article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
congenital bilateral ovarian agenesis is a rare condition, and pregnancy was not anticipated for those with this condition before the era of assisted reproduction. to the best of the author s knowledge, this is the second case in the literature of a pregnancy resulting from in vitro fertilization (ivf) in a patient with congenital bilateral ovarian agenesis.1 unfortunately, this pregnancy was complicated by morbidly adherent placenta (or placenta accreta) ; the case highlighted the possible association of morbidly adherent placenta with pregnancy achieved through assisted reproduction.2 the management of morbidly adherent placenta will also be discussed in the context of this pregnancy. a 31-year - old woman with congenital bilateral ovarian agenesis had been diagnosed with the condition at the age of 17 on investigation for primary amenorrhea. since then, the patient had been receiving oral contraceptive pills for hormonal replacement. in preparation for ivf, a dilatation and curettage was performed, followed by extended estrogen administration for thin endometrium and then ivf embryo transfer with donor eggs. an ectopic pregnancy in the second cycle necessitated a laparoscopic salpingectomy and a dilatation and curettage. in the third cycle, the intrauterine pregnancy was maintained on estradiol and progesterone until 12 weeks after embryo transfer. the pregnancy proceeded uneventfully until 38 weeks and 5 days gestation, when spontaneous rupture of membranes occurred followed by the onset of labor. labor was augmented with oxytocin (syntocinon ; novartis pharmaceuticals australia pty limited, sydney, australia) and the cervix was fully dilated 8 hours later. a normal, healthy baby weighing 3220 g was born by instrumental delivery as a result of maternal exhaustion. in the third stage, the placenta could not be delivered by cord traction, despite part of the placenta protruding from the external cervical os of the uterus, and there was active bleeding. manual removal of the placenta was performed in the operation theater but part of the placenta was noticed to be adherent and this was left in situ. bleeding was controlled with oxytocin infusion, ergometrine maleate (ergometrine injection ; hospira australia pty ltd, melbourne, australia) injection, and misoprostol (cytotec ; pfizer australia pty ltd, sydney, australia) per vaginum (pv). she was well until 5 weeks following childbirth when she presented with increasing brownish discharge pv and a low - grade fever. the white cell count was raised to 13.3 109/l with neutrophilia (11.6 109/l) ; the platelet count was 210 109/l. a pelvic ultrasound scan showed there was a piece of placenta measuring 8 5 2 cm remaining in the uterine cavity. there was no vascularity observed between the placenta and the uterine wall on doppler ultrasound examination. after discussion with the patient, misoprostol was administered vaginally. after a total dose of 2000 g of misoprostol pv, part of the placenta was protruding from the external os of the uterus. the placental tissue was removed manually and the patient was discharged the following day in good condition. parturition in humans involves complex mechanisms with key elements such as oxytocin, corticotropin - releasing hormone and urocortin, relaxin, parathyroid hormone related protein, opioids, neurosteroids, and monoamines.3 in the female, relaxin is a protein hormone produced mainly by the corpus luteum of the ovary but also by the breast and, during pregnancy, by the placenta, chorion, and decidua. in animal studies, the removal of activities of relaxin, either by oophorectomy or through administration of neutralizing antibodies, has resulted in prolonged labor and a high fetal mortality rate. this is thought to result from reduced cervical elasticity and defective cervical ripening.4 however, the action of relaxin appears to vary among species.5 in women with primary ovarian insufficiency (or premature ovarian failure) and absent circulatory relaxin,6 cervical dilatation occurs successfully in spontaneous labor, although at a slower rate.7 moreover, no difference was found in the duration of pregnancies in patients who conceived through egg donation compared with standard ivf pregnancies.8 in humans, it appears that relaxin does not play a major role in the onset and progression of labor, although there is some evidence to suggest that relaxin may play a role in cervical ripening.9 therefore, elective cesarean section is not indicated in patients with absent or nonfunctioning ovaries. ivf is known to be associated with an increased incidence of morbidly adherent placenta, with an estimated rate of 16 cases in 1000 ivf pregnancies versus 1.2 cases in 1000 spontaneous pregnancies.2 whether this results from endometrial changes with ivf treatment protocols (dilatation and curettage before ivf) or the characteristics of the gestational carrier (thin endometrium in this patient with bilateral ovarian agenesis), precaution is required in the management of ivf pregnancies if defective decidualization is expected. since morbidly adherent placenta is associated with significant maternal or fetal mortality or morbidity, screening for and anticipation of this condition may be beneficial in ivf pregnancies10,11 and the ivf treatment protocol may need to be reviewed. abnormal vascularization is observed at the placental and myometrial or tissue interface in morbidly adherent placenta.11 conservative management without separation of the placenta at delivery has been shown to decrease the blood loss and improve the maternal outcome.10 however, there are potential complications of secondary hemorrhage and infection.12,13 in this case, the morbidly adherent part of the placenta was managed conservatively. the retained adherent placenta was removed uneventfully at 5 weeks following childbirth when there was no significant flow observed between the placenta and the myometrium on doppler ultrasound examination. in conservatively managed morbidly adherent placenta, this sign may indicate a safe time for removal of the retained placental tissue when there is a concern for arising complications (eg, infection in this case). alternatively, arterial embolization and/or ligation could be considered for preservation of subsequent fertility, and ultimately hysterectomy if conservative management fails.13 spontaneous labor and vaginal delivery can be successful in patients with congenital bilateral ovarian agenesis. in ivf pregnancies, screening for and anticipation of morbidly adherent placenta may be beneficial when risk factors for this condition are present. with morbidly adherent placenta, when the blood flow between the placenta and the myometrium is absent it may be a safe time for removal of the adherent placenta. | the author presents a case of in vitro fertilization pregnancy complicated by morbidly adherent placenta in a patient with congenital bilateral ovarian agenesis. a 31-year - old woman with congenital bilateral ovarian agenesis who had undergone two previous dilatation and curettage procedures conceived following in vitro fertilization with a donor egg. spontaneous labor occurred at 38 weeks and 5 days gestation. the labor was augmented in the active phase and resulted in instrumental vaginal delivery. the third stage was complicated by hemorrhage and retained placenta. morbidly adherent placenta was diagnosed on attempt at manual removal of the placenta, and the adherent part of the placenta was left in situ. this was removed uneventfully at 5 weeks following childbirth when there was no blood flow observed between the placenta and the myometrium on doppler ultrasound examination. in conclusion, successful parturition is possible in patients with congenital bilateral ovarian agenesis. when morbidly adherent placenta is managed conservatively, the placenta may be safely removed if there is no vascularity between the placenta and the myometrium. |
competence has been defined as the state of having the knowledge, judgement, skills, energy, experience and motivation required to respond adequately to the demands of one 's professional responsibilities (1). it is also defined as being able to demonstrate that the knowledge, values and skills learned can be integrated into practice (2). adult endocrine nursing is highly specialised and, in recent years, nurses have expanded their roles according to local need. the society for endocrinology nurse committee believes that professional advice and support are required for nurses developing their roles in this dynamic and rapidly advancing field (3). in 2013, the first edition of the society for endocrinology competency framework for adult endocrine nursing was published (4). subsequently, four new competencies benign adrenal tumours, hypo- and hyperparathyroidism, osteoporosis and polycystic ovary syndrome have been added to this second edition. these competencies build on the work already undertaken by our paediatric endocrine nurse colleagues. however, we recognise that adult endocrine nurse specialists have a more disparate range of roles. some nurses may care for a whole range of endocrine disorders, whereas others may concentrate on one specific disease area. therefore nurses, and their clinical managers, will need to select the competencies which are particular to their role. in addition, it is recognised that some endocrine nurses may be caring for patients in situations not covered in this document. it is accepted that this is due to the way many posts were initiated to deal with a particular local requirement, and it is hoped that these competencies will help those individual nurses to develop competencies relevant to their own roles. in the future, additional competencies will be developed as the need for them is identified. benner 's novice to expert concept has been used and adapted as the basis for these competencies (5, 6, 7). as a general rule, we would expect nurses new to the specialty to have reached a competent level within 6 months. an endocrine nurse functioning at expert level is likely to have had some years of experience in the specialty and be working autonomously. experts in a particular disease area whilst only achieving a competent level in another area. the competency framework has been developed in this context, as well as taking into account other professional and political factors such as : the need for the development of uk - wide standards in adult endocrine nursing.the need for professional accreditation of skills and knowledge in practice.the increased focus on work - based and lifelong learning plus supervision.increasing patient and user expectations.the need for leadership in specialist nursing.national service frameworks, clinical governance and service modernisation. the increased focus on work - based and lifelong learning plus supervision. increasing patient and user expectations. the need for leadership in specialist nursing. the adult endocrine nurse specialist should be a nurse registered with the nursing and midwifery council (nmc) and holding a first degree. expert will need to be an independent nurse prescriber to be able to work autonomously at this level of clinical responsibility. it is hoped that this competency framework will help endocrine nurses to identify their current level of practice and to plan their career in a more structured way by identifying their personal education and development needs. progression through the levels will be different for each nurse, depending on context, level of skill, performance appraisal and individual objectives. expert status, in those competencies relevant to them, after 5 years in post. the uk central council for nursing, midwifery and health visiting now the nursing and midwifery council (nmc) developed a code of conduct (8) which clearly describes how all nurses, midwives and health visitors must endeavour always to achieve, maintain and develop knowledge, skills and competence, and this was echoed in 2008 (9). it has been acknowledged that nurses are increasingly extending their roles and expanding their scope of practice beyond initial registration (10). the framework focuses on knowledge, skills and interventions that are specific to nurses working as adult endocrine nurses. although the intention is for this framework to have a stand - alone function, it should be used in conjunction with other frameworks that focus on core skills and competencies for all qualified nurses and in conjunction with local and national guidelines. the competency framework provides benefits for nurses, their employers, patients and the public. nurses benefit because it helps to : deliver consistently high standards of care.identify the level of practice and plan a career in a more structured way.pinpoint personal educational and developmental needs.realise potential more effectively.seize opportunities to influence the direction of nursing. employers benefit because it provides : a model to ensure consistently high standards of care.clearer insights into the expertise and competence of staff ; for example, in assessment of risk management.assistance in organisational planning. a model to ensure consistently high standards of care. clearer insights into the expertise and competence of staff ; for example, in assessment of risk management. patients and the public benefit because it makes it possible to deliver : consistently high standards of patient care.increased effectiveness of service provision.improved access and choice for care provision. consistently high standards of patient care. increased effectiveness of service provision. improved access and choice for care provision. it is envisaged that this document will be a useful tool for : supporting job descriptions and pay reviews / negotiations by detailing targets in accordance with local and national guidelines and policies.assessing clinical competence at differing levels.developing personal goals and objectives.performance appraisal. supporting job descriptions and pay reviews / negotiations by detailing targets in accordance with local and national guidelines and policies. assessing clinical competence at differing levels. developing personal goals and objectives. the adult endocrine nurse specialist competency framework is presented in the following tables : competency 1 : acromegaly. competency 11 : steroid replacement therapy for disorders of the pituitary and adrenal glands. competency 11 : steroid replacement therapy for disorders of the pituitary and adrenal glands. the primary source for this document is competences : an integrated career and competency framework for children 's endocrine nurse specialists (11). v kieffer, k davies, c gibson, m middleton, j munday, s shalet, l shepherd and p yeoh all contributed equally to this work. | this competency framework was developed by a working group of endocrine specialist nurses with the support of the society for endocrinology to enhance the clinical care that adults with an endocrine disorder receive. nurses should be able to demonstrate that they are functioning at an optimal level in order for patients to receive appropriate care. by formulating a competency framework from which an adult endocrine nurse specialist can work, it is envisaged that their development as professional practitioners can be enhanced. this is the second edition of the competency framework for adult endocrine nursing. it introduces four new competencies on benign adrenal tumours, hypo- and hyperparathyroidism, osteoporosis and polycystic ovary syndrome. the authors and the society for endocrinology welcome constructive feedback on the document, both nationally and internationally, in anticipation that further developments and ideas can be incorporated into future versions. |
interferon- (alfaron, recombinant ifn-2b ; hualida biotechnology co., tianjin, china) had a specific activity of 3 10 units / ml and > 99% purity. the selective egfr - tki gefitinib (gd760, iressa), kindly provided by astrazeneca (macclesfield, cheshire, uk), was dissolved in dmso to a working concentration of 20 mm. both drugs were stored at 20c in tightly sealed sterile tubes and diluted to the desired concentration in culture medium (rpmi 1640 ; gibco, grand island, ny, usa) before being added to the cells. four human nsclc cell lines were used : a549, h1299, and hcc827 (cell bank of chinese academy of sciences, shanghai, china), which have different egfr and k - ras gene statuses (exons 1821 of the egfr gene and exons 23 of the k - ras gene were sequenced, a549 cell line harbours mutation (g12s) of k - ras, hcc827 cell line carries egfr 19del, and the egfr and k - ras of h1299 cell line are all wild type, data not shown). the cell lines were grown in rpmi 1640 (gibco) supplemented with 10% foetal bovine serum and maintained at 37c in a humidified atmosphere containing 5% co2 and 95% air. four different experimental regimens were investigated to evaluate the impact of ifn- pretreatment on the antiproliferative effect of gefitinib : i, 72-hour incubation with gefitinib or ifn- alone;ii, 72-hour incubation with gefitinib (at the indicated concentrations in figure 2) + 10 iu / ml ifn- (at the concentration of 10 iu / ml, ifn- inhibits the proliferation of these lung cancer cells obviously);iii, 72-hour pretreatment with 10 iu / ml ifn-, following which the ifn- was removed by washing twice with phosphate - buffered saline (pbs), followed by 72-hour incubation with gefitinib + 10 iu / ml ifn-;iv, 72-hour pretreatment with 10 iu / ml ifn-, following which the ifn- was removed by washing twice with pbs, followed by 72-hour incubation with gefitinib. i, 72-hour incubation with gefitinib or ifn- alone ; ii, 72-hour incubation with gefitinib (at the indicated concentrations in figure 2) + 10 iu / ml ifn- (at the concentration of 10 iu / ml, ifn- inhibits the proliferation of these lung cancer cells obviously) ; iii, 72-hour pretreatment with 10 iu / ml ifn-, following which the ifn- was removed by washing twice with phosphate - buffered saline (pbs), followed by 72-hour incubation with gefitinib + 10 iu / ml ifn- ; iv, 72-hour pretreatment with 10 iu / ml ifn-, following which the ifn- was removed by washing twice with pbs, followed by 72-hour incubation with gefitinib. control cells were processed in the same manner but with drug - free medium (placebo) instead of gefitinib. the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (mtt)-tetrazolium dye assay was used to evaluate cell viability. 100 l exponential growth phase cells (about 3500 cells in total) were seeded into 96-well plastic plates, incubated overnight, and added 100 l serial dilutions of gefitinib, ifn-, or gefitinib + ifn- into each well. after 72-hour incubation at 37c, 20 l 5 mg / ml mtt solution was added into each well and the cells were incubated for four hours. the media were removed and 150 l dmso was added into each well to dissolve the mtt completely, and the absorbance values were read at 570 nm using a microplate reader (model 680 ; bio - rad, hercules, ca, usa). at least three replicate wells were used for each drug concentration, and the experiment was carried out independently at least three times. cell proliferation is expressed as the percentage of drug - treated surviving cells versus control cells (in which viability was considered 100%). cells were incubated for 72 hours in drug - free medium (control), 10 iu / ml ifn-, gefitinib alone, or gefitinib after 10 iu / ml ifn- pretreatment. according to the ic50 of gefitinib in these three cell lines, the concentration of gefitinib for hcc827 cell was 20 nm, and for other two cell lines it was 10 m. the cells were harvested by trypsinisation, washed twice with pbs, incubated in 500 l binding buffer and 10 l annexin v fitc at room temperature for 30 minutes, and then 5 l pi was added and incubated for five minutes. the cells were analysed using flow cytometry (bd facscanto ii, bd biosciences, san jose, ca, usa), and the data were analysed with cellquest software (becton dickinson, franklin lakes, nj, usa). h1299 and hcc827 cells were treated with ifn- (10 iu / ml) or gefitinib (20 nm) alone or in combination for 48 hours, washed with cooled pbs three times, and then lysed in 50100 l mammalian protein extraction reagent containing a protease inhibitor cocktail for 30 minutes. the lysates were normalised for total protein content using a bicinchoninic acid assay, and 60 g protein samples were loaded on sds - page gels and transferred to pvdf membranes. the membranes were probed with rabbit monoclonal antibodies against phosphorylated (p)-egfr, egfr, p - stat3 (signal transducers and activators of transcription 3), stat3, and -actin (santa cruz, dallas, tx, usa) at 4c overnight. after washing three times in tbs - t (tris hydrochloride buffer containing 0.1% tween-20), the membranes were incubated with the goat polyclonal secondary antibody to rabbit for two hours at room temperature. the membranes were washed with tbs - t three times for 10 minutes and exposed to x - ray film for 510 minutes. the relative expression of protein was determined from the optical density ratio of the corresponding protein bands using bandscan 5.0 software (glyko inc. were calculated as previously described with minor modifications : cis = % ab / (% a %b), where % a and % b are the effect of the individual drug and % ab is the effect of the combination. cis 1 indicates synergism, additive effect, and antagonism, respectively. all data are expressed as the mean standard error (se) of at least three experiments. a two - tailed, independent student 's t - test differences at p 99% purity. the selective egfr - tki gefitinib (gd760, iressa), kindly provided by astrazeneca (macclesfield, cheshire, uk), was dissolved in dmso to a working concentration of 20 mm. both drugs were stored at 20c in tightly sealed sterile tubes and diluted to the desired concentration in culture medium (rpmi 1640 ; gibco, grand island, ny, usa) before being added to the cells. four human nsclc cell lines were used : a549, h1299, and hcc827 (cell bank of chinese academy of sciences, shanghai, china), which have different egfr and k - ras gene statuses (exons 1821 of the egfr gene and exons 23 of the k - ras gene were sequenced, a549 cell line harbours mutation (g12s) of k - ras, hcc827 cell line carries egfr 19del, and the egfr and k - ras of h1299 cell line are all wild type, data not shown). the cell lines were grown in rpmi 1640 (gibco) supplemented with 10% foetal bovine serum and maintained at 37c in a humidified atmosphere containing 5% co2 and 95% air. four different experimental regimens were investigated to evaluate the impact of ifn- pretreatment on the antiproliferative effect of gefitinib : i, 72-hour incubation with gefitinib or ifn- alone;ii, 72-hour incubation with gefitinib (at the indicated concentrations in figure 2) + 10 iu / ml ifn- (at the concentration of 10 iu / ml, ifn- inhibits the proliferation of these lung cancer cells obviously);iii, 72-hour pretreatment with 10 iu / ml ifn-, following which the ifn- was removed by washing twice with phosphate - buffered saline (pbs), followed by 72-hour incubation with gefitinib + 10 iu / ml ifn-;iv, 72-hour pretreatment with 10 iu / ml ifn-, following which the ifn- was removed by washing twice with pbs, followed by 72-hour incubation with gefitinib. i, 72-hour incubation with gefitinib or ifn- alone ; ii, 72-hour incubation with gefitinib (at the indicated concentrations in figure 2) + 10 iu / ml ifn- (at the concentration of 10 iu / ml, ifn- inhibits the proliferation of these lung cancer cells obviously) ; iii, 72-hour pretreatment with 10 iu / ml ifn-, following which the ifn- was removed by washing twice with phosphate - buffered saline (pbs), followed by 72-hour incubation with gefitinib + 10 iu / ml ifn- ; iv, 72-hour pretreatment with 10 iu / ml ifn-, following which the ifn- was removed by washing twice with pbs, followed by 72-hour incubation with gefitinib. control cells were processed in the same manner but with drug - free medium (placebo) instead of gefitinib. 100 l exponential growth phase cells (about 3500 cells in total) were seeded into 96-well plastic plates, incubated overnight, and added 100 l serial dilutions of gefitinib, ifn-, or gefitinib + ifn- into each well. after 72-hour incubation at 37c, 20 l 5 mg / ml mtt solution was added into each well and the cells were incubated for four hours. the media were removed and 150 l dmso was added into each well to dissolve the mtt completely, and the absorbance values were read at 570 nm using a microplate reader (model 680 ; bio - rad, hercules, ca, usa). at least three replicate wells were used for each drug concentration, and the experiment was carried out independently at least three times. cell proliferation is expressed as the percentage of drug - treated surviving cells versus control cells (in which viability was considered 100%). cells were incubated for 72 hours in drug - free medium (control), 10 iu / ml ifn-, gefitinib alone, or gefitinib after 10 iu / ml ifn- pretreatment. according to the ic50 of gefitinib in these three cell lines, the concentration of gefitinib for hcc827 cell was 20 nm, and for other two cell lines it was 10 m. the cells were harvested by trypsinisation, washed twice with pbs, incubated in 500 l binding buffer and 10 l annexin v fitc at room temperature for 30 minutes, and then 5 l pi was added and incubated for five minutes. the cells were analysed using flow cytometry (bd facscanto ii, bd biosciences, san jose, ca, usa), and the data were analysed with cellquest software (becton dickinson, franklin lakes, nj, usa). h1299 and hcc827 cells were treated with ifn- (10 iu / ml) or gefitinib (20 nm) alone or in combination for 48 hours, washed with cooled pbs three times, and then lysed in 50100 l mammalian protein extraction reagent containing a protease inhibitor cocktail for 30 minutes. the lysates were normalised for total protein content using a bicinchoninic acid assay, and 60 g protein samples were loaded on sds - page gels and transferred to pvdf membranes. the membranes were probed with rabbit monoclonal antibodies against phosphorylated (p)-egfr, egfr, p - stat3 (signal transducers and activators of transcription 3), stat3, and -actin (santa cruz, dallas, tx, usa) at 4c overnight. after washing three times in tbs - t (tris hydrochloride buffer containing 0.1% tween-20), the membranes were incubated with the goat polyclonal secondary antibody to rabbit for two hours at room temperature. the membranes were washed with tbs - t three times for 10 minutes and exposed to x - ray film for 510 minutes. the relative expression of protein was determined from the optical density ratio of the corresponding protein bands using bandscan 5.0 software (glyko inc., upper heyford, uk). the combination indexes (cis) were calculated as previously described with minor modifications : cis = % ab / (% a %b), where % a and % b are the effect of the individual drug and % ab is the effect of the combination. cis 1 indicates synergism, additive effect, and antagonism, respectively. all data are expressed as the mean standard error (se) of at least three experiments. a two - tailed, independent student 's t - test was used to determine the differences between the pretreatment and control groups. differences at p 1.0, and additive when cis = 0.91.0. points, mean of three individual treatments. mt, mutation type next, the antiproliferative effect of ifn- alone in the cell lines was evaluated. cell survivals were similar among three cell lines (a549 : 71.8%, h1299 : 67.9%, and hcc827 : 63.2%). we investigated whether a synergistic effect on nsclc cells could be obtained by combining gefitinib with ifn-. however, it was found that when gefitinib was administered with ifn-, it resulted in an additive interaction in all four cell lines, as shown by the ci values (ci = 1 ; fig. the mean ci values of gefitinib + ifn- for each cell line are listed in table 1 (gefitinib + ifn-) ; all of the ci values were approximately 1. combination indexes for gefitinib and ifn-/combination each value represents the mean se of all combination index (cis) values for each cell line. the p - values were analysed by a two - tailed student 's t - test. p 0.05, statistically not significant. ci value : 1 antagonism. nevertheless, when the cells were pretreated with 10 iu / ml ifn- before administering gefitinib and ifn-, there were antagonistic interactions between gefitinib and ifn- in three cell lines. 2), as demonstrated by the higher mean ci values of the gefitinib + ifn- combination after ifn- pretreatment (table 1, cisgefitinib + ifn- vs. cisifn-gefitinib + ifn-, p 1.0, and additive when cis = 0.91.0. points, mean of three individual treatments. mt, mutation type next, the antiproliferative effect of ifn- alone in the cell lines was evaluated. cell survivals were similar among three cell lines (a549 : 71.8%, h1299 : 67.9%, and hcc827 : 63.2%). we investigated whether a synergistic effect on nsclc cells could be obtained by combining gefitinib with ifn-. however, it was found that when gefitinib was administered with ifn-, it resulted in an additive interaction in all four cell lines, as shown by the ci values (ci = 1 ; fig. the mean ci values of gefitinib + ifn- for each cell line are listed in table 1 (gefitinib + ifn-) ; all of the ci values were approximately 1. combination indexes for gefitinib and ifn-/combination each value represents the mean se of all combination index (cis) values for each cell line. the p - values were analysed by a two - tailed student 's t - test. p 0.05, statistically not significant. ci value : 1 antagonism. nevertheless, when the cells were pretreated with 10 iu / ml ifn- before administering gefitinib and ifn-, there were antagonistic interactions between gefitinib and ifn- in three cell lines. 2), as demonstrated by the higher mean ci values of the gefitinib + ifn- combination after ifn- pretreatment (table 1, cisgefitinib + ifn- vs. cisifn-gefitinib + ifn-, p < 0.005). in these cell lines, the cell survival rate according to each concentration of gefitinib increased after the ifn- pretreatment (table 1, fig. to gain insight into whether ifn- could influence gefitinib sensitivity, cell survival was evaluated after gefitinib treatment following ifn- pretreatment. after the pretreatment, cell survival rates were significantly increased in the a549 and h1299 cell lines as the gefitinib concentration increased ; a significant reduction was observed at each gefitinib concentration in the hcc827 cell line (fig. 3a, cell survival rate ifn-gefitinib vs. cell survival rate placebogefitinib, p < 0.05). a) the antagonistic effect of ifn- pretreatment on the antiproliferative effect of gefitinib on human nsclc cell lines was evaluated by mtt assay. b) apoptosis in the cell lines was analysed by flow cytometry for annexin v/ pi staining. the results (top and bottom right panels) are expressed as the percentage of the apoptotic cells. data are reported as the mean se of three determinations, p < 0.05 for gefitinib vs. ifn-gefitinib to determine whether ifn- could inhibit gefitinib - induced apoptosis, the outcome of the annexin v / pi detection demonstrated that there was a decrease in gefitinib - induced apoptosis after the ifn- pretreatment (fig. previously, many studies reported that ifn- could activate egfr signalling by upregulating egfr expression [7, 8 ]. two cell lines were examined : h1299 and hcc827, where ifn- pretreatment inhibited the effect of gefitinib significantly. ifn- could not activate egfr phosphorylation but could inhibit stat3 phosphorylation in both cell lines (fig. 4). gefitinib inhibited egfr activation in both cell lines and inhibited stat3 activation in both cell lines (fig. a) p - egfr / egfr and p - stat3/stat3 were analysed by western blot. the whole protein from h1299 and hcc827 cells treated for 48 hours with ifn- (10 iu / ml) and gefitinib (10 nm) alone with ifn- b) the expression levels were analysed by the ratio of optical density with -actin. stat3 activation was inhibited by ifn- and gefitinib in both cell lines, p < 0.05 the present findings are not consistent with those of previous studies, which showed that ifn- could enhance the antiproliferation of egfr - tki in colon cancer cells, renal cell carcinoma, and hepatocellular carcinoma. in our study, ifn- reduced the gefitinib sensitivity of nsclc cells that contained egfr - tki sensitive mutations. we also noted that ifn- alone had a mild antiproliferative effect on the nsclc cell lines : the rate of cell survival inhibition was less than 50% even at 10 iu / ml ifn- (fig. 3b). as expected, the three cell lines, carrying different egfr and k - ras gene types, responded differently to gefitinib alone : a549 and h1299 cells were less susceptible to gefitinib while the hcc827 cell line was sensitive to its effects (fig. disappointingly, there was no interaction between gefitinib and ifn- when they were administered in combination in these cell lines. the cis values demonstrated that the gefitinib + ifn- combination effects were additive (table 1, fig. notably, the antiproliferation of gefitinib alone was reduced after ifn- pretreatment in the three cell lines (fig. previous studies have suggested that ifn- can upregulate egfr expression in cancer cells [14, 15 ], and others have postulated that the increases in egfr expression tend to be accompanied by enhanced activity of egfr signalling. nevertheless, based on our observations, egfr activation was not associated with ifn- in the h1299 or hcc827 cells (fig. stat3 is a stat family member that is involved in oncogenesis and tumour progression ; previous studies have shown that stat3 is activated in lung cancer, and its activation may stem from egfr mutations. similarly, it was found that stat3 was activated in the two cell lines (fig., ifn- can activate the janus kinase 1 (jak1)/stat pathway and inhibit stat3 phosphorylation ; our research also showed that ifn- inhibited p - stat3 in the nsclc cell lines. it is worth mentioning that prior studies have shown that there is cross - talk between jak / stat and egfr signalling in the regulation of hyperproliferation, and that egfr is an upstream activator of stat3 that can mediate egfr signalling [16, 17, 21 ] ; therefore, egfr - tkis may be able to inhibit stat3 activation. 4 shows that gefitinib could inhibit p - stat3 expression in the h1299 and hcc827 cells in which ifn- could inhibit gefitinib - induced apoptosis to some extent. therefore, we hypothesised that egfr signalling may be dependent on stat3 activation, in other words, the inhibitory effect of gefitinib may depend on stat3 activation, and this point of view has been reported. the phosphorylation of stat3 was inhibited by ifn- pretreatment ; therefore, the egfr pathway, being somewhat dependent on stat3 activation, may not have been activated, thereby reducing the gefitinib sensitivity of these cell lines. although ifn- may increase the susceptibility of egfr - tki in other tumour cells, but in lung cancer there is no similar action. in contrast, the antiproliferation of egfr - tki can be inhibited by ifn- in lung cancer. our data suggests that egfr - tki should avoid sequential application with ifn-. in addition, as we know, finding the mechanisms of egfr - tki resistance is the current focus, ifn- inactivates gefitinib in nsclc, it may provide a new idea to explore and enrich the mechanisms of egfr - tki resistance. we hypothesised that the potential cause may be that ifn- inhibits phosphorylation of stat3, which might be dependent on egfr signal activation. 320.6750.12241), natural science foundation of china (no. 81102012), natural science foundation of china (no. 91229104), and zhejiang medicine scientific research fund projects (no. | aim of the studymany studies have shown that interferon- (ifn-) enhances the antiproliferative effect of gefitinib in some solid tumours. we aimed to determine the effect of combining ifn- with gefitinib in human non - small cell lung cancer (nsclc) cell lines (a549, h1299, hcc827) with different egfr and k - ras gene statuses.material and methodsan mtt assay was used to assess cell proliferation. apoptosis was detected by an annexin v / propidium iodide assay using flow cytometry, and western blotting was used to determine the expression of epidermal growth factor receptor / phosphorylated epidermal growth factor receptor (egfr / p - egfr) and signal transducers and activators of transcription 3/phosphorylated signal transducers and activators of transcription 3 (stat3/p - stat3).resultsthere was an additive interaction when gefitinib was combined with ifn- in all cell lines ; however, there was antagonism when gefitinib followed ifn- pretreatment in three cell lines. notably, ifn- pretreatment significantly reduced the gefitinib sensitivity of hcc827 cells. surprisingly, while ifn- inhibited stat3 phosphorylation in cell lines, gefitinib could do so.conclusionsthe results might confirm the hypothesis that ifn- induces gefitinib sensitivity of nsclc, and ifn- inhibits phosphorylation of stat3, which may be dependent on egfr signal activation playing a role in the reduction of gefitinib sensitivity after ifn- treatment in nsclc cell lines. |
first, long arm of this osteotomy line started from the forefront of the superior border of the zygomatic arch, where the arch met the lateral orbital rim, and extended toward the medial and anterior areas of masseter muscle attachment. second, short arm of the osteotomy line was made perpendicular to the long arm at the maxillary buttress of zygoma. finally, an incision was made (1 cm long) in the sideburns, and the posterior portion of the zygomatic arch was fractured. all of the osteotomy line was made with a reciprocating saw (fig. frontal view of osteotomy line (a) and inferior view of osteotomy line (b). freed zygomaticomaxillary complex was repositioned by medially rotating the inferior border of the zygomatic arch. the most important step is medially rotating the most prominent point (red point in fig. 2). because ostectomy and bone removal were not carried out, freed zygomatic arch would prematurely contact with the posterior wall of the maxillary sinus. therefore, contour of the posterior wall of the maxillary sinus was gradually adjusted to eliminate a gap in the l - shaped osteotomy line. when intimate bony contact is verified in the osteotomy line by eliminating the gap, rigid fixation is conducted with plates and screws (fig. 2). the most prominent point of zygoma (red dot) and mesial clockwise rotation of the zygomaticomaxillary complex. therefore, reduction malarplasty can result in nonunion after reduction malarplasty if intimate bone contact is not obtained. mesial clockwise rotation of the zygomaticomaxillary complex can produce intimate bone contact and facilitates reduction malarplasty. | abstractthe 2 most common complications of reduction malarplasty are nonunion or malunion and cheek drooping. because masseter muscle is attached from zygomatic process of the maxilla to inferior two thirds of the zygomatic arch, rigid fixation and intimate bone contact without creating a gap are crucial for reduction malarplasty.mesial-clockwise rotation of the zygomaticomaxillary complex can produce intimate bone contact and facilitates reduction malarplasty. |
the first description goes back to 1988 when reaven described syndrome x as the association of insulin resistance, elevated glucose, hypertension, low hdl cholesterol, and augmented vldl triglycerides. however he did not include obesity, now identified as one of the essential criterion, especially visceral obesity. overweight and obesity progress to metabolic syndrome through pathophysiological mechanisms at the moment largely unclear. it has been hypothesized that the state of chronic low - grade inflammation associated with excess adipose tissue may explain the development of the obesity - related pathologies, such as type 2 diabetes mellitus and cardiovascular disease. this inflammatory response is different from the classical responce defined by the cardinal signs of redness, swelling, heat, and pain [3, 4 ]. furthermore, it plays an important role in the development of insulin resistance that triggers the associated comorbidities of metabolic syndrome, such as atherosclerosis, dyslipidemia, hypertension, prothrombotic state, and hyperglycemia [58 ]. the metabolic syndrome is identified as a condition of increased risk for cardiovascular disease (cvd) and type 2 diabetes mellitus (t2 dm) in both sexes. subjects with metabolic syndrome have three times risk of suffering a heart attack or stroke, twice of dying from such an event, and fivefold greater risk of developing type 2 diabetes mellitus when compared to people without the metabolic syndrome. it was first described in 1920 when kylin, a swedish physician, demonastrated the association of high blood pressure (hypertension), high blood glucose (hyperglycaemia), and gout. later in 1947, vague described that the visceral obesity was commonly associated with the metabolic abnormalities found in cvd and t2 dm. the prevalence of metabolic syndrome varies depending on the definition applied, the ethnicity, and the age of the study population. the two currently used definitions are that of the american heart association / national heart, lung, and blood institute (aha / nhlbi) and the other one of the international diabetes federation (idf). they describe overlapping but not identical populations. the major difference is that the first one sets the presence of three of five possible components, whereas the second one identifies in the waist circumference, and therefore in the abdominal obesity, the mandatory diagnostic criterion (table 1) [12, 13 ]. both aha / nhlbi and idf recognize the need of a variable definition of elevated waist circumference among different populations. the idf suggests for europids a threshold for increased waist circumference of at least 94 cm in men and 80 cm in women ; whereas the aha / nhlbi defines for the us population the cutoff of at least 102 cm for men and 88 cm for women (table 1) [12, 13 ]. two important studies show the rationale for using different cut - off points of waist circumference in people of asian extraction [14, 15 ]. east asian and south asian populations may have significant differences in lipid indices, fat mass as a proportion of bmi and cardiovascular morbidity. more studies are necessary to clarify these differences before consensus on separate cutoffs for waist circumference will be established for these ethnic groups. it is evident that a condition characterized by multiple risk factors will carry a greater risk for adverse clinical outcomes. the so - called classic risk factors of cardiovascular disease (cvd) and coronary heart disease (chd) include many of the components of the metabolic syndrome. the most widely applied prediction equation is the framingham risk score, less well validated for persons with t2 dm rather than without t2 dm. more recently, oxford investigators have developed a risk engine based on the large uk prospective diabetes study (ukpds) database with validated cvd risk estimate for people with t2 dm [1820 ]. both methods take into consideration clinical parameters, as well as age, smoking, blood pressure, and serum lipid levels. the world health organization estimates that 300 million of adults worldwide are obese and more than 1 billion are overweight. obesity is commonly classified into subgroups depending on suspected etiology : monogenic obesity, syndromic obesity, and polygenic or common obesity. the monogenic obesity is an autosomal form characterized by an extremely severe obesity in the absence of developmental delays ; there are about 20 single gene disruptions that result in an autosomal form of obesity. interestingly, all these mutations position the leptin / melanocortin pathway in the central nervous system (cns) as critical in the regulation of whole - body energy homeostasis, and obesity in these cases appears to be the result of increased appetite and diminished satiety. syndromic obesity arises from discrete genetic defects or chromosomal abnormalities at several genes, and it can be autosomal or x - linked. they are clinically obese subjects additionally distinguished by mental retardation, dysmorphic features and organ - specific developmental abnormalities ; one of the most well - known forms of syndromic obesity is prader - willi syndrome. the most common form of obesity, which affects the general population, is the polygenic form resulting from a long - term positive energy balance ; the energy excess is stored in adipose tissue and, if this process is prolonged, obesity develops. the balance between energy intake and expenditure is influenced by a complex interplay of genetic, environmental, and social factors. in common obesity, some yet unclear signals lead to insulin resistance and to health risks, such as increased risk of cvd. a positive energy balance or obesity can also be secondary to systemic disorders : hypothyroidism diminishes energy need, insulinoma causes obesity by promoting energy intake via recurrent hypoglycemia, and cushing disease is associated with obesity of the classical centripetal type. other etiological factors of obesity include the binge eating disorder, a high glycemic diet, a sedentary lifestyle, and use of certain medications like psychotropic drugs. obesity is a potent risk factor for metabolic and cardiovascular disease at the population level. at the individual patient level, however, correlations between body mass index and cardiovascular disease are not always straightforward due, in part, to differences among adipose tissue depots with respect to the overall rate of adipocyte dysfunction, tissue vascularization, and local degree of inflammation. adipose tissue develops in several distinct anatomical depots within the body, and the differential expansion of these depots is of great importance. expansion of visceral or abdominal white adipose tissue (wat) has been most strongly correlated to insulin resistance and cardiovascular disease in humans and animals. several studies have documented that peripheral adiposity (especially leg fat) may protect against cardiovascular risk [27, 28 ]. one challenge aspect of metabolic syndrome is understanding the cellular mechanisms that link the metabolic abnormalities with the pathophysiological effects that later generate clinical disease. the link between obesity and inflammation has been derived from the finding that proinflammatory cytokines are overexpressed in obesity. adipose tissue is an heterogeneous mix of adipocytes, stromal preadipocytes, immune cells, and endothelium, and it can respond rapidly and dynamically to alterations in nutrient excess through adipocyte hypertrophy and hyperplasia. with obesity and progressive adipocyte enlargement, the blood supply to adipocytes may be reduced with consequent hypoxia. hypoxia has been proposed to be an inciting etiology of necrosis and macrophage infiltration into adipose tissue that leads to a overproduction of proinflammatory factors like inflammatory chemokines. this results in a localized inflammation in adipose tissue that propagates an overall systemic inflammation associated with the development of obesity - related comorbidities. this paper will focus on three adipokine produced by macrophages : tumor necrosis factor - alpha (tnf-), interleukin-6 (il-6), and adiponectin. tnf-. it is a proinflammatory cytokine that exerts numerous effects in adipose tissue including lipid metabolism and insulin signaling whose circulating levels are increased with obesity and decreased with weight loss. an increase in tnf- promotes the secretion of other proinflammatory cytokines il-6 and tnf-, and reduces anti - inflammatory cytokines like adiponectin. evidence suggests that tnf- induces adipocytes apoptosis and promotes insulin resistance by the inhibition of the insulin receptor substrate 1 signaling pathway. il-6.the primary source of circulating il-6 is macrophages that have infiltrated wat ; il-6 has an important role in the regulation of whole - body energy homeostasis and inflammation. both in vitro and in vivo studies il-6 receptor is also expressed in several regions of the brain, such as the hypothalamus, in which it controls appetite and energy intake. weight loss has been shown to increase adiponectin levels ; in animal models of obesity and insulin resistance, its levels are reduced. adiponectin regulates lipid and glucose metabolism, increases insulin sensibility, regulates food intake and body weight, and protects against chronic inflammation. human studies show that hypoadiponectinemia is associated with insulin resistance, hyperinsulinemia, and the possibility of developing type 2 diabetes, independent of fat mass. furthermore, more recent studies have been focused on the intracellular pathways of inflammation. in obesity, it is thought that the starting signal of inflammation is overfeeding and the pathway origins in all the metabolic cells, for example, in the adipocyte, hepatocyte, or myocyte. studies in mice and humans evidence that consumption of nutrients may acutely evoke inflammatory responses [40, 41 ]. metabolic cells, such as adipocytes, respond to this insult beginning the inflammatory response. in obese men and women, if compared with lean controls, adipose tissue and liver display an increased activation of three kinases able to induce the expression of inflammatory cytokines : the c - jun n - terminal kinase (jnk), the inhibitor of k kinase (ikk), and the protein kinase r (pkr) [42, 43 ]. in the same metabolic tissues, the inflammasome and the toll - like receptors (tlrs) of the innate immune system nutrients or inflammatory signals may activate the tlrs pathways and downstream jnk, ikk, and pkr. these kinases regulate downstream transcriptional programs through the transcription factors activator protein-1 (ap-1), nf-b, and interferon regulatory factor (irf), inducing upregulation of inflammatory mediator gene expression. the increase in cytokines exacerbates receptor activation by establishing a positive feedback loop of inflammation and the inhibitory signaling of metabolic pathways. the hypothesis is that nutrients are not self and therefore elicit an immune response when metabolized, or they are naturally associated with inflammatory molecules released into the circulation [47, 48 ]. in lean healthy animals, a low pulsatile inflammatory response occurs during the feeding and resolves after the nutrients are metabolized [40, 41 ]. in obesity or in overfeeding these signals accumulate over time and may reach a level where the professional immune cells are recruited and activated leading to an unresolved inflammatory response within the tissue [43, 45 ]. the quality of diet may produce different responses : a diet rich in fruit and fibre is reported to not induce significant inflammation compared to an equicaloric high - fat diet. inflammation in obesity results in the inhibition of the insulin receptor signaling cascade : the three kinases described above, jnk - ikk - pkr, can target insulin receptor substrate 1 (irs-1) for serine phosphorilation and degradation [68 ]. insulin has important effects on the endothelium, increasing nitric oxide (no) availability and stimulating vasodilatation. in contrast, insulin resistance is associated with endothelial dysfunction. [51, 52 ]. endothelial and microvascular dysfunction are present in obese subjects and represent important factors in metabolic disturbances, since they could influence both vascular resistance and insulin - mediated glucose disposal, contributing to hypertension and insulin resistance in obesity [52, 53 ]. endothelial dysfunction is an early process in obesity : it is present even in the absence of hypertension or hyperglycemia, and it is associated with visceral obesity suggesting that obesity is an independent risk factor. it is characterized by impaired endothelium - dependent vasodilatation, reduced arterial compliance, and accelerated process of atherosclerosis. it has been hypothesised an inflammatory aetiology for both obesity and atherosclerosis [5557 ]. immune cells play an important role in all stages of the atherosclerotic process ; in addiction, a reduction in no, a key regulator of endothelial homeostasis, and an increase in reactive oxygen species result in endothelial dysfunction and a proatherogenic vascular bed. therefore, gavin and collegues demonstrated a microvascular dysfunction in obese subjects resulting in a reduction on capillary density in skeletal muscle and skin when compared to lean individuals. this produces a blunted response to vasodilatation induced by oral glucose loading probably due to impaired capillary recruitment in response to an increased plasma insulin level. there is also a reduction in transcapillary delivery of insulin to muscle in obese subjects. considering the obesity - induced inflammatory state, studies from the literature have evaluated therapeutic interventions by interfering with inflammatory mediators. in patients with type 2 diabetes mellitus, the pancreatic il1-receptor antagonist (il-1ra) expression is reduced and high glucose concentrations induce il-1 production in -cells leading to impaired insulin secretion, decreased cell proliferation, and apoptosis. larsen., using anakinra, a recombinant human il-1ra, in 70 patients with type 2 diabetes mellitus, observed after 13 weeks an improved -cell secretory function (reduced glycated haemoglobin level, enhanced c - peptide secretion, reduced ratio of proinsulin to insulin) and a reduction of il-6 and c - reactive protein, markers of systemic inflammation. the same authors in a 39-week follow - up study investigated the durability of these responses : the reduced proinsulin / insulin ratio and crp and il-6 serum levels were maintained. the improvement in -cell function could be a consequence of inhibited il-1 signaling and not only of improved glycaemia per se. in obese humans are observed increased circulating levels of tnf- ; this event has been proposed to be causatively involved in the evolution of insulin resistance, type 2 diabetes, and its complications. animal studies showing that interference with tnf- signaling protects against developing the metabolic syndrome in obesity and studies in patients with chronic inflammatory conditions, such as rheumatoid arthritis and psoriasis, clearly show that quenching tnf- activity improves insulin sensitivity [63, 64 ]. alternatively, some studies were conducted to demonstrate the effect of tnf- neutralization on insulin sensitivity in patients with type 2 diabetes : most of them indicated no appreciable effect of tnf- neutralization on insulin sensitivity [6567].the basis for this controversy is unclear but may relate to patient populations studied or length of clinical trials ; all these studies potentially did not allow sufficient time for normalization of the metabolic derangements. in fact more recently, a long - term study conducted in obese subjects with glucose alterations and subclinical inflammation treated with etanercept, tnf- antagonist, found an improved fasting glucose, increased ratio of high molecular weight (hmw) adiponectin to total adiponectin, and decreased soluble intracellular adhesion molecule-1 (sicam). however, this evidence brings to question whether in tnf- is a causative link between adiposity and insulin resistance. the thiazolidinediones (tzds), a class of potent agonists of peroxisome proliferator activated receptor- (ppar), increasing the activation of this transcription factor in adipose tissue, restores lipogenic function and decrease inflammation. tzds also block the ability of tnf- to alter the most proximal steps of insulin signaling through the serine phosphorylation of insulin receptor and increase adiponectin expression. one in vitro study demonstrated that adiponectin exerts potent immunosuppressive properties inducing the production of anti - inflammatory mediators il-10 and il-1 receptor antagonist (il-1ra) in a variety of myeloid cell types. il-10 can inhibit the production of many other proinflammatory cytokines including il-1, il-2, inf, and tnf- and impairs the phagocytic and all - stimulatory capacity of macrophages. in addition, adiponectin through the upregulation of il-10 increases the tissue inhibitor metalloproteinase-1 (timp-1) levels in human macrophages preventing the extracellular degradation. the association between visceral obesity and metabolic syndrome is well known, but the pathophysiological mechanisms that explain this link are not completely understood. metabolic syndrome is a complex of clinical features, the most important of which is an increased visceral fat depot. obesity results in a proinflammatory state starting in the metabolic cells (adipocyte, hepatocyte, or myocyte) and also recruiting immune cells with the consequent release of inflammatory cytokines (tnf-, il-6, adiponectin, etc.). it has been hypothesized that the obesity - induced inflammatory process may lead to complications such as hypertension, atherosclerosis, dyslipidaemia, insulin resistance, and diabetes mellitus which characterize metabolic syndrome (figure 1), but other studies are necessary to focus on the role of adipose tissue in the pathogenesis of diabetes mellitus and cardiovascular disease. | the metabolic syndrome is a complex of clinical features leading to an increased risk for cardiovascular disease and type 2 diabetes mellitus in both sexes. visceral obesity and insulin resistance are considered the main features determining the negative cardiovascular profile in metabolic syndrome. the aim of this paper is to highlight the central role of obesity in the development of a chronic low - grade inflammatory state that leads to insulin resistance, endothelial and microvascular dysfunctions. it is thought that the starting signal of this inflammation is overfeeding and the pathway origins in all the metabolic cells ; the subsequent increase in cytokine production recruits immune cells in the extracellular environment inducing an overall systemic inflammation. this paper focuses on the molecular and cellular inflammatory mechanisms studied until now. |
we report the case of a myopic patient who, after intraocular lens transplant in the posterior chamber, suffered elevated intraocular pressure due to pigment dispersion, with recurrent episodes of blurred vision. the patient was treated with a new surgical technique that can avoid potential iridolenticular contact. complete ophthalmologic examination and optical coherence tomography (oct) of the anterior segment were performed. contact between the pigmentary epithelium and the iris with an intraocular lens was revealed by utrasound biomicroscopy and oct. in this case, nd : yag laser iridotomy and laser iridoplasty were not effective for iridolenticular separation and control of the pigment dispersion. we propose a new technique : stitches on the surface of the iris to obtain good iridolenticular separation and good intraocular pressure control. stitches on the iris surface should be considered as optional therapy in pigmentary glaucoma secondary to intraocular lens implantation. pigmentary dispersion syndrome secondary to intraocular lens (iol) implantation in the sulcus may be a potential problem with poor response to medical treatment.14 good results have been obtained with nd : yag laser peripheral iridotomy and with argon laser iridoplasty.5,6 we report a case with poor response to conventional treatment, in which we developed a new surgical procedure by suturing the iris surface with prolene stitches in the iridolenticular contact zone. a 61-years - old woman, surgically treated for right eye cataract 30 months before, attended the emergency department for blurred vision after trauma. biomicroscopic examination of the anterior segment revealed pseudophakia with small slight displacement of the iol towards the nasal quadrant and marked iridopseudophakodonesis, tyndal positive, flare + 3, and retrolental pigment without evidence of vitreous in the anterior chamber. left eye biomicroscopic examination showed a posterior chamber iol, no pigment dispersion, and a open angle without evident trabecular pigmentation. we observed a good response with timolol 0.5% (timoftol ; msd laboratories, whitehouse station, nj) and topical prednisolone acetate (pred - forte ; allergan laboratories, irvine, ca) administered twice daily for two weeks. we therefore decided to perform a vitrectomy, relocation of the iol to the anterior chamber, and extraction since this was an iol with three points of support (ioltech stabibag hydro - philic intraocular lens ; bausch and lomb, rochester, ny), and scleral - sutured posterior chamber intraocular lens implantation (+ 4.00 d ma60ma acrysoftiol ; alcon laboratories, fort worth, tx). immediately after intervention we observed satisfactory evolution with the iol in position and iop of 18 mmhg. at one and three months after iol replacement, both biomicroscopic examinations showed a wide chamber with pigment dispersion in the anterior chamber and a cornea with some old endothelial pigment. intraocular pressures of, 30 and 50 mmhg respectively were satisfactorily treated with a fixed combination of dorzolamide and timoftol (cosopt ; msd laboratories) and topical prednisolone acetate (pred - forte ; allergan laboratories) administered twice daily. at six months after iol replacement, examination revealed abundant pigment dispersion throughout the anterior chamber, marked iris concavity, and untreated iop of 14 mmhg (figure 1). we performed a macular ophthalmoscopy and optical coherence tomography to (oct) (visante ; carl zeiss meditec, inc., jena, germany) to look for a cystoid macular edema but no macular disorder was found. at this point oct of the anterior segment showed iris concavity produced by contact between the posterior face of the iris and the anterior face of the crystalline lens (figure 2). this finding led to the performance of nd : yag laser iridotomy which rectified the iris concavity. at successive check - ups we observed good iridolenticular separation in the right eye, permeable iridotomies, anterior chamber without celularity, and iop of 10 mmhg. two months after nd : yag laser iridectomy, the patient reported a new episode of blurred vision. examination showed extensive pigment dispersion in the anterior chamber, with right eye iop of 12 mmhg. after two months of medical treatment (topical prednisolone acetate and tapered oral prednisone) without clinical improvement, we performed 360 iridoplasty of the peripheral iris, which achieved good anatomic resolution but required maintenance therapy with antiglaucoma medication and topical nonsteroidal anti - inflamatory drugs to conserve good visual acuity. pilocarpine eye drops were used previously to check the contractility of the iris, finding a poor response. twelve months after the iridoplasty, the patient had new episodes of blurred vision caused by dispersion of pigment in the anterior chamber, which was resolved with nonsteroidal anti - inflammatory drugs and topical beta blockers (figure 3). given the chronic nature of the case and the refusal of the patient to undergo iol removal or repositioning of the iol in the anterior chamber despite good endothelial cell count, we decided to perform a more conservative surgery consisting of placing four prolene 10/0 stitches (ethicon inc, somerville, nj) on the iris surface to permanently remove the iridolenticular contact (figure 4). the technique consists of performing three paracentesis, two of them in each of the margins of the area affected by the pigment dispersion, and a third at the midpoint. in this way we could access the area to be treated by adjusting the different stitches and were thus able to lift the flaccid iris, and eliminate the iridolenticular contacts. six months after placement of the prolene stitches in the iris, we observed good tolerance (figure 5), an absence of pigment dispersion in anterior chamber, and a good iridolenticular separation in the oct (figure 6). without antiglaucoma medication, uncorrected visual acuity was 0.65, and an iop of 17 mmhg. pigment dispersion syndrome (pds) is produced when iris pigmentary epithelium pigment deposits pass through the aqueous humor and are dispersed throughout the anterior segment. when this dispersion is associated with increased iop, it is called pigmentary glaucoma (pg), which must be taken into account on evaluating primary open - angle glaucoma.1 the literature contains cases of pg secondary to iol implantation in the posterior chamber. among the different theories attempting to explain this increase of iop, the most widely accepted proposes that chronic contact between the haptics and the posterior face of the iris triggers pigment release. this, together with the localization of iris transillumination defects and increased iop months after intervention, suggests that the iol is the most probable cause.2 the thickness, size, material, implantation technique, and the degree of inclination of the haptics are factors that influence changes in the iris.3 anterior segment optical coherence tomography (as - oct) is a high resolution noninvasive technique allowing rapid in vivo evaluation of possible iridolenticular contact, as well as visualization of anatomic details such as iris concavity, amplitude, and angle of the anterior chamber.4,5 in order to equalize anterior and posterior chamber pressure, many authors propose the use of nd : yag laser iridotomy, with confirmation of iris flattening by ultrasound biomicroscopy. although most cases prove anatomically successful (with restitution of the iris in its anatomic position), pressure control is often not achieved. this explains why the efficacy of yag laser iridotomy in pigmentary glaucoma is not generally established.6 considering the physiopathologic mechanisms of pigmentary glaucoma and the mechanism of action of argon laser iridoplasty (which aims to provoke contraction of the peripheral iris and flattening of the peripheral curvature using the thermal effect of the laser), we believe that this method could be useful for this type of pathology, reducing iris concavity and avoiding reverse pupillary block and the consequent increase of intraocular pressure. however, this hypothesis requires prolonged studies with greater numbers of patients to determine its possible indication and long - term benefits. pigment dispersion syndrome secondary to iol implantation in the sulcus and mainly if haptic - optic angulation is present as in the case described (ma60ma acrysoft iol, alcon labs) may prove refractory to medical treatment and require coadjuvant laser treatment (such as iridotomy or iridoplasty), to correct episodes of pigment dispersion by minimizing iris - optic and iris - haptic contact. when the laser treatment is not sufficient to reverse this process, different authors propose explants or iol exchange to solve the pigment dispersion.710 in our case, the refusal of the patient to agree to iol removal and due to the clearly identified iridolenticular contact, we decided to perform surgery that involved stitches to the surface of the iris in order to lift the iris and separate it from the iol. as this is a new technique, we need more follow - up time and a larger series of patients, to confirm this method as an alternative surgical treatment when conventional laser (iridotomy and iridoplasty) does not resolve the iridolenticular contact. if the stitches do not suceed, we propose removal of the iol to prevent chronic evolution of pigment loss. | aimswe report the case of a myopic patient who, after intraocular lens transplant in the posterior chamber, suffered elevated intraocular pressure due to pigment dispersion, with recurrent episodes of blurred vision. the patient was treated with a new surgical technique that can avoid potential iridolenticular contact.methodscomplete ophthalmologic examination and optical coherence tomography (oct) of the anterior segment were performed.resultscontact between the pigmentary epithelium and the iris with an intraocular lens was revealed by utrasound biomicroscopy and oct. in this case, nd : yag laser iridotomy and laser iridoplasty were not effective for iridolenticular separation and control of the pigment dispersion. we propose a new technique : stitches on the surface of the iris to obtain good iridolenticular separation and good intraocular pressure control.conclusionstitches on the iris surface should be considered as optional therapy in pigmentary glaucoma secondary to intraocular lens implantation. this surgical technique can avoid potential iridolenticular contacts more definitively. |
psoriatic arthritis (psa) is an incapacitating seronegative arthritis that occurs in up to 30% of patients with psoriasis.13 psa is more prevalent among patients with relatively severe psoriasis. risk factors for a more severe course of arthritis include initial presentation at an early age, female sex, polyarticular involvement, genetic predisposition, and radiographic signs of the disease early on.3 the following classification has been outlined by moll:4 mono- and asymmetric oligoarthritis (including the classic involvement of the whole digit referred to as the sausage digit), arthritis of the distal interphalangeal joints, rheumatoid arthritis - like presentation, arthritis mutilans, and spondylitis and sacroiliitis. in recent years, among biologic agents, tnf inhibitors have been a mainstay for the treatment of psa.5 although these agents can remarkably improve the clinical manifestations of psa and prevent radiographic joint damage,5,6 a number of patients fail to respond to tnf inhibitors, experience recurrence, or develop resistance to these therapies. the introduction of ustekinumab and similar drugs was therefore considered an advancement in the management of emergent or refractory psa. in 2008 and 2009, ustekinumab was approved by the european medicines agency (ema) and the us food and drug administration (fda), respectively, for the treatment of moderate - to - severe plaque psoriasis in adult patients. in september 2013, the ema and fda also approved ustekinumab for the treatment of psa. in this article, we review the pharmacodynamics, pharmacokinetics, efficacy, and safety profile of ustekinumab for the management of psa. ustekinumab is a fully human immunoglobulin g1 monoclonal antibody against the shared p40 subunit of il-12 and il-23, thereby preventing il-12 and il-23 from binding to the receptor chain il-12rb1 to trigger downstream signaling pathways.7 the pathways activated by il-12 and il-23 are well established, and are linked to the pathogenesis of psoriasis. it has been demonstrated that dendritic cells and macrophages can overexpress il-12 and il-23 cytokines in psoriatic lesions.8 il-12 is a proinflammatory cytokine involved in differentiating nave t cells into t - helper (th)-1 cells and producing ifn and tnf.9 il-23 enables the expansion of th17-positive cells, which produce il-17 and other cytokines.10,11 studies support the fundamental role of il-23 and th-17 in the pathogenesis of psoriasis.12,13 in addition, filer noted that variations in the il-23 receptor and il-12b single nucleotide polymorphisms are associated with susceptibility to both psoriasis and psa.14 although psoriasis and psa have been recently shown to have similar susceptibility loci and considerable genetic overlap,15 it is still not clear that both conditions respond equally well to ustekinumab. zhu reported that the mean values for apparent clearance, apparent volume of distribution, and absorption - rate constant were similar among psa patients and patients with mild - to - severe psoriasis.16 importantly, the patient s body weight and the levels of antibodies against ustekinumab significantly affected the pharmacokinetic properties,16 although the significance of antiustekinumab antibodies has not yet been determined.17 other variables, such as age, sex, disease duration, and baseline psoriasis area and severity index (pasi) score showed no remarkable effects on the volume of distribution or clearance values.16 indeed, in a population - based pharmacokinetic analysis, there were no apparent changes in pharmacokinetic properties among elderly patients.7 also, it has been shown that the clearance of ustekinumab was not changed by concurrent administration of methotrexate, nonsteroidal anti - inflammatory drugs, oral corticosteroids, or prior exposure to anti - tnf agents in psa patients.7 kauffman reported that 67% of patients treated with ustekinumab showed a pasi 75 over the course of a 16-week phase i study.18 in another phase i study, compared to no symptom improvement for the placebo group, 76% of patients treated with ustekinumab achieved 75% improvement in pasi score.19 in a phase ii dose - ranging randomized clinical trial (rct), pasi 75 was achieved by week 12 with a distinct dose - dependence : 52% of patients treated with a single 45 mg dose, 59% of patients treated with a single 90 mg dose, 67% of patients treated with 45 mg doses every 4 weeks, and 81% of patients treated with 90 mg doses every 4 weeks.20 over the same time period, only 2% of placebo - treated patients achieved pasi 75. in the phase iii phoenix (psoriasis followed by long - term extension) 1 trial with 766 patients, 67.1% of patients treated with 45 mg ustekinumab and 66.4% of patients treated with 90 mg ustekinumab achieved pasi 75 after 12 weeks, whereas 3.1% of the placebo - treated patients achieved pasi 75.21 phoenix 2 showed comparable results in 1,230 patients. pasi 75 was achieved in 66.7% of patients receiving ustekinumab 45 mg, 75.7% receiving ustekinumab 90 mg, and 3.7% receiving placebo.22 the phase iii accept (active comparator [cnto1275/enbrel ] psoriasis trial) showed pasi 75 in 67.5% of the group treated with 45 mg ustekinumab, 73.8% of the group treated with 90 mg ustekinumab, and 56.8% of the group treated with 50 mg etanercept.23 finally, pearl (efficacy and safety of ustekinumab for the treatment of moderate - to - severe psoriasis : a phase iii, randomized, placebo - controlled trial in taiwanese and korean patients) evaluated an asian population of psoriasis patients, and found pasi 75 in 67.2% of ustekinumab - treated patients, compared to only 5.0% of placebo - treated patients.24 thus far, there have been no phase i clinical trials investigating the dose response or safety profile of ustekinumab for treating psa. support for conducting later - stage clinical trials for psa efficacy was based on phase i evidence for efficacy reported from clinical trials for the treatment of moderate - to - severe plaque psoriasis.17,18 one phase ii25 and two phase iii26,27 large - scale rcts investigated the efficacy and safety of ustekinumab in the management of psa. the results of these trials were published recently, and are summarized in table 1. the first study was a randomized, multicenter, double - blind, placebo - controlled, crossover phase ii trial that was published in 2009.25 in this study, 146 patients with active psa were recruited at multiple clinical sites in europe and north america, with inclusion criteria consisting of three or more swollen joints, three or more tender joints, and either a c - reactive protein (crp) level of at least 15 mg / l or a minimum of 45 minutes of daily morning stiffness. patients were also required to have at least one active skin psoriatic lesion of 2 cm or larger. patients in the first group received weekly subcutaneous ustekinumab (90 or 63 mg) for 4 weeks, followed by placebo at weeks 12 and 16, and patients in the second group received placebo every week for 4 weeks, followed by ustekinumab (63 mg) at weeks 12 and 16. an american college of rheumatology (acr) 20 response (20% or greater improvement in arthritis28) at week 12 was defined as the primary end point of the study. after 12 weeks, acr 20 was observed in 42.1% of ustekinumab treated patients versus 14.3% of patients who received placebo. at week 36, 34% of patients in the ustekinumab - treated group, who had not received the drug for 33 weeks, still showed acr 20. acr 20 was also observed in 51% (week 24), 45% (week 28), and 42% (week 36) of patients treated with placebo followed by ustekinumab. acr 50 and acr 70 were achieved in 25% and 11% of ustekinumab - treated patients, compared to 7% and 0 in the placebo group, respectively. additionally, the ustekinumab group showed a significantly larger decrease from baseline in the health assessment questionnaire disability index (haq - di) than the placebo group at week 12 (0.25 [interquartile range 0.50 to 0 ] versus 0 [interquartile range 0.25 to 0.13 ], respectively). moreover, pasi scores were assessed in patients with psoriatic lesions affecting 3% or more of their body surface area. at week 12, pasi 75 was achieved in 52% of the ustekinumab - treated group and 5% of the placebo - treated group. among this cohort of patients, dermatology life quality index (dlqi) data showed a significantly greater median decrease from baseline in ustekinumab - treated patients than in placebo - treated patients at week 12 (6.0 [interquartile range 14.0 to 3.0 ] versus 0 [interquartile range 4.0 to 2.0 ], respectively). this study demonstrated the superior efficacy of ustekinumab compared to placebo in improving the signs and symptoms of psa as well as skin psoriatic lesions. the two phase iii studies for psa treatment psummit (study of the safety and effectiveness of ustekinumab in patients with psoriatic arthritis) 126 and psummit 227 were multicenter, randomized, double - blind, placebo - controlled trials that assessed the efficacy and safety of ustekinumab in large populations of psa patients. in psummit 1, 1,174 patients were screened, and 615 eligible patients with active psa were randomly assigned to treatment groups. the patient population was from 14 countries in north america, europe, and the asia - pacific region. the patients were included if they had at least five swollen joints, at least five tender joints, crp 3 mg / l, and an active or past history of plaque psoriasis. patients were randomly grouped to receive either subcutaneous ustekinumab 45 mg, subcutaneous ustekinumab 90 mg, or placebo at weeks 0 and 4, and every 12 weeks thereafter. patients were evaluated at week 16, and those with less than 5% improvement in tender and swollen joint count were switched to another treatment arm : patients receiving placebo entered the ustekinumab 45 mg group, and patients treated with ustekinumab 45 mg entered the ustekinumab 90 mg group. finally, all patients who remained in the placebo group received ustekinumab 45 mg at weeks 24 and 28, and then every 12 weeks thereafter. the primary end point of the study was defined as acr 20 at week 24. the secondary end points at week 24 were acr 50 and acr 70, pasi 75, 28-joint disease activity score based on crp (das28-crp), bath ankylosing spondylitis disease activity index (basdai), haq - di, 36-item short - form health survey (sf-36), and dlqi scores. the patients in the ustekinumab 45 mg group and 90 mg group had significantly higher rates of acr 20 response (42.4% and 49.5%, respectively) than the patients in the placebo group (22.8%) at week 24. an acr 50 response was achieved in 24.9% of patients in the ustekinumab 45 mg group, 27.9% of patients in the ustekinumab 90 mg group, and 8.7% of patients in the placebo group (p0.05). other outcome measures, such as acr 50, acr 70, quality - of - life measures, and skin indices, showed the same trend at week 52. it is important to consider the fact that this trial was not placebo - controlled beyond 24 weeks. therefore, the results beyond this time point should be interpreted cautiously. in psummit 2, 312 patients with psa were randomly assigned to be treated with 45 mg or 90 mg ustekinumab or a placebo. similar to psummit 1, the treatments occurred at weeks 0, 4, and every 12 weeks thereafter. the eligible patients on other treatments also had a minimum refractory period to other treatments, including disease - modifying antirheumatic drugs, (3 months), non - steroidal anti - inflammatory drugs (4 weeks), etanercept, adalimumab, golimumab, or certolizumab pegol (8 weeks), or infliximab or other tnf antagonists (14 weeks). concurrent methotrexate therapy was allowed if started more than 3 months before commencement of the trial and if at a stable dose of 25 mg / week for at least 4 weeks. patients who had less than 5% improvement in their joint symptoms entered a blinded early escape at week 16. this protocol involved patients receiving placebo switching to ustekinumab 45 mg, those receiving ustekinumab 45 mg switching to ustekinumab 90 mg, and patients receiving ustekinumab 90 mg continuing with blinded 90 mg dosing. placebo - treated patients who did not start the early escape crossed over to receive ustekinumab 45 mg at week 24 and thereafter. the primary end point of this trial was the same as for psummit 1, and included acr 20 at week 24. other end points included pasi score, das28-crp less than 2.6, dlqi, sf-36, 0.3 or more unit improvement in haq - di, presence of dactylitis, entheseal tenderness or pain using the psa - modified maastricht ankylosing spondylitis enthesitis score 24, basdai, and level of fatigue using the 13-item functional assessment of chronic illness therapy fatigue (facit - fatigue) questionnaire. the acr 20 response for psummit 2 at week 24 was very similar in the 45 mg and the 90 mg ustekinumab groups (43.7% and 43.8%, respectively). both doses achieved a significantly higher response rate when compared to the placebo group (20.2%, p<0.001 compared to either ustekinumab - treatment groups). the number of patients who achieved das28-crp response was comparable in both of the ustekinumab groups, with a cumulative response of 53.8%, and both were significantly higher than the placebo group, with a 29.8% response. pasi 75 response was achieved in a higher proportion of the ustekinumab - treated than placebo - treated patients at week 24, and all comparisons showed statistically significant efficacy (table 1), irrespective of the status of methotrexate therapy or body weight. all the quality - of - life measures (haq - di score, facit - fatigue score, dlqi score, and sf-36 score) were significantly improved in both ustekinumab groups versus the placebo group, except the mental component of sf-36, which was comparable between all groups at week 24. patients with enthesitis and dactylitis responded better to both ustekinumab groups than the placebo group. however, this improvement only reached statistical significance in patients with enthesitis. among those patients who received methotrexate, an acr 20 response was achieved at week 24 in 35.6% of patients in the combined ustekinumab groups versus 14.5% of patients in the placebo group (p<0.01). the pasi 75 response was even more apparent in the combined ustekinumab groups compared to the placebo group among the same subgroup of patients (47.1% versus 2.0%, p<0.01). among patients who were on tnf inhibitors, median changes in haq - di scores were significantly more pronounced (0.13, interquartile range 0.38 to 0) in the combined ustekinumab groups than the placebo - treatment group (0, interquartile range 0.13 to 0.13) (p<0.05). in a recent updated report of psummit 1 and psummit 2, kavanaugh showed that both ustekinumab 45 mg and ustekinumab 90 mg can provide a sustained inhibition of radiographic progression of joint damage, and this effect was significantly higher than the placebo group. sharp score was used to evaluate hand or foot radiographs to monitor the progression of joint involvement. the placebo group had a significantly higher average score (1.03.9) at week 24 when compared to the ustekinumab 45 mg (0.42.1) and 90 mg groups (0.42.4).30 the safety profile of ustekinumab has been extensively examined for the treatment of psoriasis as well as psa. the phase iii multicenter psummit 1, which administered treatment of 45 mg ustekinumab, 90 mg ustekinumab, or placebo for 52 weeks, demonstrated a 42% rate by week 16 and 49.5% by week 24 of at least one adverse event (ae) occurring in the combined ustekinumab - treatment groups.26 the most common aes of the combined ustekinumab - treatment groups for psoriasis were respiratory tract infections, headaches, arthralgia, and nasopharyngitis. there was a combined 1.7% rate of serious aes, with consequent discontinuation of treatment in six patients.26 in a randomized clinical study of 146 patients with psa treated with ustekinumab, the treatment was reasonably well tolerated.25 patients were administered a 63 mg or 90 mg dose of ustekinumab or a placebo. by 12 weeks of treatment, 61% of the patients in the combined treatment groups and 63% of the patients in the placebo group had one or more aes, suggesting that ustekinumab was well tolerated compared to placebo. by week 36, the treatment group had 76% of participants with an ae compared to 63% of the patients treated with placebo followed by ustekinumab.25 similar to ustekinumab treatment for psoriasis, the majority of aes were upper respiratory tract infections or nasopharyngitis. in psummit 1, 615 adult psa patients were randomized to receive 45 mg/90 mg / placebo treatment and were followed for 2 years.31 the placebo - treated patients began 45 mg ustekinumab therapy at week 24. a total of 490 of the participants completed the study, with 5% of the participants discontinuing due to serious aes. the rates (per 100 patient - years of follow - up) of serious infections, malignancies, and major adverse cardiovascular events were 1.23, 0.38, and 0.66, respectively, in the ustekinumab - treated groups when combined.31 in psummit 2, with 312 patients with psa, ustekinumab was administered at doses of 45 mg or 90 mg or a placebo, with the placebo group crossing over to 45 mg ustekinumab at 24 weeks.27 after 16 weeks of treatment, the combined ustekinumab - treatment group had aes in 61.8% of the patient population compared to 54.8% in the placebo group. even at 24 weeks, the combined ustekinumab group showed 66.4% of the patients having an ae compared to 63.5% for the placebo group.27 the majority of aes were similar to those found in psoriatic patients, with nasopharyngitis and upper respiratory tract infections as the most common. a study aggregating the results from a phase ii study,25 psummit 1, and psummit 2 results included 1,071 treated patients with psa.32 the placebo - treated group had 348.07 aes per 100 patient - years compared to 375.83 for ustekinumab - treated patients in the psa - specific studies. furthermore, the placebo group had 12.69 serious aes compared to 5.75 for the ustekinumab - treated group per 100 patient - years. results from psoriasis studies with psa patient subgroups reported similar levels of aes of 476.42 for the placebo and 481.31 for the ustekinumab - treated groups (events per 100 patient - years).32 aggregated data from a phase ii study,20 phoenix 1, phoenix 2, and accept included 3,117 patients totaling 8,998 patient years of follow - up and compared the safety of ustekinumab 45 mg or 90 mg treatment in psoriatic patients to the psa subgroup.33 of the 858 patients with psa totaling 2,490 years of patient follow - up, there were 249.40 aes per 100 patient - years compared to 232.59 aes per 100 patient - years for the overall population. among the aes, the rate of major adverse cardiovascular events and serious infections for the psa group was 0.56/100 patient - years and 1.53/100 patient - years compared to 0.44/100 patient - years and 1.10/100 patient - years in the overall population.33 therefore, ustekinumab treatment for psa appears to have comparable results to the overall treated psoriasis population. there has been extensive research on the safety profile of ustekinumab for the treatment of psoriasis and psa, and it appears that long - term treatment with ustekinumab does not alter the risks associated with its use. the safety of ustekinumab is comparable to other approved drugs for the treatment of psoriasis and psa. the current literature supports the efficacy and safety of ustekinumab in the treatment of psa. the results from phase iii trials suggest that ustekinumab is also useful for treating enthesitis, dactylitis, and spondyloarthrosis. furthermore, data from the psummit trials suggest that the onset of action is slower with ustekinumab than tnf inhibitors, although a similar efficacy rate can be achieved by 52 weeks. future trials comparing these two classes of drugs are essential to further elucidate their relative efficacy.29 | psoriatic arthritis occurs in 30% of psoriasis patients, and the treatment can be challenging in some patients. recently, the us food and drug administration approved ustekinumab, a fully human monoclonal antibody, for the management of psoriatic arthritis. in this article, we review large - scale randomized clinical trials addressing the efficacy and safety profile of ustekinumab for the treatment of psoriatic arthritis. |
women in southeast asia are characterized by small body size, and usually gain less weight during pregnancy than larger caucasian1. lower resting minute ventilation (ve), oxygen consumption (vo2), and carbon dioxide production (vco2) have been reported for healthy thai women than for western women2. adaptation to pregnancy in humans involves major anatomical, physiological and metabolic changes to compensate for nutritional and metabolic demands throughout the 3 trimesters. the most evident change in the physical appearance of a mother s body during pregnancy is the consequential weight gain which depends on the individual3. cardiorespiratory alterations take place in the early stages of pregnancy resulting in an increase in tidal volume (vt) which remarkably affects minute ventilation (ve) throughout pregnancy. the enlargement of the uterus occurs later in gestation, and increases the pressure on the diaphragm causing an increase in resting vo2, and an increase in the energy required for breathing4. in the initial stage of pregnancy, maternal metabolism changes to anabolic metabolism accumulating a greater proportion of nutrients, as evidenced by an accumulation of fat stores. during the final stage of pregnancy period, when fetal growth is rapid, maternal metabolism switches to catabolic metabolism which enhances transfer of nutrients across the placenta5. very few studies have attempted to estimate energy expenditures in pregnant thai women, and interestingly, none have investigated all 3 trimesters. considering that maternal anthropometry differs across populations and physiological adaptations occur during the 3 trimesters, the present study aimed to examine cardiorespiratory and metabolic changes across the 1st (g1), 2nd (g2) and 3rd (g3) trimesters in pregnant women. this investigation was a cross - sectional study of 42 healthy pregnant women, attending the maternal fetal medicine unit, thammasat university hospital. all subjects were non - smokers, and were not taking long - term medication, or habitually abusing alcohol or drugs, and they were normoglycemic, euthyroid, and non - anemic. gestational age was confirmed via the gynecological report of the last menstrual period, or by ultrasound. the first, second and third trimesters of pregnancy were classified using gestational age as follows : the first group extended from conception through week 14 of pregnancy (g1) ; the second group from weeks 14 through 28 (g2), and the third group from weeks 28 through 36 (g3). both interview and physical activity questionnaire revealed that subjects of this study had sedentary lifestyles. this study was approved by both thammasat university hospital and mahidol university ethics committee. experimental protocols and testing procedures were clearly explained to the subjects prior to them providing their informed consent. to prevent risk during measurements, our study was conducted under the direct supervision of an obstetrician, who was also one of the investigators. physical characteristics including height (h), body - weight (bw) and blood pressure (bp) were obtained at the enrollment. body mass index (bmi, kg.m) was calculated thereafter6. cardiorespiratory and metabolic changes were measured using a telemetric indirect calorimetry method (oxycon, usa) for variables including heart rate (hr), minute ventilation (ve), breathing frequency (bf), tidal volume (vt), oxygen consumption (vo2), carbon dioxide production (vco2), ventilatory equivalents of oxygen (ve / vo2) and carbon dioxide (ve / vco2), the respiratory exchange ratio (rer), and resting energy expenditure (ree). before each evaluation, they were instructed to avoid any intense physical activity with appropriate work / rest period during the 24 h before measurement. after 30 min of resting in a sitting position, metabolic profiles were measured continuously for 35 min. after subjects had had adequate acclimation, data were recorded as the average of every minute of quiet breathing. subjects were instructed to avoid hyperventilation, fidgeting, or falling asleep during the test. ree was calculated using weir s equation7, without urinary urea nitrogen level. the statistical differences among the three groups were analyzed using anova followed by post hoc analysis with tukey s test. mean gestational age at the time of testing was 10.5 2.9 weeks in g1, 19.2 3.4 weeks in g2, and 33.3 3.1 weeks in g3. the non - anemic status of the women was confirmed by routine tests for hemoglobin (hb) and hematocrit (hct) levels. all women were followed with routine, standard prenatal care at thammasat university hospital. as shown in table 1table 1. general physical characteristics of thai pregnant women (n=42)pregnantg1 (n=14)g2 (n=14)g3 (n=14)ages (yrs)27.75.826.95.124.05.2height (m)1.590.041.590.061.570.05weight (kg)57.67.861.411.666.67.4body mass index (bmi, kg.m)22.73.424.13.626.74.2gestation (weeks)10.52.919.23.433.33.1all values are presented as means sd ;, significantly different from g1 (p<0.05). g1 : trimester 1 ; g2 : trimester 2 and g3 : trimester 3, g1, g2 and g3 were matched for age and body height. maternal weight and bmi increased with advancing gestation and were significantly greater in g3 than in g1 (p < 0.05). the results of bp, hr, ve, bf and vt in g1, g2 and g3 are reported in table 2table 2. resting cardiorespiratory and metabolic changes of thai pregnant womenvariablespregnantg1g2g3cardiorespiratory variablesbp (systolic, mmhg)106.92.43105.12.48106.03.24(diastolic, mmhg)68.31.6865.01.4969.61.86heart rate (hr, bpm)81.32.184.22.890.72.0 minute ventilation (ve, l / min)10.40.6410.470.5011.300.66breathing frequency (bf, breaths / min)19.500.5120.190.7318.360.83tidal volume (vt, l)0.570.030.570.020.600.02metabolic variablesoxygen consumption (vo2, ml / min)253.913.56262.311.94298.215.38carbon dioxide production (vco2, ml / min)205.113.97226.411.32268.313.62ve / vo238.710.9940.840.9538.810.88ve / vco248.561.6247.591.4343.050.63 respiratory exchange ratio (rer)0.790.030.860.030.910.12 resting energy expenditure (ree, kcal / day)1861103.491815.684.622081.8108.07all values are presented as means sem ;, significantly different from g1 (p<0.05) ;, significantly different from g2 (p<0.05). g1 : trimester 1 ; g2 : trimester 2 and g3 : trimester 3. only hr in g3 was significantly higher than in g1 (p < 0.05). no significant difference in any other cardiorespiratory variable was detected. at rest, vo2, ve and vt showed modest increases with advancing gestation but no significant differences were found among the groups. significant differences in vco2, ve / vco2 and rer were found (table 2), with g3 showing statistically higher values of vco2 and ve / vco2 than g1 (p < 0.05) and g2 (p < 0.05). rer was significantly higher in g3 than in g1 (p < 0.05). despite ree being higher in g3, there were no significant differences in ree among the groups. all values are presented as means sd ;, significantly different from g1 (p<0.05). g1 : trimester 1 ; g2 : trimester 2 and g3 : trimester 3 all values are presented as means sem ;, significantly different from g1 (p<0.05) ;, significantly different from g2 (p<0.05). to our knowledge, this is the first study to determine cardiorespiratory and metabolic adaptations across 3 trimesters in pregnant women. several types of evidence have shown that the smaller size of southeast asian women is related to their lower weight gain during pregnancy than caucasian women1. our study showed that the average value of bmi in the 1st trimester of pregnant women is 22.7 kg.m. this is consistent with liabsuetrakul t.8, who studied 485 pregnant women, aged between 1346 years with a gestational age of < 14 weeks, and reported their average value of bmi was about 22.4 kg.m. in contrast, more than 50% of pregnant women in the united states have a bmi greater than 25.13 kg.m9. in comparison, vietnamese women have a maternal body size [height (1544.8 cm), bw (562.9 kg) and bmi (20.31.2 kg.m ] which is similar to that of pregnant thai women during the 1st gestational stage1. as shown in our results, the maternal weight and bmi of pregnant thai women continuously increased with a remarkable peak in the last trimester, indicating our subjects were well - nourished. these results therefore need to be interpreted with caution. even though the changes seem to be typical maternal anthropometric characteristics of southeast asian women, the nutritional and socio - economic status of pregnancy the average values of resting hr, ve, vo2 and vco2 in the 1st trimester of pregnancy were within the normal ranges of thai women of this age range2. with advancing gestation, the present study found progressive changes : hr increased 6 beat per min. (bpm) in the 1st trimester, and 9 and 15 bpm in the 2nd and 3rd trimesters ; ve increased 60%, 33% and 83% in the 1st, 2nd and 3rd trimesters ; vo2 increased 19%, 15% and 34% in the 1st, 2nd and 3rd trimesters ; and vco2 increased 7% in the 1st and 2nd trimesters and 28% in the 3rd trimester. these findings are in agreement with reports in the literature on the physiological adaptations of the mother to the developing embryo10. the heart must work harder during pregnancy in order to pump more blood to the uterus. this was reflected in the rise in heart rate of around 6 bpm in the 1st trimester, with a further 20% increase during the 2nd and 3rd trimesters, for a rise of around 15 bpm by the end of pregnancy4, 10. our study confirms the results of previous studies that pregnancy - induced increases in ve are greater than those typically observed for the metabolic rates of vo2 and vco211. our results differ from those of a previous study with regard to changes in ve / vo2 and ve / vco2 values12. we found that the value of ve / vo2 did not change, whereas the ve / vco2 value in late gestation was significantly lower than in the first two trimesters of gestation. since the ve / vco2 ratio represents the responsiveness of ventilation to changing co2 concentrations and the lung s efficiency in removing co2 from the body, the lower ve / vco2 ratio may reflect a better gas exchange efficiency13. however, further investigations with larger sample sizes are required to confirm this result. rer is the ratio between vo2 and vco2 and is used as an indicator of the energy substrate being metabolized within the body. our data show that the value of rer gradually increased from 0.8 in the 1st trimester to 0.86 in the 2nd trimester and 0.91 in the 3rd trimester. most previous studies have reported an increase in rer in pregnant women, indicating higher rates of net carbohydrate utilization5. our results confirm the evidence of increasing rer of pregnant women, towards greater carbohydrate utilization, as gestation progresses. this indicates that carbohydrate and fat are the main energy supply during the 1st trimester, whereas a higher contribution comes from carbohydrate during the last trimester. although several studies have reported energy expenditure increases during pregnancy, our data show only a moderate increase during the final trimester. the small increase in ree could be due to either low energy reserves or low bmi before pregnancy a characteristic of southeastern asian women. however, various biological or behavioral factors may also mediate or modify resting energy expenditure which is influenced by height, weight, age, nutritional status and body composition1. in pregnant women, in addition, changes in cardiorespiratory variables, in parallel with gas exchange, indicate a better gas exchange process. we suggest further studies are needed to determine the effects of daily physical activity or exercise on cardiorespiratory and metabolic changes during the three phases of pregnancy. | [purpose ] we examined cardiorespiratory and metabolic changes across the 1st (g1), 2nd (g2) and 3rd (g3) trimesters in pregnant women. [subjects and methods ] forty - two healthy, active, non - smoking, pregnant women participated in this study. they were divided into g1, g2 and g3 groups depending on their mean gestational ages at the time of testing which were 10.5 2.9, 19.2 3.4, and 33.3 2.4 weeks of gestation, respectively. cardio - respiratory and metabolic variables, vo2 (oxygen consumption), vco2 (carbon dioxide production), and ve (minute ventilation), were measured using indirect calorimetry (ic, gas analyser) to estimate ventilatory equivalents of oxygen (ve / vo2) and carbon dioxide (ve / vco2), rer (respiratory exchange ratio) and ree (resting energy expenditure). [results ] women in the late pregnancy period had higher resting vco2 and rer, whereas the ve / vco2 ratio was significantly lower than in g1 and in g2. even though the values of vo2 and ree increased throughout the course of pregnancy, no significant differences were found. [conclusion ] in pregnant women, resting cardiorespiratory and metabolic variables continuously changed throughout the 3 trimesters. changes in ve / vco2 and rer indicate shifting metabolic energy substrates. in addition, changes in cardiorespiratory variables, in parallel with gas exchange, indicate a better gas exchange process. |
nanoparticles are engineered materials produced within the nanoscale range of 1100 nm in one or more dimensions.1 pure silver has the highest electrical and thermal conductivity of all the metals and has low contact resistance. silver nanoparticles (agnps) have unique physical and chemical properties2 and have been used in a wide variety of applications.3 agnps are the best known nanoproducts,4 have attracted considerable attention as antimicrobial agents,5 and have been incorporated into a number of products, including catheters, clothing, and electrical home appliances due to their high specific surface area and high proportion of surface atoms.6 more utilities were added to numerous consumer products including industrial and food products in addition to biological and health and medical applications.7,8 nanosilver with a particle size less than 20 nm in diameter has been reported to be effective in the treatment of certain infectious diseases,9 and is effective in retarding growth of bacteria, mold, and harmful spores. it has been reported that silver is re - emerging as a viable treatment option for infections associated with burns, open wounds, and chronic ulcers.10 agnps can be ingested directly via water, food, cosmetics, drugs, and drug delivery devices.11 some investigators have demonstrated that silver ions released from ingested products into the blood can accumulate in body organs and have toxic effects, especially in the liver and kidney.12 however, acute oral or transdermal doses of agnps (2,000 mg / kg body weight) in rats, guinea pigs, and rabbits have not resulted in significant clinical signs, mortality, acute irritation, or corrosive reactions affecting the eyes and skin.13 it has been reported that agnps are more toxic than other metal nanoparticles, including aluminum, iron, nickel, and manganese,14 but the mechanism of their toxicity is not clear.15 the aim of this study was to assess the biological risks and benefits of agnps. we studied the effect of acute dosing with agnps in order to identify potential ultrastructural alterations in the liver and kidney and blood parameters in the albino rat, in the hope of shedding light on the biological responses induced by acute dosing, and to assess cellular responses when these nanoparticles are used in biomedical applications. silver nanopowder with a particle size less than 100 nm and a 99.9% trace metals basis was purchased from sigma - aldrich chemicals, cairo, egypt. agnps have been dissolved in 0.5% aqueous carboxymethylcellulose (sigma - aldrich) were coated with carbon, mounted on an electron microscope grid (200 mesh),16 and visualized using a transmission electron microscope ([tem ] ; jem-100cxii, jeol ltd., tokyo, japan) operating at 80 kv. however, agnps in the injected doses should be distributed more uniformly by sonication for 10 minutes just before injection, to be taken by systemic circulation. we purchased 20, 6-week - old male albino rats (weighing 2605 g) from the animal house of assiut university, assiut, egypt. the rats were randomly assigned to polycarbonate cages (five rats per cage), and acclimatized for 10 days at a temperature of 22c0.05c and 51%0.5% humidity with a 12/12 hour - light / dark cycle and access ad libitum to fresh tap water and a rodent diet for 2 weeks before the experiment. the experiments were performed in accordance with the research protocols established by the animal care committee of the national research center, egypt. five rats were used as controls and injected intraperitoneally with 0.5 ml of sterile saline solution followed by a second dose after 48 hours. the remaining 15 rats were injected intraperitoneally with agnps at a dose of 2,000 mg / kg body weight dissolved in 0.5 ml of distilled water followed by a second injection after 48 hours.13 the rats were euthanized 3 days after the second injection, two blood samples were collected from the left ventricle of each rat under sterile conditions in heparinized tubes for hematology and non - heparinized tubes for biochemistry. the blood samples were taken for a complete blood count, including erythrocytes, total leukocytes, hemoglobin, and hematocrit. serum from the second blood sample was harvested after centrifugation at 5,000 rpm and stored at 20c until determination of aspartate and alanine aminotransferases, as well as creatinine and urea according to standard methods.17,18 using 2.5% glutaraldehyde, small slices of kidney and liver tissue were extracted, fixed immediately, rinsed in 0.1 m sodium cacodylate buffer (ph 7.2), postfixed for 2 hours in 1% osmium tetroxide. then they were rewashed with fresh sodium cacodylate buffer and dehydrated in an ascending series of ethanol. the specimens were embedded in epon 812.19 semithin (0.51 m thickness) and ultrathin (700800 a thickness) sections were cut using an lkb ultramicrotome (lkb produkter ab, ltd., the semithin sections were stained with toluidine blue and the ultrathin sections with uranyl acetate and lead citrate. silver nanopowder with a particle size less than 100 nm and a 99.9% trace metals basis was purchased from sigma - aldrich chemicals, cairo, egypt. agnps have been dissolved in 0.5% aqueous carboxymethylcellulose (sigma - aldrich) were coated with carbon, mounted on an electron microscope grid (200 mesh),16 and visualized using a transmission electron microscope ([tem ] ; jem-100cxii, jeol ltd., tokyo, japan) operating at 80 kv. however, agnps in the injected doses should be distributed more uniformly by sonication for 10 minutes just before injection, to be taken by systemic circulation. we purchased 20, 6-week - old male albino rats (weighing 2605 g) from the animal house of assiut university, assiut, egypt. the rats were randomly assigned to polycarbonate cages (five rats per cage), and acclimatized for 10 days at a temperature of 22c0.05c and 51%0.5% humidity with a 12/12 hour - light / dark cycle and access ad libitum to fresh tap water and a rodent diet for 2 weeks before the experiment. the experiments were performed in accordance with the research protocols established by the animal care committee of the national research center, egypt. five rats were used as controls and injected intraperitoneally with 0.5 ml of sterile saline solution followed by a second dose after 48 hours. the remaining 15 rats were injected intraperitoneally with agnps at a dose of 2,000 mg / kg body weight dissolved in 0.5 ml of distilled water followed by a second injection after 48 hours.13 the rats were euthanized 3 days after the second injection, two blood samples were collected from the left ventricle of each rat under sterile conditions in heparinized tubes for hematology and non - heparinized tubes for biochemistry. the blood samples were taken for a complete blood count, including erythrocytes, total leukocytes, hemoglobin, and hematocrit. serum from the second blood sample was harvested after centrifugation at 5,000 rpm and stored at 20c until determination of aspartate and alanine aminotransferases, as well as creatinine and urea according to standard methods.17,18 using 2.5% glutaraldehyde, small slices of kidney and liver tissue were extracted, fixed immediately, rinsed in 0.1 m sodium cacodylate buffer (ph 7.2), postfixed for 2 hours in 1% osmium tetroxide. then they were rewashed with fresh sodium cacodylate buffer and dehydrated in an ascending series of ethanol. the specimens were embedded in epon 812.19 semithin (0.51 m thickness) and ultrathin (700800 a thickness) sections were cut using an lkb ultramicrotome (lkb produkter ab, ltd., the semithin sections were stained with toluidine blue and the ultrathin sections with uranyl acetate and lead citrate. tem imaging of agnps ranging from 20 nm to 65 nm in diameter was performed to confirm primary particle size and general morphology. figures 1 and 2a show aggregation of agnps in the size range of 4765 nm. however, smaller nanomolecules (less than 30 nm) appeared to exist as solitary entities (figure 2b d). no mortality, gross effects, or significant differences in food consumption or body weight were observed during the study period in any of the rats administered agnps when compared with the control group. however, treated rats showed a marked decrease in activity. the treated animals showed distinct morphological changes in the kidney and liver on microscopic observation when compared with the control group, indicating unhealthy cells. figure 3 shows the normal histological structure of renal tubules in kidney tissue from the control group. however, the renal cortex in kidney tissue from the treated group shows swollen epithelium and cytoplasm containing numerous membranous vacuoles, with some nuclei showing hypertrophied nucleoli. figure 4 shows a semithin section of kidney tissue from the treated group, with swelling of the tubular epithelium, cytoplasmic vacuolization, glomeruli with increased cellularity, and obliteration of bowman s space. ultrastructural investigations of renal epithelium from control kidney tissue showed a normal brush border, basement membrane, and intact cell organelles, including mitochondria, nuclei, and a few membranous vacuoles (figure 5). the glomeruli showed normal mesangial cells and a normal basement membrane in the capillary tufts, with some red blood cells in their lumen and normal surrounding primary and secondary processes of intact podocytes (figure 6). in treated rats, the renal epithelium had a thickened basement membrane, and the cytoplasm showed some mitochondria with destroyed cristae and numerous large membranous vesicles (figures 7 and 8). the glomeruli showed podocytes with swollen and elongated primary and secondary processes, and the basement membrane of the endothelial cells in the capillary tufts was thickened (figure 9). semithin sections from a sample of control liver tissue demonstrated a normal histological structure (figure 10), while semithin sections of treated liver tissue showed narrowing of the sinusoidal lumen and damaged hepatocytes (figure 11). ultrathin sections of treated liver tissue showed swollen hepatic cells, narrowing of the sinusoidal lumen, and appearance of hypertrophied kupffer cells (figure 12). the nuclei had a normal ultrastructural appearance with a distinct nuclear envelope, and the nucleoplasm showed aggregations of euchromatin and heterochromatin granules (figure 13). other intact cytoplasmic organelles could be seen, including spheroid or ovoid mitochondria with well - developed cristae and flattened cisternae of rough endoplasmic reticulum studded with ribosomes ; in addition, considerable numbers of glycogen granules were observed in the cytosol (figure 14). figure 15 showed a hepatocyte with strong cytoplasmic vacuolization, numerous intranuclear and intracytoplasmic fat globules of various sizes that appeared swollen, with smaller stacks of fragmented rough endoplasmic reticulum cisternae. numerous intracytoplasmic and intranuclear fat globules of various sizes were intermingled with mitochondria that appeared swollen with obviously condensed electron - dense matrices and some of them without cristae (figures 15 and 16). some kupffer cells showed numerous membranous vacuoles, fragmented rough endoplasmic reticulum cisternae, endosomes, and a large number of lysosomes filled with agnps of different sizes that appear as electron - dense material (figures 1719). disse s spaces contained fragmented microvilli (figures 18, 20, and 21), and the mitochondria showed complete loss of internal ridges and matrices (figures 22 and 23). figure 23 shows degenerated hepatic kupffer cells and nuclei, with destruction of the microvilli in disse s spaces and lysosomes filled with agnps that appear as electron - dense material. complete blood count sampling in the treated group showed a significant increase in white blood cells and hemoglobin, with slight changes in red blood cell and hematocrit values (table 1). in comparison with the control group, serum alanine and aspartate aminotransferase levels in the treated group were significantly elevated in comparison with those in the control group (figure 24a and b), indicating disruption of liver function. serum creatinine and urea were significantly increased, indicating changes in kidney function (figure 24c and d). tem imaging of agnps ranging from 20 nm to 65 nm in diameter was performed to confirm primary particle size and general morphology. figures 1 and 2a show aggregation of agnps in the size range of 4765 nm. however, smaller nanomolecules (less than 30 nm) appeared to exist as solitary entities (figure 2b d). no mortality, gross effects, or significant differences in food consumption or body weight were observed during the study period in any of the rats administered agnps when compared with the control group the treated animals showed distinct morphological changes in the kidney and liver on microscopic observation when compared with the control group, indicating unhealthy cells. figure 3 shows the normal histological structure of renal tubules in kidney tissue from the control group. however, the renal cortex in kidney tissue from the treated group shows swollen epithelium and cytoplasm containing numerous membranous vacuoles, with some nuclei showing hypertrophied nucleoli. figure 4 shows a semithin section of kidney tissue from the treated group, with swelling of the tubular epithelium, cytoplasmic vacuolization, glomeruli with increased cellularity, and obliteration of bowman s space. ultrastructural investigations of renal epithelium from control kidney tissue showed a normal brush border, basement membrane, and intact cell organelles, including mitochondria, nuclei, and a few membranous vacuoles (figure 5). the glomeruli showed normal mesangial cells and a normal basement membrane in the capillary tufts, with some red blood cells in their lumen and normal surrounding primary and secondary processes of intact podocytes (figure 6). in treated rats, the renal epithelium had a thickened basement membrane, and the cytoplasm showed some mitochondria with destroyed cristae and numerous large membranous vesicles (figures 7 and 8). the glomeruli showed podocytes with swollen and elongated primary and secondary processes, and the basement membrane of the endothelial cells in the capillary tufts was thickened (figure 9). semithin sections from a sample of control liver tissue demonstrated a normal histological structure (figure 10), while semithin sections of treated liver tissue showed narrowing of the sinusoidal lumen and damaged hepatocytes (figure 11). ultrathin sections of treated liver tissue showed swollen hepatic cells, narrowing of the sinusoidal lumen, and appearance of hypertrophied kupffer cells (figure 12). the nuclei had a normal ultrastructural appearance with a distinct nuclear envelope, and the nucleoplasm showed aggregations of euchromatin and heterochromatin granules (figure 13). other intact cytoplasmic organelles could be seen, including spheroid or ovoid mitochondria with well - developed cristae and flattened cisternae of rough endoplasmic reticulum studded with ribosomes ; in addition, considerable numbers of glycogen granules were observed in the cytosol (figure 14). figure 15 showed a hepatocyte with strong cytoplasmic vacuolization, numerous intranuclear and intracytoplasmic fat globules of various sizes that appeared swollen, with smaller stacks of fragmented rough endoplasmic reticulum cisternae. numerous intracytoplasmic and intranuclear fat globules of various sizes were intermingled with mitochondria that appeared swollen with obviously condensed electron - dense matrices and some of them without cristae (figures 15 and 16). some kupffer cells showed numerous membranous vacuoles, fragmented rough endoplasmic reticulum cisternae, endosomes, and a large number of lysosomes filled with agnps of different sizes that appear as electron - dense material (figures 1719). disse s spaces contained fragmented microvilli (figures 18, 20, and 21), and the mitochondria showed complete loss of internal ridges and matrices (figures 22 and 23). figure 23 shows degenerated hepatic kupffer cells and nuclei, with destruction of the microvilli in disse s spaces and lysosomes filled with agnps that appear as electron - dense material. figure 3 shows the normal histological structure of renal tubules in kidney tissue from the control group. however, the renal cortex in kidney tissue from the treated group shows swollen epithelium and cytoplasm containing numerous membranous vacuoles, with some nuclei showing hypertrophied nucleoli. figure 4 shows a semithin section of kidney tissue from the treated group, with swelling of the tubular epithelium, cytoplasmic vacuolization, glomeruli with increased cellularity, and obliteration of bowman s space. ultrastructural investigations of renal epithelium from control kidney tissue showed a normal brush border, basement membrane, and intact cell organelles, including mitochondria, nuclei, and a few membranous vacuoles (figure 5). the glomeruli showed normal mesangial cells and a normal basement membrane in the capillary tufts, with some red blood cells in their lumen and normal surrounding primary and secondary processes of intact podocytes (figure 6). in treated rats, the renal epithelium had a thickened basement membrane, and the cytoplasm showed some mitochondria with destroyed cristae and numerous large membranous vesicles (figures 7 and 8). the glomeruli showed podocytes with swollen and elongated primary and secondary processes, and the basement membrane of the endothelial cells in the capillary tufts was thickened (figure 9). semithin sections from a sample of control liver tissue demonstrated a normal histological structure (figure 10), while semithin sections of treated liver tissue showed narrowing of the sinusoidal lumen and damaged hepatocytes (figure 11). ultrathin sections of treated liver tissue showed swollen hepatic cells, narrowing of the sinusoidal lumen, and appearance of hypertrophied kupffer cells (figure 12). the nuclei had a normal ultrastructural appearance with a distinct nuclear envelope, and the nucleoplasm showed aggregations of euchromatin and heterochromatin granules (figure 13). other intact cytoplasmic organelles could be seen, including spheroid or ovoid mitochondria with well - developed cristae and flattened cisternae of rough endoplasmic reticulum studded with ribosomes ; in addition, considerable numbers of glycogen granules were observed in the cytosol (figure 14). figure 15 showed a hepatocyte with strong cytoplasmic vacuolization, numerous intranuclear and intracytoplasmic fat globules of various sizes that appeared swollen, with smaller stacks of fragmented rough endoplasmic reticulum cisternae. numerous intracytoplasmic and intranuclear fat globules of various sizes were intermingled with mitochondria that appeared swollen with obviously condensed electron - dense matrices and some of them without cristae (figures 15 and 16). some kupffer cells showed numerous membranous vacuoles, fragmented rough endoplasmic reticulum cisternae, endosomes, and a large number of lysosomes filled with agnps of different sizes that appear as electron - dense material (figures 1719). disse s spaces contained fragmented microvilli (figures 18, 20, and 21), and the mitochondria showed complete loss of internal ridges and matrices (figures 22 and 23). figure 23 shows degenerated hepatic kupffer cells and nuclei, with destruction of the microvilli in disse s spaces and lysosomes filled with agnps that appear as electron - dense material. complete blood count sampling in the treated group showed a significant increase in white blood cells and hemoglobin, with slight changes in red blood cell and hematocrit values (table 1). in comparison with the control group, serum alanine and aspartate aminotransferase levels in the treated group were significantly elevated in comparison with those in the control group (figure 24a and b), indicating disruption of liver function. serum creatinine and urea were significantly increased, indicating changes in kidney function (figure 24c and d). agnps have received much attention due to their antimicrobial properties20,21 and their potential for application in the treatment of diseases that need a constant drug concentration in the blood or targeting of specific tissue.2224 despite these beneficial effects, some studies based on actual data from rat models suggesting that agnps may be cytotoxic even at low doses,25,26 potentially increasing reactive oxygen species,6,27 via which phospholipid membranes may be attacked, and decreasing function of the mitochondrial respiratory chain complexes in the liver, brain, and skeletal muscles.28,29 nanoparticles released into the blood have been shown to accumulate, with toxic effects in the liver, kidney, and heart, causing scattered cytoplasmic vacuolization, appearance of chronic inflammatory cells, and congested and dilated blood vessels.12,30 the agnps used in our study appeared to be very uniform with a mostly spherical morphology and a particle size of 2060 nm. spherical, triangular, and hexagonal nanoparticles have better antimicrobial and physical properties if they are produced in a small size range.31 jiang reported that agnps in the 4050 nm size range demonstrated the best antimicrobial activity. however, sonification of the dose for 10 minutes immediately before injection may prevent aggregation of agnps before they can be taken up by the systemic circulation. once agnps aggregate, significant loss of antibacterial activity occurs due to their inability to penetrate the plasma membrane and loss of surface area. consequently, the decreased stability of agnps may lead to loss of their nanoscale properties.33 further, aggregation of agnps decreased their effect and cellular uptake34 and modifies their bioavailability and toxicity.35 our study suggests that the toxicity of agnps is dose - dependent and time - dependent, with more accumulation of silver in the liver than in the kidneys at 3 days post - injection. limited tissue clearance was observed after 26 weeks in the liver, spleen, and lungs of mice treated with titanium dioxide nanoparticles.36 however, it has been concluded that the target organs for agnp toxicity are the liver and kidneys of male and female rats and that deposition of agnps in tissue samples is size - dependent.16,37 it has also been demonstrated that different sized and shaped gold nanoparticles have different toxicity.38 also, the smallest (mean size 2.4 nm) gold nanoparticles were found to be localized in the nucleus,39 and intermediate ones (size 5.58.2 nm) were partly delivered into the cytoplasm, causing greater oxidative stress and cytotoxic effects than larger nanoparticles,40 while larger gold nanoparticles (> 16 nm) did not enter cells.39 in contrast, no histopathological evidence of tissue damage in response to treatment with gold or titanium dioxide nanoparticles has been observed in murine models,36,41 although the presence of these nps inside intracellular vacuoles as endosomal containment. the increased levels of silver in the kidney seen in our study are consistent with published literature showing that subchronic oral dosing with agnps induces minimal tubular basophilia in addition to unilateral or bilateral mineralization in the rat kidney.16 other investigators have reported deposition of ingested silver in the renal tubules, the glomerular basement membrane,16,4244 and mesangium,45 as well as proliferation of mesangial cells.46 further, swelling of the renal epithelium and the presence of membranous vacuoles along with hypertrophied nucleoli have been demonstrated in all animals treated with agnps.44,4750 moreover, the present work suggests increasing glomerular cellularity and swelling of the primary and secondary processes of podocytes which, to the authors knowledge, has not been reported before. with regard to liver toxicity, we found swelling of hepatocytes with prominent hypertrophied nucleoli and narrowing of the sinusoidal lumen. these results are consistent with previous reports of the liver being the target organ for agnps and the site at which they preferentially accumulate.11,16,44,51 the liver damage seen in the current study may be explained by : deposition of agnps in the hepatic kupffer cells and endothelial cells lining the sinusoidal spaces;52 inhibition of the mitochondrial respiratory chain that normally produces energy for cells;4,28,53,54 generation of reactive oxygen species associated with inflammatory, oxidative, genotoxic, and cytotoxic events ; and induction of apoptosis.29,51,53 endocytosis of agnps by numerous endosomes and lysosomes in kupffer cells was seen in the present work. similarly, our observation of intracellular fat globules in the cytoplasm of hepatocytes is new, although empty vacuole - like spaces have been reported in rats.44 also, the first - pass effect of agnps in the liver resulted in excretion into the bile, inducing bile duct hyperplasia and focal, multifocal, or lobular necrosis.16 silver had also been shown to be toxic to other organs, including the brain,55 and administration of gold nanoparticles has been associated with dilated interlobular sinusoidal capillaries and congestion of blood between hepatocytes in the liver.46 agnps endocytosed by kupffer cells that appeared in the form of electron - dense materials were reported.43,50 with regard to the mitochondrial injury, this study confirms that the smallest ag - nps destructed biomembranes, decreased bioenergetics and adenosine triphosphate (atp) levels which preceded cell death. similarly, decreased atp and creatine kinase levels suggest a potential for metabolic and cell cycle arrest, leading to widespread cell death.50,56 complete blood counts revealed a significant increase in white cells and hemoglobin in the treated group, along with slight changes in red cell and hematocrit values. moreover, when agnps are injected intravenously, they interact initially with the blood and its components and they may cause various immunogenic responses, inflammation, and changes in hematological parameters, including white cells and platelets.26 the changes in white and red blood cells reported here after the first injection of nanoparticles have been described before, and are possibly due to an increased immunogenic response26,57,58 or disturbances in signaling pathways and maturation of cells,59 which can affect red blood cells as well as the division and development of other cells. with regard to biochemistry, significant elevations of serum alanine and aspartate aminotransferase, creatinine, and urea levels were seen, indicating disruptive changes in liver and kidney function. previous studies have shown that metal nanoparticles alter the levels of various biochemical markers indicating changes in composition of serum enzyme levels,60 suggesting hepatocellular injury, hepatic inflammation, and impairment of kidney function.60,61 the aim of this study was to evaluate the potential toxicity of acute dosing with agnps. we found that acute doses of agnps were not associated with mortality and did nt affect the normal activity (behavior) of examined rats. renal damage was observed, including swollen epithelium in the renal tubules, cytoplasmic vacuolization, hypertrophied nucleoli, thickening of the basement membrane in the glomerular tufts, and reduction of bowman s space. on the other hand, liver tissue showed damaged hepatocytes and kupffer cells with numerous intracellular and intranuclear fat globules, fragmented cisternae in the rough endoplasmic reticulum, and swollen or destroyed mitochondria with complete loss of internal ridges and matrices. it can be concluded that an acute dose of agnps will induce significant damage to the structure and function of the liver and kidney, as well as disrupting blood parameters. in this study, the acute dose generated remarkable toxic effect in killing any tumor cells. to protect healthy tissues and to reduce agnps toxicity, biodegradable, biocompatible organic substance, polymer matrix or even lipids further in vivo studies are essential to evaluate the critical concentration needed for agnps and to evaluate further ultrastructural effects on the high - energy consuming organs such as brain, skeletal muscles, and heart. | backgroundthe purpose of this study was to investigate the effect of acute dosing with silver nanoparticles (agnps) and identify potential ultrastructural alterations in the liver and kidney and their effect on blood parameters in the albino rat.methodstwenty rats were used to assess the acute effects of agnps. rats in the treatment group were injected intraperitoneally with 0.5 ml of distilled water containing agnps at a dose of 2,000 mg / kg body weight followed by a second injection after 48 hours. control rats received two 0.5 ml doses of distilled water only. after 3 days, blood samples were collected, and the rat kidneys and livers were extracted and processed for electron microscopy to investigate for hematologic and histopathologic alterations.resultsrenal tubules showed swollen epithelium with cytoplasmic vacuolization, thickening of the basement membrane, and destruction of some mitochondrial cristae. podocytes showed elongation and swelling of their primary and secondary processes. the basement membrane of the capillary tufts became thicker. the hepatic tissue showed narrowing of the sinusoids, swollen hepatocytes with hypertrophied nucleoli, and accumulation of fat globules in the nucleoplasm and cytoplasm. the hepatic sinusoids showed hypertrophied endothelial and kupffer. destructed cristae of some mitochondria, endosomes, and larger lysosomes filled with ag - nps were also observed in the kupffer cells. significant increases were observed in white blood cell count, lymphocyte count, granulocytes, and hemoglobin. there was a significant increase in serum creatinine, urea, and aspartate and alanine aminotransferases.conclusionto the best of the authors knowledge, the ultrastructural changes in renal and liver tissue observed in this study have not been described before. our results suggest that injection of agnps could have severe cytotoxic effects on the structure and function of these organs. |
supervision is observation of staffs during work and formal guidance on how to do so with each of them. in health care organizations, as protecting life and human health and nullifying clients needs are the main goals and much complexity has been observed in them than in other organizations, supervision becomes more necessary and its importance becomes obvious. the department of health 's clinical supervision has been defined as a formal process for supporting, training, and professional learning. it provides a safe and confidential environment for the staff to reflect on and discuss their work, which enhances their awareness and clinical skills and leads to improved competency. clinical supervision is a process in which between two or more professionals (novice nurse and practitioner nurse), the focus is to provide a basis for monitoring, assessing, examining practice and receiving feedback at work, which could lead to the development of professional skills. clinical supervisor is a nurse who has the responsibility to directly supervise nursing services and helps in reaching the organization 's goals with supporting and expanding knowledge, skills, commitment, and performance. supervision is helpful in identification of clinical problems and supervisor may help nurses in the admission of new role. experts and fully trained clinical supervisor / s can inform nurses what and when to do, while supervising, and bring development to the organization ; they support and strengthen the supervised nurse and maintain and enhance the quality of care. organizations and/or employers are bound to empower supervisor in clinical supervision in order to provide qualitative monitoring services. according to butterworth. the department of health in england also recommended familiarity with clinical supervision in a professional training course. while there are few studies on training a supervisor, expanding supervisory standards, and evaluation of the supervisory process, most of them have been used in counseling, psychotherapy, and other mental health disciplines. although training and educating resources are restricted, there is willingness and attention in training and educating nurses in clinical supervision. there are problems in the development and establishment of clinical supervision. owing to lack of resources for education and training, as well as insufficient support from supervisors, regard, sloan mentioned that 65% of the supervisors believe that they do not have enough readiness for supervisory role. in iran, azimian writes that nursing managers have high educational need to guarantee the quality of care. state that nurse managers tend to improve the knowledge, attitude, and performance management. therefore, there is not enough knowledge about the role and the different responsibilities of a clinical supervisor and their way of training. on the other hand, the concept and usage of clinical supervision these conceptual differences are assumed to have an effect on the goal, meaning, nature, and duration of relationships, the role of supervisor, and supervisee (such as experience, education, and position in the organization). further research is needed to know about the meaning of this concept in any culture. consequently, regarding the unique feature of iranian culture and paying attention to supervisor 's and supervised experience in the supervision, qualitative research methods were used in this study to understand the clinical supervision phenomenon. the qualitative research is a tool for understanding and deeply discovering the inherent complexity of a phenomenon that reveals various aspects of the subject. qualitative research has been found to be an appropriate approach for recognizing unknown dimensions of the clinical supervision phenomenon, and has been used in this research to explore the factors that influence the training of nursing supervisor. the role of a supervisor is affected by various factors and understanding these factors needs consideration of experiments, beliefs, and values of supervisors and supervised nurses. as there is not adequate information in this regard, researchers chose qualitative research. content analysis is a widely used qualitative research technique which is potentially one of the most important techniques in social science research that analyzes data in order to identify them. this method is also used in nursing research and education to collect a wide variety of data and to have deep interpretation. it consisted of 25 participants (including 10 nurses, 9 supervisors, 2 matrons, and 4 head nurses) employed in yazd 's hospitals. participants willing to participate and possessing the ability to describe their experiments about clinical supervision were chosen by purposive sampling method. in - depth and semi - structured interviews were appropriately used regarding qualitative research tenets. some questions in the interview guide are, how can a nurse become a supervisor ? and talk about a supervisory shift. also, some existing documents such as supervisory notes were analyzed. before each interview, the participants were informed of the approximate length of the interview and all the interviews had been conducted by prior arrangement and written right after the interview within the first 24 h ; therefore, they could be used as main data. interview duration was a minimum of 20 min and a maximum of 130 min, and interviews were continued till data saturation was reached. since the environment of qualitative study is the real arena, i.e., the real place at which the process occurs, the hospital was chosen for the place of this research. conventional content analysis method was used to analyze data ; the content of all interviews and supervisory reports were collected and through inductive process, the coding was analyzed. the four main steps of content analysis were used with some adjustments in order to find the master codes. after reading them several times, the first stage of coding process was started through identifying and highlighting sentences and paragraphs of the analyzing unit. according to a prior decision, a master code was given to each analyzing unit and subcodes were extracted. in the second stage of coding, superior codes with same meaning were classified. themes were extracted in order to validate, member check, and data sets were separately analyzed to derive the source of supporting evidence. different methods like persistent observation, allocating sufficient time for collecting data, and good communication with participants in order to increase the trustworthiness, credibility, and confirmability of the data have been used. in addition, member check has been used to review the interview text and themes extracted from the interviews. also, the accuracy of the coding process and content was confirmed by two external observers, who were skilled colleagues. research ethics had been observed in the study in obtaining informed consent, ensuring participants privacy, data confidentiality, the right to withdraw from the study anytime they wanted, and the right to ask for recording interviews and the text of it by the participants. research ethics had been observed in the study in obtaining informed consent, ensuring participants privacy, data confidentiality, the right to withdraw from the study anytime they wanted, and the right to ask for recording interviews and the text of it by the participants. analysis of data showed that there were two themes in order to train a nurse as a supervisor : establishment of supervisory infrastructure and comprehensive supervisory competencies. the establishment of supervisory infrastructure included making the appointments and retention of supervisors, clarifying the duties and authority of supervisor, developing supervisory culture, specializing supervision, conducting practice - based training and comprehensive supervisory competencies included acquiring scientific adequacy, acquiring managing adequacy, acquiring communicative adequacy, acquiring professional and ethical adequacy, and acquiring pedagogical and supporting adequacy [figure 1 ]. a summary of themes and categories of nurse supervisor training the first subcategory is making the appointments and retention of supervisors. the experiences of the participants showed that selecting the supervisor was done based on several criteria and some were vague ; most nurses were not aware of supervisors criteria and the legal requirements in selecting and monitoring supervisor were not clear. moreover, the retention period was uncertain for supervision. one of the participants said in this regard : supervisors are not selected really according to the reception staff, who do not have merit and competence and it is not important that who he is, where he is from, what his literacy is, what his experiences are, which part did he work in, can he respect the staff or not. also, the purposes of supervision are unclear and some nurses believe the reason of not doing some duties by supervisors is the lack of explanation for the task and that the supervisors performance in hospital is not clear supervisor 's role in hospital, it is only on individual attendance and absence. because there is no clear task explanation, each supervisor has different routines and processes. the supervised believe that some supervisors shift is convenient and some are with objection and severity. the supervisor 's authority is ambiguous, and the supervisor does not have enough authority or as much authority as his responsibilities. due to lack of sufficient authority, to make the smallest things and decisions, they should consult with their superior. regarding this, the participants said thus : now, our task explanations are not written, it 's oral. supervisors task explanations are not clear and you do not know what should you do or not at all. our authorities are narrow, we do not have enough authority and sometime we have to consult with the headmaster or hospital principle by plan and it wastes our time and energy to find them and speak with them and maybe there is not enough time for all of those. i have to have many and sufficient authorities to work, but it is not like this. (supervisor 7). most of the times we speak and coordinate with headmaster and matron to not to get in trouble tomorrow. the other subcategory is developing supervisory culture. as in many countries clinical supervision is an interpersonal process, an activity that brings skilled supervisors by supporting which enables less - experienced nurses to develop knowledge and competence, as increase understanding of professional issues. but according to our respondents experience, our supervisory process has no meaning. in our country this situation does not provide effective supervision, which requires the establishment of an appropriate supervisory culture. participants said thus : only some (supervisor) comes, to mention the staff, troubleshooting personnel, to fill report, to have two lines report tomorrow, someone does say that has not gone to the hospital ward for supervising. (nurse 6). another subcategory is specializing supervision. based on the participants views, the nature of supervision as a construct is complex and multidimensional (such as the complexity of the treatment, health care, environment). these views showed that for better supervision, each supervisor works out a particular area or a specific unit. participants said about this as follows : one of the important things i learned this year from the work of a supervisor, the relevant unit of the hospital should be supervised by a supervisor, for example, surgical unit should be supervised by a supervisor, medical unit should be supervised by another supervisor, and it is good to know what each unit is, how it works. supervisors believe that appropriate teaching methods should be used to improve knowledge, skills, abilities, and attitudes. regarding this none of us have scientific, pedagogical, managing education regarding supervision and we want to do well inherently. (supervisor 8) very often we have nursing classes such as nursing management, but it is not helpful. what we are taught must be put into practice and skills so that we can do our job well. based on the experience of participants, the supervisors have lack of basic and specialized knowledge and clinical skills. some of them do not even have enough clinical skill and knowledge in their history because of the shortage of clinical records. usually, for various reasons, supervisors do not have enough training and learning and this is the cause that supervisors do not have adequate and appropriate supervision of all clinical areas. but based on supervisors understanding, knowledge and experience are very important in supervision [table 1 ]. participants said in this regard as follows : process of content analysis illustrated by examples of code, subcategories, and categories about acquisition of scientific competence for example, mrs. x of whom i do not want to talk at her back, comes to nicu (neonatal intensive care unit) and i can swear does not know anything. when we do the gavages, we elevate the head of the bed so the kid wo nt aspirate, but supervisors ask why ? i m sure if i say turn the incubator on and adjust it, she ca nt. according to nurses and supervisors understanding, the most important requirement for supervisory is their management, although the supervisors say they do not have management education and their performance is empirical, tentative, and imitative and there is no innovation. however, according to statements from supervisors, they need to identify, state, and solve the problem for planning, decision - making, and knowing how to deal with conflict. participants said in this regard : they have to manage an administrative training class for us to get to know with management rules. we perform something natural or tentative, sometimes it is good to know what you should do legally, the thing that is administrating ; we have to get informed about rules, some information about staffing employees. some classes about hospital decisions that i should be informed before. we should become familiar with the administrative rules ; we need to learn management skills such as solving and conflict resolution. there are a few things we have on our own experience that we do not know is true or not. (supervisor 19). based on the experiences of participants in the study, this subcategory means that it requires appropriate behavior between the supervisor and the supervisee. also, supervisor needs capabilities such as negotiation, coordination, collaboration, and facilitating teamwork. supervisors should have learned how to deal with staff, what to say to everyone, how to behave that way, not to offend staff and not damage patients. therefore, in this study, from the perspective of the participants, the supervision requirements are ethics, commitment, compliance with laws, rules, and regulations, acting in accordance with the conditions, maintaining privacy and confidentiality, seriousness of the work, stability of behavior and stability of decision making at work, the effort and perseverance, and behave justly. however, many times, we do not see some supervisor participate in training classes. in your opinion, he had an awful temper with supervisor, he had shouted, but the supervisor never spoke about it with me and nowhere she said about it. (nurse 24). based on the participants views, the educational role is to provide scientific guidance to supervisee. it is necessary that rather than simply report problems, simultaneously education reforms are applied. supervisors also need to offer support to supervisee or play a supporting role so as to provide empathy, take part in active listening, give confidence and assurance. the supervisor must, with respect to the competencies and capabilities of the personnel under their supervision, offer support to supervisee in times of need. some of the supervisors, for example, if staff does not write correct nursing documentation, they teach staff how to write correctly, whereas some supervisors will only have to report to the directors., i often speak with him and say to him, our department is very busy, the number of patients is high, we can not do all the work. for example, once between me and a medical student, there was a conflict to accompany the patient to the computed tomographic scanner to another hospital ; the medical student said that i should go, but i said to the student, you should go to the hospital with the patient under the hospital laws. the issue was brought to the supervisor ; the supervisor said medical student should go. clinical supervisor has a very important role in ensuring the quality of care, and improves patient care and follows personal professional development of staff nurses. according to the experiences of participants in this study, both the themes, i.e. establishing supervisory infrastructure and comprehensive supervisory competencies, affected supervisor training. due to the special role of supervisors in hospitals, it is very important that the process of training and preparation be done for supervisors. grealish and carrall found that supervisors do not have enough preparation for their role and felt that their supervising is done non - intelligently. eriksson and fagerberg, while describing the experiences of geriatric nursing supervisor, mention that the results refer to the need for improving the abilities and skills of supervisors. tembani and strmpher observed that lack of proper monitoring had been reported in a number of clinics. thus, formal and informal preparation of clinical supervisors is important for their supervisory role. report that supervisors should be trained in the process of supervision and provided time and resources to manage it. pillay and menshaly showed found that some supervisors were not prepared for their role and responsibilities and there is a need for increasing the supervisors competence. based on the findings of the research, establishment of supervisory infrastructure, making the appointments and retention of supervisors, clarifying the duties and authority of supervisor, developing supervisory culture, specializing supervision, and conducting practice - based training should be done for training supervisors. showed that for the supervisor and supervisee, the expectation of supervision should be clear and barriers to clinical supervision are conflicting demands of the hospital and the supervised to the supervisor and the lack of clarity of rules. mention that the supervision should be structured and carried out regularly according to the program. 's study also showed the quality of clinical supervision is strongly dependent on the perception of autonomy or authority at work. the findings this study and the studies published by another researcher determined the importance of supervision goals, clarified the roles and responsibilities, and delegated responsibilities to the supervisor. for the implementation of effective supervision, it is very important to give attention to organizational culture, and the organizational climate and atmosphere should be prepared in compliance with the culture of supervision. gonge and buus found that characteristics of the work environment, including organizational status, shift work, and environmental factors in the workplace affect the outcome of clinical supervision. based on the findings, supervisors have to acquiring scientific, managing, communicative, professional, ethical, pedagogical, and supporting adequacy. supervisors need enough clinical and administrative knowledge and skills for their roles and it should be considered in their training and preparation. arvidsson and fridlund write that the factors that affect supervisors competence have both personal dimensions including supervisor 's behavior in dealing with nurses and professional dimensions included creating a safe place to learn and facilitating consideration. reported that the things that are necessary to train supervisors include the skill of advising and guiding, supervising, feedback, and interpersonal communication skills. sivan., state that the relationship between supervisor and supervisee at interpersonal level affects the quality of the supervision process. supervisor relationship affects the professional commitment on the hospital and the intent to leave the profession. farr - wharton., found that poor nurse / supervisor relationships lead to increased nurse replacement costs. blomberg puts clinical supervision as an approach that can be used to support nurses for complying with the workplace. according to the studies mentioned above and based on the present research findings, having sufficient competence in all aspects of scientific knowledge and clinical skills, management, communication, ethical and professional behavior, teaching and support, competence in the supervision process, is very important, but no compiled program has been planned or collected yet. it is, therefore, necessary that a program be provided for the preparation of supervisors. supervisors participating in this study had requested for special training methods that enhance their competence. mather. found the need to organize workshops, and appropriate education and training on professional development enables the clinical supervisors give positive performance. it is necessary to enable supervisors to play a worthy role of clinical supervision at work. so, for the chief nursing officers and directors of nursing services, it is suggested that in order to achieve this objective, first supervised infrastructure should be provided, such as making the appointments and retention of supervisors, clarifying the duties and authority of supervisor, developing supervisory culture, specializing supervision, and conducting practice - based training ; then the competent supervisors should be provided comprehensive and integrated training in aspect of acquiring scientific, managing, communicative, professional, ethical, pedagogical, and supporting adequacy. the chief nursing officers should provide training readiness and application practice - based teaching to supervisors for performing the supervisory role in an excellent way. clinical supervisor has an important role in guaranteeing quality nursing care and improvement of patient care, and helps in nurses personal and professional growth. it is necessary to enabling supervisors to play a worthy role of clinical supervision at work. therefore, for the chief nursing officers and directors of nursing services, it is suggested that in order to achieve this objective, first supervised infrastructure should be provided, such as making the appointments and retention of supervisors, clarifying the duties and authority supervisor, developing supervisory culture, specializing supervision, and conducting practice - based training ; and then the competent supervisors should be provided comprehensive and integrated training in the aspect of gaining scientific, managing, communicative, professional, ethical, pedagogical, and supporting adequacy. the chief nursing officers should provide training readiness and application practice - based teaching to supervisors for performing the supervisory role in an excellent way. researchers express their gratitude and appreciation for all participants in the study, such as matrons, supervisors, and head nurses. | background : supervisors should have certain characteristics and adequate preparation for their roles. yet, there are no well - educated experts knowing about the supervisor 's role and responsibilities and how to train them. so, this research was conducted with the purpose of finding the factors affecting nursing supervisor training.materials and methods : this research is an inductive content analysis. participants were 25 in number, consisting of nurses and supervisors in shahid sadoughi university hospitals. the participants were chosen by a purposive sampling method. data collection was done by semi - structured interviews and reviewing documents. data were analyzed using conventional content analysis.results:findings included two main themes : firstly, establishment of a supervisory infrastructure that includes making the appointments and retention of supervisors, clarifying the duties and authority of supervisor, developing supervisory culture, specializing supervision, and conducting practice - based training and secondly, comprehensive supervisory competencies that include acquiring scientific, managing, communicative, professional, ethical, pedagogical, and supporting adequacy.conclusions:clinical supervisor has a major role in ensuring the quality of nursing care. this leads to improvements in patient care and nurses personal and professional development. so, it is necessary that for effective supervision in nursing, first an infrastructure is provided for supervision and then the comprehensive competency of a supervisor is enhanced to apply effective supervision. |
normal vaginal birth and the higher number of vaginal deliveries are predisposing factors for this matter as well as pelvis organ prolapse. other predisposing factors include obesity, strenuous physical activity, and chronic coughs due to the chronic respiratory disease. women aged 20 years or older showed that 11.1% of these women had life - time risk of undergoing a surgery due to the pelvic prolapse or incontinency by the age of 80. there is lack of standard practice in facing patients who are suffering from vaginal laxity. there is no standard method for evaluation of vaginal laxity before and after vaginal surgery and on the other hand the patient 's sexual satisfaction is very important and should be considered carefully. much publicity about this type of surgeries is performed by surgeons ; however, some professionals are questioning the quality of these surgeries. although many surgeons claim that results of these types of surgeries are very good, there is insufficient evidence to substantiate the claim. some surgical procedures such as posterior colpoperineorrhaphy, colpoperineoplasty, or perineorrhaphy can be useful to solve this problem. in a study conducted by goodman., results showed that 90% of women underwent aesthetic surgeries because they wanted to obtain more subjective pleasure regarding their sexual relationship without any real reason for surgery. a study conducted by pardo. on 53 women who underwent colpoperineorrhaphy because of wide vagina showed that after six months, 94% of women experienced tighter vagina and they could achieve orgasm and only two patients regretted the surgery. in a retrospective observational study to assess the effect of fascial posterior colpoperineorrhaphy over the five - year period, results showed that vaginal pain, dyspareunia, and vaginal laxity were all significantly reduced ; however, there was no significant difference in sexual activity. in a review study by goodman, results showed that after vaginal aesthetic plastic surgeries, the rate of patient 's satisfaction was 9095% and sexual satisfaction was 8085%. the rate of these types of surgeries is quite high in iran, but there is lack of conclusive documents. the primary aim of this study was to evaluate the long term effect of colpoperineoplasty on sexual function among women who complained of vaginal laxity in iran. in this prospective observational study 86 women, who were candidates for elective colpoperineoplasty, were recruited nonrandomly for the study. the study design was approved by the ethics committee of ahvaz jundishapur university of medical sciences, iran. the study started on may 2011 and was completed on october 2012 in a public hospital in jahrom, iran. inclusion criteria were married women who complained of vaginal laxity and literate women who aged between 15 and 45 years. the exclusion criteria were women who had a history of urogenital infections, experienced recent stressful events in their life, suffered from chronic diseases, were under medication that affects sexual function, for example, antihypertensive drugs, cimetidine, and antidepressants, were smokers, and were pregnant women and those whose husbands had a history of sexual disorders. a written informed consent was obtained from each participant prior to the study and anonymity of participants was preserved. data was selected through a sociodemographic and the female sexual function index (fsfi) questionnaires, preoperative, while fsfi was recompleted six and 18 months after surgery. during the 18-month follow - up, the participants were free to contact the researcher (sj) in case they had any question about their surgery and sexual function. the fsfi questionnaire contained 19 questions including two questions in the libido domain, four questions in the sexual arousal area, four questions in the lubrication area, and three questions each for orgasm, sexual satisfaction, and pain the factor for desire was 0.6, 0.3 for arousal and lubrication, and 0.4 for other domains. all women were consulted by a gynecologist and also one of the researchers who is a midwife (sj) and were given essential information about the consequences of the surgery. the chief complaints of all women were vaginal laxity, sexual dissatisfaction, and lack of orgasm. the vaginal laxity was confirmed by a gynecologist and wide hiatus, posterior, and/or anterior wall relaxation. the rectovaginal area was cut until the inner section of the levator ani muscle was visible. the surgeon 's aid placed a finger in the rectum of the patient to be sure there is no damage to the rectum. according to the degree of vaginal laxity, the appropriate amount of tissue was removed from the vagina. then the soft tissues and muscles especially pudendal body were tightened. the stitches started in the upper triangle of the vagina and ended at the edge of the hymen. if two fingers of surgeon were fitted in the vagina after repair, the size of vagina was considered appropriate. all patients were carefully assessed for any signs and symptoms of bleeding and hematoma after surgery. women were asked to return to the clinic, one week, one, two, three, six, and 18 months after surgery for checkup. besides the examination by gynecologist, each participant was requested to complete fsfi questionnaire in the 6th and 18th months after surgery. the data were analyzed using spss version 19. the paired t - test was used for comparing means in the normal distributed data and the mann - whitney u test was used for data that was not normally distributed. the repeated measure test was used for comparing sexual function score in the beginning, 6th and 18th months of the study. seventy - nine women completed the six - month follow - up, while 76 could accomplish the study by 18 months. the mean age of women was 34.02 years and the average age of spouses was 40.6 years. most women had a history of vaginal delivery and the average number of children was 3.18. table 2 is demonstrating the sexual function score of participants at the beginning of the study, six and 18 months after surgery. as evident from table, all aspects of sexual function were improved significantly except for pain during intercourse and lubrication after six months (p < 0.001). after 18 months all areas of sexual function including pain and lubrication improved significantly compared to the 6th month of the study. there was no report of sexual dysfunction after 18 months (p < 0.001). the total score of sexual function was improved from 24.19 3.09 before surgery to 26.92 3.41 in the 6th month of study and 32.61 1.32 in the 18th month of study (p < 0.001). the glm repeated measure showed a significant difference in all areas of sexual function and satisfaction in two follow - up times (p < 0.001). this study was designed to evaluate the long term effects of selective colpoperineoplasty on sexual function among reproductive aged women in iran. the results of this study showed that all aspects of sexual function were improved after six months except for dyspareunia and lubrication. however after 18 months the scores of pain and lubrication also were improved significantly and none of the women had sexual dysfunction. however, sexual dysfunction and dissatisfaction are not entirely related to the vaginal narrowing following vaginal surgery. vaginal nerve supply is focused on the anterior and posterior aspects of the vaginal wall and mostly dyspareunia results from damage to the vaginal nerves. decreased blood flow of vagina and genital following vaginal surgery may decrease pelvic blood flow and vaginal fibrosis and in turn result in vaginal dryness and dyspareunia. a study was conducted by moore. on 78 women who complained from vaginal laxity and decreased sensation with intercourse and underwent vaginal rejuvenation / vaginoplasty procedure. results showed that after six - month follow - up, all sexual function 's area significantly improved except for desire, pain, and partner premature ejaculation. our study 's results after six - month follow - up are not consistent with moore. 's study, since dyspareunia increased in our patients, while our results are similar to moore. this dissimilarity may be due to the fact that almost one - third of moore. 's patients had prolapse and underwent anterior - posterior repair simultaneously, while none of the women in our study underwent anterior repair. a study on 49 women who underwent vaginal repair surgery showed that after six - month follow - up, 25% of patients were concerned about vaginal pain during intercourse. 's study, where after six months the rate of dyspareunia increased by almost 50%. porter. reported that posterior colporrhaphy alone or with other vaginal surgeries does not adversely affect sexual function and in fact it may aid in the resumption of sexual activity and significantly improving quality of life and social aspects of daily living. in the porter. 's study, dyspareunia significantly improved or was cured following surgery in 73% of 125 patients, while it worsened in 19% of patients and did not change in three. there was no change in vaginal dryness, orgasm ability, sexual desire, sexual frequency, or sexual satisfaction. porter. believed that the defect of specific repair without levator ani manipulation appears to improve sexual function. 's study, except that in our study after six months almost half of the women had sexual dysfunction and after 18 months this rate was zero. in a study by robinson., in which 34 women underwent posterior colpoperineorrhaphy and followed 41 months, the results showed that vaginal pain, dyspareunia, and vaginal laxity were all significantly reduced. our results in long term follow - up after surgery are similar to robinson. results of multi - armed clinical trial by barber. on 343 women older than 45 years with advanced prolapse or urinary incontinence showed that women reported fewer problems with their sexual relationship after surgery compared to the baseline, but overall sexual satisfaction did not change. in our study the sexual function and satisfaction is that our participants were younger (34.02 5.3 years) than that in the barber. this was the first time that we evaluated the long term effect of selective colpoperineoplasty on sexual function in women with vaginal laxity in iran. we do not have exact statistics about the rate of these surgeries in iran, but according to the researcher 's experiences, the rate of elective colpoperineoplasty due to the vaginal laxity is quite high. women in our study were not consulted by a psychologist ; they only benefited from gynecologist and also a midwife consultation. the long term effect of colpoperineoplasty in women who suffer from vaginal laxity and sexual dysfunction is promising. it seems that patient 's complaint of sexual dysfunction can be a basis for colpoperineoplasty. | objective. many women are suffering from sexual dysfunction followed by vaginal laxity in their reproductive age. the aim of this study was to evaluate the long term effect of colpoperineoplasty on sexual function in iranian reproductive aged women. methods. this was a prospective observational study in which 79 women with vaginal laxity who were candidate for selective colpoperineoplasty in jahrom, iran, were recruited. data on sexual function was collected via the female sexual function (fsfi) questionnaire preoperatively, six months and 18 months after colpoperineoplasty. the paired t - test, wilcoxon, mann - whitney, and repeated measure test were utilized for statistical purposes. results. seventy - six women completed the study by 18 months. the mean fsfi score changed from 24.19 3.09 in baseline to 26.92 3.41 after six months (p < 0.001) ; however dyspareunia and vaginal dryness were increased significantly. after 18 months all areas of sexual function including pain and lubrication improved significantly compared to the 6th month (p < 0.001). sexual satisfaction was increased significantly six and 18 months after surgery (p < 0.001), and the total score of sexual function increased to 32.61 1.32 after 18 months (p < 0.001). conclusion. the long term effect of colpoperineoplasty in women who suffer from vaginal laxity is promising. it seems that patient 's dissatisfaction of sexual function can be a basis for colpoperineoplasty. |
in 2010, more than 30 million of pregnant women in sub - saharan africa were exposed to malaria ; among them 11.4 million were infected. malaria caused by plasmodium (p.) falciparum has adverse effects on pregnancy and about a quarter of pregnant women present placental infection at delivery [2, 3 ]. this phenomenon occurs when malaria parasites are sequestered in the placenta, causing functional disorders of placental villosity and disrupting the fetomaternal compartment. the world health organization (who) recommendations for malaria prevention during pregnancy were implemented in gabon in 2005. studies conducted in 2005 and 2007 at libreville and lambarn confirmed the positive impact of intermittent preventive treatment during pregnancy with sulfadoxine - pyrimethamine (iptp - sp) associated with the use of insecticide - treated nets (itns) on the rates of microscopy positive infections at delivery [68 ]. during the same period, most women with p. falciparum infections at delivery reported a history of fever treated with an antimalarial drug (hfta), mostly on a presumptive basis. as a single infection during pregnancy might contribute to poor outcome, it is important to monitor malaria throughout the entire period of gestation. hfta is a strong predictor of microscopic and submicroscopic infection at delivery [10, 11 ]. indeed, parasites infecting pregnant women persist even after delivery, mostly as submicroscopic infections not detected on light microscopy examinations. recent reports have indicated that, in areas in which the prevalence of malaria has decreased, submicroscopic infections account for 70 to 80% of all plasmodium infections in children, non pregnant adults, and pregnant women [1215 ]. thus, the aim of this study was to estimate the frequency of submicroscopic p. falciparum infections in matched peripheral and placental blood samples with microscopy negative or discordant results, and its relationship with iptp administration. this study was conducted at the delivery unit of the centre hospitalier universitaire de libreville (chul ; libreville university hospital), the largest public hospital in libreville, the capital of gabon. malaria transmission is perennial in this area, with an estimated prevalence of 24%, and maternal microscopic peripheral infection at 6% [16, 17 ]. the chul is a sentinel site for malaria surveillance, at which all pregnant women consulting for antenatal care (anc) at public health centers have free access to a delivery unit. samples from delivering women who participated in two cross - sectional surveys for the estimation of malaria burden and outcomes during pregnancy at the time and after the implementation of iptp were analyzed. details on patient demographics and history of pregnancy are described elsewhere. each woman attending the delivery unit antenatal data were obtained from either the antenatal card or the register of the centre with assistance of the midwife ; they included parity, gestational age at the interview, and use of malaria preventive strategies. if prevention was performed, the type of medicine taken was recorded as well as the first time of dosing, the number and dates of drug administration, and the number of tablets taken. peripheral blood and placental blood obtained for the cleaned maternal face of the placenta (two ml) were collected from each woman for thick smears and molecular assays. the samples were selected for this study on the basis of two major criteria : having a hfta during pregnancy and having peripheral and placental blood samples that gave concordant negative or discordant results after thick blood smear examinations. thick smears were screened for the presence of malaria parasites according to the lambarn method. carefully, 10 l of blood was laid on a 10 by 18 mm area of a microscope slide, then dried, and stained. the parasitemia was expressed as number of parasites per microliter of blood (p/l), and parasite species were identified in the matched thin blood smears. smears were read by two experienced technicians using a light microscope (100 oil immersion lenses). smears were considered negative if no parasite was seen after the examination of at least 100 oil immersion fields in a thick blood smear. the definition of a malaria case was a febrile patient with a positive blood smear (pbs). the blood smears were read by two experienced microscopists and in case of discordant results (presence or lack of asexual / sexual blood stages, mismatch species, or parasite density), the slides were reviewed by a third technician who resolved any discrepancy. the blood samples were centrifuged to separate the pellet containing erythrocytes from the plasma, both of which were frozen at 80c. dna was extracted from the stored samples with the qiaamp dna mini kit (qiagen, germany), according to the manufacturer 's instructions. five microliters of the extracted dna were used as a template for p. falciparum detection. the merozoite surface protein 1 (msp1) and merozoite surface protein 2 (msp2) genes were amplified by nested pcr, as described elsewhere, on a labnet multigene ii thermal cycler. primary amplifications were run with primer pairs corresponding to the flanking sequence of the conserved regions of the msp1 and msp2 genes. the second amplification reactions were carried out with allele - specific primer sets corresponding to the msp1 (k1, ro33, and mad20) and msp2 (fc27 and 3d7) allele families. pcr products were either stored at + 4c or analyzed immediately by electrophoresis in a 2.5% agarose gel. the matched samples were the peripheral and placental blood samples collected from the same woman. concordant samples were matched samples that gave the same results after microscopy examination of thick blood smears : positive (concordant positive) or negative (concordant negative). discordant samples were paired peripheral and placental blood samples that gave different results after microscopy examination of thick blood smears : positive for the peripheral sample and negative for the placental sample, or vice versa. samples with p. falciparum submicroscopic infection are those without detected parasites on thick and thin blood smear (microscopy negative) but with a positive pcr result (i.e., detected plasmodial dna). iptp - sp coverage was defined as the proportion of women taking at least one dose of sp during pregnancy. thus, 2005, a year in which close to 35% of pregnant women received a single dose of sp, was classified as a period of low iptp - sp coverage. by contrast, 2011, a year in which more than 80% of pregnant women took at least one single dose of sp, the study was approved by the gabonese ministry of health (gmh) and the national ethics committee. all data obtained are part of routine activities in sentinel sites that are under the administrative supervision of the gabonese ministry of health (gmh). prompt malaria diagnosis and accurate treatment, drug resistance monitoring and interventions coverage in sentinel sites are the main strategies for malaria control of the gmh represented by the mncp. the department of parasitology - mycology (dpm) is the reference laboratory for malaria survey including diagnosis, antimalarial drug resistance evaluation, treatment efficacy, and impact of control strategies. women were informed about the study protocol, and their written consent was required prior to the interview and sample collection. all data were analyzed with stata 9.2 (stata corporation, college station, tx, usa). the median and interquartile range (25th and 75th percentiles) were used for continuous variables, such as parasitemia. chi - squared tests and fisher 's exact tests were used for the comparison of proportions. overall, 44 women were selected, more than half n = 25 (57%) were multiparous. the median age was 26 [2334 ] years ; nine were aged less than 20 years and 14 were between 20 and 24 years old. the frequency of iptp - sp use was 33% (n = 8/24) in the group of women selected in 2005 and 85% (n = 17/20) in 2011 (table 1). overall eleven samples were microscopically infected (table 2) ; among the peripheral blood samples (n = 5), the median microscopic parasite density was 294 [45801 ] p/l, while parasitaemia varied from 8 to 378 p/l with a median of 16 [11152 ] p/l in placental blood (n = 6 samples). the proportion of matched concordant negative samples (33/44) was higher than the proportion of discordant samples, whatever the study period considered (table 1). the frequency of concordant matched samples was higher in 2005 (83%) compared to 2011 (65%), but this difference was not statistically significant (p = 0.16 fisher 's exact test ; table 1). among discordant samples (n = 11), those with microscopy negative results (mn) in placental blood tended to be more frequent in 2011 than in 2005 (20% versus 4% in 2005), whereas the proportion of microscopy positive (mp) placental blood samples was similar in both years (table 1). p. falciparum dna was amplified in all samples shown to be infected by microscopy examination (n = 11) ; one concordant negative pair of matched samples also tested negative by pcr. submicroscopic plasmodium infections were detected in most (41/44) of the mn samples of peripheral (90% n = 35/39) and placental (87% n = 33/38) blood. the prevalence of submicroscopic infections did not differ significantly as a function of the level of iptp - sp coverage : 95% in 2011 versus 79% in 2005 (table 3) (p = 0.27). all infected placental blood samples were matched with peripheral blood samples displaying microscopic or submicroscopic infection (table 3). the frequency of concordant true - negative matched samples was less than 10% (n = 3/44 ; 7%). only one of the pairs of discordant samples (peripheral positive / placental negative) was discordant for both microscopy and pcr (table 4). microscopy failed to detect the malaria parasite in most of the samples of placental and peripheral blood collected from women with a hfta (table 3). the epidemiological profile of malaria is changing in gabon, so additional information is required for the development of effective control strategies. malaria in pregnancy is characterized by the accumulation of p. falciparum - infected erythrocytes in placental intervillous spaces. thus, placental malaria infection can be detected only at delivery, frequently in the absence of peripheral blood infection. tools for detecting the parasite and estimating the true risk of placental malaria before delivery are limited. a history of fever treated with antimalarial drugs (hfta) with or without biological diagnosis, and the molecular detection of the malaria parasite in cases of peripheral and placental malaria would be helpful in this respect. a hfta is associated with a higher frequency of placental and peripheral malaria at delivery. it therefore constitutes a good indicator of the presence of the parasite in women giving birth [22, 23 ]. this study confirms that the molecular detection of p. falciparum provides valuable information about the burden of peripheral and placental malaria. submicroscopic infection was detected in most of the microscopy negative samples (more than 80%), consistent with previous data from gabon, and for pregnant women, non pregnant adults, and children from mozambique, tanzania, and congo [10, 13, 14, 24, 25 ]. the observed discrepancies between the results obtained with the two methods probably reflect the inclusion criteria, particularly for a hfta, which is a recognized risk factor for placental plasmodium infection. however, the relationship between hfta and submicroscopic infection was not well identified in our setting, in which antimalarials are frequently prescribed presumptively to pregnant women presenting fever at ancs, and in an era in which iptp - sp treatment is widespread. an absence of peripheral blood infection is not predictive of an absence of parasite in the placenta. indeed, all venous blood samples from women with positive pcr results for placental blood displayed microscopically undetectable parasitemia, confirming the strong relationship between gestational malaria and submicroscopic placental and/or peripheral parasitemia at delivery. in a study performed in colombia, thus, the persistence of peripheral parasitemia at delivery is a matter of great concern. nurses, obstetricians, and pregnant women should be informed on its potential impact on birth weight and its contribution to maternal anemia and puerperal malaria. pregnant women should be regularly screened for malaria during pregnancy at least with microscopy or rapid diagnostic tests and treated if required. most women presenting fever during visits to ancs received an antimalarial drug, mostly quinine, which, unlike acts, is not active against ring - stage parasites. acts have been shown to decrease cumulative parasite biomass and to prevent high levels of hemozoin deposition in the placenta. their use from the second trimester, a period with a high frequency of pregnancy associated malaria, should be encouraged. another surprising result is the lack of effect of iptp - sp coverage on the frequency of submicroscopic infection. however, most of the women included in 2011 received only two doses of iptp - sp, which is now known not to have a significant impact on microscopic or submicroscopic p. falciparum parasitemia [15, 25 ]. indeed, the administration of two doses of sp seems to be sufficient to decrease parasite density but not to achieve complete clearance, as reported elsewhere [15, 27 ]. the administration of too low dose of sp and the high frequency of molecular markers of sp resistance in circulating isolates may partly account for the observed residual parasitemia [15, 27, 28 ]. treatment with sp generally leads to the development of resistance, and clearance of the resident parasite therefore takes longer than clearance of sensitive strains. this could lead to persistence of the parasite at low densities not detectable by conventional microscopy. between 2005 and 2011, the frequency of dhfr / dhps multiple mutations in isolates from pregnant women increased significantly, with the proportion of isolates displaying such mutations reaching more than 85% (bouyou - akotet submitted). gametocytemia in the absence of asexual forms and the persistence of nucleic acids after parasite clearance may also yield positive test results. in summary, these data highlight the high frequency of submicroscopic peripheral and placental p. falciparum infection, probably due to residual uncleared gestational infections. discordant results for peripheral and placental blood seem to be otherwise infrequent. there is a need for accurate diagnostic tools for regular antenatal screening, to promote the early detection and prompt treatment of malaria episodes during pregnancy. | submicroscopic infections account for more than 50% of all plasmodium (p.) infections in areas with decreasing malaria prevalence and might contribute to poor pregnancy outcomes. the frequency of submicroscopic p. falciparum infections was assessed in matched peripheral and placental blood samples with microscopy negative or discordant results according to iptp administration. methods. p. falciparum infection was detected by nested pcr in matched blood samples collected from delivering women with a history of antimalarial drug treatment and living in gabon. results. submicroscopic p. falciparum infections were detected in 87% (n = 33) of the 44 selected matched samples. plasmodial dna was found in 90% (n = 35/39) and 87% (n = 33/38) of microscopy negative peripheral and placental blood samples, respectively. overall, 95% of samples obtained during the high iptp - sp coverage period had a submicroscopic infection versus 79% among those from the low coverage period. conclusion. submicroscopic infections frequency is high in peripheral and placental blood samples from delivering women with a history of antimalarial treatment whatever the level of iptp coverage. these data highlight the need of accurate diagnostic tools for a regular antenatal screening of malaria during the pregnancy in endemic areas. |
gastrointestinal stromal tumours (gists) are the most common mesenchymal tumours of the digestive tract. three to 5% of gists are located in the duodenum and are associated with an increased risk of gastrointestinal (gi) bleeding as a primary manifestation. complete surgical resection with clear margins is thought to be the treatment of choice for gists. due to technical complexity in obtaining wide surgical margins with duodenal gist, present surgical options are not clear. surgical techniques depend on tumour location in the duodenum, size, and relation to surrounding structures. only a few studies revealed using laparoscopic technique with limited resection of gists ; emphasising that there is very little experience with duodenal gist. herein, we present a case of a man who presented with a bleeding duodenal gist and underwent a successful laparoscopic resection. a 68-year - old man with a medical history of bph and glaucoma was admitted to the hospital with upper gi bleeding, presenting as general weakness and melena. he underwent resection of sessile polyp in the gastroesophageal junction and treated with ppi 3 years before admission. on admission his blood pressure was 118/72 mmhg, pulse 81 beats / min, haemoglobin level was 8.5 g / dl. gastroduodenoscopy showed a bleeding submucosal 5 cm tumour, with ulceration in the centre and a large clot, in the second part of the duodenum. the following gastroscopy, he was admitted to the surgical department. on admission he was hemodynamically stable, physical examination revealed paleness and some epigastric sensitivity. the next day abdominal computer tomography showed a round exophytic space - occupying lesion that looked to be an integral part of the duodenum, located between the second and third parts of the duodenum, measuring 55 mm 56 mm, with air bubbles inside, suspected to be a gist [figure 1 ]. a few enlarged retroperitoneal lymph nodes were demonstrated, the largest 7 mm in diameter. abdominal computed tomography scan showing duodenal gastrointestinal stromal tumour with air bubbles inside diagnostic laparoscopy found a mass arising between the second and third parts of the duodenum adjacent to the transverse mesocolon and covered by a small amount of fibrin [figure 2 ]. laparoscopic wedge resection of the duodenum wall including the tumour with 2 fires of eshelon flex endopath stapler 60 mm golden cartridge (ethicon endo - surgery, j and j) over the gastroscope was done [figure 3 ]. the specimen [figure 4 ] was extracted from the peritoneal cavity in a bag, and the abdominal wall was closed with vicryl 2/0. tumour with fibrin on laparoscopy tumour resected over the gastroscope pathological examination revealed a unifocal, low grade (mitotic count less than 1 per 50 hpf) gist, of spindle cell subtype, stained positive for c - kit. the tumour was 5 cm in the largest diameter (including the area of necrosis 80%). contrast x - ray of the duodenum showed a filiform passage of contrast agent, probably due to oedema in the operated site. in the next few days, he gradually started drinking and eating and was discharged on pod 8. the gastroscope was passed freely through the second and third parts of the duodenum, and there was no stricture found. after 1.5 years follow - up, the patient eats drinks well and has regained weight. gists of the duodenum are relatively rare tumours, accounting for nearly 30% of all primary tumours of the duodenum. the clinical presentations of duodenal gists are highly variable in size and the existence of mucosal ulceration. the most common clinical presentation of duodenal gists has been reported to be gi bleeding or abdominal pain. for gists of the foregut, gi endoscopy may be diagnostic whenever the tumour is located in the stomach or the upper duodenum. on the other hand, gists of the distal duodenum may remain undetected at gi endoscopy. alternative diagnostic means include computed tomography, magnetic resonance imaging, barium study or ultrasonography. the tumour should be removed en bloc with its pseudocapsule to yield an adequate resection margin. the optimal width of the tumour - free margin has not been defined, and it is unclear if re - resection is beneficial for positive microscopic surgical margins (r1), especially as the free radial margin is the one that is positive in most instances and there is no additional tissue to be removed. although large gists more frequently dictate resection of adjacent structures, a small gist may arise at organ interfaces or potentiate a desmoplastic reaction, which dictates resection of adjacent structures. surgical removal of duodenal gists may be accomplished by several options, ranging from minimal to major procedures. limited resection should be considered a viable treatment option for duodenal gists when technically feasible. various techniques of limited resection for duodenal gists have been advocated depending on the site and the size of the tumours. wedge resection with primary closure can be performed for small lesions if the resulting lumen is adequate and the ampulla of vater can be preserved. segmental duodenectomy with side - to - end or end - to - end duodenojejunostomy can be performed for larger tumours located at the third and fourth portions of the duodenum. partial duodenectomy with roux - en - y duodenojejunostomy can be performed for larger tumours involving the antimesenteric border of the second and third portions of the duodenum. major resection via a pancreaticoduodenectomy or a pancreas - sparing duodenectomy is indicated when the tumours are located at the second portion of the duodenum. the patient went through laparoscopic limited resection, a procedure with relatively low postoperative morbidity and short hospital stay. however, in two cases of duodenal bulb, they performed preventive laparoscopic gastrojejunostomy due to structural deformity following wedge resection. actually, a case included in area of tumour location with gastric outlet obstruction. in this case, the lesion was located at the antrum, lesser curvature side. laparoscopic wedge resection of the duodenal wall lowers operative morbidity and complications, but offers a few challenges. the first concern is resection of the tumour with clear margins, a goal that is achieved by meticulous dissection of the surrounding tissues. due to the fact that gists, unlike carcinoma, rarely metastasize to regional lymph nodes or infiltrate to surrounding tissue microscopically, that dissection was satisfactory. a rupture of the tumour has to be strictly avoided during surgery to prevent intraperitoneal seeding and haemorrhage. a gentle touch technique should be applied, as gists tend to have a friable consistency. the second concern was resecting the wall, and leaving a wide enough lumen for the passage of digested food. horizontal tumour resection and suturing, and reconstruction of duodenal wall such as heineke - mikulicz pyloroplasty intraoperative insertion of wide ng tube or boogie (more than 36f diameter) is another possibility. in our case, the use of gastroscopy intraoperatively, simultaneously with the resection, ensured that goal. this technique limited the amount of resection, and we were able to avoid the extensive resection of adjacent nontumourous organs and the need for bowel anastomosis. to the best of our knowledge, only a few cases of laparoscopic wedge resection of duodenal gists have been reported. the laparoscopic limited resection in this challenging area is feasible and safe, reducing postoperative morbidity without compromising oncologic results. | only a few studies have revealed using laparoscopic technique with limited resection of gastrointestinal stromal tumour (gist) of the duodenum. a 68-year - old man was admitted to the hospital due to upper gastrointestinal (gi) bleeding. evaluation revealed an ulcerated, bleeding gi tumour in the second part of the duodenum. after control of bleeding during gastroduodenoscopy, he underwent a laparoscopic wedge resection of the area. during 1.5 years of follow - up, the patient is disease free, eats drinks well, and has regained weight. surgical resection of duodenal gist with free margins is the main treatment of this tumour. various surgical treatment options have been reported. laparoscopic resection of duodenal gist is an advanced and challenging procedure requiring experience and good surgical technique. the laparoscopic limited resection of duodenal gist is feasible and safe, reducing postoperative morbidity without compromising oncologic results. |
systemic administration of kainic acid (ka) induces seizures and brain damage associated with epilepsy. -amino butyric acid (gaba) is the main inhibitory neurotransmitter in the mammalian brain, and it is composed of five subunits that form a chloride channel. the messenger ribonucleic acid (mrna) molecules of the three subunits have been shown to be distributed throughout the principal cell layers of the hippocampal and the parahippocampal areas in rats. in addition, an association between mutations in the gabrb3 gene, encoding the 3 subunit of the gaba receptor (gabr), and families from honduras and mexico with no incidents of childhood epilepsy has been established. the association between mutations in the gabrb3 gene, encoding the 3 subunit of the gabar, has been established in families with childhood absence epilepsy (cae) from honduras and mexico. quercetin (3,3,4,5,7-pentahydroxyflavone) is a flavonoid and an important dietary constituent of fruits and vegetables. it has several biological effects, including anti - oxidative anti - inflammatory, and neuroprotective [8 - 10 ] activities. quercetin at a concentration of 30 m has been shown to have an inhibitory effect on the 112 gabaa and the p1 gabac receptors in xenopus laevis oocytes. gabaaap receptors are known to have low affinity for allosteric modulators of gaba such as benzodiazepine and barbiturates, and quercetin has been shown to antagonize gabaaap1 receptors in a dose - dependent way via a redox - independent allosteric mechanism. our previous studies demonstrated that quercetin had an anticonvulsant activity in acute and chronic models of pentylenetetrazole (ptz) in rats [13, 14 ]. furhtermor, the expressions of the gabaa receptor subunits were reported to have been altered at early time points during or soon after acute seizures induced by ka injection,. thus, this study aimed to assess the effects of quercetin by determining the variations in the mrna levels in the subunits of gabaa receptors in the ka model of epilepsy in mice. a total of 70 male balb / c mice (20 25 g) were maintained at constant room temperature (21 2) under a 12:12 hour light / dark cycle and had free access to food and water. all animal experiments were performed in accordance with the european communities council directive of november 24, 1986 (86/609/eec). the 70 mice were divided into 4 groups as follows : each mouse in the saline group (group 1, n = 10) received a daily intraperitoneal (i.p.) injection of saline and tween 80 (10 ml / kg) for 6 days and two i.p. each mouse in the ka group (group 2, n = 20) received a daily i.p. injection of ka (10 mg / kg) on the 7 day. the mice in groups 3 (n = 20) and 4 (n = 20) received daily i.p. injections with quercetin at doses of 50 and 100 mg / kg, respectively, for 6 days and, on the 7 day i.p. injections of ka (10 mg / kg, i.p.) were administered 30 minutes after the quercetin injections. fifty percent of mice in each group were anesthetized with i.p. injections of ketamine (60 mg / ml)/xylazine (6 mg / kg), and then sacrificed at 2 hours after ka administration, with the other fifty percent undergoing the same procedure at 7 days after ka administration. the -actin gene was used as an internal control for quantifying the expressions of the target genes. primers for the gabrb1 and the gabrb3 genes of subunits of the gabaa receptors were designed by using gene runner software (version 3.05). primer sets were gabrb1 f : 5cctggctctactggaatatg3, r : 5attggcactctggtcttg3 ; gabrb3 f : 5ctcctacgctggtgtctgaa3, r : 5cactgtgttcccacatgaca3 ; -actin f : ttactgagctgcgttttacac, r : acaaagccatgccaatgttg. quantitative real - time polymerase chain reaction (rt - pcr) assays were conducted with sybr green i master mix (bioneer, korea). thermal cycling was performed using the abi-7500 sequence detection system (applied biosystems, foster, ca, usa) as follows : 10 minutes at 95for the first denaturation step, followed by 40 cycles at 95 for a total of 20 seconds and 40 cycles at 60 for a total of 45 seconds. the values of the cycle threshold (ct) were used to quantify mrna fold changes. in this regards, we used the 2 calculating method by normalizing the ct of the target mrnas to the ct of housekeeping gene -actin in the treated and the control samples. statistical analyses were performed using the one - way analysis of variance (anova), followed by the post - hoc turkey test for multiple comparisons. for the analyses, compared to the mrna levels of the gabaa receptor 1 subunit in the saline group, those levels in the ka group were significantly increased in the hippocampi of the mice at 2 hours and 7 days after ka administration (fig. in contrast, no statistically significant changes were observed in the quercetin groups compared to the saline at those times. however, statistically significant differences were observed when comparing the ka group and the 100-mg / kg quercetin group at 7 days after ka administration. the mrna levels of the gabaa receptor 3 subunit were significantly higher in the ka group at 2 hours and 7 days after ka administration than they were in the saline group (fig. in contrast, no significant differences were observed in the mrna levels of the gabaa receptor 3 subunit between the 50-mg / kg quercetin group at 2 hours after ka administration and the saline group (fig. however, mrna levels were increased in the quercetin 50-mg / kg group at 7 days after ka administration compared to the saline group (fig. furthermore, the mrna levels of the gabaa receptor 3 subunit observed in the 100-mg / kg quercetin group at 2 hours and 7 days after ka administration were similar to those observed in the saline group at those times (fig. 2a, 2b). however, significant differences were found when comparing the ka group and both quercetin groups at 2 hours after ka administration (fig. moreover, significant differences were observed between the ka group and the quercetin groups at 7 days after ka administration (fig. this study aimed at determining the effects of quercetin pretreatment on the expressions of the 1 and the 3 subunits of the gabaa receptor in a mouse ka - induced seizure model. the doses of quercetin used in this study were the same as those employed in a previous study assessing quercetin s anticonvulsant activity [13, 14 ]. compared to the saline group, pretreatments with quercetin at doses of 50 and 100 mg / kg prevented significant increases in the mrna levels of the 1 and the 3 subunits of the gabaa receptor at 2 hours after ka injection. in addition, pretreatment with 100 mg / kg of quercetin inhibited increases in the mrna levels of the 3 subunit of the gabaa receptor at 7 days after ka administration. our results showed similar mrna levels of the 1 and the 3 subunits of the gabaa receptor both in the 100-mg / kg quercetin group at 2 hours and day 7 after ka administration and the saline group, suggesting that high doses of quercetin have inhibitory effects on the gene expression in the 1 and the 3 subunits of the gabaa receptor. however, this inhibitory effect of quercetin at 50 mg / kg on the mrna levels of the 3 subunit of the gabaa receptor was not observed at 7 days after ka administration. this may be related to the narrow therapeutic dose range for the anticonvulsant activities of quercetin in different modes of seizure. of the three subunits of the gabaa receptor, the mrna level in the 3 subunit is the one that is increased in animal models and human temporal lobe epilepsy (tle), as well as in the ka - induced - seizure model. in addition, significant increases in the mrna levels in the 1 and the 3 subunits have been observed in the granule cells of the dentate gyrus at 12 hours to 30 days and at 7 to 30 days after ka injection. these changes are consistent with the presumed compensatory up - regulation of gabaa receptors observed in the dentate molecular layer in epileptic rats. in conclusion, pretreatment with quercetin significantly inhibited the gene expression of the gabaa receptor subunits in the ka model of seizure. quercetin (100 mg / kg) seems to modulate the expression of the gabaa receptor subunits to prevent any progress in neurodegenerative and compensatory responses. p < 0.01 compared to the saline, p < 0.001 compared to the ka group at d7, n = 10. mrna, messenger ribonucleic acid ; gabaa, -amino butyric acid type a ; ka, kainic acid. mrna, messenger ribonucleic acid ; gabaa, -amino butyric acid type a ; ka, kainic acid. | objectives : quercetin is a flavonoid and an important dietary constituent of fruits and vegetables. in recent years, several pharmacological activities of quercetin, such as its neuroprotective activity and, more specifically, its anti - convulsant effects in animal models of epilepsy, have been reported. this study evaluated the role of quercetin pretreatment on gene expression of -amino butyric acid type a (gabaa) receptor beta subunits in kainic acid (ka)-induced seizures in mice.methods:the animals were divided into four groups : one saline group, one group in which seizures were induced by using ka (10 mg / kg) without quercetin pretreatment and two groups pretreated with quercetin (50 and 100 mg / kg) prior to seizures being induced by using ka. next, the messenger ribonucleic acid (mrna) levels of the gabaa receptor subunits in the hippocampus of each animal were assessed at 2 hours and 7 days after ka administration. quantitative real - time polymerase chain reaction (rt - pcr) assay was used to detect mrna content in hippocampal tissues.results:pretreatments with quercetin at doses of 50 and 100 mg / kg prevented significant increases in the mrna levels of the 1 and the 3 subunits of the gabaa receptor at 2 hours after ka injection. pretreatment with quercetin (100 mg / kg) significantly inhibited 1 and 3 gene expression in the hippocampus at 7 days after ka injection. but, this inhibitory effect of quercetin at 50 mg / kg on the mrna levels of the 3 subunit of the gabaa receptor was not observed at 7 days after ka administration.conclusion:these results suggest that quercetin (100 mg / kg) modulates the expression of the gabaa receptor 1 and 3 subunits in the ka model of epilepsy, most likely to prevent compensatory responses. this may be related to the narrow therapeutic dose range for the anticonvulsant activities of quercetin. |
