in the watershed of the nakdong river and other streams in the southern part of korea (jeon, 1982). the korean rose bitterling breeds between the end of april and mid - june, and shows special features in breeding in the fresh water bivalves of the family unionidae by extending the ovipositor in the female (uchida, 1939 ; nakamura, 1969). seen from the side, the body of the korean rose bitterling is relatively compressed from nose to tail and relatively tall from the caudal to dorsal aspect, with the male generally being taller than the female. in color, the body is light brown on the back, darker on the front back of the dorsal fin and the caudal peduncle, and reddish white silver on the flank. the male is black on the outside of its rear fin and exhibits a small white spot inside. given its excellent visual effect, the male is far preferred over the female as an aquarium fish, besides the taxonomic group with urgent preservation due to easy exposure to the recent biological and environmental pollution (kang., researchers have studied : the early life history of laboratory - reared fish ; egg and larval development ; the seasonal sex ratio in the field ; the reproductive cycle of the spring - spawning bitterling ; osteology ; elongation of the ovipositor ; the temperaturedependent index of the mitotic interval (0) for chromosome manipulation ; morphometric traits ; cytogenetics of induced crosses and reciprocal hybrids between korean rose bitterling and r. notatus ; and the use of lidocaine hydrochloride and clove oil as an anesthetic (for both korean rose bitterling and oily bitterling, acheilognathus koreensis) (kim & han, 1990 ; park & kim, 1990 ; an, 1995 ; kim, 1997 ; chae, 2001 ; kim., 2011, 2012). studies have also examined trends in the early development of the gonad and the potential for sex change, but the process of sex differentiation in the korean rose bitterling is not yet fully understood. here, we investigated the sex differentiation and gonadal development of the korean rose bitterling, and their dependence on the initial growth and integral water temperature at the constant breeding water temperature for the hatching fry through the artificial insemination as a part of production of the monosexual population and the seed production of the korean rose bitterling. brood stock of the korean rose bitterling, rhodeus uyekii, were obtained from the inland aquaculture research center, national institute of fisheries science (nifs ; changwon, korea) and housed in a mariculture facility at the fishery genetics and breeding sciences laboratory of the korea maritime and ocean university in busan, korea. the fish were maintained in a glass tank (w 120 cm l 30 cm h 50 cm) at a water temperature of 201c until the experiments were initiated. during the 2013 spawning season (late april to midjune), densely colored males and ovipositor - extended females were selected and used as brood stock. eggs were harvested by abdominal compression of ovipositor - extended females, semen was harvested by abdominal compression of males and inseminated within 2 minutes. plastic tanks (w 30 cm l 20 cm h 15 cm ; fresh plus, mirae chemical, korea) were loaded with 200 eggs each and maintained at a water depth of 10 cm and a l : d ratio of 13:11 until hatching. the water was replaced twice daily with aerated bottled water (natural mineral water, pulmuone, korea), and the water temperature was maintained at 220.5 oc. hatched larvae were divided into groups of 10 and distributed to transparent plastic containers (w 10 cm l 5 cm h 3 cm ; coolrara, easyfilm, korea). the larvae began to feed once the yolk was completely absorbed, at 21 days post - hatching (dph). the hatchlings (n = 20) were sampled daily from hatching to 5 dph, at 2-day intervals from 7 to 21 dph, at 4-day intervals from 25 to 41 dph, at 6-day intervals from 47 to 83 dph, and at 30-day intervals from 110 to 170 dph. the fish were sampled at different stages and anesthetized with 300 ppm lidocaine - hcl / nahco3 at 25c according to method of kang. body weight (bw) was measured to the nearest 0.01 g using an electric balance (ax 200, shimadzu corp., japan), the total length (tl) was measured to the nearest 0.01 cm using a vernier caliper (cd-20 cp, mitutoyo, japan), and growth was estimated using an exponential growth curve and the calculation of a condition factor. a mimetic diagram was produced according to the growth for indicate morphological changes. each sample of whole fish was fixed in bouin s solution for 24 h, washed thoroughly with water, exposed to decalcification solution for 24 h, washed again, and dehydrated through a graded alcohol series (70%, 80%, 90%, and 100% ethanol 1 h each). the samples were then cleared with xylene, impregnated with soft paraffin, impregnated with hard paraffin, embedded, trimmed, and cut (6 m). eosin, mounted with canadian balsam, and examined / photographed under optical microscopy (axiocam mr, carl zeiss, germany). the korean rose bitterling, rhodeus uyekii, hatched at two days post - fertilization with a post - fertilization integral water temperature (iwt) of 43c. fig. 1, fig. 2, and 3 present the changes in total length (tl), body weight (bw), condition factor, and morphology from just - hatched (iwt post - hatching 0c) to 170 days post - hatching (dph ; iwt post - hatching 3,740c). at hatching, the average tl and bw were 6.10.09 (sd) mm and 4.90.07 mg, respectively, while at 83 dph, these values were 18.90.28 mm and 48.20.72 mg, respectively (fig. 1 and fig. 3). tl increased continuously from hatching to 83 dph, and could be represented by the growth equation : tl=4.914e (r = 0.961 ; t, time) (fig. 1, upper panel). bw showed a slight reduction between hatching and the completion of yolk absorption (21 dph, see below), but increased rapidly once the hatchling began to feed ; it could be represented by the growth equation : bw=2.200e (r=0.725) (fig. the condition factor decreased from just - hatching to 21 dph, but remained steady thereafter (fig. yolk absorption was complete at 21 dph (9.20.14 mm tl, 4.80.07 mg bw ; 462c iwt post hat ching) (fig. abbreviations : tl, total length ; bw, body weight ; and t, time. condition factor = (a / b)1,000 where a is bw and b is tl. bars = 3 mm. a : at 17 dph, 374c iwt ; inset shows a high - power view of a primordial germ cell (pgc ; inset bar = 10 m). abbreviations : ab, air bladder ; cc, condensed chromatin ; ec, endoovarian canal ; g, gut ; gr, genital ridge ; m, mesentery ; mf, me - iotic figure ; mp, meiotic prophase ; mpgc, mitotic primordial germ cell ; pgc, primordial germ cell ; sc, somatic cell ; sd, sperm duct ; sg, spermatogonia ; and y, yolk. bars = 20 m. at 17 dph (7.90.12 mm tl, 3.70.06 mg bw, 374c iwt) (fig. 2-g) when the first feeding commenced following complete absorption of the yolk, gonads became apparent on both sides, running beneath the air bladder mesentery to the genital ridge in the abdominal cavity (fig. the primordial germ cells (pgcs) were oval, approximately 7.2 m in diameter, and enclosed by loose connective tissue. their cytoplasm was weakly stained by hematoxylin, and they contained round nuclei of 2 m in diameter (fig. 3a insert). by 19 dph (8.20.12 mm tl, 3.60.05 mg bw, 418c iwt) (fig. 2-h) the number of pgcs was increased and numerous mitotic pgcs and condensed chromatin were apparent (fig. 3b). at 21 dph (fig. 2-i : 9.20.14 mm tl, 4.80.07 mg bw, 462c iwt), some of the pgcs contained condensed chromatin ; oocytes were observed in meiotic prophase ; and the pgcs and oocytes were enclosed by somatic cells (fig. 2-k : 11.20.17 mm tl, 10.5 0.16 mg bw, 726c iwt), numerous oocytes were observed in meiotic prophase, meiotic figures were present, and the oocytes were in the chromatin - nucleolus stage, with blood vessels and endo - ovarian canals beginning to fill the ovary (fig. 13.60.20 mg bw, 1,166c iwt), the oocytes were in the perinucleolus stage and had increased to 50 m in diameter (fig. perinucleolus - stage oocytes increased in number and size to 83 dph. from 110 to 170 dph, abbrevia - tions : ec, endoovarian canal ; pno, oocyte in the perinucleolus stage ; sc, somatic cell ; sg, spermatogonia ; smc, spermatocyte. bars : in a and b = 30 m ; in c = 500 m ; and in d = 20 m. the korean rose bitterling appeared to begin its sex differentiation when yolk absorption was completed and the first feeding began (21 dph). at 25 dph (fig. 2-j : 10.10.15 mm tl, 5.40.08 mg bw, 550c iwt), spermatogonia could be distinguished from pgcs (fig. 3d). at 33 dph (fig. 2-k : 11.20.17 mm tl, 10.50.16 mg bw, 726c iwt), the spermatogonia had increased in number (fig. no significant development of the testes was seen up to 83 dph (18.9 mm tl, 48.2 mg bw, 1,826c iwt). spermatocytes and sperm cells were first observed at 140 dph (31.2 mm tl, 265.8 mg bw, 3,080c iwt) and continued to mature through 170 dph (fig. these observations indicate that the korean rose bitterling belongs to the differentiated type of gonochoristic teleosts (fig. the present study shows that although the tl of the korean rose bitterling, rhodeus uyekii, increased continuously post - hatching, the bw decreased somewhat until yolk absorption was complete and feeding began (at 21 dph). this likely reflects the dependence of the metabolism on energy from the yolk rather than the intake of exogenous food. the sex differentiation of teleostei varies and can show irregular features, and many gonochoric fishes, including some hermaphroditic fishes, easily change sex (devlin & nagahama, 2002). in aquaculture, this has been used to produce monosexual populations with improved economics. thus, we need to fundamentally understand the sex differentiation and sex change of fishes (park., 2004). here, the sex differentiation of the korean rose bitterling was analyzed with respect to tl and bw at various dph. result of gonadogenesis and sex differentiation in european eel, anguilla anguilla and bagrid catfish, pseudobagrus fulvidraco. these results relatively correct better than pre - vious studies based on simply dph (colombo & grandi, 1996 ; park., 2004). moreover, as include the integral water temperature for check factor in this study, it will be more correctly standard than previous studies. those of the tilapia, tilapia zillii, appear at hatching ; those of the rainbow trout, salmo gairdneri, are first seen at 36 dph under the mesonephric duct ; those of the ussurian bullhead, leiocassis ussuriensis, and black bullhead, p. koreanus, appear at 1 dph ; those of the ko - rean bullhead appear at 3 dph ; and those of the chinese minnow, moroco oxycephalus, appear at 8 dph under the air bladder mesentery (yoshikawa & oguri, 1978 ; takashima., 1980 ; park., 1998, 2001, 2004, 2008). the present study shows that the pgcs of the korean rose bitterling first appear at 17 dph under the air bladder mesentery, and formation genital ridge thus confirmed early gonad. undifferentiated gonads of fish during gonadal differentiation in the ovary or testis differentiation into different duct can be determined by forming patterns. ovarian differentiation in the korean rose bitterling began at 21 dph (9.20.14 mm tl, 4.80.07 mg bw, 462c iwt), as indicated by the appearance of meiotic prophase oocytes. the timing of sex differentiation differs by species, beginning at 40 dph (326c iwt) in the cherry salmon, oncorhynchus masou, but at (270c iwt) in the coho salmon, o. kisutch (pifferrer & donaldson, 1989 ; park., however, there seems to be some consistency in that the sex differentiation of various fish species begins at the time the yolk sac is completely absorbed and the first feeding occurs, such as in the rainbow trout, the cherry salmon (40 dph) (park., 1997 ; van den hurk & solf, 1981), and the korean rose bitterling (21 dph ; this work). the sex differentiation of teleosts can be grouped at the level of species or family, with the process occurring at 10 ~40 dph in cichlids, 10~30 dph in cyprinodontids, and 3~40 dph in anabantids (yamazaki, 1976 ; shelton & jensen, 1979 ; pandian & sheela, 1995). the sex differentiation of the ussurian bullhead occurs at 15~20 dph and that of the korean bullhead occurs in a similar range of 12 - 20 dph, while those of the mandarin fish, siniperca scherzeri, and cherry salmon begin somewhat later, at 40 dph (park., 1997, 2001, 2004). the present study shows that the sex differentiation of the korean rose bitterling occurs at 21~25 dph, with ovaries first seen at 21 dph and testes observed at 25 dph. in some fishes, such as the ocean perch, diterma temmincki, testicular differentiation is seen first ; however, most fish show initial differentiation of the ovary (takashima., 1980 ; lee & lee, 1996 ; park., 2004), as observed here for the korean rose bitterling. the entovarian sac forms at the center of the ovarian cavity, while the parovarian sac forms on the edge of ovary (lee & lee, 1996). the sweet fish, plecoglossus altivelis, and the threespine stickleback, gasterosteus aculeatus, reportedly form parovarian sacs (bang., 2000), while the white spotted char, salvelinus leucomaenis, the rainbow trout, and the ussurian bullhead reportedly form entovarian sacs. the present study shows that the korean rose bitterling forms its sacs in the middle of the ovary pattern, indicating that this species forms entovarian sacs (takashima., 1980 ; park., 2001 the observation that the korean rose bitterling began ovarian differentiation at 21 dph and testicular differentiation at 25 dph indicates that this species exhibits gonochorism. in this, the korean rose bitterling resembles the rainbow trout, the chum salmon, o. keta, the medaka, oryzias latipes, the ussurian bullhead, the chinese minnow, and the ocean perch (robertson, 1953 ; tuzuki., 1966 ; yoshikawa & oguri, 1978 ; takashima., 1980 ; lee & lee, 1996 ; park., 1998, 2001). the korean rose bitterling is endemic species to korea and the importance in the resources enforcement has been emerged (jeon, 1982). therefore, it is important that we understand the timing of sex differentiation timing and the sex ratio in this species. future studies should focus on tracking the differentiation and development of the gonad in the korean rose bitterling to see how the sex ratio and timing of sex differentiation can be altered by artificial factors (e.g., hormones and environmental factors). the results of the present study could be utilized as fundamental data for the resources proliferation and the ecological changes in this species. | abstractthis report describes the sex differentiation of the korean rose bitterling, rhodeus uyekii, from hatching to 170 days post - hatch (dph) in relation to total length (tl), body weight (bw), and integral water temperature (iwt). the growth curve of tl from just hatching to 83 dph was 5.144e0.045 t (r = 0.961 ; t, time), and that of bw was 2.398e0.086 t (r = 0.725). primordial germ cells (pgcs) were observed at 17 dph (7.9 mm tl, 3.74 mg bw, 374c iwt), and thereafter began to protrude into the peritoneal cavity. at 21 dph (9.20.14 mm tl, 4.80.07 mg bw, 462c iwt), some pgcs contained condensed chromatin and oocyte were observed in meiotic prophase. in contrast to the ovaries, which grew gradually after sexual differentiation, testes began multiplying at 25 dph (10.1 mm tl, 5.42 mg bw, 550c iwt), when testicular differentiation was first identified, and multiplied continuously thereafter. at 33 dph (11.2 mm tl, 10.5 mg bw, 726c iwt), the developing testes contained spermatogonia that exhibited mitotic activity. no spermatocyte or sperm cell was observed until 83 dph (18.9 tl, 48.2 mg bw, 1,826c iwt). at 170 dph (32.5 mm tl, 270.1 mg bw, 3,740c iwt), which was the end point of this study, the mature ovaries showed germinal vesicle breakdown, while the mature testes contained observable spermatocytes and sperm cells. these results allow us to identify the sex differentiation type of the korean rose bitterling as differentiated gonochoristic. |
the erinyes were three netherworld goddesses depicted as ugly, winged women with hair, arms, and waists entwined with poisonous serpents and personified the tormenting madness inflicted upon a patricide or matricide. they could make people suffer, and a nation harbouring such people could experience dearth, and with it hunger and disease. on the contrary, the charites, also commonly known as the graces, were three goddesses daughters of zeus and named aglaia, thalia, and euphrosyne. they were often associated with grace, beauty, adornment, mirth, festivity, dance, and songs of revel. the endotoxins of gram - negative bacteria are lipopolysaccharides (lpss), which are vital to both the structural and functional integrity of the bacterial outer membrane [2, 3 ]. in the first reports on endotoxin by pfeiffer (1892) and centanni (1894), lewis thomas reported the reaction of higher animals (including humans) to endotoxins as a uncontrolled and auto - destructive behaviour of the host, leading to the consideration of endotoxin as a venom. there is nothing intrinsically poisonous about endotoxin, but it must look awful, or feel awful, when sensed by cells some of such beneficial activities have been published a few years after endotoxin discovery, including the inhibitory effects on human sarcoma studied (since late 1890s) by william bradley coley, who used killed serratia marcescens, and the successful therapy of lethal tertiary syphilis reported by the 1927 nobel laureate julius wagner von jauregg, who used different types of microbial suspensions. the purpose of this paper is to focus on recent data supporting beneficial activities of both typical and atypical endotoxins. the lipid a, the core oligosaccharide, and the o - antigen polysaccharide chain are the three domains usually found in an lps molecule. the innermost, hydrophobic region, lipid a, is responsible for the major toxic and beneficial properties of bacterial endotoxins. lipid a is the least variable part of the molecule among the different species of a genus, and its structure generally consists of a diglucosamine backbone substituted with varying numbers (usually four to seven) of ester- or amide - linked fatty acids. phosphate and/or other substituents are linked to carbons at the c-1 and c-4 positions of the glucosamine disaccharide (figure 1). a 2-keto-3-deoxyoctonate (kdo) unit links the lipid a to a core oligosaccharide (os) composed of about 10 sugar residues. the core is linked to a third outermost region of a highly immunogenic and variable o - chain polysaccharide (ps) or o - antigen made up of repeating os units. the latter region of the lps molecule is responsible for bacterial serological strain specificity and is present only in smooth - type bacteria. the core region of enterobacterial lps includes an outer portion, distal from lipid a (proximal to the o - polysaccharide chain), and an inner portion directly linked to the lipid a. the complete outer core region (ra - structure) mainly consists of hexoses and hexosamines, whereas inner core region is composed of kdo and heptose. the so - called rough - type bacteria produce lpss lacking o - antigens [2, 3 ]. a successive truncation of ra - structure lpss associated with specific alterations of core oligosaccharide biosynthesis in different salmonella strains (r - mutants) results, respectively, in the rb, rc, rd, and re core structures. the last structure, which contains only lipid a and kdo residues, is a minimal lps structure. the lipooligosaccharides (loss) the structural organization of los allows us to assign them to the group of intermediate molecules between typical r- and s - lps structures. the lipooligosaccharides (loss) contain a recognizable, well - conserved inner core (including kdo and heptose residues) from which extend one or two / three mono- or oligosaccharide branches (such as -, -, and -chains in neisseria loss), that exhibits serological specificity. in classical lpss, the core provides an acceptor for o - polysaccharide, on the contrary in loss (distinct from r - lps) the core is destined to terminate without o polysaccharide addition [2, 3 ]. loss are identified in such gram - negative bacteria as bordetella pertussis, neisseria meningitidis, neisseria gonorrhoeae, haemophilus influenzae, haemophilus ducreyi, burkholderia (pseudomonas) multivorans, burkholderia (pseudomonas) cenocepacia, alteromonas addita kmm 3600 t, and campylobacter jejuni [2, 3 ]. atypical lpss reportedly exhibit a lipid a chemistry which is different from archetypal structure found in escherichia coli and salmonella. atypical lipids a from different bacteria have the same general structure, but differ in the head - group substituents (e.g., phosphate groups) and in the number, distribution, and composition of fatty acids [2, 3 ]. in addition to the presence of fatty acids with hydrocarbon chain longer than 14 carbon atoms, the charge of lipids a from helicobacter pylori, porphyromonas gingivalis, francisella tularensis was lower than the charge of lipids a from e. coli and compound 506, which could also affect the binding. the low affinity of lps binding with lbp and/or scd14 is likely to influence the rate of endotoxin delivery to membranes of target cells and as a result to decrease the effectiveness of lps signalization. matera. reported that bartonella quintana lps exhibited a migration pattern of the deep rough chemotype. bartonella henselae has been found to exhibit a deeply atypical lps with an approximate molecular weight of 5000 and with a lipid a containing an acyloxyacyl residue 16:0[3-o(28:0(27-oh)) ]. therefore, lps of bartonella henselae has a deep - rough structure without an o - chain polysaccharide and contains an unusual penta - acylated lipid a with a long - chain fatty acid. the absence of o - side chain could conceivably decrease complement fixation and provide a degree of serum resistance on bartonella, but this possibility has not been explored. the unusual fatty acid composition renders bartonella henselae endotoxin at least 1000-fold less potent at toll - like receptor (tlr)4 activation (as measured by il-8 production), as compared with lpss from salmonella [3, 6 ]. lps also serves as one of the primary targets of the innate arm of the mammalian immune system, whose toll - like receptors (tlrs) are the primary pathogen recognition receptors (prr). a wealth of publications indicated tlr4 and tlr2 as the receptors involved in the recognition of most of the lps studied [2, 3, 6, 7 ]. lpss are known as endotoxins, which cause the prominent pathophysiological symptoms associated with sepsis and septic shock, that is, fever, leukopenia, hypotension, disseminated intravascular coagulation, and multiple organ failure [2, 3 ]. the well - known typical lps from enteric bacteria, such as escherichia coli and salmonella enterica, are highly potent molecules with regard to their biological, that is, endotoxic activities. naturally occurring (often typical) lpss modulate the immune system of higher vertebrates in order to keep pathogens away and to avoid the possibility of saprophytes / commensals to become invaders (translocation) ; moreover, it has been demonstrated that the immune system is dependent on certain microbial products including lpss for normal development. epidemiology studies in young children have found that lps exposure at home is inversely correlated with the development of atopic diseases, following the hygiene hypothesis for allergic disorders. the growing prevalence of broadly diffused chronic, inflammatory, and degenerative diseases in the industrialized world (allergic illnesses, diabetes and other metabolic disorders, inflammatory bowel diseases and, within the central nervous system (cns), demyelinizing inflammatory pathologies, as well as stroke) might ask for a broadening of such hygiene hypothesis, which should also include the above reported chronic / inflammatory diseases. in an asthma model, nonobese diabetic (nod) mice were immunized intraperitoneally on day 0 with ovalbumin (ova) in presence of alum, challenged one week later with 3 consecutive ova aerosol administrations and analyzed 24 hrs after the last challenge. following this protocol, mice presented allergic inflammation and abnormal lung function. allergic inflammation resulted in an increase of cell recruitment including eosinophils in the balf, and of cytokine and chemokine production, il-4, and eotaxin, respectively, in the lung. mice treated with tlr agonists, particularly lps, showed a decreased eosinophilia and il-4 and eotaxin production as compared to control mice. in a nod mice experimental model, the effect of tlr ligands, including lpss, on development of spontaneous diabetes was evaluated. in nod protected (lps - treated) animals, the histological analysis of the pancreas showed a reduction in destructive islet infiltration (i.e., invasive insulitis). this form of insulitis is associated with active destruction of insulin - secreting -cells ; this is the point in time, where the first mice showing overt hyperglycemia can be seen. it appears that in the case of lps treatment a control of insulitis progression and hyperglycemia can be observed [11, 12 ]. to address the intricate relationship between gut microbiota and host cells, colitis was induced in c57bl/6j mice with dextran sodium sulfate (dss) or by transferring cd45rb(hi) t cells into rag1 mice. the effect of anti - tlr4 antibodies (ab) on the inflammatory infiltrate was determined by cell isolation and immunohistochemistry. mucosal expression of inflammatory mediators was analyzed by real - time pcr and elisa. blocking tlr4 at the beginning of dss administration anti - tlr4 ab treatment decreased macrophage and dendritic cell infiltrate and reduced mucosal expression of ccl2, ccl20, tnf - alpha, and il-6. anti - tlr4 ab treatment during recovery from dss colitis resulted in defective mucosal healing with lower expression of cox-2, pge(2), and amphiregulin. in contrast, tlr4 blockade had minimal efficacy in ameliorating inflammation in the adoptive transfer model of chronic colitis. therefore, anti - tlr4 therapy may decrease inflammation in ibd but may also interfere with colonic mucosal healing. deficient tlr signaling may cause an imbalance in commensal - dependent homeostasis, facilitating injury and leading to inflammatory bowel disease. accordingly, systemic administration of a tlr4-blocking antibody impairs restoration of tissue integrity during dss - colitis, despite limiting exaggeration of acute inflammatory responses induced by recruited cells. several recent studies suggest that tlr signaling exerts many important cytoprotective functions in the intestinal epithelium (and adjacent cell subsets), which are required for barrier preservation, cell survival and stability, and restitution, including, for example, inhibition of apoptosis, migration, and proliferation [13, 14 ]. animals exposed to lps as neonates displayed induction of il-10 within the cns, and there was a robust inverse correlation between experimental autoimmune encephalomyelitis severity and the frequency of cns - infiltrating foxp3 t lymphocytes. these observations were supported by reduced foxp3 expression in brain tissue from multiple sclerosis (ms) patients compared with non - ms patients. a small dose of lps given systemically confers ischemic protection in the brain, a process that appears to involve activation of an inflammatory response before ischemia. lps preconditioning in the brain shares some hallmarks that are characteristics of ischemic preconditioning in other organs. interestingly, it has been reported that pretreatment of animals with lps increases myocardial functional recovery in ischemia / reperfusion heart injury model. such lps - induced beneficial effect has been shown to be mediated through inhibition of nf-b via increase of hsp70. these include delayed induction of tolerance after preconditioning and dependence on de novo