cervical cancer is one of the leading causes of death for middle - aged women in the developing world, yet it is almost completely preventable if precancerous lesions are identified and treated in a timely manner.1 there are many risk factors for cervical cancer, which include human papillomavirus infection,2,3 early age at first sexual intercourse,2,4,5 increased number of sexual partners,2,5 long - term use of oral contraceptives,6 smoking2,3,7,8 history of infertility,9 intrauterine device,9 high parity,10,1113 trauma with pregnancy,14,15 low education,16 and low socioeconomic level.17 factors reducing risk of cervical cancer include male circumcision,2,3,7,10,18 use of condoms,3,5 abstinence from sexual intercourse during menses time, and celibate status.19 cervical cancer screening based on cytological examination is largely unavailable in developing countries or available only to a small, select group of women in private facilities, maternal child health sites, or family planning clinics, thereby missing the age groups at the highest risk for precancerous lesions.1 the failure of a conventional cytology - based approach to reducing cervical cancer in developing countries, particularly in africa, can be attributed to several factors, including scarcity of trained, skilled professionals, lack of resources, and expense.20 there is interest in a new screening method using visual techniques to identify cervical cancer. one is the simple screening method, such as visual screening by use of acetic acid (via), during which the cervix is visualized with the naked eye under a direct source of light, and application of a solution of 3%5% acetic acid that is used as a chemical contrast agent to highlight areas of metaplastic changes. when neoplastic tissue is stained with acetic acid (3%5%), it uptakes the acetic acid and changes to a whitish color (aceto - white area). if this occurs, a positive via test is reported, and it indicates that there is a malignant change in the aceto - white area in the cervix, which is precisely around the squamocolumnar junction, the main anatomical site where cervical malignant neoplasia develops.21 via has been evaluated in a number of large clinical trials and is considered to be a possible alternative to cervical cytology for primary cervical cancer screening in low - resource settings. the advantages of via compared with cervical cytology are that it is inexpensive, it does not require a laboratory infrastructure, and it provides an immediate result, allowing use of screen and treat the simple visual screening methods are being evaluated as an alternative to cytology in low - resource settings where screening using cervical cytology is not feasible. multiple studies have shown via to have sensitivity similar to that of cervical cytology but much lower specificity for identifying women with high - grade cervical cancer lesion and squamous intraepithelial lesion.23 via showed a sensitivity of 79% (95% confidence interval [ci ] 73%85%) and 83% (95% ci 77%89%), and a specificity of 85% (95% ci 81%89%) and 84% (95% ci 80%88%) for cin2 + and cin3 +, respectively.24 via can be easily implemented as a quick and inexpensive test in unsophisticated health care settings. also, this method can provide the result of screening immediately, and the patient can be treated with cryotherapy at the same time. the aim of the present study conducted among women in khartoum state, sudan, was to assess risk factors of cervical cancer and the feasibility and acceptability of a single - visit method for cervical cancer screening by using via in a primary health care setting. six nurses and two supervisors were trained on prescreening counseling, data collection and via screening methods in a primary health care center setting by an investigator and gynecological oncology consultant from the radiation and isotopes center in khartoum. a campaign to raise public awareness about cervical cancer among the local women was performed. posters and pamphlets were distributed to women in public places at primary health centers, shopping centers, and transport centers. a program about cervical cancer and via screening methods was presented by a gynecological oncologist and investigator at the local radio broadcasting station. in addition, in the context of friday and sunday prayers, imams in mosques and clerks in churches talked about cervical cancer screening and encouraged women to participate in the screening project. house - to - house visits were used to recruit participants. during the home visits, pamphlets were distributed, and women were informed about cervical cancer and about the opportunity for prevention and treatment by early detection. healthy nonpregnant women aged 2550 years living in khartoum state in sudan who were voluntarily willing to participate in screening were included in the study. eligible women were given an appointment for screening at the cervical cancer screening clinic, and questionnaires containing sociodemographic, obstetric, and gynecologic variables and other risks factors were filled in. at the screening clinic, a counseling session about the screening test procedures was delivered either at an individual or a group level. written informed consent was signed by all women who had agreed to have a screening test. the via test was performed by adding 5 ml of acetic acid (vinegar) to 95 ml of distal water in a sterile kidney dish to compose 5% acetic acid. women were asked to lie on their back in a lithotomy position, in the presence of a good source of light. the external genitals were inspected and cleaned with use of gauze and normal saline, and then a sterile bivalve speculum was inserted into the vagina. the vagina wall and cervix were inspected for the presence of tumors and other diseases. any mucus or discharge at the cervix was cleaned with the use of sterile cotton. was defined as well - marginated, raised, opaque, aceto - white lesion at the squamocolumnar junction.21 via - positive women were referred to the oncology gynecologist at the radiation and isotopes center for treatment. via - negative women women who had other diseases such as bacterial or fungal infection were also treated at the screening center. descriptive statistics was used to characterize participants ; chi - square, and fischer s exact tests were used to assess differences in proportions between dichotomous outcome and explanatory variables ; and the student s t - test was used to assess differences in means of age. odds ratios (ors) were calculated to assess associations between risk factors and diagnosis of cervical cancer with use of the via test. significance level was set at p < 0.05 and ci at 95%. all statistical analyses were performed using stata version 9.2 (statacorp, college station, tx). descriptive statistics was used to characterize participants ; chi - square, and fischer s exact tests were used to assess differences in proportions between dichotomous outcome and explanatory variables ; and the student s t - test was used to assess differences in means of age. odds ratios (ors) were calculated to assess associations between risk factors and diagnosis of cervical cancer with use of the via test. significance level was set at p < 0.05 and ci at 95%. all statistical analyses were performed using stata version 9.2 (statacorp, college station, tx). one hundred and fifty women aged 2550 years were invited to participate in the cervical cancer screening project, and 100 women attended the screening clinic (response rate of 67%). the mean age was 35 years, 36% had no education, and 33% were employed. sixty percent were parous, 80% of them had spontaneous vaginal delivery, 62% were episiotomized, and 12% had laceration. only 30% of screened women used contraceptive methods, but 97% practised in the lower part of the body. table 2 describes the association between risk factors and cervical cancer diagnosis with the use of via. a highly statistically significant association was observed between cervical cancer and uterine cervix laceration (or 18.6, 95% ci : 4.6474.8). assisted vaginal delivery was also strongly related to cervical cancer (or 13.2 ; 95% ci : 2.9554.9). risk of cervical cancer was significantly higher among parous than among nulliparous women (or 5.78 ; 95% ci : 1.4123.7). moreover, this study showed that there was a statistically significant association between a positive via result and female genital mutilation (or 4.78 ; 95% ci : 1.1320.1). furthermore, the result showed a statistically significant association between episiotomy and a positive via results (or 5.25 ; 95% ci : 1.1523.8). all these statistically significant associations remained after adjusting for other factors, including age, educational level, and employment, and potential confounding factors, such as smoking, number of sexual partners, and use of contraceptive methods. no statistically significant findings were found for male partner circumcision, use of contraception method, or use of cosmetic smoking in the lower part of the body. this study revealed a high proportion of accessibility to the screening method. about 98% of screened women were satisfied with their decision to be screened. a total of 81.6% of participants stated that the visit to the screening clinic took less than 45 minutes (table 3). treatment was postponed due to a lack of resources for two patients (12.5%). in this pilot study of 100 women in khartoum state, sudan, 16% of women had a positive via result. the major risk factors were uterine cervix laceration, assisted vaginal delivery, female genital mutilation, and episiotomy. screening was feasible and acceptable, both in terms of participation rate and the experience of women. the slow natural development of cervical cancer is crucial to a screening method that identifies dysplasia and prevents its progression to invasive carcinoma. the cervical cancer prevalence of 16% was the same as in nigeria ; higher than in kenya, ghana (14%), and latin america (12%) ; and lower than in south africa and zimbabwe, where the via test was positive in 26% of the study population.2530 the results strongly suggest that incidents causing trauma to the uterine cervix are risk factors for cervical cancer in khartoum state. this was true for women with uterine cervix laceration, genital mutilation, women who delivered vaginally, women who had had an episiotomy, women who had undergone assisted vaginal delivery, and parous women. also, earlier episiotomy has been reported as a site for implantation and recurrence of cervical cancer in women who had cervical cancer during pregnancy and delivered vaginally.3136 it has been reported that metaplastic changes are also influenced by the trauma and repair experienced during delivery, and increased risk of cervical carcinoma has been identified in women who are highly parous.37,38 the results of this study revealed that uneducated and unemployed women had high risk of cervical cancer, which are consistent with previous studies that show that cervical cancer is more prevalent in low - educated and low socioeconomic status populations.16,17 factors such as cosmetic smoking of the lower body and partner circumcision are very common practices among the sample, which made it impossible to study them as risk factors for cervical cancer. the study results provide new risk factors for cervical cancer : uterine cervix, assisted vaginal delivery, episiotomy, and female genital mutilation. episiotomy, cervical laceration, and genital mutilation are major types of iatrogenic trauma.40 infection with human papillomavirus is a fundamental risk factor for cervical cancer.2,3 the majority of women were episiotomized during delivery, and a higher number of pregnancies and multiparities were reported as risk factors for cervix uteri cancer. women with these factors were about nine times more prone to cervical cancer than were women without these factors. episiotomy is found to be one of risk factors for cervical cancer.42, 43 if pregnant women diagnosed with cervical cancer are treated prior to delivery and go on to have an episiotomy, the cancer cells here will undergo metastasis.44 this pilot study showed that over two - thirds of women approached took the screening test. the screening facility was relatively easily accessed, and the examination was acceptable for most of the women. this finding was equal to that in thailand,31 lower than that in the philippines, and higher than that in ghana.27 the test is very simple and can be used effectively by nurses after 2 days of training. it is very cheap, costing about us$5 per visit for a 3-year screening strategy. a large sample size is needed to clarify the nature of the observed association between cervical cancer and risk factors in these results. this pilot study showed that women in khartoum state, sudan, who had trauma to their cervix, such as uterine cervix laceration, assisted vaginal delivery, female genital mutilation, or episiotomy, are at an increased risk of cervical cancer. it also showed that via is a feasible and acceptable cervical cancer screening method in a primary health care setting. the results showing trauma to the cervix as being a risk factor for cervical cancer point to the importance of safe delivery facilities and establishing guidelines and standard operation procedures for performing assisted vaginal delivery and episiotomy in obstetrics practice. also, abandonment of female genital mutilation can have a great effect in decreasing the incidence of cervical cancer. additional efforts are required in the training of birth attendants on safe delivery services and an increase in advocacy and community awareness about female genital mutilation risks. | objectives : to assess the risk factors of cervical cancer and the feasibility and acceptability of a visual inspection with acetic acid (via) screening method in a primary health center in khartoum, sudan.methods:a cross - sectional prospective pilot study of 100 asymptomatic women living in khartoum state in sudan was carried out from december 2008 to january 2009. the study was performed at the screening center in khartoum. six nurses and two physicians were trained by a gynecologic oncologist. the patients underwent a complete gynecological examination and filled in a questionnaire on risk factors and feasibility and acceptability. they were screened for cervical cancer by application of 3%5% via. women with a positive test were referred for colposcopy and treatment.results:sixteen percent of screened women were tested positive. statistically significant associations were observed between being positive with via test and the following variables : uterine cervix laceration (odds ratio [or ] 18.6 ; 95% confidence interval [ci ] : 4.6474.8), assisted vaginal delivery (or 13.2 ; 95% ci : 2.9554.9), parity (or 5.78 ; 95% ci : 1.4123.7), female genital mutilation (or 4.78 ; 95% ci : 1.1320.1), and episiotomy (or 5.25 ; 95% ci : 1.1523.8). all these associations remained statistically significant after adjusting for age, educational level, employment, and potential confounding factors such as smoking, number of sexual partners, and use of contraceptive method. furthermore, the via screening method was found to be feasible and acceptable to participants.conclusion:this pilot study showed that women who have uterine cervix laceration, assisted vaginal delivery, female genital mutilation, or episiotomy are at an increased risk of cervical cancer. it also showed that via is a feasible and acceptable cervical cancer screening method in a primary health care setting. |
the ballistocardiograph (bcg) is a vital signal in the 120 hz frequency range which is caused by the movements of the heart and blood. the bcg can be recorded from the surface of human body by noninvasive means. in the early 1930s, isaac starr recognized that the bcg signals closely reflect the strength of myocardial contraction and classified them into four groups to distinguish normal and abnormal heart performances [1, 2 ]. as a result of his valuable research, clinicians and medical experts for almost four decades studied the effects of different heart malfunctions by means of the bcg and proved that these malfunctions can be related to typical patterns in bcg signals [3, 4 ]. the ideal bcg waveform consists of seven waveform peaks labeled h through n as defined by the american heart association, and this annotation can be seen in figure 1. in addition to a number of clinical studies that have been performed with the bcg, specialized bcg instruments, including beds and chairs, have been developed by different research groups [57 ]. due to the unrefined nature of the previous bcg signal acquisition technologies, the lack of interpretation algorithms and the lack of practical devices new microsensor and digital wireless technologies provide more accurate bcg signal acquisition and processing, therefore, opening new possibilities to use bcg, and in general mechanical signals of the heart, clinically as a new additional tool in diagnosis and identification of heart malfunctions. based on these observations, we are improving the bcg signal acquisition system that reflects the mechanical functioning of the heart. in our first study, we used a high - precision accelerometer, which is factory calibrated, weighs 54 g, and is attached to the sternum, the same as used in reference. in our second study, we improved the previous sensor by developing a small mechanically flexible microsensor that could be easily attached to the sternum. it has been proven that all the aspects of a classical bcg signal, (h, i, j, k) waves similar to that measured through a high - precision accelerometer, can be identified in the novel microsensor recordings. the current research, reported in this paper, is aiming to go one step further by applying contactless measurement of the mechanical movement of the heart, using a radar - based mcg device operating in the range of 2.45 ghz. the extracted signal is considered a mechanocardiograph (mcg) reflecting the mechanical functioning of the heart and is highly correlated to the bcg signal acquired in previous studies. this paper is organized as follows : in the second section of the paper our signal acquisition methodology is explained and then the comparison of the acquired mcg signal to our previous bcg recordings is presented. in section three, the electronic circuit board design developed for the radar - based mcg device is explained. in section four the results of breathing rate and heart rate measurements using the new technology are presented. the comparison results of the phonocardiograph and the acquired signal are also presented clearly showing the correspondence of our mcg signal to cardiac events. the block diagram in figure 2 shows the general methodology followed in our research for processing of the radar - based mcg signal. the mcg signal was acquired by a microprocessor controlled, radar - based mcg device placed at distance of 10 cm away from the subject 's chest. the data acquisition, for the results presented in this paper, involved the measurement of ecg and respiration signals too. the design principle of radar - based mcg device is presented in section three of the paper. while monitoring the heart from the outside of the body contactlessly from the sternal location, the signal passes through only a few layers of different tissues between the sternum and the heart which can be seen in figure 3. the tissue layers between the sensor and heart muscle include : skin, sternum, lung and pleural tissue, pericardium and pericardial space. from the sternum position, therefore, the best position to record the heart 's mcg signal is from the sternum (normally on the first third of the sternum length, as this is the closest path to get to the heart muscle). rf signal with the carrier frequency of 2.45 ghz was transmitted toward the subject 's chest, and the reflected signal was band - passed filtered between 0.5 hz to 25 hz. the filtered signal was differentiated and then band - pass filtered again between 4 hz to 20 hz. the comparison of the processed mcg signal to the bcg signal recorded simultaneously from the sternum can be seen in figure 4 together with the synchronized ecg signal. it can be observed that there is a close correlation between the signal acquired from the radar - based mcg device and the signal acquired from the accelerometer - based bcg device attached to the sternum. the systolic and diastolic phases of cardiac cycle are shown to identify the correlations of these mechanical signals to the heart functioning. heart sound s1 corresponds to systolic phase of the heart cycle, and s2 corresponds to the diastolic phase of it. for the comparison purpose, the mcg signal was acquired synchronously with phonocardiograph signal and it was observed that s1 and s2 sounds of the phonocardiograph signal corresponded to the similar complexes on the mcg signal. the clear correlation of this new signal to the heart cycle 's events can be observed in figure 6. as stated before, in our experiments heart 's mcg signal was measured by a mcg device operating in the range of 2.45 ghz. at this electromagnetic frequency, the surface of the body is highly reflective to incident electromagnetic field. biological tissue is very lossy at this frequency, and there is minimal penetration of radiated electromagnetic energy into the body. therefore, a return signal from a radiated electromagnetic field incident on the body will primarily contain information associated with movement events. the effects of radio - frequency fields on human health have been monitored and studied by the scientists around the world for about 60 years now. the specific absorption rate, sar, is 0.42 w / kg which is below the limits as recommended by international commission on nonionizing radiation protection. the principal design of the radar - based mcg device is shown in figure 5. the antenna mounted in the device is hfmd24 by siemens and contains a transmitter and a receiver in the same housing. the returned signal is frequency shifted due to the doppler effect, which is the apparent change in frequency and wavelength of a wave that is perceived by an observer moving relative to the source of the waves. this effect permits the measurement of slight body movements from which physical heart movement signal can be obtained by the mcg receiver. the output signal from the receiver is filtered and amplified and is sent to the microprocessor for further processing. the cutoff frequencies for the band - pass filter shown in the schematic are 1 hz and 100 hz, and the gain of the amplifier is around 800. after filtering and amplifying, the mcg signal is sent to the a / d unit and then to the atmel cpu for further processing. the cpu is connected to a thin - film transistor (tft) display via its serial peripheral interface (spi) port. the mcg device operates with two aa batteries (2.45 v). considering that the mcg device has its own cpu and monitor, it can be used stand alone to acquire and process the mcg signal. there is also another option of sending the data to a personal computer for more advanced processing of the data using matlab. to have this option on our device, the digitized mcg signal is transformed to packets and sent through uart to the usb and finally to the host personal computer for possible further processing. the data from subjects were acquired at burnaby general hospital (british columbia, canada) and in all the measurements presented in this paper the distance from the sensor to the chest was set to 10 cm. the processed mcg signal has been superimposed on the phonocardiograph signal, and it has been noticed that s1 and s2 sounds of the phonocardiograph signal corresponded to the similar complexes on the radar mcg signal. the correlation of the mcg signal to the heart cycle 's events is observed, and the results of this superimposition can be seen in figure 6. for the heart rate measurement our experimental setup included the acquisition of the mcg signal and two leads of ecg as a reference. for respiration rate measurement, the setup included the acquisition of mcg signal together with the respiration signal as the reference. eight subjects took part in the respiration measurement tests, and six of these subjects took part in the heart rate measurement tests too. breathing rate measurement experiments were 60 seconds long while heart rate measurement experiments were 15 seconds long. for detection of breathing rate, the radar signal was low pass filtered under 0.4 hz, and the peaks were counted and compared to the results acquired from a strain gauge transducer that measures the changes in thoracic circumference, using a belt which is fastened to the subject 's thorax. as can be seen in table 1, the accuracy of respiration rate measurement was 91.35 percent over all eight subjects. the heart rate was measured using radar - based mcg device and was compared to the heart rate calculated from the simultaneous ecg signal for six subjects. the average of the heart rate accuracy on these subjects was calculated to be 92.9 percent. as an example, for subject six we had 14 cycles of respiration from which 13 of them where correctly identified. thus, for this subject, the 92 percent accuracy for respiration rate detection was achieved. for the same subject and out of 19 heart beats, 17 of them were correctly identified. thus, for heart beat detection for this subject, the accuracy of 89.4 percents was achieved. using our device, the data can be seen real time and can be processed in near real time. the reason for quick processing time is that the algorithm includes filtering of the data and then peak searching to find the corresponding peaks to the inspiration and heart beat events. the sources of interference for contactless heart motion signal acquisition can be categorized into two main categories. first, foreign electromagnetic radiation that may disrupt the desired signal on its way back to the antenna, and second, motion interference of nearby subjects. as discussed previously, the ism bands are recognized internationally, where it has been traditionally reserved for industrial, scientific, and medical purposes excluding communications. the 2.4 ghz ism band in many urban settings is in fact quite saturated with devices. examples include the very common wireless local area network (wlan) devices, bluetooth devices, microwaves ovens, and household cordless phones. these devices can exhibit relatively high signal broadcast power levels during full power transmission. in the north american / us market, the safe power level is governed by the fcc. as a result, it is possible that other 2.4 ghz, ism devices operating in the vicinity of measurement could pose undesirable electromagnetic signal interference, particularly when these devices are in - motion. however, most cellular phone devices operate in the global system for mobile communications (gsm) bands, and thus will not pose electromagnetic interference concerns, in the sense of disturbing the doppler reading, for the contactless mcg device proposed. motion interference is another possible source of signal disruption when operating the device in a high - density, busy setting. the antenna patch on the contactless mcg device is a printed patch antenna and at ranges greater than what is specified operational for this application (i.e., more than 10 cm), its side - lobes begin to pickup motion in its path. also the main - lobe of the antenna begins to exhibit relatively wide angle. in attempts to acquire useful heart motion signals at longer ranges, more than 10 cm, the motion interference from the subject 's general body movement or nearby movements that are not subject - related will both disrupt the heart motion signal acquisition greatly. in efforts to evaluate the reliability of this device considering the two major sources of interference, in addition to the measurements at burnaby general hospital, as explained previously, measurements on 200-plus participants during the wired nextfest convention were obtained. the environment of the convention hall naturally provided many possible sources of both electromagnetic interference and motion interference. in fact, the convention hosted more than 150 stations, many equipped with audio - video setup, wireless network stations, and up to thousands of visitors at any given moment, likely each carrying some sort of personal mobile device. the heart motion measurements were compared simultaneously with the corresponding heart beat of each individual participant as assessed via wrist pulse by research staff members. it was observed that when the subject held still, and without other people within 50 cm of the device radius, approximately only one out of ten subjects during 30 second recording session would exhibit grossly delayed or out - of - sync heart rates between the wrist pulse and device reading. although it is unknown how many wireless broadcasting devices, using the 2.4 ghz band, were present during the convention, nor the associated power levels, and hence the random interference power density in the foot - ball sized convention hall, the quasi field - test of the device provided assurance that even in the busiest everyday environments, filled with urban electronics and random motion, when the subject recordings are controlled properly, the reliability of the heart rate detection is seemingly good. further testing on the effects of both electromagnetic and motion interference is necessary to fully assess the performance of the proposed contactless mcg device. though, it suffices to say that the observations through the combined evaluations and field - trials give high - hopes on the performance and for the eventual perfection of this device. in this research work, the mcg signal was extracted from the radar - based mcg device and by using two other heart related signals, bcg and phonocardiograph, it has been proven that the extracted mcg signal corresponds to the mechanical functioning of the heart. two physiological signals, heart rate and respiration rate, were measured using the mcg signal and a noticeable accuracy of 91.35% for respiration rate, and 92.9% for heart rate were achieved. it should be noticed that these results are acquired from the first generation of our device, and the accuracy of the detection can be improved by focused targeting of the mcg device on the sternum and further hardware improvements. another important factor, which is an asset of our device, is the fact that all the electronics and the radar sensor can be fabricated for less than $ 200 usd which makes our device economical for general heart monitoring purposes. considering the short amount of processing and the low cost of the contactless measurement of heart rate and breathing rate as we presented, our device can have numerous applications in the health care system such as, prevention of sudden infant death syndrome (sids), sleep apnea, and other areas in which contactless monitoring is desired. in this research work, we have proposed a new methodology and a new device based on radar technology. we proved the correspondence of our acquired mcg signal to sternal bcg and phonocardiograph signals. further improvement of the current device can provide us with more accurate mcg signal corresponding to mechanical performance of the heart and ultimately development of an additional contactless heart diagnostic tool. | a novel method of detecting mechanical movement of the heart, mechanocardiography (mcg), with no connection to the subject 's body is presented. this measurement is based on radar technology and it has been proven through this research work that the acquired signal is highly correlated to the phonocardiograph signal and acceleration - based ballistocardiograph signal (bcg) recorded directly from the sternum. the heart rate and respiration rate have been extracted from the acquired signal as two possible physiological monitoring applications of the radar - based mcg device. |
in 1980, the world health organization (who), the international labor organization, and the united nations environment program set up the international program on chemical safety (ipcs) to advise governments on the scientific basis for chemical safety and to strengthen national capabilities. initially, the ipcs focused on safety of production, storage, and transport of chemicals, but high - profile chemical disasters with potential long - term impact on the wider public, such as the seveso disaster in italy in 1976 (resulting in the highest known exposure to 2,3,7,8-tetrachlorodibenzo - p - dioxin (tcdd) in residential populations), the spanish toxic oil incident in 1981, and the bhopal explosion in 1984, led to a general recognition of the public health impact of chemical events. in 1992, an ipcs expert panel found that countries commonly lacked public health capacity, training, and plans with clear lines of accountability. there was commonly confusion over roles of emergency responders, police, local, regional, and national government, and over the responsibilities of government departments for environment, health, and homeland security, as well as a lack of appreciation of the psychological impact on the population and the effect of exposures on vulnerable groups such as children, pregnant women, and the frail elderly. compounding these systemic weaknesses, the 1995 tokyo sarin terrorist attack, and then the 9/11 2001 new york atrocity, raised international concern and exposed weaknesses in national capability to deal with chemical threats. the prospect of white powder ' and dirty bomb ' incidents that might involve simultaneously infectious, chemical, and radiological agents signalled the need for public health responses to be planned around the management of complex situations in an integrated manner, rather than organized vertically through the individual specialist disciplines of infectious disease control, toxicology, and radiological protection. and this conclusion has been reinforced by the most contemporary public health concerns about climate change and complex emergencies. in may 2003, the 56th world health assembly (wha) adopted a resolution (wha56.28) to revise the international health regulations (ihr) to cover not just cholera, plague, and yellow fever, but also biological, chemical, or radiological events of international concern '. (a global surveillance study in 2002/3 identified 35 major chemical incidents in 26 countries that met ihr criteria, and chemical incidents have now been added to the responsibilities of the who 's global outbreak and response network.) the ihr place new requirements on countries to cooperate in any public health incident that has serious international implications. the ipcs recommends that chemical hazards be dealt with within comprehensive public health systems that embrace : incident planning and preparedness, training and simulation exercises, commissioning of emergency medical services to deal with chemical casualities and decontamination, emergency medical toxicology and poisons information services, hazard analysis, risk assessment, risk communication, environmental public health tracking, environmental epidemiology, andenvironmental monitoring and modelling. incident planning and preparedness, training and simulation exercises, commissioning of emergency medical services to deal with chemical casualities and decontamination, emergency medical toxicology and poisons information services, hazard analysis, risk assessment, risk communication, environmental public health tracking, environmental epidemiology, and environmental monitoring and modelling. at the 65th who general assembly in 2012, most countries admitted to poor readiness for chemical threats, with average capacity scores of only 45 per cent (compared with 70 per cent for food safety events). even when statutory duties and functional arrangements for chemical safety, emergency response, and clinical toxicologyare well established, there remain considerable gaps in public health capability to deal with wider population health aspects. as other countries work to develop health protection systems to comply with ihr responsibilities, we offer an analysis of the evolution of health protection services in the united kingdom designed to deal with chemical incidents. in 1974 in the united kingdom, when general and clinical public health services were split from non - medical environmental health services, they were transferred from local government control to local national health service (nhs) authorities. the opportunity to set up a national public health service as proposed by galbraith in 1972 when, in 1978, the government - funded public health laboratory service established a national epidemiology unit following the review of an outbreak of smallpox in london, chemical incidents were not perceived as a significant threat and thus excluded from its remit. through the 1980s, however, growing concern about chemical hazards led to a new focus on medical management of mass casualties and injuries from major incidents. then the clustering of leukaemia around the sellafield nuclear plant led to a public enquiry and a recommendation for an expert unit to support the nhs, but only in the interpretation of routine statistics on clusters. in 1989, scotland established a small environmental public health unit with a broader remit and it quickly proved its value in the management of the health risks of the braer oil spill.but in england, the government 's department of health was satisfied with the status quo. nevertheless, major drinking water contamination incidents (phenol in 1984 and aluminum in 1988) exposed serious inadequacies in public health capability. the ability of local public health services to cope with chemical emergencies was widely questioned ; there was no provision for deploying back - up for local emergency services ; and no central government responsibility for coordinating major chemical incidents in peacetime '. public health specialists remained almost exclusively focused on communicable disease control ; the government 's health department circular that set out public health responsibilities of local nhs authorities did not even mention non - infectious hazards. two public enquiries into the lowermoor aluminum incident (where 20 tonnes of aluminium sulphate were inadvertently emptied into the water supply at the lowermoor treatment works in north cornwall on 6 july 1988) pointed up inadequacies in understanding the longer - term health consequences and recommended an expert panel to advise local public health professionals. although a panel of volunteers ' was created, its advice could only have been accessed through the government 's chief medical officers, and in fact it was never activated. there was no capability to deploy teams of experts and no attempt to address the shortfall in local expertise. consequently, calls persisted for a properly resourced national public health agency ; government advice still lacked clarity on roles and responsibilities and local plans remained inadequate. in the absence of central government strategy, in the early 1990s, some medical toxicology units attached to the national poisons information service (npis) and university academics undertook initiatives to fill the gap. these so - called regional provider units depended on generating income from contracts for 24/7 response to incidents, surveillance, and research, but there was no common pattern of service provision, nor national evidence - based standards of practice. in some parts of the country, units competed for contracts ; a local municipality might contract with one unit and the local nhs authority covering the same population contract with another. in 1996, the uk government health department, under increasing grass - roots pressure, funded a very small unit, the national focus for chemical hazards ', that operated from 1997 to 2003 to undertake national surveillance, disseminate good practice and training, provide a reference point in emergencies, and help coordinate health aspects of emergency planning across government. this unit achieved its limited objectives, but the national focus had no authority to standardize and coordinate the work of the regional provider units. the role of nhs public health departments in chemical events remained confused, and rapid access to authoritative expertise continued to be a problem. though the various units undertook a growing number of public health investigations of chemical incidents, capacity was limited and there was no national field epidemiology resource. in 2001, because of increasing threats from deliberate release plus recent experience with complex emergencies of flooding and of a foot and mouth epidemic, the uk government eventually accepted the need for a national agency. the new health protection agency (hpa), established in 2003, created teams at area and regional levels supported by national specialist centres, but it took several years to achieve reasonable clarity about the relative responsibilities of the nhs and the hpa. creation of the hpa 's chemical hazards and poisons division by incorporating the national focus and the regional provider units allowed the hpa to reallocate relatively modest resources from infectious disease services to double the chemical hazards budget within 12 months. it significantly increased the number of clinical toxicologists available to the hpa through the npis. to exploit the potential synergies, the hpa co - located the chemical hazards and poisons division with the national radiological protection board. then, in 2005, it merged the two organizations to create the hpa 's centre for radiation, chemical and environmental hazards. the service initially focused on acute incident management, but piecemeal transfer to hpa from the government 's health department of central advisory functions (the consequence of growing confidence in the ability of the hpa and a government political imperative to cut the numbers of civil service staff in central london) largely shaped its early development from 2004 to 2006. hpa 's centre for radiation, chemical and environmental hazards absorbed transferred functions including advice on the health effects of chemicals in air, soil, water, and consumer products ; the approvals process for pesticides, biocides, and veterinary medicines ; and the secretariat for the expert advisory committees on toxicity, mutagenicity, and carcinogenicity of chemicals ; as well as the expert group on the medical management of casualties from chemical terrorism. several major incidents, including the london bombings, the deliberate fatal polonium poisoning of a russian in london, and an influenza pandemic, fully and successfully tested the hpa model of national health protection services. the massive explosion and subsequent fire at a major oil depot in 2005 led to a huge plume of smoke over london and the south east of england for 4 days. the hpa provided advice on health risks nationally, but the incident exposed the lack of national capability to sample the plume and make appropriate public health risk assessments. (environmental sampling in emergencies is now clearly the responsibility of the government 's environment agency.) in 2007, serious flooding in england provoked a public enquiry that revealed general satisfaction with the overall civil response, but noted there was confusion over the respective roles and accountabilities in law of staff of the health protection agency, primary care trusts, strategic health authorities the drinking water inspectorate and their interface with gold command '. the public as well as the building industry found it difficult to acquire consistent advice in the response and early recovery phases, and information was particularly lacking or inconsistent on the sources of support available and possible longer - term health impacts '. the hpa rapidly developed advisory fact sheets for its website, but the structural issues related to coordination across complex organizational arrangements remain. one unintended consequence of including regional and university - based provider units for chemical response within the new hpa in 2003 was a narrowing of their scope of activities. previously, units were free to use a broad definition of environmental public health and some were working with local authorities on the built environment, housing and health, and on burns, injuries, and violence prevention, in addition to their core responsibilities for chemical events. from the outset, it was the ambition of the hpa 's chemical hazards and poisons division to build on this broader approach and develop services for environmentally related diseases such as asthma, allergy, congenital anomalies, other chronic diseases, as well as reproductive health. however, the division competed for diminishing resources with the much larger and longer established infectious disease divisions. the hpa board did commission a major programme of work to measure disease burden in order to prioritize investment, but this ambition remained an aspiration. had it followed this line, development of services for environmentally induced morbidities such as asthma and injuries would have featured much more prominently, as would the hpa - led national children 's environmental health strategy. in 2009, the newly elected uk government announced plans for reconfiguration of the nhs and public health services in england, including abolition of the hpa as a separate legal entity and its incorporation in 2013 in a new broader public health national service for england. (devolution produced a variety of models for health services and public health in scotland, wales, and northern ireland.) the united kingdom 's faculty of public health expressed serious concerns about destabilizing emergency response arrangements and sought clarification of roles and responsibilities during public health emergencies '. general public health responsibilities would return to local governments from the nhs, with public health england created as a new executive agency of the government 's department of health to coordinate nationally and provide some specialist services. the hpa, an independent agency set up by statute, will disappear and its functions will be incorporated into public health england, together with the current regional public health units of the nhs, and the public health observatories and cancer registries. the major concern of the public health profession about this change has been the potential loss of independent advocacy and advice, a basic feature of public health success over the last 150 years. there may be renewed opportunities arising from the planned closer integration of health protection services with general public health functions. this will align health protection functions more closely to disease burden (for example, asthma, allergy, injury) and embrace the ambition of prevention of chronic environmental diseases. countries still inadequately prepared for the ihr should note that chemical events can cause major loss of life, long - term disability, and, in major ways, disrupt psycho - social health and well - being of large populations as well as the economy. countries should therefore assess urgently their capabilities for dealing with chemical events against ipcs guidelines. in the united kingdom, major incidents exposed weaknesses in handling public concern about longer - term health effects. a paucity of data on health effects of environmental exposures prevented public health authorities from being able to offer robust evidence - based reassurances, thereby exacerbating media and public anxiety. the united kingdom was slow to recognize the need for national health protection leadership, unlike the united states which created the national institute for environmental health sciences in 1969, the centers for disease control and prevention 's center for environmental health in 1980, and the agency for toxic substances and disease registry in 1983. in contrast, in the united kingdom, chemical hazards services evolved slowly through a grass - roots movement pressuring an apparently reluctant government. resources for the adequate management of the public health aspects of chemical events are usually relatively modest, and moreover, chemical events are best addressed within a stable public health infrastructure that can cope with complex situations. the hpa model of multidisciplinary teams at area and regional levels supported by a national expert centre has generally worked well in difficult circumstances (although this model is now being reconfigured), and countries should consider moving away from health protection models based on individual scientific and professional disciplines to models based on a multidisciplinary approach to complex situation management (white powder ' threats and outbreaks of unknown etiology). nevertheless, the scientific skills required for the public health management of chemical events such as public health toxicology, environmental public health, and environmental epidemiology are in short supply, and governments need to work with international agencies and professional bodies to ensure sustainability of national capacity. | the revised international health regulations (2005) require that countries develop plans for chemical threats. in 2012, the world health assembly reported that most countries had not yet achieved adequate capacity '. we review the evolution of chemical hazards services in the united kingdom, the result of 15 years of grass - roots pressure and an accumulating weight of chemical incidents that eventually convinced the uk department of health of the need for a new national public health function, culminating, in 2003, in the creation of the chemical hazards division of the new health protection agency. ten years later, public health services are again being radically reorganized with the creation of public health england, potentially destabilizing health protection arrangements and creating confusion among roles in managing chemical emergencies. incorporating health protection into a broader public health organization, however, offers a new opportunity to broaden the scope of health protection services to embrace prevention of non - infectious environmental diseases. |
the first implantable cardiac pacemakers were designed to pace at a fixed rate without any attempt to mimic heart rate changes. since there, technologically advanced pacemakers were introduced that adjusted the pacing rate by sensing the patient 's intrinsic atrial activity and regulating the ventricular pacing rate accordingly. successively, by the mid-1980s, artificial sensors were introduced in order to overcome problems with chronotropic incompetence in the pacemaker - recipient population. the prevalence of chronotropic incompetence is estimated to be present in 20% to 58% of pacemaker recipients [1, 2 ]. in these patients, rate responsive pacing has been demonstrated to improve cardiac output and exercise tolerance when compared with fixed rate pacing ; many older studies have shown that exercise capacity, stroke volume changes with exercise, and maximum oxygen consumption depend primarily on heart rate change in most subjects [47 ]. aim of the present paper is to address the different hemodynamic sensors currently implemented in rate responsive pacemakers. ideally, the rate - adaptive sensors should be capable of mimicking the sinoatrial 's node ability to provide an appropriate heart rate response to the physiological and psychological stress and rate decay during recovery after exercise should match metabolic needs. many different types of rate - modulated cardiac pacemakers have been investigated. in the mid-1970s, cammilli. provided the first implantable device using central venous ph sensing ; the concept was that the decrease of central venous ph associated with exercise would increase pacemaker rate ; unfortunately this sensor was not found to be stable in the long - term, and it was abandoned. variations in the oxygen content of mixed venous blood, measured as the right ventricular oxygen saturation, have been successively evaluated as indicators for controlling the pacing rate. the main technical problem involved in using this biosensor was that the signal received from the oxygen sensor showed dynamic fluctuations that depend on numerous factors : changing conditions of light reflection around the electrode, movements of erythrocytes with different oxygen saturation levels, incomplete mixing of blood, position of the oxygen sensor within the right ventricular cavity, and the direction of the light beam emitted. the qt interval, which is the interval between the pacing stimulus to the peak of the t wave, is another parameter that has been investigated for controlling the pacing rate [12, 13 ]. this interval is modified by changes in circulating or locally released cathecholamines, constituting a physiological indicator for adapting the pacing rate in response to increased sympathetic activity induced by exercise or emotion. however, the qt interval may be unreliable in t wave undersensing and is affected by drugs and electrolyte alterations ; besides, as it requires ventricular pacing, it can not be used in aair mode. respiration has been used as a physiological sensor to restore physiological rate control of the heart with a respiratory - dependent pacemaker. sensing of breathing rate and tidal volume was monitored by impedance variations initially detected between the pacemaker casing and an auxiliary lead implanted subcutaneously. the use of the respiratory rate as a pacing sensor was demonstrated to significantly improve exercise tolerance compared to fixed rate pacing. a successful approach calculated minute ventilation by impedance measurements made between a bipolar pacemaker lead and the pulse generator case. this respiratory pacemaker changes the cardiac stimulation rate in response both to the rate of respiration and to the tidal volume, both of which make up minute ventilation, a value that has been demonstrated to correlate well with exercise. limitations of this sensor include lower reliability in subjects with obstructive pulmonary disease, false positive reaction in hyperventilation, or interference with posture. activity sensors are the older, and by far, the most popular and more widely used. activity may be acknowledged either by a piezoelectric crystal which recognizes body movements or by an accelerometer that identifies the postural changes and the body movements related to physical activity.the main limitation of this kind of sensor is that the rate of adaptation may not be proportional to the metabolic demand. for example, activity sensors may underrespond to activities in which there is minimal thoracic movement such as smooth callisthenics movements, treadmill gradient change, and cycle ergometer exercise. these sensors may also yield an excessive heart rate response to tempo changes, staircase decent, and upper arm activity. as shown before the most frequent association includes the combination of an activity sensor which allows a rapid response during exercise and a metabolic sensor such as minute ventilation or qt interval which provides an increasing pacing rate during mental stress. the life study, which compared the relative benefit of a blended sensor (accelerometer and minute ventilation) versus single sensor (accelerometer), has demonstrated that the use of dual - sensor pacemaker restored chronotropic response and allowed a significant improvement of exercise capacity when compared with the use of only the accelerometer sensor. pacemaker sensor features, alone or in combination, are frequently used in default setting ; the role of individual optimization of the actual sophisticated sensors in improving quality of life and exercise capacity requires further investigation. a recent study has demonstrated that after 1 month of individual optimization of rate response pacemakers, exercise capacity was improved and maximum heart rate increased, although quality of life remained unchanged. besides, the adept study which was a single - blind randomized controlled trial comparing dual - chamber with rate - modulated dual - chamber pacing in patients with predominant sinus node dysfunction, failed to demonstrate the effectiveness of rate modulation in improving the functional status or quality of life. hemodynamic sensors detect changes in the hemodynamic performances of the heart, which partially depends on the autonomic nervous system - induced inotropic regulation of myocardial fibers. under physiological conditions, inotropic and chronotropic properties are controlled in order to synergistically modulate the cardiac output according to the metabolic demand. thanks to this intrinsic negative feedback, in the case of chronotropic incompetence, assessment of cardiac contractility would allow timely rate adaptation with reduced risk of overpacing. specific haemodynamic sensors have been designed to measure different expression of the cardiac contraction strength. the main intracardiac sensors which today seem to better measure surrogate parameters of hemodynamics include peak endocardial acceleration (pea) (sorin group, italy), ventricular impedance guiding a closed loop stimulation (cls) (biotronik, germany), and transvalvular impedance (tvi (medico, italy). theoretically, the contractile state of the heart can be identified in terms of ventricular mechanics by the maximum velocity of shortening of unloaded myocardial contractile elements. more than 20 years ago, an experimental rate responsive pacemaker based on the detection of the peak dp / dt of the right ventricle to drive the pacing rate was investigated ; while the peak dp / dt of the right ventricle has been demonstrated to reflect quite well the contractile property of the total heart, theoretically the main difficulties could be in long - term sensing of dp / dt, due to tissue encapsulation and ventricular muscle pressing on the membrane of the transducer. the measurement of endocardial vibration, by means of an accelerometer in the right ventricle only during the isovolumetric phase, allows to assess a parameter of heart contractility : the systolic isovolumic peak acceleration, that was called pea is recorded by an accelerometer mounted in the tip of a dedicated pacing lead which is sensitive to right ventricle wall vibrations generated by the mechanical activity of the heart ; it was demonstrated to increase during adrenergic stimulation and to follow the changes in heart rate interestingly, even if the sensor is located in the right ventricle, the pea amplitude is determined by the contraction strength in the left ventricle, where the systolic myocardial vibrations are generated. pea dynamic monitoring has been demonstrated to provide fast pacing rate responses with long - term performance of sensor lead also in patients with heart failure and wide qrs complexes. in addition to the first pea (pea i), recorded during the isovolumic systole, the sensor can detect a further signal, which is designated as pea ii. pea ii is recorded during the isovolumic relaxation and corresponds to the second cardiac sound. experimental studies indicated that the pea ii amplitude reflects the rate of rise of the pressure gradient across the aortic valve at the time of valve closure, which depends on both the rate of ventricular pressure reduction (negative dp / dt) and the afterload, although its role in measuring diastolic function has not been confirmed yet. moreover, the pea signal can be recorded at different locations in the heart ; it has been recently demonstrated that the pea signal measured in the atrium is reliable and proportional to the signal recorded in the ventricle. the main disadvantage of the pea recording comes for the need of a dedicated lead mounting the intracardiac accelerometer, which may limit the number of patients who could benefit from this sensor system. an attractive method to obtain a physiological pacemaker system would be the integration of the pacing device into the natural cardiocirculatory system. this concept has been realized in the closed loop stimulation (cls) system, which converts information from the circulation applied to the right ventricle into a concordant heart rate. even under pathophysiological conditions inotropic regulation affects myocardial contractility, which consequently reflects information about the hemodynamic state and requirements. based on that relationship, the cls pacemakers from biotronik (biotronik gmbh t co., germany) detect changes in myocardial contraction dynamics through intracardiac measurement and transfer them into individual pacing rates. in these pacemakers, load - dependent changes in myocardial contractility reflect variations in the unipolar intracardiac impedance, measured between the ventricular electrode tip of a conventional bipolar lead and the pacemakers case. during myocardial contraction, the proportions of blood and myocardium vary in the close vicinity of the electrode tip. since the specific resistance of blood differs significantly from that of the myocardium, the dynamics of the myocardial contraction can be well detected in a time - course impedance curve. therefore, by monitoring the unipolar intracardiac impedance, changes in myocardial contractility can reliably be measured. in a previous study, it has been demonstrated that cls - driven pacemakers, in a population of patients with chronotropic incompetence, allowed overall cardiovascular responses comparable to those of healthy individuals throughout incremental exercise. additionally, the rate decay algorithm appeared to result in physiologically appropriate haemodynamics during the initial phase of recovery. the role of cls has also been well established in patients with refractory and recurrent vasovagal syncope even during a long - term follow - up [3032 ]. the rationale for the effectiveness of cls in these situations is that during a vasovagal syncope the diminished venous return stimulates a sympathetic compensatory tone that leads to a positive inotropic effect. since ventricular filling is reduced, left ventricular systolic pressure may increase participating in a baroreceptor induction of bradycardia, thereby creating a paradoxical situation : increased inotropic effect associated with decreased chronotropic state. this anomalous situation inhibits sympathetic activity and promotes a reactive vagal effect that causes vasovagal syncope by increasing peripheral vasodilatation and reflex bradycardia. the cls detection of the increased contractility in the first stage of vasovagal syncope could activate atrioventricular sequential pacing that may anticipate withdrawal of sympathetic tone and counterbalance the increase in vagal tone, preventing in this way arterial hypotension, bradycardia, and finally syncope. the fourth generation of cls devices, capable of operating on both sensed and paced ventricular beats, have overcome the major limitation of the previous systems which required permanent ventricular pacing. cardiac impedance could be applied to detect changes in end - diastolic ventricular volume as well as volume changes from diastolic to end - systolic conditions provided that the absolute impedance is recorded instead of just peak - to - peak variation. this is possible if high - quality, stable, and noise - free impedance signals are derived. this goal has been achieved thanks to a recently developed recording method, whereby impedance is detected between the right atrium and the right ventricle, called transvalvular impedance (tvi). tvi is a regular periodic waveform with a minimum value during atrial systole (theoretically corresponding to the end - diastolic phase) and a maximum at the end of the qt period (theoretically corresponding to the end - systolic phase). the minimum tvi, which is recorded close to the maximum ventricular filling, is sensitive to all conditions known to modify the preload. the maximum tvi, which is recorded when the ventricular systole is completed, corresponds to the minimal ventricular volume (end - systolic volume) and is sensitive to changes in cardiac contractility. the relative variations, that could surrogate the end - diastolic and end - systolic volumes, left ventricular ejection fraction and stroke volume, define a cardiac inotropic index fully independent from preload effects, which is a direct expression of the autonomic nervous system regulation of the heart. even if tvi data are referred to the right ventricle, the essential haemodynamic information holds for the systemic circulation as well, since under steady conditions, the stroke volume is the same in the pulmonary artery and the aorta. when inotropic index was used to drive a rate - responsive stimulator (sophs by medico, padova, italy), the tvi - indicated pacing rate proved a precise replication of the individual sinus rate in patients with physiological chronotropic competence. the ability to discriminate the hemodynamic expression of cardiac contractility from the preload effects is an important advance in hemodynamic sensor technology, which is expected to improve pacing rate regulation in all circumstances entailing a modification in venous return. furthermore, the prospect of obtaining diagnostic information on the trend of diastolic ventricular filling, as well as on the ejected blood volume, in changing daily - life conditions by an implanted device, makes tvi an appealing new tool in the medical care of pacemaker patients. rate - responsive pacing is just one of the many potential applications of haemodynamic sensors in implantable pacemakers, always blending with activity sensors. specially in heart failure patients they could assure an optimal upper rate limit control, reducing deleterious inappropriate rate response induced by motion sensors. if applied to a cardioverter defibrillator device (icd), they could be used to discriminate the supraventricular and ventricular malignant tachyarrhythmias : its use could be a marker of hemodynamic deterioration during tachyarrhythmias and guide the atp or shock therapy. tvi has been proposed for beat - to - beat detection of mechanical ventricular activity and capture confirmation, with a haemodynamic alternative to the electrical autocapture control of the effective ventricular pacing. clinical trials support the use of these tools to recognize the prodromes of neurally mediated syncope and to trigger a protective increase in the cardiac pacing rate : this one could be possible as with pea sensor and with cls pacing [3032 ]. closed loop stimulation and peak endocardial acceleration based algorithm has been recently demonstrated to be effective in atrioventricular delay optimal and dynamic programmation [40, 41 ]. besides, very recently, becher. have published the results of an animal study in which implant - based impedance showed a strong inverse correlation with changes of directly measured intrathoracic fluid accumulation. in this setting, intrathoracic impedance monitoring, a hemodynamic sensor which is an index of changes of fluid status, even if not developed to drive heart rate, has been shown to reduce hospitalizations in heart failure patients. besides, when combined with other heart failure device diagnostic information such as long - lasting atrial fibrillation especially with rapid ventricular rate, low patient activity, high night heart rate, low heart rate variability could predict the clinical deterioration of ambulatory heart failure subjects, enhancing the ability to risk - stratify patients for subsequent heart failure events. in cardiac resynchronization therapy, hemodynamic sensors could provide indications about the most appropriate left ventricular pacing site or the best interventricular delay to apply [2446 ]. furthermore, hemodynamic sensors might play a role in the long - term monitoring of heart failure, helping the physician in the individual care of each patient. this last task would be quite appealing, especially if the diagnostic system gives information on the trend of the main hemodynamic variables such as the preload, the afterload, the stroke volume, and left ventricular ejection fraction. | the rate adaptive sensors applied to cardiac pacing should respond as promptly as the normal sinus node with an highly specific and sensitive detection of the need of increasing heart rate. sensors operating alone may not provide optimal heart responsiveness : central venous ph sensing, variations in the oxygen content of mixed venous blood, qt interval, breathing rate and pulmonary minute ventilation monitored by thoracic impedance variations, activity sensors. using sensors that have different attributes but that work in a complementary manners offers distinct advantages. however, complicated sensors interactions may occur. hemodynamic sensors detect changes in the hemodynamic performances of the heart, which partially depends on the autonomic nervous system - induced inotropic regulation of myocardial fibers. specific hemodynamic sensors have been designed to measure different expression of the cardiac contraction strength : peak endocardial acceleration (pea), closed loop stimulation (cls) and transvalvular impedance (tvi), guided by intraventricular impedance variations. rate - responsive pacing is just one of the potential applications of hemodynamic sensors in implantable pacemakers. other issues discussed in the paper include : hemodynamic monitoring for the optimal programmation and follow up of patients with cardiac resynchronization therapy ; hemodynamic deterioration impact of tachyarrhythmias ; hemodynamic upper rate limit control ; monitoring and prevention of vasovagal malignant syncopes. |
to evaluate how widespread the emergence of environmental isolates as causes of clinical infections may be, we used a highly discriminatory and transportable typing method to study isolates from several large bacterial culture collections. multilocus sequence typing (mlst) is a relatively new technique based upon unambiguous sequence analysis of several housekeeping genes. unlike previous methods for bcc strain typing (10), mlst is not based on banding patterns but instead relies on the robust comparison of dna sequence information. this process facilitates both the identification and matching of identical clones as well as their evolutionary comparison to closely related strains. using a recently validated mlst scheme (11), we analyzed a collection of 381 clinical isolates of all 9 currently reported bcc species, from 28 countries. a total of 187 distinct sequence types (sts) were identified from clinical isolates within this collection and compared with 233 environmental bcc isolates (113 sts). we found that 81 clinical isolates (encompassing15 sts) were identical by mlst to a wide range of environmental isolates. this figure represents 21.5% of the clinical isolates examined (for clarity, a subset are shown in the table ;). mlst, multilocus sequence typing ; bcc, b. cepacia complex ; st, sequence type ; env, isolated from the environment ; non, isolated from a non - cystic fibrosis (cf) patient ; cf, isolated from a cf patient ; iiia or iiib, isolates belonging to b. cenocepacia reca subgroup a or b, respectively ; envh, isolated from a hospital environment., panel strain (12) ; suprascript t, type strain for species. the resolution of strain identification offered by mlst is such that different isolates sharing the same st (genotypically indistinguishable at all 7 loci) are defined as clones of the same strain (e.g., for a group of isolates within this collection, we have further validated this identity by cloning and sequencing up to 10 random fragments of dna). the 15 sts identified from environmental and clinical sources belonged to 6 different bcc species (table) : b. cepacia (4 sts), b. multivorans (2 sts), b. cenocepacia (3 sts), b. stabilis (2 sts), b. vietnamiensis (2 sts), and b. ambifaria (2 sts). three b. cenocepacia sts also belonged to 2 different reca lineages defined within this species : iiia (1 st) and iiib (2 sts). sts occurring in both clinical and environmental niches were found in 6 of the 9 formally described bcc ; the greatest degree of overlap occurred in b. cepacia and b. stabilis (figure). the proportion of sts not shared between clinical and environmental isolates varied for each bcc species we examined. this finding may reflect the few clinical or environmental isolates for that species or high genetic diversity ; a larger sample size is needed to find identical matches. species dominated by clinical sts (> 83% of sts) were b. multivorans, b. cenocepacia reca lineage iiia, and b. dolosa. those species containing mainly environmental sts (> 80%) were b. ambifaria, b. anthina, and b. pyrrocinia (figure). although this distribution agrees with findings of previous studies (2), it also reflects the distribution of isolates within the collections from which isolates were obtained. proportion of sequence types (sts) within each burkholderia cepacia complex (bcc) species from clinical, environmental, or both sources. the bar chart shows the proportion of sts derived from the environment (white), clinical (gray), and both sources (black shading). mlst st-10 was shared by b. cepacia j1050, a human isolate cultured in the united states (cleveland, ohio) and the type strain for b. cepacia atcc 25416, isolated from an onion. this evidence of clonality augments the clonal relationship reported earlier (9) between atcc 25416 and a uk isolate from a cf patient. the b. multivorans ist455 isolated from a cf patient s sputum in portugal, as reported in a previous study (13) had the same sequence type (st-375) as r-20526, which was isolated from the river schelde in belgium. b. cenocepacia reca lineage iiia isolates with st-32 (table) were from 4 independent sources : popr8 (isolated from a radish in mexico), bcc1118 (isolated from a uk non - cf patient infection), r-16597 (isolated from a cf patient in belgium), and 5457 (isolated from a cf patient in the czech republic). st-32 appears to be a globally distributed, predominantly clinical strain (a. baldwin, unpub. the b. cenocepacia reca lineage iiib isolates identified as st-122 (table) include the phdc strains, predominant in us cf patients (au1054) and previously found in us soil (hi-2424) (10), and cep0497, which was obtained from a leg wound in a non - cf patient in canada. together with a recent report of phdc strains identified in europe (14), the canadian isolate in our study adds further weight to the identification of this st as a globally distributed strain. mlst analysis of b. stabilis corroborated the high degree of clonality observed by pfge fingerprint analysis in the original description of this species (15). however, mlst was further able to distinguish 8 sts among the 26 isolates examined, which indicates that mlst may be a more effective method than pfge for epidemiologic analysis of b. stabilis. this increased resolution adds to the observation that 2 b. stabilis sts are globally distributed and isolated from clinical samples and an array of different niches, including domestic products, medical solutions, industrial process contaminants, and hospital devices. in summary, > 20% of the clinical isolates we examined were indistinguishable by mlst from isolates from environmental sources. this finding suggests that conservation of intrinsic determinants necessary to thrive in environmental niches may confer an ability to colonize susceptible humans. further work is urgently required to more extensively investigate the emergence of pathogenic members of the bcc in the natural environment and the risk for infection this may represent. | members of the burkholderia cepacia complex (bcc), found in many environments, are associated with clinical infections. examining diverse species and strains from different environments with multilocus sequence typing, we identified > 20% of 381 clinical isolates as indistinguishable from those in the environment. this finding links the natural environment with the emergence of many bcc infections. |
metformin is a first - line drug choice for the treatment of type 2 diabetes mellitus (dm-2). we report on a case of metformin - induced mixed hepatocellular and cholestatic liver injury in an elderly patient with dm-2 as well as review and summarize case reports of metformin hepatotoxicity available in english on the pubmed database. after receiving metformin 850 mg / day for 2 weeks, a 78-year - old male presented with a 10-day history of abdominal pain, vomiting, diarrhea, and jaundice. discontinuation of metformin treatment led to significant subjective improvement after 1 week, and all hepatic abnormalities resolved by 2 months. metformin is an important drug for the treatment of dm-2, which is also used for treatment of patients with fatty liver. it can, however, induce hepatocellular and cholestatic hepatic injury ; both physicians and patients should be aware of this potential side effect. metformin is the current biguanide of choice for the treatment of type 2 diabetes mellitus (dm-2).1 studies have shown that metformin ameliorates hyperglycemia without stimulating insulin secretion, weight gain, or hypoglycemia.2 a large - scale study found that metformin reduced all - cause mortality in obese patients with dm-2.3 metformin has a multifactorial mechanism of action, but acts primarily by improving insulin sensitivity, with a concomitant decrease in hepatic glucose production and an increase in glucose transport across the skeletal muscle membrane.4,5 despite its clinical efficacy, metformin has been associated with several adverse effects. these are primarily gastrointestinal in nature (diarrhea, nausea, vomiting, bloating, and flatulence), and with long - term use, reductions in serum folic acid and vitamin b12 levels have been reported.4 because of its interference with mitochondrial oxidative processes, its most significant, although rare, side effect is lactic acidosis in the context of significantly chronically decreased renal function.6 other oral antidiabetic agents, such as acarbose,7 gliclazide,8 and some of the thiazolidinediones (mainly troglitazone), have been implicated in liver toxicity.9 in the case of metformin, hepatotoxicity has been only rarely reported.10,11 we report a case of acute hepatocellular and cholestatic jaundice due to metformin therapy and review the literature. a 78-year - old jewish male patient was hospitalized in our department with a 10-day history of fatigue, nausea, vomiting, diarrhea, anorexia, and abdominal pain. dm-2 had been recently diagnosed and metformin 850 mg / day had been initiated 2 weeks before presentation to the hospital. the patient reported no alcohol use, smoking, previous liver disease, family history of liver diseases, blood transfusion, exposure to toxins, or cholelithiasis. one month before initiation of metformin treatment, the patient had been given a 13-day amoxicillin - clavulanate (augmentin) treatment for acute parotitis. his past medical history was significant for hypertension, gout, hyperlipidemia, and diverticulosis. his other medications included aspirin (75 mg / day), pravastatin (20 mg / day), amlodipine (5 mg / day), atenolol (100 mg / day), candesartan (16 mg / day), and hydrochlorothiazide (12.5 mg / day). on physical examination, his weight was 82 kg, his height 172 cm, and his body mass index 27.7 kg / m. results of serologic tests were negative for the following : hepatitis b surface antigen ; anti - hepatitis b core immunoglobolin m (igm) ; anti - hepatitis a virus igm ; anti - hepatitis c virus antibody ; anti - cytomegalovirus igm ; anti - epstein barr virus igm ; anti - nuclear antibodies ; anti - smooth - muscle antibodies ; anti - mitochondrial antibodies ; and anti - neutrophil cytoplasmic antibodies. c - reactive protein level was 9.97 mg / l (normal range : 05 mg / l). complete blood count was normal. an ultrasound and a computerized tomography (ct) scan of the abdomen revealed no abnormalities. on admission, metformin and pravastatin were discontinued immediately. after 1 week, the patient described significant subjective improvement and the level of bilirubin, alanine transaminase (alt), aspartate aminotransferase (ast), alkaline phosphatase (alkp), and -glutamyl transpeptidase (ggt) began to decline gradually. after 9 days of hospitalization, the patient s laboratory results were as follows : total bilirubin, 16.9 mg / dl ; direct bilirubin, 12.4 mg / dl ; alt, 308 u / l ; ast, 77 u / l ; alkp, 809 u / l ; and ggt, 876 u / l. thereafter, pravastatin therapy was readministered, and no changes in bilirubin, alt, ast, alkp, or ggt levels were observed. this case report is a useful addition to the short list of literature describing metformin hepatotoxicity available so far. dealing with a particular patient with diabetes and polypharmacy makes decisions regarding medication termination difficult. the patient was taking other medications, including pravastatin, for at least 1 year prior to the hepatotoxicity, without adverse sequelae. furthermore, pravastatin was readministered following resolution of the hepatic abnormalities, without any changes in bilirubin or liver enzyme concentration. the patient s other medications included aspirin (75 mg / day), amlodipine (5 mg / day), atenolol (100 mg / day), candesartan (16 mg / day), and hydrochlorothiazide (12.5 mg / d). in addition, liver enzymes and bilirubin returned to normal values after metformin was stopped and despite continuation of the other medications. however, exposure to amoxicillin - clavulanate had occurred 1 month prior to the patient presenting at our hospital. amoxicillin - clavulanate - associated liver injury has been extensively reported in the literature.1214 a recent report from england assessed the incidence of amoxicillin - clavulanate - induced liver injury at 9.91 cases to 100,000 prescriptions.14 in another report, from spain, a mixed cholestatic - hepatocellular pattern of liver injury was associated with older age ; the mean time lapse between therapy initiation and jaundice onset was 16 days.13 in an attempt to determine the likely cause for acute liver injury in this case ie, metformin or amoxicillin - clavulanate we used the maria and victorino scale.14 this clinical scale is based on (1) the temporal relationship between treatment initiation and the onset of the clinical picture ; (2) the exclusion of alternative causes for liver injury ; (3) extrahepatic manifestations ; (4) re - challenging of outcomes ; and (5) previous reported cases in the literature. in the present case, amoxicillin - clavulanate scored only 8 points (unlikely), while metformin scored 12 points (possible), thus implicating metformin as the cause for liver injury rather than amoxicillin - clavulanate. moreover, using the naranjo adverse drug reaction probability scale which consists of ten questions that are answered with either yes, no, or do not know, with different point values (1, 0, + 1, or + 2) assigned to each answer the probability that the symptoms of hepatotoxicity were an adverse drug reaction of metformin was 5 (probable).15 therefore, metformin was considered to be the offending medication. re - challenge was not performed, as it was considered to be inappropriate. because metformin is not metabolized in the liver, it has been considered safe from a hepatic standpoint;16 however, metformin hepatotoxicity has rarely been reported. possible mechanisms of injury are direct, idiosyncratic, or a drug drug interaction11 leading to acute hepatocellular and/or cholestatic jaundice. we searched the pubmed database for english - language publications on metformin hepatotoxicity and found six reports (table 2) : two cases of acute hepatitis,6,19 two cases of cholestasis,11,17 and two cases of mixed - type (hepatocellular and cholestatic) injury.10,18 in all cases, as in our case report, after discontinuation of metformin therapy, the patients signs and symptoms resolved and the liver enzymes normalized, except for a persistently increased level of alkaline phosphatase in one case,17 which was considered likely related to a prolonged cholestatic effect of metformin. liver biopsy was performed in three cases, and re - challenge in one case.6,10,11,17 the patient we have described represents the third case report in the literature of mixed hepatocellular and cholestatic liver injury. discontinuation of metformin treatment led to complete resolution of the patient s signs and symptoms as well as normalization of liver enzymes and bilirubin after 2 months. metformin can induce hepatic injury (hepatocellular and/or cholestatic), and both physicians and patients should be aware of this potential side effect. | introductionmetformin is a first - line drug choice for the treatment of type 2 diabetes mellitus (dm-2). metformin - induced hepatotoxicity has rarely been reported. we report on a case of metformin - induced mixed hepatocellular and cholestatic liver injury in an elderly patient with dm-2 as well as review and summarize case reports of metformin hepatotoxicity available in english on the pubmed database.caseafter receiving metformin 850 mg / day for 2 weeks, a 78-year - old male presented with a 10-day history of abdominal pain, vomiting, diarrhea, and jaundice. laboratory analysis showed severe hepatocellular and cholestatic hepatic injury. other causes for acute liver injury were ruled out. discontinuation of metformin treatment led to significant subjective improvement after 1 week, and all hepatic abnormalities resolved by 2 months.conclusionmetformin is an important drug for the treatment of dm-2, which is also used for treatment of patients with fatty liver. it can, however, induce hepatocellular and cholestatic hepatic injury ; both physicians and patients should be aware of this potential side effect. |
both pediatricians and parents agree that anticipatory guidance is an important component of the well - child visit. however, parents report unmet expectations related to parenting advice, education, or screening during their child 's health supervision visit. few available studies suggest that there may be large variations in the delivery of anticipatory guidance, depending on the population and clinical setting [1, 2 ]. paradis. found that parents receiving a video intervention rated higher confidence with specific infant care skills and reported feeling better prepared to care for their baby, compared to parents receiving only handouts. first - time parents have many questions about the care of their newborns and most of them are not addressed during the standard follow - up visit at two days or two weeks of age. these concerns bring them into the physician 's office or the emergency department (ed) for unnecessary visits that could have been resolved at home. utilization of the ed for nonurgent conditions (nucs) has long been recognized to be problematic because of cost and lack of continuity of routine care. it has been estimated that about 20 million children in the us are annually brought to the ed for medical care and that up to half of those visits are for nucs. ed visits for nucs occur especially frequently in the immediate postnatal period and early infancy [5, 6 ]. in the literature, management of nucs in the ed can be considered when a nonurgent triage code was assigned at the time of presentation, no laboratory or radiologic investigations were performed, no physician referral occurred, and the final disposition was to discharge the child home [6, 7 ]. newborns obviously represent a unique group of pediatric patients as the increased risk of serious bacterial infection is paired with often only subtle signs of illness naturally leading to heightened parents ' anxiety. indeed, one study showed that more than a third of neonates who returned to the ed within 5 days after being discharged with nuc required subsequent hospitalization. however, there might be an additional burden of newer parents with limited parenting experience or knowledge of their infants ' primary pediatric medical home. as this help seeking behavior characterized by unnecessary ed use during the newborn period may be the onset of a pattern of future frequent ed use, we asked whether it could be influenced through a focused educational intervention. specifically, we aimed to evaluate the impact of an intensified nursery - based anticipatory guidance program on ed use for newborns with nuc. eligible for participation were english- and spanish - speaking parturient mothers (aged 18 years) of healthy full - term newborns (36 weeks of gestational age) who received care during the study period at the neonatal service of the bronx - lebanon hospital center. inability to converse in either english or spanish and existing hearing / vision impairments were exclusion criteria. a trained research assistant and the coinvestigators enrolled participants between december 1, 2011, and march 31, 2012. parturient mothers were approached at the neonatal service on the day of discharge and the ones who agreed to participate in the study were asked to sign an informed consent. the participants were randomly assigned to a control arm receiving a routine anticipatory guidance program or to an intervention arm receiving an intensified anticipatory guidance program. assignment to respective study arms was determined by month of birth. during months # 1 and # 3 of the study participant mothers were assigned to the intervention arm, while during months # 2 and # 4 of the study they were assigned to the control arm. the routine anticipatory guidance program consisted of the already established educational materials (handout and videos) on breastfeeding, reducing the risk of sudden infant death syndrome (from the safe to sleep campaign), and prevention of shaken baby syndrome (from the portrait of promise : preventing shaken baby syndrome). the intensified anticipatory guidance program included in addition to the routine anticipatory guidance program a 30-minute video entitled newborn care : a guide to the first six weeks with detailed information based on the latest american academy of pediatric safety guidelines on newborns ' nuc (e.g., jaundice, well - baby visits, taking temperature, and when to call the doctor). this video was shown to the participants on the day of discharge by the coinvestigators and/or the research assistant in the nursery. our primary outcome was to determine the proportion of neonates with at least one nonurgent ed visit during the first month of life. nonurgent ed use was assessed at 1-month follow - up and by reviewing newborns ' electronic medical record. a nonacute ed visit was defined as follows : the infant presented for an acute health concern but a nonurgent triage code at the time of presentation was assigned by the triage nurse, no laboratory or radiologic investigations were performed, and the infant was subsequently discharged home with no physician referral [6, 7 ]. knowledge on nonurgent conditions was surveyed using a self - administered, anonymous questionnaire at baseline (before receiving the respective anticipatory guidance program) and at 1-month follow - up (phone interview). after reviewing the 30-minute video, a questionnaire (11 questions) was drawn up to assess maternal knowledge on nonurgent conditions in newborns at baseline and at 1-month follow - up as follows.during feeding, baby should be burped : (a) never, (b) if breastfed, after changing breast, (c) if formula fed, after 2 - 3 ounces of formula, (d) (b) and (c), (e) i do n't knowwhere is the best place to take the temperature in a newborn baby ? (a) under arm, (b) mouth, (c) buttocks, (d) i do n't knowa newborn baby has fever when the temperature is above : (a) 98.5 f, (b) 99.4 f, (c) 100.4 f, (d) i do n't knowthis question is to assess your knowledge regarding normal range of stool frequency in newborns : 1 soft stool after 3 days to multiple soft stools in one day : (a) true, (b) false, (c) i do n't knowthis question is to assess your knowledge regarding normal range of wet diapers in newborns : 58 wet diapers in one day : (a) true, (b) false, (c) i do n't knowhow should your baby sleep ? (a) sideways, (b) on back, (c) on belly, (c) i do n't knowwhere do you think your baby should be sleeping ? (a) mother 's lap, (b) mother 's bed, (c) in his own crib / playpen / bassinet, (d) i do n't knowwhen should you call the doctor or take the baby to the emergency room ? (a) constant / distressed crying, (b) vomiting / choking, not feeding well, (c) tightness or shaking or hands or legs, (d) breathing fast for long time, turning blue, (e) all of the abovewhich of these is normal for babies ? (a) sneezing, hiccups, (b) spit up after feeding or during burping, (c) irregular breathing with no change in skin color, (d) startle on loud noise or stimulation, (e) all of the abovewhich of these are normal for a newborn baby ? (a) a bluish green or gray birthmark on the lower back or buttocks, (b) a newborn rash or red splotches on skin, (c) tiny white bumps on the face, (d) soft spot on the head, (e) all of the abovewhat are the common reasons for crying of normal newborn babies ? (a) wet diaper, (b) hungry, (c) in pain, (d) feeling lonely or tired, (e) all of the above.a composite score (011) based on the correct answers on the knowledge questions was calculated. the questionnaire was pretested for clarity and timing in the first 2 weeks of the study period. during feeding, baby should be burped : (a) never, (b) if breastfed, after changing breast, (c) if formula fed, after 2 - 3 ounces of formula, (d) (b) and (c), (e) i do n't know where is the best place to take the temperature in a newborn baby ? (a) under arm, (b) mouth, (c) buttocks, (d) i do n't know a newborn baby has fever when the temperature is above : (a) 98.5 f, (b) 99.4 f, (c) 100.4 f, (d) i do n't know this question is to assess your knowledge regarding normal range of stool frequency in newborns : 1 soft stool after 3 days to multiple soft stools in one day : (a) true, (b) false, (c) i do n't know this question is to assess your knowledge regarding normal range of wet diapers in newborns : 58 wet diapers in one day : (a) true, (b) false, (c) i do n't know how should your baby sleep ? (a) sideways, (b) on back, (c) on belly, (c) i do n't know where do you think your baby should be sleeping ? (a) mother 's lap, (b) mother 's bed, (c) in his own crib / playpen / bassinet, (d) i do n't know when should you call the doctor or take the baby to the emergency room ? (a) constant / distressed crying, (b) vomiting / choking, not feeding well, (c) tightness or shaking or hands or legs, (d) breathing fast for long time, turning blue, (e) all of the above which of these is normal for babies ? (a) sneezing, hiccups, (b) spit up after feeding or during burping, (c) irregular breathing with no change in skin color, (d) startle on loud noise or stimulation, (e) all of the above which of these are normal for a newborn baby ? (a) a bluish green or gray birthmark on the lower back or buttocks, (b) a newborn rash or red splotches on skin, (c) tiny white bumps on the face, (d) soft spot on the head, (e) all of the above what are the common reasons for crying of normal newborn babies ? (a) wet diaper, (b) hungry, (c) in pain, (d) feeling lonely or tired, (e) all of the above. proportion of newborns who presented for nonurgent ed use at least once during the first month of life in the two trial arms were compared using fisher 's exact test. the difference in within subject nonurgent conditions knowledge score change from baseline to follow - up between the two study groups was assessed using a paired t - test. analyses were based on subjects with complete data on both assessments and on intention to treat with zero score change imputed to subjects absent for the follow - up assessment. we powered our trial for analysis on the primary outcome, nonurgent ed visit. with an anticipated event rate of 20% in the control group, we randomized at least 150 subjects (allowing for a 10% rate of loss to follow - up) to each trial arm to have 95% power with p < 0.05, two - sided, to detect a 15% difference between the two arms in the proportions of newborns making at least one nonurgent ed visit [13, 14 ]. of a total of 594 parturient mothers during the study period, 323 (54%) consented to participate in the study and were randomized to the control (n = 153) or the intervention (n = 170) group (figure 1). the overall mean age was 26.5 years ; most were single (61%), of hispanic ethnicity (68%), and with an incomplete high school education (44%). a third (35%) there were no significant differences between groups regarding age, race / ethnicity, education, marital status, and number of children. 44% (n = 74) and 40% (n = 61) of the participants were unable to be contacted for the 1-month follow - up survey from the intervention group and the control group, respectively. overall, a quarter (76/323, 24%) of the subjects ' newborns had at least one nonurgent ed visit reported during the first month of life. while such visits were reported in only 35/170 (21%) infants of the intervention group compared to 41/153 (27%) infants of the control group, this difference was not statistically significant (p = 0.12). subgroup analysis (marital status, level of education, maternal age, ethnicity, and number of children) also did not reveal any statistically significant difference in reported nonurgent ed visits between intervention and control group (data not shown). there was no significant difference in mean baseline scores between groups (control group : 7.0, sd 2.2 ; intervention group : 6.9, sd 2.4 ; p = 0.59). likewise, the mean scores at the 1-month follow - up survey were comparable (control group : 8.5, sd 1.9 ; intervention group : 8.0, sd 2.2 ; p = 0.11). further, there was no statistically significant difference in within subject change scores between the two study arms (p = 0.52 and p = 0.80 for subjects with complete data and intention to treat analysis, resp.). first and foremost this study documents that about a quarter of newborns in the bronx are brought to the ed for nuc within the first month of life. further, we showed that providing parturient mothers in the nursery with intensified anticipatory guidance about such nuc in neonates did not lead to a significant reduction of the rate of nonurgent ed use among the subjects ' newborns, nor to superior knowledge gain regarding nonurgent conditions compared to mothers in the control group. nationally, ed use overall has continued to rise, with children and especially infants being brought there by caretakers for concern about nuc. a study conducted in cincinnati, ohio, more than 10 years ago described that about 20% of infants had an ed visit for a nuc in the first 3 months of life. our apparent higher rate of this help seeking behavior may be explained by the fact that our institution serves almost exclusively an indigent minority population with poor educational attainment while about half of the subjects in the study from cincinnati were white. indeed, non - white race of the mother apart from younger maternal age and medicaid insurance were identified as significant risk factors associated with ed visits for nuc in the study from cincinnati. subgroup analysis in our study failed to find any relevant associations. with low caregiver health literacy found to be an independent predictor for higher ed use overall and for use of ed for nuc, interventions targeting health literacy skills in parents have been of great interest [1620 ]. preventive pediatric care guidelines by the american academy of pediatrics prescribe the discussion of many topics to be covered at each office visit to provide parent with anticipatory guidance. anticipatory guidance is a developmentally based counseling technique that focuses on the needs of a child at each stage of life. these needs are discussed during well - child care visits to increase parental satisfaction and help them to become a more effective caregiver [1, 2 ]. barriers to delivering better anticipatory guidance include limited time and lack of confidence in counseling techniques. however, a recent trial of newborn anticipatory guidance delivered by a dvd during the infant 's first visit to the pediatrician 's office demonstrated increased parental confidence in specific infant care items that were emphasized in the video and most importantly succeeded in reducing additional health care utilization. we were unable to demonstrate a similar benefit with our video - enhanced anticipatory guidance program on nuc in the nursery. this may be because our study cohort in the south bronx consisted predominantly of single women who were of hispanic ethnicity. both characteristics have been previously identified as leading predictors for seeking care for nuc with children in the ed. other explanations for lack of impact may be that the added information about nuc was brief, presented only once, and competed with other preventive health messages to be discussed in the nursery (e.g., breastfeeding, sids prevention, and shaken baby syndrome) therefore limiting likelihood of parental recall [20, 22 ]. indeed, discussing more than 8 anticipatory guidance topics during a pediatric health maintenance visit has not been found to be helpful. first, our study may have been underpowered to detect smaller differences in ed use and gained knowledge due to a high attrition rate in both study groups. second, the intensified anticipatory guidance program that we used in the nursery may not suffice and/or may not be at the right time to improve parental nonurgent conditions knowledge and reduce nonurgent ed visits. further, during the phone follow - ups, mothers might not remember well or answer truthfully about ed visits of their newborns. a significant proportion of healthy newborns in the south bronx are brought to the ed for a nuc during the first month of life. incorporating an intensified anticipatory guidance program in the nursery did not have a significant impact on reducing the rate of such ed visits for nucs nor did it result in an improved gain of nuc - relevant knowledge in parturient mothers. it is possible that the video - enhanced educational program we used in the nursery may not suffice and/or may not be at the right time to improve parental knowledge on nuc and reduce ed use for nuc in our patient population. introduction of nuc - related topics to future parents using alternative educational modalities (e.g., parenting class) or alternative timing (e.g., pediatric prenatal visit) may be potentially more promising strategies in urban, low - income communities to effect reduced ed use. | objective. we aimed to evaluate the impact of an intensified anticipatory guidance program in the nursery on emergency department (ed) use for nonurgent conditions (nucs) in the neonatal period. methods. parturient mothers of healthy newborns were randomized to an intervention group or control group. baseline and 1-month follow - up knowledge surveys regarding newborn care were conducted. the primary outcome was the proportion of neonates who used the ed for a nuc. secondary outcome was change in caregivers ' knowledge on nuc. results. of a total of 594 mothers, 323 (54%) agreed to participate and were randomized to intervention (n = 170) or control (n = 153) group. most were hispanic (68%), single (61%), primiparous (39%), and without high school diploma (44%). 35 (21%) neonates in the intervention group and 41 (27%) in the control group were brought at least once for a nuc to the ed (p = 0.12). there was no statistically significant difference in within subject change on knowledge scores between the two study arms. conclusions. neonatal ed visits for nucs occur frequently. this nursery - based intensified anticipatory guidance program had no statistically significant impact on neonatal ed use for nuc, nor on neonatal care - relevant knowledge among parturient mothers. alternative modalities and timing of parental educational intervention may need to be considered. this trial is registered with clinical trials number nct01859065 (clinicaltrials.gov). |
owing to recent advances in transplant immunology and surgical improvements, heart transplantation appears to be a prevailing alternative for end - stage heart disorders. however, they become significantly less common during the late follow - up period after heart transplantation. while macro - reentrant atrial tachyarrhythmia arises from surgical anastomosis lines, focal the most common arrhythmias encountered after heart transplantation are ventricular or atrial premature complexes, sinus or junctional bradycardia, atrial fibrillation, and atrial flutter, which have varying clinical significance, depending on associated or causative conditions. allograft rejection, transplant coronary artery disease, altered anatomy, or autonomic nervous system changes have been suggested to be responsible for posttransplant arrhythmia. atrial electromechanical coupling (pa) and atrial electromechanical delay (aemd) measured by doppler tissue imaging (dti) were found to be significantly longer in patients with paroxysmal atrial fibrillation (af),,. aemd has also been demonstrated to be longer in many diseases that affect heart tissue,,,,,,. to date, dti has not been used in patients undergoing heart transplantation for the detection of atrial conduction abnormalities and electromechanical coupling. the aim of our study was to investigate pa noninvasively in patients who underwent heart transplantation. a total of 32 patients who had undergone biatrial anastomosis heart transplantation and were operated between january 2005 and december 2014 at kartal kosuyolu high specialty training and research hospital (24 men, 8 women ; mean age : 4211 years) and 30 healthy volunteers (20 men, 10 women ; mean age : 3613 years) were included in the study. echocardiographic and biochemical data were collected at least six months after the surgery in the study group. patients with moderate to severe left ventricular (lv) wall motion abnormality, moderate to severe vasculopathy and rejection, lv ejection fraction (lvef) less than 50%, bundle branch block, atrioventricular conduction abnormalities on electrocardiogram (ecg), and patients with moderate to severe atrial conduction delay (first - degree av block in ecg), pericarditis, thyroid dysfunction, anaemia, hypercholesterolaemia, electrolyte imbalance, renal failure, pulmonary disease, moderate to severe valvular dysfunction, or echocardiographic images that were technically insufficient were excluded from the study. the patients who had electrocardiographically documented af episodes or who were cardioverted to sinus rhythm pharmacologically and/or electrically, and patients who were taking antihypertensive drugs causing prolongation in pr duration (such as beta blocking agents, verapamil, or diltiazem) were also excluded. we did not perform a pharmacological denervation to avoid the influence of the autonomic nerve system. all of the patients were in sinus rhythm and none was taking medications such as antiarrhythmics, tricyclic antidepressants, antihistaminics, or antipsychotics. the demographic and baseline characteristics of patients in the study and control groups are provided in table 1. in all subjects, two - dimensional, pulsed wave doppler, colour flow doppler, m - mode echocardiographic examinations (vivid 7 pro, ge, horten, norway, 24 mhz phased array transducer) were performed by a cardiologist who was blinded to the clinical details and results of the study. during echocardiography, a one - lead surface ecg (d iii) was recorded continuously. four consecutive cycles were averaged for every parameter. left atrial dimension lv end - systolic dimension, lv end - diastolic dimension, lvef, interventricular septal thickness, and posterior wall thickness were measured. dti was performed by transducer frequencies of 3.54.0 mhz, adjusting the spectral pulsed doppler signal filters until a nyquist limit of 1520 cm / s was reached while using the minimal optimal gain. the monitor sweep speed was set at 50100 mm / s to optimise the spectral display of myocardial velocities. in apical four - chamber view, the pulsed doppler sample volume was accordingly set at the level of lv lateral mitral annulus, septal mitral annulus, and right ventricular tricuspid annulus. the sampling window was positioned as parallel as possible to the myocardial segment of interest to provide the optimal angle of imaging. the time interval (in milliseconds) from the onset of the p wave on the surface electrocardiogram to the beginning of the late diastolic wave (am wave), which is called atrial electromechanical coupling, was obtained from the lateral mitral annulus, septal mitral annulus, and right ventricular tricuspid annulus and named as pa lateral, pa septum, and pa tricuspid, respectively (fig. these values were corrected for heart rate by dividing by the square root of the r the difference between pa lateral and pa tricuspid, i.e., pa lateral pa tricuspid, was defined as the inter - aemd. the difference between pa septum and pa tricuspid, i.e., pa septum pa tricuspid, was defined as right intra - aemd. the difference between pa lateral and pa septum, i.e., pa lateral pa septum, was defined as left intra - aemd. in aemd measurements, intraobserver variability was assessed in 10 subjects selected at random from the study group by repeating the measurements under the same conditions. interobserver variability was tested by a second observer while the measurements were performed offline from video recordings. the intraobserver and interobserver variability for dti calculated from 10 consecutive patients was 4.2% and 4.7% for pa lateral, 4.9% and 4.1% for pa septum, and 5.9% and 4.8% for pa tricuspid, respectively. a total of 32 patients who had undergone biatrial anastomosis heart transplantation and were operated between january 2005 and december 2014 at kartal kosuyolu high specialty training and research hospital (24 men, 8 women ; mean age : 4211 years) and 30 healthy volunteers (20 men, 10 women ; mean age : 3613 years) were included in the study. echocardiographic and biochemical data were collected at least six months after the surgery in the study group. patients with moderate to severe left ventricular (lv) wall motion abnormality, moderate to severe vasculopathy and rejection, lv ejection fraction (lvef) less than 50%, bundle branch block, atrioventricular conduction abnormalities on electrocardiogram (ecg), and patients with moderate to severe atrial conduction delay (first - degree av block in ecg), pericarditis, thyroid dysfunction, anaemia, hypercholesterolaemia, electrolyte imbalance, renal failure, pulmonary disease, moderate to severe valvular dysfunction, or echocardiographic images that were technically insufficient were excluded from the study. the patients who had electrocardiographically documented af episodes or who were cardioverted to sinus rhythm pharmacologically and/or electrically, and patients who were taking antihypertensive drugs causing prolongation in pr duration (such as beta blocking agents, verapamil, or diltiazem) were also excluded. we did not perform a pharmacological denervation to avoid the influence of the autonomic nerve system. all of the patients were in sinus rhythm and none was taking medications such as antiarrhythmics, tricyclic antidepressants, antihistaminics, or antipsychotics. the demographic and baseline characteristics of patients in the study and control groups are provided in table 1. in all subjects, two - dimensional, pulsed wave doppler, colour flow doppler, m - mode echocardiographic examinations (vivid 7 pro, ge, horten, norway, 24 mhz phased array transducer) were performed by a cardiologist who was blinded to the clinical details and results of the study. during echocardiography, a one - lead surface ecg (d iii) was recorded continuously. four consecutive cycles were averaged for every parameter. left atrial dimension lv end - systolic dimension, lv end - diastolic dimension, lvef, interventricular septal thickness, and posterior wall thickness were measured. dti was performed by transducer frequencies of 3.54.0 mhz, adjusting the spectral pulsed doppler signal filters until a nyquist limit of 1520 cm / s was reached while using the minimal optimal gain. the monitor sweep speed was set at 50100 mm / s to optimise the spectral display of myocardial velocities. in apical four - chamber view, the pulsed doppler sample volume was accordingly set at the level of lv lateral mitral annulus, septal mitral annulus, and right ventricular tricuspid annulus. the sampling window was positioned as parallel as possible to the myocardial segment of interest to provide the optimal angle of imaging. the time interval (in milliseconds) from the onset of the p wave on the surface electrocardiogram to the beginning of the late diastolic wave (am wave), which is called atrial electromechanical coupling, was obtained from the lateral mitral annulus, septal mitral annulus, and right ventricular tricuspid annulus and named as pa lateral, pa septum, and pa tricuspid, respectively (fig. these values were corrected for heart rate by dividing by the square root of the r the difference between pa lateral and pa tricuspid, i.e., pa lateral pa tricuspid, was defined as the inter - aemd. the difference between pa septum and pa tricuspid, i.e., pa septum pa tricuspid, was defined as right intra - aemd. the difference between pa lateral and pa septum, i.e., pa lateral pa septum, was defined as left intra - aemd. in aemd measurements, intraobserver variability was assessed in 10 subjects selected at random from the study group by repeating the measurements under the same conditions. interobserver variability was tested by a second observer while the measurements were performed offline from video recordings. the intraobserver and interobserver variability for dti calculated from 10 consecutive patients was 4.2% and 4.7% for pa lateral, 4.9% and 4.1% for pa septum, and 5.9% and 4.8% for pa tricuspid, respectively.. values between different groups were compared using the independent - samples t - test. the two groups were similar regarding age, sex, systolic blood pressure, diastolic blood pressure, and heart rate (bpm) (table 1). lv end - diastolic dimension, lv end - systolic dimension, posterior wall thickness, and lv ejection fraction (%) were not statistically different between the groups (table 2). left atrial dimension and interventricular septal thickness were higher and deceleration time was lower in patients who underwent heart transplantation than in the control population (table 2). two - dimensional conventional doppler and the pa parameters of different sites measured by dti are shown in table 2. pa lateral (687 vs. 5111 ms, p<0.01), pa septal (505 vs. 428 ms, p<0.01) and pa tricuspid (396 vs. 369 ms, p<0.01) values were higher in patients who underwent heart transplantation than in a control population (table 2). furthermore, inter - aemd, right aemd and left intra - aemd were prolonged in patients who underwent heart transplantation as compared to the control population. inter - aemd (277 vs. 104 ms, p<0.01), left intra - aemd (187 vs. 104 ms, p<0.01), right intra - aemd (135 vs. 53 ms, p<0.01) (fig. prolongation of intra - aemd and inter - aemd and the inhomogeneous propagation of sinus impulses are well - known electrophysiologic characteristics of the atria prone to fibrillation,,,,,,,,,,. fibrosis in the left atrium and left ventricle accounts for the development of lv diastolic dysfunction and af,,,,,,,,,,,,,. increases in intra- and inter - aemd have been identified in patients who are prone to develop af, such as those with mitral stenosis, familial mediterranean fever, type ii diabetes, scleroderma, paroxysmal af, and essential hypertension,,,,. the anisotropy and dispersion of refractory periods resulting from the decrease in electrical connections and deposition of connective tissue between the myocytes may lead to atrial conduction abnormalities, resulting in intra- and inter - aemd that can prepare a convenient substrate for af,,. however, because the number of wavelets at any time depends on the refractory period, mass, and conduction velocity in different parts of the atria, the shortened refractory period and delayed conduction may increase the quantity of daughter wavelets according to the multiple wavelet hypothesis. determined the correlation of aemd with the electrophysiologic (eps) and dti measurements, and evaluated the appropriateness of the usage of dti in patients with clinical arrhythmias. however, erdem. validated the correlation of aemd with tdi and eps measurements in healthy subjects. they suggested that dti measurements of aemd may be used accurately and confidently instead of the eps and were significantly advantageous because of their low cost and non - invasiveness. to our knowledge, there is no prior study of aemd in patients undergoing heart transplantation. in this study, we found that intra- and inter - aemd were higher in patients who underwent heart transplantation than in a control population. all patients included our study were operated on by using the orthotopic biatrial technique. in this technique, the incision that originates from the inferior vena cava is extended to the right atrial appendix. then, the incision is lengthened to the left atrial ceiling in the vicinity of the transverse sinus. the septal suture line is revealed by extending the right atrial incision line towards the septum and septal leaflet of the tricuspid valve, and is connected to the incision in the left atrial wall. in the bicaval technique, the heart is extracted relatively intact and much fewer incisions are applied to the atrial tissue. extensive incision lines applied to atrial tissue may create electrophysiological instability by disturbing action potential propagation velocity and homogeneous distribution, thus creating a tendency to af after using the biatrial technique. owing to more extensive surgery lines, a temporary pacemaker requirement, left bundle branch block, and atrioventricular block were also observed statistically more significantly often compared to bicaval anastomosis,,,. in a study comparing the atrial arrhythmia incidence after both techniques, 31 bicaval and 35 biatrial operated patients were examined and the af incidence were found to be significantly higher in the biatrial group (21 vs. 3 patients, p<0.01). therefore, it can be suggested that bicaval anastomosis may be a better choice for avoiding future arrhythmias in patients undergoing heart transplantation. in our study, inter - aemd, right intra - aemd, and left intra - aemd durations were found to be significantly prolonged in patients who underwent heart transplantation as compared to a control population. it is thought that extensive surgery lines applied to the atrial tissue might create electrophysiologically insulated areas and inhomogeneously delayed conduction of action potential throughout the atrial tissue and might explain the higher incidence of af observed in patients who underwent heart transplantation. inter - aemd and intra - aemd were prolonged in patients who underwent heart transplantation as compared to a control population. this may explain increased atrial fibrillation and other atrial arrhythmia incidences associated with the biatrial anastomosis heart transplantation technique and may contribute to the treatment of af in this special patient group. only patients who had undergone biatrial anastomosis heart transplantation were included in the study, so the results can not be extrapolated to patients who had undergone bicaval surgery. studies comparing these two techniques head to head might be useful to address this limitation. effects of post - transplantation medications on the results can not be fully negated because of the inconvenience of discontinuing immunosuppressive agents. they certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript. | backgroundwe aimed to assess atrial electromechanical delay (aemd) in patients who had undergone heart transplantation.methodsa total of 32 patients who underwent biatrial anastomosis heart transplantation (24 men, 8 women ; mean age : 4211 years) and 30 healthy volunteers (20 men, 10 women ; mean age : 3613 years) were included in the study. atrial electromechanical coupling (pa), intra - aemd, and inter - aemd were measured.resultspa lateral (687 vs. 5111 ms, p<0.01), pa septal (505 vs. 428 ms, p < 0.01) and pa tricuspid (396 vs. 369 ms, p<0.01), inter - aemd (pa lateral pa tricuspid) (277 vs. 104 ms, p<0.01), left intra - aemd (pa lateral pa septal) (187 vs. 104 ms, p<0.01), right intra - aemd (pa septal pa tricuspid) (135 vs. 53 ms, p<0.01) values were higher in patients who underwent heart transplantation than in a control population.conclusioninter-aemd and intra - aemd were prolonged in patients who underwent heart transplantation as compared to a control population. this may explain the increased atrial fibrillation and other atrial arrhythmia incidences associated with the biatrial anastomosis heart transplantation technique and may contribute to the treatment of atrial fibrillation in this special patient group. |
retinal neovascularization (nv) due to retinal ischemia is one of the principal causes of vision impairment in patients with ischemic retinal diseases such as proliferative diabetic retinopathy (pdr), retinal vein occlusion, and retinopathy of prematurity. retinal nv can result in macular edema, vitreous hemorrhage, and tractional retinal detachment, which are the causes of the vision reduction. despite recent progress in pharmacological therapies and surgical techniques, retinal nv is an example of excessive angiogenesis that is characterized by proliferation, migration, and tube formation of the retinal vascular endothelial cells. in this process, the extracellular matrix (ecm) components play a critical role in regulating retinal nv. previous studies have shown that several growth factors, including the vascular endothelial growth factors (vegfs), platelet - derived growth factors, transforming growth factor s, and placenta growth factor, are involved in this process.3, 4, 5, 6 among these factors, the vegfs have been well characterized and are known to play a causal role in retinal nv. although anti - vegf therapies have been shown to inhibit the progression of retinal nv to some degree, it was recently reported that the intravitreal injection of anti - vegf antibodies can cause retinal damage and might promote retinal fibrosis.7, 8, 9 therefore, retinal nv still remains a vision - threatening pathological condition. several laboratories including ours have demonstrated a higher expression of periostin (postn) in the fibrovascular membranes (fvms) of patients with pdr than in those of patients with normal retinas by comprehensive gene and protein expression profiling.10, 11, 12 we have also detected increased levels of postn protein in the vitreous of patients with pdr. postn is a 90-kda matricellular protein belonging to the fasciclin family that interacts not only with other ecms but also with the integrins, such as v3 and v5, as a ligand.14, 15 postn is associated with tissue development and remodeling through these interactions. postn has been reported to promote angiogenesis in an ischemic limb, in the choroid, in cancerous tissues, in keloids, and in cardiac valve degeneration.16, 17, 18, 19, 20 these findings suggest that postn may play a role in the development of pathological retinal nv. the silencing of post - transcriptional genes by rnai is an excellent method of inhibiting gene expressions because of its high selectivity and potency, which are advantages over conventional therapies using antibodies and small molecules. moreover, rnai agents have other advantages due to their easy synthesis and rapid identification and optimization. however, previous investigations have shown that canonical double - stranded small interfering rnas (sirnas) have several problems for their use, including the need of a drug delivery system (dds), low biological stability, off - target gene silencing, and immunostimulatory effects through the activation of toll - like receptor 3 (tlr3).22, 23, 24, 25 we used a novel single - stranded rnai agent that can overcome these obstacles, and we found that the naked single - stranded rnai agent had an inhibitory effect on choroidal fvm formation with good stability, no sequence - independent choroidal neovascularization (cnv) suppression through tlr3, and no serious toxicity. based on these findings, we hypothesized that postn is involved in retinal nv and can be used as a therapeutic target. to test this hypothesis, we investigated the role played by postn in retinal nv using a mouse model of oxygen - induced retinopathy (oir) in vivo and human retinal microvascular endothelial cells (hrecs) in vitro. we also studied the therapeutic effect of the single - stranded rnai agent targeting postn in retinal nv. to determine whether postn is involved in retinal nv, the expression of the mrna of postn in oir retinas was determined by real - time rt - pcr at several time points. the expression of the mrna of postn in the oir retinas was significantly upregulated compared to that in the retinas of control mice and reached a peak on postnatal day 17 (p17) when the retinal nv reaches its peak (p < 0.05, n = 4 ; figure 1a). to confirm the results of real - time rt - pcr, we performed elisa and determined the protein concentration of postn. elisa showed that the level of postn protein in the oir retinas was significantly higher at p17 (2,835.54 750.11 pg postn / mg total protein, p < 0.001 ; n = 4) than that in the control retinas (602.59 52.07 pg postn / mg total protein ; n = 4 ; figure 1b). next, we stained retinal sections and retinal flat - mounts with antibodies to determine the location of the postn in the oir retinas. immunohistochemical analyses of retinal sections showed that postn - positive cells were co - stained with both cd31 and -smooth muscle actin (sma) in the preretinal pathological nvs. in the retinal flat - mounts, postn co - stained with f4/80. in addition, postn co - stained the preretinal pathological nvs with cd206 (figure 1c). these findings indicated that the expression of postn was increased in the vascular endothelial cells, pericytes, and m2 macrophages in the preretinal pathological nv of oir retinas. to investigate whether postn alters the ischemia - induced retinal nv, we quantified the size of the neovascular tufts and avascular areas in the oir retinas of wild - type (wt) mice and postn knockout (ko) mice stained with isolectin b4 at p17. in the oir retinas, the neovascular tufts indicate preretinal pathological nv, whereas the avascular areas represent the physiological revascularization. the size of the neovascular tufts was significantly smaller in the oir retinas of postn ko mice than in wt mice (p < 0.01, n = 6 ; figures 2a and 2b). the mean avascular area was significantly larger in postn ko mice than that in wt mice (p < 0.01, n = 6 ; figures 2a and 2b). these results indicated that postn promotes both preretinal pathological nv and physiological revascularization in oir retinas. to test the functional role of postn in retinal nv, we examined the effect of postn on proliferation, migration, and tube formation of hrecs, which are key steps of angiogenesis. postn promoted the proliferation of hrecs in a dose - dependent manner as determined by bromodeoxyuridine (brdu) incorporation, and the difference of proliferation between the 100 ng / ml postn group and the control group was significant (p < 0.05, n = 6 ; figure 3a). the migration of hrecs examined in boyden chambers was also significantly promoted by postn (p < 0.0001, n = 12 ; figure 3b). furthermore, postn significantly increased the tube formation of hrecs in a dose - dependent manner (p < 0.0001, n = 12 ; figure 3c). these results indicated a causal role of postn in retinal nv. because postn can bind to integrin v3 or v5 as a ligand, and because fak / akt phosphorylation is involved in cell proliferation, migration, and tube formation through integrin v3 or v5, we examined the effect of postn on fak / akt phosphorylation in hrecs. fak - tyr397 and akt - ser473 phosphorylation was increased at 15 min after postn stimulation (figures 4a and s1a). in addition, we observed the integrin - linked kinase 1 (ilk1) phosphorylation, which is a key mediator between ecms and integrins. ilk1 phosphorylation was also increased 15 min after postn stimulation (figure 4a). to confirm that the fak / akt phosphorylation induced by postn was mediated through integrin v3 or v5, we used antibodies against integrin v3 or v5 in hrecs 30 min before the postn stimulation. inhibition of integrin v3 reduced the fak / akt phosphorylation, whereas inhibition of integrin v5 had no influence on the akt phosphorylation (figures 4b and s1b). these results indicated that postn stimulated fak / akt phosphorylation through integrin v3 and ilk1 in hrecs. to confirm that the fak / akt phosphorylation enhanced by postn through integrin v3 is involved in key steps of angiogenesis, we inhibited integrin v3 and akt by the antibody (ab) and the inhibitor (ly294002). the inhibition of integrin v3 and akt significantly suppressed the postn - induced migration (p < 0.0001, n = 12 ; figure 4c) and the tube formation of hrecs (p < 0.01 or 0.0001, n = 4 ; figure 4d). these results demonstrated that postn stimulated akt phosphorylation through integrin v3, which then resulted in the promotion of migration and tube formation of hrecs. a novel single - stranded rnai agent targeting postn (nk0144) was used as described in materials and methods. the difference in the structure of canonical double - stranded sirna (ni0079) and first, we tested the effects of inflammatory cytokines related to pdr on the synthesis of postn by hrecs. interleukin-6 (il-6), il-8, il-13, mcp-1, and vegf were used for stimulation.27, 28 the expression of postn in hrecs was significantly increased in a dose - dependent manner only by il-13 (p < 0.01 or 0.0001, n = 4 ; figure 5b). il-13 was also expressed by cd4-positive cells in oir retinas (figure 5c). hrecs exposed to the other cytokines did not show a significant induction in the expression of postn (data not shown). next, the knockdown effect of nk0144 on the expression of the mrna of postn in hrecs was examined. real - time rt - pcr showed that the expression of postn mrna in hrecs induced by il-13 was significantly decreased following transfection with 10 nm nk0144 (p < 0.01, n = 4 ; figure 5d). transfection with 10 nm of single - stranded scramble rnai agent (nk0000) as a negative control rnai agent had no significant inhibitory effect on the expression of postn mrna. to confirm the results of real - time rt - pcr, we performed elisa to examine whether the protein level of postn was also decreased in the supernatant after transfection with nk0144. elisa showed that the level of postn protein in the supernatant from hrecs transfected with nk0144 was significantly decreased (222.4 14.0 pg / ml, p < 0.01 ; n = 4) compared with that in the control group (554.0 77.9 pg / ml ; n = 4 ; figure 5d). these results indicated that nk0144 can inhibit the expression of postn from vascular endothelial cells induced by il-13. we next investigated whether nk0144 affected the migration and tube formation of hrecs facilitated by il-13. the migration of hrecs induced by 50 ng / ml il-13 was significantly inhibited by 10 nm nk0144 transfection (p < 0.0001, n = 18 ; figure 6a) compared to that with 10 nm nk0000 transfection. the tube formation of hrecs was also significantly reduced by 10 nm nk0144 transfection (p < 0.01, n = 6 ; figure 6b). these results indicated that nk0144 can inhibit the angiogenesis of hrec in vitro. to determine whether nk0144 also inhibits the ischemia - induced retinal nv in vivo, nk0144 was injected intravitreally in oir mice at p12. at p17, the eyes that received an intravitreal injection of 1 l of 10 m nk0144 had smaller preretinal pathological nv area than eyes after 1 l of 10 m nk0000 injections (p < 0.001, n = 4 ; figures 7a and 7b). in addition, the inhibitory effect of nk0144 on preretinal pathological nv was significantly greater than that of the canonical double - stranded sirna (ni0079 ; p < 0.05, n = 4 ; figures 7a and 7b). we further investigated the effect of nk0144 on the size of the avascular area. at p17, there was no significant difference in the avascular area between the nk0000 treatment group and the nk0144 treatment group, whereas the difference between the novel single - stranded rnai agents (nk0000 and nk0144) treatment groups and canonical double - stranded sirnas (ni0000 and ni0079) treatment groups was significant (p < 0.05, n = 4 ; figures 7a and 7b). these results indicated that the single - stranded rnai agent (nk0144) had a greater inhibitory effect on preretinal pathological nv than the canonical double - stranded sirna, whereas the inhibitory effect of nk0144 on physiological revascularization was less than that of canonical double - stranded sirna. the results of this study showed the functional role of postn in the pathogenesis of ischemia - induced retinal nv, and the possible therapeutic effect of a novel single - stranded rnai agent targeting postn in retinal nv. we showed that postn promoted akt phosphorylation through integrin v3, which can promote retinal nv. we also demonstrated that a novel single - stranded rnai agent targeting postn (nk0144) can inhibit retinal nv more than a canonical double - stranded sirna targeting postn (ni0079) both in vivo and in vitro. our studies thus raise the possibility that this single - stranded rnai agent targeting postn can be considered as a potential therapeutic agent for pathological retinal nv. our results demonstrated that postn was expressed in vascular endothelial cells during ischemia - induced preretinal pathological nv. in addition, il-13 stimulation enhanced the expression of postn in the vascular endothelial cells. these results are in line with earlier reports showing that il-13 induced postn production by human microvascular endothelial cells from lung and skin blood vessels. in this study a previous study has shown that th2 cells are one of the cellular components in fvms of pdr patients. we have also reported an increase of the il-13 level in the vitreous of patients with pdr.27, 28 based on these findings, the il-13 produced by cd4-positive th2 cells may be the inducer of postn secreted by the retinal vascular endothelial cells in ischemic retinas. our results showed that postn also co - stained with markers of pericytes and m2 macrophages in ischemic retinas. earlier studies including ours have reported that sma - positive cells can secrete postn.13, 31, 32 in addition, our earlier studies have shown a strong positive correlation between m2 macrophage markers and postn in the vitreous of pdr patients. we have subsequently shown that macrophage polarization toward m2 phenotype by il-13 resulted in the production of postn. thus, sma - positive pericytes and m2 macrophages polarized by il-13 may also produce postn in ischemic retinas. our data demonstrated that genetic ablation of postn resulted in a reduction of both preretinal pathological nv and physiological revascularization. additionally, we observed the promotion effects of postn on the proliferation, migration, and tube formation of retinal vascular endothelial cells and akt phosphorylation through integrin v3. in addition, several reports have shown that postn can promote nv through integrin v3 in ischemic limbs, cancerous cells, and keloid cells.16, 18, 19 furthermore, the expression of integrin v3 on the vascular cells in tissues from patients with pdr has been reported. previous papers including ours also showed the fak / akt phosphorylation through integrin v by postn in endothelial cells and epithelial cells.31, 35 our laboratory has also shown that m2 macrophages enhance preretinal pathological nv in oir retinas. thus, an elevated expression of postn by retinal vascular endothelial cells, pericytes, and m2 macrophages may promote the development of ischemia - induced retinal nv mediated by akt phosphorylation through integrin v3 in both an autocrine and paracrine fashion. although recent studies have shown the attractive and promising aspects of canonical double - stranded sirnas as a new therapy for retinal nv, some hurdles still remain to be overcome before their clinical application. the obstacles are the lack of a safe dds, adverse off - target effects through tlr3 activation, and the lack of stability. we used a novel single - stranded rnai agent that self - anneals into a unique structure containing a canonical double - stranded rna to overcome these obstacles. our results demonstrated that this single - stranded rnai agent targeting postn can significantly inhibit the preretinal pathological nv following an intravitreal injection without any dds. moreover, the inhibitory effect of the single - stranded rnai agent was greater than the canonical double - stranded sirna, whereas treatment with the single - stranded rnai agent led to a significant decrease in the avascular areas in oir retinas compared to treatment with canonical double - stranded sirnas. furthermore, the sequence used for postn knockdown is present in not only human postn but also in mouse, rat, rabbit, and rhesus macaque postn. this indicates that nk0144 can be used for both in vitro and in vivo experiments and would also be suitable for future human clinical trials. previous studies including ours have shown that, compared with canonical double - stranded sirna, the single - stranded rnai agent has a greater effect without target sequence - independent nv suppression through tlr3 activation.17, 38, 39, 40 the mechanisms causing the differences of the effect on ischemia - induced retinal nv between the single - stranded rnai agent and the canonical double - stranded sirna were not completely determined. however, we suggest that these are because the single - stranded rnai agent has better stability against nuclease, no off - target gene silencing, and no immunostimulatory effects through tlr3 activation.17, 38, 39, 40 thus, intravitreal injection of naked single - stranded rnai agent targeting postn may be a safer and a more efficient therapeutic method of inhibiting preretinal pathological nv. although anti - vegf therapy for pdr is now a mainstream therapy to prevent retinal nv, it was recently reported that anti - vegf therapy might be associated with impairment of the function of normal retina and the maintenance of the choriocapillaris. thus, therapies that block vegf to inhibit pathological nv could result in unexpected complications of the normal retina and should be used cautiously. in contrast to vegf, we have reported that postn was barely detectable in the normal retina.10, 13 we also reported that the correlation between the vitreous concentration of postn and vegf was weak in patients with pdr. in addition, previous studies have shown that the binding of vegf with vegf receptor-2 (vegfr2) promoted angiogenesis mainly through the plc/pkc / mapk pathway, whereas the binding of postn with integrin v3 promotes angiogenesis mainly through the fak / akt pathway. this is good evidence of the concept that anti - postn therapy might have independent effect on retinal nv from anti - vegf therapy. together with the results of anti - postn therapy disease - specific pathways involved in the development of retinal nv while minimizing the unfavorable side effects on the normal retina. in conclusion, our results show a causal link between postn and retinal nv, and the effects of a naked, unmodified single - stranded rnai agent targeting postn. although additional preclinical studies on the toxicity, stability, and effect on duration are underway, a postn - targeting rnai agent may be a new therapeutic agent against preretinal pathological nv. all animal experiments were performed following the guidelines of the association for research in vision and ophthalmology (arvo) statement for the use of animals in ophthalmic and vision research. the experimental protocols were approved by the institutional animal care and use committee of kyushu university. wt c57bl/6j mice (clea) and postn ko mice were used for the animal experiments. pcr was used to determine the genotype of the experimental mice as described in detail. briefly, pups were exposed to 75 2% oxygen from p7 to p12 and then returned to room air. total rnas were extracted from homogenized retinas at the selected time points using a magdea rna kit (precision system science) according to the manufacturer s protocol. cdnas were synthesized by reverse transcription with a first strand cdna synthesis kit (roche) following the quantification of the rnas concentration. qrt - pcr was performed and analyzed using a lightcycler 96 pcr system (roche) and a sybr premix ex taq (takara). the primer sequences were as follows : for mouse postn, 5-ctttcgagaaactgccacgag-3 and 5-ccttccatggtctcaaacacg-3 ; for mouse -actin, 5-gatgacccagatcatgtttga-3 and 5-ggagagcatagccctcgtag-3 ; for human postn, 5-tgcccagcagttttgcccat-3 and 5-cgttgctctccaaacctcta-3 ; and for human -actin, 5-atagcacagcctggatagcaacgtac-3 and 5-caccttctacaatgagctgcgtgtg-3. the quality and specificity of the pcr were determined by melting curves, and the relative expression levels by standard curves. total protein was isolated from sonicated retinas using tissue protein extraction reagent with protease inhibitor (t - per ; thermo). the concentrations of postn in the mouse retinas and the supernatants from the cultured hrecs were measured with a mouse postn immunoassay kit (r&d systems) and human postn elisa according to the manufacturer s instructions. eyes enucleated from oir mice were fixed in 4% paraformaldehyde (pfa), embedded in paraffin, and cut at 3-m thickness. after deparaffinization, rehydration, antigen retrieval by citric acid, and blocking with 5% skim milk, the sections were incubated with the primary antibodies overnight at 4c, and the secondary antibodies were added for 1 hr at room temperature., the slides were coverslipped with an aqueous mounting medium (thermo). a fluorescent microscope (bz-9000 ; keyence) the primary antibodies were postn (mab 3548 : 5 g / ml ; r&d systems), cd31 (550274 : 1:50 dilution ; bd biosciences), sma (f3777 : 1:250 dilution ; sigma - aldrich), f4/80 (mca497 : 1:100 dilution ; abd serotec), cd206 (1:100 dilution ; biolegend), il-13 (ab106732 : 1:100 dilution ; abcam), and cd4 (sc-1140 : 1:100 dilution ; santa cruz). the secondary antibodies were alexa fluor 488 and 647 (1:100 dilution ; molecular probes). both preretinal pathological nv and physiological revascularization in the oir retinas were quantified at p17 as described in detail. briefly, after fixation in 4% pfa, the neurosensory retinas were isolated from the eye cups. the retinas were washed with pbs and placed in 50% and 100% methanol for 10 min each at room temperature. the retinas were then blocked by pbs containing 1% bsa and 0.5% triton x-100 for 1 hr at room temperature. this was followed by incubation with fluorescein - labeled isolectin b4 (fl1201 ; 1:200 dilution ; vector laboratories) overnight at 4c. the retinal flat mounts were mounted with mounting medium and were examined with a fluorescent microscope (bz-9000 ; keyence), and each area was quantified with adobe photoshop cs6. hrecs were purchased from applied cell biology research institute and used for the in vitro studies. cells were grown in complete medium of the kit with serum and cultureboost - r (4z0 - 500-r ; cell systems) containing 100 u / ml penicillin and 100 g / ml streptomycin at 37c in 5% co2. cultured hrecs with normal morphology at the fifth to seventh passages were used for these experiments. starved hrecs were seeded in each well of 96-well plates at 1 10 cells and incubated with recombinant postn. after 48 hr, the degree of proliferation was assessed using brdu elisa (roche) according to the manufacturer s instructions. migration of hrecs was determined using a modified boyden chamber containing polycarbonate membranes (transwell, 8-m pore size ; corning) coated with 10 g / ml of collagen for 1 hr at 37c. starved hrecs were seeded into the upper chamber at 2 10 cells / insert in medium containing recombinant postn (r&d systems) or recombinant il-13 (50 ng / ml ; r&d systems). after 16 hr of incubation at 37c, non - migrated cells on the upper surface of the membrane were removed by gentle scraping with cotton swabs, and the migrated cells on the lower surface of the membrane were stained with hoechst 33342 (molecular probes). three photographs were taken of each insert at randomly selected sites with a fluorescence microscope (bz-9000 ; keyence). tube formation assay was performed as described in detail. in brief, starved hrecs were suspended in 96-well plate coated with growth factor - reduced matrigel matrix (bd biosciences) at 2 10 cells. the cells were cultured with recombinant postn or recombinant il-13 (50 ng / ml). after culturing for 24 hr, the cells were photographed with a phase contrast microscope (olympus ck2 ; olympus). after starvation with serum - free medium for 24 hr, the cells were cultured with postn following treatment with control igg, integrin v3 ab, integrin v5 ab, or ly294002 for 30 min. total cell lysates of hrecs were extracted using lysis buffer with protease inhibitor and phosphatase inhibitor (thermo). the extracted cell lysates were added to 4%12% sds - nupage, and the blots were incubated with antibodies against phosphorylated fak (tyr397, 3283 : 1:1,000 dilution ; cell signaling technology), fak (3285 : 1:1,000 dilution ; cell signaling technology), phosphorylated akt (ser473, 4060 : 1:2,000 dilution ; cell signaling technology), akt (4691 : 1:1,000 dilution ; cell signaling technology), or ilk1 (3862 : 1:1,000 dilution ; cell signaling technology). the signals were made visible with supersignal west femto maximum sensitivity substrate (thermo) detection system. differences in lane loading were determined by blotting the membranes with an ab against -actin (4970 : 1:1,000 ; cell signaling technology). the novel single - stranded rnai agent (nk) and the canonical double - stranded sirna (ni) targeting postn that were used were as follows : canonical double - stranded sirna (ni0079), sense 5-gcaccaaaaagaaauacuutt-3, antisense 5-aaguauuucuuuuuggugctt-3 ; canonical double - stranded scramble sirna (ni0000), sense 5-uacuauucgacacgcgaagtt-3, antisense 5-cuucgcgugucgaauaguatt-3 ; novel single - stranded rnai agent (nk0144), 5-agcaccaaaaagaaauacuuuuccccacaccggaaaaguauuucuuuuuggugcuucuucgg-3, novel single - stranded scramble rnai agent (nk0000), 5-auacuauucgacacgcgaaguuccccacaccggaacuucgcgugucgaauaguauucuucgg-3. the sequence for the postn knockdown was designed to target the mrna of both human and mouse postn. the novel single - stranded rnai agent was constructed by incorporating the sense and antisense nucleotides of the canonical double - stranded sirna into the scaffold of a unique rnai platform named nkrna. the nkrnas spontaneously anneal to form a helical structure containing a double - stranded central stem and two loops within a molecule. rnai agents were mixed (10 nm, final concentration) with rna transfection reagent (lipofectamine rnaimax ; invitrogen) according to the manufacturer s protocol. the mixtures for transfection were replaced after 24 hr by medium containing il-13 at a final concentration of 50 ng / ml as the inducer of postn followed by each assay. immediately after returning the pups to room air at p12, they were given an intravitreal injection of 1 l of pbs containing 10 m scramble rnai agent in one eye and rnai agent targeting postn in the other eye. the intravitreal injections were performed 0.5 mm away from the limbus using a 1-ml hamilton syringe (hamilton) and a 33-gauge needle under a surgical microscope. the statistical significance of differences between groups was determined by two - tailed t tests. for comparisons with the control group, s.y. designed the study, and t.n. wrote the initial draft of the manuscript. contributed to analysis and interpretation of data, and assisted in the preparation of the manuscript. all other authors have contributed to data collection and interpretation, and critically reviewed the manuscript. the patent on periostin (wpo patent wo/2013/147140) became public, and in these patents, the names of t.n. | retinal neovascularization (nv) due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. we recently reported that periostin (postn) may play a role in the development of preretinal fibrovascular membranes, but its role in retinal nv has not been determined. the purpose of this study was to examine the expression of postn in the ischemic retinas of a mouse model of oxygen - induced retinal nv. we also studied the function of postn on retinal nv using postn ko mice and human retinal endothelial cells (hrecs) in culture. in addition, we used a novel rnai agent, nk0144, which targets postn to determine its effect on the development of retinal nv. our results showed that the expression of postn was increased in the vascular endothelial cells, pericytes, and m2 macrophages in ischemic retinas. postn promoted the ischemia - induced retinal nv by akt phosphorylation through integrin v3. nk0144 had a greater inhibitory effect than canonical double - stranded sirna on preretinal pathological nv in vivo and in vitro. these findings suggest a causal relationship between postn and retinal nv, and indicate a potential therapeutic role of intravitreal injection of nk0144 for retinal neovascular diseases. |
in previous work, a peptide - based approach was used to identify peptides devoid of lps - binding capacity from lalf residues 3251. two peptides (l-2 and l-20) lost their ability to bind lps and exhibited a differential cytotoxic activity, although a similar cell penetrating capacity was demonstrated for both peptides. we introduced a chemical modification in the primary structure of the peptide l-2 to improve the biological activity and specificity. the chemical modification included the substitution of a natural amino acid residue by an unnatural amino acid (d - configuration) and blocked n - terminal by acylation. this modification led to the development of a second - generation peptide (cigb-552) with increased cytotoxic activity on murine and human tumor cells. although the antitumor effects of the peptides involve an increase in the apoptosis and a negative regulation of cell - cycle progression, little is known regarding this mechanism of action. in this study, two complementary approaches were used : a yeast two - hybrid search for molecules that specifically interact with the peptides and a pull - down technique to validate the interaction. furthermore, the specificity peptide / commd1 complexes were corroborated by related synthetic peptides with a differential cytotoxic activity (l-2, l-20, and cigb-552) in cells expressing endogenous commd1. comm domain containing 1 (commd1), the first commd family member to be identified, is a pleiotropic factor that participates in multiple processes, including copper metabolism, sodium excretion, inflammatory responses, and adaptation to hypoxia [36 ]. a growing body of data suggests that commd1 is associated with a multimeric e3 ubiquitin ligase complex and regulates the stability of proteins such as nf-b subunits, atp7b, and hif-1- [711 ]. in addition to its physiological roles, hif participates in the pathophysiology of several disorders, including cancer, in which enhanced hif activity is associated with tumor growth, neovascularization, local invasion, metastatic disease, and poor clinical outcomes. while under physiological conditions nf-b plays critical roles in inflammatory responses and cellular survival to stress, the activation of nf-b has also a frequent occurrence in cancer. in particular, the ability of nf-b to promote the expression of various antiapoptotic factors is thought to play a major role in the survival of cancer cells. consistent with the notion that commd1 functions in multiple cellular pathways involved in the survival of cancer cells, it has been demonstrated that the decreased commd1 expression in human cancer correlates with a more invasive tumor phenotype. it is reported in this study that cigb-552 increases the levels of the protein commd1 and negatively regulates the anti - apoptotic activity of nf-b. furthermore, cigb-552 induces an imbalance in the antioxidant / prooxidant balance in cancer cells that promotes the peroxidation of proteins and lipids. these findings have relevance for the design of anticancer agents that act by targeting commd1 to inhibit nf-b activity. peptides were synthesized on a solid phase and purified by reverse - phase - high - performance liquid chromatography to > 95% purity on an acetonitrile / h2o - trifluoracetic acid gradient and confirmed by ion - spray mass spectrometry (micromass, manchester, uk). lyophilized peptides were reconstituted in phosphate - buffered saline (pbs) for experiments in vitro. the sequences of peptides used were l-2 : harikptfrrlkwkykgkfw ; l-20 : hyrikptfrrlkwkykgkfa and cigb-552 second - generation peptide ac - harikptfrrlkwkykgkfw where proline and leucine were substituted by d - amino acid ; and n - terminal blocked by acylation. oligonucleotides with the sequences corresponding to peptides l-2 and l-20 were synthesized and cloned in - frame into pgbkt7 yeast two - hybrid vector (table 1). the recombinant clones pgbkt7-l2 and pgbkt7-l20 were verified by dna sequence and subsequently transformed into yeast strain ah109. a matchmaker pretransformed liver cdna library in y187 (clontech) was used to identify the protein interactions of l-2. briefly, 5 10 ah109 cells containing the plasmid pgbkt7-l2 were grown and matted with 5 10 y187 cells containing the cdna library from human liver and transferred to minimal medium plates sd - trp - leu - his - ade and grown at 30c 7 days. the positive colonies were grown in trp - leu medium and the plasmids recovered and transformed into dh10b cells. each individual clone was transformed in y187 strain and the interaction verified by matting with the strain ah109 transformed with the plasmids pgbkt7, pgbkt7-l2, and pgbkt7-l20. commd1 subclones n - terminus containing 6110 amino acids and c - terminus containing 111190 amino acids (nucleotides 18332 and 333570, resp.) were cloned in - frame into a two - hybrid yeast vector containing the gal4 activation domain (pgadt7). each commd1 subclone was transformed into y187 strain and the interaction verified by matting with the ah109 strain transformed with the plasmids pgbkt7, pgbkt7-l-2, and pgbkt7-l-20. the following chemicals and reagents used were from the indicated companies : rpmi 1640 (gibco brl, ny, usa) ; fetal bovine serum (fbs) and pbs 1x (from paa, canada) ; gentamicin, hydrogen peroxide (h2o2), mg132, propidium iodide, nonidet p-40 (np-40), dithiothreitol (dtt), protease inhibitor cocktail and albumin (bsa) (all from sigma) ; and rnase a, (boehringer mannheim) and absolute ethanol from merck. h460 (atcc, htb-117) cells were seeded in flasks t-75, and were kept at 37c and 5% co2 in rpmi 1640 medium supplemented with 10% (v / v) fbs, l - glutamine plus 50 g / ml of gentamicin. briefly, the pelleted cells were resuspended in 300 l of hypotonic buffer (10 mm hepes, ph 7.5, 10 mm kcl, 3 mm nacl, 3 mm mgcl2, 1 mm edta, and 2 mm dtt) containing a protease inhibitor mixture from sigma (p-8340), used at 60 l/5 10 cells. after 15 min incubation on ice, 0,05 volumes of 10% np-40 were added, the cells were mixed for 10 s and immediately centrifuged at 500 g for 10 min at 4c. the supernatants were collected, labeled as cytoplasmic extracts, aliquoted, and stored at 80c. the pelleted nuclei were resuspended in 50 l of the ice - cold nuclear buffer (20 mm hepes, ph 7.5 ; 25% glycerol, 0.8 m kcl, 1 mm mgcl2, 1% np-40, 0.5 mm edta, 2 mm dtt) containing the protease and phosphatase inhibitors as described above. following a 20 min incubation on ice with occasional stirring, the samples were centrifuged (14,000 g, 15 min, 4c) and the resulting supernatants were aliquoted and stored at 80c. 40 g of total protein extract was applied on 7.5% to 12.5% sds polyacrylamide gels and western blot conducted by standard procedures. the primary antibodies used were commd1 monoclonal (2a12), beta - actin monoclonal (ac15), heterogeneous nuclear ribonucleoproteins (hnrnp) monoclonal (4f4), anti - caspase 3, active (c8487) (all from sigma) ; bcl-2 polyclonal (c21) and bax antibody (santa cruz biotechnology), monoclonal rela (ab95020) and polyclonal ubiquitin (ab19247) abcam ; and parp antibody (9542) from cell signaling technology. for immunoprecipitation assays, the cells were lysed in ripa lysis buffer (1% nonidet p40, 0.5% sodium deoxycholate, 0.1% sds, and 0.5% bsa in pbs). rabbit polyclonal anti - rela (adi - kas - tf-110) (abcam) was used to immunoprecipitate the appropriate protein and monoclonal igg (a-1949) (sigma) was used as a negative control. complexes were separated by sds - page and then analyzed by western blot analysis. ht-29 (atcc, htb38) and mcf-7 (atcc, htb22) cells were seeded in 12 well plates containing cover slips (5 10 cell / well) and were cultured in d - mem - glutamax, 10% fetal bovine serum, at 37c for 24 h. subsequently, cigb-552 peptide was added to a final concentration of 60 and 20 m in ht-29 and mcf-7, respectively. cells were incubated at 37c for 5 h, then cover slips were washed with pbs, and the cells were fixed in 4% paraformaldehyde for 15 min and permeabilized in tween 20 solution (0.2% in pbs). blocking was performed with 3% bovine serum albumin in pbs (bsa - pbs) for 1 h. anti - commd1 monoclonal antibody (2a12) (abnova) was diluted 1 : 500 in bsa - pbs and the secondary antibody cy3 goat anti - mouse igg (invitrogen) was used at 1 : 1000 dilution. all images were taken using laser confocal microscope leica tcs sp5 and a 63x oil objective. in order to make comparable data, fluorescence images were taken using the same microscope settings (laser power, photomultiplier voltage, and offset). four optical sections scanned at intervals of 0.3 m were taken per sample projected using maximum intensity model and colored with predefined lut (spectrum) provided in the lasaf lite 2.6.0v software. for commd1 precipitation, h460 (atcc, htb-117) cells were lysed in triton lysis buffer (1% triton x-100, 25 mm hepes, 100 mm nacl, 1 mm edta, and 10% glycerol) supplemented with protease inhibitor cocktail and 2 mm of dithiothreitol. pull - down assays were done using 500 g of whole - cell lysates. the biotinylated peptides l-2, l-20, and cigb-552 (300 g) were independently incubated with 50 l of the resin streptavidin sepharose (ge healthcare) for 1 h. resin of streptavidin sepharose without peptides was used as a negative control. proteins remaining bound to the resins were resuspended in 25 l of sds sample loading buffer and separated by sds - page. h460 cells were seeded at confluence and treated with 25 m of cigb-552 for 30 min, 2 h, and 5 h. cells were harvested and total rna was extracted using the allprep dna / rna / protein mini kit (quiagen, valencia). cdna synthesis from rna using 500 ng of total rna was done with the quantitect reverse transcription kit (quiagen, valencia). cdna was diluted 20-fold and 5 l was used in each quantitative pcr reaction (qpcr). reactions were conducted in rotor gene 6000 equipment using absolute sybr greenqpcr kit (abgene, epsom). primers sequences for reference genes : b2 m, gapdh, hmbs, actb, ddx5 and gene of interest commd1 were selected from http://primerdepot.nci.nih.gov/ database. all biochemical parameters of oxidative stress were determined by spectrophotometric methods using a pharmacia 1000 spectrophotometer (pharmacia lkb, uppsala, sweden). total protein levels were determined using the method described by bradford with bovine serum albumin as standard. sod activity was determined using ransod kit (randox labs, crumlin), where xanthine and xanthine oxidase were used to generate superoxide anion radicals (o2), which react with 2-(4-iodophenyl)-3-(4-nitrophenol)-5-phenyltetrazolium chloride (int) to form a red formazan dye. briefly, 1 ml of samples in pbs was treated with 50 l of 1.16 m potassium iodide followed by the addition of 100 l of glacial acetic acid. the concentration of malondialdehyde (mda) was determined using the lpo-586 kit obtained from calbiochem (la jolla, ca, usa). in the assay, the production of a stable chromophore was read at 586 nm after 40 min of incubation at 45c. freshly prepared solutions of mda bisdimethyl acetal (sigma st louis, mo, usa) ferric reducing ability of plasma (frap) was assayed through the reduction of fe to fe by cell lysates or ascorbic acid as reference. the fe-2,4,6-tripiridil - s - triazine complex was detected at 593 nm. all results shown are the mean of duplicates of at least three independent experiments with se. plasmids encoding a short hairpin control (shcontrol) and plasmid encoding a short hairpin targeting commd1 mrna sequence (shcommd1) were obtained from genecopeia (usa). generation of h460 stable cell lines was performed with lentivirus infection with the addition of 4 g / ml polybrene (sigma). the selection was done in rpmi 1640 supplemented with 1 g / ml puromycin (sigma) according to the manufacturer 's instructions. the knockdown level of commd1 was determined by western blot analysis using mouse monoclonal anti - commd1. cells were seeded on 6 well plates during 24 h and then treated with 25 m of cigb-552 for 24 h. the harvested cells were fixed gently by putting 100% ice - cold ethanol in freezer for 2 h. subsequently, cells were resuspended in 300 l of pbs containing 40 g / ml of propidium iodide and 10 g / ml dnase - free rnase and incubated for 20 min at 37c. after gating out cellular aggregates, the cell cycle distribution analysis was done on facscalibur flow cytometer using cellquest software (becton dickinson). for each sample, at least 20,000 cells were counted and plotted on a single parameter histogram. cells in early and late stages of apoptosis were detected with an annexin v - fitc apoptosis detection kit from sigma (041m4083). cells were treated with cigb-552 (25 m) and incubated for 24 h and 48 h prior to analysis. briefly, 2.5 10 cells were washed with pbs and adjusted in 1 binding buffer to a concentration of 1 10/ml. to 100 l of cell suspension, 5 l of annexin v - fitc and 10 l propidium iodide (pi) were added and incubated for 10 min at room temperature prior to analysis. cells that were positive for annexin v - fitc alone (early apoptosis) and annexin v - fitc and pi (late apoptosis) were counted. to identify proteins that interact with the antitumor peptides l-2 and l-20, a yeast two - hybrid screening was performed. as the peptide l-2 has shown the major antitumor activity, the plasmid pgbkt7-l-2 was selected as bait in the yeast two - hybrid screening of a human liver cdna library to identify peptide - binding partners. the interaction of each positive clone was verified by matting with pgbkt7 as a negative control and with constructions pgbkt7 l-2 and pgbkt7 l-20. from the initial number of clones all positive clones were sequenced and their sequences analyzed using blast. among them, a plasmid containing the sequence of commd1 (from amino acids 6 to 190) was identified. interestingly, the diploid of commd1 with the l-20 peptide on selection plate showed a lower growth indicating a lower strength of this interaction compared with l-2 (figure 1(a)). a second gal-4-based yeast two - hybrid screening identified the region containing the amino acids 111190 of commd1 as the potential interaction site for the peptides figure 1(a), (bottom of the figure). the proteolytic stability of natural peptides is one of the principal limitations for their use as drug candidates. in this study, the substitution of proline (pro6) and leucine (leu11) by an unnatural amino acid and blocking n - terminal ends by n - acylation from l-2 resulted in a second generation peptide named cigb-552, which showed an increased antitumor activity in vitro and in vivo. this finding suggests that the incorporation of unnatural amino acids in the sequence could improve the metabolic stability of the peptide. to elucidate the functional significance of this chemical modification, the interaction between commd1 and the synthetic peptides l-2, l-20, and cigb-552 was evaluated by pull - down analysis in human lung cancer cells h460, following western blot with specific commd1 antibody. as shown in figure 1(b), commd1 was detected in the peptides - pull - down precipitation confirming the existence of specific commd1/peptide complexes in cells that express endogenously commd1. quantification of the complexes commd1/peptides (ri) inversely correlates with the cytotoxic activity of the peptides expressed by its inhibitory concentration (ic50), table 2. the complex cigb-552/commd1 increases in respect to the complex 's l-2 and l-20/commd1 indicating that modifications done in the primary structure of the peptides increased the affinity to commd1 and this correlates with the increased cytotoxic activity. the results of two hybrid and pull - down experiments indicate that the interaction between the peptides and commd1 is specific and that the strength of this interaction may be relevant for the antitumor effect of the peptides. in addition, the interaction between cigb-552 and commd1 was also confirmed in whole - cell lysates of human cancer cells of different histological origins (data not shown). given that commd1 was identified as a protein that associates to the above - mentioned antitumor peptides, we studied the role of commd1 in the mechanism of action of cigb-552. first, the cellular expression of commd1 in whole - cell lysates of human cancer cells of different histological origin was determined using western blot analysis, and the proteasome inhibitor mg132 which induces the accumulation of commd1 was used as a positive control. these experiments revealed an increase in the levels of commd1 after 5 h of treatment with the peptide. treatment with mg132 led to the increase of commd1 but not at a greater extent than cigb-552 (figure 2(a)). the cellular accumulation of commd1 was also found in situ immunofluorescence in human cancer cells. both cell lines assayed, mcf7 and ht29, showed the accumulation of commd1 after 5 h of treatment with the peptide similar to the obtained results by western blot (figure 2(b)). commd1 undergoes constitutive nucleocytoplasmic transport and its nuclear localization is needed for negative regulation of nf-b signaling. since our interest in this study is focused on the human lung cancer, the levels of the protein commd1 in the cytoplasm and nucleus of the h460 cells treated with cigb-552 were evaluated by western blot. however, in response to cigb-552, commd1 was increased in the cytoplasm and nucleus of cells at 40 min following treatment, and, most interestingly, this increment remained until up to 5 h after treatment (figure 2(c)). to examine whether the increase of commd1 levels is due to an increase in the rna expression, the results showed that increased levels of commd1 were not accompanied by significant changes in mrna expression of the protein (figure 2(d)), suggesting a posttranscriptional effect of cigb-552 on commd1. it has been known that overexpression of commd1 accelerates the ubiquitination and degradation of the rela subunit of nf-b and decreases the activation of anti - apoptotic genes. taking into account the above data, the second question to elucidate in this study was the effect of cigb-552 on the nf-b signaling in human lung cancer cells. immunoprecipitation of endogenous rela using a mouse anti - rela followed by antiubiquitin western blot confirmed the increased amounts of ubiquitinated rela in response to the peptide as early as 2 h after treatment, and the increment remained for 12 h after treatment (figure 3(a)). immunoprecipitation using a rabbit anti - igg as negative control did not result in the recovery of ubiquitinated rela, indicating the specificity of the recovered material. as shown in figure 3(a), cigb-552 as well as mg132 (used as a positive control) increased the ubiquitinated forms of rela. to investigate whether the cigb-552 induces ubiquitination and subsequent degradation of rela through a proteasome - dependent process, the effect of mg132 and cigb552 on the basal levels of the protein was tested. treatment with cigb-552 led to a decrease in basal levels of rela, while protein levels were accumulated in the presence of mg132 treatment and cigb-552. this result suggests that cigb-552 induces ubiquitination of rela and promotes its proteasomal degradation (figure 3(b)). further, we assess whether cigb-552 could modulate the expression of proteins involved in the intracellular apoptosis signaling. as shown in figure 3(c), proapoptotic protein bax was markedly induced, whereas bcl-2 was significantly inhibited after 12 h of treatment with the peptide, indicating that the apoptotic effect of cigb-552 is partly caused by upregulating the bax / bcl-2 protein ratio, which is a critical determinant of apoptosis. additionally, western immunoblotting showed a significant appearance of cleaved caspase-3 and parp in h460 cells after 24 h of treatment with cigb-552 (figure 3(c)). parp helps cells to maintain their viability ; the cleavage of parp facilitates cellular disassembly and serves as a marker of cells undergoing apoptosis. we found that rela ubiquitination occurred within 2 h of treatment (figure 3(a)) and was associated with a nuclear accumulation of commd1 (figure 2(c)). these early events had no effect on the levels of apoptotic - related proteins (figure 3(c)). based on our observations so far, the accumulation of commd1 and ubiquitination of rela are events that precede a repression of the antiapoptotic activity of nf-b. to assess if commd1 has a functional role in the antitumor activity of cigb-552, knockdown of commd1 by sirna was generated in h460 cell line and the cytotoxic effect of the peptide was determined. as shown in figure 4(a), the cytotoxic activity of cigb-552 in knockdown cells decreased in comparison to control cells. to confirm that the observed reduction in the antitumor effect of cigb-552 in knockdown cells was not an artifact, the levels of protein were determined by western blot. as shown in figure 4(a), commd1 expression decreased in respect to control cells (top of the figure). however, the cytotoxic activity of the peptide was not completely blocked in knockdown cells. this result might be explained by the efficiency of knockdown but we do not discard that other factors could be involved in the cytotoxic activity of the peptide. the reduced cytotoxic activity of the peptide in commd1 knockdown cells could be associated with decreased rela ubiquitination and degradation. to study this possibility, the endogenous ubiquitination of the rela levels in control and commd1 knockdown cells treated with the peptide was examined. as shown in figure 4(b), commd1 deficiency cells resulted in lesser levels of ubiquitinated rela when treated with the cigb-552 in respect to the control cells. next, we examined the levels of endogenous rela and bcl-2 in cytosolic extracts of control and commd1 deficiency cells using western blot. as shown in figure 4(c), commd1 knockdown cells showed greater levels of rela and bcl-2 proteins when treated with the cigb-552 in respect to the control cells. we have previously reported that the cytotoxic effect of the l-2 peptide involved cell cycle arrest followed by cell death. therefore, the possibility that commd1 might be involved in the cell death induced by cigb-552 was explored. to elucidate this, the alteration of the cell division cycle in control and commd1 knockdown cells was analyzed by flow cytometry. as shown in figure 5, control cells undergoing apoptosis after 24 h of treatment showed a significant increase in the sub - g0 peak. in contrast, the apoptosis induced by the cigb-552 was blocked in commd1 knockdown cells. one variable of apoptosis is phosphatidylserine externalization, which can be measured by annexin v staining. the effect of the cigb-552 on annexin v staining was determined after 24 h and 48 h of treatment. as shown in figure 6, control cells treated with cigb-552 showed a significant increase in annexin v positive cells compared with commd1 knockdown cells. altogether, these results support the hypothesis of the effect of commd1 on the apoptosis induced by cigb-552. the maturation and activation of the antioxidant superoxide dismutase (sod1) are highly regulated processes that require several posttranslational modifications. recently, it has been described that commd1 is a novel interaction partner of sod1. commd1 impairs sod1 activity by reducing the expression levels of enzymatically active sod1 homodimers late in the posttranslational maturation process of sod1. next, we considered it important to determine the relevance of this accumulation in the enzymatic activity of sod1, and the antioxidant capacity of the lung cancer cells. the activity of the superoxide dismutase sod1 was measured and the total antioxidant capacity was evaluated by frap. consistent with our expectation, the activity of sod1 in knockdown cells is markedly increased compared to h460 cells after 8 h of treatment with cigb-552 (figure 7(a)). in line with vonk 's report as shown in figure 7(b), the total antioxidant capacity was significantly diminished after 8 h of treatment. next, we examined the levels of protein and lipid peroxidation, as a sign of oxidative stress damage by the formation of mda (malondialdehyde) and aopp (advance oxidation protein products). concordantly, the levels of mda and aopp markedly increased after 8 h of treatment, likely in response to an imbalance in the antioxidant capacity figure 7(c). altogether, these data demonstrate that cigb-552 might promote cell cycle arrest and apoptosis by inducing damage to proteins and lipids in lung cancer cells. our previous studies showed that the substitution of alanine in specific amino acids of the region lalf3251 led to the design of peptides that lost the ability to bind lps and exhibit a differential cytotoxic activity (l-2 and l-20). in this study, we developed the peptide cigb-552 from the chemical optimization in the primary structure of the peptide l-2 with the purpose of reducing the elimination and biodegradation of the peptide and increasing selectivity or affinity to its potential target. first we confirmed that the peptides l-2 and l-20 bound the region 111190 of commd1 protein. particularly a higher capacity of binding was shown by the peptide l-2 and this correlated with its higher cytotoxic activity. interestingly, our subsequent studies using the pull - down technique demonstrated that modifications in the primary structure of the peptides increased the affinity to associate commd1 and this correlated with increased antitumor activity. for the first time, our results identified commd1 as a potential target of the anticancer peptide cigb-552 and indicated that targeting of a protein - peptide interaction may be a strategy to increase the specificity and biological activity of novel anticancer peptides derived from lalf3251 region. recently, it has been reported that a decreased expression of commd1 is frequently observed in a variety of cancers and that this correlates with tumor invasion as well as with the overall patient survival. this suggests that decreased commd1 expression might represent a novel mechanism that confers cancer cells with invasion potential and proliferating capacity. cigb-552 was undoubtedly found to accumulate commd1 in cancer cells and this accumulation was not accompanied by changes in the mrna expression. the basal levels of commd1 expression are tightly regulated by xiap (x - linked inhibitor of apoptosis). the interaction between commd1 and xiap have been mapped to the comm domain and identified leucine repetitions within the comm domain are required for ubiquitination and proteasomal degradation of commd1. interestingly, the peptides derived from lalf3251 region were found to bind comm domain (amino acids 119190) and, more important, our results provide the first indication that cigb-552 could regulate the levels of commd1 to induce the cell death in cancer cells. the mechanism by which cigb-552 induces the stabilization of commd1 is currently the issue of ongoing researches in our lab. a central function of nf-b, in particular of rela subunit, is the regulation of cellular growth and apoptosis. besides, the persistent activation of nf-b is a recognized contributory factor in a number of carcinomas and may provide the cancer cells with a survival advantage. recently, it has been demonstrated that ubiquitination and the degradation of rela subunit by commd1-containing ubiquitin ligase is a critical mechanism of regulation of the antiapoptotic activity of nf-b and this event has considerable relevance to cancer prevention and therapy, as well as the postinduction regulation of rela / nf-b [7, 35 ]. it was found in this study that the treatment of lung cancer cells with cigb-552 increased the levels of the protein commd1 in the cytoplasm and nucleus. this observation, along with the fact that commd1 can repress nf-b activation, suggests a significant role for cigb-552 in the regulation of rela / nf-b in lung cancer cells. our results demonstrated that cigb-552 induces the ubiquitination of the rela subunit of nf-b and our data also indicated that this effect promotes its proteasomal degradation. the stabilization and nuclear accumulation of commd1 mediated by cigb-552 could be an attractive mechanism for the regulation of the constitutive activity of the transcription factor nf-b in cancer cells. consistently, our studies showed a role for commd1 in the cytotoxic effect of cigb-552. h460 knockdown of commd1 was more resistant to the cytotoxic effect of the peptide, and this commd1 deficiency correlates with reduced levels of ubiquitinated rela and apoptosis. oxidative stress, involved in the etiology of cancer, results from an imbalance in the production of reactive oxygen species (ros) and the cells ' own antioxidant defenses. accordingly, there is an aberrant regulation of redox homeostasis and stress adaptation in cancer cells and this event is associated with drug resistance [36, 37 ]. here, we found that the treatment of the lung cancer cells with cigb-552 impaired the sod1 activity and it could be associated with the accumulation of commd1. moreover, the cigb-552 induced a failure of the antioxidant defenses and this effect was accompanied by damage to proteins and lipids. these observations suggest that cigb-552 plays a significant role in the regulation of the redox status of cancer cells. altogether, our results demonstrate that cigb-552 could regulate the anti - apoptotic activity of nf-b and the oxidative stress in lung cancer cells, two biological processes involved in the survival and growth of tumor cells. | we have demonstrated that the peptide l-2 designed from an alanine scanning of the limulus - derived lalf32 - 51 region is a potential candidate for the anticancer therapy and its cell - penetrating capacity is an associated useful property. by the modification in the primary structure of l-2, a second - generation peptide (cigb-552) was developed. however, the molecular mechanism underlying its cytotoxic activity remains partially unknown. in this study, it was shown that cigb-552 increases the levels of commd1, a protein involved in copper homeostasis, sodium transport, and the nf-b signaling pathway. we found that cigb-552 induces ubiquitination of rela and inhibits the antiapoptotic activity regulated by nf-b, whereas the knockdown of commd1 blocks this effect. we also found that cigb-552 decreases the antioxidant capacity and induces the peroxidation of proteins and lipids in the tumor cells. altogether, this study provides new insights into the mechanism of action of the peptide cigb-552, which could be relevant in the design of future anticancer therapies. |
in 1948 haldane firstly hypothesized the existence of a protective relationship between an otherwise harmful genetic mutation and a population with a high frequency of parasite infection. since then, the protective role of sickle cell trait (sct) in malaria endemic areas has been proved in several studies.1,2 in fact, if red cells are abnormal, the chance of success of the parasite is affected, reducing death rate due to plasmodium spp. splenic infarction is a well - known complication of sct, in particular during exercise at high altitude, but it has also been described at rest in aircrafts or with exercise at sea level. fever, leukocytosis and elevation of ldh usually occur in the first 3 days.3 in contrast, malaria - associated splenic infarctions are considered rare. anyway, reports of single or small series of cases have appeared almost annually.4 is therefore really unusual to find these three conditions co - existing ? we report the case of an 11-year - old nigerian boy, living in italy since 2010. on august, 26 he flew back from a one - month stay in nigeria, and two days later he started presenting fever. on august, 31 he complained vomiting and abdominal pain and was then conducted to the emergency room of our hospital. here, after an initial suspect of appendicitis, a diagnosis of plasmodium falciparum malaria was made, and the patient was admitted to the infectious diseases ward. his complete blood count showed leukopenia (wbc 4060, nv 450010800) and thrombocytopenia (plt 59,000, nv 100,000400,000), while hemoglobin was 13 g / dl (nv 1316.5 g / dl). his chemistry profile showed hyperbilirubinemia (2.93 mg / dl, nv 0.20.5 mg / dl), ast 136 ui / l and alt 122 ui / l (nv 1351 ui / l and 1547 ui / l, respectively), creatinine was 1.06 mg / dl (nv 0.30.9 mg / dl) and an increase of ldh values (657 u / l) was present (nv 120330 u / l) ; c - reactive protein was 85.6 mg / l (nv 20% ; therefore this diagnosis must be taken into account in a patient hailing from one of these countries,2 especially when anemia is present. splenic infarction is a complication of sct,3 and it has been reported at rest in aircrafts, moreover it has been described as a rare complication of malaria, it is primarily caused by p. falciparum, occurring mostly during the acute phase of the infection,4 even if the exact frequency of malaria - associated splenic infarction remains unclear because of under - diagnosis and under - reporting.5 in our case, as long as fever kept on after the conclusion of an adequate cycle of antimalarial therapy, in association with abdominal pain in the right upper quadrant and evidence of splenic lesions, further analysis have been undertaken in the suspect of a concomitant condition. therefore we considered as differential diagnosis splenic abscesses, both primary or secundary (e.g. endocarditis, patent foramen ovale), splenic infarction, primary hematologic diseases and granulomatous diseases (e.g. tuberculosis and chronic granulomatous disorder). contrary to our case, abdominal pain is generally reported as localized to the left upper quadrant, when splenic infarction is present.4 in the reported case, atypical clinical presentation, concomitant cholecystitis and radiological diagnosis of splenic abscesses were misleading. splenic infarction should be taken into account in a patient with malaria and abdominal pain, particularly when localized to upper quadrants, and us and ct scan should be performed to confirm the diagnosis. computed tomography scan with contrast is the gold standard for diagnosis of splenic infarction. in our case, however, us has been primarly performed in the suspect of cholecystitis. mri was then performed, taking into account the young age of the patient and the good sensitivity of this technique for spleen lesions.5 conservative therapy must be attempted, and the prognosis is good.6 splenectomy should be reserved for those patients with severe damage to the spleen, also taking into account possible future complications,7 including severe malaria. finally, as long as the number of international migrants worldwide kept on growing over the past decades, all of us clinicians should be aware of pathologies we havent been familiar with in our daily activity. | the protective role of sickle cell trait (sct) in malaria endemic areas has been proved, and prevalence of hbs gene in malaria endemic areas is high. splenic infarction is a well - known complication of sct, while the association with malaria is considered rare. a nigerian boy was admitted to our ward after returning from his country of origin, for p. falciparum malaria. he underwent abdominal ultrasound for upper right abdominal pain, showing cholecystitis and multiple splenic lesions suggestive of abscesses. empiric antibiotic therapy was undertaken. bartonella, echinococcus, entamoeba serologies, blood cultures, quantiferon test, copro - parasitologic exam were negative ; endocarditis was excluded. he underwent further blood exams and abdomen mri, confirming the presence of signal alterations areas, with radiographic appearance of recent post - infarction outcomes. hemoglobin electrophoresis showed a percentage of hbs of 40.6% and a diagnosis of sct was then made. splenic infarction should be taken into account in patients with malaria and localized abdominal pain. moreover, diagnosis of sct should be considered. |
multiple sclerosis (ms, omim 126200) is the most common cause of non - traumatic chronic neurological disability in young adults.1 the incidence of ms seems to have increased considerably over the last century,2 but ancestry remains an important modifier of the global burden of ms ; disease prevalence is substantially higher in populations of northern european decent. other populations, including asians, africans, and north and south amerindians, have a pronounced lower frequency of ms.3 although african americans have a higher disease risk compared to black africans, they have a lower relative risk compared to northern europeans and white americans (relative risk of 0.64).4 on the other hand, african americans with ms appear to have a greater risk of ambulatory disability and more often have symptoms restricted to the spinal cord and optic nerve compared to white patients.510 the differences in the clinical phenotype between african americans and whites with ms may be due to the influence of genetic and/or environmental factors. multiple studies yielded convincing evidence for the presence of a major susceptibility gene or genes in the mhc locus on chromosome 6p21.3, but also indicated a polygenic mode of inheritance with each non - mhc gene contributing only a modest effect to the overall risk.11 spearheaded by the recent remarkable progress in high - throughput genotyping technologies, hypothesis - neutral genome - wide association studies (gwas) in ms led to the identification of true susceptibility genes and loci of interest, including cd25 antigen (cd25), cd58 antigen (cd58), c - type lectin domain family 16, member a (clec16a). interleukin-7 receptor (il7r), glypican 5 (gpc5), regulator of g protein signaling 1 (rgs1) and tyrosine kinase 2 (tyk2).1214 a meta - analysis of gwas data identified additional susceptibility snps in or next to tumor necrosis factor receptor superfamily member 1a (tnfrsf1a), interferon regulatory factor 8 (irf8) and cd6 antigen (cd6).15 the distribution and penetrance of these genetic variations in non - white ms groups is unknown. in african americans, previous studies have demonstrated the association of mhc class ii hla - drb1 15 alleles with disease susceptibility and progression.16, 17 in addition, the presence of hla - drb1 15 alleles in african american patients correlates with the disseminated ms phenotype compared to opticospinal ms.18 however, the hla effect in disease risk may not be as strong as in whites, suggesting a more prominent role for non - hla genes. to better describe the ms susceptibility genetic profile in african americans, the objectives of this study were to confirm in this population the previously identified susceptibility genes in whites affected with ms and to test whether these genes are associated with disease phenotypes. we tested, in 918 well characterized cases and 656 controls, the allele frequencies of 19 snps in 12 ms loci.1315, 19, 20 cd6, clec16a, ecotropic viral integration site 5 (evi5), gpc5, and tyk2 contained snps that are significantly associated with ms in african americans. in addition, a preliminary analysis suggests that rgs1 may be associated with age of onset, whereas tnfrsf1a may affect disease severity. the african american dataset used in this study is comprised of 918 cases and 656 controls. gender, therefore, is fit into the model for all subsequent analyses, thus minimizing the effect of this difference. the average age of onset of ms was 32.4 years and the mean age at time of analysis was 44 years for cases and 43 years for controls (t test, p = 0.081). the majority of the cases (85%) had either relapsing remitting or secondary progressive ms. we genotyped all individuals for the presence of drb1 1501 or 1503, since these alleles are associated with ms in african americans.16, 17 drb1 1501 and 1503 are in hardy - weinberg equilibrium (pearson s test, p = 0.26). we used logistic regression analysis to test 19 snps in 12 genes, previously identified in ms datasets of northern european ancestry, for association with ms in african americans (table 2). none of the snps deviated from hardy - weinberg equilibrium (p > 10) in controls. seven of the snps in five genes were significantly associated with ms in the african american dataset : cd6 rs11230563 (p= 0.012, or= 1.203, 95% ci= 1.0421.388), clec16a rs12708716 (p= 0.029, or= 1.173, 95% ci= 1.0161.357), clec16a rs6498169 (p= 0.028, or= 1.142, 95% ci= 0.9231.416), evi5 rs10735781 (p= 0.006, or= 1.233, 95% ci= 1.0631.431), evi5 rs6680578 (p= 0.025, or= 1.185, 95% ci= 1.0211.375), gpc5 rs553717 (p= 0.007, or= 1.281, 95% ci= 1.0251.602), and tyk2 rs34536443 (p=0.045, or= 2.037). due to the low minor allele frequency (0.01) of rs34536443 all p values are uncorrected, but we considered the present study as a replication of previously validated findings. however, drb1 status was found to possibly interact with evi5 (rs10735781, p= 0.0493) and cd226 antigen (cd226) (rs763361, p= 0.0041) (table 3). the minor alleles are susceptible for both snps in the drb1 non - carriers group. a recent gwas study performed using cases from australia and new zealand also identified the evi5-drb1 interaction.21 although most of the tested snps failed to show significant association in this dataset, those that were significant had slightly larger odds ratios when compared to previous studies in whites (table 2 and figure s1). however, none of the tested snps showed significant differences in a cochrane heterogeneity q test, signifying no difference in the association between african americans and whites. global association between ms and each snp across the 2 populations, are also shown in table 2. because the major ms susceptibility gene hla - drb1 was previously shown to affect some important aspects of the phenotype, we next tested the above 19 snps for association with age of onset and multiple sclerosis severity scale (msss) using linear regression analysis with relevant covariates placed in the model (table 4). as expected, drb1 1501/1503 were significantly associated with age of onset (p = 7.496 10).18 individuals with 0 copies of the drb1 risk allele had a mean age of onset of 33.3 years. one copy of the drb1 risk allele reduced the mean age of onset by 2.7 years and two copies of the drb1 risk allele reduced the mean age of onset by 6.02 years. individuals with two copies of the rs2760524 minor allele had a reduced mean age of onset of 23.0 years from 32.1 years. one copy of the tnfrsf1a minor allele reduced the mean msss by 0.86. with the exception of the hla, none of these modifier associations survive statistical correction for multiple comparisons. given the low prior odds that these snps are associated with ms phenotypes and the failure of these snps to survive correction for multiple comparisons, we consider this data to be preliminary and further testing will be necessary to confirm the association of rgs1 and tnfrsf1a to age of onset and msss, respectively. previous studies have determined an association between hla and ms in african americans, albeit not as strong as in whites,16, 17 suggesting common immunological mechanisms underlying the diseases across ethnic backgrounds. in the present study, we report the first evidence of genetic association between non - hla genes and ms risk in this population. cd6, clec16a, evi5, gpc5, and tyk2 convincingly replicated in the african american dataset. on the other hand, cd226, cd58, il7r, il2r, irf8, rgs1, tnfrsf1a failed to show evidence of association. two primary explanations exist for this difference : first the study may have been underpowered to detect these associations, and second it is possible the different linkage disequilibrium patterns across populations may render the selected snps less effective in tagging putative causative variants in african americans. it is also conceivable that some of the genes that influence ms in whites do not do so in african americans. with a sample size of 1574 african americans, one would expect only some of the genetically relevant loci to show statistically significant evidence of association, even if an association exists. also for a majority of the markers, the minor allele frequencies were lower in this african american dataset compared to previous studies in whites. therefore, this study may have indeed been underpowered to detect associations for some of the snps. for example, the minor allele frequencies for snps such as rs12044852 (cd58, maf 0.07), rs2104286 (il2ra, maf 0.07), rs17445836 (irf8, maf 0.05), rs2760524 (rgs1, maf 0.06), rs1800693 (tnfrsf1a, maf 0.08), and rs34536443 (tyk2, maf 0.01) are lower than in whites (all mafs are greater than 0.1 in ceu, www.hapmap.org). to illustrate this effect, power was plotted as a function of minor allele frequency (supplementary figure 2). for the snps, rs12720222 (tyk2), rs17445836 (irf8), rs1800693 (tnfrsf1a), rs2816316 (rgs1), rs17424933 (cd6), rs34536443 (tyk2) and rs12044852 (cd58) the power to detect a true association in this dataset was low. however, for snps rs2760524 (rgs1), rs2104286 (il2ra), rs6897932 (il7ra), rs763361 (cd226) and rs9533762 (gpc5) there appears to have been sufficient statistical power but an association was not identified. in addition, the linkage disequilibrium data in hapmap (www.hapmap.org) suggests that snps used to detect association may be less powerful in african americans, and even if the association of a gene with ms is the same in african americans and whites, significantly larger datasets may be needed. it should be noted, however, that very large datasets, currently only available for high - risk white populations, may be necessary to categorically exclude or replicate ms susceptibility markers.13 based on us census figures and the relative risk of ms, the current dataset represents an estimated 5% sample of african americans with ms. it is plausible nevertheless, that differences in genetic susceptibility snps between whites and african americans may represent true differences in disease heritability and that these snps do not influence ms risk in african americans. of the genes associated with ms risk in african americans, evi5 displayed the most significant association outside the mhc. the association of evi5 with ms was first detected in a gwas performed using 12,360 non - hispanic whites from the us and the uk, (snps rs10735781 ; or=1.14, p = 3.35 10 and rs6680578 ; or= 1.11, p = 5.00 10).13 the association was confirmed through the analysis of 240 case - control individuals from a genetically isolated dutch population (rs10735781 ; or= 2.01, p = 0.01, and rs6680578 or= 1.9, p = 0.01) and in a larger dataset comprised of 2825 individuals from multi - case canadian families (rs10735781 ; or= 1.15, p = 0.03 ; and rs6680578 ; or= 1.15, p = 0.04).20 evi5 is an oncogene implicated in t cell lymphomas, is a common site of retroviral integration22, and facilitates cell septation during mitosis.23 evi5 has been shown to physically bind the small gtpase binding protein rab11 in cell culture.24, 25 rab11 is required for the endocytic recycling of cell surface molecules26 including transferrin,27 iga,28 and cxcr2 chemokine receptors,29 and has also been implicated in the regulation of cytokinesis,30, 31 neurite extension,32 and the formation of the immune synapse.33 evi5 competes with rab effector proteins to bind with rab11, which suggests a role for evi5 regulation of downstream rab11 pathways.25 in cd4 + t cells, uncoordinated 119 (unc119) activates rab11 to transport lymphocyte cell - specific protein - tyrosine kinase (lck) to the plasma membrane.33 upon binding of the antigen - mhc complex from the antigen presenting cell, lck initiates signaling from the t cell receptor leading to t cell activation.34, 35 allelic differences in evi5 may contribute to altered function of rab11 and altered formation of the immunological synapse, thus contributing to ms susceptibility. further studies will be needed to determine the functional effect of evi5 allelic variants on rab11 and the immune synapse. cd6, clec16a, and gpc5 are also associated with ms risk in african americans. cd6 is a t cell surface protein involved in the activation of t cells.36 allelic variants at rs11230563 may result in altered activation of t cells, thereby affecting an individual s susceptibility to ms. clec16a has been associated with disease susceptibility in white ms patients13, 15, 21, 37, 38 as well as other autoimmune diseases.3840 although the function of clec16a is unknown, clec16a is expressed on b cells, dendritic cells, and natural killer cells.41 gpc5, a member of the glypican family, is a cell surface molecule and is a type of heparan sulfate proteoglycan.42 these molecules are implicated in axon guidance and growth, and synapse formation.43, 44 interestingly, heparan sulfate proteoglycans have been identified in active ms brain lesions where they may contribute to the sequestering of proinflammatory cytokines.45 gpc5 is expressed in neurons46 and is known to interact with chemokines, extracellular matrix proteins, and growth factors.47 allelic variants of gpc5 may affect neuronal repair and contribute to differences in ms susceptibility. the rgs1 snp, rs2760524, did not show evidence of association with ms risk in african americans, but our preliminary analysis suggests an effect on age of onset that warrants follow - up in large northern - european datasets. rgs1 is involved in the trafficking of b cells into and out of lymph nodes.48 b cell - mediated antigen presentations and antibody responses appear to be necessary for the full development of demyelination, both in humans and in experimentally induced disease. b cells from rgs1 knockout mice have increased homing to lymph nodes, increased adhesion to lymph nodes, and faster movement within lymph nodes compared to wild - type b cells.48 in humans with ms, polymorphisms in rgs1 may conceivably lead to changes in b cell mobility, leading to altered recruitment of b cells to the central nervous system, thereby affecting the initiation of ms. recent studies associated polymorphisms in rgs1 to celiac disease and type i diabetes, further supporting a key role for rgs1 in the initiation and development of autoimmunity.4951 the association of tnfrsf1a - rs1800693 with ms was recently identified through a gwas meta - analysis.15 the present data suggests that tnfrsf1a, one of the major receptors for tnf-, which is involved in apoptosis, inflammation, and under certain conditions immunosuppression,52, 53 may also affect disease progression. polymorphisms in tnfrsf1a may cause altered signaling of tnf- in the cns, leading to increased activation of t cells, demyelination and inflammation, thereby affecting the severity of ms.5457 in conclusion, in a large african american dataset we have tested a selected number of polymorphisms in candidate genes recently shown to be associated with ms in white populations. snps in cd6, clec16a, evi5, gpc5, and tyk2 replicated the association with ms risk in african americans. this is the first observation of an effect by non - hla genes in a non - white ms group. the data is consistent with a commonality in disease mechanisms among individuals of european and african ancestry, and suggest the prominent role of environmental factors in explaining the paucity of ms in africa. the data set studied consisted of 1574 african american individuals, including 918 ms cases, and 656 unrelated control individuals. all study participants are self - reported african americans, but european ancestry was documented in 985 of the individuals based on the genotyping of 186 snps highly informative for african versus european ancestry as previously described (mean european ancestry = 21%).58 all ms subjects met established diagnostic criteria.59 ms phenotypes were characterized by systematic chart review as described.7 ascertainment protocols and clinical and demographic characteristics were summarized elsewhere.7, 17 eight individuals with aquaporin-4 seropositivity were excluded from this study as they have met new diagnostic criteria for neuromyelitis optica.60 informed consent was obtained from all study participants prior to participation in the study. genotyping of snps was performed using validated taqman snp genotyping assays (applied biosystems inc., foster city, ca) for all snps except rs9523762, which was performed using a custom taqman snp genotyping assay (applied biosystems inc. each pcr reaction contained 10ng dna, 1x ; taqman genotyping master mix (applied biosystems inc. amplification was performed in an abi 9700 geneamp pcr system (applied biosystems inc., the pcr program consisted of 95c for 10min, followed by 50 cycles of 95c for 15s and 62c for 1min. the plates were then read on an abi prism 7900ht sequence detection system using sds 2.0 software (applied biosystems inc., foster city, ca). for drb1, a pcr locus - specific amplification was used as previously described.16 the average genotyping failure rate was 0.43% for all snps tested. all snp genotypes were tested for deviation from hardy - weinberg equilibrium in cases and controls using snp stats (http://bioinfo.iconcologia.net/index.php?module=snpstats).61 to determine snp associations with ms risk, logistic regression was performed using sas v.9.1.3 (sas institute, inc., cary, nc) with sex and drb1 status as covariates in the regression model. positive drb1 status was defined as at least one copy of either the drb1 1501 or 1503 allele. the genotypic model tested the dominant / recessive / additive allele model and the trend model tested additive allelic effects for each snp. the model that best fit the data is reported. since this is a replication study, snp interactions with gender and drb1 status were tested using snp stats (http://bioinfo.iconcologia.net/index.php?module=snpstats).61 the cochrane heterogeneity q test was performed using the rmeta package in r. the q test measures the existence of differences between the individual study effects and the pooled effect across studies. the global odds ratio was calculated under a fixed effect model using the inverse variance weighting method. cary, nc). for age of onset, the data followed a normal distribution and was not transformed. for all snps tested, gender and drb1 status were covariates in the linear regression model. for drb1, only gender was fit into the model. for msss, the data was transformed using the normal score transformation (yi=(ri3/8)/(n+1/4)) to yield a normally distributed dependent variable for regression analysis.62 gender, age of onset, and treatment status (y / n / unknown) were fit into the linear regression model for all snps and drb1. the data set studied consisted of 1574 african american individuals, including 918 ms cases, and 656 unrelated control individuals. all study participants are self - reported african americans, but european ancestry was documented in 985 of the individuals based on the genotyping of 186 snps highly informative for african versus european ancestry as previously described (mean european ancestry = 21%).58 all ms subjects met established diagnostic criteria.59 ms phenotypes were characterized by systematic chart review as described.7 ascertainment protocols and clinical and demographic characteristics were summarized elsewhere.7, 17 eight individuals with aquaporin-4 seropositivity were excluded from this study as they have met new diagnostic criteria for neuromyelitis optica.60 informed consent was obtained from all study participants prior to participation in the study. genotyping of snps was performed using validated taqman snp genotyping assays (applied biosystems inc., foster city, ca) for all snps except rs9523762, which was performed using a custom taqman snp genotyping assay (applied biosystems inc. each pcr reaction contained 10ng dna, 1x ; taqman genotyping master mix (applied biosystems inc. amplification was performed in an abi 9700 geneamp pcr system (applied biosystems inc., the pcr program consisted of 95c for 10min, followed by 50 cycles of 95c for 15s and 62c for 1min. the plates were then read on an abi prism 7900ht sequence detection system using sds 2.0 software (applied biosystems inc., foster city, ca). for drb1, a pcr locus - specific amplification was used as previously described.16 the average genotyping failure rate was 0.43% for all snps tested. all snp genotypes were tested for deviation from hardy - weinberg equilibrium in cases and controls using snp stats (http://bioinfo.iconcologia.net/index.php?module=snpstats).61 to determine snp associations with ms risk, logistic regression was performed using sas v.9.1.3 (sas institute, inc., cary, nc) with sex and drb1 status as covariates in the regression model. positive drb1 status was defined as at least one copy of either the drb1 1501 or 1503 allele. the genotypic model tested the dominant / recessive / additive allele model and the trend model tested additive allelic effects for each snp. the model that best fit the data is reported. since this is a replication study, snp interactions with gender and drb1 status were tested using snp stats (http://bioinfo.iconcologia.net/index.php?module=snpstats).61 the cochrane heterogeneity q test was performed using the rmeta package in r. the q test measures the existence of differences between the individual study effects and the pooled effect across studies. the global odds ratio was calculated under a fixed effect model using the inverse variance weighting method. linear regression was performed using sas v.9.1.3 (sas institute, inc., cary, nc). for age of onset, the data followed a normal distribution and was not transformed. for all snps tested, gender and drb1 status were covariates in the linear regression model., the data was transformed using the normal score transformation (yi=(ri3/8)/(n+1/4)) to yield a normally distributed dependent variable for regression analysis.62 gender, age of onset, and treatment status (y / n / unknown) were fit into the linear regression model for all snps and drb1. | multiple sclerosis (ms) is an autoimmune demyelinating disease characterized by complex genetics and multifaceted gene - environment interactions. compared to whites, african americans have a lower risk for developing ms, but african americans with ms have a greater risk of disability. these differences between african americans and whites may represent differences in genetic susceptibility and/or environmental factors. snps from 12 candidate genes have recently been identified and validated with ms risk in white populations. we performed a replication study using 918 cases and 656 unrelated controls to test whether these candidate genes are also associated with ms risk in african americans. cd6, clec16a, evi5, gpc5, and tyk2 contained snps that are associated with ms risk in the african american dataset. evi5 showed the strongest association outside the mhc (rs10735781, or = 1.233, 95% ci = 1.061.43, p value = 0.006). in addition, rgs1 appears to affect age of onset whereas tnfrsf1a appears to be associated with disease progression. none of the tested variants showed results that were statistically in - consistent with the effects established in whites. the results are consistent with shared disease genetic mechanisms among individuals of european and african ancestry. |