protein synthesis. the systemic route of lps administration and the induction of some systemic changes are unique aspects of lps preconditioning that might offer some clinical advantages [1416 ]. also, the very recent paper by mouihate., underlined that early postnatal lps exposure remodulates neuroimmune axis allowing enhanced activation of a novel prostaglandin - mediated activation of the hypothalamic - pituitary - adrenal (hpa) axis brought about by increased constitutive expression of tlr4 and cox2. reprogramming the neuroimmune axis during infancy might be beneficial in the rest of animal and human life. such lps - driven tight regulation of overwhelming or inappropriate immune system activation would pay off during acute systemic inflammatory reaction (e.g., sepsis / septic shock) or severe allergic disorders (e.g., asthma attack) in adult life. some bacteria (e.g., bartonella, yersinia, rhodobacter, chromobacterium) contain an atypical lps with low endotoxic activity and/or prominent antagonistic effect on lpss from enteric bacteria [2, 1719 ]. coevolution of organisms bearing a deeply modified / atypical lps with a vertebrate host would be beneficial to both of them. indeed the microorganisms factors including lps may reduce / inhibit the inflammatory potential of same tissue / district (respiratory and digestive mucosal, cns). rough mutants of yersinia enterocolitica exhibited atypical lps and attenuated virulence and lack of ability to colonize organs as spleen and liver. even more interestingly such mutants showed a substantial impairment of several other virulence factors, which depend on a full structure of lps for proper function and/or expression. therefore, these strains might be exploited for preparation of vaccines or adjuvants. similarly to other atypical lps - bearing bacteria also bartonella spp. are endowed with anti - inflammatory activities which might be exploited for medical purposes [18, 19 ]. bartonella spp.lps have been found to behave in a manner that is substantially different from other lpss from saprophytic, commensal, and pathogenic microorganisms. reported that b. quintana lpss exhibited a migration pattern of the deep rough chemotype, a strong reactivity following the chromogenic limulus amoebocyte lysate test and a very low cytokine release from human whole blood samples. in human leucocytes or in endothelial cells, as well as in a rat model, b. quintana lps was not able to induce significant levels of blood tnf. moreover, b. quintana lps induced an increase in the white blood cell count without a substantial change in heart rate, hematocrit, platelet count, or blood pressure. remarkably, bartonella quintana lps possesses antagonistic properties for tlr4 and does not activate tlr2 [18, 19 ]. however, the physical - chemical features of b. quintana lps warrant further investigations for a more in - depth knowledge of the structure - activity relationship. the atypical lps attributes undoubtedly contribute to the establishment and maintenance of mild although persistent infection, since the bacterium 's major surface component is subinflammatory and antagonistic to the host 's innate immune response. interestingly, long - chain fatty acids are a conserved feature in the lps of intracellular bacteria that establish long - term symbioses with their host, including legionella, chlamydia, and closely related rhizobia. the control of inflammatory illnesses and the decrease of allergic / atopic disorders might be obtained by the administration of such antagonistic lps species. also the control of experimental rheumatic disease has been obtained by administration of tlr4 antagonist lps from b. quintana. however, impaired nf-b translocation by lps pretreatment was also observed in tlr4-transfected overexpressing cells, suggesting that downregulation of tlr4 or tlr4 antagonism are not necessary events in impaired signal transduction in lps - tolerant cells / tissues and pointing to downstream site(s) of regulation and control of tlrs - dependent cascades carried out by lpss and other bacterial products. the complex population of microbes that we harbor within our mucosal cavities is not just passive bystanders, rather these organisms seem to actively shape our immune system responses both along the mucosal surface and in very remote tissues / organs. therefore, we suggested that some pivotal virulence factors, such as lpss, control broad and increasingly diffused chronic, inflammatory, and degenerative diseases during the human evolution. more interestingly some atypical lpss could be plausible candidates to be developed into useful drugs for many diseases such as allergic illness, inflammatory bowel disease, and demyelinizing pathology of cns. furthermore, enzymes involved in lipid a biosynthesis / modification not only provide access to new lipid a derivatives that may be useful as adjuvants or endotoxin antagonists, but also can be exploited for generating novel live bacterial vaccines. heterologous expression of lipid a modification enzymes like lpxe, lpxf, lpxr, or pagl in pathogens such as salmonella might attenuate these bacteria by altering lipid a structural elements recognized by the tlr-4/md2 complex. monophosphoryl lipid a (mpl) has been obtained from salmonella minnesota r595 by removal of core kdo, one phosphate and one acyl chain from disaccharide backbone. mpl is among the recently licensed adjuvants and is used in combination with alum in recently approved vaccines for human papillomavirus and hepatitis b virus. adjuvants can modify the delivery of the antigen or act as immunopotentiators, influencing both the amount and the quality of the adaptive immune response. delivery can be modified through the slow release of antigen and enhancement of uptake by apcs in emulsions and liposomes, for example, whereas immunopotentiators act through the activation of the innate immune system. while it seems clear that the microbiota influences progression and/or prevention of disease, the mechanism by which it can accomplish this task remains to be assessed. we have presented evidence that there is an intimate relationship between host and microbe that involves bacterial lpss and host intricate mechanisms. as many other molecules in biology, lpss appeared as a beneficial activity of both typical and atypical endotoxins look promising for the development of new drugs for prevention and the therapy of several human diseases. | following the discovery of endotoxins by richard pfeiffer, such bacterial product was associated to many severe disorders produced by an overwhelming inflammatory response and often resulting in endotoxic shock and multiple organ failure. however, recent clinical and basic sciences investigations claimed some beneficial roles of typical as well as atypical endotoxins. the aim of this paper is to focus on recent data supporting a beneficial activity of both typical and atypical endotoxins. such novel perspective looks promising for development of new drugs for prevention and therapy of several human diseases. |
severely damaged incisors may lead to difficulty in speech, decreased masticatory efficiency, abnormal tongue habits, subsequent malocclusions and psychological and self - esteem problems. in addition to problems for the patient, the restoration of severely decayed primary maxillary incisors poses a challenge for pedodontists. these teeth usually have short and narrow crowns, thus, only a small surface is available for bonding and the enamel is inherently difficult to acid etch due to its aprismatic nature. there are several methods mentioned in the literature for the restoration of severely decayed primary anterior teeth, such as direct and indirect techniques, use of metal posts, biological posts, resin composite posts and core restorations, reinforced composite and glass fiber posts [912 ] and custom made orthodontic wire posts. for example, prefabricated posts and omega shaped stainless steel orthodontic wires are simple, quick and cheap, but their adaptation is not always ideal. polyethylene fiber and glass fiber - reinforced composite posts have optimal properties in terms of elasticity, translucency and adaptation. biological posts are natural but they require creation of a tooth bank [5, 912, 15,16 ]. in the present study, we introduce a custom made sectioned endodontic file post as the retentive part of the restoration of severely damaged anterior primary teeth because of its accessibility and simplicity of fabrication for dentists as well as its affordability. for this non - control clinical trial, 12 healthy children (five boys and seven girls), who were referred to the pediatric dentistry clinic of mashhad university of medical sciences, were selected. furthermore, the selection of teeth was based on the following criteria : primary maxillary anterior teeth with ecc or fracture due to trauma involving more than three - fourths of the crownsound root structure and no caries in the root dentinno mobilityno trauma from the occlusion, as in cross bite, deep bite, etc.no abnormal oral habitsnormal root formation, with a sufficient amount of root structure present (at least two - thirds)no subgingival caries primary maxillary anterior teeth with ecc or fracture due to trauma involving more than three - fourths of the crown sound root structure and no caries in the root dentin no trauma from the occlusion, as in cross bite, deep bite, etc. no abnormal oral habits normal root formation, with a sufficient amount of root structure present (at least two - thirds) no subgingival caries the ethics committee of mashhad university of medical sciences approved the study protocol. full detailed treatment plans were explained to the parents or guardians of each child and then a written consent was obtained. during the process subsequently, periapical radiographs of the teeth to be treated were obtained. during the study, a total of 38 primary maxillary incisors of the selected 12 children received composite restorations with a custom made intracanal post. the teeth were endodontically treated and then the canals were obturated with zinc oxide eugenol cement (zoe, golchay, iran). afterwards, they were temporarily restored with reinforced zinc oxide eugenol cement (zonalin, kemdent, uk) (figure 1). a) carious maxillary anterior teeth b) endodontically treated teeth temporarily restored with reinforced zinc oxide eugenol due to extensive crown damage, it was necessary to use intracanal posts. thus, at the second appointment, about 2 mm of the cement was removed from one - third of the coronal part of the canal. next, a custom made post was fabricated using a 4 mm k - file (k - file, mani, tokyo, japan) (figure 2a) ; it was the largest file which was retained in the canal, and was then sectioned and inserted into the canal, so that the incisal end of the sectioned k - file projected 2 mm above the cej. this k - file post was selected because it provided optimal mechanical retention and support for the restorative material. a) k - file custom made post b) teeth with cemented k - file post the root canal was conditioned with polyacrilyc acid (fuji, gc corp., the sectioned file was cemented into the canal with a resin modified glass ionomer (fuji ii, gc corp., tokyo, japan) and was subsequently covered with the glass ionomer to mask its metallic shade (figure 2b). after the setting of the cement, a celluloid strip crown (3 m espe, usa) was adopted for the tooth and then the remaining coronal structure was etched with 35% phosphoric acid (scotchbond etchant, 3 m espe, usa) for 20 seconds, and then rinsed and dried for 30 seconds. bonding agent (single bond adper 2, 3 m esp3e, usa) was applied and cured for 20 seconds with an led light - curing unit (blue phase, ivoclar vivadent, schaan, liechtenstein). the celluloid crown was perforated at the lingual aspect with a round diamond bur (jota, swiss) to discharge the excess composite. then, the crown was filled with the previously selected shade of nanofilled composite resin (filtek z350, 3 m espe, usa) and placed over the remaining tooth structure, and then the composite was cured with an led light curing unit for 40 seconds from each aspect. the excess composite at the lingual and gingival margins was removed with finishing and polishing burs (jota, switzerland). occlusion was checked and after the removal of interferences, the final finishing and polishing of the restoration was performed with a polishing disc (soflex, 3 m espe, usa) (figure 3). the patients and their parents were instructed on proper oral hygiene and emphasis was placed on follow up. clinical evaluation for several parameters was done at baseline and intervals of 3 and 12 months in accordance with the modified usphs criteria (table 1). modified united state public health service (usphs) criteria in the modified usphs criteria, the rating results of alfa were acceptable, while the rating results of bravo and charlie were poor. the descriptive - analytical tests were used for marginal adaptation and restoration retention and recurrent caries at 0, 3, and 12 months using the spss version 11.5 software and 95% confidence interval was calculated for success proportion. in this open label clinical trial, the quality of marginal adaptation decreased after three and 12 months intervals. at the 3-month follow up, only four teeth had poor marginal adaptation that required correction ; however, at the 12-month follow up, eight teeth had poor marginal adaptation. in terms of restoration retention, at the three - month follow up, 35 restored teeth remained intact and just two restored teeth were fractured, but the posts remained in the canals. follow up, only 30 teeth remained intact, six teeth had posts remaining, and two teeth had lost the posts and the restorations (table 2). evaluation of marginal adaptation, restoration retention and recurrent caries usphs : united state public health service recurrent carious lesions were observed at three and 12 months. in one patient, recurrent carious lesions were observed around the margins of the restoration at the 3-month follow - up. in eight teeth, at the 12-month follow up, recurrent carious lesions were observed around the margins of the restoration (table 2). esthetic reconstruction of deciduous maxillary anterior teeth severely damaged by caries or trauma is challenging for pedodontics for several reasons such as loss of tooth structure, weak adhesion of the bonding agent to primary teeth and uncooperative children for whom these treatments are needed. however, retention of such restorations in endodontically treated teeth can be improved using an intracanal post and different techniques and materials have been used to reinforce large root canals. direct composite resin restorations reinforced with an orthodontic wire are simple and fast, but the wire adaptation into the canal is not sufficient [5,13, 15 ]. metallic posts are not expensive but an additional laboratory stage and high cost are the two major disadvantages of this method [3,4, 5 ]. it also requires the usage of an opaque resin to mask the post, which may in turn compromise the final appearance of the restoration. furthermore, the use of metal posts in primary teeth could pose additional problems during the course of natural exfoliation. another aesthetic option could be using biological posts made from extracted primary teeth [6, 7 ]. the disadvantages of this technique include the need for a tooth bank and parental and child donor consent as well as that of the recipients of such tooth fragments. moreover, this technique may not comply with today s cross - infection control policies. the composite resin post method provides acceptable esthetic appearance, but the polymerization shrinkage of the composite may lead to retention loss of the post [7, 18 ]. the use of prefabricated nonmetallic posts has become a preferred treatment modality [7,17, 18 ]. the advantages of this technique are proper adaptation to the canal walls by the application of composite resin, adequate retention, and stability [5,912 ]. in this study, we introduced a simple and cost effective technique for restoring severely decayed maxillary anterior teeth. this method is affordable for patients, trouble - free for dentists and it does not require any laboratory work. additionally, it can be done easily by sectioning a proper size endodontic k - file, which is available in any dental clinic. according to the results of this study, after 12 months of follow up, only two teeth lost post and restoration and in one case hard biting led to restoration fracture. therefore, this method provides adequate retention for durable restoration of severely damaged primary incisors. in this study, the sectioned k - file was introduced 2 mm inside the canals until it reached the limit of the cervical third as described by rifkin in 1983. a longer file length is not preferred because it may interfere with the eruption of the underlying permanent tooth during the final stages of resorption of the primary roots. in addition, in this technique we applied glass ionomer for masking the sectioned k - file in the core part of the post system and since there was enough composite resin around the core, no metal showed through the composite restoration and thus favorable esthetics was achieved. however, based on the results of this study and with regard to marginal adaptation, this variable worsened during the follow up intervals, probably due to the lack of enamel for bonding to the composite in severely damaged incisors. recurrent caries occurred in eight children with ecc, who had a high risk of dental caries. the absence of a proper preventive strategy could result in caries recurrence in this group. as oral hygiene and diet are critical factors in developing caries, one of the limitations of this study was that there was no control over the oral hygiene and diet of the children ; thus, these factors could have influenced caries recurrence rates in our study. another limitation was that no comparison was carried out between the type of teeth (central or lateral incisors), which may affect post retention because of differences in tooth morphology and tooth position in the dental arch ; therefore, further investigational studies are recommended in this regard. in this study, a strip crown restoration reinforced with a sectioned k - file intracanal post showed favorable retention and aesthetic results after 12 months of follow - up. additionally, this method requires short chair time, which is ideal for pediatric patients, and no laboratory work and is cost effective as well. | objectives : caries and dental trauma are common reasons for primary anterior teeth restorations in children. this non - control clinical trial was designed to evaluate crown restorations reinforced with a sectioned file post for the restoration of severely damaged primary maxillary incisors.materials and methods : thirty - eight primary maxillary incisors of 12 children (35 years old) with early childhood caries (ecc) received composite restorations with a custom made post. the restorations were evaluated using the modified united state public health service (usphs) criteria. the results were statistically analyzed by descriptive analytical tests.results:in this trial, the quality of marginal adaptation decreased after three and 12 months intervals. recurrent carious lesions were observed during intervals. in terms of restoration retention, only one patient lost both the post and the restoration at the 12-month follow up.conclusion:the sectioned file post technique showed good retention and aesthetics for restoring severely damaged primary maxillary anterior teeth. |
copd is characterized by persistent airflow limitation related to a chronic inflammatory response in the airways and the lung derived from inhaling toxic particles or gases for a long - term exposure.1 this condition is the fourth leading cause of death worldwide, and it represents a major cause of chronic morbidity and economic and social burden.1 thus, some studies have focused on calculating the cost of treatment for copd in spain. de miguel diez showed that the total treatment cost per copd patient per year was ~2,000. in that study, 40% of the total expenses were produced by the hospitalization component, and the drug costs represented almost the 26%. masa also conducted a study on the copd treatment costs in spain and found that although the cost per patient was not calculated, the division of expenses was similar to the one obtained by miguel diez, corresponding 41% to hospitalization and 37% to pharmacological treatment. in spain, 10.2% of individuals between the ages of 40 and 80 years have copd, whereas a significant proportion of the population remains undiagnosed.4 this high prevalence is worsened by the fact that ~60% of patients with copd do not adhere to the prescribed therapy.5,6 medication adherence is a complex issue that can be defined as the degree to which a patient s medication - taking behavior and/or executing lifestyle changes correspond with agreed recommendations from a health care professional with respect to timing, dosage, and frequency.7 medication adherence is a key factor for controlling the progression of chronic disease. although inhaled corticosteroids (ics) and long - acting 2-agonist fixed - dose combinations (fdcs) have shown to relieve copd symptoms similarly, inhalation technique might affect adherence and hence efficacy of pharmacological treatment. common, real - life errors during the inhalation process include holding inhaler upright, inhaling deeply and quickly, and breath - holding.8,9 delivering sufficient drug dose to the lungs is crucial to achieve a good medication efficacy so as to avoid poor health outcomes.10 as in other chronic diseases, the previous studies have demonstrated low medication adherence in copd patients. a study distributed by the world health organization reported that in patients on long - term pharmacotherapy the adherence was half or less.11 recent studies, based on the medication adherence in copd patients, additionally show a poor adherence. breekveldt - postma reported that approximately half of the patients stopped their treatment with ics within 6 months, and only 18% persevered > 1 year. bender studied the utilization of an inhaler (fluticasone propionate / salmeterol) and detected that only 9% of patients proceed with the treatment for more than 1 year. cramer identified that the adherence to copd medications was low over a wide range of medications, ranging from 57 to 96 mean days until discontinuation over a year of observation time. medication regimens for patients with copd are notably susceptible to adherence problems due to the chronicity of the disease, the use of multiple medications, and the periods of symptom remission and patients comorbidities. given the developments in inhaler devices (eg, pressurized metered - dose inhalers to dry powder inhalers [dpis ]), there is still a high unmet need to have more intuitive inhalers that are easier to use for patients. this is also recognized by the decision makers and physicians.15,16 the ease of use of the device according to patient comorbidities and preferences may contribute to a better medication adherence.7 the present study focused on developing a budget impact model (bim) in order to estimate the economic impact that arises from a growing presence in the market of duoresp spiromax for the maintenance therapy with budesonide / formoterol fdc. spiromax, a new inhalation device, helps to reduce common errors that could occur while using the device which could limit the direct drug delivery to the lungs.17 the model was elaborated from the perspective of the spanish national honor society (nhs), and regional data from 5 spanish autonomous communities (hereafter referred as regions) were also included : andalusia, catalonia, galicia, madrid, and valencia. this study did not require any ethics committee review as the authors did not have access to patient - level data. the bim was developed in microsoft excel from the perspective of the spanish nhs with a 4-year time horizon (20152018). the present analysis focused on the population from spain and 5 spanish regions : andalusia, catalonia, galicia, madrid, and valencia. budesonide / formoterol fdc delivered by turbuhaler was considered the relevant comparator for evaluating the budget impact of the introduction of budesonide / formoterol fdc delivered by spiromax. although fdcs such as beclomethasone / formoterol and fluticasone / salmeterol are available, only budesonide / formoterol fdc was included in the present analysis because changes in patients regimens were not hypothesized. input data on health care resources such as medical visits and length of hospitalization were obtained by expert panel consultation from various spanish hospitals. therefore, the model analyzed health care resource utilization per patient based on his / her daily maintenance treatment for copd and the number of days with events such as hospitalizations, visits to the emergency room, primary care (pc) visits, and specialist visits. these data were obtained from daily clinical practice, given that there is no published literature on how suboptimal adherence related to inhalation technique affects health care resource utilization. all the costs were estimated in eur 2015, and a discount rate of 3% was assumed. it should be noted that when this study was being completed, there was a significant change in drug prices included in this analysis. from october 2015 onward, prices of both the drugs were set at the same level by the spanish ministry of health ; therefore, price effect was no longer useful to calculate the economic impact of the introduction of duoresp spiromax.18 the model focused on diagnosed patients with copd, who followed an inhaler maintenance therapy. ims health reported the proportion of patients using budesonide / formoterol fdc delivered by a dpi according to spanish national and regional sales data. therefore, the authors were able to estimate the target population, given the data on symbicort / rilast turbuhaler utilization in spain and 5 spanish regions. data on market uptake of duoresp spiromax were provided directly by teva pharma, spain. the model provided estimates for the annual costs per patient and the total direct costs of treatment from predefined market shares and other input parameters. the total cost estimated for copd patients is based on drug costs and medical resources, such as medical visits, hospitalization, emergency visits, and monitoring tests. a univariate deterministic sensitivity analysis was conducted to confirm the model robustness and to identify the parameters having the greatest influence on the results. different market shares, adherence rates, and copd severity were assessed for the analysis. furthermore, a change in the age of the target population was analyzed, considering the population older than 40 years (greater copd prevalence) instead of the adult population. this study did not require any ethics committee review as the authors did not have access to patient - level data. the bim was developed in microsoft excel from the perspective of the spanish nhs with a 4-year time horizon (20152018). the present analysis focused on the population from spain and 5 spanish regions : andalusia, catalonia, galicia, madrid, and valencia. budesonide / formoterol fdc delivered by turbuhaler was considered the relevant comparator for evaluating the budget impact of the introduction of budesonide / formoterol fdc delivered by spiromax. although fdcs such as beclomethasone / formoterol and fluticasone / salmeterol are available, only budesonide / formoterol fdc was included in the present analysis because changes in patients regimens were not hypothesized. input data on health care resources such as medical visits and length of hospitalization were obtained by expert panel consultation from various spanish hospitals. therefore, the model analyzed health care resource utilization per patient based on his / her daily maintenance treatment for copd and the number of days with events such as hospitalizations, visits to the emergency room, primary care (pc) visits, and specialist visits. these data were obtained from daily clinical practice, given that there is no published literature on how suboptimal adherence related to inhalation technique affects health care resource utilization. all the costs were estimated in eur 2015, and a discount rate of 3% was assumed. it should be noted that when this study was being completed, there was a significant change in drug prices included in this analysis. from october 2015 onward, prices of both the drugs were set at the same level by the spanish ministry of health ; therefore, price effect was no longer useful to calculate the economic impact of the introduction of duoresp spiromax.18 the model focused on diagnosed patients with copd, who followed an inhaler maintenance therapy. ims health reported the proportion of patients using budesonide / formoterol fdc delivered by a dpi according to spanish national and regional sales data. therefore, the authors were able to estimate the target population, given the data on symbicort / rilast turbuhaler utilization in spain and 5 spanish regions. data on market uptake of duoresp spiromax were provided directly by teva pharma, spain. the model provided estimates for the annual costs per patient and the total direct costs of treatment from predefined market shares and other input parameters. the total cost estimated for copd patients is based on drug costs and medical resources, such as medical visits, hospitalization, emergency visits, and monitoring tests. a univariate deterministic sensitivity analysis was conducted to confirm the model robustness and to identify the parameters having the greatest influence on the results. different market shares, adherence rates, and copd severity were assessed for the analysis. furthermore, a change in the age of the target population was analyzed, considering the population older than 40 years (greater copd prevalence) instead of the adult population. the study population was selected based on spanish national and regional prevalence of copd from the literature review.19,20 prevalence estimates of copd were extrapolated to the obtained estimates of adult population, taking into account projections performed by the spanish national institute of statistics.21 we considered that 73% of copd patients were not diagnosed.22 finally, a percentage was applied to distinguish the patients using an fdc, and among them, the number of patients who used budesonide / formoterol fdc delivered by a dpi was determined. the proxy for capturing these patients was the percentage of patients using symbicort / rilast turbuhaler (ims health. national sales data 20132014 for copd maintenance treatment with fixed - dose - combinations for spain, unpublished data, 2015). a panel of 5 clinical experts in pneumology and allergy and also a general practitioner from different spanish hospitals was asked to report whether critical inhaler misuses were observed in daily practice. the incorrect dose loading and keeping the inhaler inclined no more than 45 from the vertical axis were the most common errors in patients taking symbicort turbuhaler and rilast turbuhaler versus duoresp spiromax (table 1). these results were not used for calculations, but these were relevant to confirm that the misuse of inhaler was found in clinical practice. gathering input data on health care resource utilization related to a potential enhancement of adherence was the basis to estimate the economic impact of the introduction of spiromax in spain. the proportion of emergency room visits and hospitalizations that might be due to errors in the use of inhaler technique were reported to be 4.92% and 3.26%, respectively. moreover, according to the experts point of view, there are some differences in the number of emergency room visits and hospitalizations between patients using turbuhaler and patients using spiromax (table 2). there were some difficulties in obtaining directly the proportions of pc visits and specialist visits per patient. pc visits implies that the health care providers need to deal with different patient concerns, which might not be related only to the use of inhaler devices. such situations made it necessary to ask for the number of pc and specialist visits that a regular copd patient had undergone. on average, the number of patients who used turbuhaler should not be different from those using spiromax as they share indication with the same fdc of budesonide / formoterol.23 therefore, it is plausible to imply that deviation between health care resource utilization associated with spiromax versus turbuhaler might be related to the inhalation device. finally, the present study included other health care resources such as spirometry and thorax radiograph.3 some studies showed that a greater number of monitoring tests such as blood test and electrocardiogram were taken, causing the budget to exceed the cost of a regular monitoring test, which are most efficient to make a prognostic of copd.24 therefore, it can be concluded that the cost of monitoring tests could be underestimated in the present model. drug costs were obtained from a spanish database of pharmacists.25 cost of budesonide / formoterol fdc delivered by turbuhaler or spiromax was included exclusively as a drug cost in order to simplify the analysis. costs of health care resources included in this analysis were based on spanish regional tariff lists.2637 at the national level, costs of health care resources correspond to the mean of 12 regions, including those 5 regions included in this analysis. for each scenario, the economic impact for the time period of 20152018 was calculated based on the estimated number of patients who are treated with budesonide / formoterol fdc delivered by turbuhaler each year, the annual average cost per patient for each treatment option, the target population, and the market shares for both products included in this study. in the current scenario, duoresp spiromax this current scenario was compared with an alternative scenario in which the economic impact considered the introduction of duoresp spiromax and its effects toward medication adherence. the market uptake of duoresp spiromax increased gradually over the course of the 4 years (table 3). the study population was selected based on spanish national and regional prevalence of copd from the literature review.19,20 prevalence estimates of copd were extrapolated to the obtained estimates of adult population, taking into account projections performed by the spanish national institute of statistics.21 we considered that 73% of copd patients were not diagnosed.22 finally, a percentage was applied to distinguish the patients using an fdc, and among them, the number of patients who used budesonide / formoterol fdc delivered by a dpi was determined. the proxy for capturing these patients was the percentage of patients using symbicort / rilast turbuhaler (ims health. national sales data 20132014 for copd maintenance treatment with fixed - dose - combinations for spain, unpublished data, 2015). a panel of 5 clinical experts in pneumology and allergy and also a general practitioner from different spanish hospitals was asked to report whether critical inhaler misuses were observed in daily practice. the incorrect dose loading and keeping the inhaler inclined no more than 45 from the vertical axis were the most common errors in patients taking symbicort turbuhaler and rilast turbuhaler versus duoresp spiromax (table 1). these results were not used for calculations, but these were relevant to confirm that the misuse of inhaler was found in clinical practice. gathering input data on health care resource utilization related to a potential enhancement of adherence was the basis to estimate the economic impact of the introduction of spiromax in spain. the proportion of emergency room visits and hospitalizations that might be due to errors in the use of inhaler technique were reported to be 4.92% and 3.26%, respectively. moreover, according to the experts point of view, there are some differences in the number of emergency room visits and hospitalizations between patients using turbuhaler and patients using spiromax (table 2). there were some difficulties in obtaining directly the proportions of pc visits and specialist visits per patient. pc visits implies that the health care providers need to deal with different patient concerns, which might not be related only to the use of inhaler devices. such situations made it necessary to ask for the number of pc and specialist visits that a regular copd patient had undergone. on average, the number of patients who used turbuhaler should not be different from those using spiromax as they share indication with the same fdc of budesonide / formoterol.23 therefore, it is plausible to imply that deviation between health care resource utilization associated with spiromax versus turbuhaler might be related to the inhalation device. finally, the present study included other health care resources such as spirometry and thorax radiograph.3 some studies showed that a greater number of monitoring tests such as blood test and electrocardiogram were taken, causing the budget to exceed the cost of a regular monitoring test, which are most efficient to make a prognostic of copd.24 therefore, it can be concluded that the cost of monitoring tests could be underestimated in the present model. drug costs were obtained from a spanish database of pharmacists.25 cost of budesonide / formoterol fdc delivered by turbuhaler or spiromax was included exclusively as a drug cost in order to simplify the analysis. costs of health care resources included in this analysis were based on spanish regional tariff lists.2637 at the national level, costs of health care resources correspond to the mean of 12 regions, including those 5 regions included in this analysis. for each scenario, the economic impact for the time period of 20152018 was calculated based on the estimated number of patients who are treated with budesonide / formoterol fdc delivered by turbuhaler each year, the annual average cost per patient for each treatment option, the target population, and the market shares for both products included in this study. in the current scenario, this current scenario was compared with an alternative scenario in which the economic impact considered the introduction of duoresp spiromax and its effects toward medication adherence. the market uptake of duoresp spiromax increased gradually over the course of the 4 years (table 3). it was estimated that, in 2015, 130,777 adults in spain suffered from copd, and they were treated with budesonide / formoterol delivered by a dpi (in this study turbuhaler ; table 4). however, this population decreased over time and will be 128,618 in 2018. the same pattern was observed for target population in catalonia, galicia, madrid, and valencia, whereas the number of patients in andalusia increased slightly between 2015 and 2018 (table 4). based on the annual drug cost and health care resource use per patient, the total treatment cost per patient was estimated in eur 2015. with the annual average cost per patient for each treatment option, the target population, and the market shares for both products included in this study, the overall economic impact of the management of copd for the time period of 20152018 was obtained. in the current scenario for spain, the total economic impact of treatment with budesonide / formoterol fdc delivered by turbuhaler was estimated to be 108.76 million, 110.44 million, 114.61 million, and 121.73 million for the years 2015, 2016, 2017, and 2018, respectively (table 5). in the alternative scenario for spain, with the market share of duoresp spiromax increasing annually from 2015, matched by a reduction in the share of symbicort turbuhaler and rilast turbuhaler, the total economic impact was estimated to be 107.92 million, 109.03 million, 112.79 million, and 119.48 million for 2015, 2016, 2017, and 2018, respectively (table 5). overall, the total budget savings for spain were expected to be 6.01 million over the next 4 years (tables 5 and 6). results of the region - specific analysis vary widely. in the current scenario, the total economic impact was expected to be 65.49 million, 55.58 million, 30.45 million, 63.30 million, and 32.94 million in andalusia, catalonia, galicia, madrid, and valencia, respectively, for the time period of 20152018 (table 5). the economic impact of treating copd was reduced in all spanish regions with the introduction of spiromax, alternative scenario, over the time period of 20152018. thus, total costs were estimated to be 64.59 million for andalusia, 54.84 million for catalonia, 29.98 million for galicia, 62.54 million for madrid, and 32.44 million for valencia (tables 5 and 6). the comparison between the current scenario and the alternative scenario led to savings in all 5 spanish regions. total savings during the time period of 20152018 were estimated to be 902,133, 740,520, 464,281, 748,996, and 495,812 for andalusia, catalonia, galicia, madrid, and valencia, respectively. results were obtained through the reduction of health care resources, especially fewer days of hospital stay and avoided pc visits and emergency room visits (table 6), the reduction in pc visits related to problems with the inhaler device being more important. finally, the univariate deterministic sensitivity analysis confirmed the robustness of the model. variations in the most sensitive parameters, such as copd severity or the adherence rate, do not lead to significant changes in the results of the analysis, since in all cases savings were obtained for both spain and the 5 regions. in addition, when changing the age of the population considered, savings were obtained with the alternative scenario compared with the current one. thus, the savings obtained ranged between 9.4 million and 606,641 for spain and 1.7 million and 50,077 for the 5 spanish regions (table 7). this study compared the costs of budesonide / formoterol fdc delivered by two different inhalation devices, spiromax and turbuhaler, to estimate the budget impact for the treatment of copd in spain and the 5 regions. results of the budget impact analysis suggest that the increasing use of spiromax would result in a 4-year budget savings for the spanish nhs of 6.01 million at the national level. results suggest that savings summed up to 902,133, 740,520, 464,281, 748,996, and 495,812 for andalusia, catalonia, galicia, madrid, and valencia, respectively. lewis conducted an assessment to determine the budget impact of using spiromax instead of turbuhaler to manage copd in adult patients in the uk. they also analyzed the potential cost benefit of the improved inhalation technique. in the lewis study, the model predicted total drug cost savings of 36.09 million and further savings of 3.5 million due to improvement in inhalation technique. this assessment was been carried out by torvinen on the italian copd population. their model also anticipated a total drug cost savings of 53.66 million and additional savings of 4.12 million because of the progression in inhalation technique. regarding other inhalation devices, nicolai assessed the potential economic impact of introducing an inhaler with improved features compared to spiriva handihaler to treat copd in the uk. the potential budgetary impact achieved by using the new inhaler instead of handihaler is calculated as 104.91 per patient and 16.69 million for the uk copd population per year. dealing with this chronic disease remains complex due to several problems such as the chronicity of the disease, the use of multiple medications, the periods of symptom remission, comorbidities that limit the movement such as arthritis and osteoarthritis, and the lack of adherence related to the inhalation technique. inhaled medication is typically prescribed in a maintenance therapy using fdcs, considering that single - inhaler combination regimens provide improved symptom control and slow down the progression of the disease.41,42 although current prescription guidelines contribute to improve the quality of life of copd patients, it was reported that up to 85% of the patients use their inhaler ineffectively, and this was associated with low medication adherence.41,43,44 our estimates suggest that the introduction of spiromax could result in savings by reducing health care resource utilization related to suboptimal medication adherence.45,46 this new inhalation device helps to reduce common utilization errors such as dose preparation errors, adequate flow rates, or even environmental conditions that might limit the delivery of the drug directly to the lungs, which would be closer to patients real - life situations.46 in addition, the current model can obtain region - specific results, which suggest that the highest populated regions correspond to those with greater savings for the health care budget., these regions were expected to obtain higher savings if adherence improves in the patients diagnosed with copd. it was also explored that the breakdown of overall savings and the savings due to avoided pc visits has shown to yield significant monetary savings. copd is mostly found in a population older than 40 years, and the chronicity of the disease makes it relevant to focus effort in new strategies to solve the current problems of suboptimal adherence.43,47 when clinical data were not available, we used data from the literature. due to differences in study population, geographic area, patients health status, and additional factors, some input variables may not be generalizable to all 5 regions. moreover, the first assumption in the model was a growing market share of duoresp spiromax along with a reduction of symbicort turbuhaler and rilast turbuhaler utilization. nevertheless, the estimate of the budget impact under this scenario may not predict the real - world changes. furthermore, other formulae prescriptions different from budesonide / formoterol were not included, which could be an alternative for duoresp spiromax. regarding the study results, it was found that gains in adherence generated savings for the health care budgets. although these amounts could be considered conservative, they are adjusted only to be related with inhalation technique problems, and not with the whole adherence problem, which is linked with many factors.41,44 it is worth mentioning that difficulties in the use of inhaler devices were exacerbated in elderly patients, whose reduced inhalation effort leads to a poor drug release.48 a greater impact on the copd economic budget was expected because of the aging population in spain. furthermore, it was also observed that underdiagnosis is a current problem in spain, with up to 73% of copd potential population remain unaware of their health status.45 thus, copd health care expenditure could be even higher since a low proportion of these patients was actually treated. the results from this analysis suggest that the introduction of duoresp spiromax would result in a 6.01 million decrease in spain s overall budget in the period 20152018 associated with a lower health care resource utilization costs. region - specific data resulted in savings in 5 spanish regions of study which sum up to 902,133, 740,520, 464,281, 748,996, and 495,812 for andalusia, catalonia, galicia, madrid, and valencia, respectively. copd treatment regimens that increase the probability of higher medication adherence rates would be expected to contribute to improved disease management and to have an impact on the utilization of health care resources. | objectivethe objective of this study was to estimate the economic impact of the introduction of duoresp spiromax, budesonide / formoterol fixed - dose combination (fdc), focusing on an increase in medication adherence due to an enhancement of the inhalation technique for the treatment of copd patients in spain and 5 regions including andalusia, catalonia, galicia, madrid, and valencia.methodsa 4-year budget impact model was developed for the time period of 20152018. this study aimed at evaluating the budget impact associated with the introduction of duoresp spiromax in comparison with symbicort turbuhaler and rilast turbuhaler. national and regional data on copd prevalence were obtained from the literature. input data on health care resource utilization were obtained by clinical consultation. resource included primary care visits, specialist visits, hospitalization, and emergency room visits as well as the length of hospital stay. based on both pharmacological and health care resource costs, overall annual treatment cost per patient was estimated in eur 2015.resultsit was calculated that 130,777 adults were treated with budesonide / formoterol fdc delivered by a dry powder inhaler, turbuhaler, in spain in 2015. however, the target population decreases over the next 4 years. this pattern was observed in 4 regions, but for andalusia, the treated population increased slightly. the overall budget savings in spain with the market share of duoresp spiromax were estimated to be 6.01 million for the time period of 20152018. region - specific data resulted in savings of 902,133 in andalusia, 740,520 in catalonia, 464,281 in galicia, 748,996 in madrid, and 495,812 in valencia for the time period of 20152018.conclusionthe introduction of budesonide / formoterol fdc delivered by spiromax for copd treatment is likely to contribute in a reduction of health care costs for spain and in 5 spanish regions. this model forecasts that spain and these 5 spanish regions were likely to have savings, which might be due to fewer days of hospitalization, avoided emergency room, and primary care visits. |
three hundred forty nine patients who were diagnosed with colorectal cancer at the korea university guro hospital from january 2002 to december 2009, who had surgical procedure such as right hemicolectomy, left hemicolectomy, sigmoidectomy, anterior resection, and abdominoperineal resection and had no prior history of neo - adjuvant chemotherapy were included in this study. clinicopathologic data such as sex, age, and distant metastasis were collected from medical records. all of the cases were reviewed and classified according to the criteria of the world health organization (who) classification.21 pathologic staging was reviewed based on the tnm staging system of the american joint committee on cancer.22 the patients were grouped according to age, sex, location, tnm stage, tumor invasion, presence of lymph node metastasis, presence of distant metastasis, and histologic grade. this study obtained approval from the institutional review board of korea university guro hospital (kuggr-2011 - 015). hematoxylin and eosin - stained glass slides of selected patients were reviewed for construction of tissue microarray (tma). one 2.0 mm core of tumor per case and one 2.0 mm core of representatively sampled normal mucosa were arrayed. tma blocks were cut into 4 m slices for immunohistochemical staining. a standard streptavidin - biotin peroxidase complex method was used. after deparaffinization and rehydration, slides were heated in a microwave oven for 15 minutes in 10 mm citrate buffer (ph 6.0) and treated with 3% hydrogen peroxide for 20 minutes. the following antibodies were used : sirt1 (1:50, clone h-300, santa cruz biotechnology, santa cruz, ca, usa), dbc1 (1:100, polyclonal, abcam, cambridge, ma, usa), -catenin (1:500, clone -catenin-1, dako, carpinteria, ca, usa), survivin (1:400, polyclonal, novus, littleton, ma, usa), and p53 (1:500, clone do-7, novocastra, newcastle upon tyne, uk). each case was evaluated by estimating the percentages and intensity of tumor cells showing a nuclear staining pattern. immunostaning for sirt1 was considered positive if 30% or more of the tumor cells were stained with an antibody, referring to other previous studies using the same antibody.12,15 immunostaining for dbc1 was considered negative if more than 30% of tumor cells showed loss of expression, because dbc1 was expressed in all of the normal mucosa with nuclear staining pattern and at least moderate intensity ; the cutoff value of 30% was chosen because dbc1 is known as negative regulator of sirt1, so it was adjusted to the cutoff value of sirt1. survivin was also expressed in normal colonic mucosa with moderate intensity and is known to be inhibited by sirt1. in the same manner, immunostaining for survivin was considered negative if more than 30% of tumor cells showed loss of expression. immunostaining for -catenin was considered positive if the tumor cells showed cytoplasmic and/or nuclear expression, so called altered expression. immunostaining for p53 was considered positive if more than 10% of tumor cells were stained with the antibody, according to previous guidelines.23 all statistical analyses were performed using ibm spss ver. the endpoint of follow - up was the date of final contact or the date of death through july 2011. correlations between immunohistochemical expression and the clinicopathological characteristics were analyzed by pearson 's tests. overall survival was calculated as the time from the date of the surgery to the date of death or final contact. univariate and multivariate analyses for overall survival were performed using the cox proportional hazard model. in all statistical analyses, three hundred forty nine patients who were diagnosed with colorectal cancer at the korea university guro hospital from january 2002 to december 2009, who had surgical procedure such as right hemicolectomy, left hemicolectomy, sigmoidectomy, anterior resection, and abdominoperineal resection and had no prior history of neo - adjuvant chemotherapy were included in this study. clinicopathologic data such as sex, age, and distant metastasis were collected from medical records. all of the cases were reviewed and classified according to the criteria of the world health organization (who) classification.21 pathologic staging was reviewed based on the tnm staging system of the american joint committee on cancer.22 the patients were grouped according to age, sex, location, tnm stage, tumor invasion, presence of lymph node metastasis, presence of distant metastasis, and histologic grade. this study obtained approval from the institutional review board of korea university guro hospital (kuggr-2011 - 015). hematoxylin and eosin - stained glass slides of selected patients were reviewed for construction of tissue microarray (tma). one 2.0 mm core of tumor per case and one 2.0 mm core of representatively sampled normal mucosa were arrayed. tma blocks were cut into 4 m slices for immunohistochemical staining. a standard streptavidin - biotin peroxidase complex method was used. after deparaffinization and rehydration, slides were heated in a microwave oven for 15 minutes in 10 mm citrate buffer (ph 6.0) and treated with 3% hydrogen peroxide for 20 minutes. the following antibodies were used : sirt1 (1:50, clone h-300, santa cruz biotechnology, santa cruz, ca, usa), dbc1 (1:100, polyclonal, abcam, cambridge, ma, usa), -catenin (1:500, clone -catenin-1, dako, carpinteria, ca, usa), survivin (1:400, polyclonal, novus, littleton, ma, usa), and p53 (1:500, clone do-7, novocastra, newcastle upon tyne, uk). each case was evaluated by estimating the percentages and intensity of tumor cells showing a nuclear staining pattern. immunostaning for sirt1 was considered positive if 30% or more of the tumor cells were stained with an antibody, referring to other previous studies using the same antibody.12,15 immunostaining for dbc1 was considered negative if more than 30% of tumor cells showed loss of expression, because dbc1 was expressed in all of the normal mucosa with nuclear staining pattern and at least moderate intensity ; the cutoff value of 30% was chosen because dbc1 is known as negative regulator of sirt1, so it was adjusted to the cutoff value of sirt1. survivin was also expressed in normal colonic mucosa with moderate intensity and is known to be inhibited by sirt1. in the same manner, immunostaining for survivin was considered negative if more than 30% of tumor cells showed loss of expression. immunostaining for -catenin was considered positive if the tumor cells showed cytoplasmic and/or nuclear expression, so called altered expression. immunostaining for p53 was considered positive if more than 10% of tumor cells were stained with the antibody, according to previous guidelines.23 all statistical analyses were performed using ibm spss ver. 20 (ibm, armonk, ny, usa). the endpoint of follow - up was the date of final contact or the date of death through july 2011. correlations between immunohistochemical expression and the clinicopathological characteristics were analyzed by pearson 's tests. overall survival was calculated as the time from the date of the surgery to the date of death or final contact. univariate and multivariate analyses for overall survival were performed using the cox proportional hazard model. in all statistical analyses, the expression of sirt1 and dbc1 in colorectal cancer was observed in 235 (67%) and 183 (52%) patients with nuclear staining pattern, respectively. 