a 6-year - old, neutered female british shorthair cat presented with acute - onset weakness and mental dullness. the cat had previously been regarded as healthy apart from a transient myopathy (suspected toxoplasmosis) which resolved with clindamycin and supportive care 3 months earlier. a serum biochemistry panel and complete blood count were unremarkable apart from mild hyperglycaemia (9.9 mmol / l ; 3.36.7 mmol / l) which was thought to reflect stress hyperglycaemia (catecholamine antagonism of insulin). creatine kinase (ck) was within the reference interval (59 u / l ; reference interval [ri ] 0314). over the following 12 h the cat developed central blindness, tremors, intermittent seizures and opisthotonus. repeat blood sampling (while the cat was symptomatic) revealed a marked hypoglycaemia (0.8 mmol / l). a concurrent insulin level (performed on a serum sample collected while the cat was hypoglycaemic) was inappropriately elevated (1575 miu / l ; ri 1080 miu / l). pre- and post - prandial bile acids and a resting cortisol level were within the reference interval. an intravenous bolus of 5% glucose (0.5 g / kg diluted 1:3 in 0.9% sodium chloride solution) resulted in rapid resolution of all clinical signs and mild transient hyperglycaemia (12.5 mmol / l). despite frequent feeding, the hypoglycaemia (2.0 mmol / l) rapidly recurred. an intravenous 2.5% glucose continuous - rate infusion (sodium chloride 0.45% w / v and glucose 2.5% w / v solution for injection [bp ; baxter healthcare ]) was commenced. an abdominal ultrasound was unremarkable, although three cranial mesenteric lymph nodes were noted to be prominent (3 mm in width). given the concurrent hypoglycaemia, hyperinsulinaemia and resolution of clinical signs following glucose supplementation, an insulinoma was suspected. following surgical resection of the left limb of the pancreas, the cat returned to a euglycaemic state after a brief rebound hyperglycaemia. histopathology revealed pancreatic fibrosis with marked multifocal micronodular hyperplasia of exocrine and endocrine cells, mild lymphoplasmacytic inflammation and ductular ectasia (figures 1 and 2). mild granulomatous lymphadenitis and hydropic change within hepatocytes was also noted in biopsies acquired from the cranial mesenteric lymph node and liver, respectively. the histopathological findings were consistent with a diagnosis of acquired non - neoplastic hyperinsulinaemic hypoglycaemic syndrome (also known as nesidioblastosis) and underlying, chronic pancreatic inflammation with possible partial ductular obstruction. there are multiple regions of hyperplastic and hypertrophied islet cells forming micronodules (indicated by the black arrows) which observe the normal lobar architecture. there are also regions of lymphocytic infiltration (yellow arrows) and fibrosis (white arrow) and ductular proliferation medium power (100 magnification) of the affected pancreas. there are multiple regions of hyperplastic and hypertrophied islet cells forming micronodules (indicated by the black arrows). there is also a region of lymphocytic infiltration (yellow arrow) medium power (100 magnification) view of the pancreas after immunohistochemical staining. the positive (red brown) staining represents synaptophysin on the neuroendocrine pancreatic cells. the acinar cells are negatively staining the cat recovered uneventfully without any further intervention. over the following 12 months, the cat remained clinically well and euglycaemic. a random insulin level performed 6 months after partial pancreatectomy was normal (20 a biochemistry panel revealed mild hyperglycaemia (10.8 mmol / l) with a moderate myopathy (ck 6942 u / l) and mild cholestasis (total bilirubin 22 ; ri 015). a recrudescence of toxoplasmosis was suspected. while an ante - mortem serum toxoplasma igg titre was subsequently found to be positive (1:64), acquired non - neoplastic hyperinsulinaemic hypoglycaemia syndrome has not previously been described in the veterinary literature, although it is a well - known syndrome in people, where it is often referred to as nesidioblastosis. this syndrome has been increasingly identified in the human field since 1980, where it is now documented as the cause in up to 7% of adults who present with hyperinsulinaemic hypoglycaemia. nesidioblastosis describes a syndrome of hyperinsulinaemia and associated hypoglycaemia secondary to focal or diffuse non - neoplastic -cell hypertrophy and/or hyperplasia within the pancreas. in humans, while the clinical signs and biochemical findings are similar, the two forms differ in terms of the distribution of lesions within the pancreas and the aetiology. the congenital form is more commonly associated with focal -cell hypertrophy and tends to be associated with genetic defects resulting in dysfunction of the adenosine triphosphate - sensitive potassium channel present in the plasma membrane of pancreatic -cells. the closure of these channels initiates the depolarisation of the -cell membrane, opening of calcium channels and subsequent insulin hypersecretion. clinical hypoglycaemia generally becomes apparent within the first 2 years of a child s life. in contrast, the adult form tends to reflect focal to diffuse -cell hypertrophy with or without hyperplasia. the cause of the acquired form remains uncertain, but there is some evidence to suggest that it is a regenerative response following pancreatic injury. in this case, the concurrent pancreatic fibrosis and leukocytic infiltrate suggests a degree of chronic inflammation and injury which could have acted as a stimulus for nesidioblastosis. this cat was originally suspected of having toxoplasmosis based on a high likelihood of exposure (outdoor access, fed a raw lamb diet) and a clindamycin - responsive myopathy, but this was never confirmed. the initial serum toxoplasma immunoglobulin (igg and igm) titres were negative and convalescent titres were not performed until 18 months later (samples collected just prior to death). at that stage the cat was igg positive (1:64) but igm negative. while the igg titre was low, seroconversion suggests exposure and possibly infection over the intervening period. if this cat were infected with toxoplasma, this could explain the chronic pancreatic injury as toxoplasma has been shown to have a high affinity for the pancreas (1664% of cats with clinical toxoplasmosis had histopathological evidence of pancreatic involvement at post mortem) and this could have been a potential trigger for the acquired nesidioblastosis. it is unfortunate that a post mortem was not performed to investigate this possibility. to the author s knowledge there has been no prior correlation between a myopathy and nesidioblastosis in the human literature. while a high rate (> 90%) of postprandial hypoglycaemia has been noted in people with nesidioblastosis, postprandial hypoglycaemia has occasionally been reported with insulinoma (although with the latter, fasting or exercise - induced hypoglycaemia is more common). the age of onset may have provided a clue to this non - neoplastic disease, as this cat was much younger than all previously reported cases of feline insulinoma (all were > 12 years of age at diagnosis). it is interesting to note that this cat was mildly hyperglycaemic at the time of presentation. this was likely to reflect the release of insulin antagonists (eg, catecholamines, corticosteroids and glucagon) in response to stress or a somogyi effect. this situation has been documented in dogs with insulinoma, where up to 8% were normoglycaemic at the time of initial presentation. consequently, a single normal blood glucose reading does not exclude hypoglycaemic disorders and repeated measurement of a fasting sample is advisable if clinical signs progress. in this case, the insulin level was initially determined using a canine insulin chemiluminescent immunoassay (owing to the lack of local availability of a feline validated assay) and the reference interval was extrapolated from previous feline studies. a portion of the initial serum sample was frozen with the intention of repeating the insulin level using a feline - validated insulin assay, but the sample was lost in transit. given that it is important to use an insulin assay that has been validated in the target species, a correlation study between the canine chemiluminescent immunoassay and a feline - validated insulin radioimmunoassay (nationwide specialist laboratories) was subsequently performed to validate the result and ri using feline control and test serum samples (unpublished data). in human cases of nesidioblastosis, the pancreas is often grossly normal and the microscopic changes are difficult to discern with standard forms of preoperative pancreatic imaging. positron emission ct targeting glucagon - like peptide 1 receptors may aid localisation but can not distinguish between neoplastic and non - neoplastic causes. intraoperative selective arterial stimulation tests may also aid localisation and possibly aid differentiation between an insulinoma and nesidioblastosis, but in most cases differentiation relies on histopathological analysis of the pancreas. histopathological findings in nesidioblastosis can be variable, but the most consistent finding is hypertrophy of the islet cells. these hypertrophied cells are often recognisable even at medium magnification as they have abundant clear cytoplasm (often twice the diameter of normal islet cells) and prominent, hyperchromatic nuclei. other findings such as islet - cell hyperplasia, lobulated arrangement within the islets and an increase in -cell mass are less common. in contrast to insulinoma, the lobular architecture of the exocrine pancreas is preserved and there is an absence of ki-67 antigen activity (marker of proliferation). this cat satisfied these diagnostic features, although ki-67 antigen levels were not assessed. in one study assessing the histopathological detection of nesidioblastosis by human pathologists, the interobserver analysis revealed 100% specificity and 87.7% sensitivity. islet - cell hyperplasia has been reported as an incidental finding in post - mortem studies of research beagles (after use in toxicology studies), aged horses and aged rats. vacuolar hyperplasia of islet - cells has also been documented as an incidental finding in diabetic dogs where it is thought to reflect a regenerative response. there has been no clinical or biochemical evidence of hyperinsulinism or hypoglycaemic in any of these cases. in 2014, a hyperinsulinaemic hypoglycaemia syndrome was reported in two juvenile (6- and 9-month - old) dogs. both dogs presented with neurological signs, marked hypoglycaemia, concurrent hyperinsulinaemia and a range of other haematological and biochemical abnormalities. the pancreas appeared normal in one dog, but concurrent severe cholangitis and hepatic fibrosis were noted. mild - to - moderate islet cell hyperplasia (without hypertrophy) was noted in the second dog along with encephalitis, arteritis and pneumonia. both dogs returned positive pcr results for bartonella species (from the liver and blood, respectively). it is possible that these two cases represent congenital nesidioblastosis, but the role of bartonella species in their hypoglycaemic, hyperinsulinaemic syndrome is unknown. traditionally, in humans, partial pancreatectomy has been the favoured method of both diagnosis and treatment of nesidioblastosis, but high recurrence rates have sparked more interest in medical forms of management, including diazoxide, long - acting octreotide, glucagon and calcium - channel blockers (eg, nifedipine and amlodipine). medical management was not attempted in this case, but partial pancreatectomy appeared an effective form of treatment as the hypoglycaemia did not recur. this the first time successful treatment of clinically significant, acquired nesidioblastosis has been reported in the veterinary field and the first time nesidioblastosis has been reported in the cat. while it is difficult to prognosticate based on one feline case, the prognosis of people diagnosed with nesidioblastosis is considered good. while this condition is rare, nesidioblastosis is an important differential to consider when investigating hypoglycaemia as it can not be differentiated from insulinoma without histopathological evaluation. given that the pancreas can appear grossly normal in humans with this condition, histopathological analysis of the pancreas should be undertaken in hyperinsulinaemic, hypoglycaemic patients even if focal pathology can not be identified. postprandial hypoglycaemia in a young - to - middle - aged patient with normal pancreatic imaging may give rise to a clinical suspicion of nesidioblastosis. in contrast with insulinoma, the prognosis of patients diagnosed with nesidioblastosis may be more favourable. | case summary a 6-year - old, neutered female british shorthair cat presented with acute - onset weakness and mental dullness. initially the cat was mildly hyperglycaemic (9.9 mmol / l ; reference interval [ri ] 3.36.7 mmol / l). over the following 12 h the cat developed central blindness, tremors, intermittent seizures and opisthotonus. repeat blood sampling revealed a marked hypoglycaemia (0.8 mmol / l). insulin level (performed on a serum sample collected while the cat was hypoglycaemic) was inappropriately elevated (1575 miu / l ; ri 1080 miu / l). an abdominal ultrasound was unremarkable. an exploratory laparotomy revealed a firm and erythematous left limb of the pancreas. following surgical resection of the left limb of the pancreas, the cat returned to a euglycaemic state after a brief rebound hyperglycaemia. histopathology revealed pancreatic fibrosis with marked multifocal micronodular hyperplasia of exocrine and endocrine cells. synaptophysin immunohistochemistry confirmed nodular -cell hyperplasia.relevance and novel information nesidioblastosis describes a syndrome of acquired hyperinsulinaemia and associated hypoglycaemia secondary to focal or diffuse (non - neoplastic) -cell hyperplasia within the pancreas. acquired nesidioblastosis has been reported in humans, where -cell dysregulation is thought to occur in response to pancreatic injury. this is the first reported case of clinically significant hypoglycaemia due to acquired nesidioblastosis in an adult domestic cat. while this condition is rare, nesidioblastosis is being increasingly recognised in humans and it is an important differential diagnosis to consider when investigating hypoglycaemia as it can not be distinguished from insulinoma without histopathological evaluation. while recurrence has been occasionally reported in humans, the prognosis is considered good. |
prostate cancer is the most common male malignancy in the western world, and as life expectancy increase, the prevalence is also expected to increase in an aging population. radiotherapy is an important therapeutic modality for the treatment of patients with localized or locally advanced prostate cancer utilizing both external beam radiotherapy (ebrt) and brachytherapy. over the last few decades, significant advances in technology related to high - dose - rate (hdr) brachytherapy have seen an increase in its use as a localized boost to ebrt of the prostate. an important technological advancement in hdr brachytherapy is the evolution from forward planning to inverse planning techniques [3, 4, 5 ]. the inverse planning optimization algorithm currently implemented in the nucletron oncentra (nucletron b.v., veenendaal, the netherlands) brachytherapy treatment planning system (tps) is the inverse planning simulated annealing (ipsa) optimization algorithm. inverse planning simulated annealing is based on contoured anatomy and optimizes dwell times using a simulated annealing algorithm. the algorithm is constrained by user specific surface and volumetric dose constraints for both the target volume and organs at risk to calculate clinically acceptable treatment plans. inverse planning simulated annealing optimized brachytherapy treatment plans are characterized with large isolated dwell times at the first or last dwell position of each catheter. the central dwell positions however consist of extremely short, or zero, dwell times. there is concern amongst users that these large isolated dwell times may lead to hot spots, either inside or outside the target. also, the potential of catheter shifts relative to the target and organs at risk may lead to a more significant change in delivered dose to the volumes of interest relative to plans with more uniform dwell times. recently, the nucletron oncentra tps has added the dwell time deviation constraint (dtdc) parameter to the ipsa optimization process. this parameter constrains the allowable dwell times in the optimization process and can be set to a value between 0 and 1 in increments of 0.1. a value of 0 corresponds to completely unrestricted dwell times and a value of 1 results in homogeneous dwell times. the displacement of catheters relative to the target and organs at risk during the time between imaging and patient treatment has been reported by a number of groups [10, 11, 12, 13 ]. the displacements have predominantly been reported along the patient longitudinal axis and in the caudal direction primarily due to acute edema between the prostate and perineal skin. previous work from our group demonstrated a median catheter displacement of 7.5 mm in caudal direction (range 2.9 - 23.9 mm) in the time from planning ct to treatment (approximately 1 - 3 hours). have reported significant adverse effects on the tumor control probability for catheter displacements larger than 3 mm, including underdosage of the target and overdosage to critical structures. due to these findings, our department has implemented a clinical protocol, in which internal catheter positions are verified and corrected immediately prior to treatment delivery with a tolerance of 3 mm. this study aims to determine if the dtdc parameter can be optimized to improve the robustness of hdr prostate brachytherapy plans to catheter displacements relative to patient anatomy. a set of 10 clinically acceptable prostate plans were re - optimized with a dtdc parameter of 0 and 0.4. the values of 0 and 0.4 were chosen to reflect the change that is currently occurring in our clinical protocol. for each plan, catheter displacements of 3, 7, and 14 mm were retrospectively applied, and the change in dvh indices and conformity indices analyzed. these ct plans were created between 2012 and 2015 on the nucletron oncentra brachytherapy tps (v4.3, nucletron b.v., veenendaal, the netherlands). the prostate planning target volume (ptv), urethra, and rectum were all contoured by the same radiation oncologist at the time of treatment. prostate volumes varied between 25.1 and 59.4 cm and the number of catheters used was between 14 and 24. catheter insertion (using oncosmart, proguide sharp needle, 6f, nucletron b.v., veenendaal, the netherlands), ct scan, planning, and treatment are all performed on the same day, and the mean time between the planning ct and treatment was 182 minutes. each plan was optimized using the ipsa algorithm using the parameters outlined in table 1. as per clinical protocol the plans were then re - optimized with the dtdc parameter set to 0.4 and all other parameters kept constant. the dwell time characteristics of each plan were then compared using the plan modulation index (m), as defined by smith.. the plan modulation index is defined as the maximum deviation of dwell time from the average dwell time for each catheter, normalized to the maximum dwell time for the treatment plan, averaged over all catheters in the plan. inverse planning simulated annealing (ipsa) optimization parameters used for patient plan optimization ptv planning target volume catheter displacements in the caudal direction were then simulated for each plan. displacements of this magnitude were chosen as they corresponded to clinically relevant catheter displacements, as found in a previous study by our group. our center has implemented a clinical protocol, in which catheter displacements 3 mm are corrected for, immediately prior to treatment by altering the indexer length at the treatment console. implanting the catheters past the prostate base into the bladder allowed for extra dwell positions beyond the prostate in the event of a caudal shift. all patient plans were assessed by evaluating dose volume histogram (dvh) indices and dose quality indices. furthermore, a normal tissue (nt) contour was created by adding a 2 mm margin around the ptv and subtracting this expanded contour from the external contour, e.g. nt = body (ptv + 2 mm). these parameters were automatically calculated by the tps and are highly dependent on the size of the histogram bin used for calculation. because of this, a conformity index (ci), a dose inhomogeneity index (dhi), and an overdose volume index (odi) were also calculated for each plan. clinically acceptable dose volume histogram (dvh) indices ptv planning target volume the ci used in this study is the one introduced by van't riet. and is shown in equation 1:1cl = vt, refvtvt, refvref where v t, ref is the volume of the ptv receiving a dose greater than or equal to the 100% isodose, v t is the volume of the ptv, and v ref is the volume of the 100% isodose. the dhi parameter gives an indication of the homogeneity of the dose within the ptv, which was first introduced by wu. and is shown in equation 2:2dhi = vt, ref - vt,1.5refvt, ref where v t,1.5ref is the volume of the ptv receiving a dose greater than or equal to the 150% isodose, and v t, ref is as described above. finally, the odi parameter indicates the amount of high dose (greater than 200%) within the ptv:3odi = vt,2refvt, ref where v t,2ref is the volume of the ptv receiving a dose greater than or equal to the 200% isodose. the change in dvh and dose quality indices was then calculated as a function of catheter displacement for both dtdc values of 0 and 0.4. the change in these indices with increasing catheter displacement gives an indication of the robustness of the plans to changes in catheter position relative to the targets and organs at risk between planning ct and treatment. statistical significance between the dtdc values was verified using a paired t - test with = 0.05 (corresponding to a 5% significance level). these ct plans were created between 2012 and 2015 on the nucletron oncentra brachytherapy tps (v4.3, nucletron b.v., veenendaal, the netherlands). the prostate planning target volume (ptv), urethra, and rectum were all contoured by the same radiation oncologist at the time of treatment. prostate volumes varied between 25.1 and 59.4 cm and the number of catheters used was between 14 and 24. catheter insertion (using oncosmart, proguide sharp needle, 6f, nucletron b.v., veenendaal, the netherlands), ct scan, planning, and treatment are all performed on the same day, and the mean time between the planning ct and treatment was 182 minutes. each plan was optimized using the ipsa algorithm using the parameters outlined in table 1. as per clinical protocol the plans were then re - optimized with the dtdc parameter set to 0.4 and all other parameters kept constant. the dwell time characteristics of each plan were then compared using the plan modulation index (m), as defined by smith.. the plan modulation index is defined as the maximum deviation of dwell time from the average dwell time for each catheter, normalized to the maximum dwell time for the treatment plan, averaged over all catheters in the plan. inverse planning simulated annealing (ipsa) optimization parameters used for patient plan optimization ptv planning target volume catheter displacements in the caudal direction were then simulated for each plan. offsets of 3, 7, and 14 mm were performed. displacements of this magnitude were chosen as they corresponded to clinically relevant catheter displacements, as found in a previous study by our group. our center has implemented a clinical protocol, in which catheter displacements 3 mm are corrected for, immediately prior to treatment by altering the indexer length at the treatment console. implanting the catheters past the prostate base into the bladder allowed for extra dwell positions beyond the prostate in the event of a caudal shift. all patient plans were assessed by evaluating dose volume histogram (dvh) indices and dose quality indices. furthermore, a normal tissue (nt) contour was created by adding a 2 mm margin around the ptv and subtracting this expanded contour from the external contour, e.g. nt = body (ptv + 2 mm). these parameters were automatically calculated by the tps and are highly dependent on the size of the histogram bin used for calculation. because of this, a conformity index (ci), a dose inhomogeneity index (dhi), and an overdose volume index (odi) were also calculated for each plan. clinically acceptable dose volume histogram (dvh) indices ptv planning target volume the ci used in this study is the one introduced by van't riet. and is shown in equation 1:1cl = vt, refvtvt, refvref where v t, ref is the volume of the ptv receiving a dose greater than or equal to the 100% isodose, v t is the volume of the ptv, and v ref is the volume of the 100% isodose. the dhi parameter gives an indication of the homogeneity of the dose within the ptv, which was first introduced by wu. and is shown in equation 2:2dhi = vt, ref - vt,1.5refvt, ref where v t,1.5ref is the volume of the ptv receiving a dose greater than or equal to the 150% isodose, and v t, ref is as described above. finally, the odi parameter indicates the amount of high dose (greater than 200%) within the ptv:3odi = vt,2refvt, ref where v t,2ref is the volume of the ptv receiving a dose greater than or equal to the 200% isodose. the change in dvh and dose quality indices was then calculated as a function of catheter displacement for both dtdc values of 0 and 0.4. the change in these indices with increasing catheter displacement gives an indication of the robustness of the plans to changes in catheter position relative to the targets and organs at risk between planning ct and treatment. statistical significance between the dtdc values was verified using a paired t - test with = 0.05 (corresponding to a 5% significance level). initial clinical prostate plans ipsa optimized with a dtdc value of 0 produced a large spread of dwell times, relative to those plans optimized with a dtdc value of 0.4. the plan modulation index (m) for each plan variant is given in table 3 along with the total dwell time, normalized to the air kerma strength of the source. the average m for the 0 dtdc case (1 sd) was equal to 0.44 0.07, whereas for the 0.4 dtdc case m = 0.20 0.06. the effect of increasing the dtdc parameter is to limit the maximum dwell time in any catheter ; this is reflected by the decreasing value of m, as more homogeneous dwell time distribution is created within each catheter. the total dwell time, normalized to the air kerma strength of the source was also seen to decrease for plans optimized with a dtdc value of 0.4, relative to a dtdc of 0. this is due to the reduction in large isolated dwell times at the first or last dwell positions of each catheter. plan modulation index (m) and normalized total dwell time (cgycm) dtdc dwell time deviation constraint table 4 shows the change in dvh and dose quality indices when re - optimizing the plans with a dtdc parameter of 0.4. by changing the dtdc value to 0.4, the coverage of the ptv is improved, as reflected by the increase in ptv v100% and ci, however, only the difference in ci was found to be statistically significant. statistically significant reductions in nt v100%, nt v150%, and nt v200% were also found when changing dtdc from 0 to 0.4. this, along with the improvement in ci, is due to the reduction in the large isolated dwell times just outside of the ptv, which are delivering higher doses to the adjacent healthy tissue. on the other hand, there is a statistically significant increase in ptv v150%, ptv v200%, dhi, and odi for dtdc 0.4 versus dtdc 0. the rectum v150% was largely unaffected by the dtdc change, and a small reduction in the urethra v120% was observed. initial dose volume histogram (dvh) and dose indices before catheter displacement ptv planning target volume, nt normal tissue, ci conformity index, dhi dose inhomogeneity index, odi overdose index, v100%, v150%, v200%, v70%, v120% volume of relevant structure receiving 100%, 150%, 200%, 70%, and 120% of the prescribed isodose, respectively, dtdc dwell time deviation constraint the effect of catheter displacements on dvh and dose quality indices are shown in tables 5, 6, and 7 for catheter shifts of 3, 7, and 14 mm, respectively. overall, a dtdc value of 0 improves the robustness of ptv coverage to catheter displacements relative to a dtdc value of 0.4. this is reflected in the smaller changes in ptv v100% (figure 1) and ci (figure 2) for all three catheter displacement values. the dwell positions moving out of the ptv in the dtdc 0 plans have smaller weights relative to those in the dtdc 0.4 plans, resulting in smaller changes in ptv v100% and ci with catheter displacement. the change in ptv v100% as a function of catheter displacement for plans optimized with dtdc set to 0 and 0.4 (error bars showing 95% confidence interval) the change in ptv v200% as a function of catheter displacement for plans optimized with dtdc set to 0 and 0.4 (error bars showing 95% confidence interval) change in dose volume histogram (dvh) and dose indices for a 3 mm catheter displacement ptv conformity index, dhi dose inhomogeneity index, odi overdose index, v100%, v150%, v200%, v70%, v120% volume of relevant structure receiving 100%, 150%, 200%, 70%, and 120% of the prescribed isodose, respectively, dtdc dwell time deviation constraint change in dose volume histogram (dvh) and dose indices for a 7 mm catheter displacement ptv planning target volume, nt normal tissue, ci conformity index, dhi dose inhomogeneity index, odi overdose index, v100%, v150%, v200%, v70%, v120% volume of relevant structure receiving 100%, 150%, 200%, 70%, and 120% of the prescribed isodose, respectively, dtdc dwell time deviation constraint change in dose volume histogram (dvh) and dose indices for a 14 mm catheter displacement ptv planning target volume, nt normal tissue, ci conformity index, dhi dose inhomogeneity index, odi overdose index, v100%, v150%, v200%, v70%, v120% volume of relevant structure receiving 100%, 150%, 200%, 70%, and 120% of the prescribed isodose, respectively, dtdc dwell time deviation constraint conversely, a dtdc value of 0.4 improves the robustness of the plans to changes in hotspots, reflected by statistically significant differences in changes to ptv v150%, ptv v200% (figure 3), dhi, and odi (figure 4) compared to plans optimized with a dtdc value of 0 for catheter displacements up to 14 mm. this behavior can be explained by considering that the isolated dwell times at the end of the catheters often exist just outside the ptv before a catheter shift is implemented. therefore, the v150% and v200% volumes are surrounding these dwell positions and, as a catheter shift is implemented, they move further away from the ptv and into healthy tissue. the change in ci as a function of catheter displacement for plans optimized with dtdc set to 0 and 0.4 (error bars showing 95% confidence interval) the change in odi as a function of catheter displacement for plans optimized with dtdc set to 0 and 0.4 (error bars showing 95% confidence interval) for a catheter displacement of 3 mm, plans optimized with a dtdc value of 0.4 were found to be more robust in terms of nt v100%, nt v150%, and nt v200%. conversely, for larger catheter shifts of 7 and 14 mm, the plans optimized with dtdc 0 were more robust. this is due to the fact that for a catheter shift of 3 mm, one of the large isolated dwell positions in the dtdc 0 plans moves into the normal tissue. however, for larger shifts, subsequent dwell positions moving into the normal tissue have significantly smaller dwell times compared to those in the dtdc 0.4 plans, resulting in smaller changes in nt v100%, nt v150%, and nt v200%. the urethra v120% was more sensitive to catheter displacements than the rectum v70% for both values of dtdc. a dtdc value of 0.4 improved the robustness of the plans to changes in urethra v120% compared to plans optimized with a dtdc value of 0, with statistically significant differences for catheter displacements of 3 and 7 mm. there was also no statistically significant difference found between dtdc values for the rectum v70%. initial clinical prostate plans ipsa optimized with a dtdc value of 0 produced a large spread of dwell times, relative to those plans optimized with a dtdc value of 0.4. the plan modulation index (m) for each plan variant is given in table 3 along with the total dwell time, normalized to the air kerma strength of the source. the average m for the 0 dtdc case (1 sd) was equal to 0.44 0.07, whereas for the 0.4 dtdc case m = 0.20 0.06. the effect of increasing the dtdc parameter is to limit the maximum dwell time in any catheter ; this is reflected by the decreasing value of m, as more homogeneous dwell time distribution is created within each catheter. the total dwell time, normalized to the air kerma strength of the source was also seen to decrease for plans optimized with a dtdc value of 0.4, relative to a dtdc of 0. this is due to the reduction in large isolated dwell times at the first or last dwell positions of each catheter. plan modulation index (m) and normalized total dwell time (cgycm) dtdc dwell time deviation constraint table 4 shows the change in dvh and dose quality indices when re - optimizing the plans with a dtdc parameter of 0.4. by changing the dtdc value to 0.4, the coverage of the ptv is improved, as reflected by the increase in ptv v100% and ci, however, only the difference in ci was found to be statistically significant. statistically significant reductions in nt v100%, nt v150%, and nt v200% were also found when changing dtdc from 0 to 0.4. this, along with the improvement in ci, is due to the reduction in the large isolated dwell times just outside of the ptv, which are delivering higher doses to the adjacent healthy tissue. on the other hand, there is a statistically significant increase in ptv v150%, ptv v200%, dhi, and odi for dtdc 0.4 versus dtdc 0. the rectum v150% was largely unaffected by the dtdc change, and a small reduction in the urethra v120% was observed. initial dose volume histogram (dvh) and dose indices before catheter displacement ptv planning target volume, nt normal tissue, ci conformity index, dhi dose inhomogeneity index, odi overdose index, v100%, v150%, v200%, v70%, v120% volume of relevant structure receiving 100%, 150%, 200%, 70%, and 120% of the prescribed isodose, respectively, dtdc dwell time deviation constraint the effect of catheter displacements on dvh and dose quality indices are shown in tables 5, 6, and 7 for catheter shifts of 3, 7, and 14 mm, respectively. overall, a dtdc value of 0 improves the robustness of ptv coverage to catheter displacements relative to a dtdc value of 0.4. this is reflected in the smaller changes in ptv v100% (figure 1) and ci (figure 2) for all three catheter displacement values. the dwell positions moving out of the ptv in the dtdc 0 plans have smaller weights relative to those in the dtdc 0.4 plans, resulting in smaller changes in ptv v100% and ci with catheter displacement. the change in ptv v100% as a function of catheter displacement for plans optimized with dtdc set to 0 and 0.4 (error bars showing 95% confidence interval) the change in ptv v200% as a function of catheter displacement for plans optimized with dtdc set to 0 and 0.4 (error bars showing 95% confidence interval) change in dose volume histogram (dvh) and dose indices for a 3 mm catheter displacement ptv conformity index, dhi dose inhomogeneity index, odi overdose index, v100%, v150%, v200%, v70%, v120% volume of relevant structure receiving 100%, 150%, 200%, 70%, and 120% of the prescribed isodose, respectively, dtdc dwell time deviation constraint change in dose volume histogram (dvh) and dose indices for a 7 mm catheter displacement ptv planning target volume, nt normal tissue, ci conformity index, dhi dose inhomogeneity index, odi overdose index, v100%, v150%, v200%, v70%, v120% volume of relevant structure receiving 100%, 150%, 200%, 70%, and 120% of the prescribed isodose, respectively, dtdc dwell time deviation constraint change in dose volume histogram (dvh) and dose indices for a 14 mm catheter displacement ptv planning target volume, nt normal tissue, ci conformity index, dhi dose inhomogeneity index, odi overdose index, v100%, v150%, v200%, v70%, v120% volume of relevant structure receiving 100%, 150%, 200%, 70%, and 120% of the prescribed isodose, respectively, dtdc dwell time deviation constraint conversely, a dtdc value of 0.4 improves the robustness of the plans to changes in hotspots, reflected by statistically significant differences in changes to ptv v150%, ptv v200% (figure 3), dhi, and odi (figure 4) compared to plans optimized with a dtdc value of 0 for catheter displacements up to 14 mm. this behavior can be explained by considering that the isolated dwell times at the end of the catheters often exist just outside the ptv before a catheter shift is implemented. therefore, the v150% and v200% volumes are surrounding these dwell positions and, as a catheter shift is implemented, they move further away from the ptv and into healthy tissue. the change in ci as a function of catheter displacement for plans optimized with dtdc set to 0 and 0.4 (error bars showing 95% confidence interval) the change in odi as a function of catheter displacement for plans optimized with dtdc set to 0 and 0.4 (error bars showing 95% confidence interval) for a catheter displacement of 3 mm, plans optimized with a dtdc value of 0.4 were found to be more robust in terms of nt v100%, nt v150%, and nt v200%. conversely, for larger catheter shifts of 7 and 14 mm, the plans optimized with dtdc 0 were more robust. this is due to the fact that for a catheter shift of 3 mm, one of the large isolated dwell positions in the dtdc 0 plans moves into the normal tissue. however, for larger shifts, subsequent dwell positions moving into the normal tissue have significantly smaller dwell times compared to those in the dtdc 0.4 plans, resulting in smaller changes in nt v100%, nt v150%, and nt v200%. the urethra v120% was more sensitive to catheter displacements than the rectum v70% for both values of dtdc. a dtdc value of 0.4 improved the robustness of the plans to changes in urethra v120% compared to plans optimized with a dtdc value of 0, with statistically significant differences for catheter displacements of 3 and 7 mm. there was also no statistically significant difference found between dtdc values for the rectum v70%. as expected, the plan modulation index (m) was observed to decrease with an increased value of dtdc. the calculated values of m = 0.44 0.07 (dtdc = 0) and m = 0.20 0.06 (dtdc = 0.4) are in close agreement with those found in a previous study by smith.. the increase value of dtdc was also observed to increase the ptv v100%, v150%, and v200%. the increase in ptv v150% of 4% and ptv v200% of 1.5% when changing the dtdc value from 0 to 0.4 was also observed in the same study. this increase resulted in dvh indices that were still clinically acceptable for treatment according to our local protocol as outlined in table 2. contrary to expectation, the dtdc value of 0 produced plans that were more robust to catheter displacements in terms of target coverage. however, for a catheter displacement of 3 mm, the average ci was 0.693 0.049 and 0.723 0.045 for dtdc = 0 and dtdc = 0.4, respectively. our center has implemented a clinical protocol, in which catheter displacements 3 mm are corrected for, immediately prior to treatment by adjusting the indexer length on the treatment control system. therefore, if used in combination with this catheter correction protocol, plans optimized with a dtdc value of 0.4 may be clinically superior to those optimized with dtdc = 0, especially when considering that using a dtdc value of 0.4 improves robustness to changes in hotspots and dose to oars and healthy tissue. one recent advance in the field of hdr prostate brachytherapy has been the use of 3d trans - rectal ultrasound (trus) based treatment planning. the use of this technique has been shown to significantly reduce the time between imaging and treatment compared to ct based treatment planning. have shown that for an average time between imaging and treatment of 51.2 minutes, the average needle displacement was found to be 1 mm. this displacement is small relative to those noted in other studies [11, 14 ], and is likely due to the reduction in time between imaging and treatment. therefore, one current initiative of our group is to reduce the time between imaging and treatment, and the introduction of 3d trus based planning is being investigated. a previous study by our group has shown that catheter displacements in the cranial direction occurred for only 3 of 48 cases, with the remainder occurring in the caudal direction. one limitation of this study is that catheter displacements were only considered along the longitudinal axis in the caudal direction. catheter shifts in the lateral and anterior - posterior directions due to edema were also not considered. preliminary calculations showed that small changes in dtdc, e.g. from 0.2 - 0.4 do not significantly affect the robustness of the plans to catheter displacements. furthermore, values of 0 and 0.4 were chosen to reflect the change that is currently occurring in our clinical protocol. historically, plans have been optimized using a dtdc value of 0 ; however previous studies have shown that a dtdc value of 0.4 gives plan modulation equivalent to graphical optimization without significantly compromising plan quality. the results of this study indicate that the robustness of clinically acceptable prostate plans to catheter displacements in the caudal direction are dependent on the dtdc parameter. a dtdc value of 0 improves the robustness of ptv coverage to catheter displacements relative to a dtdc value of 0.4. whereas a dtdc value of 0.4 improves the robustness of the plans to changes in hotspots compared to a dtdc value of 0. for a catheter displacement of 3 mm, plans optimized with a dtdc value of 0.4 were found to be more robust in terms of the dose to normal tissue. however, for larger catheter shifts, the plans optimized with dtdc 0 were more robust, due to larger shifts moving relatively small weight dwell positions into the normal tissue compared to the dtdc 0.4 plans. when used in combination with a pre - treatment catheter displacement correction protocol and a tolerance of 3 mm, a dtdc value of 0.4 may produce clinically superior plans. in future work, attempts will be made to measure the actual dwell times delivered by the afterloader as compared to those calculated by the tps for a range of dtdc values and the effect on the dose examined. | purposeinverse planning simulated annealing (ipsa) optimized brachytherapy treatment plans are characterized with large isolated dwell times at the first or last dwell position of each catheter. the potential of catheter shifts relative to the target and organs at risk in these plans may lead to a more significant change in delivered dose to the volumes of interest relative to plans with more uniform dwell times.material and methodsthis study aims to determine if the nucletron oncentra dwell time deviation constraint (dtdc) parameter can be optimized to improve the robustness of high - dose - rate (hdr) prostate brachytherapy plans to catheter displacements. a set of 10 clinically acceptable prostate plans were re - optimized with a dtdc parameter of 0 and 0.4. for each plan, catheter displacements of 3, 7, and 14 mm were retrospectively applied and the change in dose volume histogram (dvh) indices and conformity indices analyzed.resultsthe robustness of clinically acceptable prostate plans to catheter displacements in the caudal direction was found to be dependent on the dtdc parameter. a dtdc value of 0 improves the robustness of planning target volume (ptv) coverage to catheter displacements, whereas a dtdc value of 0.4 improves the robustness of the plans to changes in hotspots.conclusionsthe results indicate that if used in conjunction with a pre - treatment catheter displacement correction protocol and a tolerance of 3 mm, a dtdc value of 0.4 may produce clinically superior plans. however, the effect of the dtdc parameter in plan robustness was not observed to be as strong as initially suspected. |
endoscopic ultrasonography (eus) and endobronchial ultrasound - fine - needle aspiration (ebus - fna), is an accurate technique for evaluation of mediastinal lymph nodes (mln) and stadification of lung cancer. the aims of the study are to evaluate the feasibility and the efficacy of the combined technique compared with mediastinoscopy for the diagnosis of mln. all patients with suspected malignant mln and/or lung lesion identified by positron emission tomography - computed tomography underwent combined eus - ebus - fna. the combined procedure was performed in outpatients under general anesthesia for eus and sedation by intravenous midazolam for ebus when performed separately, using linear - array echoendoscopes. the mln were punctured during the eus and ebus - fna procedures with a 22 gauge needle. thirty - four patients underwent consecutively eus and ebus - fna between september 2011 and november 2013 (8 women, 26 men, mean age of 65.9 year, range : 51 - 83). combined eus - ebus - fna was performed in a single time procedure in 26 patients (mean time 50 min) and in two different times in eight patients (mean delay 3 days). mediastinoscopy was performed in nine patients and confirmed in eight patients the initial combined eus - ebus - fna diagnosis. the diagnosis was obtained in 91.2% with eus - fna, 70.6% with ebus - fna and 97% when combined procedure was performed. the overall sensitivity, specificity, positive and negative predictive values of eus - ebus - fna for diagnosing malignancy were 96.5%, 100%, 100% and 90% respectively. combined eus - ebus - fna represents an accurate technique in the diagnosis of mln, can be done in a single time procedure and has the advantage of being less invasive than mediastinoscopy. | objectives : endoscopic ultrasonography (eus) and endobronchial ultrasound - fine - needle aspiration (ebus - fna), is an accurate technique for evaluation of mediastinal lymph nodes (mln) and stadification of lung cancer. the aims of the study are to evaluate the feasibility and the efficacy of the combined technique compared with mediastinoscopy for the diagnosis of mln.design and methods : all patients with suspected malignant mln and/or lung lesion identified by positron emission tomography - computed tomography underwent combined eus - ebus - fna. the combined procedure was performed in outpatients under general anesthesia for eus and sedation by intravenous midazolam for ebus when performed separately, using linear - array echoendoscopes. the mln were punctured during the eus and ebus - fna procedures with a 22 gauge needle.results : thirty - four patients underwent consecutively eus and ebus - fna between september 2011 and november 2013 (8 women, 26 men, mean age of 65.9 year, range : 51 - 83). combined eus - ebus - fna was performed in a single time procedure in 26 patients (mean time 50 min) and in two different times in eight patients (mean delay 3 days). twenty - five malignant and 9 inflammatory lesions were diagnosed. mediastinoscopy was performed in nine patients and confirmed in eight patients the initial combined eus - ebus - fna diagnosis. the diagnosis was obtained in 91.2% with eus - fna, 70.6% with ebus - fna and 97% when combined procedure was performed. the overall sensitivity, specificity, positive and negative predictive values of eus - ebus - fna for diagnosing malignancy were 96.5%, 100%, 100% and 90% respectively. no complications related to the procedure were observed.conclusion:combined eus - ebus - fna represents an accurate technique in the diagnosis of mln, can be done in a single time procedure and has the advantage of being less invasive than mediastinoscopy. |
if you look into an abyss, the abyss will look into you. - ' beyond good and evil : prelude to a philosophy of the future ', friedrich nietzsche the study by regli and colleagues in the previous issue of critical care reports the effects of different levels of positive end - expiratory pressure (peep) on respiratory function and hemodynamics in an animal model of acute respiratory distress syndrome (ards) associated with intra - abdominal hypertension (iah). iah is highly prevalent in critically ill patients and has a serious impact on the function of the lungs and peripheral organs. in the presence of alveolar capillary membrane damage, iah promotes lung injury as well as edema and increases intra - thoracic pressures, leading to atelectasis, airway closure, and deterioration of gas exchange. regli and colleagues reported an increase of end - expiratory lung volume and gas exchange, with a reduction of pulmonary shunt and dead space fraction when intra - abdominal pressure (iap)-matching peep was applied. although high iap - matching peep decreased cardiac output, moderate iap - matching peep provided a compromise between lung function and hemodynamics. in an experimental model of iah in normal animals, the same authors showed that peep level matched to iap did not improve oxygenation but reduced cardiac output. the optimal setting of mechanical ventilation in ards with iah has not been assessed yet. as a consequence, the hemodynamics and respiratory effects of mechanical ventilation in these patients can not be predicted. a protective ventilation strategy with a low tidal volume (6 ml / kg ideal body weight) and an airway plateau pressure of below 30 cm h2o improves survival in patients with ards. on the other hand, low tidal volume may lead to alveolar de - recruitment in the presence of ards associated with iah. the effect of tidal volume in iah depends on the degree of inspiratory trans - pulmonary pressure that is usually reduced because of cephalic shift of the diaphragm. recently, santos and colleagues showed that, in extra - pulmonary ards with iah, high tidal volume (10 ml / kg ideal body weight) decreased atelectasis and inflammatory response of the lung tissue and improved oxygenation by increasing end - inspiratory trans - pulmonary pressure. recruitment maneuvers in patients with ards may have a beneficial effect on the respiratory function. in the presence of iah and increased chest wall elastance, the inspiratory pressure of the respiratory system applied during recruitment maneuver should be higher than usually applied, in order to achieve an inspiratory trans - pulmonary pressure that is large enough enough to reopen collapsed alveoli. the study by regli and colleagues shows that the peep setting based simply on iap could have a negative impact on hemodynamics. previous clinical studies reported different results on the role of peep in ards patients with iah. krebs and colleagues showed similar beneficial effects of peep on gas exchange and alveolar recruitment in ards patients with or without iah. gattinoni and colleagues showed that the effects of peep on alveolar recruitment were more beneficial in patients with extra - pulmonary as compared with pulmonary ards. however, independently of iah, both studies found that the ' optimal ' peep should be selected according to the ' best ' elastance of the respiratory system and the lung. higher peep in the presence of iah markedly increases pleural pressure, negatively affecting cardiovascular function and impeding the lymphatic drainage. it is likely that, in cases in which higher peep levels are required, the open abdomen might be considered, according to patient 's clinical condition. the prophylactic use of the open abdomen technique should be reserved for surgical patients with a high risk of abdominal compartment syndrome and death. in patients with severe ards and iah, the prone position could be used to reduce the cranial diaphragmatic load, even if prone positioning may induce a mild elevation in iap or ameliorate or exacerbate iah and may be difficult to apply in patients with transiently open abdomen treatment. finally, experimental evidence suggests that assisted ventilation should be cautiously applied in the presence of mild or severe ards associated with iah. in conclusion, we suggest that the optimal ventilator management of patients with ards and iah would include the following : (a) intra - abdominal, esophageal pressure, and hemodynamic monitoring ; (b) ventilation setting with protective tidal volume, recruitment maneuvers, and peep level set according to the ' best ' compliance of the respiratory system or the lung ; (c) deep sedation with or without neuromuscular paralysis in severe ards ; and (d) open abdomen in selected patients with severe abdominal compartment syndrome. ards : acute respiratory distress syndrome ; iah : intra - abdominal hypertension ; iap : intra - abdominal pressure ; peep : positive end - expiratory pressure. | intra - abdominal hypertension is frequent in surgical and medical critically ill patients. intra - abdominal hypertension has a serious impact on the function of respiratory as well as peripheral organs. in the presence of alveolar capillary damage, which occurs in acute respiratory distress syndrome (ards), intra - abdominal hypertension promotes lung injury as well as edema, impedes the pulmonary lymphatic drainage, and increases intra - thoracic pressures, leading to atelectasis, airway closure, and deterioration of respiratory mechanics and gas exchange. the optimal setting of mechanical ventilation and its impact on respiratory function and hemodynamics in ards associated with intra - abdominal hypertension are far from being assessed. we suggest that the optimal ventilator management of patients with ards and intra - abdominal hypertension would include the following : (a) intra - abdominal, esophageal pressure, and hemodynamic monitoring ; (b) ventilation setting with protective tidal volume, recruitment maneuver, and level of positive end - expiratory pressure set according to the ' best ' compliance of the respiratory system or the lung ; (c) deep sedation with or without neuromuscular paralysis in severe ards ; and (d) open abdomen in selected patients with severe abdominal compartment syndrome. |
the reasons for errors made in ultrasound diagnosis of the urinary system are usually of multifactorial nature. generally, they result from improper technique of ultrasound (us) examination or its erroneous interpretation. such errors are frequent effects of insufficient experience of the ultrasonographer, inadequate class of the scanner, insufficient knowledge of its operation and of wrong preparation of patients, their constitution and severe condition as well as the lack of cooperation during the examination. the reasons for misinterpretations of ultrasound images of the urinary system may lie in a large polymorphism of the kidney (defects and developmental variants) and may result from improper access to the organ as well as from the presence of artefacts. moreover, mistakes in ultrasound diagnosis of the urinary system are frequently related to the lack of knowledge of the management algorithms and diagnostic possibilities of other imaging modalities. below, the authors list errors in ultrasound diagnosis of the urinary system divided into : errors resulting from improper technique of examination, incorrect preparation of patients for the examination or their constitution and errors resulting from misinterpretations of ultrasound images. insufficient quality of ultrasound equipment precludes obtaining diagnostic images and thus, involves a risk of failing to visualize pathologies, mistaking artefacts for pathologies and making differential diagnosis impossible to conduct.inadequate selection of the transducer, i.e. wrong type of the transducer and frequency, e.g. selecting convex probes with the frequency 2.05.0 mhz in examining the urinary system in children (fig. 1 a, b).inadequate set up selection for the examination of given organs, e.g. to examine the urinary system, one should choose the abdomen set up and to examine the kidneys, the correct choice is kidney set up. inappropriate gain of the ultrasound beam and other parameters (tgc, brightness of the monitor, penetration, focus). each time, the image should be optimized and adjusted to the conditions of the examination and constitution of the patient.improper lighting in the ultrasound laboratory, i.e. too bright rooms or placing the ultrasound monitor opposite the windows.noise which affects concentration of the ultraso nographer.excess tiredness of the ultrasonographer which limits logical thinking and affects image interpretation.artefacts and distortions caused by electric and electromagnetic devices which affect the operation of the ultrasound scanner (e.g. magnetic resonance, respirators etc.). insufficient quality of ultrasound equipment precludes obtaining diagnostic images and thus, involves a risk of failing to visualize pathologies, mistaking artefacts for pathologies and making differential diagnosis impossible to conduct. inadequate selection of the transducer, i.e. wrong type of the transducer and frequency, e.g. selecting convex probes with the frequency 2.05.0 mhz in examining the urinary system in children (fig. inadequate set up selection for the examination of given organs, e.g. to examine the urinary system, one should choose the abdomen set up and to examine the kidneys, the correct choice is kidney set up. inappropriate gain of the ultrasound beam and other parameters (tgc, brightness of the monitor, penetration, focus). each time, the image should be optimized and adjusted to the conditions of the examination and constitution of the patient. improper lighting in the ultrasound laboratory, i.e. too bright rooms or placing the ultrasound monitor opposite the windows. noise which affects concentration of the ultraso nographer. artefacts and distortions caused by electric and electromagnetic devices which affect the operation of the ultrasound scanner (e.g. magnetic resonance, respirators etc.). error caused by the selection of the transducer with too low frequency in ultrasound examination of the urinary system in children. a. examination performed with the use of a convex probe with the frequency of 2.06.0 mhz visualizes solely the dilatation of the upper pelvicalyceal system. b. examination performed with a high - frequency transducer (9.012.0 mhz) visualizes the dilatation of the pelvicalyceal system also in the region of the middle and lower calyces and renal pelvis. intestinal gas and contents cause artefacts which conceal the internal organs.the inability to take and hold breath by the patient may considerably inhibit or preclude kidney visualization, particularly in obese patients.lack of cooperation with the patient : children lack of cooperation, crying, screaming, physical agitation;unconscious patients lack of cooperation in terms of breathing, position and taking the patient 's history. tenderness and pain in the abdominal cavity impossibility to apply necessary pressure with the transducer.pyknic constitution high position of the diaphragm may considerably reduce the possibility to visualize the kidneys (an attempt should be made to visualize them by intercostal access) ; the presence of gas in the intestine frequently produces artefacts that conceal the kidneys.patients with dyspnea impossibility to draw a deep breath and frequently, inability to remain in supine position.open wounds in the region of the abdomen, dressings, sutures or catheters optimal transducer application is impossible.empty urinary bladder impossibility to assess the bladder and other organs of the pelvis minor. intestinal gas and contents cause artefacts which conceal the internal organs. the inability to take and hold breath by the patient may considerably inhibit or preclude kidney visualization, particularly in obese patients. lack of cooperation with the patient : children lack of cooperation, crying, screaming, physical agitation;unconscious patients lack of cooperation in terms of breathing, position and taking the patient 's history. children lack of cooperation, crying, screaming, physical agitation ; unconscious patients lack of cooperation in terms of breathing, position and taking the patient 's history. tenderness and pain in the abdominal cavity impossibility to apply necessary pressure with the transducer. high position of the diaphragm may considerably reduce the possibility to visualize the kidneys (an attempt should be made to visualize them by intercostal access) ; the presence of gas in the intestine frequently produces artefacts that conceal the kidneys. patients with dyspnea impossibility to draw a deep breath and frequently, inability to remain in supine position. open wounds in the region of the abdomen, dressings, sutures or catheters optimal transducer application is impossible. empty urinary bladder impossibility to assess the bladder and other organs of the pelvis minor. errors concerning the number of kidneys : failure to visualize the kidney in its typical site : agenesis / aplasia sonography does not enable the differentiation between these two pathologies;renal ectopia or dystopia;hypoplasia or aplasia the kidney is so small or so altered that its identification is impossible for various reasons (obesity, artefacts produced by intestinal gas, kidney localization etc.). the final verification is conducted on the basis of intravenous urography or computed tomography.situations occurring more rarely : renal agenesis in neonates the possibility to mistake enlarged adrenal glands for hypoplastic kidneys;tumors of the gastrointestinal tract pseudokidney, particularly in patients with unilateral renal agenesis;ectopic kidneys possibility to mistake pelvic kidney for a tumor - like lesion;in extreme cases, ectopic ovaries and their high, abdominal localization may mimic a hypoplastic kidney;renal hypoplasia and dysplasia with concomitant ectopia a particularly complex anomaly which prohibits the identification of the kidneys and inhibits their assessment;horseshoe kidney erroneous interpretation of the isthmus of a horseshoe kidney as a pathological mass in the extraperitoneal space (fig. 2 a, b). errors in size assessment : errors resulting from anomalous location, structure and rotation of the kidney ; this inhibits the measurement of the longest longitudinal and transverse lengths which should be measured in these planes, e.g. horseshoe kidney;errors resulting from the selection of improper plane for the measurements renal measurements should be conducted after the longest longitudinal and transverse lengths have been obtained ; errors may be caused by taking measurements in oblique sections;errors resulting from the lack of standardization of measurement sites failure to obtain reproducible measurements ; measurements of the kidneys and dilated pelvicalyceal system ought to be performed each time in the same manner;errors resulting from the dynamics of renal conditions, influence of an ongoing treatment as well as degree of hydration and fullness of the pelvicalyceal system, e.g. erroneous interpretation of the pelvicalyceal system filled with urine with maximally filled bladder as hydronephrosis in such cases, one should assess the kidneys following miction;errors resulting from the impossibility to visualize the entire kidneys or overlapping shadows of the ribs and intestinal loops as well as faulty measurements reflecting a part of the kidney, not the entire one. errors in the interpretation of fluid - filled spaces in the kidneys : identification of isolated dilatation of the calyceal system / systems in the case of central cysts;mistaking central renal cysts for dilatation of the pelvicalyceal system;misinterpretation of a cyst localized at the hilum as dilated renal pelvis;erroneous differentiation between a central cyst and aneurysm of the renal artery doppler mode is used for differential diagnosis;erroneous differentiation of the character of a cystic lesion a complex cyst versus cystic form of renal carcinoma or solid - cystic renal carcinoma;erroneous interpretation of the cyst in the upper pole as an adrenal or hepatic cyst in the case of the right kidney and as a cyst in the tail of the pancreas or spleen in the case of the left kidney;errors in interpreting a cystic lesion with abscesslike character as a cyst without obtaining clinical information (fig. 3);erroneous interpretation of hypoechoic lesions, e.g. renal lymphoma (fig. 4 b), as dilatation of the pelvicalyceal system ; errors resulting from the morphological similarity of pathological lesions to the presentation of the kidney, which is the effect of diverse renal structures depending on the patient 's age, developmental defects, individual polymorphism and proliferative changes (tab. 1) : normal presentation of the kidneys in premature infants and neonates (kidneys of lobar structure with hypoechoic pyramids and hyperechoic cortex) is erroneously interpreted as lesions in the course of pyelonephritis, renal failure or renal cysts;renal scar (elements of the connective tissue penetrating into the parenchyma) interpreted as angiomyolipoma or postinflammatory scar;dromedary hump of the kidney mistaken for a tumor (fig. 5 a c);hypertrophy of the pyramid and renal column mistaken for a tumor (fig. 6 a, b);inflammatory tumors, postinfarction tumors and other lesions related to vascularity disorders may be erroneously interpreted as neoplastic tumors;renal lymphomas, leukemic infiltrations and primary proliferative lesions with echostructure and vascular pattern resembling normal renal parenchyma may be misinterpreted as a normal kidney particularly when they are small and not well - demarcated. the essence of ultrasound imaging is the phenomenon of ultrasound wave reflection. making use of the reverse piezoelectric effect, the us transducers generate ultrasonic waves which are sent inside the tissues where they are reflected and return to the transducer. depending on the presentation used by the scanner, these returning echoes are enhanced, appropriately processed and displayed. the size of the returning echo depends on multiple factors, the knowledge of which enables accurate interpretation of ultrasound images. apart from being reflected, the ultrasonic wave also undergoes refraction, interference, scattering and absorption. in sonography, there are other equally significant factors such as : acoustic impedance of tissues, the shape of reflecting surfaces or elastic properties of tissues. being familiar with all these phenomena and their influence on the displayed ultrasound image is a condition for its accurate interpretation. errors in differentiating between hyperechoic images, such as renal concretions, with calcifications, (postinflammatory) scars, peripapillary fibrosis and, most frequently, with lesions in the arciform arteries in young patients and children with nephrolithiasis (fig. 8 a, b). errors in the assessment of the site after nephrectomy : false positive identification of neoplastic relapse caused by stool retention in the bowel loops;errors resulting from the presence of gas in the bowels, which precludes reliable assessment of the site after kidney removal. failure to visualize the kidney in its typical site : agenesis / aplasia sonography does not enable the differentiation between these two pathologies;renal ectopia or dystopia;hypoplasia or aplasia the kidney is so small or so altered that its identification is impossible for various reasons (obesity, artefacts produced by intestinal gas, kidney localization etc.). sonography does not enable the differentiation between these two pathologies ; renal ectopia or dystopia ; hypoplasia or aplasia the kidney is so small or so altered that its identification is impossible for various reasons (obesity, artefacts produced by intestinal gas, kidney localization etc.). situations occurring more rarely : renal agenesis in neonates the possibility to mistake enlarged adrenal glands for hypoplastic kidneys;tumors of the gastrointestinal tract e.g. colon carcinoma manifests itself as a, so - called, pseudokidney, particularly in patients with unilateral renal agenesis;ectopic kidneys possibility to mistake pelvic kidney for a tumor - like lesion;in extreme cases, ectopic ovaries and their high, abdominal localization may mimic a hypoplastic kidney;renal hypoplasia and dysplasia with concomitant ectopia a particularly complex anomaly which prohibits the identification of the kidneys and inhibits their assessment;horseshoe kidney erroneous interpretation of the isthmus of a horseshoe kidney as a pathological mass in the extraperitoneal space (fig. the possibility to mistake enlarged adrenal glands for hypoplastic kidneys ; tumors of the gastrointestinal tract possibility to mistake pelvic kidney for a tumor - like lesion ; in extreme cases, ectopic ovaries and their high, abdominal localization may mimic a hypoplastic kidney ; renal hypoplasia and dysplasia with concomitant ectopia a particularly complex anomaly which prohibits erroneous interpretation of the isthmus of a horseshoe kidney as a pathological mass in the extraperitoneal space (fig. errors in size assessment : errors resulting from anomalous location, structure and rotation of the kidney ; this inhibits the measurement of the longest longitudinal and transverse lengths which should be measured in these planes, e.g. horseshoe kidney;errors resulting from the selection of improper plane for the measurements renal measurements should be conducted after the longest longitudinal and transverse lengths have been obtained ; errors may be caused by taking measurements in oblique sections;errors resulting from the lack of standardization of measurement sites failure to obtain reproducible measurements ; measurements of the kidneys and dilated pelvicalyceal system ought to be performed each time in the same manner;errors resulting from the dynamics of renal conditions, influence of an ongoing treatment as well as degree of hydration and fullness of the pelvicalyceal system, e.g. erroneous interpretation of the pelvicalyceal system filled with urine with maximally filled bladder as hydronephrosis in such cases, one should assess the kidneys following miction;errors resulting from the impossibility to visualize the entire kidneys or overlapping shadows of the ribs and intestinal loops as well as faulty measurements reflecting a part of the kidney, not the entire one. errors resulting from anomalous location, structure and rotation of the kidney ; this inhibits the measurement of the longest longitudinal and transverse lengths which should be measured in these planes, e.g. horseshoe kidney ; errors resulting from the selection of improper plane for the measurements renal measurements should be conducted after the longest longitudinal and transverse lengths have been obtained ; errors may be caused by taking measurements in oblique sections ; errors resulting from the lack of standardization of measurement sites failure to obtain reproducible measurements ; measurements of the kidneys and dilated pelvicalyceal system ought to be performed each time in the same manner ; errors resulting from the dynamics of renal conditions, influence of an ongoing treatment as well as degree of hydration and fullness of the pelvicalyceal system, e.g. erroneous interpretation of the pelvicalyceal system filled with urine with maximally filled bladder as hydronephrosis in such cases, one should assess the kidneys following miction ; errors resulting from the impossibility to visualize the entire kidneys or overlapping shadows of the ribs and intestinal loops as well as faulty measurements reflecting a part of the kidney, not the entire one. errors in the interpretation of fluid - filled spaces in the kidneys : identification of isolated dilatation of the calyceal system / systems in the case of central cysts;mistaking central renal cysts for dilatation of the pelvicalyceal system;misinterpretation of a cyst localized at the hilum as dilated renal pelvis;erroneous differentiation between a central cyst and aneurysm of the renal artery doppler mode is used for differential diagnosis;erroneous differentiation of the character of a cystic lesion a complex cyst versus cystic form of renal carcinoma or solid - cystic renal carcinoma;erroneous interpretation of the cyst in the upper pole as an adrenal or hepatic cyst in the case of the right kidney and as a cyst in the tail of the pancreas or spleen in the case of the left kidney;errors in interpreting a cystic lesion with abscesslike character as a cyst without obtaining clinical information (fig. 3);erroneous interpretation of hypoechoic lesions, e.g. renal lymphoma (fig. 4 b), as dilatation of the pelvicalyceal system identification of isolated dilatation of the calyceal system / systems in the case of central cysts ; mistaking central renal cysts for dilatation of the pelvicalyceal system ; misinterpretation of a cyst localized at the hilum as dilated renal pelvis ; erroneous differentiation between a central cyst and aneurysm of the renal artery doppler mode is used for differential diagnosis ; erroneous differentiation of the character of a cystic lesion a complex cyst versus cystic form of renal carcinoma or solid - cystic renal carcinoma ; erroneous interpretation of the cyst in the upper pole as an adrenal or hepatic cyst in the case of the right kidney and as a cyst in the tail of the pancreas or spleen in the case of the left kidney ; errors in interpreting a cystic lesion with abscesslike character as a cyst without obtaining clinical information (fig. 3) ; erroneous interpretation of hypoechoic lesions, e.g. renal lymphoma (fig. 4 b), as dilatation of the pelvicalyceal system ; differential diagnosis is facilitated by doppler options. errors resulting from the morphological similarity of pathological lesions to the presentation of the kidney, which is the effect of diverse renal structures depending on the patient 's age, developmental defects, individual polymorphism and proliferative changes (tab. 1) : normal presentation of the kidneys in premature infants and neonates (kidneys of lobar structure with hypoechoic pyramids and hyperechoic cortex) is erroneously interpreted as lesions in the course of pyelonephritis, renal failure or renal cysts;renal scar (elements of the connective tissue penetrating into the parenchyma) interpreted as angiomyolipoma or postinflammatory scar;dromedary hump of the kidney mistaken for a tumor (fig. 5 a c);hypertrophy of the pyramid and renal column mistaken for a tumor (fig. 6 a, b);inflammatory tumors, postinfarction tumors and other lesions related to vascularity disorders may be erroneously interpreted as neoplastic tumors;renal lymphomas, leukemic infiltrations and primary proliferative lesions with echostructure and vascular pattern resembling normal renal parenchyma may be misinterpreted as a normal kidney particularly when they are small and not well - demarcated. normal presentation of the kidneys in premature infants and neonates (kidneys of lobar structure with hypoechoic pyramids and hyperechoic cortex) is erroneously interpreted as lesions in the course of pyelonephritis, renal failure or renal cysts ; renal scar (elements of the connective tissue penetrating into the parenchyma) interpreted as angiomyolipoma or postinflammatory scar ; dromedary hump of the kidney mistaken for a tumor (fig. c) ; hypertrophy of the pyramid and renal column mistaken for a tumor (fig. 6 a, b) ; inflammatory tumors, postinfarction tumors and other lesions related to vascularity disorders may be erroneously interpreted as neoplastic tumors ; renal lymphomas, leukemic infiltrations and primary proliferative lesions with echostructure and vascular pattern resembling normal renal parenchyma may be misinterpreted as a normal kidney particularly when they are small and not well - demarcated. vascular malformations (e.g. angiomas) may be misinterpreted as renal tumors (fig. 7 a, the essence of ultrasound imaging is the phenomenon of ultrasound wave reflection. making use of the reverse piezoelectric effect, the us transducers generate ultrasonic waves which are sent inside the tissues where depending on the presentation used by the scanner, these returning echoes are enhanced, appropriately processed and displayed. the size of the returning echo depends on multiple factors, the knowledge of which enables accurate interpretation of ultrasound images. apart from being reflected, the ultrasonic wave also undergoes refraction, interference, scattering and absorption. in sonography, there are other equally significant factors such as : acoustic impedance of tissues, the shape of reflecting surfaces or elastic properties of tissues. being familiar with all these phenomena and their influence on the displayed ultrasound image is a condition for its accurate interpretation. errors in differentiating between hyperechoic images, such as renal concretions, with calcifications, (postinflammatory) scars, peripapillary fibrosis and, most frequently, with lesions in the arciform arteries in young patients and children with nephrolithiasis (fig. 8 a, b). errors in differentiating between hyperechoic images, such as renal concretions, with calcifications, (postinflammatory) scars, peripapillary fibrosis and, most frequently, with lesions in the arciform arteries in young patients and children with nephrolithiasis (fig. errors in the assessment of the site after nephrectomy : false positive identification of neoplastic relapse caused by stool retention in the bowel loops;errors resulting from the presence of gas in the bowels, which precludes reliable assessment of the site after kidney removal. false positive identification of neoplastic relapse caused by stool retention in the bowel loops ; errors resulting from the presence of gas in the bowels, which precludes reliable assessment of the site after kidney removal. 2d b - mode presentation focal lesion in the kidney with low echogenicity (abscess) mimicking a cyst. being familiar with clinical presentation (apart from certain clinically silent cases, such as considerable immunodeficiency) and application of doppler options enables the differential diagnosis in these cases a. hypoechoic regions (lymphoma) mimicking the dilatation of the pelvicalyceal system with concomitant dilatation of the upper pelvicalyceal system. 2d b - mode presentation a. dromedary hump of the left kidney mimicking a tumor. b. application of the b - flow mode reveals vascularization that is analogous to the one of the remaining renal parenchyma. c. impression of the spleen on the left kidney causing renal hump which may be misinterpreted as a renal tumor. 2d b - mode presentation a. hyperechoic focal lesion in the kidney (angioma) mimicking a malignant tumor. b. power doppler examination failed to show the signs of flow in the region of the lesion a. hyperechoic region in the kidney (postinflammatory scar) mimicking a stone. b. hyperechoic connective tissue of the renal pelvis produces acoustic shadow and mimics a stone. 2d b - mode presentation pseudotumors in the kidneys normal ureters are not usually visible on us examination, except for in very slim patients. usually, it is possible to visualize the upper fragment of the ureter down to the level of the inferior pole of the kidney and perivesical portion of the ureter (intramural and retrovesical parts) provided that the urinary bladder is well filled. the visualization of the entire ureter should raise suspicions of a pathology which inhibits urine draining from the kidney. in normal conditions, the ureter has its peristaltic waves which in a natural way eliminate the possibility to trace the ureter on its entire length. retroperitoneal fibrosis (ormond 's disease) is a disease entity which is difficult to diagnose on the basis of us examination. one of the characteristic features observed in intravenous urography or in computed tomography (ct) in the urographic phase is the medial shift of the ureters caused by inflammatory process taking place in the retroperitoneal space. the changes in the retroperitoneal space may be visible as iso- or hyperechoic focal lesions. ct and mri are referential methods. with respect to the comments above, in us diagnosis of the ureters the following may occur : errors resulting from the presence of artefacts generated by the intestinal contents and gas, e.g. mimicking concretions in the ureter.erroneous interpretation of the iliac vessels as dilated ureters doppler examination helps in differentiation.erroneous indication of the level of narrowing or obstruction of the ureter due to its covering by intestinal contents.errors resulting from diseases of the tissues adjacent to the ureter, e.g. extraperitoneal fibrosis. errors resulting from the presence of artefacts generated by the intestinal contents and gas, e.g. mimicking concretions in the ureter. erroneous interpretation of the iliac vessels as dilated ureters doppler examination helps in differentiation. erroneous indication of the level of narrowing or obstruction of the ureter due to its covering by intestinal contents. errors resulting from diseases of the tissues adjacent to the ureter, e.g. extraperitoneal fibrosis. errors resulting from insufficiently or excessively filled bladder : when the bladder is not filled sufficiently, its reliable assessment is inhibited and there is a risk of omitting proliferative changes in the wall, diverticula, vesical stones, abnormalities in the structure of the bladder neck and ureteral orifices as well as mistaking the folds of the mucous membrane of the urinary bladder for a neoplastic infiltration;the urinary bladder which is filled excessively or insufficiently does not allow for a reliable assessment of retained urine volume and measurement of the wall thickness ; assessing the thickness of the bladder wall is a measure of subvesical obstruction and to perform it, the urinary bladder must be filled with at least 250 ml of fluid. errors resulting from the impression of the bladder by the surrounding organs : dilated intestinal loops with the empty bladder may mimic a tumor of the bladder;the enlarged prostate gland indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder;the enlarged uterine body with myomas indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder;a tumor of the ovary indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder;when the bladder is empty, smooth - walled ovarian cysts, embryonic cysts in the medial line of the prostate and cystic form of seminal vesicle carcinoma may be interpreted as the urinary bladder. errors resulting from insufficiently or excessively filled bladder : when the bladder is not filled sufficiently, its reliable assessment is inhibited and there is a risk of omitting proliferative changes in the wall, diverticula, vesical stones, abnormalities in the structure of the bladder neck and ureteral orifices as well as mistaking the folds of the mucous membrane of the urinary bladder for a neoplastic infiltration;the urinary bladder which is filled excessively or insufficiently does not allow for a reliable assessment of retained urine volume and measurement of the wall thickness ; assessing the thickness of the bladder wall is a measure of subvesical obstruction and to perform it, the urinary bladder must be filled with at least 250 ml of fluid. when the bladder is not filled sufficiently, its reliable assessment is inhibited and there is a risk of omitting proliferative changes in the wall, diverticula, vesical stones, abnormalities in the structure of the bladder neck and ureteral orifices as well as mistaking the folds of the mucous membrane of the urinary bladder for a neoplastic infiltration ; the urinary bladder which is filled excessively or insufficiently does not allow for a reliable assessment of retained urine volume and measurement of the wall thickness ; assessing the thickness of the bladder wall is a measure of subvesical obstruction and to perform it, the urinary bladder must be filled with at least 250 ml of fluid. errors resulting from the impression of the bladder by the surrounding organs : dilated intestinal loops with the empty bladder may mimic a tumor of the bladder;the enlarged prostate gland indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder;the enlarged uterine body with myomas indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder;a tumor of the ovary indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder;when the bladder is empty, smooth - walled ovarian cysts, embryonic cysts in the medial line of the prostate and cystic form of seminal vesicle carcinoma may be interpreted as the urinary bladder. dilated intestinal loops with the empty bladder may mimic a tumor of the bladder ; the enlarged prostate gland indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder ; the enlarged uterine body with myomas indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder ; a tumor of the ovary indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder ; when the bladder is empty, smooth - walled ovarian cysts, embryonic cysts in the medial line of the prostate and cystic form of seminal vesicle carcinoma may be interpreted as the urinary bladder. errors concerning the number of kidneys : failure to visualize the kidney in its typical site : agenesis / aplasia sonography does not enable the differentiation between these two pathologies;renal ectopia or dystopia;hypoplasia or aplasia the kidney is so small or so altered that its identification is impossible for various reasons (obesity, artefacts produced by intestinal gas, kidney localization etc.). the final verification is conducted on the basis of intravenous urography or computed tomography.situations occurring more rarely : renal agenesis in neonates the possibility to mistake enlarged adrenal glands for hypoplastic kidneys;tumors of the gastrointestinal tract pseudokidney, particularly in patients with unilateral renal agenesis;ectopic kidneys possibility to mistake pelvic kidney for a tumor - like lesion;in extreme cases, ectopic ovaries and their high, abdominal localization may mimic a hypoplastic kidney;renal hypoplasia and dysplasia with concomitant ectopia a particularly complex anomaly which prohibits the identification of the kidneys and inhibits their assessment;horseshoe kidney erroneous interpretation of the isthmus of a horseshoe kidney as a pathological mass in the extraperitoneal space (fig. 2 a, b). errors in size assessment : errors resulting from anomalous location, structure and rotation of the kidney ; this inhibits the measurement of the longest longitudinal and transverse lengths which should be measured in these planes, e.g. horseshoe kidney;errors resulting from the selection of improper plane for the measurements renal measurements should be conducted after the longest longitudinal and transverse lengths have been obtained ; errors may be caused by taking measurements in oblique sections;errors resulting from the lack of standardization of measurement sites failure to obtain reproducible measurements ; measurements of the kidneys and dilated pelvicalyceal system ought to be performed each time in the same manner;errors resulting from the dynamics of renal conditions, influence of an ongoing treatment as well as degree of hydration and fullness of the pelvicalyceal system, e.g. erroneous interpretation of the pelvicalyceal system filled with urine with maximally filled bladder as hydronephrosis in such cases, one should assess the kidneys following miction;errors resulting from the impossibility to visualize the entire kidneys or overlapping shadows of the ribs and intestinal loops as well as faulty measurements reflecting a part of the kidney, not the entire one. errors in the interpretation of fluid - filled spaces in the kidneys : identification of isolated dilatation of the calyceal system / systems in the case of central cysts;mistaking central renal cysts for dilatation of the pelvicalyceal system;misinterpretation of a cyst localized at the hilum as dilated renal pelvis;erroneous differentiation between a central cyst and aneurysm of the renal artery doppler mode is used for differential diagnosis;erroneous differentiation of the character of a cystic lesion a complex cyst versus cystic form of renal carcinoma or solid - cystic renal carcinoma;erroneous interpretation of the cyst in the upper pole as an adrenal or hepatic cyst in the case of the right kidney and as a cyst in the tail of the pancreas or spleen in the case of the left kidney;errors in interpreting a cystic lesion with abscesslike character as a cyst without obtaining clinical information (fig. 3);erroneous interpretation of hypoechoic lesions, e.g. renal lymphoma (fig. 4 b), as dilatation of the pelvicalyceal system ; errors resulting from the morphological similarity of pathological lesions to the presentation of the kidney, which is the effect of diverse renal structures depending on the patient 's age, developmental defects, individual polymorphism and proliferative changes (tab. 1) : normal presentation of the kidneys in premature infants and neonates (kidneys of lobar structure with hypoechoic pyramids and hyperechoic cortex) is erroneously interpreted as lesions in the course of pyelonephritis, renal failure or renal cysts;renal scar (elements of the connective tissue penetrating into the parenchyma) interpreted as angiomyolipoma or postinflammatory scar;dromedary hump of the kidney mistaken for a tumor (fig. 5 a c);hypertrophy of the pyramid and renal column mistaken for a tumor (fig. 6 a, b);inflammatory tumors, postinfarction tumors and other lesions related to vascularity disorders may be erroneously interpreted as neoplastic tumors;renal lymphomas, leukemic infiltrations and primary proliferative lesions with echostructure and vascular pattern resembling normal renal parenchyma may be misinterpreted as a normal kidney particularly when they are small and not well - demarcated. the essence of ultrasound imaging is the phenomenon of ultrasound wave reflection. making use of the reverse piezoelectric effect, the us transducers generate ultrasonic waves which are sent inside the tissues where they are reflected and return to the transducer. depending on the presentation used by the scanner, these returning echoes are enhanced, appropriately processed and displayed. the size of the returning echo depends on multiple factors, the knowledge of which enables accurate interpretation of ultrasound images. apart from being reflected, the ultrasonic wave also undergoes refraction, interference, scattering and absorption. in sonography, there are other equally significant factors such as : acoustic impedance of tissues, the shape of reflecting surfaces or elastic properties of tissues. being familiar with all these phenomena and their influence on the displayed ultrasound image is a condition for its accurate interpretation. errors in differentiating between hyperechoic images, such as renal concretions, with calcifications, (postinflammatory) scars, peripapillary fibrosis and, most frequently, with lesions in the arciform arteries in young patients and children with nephrolithiasis (fig. 8 a, b). errors in the assessment of the site after nephrectomy : false positive identification of neoplastic relapse caused by stool retention in the bowel loops;errors resulting from the presence of gas in the bowels, which precludes reliable assessment of the site after kidney removal. failure to visualize the kidney in its typical site : agenesis / aplasia sonography does not enable the differentiation between these two pathologies;renal ectopia or dystopia;hypoplasia or aplasia the kidney is so small or so altered that its identification is impossible for various reasons (obesity, artefacts produced by intestinal gas, kidney localization etc.). sonography does not enable the differentiation between these two pathologies ; renal ectopia or dystopia ; hypoplasia or aplasia the kidney is so small or so altered that its identification is impossible for various reasons (obesity, artefacts produced by intestinal gas, kidney localization etc.). situations occurring more rarely : renal agenesis in neonates the possibility to mistake enlarged adrenal glands for hypoplastic kidneys;tumors of the gastrointestinal tract e.g. colon carcinoma manifests itself as a, so - called, pseudokidney, particularly in patients with unilateral renal agenesis;ectopic kidneys possibility to mistake pelvic kidney for a tumor - like lesion;in extreme cases, ectopic ovaries and their high, abdominal localization may mimic a hypoplastic kidney;renal hypoplasia and dysplasia with concomitant ectopia a particularly complex anomaly which prohibits the identification of the kidneys and inhibits their assessment;horseshoe kidney erroneous interpretation of the isthmus of a horseshoe kidney as a pathological mass in the extraperitoneal space (fig. the possibility to mistake enlarged adrenal glands for hypoplastic kidneys ; tumors of the gastrointestinal tract possibility to mistake pelvic kidney for a tumor - like lesion ; in extreme cases, ectopic ovaries and their high, abdominal localization may mimic a hypoplastic kidney ; renal hypoplasia and dysplasia with concomitant ectopia a particularly complex anomaly which prohibits erroneous interpretation of the isthmus of a horseshoe kidney as a pathological mass in the extraperitoneal space (fig. errors in size assessment : errors resulting from anomalous location, structure and rotation of the kidney ; this inhibits the measurement of the longest longitudinal and transverse lengths which should be measured in these planes, e.g. horseshoe kidney;errors resulting from the selection of improper plane for the measurements renal measurements should be conducted after the longest longitudinal and transverse lengths have been obtained ; errors may be caused by taking measurements in oblique sections;errors resulting from the lack of standardization of measurement sites failure to obtain reproducible measurements ; measurements of the kidneys and dilated pelvicalyceal system ought to be performed each time in the same manner;errors resulting from the dynamics of renal conditions, influence of an ongoing treatment as well as degree of hydration and fullness of the pelvicalyceal system, e.g. erroneous interpretation of the pelvicalyceal system filled with urine with maximally filled bladder as hydronephrosis in such cases, one should assess the kidneys following miction;errors resulting from the impossibility to visualize the entire kidneys or overlapping shadows of the ribs and intestinal loops as well as faulty measurements reflecting a part of the kidney, not the entire one. errors resulting from anomalous location, structure and rotation of the kidney ; this inhibits the measurement of the longest longitudinal and transverse lengths which should be measured in these planes, e.g. horseshoe kidney ; errors resulting from the selection of improper plane for the measurements renal measurements should be conducted after the longest longitudinal and transverse lengths have been obtained ; errors may be caused by taking measurements in oblique sections ; errors resulting from the lack of standardization of measurement sites failure to obtain reproducible measurements ; measurements of the kidneys and dilated pelvicalyceal system ought to be performed each time in the same manner ; errors resulting from the dynamics of renal conditions, influence of an ongoing treatment as well as degree of hydration and fullness of the pelvicalyceal system, e.g. erroneous interpretation of the pelvicalyceal system filled with urine with maximally filled bladder as hydronephrosis in such cases, one should assess the kidneys following miction ; errors resulting from the impossibility to visualize the entire kidneys or overlapping shadows of the ribs and intestinal loops as well as faulty measurements reflecting a part of the kidney, not the entire one. errors in the interpretation of fluid - filled spaces in the kidneys : identification of isolated dilatation of the calyceal system / systems in the case of central cysts;mistaking central renal cysts for dilatation of the pelvicalyceal system;misinterpretation of a cyst localized at the hilum as dilated renal pelvis;erroneous differentiation between a central cyst and aneurysm of the renal artery doppler mode is used for differential diagnosis;erroneous differentiation of the character of a cystic lesion a complex cyst versus cystic form of renal carcinoma or solid - cystic renal carcinoma;erroneous interpretation of the cyst in the upper pole as an adrenal or hepatic cyst in the case of the right kidney and as a cyst in the tail of the pancreas or spleen in the case of the left kidney;errors in interpreting a cystic lesion with abscesslike character as a cyst without obtaining clinical information (fig. 3);erroneous interpretation of hypoechoic lesions, e.g. renal lymphoma (fig. 4 b), as dilatation of the pelvicalyceal system identification of isolated dilatation of the calyceal system / systems in the case of central cysts ; mistaking central renal cysts for dilatation of the pelvicalyceal system ; misinterpretation of a cyst localized at the hilum as dilated renal pelvis ; erroneous differentiation between a central cyst and aneurysm of the renal artery doppler mode is used for differential diagnosis ; erroneous differentiation of the character of a cystic lesion a complex cyst versus cystic form of renal carcinoma or solid - cystic renal carcinoma ; erroneous interpretation of the cyst in the upper pole as an adrenal or hepatic cyst in the case of the right kidney and as a cyst in the tail of the pancreas or spleen in the case of the left kidney ; errors in interpreting a cystic lesion with abscesslike character as a cyst without obtaining clinical information (fig. 3) ; erroneous interpretation of hypoechoic lesions, e.g. renal lymphoma (fig. 4 b), as dilatation of the pelvicalyceal system ; differential diagnosis is facilitated by doppler options. errors resulting from the morphological similarity of pathological lesions to the presentation of the kidney, which is the effect of diverse renal structures depending on the patient 's age, developmental defects, individual polymorphism and proliferative changes (tab. 1) : normal presentation of the kidneys in premature infants and neonates (kidneys of lobar structure with hypoechoic pyramids and hyperechoic cortex) is erroneously interpreted as lesions in the course of pyelonephritis, renal failure or renal cysts;renal scar (elements of the connective tissue penetrating into the parenchyma) interpreted as angiomyolipoma or postinflammatory scar;dromedary hump of the kidney mistaken for a tumor (fig. 5 a c);hypertrophy of the pyramid and renal column mistaken for a tumor (fig. 6 a, b);inflammatory tumors, postinfarction tumors and other lesions related to vascularity disorders may be erroneously interpreted as neoplastic tumors;renal lymphomas, leukemic infiltrations and primary proliferative lesions with echostructure and vascular pattern resembling normal renal parenchyma may be misinterpreted as a normal kidney particularly when they are small and not well - demarcated. normal presentation of the kidneys in premature infants and neonates (kidneys of lobar structure with hypoechoic pyramids and hyperechoic cortex) is erroneously interpreted as lesions in the course of pyelonephritis, renal failure or renal cysts ; renal scar (elements of the connective tissue penetrating into the parenchyma) interpreted as angiomyolipoma or postinflammatory scar ; dromedary hump of the kidney mistaken for a tumor (fig. c) ; hypertrophy of the pyramid and renal column mistaken for a tumor (fig. 6 a, b) ; inflammatory tumors, postinfarction tumors and other lesions related to vascularity disorders may be erroneously interpreted as neoplastic tumors ; renal lymphomas, leukemic infiltrations and primary proliferative lesions with echostructure and vascular pattern resembling normal renal parenchyma may be misinterpreted as a normal kidney particularly when they are small and not well - demarcated. vascular malformations (e.g. angiomas) may be misinterpreted as renal tumors (fig. 7 a, the essence of ultrasound imaging is the phenomenon of ultrasound wave reflection. making use of the reverse piezoelectric effect, the us transducers generate ultrasonic waves which are sent inside the tissues where depending on the presentation used by the scanner, these returning echoes are enhanced, appropriately processed and displayed. the size of the returning echo depends on multiple factors, the knowledge of which enables accurate interpretation of ultrasound images. apart from being reflected, the ultrasonic wave also undergoes refraction, interference, scattering and absorption. in sonography, there are other equally significant factors such as : acoustic impedance of tissues, the shape of reflecting surfaces or elastic properties of tissues. being familiar with all these phenomena and their influence on the displayed ultrasound image is a condition for its accurate interpretation. errors in differentiating between hyperechoic images, such as renal concretions, with calcifications, (postinflammatory) scars, peripapillary fibrosis and, most frequently, with lesions in the arciform arteries in young patients and children with nephrolithiasis (fig. 8 a, b). errors in differentiating between hyperechoic images, such as renal concretions, with calcifications, (postinflammatory) scars, peripapillary fibrosis and, most frequently, with lesions in the arciform arteries in young patients and children with nephrolithiasis (fig. errors in the assessment of the site after nephrectomy : false positive identification of neoplastic relapse caused by stool retention in the bowel loops;errors resulting from the presence of gas in the bowels, which precludes reliable assessment of the site after kidney removal. false positive identification of neoplastic relapse caused by stool retention in the bowel loops ; errors resulting from the presence of gas in the bowels, which precludes reliable assessment of the site after kidney removal. 2d b - mode presentation focal lesion in the kidney with low echogenicity (abscess) mimicking a cyst. being familiar with clinical presentation (apart from certain clinically silent cases, such as considerable immunodeficiency) and application of doppler options enables the differential diagnosis in these cases a. hypoechoic regions (lymphoma) mimicking the dilatation of the pelvicalyceal system with concomitant dilatation of the upper pelvicalyceal system. 2d b - mode presentation a. dromedary hump of the left kidney mimicking a tumor. b. application of the b - flow mode reveals vascularization that is analogous to the one of the remaining renal parenchyma. c. impression of the spleen on the left kidney causing renal hump which may be misinterpreted as a renal tumor. 2d b - mode presentation a. hyperechoic focal lesion in the kidney (angioma) mimicking a malignant tumor. b. power doppler examination failed to show the signs of flow in the region of the lesion a. hyperechoic region in the kidney (postinflammatory scar) mimicking a stone. b. hyperechoic connective tissue of the renal pelvis produces acoustic shadow and mimics a stone. normal ureters are not usually visible on us examination, except for in very slim patients. usually, it is possible to visualize the upper fragment of the ureter down to the level of the inferior pole of the kidney and perivesical portion of the ureter (intramural and retrovesical parts) provided that the urinary bladder is well filled. the visualization of the entire ureter should raise suspicions of a pathology which inhibits urine draining from the kidney. in normal conditions, the ureter has its peristaltic waves which in a natural way eliminate the possibility to trace the ureter on its entire length. retroperitoneal fibrosis (ormond 's disease) is a disease entity which is difficult to diagnose on the basis of us examination. one of the characteristic features observed in intravenous urography or in computed tomography (ct) in the urographic phase is the medial shift of the ureters caused by inflammatory process taking place in the retroperitoneal space. the changes in the retroperitoneal space may be visible as iso- or hyperechoic focal lesions. ct and mri are referential methods. with respect to the comments above, in us diagnosis of the ureters the following may occur : errors resulting from the presence of artefacts generated by the intestinal contents and gas, e.g. mimicking concretions in the ureter.erroneous interpretation of the iliac vessels as dilated ureters doppler examination helps in differentiation.erroneous indication of the level of narrowing or obstruction of the ureter due to its covering by intestinal contents.errors resulting from diseases of the tissues adjacent to the ureter, e.g. extraperitoneal fibrosis. errors resulting from the presence of artefacts generated by the intestinal contents and gas, e.g. mimicking concretions in the ureter. erroneous interpretation of the iliac vessels as dilated ureters doppler examination helps in differentiation. erroneous indication of the level of narrowing or obstruction of the ureter due to its covering by intestinal contents. errors resulting from diseases of the tissues adjacent to the ureter, e.g. extraperitoneal fibrosis. errors resulting from insufficiently or excessively filled bladder : when the bladder is not filled sufficiently, its reliable assessment is inhibited and there is a risk of omitting proliferative changes in the wall, diverticula, vesical stones, abnormalities in the structure of the bladder neck and ureteral orifices as well as mistaking the folds of the mucous membrane of the urinary bladder for a neoplastic infiltration;the urinary bladder which is filled excessively or insufficiently does not allow for a reliable assessment of retained urine volume and measurement of the wall thickness ; assessing the thickness of the bladder wall is a measure of subvesical obstruction and to perform it, the urinary bladder must be filled with at least 250 ml of fluid. errors resulting from the impression of the bladder by the surrounding organs : dilated intestinal loops with the empty bladder may mimic a tumor of the bladder;the enlarged prostate gland indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder;the enlarged uterine body with myomas indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder;a tumor of the ovary indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder;when the bladder is empty, smooth - walled ovarian cysts, embryonic cysts in the medial line of the prostate and cystic form of seminal vesicle carcinoma may be interpreted as the urinary bladder. errors resulting from insufficiently or excessively filled bladder : when the bladder is not filled sufficiently, its reliable assessment is inhibited and there is a risk of omitting proliferative changes in the wall, diverticula, vesical stones, abnormalities in the structure of the bladder neck and ureteral orifices as well as mistaking the folds of the mucous membrane of the urinary bladder for a neoplastic infiltration;the urinary bladder which is filled excessively or insufficiently does not allow for a reliable assessment of retained urine volume and measurement of the wall thickness ; assessing the thickness of the bladder wall is a measure of subvesical obstruction and to perform it, the urinary bladder must be filled with at least 250 ml of fluid. when the bladder is not filled sufficiently, its reliable assessment is inhibited and there is a risk of omitting proliferative changes in the wall, diverticula, vesical stones, abnormalities in the structure of the bladder neck and ureteral orifices as well as mistaking the folds of the mucous membrane of the urinary bladder for a neoplastic infiltration ; the urinary bladder which is filled excessively or insufficiently does not allow for a reliable assessment of retained urine volume and measurement of the wall thickness ; assessing the thickness of the bladder wall is a measure of subvesical obstruction and to perform it, the urinary bladder must be filled with at least 250 ml of fluid. errors resulting from the impression of the bladder by the surrounding organs : dilated intestinal loops with the empty bladder may mimic a tumor of the bladder;the enlarged prostate gland indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder;the enlarged uterine body with myomas indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder;a tumor of the ovary indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder;when the bladder is empty, smooth - walled ovarian cysts, embryonic cysts in the medial line of the prostate and cystic form of seminal vesicle carcinoma may be interpreted as the urinary bladder. dilated intestinal loops with the empty bladder may mimic a tumor of the bladder ; the enlarged prostate gland indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder ; the enlarged uterine body with myomas indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder ; a tumor of the ovary indenting the urinary bladder may be erroneously interpreted as a tumor of the bladder ; when the bladder is empty, smooth - walled ovarian cysts, embryonic cysts in the medial line of the prostate and cystic form of seminal vesicle carcinoma may be interpreted as the urinary bladder. authors do not report any financial or personal links with other persons or organizations, which might affect negatively the content of this publication and/or claim authorship rights to this publication. | the article presents the most frequent errors made in the ultrasound diagnosis of the urinary system. they usually result from improper technique of ultrasound examination or its erroneous interpretation. such errors are frequent effects of insufficient experience of the ultrasonographer, inadequate class of the scanner, insufficient knowledge of its operation as well as of wrong preparation of patients, their constitution, severe condition and the lack of cooperation during the examination. the reasons for misinterpretations of ultrasound images of the urinary system may lie in a large polymorphism of the kidney (defects and developmental variants) and may result from improper access to the organ as well as from the presence of artefacts. errors may also result from the lack of knowledge concerning clinical and laboratory data. moreover, mistakes in ultrasound diagnosis of the urinary system are frequently related to the lack of knowledge of the management algorithms and diagnostic possibilities of other imaging modalities. the paper lists errors in ultrasound diagnosis of the urinary system divided into : errors resulting from improper technique of examination, artefacts caused by incorrect preparation of patients for the examination or their constitution and errors resulting from misinterpretation of ultrasound images of the kidneys (such as their number, size, fluid spaces, pathological lesions and others), ureters and urinary bladder. each physician performing kidney or bladder ultrasound examination should possess the knowledge of the most frequent errors and their causes which might help to avoid them. |
schwannoma, also known as neurilemoma, is the most common benign tumour of peripheral nerves originating from the schwann cells of the nerve sheath [1, 2 ]. schwannomas are usually solitary, encapsulated and homogenous masses and present with slowly growing masses, sometimes associated with pain and paresthesia [13 ]. schwannomas are usually isolated masses < 2.5 cm in diameter, but the size of these tumours may differ according to localization. these tumours may be located anywhere in the longitudinal axis of the extremity originating from nerve sheath of a peripheral nerve. because of their similar consistency, they may be misdiagnosed as ganglion. preoperative evaluation is based on ultrasonography and magnetic resonance imaging (mri), but final diagnosis requires histopathology. the characteristic histological features include the presence of alternating antoni a and antoni b areas.. there may be nuclear palisading. in - between two compact rows of well - aligned nuclei, the mass usually appears at trunk, head and neck, or at upper extremity. localization in the lower extremity originating from tibial nerve sheath is very uncommon and rarely reported in the literature. diagnosis of tibial nerve neurilemmoma is usually delayed because only 48% of these masses can be detected and can also be misdiagnosed as baker cyst. in this article, we present a case of popliteal schwannoma that can be misdiagnosed as baker cyst. fifty - eight - year - old man presented to the outpatient clinic of orthopaedics department with the complaints of slowly growing mass on his right popliteal region and mild pain and intermittent paresthesia of right leg and right foot. the patient emphasized that the mass existed for 2 years but has grown in the last 6 months. on physical examination, 4 2 cm mobile, solid mass was palpable at the posterior of the knee. ultrasound imaging showed that the mass was solid and separate from the adjacent muscles and tendons. mri showed well - defined solid, heterogenous, dense mass originating from the tibial nerve (fig. 1). sheath of the nerve was incised longitudinally to minimize damage to the nerve fascicles and the mass was resected in en - bloc form by sharp dissection using the microscope with no complication. the patient was discharged at the post - op third day. at the third week of the operation, histopathological examination of the mass revealed hypocellular antoni b and spindle - shaped schwann cells containing antoni a areas with nuclear palisading. schwannoma is the most common benign neoplasm of the peripheral nerves and may originate from any of peripheral nerves. it is usually solitary, painless, encapsulated and well - defined, slowly growing mass [13 ]. in our case, both patients experienced non - specific symptoms, such as painful numbness and burning dysaesthesia, involving the lower extremity and tinel s sign was positive over the popliteal fossa in one of these cases. in our case, tinel 's sign was positive. in the literature, tarsal tunnel syndrome secondary to tibial nerve schwannoma was reported and mr imaging was advised. sometimes it is impossible to differentiate the schwannoma from neurofibroma or malignant peripheral nerve sheath tumours and biopsy can be a necessity to confirm the diagnosis.. in our case, we also preferred to excise the tumour and confirmed the diagnosis by histopathological examination. histopathological examination of the schwannoma reveals hypocellular antoni b and spindle - shaped schwann cells containing antoni a areas with nuclear palisading. also immunohistochemical staining (s100 +) confirms the tumoural cells originating from schwann cells and the diagnosis of schwannoma. in our case, necrosis, increased mytotic activity or atypical cells were not observed in histopathological examination and also positivity of s100 staining confirmed the diagnosis of schwannoma (fig. 2 and 3). after surgical excision, sometimes paresthesia may be seen but usually it resolves without any neurological problem and also recurrence of the tumour is very uncommon [13 ]. in this case, we did not meet any neurological complication. at the last control the patient was free of symptoms and baker cysts are very common pathologies of popliteal region, but other benign and malignant tumours should also be kept in mind. we suggest mr investigation for differential diagnosis and excisional biopsy for confirmation of diagnosis and we also suggest excision of the schwannoma with careful dissection by using a microscope to minimize the complications and not to damage the nerve fascicules. | schwannoma, also known as neurilemoma, is the most common tumour of peripheral nerves. although it is the most common tumour of peripheral nerves, it is seldom seen in adult population. we present a very rare case of schwannoma in an unusual localization. the presented case concerns a 58-year - old patient with a slowly growing popliteal mass and neuralgia for 6 months. a mass originating from a nerve or compressing a nerve was thought in the differential diagnosis. ultrasonographic and magnetic resonance imaging revealed a heterogenous, well - defined solid mass that seems to originate from tibial nerve. surgical excision and histopathological examination confirmed the diagnosis of schwannoma. diagnosis of the neurilemmoma originating from lower extremity peripheral nerves may be delayed because the mass can be misdiagnosed as baker cyst or the symptoms of the patient can be thought as a result of lumber disc herniation. |
break - dancing, a term named by a disc jockey in the south bronx in new york city in the late 1970s, was first used to describe a style of street dance done to accompany the breakbeat, or syncopated rhythm, that disc jockeys used to set the pace for a piece of hip - hop music.6) the dancers are often called ' b - boys ' or ' b - girls '. in contrast to the popularity of this sport, there were only case reports and small series dealing with injuries. stress reactions and fractures of the spinal iliaca anterior superior, femur, carpal, metacarpal, and metatarsal bones, pulmonary embolism, paget - schroetter disease, ocular trauma, genitourinary injuries, and cervical injuries including fracture, slipped disc, and neurological deficit are reported.4) however, a systematic epidemiological study in break - dancers is rare.148) according to an epidemiological study of musculoskeletal injuries in break - dancers in korea,1) the incidence of musculoskeletal injuries were high ; 95% of 42 study subjects experienced musculoskeletal injuries at more than one site and the most prevalent site of injuries were : wrist (69.0%), fingers (61.9%), and knee (61.9%).1) another epidemiological study of 144 break - dancers,4) professionals had significantly more injuries and overuse syndromes than amateurs with significantly more injuries of the wrist, knee, hip / thigh, ankle / foot, and elbow, and break - dancing was considered as a potentially high - risk dancing sport.4) although the wrist was reported to be injured with high prevalence associated with break dancing, only the musculoskeletal injuries, such as sprain, strain, and tendinitis, were reported and no associate peripheral nerve injury was reported.1) this article reports an occurrence of the compression syndrome of the superficial sensory branch of the ulnar nerve, type iii guyon 's canal syndrome in an amateur ' b boy ' break dancer. a 23-year - old, right handed college man presented with a tenderness over the left hypothenar eminence and painful paresthesia over the ring and little fingers of 3 months duration. he trained himself as an amateur ' b boy ' break - dancer without the supervised training for the last 10 months before presentation. the onset was gradual with repetitive training of several stylized movements including ' toprock ', ' footwork ', ' power moves ', and ' freezes '. upon development of left hand pain, he discontinued b - boying, however, the pain and paresthesia were not relieved. he had been treated with nonsteroidal anti - inflammatory drugs (nsaids) and physical therapy under the clinical diagnosis of wrist sprain for two months, however, his symptoms were not relieved. on physical examination, digital pressure over the hypothenar eminence elicited a paresthesia over left ring and little fingers. there was no evidence of fracture or deformity in the x - ray films of left hand. the magnetic resonance imaging (mri) of the left hand showed minimal swelling the ulnar nerve with subtle enhancement within the guyon 's canal without soft tissue swelling (figure 1). mild effusion of the intercarpal and carpo - metacarpal joint was noticed as a traumatic change. the sensory nerve conduction study demonstrated decreased amplitude of sensory nerve action potential (snap) in the left ulnar nerve with abnormality of the motor nerve conduction and electromyographic examination. with the clinical symptoms and signs of tenderness and the distribution of paresthesia, combined with a decreased snap with preserved motor conduction on nerve conduction velocity examination along with the mri findings, a diagnosis of type iii ulnar tunnel syndrome (guyon 's canal syndrome) was made. an exploration of the guyon 's canal for decompression of the superficial branch of the ulnar nerve was planned after an additional course of medical treatment including corticosteroid (hydrocortisone 20 mg) with nsaids for 4 weeks. month after medical treatment, the patient 's pain and paresthesia were significantly alleviated and further observation with discontinuation of the medication was followed. break - dancing reached the height of its popularity in the early and mid-1980s, faded away for a while, and then became popular again in the 1990s. the widespread public use of the internet starting in the late 1990s gave break - dancers a new venue for acquiring a wider audience.1) under the influence of internet, dance was popularized around world, and an entire sub - branches has evolve around it.1) although there has been the reports regarding the injuries in ballet dancers, modern dancers, and theatrical dancers, an epidemiological study in break - dancers is relatively rare.148) according to kauther.,4) professional break dancers was reported to have significantly more injuries and overuse syndromes with injuries of the wrist, knee, hip / thigh, ankle / foot, and elbow. no significant differences were found in the time lost per injury and the time lost per overuse syndrome. other recent, korean epidemiological study by cho.1) showed that 95.2% of break - dancers suffer from the musculoskeletal injuries at more than one site and the wrist was the most prevalent site of injury. 's study,1) the rate of injuries was significantly higher in amateurs without supervised training than professionals, and they stressed out the importance of careful screening, instruction and supervised training to prevent injuries. the musculoskeletal injuries that have far been reported in break - dancers include sprain ; strains ; tendinitis ; bursitis ; growth plate injuries ; fractures of the clavicle, radius, ulnar, carpal bone ; phalanx and fifth metatarsal bone ; stress fractures of the femur and calcaneus ; vertebral fractures ; and spinal cord injuries.12) and the most common type of injuries are sprain, strain and tendinitis, otherwise peripheral nerve injuries are rarely reported. it seems that several basic stylized movements including ' toprock ', ' uprock ', and ' freeze ' would cause a serious burden and stress to multiple joints, especially in the wrist. guyon 's canal, or the ulnar - carpal canal refers to the ulnar tunnel at the wrist named for the french surgeon jean casimir flix guyon, who described this space in 1861.5) the canal is composed of medially pisiform bone and laterally hamate 's hook. the roof of guyon 's canal is formed by palmar carpal ligament and the floor is formed by transverse carpal ligament. guyon 's canal is approximately 4 cm long, from proximal edge of transverse carpal ligament to the aponeurotic arch of hypothenar muscles, and it contains ulnar artery and ulnar nerve. when ulnar nerve runs through the aponeurotic arch of hypothenar muscles, it divided into two branches, superficial sensory branch and deep motor branch, and distal ulnar nerve lesions are classified into one of three categories.3) type i guyon 's canal syndrome shows motor weakness of ulnar innervated muscle and sensory loss in the palmar surfaces of the hypothenar eminence and the fourth and fifth fingers, because it is related to the compression of proximal part of guyon 's canal. type ii guyon 's canal syndrome, compression of the deep motor branch, leads to the weakness of ulnar innervated muscle and spares sensation. type iii guyon 's canal syndrome only involve sensory loss in the little finger 's palmar surface and the ring finger 's ulnar side and spares motor, and our case is related to type iii with this classification (figure 2). conservative treatment remains the first line in treating ulnar nerve compression in the guyon 's canal syndrome.7) avoidance of repetitive trauma, rest immobilization (splinting), local corticosteroid injection, and anti - inflammatory medication may be tried individually and in combination to achieve relief. any underlying disease leading to nerve damage must be treated. to prevent permanent nerve damage, surgical decompression of the ulnar nerve is recommended if there is no relief of symptoms within 6 months or development of muscle atrophy or weakness.7) since the wrist is the most commonly affected site of musculoskeletal injury in break - dancing, physicians should be aware of the possibility of the peripheral nerve injury. | although the musculoskeletal injuries associated with break - dancing which is gaining more popularity among adolescent and young people has been reported, the report regarding a peripheral nerve injury associated with breakdance is scarce. we report a rare case of a young amateur break - dancer, ' b - boy ' who suffered from a painful paresthesia in his left hand, later diagnosed as type iii guyon 's canal syndrome. a 23-year - old, right handed college man presented with a tenderness over the left hypothenar eminence and painful paresthesia over the ring and little fingers of 3 months duration. he trained himself as an amateur ' b boy ' break - dancer for the last 10 months. conservative management under the diagnosis of wrist sprain before presentation did not improve his hand pain. an magnetic resonance imaging and electrodiagnostic study revealed that painful paresthesia was caused by type iii guyon 's canal syndrome, and 4 weeks of corticosteroid treatment was given with resolution of pain and paresthesia. |
myocardial infarction (mi) is a major cause of morbidity and mortality worldwide 1. partial or complete epicardial coronary artery occlusion from plaques vulnerable to rupture or erosion is the most common cause of mi 2. mi may be a minor event in a lifelong chronic disease and may even go undetected, but it may also be a major catastrophic event leading to sudden death or severe hemodynamic deterioration. the term mi reflects cell death of cardiomyocyte caused by ischemia, which is the result of a perfusion imbalance between supply and demand. because of tissue damage and necrosis of cardiac cells, danger signals, such as extracellular matrix breakdown products, mitochondrial dna (mtdna), heat shock proteins, and high mobility box 1,, the use of more specific and sensitive biomarkers of myocardial necrosis has improved the detection of mi. for example, lactate dehydrogenase was shown to be better than glutamine - oxaloacetic transaminase and replaced it in the diagnosis of mi, and later, creatine kinase (ck) and the mb fraction of ck, that is, ckmb activity and ckmb mass were used instead for the diagnosis 4. nevertheless, more specific and sensitive biomarkers to detect mi are required. mitochondria are double - membrane organelles in the cytoplasm of eukaryotic cells and contain their own dna. they carry out oxidative phosphorylation to produce atp that is required for many cellular activities as energy 5. recent studies have shown that mtdna is released as damage - associated molecular patterns into circulation after aseptic trauma and its levels correlate with the incidence of distant organ failure and death 68. mtdna that escapes from autophagy cell autonomously has been shown to act through toll - like receptor 9 to induce inflammation and cardiomyocyte injury 9. mtdna could be part of plasma cell - free dna, which includes both mtdna and nuclear dna 10. a recent study shows that plasma nuclear dna concentrations increase proportionately to the complications arising from acute coronary syndrome 11. moreover, another study has shown that acute myocardial infarction (ami) can lead to an increase in circulating mtdna 12. however, the changes in circulating nuclear and mtdna levels have not been examined simultaneously in ami. we hypothesized that nuclear and mtdna contents are increased after ami and decreased by a percutaneous coronary intervention (pci). in a clinical setting, mtdna or nuclear dna may serve as a prognostic and/or a diagnostic biomarker in ami. the present study protocol was approved by jinling hospital s institutional review committee on human research. all experimental procedures and written informed consent obtained from all donors were reviewed and approved by the local ethics committee. a total of 25 ami patients were enrolled from jinling hospital between january 2014 and april 2014. ami was diagnosed according to the european society of cardiology (esc), the american college of cardiology, and american heart association (acc / aha) redefined guidelines. exclusion criteria were as follows : surgery, trauma, previous transmural infarction, cardiogenic shock, severe liver disease, renal failure, underlying neoplasm, hematologic disorders that affect platelet count or function, and fever or infectious conditions upon study entry. twenty - five control participants without acute coronary syndrome, whose routine coronary angiography was negative, served as non - mi controls. all participants signed an informed consent. in the study, 5 ml of whole blood samples were drawn at hospital days 1 (within 8 h of admission) and 3 (2 days after pci), transferred into edta - coated blood collection tubes, and processed within 2 h after venipuncture. briefly, whole blood was centrifuged at 500 g at room temperature for 10 min, and the supernatant was transferred to a fresh tube and centrifuged at 700 g at 4c for 5 min. then, the supernatant (240 l) obtained from the whole blood (5 ml) was collected carefully using a pipette without touching the pellet or the bottom of the tube. the supernatant obtained was further centrifuged at 15 000 g at 4c for 10 min, and the resulting supernatant (200 l) was collected carefully. the plasma samples were stored at 80c and were used for dna isolation within 4 months of storage. plasma dna was isolated from plasma using the qiaamp dna blood mini kit (# 51104 ; qiagen, valencia, california, usa) following the manufacturer s manual 13. in brief, samples were thawed on ice and were then mixed briefly by vortex. then, we incubated the plasma samples with lysis buffer and proteinase k at 56c for 10 min. at the final step of isolation, dna was eluted with 150 l of nuclease - free deionized and distilled h2o, followed by a quantitative real - time pcr assay. mtdna and nuclear dna were quantified by real - time pcr using the lightcycler 96 sequence detection system (roche, mannheim, germany) with the following primers : human nadh dehydrogenase 1 gene (mtdna) : forward 5-atacccatggccaacctcct-3, reverse 5-gggcctttgcgtagttgtat-3 6,14 ; human b - globin (nuclear dna) : forward 5-gtgcacctgactcctgaggaga-3, reverse 5-ccttgataccaacctgcccag-3 15. the thermal profile for mtdna quantitative real - time pcr was as follows : denaturation at 95c for 10 min, followed by 40 cycles of 10 s at 95c, 10 s at 58c, and 10 s at 72c. in each application, samples were analyzed in duplicate and the mean was used in the subsequent analysis. the concentration of the standards was quantified spectrophotometrically (nano drop 2000 ; thermo fischer, wilmington, delaware, usa). statistical analyses were carried out using the statistical package for social sciences (spss inc., a one - way analysis of variance with the bonferroni post - hoc test was used for multiple comparisons. the present study protocol was approved by jinling hospital s institutional review committee on human research. all experimental procedures and written informed consent obtained from all donors were reviewed and approved by the local ethics committee. a total of 25 ami patients were enrolled from jinling hospital between january 2014 and april 2014. ami was diagnosed according to the european society of cardiology (esc), the american college of cardiology, and american heart association (acc / aha) redefined guidelines. exclusion criteria were as follows : surgery, trauma, previous transmural infarction, cardiogenic shock, severe liver disease, renal failure, underlying neoplasm, hematologic disorders that affect platelet count or function, and fever or infectious conditions upon study entry. twenty - five control participants without acute coronary syndrome, whose routine coronary angiography was negative, served as non - mi controls. in the study, 5 ml of whole blood samples were drawn at hospital days 1 (within 8 h of admission) and 3 (2 days after pci), transferred into edta - coated blood collection tubes, and processed within 2 h after venipuncture. briefly, whole blood was centrifuged at 500 g at room temperature for 10 min, and the supernatant was transferred to a fresh tube and centrifuged at 700 g at 4c for 5 min. then, the supernatant (240 l) obtained from the whole blood (5 ml) was collected carefully using a pipette without touching the pellet or the bottom of the tube. the supernatant obtained was further centrifuged at 15 000 g at 4c for 10 min, and the resulting supernatant (200 l) was collected carefully. the plasma samples were stored at 80c and were used for dna isolation within 4 months of storage. plasma dna was isolated from plasma using the qiaamp dna blood mini kit (# 51104 ; qiagen, valencia, california, usa) following the manufacturer s manual 13. in brief, samples were thawed on ice and were then mixed briefly by vortex. then, we incubated the plasma samples with lysis buffer and proteinase k at 56c for 10 min. at the final step of isolation, dna was eluted with 150 l of nuclease - free deionized and distilled h2o, followed by a quantitative real - time pcr assay. mtdna and nuclear dna were quantified by real - time pcr using the lightcycler 96 sequence detection system (roche, mannheim, germany) with the following primers : human nadh dehydrogenase 1 gene (mtdna) : forward 5-atacccatggccaacctcct-3, reverse 5-gggcctttgcgtagttgtat-3 6,14 ; human b - globin (nuclear dna) : forward 5-gtgcacctgactcctgaggaga-3, reverse 5-ccttgataccaacctgcccag-3 15. the thermal profile for mtdna quantitative real - time pcr was as follows : denaturation at 95c for 10 min, followed by 40 cycles of 10 s at 95c, 10 s at 58c, and 10 s at 72c. in each application, samples were analyzed in duplicate and the mean was used in the subsequent analysis. the concentration of the standards was quantified spectrophotometrically (nano drop 2000 ; thermo fischer, wilmington, delaware, usa). statistical analyses were carried out using the statistical package for social sciences (spss inc., chicago, illinois, usa). a one - way analysis of variance with the bonferroni post - hoc test was used for multiple comparisons. twenty - five adults (four women and 21 men, aged 4481 years) with ami were evaluated. the mean age of the ami patients was 59.313.4 years and that of the controls was 64.512.0 years (p=0.165). according to the ecg criteria, 14 patients showed signs of inferior / posterior wall infarction and 11 patients showed signs of anterior wall infarction. there were no significant differences in other vascular risk factors, including hypertension, diabetes mellitus, dyslipidemia, and smoking status, between the two groups. characteristics of the study patients with and without ami the levels of plasma nuclear and mtdna in patients with ami, non - mi controls, and healthy volunteers are shown in figs 2 and 3. the concentrations of nuclear and mtdna were significantly higher in the ami group on hospital day 1 than that in the non - mi controls (nuclear : 0.49480.0830 vs. 0.20470.0222 ng/l, p0.05). plasma levels of nuclear dna were 0.49480.0830 ng/l in the patients with ami on hospital day 1 and 0.27090.0386 ng/l on hospital day 3 (p0.05). plasma levels of nuclear dna were 0.49480.0830 ng/l in the patients with ami on hospital day 1 and 0.27090.0386 ng/l on hospital day 3 (p<0.05). levels of plasma mtdna were 3.7540.384 ng/l in the patients with ami on hospital day 1 and 2.1120.213 ng/l on hospital day 3 (p<0.05). ami, acute myocardial infarction ; mi, myocardial infarction. concentrations of plasma mitochondrial dna on different days in ami patients and control participants. this is the first study that has shown marked increases in circulating nuclear and mtdna levels in the patients with ami compared with non - ami patients and decreases after pci. our work has confirmed and extended previous studies showing that a high level of mtdna or cell - free dna may be accompanied by myocardial damage in patients 3,5,10,12,1618. to our knowledge, plasma dna has been studied in a wide range of human diseases from cancer to diabetes, as well as in development, aging, and exercise 1924. the prognostic and diagnostic utility of plasma dna has been proven in some critical conditions 25. increase in plasma dna appears to be common in the diseases involving cell death, including infections, cancers with metastasis, hepatitis, irreversible cardiac failure, severe respiratory insufficiency, and thrombophlebitis 26. the cellular origin of plasma dna seems to be different in various pathologic conditions, but remains uncertain in most cases. moreover, mtdna acts as a damage - associated molecular pattern 27 that can promote molecular processes, leading to inflammatory responses and organ injuries 6,13,28,29. inflammation can affect the release of dna from cells undergoing apoptosis or necrosis, although the nature of this effect may vary depending on the inflammatory stimulus and local cellular events 30. furthermore, inflammatory responses and recruitment of neutrophils in ami are more pronounced than that in chronic heart failure 31. therefore, it is possible that mtdna released from necrotic cells or escaped from autophagy may induce a danger signal, leading to inflammatory responses in ami. currently, cardiac troponin t and troponin i are the best biomarkers for the diagnosis of ami because of its cardiac specificity and sensitivity 32. however, measurable amounts of troponin proteins are usually not released from the damaged myocardium before 48 h after the onset of symptoms, making an early biomarker - based diagnosis of ami rather difficult. by contrast, mtdna arises ahead of time (about 1 h after chest pain) in the plasma 12, potentially making it a novel biomarker for early diagnosis of ami. however, the specificity and sensitivity of mtdna in the diagnosis of ami need to be further investigated. first, the levels of plasma nuclear and mtdna may be affected by age and pre - existing diseases 33. second, the number of cases in the study was small and the follow - up period was also short. large - scale prospective studies are warranted to evaluate the diagnostic and prognostic utility of plasma dna for ami. in summary, further studies are essential to show the specificity and sensitivity of mtdna in the diagnosis of ami. it is likely that plasma nuclear and mtdna may serve as biomarkers and should be tested routinely in the future. concentrations of plasma nuclear and mtdna in patients with ami were significantly higher than those in the non - mi controls and healthy participants and decreased shortly after pci. concentrations of plasma nuclear and mtdna in patients with ami were significantly higher than those in the non - mi controls and healthy participants and decreased shortly after pci. | objectiveplasma nuclear and mitochondrial dna (mtdna) levels are altered in many diseases. however, it is not known whether they are also altered in acute myocardial infarction (ami). in the present study, we examined plasma nuclear and mtdna levels in the patients with ami before and after a percutaneous coronary intervention (pci) to explore their potential as biomarkers.methods and resultsplasma nuclear and mtdna levels were measured by quantitative pcr in 25 ami patients, 25 non - myocardial infarction (mi) control participants (with mi risk), and 20 healthy individuals during the study period. the concentrations of nuclear and mtdna were significantly higher in the ami group on hospital day 1 than that in the non - mi controls (nuclear : 0.49480.0830 vs. 0.20470.0222 ng/l, p<0.05 ; mitochondrial : 3.7540.384 vs. 1.8510.3483 ng/l, p<0.05) and healthy individuals (nuclear : 0.49480.0830 vs. 0.16830.0254 ng/l, p=0.001 ; mitochondrial : 3.7540.384 vs. 0.15170.0924 ng/l, p<0.05) and decreased shortly after pci.conclusionboth plasma nuclear and mtdna levels are elevated in ami patients, but return to normal levels immediately after pci, suggesting that they are potentially novel biomarkers for ami. |
a total of 287 consecutive unrelated white patients with pcos and 187 unrelated white control women were recruited from the birmingham, alabama, area. case patients were recruited from the reproductive endocrine practice of one of the investigators (r.a.) at the university of alabama at birmingham. participation in research was offered to patients meeting the inclusion criteria (being premenopausal and nonpregnant, having undergone no hormonal therapy [including oral contraceptives ] for at least 3 months, and meeting the 1990 national institutes of health criteria for pcos). the comprehensive physical examination and hormonal evaluation used in our research have been described in detail previously (15). control subjects were healthy women, with regular menstrual cycles and no family history of hirsutism. these women had no hirsutism, acne, alopecia, or endocrine dysfunction and had not undergone hormonal therapy (including oral contraceptives) for at least 3 months before testing. control subjects were recruited by word of mouth and advertisements in the birmingham, alabama, area through a call for healthy women without detailing the nature of the studies. the study was performed according to the guidelines of the institutional review boards of the university of alabama at birmingham and cedars - sinai medical center. we selected four snps (rs11671439, rs8100018, rs3730051, and rs2304188) that span the 51.5-kb genomic length of akt2 at chromosome 19q13.113.2. these were selected because they are predicted to tag the haplotypes (across the entire gene, plus 10 kb upstream and 10 kb downstream) occurring at > 1% frequency in the caucasian population of the hapmap database (16). the four snps were genotyped using the 5-exonuclease assay (taqman mgb ; applied biosystems, foster city, ca) (17) ; duplicate genotyping of 96 samples for one snp yielded 100% concordance. haploview 3 (18) was used to determine haplotypes as well as haplotype blocks, with an accelerated expectation maximization algorithm. haploview was also used to calculate linkage disequilibrium (ld) (the d statistic) between each pairwise combination of all the snps. haplotypes were assigned to individual subjects only when the assignment could be made with > 95% certainty. unpaired t tests and tests were used to compare clinical characteristics between women with and without pcos ; quantitative trait values were log- or square root transformed as appropriate to reduce non - normality. association of snps or haplotypes with presence or absence of pcos was evaluated using logistic regression, with adjustment for bmi and age in every analysis. ancova was used for association between genotype and quantitative traits, again with adjustment for age and bmi. significance was taken at p 1% frequency in the caucasian population of the hapmap database (16). the four snps were genotyped using the 5-exonuclease assay (taqman mgb ; applied biosystems, foster city, ca) (17) ; duplicate genotyping of 96 samples for one snp yielded 100% concordance. haploview 3 (18) was used to determine haplotypes as well as haplotype blocks, with an accelerated expectation maximization algorithm. haploview was also used to calculate linkage disequilibrium (ld) (the d statistic) between each pairwise combination of all the snps. haplotypes were assigned to individual subjects only when the assignment could be made with > 95% certainty. unpaired t tests and tests were used to compare clinical characteristics between women with and without pcos ; quantitative trait values were log- or square root transformed as appropriate to reduce non - normality. association of snps or haplotypes with presence or absence of pcos was evaluated using logistic regression, with adjustment for bmi and age in every analysis. ancova was used for association between genotype and quantitative traits, again with adjustment for age and bmi. significance was taken at p 99% of the population (table 3). there was a significant association between haplotype t - g - c - t and pcos (or 2.0, 95% ci 1.13.4, p = 0.01). this haplotype includes the minor alleles of both rs8100018 and rs3730051, the two snps associated with pcos. the nine - snp haplotype c - a - c - c - g - g - a - g - g was significantly associated with pcos (or 1.7, 95% ci 1.032.85, p = 0.028) and was the most common haplotype among the white subjects with pcos but the second most common in control subjects. taking into account the previous association between gsk3b haplotype and pcos, we conducted exploratory analyses with a set of logistic regression models that simultaneously considered akt2 and gsk3b (table 4). the first model was designed to evaluate the independence of the risk haplotypes of both akt2 and gsk3b on pcos susceptibility. in this model, each risk haplotype retained a significant association with pcos (akt2 risk haplotype carriers, or 2.1, p = 0.01 ; gsk3b risk haplotype carriers or 1.8, p = 0.036), demonstrating independence. in the next logistic regression with pcos as the dependent variable, the independent variables were age, bmi, and number of risk haplotypes (for each subject, ranging from 0 to 4). this analysis revealed that each additional risk haplotype conferred a 58% increase in the odds of pcos (p = 0.01). in the final combined model, carriers of both risk haplotypes had an increased odds of pcos compared with subjects with neither haplotype (or 3.1, p = 0.005). the minor alleles of rs3730051 and rs8100018 were associated with pcos, and the corresponding haplotype was also associated with pcos. we used independent, additive, and combined logistic regression models to demonstrate that the association between akt2 haplotype t - g - c - t and pcos was independent of the gsk3b risk haplotype, but pcos risk was increased when both were present. these data offer two potential susceptibility loci from the insulin signaling pathway that may confer increased pcos risk and suggest that the presence of multiple lesions in a single pathway confers increased risk. the significant association of rs3735001 and rs8100018 with pcos extends to a haplotype that includes the minor alleles of these two akt2 snps. carriers of both minor alleles, in a haplotype, had the same or as carriers of either risk allele alone, as a snp. this finding suggests that these alleles are markers tagging the same variant in the gene region. the unknown functional variant can be a coding variant or a noncoding variant that alters akt2 promoter activity or mrna transport and stability, resulting in changes in protein expression. our analyses did not show any significant associations with quantitative traits related to glucose homeostasis. this was also the case for gsk3b (13). because analyses to detect association between quantitative traits and genotype are conducted only within women with pcos also, in our cohort insulin resistance was quantified via homeostatic model assessment, which may be insufficiently reflective of insulin resistance to allow detection of association with genetic variants. analysis in a larger cohort or one characterized by physiological studies (e.g., euglycemic clamp) would be necessary to definitively rule out whether there is an association of akt2 variants with insulin resistance and whether such a relationship mediates the effect of genetic variants on pcos risk. alternatively, whereas akt2 and gsk3 are best known for their role in glucose uptake (5), it is possible that their role in pcos does not manifest as an alteration in androgen levels or metabolic disturbance, but in other pathways not reflected in typical quantitative traits. akt is known to participate in several pathways including inflammation, lipogenesis, and endothelial function (5), and it is possible that aberrant function in these pathways contributes to the pathophysiology of pcos. akt is expressed in granulosa and theca cells of primordial follicles and is involved in signal transduction, cell cycle, and cell fate (19,20). recent studies have shown altered rates of apoptosis in pcos ovarian tissue including granulosa (21) and theca (22). overexpression of akt2 has been shown to result in a reduced rate of apoptosis in a number of cell types including ovary (5) and is a potential causal factor in the increased follicular growth and lack of atresia associated with pcos. aberrant akt2 and gsk3 expression and activation could result in increased cell survival in pcos follicles and contribute to the theca cell hypertrophy and abnormal follicular development and promote the proliferation of granulosa. an increase in the latter less proliferative and highly steroidogenic cell type (23) could potentially increase androgen production by the ovary, a characteristic of pcos. increased basal, luteinizing hormone- and insulin - stimulated akt phosphorylation has been reported in pcos ovarian theca (22), with a subsequent increase in levels of aromatase and luteinizing hormone receptor mrna expression (20), resulting in stimulation of granulosa cell proliferation. increased serine and tyrosine phosphorylation of akt in the ovary has been demonstrated in an animal model exhibiting pcos - like symptoms (24). each report represented a separate genotyping experiment performed over the past several years, testing an independent hypothesis ; therefore, each was analyzed separately. we have published a positive association of variants in six genes with pcos (supplemental table a1, available in an online appendix at http://dx.doi.org/10.2337/dc08-0532). to assess the independence of these associations and their relative significance, we conducted a logistic regression simultaneously analyzing all of the associated variants, with pcos status as the dependent variable (supplemental table a2). this joint analysis revealed that the variants most significantly associated with pcos were the akt2 and gsk3b risk haplotypes. two akt2 snps and the haplotype characterized by them were significantly associated with an increased odds of pcos. genes with pleiotropic effects are sensible candidates for pcos, a syndrome characterized by dysfunction in multiple systems. akt2 is expressed in several key pcos tissues including adipose tissue, pancreas, and ovary and has a potential role in the regulation of insulin signaling and glucose uptake, insulin secretion, and cell proliferation in the ovary, all of which may be deranged in pcos (1). by examining multiple members of a pathway that has been previously implicated in both the genetics (13) and physiology (11) of pcos, we have demonstrated that the presence of variants in multiple members of a single pathway may increase pcos susceptibility. | objective insulin resistance has been reported in up to 70% of women with polycystic ovary syndrome (pcos). physiologic and genetic data currently implicate post insulin receptor signaling defects in substrates such as glycogen synthase kinase 3 (gsk3). the akt2 gene was chosen as a candidate for pcos because its product affects glucose metabolism and mitogenic signaling, interacts with gsk3, and mediates cell survival in the ovary.research design and methods subjects were recruited from the reproductive endocrinology clinic at the university of alabama at birmingham, and control subjects were recruited from the surrounding community ; 287 white women with pcos and 187 white control subjects were genotyped for four single nucleotide polymorphisms (snps) in akt2. genotyping took place at cedars - sinai medical center in los angeles. snps and haplotypes were tested for association with pcos risk and phenotypic markers of pcos.resultsminor allele carriers of snps rs3730051 and rs8100018 had increased odds of pcos (odds ratio [or ] 2.2, p = 0.004, and 2.4, p = 0.001, respectively). the haplotype t - g - c - t was significantly associated with pcos (or 2.0, p = 0.01). carriers of the risk haplotypes for both akt2 and gsk3b had a further increased odds of pcos (or 3.1, p = 0.005).conclusions these data suggest that polymorphisms in two components of the insulin signaling pathway, akt2 and gsk3b, are associated with pcos. the presence of multiple lesions in a single pathway may confer increased risk. |
in order to improve photon statistics in the image, photopeak window is widened, thus the contribution of penetrated and scattered photons are included in the image. the geometric components of the photons are the photons which were detected without interaction inside the collimator. gamma camera can not classify the image forming photons into geometric, penetrated, or scattered photons. therefore, with measuring the radio - activity, we can not accurately characterize the collimator which includes the accurate assessment of penetrated and scattered photons. single - photon emission computed tomography images are reconstructed on the assumption that detected photons are those photons which are emitted from a source located in a pixel area (rectangular area of constant width) and entered the collimator hole parallel to the hole axis. these criteria are only achieved if the collimator hole have infinite length and infinitely small hole size. parallel - hole collimator has finite length and finite hole size and, therefore, the detected photons are from the area enclosed by a cone whose vertex is at the point of interaction site of the photon on the crystal. in this case, the number of detected photons increases with the distance of the source from the collimator encompassing more area and therefore spatial resolution decreases. moreover, photons entering the collimator hole at small angle can be detected after penetrating the septa and/or scattering inside the collimator and introduces error in the quantification of in vivo activity and results in reduced image contrast. it is possible to track and record the life history of the individual photon originating from the source that ultimately deposits its complete energy inside the crystal using monte carlo simulation. therefore, with the help of monte carlo simulation technique, accurate assessment of the geometric, penetration and scatter contribution inside the photopeak window can be made. the aim of the study was to estimate the geometric, penetration, and scatter components for parallel - hole collimators using simulation of imaging nuclear detectors (simind) monte carlo simulation code. in order to characterize the parallel - hole collimators we simulated the millennium vg high - performance dual head gamma camera equipped with advanced xp digital detector ge medical systems, milwaukee, wi, usa. having 1 inch nai (tl) crystal thickness, intrinsic spatial resolution of 0.450 cm and energy resolution of 8.80% at 140 kev. the parallel - hole collimators used was vg low - energy general - purpose (legp), low - energy high - resolution (lehr), medium - energy general - purpose (megp) and high - energy general - purpose (hegp) collimators. collimator data used during the simulation study we have used the simind v4.9f monte carlo code developed by professor michael ljungberg. we installed it on a personal computer having windows 7 home basic (copyright 2009 microsoft corporation) 64-bit operating system, 2 gb ram and intel (r) core (tm) i3 - 2120 cpu @ 3.30 ghz processor. a cylindrical horizontal source of dimension 0.002 0.002 0.002 cm in a horizontal cylindrical phantom of size 22 30 22 cm was placed at the height of 12 cm from the detector. acceptance angle of photons emitted towards the camera was set as 45. a total of twenty simulations were made for four different collimators (legp, lehr, megp, and hegp) with five different energies (75, 140, 245, 364, and 511 kev) each. at each simulation, we have included the contribution of lead x - rays scatter photons inside the collimator. in each simulation, we collected 1000 million (1 10) photons. the pixel size in the simulated planar point source images was 0.340 cm, and they were stored in 128 128 matrix. the simind code creates a binary matrix image having float values (real 4). the simulations were set up in such a way that during each simulation gamma photons must impinge on whole camera surface, and at the end of simulation simind writes the value of each component (geometric, penetration, and scatter) and images in separate files. we imported these images in imagej and applied logarithmic transformation before displaying for visual and/or quantitative analysis. a square roi was placed as shown in figure 1 so that it completely enclosed the point source then used a java plug - in fwhm to calculated fwhm in both vertical and horizontal direction. the java plug - in provided the value of fwhm in terms of number of pixels. the value of fwhm was converted into mm by multiplying the number of pixel by the pixel size. (a) image of the point source with square roi, (b) horizontal profile, (c) vertical profile and (d) result the authors of the simind monte carlo code have used the delta scattering methods to sample the photons interaction through the collimators. the path length of the photons has been sampled according to the equation 1. where ln is the natural logarithm, r is the sampled uniform random number, and max is the largest attenuation coefficient within the heterogeneous media. the collimator can be considered as heterogeneous medium of air (0 g / cm) and lead. therefore, the ratio of /max for the collimator will be either 0 or 1. in this case, it is only necessary to test whether the end point is within the collimator hole or not. it is not necessary to find the geometric coordinates of end point of the photon. the algorithm they have used to assess geometric, penetrated and scattered photons is briefly summarized as follows : step 1 : record the entrance point of the gamma photon on the collimator face.step 2 : determine whether the entrance point is inside the collimator hole or in the lead septa based on a mathematical formula mentioned in the reference and keep the recordstep 3 : sample the path length of the photon using equation (1) and determine what will happen to the photon at the end of the sampled path. if r < /max, then location is the final end point of the photon following the real interaction. otherwise, continue tracking of photon by a new distance sampled according to equation (1). record the number of interactions between the entrance point and final end point of the photon. the history of the gamma photon is terminated when all of their energy was absorbed within the collimator material or escaped from collimator.step 4 : record the exit point on the collimator face towards nai (tl) crystal.step 5 : compare the entrance and the exit points. if the entrance and exit point is inside the hole of the collimator, then flag the photon as the geometric photon. if some (one or more) interaction has occurred inside the lead material then flag the photon as scattered photons, otherwise flag the photon as the penetrated photon.steps 6 : calculate the percentage of geometric, scattered and penetrated photons by dividing these numbers with the total number of photons that makes hits with the detector.step 7 : geometric, scattered and penetrated photon when makes hit with detector, track them individually and sampled for their contribution in the photopeak window. calculate the percentage of geometric, scattered, penetrated in the photopeak window by dividing with the total number of photopeak counts. step 1 : record the entrance point of the gamma photon on the collimator face. step 2 : determine whether the entrance point is inside the collimator hole or in the lead septa based on a mathematical formula mentioned in the reference and keep the record step 3 : sample the path length of the photon using equation (1) and determine what will happen to the photon at the end of the sampled path. if r < /max, then location is the final end point of the photon following the real interaction. otherwise, continue tracking of photon by a new distance sampled according to equation (1). record the number of interactions between the entrance point and final end point of the photon. the history of the gamma photon is terminated when all of their energy was absorbed within the collimator material or escaped from collimator. step 4 : record the exit point on the collimator face towards nai (tl) crystal. if the entrance and exit point is inside the hole of the collimator, then flag the photon as the geometric photon. if some (one or more) interaction has occurred inside the lead material then flag the photon as scattered photons, otherwise flag the photon as the penetrated photon. steps 6 : calculate the percentage of geometric, scattered and penetrated photons by dividing these numbers with the total number of photons that makes hits with the detector. step 7 : geometric, scattered and penetrated photon when makes hit with detector, track them individually and sampled for their contribution in the photopeak window. calculate the percentage of geometric, scattered, penetrated in the photopeak window by dividing with the total number of photopeak counts. the authors of the simind monte carlo code have used the delta scattering methods to sample the photons interaction through the collimators. where ln is the natural logarithm, r is the sampled uniform random number, and max is the largest attenuation coefficient within the heterogeneous media. the collimator can be considered as heterogeneous medium of air (0 g / cm) and lead. therefore, the ratio of /max for the collimator will be either 0 or 1. in this case, it is only necessary to test whether the end point is within the collimator hole or not. it is not necessary to find the geometric coordinates of end point of the photon. the algorithm they have used to assess geometric, penetrated and scattered photons is briefly summarized as follows : step 1 : record the entrance point of the gamma photon on the collimator face.step 2 : determine whether the entrance point is inside the collimator hole or in the lead septa based on a mathematical formula mentioned in the reference and keep the recordstep 3 : sample the path length of the photon using equation (1) and determine what will happen to the photon at the end of the sampled path. if r < /max, then location is the final end point of the photon following the real interaction. otherwise, continue tracking of photon by a new distance sampled according to equation (1). record the number of interactions between the entrance point and final end point of the photon. the history of the gamma photon is terminated when all of their energy was absorbed within the collimator material or escaped from collimator.step 4 : record the exit point on the collimator face towards nai (tl) crystal.step 5 : compare the entrance and the exit points. if the entrance and exit point is inside the hole of the collimator, then flag the photon as the geometric photon. if some (one or more) interaction has occurred inside the lead material then flag the photon as scattered photons, otherwise flag the photon as the penetrated photon.steps 6 : calculate the percentage of geometric, scattered and penetrated photons by dividing these numbers with the total number of photons that makes hits with the detector.step 7 : geometric, scattered and penetrated photon when makes hit with detector, track them individually and sampled for their contribution in the photopeak window. calculate the percentage of geometric, scattered, penetrated in the photopeak window by dividing with the total number of photopeak counts. step 1 : record the entrance point of the gamma photon on the collimator face. step 2 : determine whether the entrance point is inside the collimator hole or in the lead septa based on a mathematical formula mentioned in the reference and keep the record step 3 : sample the path length of the photon using equation (1) and determine what will happen to the photon at the end of the sampled path. if r < /max, then location is the final end point of the photon following the real interaction. otherwise, continue tracking of photon by a new distance sampled according to equation (1). record the number of interactions between the entrance point and final end point of the photon. the history of the gamma photon is terminated when all of their energy was absorbed within the collimator material or escaped from collimator. step 4 : record the exit point on the collimator face towards nai (tl) crystal. if the entrance and exit point is inside the hole of the collimator, then flag the photon as the geometric photon. if some (one or more) interaction has occurred inside the lead material then flag the photon as scattered photons, otherwise flag the photon as the penetrated photon. steps 6 : calculate the percentage of geometric, scattered and penetrated photons by dividing these numbers with the total number of photons that makes hits with the detector. step 7 : geometric, scattered and penetrated photon when makes hit with detector, track them individually and sampled for their contribution in the photopeak window. calculate the percentage of geometric, scattered, penetrated in the photopeak window by dividing with the total number of photopeak counts. we evaluated the geometric, septal penetration, and scattering component in parallel - hole collimators (legp, lehr, megp, and hegp) using radio - active point source having energy ranging from 75 kev to 511 kev using monte carlo simulation. figure 2 shows the variation of geometric, penetration, and scatter component with energy in legp, lehr, megp, and hegp collimators, respectively. it is clear that the geometric component has decreased with increase in energy, very sharp transition in case of legp and lehr while comparatively smooth transition in megp and hegp collimators [figure 2 ]. penetration and scatter component has increased with increase in energy showing sharp increase in case of legp and lehr, with a smooth increase in megp and hegp collimator. the result of the simulation the variation of geometric, penetration, and scatter component with energy in low - energy general - purpose (a), low - energy high - resolution (b), medium - energy general - purpose (c) and high - energy general - purpose (d) collimators, respectively image of the point source created at the end of each twenty simulation. low - energy general - purpose (a - e), low - energy high - resolution (f - j), medium - energy general - purpose (k - o), high - energy general - purpose (p - t) images were simulated at 75 kev, 140 kev, 245 kev, 364 kev, and 511 kev, respectively image of the point source created at the end of each twenty simulation is shown in figure 3. as shown in figure 3, we have found the point source image superimposed on intense foggy background, and star artefacts (the camera - wide tails showing six - fold symmetry) resulting in the loss of image contrast. for a particular selection of collimator this may be because of the selected higher energy photons to be imaged with respective collimators ; at these energies respective collimators are becoming virtually transparent. this is evident from the calculated value of high septa penetration and scattering obtained as a result of the simulation in these selected combination of collimator and energy of the gamma photon shown in table 2. it is important to note that figure 3e, the foggiest image has the highest value of penetration. the 6-fold symmetry of tails is associated with the hexagonal - hole shape of the collimator used in the simulation. the calculated vertical and horizontal fwhm on the images shown in figure 3 is given in table 3. fwhm of the point source images of figure 3 for a particular value of collimator, the fwhm of the point source (point spread function) have found to increase with increase in the energy, that is, with increase in energy, the system shows poorer spatial resolution. this may be due to increase in penetration and scatter inside the collimator with increase in photon energy. the spatial resolution (v = 9.962 mm and h = 9.52 mm at 140 kev) observed with lehr collimator is best spatial resolution observed in this study. in this study we had selected two low - energy collimators (legp and lehr), the better resolution of lehr than that of legp may be due to smaller diameter of the holes (diameter = 0.150 cm, lehr, and diameter = 0.190 cm, legp) [table 2 ]. the spatial resolution observed at 140 kev for megp and hegp in comparison to legp collimator may be due to combined effect of larger diameter of the holes (diameter = 0.300 cm for megp and diameter = 0.400 cm for hegp, increases sensitivity) and comparatively low percentage of scattered and penetrated components in case of megp and hegp collimators (penetration and scatter = 6.80% for legp, 3.58% for megp, and 3.30% for hegp) [table 2 ]. image of the point source created at the end of each twenty simulation is shown in figure 3. as shown in figure 3, we have found the point source image superimposed on intense foggy background, and star artefacts (the camera - wide tails showing six - fold symmetry) resulting in the loss of image contrast. for a particular selection of collimator this may be because of the selected higher energy photons to be imaged with respective collimators ; at these energies respective collimators are becoming virtually transparent. this is evident from the calculated value of high septa penetration and scattering obtained as a result of the simulation in these selected combination of collimator and energy of the gamma photon shown in table 2. it is important to note that figure 3e, the foggiest image has the highest value of penetration. the 6-fold symmetry of tails is associated with the hexagonal - hole shape of the collimator used in the simulation. the calculated vertical and horizontal fwhm on the images shown in figure 3 is given in table 3. fwhm of the point source images of figure 3 for a particular value of collimator, the fwhm of the point source (point spread function) have found to increase with increase in the energy, that is, with increase in energy, the system shows poorer spatial resolution. this may be due to increase in penetration and scatter inside the collimator with increase in photon energy. the spatial resolution (v = 9.962 mm and h = 9.52 mm at 140 kev) observed with lehr collimator is best spatial resolution observed in this study. in this study we had selected two low - energy collimators (legp and lehr), the better resolution of lehr than that of legp may be due to smaller diameter of the holes (diameter = 0.150 cm, lehr, and diameter = 0.190 cm, legp) [table 2 ]. the spatial resolution observed at 140 kev for megp and hegp in comparison to legp collimator may be due to combined effect of larger diameter of the holes (diameter = 0.300 cm for megp and diameter = 0.400 cm for hegp, increases sensitivity) and comparatively low percentage of scattered and penetrated components in case of megp and hegp collimators (penetration and scatter = 6.80% for legp, 3.58% for megp, and 3.30% for hegp) [table 2 ]. the effect of penetration and scatter have been studied both qualitatively and quantitatively in clinical and phantom study and found that the accuracy of quantification improves by incorporating the compensation of collimator detecting response function. the collimator detector response function has four component namely intrinsic response, geometric, penetration and scatter component of the collimator parameters. accurate quantification of in vivo activity requires the assessment of the contribution of penetrated and scattered photons so that the correction can be made. we assessed these contributions using monte carlo simulation. although the geometric component does not depend on the energy, for all the four investigated parallel - hole collimator we found the value of geometric component at 75 kev was less than that at 140 kev. this may be because the one inch crystal thickness (used in the simulation) is optimized for imaging radioisotope having energy more than 100511 kev and gamma camera is optimized for 140 kev most widely used radioisotope in nuclear medicine. 75 kev photon will penetrate approximately half the distance than that of 140 kev and light will travel from that point to the end of the crystal to pmt. the amount of light reaching the pmt will be less due to absorption and scattering of light inside the nai (tl) crystal. therefore, the photopeak efficiency will be less in case of 75 kev photons. this may be the reason for less geometric component for 75 kev in comparison to 140 kev. low - energy photon (75 kev) can also undergo multiple compton scattering and final photopeak absorption, and this will increase the photopeak counts. both the phenomena, that is, multiple scattering leading to final photopeak absorption and diffusion of light over a longer path before reaching pmts, also degrade the spatial resolution. for all the four collimators, we have found more fwhm (less spatial resolution) in comparison to the 140 kev photon [table 3 ]. the value of geometric component has decreased with increase in energy of the gamma photons with all the collimator. one inch crystal is sufficient to absorb all 140 kev gamma photon completely ; however, it is not sufficient to stop all high energy photon above 245 kev. and the low geometric component may be due to low efficiency of one inch crystal thickness used in the simulation. they have estimated geometric, penetration, and scatter component for the energy range of 250450 kev for dst - xli dual - head gamma camera with hegp collimator. the poor spatial resolution was observed in the case of megp in comparison to lehr and legp for 140 kev photon. the septa thickness is designed to control the number of photons penetrating the septa and generally it is such that less than 5% penetrated photons are allowed. we have found less than 5% septa penetration in both lehr and legp collimators which is in agreement with the general principle of designing collimators septa thickness for imaging low - energy isotope up to 140 kev energy. we have found very high value of septa penetration and scatter, at energy higher than 140 kev for legp and lehr collimator so that it is advised not to use these collimators for imaging high energy radioisotopes. septa penetration was found to be more than 5% for both the collimators designed to image medium - energy or high energy radioisotopes. for megp collimator designed to image 245 kev, the septa penetration was 5.43% and hegp designed to image 364 kev photons, we have found the value of septa penetration as 18.63% which is quite high, the contribution due to penetration and scattering is equal to 32.22%. therefore, correction for penetration and scattering becomes very important in case of i-131 imaging when we are interested in the quantification of in vivo i-131 activity. as holes are made longer, gamma rays that are not quite perpendicular to the collimator are more likely to be absorbed in the septa before they reach the scintillation crystal. for megp and hegp collimator, hole length are increasing to maintain the resolution and hole size is increasing to maintain the sensitivity. hole size for megp and hegp collimator are 0.300 cm and 0.400 cm, respectively. septa thickness is also increased to reduce the septal penetration in these collimators at high energy. the inaccuracy in the calculation of fwhm [s. no. 3, 4, 5, 8, 9, 10, 14, 15, 19, 20 in table 3 ] was observed in case of all the combination of collimator and energy of photons listed in table 3. the calculated fwhm is nearly same for megp collimator (approximately 11.55 mm, s. no. however, by looking at the figure 2m - o, it is obvious that the calculated fwhm can not be accepted. the second example is in case of hegp collimator, the calculate fwhm value shows that hegp collimator has better resolution for 511 kev in comparison to the 364 kev photons, that is not acceptable which is clear from the figure 2s and t. this inaccuracy in calculation of fwhm may be attributed to heavy septa penetration and scattering inside the collimator that has introduced star artefacts. the plugin used to calculate fwhm fits a gaussian function to a horizontal and vertical cut that is centered on the brightest point in the image and returns the fwhm of the function both in numerical and graphical formats. there is an obvious star artefact in figure 3n is due to septa penetration, it is clear from the figure that a bright line is passing vertically through the brightest point source, therefore, vertical profile have high value of fwhm, while no such line exists in the horizontal direction through the brightest points, therefore, horizontal fwhm will be much less in comparison to vertical fwhm. when the contribution of penetration and scattering is very high, the image of a point source becomes very blurred and becomes very difficult to put roi in order to quantify the activity. the gamma camera modeled in our study is not the same as other investigators ; therefore, a quantitative comparison is not possible. however, there are few studies related with assessment of geometric, penetration, and scatter components. have also calculated geometric, penetration and scatter components of events within 20% window at 364 kev for point source in air and found 73% of the events in the photopeak window had either scattered or penetrated the collimator. they simulated for nai (tl) crystal of size 24 40 cm and 0.95 cm crystal thickness, hegp collimator with square size hole = 3.54 mm, septa = 1 mm, thickness = 5.84 cm. simulated for 3/8 inch nai (tl) crystal thickness, energy resolution 9.8% at 140 kev, hegp collimator hexagonal - hole, collimator thickness 5.4 cm, septa thickness 0.16 cm, and found 64% either penetration or scatter in the photopeak window. we have found 32.22% of the event, the 20% photopeak window center at 364 kev either penetrated or scattered in the hegp collimator (hexagonal - hole, hole diameter = 0.447 cm, collimator thickness 6.60 cm, septa thickness 0.535 cm). and 65.11% of the event the 20% photopeak window center at 364 kev either penetrated or scattered in the megp collimator (hexagonal - hole, hole diameter = 0.335 cm, collimator thickness 5.80 cm, septa thickness 0.350 cm). it is important to take into account the effect of backscatter from the pmts and shielding material surrounding the crystal because these photons might re - enter into the crystal. we have used a single slab of 5 cm thick pyrex just below the crystal to include the effect of backscatter in the simulation. low - energy general - purpose and lehr collimator is best to image 140 kev photon. hegp can be used for 245 kev and 364 kev ; however, correction for penetration and scatter must be applied if one is interested to quantify the in vivo activity of energy 364 kev. due to heavy penetration and scattering the result of this study can be used for optimal collimator design and development of new correction algorithm, because for evaluation and design of scatter correction algorithm, proper understanding of how the scattered photons are distributed and about its properties is required. | objective : accuracy of in vivo activity quantification improves after the correction of penetrated and scattered photons. however, accurate assessment is not possible with physical experiment. we have used monte carlo simulation to accurately assess the contribution of penetrated and scattered photons in the photopeak window.materials and methods : simulations were performed with simulation of imaging nuclear detectors monte carlo code. the simulations were set up in such a way that it provides geometric, penetration, and scatter components after each simulation and writes binary images to a data file. these components were analyzed graphically using microsoft excel (microsoft corporation, usa). each binary image was imported in software (imagej) and logarithmic transformation was applied for visual assessment of image quality, plotting profile across the center of the images and calculating full width at half maximum (fwhm) in horizontal and vertical directions.results:the geometric, penetration, and scatter at 140 kev for low - energy general - purpose were 93.20%, 4.13%, 2.67% respectively. similarly, geometric, penetration, and scatter at 140 kev for low - energy high - resolution (lehr), medium - energy general - purpose (megp), and high - energy general - purpose (hegp) collimator were (94.06%, 3.39%, 2.55%), (96.42%, 1.52%, 2.06%), and (96.70%, 1.45%, 1.85%), respectively. for megp collimator at 245 kev photon and for hegp collimator at 364 kev were 89.10%, 7.08%, 3.82% and 67.78%, 18.63%, 13.59%, respectively.conclusion:low-energy general - purpose and lehr collimator is best to image 140 kev photon. hegp can be used for 245 kev and 364 kev ; however, correction for penetration and scatter must be applied if one is interested to quantify the in vivo activity of energy 364 kev. due to heavy penetration and scattering, 511 kev photons should not be imaged with hegp collimator. |
knee osteoarthritis (oa) is a motor disorder that leads to decreased quality of life (qol)1 and physical function2, 3 in old age due to knee pain and is one of the causes of the need for nursing care. the prevention of knee oa and amelioration of its symptoms are urgent issues today due to rapidly increasing elderly populations. the importance of knee muscle strength training in conservative treatment is well known, and its effects have been verified in previous studies4,5,6,7,8,9,10,11,12,13. the pain of oa is often worsened with activity, and as oa progresses, pain may become more persistent and can also appear at rest and during the night14. in the abovementioned studies, however, pain assessment was performed only at rest or while walking and ascending / descending stairs. in addition, the abovementioned studies have shown improvements in knee extension muscle strength after training, as well as reductions in pain in people with knee oa. the quadriceps are the largest group of muscles crossing the knee joint and the primary stabilizer of the knee and have the greatest potential to generate and absorb forces at the knee15. dynamic stability at the knee joint is provided by the muscles that surround the knee joint, the principal of which are the quadriceps and hamstring muscles16. knee extension and flexion muscle strength are both lost as symptomatic knee oa progresses18, 19. evaluation of both quadriceps and hamstring muscle strength is therefore important, and the relationship of quadriceps and hamstring muscle strength with pain symptoms should be examined. the strength relationship between the quadriceps and hamstring muscles has been measured and reported by various researchers20,21,22. the ratio of quadriceps to hamstring muscle strength, usually assessed by the hamstring : quadriceps (h : q) ratio, is important for the stability of the knee and for the balance of muscle strength20, 23. on the other hand, gibbon. argued that if discrimination is performed by comparing absolute differences, then equal absolute differences might be expected to result in equal discrimination of performance. conversely, if choices are made based on a ratio comparison, then discrimination performance might be expected to be constant at constant ratios of a short to a long interval when the time values, short and long, are changed, but kept in the same ratio24. one may assume that both knee extension and flexion muscle strength would be lower with increasing knee pain, in which case there would be no change in the h : q ratio. for this reason, the absolute difference between extension strength and flexion strength (q h) may be a more reasonable indicator of knee pain. in addition, positive correlation between strength and body size is expected25, 26 ; thus it is necessary to calculate the muscle strength / body weight ratio. however, to our knowledge, the relationship between quadriceps and hamstring muscle strength and pain during detailed activities of daily living (adl) has not been reported from the point of view of q h compared with the h : q ratio. to elucidate the relationship between muscle strength and pain symptoms, we investigated the relationship between knee pain in adl and not only knee extension and flexion muscle strength but also q h and the h : q ratio. as a supplement, the participants of the present study were recruited from among female outpatients and inpatients diagnosed with knee oa, which had been treated in the orthopedics department of the national center for geriatrics and gerontology in obu city, aichi prefecture, japan. the period of recruitment was from february 24, 2011, to may 31, 2013. participants were excluded if they reported a previous knee joint replacement, hip or lumbar spine arthritis or other joint pathology causing lower - limb pain, or knee surgery. after selection, the participants were informed about the objectives of the study, and all participants signed a consent form to participate in this study. the participants of this study were 78 females (mean age 73.6 8.4 years), and a total of 133 knees that had not been treated surgically were the targets of this research. one of an individual s legs is generally dominant, and the other is nondominant. the leg with which the relatively skilled action of kicking a ball is done is generally the dominant leg, while the leg with which weight is supported is generally the nondominant leg27, 28. therefore, the legs were divided according to lower limb dominance, and the dominant leg was found to be the right leg in 72 females and the left leg in 6 females. knee extension and flexion muscle strength was measured using a prototype instrument developed jointly with the department of gerontechnology at our center. the instrument can be transported on a cart and uses a force gauge (zp-500n, imada co., ltd., toyohashi, aichi, japan) to measure the precision of industrial products. in the pilot study, six healthy participants were randomly selected, and their left and right legs (n=3 for each) were measured. the intra - rater reliability was good for both knee extension (intraclass correlation coefficient (icc1,2)=0.988) and flexion (icc1,2=0.951) muscle strength. significant correlations were seen between measurements from the prototype instrument and an isokinetic dynamometer (kin com 500h, isokinetic international, chattanooga, tn, usa). with subjects in a sitting position with their legs flexed 90 and a strap on the ankle joint, knee extension and flexion muscle strength were measured isometrically for 3 seconds. knee extension and flexion muscle strength were measured two times each in the left and right legs, and the better value for each side was utilized. knee extension and flexion muscle strength were expressed as the proportion to body weight, the h : q ratio (flexion strength / extension strength). the difference between extension and flexion strength, (extension strength / weight) minus (flexion strength / weight), that is, q h, was also calculated. knee pain during adl in the dominant and nondominant legs was surveyed with a questionnaire. the adl questionnaire used the western ontario and mcmaster universities osteoarthritis index (womac) as a reference. the adl questionnaire added the japanese traditional style to 4 activities in the womac and level ground walking. stair climbing, lying down, standing up, and sitting on the floor with the legs folded underneath the body were assessed. the scale consisted of 5 grades, from 1 to 5, with 1 corresponding to no pain and 5 corresponding to severe pain. the scores for each adl measure and the total score obtained by summing the individual scores were used. the correlation between the indices related to muscle strength and knee pain score during adl was investigated using pearson s correlation coefficient in the dominant and nondominant legs. the study was a case - control study, and ethical approval was obtained from the national center for geriatrics and gerontology research ethics committee. demographic data of participants are listed in table 1table 1.characteristics of the study participantsdominantnondominantknee extension muscle strength (kg)18.9 5.6917.7 5.56knee extension strength / weight0.34 0.110.32 0.10knee flexion muscle strength (kg)8.50 3.337.66 3.31knee flexion 0.140.44 0.15q h0.18 0.080.18 0.08knee pain during activities of daily livinglevel ground walking1.97 1.002.04 1.06stair climbing2.48 1.182.67 1.35lying down1.76 0.911.71 0.80standing up2.11 0.972.04 1.00sitting on the floor with the legs folded underneath the body3.75 1.663.70 1.72total12.1 4.6812.2 4.93mean sd. in the dominant leg, significant correlations were seen between knee extension muscle strength and knee pain scores during level ground walking (r=0.34, p=0.006) and stair climbing (r=0.28, p=0.029) and between knee extension strength and the total score (r=0.27, p=0.033). the correlation between knee extension strength / weight and knee pain scores was also significant (walking, r=0.36, p=0.004 ; stair climbing, r=0.34, p=0.007 ; total pain score, r=0.31, p=0.014) (table 2table 2.correlation between knee muscle strength and knee pain during adl in the dominant legadllevel ground walkingstair climbinglying downstanding upsitting on the floor with the legs folded underneath the body totalextension muscle strength0.340.280.170.130.190.27extension strength / weight0.360.340.230.190.180.31flexion muscle strength0.220.160.010.050.120.14flexion strength / weight0.230.150.050.050.080.14h : q ratio 0.040.110.09 0.050.0040.06q h0.290.320.270.200.170.29h : q ratio : hamstring : quadriceps ratio ; q h : the difference between extension strength and flexion strength. significance of p<0.05, significance of p<0.01 (pearson s correlation coefficient)). h : q ratio : hamstring : quadriceps ratio ; q h : the difference between extension strength and flexion strength. significance of p<0.05, significance of p<0.01 (pearson s correlation coefficient) in the nondominant leg, significant correlations were seen between knee extension muscle strength and knee pain scores during level ground walking (r=0.33, p=0.005), stair climbing (r=0.25, p=0.034), sitting on the floor with the legs underneath the body (r=0.33, p=0.005), and the total score (r=0.31, p=0.009). regarding knee extension strength / weight, knee pain scores during standing up were added to the significant correlations (table 3table 3.correlation between knee muscle strength and knee pain during adl in the nondominant legadllevel ground walkingstair climbinglying downstanding upsitting on the floor with the legs folded underneath the body totalextension muscle strength0.330.250.090.190.330.31extension strength / weight0.330.320.100.310.320.35flexion muscle strength0.200.220.050.080.270.22flexion strength / weight0.180.230.060.110.210.21h : q ratio 0.100.020.04 0.16 0.040.06q h0.300.240.090.330.270.31h : q ratio : hamstring : quadriceps ratio ; q h : the difference between extension strength and flexion strength. significance of p<0.05, significance of p<0.01 (pearson s correlation coefficient)). h : q ratio : hamstring : quadriceps ratio ; q h : the difference between extension strength and flexion strength. significance of p<0.05, significance of p<0.01 (pearson s correlation coefficient) knee flexion muscle strength was not found to be significantly correlated with knee pain in any activity except sitting on the floor with the legs underneath the body, which showed significant correlation in the nondominant leg (tables 2 and 3). the h : q ratio was not significantly correlated with knee pain during any adl, irrespective of dominancy. on the other hand, the correlation with the knee pain score and q h were significant in all activities except standing up and sitting on the floor with the legs underneath the body in the dominant leg. in the nondominant leg, the correlations with the knee pain score and q h were significant during all activities except lying down (tables 2 and 3). in the present study, we investigated the relationship between knee extension and flexion muscle strength and knee pain in adl in the dominant and nondominant leg. the tendency for significant correlations between knee pain scores was basically similar, irrespective of dominancy. in both the dominant and nondominant legs, there were moderate but significant correlations between knee pain and the absolute value of knee extension muscle strength, the extension strength / weight ratio, and q h. knee flexion muscle strength and the h : q ratio were not significantly correlated with knee pain during any activity. in past reports on the relationship between muscle strength and knee pain, the knee - specific vas pain score and the association between tertiles of quadriceps strength (expressed as quadriceps strength relative to body weight (nm / kg)) were examined. in a study with 265 males and females with symptomatic knee oa, subjects with greater quadriceps strength had less knee pain29. in another report, the association of the consistency of frequent knee pain (fknp) with extension muscle strength (nm) was also evaluated. in a study of 2,940 participants either with or at high risk of knee oa, knees with consistent pain had the lowest quadriceps strength, while those with inconsistent pain had intermediate quadriceps strength ; those with no fknp had the greatest quadriceps strength30. in addition, whether maximal isometric extension and flexion muscle strength (n) differ between oa knees with frequent pain (most days of the month within the past 12 months) and contralateral knees without pain was examined. painful knees showed lower maximal extension muscle strength than contralateral knees without pain, and there were no significant differences in flexion muscle strength in 17 males and 31 females with knee oa31. similar to these previous studies, both the absolute value of extension muscle strength and the extension strength / weight ratio in this study were related to knee pain in both legs, but knee flexion muscle strength was not found to be correlated with knee pain. because the lower limb musculature is the natural brace of the knee joint, important muscle dysfunction may arise from either quadriceps weakness or weakness of the hamstring relative to the quadriceps, which is usually assessed by the h : q ratio32,33,34. in the present study, however, we found that the h : q ratio was not significantly correlated with knee pain during any adl. the reason for this, we supposed, is that both knee extension and flexion muscle strength may decrease with increasing knee pain, in which case there would be no change in the h : q ratio. in a previous examination of whether the h : q ratio predicts risk for incident symptomatic whole knee oa in adults aged 5079 years, the h : q ratio was not found to be predictive of incident symptomatic whole knee oa in either gender. in other reports, the correlation of the h : q ratio with the usual level of pain was negative in patients with knee oa20, and pain intensity during testing did not affect the h : q ratio in subjects with knee oa19. this study also found that q h was significantly correlated with knee pain during many activities. therefore, it may be that q h is a more reasonable indicator than the h : q ratio, as q h may better reflect the balance of muscle strength, that is, the stability of the knee, than the h : q ratio. additionally, the results regarding the correlation between q h and knee pain showed no difference between the dominant and nondominant legs. limitations of this study include that it was a cross - sectional study, and therefore comments about causality can not be made. second, we did not account for other individual characteristics affecting knee pain, such as knee alignment and inflammation. in conclusion, knee extension muscle strength and the difference between extension strength / weight and flexion strength / weight were found to be significantly correlated with knee pain during adl, whereas the hamstring : quadriceps ratio was not. this finding suggests that increasing the strength of knee extensors while maintaining a balance with hamstring muscle strength may contribute to reducing knee pain during adl. | [purpose ] the purpose of this study was to elucidate the relationship between knee muscle strength and knee pain in activities of daily living, based on consideration of the difference between extension and flexion strength (q h) and the hamstring : quadriceps (h : q) ratio in patients with knee osteoarthritis. [subjects and methods ] the participants were 78 females with knee osteoarthritis, and a total of 133 knees that had not been treated surgically were the targets of this research. the legs were divided according to dominance. isometric knee extension and flexion muscle strength and knee pain during activities of daily living were measured. the h : q ratio (flexion / extension muscle strength) and the difference between extension and flexion strength, (extension muscle strength / weight) minus (flexion muscle strength / weight), that is, q h, were calculated. the correlation between these indices and the knee pain score during activities of daily living was investigated. [results ] greater knee pain during activities of daily living was related to lower knee extension muscle strength and q h in both the dominant and nondominant legs. knee flexion muscle strength and the h : q ratio were not significantly correlated with knee pain during any activities of daily living. [conclusion ] knee extension muscle strength and q h were found to be significantly correlated with knee pain during activities of daily living, whereas the h : q ratio was not. |
malignancy and clonal proliferation of common myeloid progenitors result in chronic myeloproliferative neoplasms involving myeloid lineage, including monocytic, erythroid megakaryocytic series. unlike acute leukemias, these neoplasms do not show disruption in cell maturation and differentiation, and thus, a high count of differentiated cells of myeloid series is observed in bone marrow and peripheral blood of patients. moreover, increase in immature and mature granulocytes (with blast count 25,000/l with a sharp increase ingranulocytes and their precursors. 510 ml peripheral blood of patients was drawn on ethylene diamine tetra acetic acid anticoagulant (sigma, germany). mononuclear cells were separated by ficoll (sigma aldrich, germany) within 2 h, and rna was extracted using qiazol lysis reagent (qiagen, germany) as manufactured protocol. rna level was determined by optical density, the absorption was measured in 260 nm and the quality of extracted rna was confirmed using electrophoresis and revelation of 18s and 28s bands. cdna was synthesized from extracted rna by cdna synthesis kit (fermentas, germany) according to kit protocol. multiplex reverse transcription polymerase chain reaction (rt - pcr) was used to assess different abl - bcr fusions, including b2a2, b3a2, e1a2 b2a3, b3a3, or e19a2. the primers used to detect the relevant fusions and other pcr information are presented in tables 13. sequence of primers for multiplex polymerase chain reaction size of amplified region using primers listed for breakpoint cluster region - abelson murine leukemia fusions multiplex polymerase chain reaction thermal program k562 cell line was used as positive control (b3a2) and samples from healthy subjects were used as negative control. finally, the data were subject to statistical analysis using spss version 16 (spss inc, chicago, ill) and descriptive statistics (mean, standard deviation, and frequencies) as well as multiple analysis of variance (manova). fifty - eight patients among those with chronic myeloproliferative morphology were positive for philadelphia chromosome. of 58 patients, 18 (30%) had b2a2 fusion and 37 (63.9%) had b3a2 fusion [figure 1 ]. in figure 1, multiplex rt - pcr results, various bands related to b2a2 and b3a2 fusions as well as positive and negative controls have been shown. three patients (5.1%) had e1a2 fusion but were excluded from the study to avoid errors in statistical analyzes. mean age of participants was 48 1.457 years, and there were 24 male and 31 female patients [table 4 ], which was an interesting finding. patients 1 and 2 had b3a2 fusion and patients 3, 4, 9 and 10 had b2a2 fusion (generating 210 kda protein). other patients were negative for philadelphia chromosome prevalence of fusions in studied patients according to gender manova was used for comparison between four variables of hemoglobin (hb), platelet count, age and wbc count in patients with b2a2 and b3a2 fusions [table 5 ]. box 's test was used to evaluate the equivalence of covariance matrices with f = 1.222, degree of freedom 1 = 10 (df), df2 = 49.5449 and significant = 0.266, which confirmed the equivalence hypothesis of multivariate covariance matrices. considering the results of multivariate analysis and significance level of indices (p > 0.05), it can be stated that isoforms were not significantly different in terms of variables such as age as well as hematological parameters of hb, platelet count, and wbc [table 6 ]. the results of univariate analysis showed that mean age and hematological parameters were not different in various fusion types [table 7 ]. meanstandard deviation age of hematologic parameters and age based on fusion type multiple analysis of variance results estimation of marginal means chronic myeloid leukemia is a chronic malignancy of myeloid lineage associated with increased wbc count with varying degrees of granulocytic cell immaturity at diagnosis. the number of blasts and promyelocytes fluctuates in untreated patients, platelet count is high on diagnosis and mild normochromic normocytic anemia is observed in patients. detection of abl - bcr variants plays an important role in the diagnosis and treatment of cml patients. in this study, patients with cml morphology were assessed regarding abl - bcr fusions and their correlation with changes in peripheral blood cells, and 100 patients with chronic myeloproliferative morphology were examined for different abl - bcr fusions. finally, among 58 philadelphia - positive patients, frequency of b2a2, b3a2, and e1a2 fusions was 5.30, 71.62, and 80.3, respectively, which indicated that b3a2 fusion generating a p210 kda fusion protein had the highest prevalence among the studied patients. comparison between four variables of hb, platelet count, age, and wbc count in patients with b2a2 and b3a2 fusions indicated no significant correlation between these variables and type of fusion. this is while similar studies have indicated a significant correlation between fusion type and a number of peripheral blood parameters. wei showed that b3a2 fusion and m - bcr - abl sequence expression increased platelet count on diagnosis but did not affect hematologic parameters in the expression of b2a2 sequence. another study by bennour. in 2013 showed that the level of increase in platelet count was higher in patients with b3a2 fusion relative to patients with b2a2 fusion whereas there was no significant difference in other parameters. in another similar study, perego. studied the relationship between b2a2 and b3a2 fusions and parameters such as age, gender, hb, platelet, and wbc count and showed that platelet count was higher in b3a2 relative to b2a2 sequence. rosas - cabral. reported a significant correlation between b3a2 fusion and increased platelet count in mexico. however, in this study, similar to other studies conducted in iran, no significant correlation was reported between fusion type and hematological parameters in cml patients. despite the racial features of people in lorestan province, the results of this study were comparable with similar studies in the country. | context : chronic myelogenous leukemia (cml) is a chronic malignancy of myeloid linage associated with a significant increase in granulocytes in bone marrow and peripheral blood. cml diagnosis is based on detection of philadelphia chromosome and abelson murine leukemia viral oncogene homolog (abl)-breakpoint cluster region protein fusions (abl - bcr fusions).aims : in this study, patients with cml morphology were studied according to abl - bcr fusions and the relationship between the fusions and peripheral blood cell changes was examined.materials and methods : all patients suspected to chronic myeloproliferative disorders in lorestan province visiting subspecialist hematology clinics who were confirmed by oncologist were studied over a period of 5 years. after completing basic data questionnaire, blood samples were obtained with informed consent from the patients. blood cell count and morphology were investigated and rna was extracted from blood samples. cdna was synthesized from rna and abl - bcr fusions including b3a2 and b2a2 (protein 210 kd or p210), e1a2 (protein 190 kdor p190), and e19a2 (protein 230 kdor p230) were studied by multiplex reverse transcription polymerase chain reaction method. coexistence of e1a2 and b2a2 (p210/p190) fusions was also studied. the prevalence of mutations and their correlation with the blood parameters were statistically analyzed.results:of 58 patients positive for abl - bcr fusion, 18 (30.5%) had b2a2 fusion, 37 (62.71%) had b3a2 fusion and three (3.08%) had e1a2 fusion. coexistence of e1a2 and b2a2 (p210/p190) was not observed. there was no significant correlation between abl - bcr fusions and white blood cell count, platelet count, and hemoglobin concentration.conclusions:the abl - bcr fusions in lorestan province were similar to other studies in iran, and b3a2 fusion had the highest prevalence in the studied patients studied. |