1). sirt1 and dbc1 were not significantly related to clinicopathological features such as age, sex, location, stage, invasion depth of tumor, lymph node metastasis, distant metastasis, or histologic grade (table 1). all of the sampled normal mucosa showed membranous expression of -catenin with weak or moderate intensity. the nuclear and/or cytoplasmic expression of -catenin was observed in 246 (70%) patients (fig. the altered expression of -catenin was correlated with left - located tumor (p=0.001), absence of distant metastasis (p=0.027), and non - poorly differentiation (p=0.026) (table 1). survivin was expressed in all of the normal mucosa with moderate or strong intensity with nuclear staining pattern. the loss of expression of survivin was observed in 156 (45%) patients (fig. the loss of nuclear expression of survivin was correlated with higher t stage (p=0.004) (table 1). cytoplasmic expression of survivin was not related to overall survival or clinicopathological features such as age, sex, location, stage, invasion depth of tumor, lymph node metastasis, distant metastasis, or histologic grade. expression of p53 was positively correlated with tnm stage (p=0.018) and distant metastasis (p=0.001) (table 1). the expression of sirt1 was significantly related to the expression of dbc1 (p<0.001), -catenin (p=0.001), and survivin (p=0.002). the expression of dbc1 was significantly related to the expression of -catenin (p=0.006) and survivin (p<0.001). expression of sirt1 and related proteins and their correlations are summarized in table 2. for univariate analysis of overall survival, analyzed clinicopathologic features, old age (65) (p=0.005), high tnm stage (stages iii and iv) (p<0.001), left - side tumor (p=0.034), invasion of more than the muscularis propria (p=0.024), presence of lymph node metastasis (p=0.001), presence of distant metastasis (p<0.001), and poorly differentiated histologic grade (p=0.001) were significantly associated with shorter overall survival. the overexpression of sirt1 and altered expression of -catenin showed significant association with better overall survival (p=0.029 and p=0.008, respectively). however, the expression of dbc1 (p=0.221), survivin (p=0.537), and p53 (p=0.218) was not associated with overall survival. the factors considered in the analysis were age, tumor location, tumor stage, histologic grade, and the expression of sirt1 and -catenin. on multivariate analysis, age, tumor stage, histologic grade, and sirt1 expression were independent prognostic factors significantly associated with overall survival. the expression of sirt1 and dbc1 in colorectal cancer was observed in 235 (67%) and 183 (52%) patients with nuclear staining pattern, respectively. 1). sirt1 and dbc1 were not significantly related to clinicopathological features such as age, sex, location, stage, invasion depth of tumor, lymph node metastasis, distant metastasis, or histologic grade (table 1). all of the sampled normal mucosa showed membranous expression of -catenin with weak or moderate intensity. the nuclear and/or cytoplasmic expression of -catenin was observed in 246 (70%) patients (fig. the altered expression of -catenin was correlated with left - located tumor (p=0.001), absence of distant metastasis (p=0.027), and non - poorly differentiation (p=0.026) (table 1). survivin was expressed in all of the normal mucosa with moderate or strong intensity with nuclear staining pattern. the loss of expression of survivin was observed in 156 (45%) patients (fig. the loss of nuclear expression of survivin was correlated with higher t stage (p=0.004) (table 1). cytoplasmic expression of survivin was not related to overall survival or clinicopathological features such as age, sex, location, stage, invasion depth of tumor, lymph node metastasis, distant metastasis, or histologic grade. expression of p53 was positively correlated with tnm stage (p=0.018) and distant metastasis (p=0.001) (table 1). the expression of sirt1 was significantly related to the expression of dbc1 (p<0.001), -catenin (p=0.001), and survivin (p=0.002). the expression of dbc1 was significantly related to the expression of -catenin (p=0.006) and survivin (p<0.001). for univariate analysis of overall survival, a cox proportional hazard model was used (table 3). among analyzed clinicopathologic features, old age (65) (p=0.005), high tnm stage (stages iii and iv) (p<0.001), left - side tumor (p=0.034), invasion of more than the muscularis propria (p=0.024), presence of lymph node metastasis (p=0.001), presence of distant metastasis (p<0.001), and poorly differentiated histologic grade (p=0.001) were significantly associated with shorter overall survival. the overexpression of sirt1 and altered expression of -catenin showed significant association with better overall survival (p=0.029 and p=0.008, respectively). however, the expression of dbc1 (p=0.221), survivin (p=0.537), and p53 (p=0.218) was not associated with overall survival. the factors considered in the analysis were age, tumor location, tumor stage, histologic grade, and the expression of sirt1 and -catenin. on multivariate analysis, age, tumor stage, histologic grade, and sirt1 expression were independent prognostic factors significantly associated with overall survival. the present study examined the immunohistochemical expressions of sirt1, dbc1, -catenin, survivin, and p53 in human colorectal cancer and their relationships with clinicopathologic factors and prognostic significance. only a few studies that have examined expression of sirt1 and its relationship to prognosis in colorectal cancer.8,9 our study is the first to examine expression of sirt1 and its relationship to expression of other related markers, dbc1, -catenin, survivin, and p53 in colorectal cancer with human tissue. as mentioned above, sirt1 might act as a tumor promoter by inhibiting tumor suppressor genes and might also act as a tumor suppressor by repressing several oncogenes.5 - 7 a number of recent studies have revealed that sirt1 expression was increased in many human malignant tumors.3,4 however, the role of sirt1 in human malignant tumors is controversial. some previous studies have reported that sirt1 overexpression was associated with shorter overall survival or poor prognostic indicators in breast and gastric carcinoma.12,15 in contrast to these studies, one study reported that sirt1 expression was gradually decreased as tumor progression and was associated with better overall survival in colorectal adenocarcinoma.8 our study also revealed that expression of sirt1 was significantly related to better overall survival. taken together with these reports, our results suggest that sirt1 expression is related to better prognosis in colorectal cancer and that sirt1 acts differently depending on the specific organ or type of tumor involved. our study examined the expression of dbc1 and its relationship to prognosis in colorectal cancer. a recent study revealed that dbc1 overexpression was related to poor prognosis in colorectal cancer.16 however, our study failed to determine the relationship between the expression of dbc1 and prognosis in colorectal cancer dbc1 is known as negative regulator of sirt1.14 the present study found that the expressions of sirt1 and dbc1 were positively correlated with each other (p<0.001). we could surmise that this result might be due to a close functional relationship between sirt1 and dbc1 in carcinogenesis. however, further functional study will be needed to investigate the relationship between sirt1 and dbc1. -catenin is a key regulator of wnt signaling and is also known as an important regulator in cancer development.17 the adenomatous polyposis coli (apc) protein negatively regulates the wnt signaling pathway.24 the apc gene mutation results in nuclear accumulation of -catenin which becomes phosphorylated and is eventually degraded via the apc - dependent ubiquitin - proteosome pathway.25 in our study, normal colonic mucosa showed membranous staining of -catenin. the altered expression of -catenin was negatively correlated with the presence of distant metastasis and poorly differentiated histologic grade. this is a conflicting result to previous study which reported that altered expression of -catenin was independently associated with poor prognosis in colon cancer.18 therefore, the relationship between -catenin expression and prognosis remains controversial, and further studies on wnt/-catenin and target gene activity and protein expression are needed. survivin is a protein that is an inhibitor of apoptosis, and is overexpressed in various cancers.19 in our study, normal colonic mucosa showed expression of survivin with nuclear staining pattern. some studies have reported that altered expression of survivin was related to poor prognosis in several tumors.26,27 another study reported that cytoplasmic expression of survivin was associated with a poor prognosis, but nuclear overexpression was related to a better prognosis.28 our study also showed that the loss of nuclear expression of survivin was related to advanced invasion depth. cytoplasmic expression of survivin was not associated with prognostic indicators ; however, loss of nuclear expression of survivin may be related to poor prognosis in colorectal cancer. sirt1 is considered to inhibit p53-mediated apoptosis through deacetylation of p53.5 however, there was no relationship between the expression of sirt1 and p53 in our study and a previous study.11 overexpression of sirt1 was related to better overall survival. if sirt1 predominantly acts like a tumor suppressor, it might have less effect on p53 in colorectal cancer. the finding that sirt1 expression was correlated with altered expression of -catenin and survivin which are considered to be oncoproteins, supports the hypothesis that sirt1 predominantly acts as a tumor suppressor and might have less effect on p53 in colorectal cancer. through multivariate analysis, we revealed that sirt1 was an independent prognostic indicator for overall survival but -catenin was not. however, to ensure our hypothesis, further functional study is needed. in summary, although the exact role of sirt1 in colorectal cancer is not clear, nor whether it is a tumor suppressor or promoter, the results of our study suggest that the expression of sirt1 is related to better prognosis and predominantly acts like tumor suppressor in colorectal cancer patients. | backgroundsilent mating type information regulation 2 homolog 1 (sirt1), an nad+-dependent deacetylase, might act as a tumor promoter by inhibiting p53, but may also as a tumor suppressor by inhibiting several oncogenes such as -catenin and survivin. deleted in breast cancer 1 (dbc1) is known as a negative regulator of sirt1.methodsimmunohistochemical expressions of sirt1, dbc1, -catenin, surviving, and p53 were evaluated using 2 mm tumor cores from 349 colorectal cancer patients for tissue microarray.resultsoverexpression of sirt1, dbc1, survivin, and p53 was seen in 235 (67%), 183 (52%), 193 (55%), and 190 (54%) patients, respectively. altered expression of -catenin was identified in 246 (70%) patients. on univariate analysis, overexpression of sirt1 (p=0.029) and altered expression of -catenin (p=0.008) were significantly associated with longer overall survival. expression of sirt1 was significantly related to dbc1 (p=0.001), -catenin (p=0.001), and survivin (p=0.002), but not with p53. on multivariate analysis, age, tumor stage, differentiation, and expression of sirt1 were independent prognostic factors significantly associated with overall survival.conclusionssirt1 overexpression is a good prognostic factor for colorectal cancer, and sirt1 may interact with -catenin and survivin rather than p53. |
uterine mesenchymal neoplasia is a broad category and includes smooth muscle tumors, endometrial stromal tumors (est 's), homologous sarcomas, heterologous sarcomas, sarcomas of uncertain histogenesis, and mixed epithelial and mesenchymal tumors, including uterine tumor resembling ovarian sex cord tumor (utrosct). est 's represent the second most common of these, but are still relatively rare, with malignant subtypes accounting for 60% of the tumor volume. the bilateral adnexa, all eighteen lymph nodes, and omentum were free of metastatic disease as were concurrent abdominopelvic washings. the lg - ess was positive for er, pr, cd10, vimentin, cd56, and calretinin (focal, weak) and negative for inhibin, pan - cytokeratin (pan - ck), epithelial membrane antigen (ema), and placental alkaline phosphatase (plap). the sertoli - like tubules were positive for cd10, vimentin, cd56, calretinin, inhibin, and pan - ck (dot - like perinuclear pattern) and negative for er, pr, ema and plap. the foamy cells were positive for vimentin, cd56, calretinin, and inhibin and negative for cd68, er, pr, ema, and plap (fig. this immunoprofile supports the impression of an endometrial stromal neoplasm involved by sertoli- and leydig cell - like elements. the colonic - type glands were strongly and diffusely positive for ck20 and cdx2 and negative for er. the endometrial glands were strongly and diffusely positive for ck7 and er and negative for ck20. fluorescent in - situ hybridization (fish) analysis of the tumor did not demonstrate rearrangement of the jazf1, phf1, or ywhae genes. the final diagnosis was that of lg - ess with extensive sex cord differentiation and heterologous elements (figo stage ib) with concurrent complex atypical hyperplasia of overlying endometrium. lg - ess is a malignant mesenchymal tumor resembling proliferative - phase endometrial stroma. by definition, permeative invasion into the myometrium and/or lymphovascular invasion ten - year survival for early - stage disease approaches 90% whereas survival for stages iii and iv is only 66%. however, late recurrences are common, even for early - stage disease (up to 56%), and an estimated 1525% of patients die of recurrent disease (rauh - hain and del carmen, 2013). lg - ess typically presents in premenopausal women (mean age 52 years) as an intracavitary polypoid mass or intramural mass (who classification of tumours of female reproductive organs, 2014). cut surfaces are soft, yellow to tan, and may be cystic, hemorrhagic, or necrotic. ill - defined borders with overt myometrial invasion are the norm, and macroscopically appreciable worm - like plugs of tumor within myometrial and parametrial veins are frequent. microscopically, lg - ess is composed of a dense monotonous proliferation of small oval cells with scant cytoplasm, round nuclei, inconspicuous nucleoli, and only mild cytologic atypia. mitotic activity is usually low (< 5 mitotic figures per 10 high power fields), but higher mitotic counts do not preclude a diagnosis of lg - ess. most but not all cases are marked by strong and diffuse immunoreactivity to cd10, vimentin, er, and pr. sex cord - like differentiation within lg - ess recapitulates ovarian granulosa cell or sertoli cell tumors as nests, cords, trabeculae, or tubules of epithelioid cells with variable amounts of cytoplasm, round nuclei, small nucleoli, and minimal mitotic activity. the extent of sex cord - differentiation within a lg - ess is variable and not well characterized in the literature. clement and scully originally described uterine tumors with sex cord - like elements in 1976. they reported six group 1 tumors (est with sex cord - like elements [estscle ]) in which the sex cord - like elements occupied 1040% of tumor volume. subsequent studies have reported similar findings (clement and scully, 1976). in most cases, sex cord - like areas stain with typical sex cord - stromal markers, including inhibin and calretinin (conklin and longacre, 2014, who classification of tumours of female reproductive organs,, oliva, 2014). most lg - ess 's demonstrate recurrent genetic translocations by fish and, of these, 80% harbor the jazf1-suz12 fusion gene (t7;17). a rearranged phf1 gene is identified in the majority of the remaining cases (lee and nucci, 2014). a subset of lg - ess 's without demonstrable genetic rearrangements have been reported, and these are thought to represent variant translocations. utrosct represents the historical group ii tumors described in the original 1976 paper on the subject, and is defined as an endometrial or myometrial neoplasm composed entirely of sex cord - like elements ; endometrial stromal neoplasia is necessarily lacking (clement and scully, 1976). similar to ovarian sertoli - leydig cell tumors, utrosct 's may rarely exhibit heterologous elements, usually enteric epithelium. while estrogen elaboration by ovarian sertoli - leydig cell tumors with consequent endometrial hyperplasia has been described, the co - occurrence of utrosct with endometrial hyperplasia is less well established. the presentation of utrosct is similar to that of lg - ess, but post - operative management differs as utrosct typically has a benign course with limited potential for recurrence (conklin and longacre, 2014, blake., therefore, the distinction between the two entities is important. in cases of utrosct, thorough sampling furthermore, utrosct is almost always well - circumscribed and lacks the extensive myoinvasion typical of lg - ess. lymphovascular invasion is rare in utrosct, and the delicate arteriolar pattern of lg - ess is not present. immunohistochemistry is not of great utility in the differential, but molecular studies have shown utrosct lacks rearrangements of jazf1 and phf1 genes (staats., 2009, nucci., 2014). to our knowledge, this case represents a previously unreported occurrence of extensive sex cord - like differentiation within a lg - ess with concomitant heterologous elements and complex atypical endometrial hyperplasia. while the gross impression of tumor plugs throughout the myometrium strongly favored ess over utrosct, thorough sampling was required to confirm areas of stromal neoplasia in a tumor predominated by sex cord - like and heterologous elements. the usual degree of sex cord differentiation within ess is not well reported ; however, a pubmed.gov search revealed only two prior cases wherein the sex cord elements represented a majority of the tumor volume (fukunaga., 1997). an additional striking feature of this case was the complex atypical hyperplasia of overlying endometrium. while it is possible that the hyperplasia was an incidental synchronous finding, we believe it more likely that the extensive sex cord - like areas produced sufficient unopposed estrogen to locally influence the endometrium. | highlightsendometrial stromal sarcoma (ess) may have sex cord differentiation, usually focal.diagnosis of ess is difficult when variant morphology predominates.prognosis differs between ess and utrosct ; therefore, distinction is critical.extensive tumor sampling is mandatory to identify neoplastic endometrial stroma.sex cord differentiation may be associated with endometrial hyperplasia. |
cytosolic pathogen receptors and their downstream molecules have recently garnered attention in the field of inflammation and innate immunity. one such molecule, the apoptosis - associated speck - like protein containing a caspase recruit domain (asc), is an adapter molecule consisting of a caspase recruit domain (card) and pyrin domain (pyd) that was first identified in our laboratory as a proapoptotic protein [1, 2 ]. the entire cdna of asc cloned by immunoscreening and race (rapid amplification of cdna ends) has revealed that the open reading frame of 585 bp contains a pyd (190 amino acids) and a card (107195 amino acids). according to genbank accession number np 037390, the cdna of asc consists of exon 1 : 190 amino acids, exon 2 : 91110 amino acids, and exon 3 : 111195 amino acids. as for isoforms, an alternatively - spliced form of asc lacking the pgr domain encoded by exon 2 of asc was detected in imr90 human diploid fibroblasts and 90sv fibroblasts by conway., and a short form of asc (192 kda) was found in thp-1 cells by fernandes - alnemri. an asc protein lacking 19 amino acids, which are encoded by exon 2 of asc, is also reported in genbank as isoform b (np 660183). asc functions as a mediator in the cytosol - type inflammatory signaling pathway as well as a downstream molecule in toll - like receptor signaling. asc has been established to activate procaspase-1 through its oligomerization in inflammasomes and process proil-1 and proil-18 into il-1 and il-18, respectively [68 ], leading to the establishment of innate immunity. inflammasomes are formed by nucleoside oligomerization domain (nod) like - receptor (nlr) family members, the adapter protein asc, procaspase-1, and caspase-5 in some form of inflammasome. mutations in the basic components of inflammasomes appear to be responsible for several autoinflammatory diseases ; mutations in the cias1 (cold induced autoinflammatory syndrome 1) gene encoding cryopyrin or in the mefv (mediterranean fever) gene encoding pyrin perturb the function of asc and the consequent activation of procaspase-1 and il-1 processing. asc also plays an important role in an inflammatory form of cell death called pyroptosis [4, 11 ]. during pyroptosis, some ligands activate pyrin by unmasking its pyd in the pyroptosome, thereby allowing it to interact with asc and facilitating asc dimerization into an active asc pyroptosome that activates caspase-1. however, the pyd of pyrin is reported to interfere with the ability of cryopyrin to associate with asc, indicating negative regulation of asc proximity in inflammasomes. since the oligomerization of asc clearly plays a pivotal role in innate immunity and pyroptosis to activate caspase-1 but the function of the pgr domain remains to be clarified, we investigated the regulation of molecular structure and activity of a variant form of asc (vasc) with a missing pgr domain in comparison with that of full length asc (fasc). asc and an unidentified protein x separated by sds page using antihuman asc monoclonal antibody (mbl, nagoya, japan) were excised from a gel after staining with coomassie brilliant blue r-250 and digested using a montage in - gel digest96 kit (millipore.com, massachusetts, usa) according to the manufacturer 's protocol. the purified peptides were then analyzed with -chca (cyano-4-hydroxycinnamic acid) by maldi - tof ms. a voyager elite xl biospectrometry workstation (perseptive biosystem, framingham, ma) equipped with a delayed extraction ion source was used for maldi - tof ms analysis in the reflector mode with the following parameters : accelerating voltage, 22 kv ; grid voltage, 80% of accelerating voltage ; guide wire voltage, 0.05% of accelerating voltage ; and delay time, 200 nanoseconds. calibration was performed using the monoisotopic peaks of the -chca dimer (379.0930 m / z), angiotensin i (1296.6853 m / z), and acth (738 clip) (3657.9294 m / z). the cdnas of human fasc, vasc, procaspase-1, and pro1l-1 were prepared from hl-60 mrna by rt - pcr (rna la pcr kit, takara bio, otsu, japan) and cloned into pcdna3 vectors (invitrogen, carlsbad, ca, usa). the prepared procaspase-1 and proil-1 and even fasc or vasc expression vectors were cotransfected into cos7 cells using fugene6 transfection reagent (roche, mannheim, germany) for transient gene - expression. the cells were dissolved with 1% sds 24 hours after transfection, and then samples were loaded onto an sds - page 615% polyacrylamide gel, transferred to pvdf membranes, and developed by ecl (ge healthcare, buckingham, uk). antibodies of caspase-1 and il-1 were obtained from santa cruz (california, usa). for cellular immunostaining, cells were fixed in a 37% formaldehyde solution, stained with cy3-asc antibody and hoechst 3342, and observed with an immunofluorescense microscope (axiovert s100, carl zeiss, tokyo, japan). il-1 excreted by cos7 cells cotransfected with expression vectors (30 ng procaspase-1 and 100 ng proil-1 with 50 ng fasc or vasc) was measured 24 hours after plating using a human il-1 immunoassay kit (r and d systems, minneapolis, usa) according to manufacturer 's instructions. analysis of variance was performed and the differences between groups in each set were evaluated by fisher 's protected least significant difference test using stat view 5.0 software (sus institute, inc., berkley, ca, usa). all values were expressed as mean standard error (se) of the mean. when hl-60 cells were subjected to sds - page, anti - asc antibody detected one band of 23 kda, which corresponds to fasc, and another of 20 kda, called protein x (figure 1(a), right lane). a mouse igg control is shown in figure 1(a), left lane. affinity - purified polypeptides from hl-60 cell lysates incubated with anti - asc antibody are displayed in figure 1(b). the unknown protein x was then treated by trypsin ingel digestion and analyzed with maldi - tof ms (figure 1(c)), and peptide mass data were subjected to a database search using ms - fit, a peptide mass fingerprinting program from the university of california, san francisco. since the n and c terminal sequences of protein x were confirmed to be the same as fasc but lacked the amino acid sequence corresponding to the pgr domain (figures 1(d) and 1(e)), we were able to identify protein x as vasc lacking a pgr domain. the sequence of vasc cdna from mrna extracted from hl-60 cells is displayed in figure 1(f) and confirms deletion of exon 2 from fasc. this vasc corresponds to a protein reported in the genebank as association number np 660183. thus, protein x was not a degraded asc but rather a variant form of asc derived from alternatively spliced mrna missing exon 2 of the asc gene. next, fasc or vasc cdna expression vectors were transfected into cos7 cells and, 23 kda and 20 kda proteins were induced, respectively (figure 2). both of these exogenously expressed proteins were the same size as the endogenous asc - related products found in hl-60 cells seen in page (figure 1(a)). since the cos7 cells used in transfection experiments were derived from african green monkey kidney fibroblasts, endogenous expression of fasc or vasc was not detected in cos7 cells by antihuman asc antibody. when the expression vectors of procaspase-1 and, proil-1 with fasc or procaspase-1 and proil-1 with vasc were expressed in cos7 cells, the 45 kda band of procaspase-1 decreased in both cases while the activated 20 kda form appeared (figure 3). the expression level of caspase-1 versus fasc in fasc - transfected cells measured using nih imaging from triplicate experiments was not significantly different from that of vasc, indicating that caspase-1 was activated by both fasc and vasc at comparable levels (figure 3). similar findings were observed between the two proteins for the 31 kda band of pro il-1 and the 17 kda - activated form of il-1. additionally, the expression level of il-1 versus fasc in fasc - transfected cells measured using nih imaging from triplicate experiments was not significantly different from that of vasc (figure 3). however, since the level of active il-1 as detected by western blotting was relatively low, we suspected that a large amount of active il-1 could have been excreted from the cells. surprisingly, when we examined il-1 levels in the medium, the amount of il-1 was significantly higher in the vasc transfectants than in the fasc transfectants (n = 3, p <.05, figure 4). representative western blotting data of fasc and vasc from three experiments are displayed in figure 4, under the graph. although protein levels of vasc were smaller than those of fasc, the amount of released il-1 was higher. both products were seen to form fibrous aggregates (figure 5), but fasc formed typical circular fibrous aggregates whereas those of vasc were branched ; almost 40% of fasc - expressing cells exhibited a diffused fasc pattern and 60% of cells formed circular fibrous aggregates, but vasc formed branched fibrous aggregates in all cells expressing it. the homophilic interactions of the n - terminal pyd and c - terminal card domains have been revealed by immunoprecipitation to be involved in the self - association and filament - like aggregation of asc. asc and pyd - family proteins seem to interact via their pyd domain, while the card domain of asc has been shown to bind to the card domain of caspase-1 [1, 17, 18 ]. ectopic expression of full - length asc, but not its isolated card or pyd domains, with procaspase-1 previously induced activation of procaspase-1 and processing of proil-1 in transfected cells. thus, pyd functions as the oligomerization domain, and card functions as the effector domain of asc in the caspase-1 activation pathway. in spite of these discoveries, the role of the pgr domain, which is located between pyd and card, remains unclear. however, the levels of excreted il-1 in the medium was significantly higher in vasc transfectants than in fasc transfectants, and immunostaining revealed remarkable differences in aggregate formation and asc distribution. glycine is known to confer flexibility to protein structures, making them candidates to act as movable hinges. proline motifs are also found in molecular hinges, and -helice conformational changes can be generated by a proline - hinge in transmembrane proteins [20, 21 ]. thus, the pgr domain may impart a bending property to asc and can be considered to be a hinge between the pyd and card domains that is folded in the inactive form of asc (figure 6). our results with the hingeless vasc support this notion in that unfoldable asc may have been constitutively activated and formed branched fibrous aggregates in cells expressing the product. in terms of il-1 released, the preventative effects of glycine on proil-1, but not il-1, released from macrophages and regulation by ca on il-1 release from lysosomes via exocytotic fusion have been reported. the involvement of fasc or vasc in the release of il-1 is unclear, however. together with a strong electric dipole moment of the pyd domain of asc, our present results suggest that the pgr domain may affect the 3-dimensional structure of asc and thus play an important role in the activation of asc. vasc lacking the pgr domain excreted higher levels of il-1 and formed a more fibrous aggregation than fasc. we hypothesize that this domain plays the structural role of a hinge between pyd and card domains. fasc may be in an inactive folded state in the absence of ligands, whereas vasc may be in a permanently active state. | the apoptosis - associated speck - like protein containing a caspase recruit domain (asc) is involved in apoptosis and innate immunity and is a major adaptor molecule responsible for procaspase-1 activation. asc mrna is encoded by three exons : exons 1 and 3 encode a pyrin domain (pyd) and caspase recruit domain (card), respectively, and exon 2 encodes a proline and glycine - rich (pgr) domain. here, we identified a variant asc protein (vasc) lacking the pgr domain that was smaller than full length asc (fasc) derived from fully transcribed mrna and searched for differences in biochemical and biological nature. both fasc and vasc were found to activate procaspase-1 to a similar degree, but the efficiency of il-1 excretion was significantly higher for vasc. there was also a marked structural difference observed in the fibrous aggregates formed by fasc and vasc. these results suggest that although the pgr domain is dispensable for procaspase-1 activation, it plays an important role in the regulation of the molecular structure and activity of asc. |
noncentrosymmetric (ncs) materials, that is, compounds that do not possess a crystallographic inversion center, are of technological interest owing to their functional ferroelectric, pyroelectric, piezoelectric, nonlinear optical (nlo), and multiferroic behaviors. the design and synthesis of ncs materials remains an ongoing challenge as competing bonding forces often result in centrosymmetric structures. nonetheless, a number of design strategies toward the creation of new ncs materials have been reported. we have focused on designing new ncs compounds by using cations susceptible to second - order jahn teller (sojt) distortion : octahedrally coordinated d transition - metal cations and lone - pair cations. to achieve and enhance acentric polyhedra and inversion symmetry lifting distortions in crystalline materials, anionic substitution was developed. because fluoride carbonates constructed from [(co3)xfy ] polyhedra are known to naturally occur in minerals, they have garnered considerable attention owing to accessible hydrothermal synthetic methods. second - harmonic generation (shg) has been observed in rare - earth fluorocarbonates na8lu2(co3)6f2 and na3lu(co3)2f2, with efficiency of approximately 4 potassium dihydrogen phosphate (kdp) (160 -sio2). also, a series of alkaline alkaline - earth fluorocarbonates, abco3f (a = k, rb, cs ; b = ca, sr, ba), was reported to be shg active. these two families of materials have a wide transparency range between 200 and 800 nm. in addition, several centrosymmetric (cs) fluorocarbonates have been discovered, including naybco3f2, na2yb(co3)2f, na2euco3f3, na3la2(co3)4f, bamco3f2 (where m = mn, cu, and zn), and ba2co(co3)2f2. recently, we reported the synthesis and characterization of two new fluorocarbonates that incorporate a lone - pair cation these materials exhibit the inherently asymmetric building blocks pb(co3)3f and pb(co3)3f2, which may be linked to create optically functional new ncs materials. fluorocarbonate family resulted in the discovery of two ncs materials rbpbco3f and cspbco3f. cspbco3f was recently reported, and it was suggested that the p interaction between pb and co3 is responsible for the large shg response of 13.4 kdp (530 -sio2). remarkably, it was reported that pb is stereochemically inactive, and model electronic structure calculations on molecular pbco3 units identified enhanced covalent interactions at the origin of the shg response upon inspection of the real space extent of the molecular orbitals characterizing the highest occupied and lowest unoccupied states. in this paper, we report the synthesis, crystal structure, characterization, and atomic scale acentric property relationships of rbpbco3f and cspbco3f. the second harmonic response and piezoelectric coefficients are determined and correlated to the locally polar pbo6f2 units with the oxygen ligands associated with the cooperatively aligned triangular carbonate units. we disentangle the contribution of the acentric displacements in the achiral and nonpolar structures from the proposed electronic polarizability mechanisms using a scheme proposed by wu. and validated by cammarata. in this regard, recent applications of group representation theory and mode crystallography inspired by chen s anionic group theory are applied in combination with density functional calculations that treat on equaling footing the point and translation periodicity of the system to address the microscopic origin for the nlo behavior. we find that the local pb coordination environment is acentric and that the ionic covalent balance among bridging ligands is highly anisotropic, suggesting that analysis of charge - density contours may be insufficient to deduce pb lone pair inactivity. rather, the application of a mode - polarization analysis and quantitative evaluation of dynamical charges provides an improved structural descriptor of the shg response, which opens a path to understand the acentric properties of other known three - dimensional (3d) fluorocarbonates. rbf, csf (alfa aesar, 99.5%), pb(oac)23h2o, pbf2, pbco3 (sigma - aldrich, 99.9%), meoh (sigma - aldrich, 99%), and cf3cooh (sigma - aldrich, 99%) were used as starting materials. crystals of rbpbco3f and cspbco3f were grown by solvothermal techniques using a mixture of methanol and trifluoroacetic acid as a solvent. for rbpbco3f, the reaction mixture of 0.379 g (1.00 10 mol) of pb(oac)23h2o, 0.627 g (6.00 10 mol) of rbf, 1.00 ml (2.47 10 mol) of methanol, and 1.00 ml (1.29 10 mol) of trifluoroacetic acid were placed in a 23 ml teflon - lined stainless steel autoclave. the autoclave was closed, gradually heated up to 180 c, held for 24 h, and then slowly cooled to room temperature at a rate of 6 c h. the solid products were isolated from the mother liquor by vacuum filtration and washed with ethanol. under the same conditions, crystals of cspbco3f were grown separately by using 0.379 g (1.00 10 mol) of pb(oac)23h2o, 0.608 g (4.00 10 mol) of csf, 1.25 ml (3.09 10 mol) of methanol, and 1.25 ml (1.61 10 mol) of trifluoroacetic acid. colorless trigonal prism - shaped crystals, subsequently determined to be rbpbco3f and cspbco3f, were obtained in approximately 60% and 70% yields, respectively, based on pb(oac)23h2o. the reported compounds are slightly hygroscopic ; thus, the products were stored in a vacuum desiccator. polycrystalline rbpbco3f and cspbco3f were synthesized by conventional solid - state techniques. for rbpbco3f, stoichiometric amounts of dried rbf (0.418 g, 4.00 10 mol) and pbco3 (1.07 g, 4.00 10 mol) were thoroughly ground and pressed into a pellet. the pellet was placed in an alumina boat that was heated to 280 c in flowing co2 gas, held for 3 d, and then cooled to room temperature at a programmed rate of 180 c h. for cspbco3f, stoichiometric amounts of dried csf (0.608 g, 4.00 10 mol) and pbco3 (1.07 g, 4.00 10 mol) were thoroughly ground and pressed into a pellet. the pellet was placed in an alumina boat that was heated to 270 c in flowing co2 gas, held for 3 d, and then cooled to room temperature at a programmed rate of 180 c h. the materials were determined to be pure by powder x - ray diffraction (supporting information, figure s1). a colorless trigonal prism crystal (0.20 0.12 0.12 mm) and a colorless plate - shaped crystal (0.20 0.12 0.08 mm) were selected for single - crystal diffraction analysis. data were collected on a bruker duo platform diffractometer equipped with a 4k ccd apex ii detector using graphite - monochromated mo k radiation. as rbpbco3f and cspbco3f are slightly sensitive to moisture, single - crystal diffraction analyses were performed at a moderately low temperature, 213(2) k, utilizing liquid nitrogen. for each sample, a hemisphere of data (1519 frames at 6 cm detector distance) was collected using a narrow - frame algorithm with scan widths of 0.30 in and an exposure time of 35 s per frame. rbpbco3f and cspbco3f crystals were found to have slight nonmerohedral and merohedral twinning, respectively. data were integrated using the bruker - nonius saint program, with the intensities corrected for lorentz factor, polarization, air absorption, and absorption attributable to the variation in the path length through the detector faceplate. the positions of the lead atoms were determined by direct methods using shelxs-97, and the remaining atoms were located by difference fourier maps and least - squares cycles, utilizing shelxl-97. selected bond distances and angles, atomic coordinates, and equivalent isotropic displacement parameters were deposited in the supporting information (tables s1s3). rw(fo) = [w(fo fc)/w(fo) ] powder x - ray diffraction (pxrd) measurements on rbpbco3f and cspbco3f materials were performed using a panalytical xpert pro diffractometer equipped with cu k radiation. data were collected in the 2 range of 570 with a step size of 0.008 and a scan time of 0.3 s. no impurities were observed, and the experimental and calculated pxrd are in very good agreement (supporting information, figure s1). the fourier transform infrared spectroscopy (ftir) spectrum for rbpbco3f was collected on a bruker tensor 37 ftir with the use of a kbr pellet pressed at 15 000 psi. a total of 64 scans were recorded, and a background spectrum was subtracted (supporting information, figure s2). visible (uv vis) reflectance data of rbpbco3f were collected on a varian cary 500 scan uv vis - nir spectrophotometer over the 2002000 nm spectral range at room temperature. the reflectance spectrum was converted to absorption using the kubelka munk function (supporting information, figure s3). approximately 20 mg of rbpbco3f was placed separately in a platinum pan and heated at a rate of 10 c min from room temperature to 900 c under flowing n2 (supporting information, figure s4). a jeol jsm 6330f scanning electron microscope equipped with an electron dispersive spectrometer was used to determine the rubidium - to - lead ratio. the collected crystal of rbpbco3f was mounted on one flat face and coated with 25 nm thickness carbon. three analyses on this sample were obtained with a focused beam of 15 kev of accelerating voltage and 12 a of emission current, one on each of the three visible faces. powder shg measurements were performed on a modified kurtz nonlinear optical (nlo) system using a pulsed nd : yag laser with a wavelength of 1064 nm. a detailed description of the equipment and methodology has been published. as the powder shg efficiency has been shown to strongly depend on particle size, rbpbco3f and cspbco3f were ground and sieved into distinct particle size ranges (90 m). relevant comparisons with known shg materials were made by grinding and sieving crystalline -sio2 and linbo3 into the same particle size ranges. converse piezoelectric measurements were performed using a radiant technologies rt66a piezoelectric test system with a trek (model 609 10) high - voltage amplifier, precision materials analyzer, precision high voltage interface, and mti 2000 fotonic sensor. rbpbco3f and cspbco3f were pressed into pellets (1.2 cm diameter, 0.7 mm thickness) and sintered at 260 c for 3 d. silver paste was applied to both sides of the pellet, and the pellet was cured at 250 c for 12 h. for all of the structural figures, the program vesta was used. first - principles density functional theory (dft) calculations were carried out using the vienna ab initio simulation package (vasp) within the pbesol generalized - gradient approximation with a planewave cutoff of 540 ev. the projector augmented - wave (paw) method was used to treat the interaction between the core and valence electrons with pseudopotentials constructed with the following valence configurations : 5s5p6s (cs), 4s4p5s (rb), 6s6p (pb), 2s2p (c), 2s2p (o), and 2s2p (f). in all calculations an 8 8 8 -centered k - point mesh and the linear tetrahedron method with blchl corrections was applied for sampling and brillouin zone integrations, respectively. all dft calculations were performed on ordered fluorine structural variants (100% occupancy) with an averaged atomic position (2/3,1/3,0) for rbpbco3f and (0,0,1/2) for cspbco3f. rbpbco3f exhibits a 3d crystal structure consisting of corner - sharing pb(co3)3f2 polyhedra (see figure 1). the pb cations are connected to carbonate groups in the ab - plane, and along the c - axial direction the connectivity is through bridging fluorides. the rb cations are located in the cavities formed between pb(co3)3f2 polyhedral building units. in this structure model, the bridging fluorine is observed to be statistically disordered in the ab - plane, resulting in a pb f pb angle of 170.8(9). in connectivity terms, the material may be written as [pb(co3)3/3f2/2 ], with charge balance maintained by one rb cation. each pb cation is bonded to six oxygen atoms and two fluorine atoms in a distorted hexagonal bipyramidal coordination environment, with pb o distances of 2.6864(8) and pb f distances of 2.421(7). the rb cation is surrounded by six oxygen atoms and three fluorine atoms, with rb o distances of 3.010(3) and rb f distances of 3.00(4). bond valence calculations resulted in values of 1.11, 1.97, and 3.93 for rb, pb, and c, respectively (supporting information, table s4). the anisotropic displacement parameters of rbpbco3f are depicted in figure 2 as ellipsoid diagrams. (a) ball - and - stick model in the ab - plane. note that the f atoms, which were refined to be disordered, have well - behaved thermal parameters. for cspbco3f, we noted discrepancies between our structure and the recently reported one during our data collection and refinement. in the reported structure, the bridging fluoride was entirely ordered in a 6m2 crystallographic site, resulting in a symmetric bridge having identical pb f distances of 2.5536(7). also, the equivalent isotropic displacement ueq for f was significantly greater than those for other atoms. in addition, the bond valence sum value of pb was reported to be 1.686, which can be considered to be fairly under - bonded. our data clearly reveal that the bridging f atom is statistically disordered along the c - axis direction. similar to rbpbco3f, cspbco3f also exhibits a 3d structure consisting of corner - sharing pb(co3)3f2 polyhedra (see figure 3). the pb cations are connected by carbonate groups in the ab - plane, and along the c - axis direction the connectivity is through a bridging fluoride. the cs cations are located in cavities formed between pb(co3)3f2 polyhedral building units. the static disorder of the bridging fluoride along the c - axis direction results in a shorter and a longer pb f distance. the pb cation is observed in a distorted hexagonal bipyramidal environment, with pb o distances of 2.709(2) and pb f distances of 2.23(3) and 2.88(3). in connectivity terms, the material may be written as [pb(co3)3/3f2/2 ], with charge balance maintained by one cs cation. the cs cation is surrounded by six oxygen atoms and three fluorine atoms, with cs o distances of 3.136(7) and cs f distances of 3.131(3). bond valence calculations resulted in values of 1.20, 1.89, and 3.84 for cs, pb, and c, respectively (supporting information, table s5). representations of cspbco3f. only one position of the disordered bridging fluoride in the structure is shown. the ir spectrum of rbpbco3f revealed c o vibrations between 1400 and 680 cm. the strong broad band observed at 1410 cm can be assigned to the stretching c o vibration. the out - of - plane vibration, (oco), is observed in the range of 840830 cm as a medium band, and the bending vibration, (oco), should appear between 700 and 670 cm as a medium weak band. a strong band, however, was observed in the range of 700670 cm, which can be attributed to the overlap between the bending vibration (oco) and the stretching vibration (pb o). the (pb f) vibration is observed at 400 cm. the ir spectrum was deposited in the supporting information (figure s2). the uv vis diffuse reflectance spectrum revealed that the absorption energy for rbpbco3f is approximately 4.1 ev (302 nm). munk function.where r represents the reflectance, k represents the absorption coefficient, and s represents the scattering factor. the uv vis diffuse reflectance spectrum was deposited in the supporting information (figure s3). the thermal behavior of rbpbco3f was investigated using thermogravimetric analysis (tga) and differential thermal analysis (dta) under n2 atmosphere. the decomposition of material begins at approximately 300 c, corresponding to the loss of co2. the endothermic peaks in the heating curve are consistent with the decomposition of the material. at approximately 755 c, the drop in mass observed in the tga plot is likely attributable to the loss of fluorides. the exothermic peaks in the cooling cycle indicate recrystallization of the residues of rbpbco3f occurred at approximately 860 and 760 c. that is confirmed by the appearance of two different modifications of lead(ii) oxide, that is, pbo (p4/nmm) and pbo (pbcm), in the powder xrd pattern of the residuals. the dta / tga diagrams and powder xrd spectra for rbpbco3f were deposited in the supporting information (figures s4 and s5). the semiquantitative energy - dispersive x - ray spectroscopy (eds) measurements were taken three times from the selected rbpbco3f crystal that was used for x - ray diffraction analysis. the average rb / pb ratio of 1.06(9) found by eds is in excellent agreement with the value of 1.00 determined by least - squares refinement of the x - ray data. since rbpbco3f and cspbco3f crystallize in the ncs space group p6m2, we investigated the shg and piezoelectric properties. powder shg measurements using 1064 nm radiation revealed an shg efficiency of approximately 250 and 300 -sio2, respectively, in the 4563 m particle size range. additional shg measurements, particle size versus shg efficiency, indicate both materials exhibits type 1 phase - matching behavior. as such rbpbco3f and cspbco3f fall into the class a category of shg materials, as defined by kurtz and perry (see figure 4). on the basis of these measurements, we estimate an average nlo susceptibility deffexp of approximately 17 pm / v and 20 pm / v for the rb and cs phases. although estimating the average nlo susceptibility solely from powders tends to overestimate deffexp, our powder - shg results for cspbco3f are consistent with those reported earlier. converse piezoelectric measurements on rbpbco3f and cspbco3f were also performed, and piezoelectric charge constants d33 of approximately 72 pm / v and 94 pm / v, respectively, were determined (see figure 5). figure 6 shows the atom - resolved densities of states (dos) for rbpbco3f (upper panel) and cspbco3f (lower panel). first, we obtain a band gap of 3.18 and 3.31 ev for rbpbco3f and cspbco3f, respectively, (at the dft - pbesol level), consistent with the concept that cs expands the lattice and makes the compound more ionic. the two - photon electronic excitation involved in shg is between states across these gaps. here we find that the onset of the valence band (vb) edge is sharper in cspbco3f and the bandwidth is much narrower (by 1 ev) compared to the rbpbco3f material, which is consistent with the observed larger shg response in the cs compound over the rb phase. in both structures the frontier orbitals in the vb are largely derived from the o 2p states of the [co3 ] group mixed with the nearly spherically symmetric 6s electrons of the pb cation ; the low - lying states in the conduction band are mainly composed of the pb 6p states. this electronic configuration is ideal for the electric field of an incident photon to produce an acentric and polarized charge distribution, because of the even odd parity mixing of the states in the lowest unoccupied molecular orbital and highest occupied molecular orbital. the alkaline metal states are deep in the valence band (data not shown), centered at 9 ev (pb) and ranging from 7 to 5 ev (cs) ; therefore, they should not largely influence the optical transition. the role of these large metal cations is to provide the crystalline lattice topology for the packing of the shg - active pbco3 groups, which we explore in more detail from a structural perspective below. as discussed earlier, in the rbpbco3f structure, the statistical disorder of the bridging f atom in the ab - plane results in a pb f pb angle of 170.8(9). this specifically disordered fluorine was also observed in k2.70pb5.15(co3)5f3 with a corresponding pb f pb angle offset by about 10 from 180. with respect to the cspbco3f structure, the f atom was initially also refined on a 6m2 site (0,0,1/2) midway between pb atoms, which created a symmetrically bridged linear chain along the c - axis. however, it was noted that u33, the component of the anisotropic displacement along the c direction, was very large, which was also observed in the previously reported cspbco3f structure. the large u33 clearly indicated that the f atom was not actually on the 6m2 site, but instead was displaced by a significant distance, 0.32, from this crystallographic site in a disordered arrangement. the z - coordinate parameter was allowed to refine independently rendering a converged value of 0.4360(4), and the anisotropic displacement parameters of the f atom is well - behaved (see figure 2). attributable to the disorder, shorter (2.23(3)) and longer (2.88(3)) pb as would be expected, the pb f distances in our structural model are different from the previous report, where two pb f distances are 2.5536(7). also, in our model there is an improvement in bond valence sum for pb in our structure compared to the reported value, 1.89 versus 1.686. further examination of the two related materials, rbpbco3f and cspbco3f, reveals some similarities and differences in the crystallographic architecture. these materials both crystallize in the hexagonal p6m2 space group with the a and b unit cell parameters nearly identical (5.3488(12) versus 5.393(3) for the rb and cs compounds, respectively) since the parameters are defined by the pb(co3)3 bonding patterns. the c - axes, however, are different (4.8269(12) (rb) vs 5.116(2) (cs)), and these are a function of the pb f distances associated with the size of the alkaline cation (see figures 1 and 3). rbpbco3f and cspbco3f are structurally similar and built up from the pb(co3)3f2 building units. with respect to the a cations, the effective ionic radii are 1.63 and 1.78 for rb and cs, respectively. if we replace rb with the larger cation cs in the structure, we notice that the cavity separation is not very big. in other words, when the larger cation cs is introduced into the crystal structure, the structural strain is produced inside the cavities between the pb(co3)3f2 frameworks. to minimize this strain, the pb(co3)3 layers need to slightly separate along the c - direction to accommodate the larger cation cs. this phenomenon is clearly observed in the increase of the c - axis of unit cell parameters (see table 1). the c - axis of cspbco3f is longer than that of rbpbco3f, whereas the a- and b - axes remain essentially constant. for fluorocarbonate materials, the spatial arrangement of the acentric carbonate groups with respect to the overall structure has been previously described. it has been observed that in fluorocarbonates, the co3 group may be parallel or inclined with regard to the rest of the structure. the carbonate groups in rbpbco3f and cspbco3f are parallel to the entire structures, which is similar to other 3d fluorocarbonates such as ksrco3f, rbsrco3f, and kcaco3f. along the c - axis, the eclipsed and staggered arrangements of the carbonate groups were observed in our kpb2(co3)2f and k2.70pb5.15(co3)5f3, whereas the acentric co3 groups in rb and cs members of this family are found to align in a coplanar and coparallel fashion with respect to the overall