calcifying odontogenic cyst, also known as gorlin cyst, is an uncommon developmental lesion that originates from the odontogenic epithelium1.. 's first description of such a lesion in 1962, it has become clear that two basic entities may be present : a cystic tumor and a solid neoplasm2. this benign cystic neoplasm is microscopically characterized by a well - defined basal layer in the epithelial lining. an overlying layer consists of stellate reticulum - like cells, and masses of ghost cells are present within the epithelial lining or fibrous capsule. moreover, dystrophic calcification forms a dentinoid tissue in the fibrous capsule34. in 2005, the world health organization classification of head and neck tumors considered this lesion an odontogenic tumor rather than a cystic lesion and thus named it calcifying cystic odontogenic tumor (ccot)5. ccot is an uncommon lesion that represents only about 1% of jaw cysts, occurring mostly within the bone. both intraosseous and extraosseous forms of the lesion are found in the maxilla and mandible with approximately the same probability6, and these lesions mostly affect the incisor and canine areas. this lesion can also involve the posterior maxilla, but only few such cases have been reported78. ccot is mostly asymptomatic ; therefore, it is frequently discovered during a routine radiographic examination3. radiographically, ccot typically presents as an unilocular or multilocular distinct radiolucent area that may include various radiopaque irregular calcified bodies. the lesion may be related with an odontoma or an unerupted tooth nearly onethird of the cases involve impacted teeth9. the treatment plan for ccot depends on the location and histological type of the lesion. a conservative treatment modality such as simple enucleation and curettage is mostly chosen for the cystic variants with good prognosis. in contrast, complete excision is recommended for the neoplastic variant, and recurrence is frequent10. ccot in the maxilla involving the maxillary sinus is relatively rare, and very few cases have been published. furthermore, only one case of recurrent ccot invading into the maxillary sinus was reported in the english literature11. therefore, the present case regarding a cystic variant of ccot in the posterior maxilla that recurred twice is uncommon. this report aimed to represent this recurrent cystic tumor occupying most of the maxillary sinus and that was successfully managed by conservative treatment. a 24-year - old male patient was referred to our department by an otolaryngologist due to an expansive lesion of the left maxillary region. the clinical exam revealed that an asymptomatic swelling had increased in size in the area of the upper left premolars and molars. the patient had undergone functional endoscopic sinus surgery (fess) twice based on a presumptive diagnosis of a cystic lesion in the maxillary sinus at the department of otorhinolaryngology. two years after the first fess procedure, the patient revisited the hospital with a complaint of nasal obstruction and cheek tenderness in the same region.(fig. 1) an additional fess procedure for cyst marsupialization and granulation tissue removal was performed at the same department. however, the patient revisited the hospital 3 years later with recurred symptoms, and an extended lesion was seen on computed tomography (ct).(fig. 2. b) extraoral examination showed facial asymmetry due to a non - tender left maxillary swelling. intraoral examination revealed a firm swelling, covered by mucosa of normal appearance, which was localized on the buccal aspect of the premolar to the first molar region. a panoramic radiograph revealed a large radiolucent lesion in the left maxillary sinus extending from # 23 to # 27, and the cystic lesion had resorbed the roots of teeth # 23 to # 27.(fig. a) ct scans showed a well - defined expansive lesion with thin cortical margins and irregular radiopaque masses. the size of the lesion was uncommonly large and occupied nearly the entire left maxillary sinus and extended to the orbital floor.(fig. b) cystic marsupialization and placement of an acrylic tube for maintaining a patency and drainage were carried out under local anesthesia.(fig. a) the patient was educated to irrigate the area with normal saline solution two times a week. endodontic treatments were also performed in the involved teeth # 23 to # 27 that showed root resorption. five months after the initial intervention, considerable regression of the lesion and new bone formation around the root areas of teeth # 23 to # 27 were noted. radiographic examination showed that the bony border between the lesion and maxillary sinus became more apparent ; the haziness in the area of the maxillary sinus not involved with the lesion appeared to be clearer, as new bone was deposited into the lesional border.(fig. c) at this time, surgical removal of the tumor was planned. under general anesthesia, 4) as mentioned, since five months of marsupialization caused a thickened wall of the maxillary sinus, which was also the border between the lesion and the maxillary sinus, the sinus was intact during the surgery. histopathological examination concluded fibrous connective tissue with an epithelial lining ; mineralization of ghost cells and dentinoid materials were identified. cuboidal and cylindrical cells were found in the basal layer, and the epithelial cells were loosely arranged with groups of ghost cells. odontogenic epithelial remnants are considered an origin of ccot ; because they are trapped within the bone or gingival tissue, ccots can be either intraosseous or extraosseous. in about 86% to 98% of cases, the lesions appear as a cyst - like structure, whereas 2% to 16% of cases show the solid or neoplastic form3. since most ccots have no symptoms, they are usually found incidentally on radiographic results, and the lesions are often located in periapical or lateral periodontal areas of adjacent teeth12. differential diagnosis of ccot involves dentigerous cyst, adenomatoid odontogenic tumor, ameloblastic fibro - odontoma, and calcifying epithelial odontogenic tumor. when calcified material is found on radiographic examination, the possibility of adenomatoid odontogenic tumor, calcifying epithelial odontogenic tumor, ossifying fibroma, and odontoma should be considered1314. in addition, it is important to recognize that, when ccot is related with apices of the teeth, there is a high incidence of root resorption11. in cases of lesion associated with the apices of the teeth, this rate of root resorption by ccot is high compared with that by ameloblastoma in the cases reported by struthers and shear16. therefore, root resorption, which was also found in the present case, can be considered one of the common features when the lesion is associated with adjacent teeth. treatment of ccots can be determined according to the site and the histological type of the lesion. ledesma - montes.17 studied 122 cases of ccot and identified the following 4 histological variants : simple cystic ccot (type 1), odontoma - associated ccot (type 2), ameloblatomatous proliferating ccot (type 3), and ccot related with benign odontogenic tumors other than odontoma (type 4). in this case, the microscopic findings corresponded to those of ccot type 1, the most commonly found histologic subtype. the treatment of the cystic (type 1) variant of ccot is usually conservative. such treatment includes enucleation with curettage for intraosseous lesions and local excision for the extraosseous lesions. enucleation with curettage is the most approved treatment for intraosseous lesions rather than enucleation alone18. enucleation with curettage means the removal of a 1- to 2-mm layer of bone around the periphery of the cystic cavity with a sharp curette or a bone bur. the purpose of this procedure is to eliminate the epithelial debris from which a recurrent lesion could originate1114. the solid variant of ccot, which is often called a dentinogenic ghost cell tumor, is usually more aggressive. although the prognosis of the cystic type of ccot is favorable, the presented patient had experienced two recurrences in five years before he was referred to our department. although the lesion initially showed regression, the recurrent symptoms of nasal obstruction and cheek tenderness appeared two years after the first fess procedure. the patient showed similar symptoms with apparent extension of the lesion on ct three years after the additional fess procedure. 1) the transnasal endoscopic approach to ccot is considered more esthetic and less invasive than the conventional lateral approach20. since ccot arises from odontogenic epithelial remnants that are often in a periapical or lateral periodontal relationship to adjacent teeth, treatment such as endodontic therapy or extraction of the involved teeth needs to be performed. when enucleation is considered the treatment of choice, the lesion should be thoroughly removed, including that in the area of the affected teeth area. although there were two recurrences in the presented case, the patient was again treated conservatively utilizing marsupialization as a decompression method not only to minimize the damage to anatomical structures, but also to reduce the size of the lesion. marsupialization has been performed as a more conservative type of treatment for large cystic lesions in order to minimize cyst size and to reduce the extent of surgery. for the treatment of ccot, the authors suggested that marsupialization could be used as a preliminary treatment option for ccot to minimize damage to the anatomical structures. sakai. emphasized the importance of marsupialization before total surgical removal in young patients with large ccot lesions8. after marsupialization, the patient was regularly followed and was subjected to saline irrigation through a tube inserted into the lesion at every follow - up visit.(fig. a) remarkable regression of the lesion and bone apposition on the inner wall of the lesion were noted.(fig. c) after the enucleation, new bone was continuously deposited into the cavity where the lesion had existed, and the cavity size was reduced.(fig. 6) interestingly, gradual shrinkage of the lesion was accompanied by restoration of maxillary sinus volume. during this process, because of the thickened bony boundary, enucleation and aggressive bony curettage can be achieved without sinus wall destruction. thus, some of the sinus volume was regained without intentionally removing the sinus wall. the patient was followed for three year after the surgical treatment, and there were no signs of relapse. in conclusion, this case reports describes another case of recurrent ccot in the posterior maxilla, which is not frequently reported. even though a long - term follow - up study and additional cases are needed, marsupialization can be considered when planning the initial treatment of recurrent ccot, especially in young patients with large maxillary lesions extending into the maxillary sinus. | calcifying cystic odontogenic tumor (ccot) is an uncommon benign cystic neoplasm of the jaw that develops from the odontogenic epithelium. invasion into the maxillary sinus by a ccot is not a typical, and the recurrence of the cystic variant of ccot in the posterior maxilla is rare. this report describes a recurrent ccot occupying most of the maxillary sinus of a 24-year - old male patient. as a treatment, marsupialization was carried out as a means of decompression, and the involved teeth were all endodontically treated. afterward, surgical enucleation was performed. the size of the lesion continued to shrink after marsupialization, and the maxillary sinus restored its volume. this patient has been followed - up for 3 years after the surgery, and there have not been any signs of recurrence. |
we studied phagolysosomal ph in alveolar macrophages (am) using fluorescein - labeled yeast (fyp) and silica particles (fsp) as probes. fluorescence intensities from the ingested test particles were measured on populations of am using fluorescence spectrometry and on individual phagolysosomes using fluorescence microscopy. measurements were performed on rabbit am, which had been incubated with fyp or fsp (in vitro procedure). we also instilled fyp or fsp via the trachea into rabbit lungs and after 1 day, 1 week, 1 month, and 3 months lavaged the lungs and measured the ph in am (in vivo procedure). phagolysosomal ph was independent of the number and size of the fluorescent particles. measurements of populations of am with fluorescence spectrometry and of individual phagolysosomes with fluorescence microscopy gave similar average ph. for the fyp, ph decreased during the first day after lavage both in the in vitro and the in vivo procedures. for the fsp, ph was unchanged during the same period. after 1 day ph was similar for both particles. electron microscopy showed a larger number of lysosomes in contact with phagosomes and a higher percentage of vacuolated phagosomes for fyp than for fsp. in the in vivo procedure, ph was unchanged at least up to 1 month, and this ph was lower than that in the in vitro procedure. the difference was probably due to conditions at the time of phagocytosis. particles retained in the lung parenchyma were within am, and their location within the am appeared unchanged from 1 week up to 3 months.imagesfigure 2. afigure 2. b |
|
canada s population is steadily aging, and the elderly (those 65 years of age and older) are projected to account for close to 25% of the population by the end of the 2030s, critically affecting the delivery of primary health care. people aged 65 and older account for approximately 50% of the visits to office - based physicians. currently there are only 242 royal college of physicians and surgeons of canada certified internist geriatricians and 128 college of family physicians of canada certified family physicians with care of the elderly designation, meaning that much of the geriatric care in canada is and will continue to be provided by generalist family physicians. due to barriers, such as a lack of exposure to geriatric medicine training, inexperience, and excessive amounts of time required to manage care, some have tried to use consultants to cope, but inaccessibility to consultant specialist help was a factor. many primary care physicians who find caring for elderly patients difficult limit the number of elderly patients in their practice. when primary care physicians were interviewed in a previous study, several different reasons for this difficulty were identified. these reasons were grouped into three major domains including medical complexity, administrative burden, and personal / interpersonal challenges (communication barriers)., pereles and russell interviewed family physicians in calgary who reported that geriatric continuing medical education (cme) priorities should focus on increasing education about medical management, medications, and mental health issues in the elderly. key informants in the community who work with the elderly established the same priorities. however, when the family physicians elderly patients were interviewed, a perceived greater need for attention to process of care issues (e.g., communication, time management, and attitudes) was indicated. frank. found that physicians personalities and communication skills affected whether geriatric patients were satisfied with their care. there are clearly multiple important domains that contribute to the difficulty family physicians face in caring for the elderly. since medical complexity appears to be the educational priority for family physicians, this study examined the patients referred to a care of the elderly physician to more clearly define this domain and shed light on future geriatric cme needs for family physicians. from 2003 to 2008, in an outpatient seniors clinic at an urban academic teaching hospital in toronto, 104 care of the elderly consultations were completed on patients who participated in a 16-week outpatient interdisciplinary program at this site. the family physicians practicing in the surrounding area, who referred their senior patients to this program, were asked whether they would like their patient to also have a consultation with a care of the elderly physician to address any medical issues. the elderly patients referred were able to discuss their medical problems over a one - hour visit. a patient - centred approach was used, with agreement over the topics to be dealt with at the consultation visit. patients often brought a list of topics to discuss but, due to time constraints, prioritization was required. it is important to note that the prioritized list of geriatric medical problems encountered included only medical issues that either the referring family physicians or the patients themselves had significant complaints about, or that the care of the elderly physician identified as a problem. preventive care screening procedures such as mammography, dexa bone mineral density scanning, and fecal occult blood testing or colonoscopy were also discussed. inquiry into and discussion of advance directives were also completed, when applicable. to help frame the current chart review, needs assessment, and the find similar and find citing articles functions were used to create a search strategy. articles were searched and reviewed for geriatrics topics selected by geriatric experts as being targets of geriatric education and those topics most frequently chosen by practicing physicians as areas they would be interested in or areas they believed their colleagues needed more information on. the topics found helped classify the medical problems encountered in our chart review of all 104 consecutive consultation letters. data were also collected from an interdisciplinary assessment form (as self - reported by the patient) for subject age, gender, medical and mental health problems, number of prescribed medications, use of vitamins and herbal remedies, history of alcohol and tobacco use, difficulties with adls and iadls, and whether the patient lived alone, had fallen in the past, and had difficulties with public transportation. whether patients received annual flu shots and a pneumonia vaccination was also noted. to substantiate and help clarify the conclusions from the chart review regarding future cme topics of need, guided by the literature, the survey questions aimed to assess the referring physicians motivations for seeking additional assistance with caring for their elderly patients. it was hoped their responses would inform whether cme topics of need relate more to disease - specific uncertainties, different approaches to presenting concerns and symptoms, or systemic barriers to providing sufficient care. at the time of surveying, only 61 of the 77 family physicians who referred patients for consultation were still active and could be located through the college of physicians and surgeons of ontario database. of this number this study received initial approval from the research ethics board at university health network in october 2008. approval for conducting follow - up surveys with referring physician was received in september 2010. the age of the patients in this study ranged from 54 to 92, with a mean age of 70.3 years. almost three - quarters of the patients seen were female (73.1%, n = 76) and 27.9% (n = 29) reported that they live alone. all patients reported having multiple co - morbidities, with over 50% of them citing current problems with osteoarthritis or joint pain, hypertension, or hypercholesterolemia. in addition, 93.3% (n = 97) of patients indicated that they were on prescription medications (ranging from one to sixteen medications), with the average being 4.6 prescription medications per patient. the majority of the patient population assessed (75%, n = 78) recalled having their yearly flu shot, 28% (n = 29) reported having difficulties with one or more adls, and 21% (n = 22) with one or more iadls. language interpretation service was frequently provided for patients in chinese (36.5%, n = 38) and portuguese (16.4%, table 1 shows the medical problems encountered by a care of the elderly physician from 104 consultations. these medical problems are classified according to topics cited in the literature as being targets of geriatric education and those for which practicing physicians would like more information. clinical problems encountered during the consultations that were not previously highly ranked by the literature are listed in table 2. tables 1 and 2 are not mutually exclusive lists. in other words, a patient noted as having joint pain in table 2 may also be included under the topic of osteoarthritis in table 1. list and frequencies of commonly cited medical problems encountered by a care of the elderly physician (n = 104) additional list and frequencies of uncommon and non - cited medical problems encountered by a care of the elderly physician (n = 104) based on physician recall, table 3 outlines the reasons why family physician referred their patients for consultation with a care of the elderly physician. the physicians were also asked to reflect on the importance of the novel cme topics that emerged from the chart review which had not been previously substantiated in the literature, as well as other topics related to processes of elderly care. table 4 presents the physicians level of agreement with these issues as future geriatric cme topics of need. reasons family physicians referred patients for care of the elderly consultation (n = 28) referring physician agreement with literature and chart audit identified issues as geriatric cme topics of need (n = 28) the age of the patients in this study ranged from 54 to 92, with a mean age of 70.3 years. almost three - quarters of the patients seen were female (73.1%, n = 76) and 27.9% (n = 29) reported that they live alone. all patients reported having multiple co - morbidities, with over 50% of them citing current problems with osteoarthritis or joint pain, hypertension, or hypercholesterolemia. in addition, 93.3% (n = 97) of patients indicated that they were on prescription medications (ranging from one to sixteen medications), with the average being 4.6 prescription medications per patient. the majority of the patient population assessed (75%, n = 78) recalled having their yearly flu shot, 28% (n = 29) reported having difficulties with one or more adls, and 21% (n = 22) with one or more iadls. language interpretation service was frequently provided for patients in chinese (36.5%, n = 38) and portuguese (16.4%, from the chart review, table 1 shows the medical problems encountered by a care of the elderly physician from 104 consultations. these medical problems are classified according to topics cited in the literature as being targets of geriatric education and those for which practicing physicians would like more information. clinical problems encountered during the consultations that were not previously highly ranked by the literature are listed in table 2. a patient noted as having joint pain in table 2 may also be included under the topic of osteoarthritis in table 1. list and frequencies of commonly cited medical problems encountered by a care of the elderly physician (n = 104) additional list and frequencies of uncommon and non - cited medical problems encountered by a care of the elderly physician (n = 104) based on physician recall, table 3 outlines the reasons why family physician referred their patients for consultation with a care of the elderly physician. the physicians were also asked to reflect on the importance of the novel cme topics that emerged from the chart review which had not been previously substantiated in the literature, as well as other topics related to processes of elderly care. table 4 presents the physicians level of agreement with these issues as future geriatric cme topics of need. reasons family physicians referred patients for care of the elderly consultation (n = 28) referring physician agreement with literature and chart audit identified issues as geriatric cme topics of need (n = 28) the seniors clinic in this study is an outpatient service that serves a relatively healthy group of elderly patients. a review of the sample s overall demographics reveals a highly functioning cohort, both cognitively and physically, as most were independent of all basic and instrumental activities of daily living. this is potentially a cohort that may be more motivated to pursue active care or treatment. the cohort may also be better medically managed as the result of being followed by family physicians that referred to a seniors wellness program. although 75% of the study group recalled having had their influenza immunization shot, the majority of patients had other significant issues relating to preventive care procedures (64.4%). freedman. documented previously that screening of elderly patients falls below desirable levels. advance directives / durable power of attorney (poa) issues were also commonly in need of discussion (23.1%). similarities were found between the medical problems dealt with during the care of the elderly consultations in this study and, per the literature, the geriatric topics and concerns that primary care physicians found to be most challenging. the most common problems found in this study included osteoarthritis (40.4%), hypertension (32.7%), osteoporosis (30.8%), depression or anxiety (22.1%), urinary problems (15.4%), dementia or memory complaints (12.5%), cardiovascular disease (10.6%), and gait disturbance or falls (9.6%). as such, the executed chart audit examining geriatric medical problems supports future continuing medical education programs that address these topics. other medical problems encountered included complaints of dizziness (7.7%) and hearing and vision sensory impairment (6.7%) ; however, these problems in particular were often previously addressed by other specialty clinics, such as otolaryngology and ophthalmology. clinical problems commonly encountered in this study s chart review that were not highly cited in the literature as being of significant nature or of interest to primary care physicians included musculoskeletal and joint pain (39.4%), diabetes (22.1%), neck and back pain (19.2%), obesity (10.6%), insomnia (10.6%) and neuropathic, fibromyalgic and leg cramps pain (9.6%). it is believed that these topics, ones that family physicians had not previously requested for cme, still prove problematic for family doctors serving the senior population and should be covered by geriatric continuing education. the importance of these topics as targets for future cme were substantiated by the referring family doctors surveyed who agreed that the topics of chronic pain (92.9%), insomnia (78.6%), neuropathic, fibromyalgic and leg cramps pain (75%), diabetes (53.5%), and obesity (50%) should be addressed. despite possibly not being medically complex, these relapsing problems can present high demands on the practicing clinician by requiring extensive counseling, education, and surveillance. in the past, family physicians have indicated that they did not need more education regarding health promotion for elderly patients, but rather cited inadequate time, remuneration, and finding accessible community resources as major hurdles in caring for the elderly. the physicians surveyed in this study also indicated challenges associated with time management and access to community services as reasons why expert consultation was sought. patients with these types of demanding medical problems may overwhelm the primary care physician and, therefore, may not have all of their issues addressed. not surprisingly, 71% of the surveyed physicians identified a need for future cme regarding time - management challenges with the elderly. the patients reviewed in this study were seen over one - hour visits, allowing for more time to prioritize multiple issues and find common ground over which topics took precedence. the patient - centred approach taken to prioritize the medical problems often helped identify the reasons for the consultations in the first place, since some of the family physician referrals were quite vague. however, in some cases, it was the patients themselves who requested that their family physicians make a referral on their behalf. with a care of the elderly physician, patients may have felt more comfortable speaking about chronic age - related problems. patient - centred interviewing has been shown to improve patient satisfaction, compliance, and physiological recovery, as well as reduce the need for consultation and investigations. family physicians elderly patients have previously indicated a need for attention to process of care issues. process of care issues include not only time - management skills, but also physician attitudes and communication skills. akin to previous research, however, the surveyed family physicians did not indicate a strong need for future cme pertaining to communication challenges with the elderly or attitudes towards the elderly. although previous geriatric cme has focused on disease - specific presentations, such as chronic obstructive lung disease or pneumonia, williams and connolly clearly found that practicing physicians requested more general topics for education programs, such as treating the frail elderly patient with multiple vague undifferentiated medical problems. identifying normal physiologic changes of aging and atypical disease presentation in the elderly were other educational interests found. most of the family physicians surveyed in this study indicated that they referred for assistance with patients having multiple coinciding problems, and identified clinical approaches to primary care of the elderly as future cme topics of need. family physicians must be able to deal effectively with elderly patients presenting with multiple problems and be able to prioritize issues in a patient - centred way. several limitations were noted throughout this study. although both the chart audit indicators measured and the survey questions posed to the referring family physicians were guided by previous studies and literature related to geriatric cme needs, such measures and indicators could have limited the amount of information gathered and may have inadvertently led to the exclusion of other pertinent information. while participating referring physicians were offered a copy of their patient s care of the elderly consultation letter to assist with accurate recollection of detail, the survey questions were certainly subject to their respective recall bias. additionally, while great effort was put forth to conduct the surveys face - to - face, there were a few exceptions where surveys were conducted over the phone or through email. additionally, the patients examined in this study had family physicians and attended a seniors outpatient clinic, so the medical problems encountered may not be representative of a general urban - dwelling elderly population. there may be other topics of importance related to those not having a family doctor or those not referred to a seniors program. there were many similarities found between the type of geriatric medical problems seen in this study s care of the elderly consultations and those previously documented in the literature. other common clinical issues found in the audit, such as osteoarthritis, hypertension, osteoporosis, depression or anxiety, resonate with the topics of importance in the literature. in addition, despite not previously being identified by physicians as challenging and valuable geriatric topics in the literature, the chart review and referring physician surveys identified significant ongoing medical issues dealing with chronic pain, diabetes, obesity, and insomnia. this study clarified medical problems of importance in a sample of geriatric patients referred to a care of the elderly physician to better define geriatric cme needs for family physicians. the medical problems not previously noted in the literature as common geriatric medical problems of importance may point to other factors that need to be considered. while medical knowledge of geriatric problems should continue to be addressed by current continuing medical education initiatives, per physician - indicated educational priority, further research into process of care factors, particularly time management and clinical approach in a family medicine context, should be considered in future geriatric cme programs for family physicians. | purposefamily physicians provide the majority of elderly patient care in canada. many experience significant challenges in serving this cohort. this study aimed to examine the medical problems of patients referred to a care of the elderly physician, to better understand the geriatric continuing medical education (cme) needs of family doctors.methodsa retrospective chart review of patients assessed at an urban outpatient seniors clinic between 2003 and 2008 was conducted. data from 104 charts were analyzed and survey follow - up with 28 of the referring family physicians was undertaken. main outcomes include the type and frequency of medical problems actually referred to a care of the elderly physician. clarification of future geriatric cme topics of need was also assessed.resultspreventive care issues were addressed with 67 patients. twenty - four required discussion of advance directives. the most common medical problems encountered were osteoarthritis (42), hypertension (34), osteoporosis (32), and depression or anxiety (23). other common problems encountered that have not been highly cited as being a target of cme included musculoskeletal and joint pain (41), diabetes (23), neck and back pain (20), obesity (11), insomnia (11), and neuropathic, fibromyalgia and leg cramps pain (10). the referring family physicians surveyed agreed that these were topics of need for future cme.conclusionsthe findings support geriatric cme for the common medical problems encountered. chronic pain, diabetes, obesity and insomnia continue to be important unresolved issues previously unacknowledged by physicians as cme topics of need. future cme focusing more on process of geriatric care may also be relevant. |
patients with ophthalmic manifestation of chronic myeloid leukemia (cml) have been reported to have lower 5-year survival than those without.1 however, ocular manifestations as the only presenting sign of cml are rare. we present a case of a previously healthy male who presented with only visual symptoms and was subsequently diagnosed with cml. this case report highlights the importance of recognizing early fundus changes, which should allow earlier diagnosis and treatment. typically, the ophthalmic manifestations of cml are florid, with vascular changes such as retinal vein tortuosity or obstruction, flame - shaped hemorrhages, dot - and - blot hemorrhages, roth spots, and even optic nerve edema. a case of macular lesion and optic nerve involvement has previously been reported as being an early ocular presentation of cml. our case presented with preretinal and white - centered hemorrhages only. a 30-year - old myanmarese male with no medical history presented with a history of seeing a black dot in his left visual field for the past 1 week. visual acuity was 20/100 and 20/20 in his left and right eyes, respectively. fundus examination revealed preretinal hemorrhage and white - centered hemorrhage in his left eye [figure 1a ]. (a) picture of the left eye fundus shows the preretinal hemorrhage over the macular area, with a white - centered hemorrhage (arrow) seen infero - nasally.(b) peripheral blood smear shows basophil, three segmented neutrophil (n), and two band forms (bf). (c) histological sections of bone marrow aspirate show hypercellular segment and cell trail (arrow). (e) resolved preretinal hemorrhages and white - centered hemorrhage in the left fundus there was no history suggestive of cardiac or autoimmune disease or family history of blood dyscrasias. a full blood count revealed a raised white blood cell count of 173 10/l (normal range : 3.269.28 10/l). peripheral blood film [figure 1b ] and bone marrow aspirate [figure 1c ] showed marked myeloid hyperplasia in 89.6% of the cells, consisting of mature neutrophils and myelocytes without any blasts. fluorescent in situ hybridization (fish) showed karyotype 46, xy, t(9;22) [figure 1d ]. he was started on cytoreductive therapy consisting of 2 g hydroxyurea twice a day along with 300 mg allopurinol every morning. the fundus changes resolved and visual acuity improved to 20/30 in his left eye. following this, he opted to switch to a long - term trial drug bosutinib started by his hematologist. there was no ocular or systemic recurrence after 12 months of follow - up [figure 1e ]. studies have shown that only 5%10% of cml patients present with eye symptoms at initial diagnosis.23 a case with a macular lesion and optic nerve involvement has previously been reported.4 optic nerve involvement typically leads to relatively rapid and potentially irreversible vision loss.5 this case was a rare exception as the usual ocular manifestation in cml is retinal involvement [table 1 ]. the macular lesion in our patient could be a precursor of further fundus changes, such as optic nerve involvement. signs of ophthalmic leukemic manifestation in the fundus leukemic retinopathy can be mistaken for other hematological disorders that have similar presenting signs in the fundus [table 2 ]. even though the other differentials of roth spot, including retinal vein occlusion, diabetes, anemia, and infective causes such as syphilis and hiv [table 3 ] were also considered, hematologist referral was a priority in view of his abnormal blood results. comparison of fundus signs in different hematological disorders differential diagnosis for roth spots with prompt investigation and diagnosis our patient was able to receive treatment early into his disease before other signs manifested. recovery was extremely good, with no recurrence thus far, i.e., after 12 months of follow - up. it was reported that 5-year survival of patients with ophthalmic manifestation of cml was 21.4% compared to 45.7% of those without.1 prompt diagnosis and treatment of such patients is of paramount importance. in summary, it is important to recognize early fundus changes in patients who do not present with the usual signs and symptoms of cml. a suspicious ocular finding should be followed up with appropriate systemic evaluation and workup, including a full blood count. | chronic myeloid leukemia (cml) is a well - studied entity and advances made in diagnosis and treatment have improved the disease outcome. patients with ophthalmic manifestation of cml have been reported to have lower 5-year survival rates. hence, recognizing the early fundus changes may improve outcome by allowing earlier diagnosis and treatment. we report a case of a previously healthy 30-year - old myanmarese male, who presented with a minor visual disturbance, complaining of seeing a black dot in his left visual field for the past 1 week. fundoscopic examination revealed bilateral retinal blot hemorrhages, white - centered hemorrhage, and preretinal hemorrhage over the left fovea. the full blood count and peripheral blood film were abnormal, and bone marrow biopsy confirmed the diagnosis of cml. cytoreduction therapy was promptly commenced and his symptoms resolved, with improvement in visual acuity. no complications were recorded at 1-year follow - up. |
infection is a major source of morbidity and the leading cause of death in immunocompromised patients. the increased susceptibility to infection results from the intertwined effects of the immunocompromising condition, treatments, and co - morbidities. human infection with the novel h1n1 influenza virus was first recognized in early april 2009 and declared a worldwide pandemic by the world health organization in june 2009. recent case series provide information on the clinical course, risk factors, and outcome of h1n1(v) infection [2 - 4 ]. both new zealand and canada have experienced h1n1(v) outbreaks with severe illness requiring intensive care unit (icu) admission, ventilatory support, and rescue therapies. however, no case series have specifically described the features of h1ni(v) infection in immunocompromised patients. here, we report the clinical and epidemiologic features in 10 critically ill immunocompromised patients with h1n1(v) infection. the case definition was icu admission for acute respiratory failure and a positive specific polymerase chain reaction test for the pandemic influenza a (h1n1) 2009 virus. all patients meeting this case definition were included. in late 2009, 15 patients with h1n1-related acute respiratory failure, including 10 immunocompromised patients, required icu admission. as reported in table 1, median time from respiratory symptom onset to icu admission the chest radiographs consistently showed extensive pulmonary infiltrates (median murray score 3 ; iqr 2 to 4), and 80% of cases showed an alveolar pattern. all patients were treated with oseltamivir, which was prescribed 1 day (range 0 to 6 days) after icu admission. superinfection (mostly bacterial pneumonia) occurred in all patients in keeping with previous data on seasonal influenza. the clinical course was characterized by prolonged oxygen dependency in the survivors (10 days ; iqr 6 to 15 days). clinical characteristics and outcomes of h1n1(v) critically ill immunocompromised patients all patients were receiving oseltamivir. bmt, bone marrow transplantation ; c3 g, third - generation cephalosporin ; ci, calcineurin inhibitor ; fq, fluoroquinolone ; gvhd, graft - versus - host disease ; icu, intensive care unit ; mmf, mycophenolate mofetil ; mv, mechanical ventilation ; niv, non - invasive mechanical ventilation. h1n1(v) infection can result in a wide spectrum of clinical patterns, ranging from no symptoms to fulminant viral pneumonia. this new pandemic virus is characterized by a high prevalence of severe viral pneumonitis, which often requires mechanical ventilation. influenza viruses are known to cause severe infections in immunocompromised patients, of whom variable proportions were reported in epidemiologic descriptions [2 - 4 ]. our case series is the first to describe the course of h1n1(v) infection in immunocompromised hosts. first, the risk factors for h1n1(v) described in the overall population [2 - 4 ] were not found in our cohort. in contrast, none of our patients had obesity (median body mass index 26.9 ; iqr 21 to 26) or chronic lung disease. of our 10 patients, 7 were on long - term steroid treatment, as described in the immunocompromised subgroup of the canadian icu patients. cellular immunodeficiency is the main risk factor for lower respiratory tract infection with influenza viruses as the main defense mechanism is cd8 t - lymphocyte - mediated cytotoxicity. the clinical presentation in our patients was similar to that described in immunocompetent individuals, with symptom onset 4 days before icu admission. mortality was high (40%) compared with the overall population with h1n1 2009 infection [2 - 4 ]. the icu stay was shorter than in the overall icu population but the hospital stay was longer, perhaps because of prolonged viral shedding in lymphopenic patients. ea is a member of the french and european boards of pfizer inc (new york, ny, usa) and gilead (foster city, ca, usa), respectively. | seasonal influenza virus has been described as an emerging and severe pathogen in immunocompromised hosts. since the beginning of the 2009 influenza a novel h1n1 pandemic, several series have described the clinical course of the disease in various populations. we report the clinical course of h1n1 2009 infection in 10 immunocompromised patients. half of the patients received long - term steroid therapy. disease was characterized by a clinical picture similar to that of non - immunocompromised patients but with prolonged course and higher mortality. |
falls are a major cause of morbidity and mortality in older people with cognitive impairment ; further, a high percentage of patients with a mental disorder (md) fall repeatedly before fall - related hip fractures [13 ]. however, once a hip fracture has occurred, the risk factors for a poorer survival prognosis are co - morbidities, age older than 85 years, male sex, dependent living arrangements, and a diagnosis of dementia [4, 5 ]. concomitant depression and dementia significantly increase the 12-month risk of elderly patients dying after surgery for a hip fracture. cognitive and mood disorders are common in elderly patients with a hip fracture and are associated with greater risk of poor outcomes, both independently and in combination. recognition and treatment of these conditions together with stratification of variables associated with these disorders may reduce adverse outcomes in this vulnerable population. since surgery to treat hip fractures is considered the gold standard even for nonagenarians with a heavy co - morbidity burden, a study to determine an association between surgical complications and a md appears to be extremely important ; nevertheless, the association between a md and iatrogenic complications after hip fracture surgery has not been addressed adequately. among iatrogenic co - morbidities, nosocomial infections (nis) are a major problem after hip fracture surgery ; because of the morbidity and mortality, the surgeon is always aware of this devastating complication. the aim of this paper was to study whether patients with a md and a hip fracture develop more infections after hip surgery than patients without a md. because mds are not only a common cause of hip fractures but also of complications after surgery, we addressed the hypothesis that patients with a md develop more infections after surgery for hip fractures than patients without a md. the null hypothesis is that there is no difference between the groups, and the alternative hypothesis is that patients with a md and a fractured hip develop fewer infections than those without a md. we designed a cohort study of patients with a md who underwent surgery for a hip fracture and a control group of patients without a md who also underwent surgery for a hip fracture. we followed them after surgery to study the differences in the rates of development of nis. we reviewed the records of all patients who underwent hip fracture surgery in our institution between 2006 and 2008. the data collection was based on the minimum data base group of the spanish national health system and followed the standardised audit of hip fractures in europe (sahfe). data management was protected by the spanish data protection law and overallprocedureswas supervised by the ethics committee of our hospital.the affiliation, full clinical history, and complications were included in our hospital database ; we worked only with computerized clinical histories (hp doctor hewlett - packard espaola sa 2001. however, since all data were computerized and codified, the potential for biased interpretation was eliminated. although all elderly patients admitted to our department underwent the mini - mental test (mmt), performed by a nurse, on ward admission, we considered a md as any behavioural disturbance that was professionally diagnosed or corroborated by the psychiatry department of our hospital. proper diagnosis for codification had to be made by a specialized doctor. according to the international classification of diseases, tenth edition (icd-10-cm), the diagnoses included nonbehavioural - alteration dementia, senile dementia without complications, vascular dementia with no complications, alzheimer 's disease, parkinson 's disease, alcoholism, unclassified depression, and other forms of anxiety and dissociative or somatomorph disorders. all patients received prophylactic intravenous antibiotics 30 minutes before surgery (2 grams of sodium cefazoline) and two additional doses during the next 2 days. in patients allergic to penicillin, since the objective of this study was to address the end point of infection or no infection, we considered both osteosynthesis and joint replacement techniques. osteosynthesis consisted of either ao cannulated screws (5 mm - cannulated screw synthes), a proximal femoral nail (pfn, synthes), or a joint replacement (either a partial or a total cemented hip replacement) (exeter, stryker). patients were not assigned to any treatment based on mental, social, or any factors other than femoral head viability and general health. patients in good general health underwent osteosynthesis ; patients with worse general health underwent joint replacement ; those with very poor general health underwent partial joint replacement. patients were classified by co - morbidity according to the criteria of charlson.. the charlson index contains 19 categories of co - morbidities, originally based on icd-9-cm diagnoses and procedural codes, and their associated weights, that provide an overall co - morbidity score to reflect the cumulative increased likelihood of 1-year mortality. we regrouped the criteria of charlson. into three groups according to the studies of deyo. and romano.. the original groups 0 to 7, for which 0 indicated the least and 7 the most severe, were regrouped into 0 to 2 (category 2 included categories 27). categories also were based on the icd-10-cm and the version of librero.. for surgical indication, we did not make a mathematical correlation between the groups of charlson. and the type of treatment. because patients did not know that research was in progress, all were considered randomized ; further, doctors were on call based on an already scheduled timetable to perform a similar number of surgeries the chance of being operated on by a specific surgeon was the same for groups a and b described below. we considered a ni as any infection that developed within 3 months after the primary surgery for a hip fracture (infection either at the surgical site, pneumonia, urologic infection, or others). classically, the topography of infection at the surgical site includes either deep or superficial infection, depending on whether the infection is deep or superficial to the fascia lata. since this classification is based on surgeon inspection, we believe that the sensitivity is very low, therefore in most cases we treated the infection thoroughly as a deep one. for this research, diagnosis of a ni retrospective analysis of the clinical history is the most sensitive and specific method for infection diagnosis, although primary detection was based on a positive bacteriologic culture. patients either with a follow - up shorter than 1 year or patients who died postoperatively before 3 months for a reason other than a ni were excluded. therefore, we were certain that all patients, whether they had a md or not, had the same chance of developing a ni. any patient with a mechanical complication such as cut out of implants (loosening of the implant), a periprosthetic fracture, or any other reintervention also was excluded provided that the patient had not developed an infection as a result of the first surgery. the main cohort of patients included those who underwent surgery for a hip fracture with a previous diagnosis of md (group a). the control group included patients who underwent surgery for a hip fracture without a previous diagnosis of a md (group b). since the aim of this study was to determine the association between a md and postoperative infection, it was especially important that the diagnosis of a md was established before surgery. age, gender, and length of hospital stay (los) also were studied. data were transported, coded, and stored in a microsoft excel programme (windows 2007, microsoft corp., redmond, wa) and analyzed using a spss programme (version 14.0 spss inc. the mean and 95% confidence intervals (cis) were calculated for the quantitative variables, and percentages were calculated for the qualitative variables. a univariate analysis was performed using a simple logistic regression model to estimate the odds ratio (or) and the corresponding 95% ci. multiple logistic regression analysis was then performed to adjust for the effect of a md on age, sex, and the index of severity of charlson. [1315 ]. group a (patients with a previous diagnosis of a md) included 223 patients ; group b (patients without a previous diagnosis of a md) included 689 patients. although the range was between 0 and 100 years, 95% of the patients were between 57.26 and 100.38 years. the range also was considered to be between 0 and 105 years, and 95% of the patients were between 47.15 and 104.46 years. the patients included 647 (70.94%) women and 265 men (29.05%) (group a, 68 men [30.49% ] and 155 women [69.51% ] ; group b, 197 men [28.59% ] and 492 women [71.41% ]). group a included 223 patients (24.45%), and group b included 689 patients (75.54%). a total of 821 patients (88%) were classified, based on the criteria of charlson., in group 0 or 1 and 91 (10%) in group 2 (group 2 included groups 2 to 7 according to the modified criteria of charlson. [1316 ]). therefore, most patients had a less severe score for the criteria of charlson. groups a (presence of a md) and b (no md) were matched according to the criteria of charlson. 79.82% of group a patients were in the 0 - 1 group of charlson. and twelve out of 223 patients (5.38%) were in group a ; 46 of 689 (6.68%) were in group b. although patients with a md had fewer infections than patients without a md, the difference was not significant (or, 0.795 ; ci, 96.5% = 0.4131.529 ; p =.49). the distribution of microorganisms and infection sites in groups a and b are shown in table 3. the median preoperative los in group a was 1.96 days (range, 08) and in group b 1.51 days (range, 09). a, the total los was 7.09 days (ci, 6.347.83) and in group b 8.74 days (ci, 8.009.48). the total los for patients in group a who developed a ni was 13.58 days (standard deviation [sd ], 16.79), whereas for patients in group b with a ni the los was 28.08 days (sd, 21.96). the los in group a decreased dramatically to 6.72 days (sd, 4.08) when patients did not develop a ni and to 7.35 days (sd, 6.45) in group b. one patient in group a with a ni was discharged to a nursing home and seven to their own home ; four patients died from the ni. in group b, five patients were discharged to a nursing home, 33 to their own home, one back to her country, and seven died because of the ni. mds were not associated with infection when considered alone (crude or, 0.79 ; 95% ci, 0.413 ; 1.529) or together with the other variables (multivariate analysis, adjusted or, 0.74, 95% ci, 0.37 ; 1.46). age was associated with infection when considered alone (crude or, 0.96 ; 95% ci, 0.95 ; 0.97) or together with other variables (multivariate analysis, adjusted or, 1.04 ; 95% ci, 1.01 ; 1.07). gender was not associated with infection when considered alone (or = 0.93 ; 95% ci, 0.51 ; 1.68) or together with other variables (or = 1.14 [0.62 ; 2.10 ]). for co - morbidities were not associated with infection when considered alone (crude or for index 1, 1.07 [95% ci, 0.60 ; 1.90 ], and for index 2, which included 2 to 7, or = 1.07 [95% ci, 0.43 ; 2.65 ] or together with other variables (multivariate analysis, adjusted or for index 1, 0.99 ; [95% ci, 0.54 ; 1.80 ], for index 2, which included 2 to 7 ; or, 1.02 [95% ci, 0.40 ; 2.62 ]. considering the outcomes of hip fracture after treatment, infection is a major issue in morbidity and mortality [4, 18, 19 ]. apparently, many variables appear to be associated with infection ; age, male sex, type of fracture and treatment, and many others which have or have not been shown to be associated with infection. studies of these issues should be addressed by considering infection as a nosocomial disease rather than only a surgical - site disease, since morbidity and mortality associated with nonsurgical - site infection justify this approach. however, the methodology should be designed such that many variables can be associated with each other ; therefore, multivariate analysis is of overwhelming importance in these studies [2125 ]. in the current paper, 24% of our patients had a md, which may represent a very low frequency ; however, we measured the prevalence and not the incidence of md. we followed patients with and without a md by the time of admission (prevalence) who can develop an infection during follow - up (incidence). we believe the professional diagnosis may be the key and tried to avoid subjective diagnoses by relatives, nurses, or orthopaedic surgeons. further, we saw that in most studies this concept is very confusing, and too many patients are included as having a md. the mmt is carried out by nurses and probably a magnification of the problem exists. it has been shown that patients living in nursing homes fall more than those living with their families ; moreover, they can develop more mds [2, 3 ]. however in the current study, we studied the prevalence of mds independent of patients origin and their risk of a ni after surgery. we used a multiple logistic regression model to study 912 patients who underwent surgery for a hip fracture. md is a risk factor for hip fracture and apparently for a poor outcome after the diagnosis has been made [4, 5, 7, 20, 2630 ]. nevertheless, to the best of our knowledge, the effect of the association of infection together with a md has not been studied. since the rate of development of a ni in patients with a previous md could be very high, and the question arises about whether it is very risky or even practical for these patients to undergo surgery, we designed a cohort study in patients with a previous diagnosis of a md who sustained a hip fracture and underwent either osteosynthesis or joint replacement. we conducted a literature search for infection as a complication of surgical treatment or hospital stay. moreover, multiple logistic analyses showed that development of a ni in patients with a md was not associated with age, gender, or comorbidities. only age was an independent variable associated with a higher risk of development of a ni. previous reports have studied variables by performing univariate analysis and excluding some confounding variables [18, 19 ]. consequently some associations can be overestimated by the effect of those variables. that probably also is true for the role of co - morbidities, according to the criteria of charlson. ; up to 90% of our patients were in groups 0 and 1, and, surprisingly, analyses showed that there was no significant association between the criteria of charlson. for comorbidities and nis. this was also the case when multivariate analyses were performed for infection, the index of charlson., and mds. grouping patients based on grade 2 or more of charlson. would probably change those results. that is why when considering the american society of anaesthesiologists (asa) score as the prognostic variable, patients with the physical status of asa 3 or 4 have a poorer prognosis. however, the accuracy of the prognosis according to the type of disease based on the criteria by charlson. we wish to clarify that although it could be suggested that if mds were associated with a high ni rate (working hypothesis), orthopaedic surgeons may consider not performing surgery, but that was not the aim of the current study. rather, if the working hypothesis was correct, a new project to identify patients with mds at greater risk of developing a ni should be developed ; then a discussion could take place about whether it is better not to operate, and a risk / benefit quotient could advise upon that. however, in the current study and in other studies in this field, there are some limitations. by including some different diagnoses within the mds, the relation of a particular md with development of a ni can be underestimated. current classifications within mds include nonbehavioural - alteration dementia, senile dementia with no complications, vascular dementia with no complications, alzheimer 's disease, parkinson 's disease, alcoholism, unclassified depression, and other forms of anxiety and dissociative or somatomorph disorders (icd-10 cm). only a large multicentre study can differentiate between every mental diagnosis in a way that could stratify diagnoses without affecting possible statistical significance. such a study, with multivariate analysis, could calculate the risk of developing a ni for every specific md. since the population under study would have to be extremely large, to our knowledge studying nis is the likelihood of adding community - acquired infections ; whether the patient developed the infection before or after the hospital stay is unknown when studying nonsurgical site infections. this problem is nearly impossible to solve ; however, in the current paper, the chance of introducing this bias was the same for groups a or b. in fact, the earliest ni developed in both groups on the second hospital day. patients with an md do not have a higher risk of developing an ni after surgery for hip fracture than patients without an md. | the association between mental disorders (mds) and iatrogenic complications after hip fracture surgery has been poorly studied. among iatrogenic complications, nosocomial infections (nis) are a major factor in hip fracture surgery. the aim of this paper was to determine whether patients with a md and a hip fracture develop more nis after hip surgery than patients with no md. we studied 912 patients who underwent surgery for a hip fracture (223 patients with a md who underwent surgery for a hip fracture and 689 control patients without a md who also underwent surgery for a hip fracture) and followed them after surgery. univariable and multivariable analyses were performed using simple and multiple logistic regression analysis (confidence interval, crude and adjusted odds ratios, and p value). we found that mds, gender, and comorbidities were not associated with a higher risk of developing a ni after surgery for a hip fracture. only age increases the risk of a ni. |
a 35-year - old female patient presented with a complaint of a painless swelling on the right buccal mucosa [figure 1 ]. the lesion was visible on extraoral examination as a 2.5 cm1 cm mass, which was well circumscribed and firm on palpation, midway in the ala - tragal line. a diagnosis of a benign buccal mass with a differential diagnosis of lipoma and schwannoma was made. clinical presentation of lesion as a swelling routine haematological examination was noncontributory. under local anesthesia, a soft tissue mass measuring 1 cm1.5 cm, firm in consistency and grayish brown in color, was cut into two pieces and processed. the histological examination showed a thin fibrous capsule with a surrounding membrane enclosing the larval stage of t. solium. the surrounding connective tissue showed a mild inflammatory response and an eosinophilic infiltrate [figure 2 ]. a diagnosis of cysticercosis was made and the patient was referred for further evaluation by the physician to rule out further disseminated lesions at other sites. protean manifestations of the human pork tape worm have perplexed medical science for almost 4000 years. these platyhelminths have an egg stage and a larval stage, and then they become adult worms. by consuming inadequately cooked infected pork and raw vegetables, the cyst wall is destroyed by gastric secretion, releasing one scolex that passes into the small intestine, where it becomes fixed. embryonated eggs and gravid proglottids are released in the feces, deposited on the soil, and later ingested by the intermediate host, the pig. the animal 's gastric secretions destroy the egg wall, and after passage into the duodenum, the larve hatch from the eggs, penetrate the intestinal wall, and are carried by blood or lymph to various tissues. the cystic structure contains a small, invaginated scolex and neck resembling the adult form. t. solium does not show tropism for any tissue, but has marked tendency to localize in the subcutaneous tissue and muscles, causing palpable and visible nodules. a large series study of 450 cases by dixon and lipscome showed 1.8% of oral cysticercosis. in our case reported here, the buccal mucosa was involved and the lesion presented itself as an asymptomatic nodule. depending on the anatomical location and the number of invasive oncospheres, cysticercosis can be asymptomatic or produce a plethora of signs and symptoms. surgical excision and an effective method to control cysticercosis may be the use of a good vaccine to prevent the infection in pigs. as with other zoonotic diseases, collaborative effort of the local and national authorities is needed to control human cysticercosis. we present a case of oral cysticercosis which presented itself as an asymptomatic submucosal nodule in the buccal mucosa. we stress on the need to include the possibility of cysticercosis in diagnosis of benign nodular masses in the oral cavity, particularly in areas endemic to the presence of t. solium. | cysticercosis caused by taenia solium is endemic in many parts of the world. we present a case of one such lesion which presented itself as an asymptomatic buccal swelling. we present the life cycle of t. solium, the endemic nature of this infection, and the relevance of histological examination to arrive at a diagnosis. |
the nhanes is conducted by the national center for health statistics (nchs) of the centers for disease control and prevention. we restricted our analysis to nhanes 20052008 participants 40 years of age or older (n = 7081). the final sample included 5746 participants who had at least one eye that could be evaluated for glaucoma using optic nerve photos (2883 men and 2863 women). the nchs institutional review board approved the nhanes, and written informed consent was obtained from all participants. the present study involved an additional review of optic nerve photos of nhanes participants by investigators at johns hopkins university and the johns hopkins school of medicine, and the nchs institutional review boards approved this review. the nhanes included a standardized questionnaire administered at home by a trained interviewer and an extensive examination in a mobile examination center (mec) that included a physical exam, specialized measurements, and laboratory tests. demographic data included age, sex, race / ethnicity, education, income, and specific questions related to access to health care and health insurance coverage. educational attainment was defined as less than high school if the participant reported having less than 12 years of schooling or equivalent. poverty was defined as having a poverty - to - income ratio (pir) 1.0, where pir is a ratio of family income to poverty threshold as defined by the united states census bureau. access to health care and health insurance coverage at the time of survey were assessed via the questions is there a place you usually go when you are sick or need advice about your health ? and are you covered by health insurance or some other kind of health care plan ? we categorized health insurance as private insurance only, government insurance only, a combination of private and government, or no health insurance. self - reported glaucoma status was ascertained via the question have you ever been told by an eye doctor that you have glaucoma, sometimes called high pressure in your eyes ? because availability of government insurance, specifically medicare, is affected by age, we analyzed insurance status separately for those < 65 and those 65 years old. each nhanes participant had nonmydriatic 45 photographs taken of the macula and optic disc of both eyes (cr6 - 45 nm ; canon usa, melville, ny, usa). initial grading of the photographs, including cup - to - disc ratio (cdr), was performed at the university of wisconsin fundus photograph reading center. the photographs were also evaluated for the presence of macular disease including macular edema, panretinal photocoagulation, focal photocoagulation, artery or vein occlusion, diabetic retinopathy, age - related macular degeneration, chorioretinal abnormalities, macular hole, and retinal detachment. all images with a cdr 0.6 on initial grading (1201 images of 1073 eyes from 549 participants) were reviewed and regraded by three glaucoma specialists (pg, mvb, and dsf) at the wilmer eye institute of the johns hopkins university school of medicine. for this analysis, we assumed that participants with cdr < 0.6 in both eyes did not have glaucoma (this value is close to the optimal cutoff point for defining glaucomatous optic neuropathy in population - based glaucoma risk factor analysis). as a consequence, all glaucoma cases in the analysis were derived from participants who had at least one eye with cdr 0.6 on initial grading. the nonstereo color images of participants with cdr 0.6 as determined by the reading center were transferred to a tablet - based review system (truthmarker, idx, llc ; iowa city, ia, usa), and three glaucoma specialists regraded each image to determine image quality (excellent, good, fair, poor, ungradable), vertical cdr (0.01.0 in increments of 0.1), notching of the neuroretinal rim (none, inferior, superior, both), excavation of the optic cup (no, maybe, yes, unable), optic disc hemorrhage (no, maybe, yes, unable), tilting of the disc (no, yes), and relative disc size (small, average, large). each glaucoma specialist then determined likelihood of glaucoma (no, possible, probable, definite, unable) based on clinical judgment of all features of disc appearance. the results were adjudicated where necessary. to evaluate the reliability of the cdr determined by the reading center, 180 participants with cdr < 0.6 in both eyes (423 images of 360 eyes of 180 participants) were randomly sampled. among the 180 participants, 2 participants had missing grading on cdr ; 157 participants had cdr < 0.6 in both eyes in both the initial and second readings ; and 21 participants were classified as having a cdr 0.6 in at least one eye on the reading at johns hopkins university. among all regraded participants, the kappa for agreement between the johns hopkins university and university of wisconsin readings on cdr categorization was 0.76. using the appearance of the optic nerve on fundus photography, three glaucoma specialists judged the presence of glaucoma in each eye (no, possible, probable, definite, unable). glaucoma was defined if the consensus assessment by the three glaucoma specialists was probable or definite in at least one eye. disagreements were adjudicated using the algorithm detailed in the supplementary material. the methodology for performing fdt perimetry on nhanes participants has been previously described. briefly, each nhanes participant with at least light - perception vision who did not have an infection underwent a 19-point suprathreshold screening test using the n-30 - 5 pattern on a matrix fdt (carl zeiss meditec, dublin, ca, usa). the nhanes protocol defined a test as unreliable if the false - positive rate was greater than 33%, if there were more than 33% fixation losses by blind spot testing, or if the technician administering the test noted an error of some kind. the result for a particular eye was deemed unreliable if either of the two tests was unreliable by these criteria. the nhanes protocol defines visual field loss as the presence of at least two field locations in the first test abnormal at the < 1% threshold level and at least two field locations in the second test abnormal at the < 1% threshold level with at least one abnormal field location being the same on both tests. an abnormal fdt was defined as any outcome of that test that would have resulted in the patient 's being referred on for further evaluation. this included the test not being done, a positive (abnormal) result as defined above, insufficient data (only one test of two completed), or an unreliable test. the reference population used in this study was the civilian, noninstitutionalized population 40 years of age and older who resided in the united states during 2005 to 2008. nhanes used a complex, stratified multistage probability sampling design that requires a weighting scheme to provide unbiased prevalence estimates representative of the us population. as people with ungradable photos in both eyes were excluded from optic disc regrading, inverse probability weighting was employed to try to account for this potential source of selection bias. we first built a selection model for the presence of gradable optic disc photographs based on age, sex, race, education, and access to care using logistic regression, and we used this model to estimate probabilities of selection for participants with at least one gradable fundus photo who were included. all statistical analyses were performed using these calibrated weights and stata svy commands (version 12 ; stata corp., college station, tx, usa) to account for the complex multistage probability sampling design. continuous and categorical demographic and clinical variables were compared across glaucoma status categories using student 's t - tests or tests. we estimated the prevalence and number of people with glaucoma in the united states overall and in subgroups defined by age, sex, and race / ethnicity. we also modeled the prevalence of glaucoma as a function of age using restricted cubic splines with knots at 50, 60, and 70 years of age to provide a smooth yet flexible description of the association. the association between demographic variables and disc size (small, medium, large) was evaluated using multinomial logistic regression models. the association between demographic variables and other disc morphology variables was evaluated using multivariable logistic regression models. the kappa statistics for agreement between the left and right eyes were 0.49, 0.09, 0.41, 0.50, and 0.07 for disc size, hemorrhage, excavation, notch, and tilt, respectively. all models were adjusted for age, sex, and race / ethnicity, and separate models were fitted for the associations of self - reported glaucoma, optic disc grading defined glaucoma, and cdr 0.6 with disc morphology variables. we also modeled the association between demographic variables and disc morphology with previous diagnosis of glaucoma using multivariable logistic regression models. the nhanes is conducted by the national center for health statistics (nchs) of the centers for disease control and prevention. we restricted our analysis to nhanes 20052008 participants 40 years of age or older (n = 7081). the final sample included 5746 participants who had at least one eye that could be evaluated for glaucoma using optic nerve photos (2883 men and 2863 women). the nchs institutional review board approved the nhanes, and written informed consent was obtained from all participants. the present study involved an additional review of optic nerve photos of nhanes participants by investigators at johns hopkins university and the johns hopkins school of medicine, and the nchs institutional review boards approved this review. the nhanes included a standardized questionnaire administered at home by a trained interviewer and an extensive examination in a mobile examination center (mec) that included a physical exam, specialized measurements, and laboratory tests. demographic data included age, sex, race / ethnicity, education, income, and specific questions related to access to health care and health insurance coverage. educational attainment was defined as less than high school if the participant reported having less than 12 years of schooling or equivalent. poverty was defined as having a poverty - to - income ratio (pir) 1.0, where pir is a ratio of family income to poverty threshold as defined by the united states census bureau. access to health care and health insurance coverage at the time of survey were assessed via the questions is there a place you usually go when you are sick or need advice about your health ? and are you covered by health insurance or some other kind of health care plan ? we categorized health insurance as private insurance only, government insurance only, a combination of private and government, or no health insurance. self - reported glaucoma status was ascertained via the question have you ever been told by an eye doctor that you have glaucoma, sometimes called high pressure in your eyes ? because availability of government insurance, specifically medicare, is affected by age, we analyzed insurance status separately for those < 65 and those 65 years old. each nhanes participant had nonmydriatic 45 photographs taken of the macula and optic disc of both eyes (cr6 - 45 nm ; canon usa, melville, ny, usa). initial grading of the photographs, including cup - to - disc ratio (cdr), was performed at the university of wisconsin fundus photograph reading center. the photographs were also evaluated for the presence of macular disease including macular edema, panretinal photocoagulation, focal photocoagulation, artery or vein occlusion, diabetic retinopathy, age - related macular degeneration, chorioretinal abnormalities, macular hole, and retinal detachment. all images with a cdr 0.6 on initial grading (1201 images of 1073 eyes from 549 participants) were reviewed and regraded by three glaucoma specialists (pg, mvb, and dsf) at the wilmer eye institute of the johns hopkins university school of medicine. for this analysis, we assumed that participants with cdr < 0.6 in both eyes did not have glaucoma (this value is close to the optimal cutoff point for defining glaucomatous optic neuropathy in population - based glaucoma risk factor analysis). as a consequence, all glaucoma cases in the analysis were derived from participants who had at least one eye with cdr 0.6 on initial grading. the nonstereo color images of participants with cdr 0.6 as determined by the reading center were transferred to a tablet - based review system (truthmarker, idx, llc ; iowa city, ia, usa), and three glaucoma specialists regraded each image to determine image quality (excellent, good, fair, poor, ungradable), vertical cdr (0.01.0 in increments of 0.1), notching of the neuroretinal rim (none, inferior, superior, both), excavation of the optic cup (no, maybe, yes, unable), optic disc hemorrhage (no, maybe, yes, unable), tilting of the disc (no, yes), and relative disc size (small, average, large). each glaucoma specialist then determined likelihood of glaucoma (no, possible, probable, definite, unable) based on clinical judgment of all features of disc appearance. the results were adjudicated where necessary. to evaluate the reliability of the cdr determined by the reading center, 180 participants with cdr < 0.6 in both eyes (423 images of 360 eyes of 180 participants) were randomly sampled. among the 180 participants, 2 participants had missing grading on cdr ; 157 participants had cdr < 0.6 in both eyes in both the initial and second readings ; and 21 participants were classified as having a cdr 0.6 in at least one eye on the reading at johns hopkins university. among all regraded participants, the kappa for agreement between the johns hopkins university and university of wisconsin readings on cdr categorization was 0.76. using the appearance of the optic nerve on fundus photography, three glaucoma specialists judged the presence of glaucoma in each eye (no, possible, probable, definite, unable). glaucoma was defined if the consensus assessment by the three glaucoma specialists was probable or definite in at least one eye. briefly, each nhanes participant with at least light - perception vision who did not have an infection underwent a 19-point suprathreshold screening test using the n-30 - 5 pattern on a matrix fdt (carl zeiss meditec, dublin, ca, usa). the nhanes protocol defined a test as unreliable if the false - positive rate was greater than 33%, if there were more than 33% fixation losses by blind spot testing, or if the technician administering the test noted an error of some kind. the result for a particular eye was deemed unreliable if either of the two tests was unreliable by these criteria. the nhanes protocol defines visual field loss as the presence of at least two field locations in the first test abnormal at the < 1% threshold level and at least two field locations in the second test abnormal at the < 1% threshold level with at least one abnormal field location being the same on both tests. an abnormal fdt was defined as any outcome of that test that would have resulted in the patient 's being referred on for further evaluation. this included the test not being done, a positive (abnormal) result as defined above, insufficient data (only one test of two completed), or an unreliable test. the reference population used in this study was the civilian, noninstitutionalized population 40 years of age and older who resided in the united states during 2005 to 2008. nhanes used a complex, stratified multistage probability sampling design that requires a weighting scheme to provide unbiased prevalence estimates representative of the us population. as people with ungradable photos in both eyes were excluded from optic disc regrading, inverse probability weighting was employed to try to account for this potential source of selection bias. we first built a selection model for the presence of gradable optic disc photographs based on age, sex, race, education, and access to care using logistic regression, and we used this model to estimate probabilities of selection for participants with at least one gradable fundus photo who were included. all statistical analyses were performed using these calibrated weights and stata svy commands (version 12 ; stata corp., college station, tx, usa) to account for the complex multistage probability sampling design. continuous and categorical demographic and clinical variables were compared across glaucoma status categories using student 's t - tests or tests. we estimated the prevalence and number of people with glaucoma in the united states overall and in subgroups defined by age, sex, and race / ethnicity. we also modeled the prevalence of glaucoma as a function of age using restricted cubic splines with knots at 50, 60, and 70 years of age to provide a smooth yet flexible description of the association. the association between demographic variables and disc size (small, medium, large) was evaluated using multinomial logistic regression models. the association between demographic variables and other disc morphology variables was evaluated using multivariable logistic regression models. the left and right eyes were assessed and reported separately. the kappa statistics for agreement between the left and right eyes were 0.49, 0.09, 0.41, 0.50, and 0.07 for disc size, hemorrhage, excavation, notch, and tilt, respectively. all models were adjusted for age, sex, and race / ethnicity, and separate models were fitted for the associations of self - reported glaucoma, optic disc grading defined glaucoma, and cdr 0.6 with disc morphology variables. we also modeled the association between demographic variables and disc morphology with previous diagnosis of glaucoma using multivariable logistic regression models. we identified 172 cases of glaucoma based on optic disc appearance in the study population. characteristics of those who did and did not have gradable fundus photos are described in detail in supplementary table s1. participants with glaucoma were more likely to be older and to have a combination of private and government insurance, abnormal fdt test results, and a self - report of a physician diagnosis of glaucoma and were less likely to have no insurance (table 1). the weighted estimate of the overall prevalence of glaucoma in the us civilian noninstitutionalized population aged 40 years and older was 2.1% (95% ci, 1.7%2.6% ; table 2), affecting 2.91 million people (1.36 million women and 1.55 million men ; table 3). the prevalence increased with age, was higher in men than in women (2.4% vs. 1.9%), and was higher in blacks compared to other ethnicities. the age - related increase in prevalence was evident in men and women and almost all race and ethnicity groups, albeit weaker for mexican americans after age 60 (fig., characteristics of study participants by glaucoma status in the national health and nutrition examination survey 20052008 prevalence of glaucoma in the united states from national health and nutrition examination survey 20052008 data estimated number of glaucoma cases (in thousands) in the united states from national health and nutrition examination survey 20052008 data the associations of participant characteristics with individual morphologic optic disc features were evaluated among the 729 participants whose optic images were reviewed at johns hopkins university (table 4 ; supplementary table s2). non - hispanic blacks, other races, and participants with cdr 0.6 were less likely to have a small disc size. disc hemorrhage, excavation, and notching were more likely to occur in participants who were older, had cdr 0.6, or had glaucoma. the prevalence of tilted disc was lower in participants with cdr 0.6, but was not statistically associated with glaucoma diagnosis. odds ratio (95% ci) for disc morphology abnormalities (right eye) in the national health and nutrition examination survey 20052008 among the 172 participants with glaucoma, only 78 reported a previous diagnosis of glaucoma (43.7%, table 5). those who were unaware of glaucoma status were more likely to be younger, to have a small disc, and to have an abnormal fdt result and were less likely to have notching or disc hemorrhages compared with those with a self - reported diagnosis. among 5551 participants without glaucoma, 271 reported a previous diagnosis of glaucoma (3.9%, table 6). those who reported a previous diagnosis of glaucoma were older and more likely to be non - hispanic black, to have an abnormal fdt test, and to have notch of the optic nerve. they were also less likely to be educated and to have private insurance only or no insurance compared with participants who correctly self - identified as not having glaucoma. the positive and negative predictive values of self - report of a glaucoma diagnosis were 18.5% and 98.8%, respectively. participant characteristics and disc morphology by self - reported glaucoma status among people with glaucoma determined in fundus photographs in the national health and nutrition examination survey 20052008 participant characteristics and disc morphology by self - reported glaucoma status among people without glaucoma determined in fundus photographs in the national health and nutrition examination survey 20052008 the overall prevalence of glaucoma in a representative sample of the us population 40 years of age and older based on fundus photographs was 2.1% (95% ci, 1.7%2.6%), representing 2.9 million cases if applied to the entire us population. this includes 1.4 million cases in women, 1.5 million cases in men, 2.3 million cases among people 60 years of age and older, and 0.9 million cases among blacks, mexican americans, and others. the prevalence of glaucoma was highest in non - hispanic blacks, followed by non - hispanic whites, mexican americans, and others. consistent with other studies, we found that 55.0% of people with glaucoma identified by masked evaluation of optic nerve photos were unaware of their disease status. our estimates of the prevalence of glaucoma overall and among non - hispanic whites were similar to those from a meta - analysis of population - based studies in the united states, but were lower than those in the more recent meta - analysis that presented global estimation of glaucoma prevalence. our study and the two meta - analyses differed in the prevalence estimates for non - hispanic blacks and mexican americans, as data were scarce and the estimates in the meta - analysis were derived from single studies. our estimate of glaucoma among non - hispanic blacks (3.7%) was lower than that of blacks in the baltimore eye survey (5.6%), the only study of blacks in the united states, and of that in the barbados eye study (10.8%) and the st. lucia study (8.8%), the two major studies of blacks outside the united states. our estimate of the prevalence of glaucoma among mexican americans (1.9%) was similar to that of proyecto ver (2.0%), but lower than that of the los angeles latino eye study (4.7%), the only two studies of mexican americans in the united states. in addition, we did not find an exponential increase of glaucoma prevalence with age in mexican americans as observed in other ethnic groups and in the two studies of latinos in the united states. possible explanations include different demographic and genetic characteristics of participants across studies and variations in sample selection, measurement techniques including potential small subgroup size despite oversampling of minority populations, and diagnostic criteria. participants in nhanes were sampled from across the united states, while participants from other studies were recruited from specific regions. in addition, we relied on fundus photographs to identify glaucoma, while other studies also used information from intraocular pressure, visual acuity, and/or visual field testing for diagnosis. our overall estimate of glaucoma prevalence in nhanes was lower than that reported by shaikh., which was limited by using solely cdr to decide on glaucoma status. in comparison, our diagnosis has the advantage of grading of the optic nerve including disc size, localized notching, and disc hemorrhage, as determined by glaucoma specialists. the prevalence of self - reported glaucoma among nhanes participants who were excluded from our analysis due to missing or ungradable photos, however, was 7.4%. individuals with missing or ungradable photos were older, poorer, and more likely to be non - hispanic blacks, and these factors are associated with higher risk of glaucoma (supplementary table s1). although we have used conditional weighting to account for the people excluded due to missing or ungradable photos, our estimates of glaucoma prevalence among these groups are likely lower than the true population prevalence. the prevalence of glaucoma based on self - reported information in nhanes 20052008 was 6.9%, 11.5%, and 6.5% in non - hispanic whites, non - hispanic blacks, and mexican americans, respectively. in our study, 4.1% of those without evidence of glaucoma on fundus photographs reported a prior diagnosis of glaucoma. because of the low prevalence of glaucoma, even a relatively high specificity results in a high proportion of false positives among participants who self - report a previous diagnosis of glaucoma in addition, the probability of a false - positive report was higher among participants who were less educated, were older, and had abnormal fdt, indicating that self - report is affected by a complex pattern of recall bias. these limitations need to be taken into account when interpreting results in studies using self - administered questionnaire data on glaucoma. visual field loss in glaucoma is irreversible, so detection and treatment are essential to limit the progression of disease and delay additional optic nerve damage. however, nearly half of those with glaucoma in our study were unaware of their diagnosis, a percentage that has been relatively constant in recent decades despite advances in diagnostic techniques. compared to participants who self - reported a diagnosis of glaucoma, those with undiagnosed glaucoma tended to be younger and were less likely to have visual field defects or clear optic disc changes such as a focal notch or a disc hemorrhage. older individuals were more likely to have had more visits to an eye doctor and therefore may have been more likely to have the disease detected during these exams. our results suggest that systematic eye exams with fundus evaluation may identify nonsymptomatic cases who are unaware of the disease and thus may benefit from treatment and clinical follow - up at earlier stages in the natural history of the disease. we did not consider information on fdt perimetry because of its poor diagnostic performance in visual field fundus photographs, however, are subject to variability in interpretation and measurement error. in order to minimize this we had three glaucoma experts independently grade all optic nerve images, and final diagnosis in addition, participants with small optic discs (which are more common in non - hispanic whites and females) may develop a pathologic appearance of the disc only after the appearance of visual field defects. second, we have likely underestimated the prevalence of glaucoma since we assumed that all participants with a cdr < 0.6 in the initial reading at the university of wisconsin were free of glaucoma. however, in our reliability analysis of 180 participants selected at random among those with cdr < 0.6 based on the initial reading from wisconsin, 21 people were reclassified as cdr 0.6 after interpretation of the images by three glaucoma specialists. we identified three glaucoma cases (all non - hispanic whites with small discs) among these 21 participants, but these numbers could not be incorporated into the overall prevalence estimates because the probabilities obtained from 180 participants were statistically unstable. these findings, however, emphasize that future studies should seek a more robust grading of cdr, especially when the nerve is small. in our analysis also, in addition to the higher prevalence of self - reported glaucoma among participants with missing or ungradable fundus photographs, participants with advanced visual defects and other subgroups at high risk of glaucoma may be more likely to refuse participation in nhanes. this selection bias may lead to further underestimation of glaucoma prevalence, particularly among older individuals, since people with advanced glaucoma may more likely be institutionalized due to visual limitations. as a consequence, our estimates likely underestimate the presence of glaucoma and should be interpreted as lower bounds of its prevalence in the us population 40 years of age and older. third, although our sample size was large overall, the sample size in some subgroups was small and subject to greater random variability, which may explain the lack of exponential increase of glaucoma prevalence with age in hispanic participants. the sample size for the evaluation of the associations between glaucoma and disc morphology characteristics was also smaller, resulting in large variance of the estimates. finally, we could not distinguish among various types of glaucoma, which is classified mainly based on the anatomic structure of the anterior chamber. future studies with more detailed anatomic assessment are needed to estimate the prevalence of different clinical forms of glaucoma in the us population. the strengths of our study include the use of a large nationally representative sample with oversampling of elderly participants and minorities for more accurate subgroup estimation, rigorous quality control procedures in data collection, and the use of expert evaluation of fundus images for glaucoma assessment. data from nhanes 20052008 suggest that the lower bound estimate is 2.9 million people in the united states who have glaucoma, of whom 1.6 million are undiagnosed. this is the first time that glaucoma prevalence in the united states has been estimated based on expert assessment of fundus photographs, with more reliable estimates than those from self - reported surveys. with the aging of the us population, it is projected that the number of glaucoma patients in the united states will increase by 28% per decade, and the socioeconomic and health burden associated with glaucoma will continue to escalate. as a consequence, developing effective and practical screening algorithms for glaucoma is a clinical research priority and a requirement for disease control in the population. prevalence of glaucoma in the united states from national health and nutrition examination survey 20052008 data. curves represent adjusted prevalence of glaucoma based on restricted cubic splines with knots at 50, 60, and 70 years of age. results were estimated using logistic regression accounting for the complex multistage probability sampling design in strata defined by sex and race, with age as the exposure. | purposeto estimate the prevalence of glaucoma in the us population based on optic nerve head photography, to estimate the prevalence of glaucoma awareness, and to identify demographic and ocular risk factors for being unaware of having glaucoma.methodsthe study included 5746 men and women 40 years of age and older participating in the national health and nutrition examination survey (nhanes) 20052008. each participant had 45 photographs of the macula and optic disc of both eyes. fundus photographs were first graded by a reading center, and those with a cup - to - disc ratio (cdr) 0.6 were regraded by three glaucoma specialists to determine the presence or absence of glaucoma. analyses were performed using nhanes weights to account for the complex multistage probability sampling design.resultsthe estimated overall prevalence of glaucoma in the us civilian, noninstitutionalized population 40 years of age and older was 2.1% (95% confidence interval [ci ], 1.7%2.6%). glaucoma affected 2.9 million individuals, including 1.4 million women ; 1.5 million men ; 2.3 million people 60 years of age and older ; and 0.9 million blacks, mexican americans, and people of other races. the prevalence of glaucoma was highest in non - hispanic blacks, followed by non - hispanic whites, mexican americans, and others. over half of participants with glaucoma were unaware that they had the disease.conclusionsthe prevalence of glaucoma based on optic nerve fundus photography assessment in the general us population 40 years of age and older was 2.1%. approximately half of glaucoma cases were previously undiagnosed. studies to determine whether and how to identify undiagnosed glaucoma are an important next step. |
mammalian cells express pattern recognition receptors (prr) and are therefore able to detect microbes. the prrs are activated upon binding to conserved molecular structures, called pathogen - associated molecular patterns (pamps), to induce expression of antiviral and proinflammatory proteins. the fact that most pamps are expressed only by microbes and not by host cells, allows the innate immune system to respond specifically to non - self. in addition to pathogen - specific pamps, dna is a potent stimulator of antimicrobial responses. to discriminate between dna derived from the microbes versus the host, dna sensors are present in the cytosol, as well as in endosomal membrane structures, that is, compartments expected to be free of host dna. toll - like receptor (tlr) 9 was the first dna sensor to be described. it is expressed in the endosomal membrane and monitors the endosomal content for unmethylated, cpg - rich dna. as host dna is mostly methylated, and hence has a low cpg content, as opposed to microbial dna, tlr9 detects foreign dna based both on location and chemical composition of the dna. tlr9 signals through the adaptor protein myd88, resulting in activation of signaling pathways eventually leading to activation of the transcription factors interferon (ifn) regulatory factor (irf) 7- and nuclear factor - kappa b (nf-b), which in turn drive transcription of type i ifn subtypes and proinflammatory cytokines (figure 1). as tlr9 is expressed by only a limited number of cell types, most notably plasmacytoid dendritic cells, this receptor is not the central sensor of viruses in the cells most often infected by viruses. rig - i - like receptors (rlrs) recognize rna species in the cytosol and include rig - i, mda5 and lgp2. both rig - i and mda5 bind double - stranded rna, but rig - i preferentially recognizes shorter fragments while long rna molecules activates mda5. furthermore, to distinguish between host and pathogen rna, rig - i senses 5-triphosphate containing rna, a structure often formed in viral rna. rig - i and mda5 both contain two caspase activation and recruitment domains, which upon ligand recognition engage in homotypic interaction with the adaptor protein mitochondrial activator of virus signaling (mavs) leading to activation of tank - binding kinase (tbk) 1, and ib kinase and, culminating in the expression of type i ifn as well as proinflammatory proteins. several receptors have been proposed to be important for cytosolic dna recognition, including absent in melanoma (aim2), gamma - interferon - inducible protein (ifi16) and cyclic gmp binding, aim2 initiates the assembly of the inflammasome, a complex that includes the adaptor protein asc and caspase 1. the activated inflammasome cleaves the proforms of the cytokines interleukin (il)-1 and il-18 to generate bioactive cytokines. the pyhin protein, ifi16 and the nucleotidyltransferase, cgas both bind dna, mainly independent of the dna sequence, with exceptions as described below. signaling through cgas or ifi16 depends on the adaptor molecule stimulator of interferon genes (sting, also known as mita, mpys, eris and tmem173), which is localized to the endoplasmic reticulum (er) membrane in non - activated cells. upon dna binding, cgas undergoes a conformational change, leading to activation of the enzyme and synthesis of the second messenger cyclic gmp amp (23-cgamp) from atp and gtp, which is a ligand for sting. many bacteria, including the intracellular bacteria listeria monocytogenes, also produce cyclic dinucleotides (cdn), but they contain a conventional 35 linkages. these cyclic dinucleotides activate a pro - bacterial type i ifn response in mice but not humans through a sting - dependent pathway. importantly, the cgas - produced 23-cgamp is a highly potent stimulator of both murine and human sting. cgamp binds in a pocket at the interface of the two sting protomers, resulting in translocation of sting from the er compartment to perinuclear autophagy - like vesicles. the translocation route of sting has been less defined, however recent results determine a translocation through the er golgi intermediate compartments (ergic) and the golgi apparatus with the activation of downstream signaling molecules taking place at or before the ergic. interestingly, the phosphorylated residue of sting has been shown to localize in a serine cluster, which is evolutionary conserved in other adaptor molecules, including mavs and tir - domain - containing adapter - inducing interferon- (trif). the phosphorylation of sting allows the transcription factor irf3 to dock to the phosphorylated residue, resulting in tbk1-dependent phosphorylation of irf3 leading to dimerization, nuclear translocation and activation, eventually turning on the transcription of type i ifn genes. ifi16 is predominantly nuclear, but a small pool of ifi16 is cytoplasmic and has been demonstrated to co - localize with herpes simplex virus (hsv)-1 genomic dna in the cytoplasm upon infection. ifi16 binds the dna via two hin domains, allowing the formation of filamentous oligomers on the dna molecule, which is thought to facilitate signaling through sting and the induction of type i ifn. one study has shown ifi16 to have higher affinity for longer, naked dna fragments (> 150 bp) than short fragments. as nuclear self - dna is bound by histones, the ifi16 affinity for longer dna fragments could potentially represent a mechanism to discriminate between self- and non - self dna. at present it is not explained how ifi16 mediates signaling, although there are papers to suggest that ifi16 and cgas act in the same pathway. experimental in vivo work in mice has demonstrated the importance of aim2 in the early control of murine cytomegalovirus (cmv) after intraperitoneal infection, acting through a mechanism dependent on induction of il-18 and stimulation of type ii ifn production by natural killer cells. likewise, cgas is essential for control of infections with hsv-1 (intravenous infection), murine gammaherpesvirus 68 (mhv68) (intraperitoneal infection), and vaccinia virus (intranasal infection), and this is believed to be dependent on induction of type i ifn. sting mice were found to display elevated mortality rate after intravenous hsv-1 infection compared with wild - type mice, and the virus replicated more efficiently in the brain of sting - deficient mice. importantly, these signs correlated with no detectable type i ifn in the blood of infected sting - deficient animals. in agreement with this, hsv-1 did not induce detectable levels of type i ifn in sting mef cells and bone - marrow - derived macrophages. interestingly, this phenotype was largely identical in cgas mice after hsv-1 infection through the same route, suggesting that potential alternative functions of these proteins are not central in host defense against hsv-1. the cytosolic dna sensors ifi16 and cgas are activated in cells infected with dna viruses. studies with different dna viruses, including hsv-1 and cmv, have shown that viral genomic dna associates with the dna sensor ifi16, thus suggesting the foreign incoming genome to stimulate the dna sensing machinery. it has been demonstrated that viral genomic dna is released into the cytosol upon infection, and this is preceded by k48-linked ubiquitination of capsid associated factors and subsequent proteosomal degradation of the viral capsid (figure 2). such studies suggest the viral genome to be the trigger of dna - dependent immune responses. other studies suggest that virus - induced cellular stress triggers release of mitochondrial dna into the cytosol, which in turn activates the cgas - sting pathway. herpesviruses are reported to induce mitochondrial stress and through this mitochondrial dna pathway stimulate cgas activation. the relative contribution of the different sources of dna for the activation of the cgas - sting pathway during viral infections remains to be characterized in details. retrovirus replication leads to accumulation of several dna - containing nucleic acid structures with the capacity to stimulate dna sensors. whereas the rna : dna intermediate has been reported to be detected by tlr9 and cgas, the single - stranded dna (ssdna) species and the final double - stranded dna (dsdna) products also have the potential to stimulate type i ifn expression in a manner dependent on ifi16 and cgas. strong - stop ()-strand dna ' (sstdna) are present in the cytosol upon hiv-1 infection. these sstdnas, formed by the first 181 nucleotides of the hiv-1 genome, are reversely transcribed and fold up in a secondary structure with three hairpin elements. this structure has recently been reported as a hiv-1 pamp, stimulating type i ifn production, due to sensing by cgas. herzner. found that the transition from dsdna to ssdna, named y - form dna, was the stimulatory part of the sstdna molecule. the y - form structure stimulates the production of cgamp and the cgamp response was found to correlate with the numbers of guanosine nucleotides in the y - form structure. have further shown that sensing of the stem - loop structures of lentiviral ssdna molecules, including sstdna is dependent on ifi16 and sting. beyond dna recognition in the infected cells, there are now emerging evidence to support that cgamp propagates signals to adjacent non - infected cells, hence spreading antiviral activity. first, it was reported that cgamp can diffuse to neighboring cells through gap junctions to stimulate sting - dependent type i ifn expression. two papers by bridgeman. and gentili., detected cgamp in vaccinia virus and murine cmv virions as well as in lentivector - derived lentivirus particles. cgamp - containing virus particles stimulated cgas sting cell lines to produce type i ifn and the particles were further able to activate dendritic cells. at present it is not known whether cgamp is actively packed into the viral particles as an antiviral strategy to allow early type i ifn responses in infected cells and in cells with low cgas expression, or whether cgamp is randomly taken up together with cytosolic material as the virus particle maturates and are released from the host cell. a third possibility is that some viruses actively incorporate cgamp, as low levels of type i ifn might influence the infection positively. studies of mhv68 have shown the establishment of latency to be ifn dependent and ifn was furthermore shown important for the inhibition of acute cell damages resulting from uncontrolled virus replication. as described above, the dna sensing pathway is activated by dna from different sources upon virus infection, but due to the co - evolution of viruses and mammalian cells, viruses have learned to counteract the innate immune system. several viral evasion mechanisms resulting in the inhibition of type i ifn responses have been reported, which demonstrates the importance of this class of antiviral cytokines in defense against viruses. the family of herpesviruses has been reported to evade the dna sensing machinery both at the level of sensing, and signaling through the sting - tbk1-dependent pathway. we previously identified a conserved herpesvirus deubiquitinase to inhibit sting - dependent dna signaling in macrophages. mechanistically, this occurred upstream of dna release into the cytosol, thus suggesting the deubiquitinase to prevent the viral dna to become accessible for dna sensors (figure 3).the infected cell protein (icp)0 protein encoded by hsv-1 possesses e3 ubiquitin ligase activity through the ring finger domain. the ubiquitination activity and an active proteasomal pathway was reported to be crucial for the establishment of lytic infection in hsv-1 infected cells. reported icp0 to trigger the degradation of ifi16 by the proteasome resulting in impaired sensing of hsv-1 and reduced production of ifn - stimulated genes. for instance, icp0 was found to inhibit irf3 in the nucleus of epithelial cells co - infected with hsv-1 and sendai virus. this was due to sequestration of irf-3 in icp0-containing foci in the nucleus, thus resulting in a dislocation of the transcription factor away from the promoter target elements. another herpesvirus protein known to target ifi16 is pul83, a tegument protein of human cmv (hcmv). pul83 is the most abundant protein in the hcmv particle and the protein localizes to the nucleus early during infection. pul83 was first shown to interact with nuclear ifi16 to stimulate ifi16-dependent transcription from the major immediate - early promoter of hcmv. in a follow - up work by li., pul83 was reported to inhibit the oligomerization of activated, nuclear ifi16 and hence to block the signal transmission from ifi16 to sting resulting in diminished type i ifn expression. the work showed pul83 to interact directly with the pyrin domain of ifi16, with inhibitory effects. the pyrin domain has been reported to be essential for cooperative assembly of ifi16 filaments on dsdna, which is likely to be a requirement for ifi16-mediated dna dependent signaling. the results on icp0 and pul83 underline that ifi16 takes part in sensing of herpesvirus genomes and activates a sting - dependent type i ifn signaling pathway. despite this, there is currently no mechanistic understanding of how ifi16 mediates activation of the sting pathway. cgas is well established to be a dna sensor, and unlike the case for ifi16, there is mechanistic understanding of how cgas links to sting - dependent signaling, through production of the second messenger cgamp as described above. the kaposi 's sarcoma - associated herpesvirus (kshv) protein orf52 was recently identified to inhibit the enzymatic activity of cgas. orf52 is like hcmv pul83 a tegument protein, but contrary to the nuclear localization of pul83, orf52 is only found in the cytosol and in perinuclear regions. orf52 was reported to be a dna - binding protein and the ability to sequester stimulatory dna was shown to be important, but not sufficient for the kshv - dependent inhibition of type i ifn. this observation was explained by cgas binding to dna occurring with higher affinity than dna binding by orf52. to complete the inhibition of cgas the orf52 homologs of three other gammaherpesviruses, namely epstein - barr virus, mhv68 and rhesus monkey rhadinovirus are also able to bind cytosolic dna and thus inhibit the enzymatic activity of cgas, indicating that the cgas target is evolutionary conserved in gammaherpesviruses. an orf52-like protein encoded by an alphaherpesvirus, with a cgas inhibitory function has not been reported. however, it has been speculated that the tegument protein vp22 from hsv-1 binds cgas, as vp22 and orf52 have some three dimensional structurally homology, but functionally evidence is still lacking. herpesvirus genomes are recognized by several dna receptors, which share the feature that they utilize the adaptor protein sting for downstream signaling. consequently, to ensure a broad inhibition of herpesvirus - induced type i ifn, targeting of sting as well as the sting interaction partner, tbk1 would be an efficient means to block early antiviral defense. recently, a study aiming to identify novel kshv - encoded proteins targeting dna sensing pathways, reported that the viral irf1 (virf1), interacted directly with sting, at a time point after sting trafficking from the er. this interaction impedes the binding of tbk1 to sting, thus inhibiting phosphorylation and activation of sting, tbk1 and irf3. consequently, virf1 was found to be able to inhibit the induction of type i ifn production. an additional role for virf1 in evasion of kshv - induced ifn production has also been reported to occur through interaction between virf1 and the transcriptionally coactivators cbp / p300. the interaction impairs the association between cbp / p300 and irf3 resulting in inefficient transcription from irf3-dependent promoters. several herpesvirus proteins are reported to target tbk1 as a viral strategy to inhibit the dna sensing pathway further downstream in the pathway. icp34.5 from hsv-1 and orf11 from mhv68 both bind directly to tbk1, resulting in decreased irf3 activation and type i ifn expression. the kshv protein orf45 uses an alternative mechanism to inhibit tbk1-dependent type i ifn expression. orf45 do not inactivate tbk1, but acts instead as an alternative substrate for tbk1. in a hek293 t cell system, orf45 was found to interact with non - phosphorylated irf7 and as orf45 in this context is a preferred substrate for tbk1 compared with irf7, orf45 is phosphorylated on two serine residues in a tbk1-dependent manner whereas irf7 remains non - phosphorylated and thus inactive. this mechanism does not affect irf3 activation but leads to decreased type i ifn expression, given the well - described role for irf7 in the ifn - positive feedback loop. the family of herpesviruses has been reported to evade the dna sensing machinery both at the level of sensing, and signaling through the sting - tbk1-dependent pathway. we previously identified a conserved herpesvirus deubiquitinase to inhibit sting - dependent dna signaling in macrophages. mechanistically, this occurred upstream of dna release into the cytosol, thus suggesting the deubiquitinase to prevent the viral dna to become accessible for dna sensors (figure 3).the infected cell protein (icp)0 protein encoded by hsv-1 possesses e3 ubiquitin ligase activity through the ring finger domain. the ubiquitination activity and an active proteasomal pathway was reported to be crucial for the establishment of lytic infection in hsv-1 infected cells. orzalli. reported icp0 to trigger the degradation of ifi16 by the proteasome resulting in impaired sensing of hsv-1 and reduced production of ifn - stimulated genes. for instance, icp0 was found to inhibit irf3 in the nucleus of epithelial cells co - infected with hsv-1 and sendai virus. this was due to sequestration of irf-3 in icp0-containing foci in the nucleus, thus resulting in a dislocation of the transcription factor away from the promoter target elements. another herpesvirus protein known to target ifi16 is pul83, a tegument protein of human cmv (hcmv). pul83 is the most abundant protein in the hcmv particle and the protein localizes to the nucleus early during infection. pul83 was first shown to interact with nuclear ifi16 to stimulate ifi16-dependent transcription from the major immediate - early promoter of hcmv. in a follow - up work by li., pul83 was reported to inhibit the oligomerization of activated, nuclear ifi16 and hence to block the signal transmission from ifi16 to sting resulting in diminished type i ifn expression. the work showed pul83 to interact directly with the pyrin domain of ifi16, with inhibitory effects. the pyrin domain has been reported to be essential for cooperative assembly of ifi16 filaments on dsdna, which is likely to be a requirement for ifi16-mediated dna dependent signaling. the results on icp0 and pul83 underline that ifi16 takes part in sensing of herpesvirus genomes and activates a sting - dependent type i ifn signaling pathway. despite this, there is currently no mechanistic understanding of how ifi16 mediates activation of the sting pathway. cgas is well established to be a dna sensor, and unlike the case for ifi16, there is mechanistic understanding of how cgas links to sting - dependent signaling, through production of the second messenger cgamp as described above. the kaposi 's sarcoma - associated herpesvirus (kshv) protein orf52 was recently identified to inhibit the enzymatic activity of cgas. orf52 is like hcmv pul83 a tegument protein, but contrary to the nuclear localization of pul83, orf52 is only found in the cytosol and in perinuclear regions. orf52 was reported to be a dna - binding protein and the ability to sequester stimulatory dna was shown to be important, but not sufficient for the kshv - dependent inhibition of type i ifn. this observation was explained by cgas binding to dna occurring with higher affinity than dna binding by orf52. to complete the inhibition of cgas, the orf52 homologs of three other gammaherpesviruses, namely epstein - barr virus, mhv68 and rhesus monkey rhadinovirus are also able to bind cytosolic dna and thus inhibit the enzymatic activity of cgas, indicating that the cgas target is evolutionary conserved in gammaherpesviruses. an orf52-like protein encoded by an alphaherpesvirus, with a cgas inhibitory function has not been reported. however, it has been speculated that the tegument protein vp22 from hsv-1 binds cgas, as vp22 and orf52 have some three dimensional structurally homology, but functionally evidence is still lacking. herpesvirus genomes are recognized by several dna receptors, which share the feature that they utilize the adaptor protein sting for downstream signaling. consequently, to ensure a broad inhibition of herpesvirus - induced type i ifn, targeting of sting as well as the sting interaction partner recently, a study aiming to identify novel kshv - encoded proteins targeting dna sensing pathways, reported that the viral irf1 (virf1), interacted directly with sting, at a time point after sting trafficking from the er. this interaction impedes the binding of tbk1 to sting, thus inhibiting phosphorylation and activation of sting, tbk1 and irf3. consequently, virf1 was found to be able to inhibit the induction of type i ifn production. an additional role for virf1 in evasion of kshv - induced ifn production has also been reported to occur through interaction between virf1 and the transcriptionally coactivators cbp / p300. the interaction impairs the association between cbp / p300 and irf3 resulting in inefficient transcription from irf3-dependent promoters. several herpesvirus proteins are reported to target tbk1 as a viral strategy to inhibit the dna sensing pathway further downstream in the pathway. icp34.5 from hsv-1 and orf11 from mhv68 both bind directly to tbk1, resulting in decreased irf3 activation and type i ifn expression. the kshv protein orf45 uses an alternative mechanism to inhibit tbk1-dependent type i ifn expression. orf45 do not inactivate tbk1, but acts instead as an alternative substrate for tbk1. in a hek293 t cell system, orf45 was found to interact with non - phosphorylated irf7 and as orf45 in this context is a preferred substrate for tbk1 compared with irf7, orf45 is phosphorylated on two serine residues in a tbk1-dependent manner whereas irf7 remains non - phosphorylated and thus inactive. this mechanism does not affect irf3 activation but leads to decreased type i ifn expression, given the well - described role for irf7 in the ifn - positive feedback loop. although most information on evasion of dna - stimulated signaling has been obtained from studies on herpesviruses, there is also accumulating evidence for other viruses targeting these pathways. for instance the hepatitis b virus dna polymerase interacts with sting, and inhibits production of type i ifns. interestingly, the pool of sting that was degraded was ubiquitinated through k63-linked chains, a process which has been reported to be mediated by several e3 ubiquitin ligases and to be essential for activation of the pathway. thus, the hepatitis b virus dna polymerase targets selectively the pool of activated sting. several dna oncoviruses express proteins that target the leu - x - cys - x - glu (lxcxe) binding site in the retinoblastoma protein, thus contributing to the oncogenic properties of these viruses. additionally, the lxcxe motif was recently found to be important in the inhibition of the dna sensing pathway by oncogenic viruses. the e7 protein from human papillomavirus and e1a from adenovirus as many cell lines are immortalized with lxcxe - containing tumor proteins, the dna sensing pathway of these cell lines is permanently impaired. thus lau. showed that knock out of e1a and e7 increased the potential to mount type i ifn responses to dsdna in these cell lines. lxcxe - containing proteins are expressed by different ssdna and dsdna viruses and potently bind the retinoblastoma protein, thus mediating cell proliferation and oncogenesis. speculated that the lxcxe motifs evolved in these viruses to inhibit sting and hence to facilitate the establishment of infection, and that the oncogenic function of the lxcxe motif may be a secondary effect. this hypothesis is supported by the fact that only a minor group of viruses expressing lxcxe - containing proteins have oncogenic properties. hiv-1 replicates efficiently in human macrophages, and this replication stimulates only modest innate immune responses. upon cell entry the viral capsid plays an important role in preventing immediate recognition of the viral genome. more host proteins, including the cofactors cleavage and polyadenylation specificity factor subunit 6 (cpsf6) and cyclophilin a (cypa), are known to be recruited to the viral capsid to facilitate virus replication in myeloid cells. the recruitment of cpsf6 to the capsid explains the ability of the pharmaceutical molecule pf-3450074 to block hiv-1 replication. pf-3450074 competes with cpsf6 for binding to the hiv-1 capsid, thus blocking virus replication. findings by rasaiyaah. showed that the recruitment of specific host proteins to the hiv-1 capsid is necessary for preventing premature dna synthesis and stimulation of innate dna receptors. myeloid cells stimulated with a capsid mutant (p90a) with impaired cypa interaction, produced cgamp through a mechanism dependent on the reverse transcriptase. this result shows that the hiv-1 genome is recognized by cgas in cases with non - intact capsids. hence hiv-1 has evolved a defense against cytosolic detectors, relying on the cloaking of a replication intermediate by the host factors cpsf6 and cypa. as described above the retroviral replication intermediates, ssdna, y - form dna, rna : dna hybrids and dsdna it is thus conceivable that retroviruses have evolved different mechanisms for inhibition of the dna sensing pathway. hiv-1 is known to target the rlr pathway via a relocalization of rig - i to lysosomes and perinuclear compartments through a mechanism dependent on the viral protease, but knowledge about inhibition of the dna sensing pathway is still insufficient. recently, the two hiv-1 proteins vpr and vif were reported to target and inactivate tbk1 in dendritic- and macrophage - like cells. tbk1 was found to be ubiquitinated, as a normal response to traf3 activation, but the subsequent autophosphorylation of tbk1 was lacking due to vpr and vif expression. vpr and vif were found to interact with tbk1 and as both proteins are present in the incoming virus particle, it is possible that hiv-1 inhibits dna receptor - dependent signaling at early time points post - viral entry. in addition to dna viruses, several viruses carrying single - stranded rna (ssrna) genomes have been reported to modulate sting and downstream signaling. although this seems counterintuitive, published data describing different cellular mechanisms, provide a rationale for why some rna viruses have evolved mechanisms to inhibit sting. first, rig - i has been shown to interact with sting in a manner dependent on mavs following activation by positive ssrna viruses, thus amplifying the ifn production. second, schoggins. found lower basal expression of ifn - stimulated genes in cgas mice, and proposed that low - grade constitutive activation of this pathway sets the immunological tone in the organism. in support of this, cgas mice showed higher mortality compared with wild - type mice upon infection with the positive sense ssrna virus west nile virus. finally, we identified that the virus cell membrane fusion induces induction of type i ifn expression in a sting - dependent but cgas - independent manner. using virus - like particles from hsv-1 lacking capsid and genomes as well as fusogenic cationic liposomes the swine virus porcine epidemic diarrhea virus, infecting epithelial cells of the intestine, encodes a protease and deubiquitinase protein, named papain - like protease 2 (plp2). in addition to targeting rig - i, plp2 is able to interact directly with sting and reduce the ubiquitination status of the protein, resulting in reduced sting - dependent ifn expressions. the sting - targeting mechanism is thought to be conserved in plp - expressing coronaviruses, as plp2-like proteins from human coronavirus (nl63) and severe acute respiratory syndrome virus (plpro) respectively, both antagonize sting in a similar manner. the protease ns2b3 from dengue virus is another sting targeting protein, with specific affinity for the human form of sting. the virus is enveloped with a non - segmented positive sense ssrna genome, which normally induces low type i ifn levels, indicating an inhibitory evasion mechanism. the virus replication was shown to be more efficient in sting - depleted cells and this phenotype was explained by a protease - dependent cleavage of sting. the viral protease ns2b3 was found to interact with and cleave sting n - terminally, at the sequence lrrg. the lrrg sequence is not conserved in mice, and this lack of ns2b3 recognition sequence explains partly why the murine sting is not degraded by ns2b3. in addition to lrrg other regions in the sting molecule are necessary for efficient targeting by ns2b3, as a mutant form of murine sting, expressing the human lrrg sequence was still resistant to ns2b3-dependent cleavage. finally, we have recently reported that the fusion peptide of the influenza a virus ha protein interacts with sting in a specific region localized close to the dimerization interphase of sting, and this prevents the dimerization of sting and downstream ifn production in response to membrane fusion but not cgamp stimulation. to our knowledge, influenza a virus is the first example of a negative sense rna virus, harboring a sting evasion mechanism. collectively, sting dependent signaling pathways are also active during infection with rna viruses. dna is a highly immunostimulatory molecule, and the immune responses evoked by dna have antiviral activity. consequently microbes with dna genomes have evolved mechanisms to evade sensing and signaling through the pathways stimulated by dna. this is probably of central importance for the ability of dna viruses to establish infection, and underscores the importance of the dna - stimulated immune pathways in protective immunity. with the accumulating insight into the mechanisms of viral evasion of dna sensing, there is now a need to understand the importance of these mechanisms in vivo. further knowledge on the cellular targets and mechanisms of action of viral strategies to evade the dna sensing machinery will lead to better understanding of the pathogenesis of viral diseases, and could also uncover potential targets for future immunomodulatory drugs. | cellular sensing of virus - derived nucleic acids is essential for early defenses against virus infections. in recent years, the discovery of dna sensing proteins, including cyclic gmp amp synthase (cgas) and gamma - interferon - inducible protein (ifi16), has led to understanding of how cells evoke strong innate immune responses against incoming pathogens carrying dna genomes. the signaling stimulated by dna sensors depends on the adaptor protein sting (stimulator of interferon genes), to enable expression of antiviral proteins, including type i interferon. to facilitate efficient infections, viruses have evolved a wide range of evasion strategies, targeting host dna sensors, adaptor proteins and transcription factors. in this review, the current literature on virus - induced activation of the sting pathway is presented and we discuss recently identified viral evasion mechanisms targeting different steps in this antiviral pathway. |
in western countries, papillary carcinoma comprises 85% in whites and 72% in blacks [1, 2 ]. according to an investigation of the japanese society of thyroid surgeons (jsts) in 2004, the incidence of papillary carcinoma in japan was 93%, which was higher than that in western countries, possibly because of sufficient amounts of iodine in the japanese diet. generally, it has an indolent character, but cases showing certain clinicopathological features are progressive and show a dire prognosis. frequent multiplicity in the thyroid and metastasis to the regional lymph nodes is prominent biological characteristics of papillary carcinoma. therefore, not only the extent of thyroidectomy but also that of lymph node dissection remains controversial. in western countries, total (or near total) thyroidectomy has been almost routinely performed because the serum thyroglobulin level can be used as a marker of recurrence or persistent disease, and radioactive iodine (rai) ablation can be performed as an adjuvant therapy. moreover, rai therapy can be immediately performed when the thyroglobluin level becomes elevated or recurrence is clinically detected. in japan, however, limited thyroidectomy such as subtotal thyroidectomy and lobectomy with isthmectomy has been traditionally adopted as the standard. this is partially because the capacity to perform rai therapy is limited due to legal restrictions, and rai therapy is not considered cost effective by the healthcare system in japan. furthermore, it is also because japanese endocrine surgeons are empirically aware that most papillary carcinomas are indolent and their prognoses are generally excellent. limited thyroidectomy decreases the incidence of severe complications such as bilateral recurrent laryngeal paralysis and persistent hypoparathyroidism, and patients may not require the administration of l - thyroxine. in contrast, lymph node dissection is not actively performed in western countries. in japan, however, extensive prophylactic lymph node dissection not only in the central but also lateral compartment has been widely adopted. this is because the organ to which papillary carcinoma most frequently recurs is the lymph node, and prophylactic lymph node dissection can decrease the recurrence rate of carcinoma. from early in the 1990s, the elevated resolution power of ultrasonography has facilitated the accurate evaluation of thyroid carcinoma by demonstrating the size and location of primary lesions and lymph node metastases. based on the prognostic data of patients who underwent surgery in the era of routine ultrasonography, it may be the time to revise the standards regarding the optimal extent of thyroidectomy and lymph node dissection for papillary carcinoma. in this paper, we compare the strategies of thyroidectomy and lymph node dissection among western and japanese guidelines as well as our experience in order to consider the most appropriate surgical designs for papillary carcinoma patients. total thyroidectomy is almost routinely recommended by western guidelines such as those of national comprehensive cancer network (nccn), ata, and bta [46 ]. as indicated in the introduction, limited thyroidectomy has been more widely adopted than total thyroidectomy in japan because of the limited capacity to perform rai therapy, and the policy of japanese endocrine surgeons that limited thyroidectomy is adequate for most papillary carcinoma patients. in the japanese guideline recently published, it is indicated that, for patients with t1n0m0 according to uicc tnm classification system, hemithyroidectomy is acceptable and adequate. indeed, one japanese study showed that 10-year disease - free survival (dfs) rates of 2638 solitary t1n0m0 patients were excellent at 97% even though 60% of these patients underwent limited thyroidectomy. the incidence of recurrence to the remnant thyroid in patients who underwent limited thyroidectomy was only 1%. however, patients who underwent total thyroidectomy are easier to follow than those receiving limited thyroidectomy because, as indicated above, thyroglobulin level can be a marker of recurrence, and rai therapy can be immediately performed for carcinoma recurrence. therefore, total thyroidectomy should be the first line for patients with high - risk features predicting poor disease - free and cause - specific survival rates. in our guideline, total thyroidectomy is strongly recommended for patients having tumor size larger than 5 cm, large number of clinical lymph node metastases detected on imaging studies, lymph node larger than 3 cm, significant extrathyroid extension, or distant metastasis at surgery. such patients are regarded as high risk and considered likely to show recurrence to local and/or distant organs. furthermore, our guideline also described that total thyroidectomy is preferable also for patients having tumor larger than 4 cm or clinical lymph node metastasis. currently, our indication for total thyroidectomy is wider than that in the japanese guideline but still narrower than that in western guidelines. we recommend total thyroidectomy for all patients except low - risk patients such as solitary t1n0m0 patients and those with microcarcinoma extending only to the muscles, muscle layer of the esophagus, or recurrent laryngeal nerve. indeed, the incidence of total thyroidectomy is increasing in our department mainly because of the ease of postoperative followup. table 1 summarizes the indications for total thyroidectomy in western and japanese guidelines and in our hospital. regional lymph nodes are located in the three compartments ; central, lateral, and mediastinal compartments. although one study recommended prophylactic mediastinal dissection in papillary carcinoma showing contralateral lateral node metastasis, generally this compartment is dissected only when radiologic evidence of metastasis is detected. in this paper, of the three compartments, the central compartment is the most adjacent to the thyroid. this compartment can be dissected without extension of the wound for thyroidectomy or exacerbation of postoperative complications such as neck discomfort and pain. in an investigation of 5805 patients who underwent central node dissection, the positive predictive value and specificity of preoperative ultrasonography were high at 92% and 98%, respectively, but negative predictive value and sensitivity were terribly low at 37% and 12%, respectively. this indicates that, of patients diagnosed as negative on ultrasonography, 63% are diagnosed as having positive lymph nodes in this compartment on pathological examination. this is possibly because the air - filled trachea, clavicle, and menubrium of the sternum disrupt the accurate depiction on ultrasonography. patients having clinical node metastasis not only to the lateral but also to the central compartment are more likely to show carcinoma recurrence than patients without clinical node metastasis (figure 1). however, there are discrepant data on improving the prognosis of central node dissection [1118 ], and there are no studies comparing prognoses between patients who underwent prophylactic central node dissection and did not undergo that. therefore, it is still debatable whether prophylactic central node dissection is of clinical significance. this is because, as indicated above, central node metastasis is difficult to evaluate preoperatively, and reoperation for recurrence to this compartment may cause severe complications such as recurrent laryngeal nerve injury and persistent hypoparathyroidism. our department has also traditionally adopted the same procedure for central node dissection as outlined in the japanese guideline. the japanese guideline also indicates that in patients who undergo hemithyroidectomy, the pretracheal and peritracheal nodes ipsilateral to the primary lesion as well as the delphian nodes should be dissected, while dissection of peritracheal nodes contralateral to primary lesion is not mandatory. we agree with this guideline because, according to our data, central node dissection in the contralateral lobe did not improve the prognosis of patients with microcarcinoma. the recommended management of central compartment dissection in the japanese guideline and in our department is in sharp contrast to that in western guidelines. the lateral compartment is more distant from the thyroid than the central compartment. in order to dissect this compartment, wound extension is necessary and, therefore, we have considered that papillary carcinoma initially metastasizes to the central compartment and, thereafter, metastasizes to the lateral compartment. however, as shown in table 3, the incidence of central - negative but lateral - positive patients was similar to that of central - positive but lateral - negative patients [3, 19 ]. it is thus suggested that papillary carcinoma shows similar incidences of initially metastasizing to the central and lateral compartments. for patients showing clinical lateral node metastasis (n1b) clinical lateral node metastasis is an important and independent prognostic factor [3, 20 ]. especially, patients having metastatic nodes larger than 3 cm or extranodal tumor extension have a significantly worse disease - free survival and cause - specific survival [10, 21 ]. thus, careful node dissection is necessary in order to prevent recurrence at least to the compartment that had previously been dissected. diagnostic accuracy for lateral node metastasis on ultrasonography is somewhat better than that for central node metastasis, but the negative predictive value and sensitivity remain low at 43% and 29%, respectively. furthermore, the incidence of lateral node metastasis for cases that are not preoperatively diagnosed as negative increases with tumor size, and about 75% of patients with primary lesions larger than 2 cm demonstrated latent metastasis in this compartment (table 4). if prophylactic lateral node dissection is not performed, metastatic nodes in this compartment remain undissected at a very high incidence. since japanese endocrine surgeons are empirically aware of the high incidence of node metastasis to the lateral compartment, they actively perform prophylactic lateral node dissection, although none of the western guidelines recommend this [46 ]. however, it is a separate issue whether these latent metastatic nodes become a clinical issue that later affects patient prognosis. indeed, previous studies, including those from japan, showed discrepant results for the significance of lateral node dissection [2230 ]. based on these, japanese guideline recognizes that prophylactic lateral node dissection decreases the risk of recurrence and improves disease - free survival but does not clearly state its indication. our department recommends prophylactic lateral node dissection for patients having a primary lesion larger than 3 cm or significant extrathyroid extension, because these patients show a significantly worse lymph node metastasis - free survival even though they underwent prophylactic lateral node dissection (figures 2(a) and 2(b)). another department in japan showed that prophylactic lateral node dissection is preferable for patient having tumors greater than 4 cm or with distant metastasis. indications of prophylactic lateral node dissection based on western guidelines, japanese guideline, and our department are summarized in table 5. recently, in japan, there has been a developing opinion that total thyroidectomy would be preferable for papillary carcinoma patients demonstrating high - risk features, and prophylactic lateral node dissection is unnecessary for low - risk patients. in contrast, routine rai ablation after total thyroidectomy for low - risk patients has come under review in western countries, and in the bta guideline, risk of second malignancy is described, indicating that routine total thyroidectomy for low - risk patients may become less significant. we have an impression that strategies for treatment of thyroid carcinoma, including papillary carcinoma, in western countries and japan are coming closer to each other. due to the high resolution power of ultrsonography, evaluation of primary lesions, including size, number and location, and lymph node metastases, can be accurately performed. under such circumstances, we consider that the treatment of papillary carcinoma should be determined on a case - by - case basis rather than in a stereotyped fashion. needless to say, total thyroidectomy is mandatory for high - risk patients predicted to develop carcinoma recurrence in high incidences. it is, however, doubtful whether routine total thyroidectomy with rai ablation is appropriate for the treatment of papillary carcinoma. for example, it is now evident that total thyroidectomy is not needed for t1n0m0 carcinoma unless there are no pathological lesions in the contralateral lobe on ultrasonography. the indications for total thyroidectomy in the japanese guideline are narrower than those in western guidelines. in our department, the prevalence of total thyroidectomy is increasing, but the indications are still stricter than those in western guidelines. this is based on our policy that low - risk patients show an excellent prognosis even though they undergo limited thyroidectomy. regarding lymph node metastasis, patients having clinical node metastasis detectable on ultrasonography are likely to show recurrence even when they undergo therapeutic lymph node dissection. unfortunately, the incidence of recurrence to the compartments that had previously been dissected is similar to that of recurrence to the compartment that had not been dissected. it is important to note that ultrasonography very often overlooks lymph node metastasis, and the indications for prophylactic node dissection come into question. the japanese guidelines and our department policy recommend routine central node dissection, which is in sharp contrast to western guidelines. in our opinion, this should be routinely performed in order to prevent recurrence to this compartment. reoperation for recurrence to this compartment may induce severe complications such as persistent hypoparathyroidsm and recurrent laryngeal injury. the japanese guideline does not clearly describe the indications for prophylactic lateral node dissection although the guideline recognizes the effectiveness of this approach to improving disease - free survival. this may reflect the fact that almost routine lateral node dissection was performed in the past. however, our department recommends prophylactic lateral node dissection for patients having tumors greater than 3 cm or significant extrathyroid extension. although there are no comparative data, such patients show a high incidence of lymph node recurrence even though they undergo prophylactic lateral node dissection. western guidelines do not recommend prophylactic lateral node dissection, which may be because of a difference in the lymph node recurrence rates considered acceptable by western countries and in our department. in summary, we described the extent of thyroidectomy and lymph node dissection recommended by the japanese guideline and our department and compared these with those outlined in western guidelines. we expect that treatment strategies in western countries and japan will become closer to each other in the future, providing the optimal treatment for patients around the world. | papillary carcinoma is a prominent malignancy originating from follicular cells. this disease generally shows an indolent character, but patients demonstrating certain clinicopathological features have a dire prognosis. at present, western countries adopted almost routine total thyroidectomy with radioactive iodine (rai) ablation, while limited thyroidectomy with extensive prophylactic lymph node dissection has traditionally been performed for most patients in japan. recently, accurate evaluation of carcinoma stage can be performed on preoperative imaging studies, especially on ultrasonography. it is therefore important to treat papillary carcinoma patients depending on clinicopathological features rather than in a stereotyped fashion. in this paper, appropriate extension of thyroidectomy and lymph node dissection is discussed based on western and recently published japanese guidelines and the experience in kuma hospital. |
since the early 1980s, the number of incidentally discovered adrenal masses has increased as a result of the widespread use of imaging studies, such as computed tomography (ct) and magnetic resonance imaging (mri) (1). the prevalence of adrenal incidentalomas is known to be as high as 3% in middle - aged people and 10% in the elderly (2). the prevalence of primary aldosteronism (pa) increases with the severity of hypertension and varies depending on the population under investigation. in a recent meta - analysis, jansen. (3) determined a mean pa prevalence of 4.3% in hypertensive primary care patients and 9.0% in referred hypertensive patients. currently, only a minority of pa requires surgery, in part because it is difficult to prove that the adenoma is the sole cause of pa (4). the assessment of eligibility for surgery requires differentiation of unilateral conn 's adenoma from cases of bilateral adrenal hyperplasia and nonfunctioning adrenal nodules (incidentalomas) (5). adrenal vein sampling (avs) is the most accurate standard test to distinguish these entities ; however, it is commonly ineffective because the adenoma only intermittently secretes aldosterone or because of technical difficulties in cannulating the right adrenal vein (6). the purpose of this report is to describe the findings of non - invasive imaging methods that can be used to lateralize aldosterone secretion to one of the bilateral incidentally - detected adrenal masses. here we report a case where unilateral pa was detected on 18f - fluorodeoxyglucose (fdg)-positron emission tomography (pet / ct) and confirmed by adrenal venous sampling of both adrenal incidentalomas. a 53-yr - old man was referred to our clinic on september 5, 2011 after bilateral adrenal masses (right : 1 cm, left : 2.5 cm) were discovered on an abdominal ct (fig., the patient underwent low anterior resection for sigmoid colon cancer and had received adjuvant chemotherapy. the patient had been prescribed antihypertensive medications (almodipine 10 mg, olmesartan 20 mg) for 12 yr, but his blood pressure could not be controlled well and was found to be 160/90 mmhg on presentation. he demonstrated an increased deep tendon reflex in both knees and had no weight gain or edema. blood analysis revealed persistent hypokalemia (serum potassium of 2.6 mm), but his medications did not include a potassium - wasting diuretic (e.g., thiazide, loop). laboratory tests showed plasma renin activity (pra) of 0.12 ng / ml / h and plasma aldosterone concentration (pac) of 10.4 ng / dl with a pac / pra ratio of 86.6. and we confirmed diagnosis of primary aldosteronism with captopril challenge test (post - captopril aldosterone level was 18.5 ng / dl). given his history of colon cancer, we had to rule out metastatic disease before continuing to adrenal venous sampling. fdg - pet / ct of his torso incidentally revealed a focal hypermetabolic lesion in the right adrenal gland (fig. but in this case, although right adrenal incidentaloma was smaller than left that, only right adrenal gland had focal hypermetabolic uptake. there was no hypermetabolic uptake except adrenal gland in fdg - pet / ct, the patient was suspected primary aldosteronism clinically. so we thought that right adrenal incidentaloma was not metastatic lesion but benign functioning tumor. adrenal venous sampling was performed at both adrenal glands, and the aldosterone / cortisol ratio was found to be 15 times higher on the right side than on the left (table 1). 3a) with tumor cells that resembled cortical cells and showed lipid - laden clear cells microscopically (fig. three months after the operation, the patient 's blood pressure, serum potassium level, and plasma renin - aldosterone activity were normalized. the widespread use of ct and mri has led to an increase in the incidental discovery of adrenal masses, requiring physicians to further evaluate whether the lesions are benign or malignant and lateralize symptoms to one lesion or the other. many review articles reported that recent advances in ct, mri, and pet / ct assist in the distinction between benign adenomas and malignant lesions of the adrenal glands (7). only a few articles described the use of imaging techniques in distinguishing functional adenomas from nonfunctioning lesions of the adrenal glands (9)., fdg - pet / ct has been used mainly for distinguishing between benign and malignant adrenal masses (8). the combination of fdg - pet / ct and ct in the evaluation of adrenal incidentalomas in patients without a history of cancer has been reported to have a 93% negative predictive value (npv) for malignancy and a 97% positive predictive value (ppv) for detecting surgical lesions (9). surgical lesions are defined as a malignancy or a benign secreting tumor. a high fdg uptake (maximum standardized uptake value 10) was highly predictive of malignancy (9). pet / ct performed for the characterization of adrenal masses in patients with cancer yielded a sensitivity of 100% for the detection of malignancy, in addition to a specificity of 99%, a ppv of 93%, a npv of 100%, and an accuracy of 99% (10). conversely, for the detection of benign tumor, the sensitivity, specificity, ppv, npv, and accuracy were 99%, 100%, 100%, 93%, and 99%, respectively (10). as mentioned above, fdg - pet / ct is a useful tool for differentiating malignancy, benign secreting tumors, and non - functioning benign tumors in adrenal masses. there are, however, some limitations of fdg - pet / ct in distinguishing adrenal masses. first, it is nonspecific for neoplasms, with uptake by macrophages and other immune cells. second, neoplasms with low glucose metabolism, such as well - differentiated net (neuroendocrine tumor), show poor fdg uptake reflecting the degree of tumor differentiation and biological behavior (11). third, fdg - pet / ct uptake does not show a consistent pattern for endocrine tumors, which is probably due to the variability inherent in fdg uptake (8). although fdg - pet / ct has some limitations, it is helpful in lateralizing aldosterone secretion in patients with bilateral adrenal incidentalomas. recently, some reports showed that c-11metomidate (mto)-pet / ct is a sensitive and specific noninvasive alternative to avs for lateralizing aldosterone secretion by conn 's adenoma (12). c-11 metomidate, a potent inhibitor of 11b - hydroylase andaldosterone synthase, has been advanced as a positron emission tomography (pet) radiotracer (12). there was a case report of an adrenocortical adenoma with an increased fdg uptake in patient with subclinical cushing 's syndrome (13). that case suggested that increased fdg uptake may be relevant to hormonal function of an adrenocortical adeoma by glucose metabolism, even in a completely asymptomatic normocortisolism patient. about increased fdg uptake f-18 fdg - pet / ct was helpful in characterizing adrenal masses and was consistent with the results of avs, the conventional diagnostic study. although there are some limitations of f-18 fdg pet / ct in the routine evaluation of adrenal incidentalomas, we propose that f-18 fdg pet / ct can play an additional role for identifying functioning adrenal tumor as an alternative to adrenal venous sampling. especially in the absence of pre - existing malignancy | in patients with primary aldosteronism who have bilateral adrenal incidentalomas, it is important to identify which adrenal gland is secreting excess aldosterone. traditionally, adrenal vein sampling (avs) has been performed for lateralization despite its invasiveness. here we report a case of bilateral adrenal incidentaloma in which 18-fluorodeoxyglucose (fdg)-positron emission tomography (pet) was used to identify the functional adrenal mass. a 53-yr - old man was referred to our clinic due to bilateral adrenal incidentalomas (right : 1 cm, left : 2.5 cm) on computed tomography (ct). given his history of colon cancer, fdg - pet / ct scanning was used to rule out metastasis. although there was focal hot uptake lesion in the right adrenal gland, the patient was suspected primary aldosteronism clinically more than metastasis because of the patient 's underlying hypertension with hypokalemia. it was consistent with the results of avs. based on these findings, we propose that fdg - pet / ct can be used instead of avs to identify the source of primary aldosteronism between two bilateral adrenal incidentalomas. |
we conducted a retrospective cohort study of staff members at the health post who participated in the meeting on september 15. a case - patient was any person who participated in the meeting and had a positive direct parasitologic examination result for t. cruzi or positive serologic results and clinical evidence of acute chagas disease. a non - case was any person who participated in the meeting and had negative test results for t. cruzi. we also conducted a 1:3 case control study (11 case - patients and 34 controls matched by sex and age) that included patients with laboratory - confirmed cases from barcarena. a case - patient was any person in whom during september 1october 15 t. cruzi was found by direct parasitologic examination, irrespective of signs or symptoms of disease, or who had positive serologic results and clinical evidence of disease. this interval was based on date of symptom onset of the first and last case - patient and a reported incubation period of 322 days for orally transmitted disease. controls were age- and sex - matched residents of case - patient neighborhoods who had negative serologic results for t. cruzi. parasitologic examinations were conducted for case - patients by using quantitative buffy coat test, thick blood smear, or buffy coat test (the latter 2 tests included giemsa staining). serologic tests were conducted by using indirect hemagglutination test, elisa, or indirect immunofluorescent test. we ruled out leishmaniasis in all persons with positive serologic results for t. cruzi by using an immunofluorescent test for igm to leishmania spp. we conducted an entomologic investigation during december 1116, 2006, at the homes of 5 case - patients and in forested areas near the homes of 2 case - patients ; at the commercial establishment where aa consumed by the case - patients linked to the health post was prepared and served ; at an aa juice production and sale establishment reported to be frequented by other case - patients ; and at the river dock market where aa delivered to barcarena is unloaded. at this market, we searched baskets used to transport aa in river boats. we applied an insect - displacing compound (piridine ; pirisa, taquara, brazil) to the interior and exterior of buildings at investigation sites and placed traps (13) to obtain triatomines. data were analyzed by using epi info version 6.04d (centers for disease control and prevention, atlanta, ga, usa). we measured relative risk in the cohort study and matched odds ratios in the matched case fisher exact, mcnemar, mantel - haenszel, and kruskall - wallis tests were used as needed. study power (1) was 5%. all case - patients had positive results for t. cruzi by direct examination of blood (figure 2). nine (82%) patients were female ; median age was 39 years (range 770 years). eight (73%) patients resided in urban areas, 7 (64%) in brick dwellings, and 3 (27%) in mixed brick and wooden dwellings. all patients denied having had blood transfusions or organ transplants, having slept in rural or sylvatic areas, and having been bitten by triatomines. trypanosoma cruzi (arrow) in a peripheral blood smear of a patient at a local health facility in a rural area of par state, brazil (giemsa stain, magnification 100). image provided by adriana a. oliveira, brazilian field epidemiology training program, brasilia, brazil. the epidemic curve for the 11 patients is shown in figure 1, panel c. main signs and symptoms were fever, weakness, facial edema, myalgia, arthralgia, and peripheral edema (table 1). no deaths occurred, and median time from symptom onset to treatment initiation was 22 days. the cohort consisted of 12 persons who attended the staff meeting. of these persons, 6 shared a meal, 5 (83%) of whom were case - patients. exposures associated with infection were consumption of thick aa paste and drinking aa juice at the health post ; consumption of chilled aa was protective (table 2). no other foods consumed at the meal were associated with illness (table 2). among exposures tested, drinking aa juice on september 15 and at the health post were significantly associated with illness (p<0.02 and p<0.001, respectively ; matched odds ratio not determined). oral transmission of this disease in the amazon region has been reported since the 1960s. aa has long been the principal suspected food vehicle, but characteristics of outbreaks, small groups with universal exposure and high attack rates, have precluded epidemiologic implication of this food. there are no reports of timely collection of aa for laboratory testing in an outbreak. in this outbreak, a shared meal was the only event linking case - patients, and cohort and case control studies demonstrated an association between aa consumption at this meal and infection.. limitations of this study are possible recall bias caused by delay between illness and investigation and failure to collect food samples for testing. studies are needed to determine viability of t. cruzi in aa, along with the tree - to - bowl continuum of aa, to identify sources of contamination. because aa is a major dietary component in the amazon region and a component of the local economy, identifying practical prevention measures is essential. | in 2006, a total of 178 cases of acute chagas disease were reported from the amazonian state of par, brazil. eleven occurred in barcarena and were confirmed by visualization of parasites on blood smears. using cohort and case control studies, we implicated oral transmission by consumption of aa palm fruit. |
high levels of c - reactive protein (crp) are associated with increased in cardiovascular events, including myocardial infarction, stroke, and cardiovascular death. despite these epidemiological associations, the correlation between atherosclerosis burden by computed tomography angiography (cta) and crp levels has been studied by using the coronary artery calcium scores (cac), but the results have been inconsistent. cac by non - contrast computed tomography can identify the calcified atherosclerotic plaques but does not assess the noncalcified atherosclerotic burden. contrast enhanced computed tomographic angiography (cta) of the coronaries is able to detect noncalcified plaque. the dense calcified plaque is thought to represent the stable coronary lesions, whereas the culprit lesions causing the acute coronary syndrome are frequently noncalcified or with minimal amount of calcium. given the underestimation of noncalcified atherosclerotic plaque in coronary arteries by using cac, this could explain the inconsistent relationship between coronary atherosclerotic burden and crp. thus, we conducted this study to assess the association between crp and noncalcified atherosclerotic plaque detected by cta. we evaluated 142 male patients 30 years of age or older who were referred to cta with one of these following problems : presence of chest symptoms (pain, dyspnea) but thought not to be acute coronary syndrome (94 patients),abnormal stress test (42 patients),asymptomatic patient with multiple coronary artery risk factors (6 patients). presence of chest symptoms (pain, dyspnea) but thought not to be acute coronary syndrome (94 patients), abnormal stress test (42 patients), asymptomatic patient with multiple coronary artery risk factors (6 patients). patients were excluded from our study if they met one of the following criteria : previous history of coronary artery disease, known history of active infection, inflammatory processes, or malignancyartifacts or image quality that preclude the complete evaluation of epicardial coronary vessels andrhythm other than sinus. previous history of coronary artery disease, known history of active infection, inflammatory processes, or malignancy artifacts or image quality that preclude the complete evaluation of epicardial coronary vessels and rhythm other than sinus. baseline characteristics were collected from a standardized questionnaire and electronic medical records (emr). the study protocol was approved by our institutional review board and was compliant with the health insurance portability and accountability act (hipaa). serum fasting level of low - density lipoprotein (ldl), high - density lipoprotein (hdl), total cholesterol, and crp were collected on the day of cta. serum samples were obtained in ethylenediaminetetraacetic acid (edta) tubes and were stored at 4c before processing. c - reactive protein (crp) was measured by using a latex immunoturbidimetric on architect ci 8200 integrated system (abbott diagnostics, abbott park, illinois) using abbott diagnostics reagents. scanning was performed using the brilliance 40 multiple detector computed tomography (mdct) scanner (philips medical systems, cleveland, ohio) following slowing of heart rate (hr) with metoprolol or diltiazem. the brilliance 40 is a 40 0.625 mm collimation scanner with gantry rotation speed of 0.42 s per rotation, minimal slice thickness 0.67 mm, and temporal resolution 210 ms or less. a volume of 100 - 120 ml of ultravist, 370 mgi / ml contrast media, (berlex, montville, new jersey) was injected intravenously at a rate of 5 ml / s. scanning was triggered automatically when contrast enhancement within the descending aorta reached a threshold level of 150 hu (hounsfield units). scanning was performed at 120 kv and 800 - 925 mas with pitch of 0.2. at least ten phases were reconstructed for each study and coronary analysis was done of diastolic or endsystolic phase. image analysis was done with dedicated workstations (philips extended brilliance workspace, cleveland ohio and vitrea, vital images, minnetonka, minnesota). all scans were analyzed by experienced cardiologist (gs) or radiologist (cs). calcium scoring was performed according to the agatston method. coronary artery segments were divided into 15 separate segments, adapted from modified american college of cardiology / american heart association (acc / aha) classification. proximal portion of the diagonal, obtuse marginal, posterolateral, and posterior descending arteries were evaluated for atherosclerotic plaque. in each coronary artery segment, atherosclerosis was defined as tissue structures more than 1 mm that existed either within the coronary artery lumen or adjacent to the coronary artery lumen which could be discriminated from surrounding pericardial tissue, epicardial fat, or the vessel lumen itself [figure 1 ]. types of atherosclerotic plaque were also defined by the attenuation coefficient of the plaque in hounsfield unit (hu). noncalcified was considered when hu were 50 - 150 hu and calcified plaque when hu were above arterial lumen contrast attenuation (typically above 300). mixed plaque was considered when both noncalcified plaque and calcified plaque were noted within the same coronary segment. coronary plaque types (a) examples of calcified plaque (left picture) (b) example of mixed plaque (middle picture) (c) example of noncalcified plaque (right picture) arrows indicate coronary artery plaque statistical analysis was performed with medcalc version 9.6.3.0 (medcalc software, mariakerke, belgium). baseline demographic variables, cardiovascular risk factors, and atherosclerotic plaques were compared across crp quartiles with chi - square trend test for categorical data and kruskal wallis or anova for continuous variables. cardiovascular (cv) risk factors, demographic variables and natural logarithmic transformation of crp (ln - crp) were used as variables to find relationship with the atherosclerotic plaques. multivariable stepwise regression analysis was used to identify the independent risk factor, including ln - crp, for total atherosclerotic burden and other type of atherosclerotic plaque. we evaluated 142 male patients 30 years of age or older who were referred to cta with one of these following problems : presence of chest symptoms (pain, dyspnea) but thought not to be acute coronary syndrome (94 patients),abnormal stress test (42 patients),asymptomatic patient with multiple coronary artery risk factors (6 patients). presence of chest symptoms (pain, dyspnea) but thought not to be acute coronary syndrome (94 patients), abnormal stress test (42 patients), asymptomatic patient with multiple coronary artery risk factors (6 patients). patients were excluded from our study if they met one of the following criteria : previous history of coronary artery disease, known history of active infection, inflammatory processes, or malignancyartifacts or image quality that preclude the complete evaluation of epicardial coronary vessels andrhythm other than sinus. previous history of coronary artery disease, known history of active infection, inflammatory processes, or malignancy artifacts or image quality that preclude the complete evaluation of epicardial coronary vessels and rhythm other than sinus. baseline characteristics were collected from a standardized questionnaire and electronic medical records (emr). the study protocol was approved by our institutional review board and was compliant with the health insurance portability and accountability act (hipaa). serum fasting level of low - density lipoprotein (ldl), high - density lipoprotein (hdl), total cholesterol, and crp were collected on the day of cta. serum samples were obtained in ethylenediaminetetraacetic acid (edta) tubes and were stored at 4c before processing. c - reactive protein (crp) was measured by using a latex immunoturbidimetric on architect ci 8200 integrated system (abbott diagnostics, abbott park, illinois) using abbott diagnostics reagents. scanning was performed using the brilliance 40 multiple detector computed tomography (mdct) scanner (philips medical systems, cleveland, ohio) following slowing of heart rate (hr) with metoprolol or diltiazem. the brilliance 40 is a 40 0.625 mm collimation scanner with gantry rotation speed of 0.42 s per rotation, minimal slice thickness 0.67 mm, and temporal resolution 210 ms or less. a volume of 100 - 120 ml of ultravist, 370 mgi / ml contrast media, (berlex, montville, new jersey) was injected intravenously at a rate of 5 ml / s. scanning was triggered automatically when contrast enhancement within the descending aorta reached a threshold level of 150 hu (hounsfield units). scanning was performed at 120 kv and 800 - 925 mas with pitch of 0.2. at least ten phases were reconstructed for each study and coronary analysis was done of diastolic or endsystolic phase. image analysis was done with dedicated workstations (philips extended brilliance workspace, cleveland ohio and vitrea, vital images, minnetonka, minnesota). scanning was performed using the brilliance 40 multiple detector computed tomography (mdct) scanner (philips medical systems, cleveland, ohio) following slowing of heart rate (hr) with metoprolol or diltiazem. the brilliance 40 is a 40 0.625 mm collimation scanner with gantry rotation speed of 0.42 s per rotation, minimal slice thickness 0.67 mm, and temporal resolution 210 ms or less. a volume of 100 - 120 ml of ultravist, 370 mgi / ml contrast media, (berlex, montville, new jersey) was injected intravenously at a rate of 5 ml / s. scanning was triggered automatically when contrast enhancement within the descending aorta reached a threshold level of 150 hu (hounsfield units). scanning was performed at 120 kv and 800 - 925 mas with pitch of 0.2. at least ten phases were reconstructed for each study and coronary analysis was done of diastolic or endsystolic phase. image analysis was done with dedicated workstations (philips extended brilliance workspace, cleveland ohio and vitrea, vital images, minnetonka, minnesota). all scans were analyzed by experienced cardiologist (gs) or radiologist (cs). calcium scoring was performed according to the agatston method. coronary artery segments were divided into 15 separate segments, adapted from modified american college of cardiology / american heart association (acc / aha) classification. proximal portion of the diagonal, obtuse marginal, posterolateral, and posterior descending arteries were evaluated for atherosclerotic plaque. in each coronary artery segment, atherosclerosis was defined as tissue structures more than 1 mm that existed either within the coronary artery lumen or adjacent to the coronary artery lumen which could be discriminated from surrounding pericardial tissue, epicardial fat, or the vessel lumen itself [figure 1 ]. types of atherosclerotic plaque were also defined by the attenuation coefficient of the plaque in hounsfield unit (hu). noncalcified was considered when hu were 50 - 150 hu and calcified plaque when hu were above arterial lumen contrast attenuation (typically above 300). mixed plaque was considered when both noncalcified plaque and calcified plaque were noted within the same coronary segment. coronary plaque types (a) examples of calcified plaque (left picture) (b) example of mixed plaque (middle picture) (c) example of noncalcified plaque (right picture) arrows indicate coronary artery plaque statistical analysis was performed with medcalc version 9.6.3.0 (medcalc software, mariakerke, belgium). subjects were divided into quartiles based on the level of crp. baseline demographic variables, cardiovascular risk factors, and atherosclerotic plaques were compared across crp quartiles with chi - square trend test for categorical data and kruskal wallis or anova for continuous variables. cardiovascular (cv) risk factors, demographic variables and natural logarithmic transformation of crp (ln - crp) were used as variables to find relationship with the atherosclerotic plaques. multivariable stepwise regression analysis was used to identify the independent risk factor, including ln - crp, for total atherosclerotic burden and other type of atherosclerotic plaque. the clinical characteristics of ninety two participants are presented in [table 1 ] and clinical characteristics according to crp quartiles are presented in [table 2 ]. there was no statistically significant difference across the crp quartiles in the cardiovascular risk factors, including diabetes, age, body mass index, serum total cholesterol, ldl, and hdl cholesterol. there was no statistically significant difference across crp quartile for total number of plaques, total number of noncalcified plaques, mixed plaques or calcified plaques [figure 2 ]. when assessing if subjects with higher total number of plaques, or higher number of any plaque had higher crp, no association was detected [figure 3 ]. multivariate stepwise analysis of total number of calcified plaques per patient was associated with age (p < 0.0001) and bmi (p < 0.05). total number of mixed plaques per patient was associated with age (p < 0.05) and diabetes (p < 0.02). total number of noncalcified plaques was associated only with diabetes (p < 0.01). when we combined three types of plaques in the model, total number of plaques per patient was associated with age (p < 0.01), diabetes (p < 0.02) and statins (p < 0.05). in our cohort baseline characteristics including crp levels and total calcium scores baseline characteristics according to crp levels number of coronary atherosclerotic plaque and crp quartile y axis : number of coronary segments x axis : c - reactive protein quartile denotes normal coronary segments. denotes non - calcified plaque. top left : crp levels and quartile of total atherosclerotic plaque (p = 0.95) top right : crp levels and quartile of calcified plaque (p = 0.66) lower left : crp levels and tertile of noncalcified plaque (p = 0.64) lower right : crp levels and quartile of mixed plaque (p = 0.98) y axis : c - reactive protein levels (mg / l) x axis : quartile or tertile of coronary atherosclerotic plaque per subject correlation of coronary artery calcium scores (cac) and c - reactive proteins levels (crp) using natural logarithmic transformation. y axis : natural logarithmic transformation of c - reactive protein levels (ln crp) x axis : natural logarithmic transformation of coronary artery calcium scores (ln cac) however, recent evidence indicates local crp production in the inflammatory site modulated by the cytokines, including the atherosclerotic plaque. study of the relationship between crp and coronary atherosclerosis by using calcium scores showed inconsistent results. studies in a certain population including post menopausal women, male military recruits, and hypertensive siblings, found no association between crp and coronary atherosclerosis using cac. francis heart study, which showed that cac predicts cad events, was unable to find relationship between coronary calcium scores and crp in persons between ages 50 - 70. the framingham heart study, on the other hand, demonstrated a positive correlation between crp and cac scores in men and women, but this correlation remained only in men after adjustment for cv risk factors. dense calcified coronary plaques were found more in patients with chronic stable angina, where as the culprit lesions are less calcified., found that about 51% of patients with normal coronary calcium scores have noncalcified plaque on coronary cta and 3.7% of those with normal coronary calcium scores had significant coronary artery stenosis. other prior studies tried to overcome this issue by using a non - calcium based measurement of atherosclerotic burden (cardiovascular mri), but results were inconsistent. the dallas heart study found no relationship between crp levels and aortic plaque after multivariate adjustment for other cardiovascular risk factors, where as a study by taniguchi., demonstrated the opposite result without using multivariate adjustment. to the best of our knowledge, the present study is the first to report the relation between overall atherosclerotic burden by contrast - enhanced cta and crp levels. total plaque burden, by using the number of coronary segment with atherosclerotic plaque was created with an idea to give the best possible estimation of atherosclerotic burden. our findings demonstrate that crp does not reflect neither atherosclerotic burden nor coronary calcium scores as measured by coronary cta. also, with sub classification of atherosclerotic plaque into noncalcified, calcified or mixed plaques, we were unable to identify a relationship between each type of plaque and crp. even using the contrast - enhanced cta which can detect more noncalcified atherosclerotic plaque, (ivus) and cta, demonstrated that 64-mdct may underestimate the amount of plaques and overestimate luminal diameter compared to ivus. only 78% of sections containing hypoechoic plaque (verified by ivus) were detected by cta. even within the proximal segments of coronary artery, lack of association between crp levels and atherosclerosis might be due to inadequate spatial resolution and systematic underestimation of noncalcified plaque volume. limitations in this study are : small number of participants, male - only population, and single - center study, reducing the external validity of the study. secondly the crp level was measured in patients who did not have any history of inflammatory diseases or clinical evidence of active infection / inflammation before coronary computed tomography angiography, but some may have occult or undiagnosed inflammation / infection which resulted in unexpected high crp levels. the number of segment with plaque is not a good estimation of atherosclerotic burden and volumetric measurements would be better. finally, a single measurement of crp could be affected by medical therapy (statin therapy or aspirin) or non - cardiac disease and therefore not reflecting patients prior inflammatory state. additionally, a snapshot of inflammatory activity at the time of blood collection (crp levels) may not represent the overall lifelong inflammatory processes. limitations in this study are : small number of participants, male - only population, and single - center study, reducing the external validity of the study. secondly the crp level was measured in patients who did not have any history of inflammatory diseases or clinical evidence of active infection / inflammation before coronary computed tomography angiography, but some may have occult or undiagnosed inflammation / infection which resulted in unexpected high crp levels. the number of segment with plaque is not a good estimation of atherosclerotic burden and volumetric measurements would be better. finally, a single measurement of crp could be affected by medical therapy (statin therapy or aspirin) or non - cardiac disease and therefore not reflecting patients prior inflammatory state. additionally, a snapshot of inflammatory activity at the time of blood collection (crp levels) may not represent the overall lifelong inflammatory processes. crp levels are not associated with any specific type of atherosclerotic plaque (calcified, mixed and noncalcified plaque) in patients without history of coronary artery disease. we were unable to identify a relationship between crp levels and coronary atherosclerosis, which could be due to the underestimation of noncalcified plaque size and volume by cta. further development in cta technology might help in identifying atherosclerosis better and more study in this area is required. | background : contrast - enhanced computed tomography angiography (cta) of the coronaries allows identification of plaques. limited data exists on the relationship between c - reactive protein (crp) and the plaque type or plaque burden detected by cta.aims:we studied relationship between crp and coronary atherosclerosis.materials and methods:92 patients without history of coronary disease underwent coronary cta for chest pain. coronary arteries were evaluated with each detected plaque labeled as calcified, noncalcified or mixed. logarithmic transformation was done on crp values for statistical analysis.results:1380 coronary segments were evaluated. the average age was 57 years (se 1.0) and basal metabolic index (bmi) 28.9 kg / m2 (se 0.5). median crp level was 2.75 mg / l (range 0.17 - 16.98). no association was found between crp quartiles and plaque type. in stepwise multivariate analysis, only diabetes was associated with noncalcified plaque (p < 0.001). when calcified and mixed plaques were added to the model, age (p < 0.001), diabetes (p < 0.02), and statin use (p < 0.05) were associated with an increased number of plaques per subject. no association was found between log - crp for any type of plaque.conclusion:there was no association between crp and plaque type by cta. lack of association is likely due to limited spatial resolution and underestimation of noncalcified plaque burden by cta. |
this disease is responsible for approximately several million deaths annually, mainly in the under developed and the developing countries. in the united states alone, as the leading cause of death, cancer accounts for more than 25% of all the deaths in human beings. it is considered as an advisory of modernization and advanced pattern of sociocultural life, dominated by the western medicine. multidisciplinary scientific investigations are making best efforts to control this disease, but, sure shot and perfect cure is yet to be brought into the scenario of world medicine. molecular genetics of cancer reveal that cell division is essential in the complex process of genesis of human cancer. cell division per second increases the risk of various kinds of cancer. cell division is necessary for conversion of dna adducts or other damages to single - strand dna to gaps or mutations. the development of a fully malignant tumor is to involve the activation or altered expression of protooncogene to oncogene and the loss or inactivation of tumor suppressor genes, the function of which is to control normal cellular activity. epidemiologic evidence indicates that increased cell division induced by exogenous or endogenous stimulation is a common denominator in the cancers. fibrosarcoma is a tumor composed of collagen fibers forming mesenchymal cells of the fibroblasts, and they arise from subcutaneous fibrous tissues. pahs are ubiquitous environmental agents commonly believed to significantly contribute to human as well as animal cancers. these chemicals are formed in the process of incomplete combustion of organic materials and are formed widely in the environment, for example, in engine exhaust, cigarette smoke, soil, water, and food. like many other carcinogens, polycyclic aromatic hydrocarbons (20-mca) are metabolized enzymically to various metabolites, of which some are reactive. in the large group of enzymes involved in carcinogenic metabolism, 20-mca has been used as an effective experimental model in the field of carcinogenesis and chemoprevention. cancer is the leading cause of mortality worldwide, and failure of conventional chemotherapy to effect major reduction in the mortality indicates that new approaches are critically needed. an extremely promising strategy for cancer prevention today is chemoprevention, which is defined as the use of synthetic or natural agents to block the development of cancer in humans. a variety of bioactive compounds and their derivatives have been shown to inhibit carcinogenesis in a number of experimental systems involving initiation, promotion, and progression. plant vegetables and herbal plants used as folk, and traditional medicines have been accepted currently as one of the main sources of cancer chemoprevention, drug discovery, and development. antitumor activities have been reported in several plant species. however till now, few research have been reported in several plant species in recognition. natural products have attracted recent attention as chemopreventive agents because of its availability and lack of toxicity and side effects. hence, this study focuses on the promising anticancer efficacy of the aqueous extract of indigofera aspalathoides on 20-mca - induced fibrosarcoma in rats. i. aspalathoides is a shrub and this plant is widely present in india and sri lanka. it is thought to be an important medicinal plant in traditional system of indian medicine. this is one of the important ingredients of the specific oil for syphilitic and other skin diseases. wister strain male albino rats, weighing 100 - 120 g, were obtained from tanuvas - lamu, madhavaram, chennai, india. the animals were fed with normal pellet diet (rat chew) and water ad libitum. the study protocol, approved by the ministry of social justice and empowerment, government of india, was followed [institutional animal ethics committee (iaec) number 07/15/02 ]. all the chemicals and reagents used were of analytical grade and were purchased from m / s sigma chemicals, usa. fresh aerial parts (leaves, stems, and seeds) of the plant of i. aspalathoides were obtained and authenticated by the chief botanist, tamil nadu aromatic and medicinal plants corporation limited (tampcol) and government siddha medical college campus, arumbakkam, chennai, india. one kilogram of the shade dried and coarsely powdered aerial parts of the plant i. aspalathoides was charged in an aspiration bottle and allowed to soak in double distilled water for 2 days at room temperature. the yield of the extract was 10% w / w of the powdered aqueous extract. the dose of the aqueous extract of i. aspalathoides was selected on the basis of acute toxicity study, and the ld50 of the extract was found to be 2500 mg / kg b.w. the plant extract administration did not produce any abnormalities, e.g. atoxic, circling, lacrimation, and labored breathing in the animals during the experimental period. the dose level selected for this study was nontoxic and safe. a cute toxicity study of aeia was done as per oecd guideline 425 using albino male rats. the animals were kept fasting for overnight providing only water, after which the extract was administered orally for one animal at the limit dose of 2500 mg kg and observed for 14 days (special attention for the first 4 h of administration followed by the next 20 h). if the animal dies, the limit test was terminated and main test was conducted. if the animal survives, four additional animals were dosed sequentially so that five animals were tested. however, if three animals died, the limit test was terminated and the main test was performed. the ld50 is greater than 2500 mg kg if three are more animals survived. if an animal unexpectedly dies during the study and there are other survivors, it is advisable to stop dosing and observing all animals to see if other animals will also die during a similar observation period. the aeia has not shown any mortality at the limit dose of 2500 mg kg b.w. fibrosarcoma was induced in wister strain of male albino rats by subcutaneous implantation of the millipore filter disc, impregnated with 5% suspension of 20-mca in paraffin oil. tumors which appeared in about 4 weeks after implantation were highly localized and were maintained by serial transplantation. the tumor was minced and suspended in normal saline. a suspension of about 1 10 cells in 0.5 ml of saline was injected, subcutaneously, into the thigh. the rats were divided into four different groups, each group consisting of six animals. group i animals were served as normal control, group ii animals were fibrosarcoma - bearing animals after the incubation period, group iii animals were fibrosarcoma - bearing animals, treated with the aqueous extract of i. aspalathoides intraperitoneally at a dose of 250 mg / kg b.w. for 30 days and group iv animals were administered with the aqueous extract of i. aspalathoides alone, at a dose of 250 mg / kg b.w. for 30 days, served as drug control animals. after the experimental period, all the rats were weighed and killed by cervical decapitation. vijayalakshmi, professor of pathology, madras medical college, chennai, india, as shown in the photographs of sections of liver and kidney histopathology. the liver and kidney tissues were excised and then homogenized in an ice - cold buffer. antioxidant enzymes such as catalase (cat) was assayed by the method of sinha, the level of superoxide dismutase (sod) was determined using the method of marklund and marklund and that of glutathione peroxidase (gpx) was estimated by the method of rotruc. in the liver and kidney tissues. the tissue protein was estimated by the method of lowery. using bovine serum albumin as standard. one - way analysis of variance (anova), using spss 7.5 student version, was used for statistical significance between the groups. wister strain male albino rats, weighing 100 - 120 g, were obtained from tanuvas - lamu, madhavaram, chennai, india. the animals were fed with normal pellet diet (rat chew) and water ad libitum. the study protocol, approved by the ministry of social justice and empowerment, government of india, was followed [institutional animal ethics committee (iaec) number 07/15/02 ]. all the chemicals and reagents used were of analytical grade and were purchased from m / s sigma chemicals, usa. fresh aerial parts (leaves, stems, and seeds) of the plant of i. aspalathoides were obtained and authenticated by the chief botanist, tamil nadu aromatic and medicinal plants corporation limited (tampcol) and government siddha medical college campus, arumbakkam, chennai, india. one kilogram of the shade dried and coarsely powdered aerial parts of the plant i. aspalathoides was charged in an aspiration bottle and allowed to soak in double distilled water for 2 days at room temperature. the yield of the extract was 10% w / w of the powdered aqueous extract. the dose of the aqueous extract of i. aspalathoides was selected on the basis of acute toxicity study, and the ld50 of the extract was found to be 2500 mg / kg b.w. the plant extract administration did not produce any abnormalities, e.g. atoxic, circling, lacrimation, and labored breathing in the animals during the experimental period. the dose level selected for this study was nontoxic and safe. a cute toxicity study of aeia was done as per oecd guideline 425 using albino male rats. the animals were kept fasting for overnight providing only water, after which the extract was administered orally for one animal at the limit dose of 2500 mg kg and observed for 14 days (special attention for the first 4 h of administration followed by the next 20 h). if the animal dies, the limit test was terminated and main test was conducted. if the animal survives, four additional animals were dosed sequentially so that five animals were tested. however, if three animals died, the limit test was terminated and the main test was performed. the ld50 is greater than 2500 mg kg if three are more animals survived. if an animal unexpectedly dies during the study and there are other survivors, it is advisable to stop dosing and observing all animals to see if other animals will also die during a similar observation period. the aeia has not shown any mortality at the limit dose of 2500 mg kg b.w. fibrosarcoma was induced in wister strain of male albino rats by subcutaneous implantation of the millipore filter disc, impregnated with 5% suspension of 20-mca in paraffin oil. tumors which appeared in about 4 weeks after implantation were highly localized and were maintained by serial transplantation. the tumor was minced and suspended in normal saline. a suspension of about 1 10 cells in 0.5 ml of saline was injected, subcutaneously, into the thigh. the rats were divided into four different groups, each group consisting of six animals. group i animals were served as normal control, group ii animals were fibrosarcoma - bearing animals after the incubation period, group iii animals were fibrosarcoma - bearing animals, treated with the aqueous extract of i. aspalathoides intraperitoneally at a dose of 250 mg / kg b.w. for 30 days and group iv animals were administered with the aqueous extract of i. aspalathoides alone, at a dose of 250 mg / kg b.w. for 30 days, served as drug control animals. after the experimental period, all the rats were weighed and killed by cervical decapitation. vijayalakshmi, professor of pathology, madras medical college, chennai, india, as shown in the photographs of sections of liver and kidney histopathology. the liver and kidney tissues were excised and then homogenized in an ice - cold buffer. antioxidant enzymes such as catalase (cat) was assayed by the method of sinha, the level of superoxide dismutase (sod) was determined using the method of marklund and marklund and that of glutathione peroxidase (gpx) was estimated by the method of rotruc. in the liver and kidney tissues. the tissue protein was estimated by the method of lowery. using bovine serum albumin as standard. one - way analysis of variance (anova), using spss 7.5 student version, was used for statistical significance between the groups. in the recent times, focus on plant research has increased all over the world and a large body of evidence has gathered to show the increased potential of medicinal plants used in various traditional systems. the following results are ample proof from in one such study that we have conducted. figure 1 tables 1 and 2 show the activities of antioxidant enzymes, e.g. cat, gpx and sod in the serum, liver and kidney, respectively, of control and experimental animals. in fibrosarcoma - induced (group ii) animals, the activity of antioxidant enzymes was decreased significantly (p < 0.001), when compared to normal control (group i) animals. the antioxidant enzyme activities were reverted to normalcy in fibrosarcoma - bearing, drug - treated group iii animals when compared to group ii animals. no significant changes were observed in (group iv) rats, when compared to the normal control (group i) animals. the letter a represents group ii, iii and iv compared with group i ; b represents group iii compared with group ii. values are mean sd ; n = 6. p < 0.001, # p < 0.01, < 0.05 ; ns, not significant the activities of antioxidant enzymes in liver of control and experimental animals the activities of antioxidant enzymes in kidney of control and experimental animals enzymatic antioxidants provide a major intracellular antioxidant protection by removing the superoxide radicals and h2o2. superoxide radicals may be reduced by the enzyme sod to form h2o2 cat converts h2o2 into neutral products o2 and h2o gpx catalyses the destruction of h2o2 and other lipid hydrogen peroxides by using glutathione as an electron donor. cytoprotective enzymes, which are located within both hydrophilic and hydrophobic compartments of the antioxidant in intra- and extracellular fluids, are involved in the scavenging of free radicals. elevation in mda production, in neoplastic conditions, may in part be attributed to the effective inhibition of free - radical scavenging enzymes. decreased activity of nadph - dependent glutathione reductase for the conversion of gssg - gsh can be ascertained by the decreased level of gsh. under conditions of oxidative stress, the nadp / nadph ratio will switch in favor of nadp, indicating decreased glucose-6-phosphate dehydrogenase activity. sod is widely distributed in cells with high oxidative metabolism and has been proposed to protect such cells against the deleterious effects of superoxide anions. gpx is considered to be the most important h2 o2 -removing enzyme in mammalian cells and is more important than cat in removing h2o2. the activity of gpx is dependent on the availability of gsh, which in turn, is maintained by the de novo synthesis. decreased level of gsh can be ascribed to depress the activity of nadph - dependent gr, which is required for the conversion of gssh to gsh. therefore, a decrease in nadp production is due to glucose-6-phosphate dehydrogenase inhibition and a decrease in the gsh level may be responsible for the impaired functioning of gpx in neoplastic tissues. decreased gpx activity was also observed in red blood cells of untreated patients with malignant lymphoma. our findings agree well with this and the activity of gpx in the liver was significantly decreased in fibrosarcoma - bearing animals. the levels of antioxidant enzymes, e.g. cat, sod and gpx, were corrected to near normalcy in fibrosarcoma - bearing animals by treating with aqueous extract of i. aspalathoides. antioxidants have also been advocated to impart anticancer activities by several other mechanisms, e.g., trapping the ultimate carcinogen, blocking the metabolic activation of carcinogen, modulating xenobiotic metabolizing enzymes, scavenging of free radicals, inhibiting generation of free radicals, inhibiting promotion stage of carcinogens by inhibiting cell proliferation through blocking of the lipoxygenase / cycloxygenase pathway or by lowering ornithine decarboxylase activity and by decreasing the bioavailability of ultimate carcinogen. treatment with i. aspalathoides showed protective action against reactive oxygen species (ros), induced by malignant tumor, possibly through its ability as an antioxidant in quenching the superoxide anions or free radicals. previous studies conducted showed that the extract has antitumor activity, but has no subacute toxicity. the preliminary phytochemical studies have shown the presence of alkaloids and flavanoids in the aqueous extract of i. aspalathoides. moreover, flavanoids have a chemopreventive role in cancer, through the induction of enzymes affecting carcinogen metabolism and inhibit various activities of tumor promoters, which are involved in the process of carcinogenesis. chemopreventive effect of the aqueous extract of i. aspalathoides may be due to the presence of these compounds. our results clearly indicate a significant chemotherapeutic effect of the aqueous extract of i. aspalathoides. further studies to characterize the active principles and to elucidate the mechanism of action of the aqueous extract of i. aspalathoides are in progress. the present observations suggested that the aqueous extract of i. aspalathoides treatment enhanced the recovery from 20-mca - induced fibrosarcoma due to its antioxidants and antineoplastic properties. dr. sivagnanam selva kumar, education ph.d.,(2000 - 2005) molecular biology- pharmacology & environmental toxicology university of madras, chennai. molecular biology, (1997 - 1999) department of biochemistry and molecular biology university of madras, chennai. experience employed as a lecturer in bio - technology in bharath college of science & management, thanjavur since 2005 - 2006. presently employed with bharath university, selaiyur, chennai as lecturer in the department of bio - technology. (july 2006 to till date) award / scholarship disabled person with higher achievement national level professional scholarship (2002 - 2003). national center for promotion and employment for disabled people (ncpedp) new delhi. | background : the anticancer and antioxidant effects of the aqueous extract of indigofera aspalathoides on 20-methylcholanthrene (20-mca) induced fibrosarcoma were investigated in male albino rats.materials and methods : the rats were divided into four different groups, each group consisting of six animals. group i animals were served as normal control, group ii animals were fibrosarcoma - bearing animals after the incubation period, group iii animals were fibrosarcoma - bearing animals, treated with aqueous extract of i. aspalathoides intraperitoneally at a dose of 250 mg / kg b.w. for 30 days and group iv animals were administered with the aqueous extract of i. aspalathoides alone, at a dose of 250 mg / kg b.w. for 30 days, served as drug control animals. after the experimental period, all the rats were weighed and killed by cervical decapitation. the serum was separated from the blood for analysis. the weights of the liver and the kidneys were noted. the fibrosarcoma was proved by pathological examinations. the liver and kidney tissues were excised and then homogenized in an ice - cold buffer. these tissues were used for biochemical analysis.results:the activities of antioxidant enzymes, e.g. catalase (cat), glutathione peroxidase (gpx) and superoxide dismutase (sod), in blood serum, liver, and kidney of control and experimental animals, respectively, have been reported.conclusion : the present observations suggested that the aqueous extract of i. aspalathoides treatment enhanced the recovery from 20-mca - induced fibrosarcoma due to its antioxidants and antineoplastic properties. |