structural architecture, which should produce a structural contribution to the observed shg efficient. in rbpbco3f and cspbco3f, the asymmetric coordination environments of the pb atoms are polar, that is, each pbo6f2 polyhedron exhibits a local dipole moment. since the structures are composed of pbo6f2 polyhedra with equal polarization magnitudes but are aligned in opposite directions, the net dipole moments in these materials are zero. first, we examine in more detail the electronic structure and charge - density distribution by computing the electron localization function (elf) for both rbpbco3f and cspbco3f (supporting information, figure s6). consistent with ref (59), we find that there is an asymmetric electron density arranged about the oxygen atoms forming the carbonate group, which is repeated in a cloverlike pattern. interestingly, the electronic density about the pb sites is nearly symmetric and resembles a reuleaux (rounded equilateral) triangle when viewed in projection (figure 7a). the pb cation is located at the center of the triangle, which is formed by the space shared by three equivalent circles, each of which has a center tangent to the other and is simultaneously collinear with the nearest - neighbor carbon atoms. as a result, the charge density on any side of the pb cation remains equidistant to the opposite vertex of maximum density (arrowed) and thus may become highly polarizable along the reuleaux triangle vertices, that is, in the [110 ],, and [110 ] directions upon excitation by the electric field of an incident photon. reuleaux triangle projection overlaid on charge - density contours of the elf in the (001) plane about the pb site in rbpbco3f. elf plot in the (120) plane corresponding to a planar slice along the direction intersecting the vertex of the reuleaux triangle. the red, silver, brown, and maroon spheres correspond to oxygen, fluorine, carbon, and lead atoms, respectively. indeed, projection of the elf plot along the normal to these directions reveals that charge density about the pb site is unevenly distributed in the plane (figure 7b). the bloated electron density extends further along the positive a direction than it does along the negative a direction in the (120) plane. this is evident by comparing the high electron - density regions about the pb site with the pb interestingly, the electron localization about the fluorine anions is also highly anisotropic (figure 7b), which manifests in our born effective charges (z) for fluorine (supporting information, table s6). we find dynamical charges of z11 = 0.7 and z33 = 3.3, whereas the nominal ionic value is 1. the anomalous value for z33 is indicative of an electric polarization to develop along the 6-fold axis since z is the proportionality constant between the electric field and the force applied on the ion by the field. the reduced value in the basal plane suggests real - space charge transfer and more ionic character. similar anomalous values are found for pb (supporting information, table s6), albeit in the basal plane, owing to the strong dynamic charge transfer along the pb o bond linked with the carbonate groups consistent with ionic covalent character of the fluorocarbonates. thus, while in the ground state these fluorocarbonates may not present an obvious lobe of electron density corresponding to well - defined static lone - pair, the charge density about the pb is indeed asymmetric, and the excited state structure should display large pb lone - pair activity. we next explore how the atomic structure supports the bonding interactions giving rise to these density distributions and use a structural approach to explain contributions to the acentric properties. we compute the total mode - distortion vector for each compound following the procedure described by wu. note that we were unable to identify a pseudosymmetric centrosymmetric structure that obeyed constraints on integer stoichiometry attributable to wyckoff site splitting ; therefore, we perform the analysis using an idealized p6m2 structure (supporting information, table s7), while including the fractional site occupancies. we find the amplitude of the mode - polarization vectors to be 0.48 and 0.55 for rbpbco3f and cspbco3f, respectively, with the main atomic displacements connecting the idealized structures via distortions of the anionic network from oxygen and fluorine displacements in the ab - plane. next, we obtain the specific acentric - mode displacements (samd), which correspond to the normalized amplitude of the inversion lifting displacements described by the mode - polarization vector per unit cell volume. we find values of 4.03 10 / cm and 4.29 10 / cm in rbpbco3f and cspbco3f, respectively. consistent with the acentric mode displacement analysis, we find that the converse piezoelectric charge coefficients d33 for rbpbco3f (72 pm / v) is lower than that of cspbco3f (94 pm / v). these values are larger than those observed in -sio2 (2.3 pm / v), linbo3 (15 pm / v), and k2.70pb5.15(co3)5f3 (20 pm / v), and are similar to those of ba1xlaxti1xcrxo3 (70 pm / v) and (bi0.5na0.5)0.95ba0.05tio3 (95 pm / v). the structural origin of the piezoelectric behavior may also be attributable to the magnitude of the samd, because when the voltage is applied the sample undergoes macroscopic strain that is mediated by strain - polarization coupling owing to the coparallel arrangement and constructive interaction of the electronically flexible carbonate units. the more total polarizability the material arises, the greater piezoelectric response is observed. on the basis of the understanding formulated for the fluorocarbonates synthesized in this work and the fact that the samd metric provides a meaningful way to measure the deviation from centricity for structures with different cell volumes, we now explore the correlations between the countercations (alkaline) and central metal sites in the broader family of known 3d alkaline metal fluorcarbonates, including those reported elsewhere (see table 2). figure 8 shows the variance in the metal ionic radii positively correlates with the samd in am fluorocarbonates, which cluster into two distinct groups indicated by filled circles (red symbols) and squares (blue symbols). the best linear fit to the data (gray line) gives a cross - correlation coefficient of 0.82, indicating that the ionic radii size mismatch between the alkali and divalent cations provides a reasonable measure of the acentricity of the structure. as the cation variance increases, the amplitude of the inversion breaking distortions increase (samd becomes larger), which is indicative of an enhanced structural contribution to the shg response. above a value of approximately 0.07, which separates the fluorocarbonate compounds into two clusters, a unit cell tripling is observed. the volume change coincides with the crossover from a carbonate topology with fully aligned triangular moieties to one with rotated and antialigned triangular units (figure 8, inset). note that the rbpbco3f and cspbco3f compounds synthesized in this work are found below that transition region with the two largest samd values in the fluorocarbonate grouping distinguished by fully aligned [co3 ] triangles. (a) relationship between the alkali metal and divalent cations in 3d fluorocarbonates and the samd. all structures exhibit the d3h point symmetry, with the different symbols (colors) corresponding to compounds with z = 1 (, red) or z = 3 (, blue) separated by a vertical bar (gradient). the gray line is a linear least - squares fit to the data (r = 0.82). insets depict the [co3 ] topology, with other atoms omitted for clarity. shg efficiency for the same compounds relative to (b) the total samd and (c) the reduced samd obtained from displacements on the (210) plane. a simplistic view of this correlation suggests that the nlo response should increase with the value of the specific acentric - mode displacements. figure 8b shows the experimentally measured shg intensity relative to that of kdp with respect to the calculated samd values for each compound. the differentiation between the fluorocarbonates with z = 1 and z = 3 becomes increasingly apparent. despite an increase in the samd value, the antialignment of the carbonate groups for z = 3 rbcaco3f and cscaco3f reduces the shg response. thus, for achiral and nonpolar compounds, a large samd value does not guarantee that a large nlo response will result ; the relative orientation of the displacements contributing to the mode - polarization amplitude need to be considered. this becomes more evident if the acentric displacements used in the samd calculation are projected onto a plane of reduced symmetry, for example, the (210) plane corresponding to a vertex of the reuleaux triangle along which the pbo6f2 exhibit local dipoles, as a way to separate the contributions to samd from those acentric distortions that occur because of the change in translational symmetry. for structures with z = 1 and space group p6m2, this coincides with a mirror plane that is absent in the z = 3 p62 m structures. figure 8c shows that the reduced quantity obtained in that plane, samd|(210), is less than the full value of the samd, because it provides a measure of the local acentric displacements relative to these crystal symmetries rather than the cooperative effect. thus, while the rbcaco3f and cscaco3f structures appear to be more distorted relative to those fluorocarbonates synthesized here (figure 8a), that is, the large samd value derives largely from the rotations of the carbonate groups that lead to the antialignment and cell tripling distortion, the additive nature of the acentric moieties leads to a net reduction in shg. indeed, a least - squares linear fit of the reduced acentricity descriptor (figure 8c), which only considers such displacements relative to directions of symmetries that generate enantiomorphic pairs, is positively correlated with the experimental shg intensity (r = 0.94). the analysis of local displacements relative to inversion generating operations is important when explaining the shg efficiency of nonpolar but noncentrosymmetric crystal structures and it provides an intuitive way to understand the relationships between acentric physical properties and missing symmetry elements. we synthesized and characterized two acentric alkali - metal lead fluorocarbonates, namely, rbpbco3f and cspbco3f. both materials exhibit achiral and nonpolar noncentrosymmetric 3d structures. powder shg measurements revealed efficiencies of approximately 250 and 300 -sio2 with d33 piezoelectric charge constants of approximately 72 and 94 pm / v for rbpbco3f and cspbco3f, respectively. samd analyses reveal that the nonlinear optical response is derived from the locally polar pbo6f2 units and the cooperatively aligned triangular carbonate units. importantly, we find that large inversion symmetry lifting distortions, i.e. large samd values, which sum to form the mode - polarization amplitude, do not guarantee a large shg response ; the relative orientation of the displacements contributing to the mode - polarization amplitude need to be taken into account when discussing acentric structure property relationships especially for achiral and nonpolar acentric structures. by examining the anisotropy in the charge distribution and dynamical charges, we identified key directions of reduced symmetry in the fluorocarbonate crystal structures that provide a positive correlation between the amplitude of the atomic displacements and the shg. this analysis enabled a quantitative assessment and atomic scale explanation of the origin of the enhanced frequency doubling in cspbco3f compared to rbpbco3f. we plan to explore the generality of this conclusion in a variety of acentric materials beyond fluorocarbonates, with structures crystallizing in polar, nonpolar, chiral, and achiral symmetries. | two lead fluorocarbonates, rbpbco3f and cspbco3f, were synthesized and characterized. the materials were synthesized through solvothermal and conventional solid - state techniques. rbpbco3f and cspbco3f were structurally characterized by single - crystal x - ray diffraction and exhibit three - dimensional (3d) crystal structures consisting of corner - shared pbo6f2 polyhedra. for rbpbco3f, infrared and ultraviolet visible spectroscopy and thermogravimetric and differential thermal analysis measurements were performed. rbpbco3f is a new noncentrosymmetric material and crystallizes in the achiral and nonpolar space group p6m2 (crystal class 6m2). powder second - harmonic generation (shg) measurements on rbpbco3f and cspbco3f using 1064 nm radiation revealed an shg efficiency of approximately 250 and 300 -sio2, respectively. charge constants d33 of approximately 72 and 94 pm / v were obtained for rbpbco3f and cspbco3f, respectively, through converse piezoelectric measurements. electronic structure calculations indicate that the nonlinear optical response originates from the distorted pbo6f2 polyhedra, because of the even odd parity mixing of the o 2p states with the nearly spherically symmetric 6s electrons of pb2 +. the degree of inversion symmetry breaking is quantified using a mode - polarization vector analysis and is correlated with cation size mismatch, from which it is possible to deduce the acentric properties of 3d alkali - metal fluorocarbonates. |
the danish board of health has defined a clinical quality database as : [] a register containing quantitative indicators, which are based on the individual patient trajectory and can elucidate the overall quality or parts of the overall quality of the health care system s activity and results for a defined group of patients.1 [] a register containing quantitative indicators, which are based on the individual patient trajectory and can elucidate the overall quality or parts of the overall quality of the health care system s activity and results for a defined group of patients.1 the aim of the danish palliative care database (dpd) is to monitor, evaluate, and improve the clinical quality of specialized palliative care (spc) (ie, the activity of hospital - based palliative care teams / departments and hospices) in denmark.2 the study population for dpd is all patients in denmark who have been referred to spc and / or have been admitted to spc. patients who have been referred to or have been admitted to spc prior to the opening of dpd (january 1, 2010) are not part of the study population and are not included in the database. the reason for including referred patients who have not been admitted to spc is that access to spc was judged to be an important aspect of quality : at the time when the dpd was designed, it was often reported in media that particularly the hospices had to decline access due to insufficient capacity. being admitted to spc requires the initiation of palliative care, ie, at least one consultation between the patient and the spc unit in any location (the patient s home, the spc unit, a non - spc hospital department, etc). a patient who has only had contact with the spc unit via telephone or who has only been evaluated with regard to eligibility is not regarded as having been admitted to spc. each patient is registered once in dpd by each spc unit receiving a referral of or admitting the patient. thus, a patient having had contact with more than one spc unit will appear with one registration for each of these spc units. the same is the case for a patient who has been referred to more than one spc unit but was not admitted to any of these units. between 2010 and 2014, 41,104 cancer patients were registered in dpd (2010 : 6,041 ; 2011 : 7,904 ; 2012 : 8,743 ; 2013 : 8,982 ; and 2014 : 9,434). in addition, patients with other diagnoses such as respiratory, cardiovascular, and neurological diseases (in 2014 : 4% of all patients) are registered. according to the rules for clinical quality databases approved by the danish board of health, table 1 lists all variables and their categories and indicates the variables that are used to estimate the following five quality indicators : proportion of referred, relevant patients who were actually received in spc.proportion of patients who waited < 10 days before admission to spc.proportion of patients who died from cancer and who obtained contact with a spc.proportion of patients screened with european organisation for research and treatment of cancer quality of life questionaire - core-15-palliative care (eortc qlq - c15-pal)3 questionnaire at admission to spc.proportion of patients discussed at a multidisciplinary conference proportion of patients screened with european organisation for research and treatment of cancer quality of life questionaire - core-15-palliative care (eortc qlq - c15-pal)3 questionnaire at admission to spc. proportion of patients discussed at a multidisciplinary conference. in addition to the variables needed for the quality indicators, the dpd includes clinical and sociodemographic variables and patient - reported outcomes at baseline (eortc qlq - c15-pal scores). problems related to these issues were often publicly debated before the creation of the dpd, and there was no national data available. the third indicator is a bit untypical by being a measure of access at the regional level. when developing the dpd, there was no knowledge as to whether the proportion of cancer patients who were admitted to spc was similar in different parts of the country or whether this proportion corresponded to figures in other countries. this indicator will be subdivided into different types of contact (in - patient, out - patient, home visit, and consultation at non - spc hospital department) when linking with the danish national patient register has been established (work in progress). there is evidence that not all the patients symptoms and problems are detected if a systematic assessment is not conducted.46 this motivates the fourth quality indicator, which requests that the patient has completed the eortc qlq - c15-pal questionnaire at the day of first contact with spc or up to 3 days before. the eortc qlq - c15-pal3 is an abbreviated version of the internationally most widely used instrument assessing health - related quality of life in cancer patients, the eortc qlq - c30, which was developed by the european organization for research and treatment of cancer.7,8 to develop an instrument with minimal patient burden while preserving the advantages of (and comparability with) a well - validated instrument used in thousands of studies, the qlq - c15-pal was established by reducing the qlq - c30 from 30 to 15 items by shortening scales and by deleting the items that were not important for patients in palliative care.3 the content of the ten scales is shown in table 1. patient - reported outcomes may be very important variables in clinical databases, and data from the eortc qlq - c15-pal can be used to describe the baseline levels of symptoms and problems in the patients admitted to spc and for other purposes. spc is defined as a multiprofessional and interdisciplinary approach.9 therefore, the fifth quality indicators measures whether it is documented in the medical record that the patient has been discussed at a multidisciplinary conference with representation from at least four disciplines (medical secretaries not included) present. most of the variables in dpd are entered by the spc units in a web - based data entry system called clinical measurement system (in danish : klinisk mlesystem [kms ]). the following two paper - based forms are used for this : a data form consisting of 18 items and the patient - completed questionnaire eortc qlq - c15-pal.3 the information for completion of the data form is extracted from the medical record, including documents relating to referral. this typically takes place after the patient s death or after contact has been stopped. the variables in dpd have a high level of data completeness, with completeness 100% for several variables, reflecting that these fields are mandatory in the reporting (table 1). as all data for each patient are entered at a single point of time, there is no subsequent follow - up. the dpd board is planning two expansions of the dpd related to follow - up. first, detailed data about all spc activity subsequent to the first contact will be added to the dpd via linking with the danish national patient register (using the unique personal registration number), which contains all hospital and hospice contacts. second, it is planned to add a second assessment with the eortc qlq - c15-pal questionnaire,3 in addition to the first, which is completed by the patient at the first contact. the second assessment will take place 14 weeks later and will allow evaluation of change in each of the scores after initiation of spc, ie, response to treatment. two ongoing phd projects are based on dpd data and take place in the dpd secretariat at bispebjerg hospital (table 2). in the first, data from dpd are linked with other national registers in denmark, the danish register of causes of death,10 the danish civil registration system,11 the danish cancer registry,12 and statistics denmark to investigate social inequality in admittance to spc. in the second project, the data from the eortc qlq - c15-pal are analyzed in order to better understand the epidemiology of symptoms and problems in the patients admitted to spc. data from the dpd play an important role in several other projects (table 2). the dpd secretariat supports the 43 spc institutions, which report data to dpd, at a daily basis concerning questions and problems in relation to the mandatory entering of data in dpd, and carries out analyses of and validation of data. data from dpd are continuously validated against the danish national patient register to ensure that all patients are entered in dpd : it is checked whether all patients registered in the danish national patient register as having a contact with an spc unit are registered in dpd, and whether there is agreement about the date of admission. to clarify any discrepancies, the dpd secretariat contacts the spc units if there is disagreement between the two data sources. this ensures a high completeness of patients in the database : in 2014, the patient completeness was 100%, ie, all patients registered with an spc contact in the danish national patient register were also registered in the dpd. the dpd secretariat, in collaboration with the dpd board, produces an annual report in danish showing the results of the indicators overall and at the spc unit level and at the regional level.2 the spc institutions have access to their own data, and the dpd secretariat offers courses in handling and analyzing their own data. dpd is funded by the danish regions (who are the owners and administrators of the public hospitals) via the danish clinical registries (rkkp). prior to the establishment of dpd, there was no knowledge about the quantity or quality of spc at the national level. the past years of work with the dpd have shown that it is possible to establish a national clinical quality database with a high level of completeness even in a newly established, very busy, and very heterogeneous part of the health care system. this positive development probably reflects the perceived importance of the data produced by the dpd (both about quantity and quality), the high level of professional motivation in the spc units and the dpd board, the relatively modest registration burden, the availability of support from a dedicated secretariat, and the fact that registration in the clinical databases, which are officially approved by the danish board of health, is mandatory. | aimsthe aim of the danish palliative care database (dpd) is to monitor, evaluate, and improve the clinical quality of specialized palliative care (spc) (ie, the activity of hospital - based palliative care teams / departments and hospices) in denmark.study populationthe study population is all patients in denmark referred to and/or in contact with spc after january 1, 2010.main variablesthe main variables in dpd are data about referral for patients admitted and not admitted to spc, type of the first spc contact, clinical and sociodemographic factors, multidisciplinary conference, and the patient - reported european organisation for research and treatment of cancer quality of life questionaire - core-15-palliative care questionnaire, assessing health - related quality of life. the data support the estimation of currently five quality of care indicators, ie, the proportions of 1) referred and eligible patients who were actually admitted to spc, 2) patients who waited < 10 days before admission to spc, 3) patients who died from cancer and who obtained contact with spc, 4) patients who were screened with european organisation for research and treatment of cancer quality of life questionaire - core-15-palliative care at admission to spc, and 5) patients who were discussed at a multidisciplinary conference.descriptive datain 2014, all 43 spc units in denmark reported their data to dpd, and all 9,434 cancer patients (100%) referred to spc were registered in dpd. in total, 41,104 unique cancer patients were registered in dpd during the 5 years 20102014. of those registered, 96% had cancer.conclusiondpd is a national clinical quality database for spc having clinically relevant variables and high data and patient completeness. |