the central nervous system (cns) has long been regarded as an immune privileged organ, entirely separated from the peripheral immune system. however, this concept has been fundamentally revised in recent years, as more evidence about the existence and the function of the innate immune defence of the brain has become known. microglia play an outstanding role in this context as these cells constitute the first line of defence against noxious agents in the brain. it is believed that their function is to constantly scan the surrounding microenvironment in order to detect possible changes in the extracellular homeostasis of the brain that might be harmful to neurones. upon activation, microglia proliferate migrate to the site of the lesion and undergo a drastic change in morphology, obtaining phagocytic abilities and releasing proinflammatory cytokines. the main purpose of this process is to remove cellular debris and finally to restore homeostasis in the extracellular microenvironment of the brain, thus protecting neuronal tissue from collateral damage. over the last decades, increasing evidence has suggested that neuroinflammation represents a crucial part in the pathogenesis of ad as well as in other neurodegenerative diseases. it has been shown that activated microglia can be found in ad brains, surrounding extracellular deposits of -amyloid, maintaining an inflammatory milieu by secreting pro - inflammatory cytokines [4, 5 ]. it has been hypothesized that this chronic inflammatory state contributes decisively to the progression of the disease, thus suggesting that activated microglia not only exert neuroprotective effects, but might also be detrimental for the survival of neuronal tissue. it is still unknown why and when, in the course of ad, microglia switch from being beneficial to becoming neurotoxic, but age - related disturbance of the physiological function and regulation of microglia (immunosenescence) has been suggested to play an important role in the ad pathogenesis. another question that remains to be answered is whether microglial activation occurs as a consequence of extracellular -amyloid deposition in ad, or if it serves as a triggering factor for -amyloid deposition in the initial stages of the disease. in animal models however, the presence of activated microglia has been observed even before the onset of -amyloid deposition. biochemical markers of microglial activation that allow monitoring of the inflammatory state of the cns, might be useful for the comprehension of the double - edged characteristics of microglia in ad. furthermore, by investigating the relation between biomarker levels and disease progression, they could contribute to the understanding of underlying pathogenic mechanisms. in addition, comparing biochemical microglial markers with neuroimaging markers will help visualize the distribution of activated microglia throughout the brain. taking a long view, these biomarkers could also be used to monitor therapy in studies of drugs that target microglial activation. cerebrospinal fluid (csf) is in direct contact with the brain parenchyma and pathological processes in the cns often lead to altered csf levels of specific analytes, which is the basis for using csf biomarkers in research and clinical neurology. during the last two decades, it has become clear that several core neuropathological hallmarks of ad may be monitored in csf, with low a42 levels secondary to amyloid pathology, and high tau and phospho - tau levels, secondary to axonal degeneration and tangle pathology, respectively. a number of biochemical markers of microglial activation have been described and investigated, not only in ad, but also in other diseases which involve neuroinflammation and/or activation of peripheral cells belonging to the macrophage lineage. chitotriosidase is an enzyme that exerts chitinolytic activity without having any known physiological function in humans, as inherited enzyme deficiency remains asymptomatic. it appears as a product of activated mononuclear cells and functions as a marker for lipid - laden macrophages in peripheral blood, which can be used for diagnosing and therapeutic monitoring of lysosomal storage disorders such as gaucher 's disease. chitotriosidase activity in the csf of ad patients is significantly higher than in cognitively healthy controls, which strengthens the hypothesis that disease - related microglia markers may be monitored in ad. however, csf chitotriosidase activity appears to be unsuitable as a diagnostic tool on its own, due to large overlap between patients and controls. ccl18, also known as parc (pulmonary activation - regulated chemokine), is a macrophage - derived chemokine that mainly attracts t - cells and, precisely as chitotriosidase, shows considerably elevated levels in blood from patients with gaucher 's disease, hence serving as a suitable surrogate marker for lipid - laden macrophages in lysosomal storage disorders. the presence of ccl18 in the csf was demonstrated in patients suffering from infectious meningitis. furthermore, the expression of ccl18 in the cns has been elucidated in relation to traumatic brain injury and cerebral tumours as well as to myelin - laden macrophages in and around demyelinating lesions in multiple sclerosis, suggesting an anti - inflammatory nature. in the previously mentioned study, ykl-40 is a member of the same protein family as chitotriosidase (family 18 glycosyl hydrolases) and is highly similar in structure to chitotriosidase, but lacks chitinolytic activity as a result of a critical amino acid substitution. its biological function is widely unknown, but a role in inflammation and tissue remodelling has been suggested. it is released by activated macrophages and elevated concentrations have been measured in the csf of ad patients. however, the difference in ykl-40 between patients and controls in the study cited above was relatively small, with a large overlap between groups, and an independent smaller study could not reproduce the group difference, suggesting that alterations of csf ykl-40 in ad are too small for this biomarker to be of diagnostic usability. however, more studies are needed to determine the ultimate value of ykl-40 as a biomarker for ad. ccl2, also known as mcp-1 (monocyte chemoattractant protein 1), is a chemokine, measurable in csf and represents a microglial secretion factor that appears to play an important role in macrophage migration. elevated levels of ccl2 in the csf of ad patients have been described [21, 22 ], but a recent study failed to reproduce this. cd14 is a surface protein, mainly expressed by macrophages and acts as a cofactor for toll - like receptors (tlrs), which are essential for the recognition of pathogens by the innate immune system of the brain. in ad, it has been shown that microglial tlrs and cd14 are involved in the inflammatory reaction surrounding -amyloid deposits. in animal models, the deletion of cd14 resulted in a change of the inflammatory response, decreasing the number of activated microglia and the amount of -amyloid plaques. one study examined cell adhesion molecules in purified monocytes from the peripheral blood of patients with ad and cognitively normal controls and found decreased ratios of monocytic icam-3/cd14 and p - selectin / cd14 in ad. these results suggest that the expression of monocytic cell adhesion molecules is decreased in ad. in fact, elevated levels of a soluble form of cd14 were recently seen in csf from ad and parkinson 's disease (pd) patients compared with healthy controls. the lack of longitudinal data in these studies prevents from drawing any conclusion on whether upregulation of cd14 is beneficial or detrimental in the disease process. neopterin is a degradation product deriving from the purine nucleotide guanosine triphosphate (gtp). it is secreted by macrophages upon activation and may stimulate the production of reactive oxygen species (ros) [28, 29 ]. it can be utilized as an indicator for immune system activation, showing elevated levels in several infectious diseases, autoimmune disorders, and malignant tumours as well as following allograft rejection. neopterin has even been measured in the csf of ad patients, however without significant differences compared to controls. in vivo visualization of microglial activation has become possible with the development and introduction of molecular imaging ligands (tracers) for use with positron emission tomography (pet) or single - photon emission tomography (spect). most so far available imaging ligands make use of their high affinity to the peripheral benzodiazepine binding site (pbbs / pbr), also called translocator protein (tspo), a receptor located in the outer membrane of mitochondria. its upregulation within the cns has been shown to reflect neuroinflammatory processes, mainly due to the activation of microglia [32, 33 ]. the most extensively employed pet imaging ligand to study microglial activation in various brain diseases both in humans and transgenic animal models is the c - labeled isoquinoline (r)-pk11195 (1-[2-chlorophenyl]-n - methyl - n-[1-methyl- propyl]-3-isoquinoline carboxamide) (pk11195), a specific ligand for the pbbs. an early pk11195 pet study that did not show any difference between ad patients and a group of controls suffered from several methodological issues. subsequent pet studies used the aforementioned more active r - enantiomer of pk11195 and applied different and more advanced quantification approaches to enhance tracer evaluation [35, 36 ]. one pk11195 pet study found increased binding levels in the entorhinal, temporoparietal, and cingulate cortex in a group of ad patients and one subject with mild cognitive impairment (mci) as compared to normal individuals. several studies have combined pk11195 pet imaging with pet examinations using the fibrillar amyloid imaging ligand c - pittsburgh compound b (pib) and dementia assessments to explore the relationship of microglial activation with underlying pathology in ad and mci. one of these studies showed increased pk11195 binding in ad patients in comparison with normal controls in parietotemporal regions and a negative correlation with pib retention levels in the posterior cingulate, a region that also showed lowest glucose metabolism as measured by f - fdg pet. another study found increased pk11195 binding in frontal, temporal, parietal, occipital, and cingulate cortices and a twofold elevated pib retention in the same cortical areas of ad subjects when compared to healthy controls. a study in 14 mci patients showed that half of them had increased cortical pib retention while five had increased pk11195 levels, and no regional correlation between the tracers was found. no difference in pk11195 binding between mild and moderate ad patients, mci patients and control subjects and no regional correlation with pib retention were found once another study claiming that microglial activation might be associated with later stages of ad alone or that pk11195 might be too insensitive to detect microglial activation at the examined disease stages. this is in disagreement with a study showing increases in microglial activation even during healthy aging. even if pk11195 is still considered the gold standard, the results of pet studies in ad and mci have been rather discordant, especially in earlier disease stages. new tracers such as n-(2,5 dimethoxybenzyl)-n-(4-fluoro-2-phenoxyphenyl) acetamide (daa1106) have higher binding affinity to pbbs and binding characteristics superior to pk11195. one study has so far been conducted in ad showing significantly higher binding in prefrontal, temporal, parietal, occipital, and cingulate cortices, as well as in striatum and cerebellum of ad patients compared with controls. another pbbs ligand, c - vinpocetine, has been suggested as potential marker for microgliosis. no difference between ad patients and age - matched control subjects was observed, however, disease and age - specific changes could successfully be displayed. as microglia play a crucial role in the inflammatory response in ad brains, the question arises whether measuring microglial activity in the csf or brain of ad patients might be useful in clinical routine. in order to serve as a diagnostic tool in ad investigations, these putative microglial biomarkers must be capable of distinguishing between ad patients and healthy individuals as well as from patients suffering from other types of dementia. however, current research suggests that microglial activation markers generally fail to provide high enough diagnostic accuracy to be clinically useful as diagnostic tools on their own. for comparison, the established ad csf biomarker triad (a42, total - tau and phospho - tau) has very high diagnostic accuracy when evaluated in well - controlled settings, both in cross - sectional studies and in longitudinal studies of early stage patients. thus, at present, microglial markers are unlikely to add diagnostic performance to the available ad investigation toolbox, although it can not be excluded that they might be more useful at certain well - defined disease stages. nonetheless, biomarkers of microglial activation may give clues on underlying pathogenic mechanisms in ad directly in vivo in human patients, particularly concerning the ambivalence between neuroprotection and neurotoxicity following microglial activation. in addition, as microglial activation may affect the progression rate in ad, biomarkers could be useful for monitoring of the course of the disease early on. future efforts investigating microglial activation markers may focus on longitudinal studies trying to elucidate whether high levels of microglial activation are beneficial or detrimental in relation to disease progression. another possible aspect is to ascertain the relation between microglial biomarkers and neuroimaging markers which allow visualizing microglia in the living brain. as microglia could become a target for possible future therapies in ad, microglial activation markers may even serve as a measuring tool for evaluating and monitoring the efficiency of these therapeutic interventions. microglial markers may also be useful to identify subgroups of patients with pronounced alteration of microglial activation, which might be most likely to respond to microglia targeting treatment. | intensive research over the last decades has provided increasing evidence for neuroinflammation as an integral part in the pathogenesis of neurodegenerative diseases such as alzheimer 's disease (ad). inflammatory responses in the central nervous system (cns) are initiated by activated microglia, representing the first line of the innate immune defence of the brain. therefore, biochemical markers of microglial activation may help us understand the underlying mechanisms of neuroinflammation in ad as well as the double - sided qualities of microglia, namely, neuroprotection and neurotoxicity. in this paper we summarize candidate biomarkers of microglial activation in ad along with a survey of recent neuroimaging techniques. |
the medical literature has demonstrated that the patient - physician relationship represents primarily the interpersonal association of two parties bound by the nature of medical care. this bond, built on mutual cooperation, loyalty, and responsibility, is likely to influence the patient 's use of health services and predict different health outcomes [19 ]. patient attachment to a family physician is often understood as the relational dimension of the concept of continuity of care [10, 11 ]. it relies on a relationship developed through provision of therapeutic care and consecutive episodes of care taking place within the entire health system [6, 7, 12 ]. it is also rooted in a formal or informal contract between patients and their physicians and implies a sustained partnership and strong interpersonal relationship. thus, patient attachment to a family physician represents a main conceptual framework to analyze and interpret data on health services utilization. identification of the patient 's type of attachment to a family physician is of great interest for health population research initiatives, when used either as an explanatory or a confounding factor. the patient - physician relationship can be framed from the physician or the patient perspective. while physicians can be surveyed to ask whether patients they have seen are their patients or not, the patient 's perspective is usually assessed by health population surveys through self - reported questions such as do you have a family physician ? or who is your family physician ? though they sound simple, these questions are designed to measure attachment to a family physician, a term that does not necessarily mean the same thing to all patients. ideally the concept of family doctor refers to having a regular physician who provides primary care services while also following up and coordinating care for a patient [1416 ], but a family doctor can also simply be, for many patients, the general practitioner they see most often. in addition, the patient - physician link may vary in intensity ranging from patient 's enrolment with a physician to occasional visits for acute problems that may occur once a distinction which can not be made with the question do you have a family doctor ? besides, this question rarely determines if the identified physician is a general practitioner or a specialist. in administrative data, attachment to a family physician is often approximated by the usual provider of care (upc) index, as the physician to whom a patient makes the majority of his or her visits has a greater probability to be this person 's family physician. attachment to a family physician can also be determined in administrative data by the enrolment of patients when available. a number of papers have looked at the identification of doctors ' practice populations using administrative data to evaluate physicians ' performance with their patients and to support provider - based analyses [1827 ]. in the algorithm they used to identify patient attachment to a family doctor, atlas. included enrolment, physician type of practice (solo or collaborative), patient age, months since last visit to a physician, and distance between the patient 's residence and the practice site. used the criteria primary care visits to the same physician and cost of care (type of visits, referrals to specialists, laboratory tests, and imaging services) to assign patients to physicians. to assign regular providers of care to patients in administrative data, shah. found that an algorithm using the largest number of visits to a family physician had a good concordance with patients ' identification of their regular family physician in survey data. however, to our knowledge, no algorithm has been developed to describe more precisely patient type of attachment to a family physician in administrative data. the objective of this study is to establish, through a step - by - step algorithm based on administrative data, the attachment between patients and family physicians, as a proxy for the answers to the question do you have a family physician ? or who is your family physician ? the aim of our project is to propose a framework regarding types of patient - family physician relationship, rather than identifying with certainty the patients ' family physician. to characterize types of patient - physician relationship, we focused on three primary care dimensions, for which information was available in our administrative databases : patient enrolment, complete medical examinations, and concentration of visits to one physician. this process oriented framework represents a first step in the development of a patient - level variable on attachment to a family physician that could be used in our analyses of health services utilization based on administrative data. this study is a secondary analysis of a major project undertaken by the population health and health services research team at montreal 's public health department to develop indicators based on health services utilization so as to monitor the impact of quebec 's primary care reforms on the users ' health [28, 29 ]. in quebec, access to physicians is an open process through which patients can seek consultations with any family physician. patient enrolment with a family physician associated with financial incentives was implemented to increase continuity of care and accessibility, as part of a reorganization renewal transformation of quebec primary care medical services initiated in 2003. from the patient 's perspective, being formally enrolled represents a reciprocal commitment, whereby the general practitioner becomes the patient 's regular provider of care (except in case of an emergency) and the patient accepts this exclusive link with a physician. for this reason, we used the explicit nature of patient enrolment to confirm whether or not a patient had a family physician. in quebec, a relatively large number of patients, most of them presenting minor health conditions, are not enrolled with a regular physician. to include these patients in our definition of attachment to a family physician, we considered a complete annual medical examination (cme) claimed by a physician as an essential piece of information to assert an existing level of patient attachment. in most cases, the cme is carried out, usually on an annual basis, by the family physician the patient considers being the regular care provider. physician 's field experience suggests that provision of two cmes to a patient in two consecutive years by the same physician is a strong indication that this physician is the patient 's family physician. even a single cme in a two - year period was judged relevant to determine a certain level of patient attachment. for patients who are not enrolled and who have not had a complete cme in the past two years, we looked at usual provider of care to identify the general practitioner likely to play the role of the patient 's family physician. concentration of visits to the same doctor over time is often used as a proxy for relational continuity measured with data from administrative databases on service utilization. prolonged or repeated contact with the same health care provider is presumed to result in stronger relationship, more effective use and sharing of information, and more consistent care management. although concentration of visits does not guarantee patient attachment to the physician seen most often, it probably indicates a certain level of patient - physician attachment. however, such an attachment may be weaker than one linked to enrolment or to having had one or more complete medical examinations. in quebec, medical services provided by family physicians are covered by the provincial health insurance plan (rgie de l'assurance maladie du qubec or ramq). study data came from a 10-year database (physician fee - for - service database and patients enrolment registries), requested from the ramq to monitor the impact of quebec 's primary care reforms on users ' health [28, 29 ]. a two - year data period was used for the construction of our algorithm. due to the gradual implementation of patient enrolment since 2003, we used the physician fee - for - service database and patients enrolment registries for the most recent two - year data period at our disposal (financial years 2008 - 2009 and 2009 - 2010). the population under study (n = 1,248,249) comprised all patients aged 20 years and over, residents of montreal, and active users of the health system, that is, patients with at least one ambulatory or hospitalization record within the two years of the study, excluding patients in long - term care facilities or deceased. our study population represents 83.1% of the residents of montreal aged 20 years and over. the variables used to construct the algorithm were enrolment, complete medical examination, and upc score. the primary care reform initiated in 2003 that included the creation of new organizational models, the family medicine groups (fmgs), aimed to improve accessibility and continuity related to a wide range of primary care, specialists, and social services [31, 32 ]. a typical fmg consists of 6 to 10 family physicians working with nurses to provide services for 8,000 to 15,000 registered patients. fmgs contract with the health ministry and agree to increase service provision (e.g., extended opening hours and 24/7 phone access) in exchange for complementary public funding for computerization and additional staff such as nurse. family physicians working in fmgs can enroll their patients, regardless of their specific medical conditions. the reform has also included the possibility, for physicians in primary health care (phc) clinics (fmgs, group or solo practices, community health centres, and family medicine teaching units), to enroll patients as vulnerable if they present specific conditions (see appendix a for the list of eligible conditions) in order to provide them with more continuous and accessible healthcare services. fmg / vulnerable patient enrolment in ambulatory settings is formalized through a document signed by both the physician and the patient and entered into ramq patients enrolment registries, whether or not the physician is paid on a fee - for - service or a time basis (sessional fees for clinical activities). the registries contain, for each patient on an annual basis, information regarding the dates at which enrolment begins and ends. in order to identify a sustained link between patients and family physicians, enrolment for at least 18 months in the two - year period of the study was used as criterion for identification of attachment. for the identification of complete medical examination and the calculation of upc score, visits to family physicians in phc clinics were identified through the ramq physician fee - for - service database since the vast majority of quebec family physicians in phc clinics are fee - for - service paid. in contrast, physicians working in community health centres or family medicine teaching units are mostly paid on a time basis ; consequently, they were excluded from the calculation of the upc score or the identification of cmes in the database. however, since enrolment of patients in those settings is usually the rule and could be identified in the ramq patients enrolment registries even if the physician is paid on a time basis, those physicians were included in the identification of patient - physician relationship through enrolment. no further exclusions were applied. regarding cme, a quebec physician can not bill for this examination more than once a year for a patient in a phc clinic (see appendix b). the upc score was calculated, for patients with two or more visits in a phc clinic in the two - year study period, as the number of patient visits (excluding visits to emergency rooms or during hospitalization) to the most frequently seen family physician in a phc clinic over the total number of patient visits to all family physicians in phc clinics during the period. as we assumed that repeated contacts with a family physician indicate a sustained patient - physician relationship, we interpreted conservative upc scores of 75% or higher as a significant aspect of patient attachment. the algorithm applied a hierarchical order of phc dimensions (enrolment, cme, and concentration of visits) that are likely to bind physicians and their patients from seemingly strong (enrolment) to weak (a single patient visit in a phc clinic without enrolment) levels of attachment. during the classification process, we assigned only one attachment type to each patient and concurrently identified the associated physician. enrolment, the algorithm first dimension, is defined in steps 1 and 2 of figure 1 : first by fmg enrolment for at least 18 months in the two - year study period and then, for the patients not enrolled in an fmg, by enrolment as vulnerable patient for at least 18 months. if a patient was identified as having both enrolments, fmg enrolment was prioritized. in this manner, the second dimension is the presence of a complete annual medical examination (cme) performed by a family physician in a phc clinic. for patients without any type of enrolment, in step 3 (figure 1), we looked for two cmes claimed by the same family physician in the two - year study period. therefore, patients who met this criterion were assigned to type 3 of attachment. in steps 4 and 4a among these patients, we distinguished those (type 4) with a concentration of visits (upc score of 75% or higher) to the physician having performed the cme from those (type 5) without such a concentration of visits to the physician having performed the cme. patients with more than one cme performed by different physicians did not meet the criteria for either of types 3 to 5. the third dimension of our algorithm is upc score calculated for each patient over a two - year period. at step 5 (figure 1), among patients not enrolled and who did not have a cme in the two - year study period, we classified patients with a upc score 75% or higher as type 6. at step 6, type 7 designated nonenrolled patients with a single visit (not a cme) to a family physician in a phc clinic in the two - year period. finally, type 8 included all patients without a designated attachment type. in summary, our 8-type measure of patient attachment to a family physician over a two - year period reads as follows : attachment defined by fmg enrolment;attachment defined by enrolment as vulnerable patient, without fmg enrolment;attachment defined by two cmes in a phc clinic by the same physician, without enrolment;attachment defined by one cme in a phc clinic with a upc score of 75% or higher to the physician who performed the cme, without enrolment;attachment defined by one cme, without enrolment or upc score of 75% or higher to the physician who performed the cme;attachment defined by a upc score of 75% or higher in a phc clinic, without enrolment or cme;attachment defined by a single patient visit (not for cme) to a family physician in a phc clinic, without enrolment;patient not attached to a family physician. attachment defined by fmg enrolment ; attachment defined by enrolment as vulnerable patient, without fmg enrolment ; attachment defined by two cmes in a phc clinic by the same physician, without enrolment ; attachment defined by one cme in a phc clinic with a upc score of 75% or higher to the physician who performed the cme, without enrolment ; attachment defined by one cme, without enrolment or upc score of 75% or higher to the physician who performed the cme ; attachment defined by a upc score of 75% or higher in a phc clinic, without enrolment or cme ; attachment defined by a single patient visit (not for cme) to a family physician in a phc clinic, without enrolment ; patient not attached to a family physician. in all, 68.1% of users were attached to a family physician (types 17) in a two - year period (2008 - 2009 and 2009 - 2010). figure 2 presents the study population distribution (n = 1,248,249) for each type of patient attachment. results suggest that type 8 patients could also be described as inconsistently attached to a particular family physician. more specifically, 20.4% of all users of health services had more than one visit to a family physician over the two - year period but were classified as nonattached, given that no formal type of enrolment or complete medical examination was found, and no upc scores of 75% or over were detected (table 1). although medical care was indeed provided to these patients through multiple encounters with different family physicians, we were unable to determine patient attachment to a family physician under such circumstances. by adding the five categories of unattached patients listed in table 1, we can extend our measure of attachment to a 12-type measure to support detailed analyses of patient attachment. as a result of evaluating eligibility to attachment types, we completed our descriptive portrait by calculating the prevalence of the three main dimensions of our algorithm (enrolment, cme, and concentration of visits) for each type of patient attachment (table 2). for example, by the time patients enrolled in an fmg formed type 1, 34.8% of them were also enrolled as vulnerable patients, 14.9% had two cme, and 39.4% had a minimum upc score of 75%. prevalence of each dimension of attachment in health services users is presented in table 3. it shows the percentage of users who would have been identified as attached to a family physician, if each dimension of attachment was considered independently of others. for example, for the two - year study period, looking at enrolment as vulnerable patients alone would have allowed us to identify attachment for 18.7% of users. table 4 compares some sociodemographic and health data in the 8 groups of patients identified by the algorithm. the proportion of unattached patients and of patients for whom the attachment was defined only by a single visit (not for cme) to a family physician in a phc clinic, without enrolment, was higher among males, younger individuals, and patients with a lower level of morbidity. the proportion of unenrolled patients for whom the attachment to a family physician was defined through the presence of two cmes by the same physician in the two - year period was higher in females than in males. our figure of 68.1% of montrealers (aged 20 years and over) attached to a family physician is comparable to those obtained through population surveys. the canadian community health survey estimated that 67.4% of montrealers (12 and over) had a family physician in 2010, while the eqes (enqute qubcoise sur l'exprience de soins) developed in 2010 - 2011 by the institut de la statistique du qubec revealed that 68.8% of montrealers (15 and over) had a family physician. moreover, another population survey conducted in 2010 to assess the evolution of primary healthcare organizations showed that 66.4% of montrealers (20 and over) reported having a family physician. appendix c presents some characteristics of patients with and without a family physician issued from that survey carried out in the same population. as shown by the results of our algorithm using administrative data, the proportion of unattached patients in the survey data was higher among males and among younger subjects. the proportion of unattached patients among diabetic patients in that survey was also quite similar to the proportion we observed in the administrative data. these comparisons suggest that identification of patients attachment to family physicians through our algorithm may be an interesting proxy, in administrative data, for the answers to the question do you have a family physician ? or who is your family physician ? however, a physician seen once over a two - year period, without enrolment or cme, may not be the physician the patient would identify as his or her family doctor. conversely, a patient could have a family physician without having seen him or her during the two - year study period. our current data did not allow us to reliably validate our identification of each patient 's family physician in administrative data. such validation would have required linking our administrative patients data to patient survey data or to physician data on identification of their patients [24, 27 ], which could not be done with our data. even if the variable we constructed did not assure us that the physician to which a patient is attached, according to our algorithm, is effectively the one considered to be the patient 's family physician, it nonetheless allowed us to characterize, in administrative data, the type of attachment of the patient to a family physician over the study period. since the aim of our project was to propose a framework for defining types of patient - family physician relationship rather than identifying with certainty the patient 's family physician, we think that our approach is valuable. moreover, creating an attachment variable that includes different categories or types of attachment enhances the precision in analysis of attachment itself, with regard to patient characteristics related to different categories of attachment as well as to the impact of different types of attachment on various outcomes. in that regard, for example, the proportion of attachment defined by the presence of two cmes by the same physician in the two - year period was higher in females, which may reflect a profile of health services utilization associated with preventive services as pap test or breast examination. our results also show that although sicker and older patients appeared to have a more important attachment to family physicians (notably through enrolment), a nonnegligible proportion of those patients were unattached to a family physician during the study period. contrary to the algorithms developed by others [1820, 23, 24 ], our objective was not to identify physicians ' practice populations, but rather to create a variable that describes each patient 's attachment to a family physician. although closely linked to the availability of administrative data, our choice of attachment dimensions to construct our algorithm aimed mostly to reflect certain aspects of the patient - family physician relationship : formal enrolment, type of examination reflecting care comprehensiveness, and concentration of visits. enrolment is quite specific : a patient can not be enrolled in an fmg or as vulnerable without having a family physician. hence, the first step of our algorithm relates to enrolment, which clearly indicates that the patient has a family physician. for patients who were not enrolled, we used information available in administrative data likely to reveal a link between them and a family physician this is why we included, for patients who were not enrolled, information on complete annual examination and concentration of visits to characterize the patient - family physician relationship. it should be noted that although the pertinence of a complete annual examination is currently reconsidered, it was still considered as a usual procedure in family practice during the study period. using these dimensions of the patient - family physician relationship allowed us to increase the sensitivity of our algorithm. for the two years considered in this study, attachment to a family physician for nearly 45% additional patients could be identified by adding to enrolment alone, concentration of visits (including patients with only one visit), and provision of at least one complete medical examination. it is interesting to note that about 40% of enrolled patients had at least one complete medical examination during the two - year study period. in addition, a majority of patients who were not enrolled in an fmg but only as vulnerable had high concentrations of visits with the enrolling physician (64.8%). similar results were observed regarding concentration of visits to the same physician for patients who had two complete medical examinations. the figure is lower for patients enrolled in fmgs (39.4%), probably due to the nature of this organizational model that fosters group practice. moreover, the higher proportion of patients who saw a family physician only once among those enrolled in fmgs compared with those enrolled as vulnerable without fmg enrolment probably reflects complementary follow - up by multidisciplinary teams in fmg (especially nurses), which is not readily detectable in administrative data. in addition to the issue of validation that has been already discussed, our study has some limits. the construction of our algorithm depends largely on the availability of relevant and accurate information in administrative data to characterize the patient - family physician relationship. complementary data, such as type of phc practice of the family physician, would have been useful but were not available. one objective of our algorithm was to create, in our database, a variable characterizing the patient - physician relationship that could eventually be used in our analyses of health services utilization covering one - year and two - year periods. since the type of patient - physician relationship may vary over time according to patient age or health status, we chose to measure this relationship over a relatively short period of time. however, we chose a period sufficiently long to capture two consecutive annual visits, concentration of visits to a physician, and significant enrolment. finally, although our algorithm depends on specific information available in administrative data in quebec, a similar approach could be used with data available in other contexts regarding similar dimensions characterizing patient - family physician relationship, namely, enrolment, certain types of exams, and concentration of visits to the same physician. we tend to see the proposed algorithm more as a conceptual framework that can be adapted to different contexts and queries than a single and unique way to characterize the link between patients and family physicians. for example, analysis of the intensity or degree of the patient attachment through additional configurations or combinations of the dimensions used in our algorithm could help identify specific elements of the patient attachment to a family physician more likely to be associated with various outcomes. it should be noted that results relating to outcomes of care are beyond the scope of the present paper. our study aimed to present an algorithm to characterize the attachment between patients and family physicians in administrative databases. compared to identification of the regular family physician that can be obtained from patients ' surveys, our 8-type measure of patient attachment generates a more refined description of the phenomena underpinning patient attachment to a family physician. this measure could be of great value for impact assessment of patient attachment on health services utilization using administrative data. by describing patients ' attachment to family physicians through different categories, our measure provides the opportunity to assess the impact of patient attachment on different outcomes and more specifically on chronic disease management and preventive services delivery in a more precise way than by just knowing whether or not the patient has a family physician. hence, our measure of attachment represents an interesting tool in order to better understand the way patients ' attachment to family physicians is associated with health services utilization. the identification of the patient 's type of attachment to a family physician could also be of great interest as a confounding factor in health services utilization research initiatives using administrative data. finally, our algorithm allows us to identify the patient 's family physician in our data. this identification enables us to pursue further data linkage and build physician / patient - based cohorts that can be followed through the continuum of care. | background. commonly self - reported questions in population health surveys, such as do you have a family physician ?, represent one of the best - known sources of information about patients ' attachment to family physicians. is it possible to find a proxy for this information in administrative data ? objective. to identify the type of patient attachment to a family physician using administrative data. methods. using physician fee - for - service database and patients enrolment registries (quebec, canada, 20082010), we developed a step - by - step algorithm including three dimensions of the physician - patient relationship : patient enrolment with a physician, complete annual medical examinations (cme), and concentration of visits to a physician. results. 68.1% of users were attached to a family physician ; for 34.4% of them, attachment was defined by enrolment with a physician, for 31.5%, by cme without enrolment, and, for 34.1%, by concentration of visits to a physician without enrolment or cme. eight types of patient attachment were described. conclusion. when compared to findings with survey data, our measure comes out as a solid conceptual framework to identify patient attachment to a family physician in administrative databases. this measure could be of great value for physician / patient - based cohort development and impact assessment of different types of patient attachment on health services utilization. |
hyperbaric oxygen (hbo) therapy is a noninvasive medical strategy in which a person breathes 100% oxygen at a pressure greater than normal. we have previously demonstrated that hbo therapy may resuscitate anesthetized rats that had a heatstroke by reducing multiple organ dysfunction or failure [24 ]. a heatstroke patient with multiple organ dysfunction although, hbo is beneficial in treating heatstroke, however, the mechanisms underlying the beneficial effects of hbo in heatstroke remain unclear. it is well - known that glutamate and lactate - to - pyruvate ratio are cellular ischemia markers, whereas glycerol is a cellular damage marker. heatstroke mice display increased production of glutamate, lactate - to - pyruvate ratio, and glycerol in hypothalamus [7, 8 ]. the thermoregulatory deficits (e.g., hypothermia occurred during room temperature exposure) that occurred after heatstroke formation in mice [710 ] may have resulted from hypothalamic ischemia and neuronal damage. because the hypothalamus regulates body temperature, it is possible that thermoregulatory deficits are induced during heatstroke. multiple organ dysfunction or failure that occurred during heatstroke may be related to alteration of hypothalamic - pituitary - adrenalaxis - mechanisms [12, 13 ]. it is not known whether the heat - induced hypothalamic dysfunction and mortality in mice can be ameliorated by hbo therapy. to deal with the question, the aim of the present study was attempted to assess the effects of hbo on the heat - induced hypothermia and lethality in unanesthetized, unrestrained mice. in addition, the temporal profiles of cellular ischemia and oxidative damage markers as well as inflammatory cytokines in the hypothalamus were assessed in heatstroke mice with or without hbo therapy. all the experiments were performed in accordance with the ethical guidelines laid down by the committee for the purpose of control and supervision of experiments on animals of chi mei medical center (tainan, taiwan). institute of cancer research (icr) inbred male mice were given food and water ad libitum and acclimatized to room temperature at 24c, relative humidity of 50 8%, and a 12-hour dark / light cycle for 1 week before starting the experiment. these icr strain mice were purchased from national taiwan university (taipei, taiwan, roc). institute of cancer research inbred male mice, aged 8 to 10 weeks and weighing 23 to 25 g, were exposed to heat stress treatment (42.4c ; relative humidity, 50%55% ; 1 hour) in an environment - controlled chamber. the time at which mice were removed from the environmental chamber was called 0 hours. the heat - stressed mice were returned to normal room temperature (24c) at the end of the heat treatment. mice that survived on day 4 of heat treatment were considered survivors, and the data were used for analysis of the results. core temperatures were measured every 5 minutes with a copper constantan thermocouple inspected into the rectum and connected to a thermometer (hr1300 ; yokogawa, tokyo, japan). similar to many sepsis studies, in this study, we used death as an end point in conscious mice. the murine model of heatstroke has been detailed previously by several investigators [710 ]. as demonstrated in our previous study [7, 8 ], all heat - stressed mice survived 4 hours after whole body heating (wbh). therefore, in the present study, physiologic parameter measurements and histologic verification were performed at 4 hours after heat treatment. three groups of animals were designated for the experiment. in the normothermic (nt) groups, their core temperatures were found to be 37.1c to 37.5c at a room temperature of 24c as well as a room oxygen content in air of 21%. the po2 of inspired oxygen (partial pressure of oxygen = 20 kpa) was calculated by multiplying 101 kpa by 21%. in the hyperbaric oxygen (hbo)-treated heatstroke group, mice were resuscitated directly after instrumentation with 100% oxygen at 253 kpa (oxygen content in hyperbaric oxygen air) for 2 hours. the chamber filled with pure oxygen (100%) was pressurized to 253 kpa at a rate of 51 kpa / min for 2 hours and was terminated at the decompression rate of 20 kpa / min. in the untreated heatstroke group, mice were exposed to normobaric air (nba) (21% ; 101 kpa). experiment 1 (effect of heat on percent survival and core temperature)a dose of nba or hbo (n = 12 for each group) was randomly administered to mice 1 hour post - wbh, and its effects on percent survival and core temperature were assessed 4 days post - wbh and 4 hours post - wbh, respectively. heatstroke mice were exposed to 42.4c for 1 hour and then allowed to recover at room temperature (24c). core temperatures were measured at 4 hours post - wbh and percent survivals were counted on 4 days post - wbh. a dose of nba or hbo (n = 12 for each group) was randomly administered to mice 1 hour post - wbh, and its effects on percent survival and core temperature were assessed 4 days post - wbh and 4 hours post - wbh, respectively. heatstroke mice were exposed to 42.4c for 1 hour and then allowed to recover at room temperature (24c). core temperatures were measured at 4 hours post - wbh and percent survivals were counted on 4 days post - wbh. experiment 2 (effect of heat on hypothalamic neuronal damage score)a dose of nba or hbo (n = 8 for each group) was randomly administered to mice 1 hour post - wbh, and its effects on neuronal damage score in the hypothalamus were assessed 4 hours post - wbh. a dose of nba or hbo (n = 8 for each group) was randomly administered to mice 1 hour post - wbh, and its effects on neuronal damage score in the hypothalamus were assessed 4 hours post - wbh. experiment 3 (effect of heat on hypothalamic levels of ischemia and neuronal damage markers)a dose of nba or hbo (n = 8 for each group) was randomly administered to mice 1 hour post - wbh, and its effects on nitric oxide (no), dihydroxybenzoic acid (dhba), and cellular ischemia (eg., glutamate and lactate - to - pyruvate ratio) and damage (eg., glycerol) markers of the hypothalamus were assessed 4 hours post - wbh. a dose of nba or hbo (n = 8 for each group) was randomly administered to mice 1 hour post - wbh, and its effects on nitric oxide (no), dihydroxybenzoic acid (dhba), and cellular ischemia (eg., glutamate and lactate - to - pyruvate ratio) and damage (eg., experiment 4 (effect of heat on hypothalamic levels of cytokines)a dose of nba or hbo was randomly administered to mice 1 hour post - wbh, and its effects on hypothalamic levels of tumor necrosis factor- (tnf-), interleukin-1 (il-1), il-10, and myeloperoxidase (mpo) were assessed 4 hours post - wbh. a dose of nba or hbo was randomly administered to mice 1 hour post - wbh, and its effects on hypothalamic levels of tumor necrosis factor- (tnf-), interleukin-1 (il-1), il-10, and myeloperoxidase (mpo) were assessed 4 hours post - wbh. experiment 5 (effect of heat on hypothalamic levels of pro - oxidant enzymes (eg, malondialdehyde, gssg) and anti - oxidant enzymes (eg, gsh, glutathione peroxidase, glutathione reductase))a dose of nba was randomly administered to mice 1 hour post - wbh, and its effects on hypothalamic levels of these pro - oxidant and anti - oxidant enzymes were assessed 4 hours post - wbh. a dose of nba was randomly administered to mice 1 hour post - wbh, and its effects on hypothalamic levels of these pro - oxidant and anti - oxidant enzymes were assessed 4 hours post - wbh. at the end of 4 hour post - wbh, animals were sacrificed and their brains were removed, fixed in 10% neutral buffered formalin, and embedded in paraffin blocks. serial (10 m) sections through the hypothalamus were stained with hematoxylin and eosin for microscopic examination. the extent of hypothalamic neuronal damage was scored on a scale of 03, modified from the grading system of pulsinelli., in which 0 is normal, 1 means that ~30% of the neurons are damage, 2 means that ~60% of the neurons are damaged, and 3 means that 100% of neurons are damaged. samples of extracellular fluids of hypothalamus were collected, immediately separated, and stored at 80c until they could be assayed. the nox concentrations in the hypothalamic dialysates were measured with the eicom eno-20 nox analysis system (eicom, kyoto, japan). in the eicom eno-20 nox analysis system, after the no2 and no3 in the sample have been separated by the column, the no2 reacts in the acidic solution with the primary aromatic amine to produce an azo compound. after this, the addition of aromatic amines to the azo compound results in a coupling that produces a diazo compound, and the absorbance rate of the red color of this compound is then measured. the dialysates were injected onto a cma600 microdialysis analyzer (carnegie medicine, stockholm, sweden) for measuring lactate, pyruvate, glycerol, and glutamate. samples of extracellular fluids of hypothalamus were collected, immediately separated, and stored at 80c until they could be assayed. we used commercially available elisa kits for the determination of levels of tnf-, il-1, or il-10, according to the manufacture 's instructions (quantikine, r&d system, mn, usa). the concentration of dhba were measured by a modified procedure based on the hydroxylation of sodium salicylate by hydroxyl radicals, leading to the production of dhba. lipid peroxidation was assessed by measuring the levels of malondialdehyde (mda) with 2-thiobarbituric acid (tba) to form a chromospheres absorbing at 532 nm. about 0.1 g of tissue was homogenized with 1.5 ml of 0.1 m phosphate buffer at ph3.5. the reaction mixture (0.2 ml of sample, 1.5 ml of 20% acetic acid, 0.2 ml of 8.1% sodium dodecyl sulfate, and 1.5 ml of aqueous solution of 0.8% tba, up to 4 ml with distilled water) was heated to 95c for 1 hour, and then 5 ml of n - butanol and pyridine (15.1 vol / vol) was added. the mixture was vortexed vigorously, centrifuged at 1500 g for 10 minutes, and the absorbance of the organic phose was measured at 532 nm. the values were expressed as nanomoles of tba - reactive substance (mda equivalent) per milligram of protein. tissues were homogenized in 5% 5-sulfosalicylic acid (1 : 10 wt / vol) at 0c, and the supernatants were used for analysis of total and oxidized glutathione. total glutathione [reduced - form glutathione (gsh) + oxidized - form glutathione (gssg) ] was analyzed according to the tietze method and gssg was determined as described by griffith. the recycling assay for total glutathione is oxidized by 5,5-dithiosis [2 acid ] (dtnb) to give gssg with stoichiometric formation of 5-thio-2-nitro - benzoic acid. gssg is reduced to gsh by the action of the highly specific glutathione reductase (gr) and nicotinamide adenine dinucleotide phosphate (reduced form ; nadph). the rate of 5-thio-2-nitro - benzoic acid formation is followed at 412 nm and is proportional to the sum of gsh and gssg present. mice were sacrificed with overdose of an anesthetic and were transcardially perfused with heparinized 0.05-m phosphate - buffered saline (pbs), followed by ice - cold 15% sucrose in pbs. coronal brain sections (5-m thick) were cut in a cryostat and were thaw - mounted on gelatin - coated slides. sections were incubated with commercially available rabbit anti - nos antiserum (1 : 50) diluted in 0.2% louis, mo)/pbs at 4c overnight then rinsed with pbs for 30 minutes and incubated in biotinylated goat anti rabbit immunoglobulin g (1 : 500) for 1 to 2 hours. myeloperoxidase (mpo) activity, an indicator of polymorphonuclear leukocyte accumulation, was determined in the hypothalamus as described previously at 4 hours after heat stress. mpo activity was defined as the quantity of enzyme degrading 1 mol of peroxide of min at 37c and was expressed in milliunits grams of wet tissue. statistical significance of survival was assessed using a x method and followed by fisher exact probability test. core temperature, levels of cytokines, nitric oxide, glutamate, glycerol, dihydroxybenzoic acid, and lactate - to - pyruvate ratio were analyzed using the kruskal - wallis h test, followed by several post hoc comparisons with dunn method. the wilcoxon 's signed rank test was used to compare the neuronal damage across two groups. the wilcoxon tests convert scores to ranks, a sum of the ranks is calculated, and critical values of the sum are provided to test the null hypothesis at a given significant level. the data were given as median, first quartile, and third quartile. as summarized in table 1, percent survival value of nba - treated heatstroke mice for 4 days post - wbh is 0% (n = 12). the core temperature value of nba - treated heatstroke mice for 4 hours post - wbh is 33.6 0.52c (n = 12 ; table 2). when compared with those of nba - treated heatstroke mice, hbo - treated heatstroke mice had higher values of both percent - survival (100%, n = 12 ; table 1) and core temperature (36.8c, n = 12 ; table 2). when the heat stress was terminated in the heatstroke group, they displayed body wet with salivary spreading and stagger. as summarized in table 3, the neuronal damage scores in the hypothalamus of nba - treated heatstroke mice were significantly higher than those of nt mice. photographs of neurodegenerative cells in the hypothalamus of nba - treated heatstroke mouse were shown in figure 1. in hbo - treated heatstroke mice, hbo therapy adopted 1-hour post - whole body heating (wbh) significantly reduced the increased neuronal damage scores in the hypothalamus obtained at 4 hours post - wbh (table 3 ; figure 1). the values of neuronal damage scores in the hypothalamus of hbo - treated normothermic (nt) mice were indistinguishable from those of nt mice that received nba (table 3). figure 2 depicts the effects of heat exposure (42.4c for 1 hour) on cellular levels of glutamate, glycerol, lactate - to - pyruvate ratio, nitrite, and dhba in the hypothalamus in nt mice that received nba, nt mice that received hbo, nba - treated heatstroke mice, and hbo - treated heatstroke mice. in nba - treated heatstroke groups, the cellular levels of glutamate, glycerol, lactate - to - pyruvate ratio, nitrite, and dhba in the hypothalamus were all significantly higher at 4 hours after the termination of heat exposure than those of nts. resuscitation with hbo 1 hour post - wbh significantly attenuated the heat - induced increased levels of glutamate, glycerol, lactate - to - pyruvate ratio, nitrite, and dhba in the hypothalamus. the basal levels of those biochemical parameters in nts treated with hbo were indistinguishable from those of nts that received hbo. as summarized in figure 3, the values of hypothalamic tnf-, il-1, and mpo activity of nba - treated heatstroke mice obtained at 4 hours post - wbh were significantly higher than those of ncs. in hbo - treated heatstroke mice, hbo therapy adopted 1-hour post - wbh significantly suppressed the increased levels of hypothalamic tnf-, il-1, and mpo activity obtained at 4 hours post - wbh. on the other hand, as compared to those of nba - treated heatstroke mice, hbo - treated heatstroke mice had higher values of il-10 in their hypothalamus obtained at 4 hours post - wbh. as summarized in figure 4, the values of pro - oxidant enzymes (eg, mda and gssg) and anti - oxidant enzymes (eg, gsh, gp, and gr) of nba - treated heatstroke mice obtained at 4 hours post - wbh were significantly higher and lower, respectively, than those of nts. in hbo - treated mice, hbo therapy adopted 1-hour post - wbh significantly reversed the increased levels of both mda and gssg and decreased levels of gsh, gp, and gr in the hypothalamus. the basal levels of these parameters in the hypothalamus of hbo - treated nt mice were indistinguishable from those of nts that received nba (figure 4). as demonstrated in table 4, the numbers of inos - positive cells in the hypothalamus of nba - treated heatstroke mice obtained at 4 hours post - wbh were higher than those of nt groups. photomicrographs of inos - positive cells in the hypothalamus of a nba - treated hs mouse were shown in figure 5. the heat - induced increased numbers of inos - positive cells were reduced significantly by hbo therapy (table 4 and figure 5). our previous and present results demonstrated that when exposed the unanesthetized, unrestrained mice to a hot environment (42.4c) for 1 hour, profound thermoregulatory deficit as well as mortality were observed. our current results further showed that the heat - induced thermoregulatory deficit (evidenced by hypothermia occurrence during room temperature exposure) and mortality could be resulted from ischemia and oxidative damage to their hypothalamus (the essential thermoregulatory center in mammalian brain) in the mouse. compared to normothermic mice, heatstroke mice had significantly higher levels of cellular ischemia (e.g., glutamate and lactate - to - pyruvate ratio) and damage (e.g., glycerol) markers in their hypothalamus [2126 ]. these heatstroke mice also displayed significantly higher hypothalamic levels of reactive nitrogen species (e.g., inos - dependent no metabolites), reactive oxygen species (e.g., dhba and superoxide anions), lipid peroxidation (e.g., mda), and enzymatic pro - oxidants (e.g., gssg / gsh), but lower hypothalamic levels of enzymatic anti - oxidant defences (e.g., activity of both gr and gpx). increased production of reactive oxygen and nitrogen species has been reported to be directly involved in oxidative damage with cellular macromolecules in ischemic brain tissues, which lead to cell death. our previous experiments have demonstrated that hbo improves survival in anesthetized rats during heatstroke by reducing multiorgan dysfunction [2, 5 ]. the present results further shows that hbo therapy effectively protects against heat - induced hypothalamic ischemia and oxidative damage, thermoregulatory dysfunction, and mortality in unanesthetized, unrestrained mice during heatstroke. the current findings are consistent with a previous study concerning with middle cerebral artery ligation - induced stroke. they also observe that the outcomes of the conventional stroke in the rats can be improved by hbo. the cardiac arrest - induced neurologic deficit could be exacerbated by hbo therapy in dogs. increased lipid peroxidation and mortality in gerbilis after global ischemia could be exacerbated by hbo therapy. in anesthetized rats, heat - induced hyperthermia, hypotension, and cerebral ischemia and damage occurred during heatstroke were associated with increased production of free radicals (specifically hydroxyl radicals and superoxide anions), higher lipid peroxidation, lower enzymatic antioxidant defenses, and higher pro - oxidants in the brain of heatstroke - effected rats. pretreatment with conventional hydroxyl radical scavengers (e.g., mannitol or -tocopherol) prevented the brain oxidative stress and increased subsequent survival time. the present results further demonstrated that in unanesthetized, unrestrained mice, hbo therapy was able to rescue mice from heat - induced unortality by reducing hypothalamic ischemia and oxidative damage. it should be mentioned that unanesthetized, unrestrained mice also displayed hyperthermia during heat stress but hypothermia 4 hours after heat stress. the heat - induced hypothermia may be due to hypothalamic dysfunction. in the rodents, environmental heat stress increased cutaneous blood flow and metabolism and progressively decreased splanchnic blood flow. it was shown that ischemia and hypoxia led to elevation of nitric oxide level in the blood stream in anesthetized [3234 ] or unanesthetized rats. heat - induced multiple organ dysfunction could be greatly reduced by inducible or neuronal nitric oxide synthase inhibitors in anesthetized rat during heatstroke [33, 36 ]. in the present study, when exposed the unanesthetized and unrestrained mice to high ambient temperature, overproduction of inos - dependent no in their hypothalamus was also noted after the onset of heatstroke, which could be ameliorated by hbo therapy. it should be stressed that, in the current experiment, we measured only the hypothalamic levels of inos - dependent nox. it is reasonable to assume that both inos - dependent and n - nos - dependent nox overproduction in different tissues following the onset of heatstroke can be ameliorated by hbo therapy. in anesthetized rats, overproduction of both tnf- and il-1 in both the peripheral blood stream and the brain was noted during heatstroke [37, 38 ]. the same phenomenon was also observed in the hypothalamus of unanesthetized, unrestrained mice attendant with heatstroke, as shown in the present results. hbo therapy greatly reduced the heat - induced overproduction of hypothalamic mpo, tnf- and il-1, but enhanced the production of il-10 in the hypothalamus. in fact, exogenous administration f recombinant il-10 was shown to protect mice from lethal endotoxemia by reducing tnf- release. in endotoxemic mice, neutralization of endogenous produced il-10 resulted in an increased production of proinflammatory cytokines and an enhanced mortality. il-10 knockout mice had an increased extent of inflammatory illness and higher mortality rates after experimental sepsis. these observations imply that hbo may improve outcomes of heatstroke by increasing il-10 but decreasing mpo, tnf- and il-1 production in multiple organs (including the hypothalamus). it has been previously demonstrated that, in anesthetized rats, the heatstroke - induced arterial hypotension, decreased arterial levels of ph, pao2, and so2%, and increased brain levels of pro - inflammatory cytokines, cellular ischemia and damage markers were all significantly reduced by hbo and, to some extent, by normobaric hyperoxia adopted immediately after the onset of heatstroke for 1 hour resuscitation. in the current study, the heatstroke - induced ischemic and oxidative damage to the hypothalamus in unanesthetized mice could also be reduced by hbo therapy adopted 1 hour after termination of heat stress for 2 hours. additionally, hbo therapy was used successfully treating a heatstroke patient with multiple organ dysfunction. because the hypothalamus was believed to be the essential thermoregulatory center in brain, it is likely that thermoregulatory dysfunction could be resulted from hypothalamic ischemia and neuronal damage after the onset of heatstroke. altering hypothalamic - pituitary - adrenal axis mechanisms would lead to multiorgan dysfunction or failure [43, 44 ]. thus, it appears that hbo may improve outcomes of heatstroke via normalization of the hypothalamic and thermoregulatory functions. our data indicate that hbo is a promising strategy for treatment of heatstroke. in the present study, the time point was considered between 2 - 3 hours after the induction of heatstroke, when the mice were alive. if we considered a time point much later, this would help in translating the idea in human trials. in fact, hyperbaric air therapy or normobaric pure oxygen was also found to be beneficial in treating heatstroke in rats to some extents. this may be easier to administer to patients in case it also helps in the recovery from heatstroke. we should further evaluate the basis of selection of the time of hbo therapy and duration of therapy in future studies. finally, it should be mentioned the heat shock preconditioning induced overproduction of heat shock protein (hsp) 72 and protected against heat - induced cerebral ischemia and damage [16, 17 ]. again, future studies are required to ascertain whether hbo therapy improves outcomes of heatstroke through induction of hsp72 in multiple organs. | the aims of the present paper were to ascertain whether the heat - induced ischemia and oxidative damage to the hypothalamus and lethality in mice could be ameliorated by hyperbaric oxygen therapy. when normobaric air - treated mice underwent heat treatment, the fractional survival and core temperature at 4 hours after heat stress were found to be 0 of 12 and 34c 0.3c, respectively. in hyperbaric oxygen - treated mice, when exposed to the same treatment, both fractional survival and core temperature values were significantly increased to new values of 12/12 and 37.3c 0.3c, respectively. compared to normobaric air - treated heatstroke mice, hyperbaric oxygen - treated mice displayed lower hypothalamic values of cellular ischemia and damage markers, prooxidant enzymes, proinflammatory cytokines, inducible nitric oxide synthase - dependent nitric oxide, and neuronal damage score. the data indicate that hyperbaric oxygen may improve outcomes of heatstroke by normalization of hypothalamic and thermoregulatory function in mice. |
atrial septal defects (asds) are documented in 2 of 1000 live births, approximately 13% of all cases of congenital heart diseases (chds). although surgical closure for secundum asd can be reliably achieved with no mortality and minimal morbidity, it requires the utilization of cardiopulmonary bypass and surgical incision, results in postoperative pain and a prolonged hospital stay, which can cause patients physical and psychological trauma. in 1976, king attempted the first transcatheter closure of a secundum asd in human beings. transcatheter closure with the amplatzer septal defect occluder (aga medical, corporation, plymouth, mn) has gradually become another standard treatment for most secundum asds. in recent years, another kind of hybrid technology that includes an intraoperative transthoracic closure device for asd has been developed and implemented, especially in china. similar to the success of transcatheter closure of asds, this approach has also achieved high technical success and good acute outcomes. the device closure approaches have nearly replaced open heart repair, especially in cases of isolated secundum asd. the results using these 2 different device closures for asd have been reported in earlier published studies. to the best of our knowledge, there has rare been a report comparing the transcatheter and transthoracic devices for asd treatment. we report on our single institutional experience with these 2 alternative therapeutic modalities for asd closure. the present study was approved by the ethics committee of our university and adhered to the declaration of helsinki. in addition, written informed consent was obtained from the patients or the patient 's relatives. the amplatzer asd device was used in group a, and a standard transcatheter closure approach was adopted. in group b, the intraoperative asd occluder was modified from the amplatzer atrial septal occluder, which was manufactured by dong guan ke wei medical apparatus co. ltd of china (fig. the device consists of an occluder made from an alloy of nickel and titanium, a metal delivered sheath, and a pushing rod. the double disc occluder has a 10-cm thread in the right disc, facilitating its withdrawal into the 40-cm long and 3 to 6 diameter sheath. we reviewed the charts of 155 patients with asd who were admitted to our hospital between january 2014 and december 2014 and they were divided into 2 groups according to which closure approach the patient chose. a total of 16 other patients who had undergone preliminary surgical treatment were excluded from this study during this same period. there were 70 patients in group a and 85 patients in group b. all of the patients clinical data are summarized in table 1. there were no differences in gender, age, and body weight distribution between the 2 groups. all of the patients had a confirmed diagnosis of asd and were sufficiently assessed by pre - operative transthoracic echocardiography (tte). routine clinical examinations were performed, which included a standard lead electrocardiogram, a chest x - ray examination, and routine blood and biochemical tests. arrhythmias (which included sinus bradycardia, atrial fibrillation, and atrial flutter) were detected in 5 patients in the 2 groups. in all of the patients, the chest x - ray showed evidence of pulmonary hypertension. patients with severe pulmonary hypertension who required drug therapy were excluded from this study. in both groups, 15 patients suffered from palpitations, shortness of breath, chest tightness, and decreased exercise tolerance. the criteria for inclusion in group a : secundum asd with presence of adequate rims (5 mm) and a maximum asd diameter of 32 mm. in group b, in addition to the inclusion criteria for group a, the patients had a secundum asd with an inferior vena cava rim deficiency and/or maximum asd diameter of 44 mm. in the 2 groups, the other indications for the asd closure included hemodynamically significant left to right shunts and (or) significant chamber enlargement and (or) mild to moderate to severe pulmonary hypertension, despite medical therapy, with presence of symptoms like shortness of breath or exercise intolerance. the exclusion criteria included elevated nonreactive pulmonary vascular resistance, other associated chd that required surgical intervention, uncontrolled congestive heart failure, any evidence of local or generalized sepsis or any infection that could not be successfully treated before device placement, malignancy with a life expectancy of less than 2 years, and the inability to obtain informed consent. in group a, the procedure was performed in the catheter lab under local anesthesia utilizing tte monitoring and x - ray guidance. the cardiac catheterization was performed through the femoral vein, and the defect was passed and quantified with a sizing balloon. the asd diameter was assessed by echocardiography and angiography, and the selected occluder was 1 to 2 mm larger than the measurement obtained by the 2 assessments. the technique employed for the device implantation has been detailed in previous reports. in group b, tte was used to assess the asd pre- and intraoperation, in particular, the defect size and the circumferential margins adjacent to the defect. the occluder was chosen to allow for a margin of 4 to 6 mm in excess of the maximum asd diameter. the surgery was performed under general anesthesia. a right anterior sub - mammary mini - thoracotomy (approximately 35 cm in length) was made through the fourth intercostal space. through this incision, a purse - string suture approximately 15 mm in diameter was stitched in the right atrium. the occluder was drawn into the delivery sheath, and then an incision was opened in the purse - string suture and the delivery sheath was inserted (fig. then, the left and the right disc were deployed in turn by pushing the rod to close the asd (figures 3 and 4). the sheath positioned from the right atrial free wall into the left atrial cavity across the asd. the disc of an occluder was deployed in the atrial cavity. final image shown after both discs were deployed. the amplatzer asd device was used in group a, and a standard transcatheter closure approach was adopted. in group b, the intraoperative asd occluder was modified from the amplatzer atrial septal occluder, which was manufactured by dong guan ke wei medical apparatus co. ltd of china (fig. the device consists of an occluder made from an alloy of nickel and titanium, a metal delivered sheath, and a pushing rod. the double disc occluder has a 10-cm thread in the right disc, facilitating its withdrawal into the 40-cm long and 3 to 6 diameter sheath. we reviewed the charts of 155 patients with asd who were admitted to our hospital between january 2014 and december 2014 and they were divided into 2 groups according to which closure approach the patient chose. a total of 16 other patients who had undergone preliminary surgical treatment were excluded from this study during this same period. there were 70 patients in group a and 85 patients in group b. all of the patients clinical data are summarized in table 1. there were no differences in gender, age, and body weight distribution between the 2 groups. all of the patients had a confirmed diagnosis of asd and were sufficiently assessed by pre - operative transthoracic echocardiography (tte). routine clinical examinations were performed, which included a standard lead electrocardiogram, a chest x - ray examination, and routine blood and biochemical tests. arrhythmias (which included sinus bradycardia, atrial fibrillation, and atrial flutter) were detected in 5 patients in the 2 groups. in all of the patients, the chest x - ray showed evidence of pulmonary hypertension. patients with severe pulmonary hypertension who required drug therapy were excluded from this study. in both groups, 15 patients suffered from palpitations, shortness of breath, chest tightness, and decreased exercise tolerance. the criteria for inclusion in group a : secundum asd with presence of adequate rims (5 mm) and a maximum asd diameter of 32 mm. in group b, in addition to the inclusion criteria for group a, the patients had a secundum asd with an inferior vena cava rim deficiency and/or maximum asd diameter of 44 mm. in the 2 groups, the other indications for the asd closure included hemodynamically significant left to right shunts and (or) significant chamber enlargement and (or) mild to moderate to severe pulmonary hypertension, despite medical therapy, with presence of symptoms like shortness of breath or exercise intolerance. the exclusion criteria included elevated nonreactive pulmonary vascular resistance, other associated chd that required surgical intervention, uncontrolled congestive heart failure, any evidence of local or generalized sepsis or any infection that could not be successfully treated before device placement, malignancy with a life expectancy of less than 2 years, and the inability to obtain informed consent. in group a, the procedure was performed in the catheter lab under local anesthesia utilizing tte monitoring and x - ray guidance. the cardiac catheterization was performed through the femoral vein, and the defect was passed and quantified with a sizing balloon. the asd diameter was assessed by echocardiography and angiography, and the selected occluder was 1 to 2 mm larger than the measurement obtained by the 2 assessments. the technique employed for the device implantation has been detailed in previous reports. in group b, tte was used to assess the asd pre- and intraoperation, in particular, the defect size and the circumferential margins adjacent to the defect. the occluder was chosen to allow for a margin of 4 to 6 mm in excess of the maximum asd diameter. the surgery was performed under general anesthesia. a right anterior sub - mammary mini - thoracotomy (approximately 35 cm in length) was made through the fourth intercostal space. through this incision, a purse - string suture approximately 15 mm in diameter was stitched in the right atrium. the occluder was drawn into the delivery sheath, and then an incision was opened in the purse - string suture and the delivery sheath was inserted (fig. then, the left and the right disc were deployed in turn by pushing the rod to close the asd (figures 3 and 4). the sheath positioned from the right atrial free wall into the left atrial cavity across the asd. the disc of an occluder was deployed in the atrial cavity. final image shown after both discs were deployed. in both groups, delivery of the occluder was successful in 153 patients, and the other 2 patients were converted to surgical closure. in group a, the diameter of the asds ranged from 10 to 30 mm (20.1 5.3 mm), and the size of the implanted occluder ranged from 12 to 32 mm (26.5 6.8 mm). the corresponding data in group b were 14 to 42 mm diameter (28.1 6.3 mm) and 20 to 46 mm occluder size (34.5 6.2 mm). the successful asd closure rate was 94.3% immediately after the operation, 100% at 3 months, and 100% at 12 months of follow - up in group a, which was not statistically different from the results in group b (94.1%, 98.8%, 98.8%, respectively). tables 1 and 2 also depict the clinical data comparison of all the patients in both groups. in group b, the patients had small residual shunts, and shunts were detected at the junction of the occluder and the deficient rim. at the 3-month and 1-year follow - up, only 1 out of the 85 patients in group b still had small residual shunts, and there was no evidence of hemodynamic effects. two patients underwent emergent surgery to retrieve the occluder and patch closure due to occluder dislodgement. the patient in group a had a 30 mm asd and received a 34 mm occluder, and a deficient inferior vena cava rim was confirmed during the operation. the other patient in group b had a 38 mm asd and received a 46 mm occlude ; the rim around the asd had been deemed sufficient during the preoperative preparation (in contrast to the aforementioned patient in group a). after the occluder was initially released and the incision was closed, occluder dislodgement was detected by tte examination. neither group had any serious complications or mortality, such as cerebral embolism, cardiac perforation, atrioventricular valve distortion, endocarditis, repeat procedure, or atrioventricular block requiring pacemaker implantation. the incidence of minor complications in group b was significantly higher than in group a (p 38 mm) defects with deficient rims are usually not offered transcatheter closure but are referred for surgical closure in their paper. guo compared transcatheter with intraoperative device closure in the treatment of large secundum asds (30 mm). their result showed a similar success rate, but the intraoperative closure group had more periprocedural complications and longer hospital stays. hongxin reported their short and mid - term results using an intraoperative device closure in large secundum asds (2037 mm, and about half of patients had one short rim). their experience showed that intraoperative device closure was a safe and feasible technique for closing large asds, and this approach had the advantages of cost savings, cosmetic results, and less trauma. our results confirmed that the 2 approaches provide nearly the same success rate, safety, and efficacy. group a had fewer complications, no icu stay, shorter hospital stays, and less trauma than group b. for patients with moderate asd, transcatheter closure should be used as the first choice. however, for patients with a larger asd, especially when combined with 1 short rim, another treatment selection may be prudent. although the above reports approved of transcatheter closure of large secundum asds, most of the large asd cases were less than 40 mm, which means that the transcatheter closure of large secundum asds is still challenging. in our opinion, transthoracic device closure can be used to treat larger defects than transcatheter device closure. in our previous experience and reports by hongxin, patients with large secundum asds, even more than 40 mm, can be treated using transthoracic device closure ; we even have experience using a 48 mm occluder via this approach. in our study, 5 transcatheter device closures failed and were then referred to surgery and underwent transthoracic device closure. dislodgement or embolization of an occluder is a catastrophic complication of a device closure procedure. especially when it occurs during the release of the occluder, emergency surgical repair is the only remedy. in our study, 2 patients in both groups experienced such a complication and required emergency surgery. some reports have also mentioned transcatheter closure of large secundum asds and reported good results. however, fraisse and trivedi noted which asd dimension was too large for this approach. it remains very challenging to use transcatheter closure devices in patients with large asds (> 38 mm) and/or defects with deficient rims. in our country, hybrid operating rooms are not very popular, only a few are distributed in large medical centers. if an occluder dislodgement occurs, the patient must be transferred to the operating room for surgical repair, which may take time and increase the embolization risk. however, it was easy to convert to a regular open - heart procedure if the intraoperative transthoracic device closure failed without additional incisions, which may ensure the safety of the procedure. thus, in our opinion, if the asd diameter is greater than 30 mm, choosing the transthoracic closure approach is obviously more sensible. although we had an occluder dislodgement failure in group b, there were more cases of large asds (> 30 mm) in group b than in group a (p 30 mm, although the transcatheter approach can successfully occlude some patients, we still recommended the transthoracic approach. for those patients with peripheral vascular disease or who are unwilling to undergo radiation exposure, in facilities that lack the technical expertise or equipment, and for those asd patients with an inferior vena cava rim deficiency, the transthoracic approach is the best choice. as in any retrospective study, there was bias associated with data collection and enrolling patients in the 2 groups, which were not randomized. as a result of the 70 cases in group a and the 85 patients in group b, our experience was limited and longer term follow - up is needed. this study was limited to 1 institution, and other institutions may find different results. the other limitation was that this study was conducted in a low - income country, and there might be different cost - effectiveness results in high - income countries. in conclusion, our study demonstrated that transthoracic device closure and transcatheter device closure were both safe and efficacious modalities to treat patients with secundum asd. the transcatheter approach had the advantage of less trauma, no scar, no postoperative pain, and shorter icu stay time and hospital stay time. compared with the transcatheter approach, the transthoracic approach had the advantage of cost saving, shorter operative time, and broader indications. | abstractthe purpose of this study was to compare patient populations, safety, feasibility, complications, and total costs of the transcatheter and transthoracic device closure treatments for secundum atrial septal defect.from january 2014 to december 2014, we enrolled 155 patients with secundum atrial septal defects in our hospital. the patients were divided into 2 groups : the 70 patients in group a underwent transcatheter device closure, and the 85 patients in group b underwent transthoracic intraoperative device closure with a right lateral mini-thoracotomy.in group a, the total occlusion rate was 94.3% immediately after the operation, 100% at 3 months, and 100% at 12 months of follow - up ; the group a results were not statistically different from the group b results (94.1%, 98.8%, 98.8%, respectively). there was a statistically significant difference in the minor complication rate (p < 0.05), and there were no reported deaths. there was a greater indicated scope using the transthoracic closure device to treat atrial septal defects. in our comparative study, the patients in group b had longer intensive care unit stays and hospital stays than group a (p < 0.05).both of the device closure treatment options for secundum atrial septal defect are safe and feasible. the transcatheter device closure approach has the advantages of more cosmetic results, less trauma, and a shorter hospital stay than the transthoracic approach. on the contrary, the transthoracic closure device is an economical alternative choice, particularly for patients who are not eligible for the transcatheter closure device. |
in stroke patients, seizures may occur at any time from the acute phase to years after the stroke. due to the huge numbers of stroke patients, stroke is the most common cause of seizures in the elderly population (1). classified the seizure into two groups according to the time of the onset of the first seizure : early seizure (within the first two weeks after the stroke) and late seizure (onset subsequent to the second week) (2). late seizure occurs in approximately 5% of stroke patients (3 - 5) ; the recurrence rate in patients with post - stroke epilepsy is 2 - 3% (4,5). late seizure is not difficult to diagnose when bystanders, such as emergency department staff, primary care doctors, the patient 's family, and even the patients themselves, witness the complete typical clinical course, which is characterized by hemi - convulsion on the paralyzed side followed by disturbance of consciousness and a generalized convulsion. however, some seizures are not associated with convulsive clinical symptoms. in such cases, the differential diagnosis is difficult because physicians must also to consider other possibilities, which include the recurrence of stroke or transient ischemic attack (tia) and seizure with unwitnessed convulsion followed by continuous neurological deficits such as todd 's palsy (6). nevertheless, the prevalence of non - convulsive seizures in patients with late seizures remains unknown. the aim of the present study was to clarify the manifestations of late seizures in clinical practice, focusing on the prevalence of non - convulsive seizures. a total of 178 consecutive patients who were diagnosed with late seizure after stroke and who were admitted to the department of neurology, neurosurgery and stroke medicine of yokohama sakae kyosai hospital between january 2003 and november 2013 were retrospectively enrolled in this study. for the purpose of ensuring the accuracy of the seizure type, the data of 127 (71%) patients for whom the complete clinical course of the seizure (from its onset to cessation) was observed by a bystander were analyzed. late seizures were defined as seizures that occurred more than 2 weeks after the primary stroke. status epilepticus was defined as a seizure that repeated frequently enough to produce a fixed and enduring neurological condition lasting for at least 30 minutes. the patients ' clinical information, including the classification, the lesion of stroke and seizure symptoms observed during the clinical course, was obtained from the medical records and nursing notes. the diagnosis of late seizure and status epilepticus for each patient was made comprehensively with reference to clinical information such as the clinical course (including witness reports from of multidisciplinary hospital staff members and family members) the response to antiepileptic drugs, the results of electroencephalography (eeg), laboratory tests, and imaging studies, including computed tomography, magnetic resonance imaging (mri), and single photon emission computed tomography. through these procedures, a careful differential diagnosis that excluded other neurological disorders, including tia, nineteen patients (15%) had subarachnoid hemorrhage, 34 (27%) had intracerebral hemorrhage, and 74 (58%) had cerebral infarction. the interval between stroke and seizure was 151210 days. regarding the clinical manifestations of the seizures on arrival, convulsion was observed in 90 patients (71%), but was not observed in 37 (29%). lateralizing signs such as hemi - convulsion, hemiparesis, and aphasia were observed in 100 patients (79%) ; the seizure types included focal seizure (n=73 ; 57%) and secondary generalization (n=27 patients ; 21%). the remaining 27 patients (21%) did not have any lateralizing signs and were classified as having a generalized seizure. status epilepticus was observed in 60 patients (47%), including 11 patients (9%) without a convulsion. the results of a univariate analysis of the background characteristics of patients with non - convulsive seizures and those with convulsive seizures are shown in table 1. patients without convulsions were significantly younger, but there were no other significant differences between the two groups with respect to the sex classification, the lesion of stroke, or the interval between stroke and seizure. the symptoms of the patients included : disturbance of consciousness (n=24, 65%), hemiparesis (n=11, 30%), aphasia (n=8, 22%), psychiatric symptoms (n=2), unilateral spatial neglect (n=2), vision disturbance (n=2), and sensation disturbance (n=2). in the present study, late seizure after stroke was comprehensively diagnosed after the intensive investigation of hospitalized patients according to their clinical course, clinical tests, imaging findings, and response to therapy. in particular, information was carefully collected from witnesses, including the patients themselves, their family, and healthcare workers, such as the ambulance crew and hospital staff. the complete clinical course of the seizure including the onset, subsequent development, and the cessation of symptoms was witnessed for 127 patients (71%). these patients were the prime focus of this study because the information about the presence or absence of convulsions was especially important. in 29% of the analyzed cases, focal seizures and their secondary generalization accounted for 79% of the seizures, which is in line with the results of previous reports (4,5,7). in principle, a late seizure should be a focal seizure, because it originates in a focal stroke lesion. in contrast to previous reports, which showed a frequency of 9 - 20% (5,7,8), almost half of the patients in the present study had status epilepticus. this discrepancy may be due to differences in the background characteristics of the recruited patients, because the present subjects were exclusively inpatients. the high frequency of status epilepticus without convulsion (9% of all patients) is particularly noteworthy. next, the symptoms of 37 patients with non - convulsive seizures were analyzed (table 2). in particular, paresis due to seizure has been reported as non - convulsive seizure paralysis (9), focal inhibitory seizure (10), inhibitory motor seizure (11,12), ictal paresis (13), or focal akinetic seizure (14), and language abnormality due to seizures is also known as ictal aphasia (15). these seizures should be adequately differentiated from the recurrence of stroke or tia when patients with a past history of stroke present to the emergency department. an eeg is essential and useful for this purpose, but in many emergency departments it will not always be available. moreover, the prevalence of specific findings in relation to the seizures, i.e. epileptiform discharges among patients with post - stroke seizure is low (5) and epileptiform discharges are also found among post - stroke patients without seizure (16). thus, the usefulness of eeg is limited in post - stroke patients with suspected seizures (16). in addition, although video - eeg is the most reliable tool for accurately evaluating the complete clinical course of the seizure and the convulsive or non - convulsive state (17), most patients with late seizure are transferred to emergency departments rather than epilepsy centers. the difficulties in the diagnosis of non - convulsive late seizure in the emergency department where eeg or video - eeg is unavailable prompted us to explore the characteristic clinical backgrounds, including the classification and lesion of stroke, suggesting the diagnosis of non - convulsive seizure. the only background difference observed between the convulsive and non - convulsive groups was the younger age of the non - convulsive group ; however, the reasons for this result are unclear. no other significant differences were observed in the characteristics of the two groups, including such as sex, stroke classification, and lesion of stroke, or the interval between the stroke and the patient 's seizure. it is therefore necessary to be aware that at any time after stroke, any type and location of stroke may cause a non - convulsive late seizure. as we recently reported (18), the demonstration of increased cortical perfusion by arterial spin - labeling mri, which does not require a contrast agent, might be helpful in the early diagnosis of late seizures in the emergency department. non - convulsive seizure occurred in 29% or our cases, which was an unexpectedly high rate, and was associated with status epilepticus in 9% of 127 consecutive patients with late seizure after stroke. the results of the present study demonstrated that any type or location of preceding stroke may cause a non - convulsive seizure. we should therefore pay more attention to this type of seizure in the face of acute neurological deficits such as disturbance of consciousness, hemiparesis, and aphasia in post - stroke patients. | objective the prevalence of the non - convulsive type of late seizure after stroke is unknown. the aim of the present study was to clarify the characteristics of late seizure in clinical practice, mainly focusing on the prevalence of non - convulsive seizure. methods a total of 178 consecutive patients who were admitted and diagnosed with late seizure after stroke were retrospectively enrolled, and the data of 127 patients for whom the complete seizure was observed by a bystander were analyzed. clinical information was obtained from the medical records and nursing notes. results a non - convulsive seizure was observed in 37 patients (29%). a focal seizure and its secondary generalization accounted for 79% of the seizure types. status epilepticus was observed in 60 patients (47%), including 11 patients (9%) without convulsion. the patients with non - convulsive seizures were significantly younger than those with convulsive seizures, but there were no other significant differences between the two groups with respect to sex, classification or the lesion of stroke. conclusion there was a high rate of non - convulsive seizures in patients with late seizure after stroke. a non - convulsive seizure may be caused by any type or location of preceding stroke. more attention is needed in the differential diagnosis of neurological deterioration after stroke. |
glucose monitoring is a key component in assessing glucose metabolic disturbance, evaluating therapeutic outcomes and guiding treatment regimens. for decades, continuous glucose monitoring (cgm) was one of the dreams of patients with diabetes and diabetologists. in this article, the research progress, opportunities and challenges of the use of cgm technology are reviewed. |
|
the most common cause of failure in glaucoma filtering surgery is scarring of the filtering bleb, and the increased amount of collagen in the surgical site suggests that proliferation of fibroblasts with associated production of collagen and glycosaminoglycans is important (1). mitomycin c (mmc) has enhanced the surgical success rate of trabeculectomy through inhibition of tenon capsule fibroblast proliferation since its introduction in 1983 (2). however, use of mmc was associated with conjunctival epithelial damage, and it is characterized by non - healing leaking blebs and the risk of an avascular bleb and bleb infection (3). it involves prolonged intraocular pressure (iop) reduction associated with disc edema, vascular tortuosity, and chorioretinal macular folds, potentially producing marked reduction in visual acuity (1). the suggested causes are excessive filtering blebs and aqueous hyposecretion, i.e., ciliary body changes (4). in addition to these serious complications, corneal problems are still common (5). pastor. (6) examined corneal endothelial cell densities in 10 patients who underwent trabeculectomies with mmc and found a 4.7% to 20.0% decrease in cell density. therefore, many agents that can modulate wound healing and are safe for other ocular tissues simultaneously have been tried. in a previous study, matrix metalloproteinase (mmp), particularly mmp-2/mt1-mmp, was associated with degradation of the extracellular matrix in the wound healing process after glaucoma filtration surgery and it was suggested as an important target for therapeutic intervention after glaucoma filtration surgery (7). in an animal study, wong. (8) reported that mmp inhibitor can effectively reduce subconjunctival scarring after experimental glaucoma filtration surgery. in another study, the sequential treatment group used the following : bevacizumab (avastin), a monoclonal, vegf antibody ; saratin, a 12 kd polypeptide with anti - inflammatory and anti - thrombotic properties ; and ilomastat, an mmp inhibitor. the study demonstrated a significant prolongation of bleb survival compared to the controls, which was not significantly different from the mmc positive control group (9). in another study, the mmp inhibitor significantly improved surgical outcomes compared with controls and the length of bleb survival was similar to the mmc group (10). however, a mmp inhibitor used in previous studies was a nonspecific target agent ; i.e., producing general inhibition on mmp. therefore, we evaluated the safety of a mmp inhibitor on other ocular tissues in an animal model. fifteen new zealand white rabbits aged between 12 and 14 weeks and weighing 2.0 to 2.5 kg were used. glaucoma filtration surgery was performed only on the right eye similarly to a previous report (11). animals were randomly divided into 3 groups according to the adjuvant agent used during the surgery : the control group (n = 5), no agent ; ilomastat - treated group (n = 5), 0.1 ml of 100 m ilomastat (calbiochem - novabiochem, nottingham, uk) in a subconjunctival injection ; and mmc - treated group (n = 5), a thin cellulose sponge soaked with mmc (0.2 mg / ml). the bleb, conjunctiva, cornea, and anterior chamber were evaluated with slit lamp biomicroscopy and seidel test preoperatively and at 7 days, 14 days, and 28 days postoperatively. a pachymeter (ultrasonic pachymeter ; nidek, aichi, japan) was used preoperatively and at postoperative 28 days to check the central corneal thickness (cct). specular microscopy (robo - specular microscope ; konan medical corporation, nishinomiya, japan) was performed preoperatively and 28 days postoperatively. at the postoperative 28th day, the rabbits in each group were sacrificed in a co2 chamber after isoflurane gas induced anesthesia. tissues were preserved in 10% formaldehyde, embedded in paraffin, and sequential 34 m sections of the operative wound site were prepared. based on previous reports, the conjunctiva and the ciliary body toxicity were evaluated and scored according to the grading systems by 2 pathologists (12). the scale used for conjunctival changes was : 0 = no histologic change : no inflammation ; 1 = minimal histologic change / conjunctiva epithelium preserved, thickening of the conjunctiva ; 2 = mild histologic change / conjunctiva epithelium preserved, thickening of the conjunctiva, and mild inflammatory cell infiltration ; 3 = moderate histologic change / score 2 with loss of collagen fibril organization ; and 4 = severe histologic change : loss of the conjunctival epithelium, total disorganization, and necrosis of the underlying scleral stroma. the scale used for ciliary body changes was : 0 = no histologic change ; 1 = minimal histologic change / ciliary epithelium height normal, demonstrating minimal fibroblast proliferation, congestion, and edema, no fibrin ; 2 = mild histologic change / ciliary epithelium height decreased, demonstrating moderate fibroblast proliferation with fibrin, moderate congestion, and edema ; 3 = moderate histologic change / score 2 with inflammatory cell infiltration ; 4 = severe histologic change / desquamation of the ciliary epithelium, total disorganization, and necrosis of the ciliary body. electron microscopic observations, the cornea was obtained from the treated eyes immediately postmortem, and fixed in 2.5% glutaraldehyde in 0.1 m phosphate buffer for transmission electron microscopic examination. afterwards, the specimens were postfixed in 1% osmium tetroxide solution, dehydrated and embedded in epoxy resin using the usual procedure. ultrathin sections of approximately 6070 nm thickness were made using an ultracut - e microtome (reichert - jung, buffalo, ny, usa) and were stained with heavy metals, uranylacetate and lead citrate. stained sections were assessed and photographed under transmission electron microscopy (tem ; h-7650 ; hitachi, tokyo, japan). the mann - whitney u test and the kruskal - wallis test were used to compare the clinical findings of the groups. this study was approved by the institutional animal care and use committee of ewha medical center(esm15 - 0291). all animal procedures and methods used for securing the animal tissue complied with the association for research in vision and ophthalmology (arvo) statement for the use of animals in ophthalmic and vision research and our institutional guidelines. glaucoma filtration surgery was performed only on the right eye similarly to a previous report (11). animals were randomly divided into 3 groups according to the adjuvant agent used during the surgery : the control group (n = 5), no agent ; ilomastat - treated group (n = 5), 0.1 ml of 100 m ilomastat (calbiochem - novabiochem, nottingham, uk) in a subconjunctival injection ; and mmc - treated group (n = 5), a thin cellulose sponge soaked with mmc (0.2 mg / ml). the bleb, conjunctiva, cornea, and anterior chamber were evaluated with slit lamp biomicroscopy and seidel test preoperatively and at 7 days, 14 days, and 28 days postoperatively. a pachymeter (ultrasonic pachymeter ; nidek, aichi, japan) was used preoperatively and at postoperative 28 days to check the central corneal thickness (cct). specular microscopy (robo - specular microscope ; konan medical corporation, nishinomiya, japan) was performed preoperatively and 28 days postoperatively. at the postoperative 28th day, the rabbits in each group were sacrificed in a co2 chamber after isoflurane gas induced anesthesia. tissues were preserved in 10% formaldehyde, embedded in paraffin, and sequential 34 m sections of the operative wound site were prepared. based on previous reports, the conjunctiva and the ciliary body toxicity were evaluated and scored according to the grading systems by 2 pathologists (12). the scale used for conjunctival changes was : 0 = no histologic change : no inflammation ; 1 = minimal histologic change / conjunctiva epithelium preserved, thickening of the conjunctiva ; 2 = mild histologic change / conjunctiva epithelium preserved, thickening of the conjunctiva, and mild inflammatory cell infiltration ; 3 = moderate histologic change / score 2 with loss of collagen fibril organization ; and 4 = severe histologic change : loss of the conjunctival epithelium, total disorganization, and necrosis of the underlying scleral stroma. the scale used for ciliary body changes was : 0 = no histologic change ; 1 = minimal histologic change / ciliary epithelium height normal, demonstrating minimal fibroblast proliferation, congestion, and edema, no fibrin ; 2 = mild histologic change / ciliary epithelium height decreased, demonstrating moderate fibroblast proliferation with fibrin, moderate congestion, and edema ; 3 = moderate histologic change / score 2 with inflammatory cell infiltration ; 4 = severe histologic change / desquamation of the ciliary epithelium, total disorganization, and necrosis of the ciliary body. the toxicity of the cornea was also assessed with light modifications. for transmission electron microscopic observations, the cornea was obtained from the treated eyes immediately postmortem, and fixed in 2.5% glutaraldehyde in 0.1 m phosphate buffer for transmission electron microscopic examination. afterwards, the specimens were postfixed in 1% osmium tetroxide solution, dehydrated and embedded in epoxy resin using the usual procedure. ultrathin sections of approximately 6070 nm thickness were made using an ultracut - e microtome (reichert - jung, buffalo, ny, usa) and were stained with heavy metals, uranylacetate and lead citrate. stained sections were assessed and photographed under transmission electron microscopy (tem ; h-7650 ; hitachi, tokyo, japan). statistical analyses were conducted using ibm spss stastics version 24.0 (ibm corp., armonk the mann - whitney u test and the kruskal - wallis test were used to compare the clinical findings of the groups. this study was approved by the institutional animal care and use committee of ewha medical center(esm15 - 0291). all animal procedures and methods used for securing the animal tissue complied with the association for research in vision and ophthalmology (arvo) statement for the use of animals in ophthalmic and vision research and our institutional guidelines. on postoperative day 7, 14, and 28, fluorescein slit lamp microscopic examination revealed no abnormalities in the bleb conjunctiva such as bleb leakage and blebitis in the ilomastat treated group, whereas one mmc treated eye showed one avascular cystic bleb. in the ilomastat - treated group, cornea problems such as keratitis and corneal ulcer were not noticed vis slit lamp examination. any other adverse events, such as cataract, anterior chamber cell reaction, and endophthalmitis, were not found during the study. cct was measured before surgery as follows : 377.0 18.9 in controls, 382.00 22.69 in the ilomastat - treated group and 372.40 21.17 in the mmc - treated group. on postoperative days, ccts were 361.5 10.6 in the control group, 384.0 8.28 in the ilomastat - treated group, and 368.33 21.12 in the mmc treated group and also showed no statistically significant changes among the 3 groups (p = 0.253). in the ilomastat - treated groups, there were no statistically significant changes in cct between preoperative and postoperative 28 days (p = 0.655) and the mmc - treated groups also showed no significant change between preoperative and postoperative 28 days (p = 0.285 ; table 1). specular microscopy findings, such as cell density, coefficient of variation, average cell area, and hexagonality for the 3 groups are shown in fig. 1 and table 2. in the ilomastat - treated group, the parameters on preoperative and postoperative 28 days were the following : cell density 2,683 and 2,621, coefficient of variation 40 and 41, average cell area 379 and 398, hexagonality 40 and 28, respectively (table 2). in the ilomastat - treated group, there was no statistically significant difference in all parameters preoperatively and at postoperative 28 days (all p > 0.05). in the mmc - treated group, the coefficient of variation was changed from 19 preoperatively to 31 at postoperative 28 days. the average cell area also decreased from 659 to 374, and hexagonality changed from 67 to 78 in the mmc - treated group. however, when parameters were compared among the 3 groups preoperatively and at postoperative 28 days, there were no statistically significant differences in all parameters (all p > 0.05)., there was no statistically significant differences in all parameters preoperatively and at postoperative 28 days. when conjunctival toxicity was evaluated, the average score was 1 in the control group, 1.5 in the ilomastat - treated group and 2 in the mmc - treated group. when assessing the ciliary body toxicity score, the ilomastat - treated group was 0.5 and the mmc - treated group was 1.5. variable - sized vacuoles were observed in the cytoplasm of epithelial cells and loss of junctional complexes were observed in basal cells. multiple vacuoles were also observed in the cytoplasm of keratocyte corneal endothelial cells. in ilomastat - treated eyes, stratified squamous non - keratinized epithelial cells in the tear film were observed and normal long spindle shaped keratocytes were scattered among the lamellae of the stroma. a thick homogenous noncellular descemet 's membrane lined by a single endothelial cell layer was also noticed. in addition, any other adverse event, such as cataract formation, anterior chamber cell reaction, or endophthalmitis via slit lamp examination, were not found in the ilomastat treated group during the study. (b) variable - sized vacuoles were observed in cytosplsm and loss of junctional complexes at lateral side was observed in basal cells. (c) cellular integrity was maintained and surface damage or cellular desquamation resulting from toxicity was not observed. (d) normal long spindle shaped keratocyte are scattered among the lamellae of the stroma and the structures in the cytoplsam were well preserved. (g) a thick homogenous noncellular descemet 's membrane lined by a single endothelial cell layer with a moderate electron - dense oval nucleus. (h) intracytoplasimc multiple vacuoles are observed in corneal endothelial cell in mmc - treated group. many glaucoma patients need glaucoma surgery during the treatment period and glaucoma filtration surgery is usually first attempted to control iop (1314). however, the success rate of trabeculectomy is not perfect and many adjunctive antifibrotic agents to modulate the wound healing process of glaucoma filtration surgery have been tried (15). in addition, mmc is one of the most commonly used agents, but it is an antibiotic derived from streptomyces caespitosus with alkylating properties that exert their most profound cellular toxicity in the late g1 and early s cellular phases (16). mmc can lead to the development of hypotony with a shallow chamber, hypotonic maculopathy, extended choroidal detachment, or a decrease in visual acuity related to progressive cataracts (17). during the many trials to find a more physiologic, alternative agent, a previous study reported that the healing response after surgery could be modulated by inhibiting the effects of mmps in animal studies. however, a mmp inhibitor is a nonspecific target agent and we did not know the exact mechanism of modulating the wound healing process in filtration blebs. in addition, keratocytes are known to be quiescent in the normal cornea but are readily activated and transformed into myofibroblasts that express a - smooth muscle actin in response to various insults (18). then myofibroblasts produce ecm, collagen - degrading enzymes, mmps, and cytokines to compensate for the insults (18). if the mmp inhibitor could influence the cornea as with 5-fluorouracil or mmc, it could further disturb the physiologic compensation process of keratocytes. therefore, we assessed the safety of the mmp inhibitor in glaucoma filtration surgery, especially the conjunctiva, cornea and ciliary body. when assessing the corneal endothelium with specular microscopy, in mmc - treated group, the coefficient of variation was changed from 19 preoperatively to 31 at postoperative 28 days, the average cell area also decreased from 659 to 374, and hexagonality changed from 67 to 78. electron micrograph of cornea microstructures showed intracytoplasmic multiple vacuoles in epithelial cells, keratocytes, and endothelial cells in the mmc - treated group. loss of junctional complexes in epithelial layers was observed in the mmc - treated group. in previous human studies, pastor. (6) reported a 4.7% to 20.0% decrease in corneal endothelial cells in 10 patients who underwent trabeculectomies with mmc. in other studies, the mean corneal endothelial cell loss following mmc augmented trabeculectomy was reported to be about 4% to 14% (19). 20) published a report on 2 patients with moderate to severe guttata who underwent trabeculectomy with mmc. it is difficult to compare the exact results because of variation in the study subjects and methods. we used a relatively low dose (0.2 mg / ml) of mmc in a soaking irrigation method that may result in fewer microstructural changes than in previous studies. however, these results showed again that special caution is needed in mmc use regarding corneal microstructures, although there was no definite clinical corneal problem. there were no adverse corneal problems in the ilomastat treated group via slit lamp microscopy. in the pachymetric results, there was no statistically significant change in the cct between preoperative and postoperative 28 day measurements in the ilomastat - treated group (p = 0.655). in specular microscopic assessments, there were no significant changes in the endothelial cell density, coefficient of variation, average cell area, and hexagonality between preoperative and postoperative 28 day measurements. through transmission electron micrographs, in the ilomastat - treated group, cellular integrity was maintained and surface damage or cellular desquamation resulting from toxicity was not observed in the epithelial layers and there was no evident abnormal change in keratocytes and endothelial cells. in assessing conjunctival toxicity, the conjunctiva epithelium was preserved and minimal histologic changes were found in the ilomastat - treated group compared to the conjunctival changes of the mmc - treated group. slit lamp microscopic examination revealed no abnormalities in bleb conjunctiva such as bleb leakage and blebitis in the ilomastat treated group, whereas one mmc treated eye showed one avascular cystic bleb. an in vivo study showed mmp inhibition significantly reduced matrix contraction and production without tenon 's capsule fibroblast toxicity (21). (9) also reported that less thinning of tissues and avascularity were noted in the ilomastat - treated group compared to the mmc group. regarding the ciliary body toxicity scores, the ilomastat - treated group was 0.5 and the mmc - treated group was 1. previous studies have shown that episcleral mmc damages the ciliary body, and another study reported that a 5-minute exposure of mmc (0.2 mg / ml, 0.1 ml) in rabbit eyes caused the nonpigmented epithelial cells of the ciliary body to become swollen, and the intracellular abundant mitochondria were swollen and vacuolized (22). many studies have been conducted to adjust the concentration and application duration of the drug due to the toxic effects of mmc (23). we used mmc (0.2 mg / ml) soaking for 2 minutes in blebs and found mild histologic changes, congestion and edema in the ciliary body. however, the ilomastat - treated group showed less histologic changes compared with the mmc - treated group. first, our study was performed in a rabbit model and it is hard to apply our results clinically considering the proliferative capacity of the rabbit endothelium. second, the number of rabbit eyes used in our study was too low, so there are some limitations in statistical analysis. therefore, larger scale cases will be needed to confirm the safety of the drug. however, the 0.2 mg / ml mmc injection procedure was reported to result in higher conjunctiva, sclera, and aqueous body concentrations and there has been no report on ilomastat intraocular concentrations (24). forth, we applied a single injection of the mmp inhibitor, so the toxic effect of the drug may have been underestimated whereas previous studies used multiple injections (8910). finally, we did not assess the long - term potential toxic effects of the drug. in conclusion, a single subconjunctival injection of a mmp inhibitor in experimental trabeculectomy showed a less toxic effect on the rabbit corneas, conjunctiva and ciliary bodies compared to mmc. however, the toxicity in human use may be different and more detailed long term studies are needed to confirm the safety of the drug. | we evaluated the safety of matrix metalloproteinase (mmp) inhibitor in experimental glaucoma filtration surgery in an animal model. fifteen new zealand white rabbits underwent an experimental trabeculectomy and were randomly allocated into 3 groups according to the adjuvant agent : no treatment group (n = 5), 0.02% mitomycin c (mmc) soaking group (n = 5), and mmp inhibitor (ilomastat) subconjunctival injection group (n = 5). slit lamp examination with seidel testing, pachymetry, and specular microscopy was performed preoperatively and postoperatively. the conjunctiva and ciliary body toxicity were evaluated with scores according to the pathologic grading systems. electron microscopy was used to examine the structural changes in cornea, conjunctiva, and ciliary body. in the ilomastat - treated group, there was no statistically significant change in central corneal thickness preoperatively and at 28 days postoperatively (p = 0.655). there were also no significant changes in specular microscopy findings over the duration of the study in the ilomastat - treated group. the conjunctival toxicity score was 1 in the control group, 1.5 in the ilomastat - treated group, and 2 in the mmc - treated group. when assessing ciliary body toxicity scores, the ilomastat - treated group score was 0.5 and the mmc - treated group score was 1.5. transmission electron microscopy did not show structural changes in the cornea and ciliary body whereas the structural changes were noticed in mmc group. a single subconjunctival injection of mmp inhibitor during the experimental trabeculectomy showed a less toxic affect in the rabbit cornea, conjunctiva, and ciliary body compared to mmc. |
reduced dynamic balance ability is a major risk factor for falls among community - dwelling elderly people. past studies that examined fall - related factors in elderly people observed correlations with falls using the timed up and go test (tugt), and the four square step test (fsst), all of which test dynamic balance ability1,2,3. falls in elderly people are most often caused by changes in the support surface and shifts of the physical center of gravity during walking. toe dysfunction in elderly people can lead to reduced dynamic balance ability, such as through reduced toe strength, reduced range of motion (rom), pain, and deformation. in previous studies that examined the correlation between dynamic balance ability and toe functions in elderly people, reduced toe flexion strength was found to correlate with reduced dynamic balance ability4. however, there are few reports that examined a dynamic balance and the association with the toe functions. determining the extent to which toe functions can reduce dynamic balance ability in elderly people would likely help in creating effective fall - prevention measures. the objective of this study was to determine the extent to which toe functions affect dynamic balance ability in elderly people. in addition to toe flexion strength, we focused on hallux rom, hallux pain, and hallux valgus deformation. the participants were 106 ambulant elderly people who were participating in a community health service in september 2014. the exclusion criteria were data defective person and male. after excluding 28 people who fell under the exclusion criteria, there were 78 participants (mean and standard deviation, age 84.8 4.4 years, weight 46.3 7.0 kg, height 143.4 5.7 cm). subjects were included after obtaining informed consent, and the study protocol was approved by the ethics committee of seirei christopher university (approval number 15092). the toe functions thought to be related to dynamic balance ability were toe flexion strength, presence or absence of restricted hallux rom, presence or absence of hallux pain, and hallux valgus angle. researchers practiced measuring all the evaluation items before executing the measurements in the study. the data used in the study was from past measurements that were stored on a personal computer belonging to the principal investigator s institution. participants began the tugt sitting on the edge of a chair with armrests5. the test measures the time it takes a participant to stand up from the chair, walk to a mark 3 m away, walk back to the chair, and sit back down. repeat measurements were taken if there were major divergences in the measurements, or if the participant needed assistance to keep from falling. two measurements were taken after one practice test, and the mean value of the two measurements was recorded. in the fsst, four sticks are laid out in a cross to create four quadrants3. the participant made two trips around the quadrants, stepping over the sticks as quickly as possible going forward, backward, left, and right. the participant began in a standing position in the left - front quadrant, moves clockwise once around the quadrants, then makes a counterclockwise circuit of the quadrants. the time it takes the participant to make one round trip was measured with a stopwatch. during the test, the participant must stop with both feet together in each quadrant, being careful not to touch the sticks when walking over them. if the participant touches a stick or loses her balance and needs the assistance of a researcher, the test is repeated. two measurements were taken after one practice test, and the mean value of those was recorded. toe flexion strength was measured with a toe grip strength measurement device (tkk3361, takei scientific instruments co.)6. measurements were performed with the participant sitting on the edge of a chair with the hip and knee joints flexed to 90. a researcher held the participant s heel stable during the measurement. two measurements were taken after one practice test, and the mean value of the two measurements divided by body weight was recorded. metatarsophalangeal joint rom was measured with a goniometer, with the first metatarsal as the base axis and the first phalange as the moving axis. restricted metatarsophalangeal rom was defined as less than 75 rom, while 75 or greater was considered unrestricted. presence or absence of hallux pain was determined by asking the participants whether they experienced pain in the hallux during regular walking. absence of hallux pain was defined as having absolutely no pain during walking, while presence of pain was when even mild pain was experienced. the hallux valgus angle was measured as the angle formed by the lines tangent to the proximal medial portion and the distal medial portion of the first metatarsophalangeal joint on a footprint (bauerfeind). footprints were taken by having the participants place their feet on the footprint while in a sitting position, then standing up. age, knee extension strength, extremity skeletal muscle mass, and cognitive functions were considered confounding factors related to dynamic balance ability. measurements were performed with the participant sitting in a chair and the lower legs hanging down. the distal lower leg was then attached to a posterior support with a belt so the lower leg hung straight down. the participants performed isometric knee extensions at maximum exertion for about 3 s, and the maximum value during this time was recorded. extremity skeletal muscle mass was measured using an 8-point contact electrical impedance tomograph (kobe medi - care co. ltd). measurements of skeletal muscle mass were divided by the square of the participant s height (m) to obtain the skeletal muscle mass index (smi) (kg / m). cognitive functions were evaluated using the japanese version of the montreal cognitive assessment (moca - j)9. correlations between dynamic balance ability and toe functions were examined by calculating the correlation coefficients of the tugt and fsst results with toe flexion strength, presence or absence of restricted hallux rom, presence or absence of hallux pain, hallux valgus angle, age, knee extension strength, and extremity skeletal muscle mass using pearson product moment analysis and spearman rank correlation analysis. next, multiple regression analyses were performed with the tugt and fsst results as the objective variables, and toe flexion strength, presence or absence of restricted hallux rom, presence or absence of hallux pain, and hallux valgus angle as the explanatory variables. the analyses were adjusted for age, knee extension strength, and extremity skeletal muscle mass. in the multiple regression analyses, the influence of multicollinearity was examined beforehand, and it was confirmed that the correlation coefficients from a correlation matrix of the explanatory variables were r>0.90 or r<0.90, or that there were no variance inflation factors of 10 or higher. the step - wise method of multiple regression analysis was used. table 1table 1.characteristics of the participantsvariablemedianinterquartile rangeage (years)868288body mass index (kg / m)22.119.725.0timed up and go test (seconds)9.68.211.2four square step test (seconds)9.98.412.3knee extension strength (kgf / kg)0.240.200.34skeletal muscle mass index (kg / m)6.86.57.7japanese version of montreal cognitive assessment (point)211824toe flexion strength (kg)4.73.26.9hallux valgus angle (deg)11718 shows the participants characteristics. their median (interquartile range) age was 86 years (8288) and the tugt result was 9.6 s (8.211.2), indicating that while this was an elderly population, it had good dynamic balance ability. for toe functions, the hallux valgus angle was 11 (718), with few participants having angles of 20 or greater, and 7.7 percent of participants experienced hallux pain while walking, which indicated that toe dysfunction was mild in this population. 12.8 percent of participants had limitation of hallux of rom. the correlation analyses showed that the tugt results were significantly correlated with age, knee extension strength, moca - j score, and toe flexion strength, with correlation coefficients of 0.410, 0.355, 0.345, and 0.507, respectively (table 2table 2.coefficient of correlation of the dynamic balance and explanation variablevariabletimed up and go testfour square step testage0.4100.382knee extension strength0.3550.311skeletal muscle mass index0.1710.172japanese version of montreal cognitive assessment0.3450.329toe flexion strength0.5070.443presence or absence of restricted range of motion of the hallux0.1600.022presence or absence of hallux pain0.1910.169hallux valgus angle0.1100.147p<0.01. real number : age, knee extension strength, skeletal muscle mass index, montreal cognitive assessment, toe flexion strength, hallux valgus angle. dummy variable : presence or absence of restricted range of motion of the hallux (0 : presence, 1 : absence). presence or absence of hallux pain (0 : presence, 1 : absence)). for the fsst results, significant correlations were observed with age, knee extension strength, moca - j score, and toe flexion strength, with correlation coefficients of 0.382, 0.311, 0.329, and 0.443, respectively. p<0.01. real number : age, knee extension strength, skeletal muscle mass index, montreal cognitive assessment, toe flexion strength, hallux valgus angle. dummy variable : presence or absence of restricted range of motion of the hallux (0 : presence, 1 : absence). presence or absence of hallux pain (0 : presence, 1 : absence) the multiple regression analysis extracted toe flexion strength, age, and presence or absence of hallux pain as factors related to the tugt results. the standard partial regression coefficients of the final model were 0.400, 0.277, and 0.218, respectively (table 3table 3.results of multiple regression analysis for the dependent variable timed up and go testmodelvariablep valuecoefficient of determination adjusted for degrees of freedom1toe flexion strength0.4630.0010.2042toe flexion strength0.3990.0010.275age0.2890.0053toe flexion strength0.4000.0010.315age0.2770.005presence or absence of hallux pain0.2180.024dependent variable : timed up and go test. independent variables : age, knee extension strength, skeletal muscle mass index, montreal cognitive assessment (0 : 25 under, 1 : 26 over), toe flexion strength, presence or absence of restricted range of motion of the hallux (0 : presence, 1 : absence), presence or absence of hallux pain (0 : presence, 1 : absence), hallux valgus angle). the model combinations were toe flexion strength for model 1, toe flexion strength and age for model 2, and toe flexion strength, age, and presence of hallux pain for model 3. their coefficients of determination adjusted for degrees of freedom were 0.204, 0.275, and 0.315, respectively. toe flexion strength and age were factors extracted as related to the fsst results. the standard partial regression coefficients of the final model were 0.334 and 0.277, respectively (table 4table 4.results of multiple regression analysis for the dependent variable four square step testmodelvariablep valuecoefficient of determination adjusted for degrees of freedom1toe flexion strength0.3940.0010.1452toe flexion strength0.3340.0020.208age0.2770.010dependent variable : four square step test. independent variables : age, knee extension strength, skeletal muscle mass index, montreal cognitive assessment (0 : 25 under, 1 : 26 over), toe flexion strength, presence or absence of restricted range of motion of the hallux (0 : presence, 1 : absence), presence or absence of hallux pain (0 : presence, 1 : absence), hallux valgus angle). the model combinations were toe flexion strength for model 1, and toe flexion strength and age for model 2. their coefficients of determination adjusted for degrees of freedom were 0.145 and 0.208, respectively. independent variables : age, knee extension strength, skeletal muscle mass index, montreal cognitive assessment (0 : 25 under, 1 : 26 over), toe flexion strength, presence or absence of restricted range of motion of the hallux (0 : presence, 1 : absence), presence or absence of hallux pain (0 : presence, 1 : absence), hallux valgus angle dependent variable : four square step test. independent variables : age, knee extension strength, skeletal muscle mass index, montreal cognitive assessment (0 : 25 under, 1 : 26 over), toe flexion strength, presence or absence of restricted range of motion of the hallux (0 : presence, 1 : absence), presence or absence of hallux pain (0 : presence, 1 : absence), hallux valgus angle first, the toe flexion strength of community - dwelling elderly people was found to be independently related to dynamic balance ability, even following adjustments for age. the dynamic balance ability of elderly people is known to decline along with age. moreover, factors such as spinal kyphosis and flexion contracture of the hip and knee joints can cause the physical center of gravity to shift posteriorly, reducing usage of the forefoot and causing toe flexion strength to decline. in a previous study that examined the relationship between dynamic balance ability and toe flexion strength in community - dwelling elderly people, reduced dynamic balance ability was associated with lower toe flexion strength, which supports the findings of our study4. in a study of an approach that addressed toe functions to prevent falls in elderly people, our findings, which show a correlation between toe flexion strength and dynamic balance ability, provide further evidence to suggest that toe interventions could contribute to improving dynamic balance. second, while toe flexion strength and hallux pain were related to the tugt results among community - dwelling elderly people, the impact of toe functions on dynamic balance ability was small. in a previous study that examined how falls correlate with toe functions and foot functions among elderly people, falls were associated with hallux valgus and severe foot pain10. however, the influence of toe functions on the tugt and fsst results in the present study went from approximately 15 to 25 percent following adjusting for age, suggesting toe functions have little impact on dynamic balance ability. most of the participants in the present study did not experience pain while walking, few had severe hallux valgus, and few had other toe problems or disease. a study that examined the correlations of falls with common foot problems, such as skin inflammation and ingrown nails, found no direct correlation between foot problems and fall incidence, which is along the same lines as our findings11. the correlation between toe functions and dynamic balance ability in community - dwelling elderly people suggests that improving toe functions could help increase dynamic balance ability. however, the effect of interventions that only address toe functions would likely be limited for elderly people with mild toe dysfunction. approaches that address not only the toes, but trunk functions, the ankles, hips, and other leg joints should be investigated for improving the dynamic balance ability of elderly people. first limitation, the participants of this study were elderly people who were voluntarily participating in a community health service, meaning they had high awareness of their own well - being. elderly participants who participate in a community health service often have high levels of physical functions ; hence, care should be taken when generalizing these results. second limitation, the items used to evaluate the toe functions that relate to dynamic balance were insufficient. our examination of the correlation between dynamic balance ability and toe functions mainly focused on hallux functions, and did not consider the impact of factors such as mobility or deformation of the second to fifth toes., we examined correlations between toe functions and dynamic balance ability in community - dwelling elderly people. the results showed that toe flexion strength and hallux pain correlated with tugt results, and toe flexion strength correlated with fsst results, though for both, the impact on dynamic balance ability was small. while improving toe functions could help improved dynamic balance ability among community - dwelling elderly people, the therapeutic effect of interventions that only address toe functions would likely be limited for elderly people with mild toe dysfunction. | [purpose ] the purpose of this study was to examine the toe function of elderly people and the association with the dynamic balance ability for the developing effective fall - prevention measures. [subjects and methods ] seventy - eight participants in a community health service were included in this cross - sectional study. the timed up and go test and four square step test were used to test dynamic balance ability. the toe functions related to dynamic balance ability were toe flexion strength, presence or absence of restricted range of motion of the hallux, presence or absence of hallux pain, and hallux valgus angle. [results ] factors related to the timed up and go test results were toe flexion strength, age, and presence or absence of hallux pain. their standard partial regression coefficients were 0.400, 0.277, and 0.218, respectively. factors related to the four square step test results were toe flexion strength and age. their standard partial regression coefficients were 0.334 and 0.277, respectively. [conclusion ] toe functions appear to have little impact on dynamic balance ability in elderly people who have mild toe dysfunction. approaches that address not only the toes, but trunk functions, and other leg joints should be investigated for improving the dynamic balance ability. |
albumin transports both fatty acids and zinc in plasma. competitive binding studied by isothermal titration calorimetry revealed that physiologically relevant levels of fatty acids modulate the zn - binding capacity of albumin, with far - reaching implications for biological zinc speciation. the molecular mechanism for this effect is likely due to a large conformational change elicited by fatty acid binding to a high - affinity interdomain site that disrupts at least one zn site. albumin may be a molecular device to translate certain aspects of the organismal energy state into global zinc signals. |
|
blood transfusion therapy (btt) is the transplantation of living cells and thus includes several risks, such as infection, inflammation, and undesirable immuno - chemical reactions. btt should be thought of as having been derived from precious material, thanks to the courtesy of donors. the proper use of blood products and strict indications for btt must be carefully considered. however, patients with severe trauma with hemorrhagic shock always require an immediate massive blood transfusion in order to survive. patients with blunt traumatic cardiopulmonary arrest on arrival at the hospital (bt - cpa) usually suffer from lethal hemorrhage and require a rapid supplement of red blood cells to resuscitate circulation and oxygen transport. however, it is known that bt - cpa patients have a very low chance of survival, even when given sufficient btt to compensate for the blood loss. the aim of this study was to evaluate the appropriateness of our strategy concerning btt for bt - cpa patients. we retrospectively examined the medical records of consecutive patients with bt - cpa and the treatments, including blood transfusion, administered to them at our hospital over the past 10 years. patients whose treatment was started on the scene by an organized medical team including doctors were excluded. until 1998, we used packed red cells (prc) without any restrictions for bt - cpa patients, regardless of the return of spontaneous circulation (rosc), if we thought it necessary to use these blood products. during this period of time, the administration of these treatments might have been biased based on the suspected chance of survival, i.e., based on the victim 's age, a suspiciously relatively small quantity of blood loss, the co - existence of a pneumothorax or hemothorax, or the interval of time from the event (i.e., brief). however, we could not evaluate the details of the anatomical injuries of all bt - cpa patients because we did not perform sufficient imaging to obtain findings, resulting in incomplete descriptions of their iss. in addition, we could not accurately evaluate pneumothorax because we usually performed emergency department thoracotomy just after arrival at the emergency department (ed). after 1999, we used prc on a case - by - case basis, but only after rosc in principle. the study period was divided into the following two intervals : the first period was from 1995 - 1998 and the second from 1999 - 2004. to clarify the effect of the treatment strategy regarding btt before rosc during cpr on the outcome of bt - cpa, the success rates of rosc, admission to the icu (or directly to the operating room or angiography room) after rosc, and survival - to - discharge were compared between these two periods. to clarify the effect of btt before rosc on the outcome of bt - cpa, these rates were compared within the first period between the group of patients who underwent btt (btt group) and the group who did not undergo btt (non - btt group) before rosc. the study was conducted in a part of yokohama city in the yokohama triage and transfer system for cpa patients, which serves all out - of - hospital cases of cpa of traumatic and non - traumatic origin. yokohama is the second - largest city in japan (with a surface area of 434 km and a population of 3.37 million), and our institute is located in the city center. we selected 11 hospitals, including our hospital, which had eds that could receive and treat all patients with traumatic and non - traumatic cpa, independent of their capacity and without any exceptions. one emergency director (medical doctor), who works for the city 's fire department, co - ordinates the activities of ambulance crews, including emergency life - saving technicians (elst), and oversees the transfer of cpa patients to the nearest of the 11 selected hospitals.[46 ] in yokohama, for each hospital, all cpa patient data are population - based. under our ems system, the response interval (the time between the ambulance 's departure from the fire station to its arrival at the scene) for cpa cases is 6.0 minutes (2.3 km in distance), the on - scene interval for cpa cases (the interval between the arrival at the scene and the departure from it) is 12.9 minutes, and the interval from the departure from the scene to arrival at the ed is 7.2 minutes (4.6 km), on an average. to evaluate the statistical differences between the first and second periods and between the btt and non - btt groups, we used the student 's t test and test. to evaluate the statistical differences between the first and second periods and between the btt and non - btt groups, we used the student 's t test and test. in 464 bt - cpa patients (175 in the first period and 289 in the second period), 44.6% achieved rosc, 22.9% were admitted to the icu, 3.4% survived to discharge in the first period and 28.0%, 14.9% and 2.4% in the second period, respectively. in the first period, prc were used for 29 non - survivors (139 units for 23 cases without rosc, 6 units for 3 cases with rosc without admission, and 18 units for 3 cases with admission) before their rosc. in the second period the mean age of the cases in the first period was 46.1 years old and that of the second period was 42.3 years old ; the former group was statistically older than the latter (p = 0.05). witnessed cpa, cpa after the scene, and cpa with some cardiac rhythm on the scene were 78.9%, 22.9%, and 39.4% in the first period and 76.8%, 18.3%. and 32.5% in the second period, respectively, and there were no statistical differences. the mean time interval between the event and arrival at the ed were 24.1 minutes in the first period and 27.9 minutes in the second period ; the former was statistically shorter than the latter (p = 0.02). the mean time interval between arrival at the ed and rosc of 81 patients in the first period was 13.9 minutes and that of 78 patients in the second period was 11.8 minutes ; there was no statistical difference. in the first period, 29 achieved rosc within 10 minutes (37.2% of 78 patients with rosc) and 36 in the second period (44.4% of 81 patients with rosc). the background and the number of cases with rosc, cases admitted into icu and surviving cases in whole cases, witnessed cpa cases, cpa after scene and cpa on the scene with electrical cardiac rhythm ; the first period and the second period with respect to the effect of the btt strategy on the outcome of bt - cpa in all cases, the success rate of rosc and admission to the icu were statistically higher in the first period than in the second (p = 0.0003 and 0.0298). however, there was no statistical difference in the rate of survival - to - discharge between the first and second periods. in cases in which rosc was successful the same tendency was observed in the witnessed cases. in cases with some electrical rhythm on the electrocardiogram (ventricular fibrillation or pulseless electrical activity) on the scene, only the rate of rosc was statistically higher in the first period than in the second period (p = 0.0094). however, there was no statistical difference in all prognostic parameters in cases with cpa occurring after the scene of the injury [table 1 and figure 1 ]. the differences of the rate of successful rosc, admission (adm.) into icu, and survival - to - discharge (surv.) between the first and the second period, (a) the rate against all cases and (b) restricted in cases with successful rosc, the rate of cases with admission and surviving cases against the cases with rosc in the first period alone, the success rate of rosc was statistically higher in the non - btt group than in the btt group in all cases and in the witnessed cases (p = 0.0046 and 0.0048). however, there was no statistical difference in the rate of admission to the icu and survival - to - discharge between these groups. in the cases after successful rosc the mean time interval between the event and arrival at the ed were 24.4 minutes in the non - btt group and 22.6 minutes in the btt group. the mean time interval between arrival at the ed and rosc of 72 patients with rosc of the non - btt group were 12.6 minutes and that of 6 patients of the btt group was 29.0 minutes. twenty - seven achieved rosc within 10 minutes in the non - btt group (37.5% of 72 patients with rosc) and one in the btt group (16.7% of 6 patients with rosc) [table 2 and figure 2 ]. the background and the number of cases with rosc, cases who admitted into icu and surviving cases in whole cases, witnessed cpa cases, cpa after scene and cpa on the scene with electrical cardiac rhythm ; the btt group and the non - btt group in the first period the differences of the rate of successful rosc, admission (adm.) into icu, and survival - to - discharge (surv.) between the btt group and non - btt group, (a) the rate against all cases and (b) restricted in cases with successful rosc, the rate of cases with admission and surviving cases against the cases with rosc the survival rate of bt - cpa is poor, reportedly only 0% to 3.7%.[711 ] some authorities consider resuscitation treatment of this patient group, including aggressive infusion, resuscitation thoracotomy, and btt, to be futile and inappropriate. the national association of ems physicians standards and clinical practice committee and the american college of surgeons committee on trauma have published guidelines for withholding or terminating resuscitation attempts in pre - hospital traumatic cardiopulmonary arrest (naemsp / acscot guidelines) in a joint position paper. according to these guidelines, some treatment efforts to resuscitate bt - cpa patients seemed to be futile. however, it has been reported that some survivors, who were not to be resuscitated if they were evaluated according to the naemsp / acscot guidelines, and these guidelines do not address the effectiveness or futility of btt for bt - cpa. btt is a useful but risky treatment for hemorrhagic shock patients, and may worsen the outcomes of some categories of patients. recently, the german trauma society suggested that massive blood transfusion of more than 10 units of prc was one of the highest risk factors for the mortality of patients with bt - cpa. however, this report did not show any benefit or risk of btt before rosc during cpr in bt - cpa patients in terms of rosc, icu admission, or survival - to - discharge. our study did not show any benefit of btt for the survival - to - discharge of bt - cpa patients, although it showed the possibility that the success rate of rosc can be improved. our historical case series showed some benefit of a treatment strategy with btt before rosc in the success rate of rosc and in admission to the icu. there was no fundamental difference in our treatment concepts and strategy for bt - cpa before rosc between the first and second periods, except btt before rosc during cpr. on the other hand, during the second period there were many improvements in terms of knowledge and instruments in the fields of emergency medicine, traumatology, and intensive care that had not been common and standard during the first period. despite these developments, the success rate of rosc and admission to the icu were worse in the second period in which we did not perform btt before rosc than in the first period in which we did. if we adopt the rate of survival - to - discharge as the primary outcome, then we have to conclude that treatment strategies for bt - cpa that include btt before rosc are futile. our data also showed that although the treatment strategy of btt before rosc improved the success rate of rosc, whether btt was used before rosc or not during cpr did not affect the outcome in cases in which rosc was achieved. although btt strategies after rosc were the same in both periods, we could not evaluate the effect of btt after rosc because we could not differentiate btt after rosc from btt performed during hospitalization from admission to discharge, particularly in surviving cases. against our expectation, our study in the first period concerning the relationship between btt before rosc and patient outcomes showed that btt itself did not improve the success rate of rosc, admission to the icu, or survival rate. during this period, physicians freely selected btt if they felt it was necessary, and there was no protocol and no restrictions for performing btt, resulting in the tendency to perform btt for severer patients not expected to achieve rosc and survive - to - discharge. in fact, the mean time interval between the event and arrival at the ed was longer in the btt group than in the non - btt group, which might mean the patients in the btt group were more severely injured and could achieve rosc after long cpr, even with btt. however, we did not and could not perform btt for patients who achieved rosc very shortly after arrival at the ed before deciding and performing btt. and they were expected to have a better prognosis because their quick rosc and short collapse. the patients with a better prognosis in the non - btt group might increase the rate of rosc and the survival rate. in this study, some patients achieved rosc after just a short cpr in the non - btt group, and underwent btt after rosc. under the free btt concept in the first period, it is possible that btt was performed even for patients who archived rosc after long cpr without btt and without noticing appropriate hemostatic procedures. it is also possible that btt was not performed even after rosc in the second period, because the strategy physicians followed during that period was to restrict using btt before rosc because it was futile to do so. although the strategies for btt after rosc were basically the same in the first and second periods, btt was performed only for bt - cpa patients with a higher expectancy of survival in some cases. we reported in our previous study that the prognosis of bt - cpa with some cardiac rhythm on the scene and with a shorter interval between the event and arrival at the ed was better. patients with a poor prognosis in the non - btt group might have decreased the success rate of rosc and survival rate in this study. however, we were not able to show these biases between the first and second periods and between the non - btt and btt groups. in any case, we concluded that btt before rosc during cpr does not improve the survival rate of bt - cpa, and may in fact be futile. the data presented here shows that btt before rosc itself is futile, but that a strategy that includes btt before rosc can improve the success rate of rosc, and increase admission to the icu. there may have been an emotional bias in these two periods ; in other words, in the first period, we treated bt - cpa patients more aggressively with btt without sufficient evaluation of the possibility of survival, while in the second period, we gave up resuscitating patients during the early phase of treatment because use of btt was restricted. because it is difficult to complete a controlled prospective study for such critical and rare cases as bt - cpa, this study has several limitations. first, the prognosis of bt - cpa is extremely poor, and it is thus difficult to compare the survival rate as the primary endpoint between two periods or between non - btt and btt groups. second, we did not consider the effect of btt after rosc in both periods. third, our indication of btt before rosc during cpr in the first period was relative, resulting in a great difference between the condition and background of the two groups. moreover, patients with quick rosc could not undergo btt before rosc if we thought it necessary to perform btt for them. btt is one of the most effective therapies for exsanguination, anemia, thrombocytopenia, and coagulopathy. however, it is one of the riskiest treatments because it is a type of transplantation of raw material containing living cells. moreover, it should be thought of as a treatment strategy using very precious material made available through voluntary self - sacrifice, and its utilization should be restricted. we must responsibly preserve and properly redistribute these precious resources. although we appeared to waste prc in the first period, after the second period, we narrowed the indications for btt, resulting in comparably proper use. however, it is still necessary to perform appropriate and active resuscitation for bt - cpa patients, and to do our utmost to save their lives. other guidelines should be developed on the appropriate use of prc, to avoid wasting these precious blood products. our retrospective consecutive study shows the possibility that btt before rosc for bt - cpa and a treatment strategy that includes these treatments improves the success rate of rosc, but not the survival rate. btt is thought to be futile as a treatment for bt - cpa before rosc. | background : blood transfusion therapy (btt), which represents transplantation of living cells, poses several risks. although btt is necessary for trauma victims with hemorrhagic shock, it may be futile for patients with blunt traumatic cardiopulmonary arrest (bt - cpa).materials and methods : we retrospectively examined the medical records of consecutive patients with t - cpa. the study period was divided into two periods : the first from 1995 - 1998, when we used packed red cells (prc) regardless of the return of spontaneous circulation (rosc), and the second from 1999 - 2004, when we did not use prc before rosc. the rates of rosc, admission to the icu, and survival - to - discharge were compared between these two periods.results:we studied the records of 464 patients with bt - cpa (175 in the first period and 289 in the second period). although the rates of rosc and admission to the icu were statistically higher in the first period, there was no statistical difference in the rate of survival - to - discharge between these two periods. in the first period, the rate of rosc was statistically higher in the non - btt group than the btt group. however, for cases in which rosc was performed and was successful, there were no statistical differences in the rate of admission and survival - to - discharge between the first and second group, and between the btt and non - btt group.conclusion:our retrospective consecutive study shows the possibility that btt before rosc for bt - cpa and a treatment strategy that includes this treatment improves the success rate of rosc, but not the survival rate. btt is thought to be futile as a treatment for bt - cpa before rosc. |
the peptide hormone gastrin plays a central role in gastric acid secretion (edkins 1906), differentiation of the gastric mucosa (koh. 1997), maintenance, homeostasis, and epithelial organization of the cells in the gastric mucosa (dockray. 2001). in addition to its role in regulation of normal physiological processes, gastrin may also be an important player in gastric carcinogenesis (watson. gastrin is shown to exert growth - promoting effects in both normal and malignant gastrointestinal tissues like the oxyntic mucosa (wang. several studies have demonstrated that gastrin stimulates growth of human gastric cell lines (ishizuka. 1992), pancreatic cell lines (seva. 1990 ; smith. 1994), and human and mouse colonic tumors (smith. 1993). 2002) have used a co - culture system to show that gastrin causes suppression of proliferation in cells expressing the gastrin receptor, cck2r, and a subsequent activation of proliferation in cells that do not express these receptors. they demonstrate that these signals are transferred via paracrine activation of the epidermal growth factor receptor (varro.. however, the growth - regulatory mechanisms are complex since gastrin also has been found to have both growth - promoting and inhibitory effects in different cells and cell lines expressing cck2r (smith. in addition to its growth - promoting effects, gastrin may also induce oncogenic transformation via increased cell migration (noble. 2003), invasion (wroblewski. 2002), and circumvention of apoptosis (todisco. 2001 ; fjeldbo. 2012). the ambiguous responses to gastrin indicate that gastrin plays pivotal roles in the regulation of many cellular processes, and the overall response to gastrin is governed by multiple intricate mechanisms. to investigate the molecular mechanisms underlying gastrin - mediated cellular responses in a genome - wide approach, we carried out several time - series gene expression microarray studies covering the first 1424 h of gastrin response in rat pancreatic ar42j cells. the studies identify a number of gastrin - responsive genes, many of which have not previously been described to be regulated by gastrin (e - mtab-123 and gse32869). in the present study, we focus on one of the new gastrin target genes based on its possible roles in cellular proliferation : mitogen activated protein kinase kinase 1 interacting protein 1 (map2k1ip1, mek partner 1, lamtor3, or mp1). mp1 was first identified as a scaffold protein enhancing the efficiency of the mapk pathway by facilitating the interaction between mek1 and erk1 upon serum stimulation (schaeffer. later, it has been demonstrated that mp1 enhances activation of both erk1 and erk2 as a response to egf (teis. mp1 is recruited to late endosomes by the adaptor protein p14 (teis. 2002), and the protein complex p14mp1mek1 is involved in regulating endosomal trafficking and cellular proliferation during tissue homeostasis (teis. mp1 has also been found to regulate cell spreading by integrating pak1 and rho signals (pullikuth. a recent report has unmasked a novel lipid raft adaptor on late endosomes, p18, which controls endosome dynamics by anchoring p14mp1 in complex with mek1 and erk1 to the membranes of late endosomes (nada. the present study demonstrates that gastrin induces proliferation in a dose - dependent manner and suggests a role of mp1 in regulation of proliferation via cck2r and erk1/2 signaling in gastric epithelial ags - gr cells. ags (human gastric adenocarcinoma, atcc, rockville, md) and ags - gr cells (ags stably transfected with the cck2 receptor (watson. a. varro, university of liverpool, england) were grown in ham 's f12 (invitrogen, carlsbad, ca) supplemented with 10% fetal calf serum (fcs ; euroclone, devon, uk), 10 u / ml penicillin streptomycin (invitrogen), and 2 g / ml puromycin (sigma chemical, st. ar42j (rat pancreatic acinar cell - derived ; atcc) were grown in dmem with 4.5 g / l glucose (invitrogen), 15% fcs, 1 mm sodium pyruvate (invitrogen), 0.1 mg / ml l - glutamine (invitrogen), 10 u / ml penicillin / streptomycin (invitrogen), and 1 g / ml fungizone (invitrogen). adherent cell proliferation was measured in a label - free, real - time manner using xcelligence technology. this system utilizes specialized culture plates that contain gold electrode arrays at the bottom of individual wells (roche applied science). this impedance value is measured by the rtca sp system and is reported in the dimensionless unit of cell index. the day before seeding, sub - confluent cells were split 1:2 in order for cells to be in exponential growth phase at the time of seeding for xcelligence analysis. prior to seeding of cells in the 96-well e - plate, 50 l plain medium was added to wells, and background read was recorded. wild - type ags and ags - gr cells were split, and 5 10 cells in 100 l medium were added to each well. finally, 50 l medium containing gastrin to 0.1100 nm or 100 ng / ml human recombinant egf (sigma) final concentration in either absence or presence of 10% serum was added to the cells. real - time monitoring of cell proliferation measured as cell index was recorded every 5 min for up to 70 h. total rna from 6-well plates was isolated using rneasy mini kit (qiagen, germantown, md) according to the manufacturer 's protocol. cdna synthesis was performed with 1 g of total rna in a 20-l reaction of reverse - it first strand synthesis kit according to the manufacturer 's instruction (abgene, rockford, il). after synthesis, sybr green real - time pcr was run in 1x absolute qpcr sybr green mix (abgene) with 70 nm of each primer and cdna equivalent to 31.3 ng total rna. real - time pcr was performed in stratagene 's mx3000p real - time pcr system : 15 min at 95c, 40 thermal cycles of 15 s at 95c, 1 min at 5660c, and 30 s at 72c. fold induction levels were calculated using the ct - method (livak and schmittgen 2001). human - mp1 s : 5-accaggtggttcaatttaatcg-3, human - mp1 as : 5-cttcaaacaatggagcaagttc-3, human - gapdh s : 5-tctgacttcaacagcgacacc-3, human - gapdh as : 5-tgttgctgtagccaaattcgt-3, rat - mp1 s : 5-aagttgccaagcgttgaagg-3, rat - mp1 as : 5-ggcgaaagtggacaagaag-3, rat -actin s : 5-ctggctcctagcaccatga-3, and rat -actin as : 5-agccaccaatccacacaga-3. for transfection with sirnas, ags - gr cells (2 10) were seeded in 6-well plates. the cells were transfected 24 h after seeding using 2.5 g (81 nm) sirna and 12.5 l metafectene pro (biontex, martinsried / planegg, germany) diluted in ham 's f12 in accordance with manufacturer 's protocol. human sirna oligonucleotides were purchased from ambion (carlsbad, ca) : simp1 (id#138573), sicycd1 (id#42828), and silencer negative control sirna#1 (sictr). cells growing in 6-well plates were harvested and subjected to western blot analysis as described previously (steigedal. binding of secondary antibodies was visualized by the supersignal west femto detection system (pierce, rockford, il) and kodak image station 2000r (kodak, pittsburgh, pa). the following antibodies were used : rabbit anti - mouse mp1 (gift from prof. a. catling), mouse anti human p - erk1/2 (santa cruz biotechnology, santa cruz, ca), mouse anti - human -actin (abcam, cambridge, uk), rabbit anti - human gapdh (santa cruz), hrp - conjugated goat anti - rabbit igg (cell signaling, danvers, ma), and hrp - conjugated goat anti - mouse (dako, glostrup, denmark). cells (2 10) were seeded in 6-well plates and transfected the following day. twenty - four hours after transfection, the cells were treated with 10 nm gastrin without medium replacement. the cells were stimulated for 24 h before they were harvested and subjected to cell cycle analysis according to a modified version of the vindelov protocol (vindelov. the nuclei were filtered through a 40-m nylon mesh and subjected to a bd facs lsrii flow cytometer (bd biosciences). quantitative rt - pcrs were run three times, with three technical replicates in each run and data presented as mean sd. flow cytometry experiments were performed three times and data presented as mean sd. gastrin may mediate proliferation, differentiation, or apoptosis depending on cell type, tissue, and organ (seva. 1993, 1994 ; wang. 1996 ; detjen. 1997a, b ; wang. 2000 ; varro. 2002 ; muerkoster. we wanted to employ the gastric cell line ags - gr, overexpressing cck2r, to study mechanisms involved in gastrin - mediated proliferation. reports in the literature are conflicting with regard to the ability of gastrin to induce proliferation in cell lines. (2002) observed an inhibitory effect of gastrin - mediated proliferation on ags - gr cells. there are also reports demonstrating both stimulation and inhibition of proliferation via cck2r in ar42j cells (bestervelt. 2000 ; hofsli., we were able to study the complete proliferative response to gastrin in a real - time manner. we investigated the effect of gastrin in cells subjected to a variety of stimulation conditions. ags - gr cells were treated with several different gastrin concentrations in either absence (fig. 1b) of serum, and proliferation was measured with real - time cell index as output. we observed a dose - dependent proliferative effect when cells were treated with gastrin both in absence and presence of serum. wild - type ags cells (without cck2r) did not show any response to gastrin, suggesting that the observed effect was mediated via the cck2r. we (hofsli. 2002) and others (bestervelt. 2000) have previously shown that gastrin promotes proliferation of ar42j cells, and varro. (2002) have shown a growth inhibitory effect of gastrin in ags - gr cells. our findings are in keeping with the assumption that gastrin exhibits both proliferative and anti - proliferative properties depending on the cell type as well as the cell state at the onset of gastrin treatment, but the assay for monitoring proliferation may also be important as real - time monitoring gives a better picture than classical end - point proliferation assays.figure 1.xcelligence proliferation assay of wild - type ags and ags - gr cells in response to gastrin. ags and ags - gr cells were seeded in 96-well e - plates for xcelligence assay monitoring impedance (cell index). the cells were treated with either 10% fcs or 100 ng / ml egf as controls or gastrin at different concentrations (0.1, 1, 10, or 100 nm) in either absence or presence of serum. (a) complete growth curves of ags and ags - gr cells from 0 to 70 h after seeding. panel to the right shows bar graph of cell index at 24 h growth. (b) complete growth curves of ags and ags - gr cells from 0 to 70 h after seeding. panel to the right shows bar graph of cell index at 24 h growth. xcelligence proliferation assay of wild - type ags and ags - gr cells in response to gastrin. ags and ags - gr cells were seeded in 96-well e - plates for xcelligence assay monitoring impedance (cell index). the cells were treated with either 10% fcs or 100 ng / ml egf as controls or gastrin at different concentrations (0.1, 1, 10, or 100 nm) in either absence or presence of serum. (a) complete growth curves of ags and ags - gr cells from 0 to 70 h after seeding. panel to the right shows bar graph of cell index at 24 h growth. (b) complete growth curves of ags and ags - gr cells from 0 to 70 h after seeding. panel to the right shows bar graph of cell index at 24 h growth. our whole genome microarray gene expression screening indicated that the gastrin - responsive gene mp1 is an early response primary gastrin target gene that is upregulated within 4 h after onset of gastrin treatment in pancreatic ar42j cells (e - mtab-123 and gse32869). in order to validate the time profile observed by microarray analysis, expression of mp1 the results showed increasing mp1 levels up to 2 h of gastrin treatment, followed by sustained mrna levels up to 6 h in ar42j cells (fig. in ags - gr cells, the peak expression for mp1 was at 4 h followed by a rapid decrease (fig. mp1 protein expression assessed by western blot in ags - gr cells showed a continuous increase up to 810 h of gastrin treatment (fig. 2c). together, these results demonstrate that mp1, previously not described in the gastrin response, is induced by gastrin in a relatively comparable manner in both ar42j and ags - gr cells.figure 2.gastrin-mediated activation of mp1 in ar42j and ags - gr cells. (a) verification of gene expression microarray results with quantitative rt - pcr in ar42j. cells were seeded in 6-well plates and serum starved for 24 h the following day prior to treatment with gastrin (10 nm) as indicated in figure. (b) quantitative rt - pcr analysis of mp1 expression in ags - gr. cells were seeded in 6-well plates and cultivated 24 h prior to gastrin treatment (10 nm) as indicated in figure. fold induction levels were calculated using the ct - method (livak and schmittgen 2001), where the expression levels were normalized to the level of -actin (ar42j) or gapdh (ags - gr) expression, and gastrin - treated cells were compared to untreated cells. one representative experiment is shown and data presented as mean sd of three technical replicates. (c) western blot of ags - gr lysates from cells treated with 10 nm of gastrin 210 h before harvesting. the blot was treated with non - commercial antibodies against mp1, and -actin was used as loading control. (a) verification of gene expression microarray results with quantitative rt - pcr in ar42j. cells were seeded in 6-well plates and serum starved for 24 h the following day prior to treatment with gastrin (10 nm) as indicated in figure. (b) quantitative rt - pcr analysis of mp1 expression in ags - gr. cells were seeded in 6-well plates and cultivated 24 h prior to gastrin treatment (10 nm) as indicated in figure. fold induction levels were calculated using the ct - method (livak and schmittgen 2001), where the expression levels were normalized to the level of -actin (ar42j) or gapdh (ags - gr) expression, and gastrin - treated cells were compared to untreated cells. one representative experiment is shown and data presented as mean sd of three technical replicates. (c) western blot of ags - gr lysates from cells treated with 10 nm of gastrin 210 h before harvesting. the blot was treated with non - commercial antibodies against mp1, and -actin was used as loading control. mp1 has been shown to be involved in activation of both erk1 and erk2 (schaeffer. 2005). since gastrin is known to induce phosphorylation of erks (seufferlein. 1995), it was of interest to investigate the functional role of mp1 in the gastrin response. we therefore assessed gastrin - induced phosphorylation of erk1 and erk2 in ags - gr cells in the presence or absence of sirna targeting mp1. the results showed that in cells treated with simp1, gastrin induced markedly lower levels of both erk1 and erk2 phosphorylation compared to cells treated with control sirna at all time - points analyzed (fig. the results demonstrate for the first time that mp1 is involved in gastrin - induced activation of the mapk pathway. this finding supports our hypothesis that mp1 is an important factor in gastrin - induced activation of processes downstream of the mapk pathway.figure 3.mp1 depletion reduces gastrin - induced phosphorylation of erk1 and erk2 (p - erk1/2). (a) ags - gr cells were transfected with simp1 and sictr for 24 h. then, the cells were serum starved for 24 h and treated with 10 nm gastrin for 5 to 30 min before harvesting. protein extracts were subjected to sds - page and analyzed for p - erk1 and p - erk2 in addition to gapdh (loading control). (b, c) densiometric analysis of relative amounts of p - erk1 and p - erk2, respectively. mp1 depletion reduces gastrin - induced phosphorylation of erk1 and erk2 (p - erk1/2). (a) ags - gr cells were transfected with simp1 and sictr for 24 h. then, the cells were serum starved for 24 h and treated with 10 nm gastrin for 5 to 30 min before harvesting. protein extracts were subjected to sds - page and analyzed for p - erk1 and p - erk2 in addition to gapdh (loading control). (b, c) densiometric analysis of relative amounts of p - erk1 and p - erk2, respectively. the mapk pathway is central for cell proliferation (hill and treisman 1995). since mp1 enhanced gastrin - induced activation of erk1 and erk2, and gastrin - mediated signaling is shown to be transduced via the mapk pathway (stepan. 1999), we investigated whether mp1 may be involved in gastrin - induced cell cycle regulation. we performed cell cycle analysis using flow cytometry on ags - gr cells in the presence or absence of simp1. sicycd1 was included as a positive control since cyclin d1 is known to be required for g1/s transition (baldin. the cell cycle profile in sicycd1-treated cells showed, as expected, a lower proportion of s - phase cells compared to controls in both untreated and gastrin - treated cells (20.2% and 24.3%, respectively ; fig. similarly, mp1 depletion induced g1 cell cycle arrest in both untreated and gastrin - treated cells. the proportion of s - phase cells in gastrin - treated simp1-transfected samples versus sictr - transfected was 22.5% and 31.7%, respectively. in untreated cells, for all sirna treatments, we observed that gastrin was a strong enhancer of proliferation, and neither sicycd1 nor simp1 treatment was able to circumvent this effect, as reflected in the fact that the overall fold change of cells in s - phase before and after gastrin treatment was not altered in cells treated with simp1 or sicycd1 compared to controls. our results showing that mp1 depletion induces g1 cell cycle arrest to a similar extent as cyclin d1 depletion indicate that mp1 plays a role in regulation of proliferation, but this effect is not restricted to proliferation induced by gastrin. the fact that single - gene knockdown of essential cell cycle genes does not halt proliferation is in keeping with other studies (kozar and sicinski 2005).figure 4.mp1 enhances cell cycle progression. ags - gr cells were grown and treated with sictr, simp1, or sicycd1. cells were treated with 10 nm gastrin without medium replacement 24 h after transfection and then grown for another 24 h. finally, the cells were harvested in citrate buffer and treated with buffers a, b, and c according to a slightly modified version of the vindelov protocol (vindelov. 1983). the proportion of cells in s - phase of the cell cycle in untreated (black) and gastrin - treated (red) bars. representative histograms are shown, and data is presented as percent cells in s - phase mean sd (n = 3). using qrt - pcr, mp1 depletion ags - gr cells were grown and treated with sictr, simp1, or sicycd1. cells were treated with 10 nm gastrin without medium replacement 24 h after transfection and then grown for another 24 h. finally, the cells were harvested in citrate buffer and treated with buffers a, b, and c according to a slightly modified version of the vindelov protocol (vindelov. 1983). the proportion of cells in s - phase of the cell cycle in untreated (black) and gastrin - treated (red) bars. representative histograms are shown, and data is presented as percent cells in s - phase mean sd (n = 3). using qrt - pcr, mp1 depletion the purpose of the present study was to enhance our knowledge of molecular mechanisms by which gastrin regulate proliferation. gastrin has been shown to display proliferative, anti - apoptotic, and anti - proliferative properties, dependent on cell type, tissue, or context (yassin 1999 ; dockray. 2005 ; watson. we show that gastrin induces proliferation in ags - gr cells in a dose - dependent manner. we recently identified mp1 to be among a large number of new gastrin target genes (e - mtab-123 and gse32869), many of which may be involved in gastrin - mediated proliferation. here, we show that mp1 is necessary for gastrin - induced phosphorylation of erk1 and erk2 and that it may be involved in mediating gastrin - induced proliferation of ags - gr cells. the present study reports for the first time evidence indicating that mp1 is involved in gastrin - mediated responses coupled to proliferation and possibly carcinogenesis. mp1 was first identified to be a scaffold protein enhancing the efficiency of the mapk pathway in response to serum stimulation in cos-1 cells (schaeffer. 1998), and later, mp1 was shown to be involved in endosomal trafficking of egf receptor and cell proliferation in mice (teis. further investigations on mp1 have also revealed its role in positive regulation of fibroblast cell spreading on fibronectin in vitro (pullikuth. 2005). our findings, demonstrating that mp1 is involved in gastrin - induced phosphorylation of erk1 and erk2, are in keeping with previous findings on its molecular function in growth stimulatory responses (pullikuth. 2005 ; teis. indeed, the observation that sirna knockdown of mp1 induced g1 cell cycle arrest to a similar extent as the positive control, cyclin d1, strongly suggests that mp1 is a positive regulator of gastrin - induced cell cycle entry. taken together, our results indicate that gastrin - mediated activation of the mapk pathway, which is known to be required for its induction of proliferation (stepan. 1999), involves facilitation of the phosphorylation of erk1 and/or erk2 by mp1 scaffold activity. our finding that mp1 depletion induces cell cycle arrest completes the picture of mp1 as a significant factor in regulation of proliferation. addition of gastrin increased the proportion of s - phase cells in simp1-transfected cells, but not completely to the same level as in untreated sictr - transfected samples. recently, pak1 was identified to be involved in gastrin signal transduction, as it was found to be required for gastrin - induced activation of the -catenin pathway (he. in addition, activation of the -catenin pathway is shown to increase expression of genes like c - myc and cyclin d1 (he., the findings that pak1 is involved in gastrin - mediated signaling and that mp1 regulates cell spreading via pak1 signals (pullikuth. 2005) suggest that pak1 and mp1 may participate in the same pathway, integrating signals leading to gastrin - induced cellular responses. further studies could therefore focus on the role of mp1 in gastrin - mediated signaling via pak1 and other carcinogenesis - related processes. mp1 was chosen for further studies due to its possible involvement in gastrin - induced responses linked to proliferation mainly by facilitating signaling via the mapk pathway acting as a molecular scaffold. the roles of such specific interactions in the spatiotemporal organization of protein complexes seem to facilitate a fine - tuning of context - specific signaling. further studies on mp1 could focus on further characterization of the detailed mechanisms in the scaffolding functions and its role in carcinogenic processes. our data shows that gastrin promotes cell proliferation in the human gastric adenocarcinoma cell line ags - gr in a dose - dependent manner. we show that gastrin induces transcription of a scaffold protein, mp1, both in the neuroendocrine pancreatic cell line ar42j and ags - gr cells. our results highlight that mp1 is important for gastrin - induced phosphorylation of erk1 and erk2, and that mp1 promotes gastrin - induced proliferation. taken together, our data suggest a new role for mp1 in regulation of cellular proliferation, and our findings are in keeping with mp1 as a scaffold protein promoting mapk signaling pathway flux and suggest new insights into some of the complex mechanisms of tumorigenesis. | the peptide hormone gastrin is an important factor for the maintenance and homeostasis of the gastric mucosa. we show that gastrin stimulates proliferation in a dose - dependent manner in the human gastric adenocarcinoma cell line ags - gr. furthermore, we demonstrate that the mapk scaffold protein mek partner 1 (mp1) is important for gastrin - induced phosphorylation of erk1 and erk2 and that mp1 promotes gastrin - induced proliferation of ags - gr cells. our results suggest a role of mp1 in gastrin - induced cellular responses involved in proliferation and homeostasis of the gastric mucosa. |
since april 3, 2016, all blood donations collected in puerto rico have been screened for zika virus by using the cobas zika id - nat, which uses pcr amplification to detect zika virus rna in plasma specimens. a blood donor with a reactive cobas zika test result on initial donation is considered to be a presumptive viremic donor (pvd). in this study, we used data on pvds to estimate zika virus incidence. for these analyses, we used data from blood donations collected by the banco de sangre de servicios mutuos (bsis ; san jose, pr) during april 3august 12, 2016, and by the banco de sangre del centro mdico de la administracin de servicios mdicos (asem ; san jose, pr) during april 4july 31, 2016. these organizations collect most blood donations in puerto rico (16), with collections throughout the main island. information collected and reported to cdc included a unique donor identification number, donor sex and age, city and zip code of donor residence, date of donation, and cobas zika test result. city and zip code of donor residence were used to identify a donor s municipality (i.e., county) and then health region as defined by the puerto rico department of health : aguadilla, arecibo, bayamn, caguas, fajardo, mayagez, metro / san juan, and ponce (17). because the minimum amount of time donors are required to wait between whole blood and plasma donations at blood centers is 56 and 28 days, respectively, the maximum number of donations per donor during the study period was 5. to estimate zika virus incidence, all donations from any 1 donor were included in these analyses, except for repeat donations from donors who had a previous cobas zika - reactive donation because such results could indicate infection and thus immunity. we also excluded donations from donors residing outside puerto rico. to calculate the total number of incident zika virus infections and the population incidence during the study period, we first calculated the proportions of cobas zika - reactive donations to estimate the point incidence of zika virus infection at the time of donation. the point incidence of cobas zika - reactive donations, which we report aggregated to the week of collection, was then scaled to give estimates of zika virus incidence during the referenced time frame. estimates and 1-at - a - time 95% cis of the number of incident zika virus infections were computed weekly and cumulatively by week beginning april 3. the weekly values are estimates of the number of incident zika virus infections during the given week ; the weekly cumulative incidence values are aggregated estimates of the number of incident zika virus infections from april 3 to the given week. the zika virus incidence estimation process for april 3august 12, 2016, followed the method of busch. (15), although this approach was modified to incorporate the fact that donors are necessarily asymptomatic at time of donation. in brief, proportions of cobas zika - reactive donations were multiplied by a factor given as the ratio of the duration of the period of collection to the average viremia duration, whereas zika virus infected persons are asymptomatic. parameters used to characterize the average asymptomatic viremia duration were the overall average viremia duration, the average incubation period (i.e., duration from infection to symptom onset), and the proportion of asymptomatic infections. we used statistical computer simulation to account for uncertainty in these parameters. because demographic or geographic factors might have affected transmission rates across puerto rico, we compared the proportions of cobas zika - reactive donations across these factors using fisher exact test. factors statistically significant at the 5% level were incorporated into the estimation procedure by simultaneously stratifying the donation and population data by these factors, using the procedure outlined earlier (technical appendix) to compute separate estimates of the numbers of incident zika virus infections during the period of interest for each stratum and summing these values for an estimate of the total number of incident zika virus infections. we divided this summation by the total size of the population at risk to give the estimated incidence of zika virus infection for this population during the 5-month study period (technical appendix). we used us census estimates for 2014 for population totals by stratum (18). for the primary analyses, the estimates of the parameters used were 9.9 days (95% ci 6.821.6 days) for mean zika virus viremia duration (19), 6.2 days (95% ci 5.37.1 days) for the mean zika virus incubation period (20), and 0.79 (95% ci 0.730.90) for proportion asymptomatic (8). the key parameter was the mean duration of zika virus viremia. we performed a sensitivity analysis to evaluate the influence of the specification of this parameter by computing estimates for the total number and percentage of zika virus infections in the population for different values of zika virus viremia duration, ranging from 7 to 21 days. analyses were performed and graphics created in the r version 3.3.1 statistical software package (https://www.r-project.org/) by using purpose - written routines, and we used statxact version eleven (http://www.cytel.com) for fisher exact test. therefore, the office of the cdc associate director for science considered it exempt from institutional review board review. data on 21,643 blood donors from bsis and asem were reported to cdc for april 3august 12, 2016. of these donors, 21,468 (17,850 from bsis and 3,618 from asem) were included in the analysis ; 175 were excluded because of invalid data or residence outside of puerto rico. included of all included donors, 190 (153 bsis and 37 asem) were pvds ; 21,278 had cobas zika - nonreactive screening test results ; 20,912 were first - time donors ; and 14,407 (67%) were men (table 1). reported donor residence included all of the municipal health regions in puerto rico (table 1). among the 190 pvds, 181 had reactive cobas zika test results on their first donation, and 9 had nonreactive results at first donation but reactive results on repeat donation. also among pvds, 142 (75%) were men, 67 (35%) were 4559 years of age, and 129 (68%) resided in either metro / san juan (44%) or bayamn (24%) (table 1). the overall rate of cobas zika id - nat donor reactivity during the 5-month period was 89/10,000 donors. data for august 1august 12, 2016 available only for bsis. cobas zika, roche molecular systems, inc., pleasanton, ca, usa. asem, banco de sangre del centro mdico de la administracin de servicios mdicos ; bsis, banco de sangre de servicios mutuos ; id - nat, individual nucleic acid testing. combining donation data from all health regions, we found no statistically significant difference in cobas zika test reactivity by age group (p = 0.32), but the proportion of reactivity (number of reactive donations / number of donations) significantly differed by donor sex (women, 48 [0.67% ] of 7,125 ; men, 142 [0.95% ] of 14,903 ; risk ratio 1.41, 95% ci 1.021.96 ; p = 0.036) and by health region (p 9.9 days in our calculations (figure 3). data for august 1august 12, 2016 available only for bsis. cobas zika, roche molecular systems, inc., pleasanton, ca, usa. asem, banco de sangre del centro mdico de la administracin de servicios mdicos ; bsis, banco de sangre de servicios mutuos ; id - nat, individual nucleic acid testing. estimated total number of incident zika virus infections and percentage of the at - risk population infected with zika virus during the study period by assumed mean viremia duration computed with cobas zika (roche molecular systems, inc., pleasanton, ca, usa) individual nucleic acid testing results from banco de sangre de servicios mutuos and banco de sangre del centro mdico de la administracin de servicios mdicos, puerto rico, april 3august 12, 2016. data for august 1august 12, 2016 available only for banco de sangre de servicios mutuos. in this analysis of routine blood donation screening data from the 2 largest blood collection centers in puerto rico, we estimated that 469,321 persons were infected with zika virus during april the estimated cumulative incidence of zika virus infection for the study period was 12.9%. among the parameters used in this estimation, mean duration of zika virus viremia is most influential because it is inversely related to the overall estimate of the number of persons infected with zika virus in puerto rico. to our knowledge, the mean duration of viremia in serum is still unknown but has been shown to range from 410 weeks in gravid women (21) to 318 days in asymptomatic, nonpregnant persons (19). we used the value of 9.9 days (95% ci 6.821.6 days) on the basis of a literature review of 25 cases that provided doubly interval - censored data (19). the wide 95% ci for the mean viremia duration estimates reflected the current paucity of data on viremia duration. to evaluate the influence of this key parameter in our analyses, we included a sensitivity analysis by varying the assumed mean viremia duration and computing corresponding incidence estimates of zika virus infection. using the mean viremia duration of 9.9 days gave a substantially higher total number of incident zika virus infections than the number of new laboratory - confirmed infections reported from puerto rico to arbonet during the same period (10,000 infections) (22). however, because of limitations in general population testing, this system reflects only symptomatic persons and a subset of asymptomatic pregnant women. one advantage of using blood donor screening as a surveillance tool is that it can rapidly capture real - time, cumulative incidence data from a large, diverse convenience sample of the general population ; this information might otherwise be unattainable during a public health emergency. as observed during previous outbreaks of arbovirus diseases (e.g., west nile, dengue, chikungunya) in the continental united states and territories, blood donation screening conducted during outbreaks can identify persons who are acutely infected and asymptomatic, which can aid in active case surveillance and enable characterization of viral and immunologic dynamics of clinical illness (15,23,24). detection of zika virus infected asymptomatic blood donors is important not only for preventing transfusion - transmitted infections but also because the infection can be sexually transmitted and might result in adverse birth outcomes, even among pregnant women who do not have signs or symptoms. as us blood centers implement updated fda recommendations for universal zika virus blood donation screening (25), the coupling of prompt communication of reactive blood donor screening results to public health authorities with appropriate prevention messages and other public health interventions will become increasingly important in helping to mitigate the spread of zika virus. first, the number of persons residing in puerto rico (estimated at 3.4 million in 2016 by the puerto rico department of health) might differ from the 2014 us census population estimate of 3.6 million in our model. second, the demographic composition of blood donors, specifically sex and age, does not match that of the general population. furthermore, data from persons < 16 years of age were unavailable because of blood donor age restrictions, so the estimates we give for the whole population include an extrapolation to this age group. although the data do not indicate a substantial difference in zika virus incidence by age, whether the lack of data from the 015-year age group substantially affected our population incidence estimates is unknown. alternatively, with regard to sex and infectivity, few data are available to support a predisposition for zika virus infection in men ; nevertheless, the statistically significant study finding of a male - to - female ratio of infectivity of 1.41 among donors suggests the need for further exploration of any possible interplay between sex and the length of viremia from zika virus infection or zika virus susceptibility. third, blood donors are subjected to a medical examination and questionnaire to ascertain signs and symptoms of illness, and potential donors who are feeling ill are excluded from donation. consequently, blood donor screening data might underestimate infection incidence because of the exclusion of symptomatic persons. because our model adjusted for the exclusion of these persons, this limitation should not affect our analysis ; however, this factor is an important consideration when blood screening data are used as a surveillance tool. last, the duration of zika virus viremia is unknown, and assumptions made for this model were based on limited data. important research priorities will be to determine viremia duration through longitudinal follow - up of infected blood donors and studies of acute infection in animal models, resulting in more precise calculation of viral kinetics. in summary, the findings of this study suggest that a much larger proportion of the population in puerto rico was infected with zika virus during april august 2016 than reported through surveillance. although puerto rico mandates reporting of zika virus infections, the conveyance of arboviral surveillance data across local, state, and national levels is often delayed and can affect strategic planning and interventions. blood donation screening data can augment clinical zika virus surveillance data to provide real - time communication of zika virus incidence estimates to enable better ascertainment of the extent of outbreaks and improved targeting of prevention and response efforts. additional statistical methods for study of zika virus infection incidence in puerto rico using blood donor data. | puerto rico has been heavily impacted by zika virus, a mosquitoborne flavivirus that emerged in the americas during 2015. although most persons with zika virus show no symptoms, the virus can cause neurologic and other complications, including fetal microcephaly. local zika virus transmission in puerto rico has been reported since december 2015. to prevent transfusion - associated transmission, local blood collection ceased in march 2016 but resumed in april 2016 after zika virus screening of blood donations became available. using data from screening of blood donations collected by the 2 largest blood centers in puerto rico during april 3august 12, 2016, and assuming a 9.9-day duration of viremia, we estimated that 469,321 persons in puerto rico were infected during this period, for an estimated cumulative incidence of 12.9%. results from blood donation screening during arboviral outbreaks can supplement routine clinical and surveillance data for improved targeting of prevention efforts. |
the subepidermal immunobullous diseases (sibd) are a group of disorders characterized clinically by the presence of cutaneous and/or mucosal blisters and histologically by subepidermal blister formation. it encompasses bullous pemphigoid (bp), epidermolysis bullosa acquisita (eba), cicatricial pemphigoid (cp), pemphigoid gestationis (pg), linear iga dermatosis (lad), dermatitis herpetiformis (dh), and bullous systemic lupus erythematosus (blse). another common feature to these conditions is the deposition of immunoglobulins and complement at the basement membrane zone (bmz), with the exception of dh where iga deposits are found in the dermal papillae. bp is the commonest type of sibd ; clinical and histopathological features of bp may often be confused with eba. direct immunofluorescence (dif) and indirect immunofluorescence (iif) typically demonstrate linear deposition of igg and c3 in the bmz in both conditions.[24 ] these features have resulted in the misdiagnosis of eba as bp or vice versa, in many patients. although immunoelectron microscopy (iem), immunoprecipitation, and immunoblotting have been employed to distinguish between these conditions, they are expensive, technically demanding and not widely available.[58 ] to overcome this problem, salt split technique (sst) using 1 mol / l nacl was introduced in 1984 to differentiate pemphigoid group from other sibd. this study was undertaken with the aim of evaluating the utility of direct sst and comparing it with the routine method of immunofluorescence in the diagnosis of sibd in a tertiary care hospital in south india. patients attending skin opd of a tertiary care hospital, between october 2007 and september 2008 with a provisional diagnosis of sibd were enrolled in the study. detailed history and thorough clinical examination was carried out for each case, and the findings were recorded in a predesigned format. the study was approved by the institutional ethical committee review board. written informed consent was obtained from all the patients. two perilesional punch biopsies (each 3.5 mm), one for dif and other for direct salt split, dif and iif (in two dilutions of 1:10 and 1:80, using normal skin as substrate) were done in all cases as per standard reference. results were recorded by the same observer and intensity of staining were graded subjectively as strong (+ + +), moderately strong (+ +), weak (+), or negative (-). additional biopsy for histopathological study (h and e) was carried out in five patients who had fresh intact vesicle. punch biopsy samples were incubated in 5 ml of nacl (1 mol / l) at 4c for 24 h. the epidermis was then teased from the dermis with the use of a fine forceps. the specimens were then processed in the same manner and treated with igg and c3 conjugates as in dif. punch biopsy samples were incubated in 5 ml of nacl (1 mol / l) at 4c for 24 h. the epidermis was then teased from the dermis with the use of a fine forceps. the specimens were then processed in the same manner and treated with igg and c3 conjugates as in dif. fourteen (five males and nine females) clinically suspected cases of sibd were enrolled in the study. average age of presentation was 57.3 years (range, 10 - 80 years). duration of the disease varied from 2 weeks to 3 years (mean duration 7.8 months). all cases were diagnosed clinically as bp ; histopathological study (hematoxyline and eosine) from the fresh blister in five patients was consistent with the diagnosis of bp. dif was positive in all the 14 (100%) patients, whereas iif was positive in only seven patients. a linear bmz band with igg and/or c3 was seen in all patients clinically diagnosed as bp [table 1 ]. results of direct salt split study [figures 1 and 2 ] are depicted in table 2. two patients showed exclusive floor pattern on salt split study ; diagnosis was then revised and they were labeled as eba. results of dif and iif in clinically suspected bp (n = 14) linear c3 band at bmz showing roof pattern (dif 20) floor pattern of bmz band with c3 in eba (dif 20) results of salt split study (n = 14) therefore, with the help of dif, iif, and salt split studies, we were able to confirm the diagnosis of bp in 12 out of 14 cases and rectify the diagnosis of two cases. dif was found to be 100% sensitive and specific whereas sensitivity of iif was 50% in our patients with sibd. bp was the commonest type (85.7%) of sibd in our study followed by eba (14.3%). wong and coworkers made similar observations ; however, nanda and coworkers reported high prevalence of pg in kuwait. hence, indirect sst would have resulted in lower sensitivity than that of direct technique. further, there was no correlation between the disease activity and titer of circulating antibodies in our study. igg was positive in 100% cases both by dif and direct salt split whereas c3 was found positive in 13 of the 14 (92.9%) samples of clinically diagnosed cases of bp. this is consistence with the findings of satyapal. who found c3 alone or in combination with other immunoreactants in 90% of cases. eba has three modes of presentation ; clinically, inflammatory form of eba masquerades as bp. these patients will have tense blisters on erythematous or urticarial background which heals without scarring or milia formation. it is imperative for the clinician to make every effort to distinguish bp from eba for two simple reasons. eba has been known to be associated with various systemic diseases such as inflammatory bowel disease (ibd) ; so, necessary investigation should be done in all cases of eba to rule out such underlying conditions. another compelling reason to establish the correct diagnosis is to predict the course of the disease, as eba is relatively resistant to treatment. sst using 1 m nacl is a simple tool which aides in the differentiation of bp from eba. in this study, we have shown that 24 h (as against 72 h) incubation could reliably split the skin at dermoepidermal junction, thereby avoiding the longer hours of incubation. the majority of our cases took a roof (epidermal) pattern, suggesting the diagnosis of bp. this is in contrast to the findings of satyapal. who observed that mixed type to be the common pattern of staining in their patients. patients with igg on the floor pattern of sss represent about 12% of patients with igg at dermal - epidermal junction. it is generally believed that floor pattern of staining corresponds to the diagnosis of eba. same criterion was adapted by earlier studies when assessing the prevalence of sbid in various parts of the world. this was further supported by zhu. who had shown that four out of five serum samples with dermal reactivity on indirect if and sss reacted with eba antigens. on the basis of these facts, we revised the diagnosis in two of our cases to eba who showed only floor pattern. immunoblotting methods have shown that 2% of their patients with floor pattern of staining were suffering from bp. they argued that dermal pattern of staining is not specific for eba autoantibodies as it may be seen with antibodies to type iv, laminin 5, or type xvii (i.e., bpag2). in contrast, they concluded that there was a good correlation between roof (epidermal) pattern and combined pattern of staining with bp. we conclude that direct sst is a simple, cheap, and easy tool and should be routinely employed in immunofluorescence study of patients with sibd. roof pattern of staining is highly suggestive of bp ; one needs to be careful when dealing with floor pattern. although it generally indicates the diagnosis of eba, further testing (such as immunoblotting, immunoelectron microscope, or indirect if using toad skin) may be necessary to confirm the diagnosis. | background : direct immunofluorescence (dif) is the gold standard in the diagnosis of immunobullous diseases. however, it can not reliably differentiate various subtypes of subepidermal immune- bullous diseases (sibd). salt split technique (sst) could be used under such circumstances to differentiate them. there is paucity of reports in the indian literature regarding the sst.aim:this study was designed to evaluate the utility of direct sst in subepidermal blistering diseases.materials and methods : fourteen clinically diagnosed cases of subepidermal blistering diseases were included in the study. two perilesional punch biopsies were taken one each for dif and salt split study.results:linear basement membrane zone band with igg and/or c3 was seen in 14 cases of patients bp. salt split study showed epidermal or mixed pattern of deposits in 12 patients and exclusive floor pattern in two patients. the diagnosis was revised in these two patients to epidermolysis bullosa acquisita.conclusion:sst is a simple, inexpensive procedure and should be routinely employed in the diagnosis of subepidermal bullous diseases. |
since its emergence in april 2009, an outbreak of influenza a (h1n1) pdm09 began in mexico and spread rapidly across many countries, including spain. a pandemic was declared by who on 11 june 2009. since then, our knowledge about influenza a (h1n1) in pregnancy has increased enormously. much more attention has been paid to pregnancy issues because it is known that pregnant women (pw) are more susceptible to developing serious influenza complications (1 4), besides suffering adverse effects during pregnancy ; e.g. spontaneous miscarriage and preterm delivery (5 7). the influenza a (h1n1) pdm09 virus extraordinarily increased both the hospital admission rate among pw and the number of maternal mortalities in the usa, australia, new zealand, south africa, brazil, greece, peru, chile, france and turkey during the pandemic (5, 9, 11 20). given the high incidence rates, the medical costs incurred during the 2009 pandemic were considerable everywhere (23, 24). pregnant women are more susceptible to complications from influenza, which often results in admission to hospital. for all these reasons, studies of the consequences for pregnancy and the fetus, both for the influenza and its treatment, are also important in the context of public health (8, 9). the spanish ministry of health (10) recommended giving priority to immunising people at increased risk of influenza complications in influenza a (h1n1)pdm09, such as pw in any trimester of pregnancy (10). although prioritisation was important, these recommendations were based on the medical literature, and their potential cost - effectiveness was largely unknown. therefore, up - to - date information on the cost of a non - vaccinated risk group, such as pregnant women, and non - pregnant women (npw), will improve the prioritisation and acceptability of influenza vaccination uptake, inform policy - makers in spain, and could be useful for making similar decisions in other counties. in order to prevent pandemic influenza a (h1n1)pdm09 from spreading, the spanish government applied not only its regular health policies, such as quarantine, isolation and hygiene campaigns, but also a special protocol in at - risk groups such as pw (e.g., offering vaccination) (21, 22). nonetheless, there were no data available on the related cost of the virus infection to allow a comparison between non - vaccinated pw and npw of childbearing age to be made. knowing the health cost incurred by women of childbearing age will allow us to : 1) learn what spending has resulted from influenza a (h1n1) pdm09 in spain in these important groups of women ; 2) improve health management strategies (prioritisation of vaccines, control programs, etc.) in future epidemics ; 3) know its relevance for future health policy and practice decisions. thus, our aim was to estimate and compare direct healthcare costs (medical visits, medication, diagnosis tests, and hospitalisation) and indirect healthcare costs (work absenteeism) that resulted from pandemic influenza a (h1n1) pdm09 in pw with those resulting in non - vaccinated npw of childbearing age. this work was a pharmaco - epidemiological study of health costs that formed part of a multicentre matched case - control study of influenza a (h1n1) pdm09 infection carried out in 28 hospitals in seven spanish autonomous communities (andalusia, the basque country, castile and leon, catalonia, madrid, navarre and the valencian community). a protocol was followed whose objective was to determine the impact of influenza a (h1n1) pdm09 on the spanish population between 1 november 2009 and 28 february 2010 during the pandemic wave (16). the healthcare cost () for unvaccinated women of childbearing age with influenza a (h1n1) pdm09 was evaluated. for the base case analysis, it was assumed that of those who developed clinical symptoms of (h1n1) pdm09, some would choose no treatment, while others would seek treatment from general practitioners (gps). those who received treatment could be prescribed medication for symptomatic relief, antibiotics or antivirals for complementation, or could be admitted to hospital. associated outcomes (consequences) and costs were summed for each group, these being : pw and npw ; the cost of each intervention (e.g. cost of treatment) ; the cost of each consequence (e.g. cost of hospitalisations)., 3,790 influenza a (h1n1) pdm09-infected subjects were surveyed. of these, 1,165 were women of childbearing age (between 1544 years old). their influenza a (h1n1) pdm09 virus infection was confirmed by a reverse transcriptase polymerase chain reaction (rtpcr) in a microbiology laboratory. the inclusion criteria considered for this study were having been microbiologically confirmed to be infected by the virus and being hospitalised for more than 24 h. of the 219 women who met the inclusion criteria, 170 were npw and 49 were pw. the economic burden resulting from pandemic influenza a (h1n1) pdm09 was estimated by an incidence approach. the associated direct healthcare costs and indirect costs deriving from absenteeism from work were calculated from a healthcare provider s perspective. since consequences of influenza generally occur during a short period of time, the time horizon was set at 4 months. therefore, we considered the healthcare costs per hospitalised patient as the reported surveillance system number of severe influenza cases coordinated by the centre for health alerts and emergencies of the spanish ministry of health and social policy (inpatients) (5, 16). information was collected at two time points : baseline (primary care general practitioner (gp) or hospital) and follow - up (hospitalisation time). the variables measured at the baseline referred to the 7 days (medical visit index (outpatients)) before hospital admission (inpatients) and the duration of this hospitalisation. as this study started after the pandemic had begun, this information was collected retrospectively : the median time from the medical visit index or hospital admission to the time that information was collected was 125 days (iqr 89166). the following variables were obtained from telephone interviews or during the personal face - to - face interviews conducted with patients diagnosed and hospitalised with the influenza a (h1n1) pdm09 virus : age ; if they were pregnant or not ; if so, trimester of pregnancy ; city / town of residence ; level of education ; marital status ; days of absenteeism from work. other variables were also obtained from medical records for hospital databases : number of medical visits ; pharmacological treatment (doses were not available) ; diagnostic tests ; health scale sf-36 ; length of stay of inpatients in a hospitalisation unit. we also used medical risk, which was evaluated by each patient s gp in relation with patient co - morbidity. the same variables were recorded for pw and npw, except for weeks of gestation, obtained for only pw. while information on the management of patients and pharmacological treatment was collected, the specific drug and dose were not available. so we assumed utilisation rates in accordance with recommendations from clinical practice guidelines (17, 18). hence alternative sources were considered for the monetary evaluation of healthcare resources utilisation (24). the unit costs of the considered healthcare resources included the retail price of the drugs published in a spanish vademecum (25). we adjusted treatment to a minimum dose (1/day), and we evaluated complete treatment for oseltamivir (5-day treatment). the actual costs of the diagnostic tests were calculated using the price list offered by the hospital clinic of barcelona and the mass media publications of the pandemic vaccine price (26) the cost per day of hospitalisation was obtained from one of the participating hospitals (hospital del mar of barcelona) during the same study period (24). this hospital has a clinical - cost evaluation system that establishes hospital expenses according to the hospitalisation unit (27). costs per day in an intensive care unit (icu) and on a general ward were calculated separately by dividing total expenses by the total number of hospitalisation days in each unit. we used the cost estimated by all the regions participating in this study (26, 28, 29). for the cost per day derived from absenteeism from work, we evaluated only 1 day of absenteeism using the national estimation (27). an economic descriptive analysis was done to characterise the study population (women of childbearing age : pw vs. npw). the number and percentage of patients who partook in healthcare resources utilisation and absenteeism from work were informed. patients absenteeism from work was estimated from those who were working when the disease started. the direct costs associated with healthcare resources utilisation and the indirect costs associated with patients absenteeism from work (loss of income) were estimated by multiplying the frequency of utilisation by each unit cost. the mean cost due to the utilisation of each resource type was calculated for all the patients. costs per patient are presented in (2009) in accordance with unit costs, along with the frequency of social and healthcare resources utilisation. all the data were included and analyses were performed with the spss software, v.19 (spss inc., chicago, il, usa). the normally distributed continuous variables were compared between pw and npw by t - tests, and p values of < 0.05 were considered statistically significant. the information collected in the present study has been treated confidentially according to legislation currently in force. the project was presented to the ethics and research committee (ceic, in spanish) of the mar parc de salut consortium of barcelona (spain) as the ciberesp - linked centre, and to the ceics of all the other participating hospitals. all the participants were invited to sign an informed written consent after explaining the aim and concerns of the study to them. this work was a pharmaco - epidemiological study of health costs that formed part of a multicentre matched case - control study of influenza a (h1n1) pdm09 infection carried out in 28 hospitals in seven spanish autonomous communities (andalusia, the basque country, castile and leon, catalonia, madrid, navarre and the valencian community). a protocol was followed whose objective was to determine the impact of influenza a (h1n1) pdm09 on the spanish population between 1 november 2009 and 28 february 2010 during the pandemic wave (16). the healthcare cost () for unvaccinated women of childbearing age with influenza a (h1n1) pdm09 was evaluated. for the base case analysis, it was assumed that of those who developed clinical symptoms of (h1n1) pdm09, some would choose no treatment, while others would seek treatment from general practitioners (gps). those who received treatment could be prescribed medication for symptomatic relief, antibiotics or antivirals for complementation, or could be admitted to hospital. associated outcomes (consequences) and costs were summed for each group, these being : pw and npw ; the cost of each intervention (e.g. cost of treatment) ; the cost of each consequence (e.g. cost of hospitalisations). in all, 3,790 influenza a (h1n1) pdm09-infected subjects were surveyed. of these, 1,165 were women of childbearing age (between 1544 years old). their influenza a (h1n1) pdm09 virus infection was confirmed by a reverse transcriptase polymerase chain reaction (rtpcr) in a microbiology laboratory. the inclusion criteria considered for this study were having been microbiologically confirmed to be infected by the virus and being hospitalised for more than 24 h. of the 219 women who met the inclusion criteria, 170 were npw and 49 were pw. the economic burden resulting from pandemic influenza a (h1n1) pdm09 was estimated by an incidence approach. the associated direct healthcare costs and indirect costs deriving from absenteeism from work were calculated from a healthcare provider s perspective. since consequences of influenza generally occur during a short period of time, the time horizon was set at 4 months. therefore, we considered the healthcare costs per hospitalised patient as the reported surveillance system number of severe influenza cases coordinated by the centre for health alerts and emergencies of the spanish ministry of health and social policy (inpatients) (5, 16). information was collected at two time points : baseline (primary care general practitioner (gp) or hospital) and follow - up (hospitalisation time). the variables measured at the baseline referred to the 7 days (medical visit index (outpatients)) before hospital admission (inpatients) and the duration of this hospitalisation. as this study started after the pandemic had begun, this information was collected retrospectively : the median time from the medical visit index or hospital admission to the time that information was collected was 125 days (iqr 89166). the following variables were obtained from telephone interviews or during the personal face - to - face interviews conducted with patients diagnosed and hospitalised with the influenza a (h1n1) pdm09 virus : age ; if they were pregnant or not ; if so, trimester of pregnancy ; city / town of residence ; level of education ; marital status ; days of absenteeism from work. other variables were also obtained from medical records for hospital databases : number of medical visits ; pharmacological treatment (doses were not available) ; diagnostic tests ; health scale sf-36 ; length of stay of inpatients in a hospitalisation unit. we also used medical risk, which was evaluated by each patient s gp in relation with patient co - morbidity. the same variables were recorded for pw and npw, except for weeks of gestation, obtained for only pw. while information on the management of patients and pharmacological treatment was collected, the specific drug and dose were not available. so we assumed utilisation rates in accordance with recommendations from clinical practice guidelines (17, 18). hence alternative sources were considered for the monetary evaluation of healthcare resources utilisation (24). the unit costs of the considered healthcare resources included the retail price of the drugs published in a spanish vademecum (25). we adjusted treatment to a minimum dose (1/day), and we evaluated complete treatment for oseltamivir (5-day treatment). the actual costs of the diagnostic tests were calculated using the price list offered by the hospital clinic of barcelona and the mass media publications of the pandemic vaccine price (26) the cost per day of hospitalisation was obtained from one of the participating hospitals (hospital del mar of barcelona) during the same study period (24). this hospital has a clinical - cost evaluation system that establishes hospital expenses according to the hospitalisation unit (27). costs per day in an intensive care unit (icu) and on a general ward were calculated separately by dividing total expenses by the total number of hospitalisation days in each unit. we used the cost estimated by all the regions participating in this study (26, 28, 29). for the cost per day derived from absenteeism from work, we evaluated only 1 day of absenteeism using the national estimation (27). an economic descriptive analysis was done to characterise the study population (women of childbearing age : pw vs. npw). the number and percentage of patients who partook in healthcare resources utilisation and absenteeism from work were informed. patients absenteeism from work was estimated from those who were working when the disease started. the direct costs associated with healthcare resources utilisation and the indirect costs associated with patients absenteeism from work (loss of income) were estimated by multiplying the frequency of utilisation by each unit cost. the mean cost due to the utilisation of each resource type was calculated for all the patients. costs per patient are presented in (2009) in accordance with unit costs, along with the frequency of social and healthcare resources utilisation. all the data were included and analyses were performed with the spss software, v.19 (spss inc., chicago, il, usa). the normally distributed continuous variables were compared between pw and npw by t - tests, and p values of < 0.05 were considered statistically significant. the information collected in the present study has been treated confidentially according to legislation currently in force. the project was presented to the ethics and research committee (ceic, in spanish) of the mar parc de salut consortium of barcelona (spain) as the ciberesp - linked centre, and to the ceics of all the other participating hospitals. all the participants were invited to sign an informed written consent after explaining the aim and concerns of the study to them. table 1 describes the characteristics of the nonvaccinated pw and npw of childbearing age (1544 yr old) infected with the influenza a (h1n1) pdm09 virus in spain (20092010). a similar mean age was obtained for both groups : 33.2 (sd=9.3) years for npw and 30.8 (sd=6.4) for pw. when considering marital status, married women pre - dominated with 75.5% and 49.5%, respectively. a higher proportion of pw had completed secondary or higher education vs. npw (91.8% vs. 63.6%, respectively). a significant difference in medical risk was also observed despite the moderate risk of becoming infected by the (h1n1) pdm09 virus category being more frequent in both pw and npw. we can see that npw showed a high medical risk (20.4%) vs. pw 6.1% (p < 0.001). the health scale sf-36 value was similar in both groups (p = 0.480). characteristics of pw and npw infected with pandemic influenza a (h1n1) pdm09 virus in spain (20092010) percentages refer to the actual number of responses / data for each group/ anova / sd, standard deviation ; n, number table 2 describes the healthcare costs related to women s requirements (according to patient management) for pandemic influenza a (h1n1) pdm09 who were not vaccinated and attended the hospital. the most widely used previous treatment was antibiotics and antipyretics in npw, while only eight of the 49 pw cases studied (16%) used antibiotics. of the medication required by hospitalised patients, oseltamivir and ibuprofen - acetaminophen stood out in both pw and npw. the most commonly used diagnostic tests done were x - rays in npw and pcr in the controls. notwithstanding, differences were found in days of absenteeism from work depending on the spanish autonomous community to which the patient belonged. each case in the npw group generated a higher individual total cost (4,689.4) than the pw group (2,945.07). healthcare costs for women infected with the pandemic a (h1n1) 2009 influenza virus in spain (20092010) minimum dose (1 day of treatment). table 1 describes the characteristics of the nonvaccinated pw and npw of childbearing age (1544 yr old) infected with the influenza a (h1n1) pdm09 virus in spain (20092010). a similar mean age was obtained for both groups : 33.2 (sd=9.3) years for npw and 30.8 (sd=6.4) for pw. when considering marital status, married women pre - dominated with 75.5% and 49.5%, respectively. a higher proportion of pw had completed secondary or higher education vs. npw (91.8% vs. 63.6%, respectively). a significant difference in medical risk was also observed despite the moderate risk of becoming infected by the (h1n1) pdm09 virus category being more frequent in both pw and npw. we can see that npw showed a high medical risk (20.4%) vs. pw 6.1% (p < 0.001). the health scale sf-36 value was similar in both groups (p = 0.480). characteristics of pw and npw infected with pandemic influenza a (h1n1) pdm09 virus in spain (20092010) percentages refer to the actual number of responses / data for each group/ anova / sd, standard deviation ; n, number table 2 describes the healthcare costs related to women s requirements (according to patient management) for pandemic influenza a (h1n1) pdm09 who were not vaccinated and attended the hospital. the most widely used previous treatment was antibiotics and antipyretics in npw, while only eight of the 49 pw cases studied (16%) used antibiotics. of the medication required by hospitalised patients, oseltamivir and ibuprofen - acetaminophen stood out in both pw and npw. the most commonly used diagnostic tests done were x - rays in npw and pcr in the controls. notwithstanding, differences were found in days of absenteeism from work depending on the spanish autonomous community to which the patient belonged. each case in the npw group generated a higher individual total cost (4,689.4) than the pw group (2,945.07). healthcare costs for women infected with the pandemic a (h1n1) 2009 influenza virus in spain (20092010) minimum dose (1 day of treatment). the results of this study suggest that during the 20092010 influenza pandemic, the management of npw was more complicated than of pw, and the healthcare cost increased in npw compared to pw. this result indicates the recommendation of extending the preventive protocol with vaccination to all women of childbearing age, and not only pw. based on the primary data of non - vaccinated pw and npw patients with a confirmed influenza a (h1n1) pdm09 diagnosis, we estimated the pattern of healthcare resources utilisation and absenteeism from work of patients. the derived cost per patient and the economic impact on healthcare services were described. from an economic point of view, and on an individual basis, npw patients incurred more costs (4,689.4 per patient) than pw patients (2,945.07 per patient). from the healthcare provider s perspective, 81.34% of the national economic burden resulted from hospitalisations of npw patients and 75.48% of pw patients. in our pandemic outbreak analysis, from these results, the benefits of vaccination and other protection strategies could be beneficial for both pw and npw. assuming that healthcare costs are an indirect indicator of patient complications, this study reveals that spanish pw were not at a higher risk of severe complications from influenza a (h1n1)pdm09 infection in 20092010 than npw, which is not consistent with earlier reports on pw in other countries [6, 7, 26, 27 ]. as stated above, the spanish ministry of health offered vaccination to the whole population, particularly to risk groups, which included pw. (10) perhaps this is the reason why fewer pw were attended to if compared with other countries. the healthcare utilisation description is essential for making an economic evaluation of health technologies and for estimating the burden of influenza a (h1n1) pdm09 in women of childbearing age. every year, approximately 1020% of the world population is infected by an influenza virus, which results in a significant number of outpatients and hospital visits, as well as a substantial economic burden for the healthcare system and society. this study into pw and npw in spain has helped highlight influenza a (h1n1) pdm09, and recommends that all women of childbearing age should be considered in preventive programmers, such as promoting vaccination in not only pw. these cost estimates were obtained from all women of childbearing age, of whom some were hospitalised for influenza a (h1n1) pdm09. the risk of serious complications was not high in patients with influenza a (h1n1) pdm09 if compared with recent seasonal strains (30). thus longer hospitalisations might be attributed to differences in medical practice during a pandemic outbreak when clinical evolution is uncertain. in our study, the mean hospitalisation stay required for npw lasted over 7.55 days, while it was 4.4 days for pw, which meant a higher healthcare cost for npw. our study offers a detailed description of healthcare resources utilisation for women of childbearing age, including medical assistance (such as home medical visits or occupational care visits), which are also relevant for organising health services. in this study, antibiotics were prescribed to 32.65% of pw and to 55.88% of npw. since influenza is a viral infection, antibiotic prescriptions were probably inappropriate for most cases. nevertheless, existing evidence does not clearly demonstrate that antiviral drugs mitigate influenza complications (31). the results of this study show the effectiveness of health care in both medical and patient treatment terms (pw and npw) because all the patients recovered from influenza a (h1n1) pdm09. length of absenteeism from work during the pandemic in spain also exceeded that reported in other european countries (39). this is not an exclusive feature of pandemic influenza a (h1n1) pdm09 because it has also been observed in other pathologies (33). the costs of pandemic influenza a (h1n1) pdm09 were clearly lower than the direct medical costs associated with other pathologies in spain, such as metabolic syndrome (1,900 million) and knee and hip osteoarthritis costs (4,075 million) (34, 35). firstly, the study population was a subsample of patients recruited for a case - control study. to correctly interpret the results, it is necessary to remember that the cases with this influenza had consulted their gp. therefore, a significant association is expected to be found in the variables that influenced the frequency of medical consultations in cases with influenza, which should produce no potential bias on the eligibility criteria and source population. however, patients were temporally representative of the pandemic surge in spain (2), and the prevalence of comorbidities among our hospitalisations was similar to that previously reported (5, 6). although the follow - up response was not 100%, the demographic characteristics of lost patients and those who continued in the study were not statistically different. secondly, none of the recruited pw and npw patients died during the influenza infection. consequently, our cost estimates underestimate the actual impact of the pandemic, especially for treatments required because we did not have complete information on the doses employed. therefore, we used a 1-day minimum dose, except for olseltamivir, whose minimum dose was 5 days. nevertheless, most of the patients who died during the pandemic were either old or had previous severe chronic conditions, which barely affected our estimation of indirect costs (5, 36). thirdly, we were able to analyse only the flu cases who had been in contact with health services and laboratory - confirmed cases. however, it may have led us to underestimate the productivity costs among specific populations (housekeepers, non - contracted individuals, for instance) (37). fourthly, despite there being evidence for possible differences in average costs according to social class (7), it was not possible to make comparisons by stratifying by this variable because many values were missing. finally, the limitations related with the sources of the data used in our study deserve further comment. some of the information was collected directly from patients (patients or proxies) during interviews. in other cases, it was collected several months after having had influenza, which implies a high risk of recall bias. however, it probably lowered given the mass media repercussion that the 2009 influenza pandemic had (38). we had to consider alternative sources of information for unit costs because the spanish national health system has no accepted common information source (36). while the sources of unit costs for hospitals and days of absenteeism from work were reliable, many ambulatory unit costs were probably overestimated as they had been obtained from the list of health services provision prices from third parties. finally, the power of the study may be insufficient to generalise (external validity) our results and further studies would be worthwhile. the health cost for the number of persons affected by influenza a (h1n1) pdm09 was considerable compared with non - vaccinated individuals. it is not clear as to whether and how the incidence of influenza a (h1n1) pdm09 will change in the future. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors | background : the healthcare and socio - economic burden resulting from influenza a (h1n1) pdm09 in spain was considerable. our aim was to estimate and compare the management (resource utilization) and economic healthcare impact in an at - risk group of unvaccinated pregnant women with an unvaccinated group of non - pregnant woman of childbearing age (1544 yr old).methods : we addressed this question with a longitudinal, observational, multicentre study. inputs were the requirements in managing both groups of women. outcome measures were healthcare costs. direct healthcare (including medical utilisation, prescriptions of antivirals, medication, diagnostic tests, and hospitalisation) costs and indirect (productivity loss) costs were considered. unit of cost was attributed to the frequency of health service resources utilisation. the mean cost per patient was calculated in this group of women.results:we found that the influenza clinical pattern was worse in non - pregnant women as they had a high medical risk of 20.4% versus 6.1% of pregnant women. non - pregnant required more antipyretics and antibiotics, and needed more health service resource utilisation (338 medical visits in non - pregnant women vs. 42 in pregnant women). the total cost of non - pregnant women was higher (4,689.4/non - pregnant and 2,945.07/pregnant).conclusions : cost per (h1n1) pdm09 was lower for pregnant women, probably due to more preventive measures adopted for their protection in spain. the highest costs were incurred by hospitalisations / day and work absenteeism for non - pregnant than for pregnant women. these data will allow better future pandemic influenza planning. |
it is considered to be a multifactorial condition that results from four primary pathophysiologic processes : abnormal follicular keratinization that leads to ductal obstruction increased and altered sebum production that is androgen - induced follicular colonization and proliferation of propionibacterium acnes altered adaptive immune response and inflammation.1 even though it is often perceived as a self - limited and not physically disabling disease of adolescence, its prevalence remains high into adulthood, and its psychological impact can be striking, contributing to lower self - esteem, anxiety, and depression.2 consequently, there is significant patient - driven demand for effective acne therapies, including prescribed medications and over - the - counter products. in addition, taking into account the need for long - term treatment, there is increased need for topical medications that are popular with patients in order to achieve long - term compliance. as a result, agents are available in a variety of formulations. these include topical antibiotics, retinoids, and benzoyl peroxide in monotherapy or in combination products. tazarotene is a member of the acetylenic class of retinoids. chemically, tazarotene is ethyl 6-([4,4-dimethylthiochroman-6-yl]ethynyl)nicotinate. tazarotene is a retinoid prodrug that is converted to its active form, the cognate carboxylic acid of tazarotene, by rapid desertification in animals and man. tazarotenic acid binds to all three members of the retinoic acid receptor (rar) family rar, rar, and rar but shows relative selectivity for rar and rar and may modify gene expression. only the 0.1% strength is approved by the us food and drug administration (fda) for the treatment of acne. cream 0.1% is indicated for acne vulgaris, and gel 0.1% is indicated for mild - to - moderate acne vulgaris, whereas foam 0.1% is indicated for moderate - to - severe acne. comparison studies between tazarotene, adapalene, and tretinoin report mixed results, with some researchers suggesting comparable efficacy and tolerability, while others report greater efficacy and irritation with tazarotene.36 the basis of the therapeutic effect of tazarotene in acne may be due to its antihyperproliferative, normalizing - of - differentiation, and anti - inflammatory effects. the cellular mechanisms and inflammatory cascades that might correlate with acne pathogenesis and are modulated by topical tazarotene include : reduced expression of hyperproliferative keratins k6 and k16, which are increased during comedogenesis suppression of activation of the activator protein 1, which results in reduced expression of several matrix metalloproteinases from keratinocytes, which have been shown to be increased in acne vulgaris decreased expression of toll - like receptor (tlr) 2 and decrease in ligand binding with p. acnes, which results in inhibition of the tlr-2-induced innate response that triggers inflammation in acne increased epidermal turnover, with reduction in postinflammatory hyperpigmentation normalization of epidermal cellular differentiation and decreased hyperkeratinization downregulated expression of the epidermal growth factor receptor.7 tazarotene foam 0.1% was fda - approved in 2012 for the treatment of acne vulgaris in patients 12 years old and over. the new foam vehicle is emulsion - based, ethanol - free, and moisturizing. it contains 1 mg / g tazarotene in an aqueous - based foam vehicle consisting of butylated hydroxytoluene, ceteareth-12, citric acid anhydrous, diisopropyl adipate, light mineral oil, potassium citrate monohydrate, potassium sorbate, purified water, and sorbic acid.8 tazarotene is a retinoid prodrug that is converted in the skin and plasma to its biologically active form of tazarotenic acid by de - esterification. tazarotene and tazarotenic acid are extensively bound (more than 99%) to human plasma proteins. secondary metabolites of tazarotenic acid (the sulfoxide, the sulfone, and an oxygenated derivative of tazarotenic acid) are eliminated through urinary and fecal pathways. a phase i study was conducted to assess the relative bioavailability of active metabolite tazarotenic acid after topical application of two different formulations of tazarotene foam or gel. twenty - nine patients with moderate - to - severe acne vulgaris received a mean once - daily dose for 22 days of 3.7 g tazarotene foam 0.1% or gel 0.1% in a ratio of 13:16, applied to approximately 15% of the body surface area (face, chest, upper back, and shoulders). systemic exposure to tazarotene and tazarotenic acid was measured through maximum plasma concentration (cmax), time to cmax, through concentration in plasma, elimination half - life, and areas under the plasma concentration time curve from time zero to time of last measurable concentration and during a dosage interval (aucs). statistical analysis of these pharmacokinetic parameters for tazarotene and its active metabolite showed significantly higher auc0t and cmax with tazarotene gel than with tazarotene foam by an average of approximately 1.8- to 2.2-fold. the results of this trial indicated that tazarotene foam 0.1% offers less tazarotenic acid systemic exposure and favorable safety for the treatment of acne vulgaris when compared to tazarotene gel 0.1%.9 two phase iii multicenter, randomized, double - blind, vehicle - controlled, parallel - group studies were conducted in participants with acne vulgaris to assess the efficacy of tazarotene foam 0.1% compared with vehicle foam. these studies were carried out in 39 centers over canada and the us.10 the first study involved 744 participants and the second 742 aged 1245 years with moderate - to - severe acne vulgaris according to the investigator static global assessment (isga) scale, with 2550 facial inflammatory lesions, and 30125 facial noninflammatory lesions at baseline. the primary end points of these phase iii studies were : lesion reduction in two of three lesion counts (inflammatory, noninflammatory, and total) from baseline to week 12 (end of treatment) percentage of subjects who had a score of 01 (clear or almost - clear skin) on the isga scale a minimum 2-grade improvement at week 12. patients were randomized to receive treatment with either tazarotene foam 0.1% or vehicle foam once daily for 12 weeks. results from both clinical trials were favorable for the treatment arm that received tazarotene foam. reduction in lesion counts at week 12 was statistically greater (p<0.001) for the tazarotene foam compared with the vehicle foam. an isga score of 0 or 1 was achieved by a higher percentage of participants on tazarotene foam than participants on vehicle foam. in both studies, a significantly greater (p<0.001) proportion of patients on the tazarotene foam arm achieved at least a 2-grade improvement on the isga scale by the end of treatment compared with the control arm. reductions in lesion counts and improvement in isga scale at week 12 are presented in table 1.10 severe adverse reactions occurred in 3.0% of subjects ; 2.6% of patients discontinued due to local skin reactions.10 two single - center, evaluator - blinded, randomized, vehicle - controlled, phase i patch studies were performed to evaluate tazarotene foam 0.1% for cumulative irritation potential and contact - sensitization potential. thirty - nine patients were enrolled in the first study, and 254 patients in the second.11 in the 21-day cumulative irritation trial, 200 ml of each study product tazarotene foam 0.1%, sodium lauryl sulfate 0.5% (positive control), distilled water (negative control), and vehicle foam was applied to participants backs once daily for 241 hours, and the application site was evaluated for signs of irritation. mean converted cumulative irritation score statistically differed among study products (p<0.0001), and in pairwise comparisons was statistically higher with tazarotene foam than the positive control (p<0.0001), the negative control (p<0.0001), and vehicle foam (p<0.0001). no serious adverse events (aes) were reported. in the contact - sensitization study, patches of either tazarotene 0.1% or vehicle foam were applied on participants backs for a 3- week induction phase (three times per week for 482 or 722 hours), followed by a 1-week challenge and a 2-week rechallenge phase (single 48-hour application) at the investigators discretion with interim 2-week rest periods. three participants demonstrated questionable sensitization reactions and underwent a rechallenge ; none of the participants displayed conclusive contact sensitization. three application - site aes were considered to be product - related ; none of the aes led to study discontinuation. results of this second study indicated a low potential for contact - sensitization reactions for both tazarotene foam and vehicle foam. overall, these studies demonstrated an acceptable tolerability and safety profile for tazarotene foam 0.1%. tazarotene foam 0.1% was evaluated for phototoxic and photoallergic potential in two single - center, evaluation - blinded, randomized, vehicle - controlled phase i studies conducted in 2012.12 in the phototoxic potential study, 38 participants were enrolled and exposed to study products tazarotene foam 0.1% and vehicle foam patches and no foam patches (blank) over 24 hours. one set each was exposed to ultraviolet (uv) irradiation, uv and visible (vis) light, and no irradiation. overall, 89% of the participants had no phototoxic reaction, and 19.4% had an unclear reaction. 59 subjects were enrolled and exposed to study products for a 3-week induction phase (six consecutive 24-hour applications, two patches per set, tazarotene / foam patches), followed by a 1-week challenge and a 1-week rechallenge phase (single 24-hour application, three patches per set, tazarotene / foam / blank patches) with interim 2-week rest periods. application sites were exposed to uvb irradiation and vis light after each application during the induction phase. after 1017 days, participants received both uva and uva / uvb irradiation, uva / uvb plus vis irradiation, or no irradiation during the challenge phase. among the participants that were administered tazarotene foam 0.1%, a rate of 50% after irradiation and 60% after no irradiation showed no visible reactions at 72 hours. seven aes were reported, but none was considered to be related to the study product. results from these studies suggest that tazarotene foam 0.1% shows minor photoirritant potential and low potential for phototoxic or photoallergic reactions. like all retinoids, tazarotene foam 0.1% is pregnancy category x. both clinical and in vitro findings have revealed that vitamin a and its active derivatives (retinoids) exert a wide variety of effects on vertebrate embryonic body - shaping and organogenesis, tissue homeostasis, cell proliferation, differentiation, and apoptosis.13 retinoic acid can induce teratogenesis of the fetus of many animals, including humans, induced mainly by rar and rar ligands. the ligands of the retinoid x receptor can not induce teratogenesis, but they can enhance the teratogenesis of the rar stimulus. rars can also affect the development of the fetus by adjusting the expression of the other genes.14 it is not known what level of exposure to tazarotene is required for teratogenicity in humans.15 there were five pregnancies in women who participated in the tazarotene - foam studies. only one subject was exposed to the active drug, and her exposure was for 25 days. she delivered a healthy baby. in clinical trials with the other topical tazarotene formulations, one woman elected to terminate her pregnancy, and the other eight women delivered healthy babies.8 according to the package insert, topical tazarotene should be avoided in women of childbearing potential who are contemplating pregnancy or who are unwilling to take adequate precautions to avoid pregnancy. it is recommended that a negative serum or urine pregnancy test be obtained prior to beginning therapy. an advisory panel exploring optimization of the use of tazarotene in clinical practice in order to minimize the irritation of previously available formulations recommended that the choice of concentration should be based on such factors as the irritability of the patient s skin and the thickness of plaques in psoriasis. irritation should be managed by reducing the concentration or frequency of application, or by adding a topical corticosteroid to therapy.16 short - contact therapy has also been explored with the previously available 0.1% gel formulation, with improved results. patients with plaque psoriasis applying the 0.1% gel formulation for 20 minutes, followed by washing with water, developed much less frequent and severe irritant contact dermatitis than traditional treatment with the same formulation.17 results of the cumulative irritation study showed that tazarotene foam can potentially induce irritation.11 results from a clinical study showed that 14% of the patients using tazarotene foam reported irritation, while only 1% of the patients using the vehicle foam experienced such an effect (table 2).18 patients who did not complete the clinical study numbered 66 among those using tazarotene foam and 39 among those using the vehicle foam (table 3).18 among those stating an adverse event as the reason for not completing the study, eleven were in the tazarotene - foam group, while only one was in the vehicle group. in addition, in the category of withdrawal by subject, 32 patients belonged in the tazarotene group and 16 in the vehicle group. consequently, one has to assume that decreased adherence is to be expected with tazarotene foam when compared to products with no active ingredients. comparison studies evaluating adherence with patients using other topical retinoid products should provide more valuable information on the subject. when considering the effects of treatment of tazarotene foam on quality of life using the dermatology life quality index on patients older than 17 years and children s dermatology life quality index on patients younger than 17 years, no information on statistical analysis is provided.18 however, the results indicate an early burden on the quality of life of patients using the tazarotene foam for the first 4 weeks, which could be attributed to possible irritation by tazarotene. results indicate a greater improvement in quality of life of patients using tazarotene when compared to those using the vehicle at week 12, which could be attributed to the efficacy of tazarotene foam in acne vulgaris (table 4).18 however, recommendations based on review of the literature improve the quality of acne therapy in general. personal experiences should always be critically evaluated, and therapeutic decision making should take into account the consented therapeutic recommendations as well as the type of acne and the severity of the disease. the european evidenced - based guidelines for the treatment of acne were made with the goals of promoting adherence of patients, and reducing serious conditions and scarring, as well as antibiotic resistance.19 they include a medium - strength recommendation for topical retinoid monotherapy for patients with comedonal acne. the german society of dermatology and the german association of dermatologists also suggest retinoid monotherapy as the treatment of choice for comedonal acne.20 an international committee of physicians and researchers in the field of acne concluded that topical retinoids should be the foundation of treatment for most patients with acne, because retinoids target the microcomedo, the precursor to all acne lesions, and they also have intrinsic anti - inflammatory effects, thus targeting two pathogenic factors in acne.21 the american academy of dermatologists treatment guidelines for acne suggest a level a strength of recommendation for topical retinoids based on level i evidence from literature available at the time of publication.22 consequently, tazarotene should be considered as the treatment of choice for comedonal acne, and one should expect an additional effect on inflammatory acne lesions, particularly after prolonged use. there is no undisputed conclusion about the efficacy and tolerability of tazarotene when compared to adapalene and tretinoin. consequently, the needs of the individual patient should be considered when deciding which topical retinoid to prescribe. even though the foam is a new vehicle with excellent moisturizing properties, no studies exist to compare efficacy and tolerability when compared with the gel- and cream - tazarotene formulations. when selecting to prescribe the tazarotene - foam formulation, physicians should inform the patient about the possibility of irritation, particularly during the first 2 weeks of application, and explain that this is associated with the product s mode of action and will eventually contribute to good therapeutic results. additional hydrating products to lessen the irritation, as well as short - contact application schedules, might be employed during the first few days to allow the patient to become gradually accustomed to the tazarotene effects. combination therapy with retinoid / antimicrobial products has been proposed as the treatment of choice in patients presenting with comedonal and papulopustular acne.22 even though no studies exist on the efficacy of tazarotene foam employed in conjunction with an antimicrobial agent, such as benzoyl peroxide or clindamycin, common sense indicates that such a combination therapy might have merit. issues that might be of concern include the possibility of additional irritation caused by benzoyl peroxide and the impact the use of two products might have on patient adherence. in conclusion, tazarotene foam 0.1% has been shown to have an excellent efficacy and good tolerability profile in the studies published. experience accumulated through prescription, as well as comparison studies with other topical retinoids and the other tazarotene formulations, will provide substantial information about its possible advantages and disadvantages in the future. | acne vulgaris is a common inflammatory chronic disease of the pilosebaceous unit. it often requires long - term treatment, resulting in increased demand for topical medications that are popular with patients in order to achieve long - term compliance. tazarotene foam 0.1% is a novel formulation of tazarotene. we review efficacy and tolerability studies of the new formulation, and suggest a possible place for the product in the management of acne vulgaris. |
treacher - collins syndrome is characterized by craniofacial deformities arising from the first and second branchial arches and nasal placodes, probably as a result of disruption of neural crest cell development1. the pinna is often distorted with excessive wrinkling and may have low implantation. the external auditory canal (eac) is narrowed, and 30% of cases present with agenesis of the eac or defects in the ossicular chain, both of which are accompanied by conductive hearing loss. the use of individual hearing aids (ha) is impossible in these cases due to the inability to stimulate the inner ear by airway hearing conduction. reconstructive surgery of the pinna and the eac is extremely technically difficult, and the results have not been encouraging2. the bone anchored hearing aid (baha) system, developed by tjellstrom in 1977, has several advantages over conventional prosthetic osseous conduction devices and has been used in over 20,000 patients worldwide. the vibration is absorbed by the skull and directly stimulates the cochlea, making the baha system superior to conventional hearing aids in cases of sensorineural and conductive3. osseointegrated implants were first introduced into clinical practice in sweden in 1977 by tjellstrom, using branemark system deployment, to treat patients with conductive or mixed hearing loss that could not be addressed with conventional hearing aids. the procedure is a 2-step process with an average delay of 3 months between the implantation and placement of the processor. the osseointegration of the implant within that period ensures the stability of the implant and is thus critical to the success of the baha system9 12. the use of hearing aids or surgical techniques can treat conductive or mixed hearing loss from many causes. however, patients with agenesis or stenosis of the eac, as well as some with chronic suppurative otitis media (csom) or chronic suppurative otitis externa (csoe) or who have undergone open mastoidectomy, may be unable to adapt to hearing aids ; alternatively, the surgical results may be poor due to inability of the airway to stimulate the inner ear or poor adaptation, which can generate problems such as discomfort and otorrhea.. however, these implants also have drawbacks that can lead to the patient 's abandoning their use. these include skin irritation due to the constant pressure on the local device support, poor aesthetic appeal, and the difficulty of keeping the easily removable tiara in place in children7. the baha system is an interesting alternative in these cases and has advantages over conventional bone conduction devices. it produces excellent results in cases of conductive hearing loss, but its use is limited in cases of associated deafness12. the use of osseointegrated implants was first introduced in 1977 in sweden by tjellstrom, using branemark system deployment, to treat patients with conductive or mixed hearing loss that could not be addressed with conventional hearing aids. the procedure is a 2-step process, with an average delay of 3 months between the implantation and placement of the processor. the osseointegration of the implant during this time ensures the implant 's stability and is thus critical to the success of the baha system9 11. the use of hearing aids or surgical techniques can treat conductive or mixed hearing loss due to many causes. however, patients with agenesis or stenosis of the eac, as well as some with csom or csoe externa or who have undergone open mastoidectomy, can not adapt to hearing aids ; alternatively, the surgical results may be poor due to the lack of stimulation of the inner ear by air or bad adaptation, which can lead to problems such as discomfort and otorrhea. the tiara type of bone conduction hearing device would be a better option in these cases. however, these implants also have drawbacks that can lead to patients ' abandoning their use. these include skin irritation due to the constant pressure on the local support of the device, poor aesthetic appeal, and the difficulty of keeping the easily removed tiara in place in children3. the baha system is an interesting alternative in these cases and also has other advantages over conventional bone conduction (bc) devices. it produces excellent results in cases of conductive hearing loss ; however, its usefulness is limited in cases of associated deafness12. case 1 : s.a.t. was a 52-year - old woman who complained of bilateral hearing loss since audiometry showed mixed hearing loss, and computed tomography showed severe bilateral temporal bone atresia at the eac without changes in the middle or inner ear. (figure 1) the patient had used a tiara - type bone contact device for 10 years but had recently noted worsening in her hearing. after jointly assessing the case with speech therapists and obtaining the patient 's consent, (figure 2) one late complication occurred in that skin grew over the titanium implant ; this was solved by simple resection in the doctor 's office. the patient states that she is satisfied with the results and has noted significant improvement in her work and in everyday activities such as watching television, talking with friends, answering calls, and listening to music. she uses the prosthesis 12 hours per day with the drawback that the battery life is short (13 days). the audiometric results obtained with the use of the prosthesis showed a postoperative reduction in the speech reception threshold (srt) by 35 db and a speech recognition rate of 65% at 92 db (figure 4). computed tomography of the temporal bone, axial section, showing atresia of the external auditory canal. intra - operative photo showing the titanium screw implanted in the cortical mastoid. speech processor coupled. case 2 : kvf was a 14-year - old girl who was diagnosed with treacher - collins and who complained of poor performance at school. baha implantation was accomplished using a dermatome to prepare the skin flap, and an osseointegration period of 5 months was allowed. post - implantation audiometry showed a decrease in the srt of 35 db with a speech recognition rate of 96% at 65 db (figure 5). the patient reported good adjustment to the prosthesis and improvement in her school performance and social life as well as a positive impact on her quality of life (figure 3). both procedures were performed in the operating room under general anesthesia, and no immediate complications such as bleeding, pain, or infection were noted. the implant unit consists of a titanium screw that is implanted in the mastoid cortical bone via an external approach. this unit is separate from the processor that captures the sound energy of the environment and transforms it into mechanical energy, which is translated into vibration by the stimulation of the cranial cortical bone. the tiara - type bone vibration prosthesis was previously the only recourse in cases of conductive hearing loss that did not benefit from the use of a hearing aid (ha), as in cases of congenital deformities of the ear and cae. however, this device has some disadvantages that prevent its suitability in many cases, such as discomfort from the constant pressure exerted by the tiara, poor sound quality due to attenuation of high frequency sounds by the skin, positioning difficulties in children, and aesthetic considerations. the bone conduction prosthesis avoids some of these problems : it does not put any pressure on the skin, produces better sound quality, remains firmly positioned in the temporal bone, and is more aesthetically acceptable. the limitations of prosthetic hearing devices in cases of sensorineural dysacousia require careful assessment and selection of the candidate patient. there are no limitations to their use in patients with conductive hearing loss as the auditory stimulation bypasses the airway2. in order to avoid complications, tomography of the temporal bones should always be performed prior to surgery in order to assess the thickness of the skull and the positions of the facial nerve and sigmoid sinus5. the placement of bone conduction prostheses is a low - risk surgery that provides an excellent alternative for patients with congenital deformities, such as those with treacher - collins syndrome. the potential major complications of bone conduction implant placement include restenosis, lateralization of the facial nerve, facial nerve damage, and temporomandibular joint dysfunction7. when the implant is to be unilateral, it should be placed on the side with the best sensorineural threshold. studies have shown that bilateral baha improves patient satisfaction in cases with symmetrical thresholds3 7. the process of osseointegration produces a direct structural and functional connection between the bone and implant surface without intermediary fibrous tissue. the osseointegration reflects the healing of the endosteum, a process involving hematoma formation buffer, buffer resolution, migration of osteogenic cells, and bone formation. postoperatively, ankylosis occurs at the interface at which the implant contacts the bone surface and is maintained through a dynamic equilibrium after osseointegration10. the major potential intra - operative problems are exposure of the dura mater, exposure of the sigmoid sinus, and opening of the mastoid cells. in children, the thinness of the skull may result in incomplete deployment of the titanium pin. the potential post - operative complications include flap necrosis or redness, irritation, or granulation of the flap, osseointegration failure, trauma, and surgical site infection. the frequency of implant loss is approximately 5%8 and is slightly higher in children, in whom it ranges from 7.5 to15 % 2 4. baha implantation is a low - risk surgery that provides an excellent alternative for patients with congenital deformities, such as those occurring in cases of treacher - collins syndrome. surgical treatment of atresia of the eac does not produce good results in many cases. baha systems provide good rehabilitation and consequently improve the quality of life of patients with treacher - collins syndrome. | summary introduction : treacher - collins syndrome is characterized by craniofacial malformations, narrowing of the external auditory canal (eac), and, in 30% of cases, agenesis of the canal and ossicular chain defects. the use of hearing aids (ha) is not possible in cases in which agenesis or stenosis of the eac accompanies conductive deafness. in contrast, bone conduction implants such as the bone anchored hearing aid (baha) allow direct stimulation of the cochlea and are thus superior to conventional hearing aids in cases of severe conductive hearing loss. objective : to present 2 cases of patients with treacher - collins syndrome who underwent implantation of baha. cases reports : the first patient was a 52-year - old woman diagnosed with treacher - collins syndrome who presented with severe bilateral mixed hearing loss and a history of unsuccessful previous use of a bone contact conduction device. the baha implantation was uneventful, and the post - operative results were good. the second patient was a 14-year - old girl who was also diagnosed with treacher - collins syndrome with bilateral moderate conductive hearing loss by audiometry. the use of a bone vibrator contact device did not improve her hearing ; however, implantation of a baha resulted in a decreased gap postoperatively. final comments : baha hearing devices provide adequate rehabilitation and consequent improvement of the quality of life in patients with treacher - collins syndrome. |
congenital heart disease (chd) is the most common birth defect and affects approximately 8 per every 1000 newborns born each year. critical chd (cchd), severe types of chd, has an incidence of approximately 2.5 to 3 per 1000 live births. these more serious defects cause significant morbidity and mortality, accounting for nearly 40% of deaths in children with congenital anomalies in the first year of life. over the past two decades numerous advances in care have resulted in a significant reduction in mortality secondary to cchd ; however, timely diagnosis remains an issue for these newborns. despite prenatal diagnosis and newborn examinations, as many as 39% of infants diagnosed with cchd are diagnosed only after discharge from the newborn nursery. delay in diagnosis may have significant adverse implications ; one study showed that 43% of cases diagnosed after hospital discharge from the nursery were in shock at the time of readmission. subsequent work has provided additional evaluation of the sensitivity, specificity and diagnostic gap of pulse oximetry screening. in 2009, the american heart association (aha) and american academy of pediatrics (aap) released a statement on the potential use of pulse oximetry screening to detect cchd. the statement recognized that the most favorable outcomes are realized when screening on the right lower extremity is conducted after 24 h of age, using 95% as the cutoff value for additional consultation and evaluation. the aha and aap concluded that pulse oximetry screening could potentially improve detection of cchd. however, universal screening was not endorsed at the time and the authors recommended that future studies in larger populations and across a broad range of newborn delivery systems are needed to determine whether this practice should become standard of care in the routine assessment of the neonate. ' the primary aims of this research were to determine if pulse oximetry screening for the detection of cchd could be successfully implemented in a large community hospital and to evaluate the feasibility of implementation (ability to screen all participants, obstacles encountered during screening and impact on staffing and/or work flow). a secondary aim of the study was to determine the number of participants with cchd identified by suggested program design. a prospective study of implementation was performed at holy cross hospital (hch), a large community hospital with approximately 8500 deliveries per year in silver spring, md, usa. the study population consisted of newborns being admitted to the well baby nursery ; mothers of newborns admitted to the neonatal intensive care unit (nicu) were not approached for participation. mothers whose newborns were eligible for participation were informed about the study through an educational information sheet (in english and spanish) and provided verbal consent if they wished to participate. the enrolled newborns meeting the following criteria were eligible for pulse oximetry screening : term or late preterm (35 weeks gestation), no prenatal diagnosis of chd, no dysmorphic features and no signs of cardiovascular abnormalities, such as cyanosis, abnormal vital signs or a cardiac murmur. the institutional review boards (irb) of children 's national medical center (cnmc) and hch approved the study. during the development of the research protocol, investigators from cnmc worked with hospital and nursery leadership from hch to determine the best practice for adding pulse oximetry screening to routine newborn care. individuals from hch included the research team (the nursing director of perinatal services, the medical director of nicu and the physician pediatric education director), the chief nursing officer, assistant nurse managers of the maternity suites, the unit educators and the nursing staff (registered nurses, licensed practical nurses and certified nursing assistants) who would be involved in research efforts and screening of newborns. prior to the implementation of screening, all members of the nursing staff practicing in the maternity suites and labor and delivery were required to attend an educational in - service, lasting approximately 1 h. training was conducted over 2 weeks covering all shifts to ensure that all providers received the training. each in - service included education on protocol aims, background and significance of pulse oximetry screening for cchd, eligibility requirements for newborns, study design and methods, potential risks and benefits, and confidentiality requirements for research participants. the staff responsible for conducting screening completed hands - on training on correct pulse oximetry technique, conducted by a representative from the manufacturer, masimo corporation (irvine, ca, usa). completion of a competency checklist and a knowledge assessment quiz was required for all the nursing staff. in - service trainings were provided accordingly for newly hired staff to ensure that 100% of staff was educated. in addition, each member of the nursing staff, ultrasonographer, licensed independent practitioner (lip) and physician responsible for providing care in labor and delivery, newborn nursery, maternity suites and nicu received a letter of study intent from the investigators. one certified nursing assistant was assigned to perform metabolic and pulse oximetry screening of each eligible newborn. when that individual was not scheduled to work, pulse oximetry of the right hand and the right foot was conducted between 24 h of age and discharge from the nursery. the masimo radical-7 pulse oximeter and a disposable low noise cable sensor were used to screen each newborn. disposable sensors were provided by the study grant and used to avoid concerns regarding potential for transmission of infection with reusable probes. to ensure accuracy of the reading obtained, the individual responsible for screening verified all confidence indicators, including the signal identification quality and perfusion index, before reporting saturations. a time requirement for performing screening on each extremity was not specified, since confidence indicators were used to indicate readings as accurate. the individual responsible for screening recorded age (in hours) of newborn, time that pulse oximetry screening began and ended, obstacles encountered with equipment, newborn, family or staff and time spent overcoming obstacles. if the oxygen saturation was > 95% for both the right hand and the right foot and there was 95% for both the right hand and the right foot and there was < 3% difference between the two, the test was considered negative and the newborn passed ' screening ; no further cardiac evaluation in the well baby nursery was necessary unless indicated by subsequent physical exam or clinical condition. if the oxygen saturation was 95% for any measurement or if there was 3% difference between the two saturations, the test was considered positive and the newborn was referred ' to his or her physician or lip. the newborn 's physician or lip was informed and responsible for all future decisions regarding care and evaluation. for newborns who were referred ', it was recommended that echocardiography be obtained to evaluate cardiac anatomy and if the oxygen saturation was 90% that he or she be transferred to the nicu for further monitoring and evaluation. decisions regarding echocardiography, additional consultation or transfer to the nicu were made at the discretion of the physician or lip caring for the newborn (figure 1). during enrollment, 6860 mothers agreed to have their newborn participate in the study (figure 2). of these, 6841 newborns met eligibility requirements for screening and 6745 newborns received full screening (defined as pulse oximetry of both the right hand and right foot). a total of 19 newborns did not meet eligibility criteria : 15 demonstrated signs or symptoms of chd, 3 had dysmorphic features and 1 newborn was ineligible for reasons not indicated. no further follow - up of these 19 newborns was obtained according to the protocol, and therefore it is unknown if they were identified to have cchd. in addition, 96 eligible newborns were not screened because of staff workload, obstacles faced while performing screening or early discharge. the average age at which screening occurred was 42.4 h (21 to 98 h). the average difference between upper and lower extremity oxygen saturations was 0.2% (0 to 6%). during the study period, of the 6745 newborns screened, 9 had positive screens and were referred to their primary physician or lip for decision regarding additional testing. five additional newborns were incorrectly identified as having negative screens ; all of these newborns had saturations above 95% but had a difference of 3% between the right hand and right foot ; none of these infants had additional testing or consultation. of the 9 newborns that were referred, 6 had additional testing or consultation, including repeat pulse oximetry (1), echocardiograms (6) and cardiology consultation (5). transfer to the nicu was required for two infants, one with cchd and one with mirror image dextrocardia and lobar pneumonia. one of these infants had oxygen saturations of 93 and 91%, and was subsequently diagnosed with cchd (anomalous drainage of the superior vena cava to left atrium). four others were diagnosed with chd (dextrocardia, dilated ascending aorta and two atrial septal defects). one infant with oxygen saturations of 100 and 97% was found upon further evaluation to have no chd and was confirmed as a false positive. three other infants had referring saturations but they had no additional testing or consultation ordered. assuming that the three infants with positive screens and no additional workup did not have chd, there were four referred infants with false positive results. the average amount of time required for screening was 3.5 min (0 to 35 min). barriers to performing screening were identified for a total of 166 of the 6841 enrolled newborns eligible for screening (2.4%). barriers were identified in 97 of 6745 infants who were successfully screened (1.4%) compared with 69 of 96 infants not screened (71.9%). barriers were identified to be related to the screening equipment (53.6% of the time) (for example, machine did n't work ' or difficulty with placement '), staff (22.9%) (for example, busy day ' or too many metabolic screens '), infant (19.9%) (for example, infant crying ' or very active ') and family (3.6%) (for example, mom was in rush '). in 100% of cases time required to overcome barriers was documented in 34 infants successfully screened and averaged 5.1 min per infant (2 to 10 min). our findings demonstrate that implementation is feasible and does not result in an excessive number of false positives. it was particularly important for feasibility to be assessed in a community hospital, as the vast majority of infants in the united states are born in such settings. in contrast, most pulse oximetry screening studies have been performed in research centers that have access to additional resources. in august 2011, a national workgroup commissioned by the united states health and human services (hhs) secretary 's advisory committee on heritable diseases in newborns and children published strategies to implement newborn pulse oximetry screening. the following month, hhs secretary kathleen sebelius fully endorsed adding screening to the recommended uniform screening panel and directed national agencies to proceed with implementation expeditiously '. given these national endorsements, universal pulse oximetry screening will become standard of care after the development of needed infrastructure. our study supports the feasibility of implementation in a community hospital setting and evaluates screening in larger populations and across a broad range of delivery systems ', as requested by the aha and aap in 2009. in our view, implementation feasibility means a high success rate of screening along with sufficiently low barriers and resource drain. successful screening occurred in the large majority of eligible participants (98.6%). we speculate that assigning that task to a single certified nursing assistant who was responsible for the screening whenever she was working allowed for more consistent and efficient care leading to a high success rate of screening. barriers to screening occurred for a variety of reasons but at a very low frequency (2.4% overall). resource equipment utilization includes the pulse oximeter, which is standard equipment in most hospitals, and the probes needed to perform screening. since the research study reported here, hch has continued newborn pulse oximetry screening as standard of care but transitioned to reusable probes to minimize cost. pulse oximetry screening can be implemented without requiring additional nursing staff. existing staff from labor and delivery and the maternity suites provided education to the providers and parents and performed all screening protocols. taking advantage of staffing models already in place, the program design linked pulse oximetry screening with newborn metabolic screening so that a small, consistent group of the nursing staff held primary responsibility for ensuring that both screenings were completed before discharge. pulse oximetry screening time was reported to be < 4 min per newborn on average. inclusion of pulse oximetry screening in newborn care did not necessarily result in a strain on pediatricians, neonatologists or ultrasonographers due to additional evaluations of failed screens. during the entire 17-month research period, only 9 of the 6745 newborns screened were referred to their pediatrician for additional evaluation. in addition, six echocardiograms were ordered for these newborns with positive pulse oximetry screens. historical data shows that 222 echocardiograms were ordered in the well baby nursery for other indications during that same time period. to date, few studies in the united states have evaluated pulse oximetry screening in non - research settings. walsh presented data from a public health initiative in 2007 offering pulse oximetry screening to all institutions that delivered newborns in middle tennessee. seventy - seven percent of hospitals agreed to participate, representing 43% of all births occurring in the region during the study period. the largest center with 7000 deliveries, among others, chose not to participate due to concerns about the need for extra staffing. of the 14 983 infants offered screening, 97.2% were successfully screened, almost as high as in our study. additionally, 0.78% of all infants screened failed testing compared with 0.12% in our study. many of the hospitals in the tennessee study did not have access to pediatric cardiology services on site and as such only 2.65% (3 of 113) of failed screens had echocardiograms performed, compared with our 67% (6 of 9). we suspect these differences may be partially explained by education and training, nursery care delivery systems and available resources. walsh 's data came from a public health initiative, without funding for education and training beyond set - up of the pulse oximeter. with additional training and defined confidence indicators for reporting accurate readings, it is not surprising that our screening took slightly longer on average but resulted in fewer failed screens. the educational resources developed to train staff and educate parents during our study have led to the development of an evidence - based educational toolkit. efforts are currently under way to evaluate this toolkit in providing aid to nurseries interested in implementing pulse oximetry screening. another major difference lies in hch 's ability to obtain an echocardiogram and cardiology consult quickly owing to an affiliation with a nearby academic center. this led to a very different approach to pulse oximetry screening and referral patterns in our institution. we recognize this to be a limitation of our study in that our results may not be generalizable to nurseries that do not have echocardiography on site, and further evaluation would require access to telemedicine or transfer to another institution. future studies and public health agencies will need to address this circumstance to maximize access to care. after completion of our research and successful implementation of the newborn pulse oximetry screening program, analysis and discussion identified a factor not formally studied. physician and nursing champions ' for screening were noted to be important during the implementation process. two hch - based physician investigators were on site, the cnmc - based nursing research coordinator made intermittent visits, and over time staff nursing champions were identified due to interest shown. these champions ensured that screening policy and protocols were carried out appropriately by serving as advocates for screening, being available for onsite support and clarification of protocols, encouraging staff during daily operations, and periodically presenting educational reinforcement and updated research findings. we speculate that these champions were instrumental in the success of implementation. regarding our secondary aim, we note that our study found a low incidence of cchd identified by pulse oximetry screening. the true incidence of cchd in the population delivered at hch during the study period could not be determined due to irb constraints and enrollment and eligibility requirements. because this was a feasibility study, only verbal consent was obtained, and mothers were informed that contact would not be initiated following discharge. consequently, the research team was unable to determine false negatives for cchd. however, the authors of this paper (including a neonatologist at hch and two cardiologists at cnmc, the primary referral center for pediatric cardiology in the region) were unaware of any subsequent diagnoses of cchd during the research period. therefore, it is probable that there were no false negatives. the low number of cchd patients identified among screened participants can be partially explained by defined research exclusion criteria causing preselection bias. first, no patients admitted to the nicu were included in the study ; the nicu population disproportionally includes infants with clinical presentations frequently associated with cchd (respiratory distress, hemodynamic instability or with multiple congenital anomalies). second, hch has a strong maternal fetal medicine program with active fetal echocardiography that may result in a higher percentage of chd diagnosed prenatally than is typical in a community hospital ; all newborns with prenatally diagnosed chd met exclusion criteria. finally, 15 neonates in the well baby nursery were ineligible to be screened due to specific clinical concern for chd ; some of these patients may have actually had cchd but we do not know as no follow - up was obtained on these patients per study protocol. newborn pulse oximetry screening for cchd is feasible and can be successfully implemented in a community hospital setting with limited resource drain (including no increase in staffing), few barriers to screening and a low false - positive rate. given recent national endorsements to move forward with universal pulse oximetry screening, these results are particularly important for other community hospital settings. although not formally studied, subsequent discussions suggest that careful implementation planning, appropriate education and training, and the support of stakeholders and champions may be important factors when implementing similar screening programs elsewhere. | objective : pulse oximetry has been recognized as a promising screening tool for critical congenital heart disease (cchd). the aim of this research was to study the feasibility of implementation in a community hospital setting.study design : meetings were conducted to determine an implementation plan. pulse oximetry was performed on the right hand and foot after 24 h of age. newborns with a saturation 95% or a 3% difference were considered to have a positive screen. screening barriers, screening time and ability to effectively screen all eligible newborns were noted.result:from january 2009 through may 2010, of 6841 eligible newborns, 6745 newborns (98.6%) were screened. of the nine infants with positive pulse oximetry screens, one had cchd, four had chd and four others were determined to have false positive screens. average screening time was 3.5 min (0 to 35 min).conclusion : pulse oximetry can be implemented successfully in community hospitals without an excessive number of false positives or additional nursing staff. |
radiotherapy during its history has been looking for two ultimate goals ; maximizing the tumor dose while minimizing the dose received by normal tissues. to attain these goals new beam delivery techniques such as intensity modulated radiation therapy (imrt) or new beam modalities such as proton and heavier ions called hadron therapy the strength of hadron therapy lies in their unique physical and radiobiological properties of these particles. hadrons can penetrate the tissues with less lateral straggling and deposit the maximum energy just before stopping. this is the so called bragg peak, which is the characteristic of hadron therapy. with the use of hadrons the tumor can be irradiated while the damage to healthy tissues is less than using megavoltage x - rays. in 1984, gray and kalogeropoulos proposed the idea of antiproton cancer treatment to take the physical and radiobiological advantages, which come from its annihilation reactions. the stopping power of high - energetic (> > 2 mev) antiprotons in tissue is similar to that of protons. when a beam of antiproton transverses a medium most of the particles kinetic energy will be lost before they come to rest. but when the antiproton stops, the particles will annihilate with nearby nuclei and result in releasing 1.9 gev of energy according to the well known mass and energy conservation relation. most of the annihilation energy is carried away by pions, gamma rays and neutrons, but part of the annihilation energy (up to 30 mev) will be still deposited locally by recoiling nuclear fragments with limited range. it is expected that recoiling nuclei will contribute with an enhanced relative biological effectiveness in the vicinity of the annihilation vertex. so a very favorable radiobiology is expected : in the plateau region, antiprotons behave mostly like protons, with well - known radiobiology and low relative biological effectiveness (rbe) but in the peak region because of recoiling nuclei with higher linear energy transfer (let) the biological effects will be increased and thereby increasing the peak to plateau ratio of the biological effect even larger compared to proton beam of same energy. attempts to find out reliable measurements of radiobiological behavior of antiproton therapy are limited because of the lack of reliable dosimetry. antiproton dose measurement is complicated because of the mixed particle spectrum especially in the peak area. the pulsed form of the antiproton beam also makes the measurement difficult. for this reason holzscheiter used the biologically effective dose ratio (bedr) to interpret a substantial increase in effective dose within the spread out bragg peak (sobp) of a cern antiprotons beam. for such situations, validated simulation toolboxes could be helpful to answer remaining questions about using antiproton in cancer therapy. furthermore simulating the adverse effects of ionizing radiation at the cellular and sub - cellular scale could be very helpful. among all available simulation codes, geant4 (geometry and tracking) is providing acceptable flexibility and extensibility, which progressively leads to the development of novel geant4 applications in research especially modeling the biological effects of ionizing radiation at the sub - cellular scale. one of the major advantages of geant4 is the possibility of applying different physics based on the experiment characteristics. besides unlimited combination of physics list, there are different standard packages, under development. meanwhile, geant4-dna is a project initiated in 2001 by dr p. nieminen at the european space agency for the development of a computing platform allowing an estimation of the biological effects of ionizing radiation using the geant4 toolkit, which is based on the object - oriented programming (c++). the current study tries to calculate depth dose of a beam of antiproton corresponding to the cern antiproton beam energy by geant4 employing the entire standard physics list available. hereby after verifying the code, a connection can be made between our works to those from geant4-dna project to take advantage of radiobiological simulation capabilities of the geant4. in this study measurement data collected at the antiproton decelerator in cern by bassler. geant4 toolkit version 9.4.6.p01 was used to reproduce the dose profile of a beam of a 502 mev / c (p / p = 0.251 mev / c) antiprotons which is the energy range used in the measurements. for all calculations, the beam profile characteristics were defined similar to the cern beam and those indicated in the measurements study. the geometry applied in our simulation consists of a 20 20 20 cm water tank to simulate the experimental beam at cern. because we did not find any significant improvements on statistical precision above 100000 primary particles (events), this number of events was used to get better cpu performance for the rest of simulations. the scoring mesh was a box placed at the entrance of the water phantom and in the centre of the beam. the length of the scoring region through the beam direction was 20 cm to cover maximum range of antiproton (which is around 13 cm). the effective diameter of the ionization chamber in the measurements study was 4 cm to include all the antiproton particles and low energy fragments generated in the annihilation events in the active region, especially in the bragg peak. for this reason the lateral dimensions of the scoring region (perpendicular to the beam direction) was defined to be equal to 4 cm to fulfill the measurement requirements. it makes the simulation resolution along the beam axis equal to 0.025 cm. for the simulation different standard physics lists these physics lists apply a string model for the modeling the interactions of high energy hadrons. the shower physics at the lower energies are handled by one of the intranuclear cascade models or the precompound model. nuclear capture process was handled by either the chiral invariant phase space (chips) model or one of the intranuclear cascade models, (bertini or binary). for each physics list, total dose deposition calculated by geant4 was compared to the measured data to find out which model can accurately predict antiproton interaction. most of the secondary particles fluxes were considered to investigate the effect of different physics models on the acquired results. in this way it would be possible to understand the origin of the discrepancies between the simulation results and measurements. all calculated depth dose curves were normalized to the dose at 60 mm beneath the entrance. the standard list is mainly based on one of two main string models which are quark gluon string (qgs) or fritiof (ftf) like string model. the simulated depth dose curves using different ftf based model lists are shown in figure 1. two different shower models binary (bic) and bertini (bert) were used, which are responsible to track low energy region. compared to the measured dose, the ftf models can predict the dose before the bragg peak (plateau dose) and also after it accurately. but in the high dose region (bragg peak) they were not adequately accurate to predict the dose level. it was found that for a basic string models (qgs or ftf) applying different cascade models (binary and bertini) could not affect the simulation results significantly [figure 2 ]. despite of the study by ribon., ftfp_bert_trv list could not give the reasonable results to predict the at - rest event using hfritiofcaptureatrest model [figure 1 ]. also ftfp_bert was used to investigate the effect of different electromagnetic options. for electromagnetic interactions there are different electromagnetic physics (em) option available other than standard one such as emv and emx as the fastest and most accurate options respectively. as it was expected there was no change on the results while using different em options for both ftf and qgs based physic lists [figure 2 ]. calculated depth dose profile of 502 mev / c antiproton beam applying geant4 physics lists (solid line) compared to measurements (dots). vertical and horizontal axis represents relative dose (arbitrary unite) and equivalent depth of water (millimeter) respectively calculated depth dose profile of 502 mev / c antiproton beam applying different quark gluon string models (solid line) compared to the measurements (dots). vertical and horizontal axis represents relative dose (arbitrary unite) and equivalent depth of water (millimeter) respectively as it is shown in figure 2, no significant difference on depth dose curves was found when implementing different physics lists based on qgs models (qgsp, qgsp_bert, qgsp_bic, qgs_bic and qgsc_chips). furthermore qgsc_chips could not calculate the depth dose in the low dose region before and after the bragg peak. it may be due to the improper use of qgsc model, which is appropriate for high energy region. but it is not appropriate for antiproton inelastic interactions in low energy region. despite of chips, qgsc_bert and lhep_emv, the chips model using g4qcaptureatrest model is not accurate to calculate the falling part of the peak in spite of its reasonable predication of plateau dose and rising arm of the bragg peak. this result did not agree with those by kossove in which simulation of at rest antiproton using chips model had been given reasonable results. figure 3 illustrates particle flux for secondary particles such as gamma, pions (+,, and 0), kaons (k +, k, k0), neutron, electron, positron, deuteron, alpha and triton. it was shown that different models calculated different particle flux, which resulted in greater discrepancy on the calculated dose consequently. figure 4 illustrates the relative antiproton flux to the entrance primary particle flux calculated by different physics lists. as it was shown, there is the significant difference on antiproton flux using chips and qgsc_chips models which agree with the calculated dose showed in figure 1. also there was not any significant difference on particle flux calculated by qgsp_bic, qgsp_bert, qgsp_bert_emv and qgsp_bert_emx which agree with the percentage depth dose (pdd) curves in figure 2. particle fluxes calculated by chips (upper left), qgsc_chips (lower left), ftf_bert_trv (upper right) and qgsp_bic (lower right) models normalized to the primary antiproton flux at the entrance level. vertical and horizontal axis represents relative flux to (arbitrary unite) and equivalent depth of water (millimeter) respectively antiproton flux calculated by different physics list normalized to the primary antiproton flux at the entrance level. vertical and horizontal axis represents relative flux (arbitrary unite) and equivalent depth of water (millimeter) respectively overall, none of the standard physics lists was able to predict the antiproton pdd. as it was shown the level of the plateau dose and the position of bragg peak reproduced in a correct manner by almost all the applied physics lists. the results of this study was different from those attained in keyes study using older version of geant4 (version 9.3.p01) in terms of the dose level before and after the bragg peak. despite of better results in our study some cases but the bragg peak level remained as the point of concern for both studies. from the particle flux study, we can conclude that different physics related to track the annihilation products could be one of the major causes to explain the different dose calculation by different lists. regarding the maximum allowable energy transfer to annihilation products, choosing the right physics model responsible for these particles is very important. since most of the annihilation dose will take away by pions, careful consideration of the physic lists must be chosen to track these particles. since this study dealt with low energy physics in qgsp the high energy interaction creates an exited nucleus, which is passed to the low energy parametrised (lep) to model the nuclear de - excitation. qgsc is the same as qgsp except applying chips, modeling the nuclear de - excitation to improve simulation of the nuclear de - excitation part of the interaction. qgsp_bert and qgsp_bic are like qgsp, lep bertini cascade and binary cascade below ~10gev thus replace the use of the lep. this study showed that there was no clear and significant difference in different lists between qgs based physics with those based on ftf physics. another finding of this study was that there is not any significant difference in calculated dose when applying different cascade models (binary and bertini). cao., suggested that that inconsistency of antiproton simulation by geant4 can come from the wrong annihilation cross section which does not agree with our findings. the difference in peak dose level can be conferred mostly from different physics than wrong cross section data. also there is no same behavior among different lists using the same cross section data e.g. lhep and lhep_emv. the lhep models are based on parameterised modeling of hadronic interactions consists of the high energy parametrised (hep) and low energy parametrised (lep) models. the lhep is the fastest physics list, but its models are usually not very accurate. better and slower models exist, but they do not apply to all particles at all energies. simulation results based on lhep lists and lep model showed that this model is not even reliable to calculate the dose in low dose region. also lhep_emv is overestimating the bragg peak level while it does not include any dedicated at rest model for antiproton and kaon minus. this study presents the comparisons between measurements and many hadronic models in geant4 for an antiproton beam with 502 mev / c kinetic energy. this work concludes that standard physics lists to predict the depth dose of 502 mev / c antiproton beam are reliable just before and after the bragg peak i.e., in low dose region. the bragg peak is placed to the correct position by near all the applied physic lists. furthermore the rising side of the bragg peak in simulated curves is interestingly matching with the measured data. this study concluded that the bertini model with high precision neutron tracking (qgsp_bert_hp) could the best to match the experimental data though it is one of the slowest physic model. nonetheless there are some discrepancies when applying qgsp_bert_hp which could be from the wrong physics model applied to pions which are responsible for transferring most of the annihilation energy resulting from nuclear fragmentation. finally it was concluded that the antiproton annihilation model needs to be improved from the current version of geant4. | after proposing the idea of antiproton cancer treatment in 1984 many experiments were launched to investigate different aspects of physical and radiobiological properties of antiproton, which came from its annihilation reactions. one of these experiments has been done at the european organization for nuclear research known as cern using the antiproton decelerator. the ultimate goal of this experiment was to assess the dosimetric and radiobiological properties of beams of antiprotons in order to estimate the suitability of antiprotons for radiotherapy. one difficulty on this way was the unavailability of antiproton beam in cern for a long time, so the verification of monte carlo codes to simulate antiproton depth dose could be useful. among available simulation codes, geant4 provides acceptable flexibility and extensibility, which progressively lead to the development of novel geant4 applications in research domains, especially modeling the biological effects of ionizing radiation at the sub - cellular scale. in this study, the depth dose corresponding to cern antiproton beam energy by geant4 recruiting all the standard physics lists currently available and benchmarked for other use cases were calculated. overall, none of the standard physics lists was able to draw the antiproton percentage depth dose. although, with some models our results were promising, the bragg peak level remained as the point of concern for our study. it is concluded that the bertini model with high precision neutron tracking (qgsp_bert_hp) is the best to match the experimental data though it is also the slowest model to simulate events among the physics lists. |
the interaction of carboxylic acids with tio2 is important in a number of applications. for instance, dyes in dye - sensitized solar cells (dssc) are typically anchored to tio2 via one or more carboxylate groups. in this work, we use acetate as a surrogate for a dye molecule with a single functionality. however, structural studies have thus far focused on exposure of tio2 to carboxylic acids at / near ultra high vacuum (uhv) conditions with a large proportion focused on formic acid. recently, we used uhv scanning tunneling microscopy (stm) to study the adsorption sites of carboxylates formed at aqueous interfaces, finding that the same sites are occupied as those identified in uhv adsorption. here we move even closer to measurements in a technologically relevant environment, examining in a quantitative fashion the in situ structure of the tio2(110) interface formed upon immersion in 0.1 m acetic acid using surface x - ray diffraction (sxrd). this concentration is chosen to match that used in an infrared spectroscopy study of the tio2 acetic acid interface, the results of which point to bidentate bonding of acetate. it is well established that exposing tio2(110) to ch3cooh vapor at room temperature results in an ordered (2 1) overlayer at saturation coverage, i.e., 0.5 monolayers (ml). the overlayer consists of acetate molecules ([ch3coo ]) formed via deprotonation, which bind to the surface through both oxygen atoms to two adjacent 5-fold surface titanium atoms, so that the molecular plane is aligned with the azimuth. a ball and stick model of the adsorption geometry is shown in figure 1. density functional theory (dft) calculations have confirmed that the bidentate adsorption mode is thermodynamically preferred over monodentate adsorption and that the p(2 1) pattern is more stable than the c(2 2) pattern with the same concentration. our sxrd results from the ch3cooh(aq) interface with tio2(110) show that carboxylate forms small overlayer domains of (2 1) symmetry. ball and stick model of the tio2(110)(2 1)[ch3coo ] surface. in the current study, the adsorbed acetate was found to be in a bidentate bridge location with the cleaved h thought to adsorb on neighboring bridging oxygen atoms. large blue, small red, small black, and small pink spheres are oxygen, titanium, carbon, and hydrogen, respectively. the labeling identifies the atom positions in tables 1, s1, s2, and s3. sxrd measurements were carried out using the six - circle diffractometer end station on id32 at the european synchrotron radiation facility. the tio2(110) (pi - kem) sample was prepared in uhv using the sample characterization laboratory at id32 (base pressure 1 10 mbar). this involved cycles of ar sputtering at room temperature and 1000 k annealing until a sharp (1 1) low energy electron diffraction pattern was obtained and row - resolution imaging in stm was achieved. after preparation the sample was transferred under uhv to a small portable ion - pumped uhv chamber (baby chamber) with a base pressure in the 10 mbar range. this chamber incorporates a dome shaped beryllium window to allow unrestricted transmission of the incident and reflected x - ray beams. subsequently, this baby chamber was mounted on the id32 six - circle diffractometer for sxrd measurements, with the sample surface in the horizontal plane. measurements were performed with the sample at room temperature using a monochromatic focused beam with energy of 17.7 kev (= 0.7), defined by slits to a size of (h v : 200 m 20 m). the angle of incidence of the x - ray beam with respect to the surface was kept constant at 0.3 for all measurements with 2 2 mm slits in front of a point detector. the experimental data were measured using rocking scans in which scattered intensity is measured, while the sample is rotated about its normal. these intensities were then integrated, and geometrical correction factors were applied to evaluate the structure factors, which, when represented versus perpendicular momentum transfer, are known as crystal truncation rods (ctrs). the tio2 (110) surface unit cell was described by lattice vectors (a1, a2, a3) parallel to the [110 ],, and directions, respectively, where a1 = a3 = a2 and a2 = c (a = 4.593 and c = 2.958). a large data set, comprising 1284 nonequivalent reflections, was recorded for the uhv - prepared surface. immediately afterward, the baby chamber was vented with n2 (99.998% purity) within a glovebag where the sample was transferred to a mylar thin film cell, which was then mounted on the id32 six - circle diffractometer. next, a 0.1 m aqueous solution of acetic acid was injected into the mylar thin film cell, and a further 1479 nonequivalent reflections were measured. for these sxrd measurements, the mylar thin film cell was in thin - layer - geometry, i.e., only a thin layer of ch3cooh(l) (< 1 m) was in contact with the sample surface. it should be noted that fractional order rods (fors) were also investigated but no measurable intensity was found. determination of the surface structure involved the use of a least - squares fitting procedure implemented within a modified version of rod in which simulated ctrs are generated. by optimizing the geometry of the structure, a best - fit model between theory and experiment can be found as measured by optimized and r - factor. a value close to 1 and an r - value close to 0.10 is considered an excellent fit between the experimentally observed and the theoretically calculated structure factors. we note that given their low x - ray scattering cross - section, h atoms were ignored in the fitting procedure. trial computer simulations for acetate adsorbed on tio2(110) (at the vacuum interface) were performed using the density functional theory (dft) code vasp. geometries and total energies were obtained using the generalized gradient approximation (gga) with the exchange - correlation functional of perdew, burke, and ernzerhof (pbe). a hubbard - type correction to the ti 3d orbitals was applied, with a value of ueff = 3 ev. no van der waals corrections were applied as their contribution to the strong chemisorption of carboxylic acids at this surface can be expected to be small. the tio2(110) surface was simulated using a periodic stack of quasi - two - dimensional slabs, where each slab is separated from the neighbor by a vacuum gap of 15. we used slabs with four o ti o trilayers, with the bottom two layers fixed to equilibrium bulk positions. a discussion about the adequacy of this model to simulate the adsorption of molecules at this surface can be seen in ref (19). sxrd analysis of uhv - prepared tio2(110)(1 1) considers a surface slab consisting of 2.5 unit cells (six tio atomic layers) in the direction that involved a total of 49 parameters : 34 atomic displacements, 12 debye waller (dw) factors, a scale factor, a roughness parameter, and a surface fraction parameter. the best - fit model produced a and r - value of 1.5 and 0.14, respectively. these values represent a high degree of agreement between experiment and simulated patterns. from the comparison of the atomic displacements from this study and that of a previous sxrd study on tio2(110), listed in table s1, it is clear that the two models are essentially in quantitative agreement with each other. this evidences the high reproducibility of the preparation procedure as described in the experimental section. all dw factors adopted reasonable values for both ti and o atoms where the highest value corresponded to the topmost surface layer (bti = 0.5 0.1, bo = 0.9 0.1) progressively decreasing with depth to their bulk value (bti = 0.3 0.1, bo = 0.2 0.1). the roughness parameter adopted a value (= 0.07) consistent with the very flat surface seen in stm images recorded prior to sxrd measurements. the surface fraction parameter confirmed that the entire surface adopted the geometry described by the best - fit model. the optimized tio2(110)(2 1)[ch3coo ] structure obtained following analysis of the sxrd data produced a of 1.05 and an r - value of 0.15. the total number of parameters used are the same as that for the uhv - prepared surface with an additional nine parameters associated with the acetate molecule ; six parameters to determine orientation and site position, two dw factors (o and c atoms), and an occupancy parameter. excellent agreement between the best - fit model and experiment is achieved, as can be seen from the comparison of the experimental and best fit simulated data in figure 2. this displays experimental ctrs (black error bars), with their best - fit theoretical simulations for the surface after exposure to 0.1 m ch3cooh(aq) (red line). it also shows the effect of removing the acetate molecule from the model and reoptimizing the structural and nonstructural parameters (i.e., dw factors) (blue line). this increases the and r - factor to values of 1.56 and 0.19, respectively. it is clearly evident that the presence of the acetate molecule significantly improves the overall goodness - of - fit. the adsorbed acetate was found to be in a bidentate bridge location, i.e., binding through both oxygen atoms to two 5-fold titanium atoms such that its molecular plane is along the azimuth (figure 1), in excellent agreement with the literature for acetate and other simple carboxylates bound to this substrate at the vacuum interface. the resulting bond distances are ti(2)o(11) = 2.13 0.03, ti(2)o(12) = 2.06 0.03, which compare well with bond distances from the formate / tio2(110) system. experimentally observed (black error bars) and calculated ctrs for the tio2(110)(2 1)[ch3coo ] surface model (red line) and after removing the acetate molecule (blue line). it is clear that the addition of the acetate molecule to the model improves the overall goodness - of - fit. in contrast to refs., here we allow the adsorbed carboxylate to be asymmetric in order to compare with dft calculations. the results of the latter indicate an asymmetric carboxylate, which appears to arise from the orientational ordering of the hydroxyl groups. in the experiment, the hydroxyls will likely be disordered and this asymmetry will be averaged, and indeed the nominal asymmetry is almost within the error bars (see table 1). the expected orientational disorder of the hydroxyl groups was confirmed by dft calculations in a 2 2 supercell, where the results indicate that all different orientational configurations are within 20 mev in energy. the apparent volume of the molecule has also been investigated by simulating a uniform expansion / compression of the molecule. the best fit is consistent with a small molecular expansion (2.9 0.6%) ; however, this is considered to be insignificant because of the lack of sensitivity of the and r - factor to this change in volume (table s3 provides optimized positions of atoms in the acetate moiety). table 1 lists the internal bond distances and angles of acetate / acetic acid emerging from this study and previous literature values. there is excellent agreement with both previous experimental and theoretical work regarding the intramolecular bond distances. discrepancies in bond angles are due to previous experimental work being on molecular acetic acid rather than acetate. when comparing displacements of substrate atoms between the uhv - prepared tio2(110)(1 1) and the tio2(110)(2 1)[ch3coo ] surfaces it is clear that adsorption of acetate reduces the clean surface relaxations (see tables s1 and s2 for atomic displacements and atomic coordinates, respectively). this almost certainly arises from an increase in substrate surface atom coordination number and has been seen before for carboxylate / tio2(110) at the vacuum interface and other metal oxide surfaces exposed to liquid water. this is also reflected in the dw parameters, which return to close to their bulk value. good agreement of atomic displacements can also be seen between sxrd and dft - pbe calculations from this study (see supporting information for details). as regards the roughness parameter, this now takes a value of 0.2, increasing from 0.07. this most likely arises from the small size of randomly distributed domains (a few nm) of both ordered acetate moieties and domains absent of molecules, as evidenced in stm images. in summary, the interface between 0.1 m acetic acid and tio2(110) comprises small domains of (2 1) ordered arrays of acetate moieties. the positions of the atoms within the molecule as well as the substrate determined by sxrd are in excellent agreement with pbe+u calculations. it is possible that steric hindrance will prevent the same ordering for monocarboxylic dye molecules in dssc for which we are using acetate as a surrogate. however, it seems likely that the same local bonding geometry will be adopted. on this basis, these data should allow more reliable calculations of charge transport at dye molecule | the positions of atoms in and around acetate molecules at the rutile tio2(110) interface with 0.1 m acetic acid have been determined with a precision of 0.05. acetate is used as a surrogate for the carboxylate groups typically employed to anchor monocarboxylate dye molecules to tio2 in dye - sensitized solar cells (dssc). structural analysis reveals small domains of ordered (2 1) acetate molecules, with substrate atoms closer to their bulk terminated positions compared to the clean uhv surface. acetate is found in a bidentate bridge position, binding through both oxygen atoms to two 5-fold titanium atoms such that the molecular plane is along the [001 ] azimuth. density functional theory calculations provide adsorption geometries in excellent agreement with experiment. the availability of these structural data will improve the accuracy of charge transport models for dssc. |
tagami who proposed the term granulocytic spongiotic papulovesiculosis (gspv) for it. it is a disorder of uncertain classification and the etiology has never been fully explained. the reported cases showed recurrent outbreaks of small, vesicopustules, predominantly on face, neck, or upper trunk with unique histopathological features of epidermal granulocytic spongiosis, neutrophilic exocytosis without any evidence of vasculitis. a 45-year - old female presented with rapidly progressing grouped red raised, itchy, nontender lesions over lower legs, hands, face, abdomen, and lower back with moderate fever 100 - 102 degree f for the past 2 weeks. history of similar episodes (for the past 4 years) more in summers was obtained. successive crops appeared, persisted for 34 weeks, and resolved, leaving behind postinflammatory hyperpigmentation. she also had symmetrical, nonmigratory joint pains involving the interphalangeal, wrists, knee, ankle, and metarsophalangeal joints without any associated swelling and redness for the past 4 years. there was no history of recurrent oral / genital ulcers, raynaud 's phenomenon, photosensitivity, muscle weakness, gastrointestinal complaints, prior drug intake, or history of any topical irritant or allergen application. on cutaneous examination, multiple grouped erythematous to violaceous papulovesicles and vesicopustules of size 0.3 cm 0.3 cm0.5 cm 0.5 cm were present over abdomen, lower trunk, arms, hands, feet, and face [figures 1 and 2 ]. few erythematous to violaceous plaques of size 0.7 cm 0.7 cm1 cm 1 cm were present over the forehead, surface showed fine white semiadherent scaling [figure 3 ]. examination of scalp, oral mucosa, palms, soles, and nails was within normal limits. multiple grouped erythematous to violaceous papulovesicles on shoulder multiple grouped erythematous to violaceous papulovesicles and crusting erythematous to violaceous plaques over the forehead based on these findings, possibility of contact dermatitis, lupus erythematosus, and neutrophilic dermatosis (sweet 's syndrome) was kept. antinuclear antibody, rheumatoid factor, perinuclear antineutrophil cytoplasmic antibodies (anca), cytoplastic anca, antistreptolysin o, c - reactive protein, hepatitis b and c antibody were negative. radiographs of bilateral knee joints revealed degenerative changes while that of chest, bilateral hands, feet, and wrist joints were within normal limits. histopathological examination of a papule showed mild hyperkeratoses, focal spongiosis, and neutrophilic exocytosis of the epidermis [figure 4 ]. dermis showed mild pigment incontinence and perivascular inflammatory infiltrate of neutrophils and few eosinophils till mid - dermis. focal spongiosis and neutrophilic exocytosis of the epidermis (h and e, 10) intraepidermal pustule containing neutrophils and few eosinophils (h and e, 40) the patient was initially started on oral prednisolone, with only partial improvement and continuous development of new lesions. the patient has not developed any new lesion in 4 months of follow - up. gspv is characterized by intermittent outbreaks of myriad, semiconfluent, small papulovesicles, and vesicopustules, predominantly on the face, neck, or upper trunk but sometimes over other sites such as axillae. predominant flexural and severe mucosal involvement of the entire oral, pharyngeal, and vaginal mucous membranes were reported in one patient. our patient presented with recurrent episodes of rapidly progressing pruritic grouped papulovesicles over face, trunk, and upper limbs. features of cases reported in literature the histopathological findings of gspv are unique showing epidermal granulocytic spongiosis, neutrophilic exocytosis with vesicles containing neutrophils and eosinophils, and not fulfilling the features of vasculitis. the histological features of neutrophilic spongiosis can be seen in several conditions as enumerated in table 2. the histology of sweet 's syndrome shows dense, predominantly neutrophilic, infiltrate located in the superficial dermis in a band - like pattern, and prominent papillary dermal edema which may occasionally lead to subepidermal vesiculation. furthermore, sweet 's syndrome responds dramatically to steroids, which was not seen in our patient. thus, the clinical and laboratory data along with dramatic response to dapsone in our patient preclude the possibility of sweet 's syndrome and other disorders as mentioned in table 2. the lesions coalesce into annular, circinate or serpinginous patterns, preferring the trunk and intertriginous areas, including the axillae, groin, and submammary regions. histopathologically, the hallmark of subcorneal pustular dermatosis is a strictly subcorneal pustule filled with polymorphonuclear leukocytes. the underlying epidermis is generally spared and spongiosis is usually absent which help in differentiating it from gspv. differential diagnosis of neutrophilic spongiotic vesiculopustular dermatoses dif in gspv is usually negative, but a positive dif with iga deposition at the dermoepidermal junction was noted in a single patient. our patient had certain distinct features such as association with multiple joint pains (attributed to systemic inflammation), fever, itching, and increased frequency of lesions in summers. another interesting feature in our patient was koebnerization, which has not been reported so far in this disease. treatment with rifampicin, gentamicin, erythromycin, antihistamines, corticosteroids, azathioprine, methotrexate, and colchicine is usually ineffective. gspv responds dramatically to dapsone in 4872 h. clofazimine was tried in a patient intolerant to dapsone, which showed therapeutic response similar to that with dapsone. our patient showed poor response to steroids, and hence, dapsone was started with response seen in 34 days. since this condition has several close differentials, it can be easily missed out and misinterpreted. hence, gspv can be suggested as a diagnosis although uncommon, especially where neutrophilic spongiosis is encountered as the predominant feature on histopathology. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. dermatologists should consider this possibility in any patient presenting with recurrent episodes of papulovesicles showing neutrophilic spongiosis on histopathology. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. dermatologists should consider this possibility in any patient presenting with recurrent episodes of papulovesicles showing neutrophilic spongiosis on histopathology. | neutrophilic spongiosis also known as granulocytic spongiotic papulovesiculosis (gspv) is an uncommon disorder of uncertain classification. we report the case of a 45-year - old woman suffering from recurrent episodes of itchy, grouped papulovesicles over her body, histologically showing granulocytic spongiosis. the eruptions showed complete response to dapsone. |
heart failure (hf) is a major public health problem [13 ] with poor outcomes especially in african americans (aa) and hispanics [1, 4 ]. the higher mortality in these groups has been attributed to differences in the severity and causes of hf, the prevalence of coexisting conditions and risk factors, socioeconomic and cultural factors, and access to high - quality medical care. beta blockers (bbs) are beneficial in patients with symptomatic hf or left ventricular (lv) systolic dysfunction [68 ]. the increase in left ventricular ejection fraction (lvef) is greater in patients with lower baseline lvef after treatment with bb therapy [9, 10 ]. it has been suggested that after response to bb therapy, the bb should not be withdrawn, because of an increased risk of clinical deterioration or death from progressive congestive heart failure (chf).. there may be race - related genetic differences in the beta - adrenergic pathway explaining that difference. differences such as the frequency of the g - protein - coupled receptor kinase (grk)-leu41 polymorphism, which desensitizes beta - adrenergic receptors, have been found between aa and caucasian patients. overall, bbs have been shown to have similar benefits in both aa and caucasians [1620 ]. previous hf studies have generally been limited to comparisons between aa and caucasian populations [2, 12 ], but there are few comparative statistics concerning hf in hispanics, one of the fastest - growing segments of the us population. for patients who experience an improvement in ventricular performance on bb therapy, there is little data regarding whether this improved performance is maintained on continued bb therapy. although several studies have shown improvements in mortality and hospitalizations for chf over more than 2 years, there is little data following lvef on bb therapy past 1 year [7, 8, 17, 19, 22, 23 ]. of special interest is the effect of bbs on non - ischemic cardiomyopathy (nicm) since the effect of bbs on lvef is often unpredictable in this group [7, 24 ]. therefore, it is unknown with what frequency lvef increase on bb therapy is maintained past 1 year in patients with hf. moreover, while substantial information is available on racial differences in mortality and risk factors, much less is known about racial differences in lvef response to bbs in patients with nicm. this study aimed to examine the frequency of decline in lvef after initial response to bb therapy in patients with nicm and to compare this frequency between aa, hispanic, and caucasian patients. a total of 238 patients with baseline a left ventricular ejection fraction (lvef) of 40 % utilizing bbs (carvedilol, metoprolol succinate, or tartrate) with nicm who were followed at the hf clinic of weiler hospital of the albert einstein college of medicine were analyzed retrospectively. patients with ischemic and hypertrophic cardiomyopathy, hemodynamically significant valvular lesions, severe bronchospastic lung disease, baseline heart rate (hr) iii50 (21 %) 12 (38 %) 38 (18 %) icd74 (31 %) 18 (56 %) 56 (27 %) 0.001valvular disease54 (23 %) 4 (13 %) 50 (24 %) 0.176dyslipidemia156 (66 %) 20 (63 %) 136 (66 %) 0.697ckd48 (20 %) 4 (13 %) 44 (21 %) 0.245smoking110 (46 %) 10 (31 %) 100 (49 %) 0.09alcohol74 (31 %) 10 (31 %) 64 (31 %) 0.983 p value (chi - square for categorical variables and mann whitney test for continuous variables) for comparison between groups (post - response lvef decline vs. sustained lvef response) aa african americans, ckd chronic kidney disease, htn hypertension, icd intracardiac defibrillator, iqr interquartile range, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy, nyha new york heart association clinical characteristics between patients with post - response lvef decline and patients with sustained lvef response p value (chi - square for categorical variables and mann whitney test for continuous variables) for comparison between groups (post - response lvef decline vs. sustained lvef response) aa african americans, ckd chronic kidney disease, htn hypertension, icd intracardiac defibrillator, iqr interquartile range, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy, nyha new york heart association regarding medication use (table 2), 142 patients (60 %) received carvedilol, whereas 96 patients (40 %) received metoprolol. the median dose of carvedilol was 25 mg daily, whereas the median dose of metoprolol was 88 mg daily. as shown, compared with patients with sustained lvef response, patients with post - response lvef decline were on lower doses of carvedilol (25 vs. 37.5 %, p 75 mg po bid)21 (9 %) 2 (6 %) 19 (9 %) 0.581overall dose of bb (combined) low83 (35 %) 13 (41 %) 70 (34 %) 0.463 medium76 (32 %) 13 (41 %) 63 (31 %) 0.257 high79 (33 %) 6 (19 %) 73 (35 %) 0.062acei or arb226 (95 %) 30 (94 %) 196 (95 %) 0.737hydralazine40 (17 %) 2 (6 %) 38 (18 %) 0.086nitrates32 (13 %) 0 (0 %) 32 (16 %) 0.017spironolactone134 (56 %) 22 (69 %) 112 (54 %) 0.127digoxin120 (50 %) 14 (44 %) 106 (51 %) 0.417calcium channel blocker42 (18 %) 4 (13 %) 38 (18 %) 0.412 p value (chi - square for categorical variables and mann whitney test for continuous variables) for comparison between groups (post - response lvef decline vs. sustained lvef response) acei angiotensin - converting enzyme inhibitors, arb angiotensin ii receptor blockers, bb beta blocker, bid twice daily, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy, po oral differences in medications between patients with post - response lvef decline and patients with sustained lvef response p value (chi - square for categorical variables and mann whitney test for continuous variables) for comparison between groups (post - response lvef decline vs. sustained lvef response) acei angiotensin - converting enzyme inhibitors, arb angiotensin ii receptor blockers, bb beta blocker, bid twice daily, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy, po oral among 238 patients with nicm, 32 (13 %) had post - response lvef decline and 206 (87 %) had sustained lvef response. overall, there was a significant improvement of lvef from baseline after 1 year of bb (3044 %, p iii50 (21 %) 12 (38 %) 38 (18 %) icd74 (31 %) 18 (56 %) 56 (27 %) 0.001valvular disease54 (23 %) 4 (13 %) 50 (24 %) 0.176dyslipidemia156 (66 %) 20 (63 %) 136 (66 %) 0.697ckd48 (20 %) 4 (13 %) 44 (21 %) 0.245smoking110 (46 %) 10 (31 %) 100 (49 %) 0.09alcohol74 (31 %) 10 (31 %) 64 (31 %) 0.983 p value (chi - square for categorical variables and mann whitney test for continuous variables) for comparison between groups (post - response lvef decline vs. sustained lvef response) aa african americans, ckd chronic kidney disease, htn hypertension, icd intracardiac defibrillator, iqr interquartile range, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy, nyha new york heart association clinical characteristics between patients with post - response lvef decline and patients with sustained lvef response p value (chi - square for categorical variables and mann whitney test for continuous variables) for comparison between groups (post - response lvef decline vs. sustained lvef response) aa african americans, ckd chronic kidney disease, htn hypertension, icd intracardiac defibrillator, iqr interquartile range, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy, nyha new york heart association regarding medication use (table 2), 142 patients (60 %) received carvedilol, whereas 96 patients (40 %) received metoprolol. the median dose of carvedilol was 25 mg daily, whereas the median dose of metoprolol was 88 mg daily. as shown, compared with patients with sustained lvef response, patients with post - response lvef decline were on lower doses of carvedilol (25 vs. 37.5 %, p 75 mg po bid)21 (9 %) 2 (6 %) 19 (9 %) 0.581overall dose of bb (combined) low83 (35 %) 13 (41 %) 70 (34 %) 0.463 medium76 (32 %) 13 (41 %) 63 (31 %) 0.257 high79 (33 %) 6 (19 %) 73 (35 %) 0.062acei or arb226 (95 %) 30 (94 %) 196 (95 %) 0.737hydralazine40 (17 %) 2 (6 %) 38 (18 %) 0.086nitrates32 (13 %) 0 (0 %) 32 (16 %) 0.017spironolactone134 (56 %) 22 (69 %) 112 (54 %) 0.127digoxin120 (50 %) 14 (44 %) 106 (51 %) 0.417calcium channel blocker42 (18 %) 4 (13 %) 38 (18 %) 0.412 p value (chi - square for categorical variables and mann whitney test for continuous variables) for comparison between groups (post - response lvef decline vs. sustained lvef response) acei angiotensin - converting enzyme inhibitors, arb angiotensin ii receptor blockers, bb beta blocker, bid twice daily, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy, po oral differences in medications between patients with post - response lvef decline and patients with sustained lvef response p value (chi - square for categorical variables and mann whitney test for continuous variables) for comparison between groups (post - response lvef decline vs. sustained lvef response) acei angiotensin - converting enzyme inhibitors, arb angiotensin ii receptor blockers, bb beta blocker, bid twice daily, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy, po oral among 238 patients with nicm, 32 (13 %) had post - response lvef decline and 206 (87 %) had sustained lvef response. overall, there was a significant improvement of lvef from baseline after 1 year of bb (3044 %, p < 0.001). figure 1 shows change in lvef after bb in patients with nicm within 4 years after the initial lvef. there was no difference in the lvef before initiation of bb in the two lvef response groups (30 vs. 29 %, p = 0.098). compared with patients with post - response lvef decline, patients with sustained lvef response had a higher lvef at 1 year (47 vs. 41 %, p < 0.01) and a higher nadir of lvef (40 vs. 25 %, p < 0.001).fig. 1change in lvef after bb in patients with nicm. compared with patients with post - response lvef decline, patients with sustained lvef response had higher lvef at 1 year (47 vs. 41 %, p < 0.01) and higher nadir of lvef (40 vs. 25 %, p < 0.001). bb beta blocker, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy change in lvef after bb in patients with nicm. compared with patients with post - response lvef decline, patients with sustained lvef response had higher lvef at 1 year (47 vs. 41 %, p < 0.01) and higher nadir of lvef (40 vs. 25 %, p < 0.001). bb beta blocker, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy table 3 shows differences in change in lvef between different races. compared with other races, hispanics had lower lvef increase after 1 year of bb (40 %, p < 0.01) and lower nadir lvef in both the post - response lvef decline group (22 %, p < 0.001) and sustained lvef response group (32 %, p < 0.01) (fig. 2). there was no difference in the percentage of sustained and post - response lvef decline between races.table 3differences in change in lvef between different races (patients with post - response lvef decline and patients with sustained lvef response)all nicm (n = 238)caucasians (n = 52)hispanics (n = 78)aa (n = 108) p valuepost - response lvef decline [n (%) ] 326 (19)14 (44)12 (38)0.288 baseline lvef before bb [median (iqr)]30 (2435)34 (2442)32 (2236)27 (1931)0.024 lvef after 1 year of bb [median (iqr)]41 (2952)47 (3550)40 (3048)45 (3652)<0.01 post - response nadir lvef [median (iqr)]25 (2029)27 (2031)22 (2025)26 (2432)<0.01sustained lvef response [n (%) ] 20647 (23)60 (29)99 (48)0.147 baseline lvef before bb [median (iqr)]29 (2336)27 (2230)30 (2038)30 (2535)0.036 lvef after 1 year of bb [median (iqr)]47 (3554)49 (3855)38 (2241)44 (3448)<0.01 post - response nadir lvef [median (iqr)]40 (2544)42 (3146)32 (2537)36 (2840)0.005 p value for comparison of different races aa african americans, bb beta blocker, iqr interquartile range, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathyfig. hisp had a lower lvef increase after 1 year of bb (p < 0.01) and lower nadir lvef in both the post - response lvef decline group (22 %, p < 0.01) and sustained lvef response group (32 %, p < 0.01). aa african americans, bb beta blocker, cauc caucasians, hisp hispanics, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy differences in change in lvef between different races (patients with post - response lvef decline and patients with sustained lvef response) p value for comparison of different races aa african americans, bb beta blocker, iqr interquartile range, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy change in lvef after bb in patients with nicm. compared with other races, hisp had a lower lvef increase after 1 year of bb (p < 0.01) and lower nadir lvef in both the post - response lvef decline group (22 %, p < 0.01) and sustained lvef response group (32 %, p < 0.01). aa african americans, bb beta blocker, cauc caucasians, hisp hispanics, lvef left ventricular ejection fraction, nicm non - ischemic cardiomyopathy table 4 shows results of the multivariable logistic analysis using post - response lvef decline as the outcome of interest. hispanic race was a significant predictor of lvef decline in both unadjusted (odds ratio (or) = 3.128, p < 0.01) and adjusted analyses (or 6.094, p < 0.001). age (or 0.933, p < 0.001) and baseline lvef (or 1.075, p < 0.05) also remained significant predictors of post - response lvef decline. gender, new york heart association (nyha) class, use of an acei / arb, and dose of bb were not significant predictors of lvef decline. similar results were noted when we examined the post - response lvef decline at 1 year (data not shown).table 4important predictors of post - response lvef decline (multivariable logistic regression). final models adjusted for important clinical characteristics such as age, gender, nyha classpredictorspost - response lvef decline (n = 32)unadjustedadjustedor p valueor p valuebaseline lvef (overall)1.0470.0381.0750.029race (white is reference) hispanic race3.1280.0036.094<0.001 aa0.9260.8420.5950.224nyha class1.4310.2402.2870.035bb dose (low dose of bb is reference) medium - dose bb1.5530.2591.2200.687 high - dose bb0.4200.0690.3120.063acei / arb0.7650.7380.5320.472gender0.6520.2650.9510.910age0.9600.0050.933<0.001 aa african americans, acei angiotensin - converting enzyme inhibitors, arb angiotensin ii receptor blockers, bb beta blocker, lvef left ventricular ejection fraction, nyha new york heart association, or odds ratio important predictors of post - response lvef decline (multivariable logistic regression). final models adjusted for important clinical characteristics such as age, gender, nyha class aa african americans, acei angiotensin - converting enzyme inhibitors, arb angiotensin ii receptor blockers, bb beta blocker, lvef left ventricular ejection fraction, nyha new york heart association, or odds ratio this study aimed to examine the frequency of decline in lvef after initial response to bb therapy and to compare this frequency between aa, hispanic, and caucasian patients. the primary finding of this study was that there might be a significant proportion of hf patients whose lvef declines after initially responding to bb therapy. this conclusion is drawn from the observed occurrence of lvef decline after initial response to bb therapy at a rate of 13.44 % over 4 years after the initiation of therapy. compared with other races, hispanics had lower nadir lvef (22 %, p < 0.001). important predictors of lvef decline were hispanic race, nyha class, baseline lvef, and age, but not gender. in our study, we found that there seems to exist an occurrence of lvef decline after initial response to bb therapy at a rate of 13.44 % over 4 years after the initiation of therapy in patients with nicm. prior studies have shown that patients with nicm may respond better to bbs than patients with ischemic cardiomyopathy [2628 ]. patients with nicm have initially increased wall tension due to dilated lv that causes increased myocardial oxygen demands. therefore bbs may find a more homogeneous substrate in the first months after initiation of therapy. during therapy and maybe over time because of changes in wall stress, this substrate may change and the effect of bbs in lvef declines. another factor that may explain the percentage of post - response lvef decline in patients with nicm may be genetic variability. prior studies have shown that patients with certain beta receptor genotypes were associated with better clinical response to bbs compared with others [15, 2932 ]. perhaps the patients with post - response lvef decline have different polymorphisms than the patients with sustained lvef response. future research aimed at analyzing polymorphisms among patients with nicm who do not seem to have a sustained response to bbs may yield interesting results. interestingly, we found that hispanics with chronic hf had worse lvef response and post - response lvef decline after use of a bb compared with other races. to our knowledge this is one of the first studies to examine differences in lvef response between aa and hispanics with nicm. although the hispanic population has been shown to comprise a high - risk cardiovascular group [3335 ], there are very limited data on hispanic patients with chronic systolic hf. aa have been underrepresented in major hf trials, whereas hispanic patients have been nearly absent in most clinical trials, and thus there are very limited data regarding the effect of medications such as bbs in this ethnic group. although lvef patterns in hispanic subgroups compared with non - hispanic whites have been examined in the mesa (multi - ethnic study of atherosclerosis) [34, 35 ], these patterns have not been associated with use of bbs. in our study, we confirm prior findings that hispanics have differences in clinical response of hf parameters compared with other races. finally, we extended this finding by showing that hispanics have worse lvef response and post - response lvef decline compared with other races after use of bbs. the different lvef response to bbs among races can be explained by a few factors [1214 ]. a difference in lvef response and lvef decline can be explained by differences among ethnic groups with respect to ancestry / race, socioeconomic factors, and dietary and lifestyle risk factors for cardiovascular disease. however, our study was not designed to explain why lvef response and lvef decline seems to differ in different ethnic subgroups and socioeconomic status was not one of the predictors of lvef decline. similar to other studies [1720 ], we found that aa and caucasians had similar response to bbs after 1 year and similar post - response lvef decline. however, other studies such as the beta - blocker evaluation of survival trial (best) showed that aa patients had a worse hf prognosis than caucasians because of genetic differences. a genetic substudy of the best data, which evaluated the effects of bbs among differing b - gene polymorphisms showed that patients with certain beta receptor genotypes were associated with the better clinical response to bbs compared with others [15, 2932 ]. another study showed that carvedilol significantly increased lvef in chf patients with the glu(27)beta(2)-adrenergic receptor allele. therefore differences in lvef response to bbs [40, 41 ] could be attributed to genetic differences. hispanic patients with nicm may have genetic polymorphisms that could explain why this racial group may be more susceptible to post - response lvef decline compared with other races. in this regard, the interactions between hispanic race, care - seeking behavior, and access to high - quality hf care remain important areas for future investigation, and future research aimed at analyzing polymorphisms among hispanics and aa may yield interesting results. whether there is any variable that can predict maintenance of lvef after initial response to bb therapy in patients with hf remains to be discovered. our study showed that age and nyha class were important predictors of lvef response compared with other predictors such as bb dose. these results are consistent with prior studies that have shown that age and nyha class have a strong association with lvef response to bbs [14, 22 ]. regarding dosing of bbs, in the multicenter oral carvedilol heart failure assessment (mocha) trial, carvedilol (12.550 mg / day) generated dose - related lvef improvement (58 %) in hf patients, of whom 77 % were caucasians. the carvedilol dose in our patients was about the same dose as that used in the mocha trial, but the magnitude of the lvef improvement for caucasians in our study was higher. although this finding is consistent with other studies [10, 42, 43 ], to the best of our knowledge there are no prior studies regarding bb dosing and lvef response in hispanics. in our study, we also confirmed the finding that the effect of bbs on lvef response was similar irrespective of type of bb used (metoprolol or carvedilol) [10, 42, 43 ]. therefore, hispanics with nicm may have worse post - response lvef decline irrespective of bb dose and type of bb used compared with other races. given that prior data have shown differences in lvef response to bbs [15, 2932, 40, 41 ] due to genetic differences (b - gene polymorphisms) our data is consistent with prior studies that have shown that baseline lvef has a significant association with response to bb therapy [9, 10 ]. the increase in lvef is greater in patients with lower baseline lvef after treatment with bb therapy. the down - regulation of beta-1-receptor density may be greater with higher chronic catecholamine exposure, which may be the case with more severe cardiomyopathy. bb therapy may then up - regulate beta-1-receptor density to a greater extent in these more severe disease states. due to the retrospective nature of the study, expected limitations the number of patients enrolled in this study precluded restriction of analyses to only those with low ejection fraction or only those with symptoms of hf. those variables that were determined by self - report or review of the medical records are beyond the control of the investigators and, thus, subject to error. there was also a lack of availability of data on medical therapy and a lack of information regarding socioeconomic status, including education and income, that may have had an effect on hf outcomes. in addition, this is a single - center study and the findings may not confer external validity. in our hispanic population, we did not identify special subgroups such as mexican - origin hispanics versus those of caribbean - origin, subgroups which have been shown to have differences in lv remodeling parameters [34, 35 ]. finally, the methods used in this study serve only to describe statistical associations between variables, which are not necessarily proof of causation. a significant proportion (13.44 %) of nicm patients who experienced an improvement in lvef with bb therapy in the first year had a subsequent decline. race, nyha class, baseline lvef, and age are important predictors of post - response lvef decline. an underlying genetic difference may explain differences in lvef response to bb therapy observed in this study. future studies should evaluate genetic polymorphisms affecting beta - adrenoceptor function in patients with nicm. funding for this project was provided by the congestive heart failure division fund, montefiore medical center. these data were presented in part at the 13th annual scientific meeting of the heart failure society of america, september 2009, boston, ma, usa. none of the authors has a financial relationship with a commercial entity that has an interest in the subject of the presented manuscript or other conflicts of interest to disclose. | background although beta blockers (bbs) are established therapy in heart failure, some patients whose left ventricular ejection fraction (lvef) initially increases on bb therapy experience a subsequent lvef decline. this study aimed to evaluate the proportion of patients with non - ischemic cardiomyopathy (nicm) whose lvef declines while on bb therapy and determine important predictors of lvef decline.methodsa retrospective analysis of 238 patients receiving a bb (carvedilol, metoprolol succinate, or tartrate), with an ejection fraction of 40 % and nicm, whose lvef initially rose 5 % after 1 year of bb therapy, was conducted. post - response lvef decline 5 % to a final lvef of 35 % was evaluated within 4 years of bb initiation.resultsin our study, we had 52 caucasians (22 %), 78 hispanics (33 %), and 108 african americans (45 %). overall, 32 patients (13.44 %) had post - response lvef decline. the nadir lvef of patients with post - response lvef decline was 25 % (interquartile range 2027). compared with others, hispanics had lower nadir lvef (22 %, p < 0.001). important predictors of lvef decline were hispanic race (odds ratio (or) 6.094, p < 0.001), new york heart association (nyha) class (or 2.287, p < 0.05), baseline lvef (or 1.075, p < 0.05), and age (or 0.933, p < 0.001).conclusiona significant proportion (13.44 %) of nicm patients with lvef increase over 1 year of bb therapy experienced subsequent lvef decline. race, nyha class, baseline lvef, and age are important predictors of this decline. |
translation is one of the last steps of gene expression, during which ribosomes synthesize proteins. a growing body of evidence indicates that the translation process per se plays a key role in tumorigenesis. significantly, it was recently revealed that components of the translational machinery play unexpected direct roles in tumorigenesis. for example, haploinsufficiency in ribosomal protein (rp) rpl24 is sufficient to significantly delay tumorigenesis in mice overexpressing the oncogene c - myc or lacking the tumor suppressor phosphatase and tensin homolog (pten). in addition, it has been extensively demonstrated that the expression of oncogenes and tumor suppressors is regulated at the protein synthesis level. finally, the specific inhibition of rna polymerase i (rna pol i) using small molecules selectively kills cancer versus healthy cells in mouse models. human ribosomes are composed of 80 ribosomal proteins and 4 ribosomal rnas (rrnas). although ribosomes were shown to be effectors of translation 40 years ago, it only recently became apparent that they also act as regulators. first, during evolution, ribosomes of higher eukaryotes have selected additional rps and rrna segments that are not directly involved in mrna decoding and peptide formation, but are predicted to support regulatory events. second, ribosomes with variable composition have been identified that support distinct translational activity in response to viral infection or depending on cell type. for instance, some ribosomes were shown to more efficiently initiate translation from internal ribosome entry site (ires) sequences. in addition, changes in ribosome composition result in developmental defects in both animals and humans while having no, or only a weak, effect on the survival of cultured cells. last, mutations in rp genes or ribosome biogenesis factor genes are associated with ribosomopathies that are characterized by selected developmental defects and by increased cancer susceptibility for particular tumors. these data support the emerging notion of the " specialized ribosome ", suggesting that ribosomes exist as different variants that regulate the selection and efficiency of translation of mrna subsets. up to now, most studies have focused on heterogeneity of rp composition. however, key molecular interactions underlying the translational process are carried out by rrnas, which decode the mrna and catalyze the peptide bond formation through a ribozyme activity. similarly to proteins, rrnas carry chemical modifications, including base methylation, pseudo - uridylation, and ribose methylation at 2-hydroxyl (2-o - methylation). with 105 sites currently mapped on rrnas, the most abundant modification is 2-o - methylation that is catalyzed by fibrillarin (fbl), a conserved methyl - transferase guided by c / d box small nucleolar rnas (snornas) that ensure site specificity. structural studies suggest that 2-o - methylation modulates rrna structure and stability and can thus affect rrna function. interestingly, 60% of the 2-o - methylation sites are within functional regions of rrnas, and genetic studies in yeast have demonstrated that 2-o - methylation is indeed important for the translational capacity of ribosomes. we reported for the first time that the rrna 2-o - methylation pattern modification is associated with changes in translational control during tumorigenesis. in immortalized human mammary epithelial cells (hmecs), p53 (tp53, best known as p53) knockdown using short hairpin rna (shrna) was associated with a modification of the rrna 2-o - methylation pattern. this p53-induced alteration in rrna 2-o - methylation pattern we further demonstrated that fbl is a p53 target gene, whose expression is repressed following binding of p53 to the first intron of the fbl gene. both an increase in fbl expression and modification of rrna 2-o - methylation pattern in hmecs - shp53 were associated with changes in the translational activity of ribosomes and in translational control. reduced p53 expression induced, in an fbl - dependent manner, both a defect in translational fidelity (i.e., amino acid misincorporation and stop codon read - through) and increased translation of a subset of ires - containing cellular mrnas (insulin growth factor-1 receptor [igf-1r ], c - myc, vascular endothelial growth factor - a [vegf - a ], fibroblast growth factor 1 [fgf1 ] and fgf2). we analyzed in more detail the regulation of igf-1r mrna translation using a panel of cell lines, igf-1r ires - containing reporter systems, and polysome analysis of endogenous igf-1r mrna. our current model is that modulation of the rrna 2-o - methylation pattern induced by changes in fbl expression promotes the translation of a subset of mrnas encoding proteins with oncogenic properties, which favors tumor initiation and progression (figure 1). we reported that fbl overexpression promotes anchorage - independent cell proliferation and chemoresistance of mcf-7 breast cancer cells. moreover, in breast cancers, a high level of fbl appeared to be an independent marker of poor prognosis, supporting the importance of maintaining a reduced level of fbl to prevent tumorigenesis. following our publication, the kouzarides group identified fbl as the methyl - transferase that catalyzes methylation of q105 of histone h2a, a novel histone post - translational modification found to be highly enriched in rdna chromatin, and enhances rna pol i activity. together, these data support an important role of fbl in controlling not only ribosome quality, but also ribosome quantity that impacts tumorigenesis. figure 1.impact of rrna 2'-o - methylation on translation and cellular malignant phenotype. compared to healthy cells (green panel), cancer cells (red panel) express higher levels of fibrillarin (fbl), which promotes an increase in the amount of ribosomes and changes the ribosomal (rrna) 2'-o - methylation pattern. alteration of rrna composition reduces the translational fidelity and enhances internal ribosome entry site (ires)-dependent translation of a subset of mrnas encoding proteins that favor tumor development. impact of rrna 2'-o - methylation on translation and cellular malignant phenotype. compared to healthy cells (green panel), cancer cells (red panel) express higher levels of fibrillarin (fbl), which promotes an increase in the amount of ribosomes and changes the ribosomal (rrna) 2'-o - methylation pattern. alteration of rrna composition reduces the translational fidelity and enhances internal ribosome entry site (ires)-dependent translation of a subset of mrnas encoding proteins that favor tumor development. the significance of the rrna perspective in the heterogeneity of ribosomes also has roots in studies of rrna pseudo - uridylation since mutation of dyskerin (dkc1), the enzyme catalyzing this modification, alters ires - dependent translation and is associated with cancer susceptibility. in the near future the different rrna chemical modifications will have to be analyzed in concert since the rrna domains critical for translational activity contain all of the chemical modifications identified to date in rrna. one must therefore wonder whether the impact of rrna chemical modifications on translation should be considered rna epigenetic regulations, as for modification of other classes of rna and for dna epigenetics. however, several key questions remain to be addressed, including are rrna chemical modifications heritable ? and do enzymes exist that are able to demethylate or de - pseudo - uridylate rrna to dynamically regulate the system ? this work was supported by cnrs, inserm, universit claude bernard lyon-1, center lon brard, fondation arc pour la recherche sur le cancer (n sfi20121205802), ligue nationale contre le cancer comit rhne - alpes - auvergne et sane et loire (n13 - 763c) and anr (13-bsv8 - 0012 - 01 ribometh). | the " specialized ribosome " concept proposes that ribosome variants are produced and differentially regulate translation. examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. however, ribosome translational activity is carried out by rrna. we, and others, recently showed that rrna heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. |
hyponatremia is a very common electrolyte abnormality with its usual initial diagnostic approach involving the determination of the patient 's tonicity and volume status. the differential diagnosis includes the syndrome of inappropriate antidiuretic hormone (siadh), glucocorticoid insufficiency, hypothyroidism and primary polydipsia. in this group, classic cases were described in alcoholics as beer potomania, which is characterized by hyponatremia in the setting of low - solute intake due to heavy beer drinking [1, 2 ]. impaired free water clearance secondary to low solute excretion with excessive free water ingestion the treatment can be challenging since there is a high risk of overcorrection of serum sodium concentration potentially resulting in osmotic demyelination syndrome (ods). a 69-year - old african american male with a past medical history of hypertension, seizure disorder, but no underlying psychiatric diagnoses, presented to the emergency department with confusion and urinary incontinence. he had had recurrent episodes of hyponatremia of unclear etiology associated with weakness and a fluctuating mental status. previous records did not exist in our hospital system, and the patient was not able to provide any information regarding the severity, diagnostic workup, treatment and the number of prior episodes. on arrival, his blood pressure was 162/62 mm hg, the heart rate 70 beats per minute, the respiratory rate 16 breaths per minute and the temperature 98.7 f. cardiovascular, respiratory and abdominal examinations were unremarkable. he had normal skin turgor with no peripheral edema and no focal motor deficits. computed tomography of the head was unremarkable for any intracranial findings. in the emergency department, his serum sodium concentration was 117 meq / l, bun was 6 mg / dl, creatinine was 0.7 mg / dl and glucose was 96 mg / dl. the urine osmolality was 132 mosm / kg, and plasma osmolality was 250 mosm / kg. a second serum sodium concentration was obtained at 12 h after the bolus, and the level was 127 five percent dextrose water (d5w) was then started at 100 ml per hour to relower the serum sodium concentration and to prevent rebound increase. fifteen hours after the initial normal saline bolus, his serum sodium concentration decreased to 123 meq / l. his urine osmolality and urine sodium were now 315 mosm / kg and 128 meq / l, respectively. additional history obtained after he regained consciousness revealed an inability to maintain oral intake due to poor appetite for 3 months. he was adamant that he only drank occasionally, 23 drinks per month, and he denied a history of liver disease. his serum sodium concentration was monitored, and the rate of d5w was adjusted to control the rate of increase in serum sodium concentration to no more than 1012 meq / l in 24 h and 18 meq / l in 48 h. the patient was finally discharged at a serum sodium concentration of 130 hyponatremia is a very common electrolyte abnormality, and in essence, it is a disorder of water balance. hyponatremia is categorized into 3 groups : hypovolemic, euvolemic, and hypervolemic hyponatremia. of those, urine sodium and urine osmolality are clinically important ; however, these parameters may be inconsistent among patients with this condition. therefore, a comprehensive evaluation is necessary to establish the definite diagnosis in a timely fashion to start the appropriate treatment. normal human physiology with adh suppression along with normal renal function allows humans to handle excessive water intake without developing hyponatremia until the maximum urinary dilution capacity is reached. however, an important factor often overlooked is the amount of solute load and the solute excretion. in addition to sodium and potassium intake, protein intake contributes to solute excretion by urea formation ; 10 g of protein produce approximately 50 mosm of urea. an analysis on free water clearance clearly demonstrates that solute excretion is an important factor determining the amount of free water clearance, and thus serum sodium concentration. v = ch2o + cosm, since cosm = uosmv / posm ; therefore, ch2o = v (uosmv / posm) ; as v = solute excretion / uosm, we can derive that ch2o = solute excretion (1 [uosm / posm])/uosm (ch2o = free water clearance, cosm = solute clearance, uosm = urine osmolality, posm = plasma osmolality, v = urine flow) figure 1 shows that at a certain urinary osmolality and the degree of solute load has a significant impact on free water clearance, especially when urinary osmolality is low. it also shows that urinary osmolality does not accurately represent the ability of the kidney to excrete free water. for example, at urinary osmolality of 50 mosm / kg, a person would excrete 15 liters of free water per day if the daily solute excretion were 900 mosm / day, but he / she would excrete only 5 liters of free water per day if the daily solute excretion were 300 mosm / day. therefore, water intake of more than 5 liters per day in the latter subject would cause hyponatremia. in low - solute hyponatremia, low urine osmolality (less than 100 mosm / kg) is not always present.. reviewed 22 published cases of beer potomania, a prototype of low - solute hyponatremia, and demonstrated that low urinary osmolality is not a consistent finding. therefore, the possibility of low - solute hyponatremia can not be ruled out in patients with high urine osmolality. once solute intake is restored, hyponatremia corrects by free water excretion, as there is no intrinsic defect in urinary dilution in these patients. a rapid increase in serum sodium concentration can occur and may lead to a significant risk of ods. our patient developed excessive diuresis that led to a rapid correction in serum sodium concentration from 117 to 127 the recommendation in managing chronic hyponatremia is to increase the serum sodium concentration no more than 1012 meq / l in the first 48 h due to the risk of ods with overcorrection exceeding these limits [8, 9 ]. symptoms of ods include ataxia, dysarthria, dysphagia, parkinsonism, paraparesis or quadriparesis, and coma. typically, these neurological symptoms occur several days after the metabolic insult [10, 11 ]. relowering of serum sodium concentration is also crucial when overcorrection occurs, and it can be achieved by the administration of d5w with the rate matching urine output. it has neurological benefits even after symptoms of ods develop [12, 13 ]. have developed a treatment algorithm for beer potomania, which can be applied in our case due to similar pathophysiology. the mainstay of treatment includes 0.5 liters of normal saline in those patients with major symptoms (such as seizure and coma) with the goal of an increase in serum sodium concentration by 23 meq / l / h for 23 h, followed by fluid restriction. for those with mild or no symptoms, fluid restriction would be an appropriate treatment option. close monitoring of serum sodium concentration is required, and d5w infusion should be started when necessary. desmopressin administration can be considered in some settings : first, if the d5w rate can not be matched with the rate of urine output ; second, if the rate of an increase in serum sodium concentration is too rapid even with d5w infusion and the limit of increase in serum sodium concentration is expected to be reached within a short period of time ; third, the increase in serum sodium concentration has already exceeded the goal, and fourth, the presence of ods symptoms. sanghvi. also recommended keeping patients nothing by mouth for 24 h before initiating the oral intake because of the risk of overcorrection after the introduction of the solute. a half - normal saline solution (0.45%) can be administered in case of failure to increase serum sodium concentration after fluid restriction. our case highlights the importance of the detection of low - solute hyponatremia since the solute load such as normal saline, which is commonly given in the emergency department to hyponatremic patients, potentially leads to a rapid increase in serum sodium concentration in these patients. the clinical picture of low - solute hyponatremia can mimic siadh as urine osmolality may exceed 100 mosm / l. however, low - solute hyponatremia will typically cause significant water diuresis resulting in a rapid increase in serum sodium concentration after a solute load as opposed to worsening serum sodium concentration in siadh. rapid correction of serum sodium concentration in hyponatremic patients can predispose to ods. if overcorrection occurs, lowering serum sodium concentration with d5w is crucial. management includes fluid restriction in mild or asymptomatic patients, finite amounts of intravenous fluids in symptomatic cases, and maintenance of the solute load with oral intake after 24 h of nothing by mouth. | low - solute hyponatremia is a relatively uncommon entity of euvolemic hyponatremia. classic cases were described in alcoholics as beer potomania, which is characterized by hyponatremia in the setting of low - solute intake due to heavy beer drinking. we report a case of low - solute hyponatremia in a nonalcoholic person who was given a solute load, and, subsequently, had excessive diuresis with the resultant rapid increase in serum sodium concentration. |
breast cancer is the most common cancer and the leading cause of cancer death among women worldwide. despite the appropriate treatment, approximately 30% of patients with breast cancer eventually progress to metastatic disease. although there has been considerable progress in the treatment of advanced or metastatic breast cancer (mbc), novel therapeutic approaches are still needed to improve the clinical outcomes for patients with the disease. eribulin mesilate, a non - taxane microtubule stabilizer, is currently approved for the treatment of patients with locally advanced or mbc, who have progressed after at least two chemotherapeutic regimens, including anthracycline and taxane. the phase iii embrace study demonstrated the overall survival benefit of eribulin over the treatment of physician s choice by a median of 2.5 months. although another phase iii study failed to show significant improvements in the overall survival with eribulin versus capecitabine, a statistically significant survival benefit was observed in the data from a pooled analysis of the two phase iii studies in patients with locally advanced or mbc. in addition, a phase ii study of eribulin in japanese patients revealed comparable efficacy and safety. nevertheless, the toxicity profile and efficacy can differ according to the population and ethnic differences, even if the agent does not perform as a pharmacogenetics drug by polymorphism [8 - 10 ]. in addition, the effective dose levels of the anti - cancer drugs can be suboptimal for some populations, particularly in asian patients. this paper reports the results from a phase iv study that evaluated the efficacy and safety of eribulin in korean patients with locally advanced or mbc. the other key inclusion criteria included the following : patients who had received two to five prior chemotherapy regimens for advanced and/or metastatic disease, and prior therapy that included anthracycline and taxane in either the adjuvant or metastatic setting ; patients must have been refractory to the most recent chemotherapy on or within the previous 6 months ; patients with adequate bone marrow, liver, and renal function ; and eastern cooperative oncology group performance status of 0 to 2. the key exclusion criteria included the following : patients who had received chemotherapy, radiation, biologics, immunotherapy, or hormonal therapy within the previous 3 weeks before treatment (palliative radiation was allowed) ; patients with known brain metastases unless treated and stable ; patients who had participated in other clinical trials within 4 weeks before screening ; patients who had previously received eribulin. a multicenter, open - label, single - arm, phase iv clinical trial was conducted in accordance with the declaration of helsinki and approved by the institutional review board of each center. patients provided written informed consent before administration of the study drug (clinicaltrial.gov identifier : nct01961544). the patients received intravenous eribulin 1.4 mg / m over 2 - 5 minutes on days 1 and 8 of every 21 days. the administration of eribulin had to be delayed in cases of an absolute neutrophil count of less than 110/l, platelet count of less than 7510/l, and grade 3 or 4 nonhematological toxicities. the dose of eribulin was reduced to 1.1 mg / m if predefined hematological toxicity or grade 3/4 nonhematological toxicity occurred after eribulin administration. if any adverse events recurred despite the previous dose reduction, the daily dose of eribulin was reduced further to 0.7 mg / m and discontinued if the dose reduction was less than 0.7 mg / m. once the dose was reduced, it could not be increased at a later date. the primary endpoint was the frequency and intensity of the treatment emergent adverse events (teae). the teae were defined as the adverse event started or exacerbated on or after the first dose of the study drug. the intensity of the adverse events was classified by national cancer institute common terminology criteria for adverse events ver. secondary endpoint was the disease control rate (dcr), which included the rate of complete responses (crs), partial responses (prs), and stable disease (sd). the tumor response was assessed according to the response evaluation criteria in solid tumors ver. the tumor response assessment was performed every 9 weeks (1 week) and at the end of treatment as well as when disease progression was suspected. the other exploratory endpoints included the objective response rate (orr ; included the rate of cr and pr), clinical benefit rate (cbr ; included the rate of cr, pr and sd 6 months), and progression - free survival (pfs). the primary objective of this study was to examine the rate of adverse events in korean subjects. a sample size of 90 was calculated, assuming the rate of adverse events to be 98.81% with a standard deviation of 2.25% based on the embrace study. after considering a dropout rate of 10%, the primary endpoint was evaluated in the safety set that comprised of patients who had received at least one dose of eribulin. the secondary efficacy endpoint was analyzed using either full analysis set (fas) or per - protocol set (pps). the fas included patients who had at least one primary efficacy evaluation after the baseline, while the pps included patients without major protocol deviations. the pfs was analyzed using the kaplan - meier method and presented with a 95% ci. the other key inclusion criteria included the following : patients who had received two to five prior chemotherapy regimens for advanced and/or metastatic disease, and prior therapy that included anthracycline and taxane in either the adjuvant or metastatic setting ; patients must have been refractory to the most recent chemotherapy on or within the previous 6 months ; patients with adequate bone marrow, liver, and renal function ; and eastern cooperative oncology group performance status of 0 to 2. the key exclusion criteria included the following : patients who had received chemotherapy, radiation, biologics, immunotherapy, or hormonal therapy within the previous 3 weeks before treatment (palliative radiation was allowed) ; patients with known brain metastases unless treated and stable ; patients who had participated in other clinical trials within 4 weeks before screening ; patients who had previously received eribulin. a multicenter, open - label, single - arm, phase iv clinical trial was conducted in accordance with the declaration of helsinki and approved by the institutional review board of each center. patients provided written informed consent before administration of the study drug (clinicaltrial.gov identifier : nct01961544). the patients received intravenous eribulin 1.4 mg / m over 2 - 5 minutes on days 1 and 8 of every 21 days. the administration of eribulin had to be delayed in cases of an absolute neutrophil count of less than 110/l, platelet count of less than 7510/l, and grade 3 or 4 nonhematological toxicities. the dose of eribulin was reduced to 1.1 mg / m if predefined hematological toxicity or grade 3/4 nonhematological toxicity occurred after eribulin administration. if any adverse events recurred despite the previous dose reduction, the daily dose of eribulin was reduced further to 0.7 mg / m and discontinued if the dose reduction was less than 0.7 mg / m. once the dose was reduced, it could not be increased at a later date. the primary endpoint was the frequency and intensity of the treatment emergent adverse events (teae). the teae were defined as the adverse event started or exacerbated on or after the first dose of the study drug. the intensity of the adverse events was classified by national cancer institute common terminology criteria for adverse events ver. secondary endpoint was the disease control rate (dcr), which included the rate of complete responses (crs), partial responses (prs), and stable disease (sd). the tumor response was assessed according to the response evaluation criteria in solid tumors ver. the tumor response assessment was performed every 9 weeks (1 week) and at the end of treatment as well as when disease progression was suspected. the other exploratory endpoints included the objective response rate (orr ; included the rate of cr and pr), clinical benefit rate (cbr ; included the rate of cr, pr and sd 6 months), and progression - free survival (pfs). the primary objective of this study was to examine the rate of adverse events in korean subjects. a sample size of 90 was calculated, assuming the rate of adverse events to be 98.81% with a standard deviation of 2.25% based on the embrace study. after considering a dropout rate of 10%, the primary endpoint was evaluated in the safety set that comprised of patients who had received at least one dose of eribulin. the secondary efficacy endpoint was analyzed using either full analysis set (fas) or per - protocol set (pps). the fas included patients who had at least one primary efficacy evaluation after the baseline, while the pps included patients without major protocol deviations. the pfs was analyzed using the kaplan - meier method and presented with a 95% ci. the patients were enrolled between june 2013 and april 2014 from 14 institutes in korea. thirteen patients discontinued the study prior to progression due to the withdrawal of consent (n=7), protocol violation (n=1), adverse events (n=1), and other reasons (n=4). five patients were excluded from fas because there had been no efficacy evaluation after the baseline. eighteen patients were further excluded from pps due to inclusion and exclusion criteria deviations (n=10) and other major protocol deviations (n=9). the median age was 51 years (range, 25 to 79 years). the median number of previous chemotherapy regimens before study enrolment was four. other than one patient, who had a contraindication to anthracycline, all patients had received taxane- and anthracycline - included regimens before study enrolment. in the safety set, a median dose 1.39 mg / m (range, 0.71 to 1.44 mg / m) of eribulin was administered each cycle. the patients received a median of three cycles (range, 1 to 31 cycles) of eribulin. the median treatment duration was 2.14 months (range, 0.04 to 23.79 months). during treatment, 40 patients (39.6%) experienced a dose delay and 10 patients (9.9%) experienced a dose reduction due to adverse events. a total of 982 teaes occurred. among them, 703 events were deemed to be related or caused by the drug investigated according to the investigator assessment. neutropenia of any grade was the most common teae and occurred in 92 patients (91.1%) (grade 3, 31.7% ; grade 4, 57.4%). anemia of any grade occurred in 12 patients (11.9%) and thrombocytopenia of any grade occurred in four patients (4.0%) (no case of grade 3 or 4). among the non - hematologic adverse events, alopecia, decrease in appetite, peripheral neuropathy was encountered in 27 patients (26.7%), including grade 3 in two patients. pseudomonal sepsis (n=1) was the only grade 4 adverse event observed in this study other than neutropenia. pseudomonal sepsis occurred on day 8 of the first cycle of eribulin and was resolved with appropriate management. a total of 27 serious adverse events (sae) occurred in 20 patients (19.8%), including two each of neutropenia and pericardial effusion. nervous system disorders were the most commonly reported system organ class with regard to sae (one event each of consciousness fluctuating, dizziness, headache, neuropathy peripheral, and syncope). death occurred in one patient due to aspiration pneumonia, which occurred on day 20 of the third cycle of the eribulin treatment. table 3 list the response rate evaluated in fas and pps. in fas, dcr was 52.7% (n=49 ; 95% ci, 42.1 to 63.1), orr was 17.2% (n=16), and cbr was 21.5% (n=20). in pps, dcr was 51.3% (n=39 ; 95% ci, 39.6 to 63.0), orr was 17.1% (n=13), and cbr was 22.4% (n=17). overall, 46.2% (n=43) of patients in fas and 47.4% (n=36) of patients in pps had progressive disease. the median pfs was 2.60 months (95% ci, 2.18 to 4.40) in fas and 2.36 months (95% ci, 2.10 to 4.32) in pps. this study examined the safety of eribulin in korean patients with locally advanced or mbc. consistent with previous studies, adverse events observed in safety set were generally well tolerated. a phase i study that administered 1.4 mg / m of eribulin on days 1 and 8 of a 21-day cycle identified febrile neutropenia and neutropenia as the dose limiting toxicities. several phase ii and iii studies reported neutropenia as the most common adverse event, as in this study. regarding the absolute incidence, this study identified a notable difference with the results from previous studies that detected neutropenia as the most frequent adverse event. the incidence of any grade neutropenia was approximately 50% in the embrace study and a study by kaufman., of which the participants comprised mainly of caucasians at the baseline. on the other hand, it was above 90% in this study and in the study by aogi., which enrolled asian patients. similar cases of ethnic differences in the incidence of chemotherapy - induced myelosuppression were also reported in other types of cancer and chemotherapy settings [14 - 16 ]. genetic polymorphisms of the drug metabolizing enzyme and transporter might have contributed to the discordant incidence of adverse events between different ethnicities. another explanation for the higher incidence of neutropenia is the large number of patients who were heavily pretreated ; the median number of prior chemotherapeutic regimens was four (range, 2 to 8). twenty - three patients (22.8%) were treated with six or more lines of chemotherapeutic regimens (table 1). although 92 patients (91.1%) experienced neutropenia in this study, only one patient (1.0%) experienced febrile neutropenia, which was subsequently resolved with the appropriate management. of 56 patients (55.5%), granulocyte colony - stimulating factor was required to treat and prevent neutropenia in 55 (54.5%) and 18 (17.8%) patients, respectively. unlike neutropenia, there was no significant difference among the incidences of peripheral neuropathy from other studies. the enrolled patients had received taxane- or anthracycline - based chemotherapy before participating in this study. despite the repetitive chemotherapy treatment history, peripheral neuropathy of grade 3 or more was infrequent (two events of grade 3 and no grade 4) among the patients. the unique mechanism of action of eribulin, which inhibits microtubule polymerization at the plus end while having no effect on depolymerization, may account for the relatively low incidence of peripheral neuropathy. a preclinical study reported that eribulin had a lower tendency to induce new - onset peripheral neuropathy and exacerbate preexisting neuropathy than paclitaxel. in a randomized phase ii study that compared the incidence and severity of eribulin- or ixabepilone - induced peripheral neuropathy, a lower incidence was recorded in the eribulin arm but the difference was not statistically significant. a relatively lower dcr and shorter pfs in fas and pps were observed in this study compared to those in previous studies. the lower response rate and shorter pfs compared to other studies may have resulted from the characteristics of the study population, which had patients with more previous lines of chemotherapy prior to study participation. the toxicity profile was consistent with previous phase ii and phase iii studies, and no new adverse events were observed in the korean patients. in conclusion, the eskimo study demonstrated that eribulin is a safe and effective therapeutic option for locally advanced or in mbc patients who had received two or more chemotherapy regimens. | purposeeribulin mesilate was approved for the treatment of patients with locally advanced or metastatic breast cancer (mbc), who had received at least two chemotherapeutic regimens, including anthracycline and taxane. on the other hand, the efficacy and safety information of eribulin in korean patients is limited by the lack of clinical trials.materials and methodsin this multicenter, open - label, single - arm, phase iv study, locally advanced or mbc patients were enrolled between june 2013 and april 2014 from 14 centers in korea. one point four mg / m2 dose of eribulin was administered on days 1 and 8 of every 21 days. the primary endpoint was the frequency and intensity of the treatment emergent adverse event. the secondary endpoint was the disease control rate, which included the rate of complete responses, partial responses, and stable disease.resultsa total of 101 patients received at least one dose of eribulin and were included in the safety set. the patients received a total of 543 treatment cycles, with a median of three cycles (range, 1 to 31 cycles). the most common adverse event was neutropenia (91.1% of patients, 48.3% of cycles). the frequent non - hematological adverse events included alopecia, decrease in appetite, fatigue / asthenia, and myalgia / arthralgia. the peripheral neuropathy of any grade occurred in 27 patients (26.7%), including grade 3 in two patients. disease control rate was 52.7% and 51.3% of patients in the full analysis set and per - protocol set, respectively.conclusionthis study demonstrated the feasible safety profile and activity of eribulin in korean patients with mbc. |
after gastric and lung cancer, prostate cancer is now the third most frequent visceral cancer in iranian men and the fifth most common cancer worldwide. although its incidence is much lower in iran than in western countries, the number has dramatically increased over the past ten years (1). increased public health awareness in iran of measuring total serum prostate specific antigens (psas) with the aim of screening and early detection of prostate cancer at earlier stages has resulted in increased early diagnoses of prostate cancer in recent years (24). these men with a clinically localized disease can be treated with radical prostatectomy, definitive external beam radiation therapy (ebrt) with or without brachytherapy, hormonal therapy and active surveillance. choosing the best method of treatment for patients with prostate cancer depends on a number of factors such as initial total serum psa, risk groups, gleason grading score, clinical tnm staging and life expectancy (5). ebrt (with or without brachytherapy) and radical prostatectomy have similar curative and long - term efficacy in the treatment of clinically organ - confined prostate cancer (67). these types of treatment have acceptable long - term cure rates in clinically localized prostate cancer patients, but unfortunately 30% to 50% of these patients will show evidence of psa failure ten years after treatment with definitive external beam radiation therapy (8). because of the lack of randomized clinical follow - up trials in clinically organ- confined prostate cancer patients treated with brachytherapy, only ebrt has been included in this study. after about 24 months of ebrt, most patients might achieve a nadir of total serum psa. almost all clinically localized prostate cancer patients who have any type of disease recurrence present the first time with psa elevation of 2 ng / ml above nadir psa (911). this study aimed to describe the biochemical progression - free survival and related prognostic factors for localized prostate cancer treated with definitive ebrt in iran. men diagnosed with pathologically localized prostate cancer from stage t1an0m0 to stage t3n0m0 (clinical t staging was defined by mri or transrectal ultrasound) were treated with definitive radiation therapy and followed up in the radiation - oncology ward of shohada - e - tajrish hospital in tehran, iran between 2006 and 2013. the medical records of the patients provided information such as age, initial psa (pretreatment psa), tnm stage, gleason score, radiotherapy dose and technique, and type of radiotherapy machine. the risk groups were defined as low - risk (t1c t2a, gs 7, or psa > 20 ng / ml), and further differentiated in terms of hormonal therapy (in the high - risk group) and time of biochemical (psa) failure. we included all of the prostate cancer patients who met the inclusion criteria at our center from 2006 to 2013 in the study. the inclusion criteria were that they be men with a histopathology diagnosis of prostate cancer without lymph node or distant metastasis that were irradiated by definitive ebrt at our center. patients were excluded from the study if they were without a histopathology diagnosis or without initial serum psa, if they had been treated by radical prostatectomy, if they presented with lymph node or distant metastasis, if they had undergone adjuvant treatments such as radiation therapy or brachytherapy initiated by another radiation oncology center and if they were without follow - up. all patients had previously been treated with a linear accelerator (linac) 9 mv or cobalt 60 with 6476 gray (gy) in 3238 fractions with 2 gy per fraction. first, 44 to 46-gy whole pelvic radiations were given to patients if they were at a higher risk of lymphatic spread, and then a 30-gy boost dose was delivered to the prostatic fossa with or without seminal vesicle. patients received a total dose of less than 70 gy administered by two - dimensional (2d) treatment planning. patients received a total radiation dose of 70 gy or above administered by three - dimensional (3d) treatment planning such as three dimensional - conformal radiation therapy (3d - crt). radiation therapy was used 5 days a week from saturday to wednesday (with the exception of public holidays) with 2 gy per fraction with 2d or 3d treatment planning. all patients were followed up according to standard guidelines and continuously, at least every three months for the first two years and at 6-month intervals thereafter. the 5-year bfs was determined per the definition of biochemical failure (bf) of psa as rising by 2 ng / ml above the nadir after radiation therapy. the ethical regulations dictated in the act provided by shohada - e - tajrish hospital in shahid beheshti university of medical sciences (reference number of research ethics committee : 301/5375) were strictly observed. we used the kaplan meier method to calculate 5-year bfs from the first day of radiotherapy and used pairwise log rank tests for comparisons of low - risk, intermediate - risk and high - risk groups. for multivariate analysis, the cox proportional hazards model was used to assess the strengths of various factors for 5-year bfs. men diagnosed with pathologically localized prostate cancer from stage t1an0m0 to stage t3n0m0 (clinical t staging was defined by mri or transrectal ultrasound) were treated with definitive radiation therapy and followed up in the radiation - oncology ward of shohada - e - tajrish hospital in tehran, iran between 2006 and 2013. the medical records of the patients provided information such as age, initial psa (pretreatment psa), tnm stage, gleason score, radiotherapy dose and technique, and type of radiotherapy machine. the risk groups were defined as low - risk (t1c t2a, gs 7, or psa > 20 ng / ml), and further differentiated in terms of hormonal therapy (in the high - risk group) and time of biochemical (psa) failure. we included all of the prostate cancer patients who met the inclusion criteria at our center from 2006 to 2013 in the study. the inclusion criteria were that they be men with a histopathology diagnosis of prostate cancer without lymph node or distant metastasis that were irradiated by definitive ebrt at our center. patients were excluded from the study if they were without a histopathology diagnosis or without initial serum psa, if they had been treated by radical prostatectomy, if they presented with lymph node or distant metastasis, if they had undergone adjuvant treatments such as radiation therapy or brachytherapy initiated by another radiation oncology center and if they were without follow - up. all patients had previously been treated with a linear accelerator (linac) 9 mv or cobalt 60 with 6476 gray (gy) in 3238 fractions with 2 gy per fraction. first, 44 to 46-gy whole pelvic radiations were given to patients if they were at a higher risk of lymphatic spread, and then a 30-gy boost dose was delivered to the prostatic fossa with or without seminal vesicle. patients received a total dose of less than 70 gy administered by two - dimensional (2d) treatment planning. patients received a total radiation dose of 70 gy or above administered by three - dimensional (3d) treatment planning such as three dimensional - conformal radiation therapy (3d - crt). radiation therapy was used 5 days a week from saturday to wednesday (with the exception of public holidays) with 2 gy per fraction with 2d or 3d treatment planning. all patients were followed up according to standard guidelines and continuously, at least every three months for the first two years and at 6-month intervals thereafter. the 5-year bfs was determined per the definition of biochemical failure (bf) of psa as rising by 2 ng / ml above the nadir after radiation therapy. the ethical regulations dictated in the act provided by shohada - e - tajrish hospital in shahid beheshti university of medical sciences (reference number of research ethics committee : 301/5375) were strictly observed. we used the kaplan meier method to calculate 5-year bfs from the first day of radiotherapy and used pairwise log rank tests for comparisons of low - risk, intermediate - risk and high - risk groups. for multivariate analysis, the cox proportional hazards model was used to assess the strengths of various factors for 5-year bfs. the follow - up period was between 1481 months, with a median of 31 months. 131 patients (68.2%) were in stage 20 ng / ml, and 46.9% had initial psa20 ng / ml. the median cumulative prostate dosage in our series was 64 gy with a range of 62 to 78 gy). for subsequent analysis, radiation dosage was grouped into patients who received less than 70 gy using two - dimensional radiation therapy (74.5%) and those who received 70 gy or more using three- dimensional radiation therapy (24.5%). 44.3% of our patients were treated with cobalt 60 and 55.7% were treated with linac 9mv. neoadjuvant hormonal therapy, concomitant hormonal therapy and adjuvant hormonal therapy were used in 81 of high - risk patients (60.9%). the 5-year biochemical progression - free survival (bfs) for all patients was 65.1%, and 5-year bfs in the low - risk, intermediate - risk and high - risk groups were 100%, 86.5% and 54.9% respectively. according to the kaplan - meier analysis and pairwise 5-year bfs log - rank comparisons of low - risk to intermediate - risk p=0.311, low - risk compared to high - risk p=0.170, intermediate - risk compared to high - risk p=0.014, overall 5-year bfs comparisons p=0.018. multivariate analysis found a significant correlation between 5-year bfs and initial psa>20 (compared to initial psa20) (p=0.003, hr=4.22, 95% ci=1.318.33), gleason score 810 (compared to gleason score 27) (p=0.032, hr=2.04, 95% ci=2.323.11), high - risk group (compared to intermediate - risk group) (p=0.014, hr=7.25, 95% ci=1.2214.17), tnm staget2cn0m0 (compared to tnm staget2bn0m0) (p=0.001, hr=8.45, 95% ci=3.2517.55), radiotherapy dose20 ng / ml that was higher than in well - developed western countries. more than 70% of our patients received a cumulative radiation dose of less than 70 gy with 2d technique, while the rtog trials used radiation doses exceeding 70 gy that explained the high rate (32.3%) of bf in our study compared to 16.7% in their series. in our study, only 24.5% of patients received a cumulative radiation dose 70 gy with 3d radiotherapy technique, while zietman. conducted a long - term trial that compared the conventional 2d radiotherapy technique with modern radiotherapy techniques such as 3d - crt and imrt that can deliver higher doses > 72 gy, a significant decrease of 5-year bfs from 32.4% to 16.7% (14). in the multivariate analysis a few important predictors of 5-year bfs were identified (15). independent predictors of unfavorable 5-year bfs in our study were initial psa>20, gleason score 810, high - risk group, tnm stage t2cn0m0, radiotherapy dose<70 gy, radiotherapy with 2d technique and no hormonal therapy (in high - risk group). first, our study was a retrospective - analytic study such as all those inherent in a retrospective analysis. third, the number of patients (192 patients) was considered small for accurate analysis of predictive factors. in summary, in this retrospective - analytic study, initial psa20, gleason score 27, intermediate - risk group, tnm staget2bn0m0, radiotherapy dose70 gy, radiotherapy with 3d technique and hormonal therapy (in high - risk group) were independent favorable prognostic factors for 5-year bfs in multivariate analysis. there was no statistically significant relationship between 5-year bfs and age and type of radiotherapy machine by multivariate analysis. our seven years experience of follow - up with psa showed that psa was the strongest predictor of biochemical progression survival in patients with prostate cancer who were treated with definitive ebrt. | introductionprostate cancer is now the third most frequent noncutaneous malignancy in iranian men and the fifth most common cancer worldwide. measurement of total serum prostate specific antigens (psas) has been one of the strongest predictors of biochemical progression and overall survival in determining the efficacy of definitive external beam radiation therapy in patients with localized prostate cancer. the aim of this research was to identify the 5-year biochemical progression - free survival (bfs) and related prognostic and predictive factors of localized prostate cancer patients who were treated with definitive external beam radiotherapy.methodsthis study analyzed 192 localized prostate cancer patients from stage t1an0m0 to stage t3n0m0 ; they were treated with definitive radiation therapy and followed up in the radiation - oncology ward of shohada - e - tajrish hospital in tehran (iran) between 2006 and 2013. the 5-year bfs was analyzed using the kaplan - meier estimate. for multivariate analysis, the cox proportional hazards model was used to assess the strengths of various factors for 5-year bfs.resultsthe follow - up period was between 1481 months, with a median of 31 months. the median cumulative prostate dose in our series was 64 gray (gy) (range 62 to 78 gy). the 5-year bfs for all patients was 65.1%, and 5-year bfs in low - risk, intermediate - risk and high - risk groups were 100%, 86.5%, and 54.9% respectively. multivariate analysis found statistically significant relation between 5-year bfs and initial psa>20, gleason score 810, high risk group, tnm staget2cn0m0, radiotherapy dose<70 gy, radiotherapy with 2d technique and hormonal therapy in high - risk group (p=0.003, p=0.032, p=0.014, p=0.001, p=0.035, p=0.035, p=0.022 respectively).conclusionour seven years experience of follow - up with psa showed that psa was the strongest predictor of biochemical progression survival in patients with prostate cancer who were treated with definitive external beam radiation therapy. |
the discovery of fullerenes and other forms of elemental carbon with curved surfaces introduced a novel aspect of supramolecular assembly based on the relatively weak dispersion forces between the convex surfaces of the conjugated carbon networks and the appropriate molecular receptors. buckybowls, curved - surface polycyclic aromatic hydrocarbons (pah) structurally related to fullerenes, appear to be good candidates for receptors due to the complementarity of their accessible concave surfaces with the convex surfaces of the fullerenes. while supramolecular assemblies of fullerenes with the smallest buckybowl corannulene (1) have not been detected in solution, we have shown that the efficient molecular receptors for both c60 and c70 can be constructed if at least two corannulene pincers are preorganized on a proper tether. for example, buckycatcher c60h28 (2) consisting of two corannulene subunits on a tetrabenzocyclooctatetraene tether was shown to form 1:1 inclusion complexes with fullerenes in both the solid state and in toluene solutions. the c60@2 inclusion complex has become a prototypical system for large dispersion - driven supramolecular systems and, as such, has been the subject of several computational studies performed at various levels of theory. recently, inclusion complexes for both c60 and c70 with 2 were incorporated into the s12l test set of noncovalently bound complexes used to evaluate computational methods performance in modeling the dispersion interactions. the reported theoretical gas - phase binding energies of the c60@2 complex vary dramatically, thus emphasizing the difficulty of accurately computing the energetics of dispersion forces. fock based calculations as well as several commonly employed dft functionals predict either repulsion or negligible binding energies for the assembly, while the dispersion - sensitive dft functionals predict strong gas - phase binding energies in the range 20 to 44 kcal mol. obviously, there is a need for reliable experimental data to assess the quality of the computational results. to date, the only reported thermodynamic results for the association of buckycatcher (2) with fullerenes are the ambient temperature gibbs enthalpies determined in toluene - d8 by h nmr titration (5.3 and 5.1 kcal mol for c60 and c70, respectively). however, since the gas - phase experimental data for the thermodynamics of these inclusion complexes are not available, it is necessary to develop reliable computational models capable of assessing the solvent contributions to the enthalpy and entropy effects on the association thermodynamics in solution. in the first such attempt, zhao and truhlar calculated the entropy contribution to the gas - phase formation of c60@2 based on the rigid rotator - harmonic oscillator model and concluded that while the calculated binding energy of the assembly is 26.4 kcal mol (e = 26.4 kcal mol) the gas - phase gibbs free energy of association is only ca. in addition, the association of c60 with 2 in solution results in a considerable loss of the solvent - accessible surfaces which further reduces the exergonicity of the process. in a more comprehensive study, grimme applied a similar approach combining dispersion - corrected dft calculations for the gas - phase binding energies with the cosmo - rs continuum solvation model for the solvation free enthalpy assessment and evaluating the remaining rotational vibrational enthalpic / entropic contributions based on the harmonic frequency calculations. a series of inclusion complexes (including the c60@2 and c70@2 complexes) were studied, and the calculated g values in solutions were reported to differ on average by only 2 kcal / mol from the available experimental data. considering the simplicity of the model, the accuracy of the results is quite impressive, but a closer inspection of the results reveals some limitations to this approach. as an example, grimme s model predicts overbinding of both c60 and c70 by buckycatcher (2) in toluene by ca. 34 kcal mol, significantly more than the average error for the studied pool of inclusion complexes. obviously, a larger set of precise experimental thermodynamic data is needed to assess the accuracy of the computational methods as well as to improve the theoretical models used to describe solvation in weakly bound inclusion complexes. herein, we report the results of our study of the energetics of complexation of c60 and c70 with buckycatcher by both isothermal titration calorimetry (itc) and h nmr titration. the use of the itc method allowed us to obtain a complete set of thermodynamic parameters (ka (or g), h, and ts) for the formation of c60@2 and c70@2 complexes in a number of solvents and at a number of different temperatures. we also repeated some of the earlier nmr titrations at lower concentration and at three temperatures for a better comparison with the itc results. the heat capacity changes, cp, for formation of the c60@2 and c70@2 inclusion complexes in toluene were also obtained from the temperature dependence of the calorimetric enthalpy changes. the buckycatcher (2) was synthesized in our laboratory according to the procedure we previously reported. anhydrous toluene, chlorobenzene, and o - dichlorobenzene were obtained from sigma - aldrich (st. louis, mo). toluene - d8 and chlorobenzene - d5 were obtained from cambridge isotope laboratories (tewksbury, ma). h nmr titrations were performed according to the procedure reported previously but at lower concentrations of fullerenes and 2 and with careful temperature control. the spectra were recorded on bruker (billerica, ma) avance iii 600 and 850 mhz spectrometers in toluene - d8 and chlorobenzene - d5 at 288, 298, and 308 k. several proton signals on the corannulene subunits of 2 exhibited measurable changes in chemical shift upon complexation with either c60 or c70. if necessary, the overlapping peaks of some of these protons were deconvoluted using spinworks 3 nmr software (kirk marat, university of manitoba) in order to extract the precise chemical shift values. the association constant ka was determined using eq 11where x = [fullerene]total, y = total, and l = max (i.e., at 100% complexation). values of ka and l were obtained from the nonlinear regression using the curve - fitting tools of origin v.8.5 (northampton, ma). itc experiments were performed using a microcal - ge (northampton, ma) vp - itc. titrations were typically done at temperatures ranging from 278 to 323 k and involved overfilling the itc cell with 1.5 ml of fullerene solution (c60 or c70) and adding as many as 20 injections (14 l each) of the titrant solution of 2. typically, three replicate measurements were performed. the raw calorimetric data were corrected for the heat of dilution of 2 and fullerenes by subtracting the heats from the appropriate blank titrations even though these heats were negligible in comparison to the binding interaction heats. the corrected itc titration results were fit with a nonlinear regression algorithm using the chasm itc data analysis program developed in our laboratory and assuming a 1:1 inclusion complex model. appi - ms experiments were carried out on a bruker (billerica, ma) micro - tof - q mass spectrometer. the fullerene solutions were prepared at a concentration of approximately 100 m, while the solutions of the buckycatcher were prepared at a concentration as high as 300 m. the appi - ms samples were prepared by mixing the solutions to yield a mixture containing a 2-fold excess of 2. the ms capillary voltage was set to + 4500 v, dry n2 gas flow was adjusted to 12 l min at 453 k, and the samples were directly infused into the ms by using a kd scientific syringe pump set to a flow rate of 200 l / h. upon the addition of c60 or c70 to a solution of the buckycatcher, several proton nmr peaks of 2 exhibit measurable changes of their chemical shifts. the job plot constructed for one of the corannulene pincer protons is shown in figure 1. following the changes in chemical shift and using the method of continuous variation, the maximum change in chemical shifts is observed at or near a mole fraction, / (+ [c60 ]), of 0.5. this is consistent with a saturation stoichiometry of 1:1 for formation of the c60@2 complex. similar results were obtained for other protons exhibiting measurable chemical shift changes upon titration. using the same job plot analysis, the 1:1 stoichiometry was also determined for the formation of the c70@2 complex in deuterated toluene and chlorobenzene. values of the [molar ratio ] are plotted vs the mole fraction of 2 at 288 k (), 298 k (), and 308 k (). 1:1 complex stoichiometry was also detected in the gas phase by appi mass spectrometry experiments. figure 2 shows the appi mass spectra obtained for each of the following chemical species in toluene : c60, c70, the buckycatcher 2, and the c60@2 and c70@2 1:1 inclusion complexes. appi mass spectra for toluene solutions containing c60 (a), 2 (b), c70 (c), and the mixtures of 2 with c60 (d) and c70 (e). panels a, b, and c of figure 2 show the appi mass spectra for solutions containing the single chemical species, c60, 2, and c70, respectively. panels a and c show only a single peak, e.g., the c60 isothermal titration calorimetry experiments were performed, wherein a dilute solution of the titrant (2) was added to a dilute solution of the fullerene titrate. a typical itc thermogram for the addition of 2 to c60 in toluene at 298 k is shown in figure 3. the solid line through the data points represents a nonlinear regression fit of the data to a thermodynamic model for the formation of a 1:1 inclusion complex. this analysis of the itc data yields a complete set of thermodynamic parameters (ka (or g), h, and ts) for the formation of the fullerene@2 complexes. the left panel shows the baseline - corrected raw itc signal for a typical titration experiment in which 20 separate injections of dilute 2 titrant solution (= 0.7 mm in toluene, injection volume = 14 l) were made into the itc cell filled with the a dilute c60 solution ([c60 ] = 70 m in toluene). the right panel shows h for each injection () along with the best - fit nonlinear regression line () for a 1:1 inclusion complex model. the thermodynamic data for the formation of the c60@2 and c70@2 complexes in toluene, chlorobenzene, and o - dichlorobenzene at 298 k are listed in table 1. similar thermodynamic data for the formation of these complexes in other solvents and at other temperatures are given in the supporting information (see tables s1, s2, s3, and s4). the association constants at 298 k as determined in the itc experiments are relatively weak, ranging from ka = 4600 m for the formation of c70@2 in toluene to ka = 200 m for the formation of c70@2 complex in o - dichlorobenzene. first, the association constants for c70 with buckycatcher (2) are typically greater than those for formation of the c60@2 complexes. second, complex formation becomes less favorable as the solvent becomes a better solvent for either the fullerene or the buckycatcher (2), resulting in a significant reduction in ka for the formation of the fullerene@2 complex in o - dichlorobenzene as compared to chlorobenzene and toluene. as seen in table 1, at 298 k, the favorable free energy change, g, for complex formation is principally the result of a favorable change in enthalpy, h. with only one exception, c70@2 in toluene at 278 k, the entropy term, ts, for formation of the fullerene@2 complexes is smaller than the enthalpy change in every instance (see the supporting information, tables s1, s2, s3, and s4). the values of the entropy term (ts) for the formation of the c60@2 complex in toluene and for the formation of the c60@2 and c70@2 complexes in chlorobenzene are close to zero. however, the values of the entropy term (ts) for the formation of the c70@2 complex in toluene and for the formation of the c60@2 and c70@2 complexes in o - dichlorobenzene range from 1.15 to 2.04 kcal mol. unexpectedly, the entropy changes for the formation of the c60@2 and c70@2 complexes are generally either zero or favorable for complex formation with notable exceptions for both complexes in 1,1,2,2-tetrachloroethane and c60@2 in anisole. values for g, h, and ts have units of kcal mol, and the errors listed are the standard deviations for a minimum of three replicate itc titrations. the association constants, ka, for formation of the c60@2 and c70@2 complexes in toluene - d8 and chlorobenzene - d5 at 288, 298, and 308 k, determined by h nmr titration, are compared with the respective itc determined constants in nondeuterated solvents in table 2. the ka values determined by two different methods are in good to excellent agreement with one another in both toluene and chlorobenzene over the temperature range of the study. the differences between the nmr and itc determined g values for the formation of c60@2 complexes at 288, 298, and 308 k, respectively, are 0.01, + 0.08, and 0.06 kcal mol in toluene and + 0.11, + 0.26 and + 0.46 kcal mol, respectively, in chlorobenzene. similarly, the differences between the nmr and itc based g values for the complexation of c70 with 2 are 0.06, + 0.22, and + 0.26 in toluene and 0.03, + 0.01, and + 0.06 kcal / mol in chlorobenzene at 288, 298, and 308 k, respectively. in order to gain a deeper insight into the solvent effects on the complexation, we performed the additional itc titrations in anisole, 1,1,2,2-tetrachloroethane, and o - dichlorobenzene at temperatures ranging from 278 to 323 k. the data from these itc experiments can be found in the supporting information (see table s4). in addition, the calorimetric enthalpy changes, hcal, for formation of the c60@2 and c70@2 complexes in toluene at 278, 288, 298, and 308 k were plotted versus temperature to yield an estimate of the heat capacity change, cp, for the formation of the two fullerene2 complexes (see figure s1, supporting information). the enthalpy changes for formation of both the c60 and c70 buckyball@buckycatcher (2) complexes are linearly dependent on t over the experimental temperature range. the estimated heat capacity changes for formation of the two host guest complexes are 0.045 0.005 and 0.028 0.005 kcal mol k for the c60@2 and c70@2 complexes, respectively. it is clear that the two cp values observed in toluene are significantly different. in this study, we have used itc methods to develop a complete thermodynamic description (ka or g, h, and ts) for the formation of c60 and c70 fullerenebuckycatcher (2) complexes. in general, the itc values for ka were in good to excellent agreement with the nmr ka data. in addition to providing values for ka, g, h, and ts for formation of these dispersion complexes, the itc experiments provided estimates for the cp values for complex formation, and evidence for an unexpected enthalpy entropy compensation effect in the temperature dependence of the free energy change. it is important to note that the itc experiments reported here were only possible for these relatively weak complexes because the complex stoichiometry was determined in complementary nmr experiments and because we were able to work at reasonably high concentrations for both the fullerenes and the buckycatcher. in other words, we designed itc experiments wherein we were able to measure the heats for the formation of the complex and were able to determine the ka values from the curvature in the titration data. these conditions were met even for the systems exhibiting ka values as low as 200 m. stoichiometric information obtained from job plot analysis of the nmr titrations clearly suggests a saturation stoichiometry of 1:1 for both the c60 and c70 inclusion complexes these results are in agreement with the previously reported crystallographic structure for the 1:1 inclusion complex of c60@2 formed in the solid state. also, the expected 1:1 inclusion complexes of the fullerenes and buckycatcher were observed in the appi mass spectrometry experiments. although formally possible, and predicted by mm calculations to be quite stable (at least in the gas phase), the 2:1 complex 3 was not detected in the appi ms experiments. in addition, job plots based on the nmr titration indicate that complex 3 does not exist in measurable amounts in toluene or chlorobenzene solutions, at least in the studied concentration ranges. in addition to the expected 1:1 inclusion complexes of 2 with fullerenes, appi experiments indicate the presence of small amounts of homodimers of the buckycatcher (figure 2). indeed, the dimeric head - to - head structure 4 was recently found in the crystals of buckycatcher grown by high - vacuum sublimation and a very substantial gas - phase binding energy for the dimer was calculated by the dispersion - corrected dft methods. however, as described in the methods section, the itc measured heat of dilution of 2 was negligible in comparison to the heats of binding to either fullerene. also, we did not observe any measurable change in the h nmr chemical shifts of 2 upon dilution in the concentration ranges studied in both deuterated toluene and chlorobenzene. we therefore conclude that the thermodynamics of association represents the formation of the solvated 1:1 fullerene@2 complex from the solvated fullerene and solvated 2. the reaction scheme for formation of the inclusion complex is shown as eq 2 below:2it is important to note that the solvation of the (fullerene@2) complex refers to the number of solvent molecules associated with the complex (z) which would be expected to be different than the total number of solvent molecules involved in the solvation of the free fullerene and buckycatcher molecules (x + y). the last term in the equation, (solvent)(x+yz), reflects the net number of solvent molecules lost, (x + y z) > 0, upon fullerene@2 complex formation. in previous studies, we reported nmr titration derived ka values for the association of both c60 and c70 with the buckycatcher (2) in toluene - d8 at ambient temperatures. the reported ka values were 8600 500 m for formation of c60@2 complex and 6800 400 m for formation of c70@2 complex, relating to g of 5.3 and 5.1 kcal / mol, respectively. the analogous itc determined g values reported in this study are 4.8 and 5.0 kcal mol, respectively (table 1). since the difference in the case of c60@2 is larger than the expected error in the itc experiments, we decided to repeat the nmr titrations. we speculated that any real differences in the g values obtained in the h nmr and itc titrations could be attributed to the very low solubility of the fullerene@2 inclusion complexes in toluene. in an attempt to resolve the differences between the results of the previous h nmr results and the current itc results, the h nmr was repeated in toluene - d8 at lower concentrations for both fullerenes and 2. the latest nmr derived ka values for the formation of c60@2 and c70@2 at 298 k in toluene are 2780 80 and 3030 330 m, respectively, in a much better agreement with the itc ka values. more importantly, we now find that in toluene the buckycatcher binds c70 with a slightly higher affinity than it binds c60 (see table 1). however, it must be noted that the small preference for binding of c70 in toluene (0.2 to 0.3 kcal mol, depending on temperature) practically disappears in the other solvents used in this study, typically exhibiting a difference in g of less than 0.1 kcal mol for formation of the c60@2 and c70@2 complexes. as noted in the results section above, the entropy term, ts, for formation of the fullerene2 complexes was typically observed to be either negligibly small (e.g., c60 and c70 in chlorobenzene) or favorable for complex formation (e.g., 2.9 kcal mol for c70 in toluene at 278 k to 1.9 kcal mol for c70 in toluene at 308 k). this is rather surprising considering the strongly destabilizing entropy contributions predicted by the computational models for the association both in the gas phase and in toluene solution. a few unfavorable or positive values for ts for formation of the fullerene2 complexes were observed (e.g., for both fullerenes in 1,1,2,2-tetrachloroethane (ca. + 1.3 kcal mol) and for c60 in anisole (+ 1.8 kcal mol)). a recent paper by barnes. reported small positive ts values of + 0.6 to + 2.5 kcal mol for the formation of pah@exbox inclusion complexes in acetonitrile. the differences between stoddard s work and the present study can be attributed to differences in the structure of the guest molecules (e.g., fullerenes vs pahs), differences in the structure and charge of the host molecules (2 vs exbox), and of course the solvent, acetonitrile. entropy changes observed for complex formation (sexp) are often decomposed into a change in the configurational entropy (sconf, associated with the host guest motions only) and a change in solvation entropy (ssolv), as shown in eq 3. the latter term is related to motions of the solvent averaged over all possible host guest conformations.3the configurational entropy term can be estimated by summing the rotational and vibrational gas phase entropic contributions. on the basis of harmonic frequency calculations, grimme predicted that the sconf should be very unfavorable for formation of the c60@2 and c70@2 complexes at 298 k (with ts values of + 14.8 and + 15.6 kcal mol for c60 and c70, respectively). similar entropy destabilization of the c60@2 complex in the gas phase had previously been predicted by zhao and truhlar. using the cosmo - rs solvation model to provide solvation free enthalpies, the solvation entropy, tssolv, contributions to the overall entropy term free energy were estimated to be 9.9 and 10.3 kcal mol for the formation of c60@2 and c70@2 complexes at 298 k, not exothermic enough to override the strongly endothermic sconf contribution. there are at least two limitations to this approach for calculating the overall entropy change, sexp, for formation of these complexes. first, the cosmo - rs solvation model does not implicitly include solvent molecules, and even with implicit solvent molecules and molecular dynamic calculations, a quantitative assessment of solvation effects is by no means routine (e.g., see moghaddam.). second, as reported by grimme, this model yields free solvation energies, and the corresponding enthalpies and entropies calculated from their temperature dependence are sometimes used for analysis purposes but they do not represent the fundamental quantities. the total entropy changes, ts, as calculated by grimme s model for the formation of the c60@2 and c70@2 complexes are + 4.9 and + 5.2 kcal mol, suggesting a substantial destabilization entropy for both complexes in toluene at 298 k. in contrast, the itc determined ts values for the formation of both complexes in toluene at 298 k are both negative (0.2 and 2.0 kcal mol, respectively, see table 1). these experimental ts values indicate at least modest entropic stabilization of the fullerene@2 complexes in toluene at 298 k. a reasonable assumption is that the calculated gas - phase sconf values are accurately estimated but the ssolv contributions are substantially underestimated by the cosmo - rs continuum solvation model. grimme also speculated that the calculated free energy changes, g values, for formation of the c60@2 and c70@2 complexes in toluene are more negative than observed experimentally due to the poor performance of the cosmo - rs solvation model in predicting ssolv for a nonpolar solute in a nonpolar solvent. the heat capacity changes, cp, for formation of fullerene@2 complexes in toluene were determined from the slope of the linear regression lines in plots of hcal versus temperature from 278 to 308 k (see figure s1, supporting information). the cp values for formation of both the c60@2 and c70@2 complexes are 0.045 and 0.028 kcal mol k. these small negative values for cp indicate that the fullerene2 complexes are somewhat less structured than the free fullerene and free 2. the observation of a negative heat capacity change is typically attributed to the release of solvent molecules upon complex formation. in the fullerene buckycatcher system, some solvent molecules must be expelled from the interacting surfaces of the fullerene and the cleft of the buckycatcher with the net negative change in cp resulting from the net loss of solvent from the complex vs the free fullerene and free buckycatcher molecules (eq 2). similar heat capacity effects were observed earlier for the complexation of various guests by macrocyclic cyclophane hosts in cdcl3. the more negative cp value for formation of the c60@2 complex (0.045 kcal mol k) vs the cp value for formation of the c70@2 complex (0.028 kcal mol k) in toluene suggests that c60 may fit better into the buckycatcher pocket and that more toluene is released in the formation of the c60 complex than for formation of the c70 complex. thermodynamic data obtained from fitting itc experiments for the addition of 2 into either c60 or c70 solutions performed at several different temperature ranging from 278 to 308 k in toluene are plotted in figure 4. normalized values for the thermodynamic parameters (g gave) (), (h have) (), and (ts + tsave) () for the formation of the fullerene 2 complexes in toluene plotted at four different temperatures 278, 288, 298, and 308 k. panel a shows the thermodynamic data for formation of the c60@2 complex. the changes in the free energy change, g, for fullerene@2 complex formation over the temperature range 278308 k are very small. for example, the change in the free energy change, g, for the formation of the c60@2 complex at 308 k vs 273 k is less than + 0.1 kcal mol and less than + 0.2 kcal mol for formation of the c70@2 complex at 308 k vs 273 k. variations in the enthalpy and entropy changes for the formation of the fullerene2 complexes are 510 times larger (ca. the changes in h and in ts have opposite signs and approximately compensate one another over this temperature range, resulting in a g/t value of almost zero. entropy compensation as brought about by changes in temperature has only infrequently been observed or reported for reactions taking place in organic solvents. referring to the extensive enthalpy entropy compensation literature for reactions taking place in aqueous solution, we are not surprised by this result, since the origin of the compensation phenomenon is typically attributed to changes in solvation. the formation of fullerene@2 complexes must involve solvent removal from the interacting surfaces of the associated fullerene guest and the buckycatcher host pocket as well as solvent reorganization around the complex. it was noted in the results section that fullerene@2 complex formation becomes less favorable in solvents where the solubility of the fullerene or 2 is greater, presumably underlining the importance of any desolvation penalty. to further explore the nature of this observation, itc results obtained in five different solvents (toluene, anisole, chlorobenzene, 1,1,2,2-tetrachloroethane, and o - dichlorobenzene) at 298 k are compared. these thermodynamic data which can be found in table 1 and in the supporting information (see table s4) are plotted as a function of solvent dielectric constant in figure 5. again, we observe enthalpy entropy compensation in which the free energy change for complex formation is less dependent on the solvent properties (e.g., polarity, hydrogen bonding, dielectric constant, etc.) than is either the enthalpy or entropy change. in fact, while the free energy changes for formation of the fullerene@2 complexes are observed to vary linearly with the solvent dielectric constant, becoming 1.52 kcal mol less favorable in o - dichlorobenzene than in toluene, both the enthalpy and entropy changes vary unpredictably while exhibiting a high degree of compensation. in effect, every change in h is opposed by a compensating change in ts. the explanation for this phenomenon must reside in the fact that complex formation proceeds with the release of solvent from the fullerene@2 complex. entropy compensation for the formation of the (a) c60@2 and (b) c70@2 complexes, respectively. the thermodynamic parameters for fullerene@2 formation, g (), h (), and ts (), are plotted as a function of solvent dielectric constant for five different organic solvents at 298 k. while the mechanism of enthalpy entropy compensation remains uncertain, it is obvious that there must be a linear relationship between h and ts for those systems where this phenomenon is observed. linear equations, like eq 4, have been used to evaluate the degree of compensation:4the slope, in eq 4, approaches a value of 1.0 for perfect compensation, and c represents the inherent stability of the complex, i.e., g for the reaction with h = 0. plot of the ts value vs the h value for formation of the c60@2 complex in five different solvents at 298 k. the data points from left to right correspond to anisole, 1,1,2,2-tetrachloroethane, toluene, chlorobenzene, and o - dichlorobenzene. the broken line shows the correlation for the four solvents with the toluene data omitted. as shown from the linear regression fit of the thermodynamic data in figure 6, there is a reasonable linear correlation between h and ts (r = 0.94), with a slope () of 0.660 and an intercept (ts0) of 2.66 kcal mol for the formation of the c60@2 complex in the five solvents sampled. if the toluene point is not included in the fit, the slope remains unchanged (= 0.661), the value for ts0 changes from 2.66 to 2.53 kcal mol, and the correlation coefficient for the linear fit is improved, r = 0.998. the slope indicates that 66% of the change in enthalpy is canceled out (or compensated) by an opposite change in the entropy term. the value of (= 0.66) determined here for the formation of the c60@2 inclusion complexes is very similar to the values found by inoue and wada for the quinine@porphyrin receptor (0.60) and pyridine@metalloporphirin (0.61) inclusion complexes in organic solvents. these moderate values of have been interpreted to indicate that only moderate conformational changes are taking place in the host molecule. the positive ts0 value (2.7 kcal / mol) indicates that the s term for desolvation is favorable for formation of the inclusion complexes in the studied solvents. this seems to be consistent with desolvation of the buckycatcher pocket (the loss of 12 molecules of solvent, see our x - ray studies of the solvates of 2) and the removal of some of the solvent molecules from the first coordination (solvation) sphere of the fullerene (probably another 24 molecules). the negative cp values discussed earlier for the formation of the fullerene@2 complexes are consistent with the loss of 47 solvent molecules. detailed nmr and itc titration studies provided a set of thermodynamic data for the formation of c60@2 and c70@2 inclusion complexes over a 30 k temperature range and in five different solvents. the formation of these host@guest inclusion complexes is typically enthalpically driven. in contrast with the predictions based on the existing solvation models, the entropy contributions are typically either stabilizing or close to zero, with the notable exception for both fullerenes in 1,1,2,2-tetrachloroethane and for c60 in anisole. entropy compensation effects were observed at different temperatures and in different solvents. better solvents for fullerenes significantly decrease their association with the buckycatcher, an effect which is not predicted by the cosmo - rs solvation model. relatively small but significant heat capacity effects were found with cp for formation of c60@2 and c70@2 complexes, 45 and 28 cal mol k. the thermodynamic data for these prototypical large dispersion - driven supramolecular systems should be invaluable to the further development and fine - tuning of computational methods and models for estimating the energetics of interacting systems in solution. these data will be particularly important in predicting dispersion - driven complex formation in aromatic or bonding solvents. | 1h nmr and isothermal titration calorimetry (itc) experiments were employed to obtain reliable thermodynamic data for the formation of the 1:1 inclusion complexes of fullerenes c60 and c70 with the buckycatcher (c60h28). nmr measurements were done in toluene - d8 and chlorobenzene - d5 at 288, 298, and 308 k, while the itc titrations were performed in toluene, chlorobenzene, o - dichlorobenzene, anisole, and 1,1,2,2-tetrachloroethane at temperatures from 278 to 323 k. the association constants, ka, obtained with both techniques are in very good agreement. the thermodynamic data obtained by itc indicate that generally the host guest association is enthalpy - driven. interestingly, the entropy contributions are, with rare exceptions, slightly stabilizing or close to zero. neither h nor s is constant over the temperature range studied, and these thermodynamic functions exhibit classical enthalpy / entropy compensation. the cp values calculated from the temperature dependence of the calorimetric h values are negative for the association of both fullerenes with the buckycatcher in toluene. the negative cp values are consistent with some desolvation of the host - cavity and the guest in the inclusion complexes, c60@c60h28 and c70@c60h28. |