in community - dwelling older persons, falls pose a major threat to function and independence. falls are a common cause for nursing home admission and health care utilization in this population.13 it is a common understanding that about 30% of persons 65 years and older experience a fall at least once a year, with a high percentage of these persons even falling several times per year.2,4 the incidence of falls, as well as fall - related injuries, increases with age.4,5 therefore, fall prevention is an important component in a society facing an increasing fall - related burden on the public health care system.6 clinical trials have shown that effective fall prevention interventions include balance training in combination with strength training.1,6,7 in contrast to this evidence, the implementation of broad ranging fall prevention programs is rare, and the challenge remains to deliver the most effective intervention to the right target group of older persons.8 the implementation process for effective intervention strategies is hampered by different barriers. one important barrier is the attitude of the older person him- or herself, and the other barrier might be the pathway of the implementation process. research has demonstrated that over 50% of older persons offered an exercise program for fall prevention refused to take part,9 and uptake rates are sometimes less than 10%.10,11 to increase the uptake rate, different strategies are feasible. one strategy could be to utilize the pathway of the general practitioner (gp) office setting to target at - risk older persons. gps might be the key persons to motivate at - risk older persons to participate in exercise programs for multiple reasons : research has demonstrated that older persons see their gp on a regular basis, view their gp as a very important source of health - related information, and value their advice.12 gps are mostly familiar with the daily routine and needs of their older patients, but in contrast, only few studies have investigated fall prevention programs in the gp setting.13 for german gps, the geriatric recommendations dictate that14 in persons 65 years and older, fall history during the past 6 months should be assessed at least once each year. a recent study in germany found that 83% of the gps were unaware of the recent falls of their patients in the previous 6 months.15 these results illustrate the need to include gps in fall prevention research targeting older persons at high risk of falling. in this paper, we investigated the effects of a previously validated 16-week complex exercise intervention targeting community - dwelling older persons at high risk of falling, in the gp setting. we compared the effects of the exercise program on physical and psychological fall - risk outcomes in the intervention group (ig) with the group receiving usual care. all fall - risk outcomes were measured at the start of the study and after the 16-week intervention. in addition, we obtained data on adherence to the exercise sessions by the included older persons. furthermore, this paper presents in - depth information on the complexity and necessity of the exercise program, including the different components of the exercise program and the challenges in the recruitment process, for both the gps and at - risk patients. the study protocol (prefalls nct01032252) we used has been previously published and no changes were made.16 in short, it was a controlled, multicenter, prospective study design with an equal cluster, random allocation of participating gps to a complex intervention or usual care control group (cg). the effects of the complex 16-week exercise intervention on physical and psychological fall risks outcomes were investigated. the number of falls and rate of fallers at 12 and 24 months postintervention will be obtained. participating patients of the included gps were tested at four points : at baseline (t0) ; after the intervention (t1) ; 12 months after baseline ; and 24 months after baseline. the study protocol was approved by the ethics board of the faculty of medicine of the technische universitt mnchen. the study was conducted according to the helsinki declaration. in this paper, the effects of the 16-week intervention on fall risk and the physical and psychological outcomes between t0 and t1 were reported. gps were recruited through local quality peer groups, from networks affiliated to the institute for family medicine of the technische universitt mnchen and by the institute of sport science and sports of the university of erlangen - nuremberg, as well as through additional advertisement in german medical journals.16 gps were invited to participate in the study by an invitation letter, and in case of no reply, contacted via telephone. the workshop provided the gps and one of their staff members with information regarding the study, including the objectives, definition of falls used in the study, and topics of the intervention. in addition, gps and their staff members were trained in the testing procedure and management of the fall - risk assessment. gps gained continuing medical education (cme) points for attending the workshop.16 with regard to implementation of fall risk assessment in the gp setting and sustainability strategies, no incentives were provided for the gps for study participation and testing procedures (due to the current health systems structure in germany). after attending the educational workshop, the gps were randomized either to the intervention or the cg and started to recruit their patients. randomization was conducted by a blockwise randomization list for both coordination centers, by a statistician who was otherwise uninvolved in the study at the time. blinding for the testing procedure is not feasible in an exercise intervention study because participants in the exercise intervention arm would tell their gps what they were doing. cluster randomization was the best solution to avoid contamination of the cg.19 after the randomization process, each gp received a list with the personal identification number ids for the recruitment of their future participants. gps or trained staff members in the participating practices approached eligible functionally declined, community - dwelling patients in their respective settings for participation in the study. the approach was based on self - selection as well as patients records, and final inclusion was based on the objective fall risk assessment. the inclusion criteria were defined as : aged 65 years and older ; reporting one or more falls in the past 12 months and/or fear of falling and/or physical fall risk obtained with the fall risk assessment (described further down) ; a cutoff score of < 10 seconds for the strength and function tests ; and self - reported or measured balance impairments.16 at least one inclusion criterion had to be fulfilled to take part in the study. all patients were required to sign informed consent forms before they were tested in their gp s office setting.16 all participants had to be mobile eg, able to stand alone and walk alone or with an assistant device. sample size calculations were based on fall reductions and showed that about 382 participants were needed.16 the intervention instructor was either recruited by the participating gp or by the local study coordinator. the instructor was either an experienced physiotherapist or sports scientist.16 for standardization of the multicenter intervention, all the instructors took part in an 8-hour educational workshop, in which they were trained to apply the standardized complex exercise program, as well as given background information of the study, eg, objective of the study, tests used, and fall definition.16 in contrast to the gps, the exercise instructors were reimbursed for their sessions, in accordance with the german national standards. to avoid testing bias, realization and the subjective experience of the instructors were obtained with a questionnaire after the exercise program ended. after signing the informed consent sheet, the eligible patient was tested by the gp or the trained staff member to ensure the inclusion criteria and obtain the base line status. in case of problems with the testing procedure due to a time restriction, the regional coordination team supported the testing process for that specific gp. all gps collected the testing protocol and data and then sent all the documents via postal service to the regional coordination center. the regional coordination center paid for the postal service and entered the data into the common database. testing in the ig and cg, for physical and psychological fall risk, was conducted at t0 and at t1. the testing was split between the gps, who managed medication and chronic diseases, and the trained staff member, who managed the questionnaires and physical performance tests. each gp setting had one trained staff member who was responsible for the testing procedure throughout the study and to whom the testing material was sent. each gp received, in addition to the training, a standardized test protocol to ensure the reliability of outcome measurements. a series of physical performance tests was administered in the gp setting to evaluate the fall risk.16 the timed up and go test (tug)17, the five repetition chair stand test (cst)18, and a modified romberg test (mod rom) were used for physical fall risk assessment. for psychological outcomes, the german version of the falls efficacy scale international (fes - i) was used.16 the tug was performed over a 3-meter course, and staff members had to note the use of walking aids in the testing protocol. the time it took to stand up and sit down five times was measured in seconds by a stopwatch.16 again, any deviation from the testing protocol had to be noted by the staff member. in case five repetitions were not possible due to the limitation of the participants, the numbers of chair rises had to be reported. the mod rom measures static balance in three conditions : feet side by side, semitandem, and tandem stance, for ten seconds in each position. fear of falling was assessed with the german fes - i.16 the complex exercise program was based on a formerly established effective exercise program.20,21 it was developed following a biopsychosocial approach, enhancing resources in older, community - dwelling persons.21 participating patients of the randomized intervention gps were organized in groups of 515 older persons. sixteen sessions, once per week for 60 minutes, were supervised, and the participants added at least one unsupervised session starting from week 5. adherence to each supervised and unsupervised session was taken with a standardized protocol and procedure by the exercise instructors. the supervised interventions took place in a community house, church location, or at the place of the exercise instructor that was near the gp setting. each supervised session started with a short, 5-minute discussion to introduce the topic of the session and address participants well - being and questions, followed by a 10-minute warm up phase, leading to a 3040 minute conditioning period, followed by a 510 minute cooling down and closing phase with relaxation and discussion between the participants and instructors about the experience. during the exercise program, local transportation service was provided for the participants, when necessary to be able to attend the group - based sessions. the group - based intervention followed standardized protocols for comparable conditions, but with as much variety as possible to address the individual needs of participants. a third party insurance was provided to the instructors, as well as to the participants, in case of adverse events. we defined our exercise intervention as a complex intervention due to the fact that it included several interacting components (some with behavioral aspects) on the part of the exercise instructor as well as the participants, number of groups being targeted by the exercise program, different outcomes, and a high degree of flexibility for tailoring the exercise to the participant s individual level.19 the complex exercise program (table 1) targeted the most important fall - risk factors, balance and gait limitation and muscle strength of the upper and lower extremities. in addition, body awareness, motor coordination, self - efficacy components, and small group dynamics games were included. modifications to the original exercise program20,21 were made by exercising only with body weight and without additional materials. the strength exercises were performed with increasing progression by changing frequency, speed, and range of movement. intensity was controlled with the borg scale,22 an evaluated self - perceived exhaustion scale, to avoid negative events. the balance exercise included challenging conditions (eg, eyes open versus closed, reduction of base of support), and training regarding postural strategies (ankle, hip, and step strategies). the gait exercise contained different rhythmical, spatial, and temporal components, as well as a dual task condition, eg, walking and talking, and combination of gait and arm movements. at the start of the exercise program, participants were allowed to use walking aids if needed, but throughout the intervention, the use of walking aids during exercise was reduced. to address the psychological fall risk dimension, sessions for behavioral changes and attitudes were also included in the complex exercise intervention. the sessions on psychological aspects were also part of the formerly evaluated exercise program.21 to sum up, the complex exercise program addressed the biopsychosocial health resources of the participants and empowered their independence by including elements of patient education with regard to behavioral changes. in order to perform the home - based unsupervised exercises, participants were provided a booklet with written instructions, safety issues, and pictures about how to do the exercise in their home. the exercises in the booklet were introduced in the group - based sessions and were occasionally integrated, as well as recalled, at the end phase of the intervention, to ensure familiarization. to ensure comparability between the different igs, close contacts were maintained between the local study coordinator and the instructors. after the intervention, instructors filled out a questionnaire to provide subjective information on their experience in managing the complex intervention program. the cg did not receive any intervention but continued seeing their gps with their usual care procedures. the focal interest here was to investigate the effects of the applied intervention on change in general fall risk, expressed in several assessments previously described. to account for the hierarchical structure in the chosen study design with patients nested in gps and measurements nested in patients, per considered outcome measure (tug, cst, mod rom, fes - i) one model was created, with time and ig as experimental factors. differences in change over time were represented by the group - by - time - interaction effect, which was the primary interest. none of the four outcome models showed the third level of gps as relevant in either explaining a notable amount of variance or accomplishing independent identical normal distributed residuals. hence, two - level models were sufficient to represent the data structure while preserving parsimony. for all four considered outcome measures, a random intercept and random slope model was deemed appropriate. because there were only two measurements per outcome, linear change from baseline to follow up was fitted saturated, which is comparable to an analysis of covariance, if no random effects were present. data were analyzed with r environment for statistical computing (institute for statistical computing, vienna, austria). the study protocol (prefalls nct01032252) we used has been previously published and no changes were made.16 in short, it was a controlled, multicenter, prospective study design with an equal cluster, random allocation of participating gps to a complex intervention or usual care control group (cg). the effects of the complex 16-week exercise intervention on physical and psychological fall risks outcomes were investigated. the number of falls and rate of fallers at 12 and 24 months postintervention will be obtained. participating patients of the included gps were tested at four points : at baseline (t0) ; after the intervention (t1) ; 12 months after baseline ; and 24 months after baseline. the study protocol was approved by the ethics board of the faculty of medicine of the technische universitt mnchen. the study was conducted according to the helsinki declaration. in this paper, the effects of the 16-week intervention on fall risk and the physical and psychological outcomes between t0 and t1 were reported. gps were recruited through local quality peer groups, from networks affiliated to the institute for family medicine of the technische universitt mnchen and by the institute of sport science and sports of the university of erlangen - nuremberg, as well as through additional advertisement in german medical journals.16 gps were invited to participate in the study by an invitation letter, and in case of no reply, contacted via telephone. the workshop provided the gps and one of their staff members with information regarding the study, including the objectives, definition of falls used in the study, and topics of the intervention. in addition, gps and their staff members were trained in the testing procedure and management of the fall - risk assessment. gps gained continuing medical education (cme) points for attending the workshop.16 with regard to implementation of fall risk assessment in the gp setting and sustainability strategies, no incentives were provided for the gps for study participation and testing procedures (due to the current health systems structure in germany). after attending the educational workshop, the gps were randomized either to the intervention or the cg and started to recruit their patients. randomization was conducted by a blockwise randomization list for both coordination centers, by a statistician who was otherwise uninvolved in the study at the time. blinding for the testing procedure is not feasible in an exercise intervention study because participants in the exercise intervention arm would tell their gps what they were doing. cluster randomization was the best solution to avoid contamination of the cg.19 after the randomization process, each gp received a list with the personal identification number ids for the recruitment of their future participants. gps or trained staff members in the participating practices approached eligible functionally declined, community - dwelling patients in their respective settings for participation in the study. the approach was based on self - selection as well as patients records, and final inclusion was based on the objective fall risk assessment. the inclusion criteria were defined as : aged 65 years and older ; reporting one or more falls in the past 12 months and/or fear of falling and/or physical fall risk obtained with the fall risk assessment (described further down) ; a cutoff score of < 10 seconds for the strength and function tests ; and self - reported or measured balance impairments.16 at least one inclusion criterion had to be fulfilled to take part in the study. all patients were required to sign informed consent forms before they were tested in their gp s office setting.16 all participants had to be mobile eg, able to stand alone and walk alone or with an assistant device. sample size calculations were based on fall reductions and showed that about 382 participants were needed.16 the intervention instructor was either recruited by the participating gp or by the local study coordinator. the instructor was either an experienced physiotherapist or sports scientist.16 for standardization of the multicenter intervention, all the instructors took part in an 8-hour educational workshop, in which they were trained to apply the standardized complex exercise program, as well as given background information of the study, eg, objective of the study, tests used, and fall definition.16 in contrast to the gps, the exercise instructors were reimbursed for their sessions, in accordance with the german national standards. to avoid testing bias, realization and the subjective experience of the instructors were obtained with a questionnaire after the exercise program ended. after signing the informed consent sheet, the eligible patient was tested by the gp or the trained staff member to ensure the inclusion criteria and obtain the base line status. in case of problems with the testing procedure due to a time restriction, the regional coordination team supported the testing process for that specific gp. all gps collected the testing protocol and data and then sent all the documents via postal service to the regional coordination center. the regional coordination center paid for the postal service and entered the data into the common database. testing in the ig and cg, for physical and psychological fall risk, was conducted at t0 and at t1. the testing was split between the gps, who managed medication and chronic diseases, and the trained staff member, who managed the questionnaires and physical performance tests. each gp setting had one trained staff member who was responsible for the testing procedure throughout the study and to whom the testing material was sent. each gp received, in addition to the training, a standardized test protocol to ensure the reliability of outcome measurements. a series of physical performance tests was administered in the gp setting to evaluate the fall risk.16 the timed up and go test (tug)17, the five repetition chair stand test (cst)18, and a modified romberg test (mod rom) were used for physical fall risk assessment. for psychological outcomes, the german version of the falls efficacy scale international (fes - i) was used.16 the tug was performed over a 3-meter course, and staff members had to note the use of walking aids in the testing protocol. the participant was asked to walk as fast, but safely as possible. the time it took to stand up and sit down five times was measured in seconds by a stopwatch.16 again, any deviation from the testing protocol had to be noted by the staff member. in case five repetitions were not possible due to the limitation of the participants, the numbers of chair rises had to be reported. the mod rom measures static balance in three conditions : feet side by side, semitandem, and tandem stance, for ten seconds in each position. the complex exercise program was based on a formerly established effective exercise program.20,21 it was developed following a biopsychosocial approach, enhancing resources in older, community - dwelling persons.21 participating patients of the randomized intervention gps were organized in groups of 515 older persons. sixteen sessions, once per week for 60 minutes, were supervised, and the participants added at least one unsupervised session starting from week 5. adherence to each supervised and unsupervised session was taken with a standardized protocol and procedure by the exercise instructors. the supervised interventions took place in a community house, church location, or at the place of the exercise instructor that was near the gp setting. each supervised session started with a short, 5-minute discussion to introduce the topic of the session and address participants well - being and questions, followed by a 10-minute warm up phase, leading to a 3040 minute conditioning period, followed by a 510 minute cooling down and closing phase with relaxation and discussion between the participants and instructors about the experience. during the exercise program, local transportation service was provided for the participants, when necessary to be able to attend the group - based sessions. the group - based intervention followed standardized protocols for comparable conditions, but with as much variety as possible to address the individual needs of participants. a third party insurance was provided to the instructors, as well as to the participants, in case of adverse events. we defined our exercise intervention as a complex intervention due to the fact that it included several interacting components (some with behavioral aspects) on the part of the exercise instructor as well as the participants, number of groups being targeted by the exercise program, different outcomes, and a high degree of flexibility for tailoring the exercise to the participant s individual level.19 the complex exercise program (table 1) targeted the most important fall - risk factors, balance and gait limitation and muscle strength of the upper and lower extremities. in addition, body awareness, motor coordination, self - efficacy components, and small group dynamics games were included. modifications to the original exercise program20,21 were made by exercising only with body weight and without additional materials. the strength exercises were performed with increasing progression by changing frequency, speed, and range of movement. intensity was controlled with the borg scale,22 an evaluated self - perceived exhaustion scale, to avoid negative events. the balance exercise included challenging conditions (eg, eyes open versus closed, reduction of base of support), and training regarding postural strategies (ankle, hip, and step strategies). the gait exercise contained different rhythmical, spatial, and temporal components, as well as a dual task condition, eg, walking and talking, and combination of gait and arm movements. at the start of the exercise program, participants were allowed to use walking aids if needed, but throughout the intervention, the use of walking aids during exercise was reduced. to address the psychological fall risk dimension, sessions for behavioral changes and attitudes were also included in the complex exercise intervention. the sessions on psychological aspects were also part of the formerly evaluated exercise program.21 to sum up, the complex exercise program addressed the biopsychosocial health resources of the participants and empowered their independence by including elements of patient education with regard to behavioral changes. in order to perform the home - based unsupervised exercises, participants were provided a booklet with written instructions, safety issues, and pictures about how to do the exercise in their home. the exercises in the booklet were introduced in the group - based sessions and were occasionally integrated, as well as recalled, at the end phase of the intervention, to ensure familiarization. to ensure comparability between the different igs, close contacts were maintained between the local study coordinator and the instructors. after the intervention, instructors filled out a questionnaire to provide subjective information on their experience in managing the complex intervention program. the cg did not receive any intervention but continued seeing their gps with their usual care procedures. the focal interest here was to investigate the effects of the applied intervention on change in general fall risk, expressed in several assessments previously described. to account for the hierarchical structure in the chosen study design with patients nested in gps and measurements nested in patients, a three - level linear mixed - effects model was determined for analysis. per considered outcome measure (tug, cst, mod rom, fes - i) differences in change over time were represented by the group - by - time - interaction effect, which was the primary interest. none of the four outcome models showed the third level of gps as relevant in either explaining a notable amount of variance or accomplishing independent identical normal distributed residuals. hence, two - level models were sufficient to represent the data structure while preserving parsimony. for all four considered outcome measures, a random intercept and random slope model was deemed appropriate. because there were only two measurements per outcome, linear change from baseline to follow up was fitted saturated, which is comparable to an analysis of covariance, if no random effects were present. data were analyzed with r environment for statistical computing (institute for statistical computing, vienna, austria). twenty - two gps (2%) agreed to participate after the invitation letters and personal contact. a further eleven gps agreed to take part in the study after telephone contact, leading to a total number of 33 gps. no systematic data was collected on the reason for declining, but in the telephone contact, the most common reasons for not taking part were lack of time, interest, and incentives, which is in line with the reasons provided by an earlier study.12 the 33 gps recruited 378 participants meeting the inclusion criteria. no systematic data was collected about whether invited patients declined to take part in the study, but reasons reported by gps to the study coordinators were : regarding group exercise as a burden and not enjoyable, low functional status, caring for spouse or other family members or not viewing themselves as at risk of falls. these arguments are in line with other, systematically collected information.9figure 1 shows the flow of the study. the characteristics of the patients are presented in table 2. in total, 16 trained exercise instructors provided the exercise intervention in 20 groups. in three of four short - term targeted outcome measures (tug, mod rom, fes - i) statistical analysis showed significant differences in the mean change, between the ig and cg. table 3 shows mean differences in the change obtained from the fitted models beta - coefficients of the interaction terms, with standard errors, bonferroni - corrected 95% confidence intervals (cis), and p - values for the four outcome measures. patients in the ig showed improvement in the tug that was 1.5 seconds greater than showed by patients in the cg, which is equivalent to a small to moderate effect, as defined by cohen.23 also in the mod rom tests, a significant relative improvement, of 0.8 seconds, was accomplished compared with cg. for the cst, no significant differences were found between the ig and cg (1.2 seconds difference). the overall score