rheumatoid arthritis (ra) is a chronic inflammatory disease characterized by synovial hyperplasia, mononuclear cell infiltration, bone erosion, and joint destruction. early diagnosis and immediate aggressive treatment are required for the amelioration of progressive joint damage and patient disability [1, 2 ]. methotrexate (mtx) is the most conventional disease - modifying antirheumatic drug (dmard) for ra, with the best efficacy and the fewest adverse effects [3, 4 ]. however, only approximately 30% of patients respond to mtx treatment [5, 6 ]. the identification of patients who are less responsive to mtx could avoid delays in adjusting their treatment and prevent future irreversible joint damage. rheumatoid factor (rf) is a part of the 2010 american college of rheumatology (acr) classification criteria for ra. rf is an autoantibody directed against the fc portion of igg and is associated with disease persistence and progressive joint destruction [911 ]. however, the data related to rf status in treatment response to mtx is inconsistent, as some studies reported no association between rf positivity and treatment efficacy [1221 ], while others indicated that seropositive patients exhibited worse responses to mtx therapy in early rheumatoid arthritis [9, 22, 23 ]. variations in disease manifestations assessed by clinical and laboratory tests produce a specific disease phenotype, which results in changes in gene expression in various affected tissues and immune effector cells. therefore, differentially expressed genes may serve as biomarkers for disease status and predictors of the response to therapy [2528 ]. as the peripheral immune system is activated in ra patients, gene expression changes in the peripheral blood mononuclear cells (pbmcs) could provide informative biomarkers. several studies involving dna microarray technology have revealed differences in the expression of specific gene clusters observed in the pbmcs of early ra patients and in patients with established progressive disease versus normal subjects. higher expression of type i interferon - regulated genes was also observed in the peripheral blood cells of ra patients compared with healthy controls. in addition, twin studies have shown that similar genes are highly overexpressed in both blood and synovial fluid of ra patients versus controls. of particular importance are ubiquitously expressed human genes that are required for the regulation of basic cellular processes. previous studies have revealed differential gene expression associated with apoptosis in the pbmcs of ra patients [25, 34 ]. in addition, low apoptotic activity has been reported in the synovial fluid leucocytes and synoviocytes of ra patients [3537 ]. mammalian target of rapamycin (mtor) is considered a key regulator of cell growth and proliferation. it has been shown recently that mtor inhibition downregulated mitogen - induced t- and b - lymphocyte proliferation and il-1 and tnf production in vitro [39, 40 ]. moreover, animal studies have shown that mtor downregulation alleviated paw swelling in antigen - induced arthritis. autophagy occurs upon arrest of proliferation and is associated with production of cyclin - dependent kinases such as p21. as autophagy can also be induced by proinflammatory cytokines and autoantibodies, it could be an important factor in ra pathogenesis. indeed, it has been shown that autophagy induction in ra synovial fibroblasts promoted their survival. several studies have presented evidence of upregulated proteolytic activity in the pbmcs of ra patients versus healthy subjects, which might result from joint destruction in ra. articular cartilage and bone degradation are associated with the upregulation of matrix metalloproteinases (mmps) and osteolytic enzymes, such as mmp-9 and cathepsin k, respectively [4547 ], in the serum and synovial fluid of ra patients [48, 49 ]. moreover, serum concentrations of cathepsin k significantly correlated with radiological joint destruction in ra patients. mmp-9 expression is activated by proinflammatory cytokines including tnf and has been shown to be both decreased [52, 53 ] and increased in response to anti - tnf therapy. here, we evaluated changes in the expression of genes responsible for cell proliferation and growth (mtor), regulation of cell cycle progression (p21), apoptosis (caspase-3), and autophagy (ulk1), as well as the proinflammatory cytokine tnf and genes associated with bone and articular cartilage turnover (mmp-9 and cathepsin k) in the whole blood of rheumatoid arthritic patients treated with mtx in relation to their rf status, clinical, immunological, and radiological parameters, and their therapeutic response at a 24-month follow - up. our results suggest that the higher radiographic joint destruction associated with rf positivity is accompanied by the upregulation of mmp-9 and cathepsin k gene expression in the pbmcs of ra patients treated with methotrexate. the study protocol was approved by the local committee on the ethics of human research, and informed consent was obtained from all subjects. the control group consisted of 35 subjects, 7 men and 28 women, (average age 46.4 13.2 years ; range 1969 years) with no current chronic or acute infection and no family history of autoimmune diseases. the ra patient group consisted of 33 consecutive, unrelated rheumatoid arthritic patients, 5 men and 28 women (average age 47.2 14.2 years ; range 1868 years), who visited the clinic of the institute of rheumatology, russian academy of medical sciences, between january and december 2008. inclusion criteria involved a diagnosis of ra, as defined by the american college of rheumatology (acr) 1987, age 18 years, and symptom duration of 5.1) at study entry (table 2). the das28 index decreased significantly after 24 months of follow - up (p = 0.001). at the end of the study, the majority of patients had moderate disease activity (3.2 5.1) at baseline (table 3). the das28 index decreased significantly after 2 years (p = 0.0002). at the end of the study, the majority of patients had moderate disease activity (3.2 < das28 < 5.1) while five patients (24%) fulfilled the remission criteria (das28 < 2.6). these findings were associated with significant decreases in morning stiffness and in the numbers of swollen and tender joints. five patients out of 21 exhibited erosions at the beginning of the study ; by the end of the study, 10 patients out of 21 had erosions, and the erosion score significantly increased (p = 0.003) after two years of follow - up. the joint space narrowing score also increased significantly over the course of the follow - up period (p = 0.001). direct comparison of the clinical, immunological, and radiological parameters between the groups showed that, at baseline, seropositive patients exhibited significantly higher rf (p < 0.001) and acpa (p = 0.01) values compared with seronegative ra subjects. after 24 months the seropositive ra patients also showed significantly elevated rf (p < 0.001) and acpa (p = 0.006) versus seronegative subjects. in addition, at the end of the study, seropositive patients exhibited higher joint space narrowing (p = 0.006) values compared with seronegative ra patients, and there was a higher number of seropositive patients than seronegative patients with bone erosions (p = 0.02). however, no significant differences in the manifestation of other examined parameters were noted between the analyzed groups of ra patients both at baseline and at the end of the follow - up period (tables 2 and 3). many aspects of a disease phenotype are produced by pathophysiological processes driven by genes and their products. therefore, comparison of gene expression signatures between ra patients and healthy subjects may reveal important insights into mechanistic differences and unravel the fundamental nature of the disease. moreover, this approach might also be useful in the evaluation of the response to ra treatment, which is supposed to restore normal cellular metabolism and should arguably aim to restore gene expression to levels comparable to healthy controls. as it has been noted that more homogenous patient groups produce more consistent results, we analyzed the value of rf status on the outcome of mtx therapy in a sample of ra patients during a 24-month follow - up in relation to changes in the expression of genes involved in basic cellular processes and joint function, as measured in the peripheral blood. we found that, in the majority of the examined patients, the disease activity in the subsets of seropositive and seronegative ra patients significantly decreased from high levels at baseline to moderate levels at the end of the follow - up. this decrease was accompanied by a significant decrease in the morning stiffness and the number of swollen and tender joints in both subsets and a significant downregulation of tnf gene expression in the blood compared with baseline levels. these results support previous observations that mtx treatment decreases tnf production in t cells from ra patients [64, 65 ]. rf status did not affect the remission frequency (p = 0.29) in the examined ra patients ; in both subsets, the remission criteria were fulfilled by 24% of the examined seropositive patients and by 33% of the seronegative ra patients. the inability of rf positivity to predict the outcome based on clinical parameters has also been observed previously [1215, 66, 67 ]. the significantly increased erosion and joint space narrowing scores observed at the end of the follow - up period in the seropositive ra patients support previous observations that many ra patients exhibit radiographic progression, even though clinically they are in a state of low disease activity [68, 69 ]. worsening of radiological parameters in these patients at the end of the study was associated with significant upregulation of mmp-9 and cathepsin k gene expression in the peripheral blood compared with baseline values. in contrast, the less severe joint destruction noted in the seronegative ra patients was accompanied by fewer alterations in mmp-9 and cathepsin k gene expression in the blood at the end of the follow - up. therefore, upregulation of mmp-9 and cathepsin k gene expression might serve as blood - based biomarker of increased joint destruction activity in ra patients treated with mtx. the difference in the observed response to mtx treatment might be partially caused by acpa positivity in the majority of the examined seropositive ra patients compared with seronegative subjects. some studies have reported previously that acpa positivity was related to resistance to dmards and was inversely associated with remission at 24 months [70, 71 ]. the decrease in the disease activity at the end of the follow - up was accompanied by downregulation of mtor gene expression in seronegative ra patients to the level observed in healthy controls. this outcome is important in mtx therapy, as mtor upregulation has been shown to be associated with interleukin (il)-1, tnf production, synovial fibroblast proliferation, and osteoclast formation. however, expression of the other examined genes (namely, p21, caspase-3, and ulk1 which are also required for maintenance of basic cellular processes) did not show significant changes in ra patients over the course of treatment, remaining significantly upregulated compared with healthy controls at the end of the study. this result might indicate that mtx treatment does not ameliorate basic cellular functions associated with apoptosis, autophagy, and cell cycle control, which are disturbed in ra. we have shown that a significant reduction in the disease activity of the examined ra patients treated with methotrexate during a 24-month follow - up was associated with the significant downregulation of tnf gene expression in the blood compared with baseline, which became equal to that in healthy subjects. nevertheless, rheumatoid factor - positive ra patients exhibited significantly increased joint destruction accompanied by significant upregulation of mmp-9 and cathepsin k gene expression in the peripheral blood compared with baseline levels. these analyses may be of value in better characterizing disease activity and joint degeneration in rheumatoid arthritic patients. | we evaluated changes in gene expression of mtor, p21, caspase-3, ulk1, tnf, matrix metalloproteinase (mmp)-9, and cathepsin k in the whole blood of rheumatoid arthritic (ra) patients treated with methotrexate (mtx) in relation to their rheumatoid factor status, clinical, immunological, and radiological parameters, and therapeutic response after a 24-month follow - up. the study group consisted of 35 control subjects and 33 ra patients without previous history of mtx treatment. gene expression was measured using real - time rt - pcr. decreased disease activity in patients at the end of the study was associated with significant downregulation of tnf expression. downregulation of mtor was observed in seronegative patients, while no significant changes in the expression of p21, ulk1, or caspase-3 were noted in any ra patients at the end of the study. the increase in erosion numbers observed in the seropositive patients at the end of the follow - up was accompanied by upregulation of mmp-9 and cathepsin k, while seronegative patients demonstrated an absence of significant changes in mmp-9 and cathepsin k expression and no increase in the erosion score. our results suggest that increased expression of mmp-9 and cathepsin k genes in the peripheral blood might indicate higher bone tissue destruction activity in ra patients treated with methotrexate. the clinical study registration number is 0120.0810610. |
study approval was from the uk department of health 's administration of radioactive substances advisory committee and newcastle, north tyneside, and northumberland research ethics committees. patients were recruited from outpatient movement disorder clinics in newcastle - upon - tyne and gateshead, while healthy controls were from patient spouses and friends in this and other studies. participants had physical, neurologic, and neuropsychiatric assessments, including mental state, history, physical examination, and, for patients, blood screen with b12 and folate levels. the study battery administered included the mmse, neuropsychiatric inventory (npi), and cambridge cognitive examination (camcog) with memory and executive function subscales (camcogmemory, camcogexec). patients with pdd were on levodopa and carbidopa or benserazide combination therapy and were naive to chei treatment at the time of qnb imaging. participants on any of the following medications were excluded from the study : antipsychotics, cholinergics, anticholinergics, and antidepressant medications. clinicopathologic diagnosis was established for 11 cases (2 controls, 9 pdd). using the technique of lee., (r, r) i - qnb radiosynthesis was conducted, the specifics of which are described elsewhere. participants were scanned with a triple - head gamma camera (picker 3000xp ; philips, best, the netherlands) 5 hours postinjection of (r, r) i - qnb using a previously reported imaging protocol. within 4 weeks of the (r, r) i - qnb scan, individuals underwent tc - exametazime regional cerebral blood flow (rcbf) spect imaging in accordance with a past scanning procedure. all spect scans were registered to match, where applicable, a i - qnb or tc - exametazime spect template in standard stereotactic montreal neurological institute space using linear image registration software (http://fsl.fmrib.ox.ac.uk/fsl/fslwiki/flirt/). the spatially transformed images were then smoothed with a 10-mm full width at half maximum 3d gaussian filter. principal component (pc) analysis was applied on a voxel basis to all processed i - qnb spect images using covariance analysis software (http://www.nitrc.org/projects/gcva_pca/), producing a series of pc images. for each pc image, voxels had either positive or negative weights that represent the sign and strength of covariance between voxels. in this study, voxels with positive and negative weights were viewed as concurrently preserved / increased and decreased m1/m4 binding, respectively. the extent to which an individual expressed the pc image was by way of a subject scaling factor (ssf) for that pc, calculated by superimposing the pc image onto an individual 's processed qnb scan by computation of a dot product, which involves image multiplication on a voxel basis followed by summation of the products generating a score. higher ssf scores for an individual for that pc image represents greater increased binding in voxels with positive weights and greater concurrent decreased binding in voxels with negative weights. to identify the qnb spatial covariance pattern (scp) that distinguished pdd from controls, each individual ssf was entered into a linear regression model as explanatory variables with group as the dependent parameter. akaike information criteria (aics) determined how many pcs should be included to reach optimal bias - variance tradeoff. the set of pcs yielding the lowest aic value was used to derive the scpqnb., positive and negative weights were interpreted as concurrent increased and decreased rcbf, respectively. the analysis produced the scprcbf that best separated pdd from controls, while each participant expressed the scprcbf by his or her ssfrcbf. following their i - qnb scan, the majority of patients (n = 18) were then treated with the chei donepezil titrated up to the standard daily clinical dose of 10 mg. after a period of 12 weeks, patients underwent repeated mmse assessments. we derived a chei - naive m1/m4 scp that correlated with mmserel_b, which described the percentage change in mmse relative to baseline. this involved conducting a separate analysis, generating a series of pcs expressed by each participant by the ssfs, which in turn were introduced into a regression model as predictor variables with mmserel_b as the response parameter. the resulting linear combination with the smallest aic value generated the scpmmse (r = 0.34, p = 0.005), where each individual expressed the pattern by the ssfmmse. stability and reliability of the scps were assessed by bootstrap resampling (1,000 iterations) to identify areas that contributed to the patterns with high confidence. this transforms the voxel weights of each scp into z maps, computed as the ratio of voxel weight and bootstrap sd. the z - statistic follows roughly a standard normal distribution where a one - tailed p 0.05 infers a threshold of |z| 1.64. continuous variables were tested for normality using visual inspection of histograms and shapiro - wilk test. demographic, clinical, and imaging measures were assessed, where applicable, using parametric (analysis of variance) and nonparametric tests. data analysis used the statistical package for social sciences (chicago, il) software (spss version 22.0 ; http://www-01.ibm.com/software/analytics/spss/products/statistics/). study approval was from the uk department of health 's administration of radioactive substances advisory committee and newcastle, north tyneside, and northumberland research ethics committees. the study comprised 49 individuals (25 pdd and 24 similarly aged controls). patients were recruited from outpatient movement disorder clinics in newcastle - upon - tyne and gateshead, while healthy controls were from patient spouses and friends in this and other studies. participants had physical, neurologic, and neuropsychiatric assessments, including mental state, history, physical examination, and, for patients, blood screen with b12 and folate levels. the study battery administered included the mmse, neuropsychiatric inventory (npi), and cambridge cognitive examination (camcog) with memory and executive function subscales (camcogmemory, camcogexec). patients with pdd were on levodopa and carbidopa or benserazide combination therapy and were naive to chei treatment at the time of qnb imaging. participants on any of the following medications were excluded from the study : antipsychotics, cholinergics, anticholinergics, and antidepressant medications. using the technique of lee., (r, r) i - qnb radiosynthesis was conducted, the specifics of which are described elsewhere. participants were scanned with a triple - head gamma camera (picker 3000xp ; philips, best, the netherlands) 5 hours postinjection of (r, r) i - qnb using a previously reported imaging protocol. within 4 weeks of the (r, r) i - qnb scan, individuals underwent tc - exametazime regional cerebral blood flow (rcbf) spect imaging in accordance with a past scanning procedure. all spect scans were registered to match, where applicable, a i - qnb or tc - exametazime spect template in standard stereotactic montreal neurological institute space using linear image registration software (http://fsl.fmrib.ox.ac.uk/fsl/fslwiki/flirt/). the spatially transformed images were then smoothed with a 10-mm full width at half maximum 3d gaussian filter. principal component (pc) analysis was applied on a voxel basis to all processed i - qnb spect images using covariance analysis software (http://www.nitrc.org/projects/gcva_pca/), producing a series of pc images. for each pc image, voxels had either positive or negative weights that represent the sign and strength of covariance between voxels. in this study, voxels with positive and negative weights were viewed as concurrently preserved / increased and decreased m1/m4 binding, respectively. the extent to which an individual expressed the pc image was by way of a subject scaling factor (ssf) for that pc, calculated by superimposing the pc image onto an individual 's processed qnb scan by computation of a dot product, which involves image multiplication on a voxel basis followed by summation of the products generating a score. higher ssf scores for an individual for that pc image represents greater increased binding in voxels with positive weights and greater concurrent decreased binding in voxels with negative weights. to identify the qnb spatial covariance pattern (scp) that distinguished pdd from controls, each individual ssf was entered into a linear regression model as explanatory variables with group as the dependent parameter. akaike information criteria (aics) determined how many pcs should be included to reach optimal bias - variance tradeoff. the set of pcs yielding the lowest aic value was used to derive the scpqnb. the degree, positive and negative weights were interpreted as concurrent increased and decreased rcbf, respectively. the analysis produced the scprcbf that best separated pdd from controls, while each participant expressed the scprcbf by his or her ssfrcbf. following their i - qnb scan, the majority of patients (n = 18) were then treated with the chei donepezil titrated up to the standard daily clinical dose of 10 mg. we derived a chei - naive m1/m4 scp that correlated with mmserel_b, which described the percentage change in mmse relative to baseline. this involved conducting a separate analysis, generating a series of pcs expressed by each participant by the ssfs, which in turn were introduced into a regression model as predictor variables with mmserel_b as the response parameter. the resulting linear combination with the smallest aic value generated the scpmmse (r = 0.34, p = 0.005), where each individual expressed the pattern by the ssfmmse. stability and reliability of the scps were assessed by bootstrap resampling (1,000 iterations) to identify areas that contributed to the patterns with high confidence. this transforms the voxel weights of each scp into z maps, computed as the ratio of voxel weight and bootstrap sd. the z - statistic follows roughly a standard normal distribution where a one - tailed p 0.05 infers a threshold of |z| 1.64. continuous variables were tested for normality using visual inspection of histograms and shapiro - wilk test. demographic, clinical, and imaging measures were assessed, where applicable, using parametric (analysis of variance) and nonparametric tests. data analysis used the statistical package for social sciences (chicago, il) software (spss version 22.0 ; http://www-01.ibm.com/software/analytics/spss/products/statistics/). groups were similar in age and sex, while as expected, all other variables differed (p < 0.001). participant characteristics the scpqnb that distinguished pdd from controls is shown in figure 1, a and b. ssfqnb scores were higher in pdd than controls (mean sd ; controls = 1.5 2.5, pdd = 6.2 3.3, f1,47 = 31.9, p < 0.001 ; figure 1c). the pattern was mainly characterized by concomitant decreases in m1/m4 binding (blue regions) in basal forebrain, temporal, striatal, insula, and anterior cingulate together with concomitant preserved or increases (red regions) in frontal and parieto - occipital areas. table e-1 on the neurology web site at neurology.org presents detailed description of specific regions contributing to the m1/m4 disease - related pattern. disease - related m1/m4 spatial covariance pattern in pdd projected onto orthogonal (a) and rendered (b) displays of the qnb template. the associated scprcbf that differentiated pdd from controls is illustrated in figure 2, a and b, where ssfrcbf scores differed between groups (controls = 0.4 0.9, pdd = 6.2 1.9, f1,47 = 177.5, p < 0.001 ; figure 2c). the pattern mainly comprised relative decreased rcbf (blue) in temporoparietal and prefrontal areas with relative increases (red) in cerebellum, brainstem, striatothalamic, and motor regions. detailed description of specific regions participating in the rcbf disease - related pattern is provided (table e-2). disease - related rcbf spatial covariance pattern in pdd projected onto orthogonal (a) and rendered (b) displays of the rcbf template. ant = anterior ; pos = posterior ; sup = superior. relationships between scp expressions and age, mmse, camcog, camcogmemory, camcogexec, total npi, npi hallucinations subscale, and unified parkinson 's disease rating scale iii were investigated in pdd. no correlations were found between ssfqnb and these measures (|r| 0.23, p 0.14). for the rcbf pattern expression, total npi correlated with ssfrcbf (= 0.62, p = 0.006), which was not observed for the other variables (|r| 0.28, p 0.09). an exploratory examination of npi subscores did not yield any specific relationships with scp expressions. summary data for the donepezil - treated group are shown (table 2). during the observation period, differences in mmse were identified between baseline and 12-week scores (p < 0.001). the resultant scpmmse is presented in figure 3, a and b, while figure 3c depicts ssfmmse plotted as a function of mmserel_b. the pattern consists of concurrent decreases in m1/m4 binding (blue) in fusiform, anterior cingulate, lingual gyrus, and precentral areas with concurrent preserved or increases (red) in pre / medial / orbitofrontal, parietal, and posterior cingulate regions. summary data of patients with pdd treated with donepezil (a c) m1/m4 scp in pdd (n = 18) that correlated with mmserel_b. groups were similar in age and sex, while as expected, all other variables differed (p < 0.001). the scpqnb that distinguished pdd from controls is shown in figure 1, a and b. ssfqnb scores were higher in pdd than controls (mean sd ; controls = 1.5 2.5, pdd = 6.2 3.3, f1,47 = 31.9, p < 0.001 ; figure 1c). the pattern was mainly characterized by concomitant decreases in m1/m4 binding (blue regions) in basal forebrain, temporal, striatal, insula, and anterior cingulate together with concomitant preserved or increases (red regions) in frontal and parieto - occipital areas. table e-1 on the neurology web site at neurology.org presents detailed description of specific regions contributing to the m1/m4 disease - related pattern. disease - related m1/m4 spatial covariance pattern in pdd projected onto orthogonal (a) and rendered (b) displays of the qnb template. ant = anterior ; pos = posterior ; sup = superior. the associated scprcbf that differentiated pdd from controls is illustrated in figure 2, a and b, where ssfrcbf scores differed between groups (controls = 0.4 0.9, pdd = 6.2 1.9, f1,47 = 177.5, p < 0.001 ; figure 2c). the pattern mainly comprised relative decreased rcbf (blue) in temporoparietal and prefrontal areas with relative increases (red) in cerebellum, brainstem, striatothalamic, and motor regions. detailed description of specific regions participating in the rcbf disease - related pattern is provided (table e-2). disease - related rcbf spatial covariance pattern in pdd projected onto orthogonal (a) and rendered (b) displays of the rcbf template. relationships between scp expressions and age, mmse, camcog, camcogmemory, camcogexec, total npi, npi hallucinations subscale, and unified parkinson 's disease rating scale iii were investigated in pdd. no correlations were found between ssfqnb and these measures (|r| 0.23, p 0.14). for the rcbf pattern expression, total npi correlated with ssfrcbf (= 0.62, p = 0.006), which was not observed for the other variables (|r| 0.28, p 0.09). an exploratory examination of npi subscores did not yield any specific relationships with scp expressions. summary data for the donepezil - treated group are shown (table 2). during the observation period, differences in mmse were identified between baseline and 12-week scores (p < 0.001). the resultant scpmmse is presented in figure 3, a and b, while figure 3c depicts ssfmmse plotted as a function of mmserel_b. the pattern consists of concurrent decreases in m1/m4 binding (blue) in fusiform, anterior cingulate, lingual gyrus, and precentral areas with concurrent preserved or increases (red) in pre / medial / orbitofrontal, parietal, and posterior cingulate regions. summary data of patients with pdd treated with donepezil (a c) m1/m4 scp in pdd (n = 18) that correlated with mmserel_b. we undertook a multivariate network perspective of (r, r) i - qnb spect, a m1/m4 receptor ligand in chei - naive patients with pdd. we derived a disease - related m1/m4 pattern of spatial covariance that appears largely distinct from rcbf, which implies the presence of several dysfunctional cholinergic networks in pdd. we also identified a clear m1/m4 covariance pattern that was associated with an improvement in mmse ; this network had distinctive spatial elements suggesting certain cortical regions and their associated cholinergic innervation may have a more preeminent role in cognitive amelioration by cholinergic treatments. relevant to the present study, this spatial covariance technique has extensively and successfully been utilized in perfusion spect and glucose metabolism pet data for the investigation of disease progression and symptomatology in pd. we derived a voxel cholinergic scp from i - qnb images that differentiated pdd from controls. the disease - related pattern comprised decreased and preserved / increased m1/m4 uptake in a number of concomitant brain regions or networks. notably, this cholinergic receptor network mapped onto previously described resting - state networks, including anterior insula and the anterior cingulate, key nodes of the salience network (sn), which is important for initiation of cognitive control and switching between networks to aid access to working memory and attention resources. networks involving the insula have also been shown to play a role in episodic memory, while hippocampus, parahippocampus, and amygdala are known to be involved in memory storage and retrieval. as such, this pattern would align with a cognitive network deficit implicating the basal forebrain and these structures, i.e., a cholinergic limbic - paralimbic / sn dysfunction. the disease - related pattern also encompassed regions implicated in dorsal (occipital parietal) and ventral (occipital temporal limbic) visual streams, providing indirect evidence for the role of distinct cholinergic networks in visual function in pdd, which would be in keeping with known visuoperceptual deficits and predisposition to visual hallucinations, symptoms that both show good response to cholinesterase inhibitors. the associated rcbf pattern largely comprised relative decreases in temporoparietal and prefrontal areas along with relative increases in cerebellum, brainstem, striatothalamic, and motor regions that implicate a number of functional networks in pdd. regions that were concomitantly reduced appear to involve hubs of the frontoparietal attention (inferior parietal, dorsolateral prefrontal cortex) and default mode networks (dmns) (medial prefrontal, posterior cingulate, ventral precuneus, inferior parietal), which is of interest since, respectively, attention deficits are one of the most disabling cognitive symptoms in pdd, while network theories have strongly implicated the dmn in contributing to cognitive decline. our previous studies revealed modulation of the frontoparietal network in pdd that was similar to patients with dementia with lewy bodies (dlb), while also demonstrating, albeit in dlb, its relationship with severity and frequency of cognitive fluctuations. other investigations have reported decreases in dmn connectivity in pdd and its association with cognitive dysfunction in pd. these and our rcbf findings appear to provide further evidence that implicate the dmn and frontoparietal networks in the pathogenesis of symptoms in pdd, in particular cognitive. moreover, perhaps not unexpectedly, the rcbf pattern seemed to represent an extended topography of the pd - related motor and cognitive patterns, which have been previously reported from f - fdg pet studies using similar network approaches, thus indirectly validating the analytic methodology used in the present study. we failed to detect any correlations between the m1/m4 pattern expressions and neuropsychological and neuropsychiatric measures in pdd. for rcbf thus, patients with more global severe neuropsychiatric symptoms, a marker of greater disease severity, were more likely to express the perfusion scp characteristic of pdd. the lack of correlations may be explained by either the notion that each spatial covariance pattern is likely to characterize a number of overlapping and convergent brain networks and thus fails to project on specific cognitive and clinical parameters or that patterns derived from combined (control dementia) cohorts are less sensitive. isolating key networks from these patterns could increase sensitivity, but this is methodologically challenging. we found a clear m1/m4 covariance pattern that correlated with a change in mmse that could indicate a positive treatment response. this pattern showed relative decreases in fusiform, striatum, anterior cingulate, lingual gyrus, and precentral areas with relative preservation or increase in pre / medial / orbitofrontal, parietal, and posterior cingulate regions. from a network perspective, there was covariant preservation / upregulation in regions overlapping key nodes of the dmn and frontoparietal networks that could imply that a relative cholinergic maintenance of these networks is prerequisite for chei treatment response in pdd, and more generally may point toward the potential relevance of these networks and their cholinergic innervation and its associated cognitive symptoms. notably, a recent study showed that cholinergic and serotonergic antagonists can impair dmn - like network in mice similarly, suggesting that both neurotransmitter systems are involved in maintaining the integrity of the dmn - like networks. hence, this pattern appears to provide some evidence that supports the cholinergic dmn maintenance hypothesis, and its potential significance as a predictor of positive treatment response in pdd and perhaps in other neurodegenerative disorders. modest sample sizes and uncertainty regarding which receptor subtype is affected (that is, m1 vs m4) are limitations of the study. another limitation was the use of mmse rather than montreal cognitive assessment to assess cognitive function in these patients, reflecting the fact that our data were collected before the widespread use of the latter scale. replication of this study with neuropsychological assessments that align more with the cognitive deficit profile of pdd may provide a more nuanced cholinergic response network pattern. strengths were scanning and clinically assessing patients with pdd free from cholinergic medications with perfusion and muscarinic spect images available for all participants. the relevance of these networks may be important in terms of their contribution to cognitive and, in particular, attentional deficits of this condition. the use of cheis could improve such deficits, but there is marked heterogeneity in response to these agents and it is not possible to reliably predict on clinical grounds who might respond to these drugs. although tentative, we observed a scp that suggests that those with cholinergic maintenance of dmn and frontoparietal networks could experience cognitive improvement with chei treatment. these findings provide further neurobiological insights into therapies targeted at improving cholinergic neurotransmission and treatment outcomes in pdd. dr. colloby : co - designed the study, conducted all image and data analyses, and wrote the manuscript. supported by medical research council uk (grant g9817682), the national institute for health research (nihr), research for public benefit, wellcome trust (wt088441ma fellowship funding j.- p.t.) ; nihr dementia biomedical research unit at cambridge university hospitals, nhs foundation trust, the university of cambridge ; and the nihr newcastle biomedical research centre in ageing and chronic disease, biomedical research unit in lewy body dementia based at newcastle upon tyne hospitals, nhs foundation trust and newcastle university. i. mckeith has been a consultant for ge healthcare, bayer health care, and nutricia. j. o'brien has been a consultant for ge healthcare, lilly, bayer healthcare, taurx, and nutricia and has received honoraria for talks from ge healthcare, lilly, and novartis. j. taylor has been a consultant of lundbeck and received honoraria for talks from ge healthcare and flynn pharmaceuticals. | objective : to investigate muscarinic m1/m4 cholinergic networks in parkinson disease dementia (pdd) and their association with changes in mini - mental state examination (mmse) after 12 weeks of treatment with donepezil.methods:forty-nine participants (25 pdd and 24 elderly controls) underwent 123i - qnb and 99mtc - exametazime spect scanning. we implemented voxel principal components (pc) analysis, producing a series of pc images of patterns of interrelated voxels across individuals. linear regression analyses derived specific m1/m4 and perfusion spatial covariance patterns (scps).results : we found an m1/m4 scp of relative decreased binding in basal forebrain, temporal, striatum, insula, and anterior cingulate (f1,47 = 31.9, p < 0.001) in cholinesterase inhibitor naive patients with pdd, implicating limbic - paralimbic and salience cholinergic networks. the corresponding regional cerebral blood flow scp showed relative decreased uptake in temporoparietal and prefrontal areas (f1,47 = 177.5, p < 0.001) and nodes of the frontoparietal and default mode networks (dmn). the m1/m4 pattern that correlated with an improvement in mmse (r = 0.58, p = 0.005) revealed relatively preserved / increased pre / medial / orbitofrontal, parietal, and posterior cingulate areas coinciding with the dmn and frontoparietal networks.conclusion:dysfunctional limbic - paralimbic and salience cholinergic networks were associated with pdd. established cholinergic maintenance of the dmn and frontoparietal networks may be prerequisite for cognitive remediation following cholinergic treatment in this condition. |
uveitis is defined as the inflammation of uveal tracts. because of the heterogeneity of its pathogenesis, recurrent disease attacks, prolonged or repeated steroid treatment is the current mainstay. firstly, multiple administrations of steroid might cause subsequent ocular complications, such as cataract, glaucomatous optic neuropathy, scleral melting, or even superimposed infection. secondly, since no reliable markers can predict upcoming recurrence in preclinical stages, steroid usage only alleviates but not prevents uveitis attacks. therefore, uveitis still accounts for 1025% of legal blindness worldwide [13 ]. among the anatomical classifications by the standardization of uveitis nomenclature (sun) working group, 4370% of uveitis cases are anterior uveitis [57 ]. despite the well - described clinical presentations, the exact underlying mechanism of the disease has not yet been completely elucidated. several animal models have been developed for the further study of uveitis. among these, as established by broekhuyse and colleagues, experimental autoimmune anterior uveitis (eaau) on lewis rats differs from another common model, experimental autoimmune uveoretinitis (eau), in that the inflammation remains exclusively anterior, and the photoreceptor cells and retinal tissues are not affected ; this resembles human acute anterior uveitis (aau).. it often exhibits disease onset at day 11 after immunization, with inflammation peaking at days 1519, recovery at day 30, and it has a recurrent nature. immunologically, previous literature has revealed the essential involvement of the nuclear factor kappa b (nf-b) pathway in eaau, with the subsequent secretion of numerous downstream cytokines and production of chemokines [11, 12 ]. while innate immunity contributes to both the disease induction and tissue damage, adaptive immunity, particularly th1/th17 activation,. however, researches on the dynamic involvement of th1/th17-related cytokines in eaau have been inconclusive [11, 16 ]. micrornas (mirnas) are small noncoding rna molecules that can function as posttranscriptional regulators of gene expression and affect numerous biological processes in eukaryotes. recently, more information on the relationship between mirna and immunity has been elucidated [1820 ]. it has been suggested that the interplay of mirnas and nf-b can regulate the immune response either positively or negatively [21, 22 ]. specifically, mir-146a and mir-155 are considered as key immunological players. by attenuating tumor necrosis factor (tnf) receptor - associated factor 6 (traf6) and interleukin- (il-) 1 receptor - associated kinase 1 (irak1), mir-146a was observed to affect downstream nf-b expression and, finally, inhibit inflammation [22, 23 ]. in contrast, mir-155 was regarded as a positive regulator in both cellular and humoral immune responses in some studies. mir-155-deficient mice failed to secrete class - switched immunoglobulins and exhibited diminished production of th17 cells. expression profiling of mirna has been carried out in human and animal panuveitis [26, 27 ]. the dynamic changes of mirnas emerge long before disease onset and are proposed to contribute to nf-b and fas ligand activation, with ultimate photoreceptor apoptosis. to our knowledge, no studies have focused on the involvement of mirnas in either animal or human aau. since mirnas regulate the nf-b pathway, detailed investigation of the dynamic expression of mirnas might provide new insights into the pathogenesis and treatment of eaau. specific mirna changes can be quantitative guidance for inflammatory activity, early predictors of disease attack, and steroid - sparing therapeutic targets. meanwhile, as evidence regarding th17 participation in eaau is scarce, th1/th17 cytokine analysis is also important in confirmation of specific cellular immune - pathogenesis in eaau. the present study was therefore conducted to reveal the dynamic changes of mirnas and th1/th17 related cytokines in eaau. lewis rats that were 68 weeks old and weighed 125160 g were used in the experiments. all animals were treated in accordance with the arvo statement for the use of animals in ophthalmic and vision research. melanin - associated antigen (maa) was prepared according to the method from broekhuyse. 's publication in 1991. the tissue was homogenized and then filtered through a wire mesh to remove all the connective tissue and cellular debris. next, the homogenate was centrifuged at 1.2 10 g at 4c for 15 minutes. the centrifuged homogenate was then washed once with phosphate buffered saline (pbs) at ph 7.4. the resulting pellet was resuspended in 2% sodium dodecyl sulfate (bio - rad, richmond, ca, usa) and incubated at 70c for 10 minutes. these insoluble antigens were subsequently dried and stored at 20c. in order to induce eaau, (1) maa was suspended in pbs and 1 : 1 emulsified in complete freund 's adjuvant (sigma aldrich, st. the suspension (0.05 ml) was injected into the left hind footpad of the rats. (2) maa was emulsified with 1 g purified bordetella pertussis toxin (list labs, campbell, ca, usa) and injected intraperitoneally in a total volume of 0.05 ml. in the control group, 0.05 ml of pbs was simultaneously injected into the left hind footpad and intraperitoneally in the rats. the disease severity was graded from 0 to 4 : 0 : normal, without any anterior chamber cells or iris changes ; 1 : slight iris vessel dilation and some anterior chamber cells ; 2 : iris hyperemia, with some limitation in pupil dilation ; 3 : miotic, hyperemic, irregular, and slightly damaged iris, with considerable flare and cells (especially when accumulated near the iris) ; and 4 : seriously damaged and hyperemic iris, with a miotic pupil filled with protein, and cloudy, gel - like aqueous humor (aqh). three lewis rats each in the study and control groups were sacrificed on days 0, 7, 10, 15, and 25 after immunization. the eyes were enucleated, and then the iris and ciliary bodies were carefully isolated under an operating microscope. the popliteal lymph nodes were also harvested. immediately after sacrificing the animals and before dissection of ocular tissues at each time point, the aqh was obtained using a 30-gauge needle (2 l). the aqh was then collected in silicone - treated microcentrifuge tubes (fisher scientific, pittsburgh, pa, usa) and stained with 0.4% trypan blue. total rna was isolated from iris, ciliary bodies, and popliteal lymph nodes with trizol reagent (life technologies, gaithersburg, md, usa). the samples were labeled using the mircury lna microrna hi - power labeling kit, hy3/hy5, and hybridized on the mircury lna microrna array (7th gen, exiqon, vedbk, denmark) in accordance with the manufacturer 's instructions. the mean standard deviation was calculated for each group, and mirna signals were all transformed to logarithm base 2 for further statistical analysis. preliminary comparison was performed between samples from three studies (14 days after induction) and three control lewis rats. the mirna profiling first identified a subset of 138 mirnas with the absolute value of the log fold changes larger than 1. from these mirnas, finally, eight of the most relevant mirnas were selected in accordance with the following principles : (1) significant differential expression between study and control samples was noted (log fold changes 2, either positively or negatively) ; (2) involvement in the nf-b pathway has been reported ; and (3) potential ways that the mirna contributes to uveitis have been addressed in the literature. the eight mirnas studied were mir-155b-5p, mir-21 - 5p, mir-146a-5p, mir-9 - 3p, mir-147b, mirna-183 - 5p, mirna-182 - 5p, and mi - rna-223 - 3p. further, the cytokines of interest were interferon- (ifn-), il-17, il-12a, il-1, il-6, and il-10. the relative mrna expression levels of these six cytokines were studied after total rna was extracted from the iris, ciliary bodies, and popliteal lymph nodes of the rats, as mentioned above. il-12 and ifn- have long been recognized as th1 key cytokines, while il-1 and il-17 are regarded as th17 signature cytokines. in order to elucidate how th1 and th17 are involved in eaau and to further confirm the results obtained with mrna, we measured the levels of ifn-, il-17, il-12a, and il-1 in the aqh at days 0, 7, 10, 15, and 25 after immunization using a sandwich enzyme - linked immunosorbent assay (elisa) kit (r&d systems, minneapolis, mn, usa) according to the manufacturer 's instructions. the elisa was repeated twice, and the samples were diluted up to a total volume of 50 l before testing. the optical density was determined at a450 (absorbance at 450 nm) with a microplate reader (bio - rad, hercules, california, usa), and the cytokine concentration was determined from standard curves using recombinant standards supplied by the manufacturer. enucleated eyes from lewis rats were embedded in paraffin and cut into 2 m sections. in situ hybridization the slides were prehybridized in a solution of 50% formaldehyde, 0.1% tween, 5x ssc buffer, 9.2 mm citric acid, 50 g / ml heparin, and 500 g / ml yeast rna. the slides were hybridized overnight in a humidified chamber at 57c, with 20 nm of digoxigenin - labeled probe per slide. oligonucleotide probes specific for the two selected mirnas (mir-146a-5p and mir-182 - 5p) were labeled at the 5 end with digoxigenin. after three washings at 57c, the sections were stained with solutions (kernechtrot, muto chemical, tokyo, japan). the levels of cytokine and mirna expression and the clinical severity grading of eaau were analyzed with the kruskal - wallis test. comparisons between the study and control groups were performed with the mann - whitney u test. the clinical signs of eaau and leukocyte infiltration were noted from day 7 after maa induction, with both peaking at day 15 and decreasing at day 25 after immunization. the dynamic changes of aqh leukocyte quantification and clinical scores are shown in figure 1, and both reached statistical significance (p = 0.0001 and p = 0.0472, resp.). the complete dynamic profiles of the levels of each mirna are summarized in table 1 and figure 2. generally, the expression of mir-9 - 3p, mir-182 - 5p, and mir-183 - 5p tended to increase from day 7 after immunization onwards and peaked at day 10 after immunization. meanwhile, mir-146a-5p, mir-147b, and mir-155 - 5p were significantly downregulated from day 7 and were repressed along the disease course, reaching the lowest level of expression at day 15. the expression levels of mir-146a-5p, mir-155 - 5p, mir-182 - 5p, and mir-183 - 5p in iris / ciliary bodies and popliteal lymph nodes are shown in figure 3. the levels of mir-146a-5p and mir-155 - 5p in the popliteal lymph nodes reached their lowest point earlier, on day 7, while those in the iris / ciliary body tissue kept decreasing until day 15 after immunization. no significant difference was noted in terms of mir-182 - 5p and mir-183 - 5p in the popliteal lymph nodes over the course of the disease. in situ hybridization in the iris / ciliary body tissue over the 14 days following disease induction (figure 4) confirmed the reduced expression of mir-146a-5p and enhanced expression of mir-182 - 5p in the eyes examined. a summary of the relative mrna expression levels in iris / ciliary bodies is shown in figure 5. among them, il-6 showed the most obvious increase in expression, with 6.89 0.28-fold changes at day 15 after immunization (p = 0.002), while il-10 exhibited significantly repressed expression, with 0.63 0.01-fold changes at day 15 after immunization (p = 0.001). the peak / trough fold changes of mrna expression of the other four cytokines were ifn : 1.68 0.03 at day 15 after immunization (p = 0.002), il-12a : 1.53 0.03 at day 25 after immunization (p = 0.004), il-17a : 1.52 0.04 at day 25 after immunization (p = 0.007), and il-1 : 1.30 0.05 at day 25 after immunization (p = 0.025). in order to elucidate the involvement of the th1 and th17 lineages and to confirm the mrna findings, the concentrations of ifn, il-12a, il-17a, and il-1 were analyzed with elisa. detailed mrna expression and aqueous concentration of each target cytokines in the disease course are shown in figure 6. the concentration of il-1 significantly increased from day 7 after immunization, peaking at day 15 and falling at day 25 after eaau induction. il-12a concentration dramatically increased at day 15 following disease induction, and decreasing soon after. further, il-17a steadily increased in concentration from day 7 after immunization, with a corresponding trend in mrna expression. ifn- concentration and mrna expression simultaneously increased, peaking at day 15 and falling at day 25 after eaau induction. overall, the dynamic changes in the concentration of each cytokine were consistent with those of the corresponding mrnas. in the current study, the differential expressions of mirnas were mostly evident 710 days after disease induction, with sequential cytokine changes 1015 days after immunization. elevation of clinical scores and corresponding leukocyte infiltration in the aqh peaked at day 15 after immunization, which was in agreement with the results in previous literature [11, 30, 31 ]. this time sequence suggests that regardless of proinflammatory (upregulated) or inhibitory (downregulated) roles of individual mirnas, immunological activation occurs days before clinical presentation, and that mirnas may be the upstream molecular driver. the earlier changes of mir-146a-5p and mir-155 - 5p in the popliteal lymph nodes than in the iris / ciliary bodies also demonstrate the immunoanatomical fact that antigen presentation with t cell maturation has already taken place in the closest draining lymph node. clinical inflammation ensues through the sequential activation of both the th1 and th17 lineages, as proven by the cytokine profiling. previous studies have addressed the involvement of innate immunity early in the course of the disease, with late involvement of adaptive immunity in eaau [8, 32 ]. molecular evidence has further disclosed the involvement of nf-b in the induction of uveitis [33, 34 ]. taken together with the detailed pathway of nf-b activation by upstream mirnas in toll - like receptor signaling and the role of mirnas in t cell clonal expansion / polarization, the mirna signatures in the current study provide insight into the immunopathogenesis of eaau. among the mirnas studied, mir-146a-5p, mir-155 - 5p, mir-182 - 5p, and mir-183 - 5p are four particularly crucial mirnas for the following reasons : they all show significant differential profiles in the disease course ; they all regulate nf-b pathway, and mir-146a-5p and mir-155 - 5p are regarded as potent immunological drivers ; they all have been reported in some uveitis models. the regulation of mir-146a and nf-b is bidirectional and encompasses both innate and adaptive immunity. while the mir-146a gene is transcriptionally activated in response to nf-b activation, it inhibits traf6 and irak1 and, hence, dampens nf-b expression [20, 22, 23 ]. additionally, the th1 lineage is normally suppressed by mir-146a through the targeting of stat-1 expression and the activation of treg cells. genetic studies on human uveitis revealed the association of the downregulated genotype of a single nucleotide polymorphism of mir-146a, rs2910164, with increased susceptibility to juvenile idiopathic arthritis and microvascular leakage in pediatric uveitis. the decreased expression of mir-146a in a chinese population with behet 's disease has also been noted. in agreement with the aforementioned studies, the dramatic downregulation of mir-146a over the disease course possibly causes the nf-b activation and th1 clonal expansion and, ultimately, the intraocular inflammation observed in this disease. as current evidence clearly delineated the regulation between mir-146a and nf-b, and the immune - inhibitory role has been consistently validated through various autoimmune diseases and uveitis, mir-146a can be a promising therapeutic target. previous literature has revealed the substantial involvement of mir-155 in both innate and adaptive immunity, including the inhibition of the myd88-dependent toll - like receptor pathway, immunoglobulin class switching, th17/il-17 axis enhancement, and th1 upregulation with th2 downregulation. while the positive contribution of the immune response in clinical and experimental arthritis and multiple sclerosis has been noted, mir-155 knockout mice suffered from an exaggerated autoimmune response in the lungs, indicating its role in the prevention of asthma. these contradictory results reflect the fact that multiple targets of the intracellular pathways can be manipulated by mir-155. firstly, nf-b upstream factors such as myd88, tab2, ikk, and rip1, which are normally inhibited by mir-155, may be overexpressed following the downregulation of mir-155. secondly, the th1 lineage may be abated after the downregulation of mir-155, which subsequently results in high levels of th17 axis expression. in accordance with our findings, mir-155 downregulation has also been noted in human subjects with active behet 's disease. mir-182 and mir-183 belong to the same family, and unlike other mirnas, mir-182 is one of the few dominant mirnas that can increase more than 100-fold. these mirnas are abundant in retinal tissues and are necessary for maintaining the outer segments of adult cone photoreceptors and visual function. previous evidence has suggested the important role of mir-182 in t cell clonal expansion after the stimulation of t helper cells by il-2 and regulation of specialization of treg cells. blockage of mir-182 led to the improvement of arthritis in an ovalbumin - induced arthritis mouse model. importantly, mir-182 was noted to be overexpressed in gliomas and directly suppressed cylindromatosis (cyld), an nf-b - negative regulator. the expression profile of the mir-182 family in panuveitis has been studied. in murine eau or human sympathetic ophthalmia eyes, mir-182 and mir-183 were downregulated following disease induction and were speculated to be associated with retinal tissue injury and forkhead box o1 or fas / fas ligand system activation [26, 53 ]. a genetic association study in humans also revealed that subjects with the downregulated mir-182 genotype are more susceptible to behet 's disease and vogt - koyanagi - harada disease. in current eaau models sparing the retina, however, the results differed from those from previous panuveitis studies. we believe that, in the absence of retinal destruction, the cause of mir-182 family overexpression in eaau is highly likely due to active involvement of nf-b activation and t cell recruitment. although cytokine profiling has been performed, few studies have provided consistent results and specific demonstration of th1/th17 relevance in the eaau model. a previous study revealed that tnf- and ifn- mrna are upregulated over the disease course of eaau and that inhibition of nf-b reduced the levels of these two proinflammatory cytokines, while augmenting the expression of anti - inflammatory cytokines such as il-10. however, another research has revealed that ifn- mrna is easily detectable in the popliteal lymph nodes but is barely measureable in iris / ciliary bodies. no changes in il-10, il-2, il-4, or il-6 mrna levels were noted in the iris / ciliary bodies in the same eaau study. the results from the current study not only show the significant differential mrna expression of il-6 and il-10 but also delineate the dynamic involvement of the th1/th17 related cytokines in eaau. il-1 is regarded as a potent proinflammatory cytokine that is involved in many autoimmune diseases in humans [55, 56 ]. some evidence has also suggested the indispensable role of il-1 in uveitides involving the whole uveal tract, such as human behet 's disease and animal eau. the upregulation of downstream cytokines such as il-17 and ifn-, along with the development of th17 cells, may further sustain intraocular inflammation. in brief, the predominant participation of il-1 in eaau shown in our study reflects the multifunctional nature of il-1 by promoting innate immunity and autoinflammation, inducing nf-b activation, enhancing th17 activation, and introducing numerous downstream cytokines activation. the th17 lineage plays a pivotal role in autoimmune diseases and is also considered to be crucial in uveitis activation [6264 ]. by activating traf6, synergizing tnf- expression, and inhibiting mir-23b, nf-b and other downstream pathways are strongly upregulated. interestingly, the contribution of immunopathogenesis by the th17 and th1 lineages can be quite complex. ifn-, the key cytokine of the th1 axis enhanced by il-12, reportedly plays a negative regulatory role in dendritic cell function and t cell priming in eau and may protect eyes from autoimmune attacks promoted by the th17/il-17 axis [67, 68 ]. however, rather than mutual antagonization, single dominant th1 or th17 lineage was found to be sufficient to generate intraocular inflammation independently from the other axis. our results demonstrate the early elevation of both il-1 and ifn-, which represent the th17 and th1 axes, respectively, at day 10 after immunization. both cytokines remain active and synergistically promote further activation of il-17a and il-12 at day 15 after immunization, with a concurrent increase in clinical inflammation. the current results confirm that both th1 and th17 lineages are active in eaau, just as in panuveitis. summarizing these findings, following the recognition of maa by toll - like receptors in antigen presenting cells, relevant mirnas may promote the activation of nf-b and subsequent cytokine secretion (figure 7). further activation of t cells and polarization of the immune axis could also be influenced by mirnas. through multiple regulation points by mirnas, innate and adaptive immunity the current study provides valuable information on the dynamic changes of mirnas and relevant th1- and th17-specific cytokines over the course of eaau. mir-146a-5p, mir-155 - 5p, mir-147b, and mir-223 - 3p were downregulated, while mir-182 - 5p, mir-183 - 5p, and mir-9 - 3p were upregulated. upstream changes of mirnas contribute to nf-b activation, with further downstream activation of both th17- and th1-specific cytokines and effector t cells. in future, studies investigating how the mirnas, especially mir-146a-5p, mir-155 - 5p, mir-182 - 5p, and mir-183 - 5p, affect each upstream nf-b signaling factor and the therapeutic effects of mirnas in eaau are warranted. | purpose. this study aimed to determine the dynamic changes of nf-b - related micrornas (mirnas) and cytokines over the course of experimental autoimmune anterior uveitis (eaau) and elucidate the possible immunopathogenesis. materials and methods. uveitis was induced in lewis rats using bovine melanin - associated antigen. the inflammatory activity of the anterior chamber was clinically scored, and leukocytes in the aqueous humor were quantified. rna was extracted from the iris / ciliary bodies and popliteal lymph nodes to reveal the dynamic changes of eight target mirnas (mir-155 - 5p, mir-146a-5p, mir-182 - 5p, mir-183 - 5p, mir-147b, mir-21 - 5p, mir-9 - 3p, and mir-223 - 3p) and six cytokine mrnas (ifn-, il-17, il-12a, il-1, il-6, and il-10). in situ hybridization of mirna and enzyme - linked immunosorbent assay quantification of cytokines were performed to confirm the results. results. disease activity and leukocyte quantification were maximum at day 15 after immunization. the profiling of mirna revealed downregulation of mir-146a-5p, mir-155 - 5p, mir-223 - 3p, and mir-147b and upregulation of mir-182 - 5p, mir-183 - 5p, and mir-9 - 3p. cytokine analysis revealed ifn-, il-17, il-12a, il-1, and il-6 overexpression, with il-10 downregulation. conclusions. dynamic changes of mirnas were observed over the course of eaau. by initiating nf-b signaling, the expressions of downstream cytokines and effector cells from the th17 and th1 lineages were sequentially activated, contributing to the disease. |
this is a retrospective cross - sectional study of suspected dhf cases reported to a referral hospital for infectious diseases in the city of fortaleza in the state of cear (ce), northeastern brazil, during its largest dengue epidemic of 2011. patients and definitions - all study patients were investigated for being reported as suspected cases of dhf. however, some of the cases did not have laboratory confirmation and did not undergo additional tests such as ultrasound and chest x - ray, which would be needed to confirm cavitary effusions. this investigation included all of the cases reported as suspected dhf at the referral unit. following the report of a suspected case, the epidemiological surveillance team performed the proper investigation for the confirmation or exclusion of each case (cavalcanti. all reported cases were required to be accompanied by a serum sample, but this was not always permitted by the patient. df was defined as an acute febrile illness (history of fever less than 7 days) accompanied by at least two of the following clinical findings : nausea, vomiting, headache, arthralgia, retro - orbital pain, rash, myalgia, haemorrhagic manifestations and leukopenia. because of the lack of specificity of these clinical signs and symptoms, laboratory evidence of dengue virus (denv) infection was required for a confirmed diagnosis. the definition of dhf consists of the presence of all of the five following criteria : fever (history of fever less than 7 days), haemorrhagic evidence (spontaneous bleeding or a positive tourniquet test), thrombocytopenia (platelet count 1,000/l and severe thrombocytopenia as platelet count 1568/84 (81)sex female39 (46.4) male45 (53.6)signs and symptoms headache74/77 (96.1) nausea44/47 (93.6) myalgia70/75 (93.3) rash60/68 (88.2) exanthema60/68 (88.2) retro - orbital pain37/42 (88.1) arthralgia31/37 (83.8) dizziness47/57 (82.5) abdominal pain61/76 (80.3) vomit57/73 (78.1) cough30/50 (60) dyspnoea20/64 (31.3) haemorrhagic manifestations70/80 (87.5) petecchiae51/63 (81) mucosal bleeding28/69 (40.6) gastrointestinal bleeding21/66 (31.8) haematemesis14/63 (22.2) positive tourniquet test8/37 (21.6) melena9/59 (15.3) epistaxis8/58 (13.8) haematuria4/34 (11.8)extravasation of plasma pleural effusion12/21 (57.1) cavitary effusion16/31 (51.6) ascites10/20 (50) plasma leakage31/75 (41.3)laboratory valuesmedian (min - max) platelet count18,000 (12,000 - 85,000) leukocyte count3,380 (900 - 9,800) haematocrit39.2 (15.5 - 57.5) according to the adapted dhf / dss classification (1997), one (1.2%) patient was classified as having df, 31 (36.9%) as having dhf and 52 (61.9%) as having dwc (tables ii, iii). the who classification of 2009 categorised the investigated patients as follows : 32 nsd [4 (4.8%) without warning signs and 28 (33.3%) with warning signs ] and 52 (61.9%) sd (table ii). table iicomparison between dengue haemorrhagic fever (dhf)/dengue shock syndrome (dss) classification for reporting severe cases during a dengue epidemic in northeastern brazil, 2011 nsd n (%) nsd with warning signs n (%) sd n (%) total n (%) df3 (75)18 (64.3)32 (61.5)53 (63.1)dhf1 (25)10 (35.7)20 (38.5)31 (36.9)dss---- total4 (100) (4.8 of total)28 (100) (33.3 of total)52 (100) (61.9 of total)84 (100) -df : dengue fever ; nsd : non - severe dengue ; sd : severe dengue. df : dengue fever ; nsd : non - severe dengue ; sd : severe dengue. the most frequently reported signs and symptoms were headache 74/77 (96.1%), nausea 44/47 (93.6%), myalgia 70/75 (93.3%), rash 60/68 (88.2%), retro - orbital pain 37/42 (88.1%), arthralgia 31/37 (83.8%), dizziness 47/57 (82.5%), abdominal pain 61/76 (80.3%), vomiting 57/73 (78.1%) and dyspnoea 20/64 (31.3%). mucosal bleeding was detected in 28/69 (40.6%) and petechiae in 51/63 (81%) and the tourniquet test was performed in 44% of patients, with 21.6% positivity (table i). among patients evaluated with at least two haematocrit counts, the lowest result showed a median value of 35.5% (15.4 - 45.6%) and the highest of 43.5% (30.3 - 57.5%). leukocyte count varied between 900 - 9,800/mm and platelet count showed a median of 18,000/mm (1,200 - 85,000) (table i). plasma leakage was identified in 31/75 (41.3%) patients, with cavity effusion in 16/31 (51.6%). a severe impairment of organs was reported in 24/83 (28.9%) cases, with an emphasis on cardiorespiratory changes present in 8/26 (30.8%) patients (table iv). a positive igm (mac - elisa) table iiicomparison between dengue haemorrhagic fever (dhf)/dengue shock syndrome (dss) classification adapted by brazilian ministry of health (2011) and the dhf / dss classification for reporting severe dengue (sd) cases during a dengue epidemic in northeastern brazil, 2011 nsd n (%) nsd with warning signs n (%) sd n (%) total n (%) df-1 (3.6)-1 (1.2)dwc3 (75)17 (60.7)32 (61.5)52 (61.9)dss----dhf1 (25)10 (35.7)20 (38.5)31 (36.9)total4 (100) (4.8 of total)28 (100) (33.3 of total)52 (100) (61.9 of total)84 (100) -df : dengue fever ; dwc : dengue with complications ; nsd : non - severe dengue. df : dengue fever ; dwc : dengue with complications ; nsd : non - severe dengue. table ivsevere clinical manifestations presents during a dengue epidemic in northeastern brazil, 2011severe clinical manifestationsvaluesdhf / dss n / total (%) dengue with warning signs n / total (%) sd n / total (%) dwc n / total (%) bleedingmild10/28 (35.7)11/28 (39.3)17/28 (60.7)18/28 (64.3)bleeding leukocytessevere7/21 (33.3)3/21 (14.3)18/21 (85.7)14/21 (66.7) 5,0007/14 (50)2/14 (14.3)12/14 (85.7)7/14 (50) 20,00018/47 (38.3)18/47 (38.3)26/47 (55.3)29/47 (61.7)platelets abdominal pain > 20,00013/37 (35.1)10/37 (27)26/37 (70.3)23/37 (62.2)-25/61 (41)20/61 (32.8)41/61 (67.2)35/61 (57.4)persistent vomiting-21/57 (36.8)18/57 (31.6)39/57 (68.4)36/57 (63.2)dizziness-15/47 (31.9)15/47 (31.9)31/47 (66)32/47 (68.1)gravity organ involvement-10/24 (41.7)-24/24 (100)14/24 (58.3) cardiac abnormality-5/8 (62.5)-8/8 (100)3/8 (68.1) shock-7/22 (31.8)-22/22 (100)15/22 (68.2) dyspnoea-9/20 (45)-20/20 (100)11/20 (55) cavitary effusions-8/16 (50)-16/16 (100)8/16 (50) admitted to treatment-20/61 (32.8)3/61 (4.9)58/61 (95.1)41/61 (67.2) ambulatory-8/23 (34.8)20/23 (87)3/23 (13)15/23 (65.2)dhf : dengue haemorrhagic fever ; dss : dengue shock syndrome ; dwc : dengue with complications ; sd : severe dengue. dhf : dengue haemorrhagic fever ; dss : dengue shock syndrome ; dwc : dengue with complications ; sd : severe dengue. considering the dhf / dss classification, which is still the current classification adopted in brazil, only 31 (36.9%) out of 84 cases reported as suspected dhf fulfilled all dhf criteria. the other 52 cases were classified as dwc, an exclusive category adopted in brazil for sd cases not enrolled as dhf / dss. all of the patients had fever, thrombocytopenia and laboratory confirmation of dengue infection, but 22/44 (54.5%) showed no plasma leakage and 19/52 (36.5%) showed no evidence of bleeding. the main severity criterion for 27/52 (51.9%) patients was platelet count < 20,000/mm. regarding the who classification of 2009, 52/84 cases were considered sd ; 31 (100%) had been previously classified as dhf and another 21 (40.4%) had been classified as dwc. the who classification of 2009 showed 60.4% sensitivity [confidence interval (ci) 95% 46.0 - 73.5 ] and 35.5% specificity (ci 95% 19.2 - 54.6) to capturing sd cases. it also showed a ppv of 61.5% (ci 95% 47.0 - 74.7) and a low npv of 34.4% (ci 95% 18.6 - 53.2) (table v). table vconcordance between dengue haemorrhagic fever (dhf)/dengue shock syndrome (dss) classification and who (2009) classification for reporting severe cases (sd) during a dengue epidemic in northeastern brazil, 20111997 classification2009 who classification totaldengue with / without warning signssd dengue fever213253dhf / dss112031 total325284negative predictive values : 34.4% [confidence interval (ci) 95% 18.6 - 53.2 ] ; positive predictive values : 61.5% (ci 95%, 47.0 - 74.7) ; sensitivity : 60.4% (ci 95%, 46.0 - 73.5) ; specificity : 35.5% (ci 95%, 19.2 - 54.6). negative predictive values : 34.4% [confidence interval (ci) 95% 18.6 - 53.2 ] ; positive predictive values : 61.5% (ci 95%, 47.0 - 74.7) ; sensitivity : 60.4% (ci 95%, 46.0 - 73.5) ; specificity : 35.5% (ci 95%, 19.2 - 54.6). in this study, we compared two classifications of dengue - the dhf / dss classification (and adapted by the ms) and the who classification of 2009 - through a retrospective analysis of cases diagnosed during the largest epidemic of dengue registered in ce. in the 1980s, a broad consensus emerged from dengue experts worldwide that the traditional df / dhf / dss classification was essentially retrospective and overly complex, limiting its usefulness for patient management and global surveillance (akbar. previous studies have addressed the difficulties in classifying dengue cases according to the dhf / dss classification (bandyopadhyay. 2011), but this is the first case series study evaluating the brazilian scenario for potentially sd cases. moreover, srikiatkhachorn. (2011) discuss the limitations of the who classification of 2009 because of its inclusion of a greater number of unspecific signs and symptoms and the difficulties associated with confirming the damage to organs in the absence of plasma leakage. considering the sd cases, the dhf / dss classification and the who classification of 2009 would have identified 31 (36.9%) and 52 (61.9%) cases, respectively. the who classification of 2009 showed a higher specificity in capturing the most sd cases, as found in taiwan (tsai. this specificity may help to improve the risk classification and the health care provided to patients upon first admission to health facilities. however, this classification system could lead to an overload in the health services network if the network is not well - prepared, as suggested by srikiatkhachorn. (, the who classification of 2009 could also serve as a stimulus for a reorganisation of health services, making them ready to intervene strategically and promptly for patients with warning signs and those already considered severe, as suggested by horstick. another relevant point of comparison is that the less rigid demand for laboratory criteria in the who classification of 2009 brings with it the possibility of concluding case reports in a timely manner by clinical and surveillance teams, bringing together experts and preventing discrepancies in clinical and epidemiological reports. an example of such a discrepancy was the creation, by the ms, of a new clinical category - dwc - to meet the request of clinicians who did not accept the fact that patients were dying of sd in brazil, without meeting any of the dhf criteria and had to be finally reported as having df. this unique inclusion of dwc is already widespread in the service routine and epidemiological surveillance in brazil, which is currently responsible for 60% of df cases worldwide (teixeira 2009). this situation impairs the ability to compare dengue cases with any other country that uses the dhf / dss classification. in 2011, ce reported the largest dengue outbreak in its history, with 457 dwc cases and a fatality rate exceeding 10%, higher than the estimated rate for dhf cases (7.5%). this fatality rate suggests that more sd were escaping dhf / dss classification and these deaths would most likely not be accounted for in the official statistics, as they did not fit as dhf or dss. considering this aspect, less than 40% of these cases would have been classified as severe. the revised case classification, with its simplified structure, will facilitate effective screening, risk classification and patient management and improve comparative analyses of surveillance data from different countries (basuki. the most severe manifestations of dengue, such as severe haemorrhage, severe leukopenia, thrombocytopenia, severe shock, effusions and severe organ involvement, were more frequently found in cases of sd compared to cases of dhf, indicating a greater sensitivity in the identification of cases that are more severe. in the dhf / dss classification (1997), among the 84 suspected cases, moreover, the tourniquet test, which is considered a good predictor of risk (kalayanarooj. 1999), was only used in 44% of patients, with very low positivity (21.6%). research carried out in nicaragua (balmaseda. 2005) noted difficulties in detecting patients with these severe manifestations, especially in adults ; this challenge was confirmed by our findings, most likely due to an underreporting of medical evaluation in hospital files / charts. defining the plasma leakage is another great difficulty in dengue patients. in most cases, this same difficulty was observed in another dengue epidemic in brazil in 2008, where 53.8% of patients with sd did not meet the haemoconcentration criteria and were not classified as dhf (gupta. the identification of effusions through x - ray or ultrasonography assessment is rarely available in current practice and could be costly in public health settings (cavalcanti. gupta. (2010) also highlighted the difficulty in diagnosing signs of plasma extravasation using research methods that can be costly. the revised who classification of 2009 for sd appears to have higher sensitivity (60.4%), although it is no longer more specific (35.5%) than the dhf / dss classification. these data are similar to recent reports from nicaragua (narvaez. 2011, gutirrez. 2013) and are the first evidence from brazil. however, the diversity of criteria used to define severity among the studies may explain the differences in sensitivity and specificity. the absence of a gold standard with which to compare these classifications requires caution when evaluating this information. in our experience thus far, the 2009 who classification has been more sensitive in detecting and more helpful for reporting sd cases in this epidemic. this classification made it feasible to classify a greater number of sd cases, which could contribute to a better and timelier management of patients and thus avoid or decrease fatalities. improvements in early diagnosis and risk prediction for severe disease are undoubtedly needed and research efforts in this area are on - going. however, the use of secondary data, even with research records and medical records, poses limitations to the quality and external validity of our data. prospective studies are needed to better define the warning signs and to evaluate the benefits of the new classification in different settings. | in 2009, the world health organization (who) issued a new guideline that stratifies dengue - affected patients into severe (sd) and non - severe dengue (nsd) (with or without warning signs). to evaluate the new recommendations, we completed a retrospective cross - sectional study of the dengue haemorrhagic fever (dhf) cases reported during an outbreak in 2011 in northeastern brazil. we investigated 84 suspected dhf patients, including 45 (53.6%) males and 39 (46.4%) females. the ages of the patients ranged from five-83 years and the median age was 29. according to the dhf / dengue shock syndrome classification, 53 (63.1%) patients were classified as having dengue fever and 31 (36.9%) as having dhf. according to the 2009 who classification, 32 (38.1%) patients were grouped as having nsd [4 (4.8%) without warning signs and 28 (33.3%) with warning signs ] and 52 (61.9%) as having sd. a better performance of the revised classification in the detection of severe clinical manifestations allows for an improved detection of patients with sd and may reduce deaths. the revised classification will not only facilitate effective screening and patient management, but will also enable the collection of standardised surveillance data for future epidemiological and clinical studies. |
congenital rch, also called longitudinal radial deficiency or radial dysplasia, is an uncommon congenital anomaly characterized by various degrees of deficiency along the preaxial or radial side of the extremity (1). the incidence of rch is estimated to be 1 in 30,000 to 1 in 100,000 live births (2). bayne and klug classified radial deficiency into four types (3) : type i : mildest form with defective distal radial epiphysis. minor radial deviation of the hand is apparent, although considerable thumb hypoplasia may be evident. type ii : involves limited growth of the radius on both its distal and proximal sides and characterized by a miniature radius and moderate radial deviation of the wrist. type iii : absence of two - thirds of the radius, most commonly the distal side and severe radial deviation of the wrist. type iv : this type of rch is the most common and most severe and involves complete absence of the radius. minor radial deviation of the hand is apparent, although considerable thumb hypoplasia may be evident. type ii : involves limited growth of the radius on both its distal and proximal sides and characterized by a miniature radius and moderate radial deviation of the wrist. type iii : absence of two - thirds of the radius, most commonly the distal side and severe radial deviation of the wrist. type iv : this type of rch is the most common and most severe and involves complete absence of the radius. about 40% of patients with unilateral club hand and 27% with bilateral club hand have associated congenital anomalies involving cardiac, genitourinary, skeletal, and hematopoietic system (4). the prominent syndromes associated with rch include : holt - oram syndrome ; thrombocytopenia - absent radius (tar) syndrome ; vertebral, anal, cardiac, tracheal, esophageal, renal, and limb (vacterl) syndrome ; and fanconi anemia. the latter is a serious associated condition which usually manifests as aplastic anemia between 3 and 12 years of age. correction of rch requires a combination of non - operative and operative management that should start immediately after diagnosis. the basic goals of correction include correction of radial deviation of wrist, balancing the wrist on forearm, maintenance of wrist and finger flexion, promotion of growth of the forearm, and improving the cosmetic appearance of the limb (5). the non - operative management comprises of stretching of the taut radial structures by physiotherapy and splintage (6). some centers utilize the appliances based on principles of distraction osteogenesis (ilazarov technique) to decrease the magnitude of contracture before definitive surgery (7). the cases of rch need to be kept under follow - up upto adulthood to prevent the recurrence of the deformity (5), and monitor the function of the affected limb and undertake corrective operative and non - operative interventions as warranted. the authors have not received any funding or benefits from industry to conduct this study. | congenital radial club hand (rch) is an uncommon congenital anomaly characterized by various degrees of deficiency along the preaxial or radial side of the extremity. we present one such case of type 4 congenital isolated rch who presented to a tertiary care center in the middle east. |
the ethics of experimentation involving patients is least troubling when participation in the research offers the best prospects for the subjects ' future well - being of all available options. favourable risk - benefit ratio does not obviate the need for informed consent, but this is ordinarily forthcoming once the prospective subject understands what is on offer. but must an experiment offer patients their best prospect for healthy recovery, in order to be ethically justified ? indeed, might some studies offer greater prospect of harm than benefit, and still be judged ethically sound ? and if an experiment is to be performed not on patients but on healthy volunteers, must any risks be more than offset by prospective benefits to these subjects, in order to be ethically permissible ? the answers to these questions are almost certainly and unequivocally no. experiments on patients and on healthy volunteers alike may be ethically justified even when the subjects would be likely to fare better by declining to participate, either to choose other options (eg, treatment) or simply to do nothing. nor is this in any way a secret in the research ethics literature or in government or professional regulations and guidelines. if this conclusion is both well established and widely and officially recognised, why is it worth devoting an essay to its defence ? the answer is that the contrary thesis that only research that offers better chances for gain than harm can be judged ethically sound seems to be widely believed. several provisions of the world medical association 's (wma) declaration of helsinki, the most influential international research ethics guidelines, seems to support this view.1 principle 3 states that the declaration of geneva of the wma binds the physician with the words, the health of my patient will be my first consideration, and the international code of medical ethics declares that, a physician shall act in the patient s best interest when providing medical care. principle 8 holds that while the primary purpose of medical research is to generate new knowledge, this goal can never take precedence over the rights and interests of individual research subjects. although other provisions seem clearly to envision the possibility that subjects in some experiments might stand to lose more than they might hope to gain, principles 3 and 8 are stated unequivocally. it is no coincidence that ethical review committees (irbs, in the usa) are often called committee for the protection of human subjects, even though for research that offers, in prospect, more likelihood of burden than benefit, the way to protect prospective human subjects would be to convince them not to enrol. much of the discussion about risks and benefits is concerned with elaborating our duties to human subjects and with minimising the risks. the possibility of ethically sound research that offers greater prospect of harm than benefit may be acknowledged, but is rarely emphasised or is even buried. nevertheless, ethical review committees (some, if not most) do permit investigators to recruit patients and healthy volunteers for experiments that do not offer a moreover, this action is fully compliant with the research ethics guidelines, which most committees cite as sources of guidance. in this brief paper, i can not attempt an ethical justification of these judgements (though i do endorse them). this phrase, which i have placed between quotation marks in the preceding, is reasonably clear, but some elaboration will be useful if we wish to focus on possible differences in ethical principle rather than semantics. for example, the phrase favourable risk - benefit ratio is ambiguous between two distinct ratios. it is often used in reference to the prospects of gain and loss for the individual participant. in other contexts, however, the ratio in question may be that between the prospective burdens for the individual subject and the sum of two sources of benefit : those accruing to the individual subject and those enjoyed by individuals in the future who may benefit from the application of any knowledge gained as a result of the experiment. ambiguity presents little problem so long as their meaning is made clear by the context of use, but in this case it may be a source of confusion. consider two opposing points of view, one insisting that experiments can never be justified unless human subjects stand to gain at least as much as they stand to lose, the other open to the possibility of endorsing an experiment whose subjects stand to lose more than they stand to gain, so long as the experiment has a reasonable chance of offering significant benefits to others by advancing knowledge that might be used to relieve suffering. both sides can (and do) say that experiments with human subjects are justified only if they offer a favourable risk - benefit ratio. nevertheless, the appearance of agreement on this point is purely verbal. the risk - benefit ratio to which the italicised phrase refers when endorsed by the first of these opposing viewpoints includes benefits to the human subjects only, and excludes any benefits that might accrue to patients and others in the future as a result of applications of the knowledge gained in the experiment. the ratio referred to by adherents of the second viewpoint is a different ratio, because it includes those potential benefits (if any) to people in the future, resulting from the application of knowledge gained in the experiment. thus, it is possible that an adherent of the first of these viewpoints would assume that a guideline or rule that includes the italicised phrase would endorse their viewpoint ; but this would be completely erroneous if the guideline or rule was referring to the second, wider ratio. benefit are less clear than they might be. if understood literally, they are odd choices for calculating an ethically relevant ratio, since the former involves probability as well as magnitude (of potential burden), while word, we no doubt understand that this is a faon de parler and that what is literally meant is ex ante net benefit or ex ante net harm, that is, something like the sum of the products of each possible burden (worse health ; injury, duress, indignity ; anxiety ; investment of time, etc, each measured by some common denominator of burden or loss) multiplied by the probability of their occurrence, compared with a similar sum for prospective benefits. we focus on ex ante burden and benefit, of course, because ethical approval of the research begins before the experiment is initiated. ethical review committees may insist on a ceiling or threshold limiting prospective harm in some cases (eg, where the likelihood of moderate benefit is high, so that the ratio is positive, but where the human subject might suffer catastrophic harm or loss of life if things go badly). those benefits that do not accrue to the individual subjects are often referred to as value to society, or gain in scientific knowledge. the use of these terms, when used in efforts to judge whether the burden (if any) on human subjects is justified in view of the likely outcomes, has two drawbacks. first, each is so broad that it is difficult even to imagine how to estimate their magnitude for an experiment under ethical review. second, they include (if understood literally) outcomes that would not ordinarily be considered relevant in judging the ethics of an experiment with human subjects. a given experiment might, for example, have value to society if they provided jobs, or if the profits that would accrue to a sponsoring pharmaceutical firm proved to be an economic stimulant, but these kinds of gains are rarely if ever cited as justifying the exposure of human subjects to net ex ante harm or burden (ie, the prospect of harm or burden that would exceed any anticipated gain to the individual subject). similarly, it is difficult to imagine an ethical review committee approving such an experiment if the gain in scientific knowledge were, say, a significant step toward constructing a proof of a theorem in pure mathematics that would have no useful application or other benefits to society, so far as this can be estimated. for these reasons, our discussion of whether value to society and/or gain in scientific knowledge can justify experiments that fail to offer a favourable risk - benefit ratio to individual human subjects may be more tractable, if we focus our attention on that which is of value to society that may result from the possible gains in scientific knowledge if the study is conducted. although there are some possible exceptions, the outcome in question is the potential protection from suffering (or the enhancement of well - being) that might be possible for individuals in the future as a result of the application of the scientific knowledge gained by doing the experiment, if there is any. apples versus apples ethical judgement (well - being of research subjects vs well - being of future beneficiaries of research), which the frequently used terms value to society and gains to scientific knowledge do not. this refinement of terms, of course, does not in itself tell us what net risk to subjects might be justified by a specified amount of benefit to others in the future. that is an ethical judgement that the members of the ethical review committee are asked to undertake. i have used the term burden as the catch - all category for adverse outcomes of participation in experiments. as noted, this permits us to compare like with like when it is used in place of risk. it also enables us to take into account a broader range of adverse outcomes, such as reduced privacy or security, than does the more common term harm, which is one kind of burden but is not the principal concern in many experiments. here are examples of experiments with human subjects that do not offer an ex ante net benefit and which are routinely (and appropriately) approved by ethical review committees at institutes and schools of medicine and public health : basic research that involves risks of burden but no anticipated benefit to subjects.2 for example, a study of the mechanisms of perception of pain in the hand required subjects to submit to a series of painful stimuli, including moderate electric shocks and placement of hands in very cold water, while wearing an uncomfortable monitoring device. care was taken to avoid enrolling subjects who may perceive, rightly or wrongly, that their supervisors would be displeased unless they participated.phase i drug testing, in which promising compounds are injected into human volunteers to determine their safety and tolerability. though the chance of dramatic improvement for participants in these trials can not be ruled out, these are so unlikely that standard practice in many institutions is to state flatly that participation in these trials will offer no benefit to prospective subjects.so-called challenge trials in infectious - diseases research, in which healthy volunteers contract infectious diseases so that scientists can investigate the mechanisms of infection and the early stages of the diseases. for example, volunteers have been asked to place their arms in a chamber filled with mosquitoes that transmit malaria. in most cases, infected volunteers are treated for the disease before it becomes intolerable or inflicts lasting damage, but subjects in many of these trials are cautioned to expect substantial discomfort and pain.3placebo - controlled trials of surgical techniques that require sham surgery, in which invasive procedures that have no anticipated benefit are conducted on controls so that none of the subjects knows whether the procedure under study was performed on them. in some instances, patients who might be candidates for the experimental procedure are stable, and thus have the option of waiting until the trial is performed on others before deciding whether to agree to have the procedure performed on them (as a clinical procedure rather than within a randomised study) ; and in some of these cases, patients also have the option of engaging surgeons who will perform the procedure immediately (again, as a clinical procedure rather than within a randomised study). in such cases, there is little or no personal gain for those who volunteer to accept the 50% chance of having sham surgery practiced on them. they might gain from the knowledge produced by the experiment (eg, that the procedure in question is efficacious, or is not), but this knowledge would likewise be available to them if they stood aside, while others stepped forward as volunteers.4 5 basic research that involves risks of burden but no anticipated benefit to subjects.2 for example, a study of the mechanisms of perception of pain in the hand required subjects to submit to a series of painful stimuli, including moderate electric shocks and placement of hands in very cold water, while wearing an uncomfortable monitoring device. care was taken to avoid enrolling subjects who may perceive, rightly or wrongly, that their supervisors would be displeased unless they participated. phase i drug testing, in which promising compounds are injected into human volunteers to determine their safety and tolerability. though the chance of dramatic improvement for participants in these trials can not be ruled out, these are so unlikely that standard practice in many institutions is to state flatly that participation in these trials will offer no benefit to prospective subjects. so - called challenge trials in infectious - diseases research, in which healthy volunteers contract infectious diseases so that scientists can investigate the mechanisms of infection and the early stages of the diseases. for example, volunteers have been asked to place their arms in a chamber filled with mosquitoes that transmit malaria. in most cases, infected volunteers are treated for the disease before it becomes intolerable or inflicts lasting damage, but subjects in many of these trials are cautioned to expect substantial discomfort and pain.3 placebo - controlled trials of surgical techniques that require sham surgery, in which invasive procedures that have no anticipated benefit are conducted on controls so that none of the subjects knows whether the procedure under study was performed on them. in some instances, patients who might be candidates for the experimental procedure are stable, and thus have the option of waiting until the trial is performed on others before deciding whether to agree to have the procedure performed on them (as a clinical procedure rather than within a randomised study) ; and in some of these cases, patients also have the option of engaging surgeons who will perform the procedure immediately (again, as a clinical procedure rather than within a randomised study). in such cases, there is little or no personal gain for those who volunteer to accept the 50% chance of having sham surgery practiced on them. they might gain from the knowledge produced by the experiment (eg, that the procedure in question is efficacious, or is not), but this knowledge would likewise be available to them if they stood aside, while others stepped forward as volunteers.4 5 pointing out that we routinely permit studies like these to proceed does not suffice to show that they are ethically justified, and some notable contributors to the literature on research ethics, most prominently hans jonas,3 6 have offered powerful arguments for restrictions on such experiments that might preclude some or all of these examples. common rule (45cfr46), a regulation applying to all agencies of the us government and their grantees. risks to subjects are minimised : by using procedures which are consistent with sound research design and which do not unnecessarily expose subjects to risk, andwhenever appropriate, by using procedures already being performed on the subjects for diagnostic or treatment purposes.2. risks to subjects are reasonable in relation to anticipated benefits, if any, to subjects, and the importance of the knowledge that may reasonably be expected to result. in evaluating risks and benefits, the irb should consider only those risks and benefits that may result from the research (as distinguished from risks and benefits of therapies subjects would receive even if not participating in the research).the irb should not consider possible long - range effects of applying knowledge gained in the research (eg, the possible effects of the research on public policy) as among those research risks that fall within the purview of its responsibility risks to subjects are minimised : by using procedures which are consistent with sound research design and which do not unnecessarily expose subjects to risk, and whenever appropriate, by using procedures already being performed on the subjects for diagnostic or treatment purposes. risks to subjects are reasonable in relation to anticipated benefits, if any, to subjects, and the importance of the knowledge that may reasonably be expected to result. in evaluating risks and benefits, the irb should consider only those risks and benefits that may result from the research (as distinguished from risks and benefits of therapies subjects would receive even if not participating in the research).the irb should not consider possible long - range effects of applying knowledge gained in the research (eg, the possible effects of the research on public policy) as among those research risks that fall within the purview of its responsibility. in evaluating risks and benefits, the irb should consider only those risks and benefits that may result from the research (as distinguished from risks and benefits of therapies subjects would receive even if not participating in the research). the irb should not consider possible long - range effects of applying knowledge gained in the research (eg, the possible effects of the research on public policy) as among those research risks that fall within the purview of its responsibility. and that occurs in clause (2) : benefits to the individual subject are only part of what should be taken into account in ethical review of proposed research. it is noteworthy that this key regulation permits prospective benefits to future individuals to be placed on the ethical balance scale ; this is encouraged or even required. the apparently widespread misconception that the regulation requires a favourable risk - benefit ratio for the individual participant is thus a bit of a puzzle. the preceding discussion has been framed in terms of the expectations by the investigators of the prospects for benefit and for harm and other burdens for research subjects. but prospective subjects may see things differently. this may be the case with research seeking a cure or long - term antiretroviral - free remission for hiv / aids. treatment for this condition has advanced so far that hiv - infected individuals can anticipate a normal lifespan, and the side effects of treatment, while not negligible, are judged by most patients to be tolerable. aids cure experiments might expose the subjects to a non - trivial risk of death in exchange for an uncertain chance of becoming permanently hiv negative. now that the latter offers little improved chance of survival, it is remarkable that eager volunteers are plentiful. perhaps they perceive a value in being hiv - free something apart from its survival value that the investigators should count as a benefit that belongs on the risk - benefit ethical balancing scale. perhaps they are motivated by altruism. or perhaps they are simply making unsound judgements about what would be in their interests. would the ethics of an hiv / aids cure experiment depend how we explain the apparent enthusiasm of some research subjects for an aids cure experiment that the researchers view as offering greater net harm (including a chance of premature death) than net benefit ? scientists and ethical review committees might be unfriendly to a proposed experiment if the most likely explanation for the willingness of some patients to volunteer was that their judgement was unsound. this might be the result, for example, if despite elaborate efforts to educate potential subjects, not limited to the consent form patient volunteers continued to harbour false or magical beliefs about the potential benefits to them of the experimental procedure or drug. the same might be true if the potential recruits who were willing to volunteer seemed desperate or suffering from great shame. these cases would present an unenviable dilemma to scientists and to ethical review committees, if the experiments might yield valuable evidence that would point the way towards a cure for hiv / aids, but where these potential subjects were willing and eager to participate, and met the usual criteria for mental competence. the scientists and ethical review committees might correctly believe that if they approve the studies, critics would be unable to point to any clear violation of ethical rules. yet they and their critics might be concerned that they were able to proceed with the experiments only by exploiting these patients ' desperation or shame. this ethical issue in hiv / aids cure research may be acute and troubling, but it is not unique. those who volunteer for phase i research, for infectious - diseases challenge trials, and for placebo - controlled surgical trials involving sham surgery always have their own reasons. these may be difficult to understand, particularly for those who believe that science has proved that we always act in our perceived self - interest., it is perfectly appropriate to enrol subjects in many of these trials who are motivated by altruism, fairness or reciprocity, but this paper is not the occasion for arguing this point. this paper is addressed to those who may object to hiv / aids cure research on the grounds that these trials may not offer a that objection may be based on an erroneous assumption about research ethics, one that i have sought to identify and refute. this phrase, which i have placed between quotation marks in the preceding, is reasonably clear, but some elaboration will be useful if we wish to focus on possible differences in ethical principle rather than semantics. for example, the phrase favourable risk - benefit ratio is ambiguous between two distinct ratios. it is often used in reference to the prospects of gain and loss for the individual participant. in other contexts, however, the ratio in question may be that between the prospective burdens for the individual subject and the sum of two sources of benefit : those accruing to the individual subject and those enjoyed by individuals in the future who may benefit from the application of any knowledge gained as a result of the experiment. ambiguity presents little problem so long as their meaning is made clear by the context of use, but in this case it may be a source of confusion. consider two opposing points of view, one insisting that experiments can never be justified unless human subjects stand to gain at least as much as they stand to lose, the other open to the possibility of endorsing an experiment whose subjects stand to lose more than they stand to gain, so long as the experiment has a reasonable chance of offering significant benefits to others by advancing knowledge that might be used to relieve suffering. both sides can (and do) say that experiments with human subjects are justified only if they offer a favourable risk - benefit ratio. nevertheless, the appearance of agreement on this point is purely verbal. the risk - benefit ratio to which the italicised phrase refers when endorsed by the first of these opposing viewpoints includes benefits to the human subjects only, and excludes any benefits that might accrue to patients and others in the future as a result of applications of the knowledge gained in the experiment. the ratio referred to by adherents of the second viewpoint is a different ratio, because it includes those potential benefits (if any) to people in the future, resulting from the application of knowledge gained in the experiment. thus, it is possible that an adherent of the first of these viewpoints would assume that a guideline or rule that includes the italicised phrase would endorse their viewpoint ; but this would be completely erroneous if the guideline or rule was referring to the second, wider ratio. the terms risk and benefit are less clear than they might be. if understood literally, they are odd choices for calculating an ethically relevant ratio, since the former involves probability as well as magnitude (of potential burden), while word, we no doubt understand that this is a faon de parler and that what is literally meant is ex ante net benefit or ex ante net harm, that is, something like the sum of the products of each possible burden (worse health ; injury, duress, indignity ; anxiety ; investment of time, etc, each measured by some common denominator of burden or loss) multiplied by the probability of their occurrence, compared with a similar sum for prospective benefits. we focus on ex ante burden and benefit, of course, because ethical approval of the research begins before the experiment is initiated. ethical review committees may insist on a ceiling or threshold limiting prospective harm in some cases (eg, where the likelihood of moderate benefit is high, so that the ratio is positive, but where the human subject might suffer catastrophic harm or loss of life if things go badly). those benefits that do not accrue to the individual subjects are often referred to as value to society, or gain in scientific knowledge. the use of these terms, when used in efforts to judge whether the burden (if any) on human subjects is justified in view of the likely outcomes, has two drawbacks. first, each is so broad that it is difficult even to imagine how to estimate their magnitude for an experiment under ethical review. second, they include (if understood literally) outcomes that would not ordinarily be considered relevant in judging the ethics of an experiment with human subjects. a given experiment might, for example, have value to society if they provided jobs, or if the profits that would accrue to a sponsoring pharmaceutical firm proved to be an economic stimulant, but these kinds of gains are rarely if ever cited as justifying the exposure of human subjects to net ex ante harm or burden (ie, the prospect of harm or burden that would exceed any anticipated gain to the individual subject). similarly, it is difficult to imagine an ethical review committee approving such an experiment if the gain in scientific knowledge were, say, a significant step toward constructing a proof of a theorem in pure mathematics that would have no useful application or other benefits to society, so far as this can be estimated. for these reasons, our discussion of whether value to society and/or gain in scientific knowledge can justify experiments that fail to offer a favourable risk - benefit ratio to individual human subjects may be more tractable, if we focus our attention on that which is of value to society that may result from the possible gains in scientific knowledge if the study is conducted. although there are some possible exceptions, the outcome in question is the potential protection from suffering (or the enhancement of well - being) that might be possible for individuals in the future as a result of the application of the scientific knowledge gained by doing the experiment, if there is any. apples versus apples ethical judgement (well - being of research subjects vs well - being of future beneficiaries of research), which the frequently used terms value to society and gains to scientific knowledge do not. this refinement of terms, of course, does not in itself tell us what net risk to subjects might be justified by a specified amount of benefit to others in the future. that is an ethical judgement that the members of the ethical review committee are asked to undertake. i have used the term burden as the catch - all category for adverse outcomes of participation in experiments. as noted, this permits us to compare like with like when it is used in place of risk. it also enables us to take into account a broader range of adverse outcomes, such as reduced privacy or security, than does the more common term harm, which is one kind of burden but is not the principal concern in many experiments. here are examples of experiments with human subjects that do not offer an ex ante net benefit and which are routinely (and appropriately) approved by ethical review committees at institutes and schools of medicine and public health : basic research that involves risks of burden but no anticipated benefit to subjects.2 for example, a study of the mechanisms of perception of pain in the hand required subjects to submit to a series of painful stimuli, including moderate electric shocks and placement of hands in very cold water, while wearing an uncomfortable monitoring device. care was taken to avoid enrolling subjects who may perceive, rightly or wrongly, that their supervisors would be displeased unless they participated.phase i drug testing, in which promising compounds are injected into human volunteers to determine their safety and tolerability. though the chance of dramatic improvement for participants in these trials can not be ruled out, these are so unlikely that standard practice in many institutions is to state flatly that participation in these trials will offer no benefit to prospective subjects.so-called challenge trials in infectious - diseases research, in which healthy volunteers contract infectious diseases so that scientists can investigate the mechanisms of infection and the early stages of the diseases. for example, volunteers have been asked to place their arms in a chamber filled with mosquitoes that transmit malaria. in most cases, infected volunteers are treated for the disease before it becomes intolerable or inflicts lasting damage, but subjects in many of these trials are cautioned to expect substantial discomfort and pain.3placebo - controlled trials of surgical techniques that require sham surgery, in which invasive procedures that have no anticipated benefit are conducted on controls so that none of the subjects knows whether the procedure under study was performed on them. in some instances, patients who might be candidates for the experimental procedure are stable, and thus have the option of waiting until the trial is performed on others before deciding whether to agree to have the procedure performed on them (as a clinical procedure rather than within a randomised study) ; and in some of these cases, patients also have the option of engaging surgeons who will perform the procedure immediately (again, as a clinical procedure rather than within a randomised study). in such cases, there is little or no personal gain for those who volunteer to accept the 50% chance of having sham surgery practiced on them. they might gain from the knowledge produced by the experiment (eg, that the procedure in question is efficacious, or is not), but this knowledge would likewise be available to them if they stood aside, while others stepped forward as volunteers.4 5 basic research that involves risks of burden but no anticipated benefit to subjects.2 for example, a study of the mechanisms of perception of pain in the hand required subjects to submit to a series of painful stimuli, including moderate electric shocks and placement of hands in very cold water, while wearing an uncomfortable monitoring device. care was taken to avoid enrolling subjects who may perceive, rightly or wrongly, that their supervisors would be displeased unless they participated. phase i drug testing, in which promising compounds are injected into human volunteers to determine their safety and tolerability. though the chance of dramatic improvement for participants in these trials can not be ruled out, these are so unlikely that standard practice in many institutions is to state flatly that participation in these trials will offer no benefit to prospective subjects. so - called challenge trials in infectious - diseases research, in which healthy volunteers contract infectious diseases so that scientists can investigate the mechanisms of infection and the early stages of the diseases. for example, volunteers have been asked to place their arms in a chamber filled with mosquitoes that transmit malaria. in most cases, infected volunteers are treated for the disease before it becomes intolerable or inflicts lasting damage, but subjects in many of these trials are cautioned to expect substantial discomfort and pain.3 placebo - controlled trials of surgical techniques that require sham surgery, in which invasive procedures that have no anticipated benefit are conducted on controls so that none of the subjects knows whether the procedure under study was performed on them. in some instances, patients who might be candidates for the experimental procedure are stable, and thus have the option of waiting until the trial is performed on others before deciding whether to agree to have the procedure performed on them (as a clinical procedure rather than within a randomised study) ; and in some of these cases, patients also have the option of engaging surgeons who will perform the procedure immediately (again, as a clinical procedure rather than within a randomised study). in such cases, there is little or no personal gain for those who volunteer to accept the 50% chance of having sham surgery practiced on them. they might gain from the knowledge produced by the experiment (eg, that the procedure in question is efficacious, or is not), but this knowledge would likewise be available to them if they stood aside, while others stepped forward as volunteers.4 5 pointing out that we routinely permit studies like these to proceed does not suffice to show that they are ethically justified, and some notable contributors to the literature on research ethics, most prominently hans jonas,3 6 have offered powerful arguments for restrictions on such experiments that might preclude some or all of these examples. common rule (45cfr46), a regulation applying to all agencies of the us government and their grantees. risks to subjects are minimised : by using procedures which are consistent with sound research design and which do not unnecessarily expose subjects to risk, andwhenever appropriate, by using procedures already being performed on the subjects for diagnostic or treatment purposes.2. risks to subjects are reasonable in relation to anticipated benefits, if any, to subjects, and the importance of the knowledge that may reasonably be expected to result. in evaluating risks and benefits, the irb should consider only those risks and benefits that may result from the research (as distinguished from risks and benefits of therapies subjects would receive even if not participating in the research).the irb should not consider possible long - range effects of applying knowledge gained in the research (eg, the possible effects of the research on public policy) as among those research risks that fall within the purview of its responsibility. risks to subjects are minimised : by using procedures which are consistent with sound research design and which do not unnecessarily expose subjects to risk, and whenever appropriate, by using procedures already being performed on the subjects for diagnostic or treatment purposes. risks to subjects are reasonable in relation to anticipated benefits, if any, to subjects, and the importance of the knowledge that may reasonably be expected to result. in evaluating risks and benefits, the irb should consider only those risks and benefits that may result from the research (as distinguished from risks and benefits of therapies subjects would receive even if not participating in the research).the irb should not consider possible long - range effects of applying knowledge gained in the research (eg, the possible effects of the research on public policy) as among those research risks that fall within the purview of its responsibility. in evaluating risks and benefits, the irb should consider only those risks and benefits that may result from the research (as distinguished from risks and benefits of therapies subjects would receive even if not participating in the research). the irb should not consider possible long - range effects of applying knowledge gained in the research (eg, the possible effects of the research on public policy) as among those research risks that fall within the purview of its responsibility. and that occurs in clause (2) : benefits to the individual subject are only part of what should be taken into account in ethical review of proposed research. it is noteworthy that this key regulation permits prospective benefits to future individuals to be placed on the ethical balance scale ; this is encouraged or even required. the apparently widespread misconception that the regulation requires a favourable risk - benefit ratio for the individual participant is thus a bit of a puzzle. the preceding discussion has been framed in terms of the expectations by the investigators of the prospects for benefit and for harm and other burdens for research subjects. but prospective subjects may see things differently. this may be the case with research seeking a cure or long - term antiretroviral - free remission for hiv / aids. treatment for this condition has advanced so far that hiv - infected individuals can anticipate a normal lifespan, and the side effects of treatment, while not negligible, are judged by most patients to be tolerable. aids cure experiments might expose the subjects to a non - trivial risk of death in exchange for an uncertain chance of becoming permanently hiv negative. now that the latter offers little improved chance of survival, it is remarkable that eager volunteers are plentiful. perhaps they perceive a value in being hiv - free something apart from its survival value that the investigators should count as a benefit that belongs on the risk - benefit ethical balancing scale. perhaps they are motivated by altruism. or perhaps they are simply making unsound judgements about what would be in their interests. would the ethics of an hiv / aids cure experiment depend how we explain the apparent enthusiasm of some research subjects for an aids cure experiment that the researchers view as offering greater net harm (including a chance of premature death) than net benefit ? scientists and ethical review committees might be unfriendly to a proposed experiment if the most likely explanation for the willingness of some patients to volunteer was that their judgement was unsound. this might be the result, for example, if despite elaborate efforts to educate potential subjects, not limited to the consent form patient volunteers continued to harbour false or magical beliefs about the potential benefits to them of the experimental procedure or drug. the same might be true if the potential recruits who were willing to volunteer seemed desperate or suffering from great shame. these cases would present an unenviable dilemma to scientists and to ethical review committees, if the experiments might yield valuable evidence that would point the way towards a cure for hiv / aids, but where these potential subjects were willing and eager to participate, and met the usual criteria for mental competence. the scientists and ethical review committees might correctly believe that if they approve the studies, critics would be unable to point to any clear violation of ethical rules. yet they and their critics might be concerned that they were able to proceed with the experiments only by exploiting these patients ' desperation or shame. this ethical issue in hiv / aids cure research may be acute and troubling, but it is not unique. those who volunteer for phase i research, for infectious - diseases challenge trials, and for placebo - controlled surgical trials involving sham surgery always have their own reasons. these may be difficult to understand, particularly for those who believe that science has proved that we always act in our perceived self - interest., it is perfectly appropriate to enrol subjects in many of these trials who are motivated by altruism, fairness or reciprocity, but this paper is not the occasion for arguing this point. this paper is addressed to those who may object to hiv / aids cure research on the grounds that these trials may not offer a that objection may be based on an erroneous assumption about research ethics, one that i have sought to identify and refute. it is entirely understandable and commendable that investigators pause for a long and careful re - thinking of the ethics of aids cure research before taking the expedient option of accepting the prospective subjects ' informed consent, that is, their agreement, following extensive education on risks and benefits, to become subjects in the experiments. the physician - scientists do not want to take advantage of a person 's ill - considered enthusiasm for a course of action that may not, all things considered, be prudent especially (but not exclusively) if the most plausible account of the patient 's choice is that the patient mistakenly does believe that participation would be prudent. whether to accept a given individual 's consent and to enrol that individual in the experiment in such cases is an ethically difficult decision that this paper does not attempt to resolve. but it would be useful if those trying to reason their way through this ethical dilemma do not labour under the misunderstanding that approved research practices (in the usa) require that the risk - benefit ratio for research subjects be favourable based on risks and benefits to the participant alone. they need not be., those engaged in an ethical evaluation of a proposed trial of a possible cure for hiv / aids must carefully estimate a participant 's prospective benefits and also the participant 's prospects for harm or burden. if the subject stands to gain more than lose, the trial will be easier to justify. favourable - risk - benefit ratio for the individual research subject, however desirable, is not an absolute ethical requirement. | must medical experiments with human subjects offer them a favourable risk - benefit ratio, that is, more expectation of benefit than harm or burden, if they are to be judged as ethically justified ? ethical justification is easier for experiments that do offer net benefit to subjects, but ethical justification is possible also for some experiments that do not. basic science experiments with healthy volunteers and phase i drug trials that seek to determine tolerable dosage levels are routinely approved by ethical review committees ; moreover, guidance they receive from government funding agencies specifically asks them to weigh risks to subjects against benefits to subjects and also benefits to those who may benefit from the knowledge gained in the experiment. if a puzzle remains, it is why there remains any assumption that research ethics requires a favourable risk - benefit ratio for the individual research subject. |
epilepsy is one of the most prevalent serious chronic neurological disorders, effecting approximately 12 % of the population. about 30 % of patients with epilepsy do not respond to any of two to three first line antiepileptic drugs (aeds) despite considerable advances in the therapy of epilepsy and these patients will develop refractory epilepsy. although efforts to predict pharmacoresistance have revealed several risk factors (an early onset of epilepsy, symptomatic or cryptogenic epilepsy, and generalized seizure) [3, 4 ], the mechanisms underlying the resistance to aeds in the epilepsy treatment are still not well - understood. there is accumulating evidence to suggest that an increase of functional expression of multidrug transporters produces pharmacokinetic changes that modify the access of aeds to central nervous system targets. these genetic variations could be linked to changes on pharmacokinetic or pharmacodynamic of aeds and effective responsiveness to aeds. the atp - binding cassette (abc) transporters, and especially abcb1, are the focus of an international effort to establish their role in mediating drug resistance in a variety of human diseases including epilepsy. human multidrug resistant transporter gene (mdr1, also known as abcb1), which is a member of the abc superfamily, encodes a 170-kda p - glycoprotein (p - gp). the p - gp is of particular interest, and was first identified in cancer cells, as a protein responsible for resistance to a wide variety of aeds. the transmembrane p - gp that functions as a multispesific drug - efflux transporter is considered to be associated with drug absortion and elimination. it is hypothesized that overexpression of an efflux transporter such as p - gp around an epiloptegenic focus, via reducing aed accumulation, may prevent aeds from entering sites of action. the expression, efflux, substrate spesificity, and mrna stability of p - gp are influenced by various single nucleotide polymorphisms (snps) in the encoding gene, mdr1. evidence is present for supporting the important role played by more gene polymorphisms on the function of p - gp via effecting its activity [12, 13 ]. the mdr1 gene is highly polymorphic with more than 50 variants residing in the coding region and, which can possibly cause altered function. a great number of studies were focused on two most common snps, c3435 t (exon 26, rs1045642) and g2677t / a (exon 21, rs2032582) snps, to explore the associations with disease development and drug response in different populations. the synonymous c3435 t polymorphism was the first snp, which has been shown to correlate with the expression levels and function of p - gp, although conflicting reports have subsequently appeared showing no correlation with the expression levels and function of p - gp. the c3435 t polymorphism is in linkage disequilibrium with nonsynonymous g2677t / a polymorphism (ala893ser / thr), which may also contribute to the observed functional effect of variation at the c3435 t polymorphism or at associated haplotypes. furthermore, the g2677t / a snp has been shown to be associated with drug resistant epilepsy [17, 18 ]. thus, the mdr1 has been regarded as an interesting candidate gene potentially influencing the response to aed treatment. based on the hypothesis that mdr1 genetic polymorphisms can modulate drug response phenotype in epilepsy, the present study was carried out to evaluate the association of two snps [3435c > t (rs1045642) and 2677 g > t / a (rs2032582) ] of the mdr1 gene in drug - responsive and drug - resistance patients in a turkish population. a total of 152 turkish children with epilepsy treated with aeds were included in this study. the patients were diagnosed and classified according to the guidelines of the international league against epilepsy. patients, who had an established clinical diagnosis of epilepsy (defined by the occurrence of two or more unprovoked seizures) confirmed by an electroencephalogram examination by an expert were included in the study. exclusion criteria consisted of severe adverse drug reactions, poor compliance with aeds, history of pseudo - seizures, alcohol or drug abuse, or any other malignant diseases such as brain tumor, secondary metastasis, hepatic failure, or renal failure. patients were included if they had either drug - resistant or drug - responsive epilepsy according to the following definitions and criteria. the main criterion for drug resistance was the occurrence of at least four seizures over a period of 1 year with three aeds, such as carbamazepine + valproate + levetiracetam, or carbamazepine + valproate + diphenylhydantoin, according to the epileptic seizure type at maximum tolerated doses. of the 152 patients, 69 were classified as drug resistant (40 males, 29 females, mean age : 9.2 3.6 years) and 83 were drug responsive (51 males, 32 females, mean age : 9.3 3.8 years. the protocol for this study was approved by the regional ethics committee and was carried out in accordance with the code of ethics of the world medical association (declaration of helsinki) for experiments involving humans. venous blood samples (3 ml) were collected in edta vacutainer tubes for dna extraction. immediately after collection, genomic dna was extracted from leukocytes using roche dna purification kit (roche diagnostics gmbh, mannheim, germany) according to the manufacturer s instructions. genotyping of mdr1 c3435 t (exon 26) and g2677t / a (exon 21) were determined by using the polymerase chain reaction pcr amplifications of exon 26 and 21 of the mdr1 gene were performed with primers described by tanabe. and cascorbi. pcr amplifications were carried out in a total volume of 25 l containing : 100 ng of genomic dna, 1u of taq polymerase (mbi fermentas), 1 m of each primer [for c3435 t, f:5-ttg atg gca aag aaa taa agc-3 and r:5-ctt aca tta ggc agt gac tcg-3 ; for g2677t / a, f:5-ttt gca ggc tat agg ttc cag-3, r(a):5gtt tga ctc acc ttc cca g-3 and r(t):5-ttt agt ttg act cac ctt ccc g-3 ], 1x pcr buffer, 1 mm mgcl2, and 0.04 mm dntps. the amplification reactions were performed in a thermocycler 9700 (applied biosystems, california, usa) under the following conditions : for mdr1 c3435 t polymorphism, initial denaturation at 94 c for 4 min, followed by 35 cycles each of 94 c for 30 s, 56 c for 30 s, 72 c for 30 s ; and a final extension at 72 c for 5 min ; for mdr1 g2677t / a polymorphism, initial denaturation at 94 c for 3 min, followed by 40 cycles each of 94 c for 20 s, 55 c for 20 s, 72 c for 30 s ; and a final extension at 72 c for 5 min. the pcr products were digested by restriction endonucleases of mboi at 37 c (for c3435 t), bani at 37 c (for g2677 t) and bsri at 65 c (for g2677a) for 3 h and analyzed with 3 % agarose gel electrophoresis. differences between the means of the two continuous variables were evaluated by the student s t test. chi square () or fischer s exact test (two - sided) was used to compare the association between the genotypes and alleles in relation to the cases, and test for deviation of genotype distribution from hardy weinberg equilibrium. the odds ratio (or) and their 95 % confidence intervials (cis) were calculated to estimate the strength of the association. statistical analysis was performed using a statistical software package, spss 16.0 (spss inc, usa). haplotype frequency analysis and linkage disequilibrium for the two mdr1 polymorphisms were performed by using the haploview 4.2 program. a total of 152 turkish children with epilepsy treated with aeds were included in this study. the patients were diagnosed and classified according to the guidelines of the international league against epilepsy. patients, who had an established clinical diagnosis of epilepsy (defined by the occurrence of two or more unprovoked seizures) confirmed by an electroencephalogram examination by an expert were included in the study. exclusion criteria consisted of severe adverse drug reactions, poor compliance with aeds, history of pseudo - seizures, alcohol or drug abuse, or any other malignant diseases such as brain tumor, secondary metastasis, hepatic failure, or renal failure. patients were included if they had either drug - resistant or drug - responsive epilepsy according to the following definitions and criteria. the main criterion for drug resistance was the occurrence of at least four seizures over a period of 1 year with three aeds, such as carbamazepine + valproate + levetiracetam, or carbamazepine + valproate + diphenylhydantoin, according to the epileptic seizure type at maximum tolerated doses. of the 152 patients, 69 were classified as drug resistant (40 males, 29 females, mean age : 9.2 3.6 years) and 83 were drug responsive (51 males, 32 females, mean age : 9.3 3.8 years. the protocol for this study was approved by the regional ethics committee and was carried out in accordance with the code of ethics of the world medical association (declaration of helsinki) for experiments involving humans. venous blood samples (3 ml) were collected in edta vacutainer tubes for dna extraction. immediately after collection, whole blood was stored in aliquots at 20 c until use. genomic dna was extracted from leukocytes using roche dna purification kit (roche diagnostics gmbh, mannheim, germany) according to the manufacturer s instructions. genotyping of mdr1 c3435 t (exon 26) and g2677t / a (exon 21) were determined by using the polymerase chain reaction restriction fragment length polymorphism (pcr rflp) assay. pcr amplifications of exon 26 and 21 of the mdr1 gene were performed with primers described by tanabe. and cascorbi. pcr amplifications were carried out in a total volume of 25 l containing : 100 ng of genomic dna, 1u of taq polymerase (mbi fermentas), 1 m of each primer [for c3435 t, f:5-ttg atg gca aag aaa taa agc-3 and r:5-ctt aca tta ggc agt gac tcg-3 ; for g2677t / a, f:5-ttt gca ggc tat agg ttc cag-3, r(a):5gtt tga ctc acc ttc cca g-3 and r(t):5-ttt agt ttg act cac ctt ccc g-3 ], 1x pcr buffer, 1 mm mgcl2, and 0.04 mm dntps. the amplification reactions were performed in a thermocycler 9700 (applied biosystems, california, usa) under the following conditions : for mdr1 c3435 t polymorphism, initial denaturation at 94 c for 4 min, followed by 35 cycles each of 94 c for 30 s, 56 c for 30 s, 72 c for 30 s ; and a final extension at 72 c for 5 min ; for mdr1 g2677t / a polymorphism, initial denaturation at 94 c for 3 min, followed by 40 cycles each of 94 c for 20 s, 55 c for 20 s, 72 c for 30 s ; and a final extension at 72 c for 5 min. the pcr products were digested by restriction endonucleases of mboi at 37 c (for c3435 t), bani at 37 c (for g2677 t) and bsri at 65 c (for g2677a) for 3 h and analyzed with 3 % agarose gel electrophoresis. differences between the means of the two continuous variables were evaluated by the student s t test. chi square () or fischer s exact test (two - sided) was used to compare the association between the genotypes and alleles in relation to the cases, and test for deviation of genotype distribution from hardy weinberg equilibrium. the odds ratio (or) and their 95 % confidence intervials (cis) were calculated to estimate the strength of the association. statistical analysis was performed using a statistical software package, spss 16.0 (spss inc, usa). haplotype frequency analysis and linkage disequilibrium for the two mdr1 polymorphisms were performed by using the haploview 4.2 program. basic demographic and clinical charecteristics of epilepsy patients with drug - resistant and drug - responsive are presented table 1. the groups were not significantly different with respect to the age and gender (all values of p > 0.05).table 1demographic and clinical characteristics of epilepsy patientsparametersdrug - resistant n (%) drug - responsive n (%) gender male40 (58)51 (61) female29 (42)32 (39)age (years) mean sd9.2 3.69.3 3.8 range115214seizure type partial24 (35)24 (29) generalized45 (65)59 (71)etiology idiopathic31 (45)40 (48) symptomatic29 (42)27 (33) cryptogenic9 (13)16 (19) sd standard deviation demographic and clinical characteristics of epilepsy patients sd standard deviation no significant deviations from hardy weinberg equilibrium were observed in epilepsy patients (p = 0.68 for mdr1 c3435 t and p = 1.00 for mdr1 g2677t / a). table 2 shows the genotype and allele frequencies of the polymorphisms in mdr1 gene for both drug - resistant and drug - responsive epilepsy patients. the distribution of mdr1 c3435 t and g2677t / a genotypes within drug - resistant (p = 0.76 and p = 1.00, respectively) and drug - responsive (p = 0.88 and p = 0.98, respectively) groups were not significantly different from that under hary no statistically significant differences were detected for the genotype and allele frequencies of the polymorphisms in the mdr1 gene between the drug - resistant and drug - responsive groups.table 2genotype and allele distribution of the mdr1 c3435 t and g2677t / a polymorphisms in drug resistant and drug - responsive patients with epilepsygenotype / alleledrug - resistant n (%) drug - responsive n (%) or (95 % ci) p - valuec3435 t cc17 (25)22 (26)ref. ct30 (43)38 (46)1.02 (0.462.26)0.96 tt22 (32)23 (28)1.24 (0.522.93)0.63 c allele frequency0.460.49ref. gt32 (46)36 (43)1.05 (0.472.33)0.91 tt17 (25)24 (29)0.83 (0.342.04)0.69 ga1 (1)2 (3)0.59 (0.057.07)1.00 ta2 (3)1 (1)2.35 (0.2028.27)0.60 aa0 (0)0 (0) g allele frequency0.490.47ref. t allele frequency0.490.520.90 (0.521.58)0.72 a allele frequency0.020.011.92 (0.1721.87)1.00 or odds ratio, ci confidence interval genotype and allele distribution of the mdr1 c3435 t and g2677t / a polymorphisms in drug resistant and drug - responsive patients with epilepsy or odds ratio, ci confidence interval table 3 lists the haplotypes of mdr1 polymorphisms in the drug - resistant and drug - responsive epilepsy patients. haplotype frequencies of these polymorphisms in the mdr1 gene did not differ significantly between drug - resistant and drug - responsive epilepsy patients. the linkage disequilibrium test of two snps in mdr1 (rs1045642 and rs2032582) were in strong linkage disequilibrium (d = 0.991).table 3mdr1 c3435 t and g2677t / a haplotype frequencies in drug - resistant and drug - responsive patients with epilepsyhaplotypefrequency p - valuedrug - resistantdrug - responsivett0.5350.5260.988cg0.4090.4040.972tg0.0440.0350.487ct0.0120.0350.235 mdr1 c3435 t and g2677t / a haplotype frequencies in drug - resistant and drug - responsive patients with epilepsy drug - resistant epilepsy patients tend to be resistant to a broad range of aeds with a varied mode of action [5, 7 ]. the functional characteristics of non - specific drug transporter proteins could explain broader resistance across types of epilepsy and to a range of aeds. among these transporter proteins, p - gp is considered as one of the most potent contributer to the phenomenon of clinical drug resistance to aeds. various genetic polymorphisms in the mdr1 gene could be linked with altered in vivo transport activity of p - gp which may play a facilitatory role in drug - resistant epilepsy. these genetic polymorphisms among epilepsy patients are likely to contribute to different responses in patients, who have similar epilepsy syndromes and are taking similar, or even the same, doses of medication. so in the present study, we investigated two snps in mdr1 gene in drug - resistant and drug - responsive epilepsy patients. results of the present study demonstrated that genotype and allele frequencies of c3435 t and g2677t / a polymorphisms of the mdr1 gene did not differ between drug - responsive and drug resistant epilepsy patients. furthermore, the results of this study also showed no haplotype association of these mdr1 polymorphisms with drug - resistant epilepsy. the results from various studies focusing on the role of mdr1 c3435 t and g2677t / a polymorphisms in aed responsiveness are conflicting. consistent with the present study, several studies have found no significant associations between drug - resistance epilepsy and the mdr1 c3435 t and g2677t / a polymorphisms [22, 23 ]. two studies from turkey also reported that there were no associations between the polymorphisms of the mdr1 gene and drug - resistant epilepsy [24, 25 ]. similarly, kim. observed no association between the polymorphisms of g2677t / a and 3435c > t and drug resistance in korean patients. however, contrary to the above studies results, hung. found that 3435c > t and 2677 g > t in the mdr1 gene contributed to drug - resistant epilepsy.. demonstrated that the frequency of the 3435cc genotype among drug - resistant patients (27.5 %) was significantly higher than in drug - responsive patients or nonepileptic controls (15.7 or 18.5 %, respectively) among caucasian subjects. in contrast to these results, kwan. reported that patients with drug - resistant epilepsy had a higher frequency of the 3435tt genotype (16.7 %) in comparison to drug - responsive epileptics or nonepileptic controls (10.6 or 7.4 %, respectively). furthermore, seo. also demonstrated that drug - resistant epilepsy patients were significantly more likely to have the t allele and the tt genotype at c3435 t when compared to drug - responsive patients (50 vs 27 ; 36.9 vs 16.7 %, respectively). in addition, seo. found that patients with drug - resistant epilepsy had higher frequencies of the tt genotypes at g2677t / a in comparison to the drug - responsive patients (26.2, 23.8 %, respectively). the differences observed in these reports may be due to the ethnic differences in genotype / allele frequencies. ethnic differences in genotype frequency for the investigated polymorphisms might effect the results in genetic studies. for example, mdr1 3435cc was less common than 3435tt in caucasian patients (1619 vs 2733 % in drug - responsive patients) [22, 27 ], while the opposite of this was observed in han chinese cohort (38 vs 7 % in drug responsive patients), similar to other asian populations. furthermore, contradictory data reported in these epidemiologic studies may be due to other several factors such as number of patients, combinations of susceptibility variants, the isolated nature of the study populations, heterogeneity of epilepsy and gene - environment interactions. the authors assessed the association of mdr1 haplotypes derived from c3435 t, g2677t / a, and c1236 t loci in response to aeds in different epilepsy populations. in consistency with our results, alpman. found that the haplotypes of c3435 t and g2677t / a were not associated with drug resistant epilepsy in turkish epileptics. furthermore, meng. failed to detect any associations between drug - resistance and haplotypes of c3435 t, g2677t / a, and c1236 t polymorphisms. however, siddiqui. reported that the c g c haplotype of c3435 t, g2677t / a, and. found that patients with drug - resistant epilepsy had higher frequencies of the t t haplotype at c3435 t, g2677t / a, and c1236 t than patients with drug - responsive epilepsy (42.1, 30.4 %, respectively). in conclusion, our results indicate that mdr1 c3435 t and g2677t / a polymorphisms are not associated with drug - resistant epilepsy in the study population. the limitation of the current study is the small sample size. to clarify the exact clinical implication of the mdr1 polymorphisms on the multidrug resistance in epilepsy, further investigations in various ethnic populations | one - third of all individuals with epilepsy are resistant to antiepileptic drug (aed) treatment. antiepileptic treatment response has been suggested to be modulated by genetic polymorphisms of drug efflux transporters. several polymorphic variants within the multidrug resistance 1 (mdr1) gene, which encodes the major transmembrane efflux transporter p - glycoprotein, have been proposed to be associated with aed resistance in epilepsy patients. the aim of this study was to evaluate the effect of c3435 t and g2677t / a polymorphisms of mdr1 on aed resistance in turkish children with epilepsy. mdr1 c3435 t and g2677t / a were genotyped in 152 patients with epilepsy, classified as drug - resistant in 69 and drug - responsive in 83. genotypes of the c3435 t and g2677t / a polymorphisms were determined by polymerase chain reaction followed by restriction fragment length polymorphism. genotype and allele frequencies of c3435 t and g2677t / a polymorphisms of the mdr1 gene did not differ between drug - resistant and drug - responsive epilepsy patients. our results suggest that mdr1 c3435 t and g2677t / a polymorphisms are not associated with aed resistance in turkish epileptic patients. to clarify the exact clinical implication of the mdr1 polymorphisms on the multidrug resistance in epilepsy, further investigations in various ethnic populations would be necessary. |
cardiovascular disease is a challenging global public health problem, causing about 16.7 million deaths annually worldwide.1 meanwhile, kidney disease is reportedly increasing in developed countries, including the us, canada, australia, and europe.2,3 cardiovascular disease and kidney disease impose a substantial economic burden, not just on health care services but also on industry and commerce. taiwan also faces these challenges, with heart disease and kidney disease being, respectively, the second and eighth leading causes of death in 2007.4 therefore, there is a need to reduce the occurrence and death rate by means of frequent monitoring of patients who are at high risk of developing cardiovascular disease or kidney disease. on the other hand, a large clinical study has shown that the increased risk of heart disease across the spectrum of kidney disease has been recently appreciated by the medical community.5,6 therefore, simultaneous monitoring of cardiovascular disease and kidney disease is essential. highly elevated homocysteine levels were associated with a more than three - fold increase in the risk of heart attack over a five - year period.5 therefore, the blood homocysteine level is a good index for heart attack monitoring. conversely, urea in the plasma increases with the degree of renal failure and accumulates in kidney disease.6 therefore, the clinical diagnosis of chronic kidney disease is principally based on the measurement of increased levels of urea. blood sampling is the current routine clinical method to determine blood homocysteine and urea levels. this provides considerable impetus for the development of noninvasive methods for the simultaneous monitoring of blood homocysteine and urea levels. so far, no research has been reported on investigation of transdermal extraction of homocysteine by reverse iontophoresis. several papers have reported on the use of reverse iontophoresis to enhance the extraction of urea,79 but no papers have been found for the simultaneous transdermal extraction of urea and homocysteine by this method. reverse iontophoresis refers to the passage of a low voltage (10 v) and low level of current (0.5 ma / cm) through the skin to promote the extraction of both charged and neutral molecules.10 the most successful reverse iontophoresis application for patient monitoring to date, as mentioned, has been in noninvasive and continuous blood glucose detection utilizing the glucowatch.11,12 the aim of this study was to find out whether homocysteine is extractable transdermally and noninvasively, and whether homocysteine and urea can be extracted simultaneously by reverse iontophoresis. phosphate - buffered saline, urea, and homocysteine were purchased from sigma chemical company (st louis, mo). the homocysteine assay kit was purchased from ibl - america (minneapolis, mn). deionized water, purified by a millipore milli - q ufplus system (bedford, ma) was used to prepare all solutions. the diffusion cell used for the in vitro studies was the same as that previously described (figure 1).13 a reverse iontophoresis device was homemade, with an accuracy of 0.01 a for delivering current and 0.01 msec for timing. all colorimetric analysis was performed using a bio - rad 680 microplate reader (bio - rad, hemel hempstead, uk). the electrode chambers were separated from the lower chamber by porcine ear skin with a thickness of 250 m, obtained by padgett dermatome (integra lifesciences corporation, plainsboro, nj). the thickness of the skin used in this study was the same as that reported in other researchers diffusion studies.17,18 all chambers were filled with 0.1 m phosphate buffer (ph 7.0), except that the lower chamber additionally contained 5 mm urea and 15 m homocysteine, which attempted to simulate the normal physiological levels of urea and homocysteine in human blood. each upper electrode chamber contained 300 l phosphate buffer (0.1 m, ph 7.0) while the lower chamber contained the necessary solution of about 25 ml. a ag / agcl electrode was positioned inside each electrode chamber, and its fabrication procedure was the same as previously described.13 the surface area of the porcine skin exposed to the electrode in each chamber was 0.2 cm and the electrode chambers were 11 mm apart. a direct current (dc, cathodal dc abbreviated to dc - cathode and anodal dc abbreviated to dc - anode) and four symmetrical biphasic direct currents (sbdc) were applied for 12 minutes and 36 minutes via the ag / agcl electrodes. the four sbdc had four different phase durations of 15 sec (15s pdsbdc), 30 sec (30s pdsbdc), 60 sec (60s pdsbdc), and 180 sec (180s pdsbdc). at the end of each experiment, the entire contents of the electrode chambers were removed to determine the amount of urea and homocysteine extracted. for the control experiments, all the experimental arrangements and procedures were the same, except no current was applied. the amount of urea (determined by the urea assay kit) and homocysteine (determined by the homocysteine assay kit) extracted through the porcine skin were quantified by a colorimetric clinical chemistry assay method adapted for use with the bio - rad 680 microplate reader. to perform the urea and homocysteine quantifications, we followed their corresponding assay procedures mentioned in the user manuals of their assay kits,19,20 except that the amount of sample used was 100 l rather than the recommended amount. an excellent linear relationship (r > 0.95) between urea concentration and its relative absorbance was found, and the relationship between homocysteine concentration and its relative absorbance was also found to be linearly excellent (r > 0.9). one - way analysis of variance was used to determine whether there were significant differences between the dc and sbdc for urea and homocysteine extraction. all statistical analyses were carried out using spss 10.0 software (spss, chicago, il), with the level of statistical significance set at p 0.95) between urea concentration and its relative absorbance was found, and the relationship between homocysteine concentration and its relative absorbance was also found to be linearly excellent (r > 0.9). one - way analysis of variance was used to determine whether there were significant differences between the dc and sbdc for urea and homocysteine extraction. all statistical analyses were carried out using spss 10.0 software (spss, chicago, il), with the level of statistical significance set at p < 0.05. an in vitro model was used in this study because of its simplicity. we were able to create a normal (ie, healthy) model, a cardiovascular disease model, and a kidney disease model, by just simply adjusting the solution stored inside the lower chamber of the diffusion cell. for example, the kidney disease model could be created by preparing the lower chamber solution with a high urea concentration, ie, 20 mm urea. on the other hand, it is relatively difficult and expensive to create an in vivo model. hence, an in vitro model was used in this study. we simply used the normal model (5 mm urea and 15 m homocysteine) for this investigation in order to find out whether homocysteine was extractable, as well as whether homocysteine and urea could be extracted simultaneously. in a future study skin consists of three layers, ie, the epidermis, dermis, and subcutis. the epidermis (about 100 m in thickness) is the topmost layer of the skin, forming a barrier for many substances going in and out. the diffusion cell used in this study had a lower chamber, and its function was to simulate the dermis and subcutis. for the epidermis, a porcine ear skin was used, and its thickness (250 m) was the same as the thickness reported in diffusion studies done by other researchers.17,18 there are three mechanisms for reverse iontophoresis, ie, diffusion (almost negligible), electromigration, and electro - osmosis. the major mechanisms for transport of ions and molecules are electromigration of charged species to the electrode of opposite polarity, electro - osmosis of neutral molecules to the cathode or anode, or a combination of these two processes. homocysteine, an uncharged molecule with a molecular weight of about 135 da, is a hydrophilic molecule (partition coefficient 2.2). because of its small size and hydrophilic properties, urea is a negatively charged molecule and its molecular weight is about 60.06 da. as a consequence of its small size and negative charge, electromigration is the dominant physical factor for urea extraction. as expected, reverse iontophoresis facilitated the transdermal extraction of homocysteine and urea (see figure 2). figure 2a shows that there was a significant difference between the dc and the four sbdc on extraction of homocysteine (one - way analysis of variance, p < 0.001). it was found that there was a significantly higher homocysteine extraction for the dc and the four sbdc than for the control sample which utilized diffusion - only extraction (lsd test, p < 0.001 in most cases and p < 0.05 in the remaining cases). this suggests that the use of physical force, like reverse iontophoresis, can promote more homocysteine extraction than diffusion alone. because homocysteine is an uncharged molecule, it theoretically should be extracted to the electrode chamber of the diffusion cell with the negative polarity (ie, the cathode). as shown in figure 2a, although slightly higher homocysteine extraction was observed at the cathode than at the anode, the difference was not significant. this might be because prolonged dc passage can cause skin polarization, which results in the reduction of electro - osmotic flow. homocysteine extractions at the dc - cathode and the dc - anode were found to be significantly lower than that at the four sbdc (lsd test, p < 0.001 in most cases and p < 0.05 in the remaining cases). a possible explanation is that the use of dc for reverse iontophoresis causes skin polarization. polarization effects turn the skin into what is effectively a charged capacitor, and this reduces the flow of current and charged species during reverse iontophoresis. however, the use of sbdc has been suggested as a means to overcome skin polarization.14,15 therefore, sbdc promoted more homocysteine extraction than dc. also, homocysteine extraction using 60s pdsbdc was found to be significantly higher than that with protocols utilizing 15s pdsbdc (lsd test, p < 0.001) and 30s pdsbdc (lsd test, p < 0.05) but there was no significant difference when using 180s pdsbdc (lsd test, p = 0.838). this result suggests that extraction of homocysteine by sbdc is phase duration - dependent. because a plateau was observed at 60s pdsbdc and 180s pdsbdc for homocysteine extraction, the optimum mode for homocysteine extraction is therefore the 60s sbdc. moreover, it was found that a longer extraction time resulted in relatively more homocysteine extraction. however, a three - fold increase in extraction time did not result in a three - fold increase in homocysteine extraction (see figure 2a). more importantly, the homocysteine extraction flux (see figure 3a) and even effective homocysteine extraction (see table 1) decreased with increased extraction time. this indicates the presence of a homocysteine reservoir in the skin. on the other hand, as shown in figure 2b, a significant difference was found between dc and the four sbdc for the extraction of urea (one - way analysis of variance, p < 0.001). again, the dc and the four sbdc were found to promote more urea extraction than diffusion alone (lsd test, p < 0.001 in most cases and p < 0.05 in the remaining cases). because urea carries a negative charge, urea should theoretically be extracted to the electrode chamber of the diffusion cell with the positive polarity. as shown in figure 2b, our results agreed with this theoretical phenomenon that the dc - anode facilitates significantly (p < 0.001) more urea extraction than the dc - cathode. urea extraction using the dc - anode was found to be significantly higher than that of protocols utilizing 15s pdsbdc and 30s pdsbdc (lsd test, p < 0.001 in all cases) but there was no significant difference using 60s pdsbdc (lsd test, p = 0.139) and 180s pdsbdc (lsd test, p = 0.540). however, as shown in table 1, it could be argued that because the dc and sbdc have different effective extraction times (defined as the total number of hours for the passage of current at the same polarity during the whole experimental time), a standardization technique should be employed to investigate the rate of transdermal extraction of urea. therefore, the extraction rate for urea was recalculated in nmol / hour, where time was set as the actual time of the applied current at the electrode chamber collecting the molecule. this is based on the assumption that, at any time in the cycle, the anode dominates the collection of urea. as shown in table 1, calculating the effective urea extraction amount in this format shows that urea extraction using the dc - anode was significantly lower than when using sbdc (lsd test, p < 0.001 in all cases). on the other hand, urea extraction using 60s pdsbdc was found to be significantly higher than when using 15s pdsbdc and 30s pdsbdc (lsd test, p < 0.001 in all cases) but lower than that when using 180s pdsbdc (lsd test, p < 0.05). this result suggests that extraction of urea by sbdc is also phase duration - dependent. although 15s, 30s, 60s, and 180s pdsbdc showed the same effective urea extraction time, it was found that a long pdsbdc results in higher urea extraction. because skin has a thickness dimension, urea takes some time to pass through the skin. for a short pdsbdc, some urea molecules may not have enough time to pass through and may stay inside the skin. these urea molecules will not move forward into the collection chamber, and may even move backwards to the lower chamber of the diffusion cell when the phase of the sbdc is reversed. this might explain the phase duration - dependent phenomenon. because urea extraction using 60s pdsbdc was slightly lower than that using 180s pdsbdc (lsd test, p = 0.045), the optimum mode for urea extraction is 60s sbdc in order to achieve simultaneous extraction of urea and homocysteine. on the other hand, it was found that a longer extraction time caused comparatively more urea extraction, although a threefold increase in extraction time could not cause a three - fold increase in urea extraction (see figure 2b). moreover, the urea extraction flux (see figure 3b) and even the effective urea extraction (see table 1) decreased with increased extraction time. conversely, as shown in figure 3b, the result of dc - anode urea extraction flux in 36 minutes (about 0.05 mole / cm / hour 0.01 mole / hour) was found to be in agreement with the findings reported by wascotte in 2007.7 they found that the urea extraction flux in 30 minutes was about 0.015 mole / hour. however, our finding of pdsbdc urea extraction flux in 36 minutes (see figure 3b) was higher than that of wascotte. this means that pdsbdc resulted in a higher urea extraction flux as compared with dc alone. based on our findings, reverse iontophoresis potentially provides a promising technique for simultaneous, noninvasive, and transdermal extraction of urea and homocysteine. once the human study is approved, experiments will be conducted to test our hypothesis that homocysteine is transdermally extractable, and that homocysteine and urea can be simultaneously extracted in humans. if our hypothesis is correct, a homocysteine - urea glucowatch may be able to be developed in the future. of course, a homocysteine - urea watch may face the same reproducibility problems as those found with the glucowatch. a novel method for noninvasive transdermal extraction of homocysteine by reverse iontophoresis has been demonstrated. the optimum mode for simultaneous homocysteine and urea extraction appears to be sbdc with a phase duration of 60 seconds. once this hypothesist is proven in humans in the future, this new method for urea and homocysteine monitoring would be beneficial to patients, such as those with kidney disease, or obese individuals who are at high risk of developing coronary artery disease. | background : cardiovascular and kidney diseases are a global public health problem and impose a huge economic burden on health care services. homocysteine, an amino acid, is associated with coronary heart disease, while urea is a harmful metabolic substance which can be used to reflect kidney function. monitoring of these two substances is therefore very important. this in vitro study aimed to determine whether homocysteine is extractable transdermally and noninvasively, and whether homocysteine and urea can be extracted simultaneously by reverse iontophoresis.methods:a diffusion cell incorporated with porcine skin was used for all experiments with the application of a direct current (dc) and four different symmetrical biphasic direct currents (sbdc) for 12 minutes via ag / agcl electrodes. the dc and the sbdc had a current density of 0.3 ma / cm2.results : the sbdc has four different phase durations of 15 sec, 30 sec, 60 sec, and 180 sec. it was found that homocysteine can be transdermally extracted by reverse iontophoresis. simultaneous extraction of homocysteine and urea by reverse iontophoresis is also possible.conclusion:these results suggest that extraction of homocysteine and urea by sbdc are phase duration - dependent, and the optimum mode for simultaneous homocysteine and urea extraction is the sbdc with the phase duration of 60 sec. |
accurate detection of sequence similarity between distantly related proteins is essential for many fields, including protein structure prediction, protein engineering, and comparative genomics. the performance of an automatic method for sequence comparison can be characterized by sensitivity, selectivity and accuracy of produced sequence alignments. all these parameters can be significantly improved by comparing multiple sequence alignments (msas) rather than individual sequences. the improvement comes from evolutionary information about residue preferences at sequence positions in the family represented by the msa. this information can be extracted from msas in two numerical forms : traditional position - specific profiles and hidden markov models (hmms). the well - known and popular methods for profile - sequence or hmm - sequence comparison include psi - blast (1,2), hmmer (3), sam - t (4,5) and others. a newer generation of methods involves the comparison of two profiles (610) or two hmms (11,12), with several corresponding web servers available (1316). these methods further improve the quality of homology detection and alignment construction (17,18). there is a number of publicly available web servers aimed at protein structure prediction that use these and a variety of other techniques [for example, (1923) ]. compass (9) is an established method for profile - based comparison of msas. compass derives numerical profiles from given msas, constructs optimal local profile - profile alignments, and analytically estimates e - values for the detected similarities. as previously shown by us (9) and independently verified by others (12,18), compass is a sensitive and selective tool for detection of remote sequence similarity that offers accurate local alignments. in many cases, compass provides accurate homology detection and structure prediction that would be difficult or impossible to produce by psi - blast (9,24). as a standalone package, compass has been used by different research groups (2431). until now, compass was only available for download and local installation. here, to compare two msas, compass performs four steps : (i) processing input msas and generating numerical profiles ; (ii) calculating scores between individual positions of the compared profiles ; (iii) finding optimal local alignment of the two profiles ; and (iv) assessing statistical significance of the optimal alignment score (9). methodologically, compass is a generalization to profile - profile comparison of the psi - blast approach to profile - sequence comparison. numerical profiles represent effective counts and frequencies of 21 symbols (20 residue types and gaps) at each position of the input msas. to search with a query msa against a database of msas, the database profiles are pre - computed in advance. scores for the similarity between individual profile positions are calculated using our original formula (9) and then rescaled so that their distribution is similar to a standard distribution with well - known properties (such as blosum62 substitution scores). the statistical significance of the optimal alignment score is estimated using a simple formula for e - value (the expected number of hits in a random database with a score equal to or greater than the observed score). the parameters of this formula are based on our extensive simulations of random profile comparisons (9). as the final result of the search, a list of the most significant hits for the submitted query is displayed, followed by the optimal profile - profile alignments. according to our results (9) and independent evaluations (12,18), compass performance has been demonstrated to be among the top methods for profile comparison, by both the quality of homology detection and the accuracy of local alignment construction. the presented web server features a newer version of compass, with several major modifications to improve performance. higher quality of homology detection. evaluation of the statistical significance of hits is improved by using a more realistic null model of random profile comparison. the original random model involved the profiles composed of randomly sampled positions from real msas. the score statistics were modeled depending on the profile lengths only, and a rough linear approximation of the dependency was used (9). first, in order to reproduce local correlations between different positions of msa, we generate random profiles from fragments of real profiles corresponding to individual elements of secondary structure. second, to model more accurately the distribution parameters k and (2,9) for optimal profile - profile scores, we introduce their dependence on the profile finally, we use more precise non - linear functions (combinations of quadratic and square - root) to describe the dependency of these parameters on profile length and thickness. according to our preliminary results, the new version of compass shows roughly 2025% improvement in the quality of similarity detection.longer, more complete local alignments. rescaling of individual positional scores is modified, so that alignment coverage increases. in the original version, this procedure was similar to the composition - based statistic in psi - blast (2), which standardized positional scores by adjusting the distribution parameter lambda (describing mainly the distribution width). in the new version, in order to make the rescaled distribution closer to standard, the mean of the distribution is also forced to a fixed value. as a result, positional scores are more compatible with the gap penalties that were empirically optimized for the standard substitution matrices the optimal alignments on average become longer and cover similarity regions better without compromising the overall alignment accuracy.improved speed. several algorithmic modifications, as well as a general code optimization, lead to an order of magnitude improvement in computational speed over the original version. the resulting computational efficiency is now comparable to that of the fastest profile - profile methods (12,15), with a typical search taking a few minutes on one processor. this time period may increase when the server is heavily loaded or when the user requires generation of the query profile by psi - blast search, which may take longer for queries with a large number of homologs in the sequence database.flexible control of input options. the server 's front page (figure 1a) allows the user to upload the query in several common alignment formats, choose the database and adjust search parameters and output options. the query msa or single sequence can be either pasted in the input window or uploaded from a file. the available profile databases currently include pfam (32), cog, kog (33,34) and psi - blast alignments produced from sequences with known 3d structure : chain representatives of the pdb database (35) and domain representatives of scop classification (36). the pdb representatives are full chains extracted from the whole set of available 3d structures (35), based on a 70% cutoff of sequence identity. the scop representatives are structural domains defined and classified by expert analysis into families, superfamilies, folds and classes (36). these representatives are based on 40% identity and are taken from the astral database (37). the pdb and astral sequences are used as queries for psi - blast searches against ncbi nr database. the resulting msas of detected homologs are used to generate compass profiles. to allow for the choice of different levels of sequence divergence within msas, the user can choose profiles corresponding to different numbers of psi - blast iterations. pfam (32), cog and kog (33,34) databases include families of both known and unknown 3d structure, which cover protein sequence space more completely and provide alternative ways of family classification. these databases typically represent tighter sequence grouping, with more consideration of protein function, and clustering of orthologs from different genomes. cog and kog profiles are generated from msas produced from the database sequences by muscle (38). the profile databases are regularly updated when new versions of original databases are available. the main section allows the user to submit the query (by pasting in the window or by specifying the file), to choose the search database, and (if needed) to enter the email address to receive the results. the section of input processing options allows the user to choose whether a psi - blast run is needed to enrich the query profile with additional sequence homologs and to define the parameters of profile construction. the section of search options can be used to adjust the main parameters of the search. a brief explanation of each option is available by clicking on the option 's name. additional sections include the links to more detailed documentation and to the ftp page with standalone compass package. (b) search results for uncharacterized pfam duf185 as a query, supporting the structure and function prediction for this family. the list of hits among scop domains consistently includes members of the same superfamily of s - adenosyl - l - methionine - dependent methyltransferases (sam - mtases) (c.66.1). the header includes brief information about the hit : database identifier, protein description, full length of the msa (length), the length of the profile after purging positions with high gap content (filtered length), effective number of sequences as a characteristic of sequence divergence within msa (nef f), followed by compass score and e - value. in this example, the top and consensus sequences for compared profiles are displayed. +, identical residues in the two consensus sequences are marked by the residue symbol. invariant glutamates of motifs i and ii (39) involved in ligand binding are marked with red dots, glycine - rich motif is circled. d : a recently solved structure for a member of duf185 family (pdb i d 1zkd) confirms our prediction. side chains of the invariant glutamate residues are shown in red, glycine - rich loop is circled. evaluation of the statistical significance of hits is improved by using a more realistic null model of random profile comparison. the original random model involved the profiles composed of randomly sampled positions from real msas. the score statistics were modeled depending on the profile lengths only, and a rough linear approximation of the dependency was used (9). first, in order to reproduce local correlations between different positions of msa, we generate random profiles from fragments of real profiles corresponding to individual elements of secondary structure. second, to model more accurately the distribution parameters k and (2,9) for optimal profile - profile scores, we introduce their dependence on the profile thickness (sequence divergence within the profiles). finally, we use more precise non - linear functions (combinations of quadratic and square - root) to describe the dependency of these parameters on profile length and thickness. according to our preliminary results, the new version of compass shows roughly 2025% improvement in the quality of similarity detection. in the original version, this procedure was similar to the composition - based statistic in psi - blast (2), which standardized positional scores by adjusting the distribution parameter lambda (describing mainly the distribution width). in the new version, in order to make the rescaled distribution closer to standard, the mean of the distribution is also forced to a fixed value. as a result, positional scores are more compatible with the gap penalties that were empirically optimized for the standard substitution matrices the optimal alignments on average become longer and cover similarity regions better without compromising the overall alignment accuracy. several algorithmic modifications, as well as a general code optimization, lead to an order of magnitude improvement in computational speed over the original version. the resulting computational efficiency is now comparable to that of the fastest profile - profile methods (12,15), with a typical search taking a few minutes on one processor. this time period may increase when the server is heavily loaded or when the user requires generation of the query profile by psi - blast search, which may take longer for queries with a large number of homologs in the sequence database. the server 's front page (figure 1a) allows the user to upload the query in several common alignment formats, choose the database and adjust search parameters and output options. the query msa or single sequence can be either pasted in the input window or uploaded from a file. the available profile databases currently include pfam (32), cog, kog (33,34) and psi - blast alignments produced from sequences with known 3d structure : chain representatives of the pdb database (35) and domain representatives of scop classification (36). the pdb representatives are full chains extracted from the whole set of available 3d structures (35), based on a 70% cutoff of sequence identity. the scop representatives are structural domains defined and classified by expert analysis into families, superfamilies, folds and classes (36). these representatives are based on 40% identity and are taken from the astral database (37). the pdb and astral sequences are used as queries for psi - blast searches against ncbi nr database. the resulting msas of detected homologs are used to generate compass profiles. to allow for the choice of different levels of sequence divergence within msas, the user can choose profiles corresponding to different numbers of psi - blast iterations. pfam (32), cog and kog (33,34) databases include families of both known and unknown 3d structure, which cover protein sequence space more completely and provide alternative ways of family classification. these databases typically represent tighter sequence grouping, with more consideration of protein function, and clustering of orthologs from different genomes. cog and kog profiles are generated from msas produced from the database sequences by muscle (38). the main section allows the user to submit the query (by pasting in the window or by specifying the file), to choose the search database, and (if needed) to enter the email address to receive the results. the section of input processing options allows the user to choose whether a psi - blast run is needed to enrich the query profile with additional sequence homologs and to define the parameters of profile construction. the section of search options can be used to adjust the main parameters of the search. a brief explanation of each option is available by clicking on the option 's name. additional sections include the links to more detailed documentation and to the ftp page with standalone compass package. (b) search results for uncharacterized pfam duf185 as a query, supporting the structure and function prediction for this family. the list of hits among scop domains consistently includes members of the same superfamily of s - adenosyl - l - methionine - dependent methyltransferases (sam - mtases) (c.66.1). the header includes brief information about the hit : database identifier, protein description, full length of the msa (length), the length of the profile after purging positions with high gap content (filtered length), effective number of sequences as a characteristic of sequence divergence within msa (nef f), followed by compass score and e - value. in this example, the top and consensus sequences for compared profiles are displayed. +, identical residues in the two consensus sequences are marked by the residue symbol. invariant glutamates of motifs i and ii (39) involved in ligand binding are marked with red dots, glycine - rich motif is circled. d : a recently solved structure for a member of duf185 family (pdb i d 1zkd) confirms our prediction. side chains of the invariant glutamate residues are shown in red, glycine - rich loop is circled. in order to gain more confidence in detected similarities and to find the best search conditions for a specific query, tuning the parameters controlling the generation of profiles and the construction of profile - profile alignments is advisable. first, the input msa (or sequence) can be used as a query for psi - blast search, in order to produce a more diverse msa of this family. the user can adjust the maximal number of iterations, as well as the requirements for a detected homolog to be included in the alignment : maximal e - value, minimal coverage of the query and minimal sequence identity to the query. second, gap fraction threshold allows the user to control the maximal content of gaps in the msa columns included in the compass profile. if a column contains too many gaps, it is disregarded in the process of profile comparison, and shown in the final output as lower - case letters for residues and dots for gaps. the default value of this parameter is 0.5. in the construction of profile - profile alignments, effective length of the database is the parameter used in the calculation of e - values for the profile - profile alignments. for a given optimal alignment score, there is roughly a linear dependence of e - value on the assumed database length. matrix is a substitution matrix of the user 's choice, blosum62 by default. as described above, the choice of the matrix affects the rescaling of scores between individual profile positions that are used in the construction of the profile - profile alignment. changing the scale of the positional scores would (i) make gap insertion more or less likely, affecting the resulting alignments, and (ii) change the optimal alignment scores and e - values. among the output formatting options, many are similar to those of psi - blast. expect and significance threshold are, respectively, the e - value cutoffs for the hit to be included in the output and to be considered significant. the user can also limit the total number of hits to display (display up to). for example, the displayed profile - profile alignments can include different numbers of top sequences from the input msas (top sequences to show), as well as consensus sequences (show consensus sequences). brief help sections are provided for every adjustable parameter, as well as a link to more detailed documentation (figure 1a). the general structure of the output is similar to that of psi - blast : the list of top hits is sorted by e - value and split into those below and above the significance threshold, followed by optimal profile - profile alignments with brief information about each hit. the user can display the consensus sequences of profiles, as well as multiple top sequences from the input msa. the number of top sequences displayed can range from zero (to show consensus only) to all sequences of the msa. another feature for fast and convenient analysis is links to the original databases, which provide immediate access to information available for detected protein families. the general structure of the output is similar to that of psi - blast : the list of top hits is sorted by e - value and split into those below and above the significance threshold, followed by optimal profile - profile alignments with brief information about each hit. the user can display the consensus sequences of profiles, as well as multiple top sequences from the input msa. the number of top sequences displayed can range from zero (to show consensus only) to all sequences of the msa. another feature for fast and convenient analysis is links to the original databases, which provide immediate access to information available for detected protein families. as an illustration, we describe the detection of distant sequence similarities that lead to fold predictions for two uncharacterized pfam families annotated as first, the compass server detects homology between duf185 (corresponding to cog1565 of the cog database) and scop domains of the s - adenosyl - l - methionine - dependent methyltransferase (sam - mtase) fold. using the full duf185 (pfam 19.0) alignment as a query, with the default input parameters (figure 1a), the server returns a list of hits that consistently belong to the same scop superfamily (c.66.1), both above and below the e - value cutoff (figure 1b). in this list, each line consists of four fields : the identifier in the original database (implemented as a link to the database), a brief description of the protein, the compass score and the corresponding e - value. the next section of the output includes profile - profile alignments between the query and the hits. each alignment is accompanied by a header with a brief information about the hit. unlike the psi - blast format, the alignments can include different numbers of top sequences from input msas and/or consensus sequences. figure 1c shows an example of such an alignment, with a single top sequence and consensus displayed for each profile. to distinguish the gaps introduced by compass from the gaps that already occur in the input alignments, the alignment in figure 1c includes the region of similarity between the query (profile for duf185) and a homologous profile based on the psi - blast alignment for structural domain 1i4wa. in addition to similar patterns of hydrophobicity and small residues, duf185 shows a strong conservation of sam - mtase signature motifs [reviewed in (39) ]. the sam - binding loop gxgxg (circled) and conserved acidic residue in the preceding -strand (marked with a red dot) are parts of motif i, whereas the invariant glutamate at the end of the next -strand (marked with a red dot) is a part of motif ii (39). this previously published prediction had been difficult to produce by psi - blast, even for an expert user (24). however, it was more recently confirmed by the solved structure of a duf185 member. this structure (pdb i d 1zkd, northeast structural genomics consortium) has been neither functionally annotated nor classified by scop or cath, but possesses typical features of the sam - mtase fold (figure 1d). the core of the domain contains a mixed -sheet of seven -strands surrounded by two sheets of -helices. the strand order is 3214576 ; with strand 7 (colored red) anti - parallel to the rest and forming a characteristic methyltransferase -hairpin with strand 6 (colored orange). in this domain, the -hairpin contains an additional -helical insert (orange helices). the presence of a glycine - rich loop (circled) and other signature motifs, including glutamates marked in figure 1c (side chains shown in red), suggest that this domain is a functional methyltransferase. this search reveals a newly identified similarity to a pfam family of mainly hypothetical bacterial proteins with unknown structure and function, duf519 (corresponding to cog2961 in the cog database). thus, we suggest that duf519/cog2961 proteins also possess the structural sam - mtase fold. this hypothesis is supported by the results of a search with the pfam 19.0 duf519 alignment as a query against the database of scop profiles (psi - blast iteration 3). homologs detected above the significance threshold, as well as multiple hits below the threshold, consistently belong to the sam - mtase fold. figure 2a shows the compass alignment between duf519 and the detected homolog, a domain of the sam - mtase fold (pdb i d 1qyra). this domain (not shown) possesses typical features of the fold and is similar to the structure shown in figure 1d. figure 2b shows the msa of representatives from both families that covers sam - mtase motifs i and ii (39). in duf519, this region includes the invariant glutamate aligned to a ligand - binding glutamate of sam - mtases (e95 in the top sequence, marked with red dot), the characteristic location of conserved small residues in the sam - binding loop (marked with a line) and a similar hydrophobicity pattern. secondary structure prediction for this part of duf519 is also consistent with the secondary structure of the sam - mtase fold. this prediction is additionally supported by other tools, e.g. by (i) significant scores for the similarity with the scop sam - mtase domains produced by ffas03 server (14) ; and (ii) the results of multiple iterations of psi - blast search in a sequence database with a family representative as a query. after four iterations, psi - blast detects the similarity between a duf519 sequence q9pha1_xylfa (gi|15836648, residues 32 - 291) and two proteins of known structure possessing the sam - mtase fold (pdb ids 2ift and 2fpo). figure 2.search results for pfam duf519 suggest that this family possesses the structural fold of sam - mtases. (a) duf519 is used as a query for the compass search against the databases of psi - blast alignments (iteration 3) for scop representatives. the compass alignment between the query and the detected homolog (domain 1qyra) includes characteristic motifs of the sam - mtase superfamily. in this example positions corresponding to the conserved acidic residues of motifs i and ii (39) are marked with red dots. (b) multiple alignment including representatives from duf519 (top) and 1qyra homologs (bottom). positions corresponding to conserved acidic residues of sam - mtase are marked with red dots. uncharged residues (all amino acids except d, e, k, r) in mostly hydrophobic sites are highlighted in yellow ; non - hydrophobic residues (all amino acids except w, f, y, m, l, i, v) at mostly hydrophilic sites are highlighted in light gray. the secondary structure of 1qyra is shown below the alignment, with -helices and -strands displayed as cylinders and arrows, respectively. search results for pfam duf519 suggest that this family possesses the structural fold of sam - mtases. (a) duf519 is used as a query for the compass search against the databases of psi - blast alignments (iteration 3) for scop representatives. the compass alignment between the query and the detected homolog (domain 1qyra) includes characteristic motifs of the sam - mtase superfamily. in this example positions corresponding to the conserved acidic residues of motifs i and ii (39) are marked with red dots. (b) multiple alignment including representatives from duf519 (top) and 1qyra homologs (bottom). positions corresponding to conserved acidic residues of sam - mtase are marked with red dots. uncharged residues (all amino acids except d, e, k, r) in mostly hydrophobic sites are highlighted in yellow ; non - hydrophobic residues (all amino acids except w, f, y, m, l, i, v) at mostly hydrophilic sites are highlighted in light gray. the secondary structure of 1qyra is shown below the alignment, with -helices and -strands displayed as cylinders and arrows, respectively. as an illustration, we describe the detection of distant sequence similarities that lead to fold predictions for two uncharacterized pfam families annotated as first, the compass server detects homology between duf185 (corresponding to cog1565 of the cog database) and scop domains of the s - adenosyl - l - methionine - dependent methyltransferase (sam - mtase) fold. using the full duf185 (pfam 19.0) alignment as a query, with the default input parameters (figure 1a), the server returns a list of hits that consistently belong to the same scop superfamily (c.66.1), both above and below the e - value cutoff (figure 1b). in this list, each line consists of four fields : the identifier in the original database (implemented as a link to the database), a brief description of the protein, the compass score and the corresponding e - value. the next section of the output includes profile - profile alignments between the query and the hits. each alignment is accompanied by a header with a brief information about the hit. unlike the psi - blast format, the alignments can include different numbers of top sequences from input msas and/or consensus sequences. figure 1c shows an example of such an alignment, with a single top sequence and consensus displayed for each profile. to distinguish the gaps introduced by compass from the gaps that already occur in the input alignments, the alignment in figure 1c includes the region of similarity between the query (profile for duf185) and a homologous profile based on the psi - blast alignment for structural domain 1i4wa. in addition to similar patterns of hydrophobicity and small residues, duf185 shows a strong conservation of sam - mtase signature motifs [reviewed in (39) ]. the sam - binding loop gxgxg (circled) and conserved acidic residue in the preceding -strand (marked with a red dot) are parts of motif i, whereas the invariant glutamate at the end of the next -strand (marked with a red dot) is a part of motif ii (39). this previously published prediction had been difficult to produce by psi - blast, even for an expert user (24). however, it was more recently confirmed by the solved structure of a duf185 member. this structure (pdb i d 1zkd, northeast structural genomics consortium) has been neither functionally annotated nor classified by scop or cath, but possesses typical features of the sam - mtase fold (figure 1d). the core of the domain contains a mixed -sheet of seven -strands surrounded by two sheets of -helices. (colored red) anti - parallel to the rest and forming a characteristic methyltransferase -hairpin with strand 6 (colored orange). in this domain, the -hairpin contains an additional -helical insert (orange helices). the presence of a glycine - rich loop (circled) and other signature motifs, including glutamates marked in figure 1c (side chains shown in red), suggest that this domain is a functional methyltransferase. this search reveals a newly identified similarity to a pfam family of mainly hypothetical bacterial proteins with unknown structure and function, duf519 (corresponding to cog2961 in the cog database). thus, we suggest that duf519/cog2961 proteins also possess the structural sam - mtase fold. this hypothesis is supported by the results of a search with the pfam 19.0 duf519 alignment as a query against the database of scop profiles (psi - blast iteration 3). homologs detected above the significance threshold, as well as multiple hits below the threshold, consistently belong to the sam - mtase fold. figure 2a shows the compass alignment between duf519 and the detected homolog, a domain of the sam - mtase fold (pdb i d 1qyra). this domain (not shown) possesses typical features of the fold and is similar to the structure shown in figure 1d. figure 2b shows the msa of representatives from both families that covers sam - mtase motifs i and ii (39). in duf519, this region includes the invariant glutamate aligned to a ligand - binding glutamate of sam - mtases (e95 in the top sequence, marked with red dot), the characteristic location of conserved small residues in the sam - binding loop (marked with a line) and a similar hydrophobicity pattern. secondary structure prediction for this part of duf519 is also consistent with the secondary structure of the sam - mtase fold. this prediction is additionally supported by other tools, e.g. by (i) significant scores for the similarity with the scop sam - mtase domains produced by ffas03 server (14) ; and (ii) the results of multiple iterations of psi - blast search in a sequence database with a family representative as a query. after four iterations, psi - blast detects the similarity between a duf519 sequence q9pha1_xylfa (gi|15836648, residues 32 - 291) and two proteins of known structure possessing the sam - mtase fold (pdb ids 2ift and 2fpo). figure 2.search results for pfam duf519 suggest that this family possesses the structural fold of sam - mtases. (a) duf519 is used as a query for the compass search against the databases of psi - blast alignments (iteration 3) for scop representatives. the compass alignment between the query and the detected homolog (domain 1qyra) includes characteristic motifs of the sam - mtase superfamily. in this example, only consensus sequences are displayed. positions corresponding to the conserved acidic residues of motifs i and ii (39) are marked with red dots. (b) multiple alignment including representatives from duf519 (top) and 1qyra homologs (bottom). positions corresponding to conserved acidic residues of sam - mtase are marked with red dots. uncharged residues (all amino acids except d, e, k, r) in mostly hydrophobic sites are highlighted in yellow ; non - hydrophobic residues (all amino acids except w, f, y, m, l, the secondary structure of 1qyra is shown below the alignment, with -helices and -strands displayed as cylinders and arrows, respectively. search results for pfam duf519 suggest that this family possesses the structural fold of sam - mtases. (a) duf519 is used as a query for the compass search against the databases of psi - blast alignments (iteration 3) for scop representatives. the compass alignment between the query and the detected homolog (domain 1qyra) includes characteristic motifs of the sam - mtase superfamily. in this example positions corresponding to the conserved acidic residues of motifs i and ii (39) are marked with red dots. (b) multiple alignment including representatives from duf519 (top) and 1qyra homologs (bottom). positions corresponding to conserved acidic residues of sam - mtase are marked with red dots. uncharged residues (all amino acids except d, e, k, r) in mostly hydrophobic sites are highlighted in yellow ; non - hydrophobic residues (all amino acids except w, f, y, m, l, i, v) at mostly hydrophilic sites are highlighted in light gray. the secondary structure of 1qyra is shown below the alignment, with -helices and -strands displayed as cylinders and arrows, respectively. | compass is a method for homology detection and local alignment construction based on the comparison of multiple sequence alignments (msas). the method derives numerical profiles from given msas, constructs local profile - profile alignments and analytically estimates e - values for the detected similarities. until now, compass was only available for download and local installation. here, we present a new web server featuring the latest version of compass, which provides (i) increased sensitivity and selectivity of homology detection ; (ii) longer, more complete alignments ; and (iii) faster computational speed. after submission of the query msa or single sequence, the server performs searches versus a user - specified database. the server includes detailed and intuitive control of the search parameters. a flexible output format, structured similarly to blast and psi - blast, provides an easy way to read and analyze the detected profile similarities. brief help sections are available for all input parameters and output options, along with detailed documentation. to illustrate the value of this tool for protein structure - functional prediction, we present two examples of detecting distant homologs for uncharacterized protein families. available at http://prodata.swmed.edu/compass |