of the psychological risk factor fear of falling was significantly reduced by 3.7 points in the fes - i questionnaire, in the ig relative to cg. mean trajectories in all four considered outcomes of both groups can be viewed in detail in figure 2 (dotted lines). box plots represent the distributions of the each of the measures at pretest (t0) and retest (t1). in total, 76.6% (n = 170) of the ig participated in more than 75% of the supervised group sessions. only 2.7% (n = 6) missed the supervised training sessions due to sickness. of all participants, 55.6% reported that they trained according to the protocol while unsupervised. of these, 6.6% (n = 15) trained unsupervised between one and five times during the intervention phase, 8.6% (n = 19) trained six to eight times, 24.3% (n = 55) trained nine or ten times, 18% (n = 40) trained eleven times, and 12.6% trained 12 times. after the end of the intervention, each exercise instructor gave feedback about handling the structured intervention with regard to time management in each exercise session (60 minutes), about the structured protocol of the intervention sessions, and his / her experience with the intervention. the structured protocol of the sessions was rated by 80.2% of instructors as understandable and easy to handle. in total, 87.5% rated the time for each session as just right. the educational aspects included in each session were rated by ten (62.5%) of the instructors as just right. the intensity of the strength, and balance and gait exercise was rated by 13 (81.3%) and 12 (75%), respectively as the physical capacities of participants improved according to 87.6% of the exercise instructors. out of 15 instructors, six gave positive information on continuing the exercise program for the participants, as well as for new participants. in total, 76.6% (n = 170) of the ig participated in more than 75% of the supervised group sessions. only 2.7% (n = 6) missed the supervised training sessions due to sickness. of all participants, 55.6% reported that they trained according to the protocol while unsupervised. of these, 6.6% (n = 15) trained unsupervised between one and five times during the intervention phase, 8.6% (n = 19) trained six to eight times, 24.3% (n = 55) trained nine or ten times, 18% (n = 40) trained eleven times, and 12.6% trained 12 times. after the end of the intervention, each exercise instructor gave feedback about handling the structured intervention with regard to time management in each exercise session (60 minutes), about the structured protocol of the intervention sessions, and his / her experience with the intervention. the structured protocol of the sessions was rated by 80.2% of instructors as understandable and easy to handle. in total, 87.5% rated the time for each session as just right. the educational aspects included in each session were rated by ten (62.5%) of the instructors as just right. the intensity of the strength, and balance and gait exercise was rated by 13 (81.3%) and 12 (75%), respectively as out of 15 instructors, six gave positive information on continuing the exercise program for the participants, as well as for new participants. in this paper, we investigated the effects of a 16-week fall - prevention intervention on strength, balance, fear of falling, and function, with a cluster, randomized approach, in the gp office setting. with a new approach for fall prevention, we targeted functionally declined, but still independent, community - dwelling older persons by utilizing the gp setting. our positive results are in line with other effective exercise interventions addressing risk for falls in functionally declined older persons.1,7,2426 by increasing balance and function and decreasing fear of falling, the most important risk factors for falls have been positively influenced in our study population, who are at high risk of falling.27,28 our intervention showed small to moderate short - term effects on balance (mod rom), mobility (tug), and fear of falling (fes - i), but not on strength (cst). other studies in this population have demonstrated similar results for mobility and balance.7,2931 one explanation for the lack of positive results in strength might be that the exercise was performed although in a progressive manner only with body weights and not additional weights. another explanation for our data could be the enormous variation in physical performance in the ig and cg and/or the delay of effects of our strength training. our study supports the design of complex exercise programs, demonstrating effects on physiological and psychological fall risks and thus addressing physical and behavioral dimensions for fall risks.21 although complex interventions, which included educational aspects in addition to the exercise components, make it hard to pinpoint the single effects we demonstrated, addressing individual functional levels with exercise variations seemed valuable to foster adherence and motivation in our study population. the high adherence rate in our ig was also supported by the provision of transportation possibilities that enabled functionally declined older persons to take part in an exercise intervention program (supporting the findings by mcmahon).32 our study also demonstrated the feasibility of a combination of supervised and unsupervised sessions in functionally limited, community - dwelling, older persons recruited by their gps, although we have to admit that information on the unsupervised session was self - reported by the patients, thus to be interpreted with caution. the longitudinal, objective follow - up assessment will give us valuable information on adherence to unsupervised home - based exercise by the participants. the high acceptance and adherence to the structured protocol by the exercise instructors also demonstrates the need for an educational workshop for future instructors, at the start of an intervention. the competence of exercise instructors is essential for the success of the whole study, especially in a multicenter trial, demonstrating the importance of being trained in the underlying concepts and theoretical approaches. our strategy to implement a complex fall - prevention exercise program in the gp setting demonstrates the challenges in doing so. in addition to understanding what works, it is necessary to also investigate how implementation in the real world can be achieved. this remains a challenge.3335 increased awareness of possible strategies to reduce falls and assessing the risk of falling by gps seems mandatory for positive effects in fall reduction on a larger scale:8,36 gps are important in fall prevention management due to the acceptance of their advice by older persons9 and their role in identifying older at - risk persons. in contrast to other studies,12 our study required major efforts to recruit gps, with an initial response rate of 2%. although data was not obtained in a structured interview, most gps declined to participate due to a lack of financial reimbursement and time, or regarded fall prevention as being of little importance. these aspects demonstrate, on the one hand, the need for adequate financial reimbursement if fall prevention strategies are to be implemented successfully in the gp setting and, on the other hand, the ongoing education of gps with respect to the importance of fall prevention. nevertheless, our study demonstrated the possibility of implementing fall prevention in the gp setting for older patients. it further supported the need for strategies to raise the awareness in gps regarding the fall risk in their older patients, eg, educational workshops, familiarization with fall risk assessment, and the importance of a fall definition.4,34,37 nevertheless, some limitations have to be acknowledged. the recruitment of the gps depended mostly on personal contacts, thus reaching only the already interested gps. in addition, structured information about the reasons for not participating was not obtained from the invited gps or patients. unfortunately, these data were only obtained in telephone contacts in the recruitment process and not followed further. also, we obtained no information about whether the educational session changed the usual care routine of the control gps. to our knowledge, the educational session did raise the awareness of regular fall risk screening in all participating gps, but we were not able to evaluate, with our study, the possible extent of change in daily gp practice. another limitation is that the randomization process of the gps took place before they started recruiting patients, thus causing a problem with the congruency of every variable, despite clear inclusion criteria. in addition, not all randomized gps were able to recruit participants or lost interest and therefore dropped out the study. in addition, our study had over 70% female participants, making it hard to generalize our findings to both genders. the last limitation, which has to be mentioned, is the fact that the study was not blinded for the participants, creating a potential bias. however, as has been noted in this paper, it is not possible to solve this problem when comparing an exercise intervention to usual care. gps are important persons of trust for older persons, and the advice of gps is widely recognized.12 the strength of our study lies in the strategy of accessing high - risk older persons for fall prevention through their gps, with a complex approach targeting the biopsychosocial resources of the participants. the new strategy to target highly at - risk and functionally declined community - dwelling, older persons for fall prevention via a gp setting seemed promising. our complex exercise intervention for fall prevention has effectively improved balance, physical function, and led to a reduction in fear of falling in this population. further research must investigate the process of further maintenance and adherence, as well as the longitudinal effects of the exercise program. ellen freiberger participated in study conceptualization and design, acquisition of subjects and/or data, intervention development, analysis and interpretation of data, and wrote major parts of the manuscript. wolfgang a blank participated in study conceptualization and design, acquisition of subjects and/or data, and manuscript preparation. christian hentschke participated in analysis and interpretation of data, and he drafted the tables and figures, and prepared the statistical part of the manuscript. peter landendrfer participated in study conceptualization and design, and acquisition of subjects and/or data. monika siegrist participated in study conceptualization and design, acquisition of subjects and/or data, intervention development, analysis and interpretation of data, and manuscript preparation. | purposeto study the feasibility of first, reaching functionally declined, but still independent older persons at risk of falls through their general practitioner (gp) and second, to reduce their physiological and psychological fall risk factors with a complex exercise intervention. we investigated the effects of a 16-week exercise intervention on physiological (function, strength, and balance) and psychological (fear of falling) outcomes in community - dwelling older persons in comparison with usual care. in addition, we obtained data on adherence of the participants to the exercise program.methodstests on physical and psychological fall risk were conducted at study inclusion, and after the 16-week intervention period in the gp office setting. the 16-week intervention included progressive and challenging balance, gait, and strength exercise as well as changes to behavioral aspects. to account for the hierarchical structure in the chosen study design, with patients nested in gps and measurements nested in patients, a three - level linear mixed effects model was determined for analysis.resultsin total, 33 gps recruited 378 participants (75.4% females). the mean age of the participants was 78.1 years (standard deviation 5.9 years). patients in the intervention group showed an improvement in the timed - up - and - go - test (tug) that was 1.5 seconds greater than that showed by the control group, equivalent to a small to moderate effect. for balance, a relative improvement of 0.8 seconds was accomplished, and anxiety about falls was reduced by 3.7 points in the falls efficacy scale international (fes - i), in the intervention group relative to control group. in total, 76.6% (n = 170) of the intervention group participated in more than 75% the supervised group sessions.conclusionthe strategy to address older persons at high risk of falling in the gp setting with a complex exercise intervention was successful. in functionally declined, community - dwelling, older persons a complex intervention for reducing fall risks was effective compared with usual care. |
concerns exist regarding changes in the structure and metabolism of bone during pregnancy and the early postpartum period including during lactation that may have implications for short - term and long - term risk of osteoporosis and fractures. since calcium mobilization and bone resorption increase at the end of pregnancy and increase further with lactation, there has been considerable controversy over the past decades as to whether high parity and/or prolonged lactation periods are detrimental to bone mineral density (bmd). although there is loss of bmd during pregnancy and during lactation, it may be considered to be transient. yet it has also been suggested that factors such as age at and duration of menopause [57 ] may be the more definitive risk factors for osteoporosis and fractures. recently, it has been shown that pregnancies and long or repeated periods of breast - feeding do not seem to be associated with emergence of osteoporosis in later life [7, 9 ]. in fact, women with multiple pregnancies have been shown to have the same or higher bmd and lower fracture risk decades after last parturition [6, 7 ] when compared with nulliparous women. international studies in various populations of women with high parity [10, 11 ] and motivated to repeated periods of lactation generally confirm good recovery of bmd but these studies are skewed because of comparisons to nulliparous but younger control groups. in a study of > 200 sri lankan women, women with 5 children and women who had breast fed for 97 months had an age - adjusted bmd at lumbar spine (ls) and femoral neck (fn) that were not significantly different from that of women with lesser parity and fewer months of lactation. the purpose of the current study is to evaluate bmd in israeli women of differing parity and lactation histories immediately postpartum. the following question will be addressed : is there a quantitative and/or qualitative difference in bmd (based on t - scores and z - scores) at fn and/or ls (in women who are not yet menopausal) based on the cumulative months of pregnancies and approximate cumulative months of breast - feeding based on parity and/or age ? all women still in hospital postpartum (up to 48 hours) were asked to participate in this study and were offered a free evaluation of bmd and, if desired, consultation with an osteoporosis expert. in this entailed appearing for the examination at a specific time and on a different floor from the obstetrics department, some women were unable to participate (e.g., the logistics of having the baby lying - in). all candidates were asked to complete a questionnaire regarding demographic characteristics including weight before pregnancy and postpartum, height, diet, allergies, previous abortions, smoking history, and comorbidities including gestational diabetes, approximate cumulative months of pregnancies, and approximate cumulative months of breast - feeding after previous births. post hoc, for statistical analyses, the cohort was subdivided according to parity into four groups : primiparous (no successful pregnancies previous to the current one), low - parity (2nd5th live births) ; medium parity or grand multiparous (6th9th live births), and grand - grand multiparous (ggmp : 10th live birth). bmd evaluation was performed on a standard dual - energy x - ray absorptiometry machine (dxa ; hologic, bedford, ma, usa) by a single technician while the mother was still in hospital. results were recorded as bmd and as t - scores (compared to healthy females 2530 years old and who are categorized according to who classifications to identify persons who are at risk for osteoporosis and/or fractures) and z - scores (compared to healthy age - matched females) at the fn and ls. comparisons of means of parity groups used levene 's test and t - test for independent variables (age, height, weight, bmi, use of medications and dietary supplements, and duration of lactation). analysis of variance was used to evaluate homogeneity of these variables within and among parity groups. results of bone density ((bmd) t - score and z - score of each skeletal domain) were compared and correlated with each of the independent variables, using pearson 's correlation coefficient. the same procedure was used for evaluation of the relationship between bone density and duration of lactation. institutional review board (helsinki committee) approval for this study was received and all participants signed informed consent for a questionnaire and for performance of a dxa examination (gratis). there were 132 women who underwent dxa evaluation, 128 (97.0%) of whom had singleton births. table 1 presents the demographic data based on answers provided in the questionnaire and bmd outcomes of the whole group. there were fewer than 7% of women with a history of smoking (at any time) and fewer than 4% of women whose mother had been diagnosed with osteoporosis. there were very few outliers for prepregnancy body weight and body mass index (bmi). in general, mean fn t - scores and mean z - scores were higher than mean t - scores and mean z - scores at the ls, but all means were within the normal range. table 2 presents the descriptive data of the group when it was subdivided into women who were 30 years (n = 73) and women > 30 years of age (n = 59). there were significant differences between groups for gravidity, parity, months of pregnancies (where 8.5 was used as an approximate mean for pregnancy months), and months of lactation (p = 0.000). as in the whole group, mean t - scores and mean z - scores were higher at the fn than ls, respectively, in the younger women with mean z - scores lower than mean t - scores. in this case, t - scores in the younger women may be misleading because, by definition, many of these women had not yet achieved peak bone mass (i.e., they were younger than 2530 years of age which is the standard for t - scores) while theoretically all of the older women had achieved peak bone mass. this may be the reason why the mean t - scores at each site were not significantly different from the mean z - scores in the older women only. table 3 presents the group subdivided by parity, that is, comparing primiparous (and hence also no lactation history) relative to all the multiparous women (with a spectrum of parity and months of lactation including no lactation experience in 8 women). there were no statistically significant differences between the primiparous group and the multiparous group with regard to any of the bone density measures. table 4 presents the descriptive statistics of the cohort when subdivided into subgroups based on the predefined parity groups : group # 1 is primiparous ; group # 2 is 25 children ; group # 3 (grand multiparous) is 6 children of which 6 women had 10 viable births (grand - grand multiparous ; ggmp). with regard to mean t - scores at the fn versus mean t - scores at the ls, there were significant but opposite trends : mean fn t - scores were the highest in the primiparous and the lowest in the grand multiparous whereas mean ls t - scores and mean z - scores were highest in the primiparous and lowest in the grand multiparous. the maternal age is a background factor that might be closely related to other independent factors such as parity and cumulative time of breast - feeding. post hoc, this assumption was evaluated by the pearson correlation test and was indeed found to have a relatively high correlation coefficient (r = 0.583). therefore, in an attempt to tease out the effect of each of these factors on bone density separately, we evaluated the effects of these factors (), as well as the prediction power (r) in a linear regression, where we also tested for colinearity by the variance inflation factor (vif) test. table 5 presents the results of the bmd data for women who never breast fed (n = 35) relative to those who had varying histories of lactation (up to 135 months). there was a significantly higher mean fn t - score and z - score among those who never breast fed but no difference in mean ls t - scores or mean z - scores which, as in the whole group, were lower than the respective fn scores. there were 12 outliers (9.1%) based on t - scores and/or z - scores of 30 years of age) relative to younger (30 years of age), regardless of whether the mother was primiparous or multiparous including women who had had up to 13 births ; and, similarly, the number of months / years of lactation did not result in diminution of mean bmd t - scores into the osteopenic category. even when evaluating the outliers for t - scores and/or z - scores in the [2.5 ] range, only two women were identified and, in these, both t - scores and z - scores were 1.0 standard deviation below normal. nonetheless, although most studies in older women use ls t - scores and z - scores to assess fracture risk and bone health, in pregnant women, one might also be concerned about transient osteoporosis of the hip (toh) of pregnancy. during the course of this survey, there was no case of toh which most often develops in the third trimester and resolves by six months postpartum. in general hip pathology during pregnancy is rare, as confirmed in a 2-year prospective survey of nearly 5000 pregnancies in france, where there was only one case of toh and in a parallel 15-year retrospective study where only 6 patients (9 hips) with toh were identified ; of the latter six women, five had osteopenia based on dxa at the ls. thus, despite inclusion in the current study of some women with advanced maternal age and/or high parity and/or extended lactation, toh was not seen in the current cohort. there were also no cases of fractures in these women during the current pregnancy : all fractures reported by the women were noted prior to child - bearing years. however, one might consider that the two women (1.5%) who were identified as having t - scores and z - scores at the ls in the osteoporotic range (but were otherwise not outliers for any of the clinical characteristics) might actually have mild toh based on guidelines in the literature, but this is unlikely, and, moreover, the fn scores in these two women were not outliers. importantly, because of the ability to further subdivide the multiparous cohort into two groups, some subtle but potentially clinically meaningful differences were uncovered despite the lack of statistical significance. specifically, the mean ls t - scores and mean z - scores were highest in the grand multiparas, slightly lower in the multiparas, and the lowest in the primiparas because most previous studies only compared primiparas to multiparas and rarely had included many grand - grand multiparous women, this new information may be valuable in confirming the hypothesis that increased parity does not negatively impact bone density. similarly, with regard to lactation history, no previous studies included women with very extended lactation histories (albeit who naturally also had multiple pregnancies). interestingly, in comparison to women who never breast fed, there was no statistically significant difference in ls measures (which heretofore has been the basis of assessment of fracture risk and osteoporosis in comparative studies of nulliparous to multiparous postmenopausal women) while there were significant differences in the fn bone measures. the limitation of this study, if indeed it is a limitation, is that israeli women are encouraged to achieve their personal maximal family size and are also supported by well - baby clinics in maintaining good health standards prenatally. this is indirectly seen in the numbers of women complying with prenatal vitamins, not smoking, and so on. thus, from the point of view of nutrition and prenatal care, most israeli women, regardless of ethnicity, are healthy. on the other hand, very few claimed to have mothers with osteoporosis which may indicate that osteoporosis, which is a multifactorial trait, may be less common in this cohort ; a more likely explanation is that most of their mothers are too young to have evidence of osteoporosis. of relevance as well are recent data regarding the long - term effect of parity on bmd which confirm that parity greater than 7 births seems to have an osteoprotective effect against age - related bone loss in postmenopausal women. in conclusion, in a large cohort of israeli women whose bone density parameters were assessed by dxa within the first two days postpartum, mean t - scores and z - scores at both the lumbar spine and femoral neck were within the normal range regardless of age (2046 years), parity (113 viable births), and history of lactation (up to 11.25 years). in total, only two women (1.5%) were identified as having both t - scores and z - scores at the ls (but not fn) in the osteoporotic range, yet they were otherwise not outliers for any of the clinical characteristics. | changes of bone during pregnancy and during lactation evaluated by bone mineral density (bmd) may have implications for risk of osteoporosis and fractures. we studied bmd in women of differing ages, parity, and lactation histories immediately postpartum for bmd, t - scores, and z - scores. institutional review board approval was received. all women while still in hospital postpartum were asked to participate. bmd was performed by dual - energy x - ray absorptiometry (dxa) machine at femoral neck (fn) and lumbar spine (ls) by a single technician. of 132 participants, 73 (55.3%) were 30 years ; 27 (20.5%) were primiparous ; 36 (27.3%) were grand multiparous ; 35 (26.5%) never breast fed. mean fn t - scores and z - scores were higher than respective mean ls scores, but all means were within the normal limits. mean ls t - scores and z - scores were highest in the grand multiparas. there were only 2 (1.5%) outliers with low z - scores. we conclude that, in a large cohort of israeli women with bmd parameters assessed by dxa within two days postpartum, mean t - scores and z - scores at both the ls and fn were within normal limits regardless of age (2046 years), parity (113 viable births), and history of either no or prolonged months of lactation (up to 11.25 years). |
morphological studies of 6 clubfeet (2 in a 90-mm crown to rump fetus, 2 in a 7-month - old fetus and 2 in a 3-day - old infant) gave no clues to the pathogenesis of this deformity. anterior tibial tendon transfer to the third cuneiform is a useful operation for the treatment of cases of severe, relapsing clubfoot. | this classic article is a reprint of the original work by ignacio v. ponseti and jeronimo campos, observations on pathogenesis and treatment of congenital clubfoot. an accompanying biographical sketch on ignacio v. ponseti, md, is available at doi 10.1007/s11999 - 009 - 0719 - 8 and a second classic article is available at 10.1007/s11999 - 009 - 0720 - 2. this article is 1972 by lippincott williams and wilkins and is reprinted with permission from ponseti iv, campos j. observations on pathogenesis and treatment of congenital clubfoot. clin orthop relat res. 1972;84:5060. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.