to understand the origin of the studies that led to the identification of the cvt pathway, we need to briefly step back into the early days of yeast molecular genetics. randy schekman 's group was studying the secretory pathway and isolating mutants defective in various steps including endoplasmic reticulum (er)-to - golgi transport as well as secretion to the cell surface. two former postdocs from the schekman lab, scott emr and tom stevens, decided to pursue a similar direction, but to avoid a direct overlap with randy schekman by focusing on a pathway that branches off from the secretory pathway, the delivery of proteins to the vacuole. the emr and stevens labs isolated a new set of mutants initially named vpt (vacuolar protein targeting) and vpl (vacuolar protein localization), and subsequently vps (vacuolar protein sorting), which are defective in the delivery of resident proteins to the vacuole. being interested in protein sorting, one of us (d.j.k.) went to scott emr 's lab to learn about yeast. while in the emr lab, i characterized the vacuolar delivery of proteinase a (pep4) and vacuolar alkaline phosphatase (pho8). around that time, the sequence of the gene encoding another vacuolar hydrolase, aminopeptidase i (ape1) was published [3, 4 ]. it is important to keep in mind that this was the late 1980s, quite some time before the saccharomyces cerevisiae genome was sequenced in its entirety. in fact, automated sequencing was relatively new, so it was still a major accomplishment when a gene was sequenced. until then, only the sequences of pep4 [5, 6 ], prc1 (carboxypeptidase y), pho8, prb1 (proteinase b), and ams1 (-mannosidase) were known among the vacuolar hydrolases. thus, it was quite exciting to those of us studying vacuolar protein targeting when a new protein sequence became available. one of my main goals in the emr lab was to identify the vacuolar - targeting motif and determine a consensus sequence (mapping consensus targeting or retention signals was very popular in those days), a task that was all the more difficult due to the limited number of proteins available for comparison. hence, i was particularly interested in having a new protein that i could analyze. ape1 was known to be a vacuolar hydrolase, and it was characterized as being a glycoprotein. the latter finding fit with the fact that all of the characterized vacuolar hydrolases traffic through the secretory pathway to the golgi complex and from there are diverted to the vacuole. one interesting feature of the protein sequence for the precursor form of ape1 (prape1), however, was that it lacked a standard signal sequence. this seemed to add some additional interest to the analysis, as the idea of analyzing yet one more vacuolar hydrolase was getting somewhat tedious. when i discussed the idea of analyzing the targeting of prape1 with scott emr, however, he was not interested. after all, even if the details of the process were slightly unusual, we were still talking about the characterization of another vacuolar hydrolase that transits through a portion of the secretory pathway. indeed, at the time, there seemed to be more interesting projects to pursue, so the analysis of prape1 was left on the back burner. shortly after that time, i started an independent position at the university of california, davis. to stay clear of the emr lab (which, for a new assistant professor, loomed like an 800-pound gorilla), i pursued an analysis of the vacuolar h - translocating atpase and vacuolar acid trehalase. at that time, scott forwarded to me a letter (this was just before email became widely used) from a postdoc applicant that he was not able to invite to his lab. that postdoc, nieves garcia alvarez, was from one of the labs, that of paz suarez - rendueles, which was involved in characterizing yeast vacuolar hydrolases, and i agreed to offer her a position. i knew, however, that her lab in spain was one of two that had essentially simultaneously sequenced the ape1/lap4 gene encoding prape1. during nieves ' time in my lab, i wrote to beth jones who had published one paper on ape1 and asked if she intended to pursue this topic ; i did not want to compete with her, but she indicated that she was not going to be working on it, and i was welcome to it. thus, i obtained the gene from the suarez - rendueles lab and a new postdoc from that lab, rosaria cueva noval, along with my postdoc debbie yaver and me, began to examine the vacuolar targeting of prape1. the initial experiments on prape1 were confusing, because i could not find any evidence for glycosylation or for the existence of the protein within the compartments of the secretory pathway. (as a side note, our first paper on ape1 was published back - to - back with the first paper from yoshinori ohsumi 's lab on the characterization of autophagy in yeast. this was coincidental, and, to be honest, i paid no attention to the ohsumi paper at that time, because it was on the topic of autophagy ; i was studying protein targeting, not some presumed garbage pathway that was only used for protein degradation.) eventually, it dawned on me that the published data were incorrect and that ape1 was not a glycoprotein. at this time, fred dice was making headlines with his analysis of the kferq(kferq being the consensus sequence for the recognized substrates) or pentapeptide - dependent pathway for the transport of proteins into the lysosome (the current name for this pathway, chaperone - mediated autophagy, had not been coined yet). considering that ape1 was not a glycoprotein, and that it did not enter the endoplasmic reticulum, i reasoned that it entered the vacuole by translocating directly across the limiting membrane. accordingly, i further assumed that there must be protein machinery, similar to the as yet uncharacterized components involved in the kferq pathway, in the vacuolar membrane just waiting for me to come along and identify them. therefore, in order to identify the vacuolar membrane translocation components, we generated a chimera of prape1 fused to the his3 gene. our initial screen was based on the idea that a his3 mutant strain of yeast would not be able to grow in the absence of histidine if the chimera was efficiently delivered to the vacuole. accordingly, we could isolate mutants that were able to grow without histidine, and they would have defects in the various components of the translocation machinery. it became clear early on that the screen was not working, although we did not know why ; we could not easily follow the localization of the chimera because the green fluorescent protein was not yet being used for cell biology studies. randy schekman was giving a seminar on campus at that time, and i told him about our project. he suggested that we generate antibodies that only recognized prape1 and carry out a screen looking for mutants that accumulate the precursor form of the protein. we did attempt that approach, using colony blots after transferring cells to nitrocellulose, but it was very difficult to score positive colonies. however, we also noticed that wild - type cells analyzed by western blot, when grown appropriately, had essentially no prape1 ; all of the protein was in the mature form. we also determined (using a pep4 mutant as the control) that we could easily detect the precursor that accumulated when one out of ten colonies was defective for prape1 maturation. accordingly, even though it was laborious, tanya harding, and later ann hefner - gravink, in my lab began to analyze random mutants in batches of ten for the accumulation of prape1. this was quite exciting as we were finally about to identify the long - awaited translocation machinery for the vacuole. to be sure that we were not going to waste our time analyzing mutants that were already known, we began to compare our mutants with all other previously identified mutants that affected vacuolar protein delivery of course this included the vps mutants from tom stevens and scott emr, but also endocytosis mutants and vacuolar morphology (vam) mutants. even though we did not expect overlaps from the latter, we wanted to be thorough. in fact, we were so careful that we even requested protein extracts from yoshinori ohsumi and michael thumm, who had isolated apg and aut mutants, respectively, that are defective in autophagy. obviously (or so we thought at the time), there was not going to be an overlap ; autophagy is a degradative pathway, and our mutants (then named cvt) were defective in a biosynthetic pathway. imagine our surprise, and disappointment, when we found an essentially complete overlap among these three sets of genes [19, 20 ]. first, instead of having a unique set of mutants that we could study on our own, we knew we immediately had competitors. nonetheless, we continued with our studies of prape1 targeting and began to clone the cvt / apg / aut genes and analyze the gene products. after discovering the overlap with the apg genes, we sent purified antisera against ape1 to the ohsumi lab to be used in an electron microscopy analysis by misuzu baba. i can still remember yoshinori ohsumi cryptically telling me about some striking and exciting results that could not be described over the phone, but that had to be seen in person. this resulted in a visit to japan, and the viewing of images that were indeed striking, revealing that prape1 import was morphologically similar to autophagy (figure 1). much of the initial work on the characterization of the atg proteins was done in collaboration with the ohsumi lab [20, 2227 ] and also with the lab of bill dunn [22, 2832 ], who was studying peroxisome degradation in pichia pastoris. having established the historical perspective, we now present some of the details of those initial studies of the cvt pathway, starting with the characterization of aminopeptidase i import by a mechanism that is independent of the secretory pathway, identification of the vacuolar targeting domain, the isolation of mutants defective in prape1 delivery to the vacuole, and concluding with the genetic and morphological studies that revealed the overlap with autophagy. ape1 was initially characterized as a vacuolar enzyme that hydrolyzes leucine peptides (hence the original nomenclature leucine aminopeptidase, or lap, which is unfortunately confusing because lapi is encoded by the lap4 gene, whereas lapiv is encoded by lap2, etc.). the hydrolase is synthesized as an inactive zymogen containing a propeptide that may sterically block its active site ; it is processed to its mature form in the vacuole by proteinase b in a pep4-dependent manner. as mentioned above, published data suggested that the ape1 precursor was transported through part of the secretory pathway, because it was characterized as a glycoprotein. however, a detailed characterization of prape1 biosynthesis suggested that its delivery to the vacuole was independent of the secretory pathway : (1) prape1 lacks a signal sequence for transport into the er, and it is not glycosylated ; (2) the half - life of processing (i.e., removal of the propeptide in the vacuole) of prape1 is substantially longer (~30 min) than that of prc1 or pep4 (~6 min), both of which are transported to the vacuole via part of the secretory pathway ; (3) vacuolar import of prape1 is relatively unaffected by sec mutants. the obvious question then became, how does prape1 target to and enter the vacuole ? after it is synthesized as a 61-kda protein in the cytosol, prape1 is proteolytically processed to a mature 50-kda form in the vacuole. the prape1 propeptide plays an essential role in the transport process. a detailed mutagenesis analysis carried out by mike oda revealed that the first amphipathic -helix in the propeptide is critical for the vacuolar targeting of the enzyme. deletion of the precursor region or mutations that affect the first -helical region inhibit its binding to the membrane fraction and prevent subsequent vacuolar delivery and processing. further analysis by john kim revealed that prape1 is assembled as a dodecamer (~669 kda) in the cytoplasm prior to vacuolar delivery, which argued against direct translocation across the vacuole limiting membrane. a pulse chase analysis showed that the oligomeric assembly and the subsequent membrane association are very rapid events with a half - life of ~3 min. these results suggested that the long half - life of prape1 transport may be due to the rate limiting step of the import of the dodecameric enzyme into the vacuole lumen after its binding to membrane. the oligomerization of prape1 and the slow kinetics of import into the vacuole argued against transport through the secretory pathway. to understand the mechanism of vacuolar delivery, a detailed biochemical and genetic analysis was carried out in s. cerevisiae, which revealed that autophagy and the cvt pathway largely share the same machinery for double - membrane vesicle formation [16, 19, 20, 27 ]. a genetic screen to analyze the cvt pathway was carried out by monitoring the accumulation of prape1 as described in section 1. from the initial screen, five cvt mutants (cvt2/atg7, cvt3, cvt5/atg8, cvt6 and cvt7/atg9) were isolated, which showed a complete block in prape1 processing, but were not defective in the maturation of the precursor form of prc1 or pep4. most of these mutants also showed a defect in nonselective autophagy [19, 20 ]. just prior to the isolation of the cvt mutants, michael thumm in dieter wolf 's lab isolated a series of aut mutants, based on defects in the degradation of the fatty acid synthase. the aut mutants including aut3 (cvt10/atg1), aut5 (cvt17/atg15), aut7 (cvt5/atg8), and aut9 (cvt7/atg9) also displayed a significant block in the maturation of prape1, providing genetic evidence for a role of these proteins in both the cvt pathway and autophagy. a similar analysis of the apg mutants from yoshinori ohsumi 's lab also revealed an extensive overlap. subsequently, all of the atg genes, except atg11, atg17, atg19, atg22, atg29, and atg31 were found to be required for both pathways. in 2003 the genetic overlap between the cvt and apg / aut mutants gave rise to the idea of a vesicle - mediated mechanism for prape1 import. indeed, electron microscopy analyses performed by misuzu baba revealed that the prape1 dodecamers further assembled into a large complex composed of multiple dodecamers (called an ape1 complex), and that in the cytoplasm this complex is surrounded by a double membrane - bound structure, followed by fusion with the vacuolar membrane, similar to what was observed in bulk autophagy. this result demonstrated the use of an autophagy - like mechanism for the cvt pathway. however, the double membrane structure enwrapping the ape1 complex (termed a cvt vesicle) is ~150-nm in diameter, in contrast with that of the autophagosome, which is 300900 nm. in addition, the cvt vesicle, in contrast to the autophagosome, excludes bulk cytoplasm. furthermore, while autophagy is induced under starvation conditions, the cvt pathway occurs constitutively in growing conditions. finally, as we mentioned above, the cvt pathway is a selective, biosynthetic pathway, whereas autophagy is generally nonselective and is degradative. importantly, when cells are subjected to starvation, the cvt complex is sequestered within a larger autophagosome, although the kinetics for import are essentially the same as during vegetative growth. thus, while the biosynthetic cvt pathway can be distinguished from autophagy, the ape1 complex can be taken up by autophagosomes under starvation conditions, again suggesting that the cvt pathway and autophagy utilize much of the same machinery. in s. cerevisiae, the biogenesis and the vacuolar transport of both autophagosomes and cvt vesicles include the following steps : (1) membrane from various sources generates vesicles containing atg9 (see below) as a critical integral membrane protein, and these vesicles form into tubulovesicular clusters in a snare - dependent manner ; (2) one or more clusters contribute to the formation of a perivacuolar phagophore assembly site (pas), which is considered to be a foundation / nucleation site that (3) leads to formation of the phagophore, the initial sequestering compartment ; (4) two ubiquitin - like protein conjugation systems including atg8 and its conjugation to phosphatidylethanolamine (pe) contribute to the formation and elongation of the phagophore to generate the double - membrane cvt vesicle and autophagosome ; (5) the completed vesicles dock and fuse with the vacuole, releasing the inner vesicle into the lumen where the single - membrane structures are referred to as cvt or autophagic bodies. both autophagosomes and cvt vesicles are said to be formed de novo, to emphasize the fact that their generation occurs by a mechanism that is distinct from that used in the budding of transient transport vesicles in the secretory pathway. although the details of sequestering vesicle biogenesis are still not clear, almost all of the atg proteins are localized at least transiently to the pas. atg9, which is the sole integral membrane protein in yeast that is essential for cvt vesicle and autophagosome formation, is relatively unique in that it is localized at multiple sites including the pas. the population of atg9 at the non - pas sites (atg9 reservoirs) corresponds to the tubulovesicular clusters and is proposed to traffic between these sites and the pas, providing membrane for phagophore expansion. for example, atg8pe participates in cargo recognition during selective types of autophagy and is also involved in determining the size of the autophagosome, but the details of these mechanisms are not known. as mentioned above, not all of the cvt and apg / aut mutants displayed an overlap ; some mutants were defective only in autophagy or the cvt pathway, but not both. for example, the atg11 mutant shows a complete block in the maturation of prape1, but is essentially normal for autophagy [19, 23 ]. these results suggested that the cvt pathway and autophagy share most of the same machinery, but that they also need some molecules that are specific for each pathway. one of the fundamental differences between the cvt pathway and autophagy concerns their temporal and physiological activity. the cvt pathway is active during vegetative growth, consistent with its role as a biosynthetic trafficking route. in contrast, autophagy is induced under starvation conditions, where it can break down cellular macromolecules to supply building blocks and energy. a complex of proteins including atg13, which is required both for the cvt pathway and autophagy, appears to be partly responsible for switching these pathways in response to changes in the environment. in starvation conditions, atg13 interacts with the atg1 complex including atg17, atg29, and atg31 to induce autophagy [22, 4143 ]. under vegetative conditions, atg13 may have a lower affinity for atg1, a condition that may promote the cvt pathway. atg13 is regulated by its phosphorylation status in a torc1-dependent manner ; atg13 is highly phosphorylated in growing conditions but dephosphorylated in starvation conditions [41, 44 ]. another characteristic of the cvt pathway is the specificity for its cargo, whereas macroautophagy is a nonselective process, suggesting that the cvt pathway requires a receptor, which recognizes the substrate. in this case, the substrate corresponds to the cargo of the cvt vesicles, which is comprised primarily of the ape1 complex. a systematic yeast two - hybrid screen in s. cerevisiae was performed and the gene product of yol082w was found as a potential interacting protein with prape1. biochemical analysis demonstrated that yol082w encodes a protein that functions as a receptor for the targeting of prape1 by the cvt pathway, and the gene was renamed cvt19 [46, 47 ] and later atg19. in atg19 cells, the precursor form of ape1 accumulates in the cytoplasm in both nutrient rich and starvation conditions, suggesting that atg19 is necessary for the targeting of prape1 both by the cvt pathway and autophagy. an important point in this regard is that import of prape1 by autophagy is still a selective process that utilizes a receptor protein ; this explains why the kinetics of import are the same as for the cvt pathway and are much faster than would be expected for bulk uptake of cytoplasm. an immunoprecipitation analysis showed that atg19 physically interacts with the propeptide of prape1, and the coiled - coil domain of atg19 mediates this interaction. localizes at the pas with the ape1 complex ; the combination of the ape1 complex bound to atg19 is referred to as the cvt complex. in atg19 cells, gfp - ape1 forms a dodecamer, but it does not localize at the pas. the kinetics of the maturation of prape1 and the degradation of atg19 are quite similar. together with the localization data, these findings suggest that atg19 is delivered to the vacuole by the cvt pathway along with the precursor ape1 dodecamer. interestingly, deletion of ape1 results in a dispersed atg19 distribution, and atg19 does not localize to the pas in ape1 cells, suggesting that the ape1 complex itself is required for concentrating its soluble receptor at this site. further analyses revealed that atg19-prape1 movement to the pas is dependent on atg11, which we now know acts as an adaptor or scaffold protein for selective autophagy pathways, such as the cvt pathway, and the selective autophagic degradation of peroxisomes and mitochondria (termed pexophagy and mitophagy, resp.) atg11 may mediate the transport of atg9 to the pas for selective autophagy during vegetative growth, whereas atg17 may carry out this role for bulk autophagy during starvation. atg11 has certain characteristics of a scaffold protein in that it interacts with several atg proteins, including atg1, atg9, atg17, atg19, atg20, and itself [51, 52 ]. in the cvt pathway, atg11 can then interact with atg19, allowing movement of the cargo to the pas. once at the pas, atg19 also interacts with atg8pe ; it is not known if both atg8 and atg11 bind atg19 at the same time, as their binding sites are distinct, but very close to each other. thus, atg19 is a receptor that is responsible for recognizing the prape1 dodecamer to target it to the pas due to its interaction with atg11. furthermore, atg19 leads to the incorporation of the cvt complex into a double - membrane vesicle (i.e., a cvt vesicle or autophagosome) via its interaction with atg8. in the absence of other atg proteins such as atg1, cvt vesicles, and autophagosomes do not form ; however, the cvt complex is still targeted to the pas, suggesting that atg19 transport of prape1 to the pas occurs independent of the vesicle formation steps. atg19 is both ubiquitinated and deubiquitinated in vivo, and these modifications of atg19 are required for the efficient trafficking of prape1 via the cvt pathway. atg19 interacts with the deubiquitinating enzyme ubp3, and the deletion of ubp3 leads to decreased targeting of prape1. furthermore, the mutation on the ubiquitin acceptor site, lys213 and lys216 of atg19, reduces the interaction of atg19 with prape1. thus, the ubiquitination and deubiquitination of atg19 are likely to play a structural or mechanistic role in the normal progression of the cvt pathway, instead of serving as a degradation signal for the proteasome. as described above, many of the yeast atg proteins responsible for the cvt pathway and autophagy have been identified, and the general mechanism involved in these processes has been explored through genetic and biochemical approaches. many processes involving membrane rearrangement and movement, such as endocytosis or membrane ruffling, require the cytoskeleton. the actin cytoskeleton is required for the selective cvt pathway, but not for nonselective autophagy in yeast. actin plays a role in trafficking of atg9 to the pas and recruitment of the cvt cargo in growing conditions. further studies identified actin - related proteins, including components of the arp2/3 complex, as playing a role in the transport of atg9 for specific types of autophagy. thus, the arp2/3 complex may allow atg9, along with its associated membrane, to move in a directed fashion to the pas along actin cables. the specific autophagy factors such as atg19 and atg11, and perhaps other molecular components, may serve as adaptors between the cvt cargo and the actin cytoskeleton. prior to the analysis of the cvt pathway, ams1 was shown to enter the vacuole independent of the secretory pathway, although the mechanism of import was unclear. we found that ams1 is another hydrolase targeted to the vacuole by the cvt pathway, as its delivery is blocked in cvt (atg) mutants. similar to prape1, ams1 forms oligomers composed of 4 to 6 of the 122-kda species in the cytosol, and the oligomeric state is maintained during the import process. ams1 transport is also mediated by atg19 and its binding site is distinct from that used by prape1. the ams1-atg19 interaction still occurs, but this complex is dispersed in the cytosol, whereas deletion of ams1 does not affect the transport of the prape1-atg19 complex. these results indicate that ams1, which is synthesized at a level that is substantially lower than prape1, might exploit the prape1-atg19 import system to achieve its own efficient transport to the vacuole. recently, it was shown that ams1 is delivered to the vacuole in an atg19-independent manner under starvation conditions. during autophagy, atg34 (yol083w), a homolog of atg19, functions as a receptor for ams1. in atg19 cells, however, ams1 is efficiently transported into the vacuole under starvation conditions by autophagy even in atg19 cells. a genome - wide yeast two - hybrid screen suggested that yol083w is an ams1 interacting protein, and atg34 indeed physically interacts with ams1. similar to atg19, atg34 binds atg8 and atg11 using distinct domains, and these interactions are essential for its function in targeting ams1 into an autophagosome ; an atg34 mutant that lacks its atg8 interacting motif forms a complex with ams1, but shows a defect in sequestration into autophagosomes. importantly, the transport of ams1 mediated by atg34 in starvation conditions is prape1 independent, unlike that mediated by atg19 in growing conditions. also recently, aspartyl aminopeptidase (yhr113w / ape4) was found to be a third cvt cargo protein. yeast two - hybrid analyses suggested that ape4 can associate with atg19 and prape1. unlike prape1, ape4 does not possess a propeptide region and it does not self - assemble into aggregates ; however, it still binds to atg19. an immunoprecipitation analysis with truncated versions of atg19 revealed that the three identified cvt cargo components, prape1, ams1, and ape4, associate with atg19 by binding to distinct sites. gfp - ape4 colocalizes with rfp - ape1 at the pas in growing conditions, and this localization is dependent on atg19. notably, ape4 transport to the vacuole by the cvt pathway is significantly decreased in ape1 cells, suggesting that ape4 relies on the prape1-atg19 complex for its targeting, similar to ams1 in vegetative conditions. in atg11 cells, ape4 can colocalize with prape1, but it does not localize at the pas. an intriguing question has been why yeast cells have utilized the cvt pathway to import a resident vacuolar hydrolase. in higher eukaryotes, there is no evidence for a cvt pathway, and the atg genes specifically involved in this pathway are not conserved ; in contrast, those genes that are also needed for autophagy are highly conserved. however, selective types of autophagy clearly take place in higher eukaryotes, including mitophagy and pexophagy. the molecular machinery involved in these processes in mammalian cells has not been completely elucidated, but it is likely that the general mechanism is conserved. for example, receptors such as bnip3l and bnip3 function as receptors in mammalian mitophagy, whereas atg32 carries out this function in yeast ; bnip3l and bnip3 are not homologs of atg32, but they are functional counterparts, supporting the concept of mechanistic conservation. furthermore, most of the machinery for the cvt pathway is also used for pexophagy and mitophagy, which, as noted above, take place in higher eukaryotes. this means that with regard to the atg proteins, the apparent absence of the cvt pathway in mammals may be viewed as a deficiency in the specific receptor atg19, rather than a major difference between yeast and other eukaryotes. returning to the initial question regarding the origin of the cvt pathway, one possibility is that the oligomeric structure of prape1 or ams1 is critical for stability and/or function. the size of the oligomeric form of these hydrolases would prevent translocation through the er translocon, necessitating a vesicle - mediated import process. thus, it would be problematic for this hydrolase to traverse the secretory pathway along with other newly synthesized glycosylated proteins. these vacuolar hydrolases are likely required in large amounts when the cell is starved or when aggregated proteins or damaged organelles accumulate, and the synthesis of most vacuolar hydrolases increases substantially during starvation. under these conditions, the efficient transport of these hydrolases as oligomers by means of a vesicle - mediated mechanism such as autophagy would be extremely efficient. it would seem reasonable for the cell to modify the autophagy pathway very slightly with the addition of a small number of specificity components to take advantage of the existing autophagy machinery and allow it to be used for various types of selective sequestration processes. | from today 's perspective, it is obvious that macroautophagy (hereafter autophagy) is an important pathway that is connected to a range of developmental and physiological processes. this viewpoint, however, is relatively recent, coinciding with the molecular identification of autophagy - related (atg) components that function as the protein machinery that drives the dynamic membrane events of autophagy. it may be difficult, especially for scientists new to this area of research, to appreciate that the field of autophagy long existed as a backwater topic that attracted little interest or attention. paralleling the development of the autophagy field was the identification and analysis of the cytoplasm - to - vacuole targeting (cvt) pathway, the only characterized biosynthetic route that utilizes the atg proteins. here, we relate some of the initial history, including some never - before - revealed facts, of the analysis of the cvt pathway and the convergence of those studies with autophagy. |
the anterior cruciate ligament (acl) plays a crucial role in knee stability, as it contrasts the combined movement of the tibia against the femur, anterior translation and internal rotation. acl injuries can affect one or both strands (anterior - medial and postero - lateral) and, on the basis of individual characteristics, can affect ligament function and knee stability, raising the need for surgical reconstruction. defining the prevalence of this condition is not easy, as lesions are often asymptomatic ; a study carried out on a large sample of students from a us college showed that the possibility of acl injury may be over 3% in 4 years of physical activity, with a higher risk in female population. surgical reconstruction for primary isolated acl lesions is performed using autograft (mostly patellar or hamstring tendons) or allograft (allogenic tissue from humans and of different sorts), while use of synthetic ligaments has recently attracted interest after being abandoned in the past due to a high failure rate. the choice of technique is based on clinical and biomechanical factors, or on tradition and surgeon experience, or for reasons of context, as shown by various investigations carried out among surgeons from different countries [2, 3 ]. the heterogeneity in the surgical management of this condition raised a need for clarity on the effectiveness of the different types of grafts, through a systematic, critical appraisal of the literature. the national guidelines system (snlg, sistema nazionale linee guida) of the ministry of health at the national institute of health (istituto superiore di sanit, iss) therefore engaged in the elaboration of a document aimed at guiding orthopaedic surgeons in the choice of best practice for primary anterior cruciate ligament reconstruction. the document does not evaluate the different systems for graft fixation, nor the different techniques for preoperative preparation or postoperative rehabilitation. the quick review document is an instrument designed to handle very specific clinical issues through a faster process than the one used to draw up guidelines. the panel created to carry out the activities needed to elaborate the quick review is monodisciplinary, in contrast to the one created for guidelines, and aims to answer a small number of clinical questions defined as crucial by the specialists, and to reduce all heterogeneous and sometimes inappropriate clinical practices. the panel of experts who collaborated to draw up this document included 14 orthopaedic surgeons, 2 physiatrists, 1 physiotherapist and 2 epidemiologists familiar with evidence - based medicine and the methodology for guidelines development. the working group included representatives from all the main national scientific societies of reference [gruppo di lavoro ortopedia basata sulle prove di efficacia (globe), societ italiana di artroscopia (sia), societ italiana di chirurgia del ginocchio, artroscopia, sport, cartilagine e tecnologie ortopediche (sigascot), societ italiana di medicina fisica e riabilitativa (simfer), and societ italiana di ortopedia e traumatologia (siot) ], supported by a balanced group of independent experts. all participants signed a declaration of absence of conflict of interests and of acceptance of the methodology as explained during the first meeting. the panel met twice (4 july 2008 and 6 february 2009), and all materials produced during the process for the elaboration of the document are available at : http://www.snlg-iss.it. the objectives of the document, the clinical questions on the effectiveness and safety of the types of graft to be used for anterior cruciate ligament reconstruction, the inclusion and exclusion criteria for studies and the timeframe to be considered in the bibliographic search were defined by the panel during the first meeting at the italian national institute of health (iss). the following databases were searched to gather evidence : pubmed, embase and cochrane library, including randomized clinical trials (rcts) and systematic reviews (srs) dated 20002008. figure 1 presents the search filters used for both questions (effectiveness and safety) and the main inclusion criteria.fig. 1search strategy and inclusion criteria search strategy and inclusion criteria qualitative assessment of systematic reviews, rcts and observational studies was carried out using a structured method [4, 5 ]. the selection of studies, their methodological evaluation and the extraction of data were carried out by specifically trained personnel. the evidence gathered from each study was summarized in tables, each specific to a single question and type of study. the summary tables adopted in this document are those defined by the national institute for clinical excellence (nice), updated in 2007. the recommendations were drawn up for each clinical question without adopting any specific grading system, that is, without using any structured system to grade the strength of recommendations. the intensity and certainty supporting all recommendations are reported in narrative form, without any symbol, graded score or hierarchy. each recommendation is introduced by a description of the discussion that led to its definition, to make clear the level of agreement of the working group. the panel adopted the grade system to carry out the critical appraisal of literature and to draw up the recommendations [611 ]. the critical appraisal of the literature was carried out for each outcome considered relevant by the panel, following the principles of this method. the quality of evidence, finally, was related to the assessment of all risks connected to adopting that specific procedure, thus reaching the definition of the recommendation. the final draft was shared by the panel in the second and last meeting, and then sent to four external referees, asking them to assess its readability and clarity, its clinical relevance and the feasibility of recommendations. the referee group included renowned orthopaedic surgeons with an interest in knee surgery and with active scientific production in the field. the full text of the document (currently available only in italian), including all suggestions from the referees, is available on the snlg website at : http://www.snlg-iss.it. the panel of experts who collaborated to draw up this document included 14 orthopaedic surgeons, 2 physiatrists, 1 physiotherapist and 2 epidemiologists familiar with evidence - based medicine and the methodology for guidelines development. the working group included representatives from all the main national scientific societies of reference [gruppo di lavoro ortopedia basata sulle prove di efficacia (globe), societ italiana di artroscopia (sia), societ italiana di chirurgia del ginocchio, artroscopia, sport, cartilagine e tecnologie ortopediche (sigascot), societ italiana di medicina fisica e riabilitativa (simfer), and societ italiana di ortopedia e traumatologia (siot) ], supported by a balanced group of independent experts. all participants signed a declaration of absence of conflict of interests and of acceptance of the methodology as explained during the first meeting. the panel met twice (4 july 2008 and 6 february 2009), and all materials produced during the process for the elaboration of the document are available at : http://www.snlg-iss.it. the objectives of the document, the clinical questions on the effectiveness and safety of the types of graft to be used for anterior cruciate ligament reconstruction, the inclusion and exclusion criteria for studies and the timeframe to be considered in the bibliographic search were defined by the panel during the first meeting at the italian national institute of health (iss). the following databases were searched to gather evidence : pubmed, embase and cochrane library, including randomized clinical trials (rcts) and systematic reviews (srs) dated 20002008. figure 1 presents the search filters used for both questions (effectiveness and safety) and the main inclusion criteria.fig. 1search strategy and inclusion criteria search strategy and inclusion criteria qualitative assessment of systematic reviews, rcts and observational studies was carried out using a structured method [4, 5 ]. the selection of studies, their methodological evaluation and the extraction of data were carried out by specifically trained personnel. the evidence gathered from each study was summarized in tables, each specific to a single question and type of study. the summary tables adopted in this document are those defined by the national institute for clinical excellence (nice), updated in 2007. the recommendations were drawn up for each clinical question without adopting any specific grading system, that is, without using any structured system to grade the strength of recommendations. the intensity and certainty supporting all recommendations are reported in narrative form, without any symbol, graded score or hierarchy. each recommendation is introduced by a description of the discussion that led to its definition, to make clear the level of agreement of the working group. the panel adopted the grade system to carry out the critical appraisal of literature and to draw up the recommendations [611 ]. the critical appraisal of the literature was carried out for each outcome considered relevant by the panel, following the principles of this method. the quality of evidence, finally, was related to the assessment of all risks connected to adopting that specific procedure, thus reaching the definition of the recommendation. the final draft was shared by the panel in the second and last meeting, and then sent to four external referees, asking them to assess its readability and clarity, its clinical relevance and the feasibility of recommendations. the referee group included renowned orthopaedic surgeons with an interest in knee surgery and with active scientific production in the field. the full text of the document (currently available only in italian), including all suggestions from the referees, is available on the snlg website at : http://www.snlg-iss.it. the panel agreed on two clinical questions, one related to the effectiveness and the other to the safety of arthroscopic acl reconstruction carried out using autograft (table 1), allograft (table 2) or synthetic graft (table 3). the literature search gathered 489 titles and abstracts, among which 30 articles met the defined selection criteria.table 1key questions, selected studies and recommendations on use of autograft in arthroscopic acl reconstructionkey questionsstudiesrecommendationsis use of autograft effective in patients with anterior cruciate ligament injury (with or without meniscal lesions and/or grade i / ii focal chondral lesions) and a shared indication to arthroscopic reconstruction?407 identified, 26 selected, 19 rated, 19 included clinical practice evidence is currently not sufficient to absolutely recommend use of one of the treated autograft techniques. higher stability subsequent to use of patellar tendon is proven, while use of hamstring is suggested in patients needing, for various reasons, to stay on their knees for long periods of time, and who therefore need a substantial reduction of intensity and length of painis use of autograft safe in patients with anterior cruciate ligament injury (with or without meniscal lesions and/or grade i / ii focal chondral lesions) and a shared indication to arthroscopic reconstruction?48 identified, 5 selected, 5 rated, 5 included research the methodological quality of the studies investigating the different autograft techniques is not very high. randomized studies are therefore needed, with good statistical power, adequate blinding procedures in the choice of outcomes and a standardized definition of interventions and outcomesqualitative studies are also needed, aimed at investigating patients (and clinicians) preferences in relation to the relevance of the considered outcomesfurther studies are finally recommended, aimed at testing the effectiveness of autograft with hamstring associated to extra - articular surgery to contain laxitytable 2key questions, selected studies and recommendations on use of allograft in arthroscopic anterior cruciate ligament reconstructionkey questionsstudiesrecommendationsis use of allograft effective in patients with anterior cruciate ligament injury (with or without meniscal lesions and/or grade i / ii focal chondral lesions) and a shared indication to arthroscopic reconstruction?407 identified, 3 selected, 2 rated, 2 included clinical practice use of autograft is recommended in anterior cruciate ligament reconstruction. use of allograft shows, in fact, higher failure rate and slightly increased risk of infective complicationsis use of allograft safe in patients with anterior cruciate ligament injury (with or without meniscal lesions and/or grade i / ii focal chondral lesions) and a shared indication to arthroscopic reconstruction?48 identified, 3 selected, 2 rated, 2 included research randomized studies are recommended, comparing the best techniques concerning the two types of graft (autograft and allograft) and providing information on the contextual (organizational, structural, cultural) determinants of effectiveness for each interventiontable 3key questions, selected studies and recommendations on use of synthetic grafts in arthroscopic anterior cruciate ligament reconstructionkey questionsstudiesrecommendationsis use of synthetic grafts effective in patients with anterior cruciate ligament injury (with or without meniscal lesions and/or grade i / ii focal chondral lesions) and a shared indication to arthroscopic reconstruction?235 identified, 3 selected, 2 rated, 2 included clinical practice lack of evidence does not allow recommendation of use of synthetic graft for anterior cruciate ligament reconstruction. the little available evidence suggests possible future development of use of such materials, but further studies are needed to assess their effectivenessis use of synthetic grafts safe in patients with anterior cruciate ligament injury (with or without meniscal lesions and/or grade i / ii focal chondral lesions) and a shared indication to arthroscopic reconstruction?48 identified, 0 selected, 0 rated, 0 included research randomized studies are recommended, aimed at comparing use of synthetic grafts and the best available techniques of autograft and allograft for anterior cruciate ligament reconstructionstudies aimed at identifying synthetic materials and the most appropriate methodologies for their use are also recommended key questions, selected studies and recommendations on use of autograft in arthroscopic acl reconstruction key questions, selected studies and recommendations on use of allograft in arthroscopic anterior cruciate ligament reconstruction key questions, selected studies and recommendations on use of synthetic grafts in arthroscopic anterior cruciate ligament reconstruction table 1 reports the question concerning autograft, the literature screening procedure and the recommendations as defined by the panel. twelve srs and seven rcts were selected for the assessment of the effectiveness of autograft, comparing use of patellar tendon (pt) versus hamstring (hs), while five retrospective studies were chosen to define the recommendations concerning safety. all selected reviews included mostly randomized or quasi - randomized prospective studies based on follow - ups of 2 or more years, and aimed at assessing the effectiveness of autograft using objectively measured or subjectively assessed mechanical or functional outcomes (laxity, stability, return to pre - injury activity and loss of flexibility). the assessment of laxity and stability defined with various measures [knee test (kt), lachman test, pivot shift test, international knee documentation committee (ikdc) score ], the frequency with which patients return to pre - injury activity and the loss of flexibility support the hypothesis that pt in several cases performs better than hs [1219 ], while hs appears to reduce anterior pain and loss of extension. the effect rates reported are often close to statistical significance (even if unable to prove superiority of one specific technique), confirmed by the results of the included rcts. these [2025 ] are not able to demonstrate differences between the two techniques due to the lower statistical power compared with the reviews of primary studies, and often show methodological flaws affecting the inferences. promising experiences using four - strand hamstring tendon have also been carried out, or using two - strand hamstring tendon associated to extra - articular plastic (2hs ep), to limit laxity in rotation. both seem to substantially improve hs graft performance in terms of stability, but require further investigation. evidence in relation to safety of autograft comes instead from uncontrolled observational studies and refers to infections, and in one case to mechanical and functional side - effects of surgical procedures. clusters of joint infections are reported among subjects who underwent acl reconstruction (1.62.6%), with slight predominance with hs use (5.7%) and an increase of risk, probably due to former acl reconstruction [relative risk (rr) = 5.1 ] or knee surgery (rr = 1.90) and to the use of some fixation systems for femur (rr = 4.5 for endobutton) or tibial (rr = 3.2 with metallic post and washers) fractures [29, 30 ]. the infection rate, in the absence of clusters, results < 1%, showing no differences in relation to the technique chosen., finally, show that donor - site complications are more frequent in hs grafts (6.2% versus 0.6% in pt), as are complications due to complicated procedures. pt graft appears therefore to be fairly superior to hs graft, in terms of stability, return to pre - injury activity and flexural strength, while use of hs can be reasonably restricted to specific situations, due to its effectiveness in reducing pain and loss of extension. evidence on safety is scarce and fragmentary, and no inferences can be made apart from a few suggestions on infective complications. the panel therefore decided to recommend use of pt due to its proven higher stability and to identify at the same time a possible subgroup of subjects for whom knee pain can represent a particular problem (e.g., some categories of workers), or for whom reducing length and intensity of pain as much as possible could be important, and define for this subgroup a specific indication for use of hs. table 2 summarizes the activities of the panel in relation to use of allograft. the study of prodromos. analyzes data from 20 case series from 18 studies on the stability of allograft, comparing them with data from a former meta - analysis on autograft. the global stability rate indicates higher efficacy of autograft, with 72% normal stability (versus 59% registered in the allograft group) and 5.3% abnormal stability (versus 14% registered in the allograft group). the differences observed between the two types of grafts were statistically significant in both cases (p < 0.001). moreover, higher efficacy of non - irradiated tissues (63%) versus irradiated tissues (43%, p < 0.001) has been observed, and of non - patellar tissue (64%) versus patellar tissue (57%, p < 0.001). krych.s review included one quasi - randomized study and five non - randomized studies comparing effectiveness between autogenic and allogenic patellar tendon graft. the follow - up was longer than 2 years, and the same rehabilitation protocols were adopted. no statistically significant differences emerged between the two types of grafts apart from the worse performance of allograft in terms of graft failure [odds ratio (or) = 5.03, 95% confidence interval (ci) 1.3818.33 ] and of hop test results < 90% versus healthy side (or = 5.66, 95% ci 3.0910.36). the panel, in accordance with the grade methodology, was invited to vote on the relevance of the outcomes considered in the selected studies. table 4 reports the assigned score, the quality score, the estimated effectiveness and the risk benefit assessment for each outcome.table 4comparison of allograft versus autograftoutcomerelevanceeffectiveness ratequality of evidencerisk benefitreturn to pre - injury activity8.3-criticalor 1.2 (0.72.0) favouring autograft+slight increase of infective complications in allograftgraft rupture8-criticalor 5.0 (1.418.3) favouring autograft++ikdc score7.7-criticalor 1.5 (0.210.4) favouring autograftthe sterilization procedures risk affecting the effectiveness of allograftlachman test5.8-importantor 2.7 (0.710.8) favouring autograft+pivot shift test5.8-importantor 1.2 (0.53.0) favouring autograft+hop test5-importantor 5.7 (3.110.4) favouring autograft+grade method 13 = unimportant ; 46 = important ; 79 = critical high = + + + + ; moderate = + + + ; low = + + ; very low = + comparison of allograft versus autograft 13 = unimportant ; 46 = important ; 79 = critical high = + + + + ; moderate = + + + ; low = + + ; very low = + graft rupture, re - operation rate, return to pre - injury activity and ikdc score were considered critical outcomes, and graft rupture in particular benefited from evidence much higher in quality than that gathered for other outcomes, supporting higher efficacy of autograft versus allograft. the other outcomes defined by the panel seemingly showed higher efficacy of autograft, even if the values did not reach statistical significance. evidence in relation to safety, on the other hand, relies on two studies and essentially concerns infective complications. centeno.s study was not assessed due to the inadequacy of its design and the irrelevance of the results. crawford.s study, on the other hand, reports a 3.3% (11/331) infection rate among 331 patients who underwent acl reconstruction between 2000 and 2002. all infections were observed among the 250 patients treated with aseptic allograft (4.4%, 11/250), while no infections were observed among the 81 subjects treated with sterile allograft or autograft. the type of graft (allograft versus autograft, rr = 3.3, n.s.), the type of treatment adopted to process grafts (aseptic versus sterile, rr = 70.5, 95% ci 1.1), use of supplemental tibial staples (use versus non - use, rr = 10, 95% ci 3.032.9) and use of a specific device (intrafix versus no fixation, rr = 10.6, non - significant) resulted as the main risk factors. moderate superiority of autograft as acl reconstruction technique is to be pointed out, on the basis of allograft performance (versus autograft), in relation to the outcomes considered relevant and the quality of selected evidence, subsequent to the risk benefit assessment. use of allograft, in fact, shows higher failure rate and higher risk of infective complications with aseptic tissue. table 3 reports the question concerning use of synthetic grafts and the scant evidence supporting the recommendations. the full text of a systematic review identified by the literature search resulted unavailable. two more studies (rcts) gathered by the literature search compared patellar tendon autograft and synthetic graft. the full texts of both of these articles underwent critical appraisal [39, 40 ], and the studies resulted of good quality, even if based on small populations (40 enrolled in muren.s study and 53 in nau.s study). muren.s study investigated use of a polypropylene device, the ligament augmentation device (lad), stitched to the autograft, while nau. investigated the use of the ligament advanced reinforcement system (lars), a device produced in france, fixed with titanium screws. follow the 40 randomized patients for 7 years (3 years for arthrometric assessment with kt 1000), reporting no significant differences between the two groups. the results of this study refer to patients with acute acl injuries, with time of injury less than 3 weeks prior to enrolment being an inclusion criterion., on the other hand, included patients who suffered acl injury no less than 6 months before enrolment, and showed a substantial equivalence after arthrometric tests (2.38 mm in pt versus 4.86 mm in lars, p < 0.05) and ikdc assessment. patients expressed a slight preference [assessed using the knee injury and osteoarthritis outcome score (koos) score ] for lars treatment at 6 and 12 months, but not at 24 months. the panel agreed on the potential benefits of synthetic grafts in acl reconstruction ; the lack of evidence, however, does not allow recommendation of use of such materials, and further investigations to assess their efficacy and safety are needed. table 1 reports the question concerning autograft, the literature screening procedure and the recommendations as defined by the panel. twelve srs and seven rcts were selected for the assessment of the effectiveness of autograft, comparing use of patellar tendon (pt) versus hamstring (hs), while five retrospective studies were chosen to define the recommendations concerning safety. all selected reviews included mostly randomized or quasi - randomized prospective studies based on follow - ups of 2 or more years, and aimed at assessing the effectiveness of autograft using objectively measured or subjectively assessed mechanical or functional outcomes (laxity, stability, return to pre - injury activity and loss of flexibility). the assessment of laxity and stability defined with various measures [knee test (kt), lachman test, pivot shift test, international knee documentation committee (ikdc) score ], the frequency with which patients return to pre - injury activity and the loss of flexibility support the hypothesis that pt in several cases performs better than hs [1219 ], while hs appears to reduce anterior pain and loss of extension. the effect rates reported are often close to statistical significance (even if unable to prove superiority of one specific technique), confirmed by the results of the included rcts. these [2025 ] are not able to demonstrate differences between the two techniques due to the lower statistical power compared with the reviews of primary studies, and often show methodological flaws affecting the inferences. promising experiences using four - strand hamstring tendon have also been carried out, or using two - strand hamstring tendon associated to extra - articular plastic (2hs ep), to limit laxity in rotation. both seem to substantially improve hs graft performance in terms of stability, but require further investigation. evidence in relation to safety of autograft comes instead from uncontrolled observational studies and refers to infections, and in one case to mechanical and functional side - effects of surgical procedures. clusters of joint infections are reported among subjects who underwent acl reconstruction (1.62.6%), with slight predominance with hs use (5.7%) and an increase of risk, probably due to former acl reconstruction [relative risk (rr) = 5.1 ] or knee surgery (rr = 1.90) and to the use of some fixation systems for femur (rr = 4.5 for endobutton) or tibial (rr = 3.2 with metallic post and washers) fractures [29, 30 ]. the infection rate, in the absence of clusters, results < 1%, showing no differences in relation to the technique chosen., finally, show that donor - site complications are more frequent in hs grafts (6.2% versus 0.6% in pt), as are complications due to complicated procedures. pt graft appears therefore to be fairly superior to hs graft, in terms of stability, return to pre - injury activity and flexural strength, while use of hs can be reasonably restricted to specific situations, due to its effectiveness in reducing pain and loss of extension. evidence on safety is scarce and fragmentary, and no inferences can be made apart from a few suggestions on infective complications. the panel therefore decided to recommend use of pt due to its proven higher stability and to identify at the same time a possible subgroup of subjects for whom knee pain can represent a particular problem (e.g., some categories of workers), or for whom reducing length and intensity of pain as much as possible could be important, and define for this subgroup a specific indication for use of hs. table 2 summarizes the activities of the panel in relation to use of allograft. the study of prodromos. analyzes data from 20 case series from 18 studies on the stability of allograft, comparing them with data from a former meta - analysis on autograft. the global stability rate indicates higher efficacy of autograft, with 72% normal stability (versus 59% registered in the allograft group) and 5.3% abnormal stability (versus 14% registered in the allograft group). the differences observed between the two types of grafts were statistically significant in both cases (p < 0.001). moreover, higher efficacy of non - irradiated tissues (63%) versus irradiated tissues (43%, p < 0.001) has been observed, and of non - patellar tissue (64%) versus patellar tissue (57%, p < 0.001). krych.s review included one quasi - randomized study and five non - randomized studies comparing effectiveness between autogenic and allogenic patellar tendon graft. the follow - up was longer than 2 years, and the same rehabilitation protocols were adopted. no statistically significant differences emerged between the two types of grafts apart from the worse performance of allograft in terms of graft failure [odds ratio (or) = 5.03, 95% confidence interval (ci) 1.3818.33 ] and of hop test results < 90% versus healthy side (or = 5.66, 95% ci 3.0910.36). the panel, in accordance with the grade methodology, was invited to vote on the relevance of the outcomes considered in the selected studies. table 4 reports the assigned score, the quality score, the estimated effectiveness and the risk benefit assessment for each outcome.table 4comparison of allograft versus autograftoutcomerelevanceeffectiveness ratequality of evidencerisk benefitreturn to pre - injury activity8.3-criticalor 1.2 (0.72.0) favouring autograft+slight increase of infective complications in allograftgraft rupture8-criticalor 5.0 (1.418.3) favouring autograft++ikdc score7.7-criticalor 1.5 (0.210.4) favouring autograftthe sterilization procedures risk affecting the effectiveness of allograftlachman test5.8-importantor 2.7 (0.710.8) favouring autograft+pivot shift test5.8-importantor 1.2 (0.53.0) favouring autograft+hop test5-importantor 5.7 (3.110.4) favouring autograft+grade method 13 = unimportant ; 46 = important ; 79 = critical high = + + + + ; moderate = + + + ; low = + + ; very low = + comparison of allograft versus autograft 13 = unimportant ; 46 = important ; 79 = critical high = + + + + ; moderate = + + + ; low = + + ; very low = + graft rupture, re - operation rate, return to pre - injury activity and ikdc score were considered critical outcomes, and graft rupture in particular benefited from evidence much higher in quality than that gathered for other outcomes, supporting higher efficacy of autograft versus allograft. the other outcomes defined by the panel seemingly showed higher efficacy of autograft, even if the values did not reach statistical significance. evidence in relation to safety, on the other hand, relies on two studies and essentially concerns infective complications. centeno.s study was not assessed due to the inadequacy of its design and the irrelevance of the results. crawford.s study, on the other hand, reports a 3.3% (11/331) infection rate among 331 patients who underwent acl reconstruction between 2000 and 2002. all infections were observed among the 250 patients treated with aseptic allograft (4.4%, 11/250), while no infections were observed among the 81 subjects treated with sterile allograft or autograft. the type of graft (allograft versus autograft, rr = 3.3, n.s.), the type of treatment adopted to process grafts (aseptic versus sterile, rr = 70.5, 95% ci 1.1), use of supplemental tibial staples (use versus non - use, rr = 10, 95% ci 3.032.9) and use of a specific device (intrafix versus no fixation, rr = 10.6, non - significant) resulted as the main risk factors. moderate superiority of autograft as acl reconstruction technique is to be pointed out, on the basis of allograft performance (versus autograft), in relation to the outcomes considered relevant and the quality of selected evidence, subsequent to the risk benefit assessment. use of allograft, in fact, shows higher failure rate and higher risk of infective complications with aseptic tissue. table 3 reports the question concerning use of synthetic grafts and the scant evidence supporting the recommendations. the full text of a systematic review identified by the literature search resulted unavailable. two more studies (rcts) gathered by the literature search compared patellar tendon autograft and synthetic graft. the full texts of both of these articles underwent critical appraisal [39, 40 ], and the studies resulted of good quality, even if based on small populations (40 enrolled in muren.s study and 53 in nau.s study). muren.s study investigated use of a polypropylene device, the ligament augmentation device (lad), stitched to the autograft, while nau. investigated the use of the ligament advanced reinforcement system (lars), a device produced in france, fixed with titanium screws. follow the 40 randomized patients for 7 years (3 years for arthrometric assessment with kt 1000), reporting no significant differences between the two groups. the results of this study refer to patients with acute acl injuries, with time of injury less than 3 weeks prior to enrolment being an inclusion criterion., on the other hand, included patients who suffered acl injury no less than 6 months before enrolment, and showed a substantial equivalence after arthrometric tests (2.38 mm in pt versus 4.86 mm in lars, p < 0.05) and ikdc assessment. patients expressed a slight preference [assessed using the knee injury and osteoarthritis outcome score (koos) score ] for lars treatment at 6 and 12 months, but not at 24 months. the panel agreed on the potential benefits of synthetic grafts in acl reconstruction ; the lack of evidence, however, does not allow recommendation of use of such materials, and further investigations to assess their efficacy and safety are needed. the document on graft choice in primary acl surgery is the first snlg experience of a quick review (documento di revisione rapida). the main feature of this type of document, apart from some methodological issues, is the specificity of topics, being mainly monospecialistic. its strong structure allowed the collation of all information needed to draw up the recommendation, and highlighted the core points for discussion. two reviews [34, 35 ] underwent critical appraisal in relation to the question concerning allograft. these two reviews included non - randomized studies (except for gorschewsky s quasi - randomized study). kyrch.s review, according to the grade method, started from a low quality level, while prodromos.s review, including case series with historic (non - concurrent) controls, started from a very low quality level. the critical appraisal of this evidence raised some difficulties, as the quality resulted often below the low or very low level. strongly recommending a specific procedure is embarrassing if the available evidence is of very low quality, even if the method states a certain independence between quality of evidence and strength of recommendation. the panel therefore decided to express recommendation strength in a narrative way, bringing together in the text both structured assessment of evidence and unstructured discussion. the author stated that this was due to the presence of a single study considering the type of preparation and sterilization used for patellar tissue in allograft. these treatments for sterilization with radiation and dehydration with acetone would have, in other words, decreased the efficacy of allograft, producing data against its use, and caused the heterogeneity of results. the evaluation of the outcomes, as defined by the grade method, enabled verification that the statistical test used by the author highlighted no significant heterogeneity in relation to the outcomes considered relevant (ex. the analysis of sensitivity, based on the inclusion / exclusion of gorschewsky.s study, did not substantially modify the results, causing only a loss of power that did non allow the results to reach statistical relevance. the panel agreed that the sterilization procedure used in gorschewsky.s study is to be considered responsible for the lower efficacy of the allograft, but that it is not currently adopted. therefore, the recommendation defined by the working group did not take into consideration the effects of this procedure on the effectiveness of the intervention. global agreement was reached for all questions and recommendations, irrespective of divergences arising in interpretation and assessment of some studies. evidence, in fact, showed overall homogeneity, and the clinical opinions from each member converged without affecting the richness of information. the results of the review are therefore coherent with current trends in clinical practice, although they do supply robust scientific data to support the choice of graft in acl primary surgery. available evidence allows recommendation of use of autograft over allograft in arthroscopic acl reconstruction and to recognize, for autograft, better performance of pt over hs. it is therefore appropriate to select one of these two main choices (pt and hs), assessing the indication on a case - by - case basis. it is also appropriate to consider allograft and artificial ligaments only in very selected cases, discouraging widespread use, given the potential risks and paucity of well - performed, well - designed clinical studies. consolidation of the experience in use of two- and four - strand hs and in using specific techniques to contain laxity is suggested. further investigations are also strongly suggested on use of synthetic grafts in studies comparing their effectiveness versus autograft. it is valuable to recall that stepwise introduction of new orthopaedic technologies should include preclinical testing, randomized clinical trials, multicenter studies and post - market surveillance, to provide surgeons with adequate information to make informed decisions regarding use of new technologies in their practice, including acl reconstruction with synthetic ligaments. finally, this experience confirms the feasibility of practice guidelines to drive an evidence - based approach in orthopaedic surgery. in this particular case, representatives from the scientific societies with an interest in knee surgery (siot, sia, sigascot, simfer, and globe) participated in collecting, analyzing and discussing the available data to develop evidence - based guidelines using a standardized and reliable methodology. the practice of evidence - based medicine can be conceptualized as the integration of the best available research evidence, clinical circumstances and patients values and preferences. evidence - based practice guidelines allow practitioners to develop treatments for a specific patient, on the bases of not only his / her experience and personal knowledge, but also the most up - to - date scientific evidence, reviewed and evaluated using a structured, detailed and explicit approach. through the process of guideline development, clinical and methodological experts evaluate and condense the universe of information available on a clinical issue into a useful set of parameters that the physician can complete with his / her own experience and knowledge in managing a patient. guidelines are not a substitute for continuing study, rather they represent a tool for the practitioner to provide the best care for his / her patients. ezio adriani, casa di cura mater dei, roma ; angelo cacchio, divisione di medicina riabilitativa, universit la sapienza, roma ; vincenzo condello, ospedale s. cuore don calabria, negrar (vr) ; franca dangelo, istituto superiore di sanit ; salvatore de masi, dipartimento prevenzione, asl 6, livorno ; bernardino di paola, casa di cura mater dei, roma ; andrea foglia, studi di fisioterapia riabilita, civitanova marche (mc) ; piermaria fornasari, istituto ortopedico rizzoli, bologna (banche del tessuto muscolo - scheletrico) ; giovanni giordano, istituto ortopedico rizzoli, bologna ; roberto iovine, azienda u.s.l. di bologna (societ italiana di medicina fisica e riabilitativa simfer) ; stefano lupparelli, universit degli studi, laquila ; massimiliano magaletti, artrogruppo, roma ; maurilio marcacci, universit degli studi, bologna (societ italiana di chirurgia del ginocchio, artroscopia, sport, cartilagine e tecnologie ortopediche sigascot) ; giuseppe milano, universit cattolica del sacro cuore, roma ; riccardo minola, gruppo policlinico, monza (societ italiana di artroscopia sia) ; roberto padua, ospedale sandro pertini, roma ; giuseppe rinonapoli, clinica ortopedica, universit degli studi, perugia ; emilio romanini, artrogruppo, casa di cura san feliciano, rome ; gustavo zanoli, casa di cura s. maria maddalena, rovigo (gruppo di lavoro ortopedia basata sulle prove di efficacia this article is distributed under the terms of the creative commons attribution license which permits any use, distribution and reproduction in any medium, provided the original author(s) and source are credited. | backgroundanterior cruciate ligament (acl) surgical reconstruction is performed with the use of an autogenic, allogenic or synthetic graft. the document issued by the italian national guidelines system (snlg, sistema nazionale linee guida) at the national institute of health aims to guide orthopaedic surgeons in selecting the optimal graft for acl reconstruction using an evidence - based approach.materials and methodsa monodisciplinary panel was formed to define a restricted number of clinical questions, develop specific search strategies and critically appraise the literature using the grading of recommendations assessment, development, and evaluation (grade) method. the final draft was shared by the panel and then sent to four external referees to assess its readability and clarity, its clinical relevance and the feasibility of recommendations.resultsautograft shows moderate superiority compared with allograft, in relation to the relevant outcomes and the quality of selected evidence, after an appropriate risk benefit assessment. allograft shows higher failure rate and higher risk of infection. the panel recommends use of autografts ; patellar tendon should be the first choice, due to its higher stability, while use of hamstring is indicated for subjects for whom knee pain can represent a particular problem (e.g., some categories of workers).conclusionsautograft shows better performance compared with allograft and no significant heterogeneity in relation to relevant outcomes. the grade method allowed collation of all the information needed to draw up the recommendations, and to highlight the core points for discussion. |
the online version of this article (doi:10.1007/s11306 - 014 - 0653-y) contains supplementary material, which is available to authorized users. pulmonary arterial hypertension (pah) is a severe vascular disease characterized by persistent precapillary pulmonary hypertension (ph) (stacher. 2002 ; fujiwara. 2008 ; nasim. 2011 ; olschewski 2010 ; bogaard. 2012 ; mmea and 2013), which can be either be idiopathic (sporadic-90 %, familial-10 %). pah can also be a complication associated with other conditions such as connective tissue disease, congenital heart disease, anorexigen use (dexfenfluramine), portal hypertension, and human immunodeficiency virus (stacher. 2012 ; international pphc, lane kb, machado rd, pauciulo mw, thomson jr,. 2000 ; mmea. evidence in the literature suggests that metabolic pathway abnormalities characterize and may play a significant role in the development and progression of pah (fessel. for example, pulmonary arterial endothelial cells (paecs) in pah share similar hyperproliferative characteristics as malignant tumor transformation that is accompanied by significant metabolic shifts to support anabolic growth and energy metabolism (xu. 2005 ; chen. moreover, it has been shown that mitochondrial oxidative phosphorylation with glucose uptake and utilization occurs in paec development. significant elevation of hemoglobin has been found in the pah sample group without a history of diabetes or any other obvious metabolic diseases, indicating the impairment of whole - body glucose homeostasis in pah (pugh. additionally, vascular changes under chronic hypoxic condition has been directly linked to an imbalance between glycolysis, glucose oxidation, and fatty acid oxidation (sutendra. 2010), while in vitro pulmonary arterial endothelial cell culture with disruption of the bone morphogenetic protein receptor ii (bmprii) gene showed significant metabolomic changes (fessel. our recent work showed that disrupted glycolysis, increased tca cycle, and fatty acid metabolites with altered oxidation pathways exited in the human pah lung, indicating that pah has specific metabolic pathways contributing to abnormal atp synthesis for the vascular remodeling process in pulmonary hypertension (zhao. 2014). collectively, in vitro, human and animal models suggest that multiple metabolic pathways are reprogrammed during pah vascular remolding and that metabolic heterogeneity may play an important role in both atp energy supply and the molecular pathogenesis of pulmonary hypertension. here, we provide direct evidence of a novel increase in bile acid metabolites in pah lung tissue associated with the elevated expression of bile acid synthesis related transcripts, indicating de novo synthesis of bile acids may characterize and contribute to the pathogenesis of pah. global biochemical profiles were determined in human lung tissue and compared across 8 normal (47 15 years of age, 4 females) and 8 pulmonary arterial hypertension patients (40 12 years of age, 5 females). control lung samples were obtained from normal tissue of cancer patients undergoing surgery (lobectomy). biospecimens and associated clinical data related to the study were collected with written consent from the university health network and approved by the internal review board. unbiased metabolomic profiling using liquid / gas chromatography coupled to mass spectrometry (lc / gc ms) was performed as described (reitman. mrna samples from the normal (n = 8) and native pah lungs (n = 8) were isolated as described (zhao. bile acid related profiles were compared between a control group and samples with idiopathic pulmonary arterial hypertension. briefly, the total rna analysis in lung tissues was performed using trizol extraction according to the manufacturer s instructions. biotinylated crna was prepared according to the standard affymetrix protocol (expression analysis). following fragmentation the data were analyzed with partek genomics suite 6.6 using the affymetrix default analysis settings and global scaling as the normalization method. significantly changed genes were determined by t test with a false discovery rate of two fold. the data base has been submitted to ncbi / geo and has been approved and assigned a geo accession number gse53408. protein concentrations were determined using the bca protein assay (pierce, il, usa). equal amounts of the protein lysates were separated by sds - page and transferred onto nitrocellulose membranes. the membranes were incubated for overnight at 4 c with the following antibodies from abcam : anti - cyp7b1(1:1,000). after wash with tbs - tween, the blots were incubated for 60 min at room temperature with horseradish peroxidase - conjugated antibodies, respectively : anti - rabbit antibody (1:15,000 ; sigma - aldrich, st. signals from immunoreactive bands were visualized by fluorography using an ecl reagent (pierce). the sections of both pah and normal lung tissue were fixed for 4 h at room temperature with pbs made of 4 % formaldehyde, permeabilized for 30 min in triton x-100 (0.5 % in pbs), and incubated with 5 % nonfat skim milk in pbs for 90 min. sections were incubated for 180 min at room temperature with antibodies for anti - cyp7b1 (1:1,000). mrna samples from the normal (n = 8) and native pah lungs (n = 8) were isolated as described (zhao. bile acid related profiles were compared between a control group and samples with idiopathic pulmonary arterial hypertension. briefly, the total rna analysis in lung tissues was performed using trizol extraction according to the manufacturer s instructions. the data were analyzed with partek genomics suite 6.6 using the affymetrix default analysis settings and global scaling as the normalization method. significantly changed genes were determined by t test with a false discovery rate of two fold. the data base has been submitted to ncbi / geo and has been approved and assigned a geo accession number gse53408. protein concentrations were determined using the bca protein assay (pierce, il, usa). equal amounts of the protein lysates were separated by sds - page and transferred onto nitrocellulose membranes. the membranes were incubated for overnight at 4 c with the following antibodies from abcam : anti - cyp7b1(1:1,000). after wash with tbs - tween, the blots were incubated for 60 min at room temperature with horseradish peroxidase - conjugated antibodies, respectively : anti - rabbit antibody (1:15,000 ; sigma - aldrich, st. signals from immunoreactive bands were visualized by fluorography using an ecl reagent (pierce). the sections of both pah and normal lung tissue were fixed for 4 h at room temperature with pbs made of 4 % formaldehyde, permeabilized for 30 min in triton x-100 (0.5 % in pbs), and incubated with 5 % nonfat skim milk in pbs for 90 min. sections were incubated for 180 min at room temperature with antibodies for anti - cyp7b1 (1:1,000). we explored and characterized the metabolomic signature of pulmonary hypertension (pah) to enhance our understanding of disease progression. using untargeted metabolic profiling, we found that pah lung (n = 8) possessed significantly higher levels of multiple bile acid metabolites, including the primary bile acids taurocholate (fig. 1), glycocholate (fig. bile acids are normally synthesized in the liver and gallbladder from cholesterol by 7-alpha - hydroxylase, also called cytochrome p450 (cyp7a1), as a rate - limiting enzyme in the synthesis of bile acid via the classic pathway (nishimoto. although the presence of bile acids in lung tissue may partially reflect reflux in these patient (dovidio. 2009), microarray analysis surprisingly revealed that the gene encoding cytochrome p450 b1 (cyp7b1), but not cyp7a1, had a significantly higher expression in pah lung (fig. further molecular analysis using western blot showed that the expression of cyp7b1enzyme was higher in pah lung (fig. these results suggest that increased bile acid metabolites may not solely be due to reflux from the esophagus (dovidio. thus, pah lung tissue may have the capacity for de novo synthesis of bile acids. notably, increased bile acids metabolites could potentially serve as biomarkers for disease progression. by applying immunohistochemistry, cyp7b1positive immunostaining was found in pulmonary vascular endothelial cells, specifically in newly formed vascular endothelial cells in plexiform lesions of occluded pulmonary arteries (fig. 4c), suggesting that cyp7b1may also be involved in the vasculogenesis during the vascular remodeling process of pah (fig. 5). this hypothesis needs to be further tested by additional functional analyses. in summary, we have shown direct evidence that a de novo synthesis of bile acid may be involved in pathogenesis of pah, suggesting that bile acids in lavage fluid may serve as ideal biomarkers for the diagnosis and prognosis of pah.fig. top panel shows a representative negative ion, selected ion chromatogram (sic) for taurocholate (m / z 514.3) in normal (nl) and pulmonary hypertension (pah) lung tissue. taurocholate compound identification relied on confirmed experimental ms / ms fragmentation spectrum matched to the authenticated taurocholate standard, run separately (bottom panel). representative negative ion is selected ion chromatogram (sic) for glycocholate (m / z 464.4) in normal (nl) and pulmonary hypertension (pah) lung tissue (top panel). glycocholate compound identification relied on confirmed experimental ms / ms fragmentation spectrum matched to the authenticated glycocholate standard, run separately (bottom panel) fig. intermediates in the bile acids pathway revealed significantly elevated levels of multiple glycine and taurine conjugated bile acids in the pah lung. data for normal lung (nl, n = 8) are represented in green boxes, while data for pulmonary hypertension lung (n = 8) are shown in pink boxes. quantities are in relative arbitrary units specific to the internal standards for each quantified metabolite and normalized to protein concentration (pah with red frame indicates p < 0.05 compared to nl fig. 4 a microarray data showed that the gene encoding cytochrome p450, family 7, subfamily b, polypeptide 1 (oxysterol 7-hydroxylase) was significantly highly expressed in pah lung. lung lysate was loaded and immunoblotted with antibody against cyp7b1 and gapdh (loading control). consistent with a significant increase of cyp7b1 gene expression in pah, the enzyme protein for cyp7b1 (37kd) was significantly increased in pah lungs compared with nl lungs. data are expressed as mean sd (n = 4). p < 0.05 versus nl. c cyp7b1 positive immunostaining in newly formed small blood vessels (arrows) in the plexiform lesions of occluded pulmonary small vessel in pah lung. 5major intermediates in the classical bile acids pathway through cholesterol 7 alpha - hydroxylase, also known or cytochrome p450 7a1 (cyp7a1), are shown in blue. our finding suggests that pah lung has a specific bile acids pathway though cyp7b1, as shown in red ms / ms fragmentation spectrum of taurocholate in control and pah lung. top panel shows a representative negative ion, selected ion chromatogram (sic) for taurocholate (m / z 514.3) in normal (nl) and pulmonary hypertension (pah) lung tissue. taurocholate compound identification relied on confirmed experimental ms / ms fragmentation spectrum matched to the authenticated taurocholate standard, run separately (bottom panel). limited peak detection was observed in nl samples ms / ms fragmentation spectrum of glycocholate in control and pah lung. representative negative ion is selected ion chromatogram (sic) for glycocholate (m / z 464.4) in normal (nl) and pulmonary hypertension (pah) lung tissue (top panel). glycocholate compound identification relied on confirmed experimental ms / ms fragmentation spectrum matched to the authenticated glycocholate standard, run separately (bottom panel) pah lung has a unique bile acids metabolic pathway. intermediates in the bile acids pathway revealed significantly elevated levels of multiple glycine and taurine conjugated bile acids in the pah lung. data for normal lung (nl, n = 8) are represented in green boxes, while data for pulmonary hypertension lung (n = 8) are shown in pink boxes. quantities are in relative arbitrary units specific to the internal standards for each quantified metabolite and normalized to protein concentration (pah with red frame indicates p < 0.05 compared to nl a microarray data showed that the gene encoding cytochrome p450, family 7, subfamily b, polypeptide 1 (oxysterol 7-hydroxylase) was significantly highly expressed in pah lung. lung lysate was loaded and immunoblotted with antibody against cyp7b1 and gapdh (loading control). consistent with a significant increase of cyp7b1 gene expression in pah, the enzyme protein for cyp7b1 (37kd) was significantly increased in pah lungs compared with nl lungs. data are expressed as mean sd (n = 4). p < 0.05 versus nl. c cyp7b1 positive immunostaining in newly formed small blood vessels (arrows) in the plexiform lesions of occluded pulmonary small vessel in pah lung. (ratio 1:200) major intermediates in the classical bile acids pathway through cholesterol 7 alpha - hydroxylase, also known or cytochrome p450 7a1 (cyp7a1), are shown in blue. our finding suggests that pah lung has a specific bile acids pathway though cyp7b1, as shown in red below is the link to the electronic supplementary material. supplementary material 1 (docx 14 kb) supplementary material 1 (docx 14 kb) | although multiple, complex molecular studies have been done for understanding the development and progression of pulmonary hypertension (pah), little is known about the metabolic heterogeneity of pah. using a combination of high - throughput liquid - and - gas - chromatography - based mass spectrometry, we found bile acid metabolites, which are normally product derivatives of the liver and gallbladder, were highly increased in the pah lung. microarray showed that the gene encoding cytochrome p450 7b1 (cyp7b1), an isozyme for bile acid synthesis, was highly expressed in the pah lung compared with the control. cyp7b1 protein was found to be primarily localized on pulmonary vascular endothelial cells suggesting de novo bile acid synthesis may be involved in the development of pah. here, by profiling the metabolomic heterogeneity of the pah lung, we reveal a newly discovered pathogenesis mechanism of pah.electronic supplementary materialthe online version of this article (doi:10.1007/s11306 - 014 - 0653-y) contains supplementary material, which is available to authorized users. |
heterotopic pregnancy (hp) refers to the simultaneous presence of intrauterine pregnancy (iup) and ectopic pregnancy (ep), which is very rare but a potentially life - threatening condition. hp can be spontaneous or the subsequence of assisted reproductive technology (art), the spontaneous incidence of hp in general population is thought to be about 1 in 30,000, but with the widespread of art, the incidence of hp in woman with art raises to about 0.09% to 1.00%. the actual etiology of hp is still unknown, many researches have demonstrated that pelvic inflammatory disease, previous tubal surgery, ovarian stimulation, and art are high risk factors of hp ; however, some hp patients can be totally absent of these risk factors. the ectopic gestational sac of hp can be located at fallopian tube, uterus corner, uterus cervix, previous cesarean scar, or even abdomen. clinical presentations of hp are untypical, common presentations include vaginal bleeding, acute abdominal pain, and hypovolemic shock, while 1 report points out that about 50% hp patients can be totally asymptomatic. human beta chorionic gonadotropin is unimportant in the establishment of hp due to the co - existence of the iup. transvaginal sonographic examination plays an important role in the diagnosis of hp, which presents as an iup co - existed with a separated adnexal mass, gestational sac, or ring sign. however, even transvaginal sonographic examination has performed, the ep may also be missed or misdiagnosed as hemorrhagic corpus luteum cyst. in fact, it is estimated that about 58.93% to 73.75% cases of hp are not confirmed before surgery. so, it is a consensus that an early and accurate diagnosis of hp is often difficult. include expectant management, surgical management, and sonographic guided embryo aspiration with or without embryo - killing drugs. however, due to the rarity of hp, most publications about hp are case report or small case series, treatment experiences are limited, so there is no consensus on the preferred treatment modality of hp. the objective of this retrospective study is to summarize the experiences of our department in the management of hp and to analyze the influence of different treatment modality on the viable iup. there were 64 patients diagnosed as hp in the department of gynecology and obstetrics in our hospital between january 2003 and june 2014. the diagnostic criteria of hp were : in expectant management patients, hp was diagnosed mainly on the presence of an iup and typical ep sonographic characteristics ; in other patients, hp was diagnosed based on the intraoperative findings and histological examination of suspected ep tissues. all medical records and sonographic pictures are collected and reviewed carefully to exclude the misdiagnosis. since 1 objective of our study is to retrospectively analyze the influence of different treatment modality on the viable iup, 12 patients without viable iup before treatment are excluded, thus 52 patients are finally included in our study. patients are divided into 3 groups according to the treatment modality they received, those are expectant management group, surgical management group, and transabdominal sonographic guided transvaginal aspiration of ectopic gestational embryo (embryo aspiration) management group. all patients except those unconscious were well informed about their situation and the potential advantages and disadvantages of each treatment modality, the final treatment modality was confirmed based on the presentations, hemodynamic situation, and patients choice. basic demographics, such as pregnancy history, conception mode, gestational age, clinical presentations, location, sonographic characteristic, and hemodynamics situation, of all patients are presented in tables 13. characteristics of patients treated with expectant management characteristics of patients treated with surgical management characteristics of patients treated with tansabdominal sonographic guided transvaginal aspiration of ectopic gestational embryo in expectant management group, patients were under strict observation on any signs of the rupture of ep, such as the progression of abdominal pain and unstable hemodynamic presentations. transvaginal sonographic re - examinations were performed weekly to monitor the changes of ep mass and clues of hemoperitoneum. when the rupture of ep was suspected, rapid enlargement of ep mass was demonstrated or cardiac activity was presented, surgery was performed immediately to have good maternal results. in surgical management group, emergency surgery, either laparotomy or laparoscopy, was performed to those patients with unstable hemodynamic situations and to those rupture of ep were suspected. to those patients with stable hemodynamic situations, antibiotic was applied preoperatively and postoperative for 2 days to avoid infection. in embryo aspiration management group, patients received transvaginal sonographic re - examinations postoperative weekly to monitor the changes of ep mass and clues of hemoperitoneum. if enlargement of ep mass was demonstrated, another embryo aspiration or surgery would be performed. and if there was any sign of rupture, surgery was needed to rescue patient 's life. the endpoint of follow - up was the termination of this pregnancy. maternal outcome and pregnancy outcome were main therapeutic measurements. other therapeutic measurements included the transfer to other treatment modality, operation time, blood transfusion, and complications. this retrospective study was approved by the medical ethics committee of our hospital, all patients and (or) their husbands were well informed about their situation, and written informed consents were received before treatment. maternal outcome and pregnancy outcome of patients in expectant management group were showed in table 1. four patients suffered rupture of ep during hospitalization, the rupture rate was 20% (4/20). among them, 3 patients suffered tubal rupture and another patient suffered uterine corner rupture, emergency surgery was performed timely in these 4 patients. one patient showed cardiac activities of the ep and another patient showed gradual enlargement of ectopic gestational sac during weekly sonographic re - examinations, surgery was performed in both patients. one patient suffered a fever of 40.4c, she was uneventful after the application of antibiotic for 3 days. one patient ended up with abortion during observation 1 week later, the total abortion rate was 5% (1/20) during observation. three patients, with ongoing living iup before check out, lost follow - up because of the change of contact information. maternal outcome, pregnancy outcome, and operative data in surgical management group were presented in table 2. emergency surgery was performed in 9 patients with unstable hemodynamics ; among them, 6 patients needed blood transfusion, 2 patients suffered abortion during follow - up ; the abortion rate in patients with unstable hemodynamics was 22.22% (2/9). two patients with stable hemodynamics suffered abortion postoperative, the abortion rate was 11.11% (2/18). one patient suffered uterine rupture 5 weeks later after corner resection, dead fetus was demonstrated in the following surgery. two patients lost follow - up with viable iup because of the change of contact information. maternal outcome and pregnancy outcome of patients in embryo aspiration management group one patient showed obvious enlargement of the ectopic gestational sac by weekly sonographic re - examination 1 week later, another procedure was performed to avoid the rupture of ectopic gestational sac. an early and accurate diagnosis of hp is often difficult and challenging due to the rarity of hp, the delay or failure of diagnosis may lead to potential life - threatening conditions such as the rupture of ep, hypovolemic shock or even loss of life, so the early and accurate diagnosis of hp is extremely critical. though the sensitivity of transvaginal sonographic examination, ranged from 26.3% to 92.4%, in the definitive diagnosis of hp is still debatable, a routine transvaginal sonographic examination at 4 to 6 weeks after art to exclude ep and hp is recommended. so, an early transvaginal sonographic examination is recommended in early pregnancy, especially those patients conceived via art or those with other risk factors. unlike those patients with ep only, most hp patients are conceived via art and have a strong desire to preserve the viable iup, so the key point of treatment is to preserve the viable iup and to resolve the ep, this makes the treatment of hp difficult and challenging. to those patients with stable hemodynamic situation and asymptomatic, expectant management could be considered. the main advantage of expectant management is that it avoids all potential complications related to the surgery and transabdominal sonographic guided transvaginal aspiration of ectopic gestational embryo. nevertheless, expectant management should not be considered in patients with viable ep or unstable hemodynamic situation. as the risks of continued growth and rupture of ep still exist, 20% patients in expectant management group suffered rupture of ep eventually, 1 patient presented cardiac activities of ep and another 1 patient showed the enlargement of ep mass. those facts suggest that regular ultrasonographic re - examinations and close observations are essential for patients chosen expectant management. once there are any clues indicating rupture or enlargement of ep, other rescue treatment is recommended to have a good maternal outcome. surgical management, either laparotomy or laparoscopy, is a feasible treatment modality for hp. to those patients with unstable hemodynamic situation or with any signs indicating rupture of the ep, emergency surgery surgical removal of the ep mass includes salpingectomy, salpingostomy, cornual resection, oophorectomy, and even total abdominal hysterectomy. surgical management gains the advantage of complete removal of the ep mass, while there might be a higher abortion rate of the iup. in our research, total abortion rate in surgery management group was up to 14.8%, obviously higher than the other 2 groups. transabdominal sonographic guided aspiration of ectopic gestational embryo with or without embryo - killing drug, which is thought to be minimally invasive, has been performed as treatment modality of ep for years, its safety and effectiveness have been well demonstrated. the difficulty of this treatment modality in the management of hp depends on the location of the ectopic gestational sac, it should be attempted only when the ectopic gestational sac is clearly visualized. both potassium chloride and hyperosmolar glucose can be used as embryo - killing drugs in the management of hp, while methotrexate (mtx) should be avoided because of its teratogenic effects on the viable iup. since rupture of the ep after this procedure have been reported, repeated sonographic examination and strict observation are strongly advised till the ectopic gestational sac becomes stable. and if the enlargement of ep is demonstrated, a repeat procedure or change to surgery management is recommended. mtx is widely used in the conservative management of ep due to its highly effective to halt trophoblast proliferation. but evidence of mtx - related teratogenicity has already been observed in surviving intrauterine fetus after failed medical abortion or other treatment. though there are researches showed good therapeutic effect and no negative pregnancy outcomes with medical treatment of mtx, ; we hold the attitude that the use of mtx, no matter systematically or locally, should be avoided in the treatment of hp. one report pointed out that about 31.4% hp were end up with natural spontaneous abortion, in our research, the total abortion rate is 26.56% (17/64) in all hp patients, which is lower than previous reported, we speculate the reason is that part of hp are missed before diagnosis. clayton pointed out that 63.3% of iup kept on living when hp cases were treated properly and the miscarriage rate of hp patient underwent surgery was up to 31.25% (25/80). while in our research, at least 78.85% (41/52) hp patients finally delivered 1 or more babies and the abortion rate in surgery management group was 25.93% (7/27) at the most. we speculate this owns to the multi - team endeavor of gynecologist and experts in art in our center. due to the rarity of hp, it is difficult to conduct a randomized controlled trial. the limitation of our retrospective study is that patients enrolled in each group are indeed uncomparable in some basal clinical characteristics, it is difficult to point out which is the preferred treatment modality for most hp patients, so the treatment of hp should be individualized, and more researches are needed to be performed. in our retrospective study, transabdominal sonographic guided aspiration of ectopic gestational embryo has the best maternal outcome and the lowest abortion rate, surgical management group shows the highest abortion rate, and expectant management presents the worst maternal outcome. | abstractthe objective of this study is to summarize the experiences of our department in the management of heterotopic pregnancy (hp) and to analyze the influence of different treatment modality on the viable intrauterine pregnancy.there were 64 patients diagnosed as hp in the department of gynecology and obstetrics in our hospital between january 2003 and june 2014, 52 hp patients with viable intrauterine pregnancy were included and analyzed in our study. interventions included expectant management, surgical management and transabdominal sonographic guided transvaginal aspiration of ectopic gestational embryo (embryo aspiration) management.main outcome measures are maternal outcome and pregnancy outcome.in expectant management group, 4 patients suffered rupture of ectopic pregnancy, 6 patients transferred to surgical management, 1 patient suffered a fever of 40.4c, the abortion rate was 5% (1/20). in surgical management group, emergency surgery was performed in 9 patients with unstable hemodynamics and 3 patients with stable hemodynamics, 1 patient suffered uterine rupture 5 weeks later and dead fetus was demonstrated, 1 patient suffered urinary retention postoperative, the abortion rate was 14.8% (4/27). in embryo aspiration management group, 1 patient needed another embryo aspiration, all patients were eventful and no abortion was observed.in our retrospective study, transabdominal sonographic guided aspiration of ectopic gestational embryo has the best maternal outcome and the lowest abortion rate, surgical management group shows the highest abortion rate, and expectant management presents the worst maternal outcome. |
three similarly designed, phase iii, randomized, double - blind, 12-week studies evaluated the efficacy and safety of fa in combination with either rosuvastatin (3), simvastatin (4), or atorvastatin (2). after a 6-week lipid - altering drug washout period, all studies enrolled patients with mixed dyslipidemia (hdl cholesterol < 40 mg / dl [< 1.04 mmol / l ] for men, < 50 mg / dl [< 1.30 mmol / l ] for women ; triglycerides [tgs ] 150 mg / dl [1.70 mmol / l ] ; and ldl cholesterol 130 mg / dl [3.37 mmol / l ]). patients were assigned in a 2:2:2:2:2:1 ratio to 1 of 6 treatment arms : fa 135 mg monotherapy ; low - dose statin monotherapy ; fa 135 mg + low - dose statin ; moderate - dose statin monotherapy ; fa 135 mg + moderate - dose statin ; or high - dose statin monotherapy. each study used a different statin, and the respective doses of low-, moderate-, or high - dose statin were rosuvastatin 10, 20, or 40 mg, or simvastatin or atorvastatin 20, 40, or 80 mg. data were pooled across the 3 studies. for further details regarding patients and study design, assessments included the number and percent of patients with metabolic syndrome (6) at the final visit for each treatment group, as well as the number and percent of patients having individual metabolic syndrome diagnostic criteria at the baseline visit and at the final visit. in order to be included in these analyses, patients were required to have a final visit value for each metabolic syndrome diagnostic criteria. mean changes from baseline to final value in weight, blood pressure, and fasting glucose were analyzed using a one - way anova, comparing combination therapy with corresponding - dose monotherapies. percent changes in efficacy parameters were compared between combination therapy and corresponding - dose monotherapies as previously described (24). baseline data for all five metabolic syndrome criteria were available for 2,654 treated patients, and 2,190 (82.5%) patients had metabolic syndrome at baseline. the percent of patients with metabolic syndrome at baseline was generally similar within each of the 6 treatment groups and ranged from 79.9% (low - dose statin) to 85.8% (high - dose statin). across all treatment groups, 569 (26%) had a diagnosis of type 2 diabetes (supplemental appendix a, available in the online appendix at http://care.diabetesjournals.org/cgi/content/full/dc10-0357/dc1), and 461 (21.1%) received treatment with at least 1 antidiabetes drug. of the 2,190 patients in the metabolic syndrome subgroup, 2,003 patients had a final visit value for all metabolic syndrome criteria (with the exception of waist circumference since baseline values were carried forward). following 12 weeks of therapy in the 3 trials, fa + low- or moderate - dose statin reduced the number of patients meeting the diagnostic criteria for metabolic syndrome by 35.7 and 35.9%, respectively, compared with monotherapy with low-, moderate-, or high - dose statin (15.5, 16.6, and 13.8%, respectively). the percent of patients at baseline who met each individual metabolic syndrome criterion was comparable among all treatment groups (table 1). at the final visit, fa + statin substantially reduced the prevalence of the metabolic syndrome diagnostic criteria regarding hdl cholesterol and tg compared with statin monotherapy. the prevalence of the blood pressure metabolic syndrome criteria decreased slightly at the final visit in each treatment group. at the final visit, the prevalence of the fasting blood glucose criterion was decreased slightly following treatment with fa monotherapy or fa + statin but increased slightly in the statin monotherapy groups. prevalence of each metabolic syndrome criterion at the baseline visit and at the final visit, and changes from baseline to the final visit in metabolic syndrome parameters metabolic syndrome was defined as 3 or more of the following 5 criteria : hdl - c, < 40 mg / dl (< 1.04 mmol / l) for women ; tg, 150 mg / dl (1.70 mmol / l) ; blood pressure, 130 mmhg systolic or 85 mmhg diastolic or receiving treatment for hypertension ; fasting glucose, 100 mg / dl (5.55 mmol / l) or medical history of type 2 diabetes ; waist circumference, 102 cm for men, 88 cm for women. fasting blood glucose analyses included patients concomitantly using medication for type 2 diabetes. for prevalence analyses, only patients with metabolic syndrome at baseline who had both baseline and final visit values for the criteria although the hdl cholesterol and tg criteria were required entry criteria for participation in the studies, not all patients met these criteria at baseline because the lipid eligibility values were measured at the screening visit 1 week prior to randomization, while baseline lipid values occurred the day of randomization. statistically significant difference vs. corresponding - dose statin monotherapy (p < 0.001 for both hdl cholesterol and tg comparisons, p < 0.01 for all other comparisons noted). bl, baseline. regarding metabolic syndrome - associated lipid parameters, fa + low- or moderate - dose statin significantly decreased tg compared with fa or corresponding - dose statin monotherapy (p < 0.001) and significantly increased hdl cholesterol (p fa + low- or moderate - dose statin also resulted in similar or greater reductions in non - hdl cholesterol, apolipoprotein b, total cholesterol, vldl cholesterol, or high - sensitivity c - reactive protein compared with corresponding - dose statin (supplemental appendix b). the mean changes in glucose were slightly increased in all statin monotherapy groups but were slightly decreased in the fa monotherapy group and essentially unchanged in the fa + statin groups. mean increases in glucose with statin monotherapy ranged from 2.26 mg / dl (0.13 mmol / l) in the simvastatin 20 mg group to 7.46 mg / dl (0.41 mmol / l) in the atorvastatin 20 mg group. the mean change in fasting glucose was significantly different comparing fa + low- or moderate - dose statin with low- or moderate - dose statin monotherapy, respectively (p 0.002). overall, 54 (2.5%) of 2,190 patients in the metabolic syndrome subgroup initiated new antidiabetes medication during the study ; percentages were similar among treatment groups. mean changes in body weight ranged from 0.3 kg in the fa monotherapy group to + 0.3 kg in the fa + moderate - dose statin group. safety results in this metabolic syndrome subgroup were consistent with those observed in the overall population (7) (supplemental appendix c). baseline data for all five metabolic syndrome criteria were available for 2,654 treated patients, and 2,190 (82.5%) patients had metabolic syndrome at baseline. the percent of patients with metabolic syndrome at baseline was generally similar within each of the 6 treatment groups and ranged from 79.9% (low - dose statin) to 85.8% (high - dose statin). across all treatment groups, 569 (26%) had a diagnosis of type 2 diabetes (supplemental appendix a, available in the online appendix at http://care.diabetesjournals.org/cgi/content/full/dc10-0357/dc1), and 461 (21.1%) received treatment with at least 1 antidiabetes drug. of the 2,190 patients in the metabolic syndrome subgroup, 2,003 patients had a final visit value for all metabolic syndrome criteria (with the exception of waist circumference since baseline values were carried forward). following 12 weeks of therapy in the 3 trials, fa + low- or moderate - dose statin reduced the number of patients meeting the diagnostic criteria for metabolic syndrome by 35.7 and 35.9%, respectively, compared with monotherapy with low-, moderate-, or high - dose statin (15.5, 16.6, and 13.8%, respectively). the percent of patients at baseline who met each individual metabolic syndrome criterion was comparable among all treatment groups (table 1). at the final visit, fa + statin substantially reduced the prevalence of the metabolic syndrome diagnostic criteria regarding hdl cholesterol and tg compared with statin monotherapy. the prevalence of the blood pressure metabolic syndrome criteria decreased slightly at the final visit in each treatment group. at the final visit, the prevalence of the fasting blood glucose criterion was decreased slightly following treatment with fa monotherapy or fa + statin but increased slightly in the statin monotherapy groups. prevalence of each metabolic syndrome criterion at the baseline visit and at the final visit, and changes from baseline to the final visit in metabolic syndrome parameters metabolic syndrome was defined as 3 or more of the following 5 criteria : hdl - c, < 40 mg / dl (< 1.04 mmol / l) for women ; tg, 150 mg / dl (1.70 mmol / l) ; blood pressure, 130 mmhg systolic or 85 mmhg diastolic or receiving treatment for hypertension ; fasting glucose, 100 mg / dl (5.55 mmol / l) or medical history of type 2 diabetes ; waist circumference, 102 cm for men, 88 cm for women. fasting blood glucose analyses included patients concomitantly using medication for type 2 diabetes. for prevalence analyses, only patients with metabolic syndrome at baseline who had both baseline and final visit values for the criteria were included. although the hdl cholesterol and tg criteria were required entry criteria for participation in the studies, not all patients met these criteria at baseline because the lipid eligibility values were measured at the screening visit 1 week prior to randomization, while baseline lipid values occurred the day of randomization. statistically significant difference vs. corresponding - dose statin monotherapy (p < 0.001 for both hdl cholesterol and tg comparisons, p < 0.01 for all other comparisons noted). regarding metabolic syndrome - associated lipid parameters, fa + low- or moderate - dose statin significantly decreased tg compared with fa or corresponding - dose statin monotherapy (p < 0.001) and significantly increased hdl cholesterol (p < 0.001) compared with corresponding - dose statin (table 1). fa + low- or moderate - dose statin also resulted in similar or greater reductions in non - hdl cholesterol, apolipoprotein b, total cholesterol, vldl cholesterol, or high - sensitivity c - reactive protein compared with corresponding - dose statin (supplemental appendix b). the mean changes in glucose were slightly increased in all statin monotherapy groups but were slightly decreased in the fa monotherapy group and essentially unchanged in the fa + statin groups. mean increases in glucose with statin monotherapy ranged from 2.26 mg / dl (0.13 mmol / l) in the simvastatin 20 mg group to 7.46 mg / dl (0.41 mmol / l) in the atorvastatin 20 mg group. the mean change in fasting glucose was significantly different comparing fa + low- or moderate - dose statin with low- or moderate - dose statin monotherapy, respectively (p 0.002). overall, 54 (2.5%) of 2,190 patients in the metabolic syndrome subgroup initiated new antidiabetes medication during the study ; percentages were similar among treatment groups. mean changes in body weight ranged from 0.3 kg in the fa monotherapy group to + 0.3 kg in the fa + moderate - dose statin group. safety results in this metabolic syndrome subgroup were consistent with those observed in the overall population (7) (supplemental appendix c). this analysis is the first to report the effects of fibrate and statin combinations versus their respective monotherapies on the individual diagnostic components of metabolic syndrome. according to this subgroup analysis, the greatest reduction in the presence of metabolic syndrome occurred with the fa + statin combination, primarily because of the improvements in the tg and hdl cholesterol diagnostic components. although waist circumference was not measured at the end of the study, the lack of significant weight change in this study made it unlikely that changes in the waist circumference component altered the presence of metabolic syndrome. mean glucose levels rose with statins, but this effect was not statin - specific nor did it appear to be dose - related. the combination of fa with statins resulted in essentially no change in fasting blood glucose, similar to a recent report in type 2 diabetic patients (8), suggesting the possibility that fa may have mitigated the glucose - raising effect of statins. in summary, in this analysis of patients with mixed dyslipidemia and metabolic syndrome, fa combined with statins produced greater improvement in multiple metabolic parameters and in the percent of patients meeting diagnostic criteria for metabolic syndrome compared with either agent alone. | objectiveto compare fenofibric acid (fa) + statin to respective monotherapies on the prevalence of metabolic syndrome and its diagnostic components in patients with mixed dyslipidemia.research design and methodspost hoc analysis of over 2,000 metabolic syndrome patients administered either fa + low- or moderate - dose statin ; fa alone ; or low-, moderate-, or high - dose statin alone.resultsfa + low- or moderate - dose statin combination therapy reduced the presence of metabolic syndrome (35.7 or 35.9%, respectively) more than low-, moderate-, or high - dose statin monotherapy (15.5, 16.6, or 13.8%, respectively), mostly due to improvements in triglycerides and hdl cholesterol levels. mean glucose levels slightly decreased with fa monotherapy, slightly increased with statin monotherapy, and were essentially unchanged with fa + statin. fa with or without statin also reduced non - hdl cholesterol, apolipoprotein b, total cholesterol, vldl cholesterol, and high - sensitivity c - reactive protein.conclusionsfa + statin in patients with mixed dyslipidemia reduces the prevalence of metabolic syndrome. |
ion channels allow the selective movement of ions across cell membranes at very high rates. this process is best understood in highly selective k channel pores that can now be observed at atomic resolution (doyle., 1998 ; zhou., 2001 these pores contain several k ion binding sites, and multiple k ions move through the pore in a concerted fashion (bernche and roux, 2001 ; morais - cabral., 2001). the permeation mechanism so unequivocally proven by the k channel x - ray crystal structure (morais - cabral., 2001 ; zhou., 2001), that ions bind to specific sites within the pore, and unbinding and rapid conduction then results from electrostatic repulsion between ions bound simultaneously within the pore, had long been suggested based on functional evidence from electrophysiological experimentation (hodgkin and keynes, 1955 ; neyton and miller, 1988a, b ; jiang and mackinnon, 2000). a similar mechanism probably also accounts for ca selectivity and permeation in voltage gated ca channels (sather and mccleskey, 2003). recently, crystal structures of clc cl channels have been presented (dutzler., 2002, 2003). in a fascinating parallel with the k channels described above, cl ions are observed bound to three sites in the clc channel pore, and these binding sites are as close together as 4 (dutzler., 2003). again as with k channels, this agrees with prior functional evidence that clc channels have multiion pores that are capable of holding more than one anion simultaneously (pusch., 1995 ; fahlke., 1997 ; rychkov., 1998 ; winters and andreoli, 2002 ; this might suggest a similar cl permeation mechanism in these channels to that now accepted for k channel permeation (dutzler., other, structurally unrelated classes of cl channels also show biophysical properties of multiion pore behavior (bormann., 1987 ; halm and frizzell, 1992 ; tabcharani., 1993 ; dawson., 1999 ; qu and hartzell, 2000). the cystic fibrosis transmembrane conductance regulator (cftr) is a phosphorylation - regulated, atp - dependent epithelial cl channel (sheppard and welsh, 1999). as with most cl channels, cftr is weakly selective between different anions, although it selects strongly for anions over cations (dawson., 1999). its anion permeability sequence is similar to a classical hofmeister or lyotropic sequence, with anions that are more easily dehydrated (lyotropes) tending to show a higher permeability than anions that retain their waters of hydration more strongly (kosmotropes) (dawson., 1999). lyotropic anions also bind relatively tightly within the cftr cl channel pore, and as such they act as effective open - channel blockers of cl permeation (tabcharani., 1993 ; smith., 1999 ; linsdell, 2001a ; linsdell and gong, 2002). this mechanism of action is similar to that of a broad range of organic anions that act as open channel blockers of cftr (hwang and sheppard, 1999 ; linsdell, 2001b). these large blockers tend to act preferentially or exclusively from the intracellular side of the membrane, implying a structural asymmetry in the pore (linsdell and hanrahan, 1996a ; hwang and sheppard, 1999 ; linsdell, 2001b ; zhou., 2002). open - channel blockers have previously been used to reveal multiion pore behavior in the cftr channel pore (tabcharani., 1993 ; zhou., 2002 ; gong and linsdell, 2003a). most recently, we have used the highly permeant monovalent pseudohalide anion au(cn)2 as a functional probe of anion binding sites in the cftr pore (gong. here we characterize the blocking effects of divalent pseudohalide anions on cftr, and provide evidence that binding of multiple anions within the cftr pore promotes their permeation through the channel. we suggest that such a multiion mechanism may be part of the normal cl ion permeation process. experiments were performed on two mammalian cell lines, baby hamster kidney (bhk) and chinese hamster ovary (cho) cells. bhk cells used for macroscopic current recording were transiently transfected with wild - type or mutant forms of human cftr in the pires2-egfp vector (clontech) as described previously (gong., 2002a). briefly, plasmid dna was precomplexed with plus reagent (life technologies) for 15 min, followed by lipofectamine (life technologies) for a further 15 min. complexed dna was then diluted in supplement - free medium to a final concentration of 0.5 g ml and added to the cells. after 5 h at 37c and 5% co2, the medium was completely replaced with normal medium containing 5% fetal bovine serum. transiently transfected cells could be identified by fluorescence microscopy within 24 h and were used for patch clamp recording 14 d after transfection. cho cells used for single - channel recording were stably transfected with wild - type human cftr (tabcharani., 1991). in most cases, recordings were made using the excised, inside - out configuration of the patch clamp technique, as described in detail previously (linsdell and gong, 2002). briefly, cftr channels were activated after patch excision by exposure to 1560 nm protein kinase a catalytic subunit (pka) plus 1 mm mgatp. for blocker experiments, both the extracellular (pipette) and intracellular (bath) solutions contained (mm) : 150 nacl, 10 n - tris[hydroxymethyl]methyl-2-aminoethanesulfonate (tes), 2 mgcl2, except where extracellular [cl ] was reduced to 4 mm by replacement of 150 mm nacl by 150 mm na gluconate, nano3, or naclo4. for all macroscopic 2 a, cftr channels were locked in the open state by addition of 2 mm sodium pyrophosphate (ppi) to the intracellular solution after attainment of full pka - stimulated current amplitude (gunderson and kopito, 1994) as described previously (gong., 2002a ; linsdell and gong, 2002 ; gong and linsdell, 2003a, b). to estimate pt(no2)4 permeability, the intracellular solution contained (mm) : 100 k2pt(no2)4, 10 tes, 2 mgcl2, and the extracellular solution was (mm) : 150 kcl, 10 tes, 2 mgcl2. in some cases (fig. 3 c), outside - out patches were employed ; here both the intracellular (pipette) and extracellular (bath) solutions contained (mm) : 150 nacl, 10 tes, 2 mgcl2, and cftr channel activity was maintained by inclusion of 50 nm pka plus 1 mm mgatp in the pipette solution. putative blockers (k2pt(no2)4, k2ptcl4, k3fe(cn)6, k3co(cn)6) were added to the bath solution from stocks made up in normal experimental solutions. all solutions were adjusted to ph 7.4 using naoh or koh as appropriate. given voltages all chemicals were from sigma - aldrich except pka (promega) and k2pt(no2)4, k2ptcl4, and k3co(cn)6 (strem chemicals). current traces were filtered at 50 hz (for single - channel currents) or 100 hz (for macroscopic currents) using an eight - pole bessel filter, digitized at 250 hz to 1 khz, and analyzed using pclamp8 software (axon instruments, inc.). macroscopic current - voltage relationships were constructed using depolarizing ramp protocols (linsdell and hanrahan, 1996a ; linsdell and gong, 2002) or conventional voltage steps. except where indicated, background (leak) currents recorded before addition of pka were subtracted digitally, leaving uncontaminated cftr currents (linsdell and hanrahan, 1996a, 1998). the macroscopic current reversal potential (fig. 4) was estimated by fitting a polynomial function to the leak - subtracted current - voltage relationship. blocker concentration - inhibition relationships (fig. 1, b and d) were fitted by an equation of the form : (1)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}{\mathrm{fractional\;unblocked\;current}}={1}/ { \left \left[1 + \left \left({b}/{k_{{\mathrm{d}}}}\right) \right ^{{\mathrm{n}}_{{\mathrm{h}}}}\right ] \right { \mathrm{,}}}\end{equation}\end{document}where b is the blocker concentration, kd the apparent blocker dissociation constant, and nh the slope factor or hill coefficient. the relationship between the fractional unblocked current and membrane voltage was routinely fitted by the simplest version of the woodhull (1973) model of voltage - dependent block : (2)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}{i}/{i_{0}}={k_{{\mathrm{d } } } \left \left({\mathrm{v}}\right) \right } / { \left \left\{k_{{\mathrm{d } } } \left \left({\mathrm{v}}\right) \right + \left \left[{\mathrm{b}}\right ] \right \right\ } \right { \mathrm{,}}}\end{equation}\end{document}where i is the current in the presence of blocker, i0 is the control, unblocked current, and kd(v) is the voltage dependent dissociation constant, the voltage dependence of which is given by : (3)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}k_{{\mathrm{d } } } \left \left({\mathrm{v}}\right) \right = k_{{\mathrm{d } } } \left \left(0\right) \right { \mathrm{exp } } \left \left({-z{\mathrm{{\delta}}}vf}/{rt}\right) \right { \mathrm{,}}\end{equation}\end{document}where z is the effective valence of the blocking ion (actual valence multiplied by the fraction of the transmembrane electric field apparently experienced during the blocking reaction), and f, r, and t have their normal thermodynamic meanings. all other methodological details were as described in detail recently (linsdell and gong, 2002 ; gong. statistical comparisons between groups were performed using a two - tailed t test, with p 300 m, the f337a pore begins to show multiple occupancy by pt(no2)4 ions, and that repulsion between simultaneously bound ions is capable of expelling ions bound to the 13 d) ; cl or no3 binding in the outer mouth of the pore either physically or electrostatically prevents pt(no2)4 from exiting the pore, and so even in multiply occupied channels the blocker molecules ultimately return to the intracellular solution. interestingly, this lock - in effect of the permeant anions cl and no3 is apparently not shared by the impermeant kosmotropic anion gluconate (fig. 7), even though clo4 has been shown to bind tightly within the pore (linsdell, 2001a). thus, it appears that extracellular anions need to be permeant in order to lock intracellular pt(no2)4 ions in the pore, perhaps reflecting that they must enter deeply into the pore from the extracellular solution to do so. a pictorial model of pt(no2)4 block in f337a - cftr. (a) at depolarized voltages, pt(no2)4 enters only shallowly into the pore, and block is weak. (b) at hyperpolarized voltages, pt(no2)4 is driven deeper into the pore, where it interacts with a higher affinity binding site. (c) at high intracellular pt(no2)4 concentrations, multiple occupancy allows pt(no2)4 permeation through the pore as a result of destabilization between concurrently bound ions. our experiments do not give any information as to the location of the extracellular cl ion binding site underlying this effect, and a cl ion is simply shown occluding the outer mouth of the pore. this effect of extracellular cl is mimicked by the highly permeant no3, but not by the weakly permeant clo4 or the impermeant gluconate. previous evidence that cftr has a multiion pore has come from anomalous mole fraction effects on anion unitary conductance (tabcharani., 1993 ; but see linsdell, 2001c) and from apparent interactions between permeant and blocking anions bound simultaneously within the pore (zhou., 2002 ; gong and linsdell, 2003a). the present results suggest that multiple pt(no2)4 ions can bind simultaneously within the f337a - cftr pore (and perhaps also wild - type cftr), and also that pt(no2)4 binding may be able to occur concurrently with binding of extracellular cl or no3 ions. these results are therefore in agreement with previous results that permeant and blocking ions can bind simultaneously within the pore, and that the mutual destabilization associated with concurrent ion binding can speed anion exit from the pore (zhou., 2002 ; furthermore, our results suggest that binding of multiple pt(no2)4 anions inside the pore promotes their permeability through the pore, probably by a similar destabilizing effect. whether multiple cl ions bind within the pore during the normal permeation mechanism is much more difficult to prove (dutzler., 2003). our results suggest that, by removing a barrier to pt(no2)4 movement in the pore, the f337a mutation allows this anion to access a relatively high affinity binding site and simultaneously exposes it to multiion pore effects that destabilize its binding at high concentrations. this combination of tight binding and multiion destabilization leading to permeation has obvious parallels to the mechanism of cation permeation in voltage - gated k and ca channels, where the permeant ion binds tightly within the selectivity filter region, and is then destabilized and caused to permeate by repulsive interactions with other ions entering this region (bernche and roux, 2001 ; morais - cabral. potentially a similar mechanism may be used to allow rapid cl ion permeation in anion channel pores. | chloride permeation through the cystic fibrosis transmembrane conductance regulator (cftr) cl channel is blocked by a broad range of anions that bind tightly within the pore. here we show that the divalent anion pt(no2)42 acts as an impermeant voltage - dependent blocker of the cftr pore when added to the intracellular face of excised membrane patches. block was of modest affinity (apparent kd 556 m), kinetically fast, and weakened by extracellular cl ions. a mutation in the pore region that alters anion selectivity, f337a, but not another mutation at the same site that has no effect on selectivity (f337y), had a complex effect on channel block by intracellular pt(no2)42 ions. relative to wild - type, block of f337a - cftr was weakened at depolarized voltages but strengthened at hyperpolarized voltages. current in the presence of pt(no2)42 increased at very negative voltages in f337a but not wild - type or f337y, apparently due to relief of block by permeation of pt(no2)42 ions to the extracellular solution. this punchthrough was prevented by extracellular cl ions, reminiscent of a lock - in effect. relief of block in f337a by pt(no2)42 permeation was only observed for blocker concentrations above 300 m ; as a result, block at very negative voltages showed an anomalous concentration dependence, with an increase in blocker concentration causing a significant weakening of block and an increase in cl current. we interpret this effect as reflecting concentration - dependent permeability of pt(no2)42 in f337a, an apparent manifestation of an anomalous mole fraction effect. we suggest that the f337a mutation allows intracellular pt(no2)42 to enter deeply into the cftr pore where it interacts with multiple binding sites, and that simultaneous binding of multiple pt(no2)42 ions within the pore promotes their permeation to the extracellular solution. |
estrogen receptors (ers) are nuclear transcription factors that mediate the physiological functions of estrogenic compounds. these receptors exert many of their actions in the nucleus, where they bind to associated dna regulatory sequences and modulate the transcription of specific target genes. two er subtypes, (er) and (er), are known, and subsequent studies have indicated the presence of up to five different er isoforms (er15) that arise from alternative splicing of the last exon coding for er. nevertheless, the only fully functional er isoform appears to be the originally cloned 59 kda er1 isoform ; hence, this is the isoform referred to simply as er. both er and er are widely distributed throughout the human body, where they modulate biological functions in several organ systems. in addition to their obvious control of the female reproductive system, they also play key roles in skeletal, cardiovascular, and central nervous systems. er plays a more prominent role in the mammary gland and uterus, on the preservation of bone homeostasis, and on the regulation of metabolism. er has more pronounced effects on the central nervous system (cns) and immune system. moreover, the -subtype generally counteracts the er-promoted cell hyperproliferation in tissues such as breast and uterus and is generally considered a tumor suppressor in these organs. this antiproliferative effect exerted by er was also observed in several cancer tissues, such as, for example, breast, prostate, colon, renal, pleural mesothelioma, and glioma. in particular, the protective role of er in gliomas is also supported by the fact that the incidence of developing this type of cancer is smaller in women than in men, and the use of exogenous estrogens further reduces this incidence. all this evidence suggests that selective activation of this receptor subtype may be exploited in order to obtain an antitumor effect. several efforts have been dedicated so far to the development of er- or er-selective ligands. in particular, a great deal of attention has been focused on er-selective agonists, which have the potential to be used as antitumor agents because they predominantly activate the -subtype, thus being free from the undesired er-promoted proliferative effects on breast and uterus. however, this endeavor is particularly difficult since, in spite of a limited overall sequence identity (59%) in the ligand binding domains (lbd) of the two subtypes, the differences within the ligand binding cavities are at only two amino acid positions and consist of minor changes between hydrophobic residues. thus, leu384 and met421 in er are replaced by met336 and ile373, respectively, in er. a more important difference arises from the smaller volume of er binding pocket when compared to that of er, which may be exploited in the design of er-selective ligands. we have been involved in the optimization of selective er agonists that were developed by structural refinements of a monoaryl - substituted salicylaldoxime scaffold. in this article we describe how molecular modeling has indicated a simple way to introduce molecular variations that produced some salicylketoxime derivatives displaying significant improvements in binding affinity, transactivation activity, and subtype selectivity over their aldoxime counterparts. furthermore, for the first time further pharmacological evaluations were conducted on our oxime - based er-agonists, both in vitro, on a glioma u87 cell line, and in vivo on a murine xenograft model of the same tumor. some of the most potent and selective salicylaldoxime - based er-selective agonists were obtained by interchanging the respective positions of the hydroxyl and oxime groups of the salaldox a class, to produce compounds belonging to the salaldox b class (figure 1). we then decided to further analyze the complex derived by a docking procedure of the simplest member of the salaldox b class, compound 1 (figure 1), into er-binding cavity, in order to search for additional productive interactions that might enhance er binding affinity or selectivity. from this modeling analysis we realized that there is an empty hydrophobic cavity that abuts the aldoxime hydrogen atom and is delimited by phe356 and leu301 (figure 1 and figure 2a). therefore, we decided to fill this cavity with a suitable small lipophilic group, such as a methyl, an ethyl, or a trifluoromethyl substituent so that the binding affinity of the resulting compounds could be improved. a similar docking analysis of a methyl - ketoxime analogue of 1, such as compound 2a (figure 1), showed that this compound nicely fits into the receptor binding site and neatly places its methyl group in the lipophilic cavity (figure 2b). it should be noted that the presence of the ketoxime portion slightly distorts the pseudocycle, which is formed because of the intramolecular h - bond of these oxime derivatives. this is due to the larger steric interaction of the methyl group compared to a hydrogen atom with the adjacent arene c h bond. nevertheless, the most important interactions that are typical of these types of er ligands are maintained : in detail, both 1 and 2a have their oxime oh group participating in a highly energetic h - bond network with residues glu305 and arg346, and their antipodal phenolic oh group forms another h - bond with thr299 (figure 2a and figure 2b). general structures of salaldox a and salaldox b compounds ; position of the hydrophobic cavity in the complex of aldoxime 1 into er ; design of new ketoxime derivatives containing a methyl (2a), an ethyl (2b), or a trifluoromethyl (2 m) group. docking analysis of salicylaldoxime 1 (a) and salicylketoxime 2a (b) into er binding site. the volume of the small hydrophobic cavity is represented in yellow (pdb code of the starting er crystal structure is 2i0 g). in light of these theoretical results, we planned the synthesis of a selected series of methyl-, ethyl-, and trifluoromethyl - ketoximes (2a m, chart 1), where we could also investigate the effect due to the variation of the substitution pattern in the aryl substituent (r, chart 1). in particular, we wanted to verify whether the addition of an extra substituent (f, cl, or ch3) in the 3-position or the replacement of the phenol 4-oh with a group that is exclusively able to act as a h - bond acceptor (och3, f, cl) could lead to any further improvement of er affinity and selectivity. in fact, that portion of the molecules binds to the oh group of a threonine residue (thr299) of the receptor, which may act as a h - bond donor or acceptor. in fact, compounds possessing a p - oh group (2a d, 2i, 2k, 2 m, r = oh ; chart 1) are likely to mainly donate a h - bond to thr299, whereas the others (2e h, 2j, 2l, r = och3, f, cl ; chart 1) can only function as h - bond acceptors in their interaction with the same residue. it should be noted that oximes 2a l were obtained as single (e)-diastereoisomers, whereas trifluoromethyl - substituted oxime 2 m could only be obtained as a (e / z)-diastereoisomeric mixture (see discussion below). the synthesis of methyl- and ethyl - ketoximes 2a l followed a common, straightforward reaction sequence, starting from commercially available 5-bromo-2-hydroxyacetophenone (3) or 5-bromo-2-hydroxypropiophenone (4), respectively (scheme 1). the first step involved a pd - catalyzed cross - coupling reaction under classical suzuki conditions. in detail, compounds 3 and 4 were treated with 1.2 equiv of the appropriate arylboronic acid in the presence of aqueous sodium carbonate and a solvent mixture composed of toluene / ethanol (1:1). catalyst pd(pph3)4 was formed in situ by reaction of palladium acetate with a 5-fold excess of triphenylphosphine. conventional heating at 100 c overnight produced the desired aryl - substituted acetophenone (5e h, 5j, 5l) and propiophenone (6, 7) derivatives in good yields. ketoxime containing methoxy- or halogen - substituted aryl rings (2e h, 2j, 2l) were then obtained by a direct condensation with hydroxylamine hydrochloride. on the other hand, an intermediary bbr3-promoted deprotection of compounds 5e, 5f, 5j, 5l, 6, and 7 was needed to produce hydroxyaryl - substituted ketoximes (2a d, 2i, 2k), via the initial formation of ketones (8a d, 8i, 8k) followed by final condensation with hydroxylamine hydrochloride. reagents and conditions : (a) arb(oh)2 (1.2 equiv), pd(oac)2 (0.04 equiv), pph3 (0.2 equiv), aqueous 2 m na2co3, 1:1 toluene / etoh, 100 c, 16 h ; (b) nh2ohhcl, etoh h2o, 50 c, 16 h ; (c) bbr3, ch2cl2, 78 to 0 c, 1 h. as previously observed for structurally related salicylaldoxime derivatives, all methyl- and ethyl - ketoximes obtained in this manner possess the e - configuration in their oxime portion, which is also consistent with the high degree of stabilization induced by the energetic intramolecular h - bond between the oxime nitrogen atom and the adjacent oh group. these configurations were demonstrated by h and c nmr analysis of the final compounds 2a l. in the case of the methyl - ketoximes (2a, 2c, 2e l), the h nmr chemical shift values () of the methyl protons (2.44 2.46 ppm) closely correspond to the values reported in the literature for the e - isomer of analogous aromatic methyl - ketoximes. moreover, the most significant results are given by the c nmr chemical shift values of the methyl carbon atom (10.80 10.87 ppm), which nicely overlaps with the values observed for the e - isomer of previously reported aromatic methyl - ketoximes (11.5 12.4 ppm) and which differs substantially from the values reported for the z - isomers (21 21.4 ppm). by analogy, an e - configuration was assigned to ethyl - ketoximes 2b, d. the synthesis of trifluoromethyl - ketoxime 2 m required a different reaction sequence starting from commercially available 5-bromo-2-methoxybenzaldehyde (9), as shown in scheme 2. we followed a trifluoromethylation / oxidation protocol, which had already been applied to the synthesis of trifluoromethylketone 11, via the isolation of intermediate trifluoromethylcarbinol 10. subsequent pd - catalyzed cross - coupling reaction of bromoaryl 11 with 4-methoxyphenylboronic acid produced biphenyl derivative 12, which was deprotected with bbr3. the resulting dihydroxylated trifluoromethylketone 13 was then condensed with hydroxylamine hydrochloride, thus affording the final product 2 m. cf3, tbaf, thf, rt, 10 h ; then hcl (4.4 m), rt, 1 h ; (b) tempo, phi(oac)2 ch2cl2, rt, 13 h ; (c) 4-methoxyphenylboronic acid (1.2 equiv), pd(oac)2 (0.04 equiv), pph3 (0.2 equiv), aqueous 2 m na2co3, 1:1 toluene / etoh, 100 c, 16 h ; (d) bbr3, ch2cl2, 78 to 0 c, 1 h ; (e) nh2ohhcl, etoh h2o, 50 c, 16 h. in distinction with the ketoximes 2a l, which were obtained as single (e)-diastereoisomers, the trifluoromethylketoxime 2 m was obtained as an 8:2 e / z - diastereoisomeric mixture (note that in 2 m there is a nominal inversion of the e / z - diastereoisomers). assignment of the (e)-geometry to the most abundant isomer is based on a comparison of the nmr signals with a 2-hydroxyaryl - substituted trifluoromethylketoxime, which was characterized by crystallographic x - ray analysis. in fact, c nmr spectra of 2 m display peaks of the major isomer corresponding to the cf3 at 122.23 (quartet, jc f = 273.0 hz) and to the oxime carbon atom at 146.23 (quartet, jc f = 33.0 hz), which compare favorably to the corresponding peaks reported in the literature for the (e)-isomer of 1-(2,4-dihydroxy-3,5-dipropylphenyl)-2,2,2-trifluoroethanone oxime : 123.1 (quartet, jc this peculiar outcome of the condensation reaction of trifluoromethyl - ketone 13 with hydroxylamine is probably dictated by the substantial stereoelectronic repulsion that takes place when the oh and cf3 groups are placed on the same side, as in the (z)-isomer (figure 3). stereoelectronic repulsion occurring in the (z)-diastereoisomer of 2 m, which favors the formation of (e)-2 m. unfortunately, we were not able to separate the two isomers, and therefore, compound 2 m was submitted as a 8:2 (e / z)-diastereoisomeric mixture to the receptor binding assays reported below. l for er and er was measured by a radiometric competitive binding assay by using previously reported methods. the relative binding affinity (rba) values for the newly reported compounds, together with that previously obtained for reference aldoxime 1, are summarized in table 1. rba values are reported as percentage (%) of that of estradiol, which is set at 100%. determined by a competitive radiometric binding assay with [h]estradiol. preparations of purified, full - length human er and er (panvera) were used ; see experimental section. values are reported as the mean the range or sd of two or more independent experiments. the kd of estradiol for er is 0.2 nm and for er is 0.5 nm. ki values for the new compounds can be readily calculated by using the formula ki = (kd[estradiol]/rba) 100. the most important finding from these binding measurements is the confirmation of our initial hypothesis derived from the computer - aided drug design. in fact, when a methyl group is inserted onto the oxime portion of aldoxime 1, a general improvement of the binding affinity of the resulting ketoxime 2a is observed, which is particularly evident for er. in fact, 2a displays a 17-fold improvement in er-binding affinity and a 2-fold improvement in er-selectivity over its nonmethylated counterpart 1. it should be noted that the er-rba value of 45.7% observed for 2a corresponds to a ki of 1.1 nm, thus confirming the remarkably high affinity of this compound for the -subtype. an enlargement of the oxime alkyl substituent, from a methyl to an ethyl group, produces a compound (2b), which preserves an excellent affinity for er but also gains some affinity for er, thus resulting in an er selectivity that is less than that of 2a. the introduction of a m - fluorine atom into the 4-hydroxyphenyl group of compounds 2a and 2b, respectively, produced compounds 2c and 2d, which did not display any significant improvements over their nonfluorinated counterparts. rather, a marked loss of affinity for er was observed for methyl - ketoxime 2c. furthermore, when a m - methyl group (2i) or a m - chlorine atom (2k) was analogously inserted in the structure of 2a, an even more dramatic reduction of the binding to er was observed. as previously observed for other oxime derivatives, the presence of a p - methoxy group into the aryl substituent of these ketoxime derivatives always compromises the receptor binding affinities of the resulting compounds (2e, 2f, 2j, and 2l). on the other hand, the replacement of the p - hydroxy group with a fluorine (2 g) or chlorine atom (2h) restores a certain, though minimal, affinity for er. overall, these binding assays confirm that the er ligand cavity may profitably host methyl- (2a) and an ethyl- (2b) ketoxime portion, although the highest -selectivity is obtained with the former, and that the 4-hydroxyphenyl substituent still constituted an ideal moiety for an efficient binding to er. in order to evaluate the binding disposition of these derivatives in er, the most interesting compounds 2a and 2b were also analyzed for their interaction with this receptor subtype (figure 4). as already reported, the interaction of thr299 with the 4-hydroxyl of 2a and 2b is only possible in er because only in this subtype is there enough space for the phenol group to reach thr299, because of its proximity to met336, one of the two nonconserved residues that in er is replaced by bulkier leu384. as shown in figure 3, the docking results showed that for both compounds 2a and 2b the phenolic oh interacts in the er with the glu305arg346water hydrogen bonding system, the pseudocycle / oxime system does not show any important interactions, and the methyl (2a)/ethyl (2b) substituents show lipophilic interactions with phe404, phe425, and leu428. this binding disposition is very similar to that hypothesized for compound 1, and the lipophilic interactions of the methyl / ethyl group may explain the increase in er affinity associated with ketoximes 2a and 2b, when compared to that of aldoxime 1. nevertheless, the er-binding affinities of 2a increase to a larger extent (17-fold) when compared to its improvement in binding to er (8-fold), and therefore, the newly synthesized ketoxime 2a display a substantial enhancement of both affinity and selectivity for er. docking analysis of 2a (a) and 2b (b) into er (pdb code of the starting er crystal structure is 2i0j). the compounds showing the highest levels of -selectivity in the receptor binding assays (2a and 2c) were assayed for transcriptional activity through er and er by two different methods, and estradiol was always used as the reference receptor activator. the first method was a reporter gene transfection assay, which was conducted in human endometrial (hec-1) cells, using expression plasmids for either full - length human er or er and an estrogen - responsive luciferase reporter gene system. these assays (figure 5, table 2) showed that estradiol (e2) has a 2.4-fold preference in favor of er in terms of transcriptional potency (ec50[er ] = 0.16 nm vs ec50[er ] = 0.38 nm), as has been widely noted. we had previously reported that aldoxime 1 is also a potent er full agonist, with an ec50 of 10 nm, but it also stimulated er with an ec50 of 17 nm. new ketoxime 2a displayed significant improvements over aldoxime 1, in terms of both potency on er (ec50[er ] = 3.97 nm) and subtype - selectivity (ec50[er ] = 29.3 nm). ketoxime 2c proved to suffer from a 4-fold reduction in its potency on er (ec50[er ] = 14.7 nm) when compared to 2a, although an even more pronounced loss of activity on er (ec50[er ] = 194 nm) elevates its -selectivity. to compare the er subtype transcriptional potencies of these compounds with their subtype binding affinities in a more proper way, we calculated their relative transcriptional potency (rtp) values from their ec50 values according to the formula rtp = (ec50/ec50) 100 (rtp of estradiol = 100). these rtp values provide an estimate of transcriptional potency relative to that of estradiol and, therefore, are more appropriate to compare with their binding affinities, which are also measured relative to estradiol as rba. by these metrics (tables 1 and 2), compound 2a has an rba(/) ratio of 84 and an rtp(/) ratio of 18, and compound 2c has an rba(/) ratio of 72 and an rtp(/) ratio of 31. it is worth noting that differences in er-selectivity in terms of transcriptional potency vs binding affinity may be ascribed to changes in the manner in which the er- and er-ligand complexes interact with numerous cellular coregulators, which act as modulators of ligand potency. therefore, when measured relative to estradiol, most of the er affinity preference of these compounds is actually maintained in their er transcriptional potency preference. response curves for transcriptional activation by estradiol (e2), 2a, and 2c through er (red line) and er (green line) in the reporter gene transfection assay. human endometrial cancer (hec-1) cells were transfected with expression vectors for er or er and an (ere)2-ps2-luc reporter gene and were treated for 24 h with estradiol, 2a, or 2c at the concentrations indicated. luciferase activity was expressed relative to -galactosidase activity from an internal control plasmid. the er/er relative transcriptional potencies (rtp) and ratios (rtp(/)) are calculated as explained in the text. in addition to the reporter gene assays, we also examined the regulation of two endogenous genes, the progesterone receptor (pr), which is mostly activated through er, and otubain 2 (otub2), which is stimulated largely through er. we studied the activation of these genes in mcf-7 breast cancer cells containing either er only, or er and er (figure 5 and table 3). as we have observed before, the pr gene (figure 6, red curves) is effectively stimulated by estradiol (e2) in cells with only er (solid red curve), with this stimulation being somewhat less in cells containing er and er (dashed red curve). by contrast, the obut2 gene (green curves) requires the presence of er (er plus er cells, dashed green curve) to be stimulated effectively, the response being very minimal in cells with only er (solid green curve). the otub2 gene is also stimulated in er + er cells with the two er-selective ketoximes (2a and 2c ; green dashed curves), though at a somewhat lowered potency, and as expected, no stimulation of otub2 with these compounds was seen in cells with only er (solid green curves). while there was some stimulation of pr by these compounds, this required high concentrations (the red curves were right shifted compared to that for e2 ; see also table 3). response curves for transcriptional activation of endogenous genes by estradiol (e2), 2a, and 2c. the response of progesterone receptor (pr, red curves), a gene activated predominantly through er, and otubain 2 (otub2, green curves), a gene activated predominantly through er, was measured by qpcr at 24 h after exposure of human breast cancer (mcf-7) cells containing only er (solid curves) or both er and er (dashed curves) to compounds at the indicated concentrations. again, as was the case with the reporter gene assays (figure 5, table 2), comparisons of potencies in transcription assays with binding affinities require that the ec50 values from the transcription assay be referenced to the values of e2, expressed as rtp values (table 3). clearly, the rtp values of compounds 2a and 2c are far greater for the er-mediated response (otub2 activation in er + er cells) than the er-mediated response (pr activation in er only cells). the rtp (+)/ ratios, in particular, highlight the very high er selectivity of these compounds. the er/er relative transcriptional potencies (rtp) and ratios (rtp (/)) are calculated, as explained in the text. we then wanted to evaluate a possible application of our most promising er agonists as antitumor agents. among the beneficial effects of estrogens, a possible protective role in the progression of gliomas has been reported. in fact, this deadly disease has a significantly lower incidence in reproductive - aged females than in males. recently, a naturally occurring er agonist, liquiritigenin, was shown to be active in vitro against u87 glioma cells and also in a murine model of the same disease. therefore, we decided to test the ability of our best ketoximes 2a and 2c, together with aldoxime 1 and liquiritigenin, a major component in licorice root extracts, to block proliferation of glioma (u87), colon (lovo, hct), and breast (mda - mb-231, mcf7, skbr3) cancer cells. ic50 : inhibitory concentration causing a 50% reduction in cell growth, in m. mean values sd calculated from at least two triplicate cytotoxicity experiments (see experimental section). as for the u87 glioma cells, in our hands, liquiritigenin displayed an ic50 value of 88.3 m in this assay, whereas all our oxime - based er-agonists proved to be more potent than this. in particular, ketoxime 2a, which was also found to be the most potent er agonist in both the reporter (table 2) and the endogenous (table 3) gene assays, demonstrated the highest potency as an antiproliferative agent from this series, with an ic50 value of 35.0 m. in addition, since activation of er is also known to exert an antiproliferative effect in colorectal and breast tumors, we extended our in vitro screening to colon (lovo, hct) and breast (mda231, mct7) cancer cell lines. in all these cell lines, oxime derivatives 1, 2a, and 2c still displayed the most potent inhibition of proliferation when compared to liquiritigenin. finally, we included in our study the er-negative breast cancer cell line skbr3 in order to verify the contribution of er activation to the antiproliferative effect of these compounds. notably, the activities of the oxime - based er agonists 1, 2a, and 2c against skbr3 cells were significantly lower than their activities against all the other er-positive cancer cells. for a more significant evaluation of the involvement of er in the antiproliferative effect of these compounds then the differences in the ic50 values found in er-positive mda231 and mcf7 cells (2.716.4 m range) and those in er-negative skbr3 cells (86.396.2 m) are even more evident, with 6- to 34-fold reductions of antiproliferative activities in the er-negative cancer cells. of course, we can not exclude the involvement of other mechanisms in the inhibition of proliferation by compounds 1, 2a, and 2c, since some activity is also noted in skbr3 cells. nevertheless, these results confirm a highly significant involvement of the activation of er in the antiproliferative effects of these compounds. to complete the evaluation of our compounds 1, 2a, and 2c against glioma, we carried out an in vivo study using u87 glioma cells grown as xenografts in nude mice, an in vivo model that has already been used to evaluate the antiglioma effect of liquiritigenin. after tumors reached a measurable size, the indicated compounds (10 mg / kg / mouse / day) were administered for 14 days, and the tumor volume was measured with a caliper. after 14 days of treatment no signs of animal weight loss were observed (see table s1, supporting information). as shown in figure 7, ketoxime 2a produced a statistically significant reduction of the tumor volume when compared to control vehicle, whereas the effects of 1 and 2c were negligible. this is not surprising since compound 2a, when compared to the other two compounds, displayed the highest er-binding affinity and er-transcriptional activation, as well as the most potent antiproliferative activity against u87 cells. therefore, these in vivo results indicate that our most potent er-agonist, 2a, is effective in reducing the progression of tumor growth in both an in vitro and in vivo model of this glioma. tumor volume (normalized to control, which was set at 1) of subcutaneous implanted u87 cells in nude mice after 14 days of treatment with 10 mg / kg compounds. in summary, molecular modeling studies drove us to the rational design of some new ketoxime derivatives by introducing small alkyl groups on the oxime carbon atom of previously developed salicylaldoxime - based er agonists. some of the newly synthesized compounds displayed remarkably high subtype - selective binding affinities for er, which is unprecedented for this chemical class of ligands. in particular, these compounds proved to behave as full agonists on er and to activate transcription of reporter genes and endogenous genes, highlighting their very high er potency selectivity. finally, we could then demonstrate that one of these ketoxime derivatives efficiently inhibited tumor progression of er-expressing human glioma cells, both in vitro and in vivo. chromatographic separations were performed on silica gel columns by flash (kieselgel 40, 0.0400.063 mm ; merck) or gravity column (kieselgel 60, 0.0630.200 mm ; merck) chromatography. reactions were followed by thin - layer chromatography (tlc) on merck aluminum silica gel (60 f254) sheets that were visualized under a uv lamp. proton (h) and carbon (c) nmr spectra were obtained with a varian gemini 200 mhz spectrometer using the indicated deuterated solvents. chemical shifts are given in parts per million (ppm) (relative to residual solvent peak for h and c). electron impact (ei, 70 ev) mass spectra were obtained on a hp-5988a mass spectrometer. high - resolution mass spectrometry (hrms) analysis was performed using a waters quattro ii quadrupole hexapole quadrupole liquid chromatography / mass spectrometry apparatus (waters, milford, ma) equipped with an electrospray ionization source. purity of the final compounds 2a m was determined by high performance liquid chromatography (hplc) on a waters sunfire rp 18 (3.0 mm 150 mm, 5 m) column (waters, milford, ma, www.waters.com) using a beckmann systemgold instrument consisting of chromatography 125 solvent module and a 166 uv detector set at 254 and 300 nm, and injection volume was 30 l (see below for details about mobile phase and flow rate.the purity was always 95%, unless otherwise specified. a solution of pd(oac)2 (50 mg, 0.22 mmol) and triphenylphosphine (294 mg, 1.12 mmol) in ethanol (12 ml) and toluene (12 ml) was stirred at rt under nitrogen for 10 min. after that period, 5.8 mmol of commercially available 5-bromo-2-hydroxyacetophenone (3) or 5-bromo-2-hydroxypropiophenone (4), a 2 m aqueous solution of na2co3 (13 ml), and the appropriate arylboronic acid (1.2 equiv) were sequentially added. the resulting mixture was heated at 100 c in a sealed vial under nitrogen overnight. after being cooled to rt, elution with n - hexane / etoac (95:5 to 8:2) afforded the desired ketone intermediates. the same procedure was applied to 1-(5-bromo-2-methoxyphenyl)-2,2,2-trifluoroethanone (11), which was synthesized as previously reported. a solution of pure ketones 5e, 5f, 5j, 5l, 6, 7, and 12 (0.90 mmol) in anhydrous ch2cl2 (11 ml) was cooled to 78 c and treated dropwise with a 1.0 m solution of bbr3 ch2cl2 (3 ml) under nitrogen. the mixture was left under stirring at the same temperature for 5 min and then at 0 c for 1 h. the mixture was then diluted with water and extracted with ethyl acetate. elution with n - hexane / etoac (8:2 to 7:3) afforded the desired o - deprotected ketones. a solution of pure ketones 5e h, 5j, 5l, 8a d, 8i, 8k, 13 (1.2 mmol) in ethanol (20 ml) was treated with a solution of hydroxylamine hydrochloride (257 mg, 3.72 mmol) in water (4 ml), and the mixture was heated to 50 c for 16 h. after being cooled to rt, part of the solvent was removed under vacuum, and the mixture was diluted with water and extracted with etoac. the organic phase was dried and evaporated to afford a crude residue that was purified by column chromatography (n - hexane / ethyl acetate 7:3) to afford the desired ketoxime derivatives. h nmr (acetone - d6) (ppm) : 2.44 (s, 3h), 6.886.94 (m, 3h), 7.447.52 (m, 3h), 7.70 (d, 1h, j = 2.2 hz), 8.36 (exchangeable s, 1h), 10.70 (exchangeable s, 1h), 11.45 (exchangeable s, 1h). c nmr (acetone - d6) (ppm) : 10.80, 116.43 (2c), 117.98, 119.91, 126.32, 128.32 [2c ], 129.06, 132.74, 132.83, 157.45, 157.69, 159.18. ms m / z 243 (m, 71), 242 (m h, 100), 227 (m h2o, 31). hplc analysis : retention time = 1.550 min ; peak area, 98.97% (254 nm), 99.17% (300 nm) ; eluent a, nh4oac solution (10 mm) ; eluent b, ch3cn ; a gradient was formed from 50% to 95% of b in 10 min and held at 95% for 15 min ; flow rate was 1.0 ml / min. hrms (esi) : m / z calculated for c14h13no3 + h [m + h ] : 244.0974. found : 244.0971. h nmr (acetone - d6) (ppm) : 1.24 (t, 3h, j = 7.6 hz), 3.02 (q, 2h, j = 7.6 hz), 6.876.96 (m, 3h), 7.437.50 (m, 3h), 7.69 (d, 1h, j = 2.2 hz), 11.52 (exchangeable s, 1h). c nmr (acetone - d6) (ppm) : 11.60, 18.39, 116.42 [2c ], 118.28, 118.48, 126.00, 128.36 [2c ], 129.20, 132.82, 132.90, 157.41, 158.24, 164.03. ms m / z 257 (m, 100), 239 (m h2o, 39). hplc analysis : retention time = 0.983 min ; peak area, 99.01% (254 nm), > 99.95% (300 nm) ; eluent a, nh4oac solution (10 mm) ; eluent b, ch3cn ; a gradient was formed from 70% to 95% of b in 10 min and held at 95% for 10 min ; flow rate was 1.0 ml / min. hrms (esi) : m / z calculated for c15h15no3 + h [m + h ] : 258.1130. found : 258.1129. h nmr (acetone - d6) (ppm) : 2.46 (s, 3h), 6.94 (d, 1h, j = 8.6 hz), 7.05 (dd, 1h, j = 9.0, 8.6 hz 1h), 7.30 (ddd, 1h, j = 8.4, 2.2, 0.9 hz), 7.40 (dd, 1h, j = 12.6, 2.2 hz), 7.50 (dd, 1h, j = 8.4, 2.4 hz), 7.74 (d, 1h, j = 2.4 hz), 11.52 (exchangeable s, 1h). c nmr (acetone - d6) (ppm) : 10.87, 114.74 (d, j = 19.2 hz), 118.13, 118.93, 120.01, 123.26 (d, j = 2.7 hz), 126.56, 129.18, 131.51, 133.89 (d, j = 6.4 hz), 144.61 (d, j = 12.8 hz), 152.54 (d, j = 239.0 hz), 158.71, 159.26. ms m / z 261 (m, 100), 243 (m h2o, 51), 228 (m h2o hplc analysis : retention time = 10.100 min ; peak area, > 99.95% (254 nm), 99.91% (300 nm) ; eluent a, nh4oac solution (10 mm) ; eluent b, ch3cn ; a gradient was formed from 5% to 80% of b in 10 min and held at 95% for 10 min ; flow rate was 0.7 ml / min. hrms (esi) : m / z calculated for c14h12fno3 + h [m + h ] : 262.0879. found : 262.0880. h nmr (acetone - d6) (ppm) : 1.24 (t, 3h, j = 7.6 hz), 3.04 (q, 2h, j = 7.6 hz), 6.95 (d, 1h, j = 8.4 hz), 7.05 (dd, 1h, j = 9.0, 8.4 hz 1h), 7.30 (ddd, 1h, j = 8.4, 2.2, 0.9 hz), 7.39 (dd, 1h, j = 12.5, 2.2 hz), 7.50 (dd, 1h, j = 8.4, 2.2 hz), 7.73 (d, 1h, j = 2.2 hz), 8.70 (exchangeable bs, 1h), 10.61 (exchangeable bs, 1h), 11.58 (exchangeable s, 1h). c nmr (acetone - d6) (ppm) : 11.60, 18.41, 114.76 (d, j = 18.3 hz), 118.42, 118.62, 118.97, 123.30 (j = 2.7 hz), 126.22, 129.31, 131.60, 133.96 (d, j = 6.4 hz), 144.62 (d, j = 12.8 hz), 152.50 (d, j = 239.9 hz), 158.74, 164.11. ms m / z 275 (m, 100), 259 (m o, 18), 257 (m h2o, 12). hplc analysis : retention time = 10.533 min ; peak area, 98.25% (254 nm), 98.99% (300 nm) ; eluent a, nh4oac solution (10 mm) ; eluent b, ch3cn ; a gradient was formed from 5% to 80% of b in 10 min and held at 95% for 10 min ; flow rate was 0.7 ml / min. hrms (esi) : m / z calculated for c15h14fno3 + h [m + h ] : 276.1036. found : 276.1034. h nmr (acetone - d6) (ppm) : 2.45 (s, 3h), 3.83 (s, 3h), 6.94 (d, 1h, j = 8.6 hz), 6.99 (aaxx, 2h, jax = 8.8 hz, jaa/xx = 2.6 hz), 7.49 (dd, 1h, j = 8.4, 2.4 hz), 7.57 (aaxx, 2h, jax = 8.8 hz, jaa/xx = 2.6 hz), 7.73 (d, 1h, j = 2.4 hz), 10.71 (exchangeable s, 1h), 11.48 (exchangeable s, 1h). c nmr (acetone - d6) (ppm) : 10.83, 55.59, 115.00 [2c ], 118.06, 119.95, 126.45, 128.27 [2c ], 129.18, 132.39, 133.94, 157.88, 159.15, 159.74. ms m / z 257 (m, 90), 239 (m h2o, 34), 224 (m h2o ch3, 100). hplc analysis : retention time = 1.583 min ; peak area, > 99.95% (254 nm), 99.00% (300 nm) ; eluent a, nh4oac solution (10 mm) ; eluent b, ch3cn ; a gradient was formed from 70% to 95% of b in 10 min and held at 95% for 10 min ; flow rate was 1.0 ml / min. h nmr (acetone - d6) (ppm) : 2.46 (s, 3h), 3.91 (s, 3h), 6.95 (d, 1h, j = 8.4 hz), 7.18 (t, 1h, j = 8.9 hz), 7.377.48 (m, 2h), 7.52 (dd, 1h, j = 8.6, 2.4 hz), 7.76 (d, 1h, j = 2.2 hz), 10.76 (exchangeable s, 1h), 11.60 (exchangeable s, 1h). c nmr (acetone - d6) (ppm) : 10.87, 56.61, 114.74 (d, j = 19.3 hz), 114.87, 118.19, 120.03, 123.05 (d, j = 3.7 hz), 126.69, 129.29, 131.19, 134.71 (d, j = 6.4 hz), 147.49 (d, j = 10.1 hz), 153.29 (d, j = 243.6 hz), 158.33, 159.32. ms m / z 275 (m, 100), 257 (m h2o, 53). hplc analysis : retention time = 1.517 min ; peak area, > 99.95% (254 nm), > 99.95% (300 nm) ; eluent a, nh4oac solution (10 mm) ; eluent b, ch3cn ; a gradient was formed from 70% to 95% of b in 10 min and held at 95% for 10 min ; flow rate was 1.0 ml / min. hrms (esi) : m / z calculated for c15h14fno3 + h [m + h ] : 276.1036. found : 276.1037. h nmr (acetone - d6) (ppm) : 2.45 (s, 3h), 6.96 (d, 1h, j = 8.4 hz), 7.19 (double aaxx, 2h, jhf - o = 9.0 hz, jax = 8.8 hz, jaa/xx = 2.6 hz), 7.52 (dd, 1h, j = 8.4, 2.2 hz), 7.67 (double aaxx, 2h, jhf - m = 5.3 hz, jax = 8.8 hz, jaa/xx = 2.6 hz), 7.77 (d, 1h, j = 2.2 hz), 10.76 (exchangeable s, 1h), 11.57 (exchangeable s, 1h). c nmr (acetone - d6) (ppm) : 10.85, 116.18 (d, 2c, j = 22.0 hz), 118.20, 120.03, 126.98, 129.11 (d, 2c, j = 7.3 hz), 129.57, 131.58, 137.92, 158.43, 159.28, 162.83 (d, j = 243.5 hz). ms m / z 245 (m, 100), 227 (m h2o, 40). hplc analysis : retention time = 1.817 min ; peak area, 99.50% (254 nm), 97.90% (300 nm) ; eluent a, nh4oac solution (10 mm) ; eluent b, ch3cn ; a gradient was formed from 70% to 95% of b in 10 min and held at 95% for 10 min ; flow rate was 1.0 ml / min. hrms (esi) : m / z calculated for c14h12fno2 + h [m + h ] : 246.0930. found : 246.0931. h nmr (acetone - d6) (ppm) : 2.46 (s, 3h), 6.98 (d, 1h, j = 8.4 hz), 7.45 (aaxx, 2h, jax = 8.6 hz, jaa/xx = 2.3 hz), 7.55 (dd, 1h, j = 8.6, 2.3 hz), 7.69 (aaxx, 2h, jax = 8.6 hz, jaa/xx = 2.3 hz), 7.80 (d, 1h, j = 2.2 hz), 10.76 (exchangeable s, 1h), 11.61 (exchangeable s, 1h). c nmr (acetone - d6) (ppm) : 10.87, 118.33 [2c ], 120.15, 127.04, 128.89 [2c ], 129.58 [2c ], 131.24, 132.99, 140.27, 158.772, 159.28. ms m / z 261 (m, 100), 243 (m h2o, 45). hplc analysis : retention time = 2.483 min ; peak area, 98.79% (254 nm), 98.05% (300 nm) ; eluent a, nh4oac solution (10 mm) ; eluent b, ch3cn ; a gradient was formed from 70% to 95% of b in 10 min and held at 95% for 10 min ; flow rate was 1.0 ml / min. hrms (esi) : m / z calculated for c14h12clno2 + h [m + h ] : 262.0635. found : 262.0634. h nmr (acetone - d6) (ppm) : 2.26 (s, 3h), 2.44 (s, 3h), 6.88 (d, 1h, j = 8.1 hz), 6.91 (d, 1h, j = 8.4 hz), 7.28 (dd, 1h, j = 8.2, 2.4 hz), 7.38 (d, 1h, j = 2.4 hz), 7.46 (dd, 1h, j = 8.4, 2.2 hz), 7.69 (d, 1h, j = 2.2 hz), 8.19 (exchangeable s, 1h), 10.67 (exchangeable s, 1h), 11.42 (exchangeable s, 1h). c nmr (acetone - d6) (ppm) : 10.85, 16.35, 115.82, 117.95, 119.84, 125.30, 125.58, 126.31, 129.13, 129.73, 132.88, 132.95, 155.42, 157.62, 159.28. ms m / z 257 (m, 100), 239 (m h2o, 33). hplc analysis : retention time = 1.000 min ; peak area, > 99.95% (254 nm), > 99.95% (300 nm) ; eluent a, nh4oac solution (10 mm) ; eluent b, ch3cn ; a gradient was formed from 70% to 95% of b in 10 min and held at 95% for 10 min ; flow rate was 1.0 ml / min. hrms (esi) : m / z calculated for c15h15no3 + h [m + h ] : 258.1130. found : 258.1133. h nmr (acetone - d6) (ppm) : 2.23 (s, 3h), 2.44 (s, 3h), 3.86 (s, 3h), 6.906.99 (m, 2h), 7.397.43 (m, 2h), 7.48 (dd, 1h, j = 8.4, 2.4 hz), 7.72 (d, 1h, j = 2.4 hz), 10.69 (exchangeable s, 1h), 11.46 (exchangeable s, 1h). c nmr (acetone - d6) (ppm) : 10.87, 16.46, 55.77, 111.21, 118.02, 119.92, 125.67, 126.47, 127.20, 129.26, 129.49, 132.66, 133.63, 157.83, 157.86, 159.28. ms m / z 271 (m, 100), 253 (m h2o, 21), 238 (m h2o ch3, 54). hplc analysis : retention time = 2.133 min ; peak area, 99.17% (254 nm), 98.93% (300 nm) ; eluent a, nh4oac solution (10 mm) ; eluent b, ch3cn ; a gradient was formed from 70% to 95% of b in 10 min and held at 95% for 10 min ; flow rate was 1.0 ml / min. h nmr (acetone - d6) (ppm) : 2.46 (s, 3h), 6.94 (d, 1h, j = 8.6 hz), 7.08 (d, 1h, j = 8.4 hz), 7.44 (dd, 1h, j = 8.6, 2.2 hz), 7.49 (dd, 1h, j = 8.4, 2.2 hz), 7.62 (d, 1h, j = 2.2 hz), 7.74 (d, 1h, j = 2.2 hz), 8.80 (exchangeable bs, 1h), 10.60 (exchangeable bs, 1h), 11.52 (exchangeable s, 1h). c nmr (acetone - d6) (ppm) : 10.87, 117.88, 118.17, 120.03, 121.48, 126.58, 126.93, 128.49, 129.24, 131.30, 134.45, 152.76, 158.23, 159.30. ms m / z 277 (m, 90), 259 (m h2o, 100). hplc analysis : retention time = 1.050 min ; peak area, > 99.95% (254 nm), > 99.95% (300 nm) ; eluent a, nh4oac solution (10 mm) ; eluent b, ch3cn ; a gradient was formed from 70% to 95% of b in 10 min and held at 95% for 10 min ; flow rate was 1.0 ml / min. hrms (esi) : m / z calculated for c14h12clno3 + h [m + h ] : 278.0584. found : 278.0582. h nmr (acetone - d6) (ppm) : 2.46 (s, 3h), 3.94 (s, 3h), 6.95 (d, 1h, j = 8.6 hz), 7.18 (d, 1h, j = 8.4 hz), 7.497.59 (m, 2h), 7.67 (d, 1h, j = 1.8 hz), 7.77 (d, 1h, j = 2.0 hz), 10.73 (exchangeable s, 1h), 11.55 (exchangeable s, 1h). c nmr (acetone - d6) (ppm) : 10.87, 56.61, 113.67, 118.20, 120.10, 123.14, 126.69, 126.84, 128.69, 129.29, 131.02, 135.05, 154.93, 158.35, 159.23. ms m / z 291 (m, 100), 273 (m h2o, 36), 258 (m h2o ch3, 91). hplc analysis : retention time = 1.883 min ; peak area, > 99.95% (254 nm), 99.83% (300 nm) ; eluent a, nh4oac solution (10 mm) ; eluent b, ch3cn ; a gradient was formed from 70% to 95% of b in 10 min and held at 95% for 10 min ; flow rate was 1.0 ml / min. hrms (esi) : m / z calculated for c15h14clno3 + h [m + h ] : 292.0740. found : 292.0737. white solid ; yield 68% (unresolved 8:2 e / z - mixture) from 13 ; mp 187 c. h nmr (acetone - d6 ; e / z mixture, asterisk denotes minor isomer peaks) (ppm) : 6.91 (aaxx, 2h, jax = 8.6 hz, jaa/xx = 2.5 hz), 7.02 (d, 1h, j = 8.4 hz), 7.05 (d, 1h, j = 8.5 hz), 7.40 (d, 1h, j = 2.1 hz), 7.44 (aaxx, 2h, jax = 8.6 hz, jaa/xx = 2.6 hz), 7.55 (dd, 1h, j = 8.6, 2.4 hz), 8.36 (exchangeable bs, 1h). h nmr (cd3od ; e / z mixture, asterisk denotes minor isomer peaks) (ppm) : 6.83 (aaxx, 2h, jax = 8.7 hz, jaa/xx = 2.5 hz), 6.88 (d,1h, j = 8.5 hz), 6.93 (d,1h, j = 8.5 hz), 7.21 (d,1h, j = 2.2 hz), 7.30 (d,1h, j = 2.4 hz), 7.35 (aaxx, 2h, jax = 8.7 hz, jaa/xx = 2.5 hz), 7.46 (dd, 1h, j = 8.5, 2.4 hz). c nmr (acetone - d6 ; e / z mixture, asterisk denotes minor isomer peaks) (ppm) : 116.55, 116.58 [2c ], 117.29, 122.23 (q, jc f = 273.0 hz), 128.08, 128.40 [2c ], 129.55, 130.10, 130.16, 132.33, 132.39, 133.59, 133.60, 146.23 (q, jc hrms (esi) : m / z calculated for c14h10f3no3 + h [m + h ] : 298.0691. found : 298.0686. the crystal structure of er (pdb code 2i0j) and er (pdb code 2i0 g) was taken from the protein data bank. after addition of hydrogen atoms, the two proteins complexed with their reference inhibitor were minimized using amber 9 software and parm03 force field at 300 k. the two complexes were placed in a rectangular parallelepiped water box. an explicit solvent model for water, tip3p, was used, and the complexes were solvated with a 10 water cap. two steps of minimization were then carried out ; in the first stage, we kept the protein fixed with a position restraint of 500 kcal/(mol) and we solely minimized the positions of the water molecules. in the second stage, we minimized the entire system through 5000 steps of steepest descent followed by conjugate gradient (cg) until a convergence of 0.05 kcal/(mol). the two ligands were built using maestro and were minimized by means of macromodel in a water environment using the cg method until a convergence value of 0.05 kcal/(mol), using the mmffs force field and a distance - dependent dielectric constant of 1.0. automated docking was carried out by means of the autodock 4.0 program ; autodock tools was used in order to identify the torsion angles in the ligands, add the solvent model, and assign the kollman atomic charges to the protein. the ligand charge was calculated using the gasteiger method. in order to prevent the loss of the intramolecular h - bond of the pseudocycle / oxime system, during the docking we blocked the torsions involved in this intramolecular bond. the regions of interest used by autodock were defined by considering serba-1 into both receptors as the central group ; in particular, a grid of 50, 40, and 46 points in the x, y, and z directions was constructed centered on the center of the mass of this compound. a grid spacing of 0.375 and a distance - dependent function of the dielectric constant were used for the energetic map calculations. by use of the lamarckian genetic algorithm, the docked compounds were subjected to 100 runs of the autodock search, using 500 000 steps of energy evaluation and the default values of the other parameters. cluster analysis was performed on the results using an rms tolerance of 1.0, and the best docked conformation was used for the analysis. for the docking of compound 2b into er, the reported docking procedure has recently been indirectly validated by the deposition of the crystal structure of er complexed with 2-chloro-3-fluoro-3-[(e)-(hydroxyimino)methyl]biphenyl-4,4-diol (pdb code 4iwf). before the deposition of this structure, in 2011 we reported a docking analysis of this compound into er ; superimposing the docking with the experimental results, the proposed binding mode was correctly predicted, as the two compounds showed a root - mean - square deviation of their disposition of 1.0. relative binding affinities were determined by competitive radiometric binding assays with 2 nm [h]e2 as tracer, as a modification of methods previously described. the source of er was purified full - length human er and er purchased from pan vera / invitrogen (carlsbad, ca). incubations were done at 0 c for 1824 h, and hydroxyapatite was used to absorb the purified receptor ligand complexes (human ers). the binding affinities are expressed as relative binding affinity (rba) values, where the rba of estradiol is 100% ; under these conditions, the kd of estradiol for er is 0.2 nm, and for er it is 0.5 nm. the determination of these rba values is reproducible in separate experiments with a cv of 0.3, and the values shown represent the average range or sd of two or more separate determinations. the procedures used for the er and er-responsive reporter gene assays in hec-1 cells have been fully described in prior publications. the procedures used for the assay of er and er-responsive endogenous gene in mcf-7 cells containing er only, er only, or er + er have been fully described in prior publications. u87-mg cells were purchased from sigma and maintained at 37 c in a humidified atmosphere containing 5% co2 accordingly to the supplier. the day after seeding, vehicle or compounds were added at different concentrations to the medium at a concentration ranging from 1000 to 0.1 m. cell viability was measured after 96 h according to the supplier (promega, g7571) with a tecan f200 instrument. all animal experiments were approved by the ethical committee for animal experimentation (cesa) and performed in accordance with the institution guidelines. for xenograft tumor assays, 2 10 u87 cells were mixed with 30% of matrigel and implanted subcutaneously into the flanks of 6-week - old female nude mice. once tumors reached measurable size, mice were treated with specify drug (10 mg / kg) subcutaneously once every other day for 14 days (n 5). tumor volume was measured with a caliper instrument and calculated by using the formula /2(length | estrogen receptor (er) selective agonists are considered potential therapeutic agents for a variety of pathological conditions, including several types of cancer. their development is particularly challenging, since differences in the ligand binding cavities of the two er subtypes and are minimal. we have carried out a rational design of new salicylketoxime derivatives which display unprecedentedly high levels of er selectivity for this class of compounds, both in binding affinity and in cell - based functional assays. an endogenous gene expression assay was used to further characterize the pharmacological action of these compounds. finally, these er-selective agonists were found to inhibit proliferation of a glioma cell line in vitro. most importantly, one of these compounds also proved to be active in an in vivo xenograft model of human glioma, thus demonstrating the high potential of this type of compounds against this devastating disease. |
thoracic injuries have a number of causes including falls, traffic accidents, sports injuries, and physical assaults. the forms of thoracic injuries are diverse, and they include simple bruises and rib fractures as well as traumatic hemothorax or pneumothorax associated with internal organ damage from rib fractures ; in extreme cases, open thoracic trauma with exposure of the thoracic cavity occurs. among these injuries, the most common forms leading to hospitalization are simple bruises or blunt trauma in the form of a rib fracture, with complaints of tenderness around the injured area and pain during exercising, coughing, and/or breathing. depending on the chief complaints, the first doctor examining the patient conducts the physical examination and observes a simple chest radiograph, nuclear scan, computed tomography, or thoracic ultra - sonogram. in most cases, conservative treatment consisting of an analgesic, muscle relaxant, in the form of injection, or oral medication is administered ; however, depending on the patient s degree of pain or the injury severity, hospitalization and more aggressive pain control measures may be required. thus, depending on the injury severity, differences in treatment methods, hospitalization, and/or treatment duration are determined. most of the pain is eliminated after 23 days of conservative treatment in most common blunt trauma cases, and a prescription of 23 weeks of oral analgesics is enough after discharge. pain control is essential for not only primary pain relief but also preventing secondary complications such as atelectasis or pneumonia as well as the transition to chronic pain. accordingly, further steps are now being taken from the conventional pain control medication and techniques by the introduction of more aggressive pain control measures such as the intercostal nerve block (icnb) (moore and bridenbaugh, 1962 ; wurnig., 2002), transcutaneous electrical nerve stimulation (tens) (oncel., 2002), and intravenous patient - controlled analgesia (iv pca). the purpose of this study was to compare the use of icnb, as an aggressive pain control measure, with conventional oral or injectable medications in terms of the hospitalization length or medication administration duration along with pain relief degree in patients with thoracic injuries. in this study, among those patients who were admitted to our hospital between march 2008 and december 2012 with thoracic injuries, those with rib fractures were allocated to either the conventional pain control group (control group) or conventional pain control plus icnb group (experimental group), and their medical records were retrospectively analyzed. in this study, the index and methods needed for analysis were performed as indicated below by using a statistical method (chi - square test, spss 12.0) for analysis with the statistical significance level set at a p - value of less than 0.05. parameters such as sex, age, causes of rib fracture, most painful or tender area, number of patients in the control and experimental groups, presence of icnb - related complications (pneumothorax or hemothorax), and need for chest tube insertion were investigated. at the time of the initial outpatient visit or emergency room admission, the patients were presented with the visual analog scale (vas), which scores the pain level from 0 to 10 points, and the pain level at the time was evaluated objectively (fig. 1). for the conventional pain control group (control group) and conventional pain control plus icnb group (experimental group), the pain levels during hospitalization (immediately after medication or icnb, 1 day later, and 7 days later) were evaluated by using the vas, and their values were compared to the initial pain level. in this study, among those patients who were admitted to our hospital between march 2008 and december 2012 with thoracic injuries, those with rib fractures were allocated to either the conventional pain control group (control group) or conventional pain control plus icnb group (experimental group), and their medical records were retrospectively analyzed. in this study, the index and methods needed for analysis were performed as indicated below by using a statistical method (chi - square test, spss 12.0) for analysis with the statistical significance level set at a p - value of less than 0.05. parameters such as sex, age, causes of rib fracture, most painful or tender area, number of patients in the control and experimental groups, presence of icnb - related complications (pneumothorax or hemothorax), and need for chest tube insertion were investigated. at the time of the initial outpatient visit or emergency room admission, the patients were presented with the visual analog scale (vas), which scores the pain level from 0 to 10 points, and the pain level at the time was evaluated objectively (fig. 1). for the conventional pain control group (control group) and conventional pain control plus icnb group (experimental group), the pain levels during hospitalization (immediately after medication or icnb, 1 day later, and 7 days later) were evaluated by using the vas, and their values were compared to the initial pain level. for the duration of this study, there were 54 patients (44 men, 10 women) with an average age of 48.50 yr (2383 yr). the causes of thoracic injury consisted of 24 falls, 17 traffic accidents, 11 physical assauls, and 2 other causes. the most painful or tender area was the left side in 28 and the right side in 26. of the 54, 31 received the conventional medication treatment (control group) and 23 received the conventional medication treatment along with icnb (experimental group). a total of 17 patients, 11 from the control group and 6 from the experimental group, required chest tube insertion due to rib fracture - related lung injuries resulting in traumatic hemothorax or pneumothorax (table 1). the average number of fractured ribs in patients from the control and experimental groups were 3.19 (17) and 4.91 (19), respectively, a difference that was statistically significant (p=0.008). at the time of admission, the average pain scores for the control and experimental groups were 8.16 (210) and 9.43 (410), respectively, but the difference was not statistically significant (p=0.200). the average pain scores immediately after medication administration (procedure) in the control and experimental groups were 7.42 (210) and 5.39 (09), respectively, showing a statistically significant reduction in pain in the experimental group (p=0.007). the average pain scores 1 day after medication administration (procedure) in the control and experimental groups were 6.16 (210) and 5.04 (110), respectively, but were not statistically different (p=0.240) ; after 7 days, the pain scores in the control and experimental groups were 3.81 (18) and 3.65 (15), respectively, showing no statistically significant difference (p=0.944). the average hospitalization lengths for the control and experimental groups were 9.35 days (249 days) and 10.61 days (422 days), respectively, but no statistically significant difference was observed (p=0.133) (table 2, fig. for the duration of this study, there were 54 patients (44 men, 10 women) with an average age of 48.50 yr (2383 yr). the causes of thoracic injury consisted of 24 falls, 17 traffic accidents, 11 physical assauls, and 2 other causes. the most painful or tender area was the left side in 28 and the right side in 26. of the 54, 31 received the conventional medication treatment (control group) and 23 received the conventional medication treatment along with icnb (experimental group). a total of 17 patients, 11 from the control group and 6 from the experimental group, required chest tube insertion due to rib fracture - related lung injuries resulting in traumatic hemothorax or pneumothorax (table 1). the average number of fractured ribs in patients from the control and experimental groups were 3.19 (17) and 4.91 (19), respectively, a difference that was statistically significant (p=0.008). at the time of admission, the average pain scores for the control and experimental groups were 8.16 (210) and 9.43 (410), respectively, but the difference was not statistically significant (p=0.200). the average pain scores immediately after medication administration (procedure) in the control and experimental groups were 7.42 (210) and 5.39 (09), respectively, showing a statistically significant reduction in pain in the experimental group (p=0.007). the average pain scores 1 day after medication administration (procedure) in the control and experimental groups were 6.16 (210) and 5.04 (110), respectively, but were not statistically different (p=0.240) ; after 7 days, the pain scores in the control and experimental groups were 3.81 (18) and 3.65 (15), respectively, showing no statistically significant difference (p=0.944). the average hospitalization lengths for the control and experimental groups were 9.35 days (249 days) and 10.61 days (422 days), respectively, but no statistically significant difference was observed (p=0.133) (table 2, fig. in treating rib fractures among all thoracic injuries, optimal pain control is most important as it can not only relieve pain but also prevent complications in the respiratory system and related mortality. the efficacy of oral administration or injection of conventional non - steroidal anti - inflammatory drugs or opioid class drugs may vary among patients, but oral medications can generally be discontinued in 23 weeks. in this study, however, more aggressive pain relief measures are being used after considering patient s demand or advanced age as well as to prevent complications from underlying diseases. in this study, a statistically significant difference was observed in the number of fractured ribs between the control and experimental groups, while the pain levels at the time of admission did not show a statistically significant difference. these results indicated that the patients subjective pain levels were based on the number of fractures, thereby reflecting the allocation into the experimental group by patient s request. 2013) stated that pain could be controlled by injecting anesthetics or steroids into the thoracic epidural space ; it was reported to be effective for bilateral rib fractures. the technical methodology of icnb was reported by moore and bridenbaugh (1962) ; it includes using medical imaging techniques to find the intercostal nerve targeted for blocking on the basis of the pain location, and then injecting a local anesthetic into the target area. the advantages of icnb are as follows : relatively simple for use ; no neurological complications due to nausea, vomiting, dizziness, or bleeding ; and no complications from possible misjudgment observed in other measures such as thoracic epidural injection or iv pca. the disadvantages include claims that it must be repeated every 68 h because its effects do not last long (pederson., 1983) and the possibility of complications such as pneumothorax or hemothorax (rauchwerger., 2013). although no complications were observed in this study, significant pain reduction was observed immediately after treatment, a pattern of slowed pain reduction emerged 1 day after treatment, which is thought to be due to depletion of the medication used in icnb (wurnig., 2002). in addition, the lack of statistically significant differences between the two groups in the pain levels at 7 days after treatment, pain levels at the time of discharge, and the length of hospitalization leads us to believe that icnb shows maximum efficacy immediately after treatment but then gradually diminishes (fig. measures to address this effect are needed include the use of additional medication such as iv pca, and/or a fentanyl patch. other pain control measures include the intrapleural injection of a local anesthetic (mann., 1992) or a paravertebral block, which is used primarily in unilateral rib fracture cases. in addition, although supporting medical evidence may be insufficient, pain control in patients with rib fractures by using acupuncture has also been reported (ho., 2014). evidence supporting the use of aggressive pain control for rib fracture pain includes not only the aforementioned prevention of potential complications but also the prevention of sustained disability that can develop from the pain not being controlled aggressively enough early on, leading to chronic pain. according to the report by gordy. (2014) stated that chronic pain developed in 28% of patients with rib fractures, and 40% of patients developed disabilities from chronic pain. the limitations of this study include the retrospective nature of the study, examination of icnb only among several possible pain control measures, and no differentiation of the pain caused by the chest tube insertion. however, this study confirmed the efficacy and the characteristics of icnb use in patients with rib fractures. herein, we can conclude that icnb has the advantage of showing dramatically more effective pain control, in comparison to conventional medications, in the initial stage of treatment of patients with thoracic injuries. however, such effect did not extend for the entire duration of the hospitalization and gradually diminished, which indicates that when the pain becomes more severe after icnb, more aggressive pain control measures are required. | controlling pain in patients with fractured ribs is essential for preventing secondary complications. conventional medications that are administered orally or by using injections are sufficient for the treatment of most patients. however, additional aggressive pain control measures are needed for patients whose pain can not be controlled effectively as well as for those in whom complications or a transition to chronic pain needs to be prevented. in this study, we retrospectively analyzed the medical records of patients in our hospital to identify the efficacy and characteristics of intercostal nerve block (icnb), as a pain control method for rib fractures. although icnb, compared to conventional methods, showed dramatic pain reduction immediately after the procedure, the pain control effects decreased over time. these findings suggest that the use of additional pain control methods (e.g. intravenous patient - controlled analgesia and/or a fentanyl patch) is recommended for patients in who the pain level increases as the icnb efficacy decreases. |
cardiovascular disease (cvd) is a major health problem worldwide and despite significant advances in treatment approaches that led to reduced cvd - related mortality over the last few years, the number of individuals living with damaged heart has increased. it is well recognized that elevated plasma level of low - density lipoprotein - cholesterol (ldl - c) is a cardinal risk factor for atherosclerosis and cvd (1,2). deposition of pro - atherogenic ldl - c, on the intima of arterial wall, a process mediated by macrophages, contributes to the plaque formation and atherosclerosis. this further leads to lowered blood flow to vital organs and increased risk of atherothrombotic and atheroembolic sequelae. several clinical studies have shown a direct association between ldl - c reduction and coronary heart disease prevention (1,3). it is known that every 1 mm decrease in plasma ldl - c lowers the risk of cardiovascular events by 2022% (4,5). a target reduction of ldl - c to < 2.5 mm for high - risk patients and < 1.8 mm for very high - risk patients has been suggested by the european guidelines for managing dyslipidemia (6). the identification of statins, the inhibitors of 3-hydroxy-3-methylglutaryl - coenzyme a (hmg - coa) reductase, the rate - limiting enzyme of cholesterol biosynthesis, revolutionized the treatment of dyslipidemia and due to their overwhelming success in reducing hypercholesterolemia and reducing ldl - c they rapidly became the choice of first line therapy for this indication (7). however, statin therapy was effective in reducing dyslipidemia and preventing cardiovascular events only in 50% of the patient population (4) and in some patients, particularly those with familial hypercholesterolemia, these drugs were not effective to meet the required goals of lower ldl - c, and to reduce the cvd risk (8). in addition, many patients even develop intolerability to statins and resistance (9). thus there has been a significant impetus to develop alternate therapeutics to meet the requirements of reducing ldl - c and the incidence of cardiovascular events. several such programs to develop novel therapeutics were not successful due to safety issues and lack of better efficacy over statins (10,11), except ezetimide, which has been found to further improve dyslipidemia over statin therapy (12). even combination of lipid lowering drugs such as fibrates and nicotinic acid derivatives failed to improve cvd events, when used in conjunction with statins (13). thus, clinical guidelines do not recommend the use of non - statin drugs in combination with high - intensity statin treatment (14). the finding of pro - protein convertase subtilisin / kexin type 9 (pcsk9) (15) and association of mutations in this protein with familial hypercholesterolemia (16) led to the identification of pcsk9 as a new therapeutic target for lowering ldl - c and dyslipidemia - associated cvd. convertase or subtilase enzymes that process precursor protein, and are generally inactive, to active mature products that are functional. substrates for these convertases include a wide array of precursor proteins, such as hormones, receptors, growth factors and other enzymes (17). however, pcsk9 per se does not have an enzymatic function except for the autocatalytic cleavage of its own pro - domain, to become a mature protein. pcsk9 is encoded by a 22-kb long gene consisting of 12 exons and located at chromosome 1p32. pcsk9 gene codes for a 692-amino acid protein of 74 kda molecular weight, which later undergoes autocatalytic cleavage to the mature 62 kda form, in endoplasmic reticulum / golgi bodies, from where it is secreted into circulation. the cleaved prodomain remains non - covalently associated with the mature 62 kda protein and is essential for the biological function of pcsk9 (18). pcsk9 is primarily synthesized in hepatocytes but other tissues including intestine, brain and kidneys are also known to express this protein (19,20). the transcription factor sterol regulatory element - binding protein 2 (srebp-2) upregulates pcsk9 expression (21) and ldl - receptor (ldlr) as well as enzymes involved in cholesterol biosynthesis, such as hmg - coa reductase. unlike other proconvertase enzymes, pcsk9 is secreted as a complex of mature pcsk9 (153692 aa) and its inhibitory pro - segment (aa 32152) (15,22). this complex of pcsk9 is enzymatically inactive as its active site is blocked by the inhibitory pro - segment and thus prevents it from binding with any other substrates (23). thus, it appears that pcsk9 is its own substrate and its physiological activity probably resides in its ability to bind specific target proteins to escort them towards intracellular degradation compartments. the first and probably the most studied and important target of pcsk9 is ldlr on the hepatocyte surface in liver (22). it has been shown in a mouse model that pcsk9 inactivation leads to a significant reduction in cholesteryl esters and atherosclerosis, whereas the overexpression of pcsk9 led to opposite changes and excessive atherosclerosis and all these effects of pcsk9 expression were absent in the ldlr - ko mouse (24). pcsk9 is shown to associate with the epidermal growth factor - a (egf - a) domain of ldlr and to other similar receptors such as the vldl receptor (25). previous studies have indicated that pcsk9 is involved in the regulation of plasma triglyceride rich protein and thus it was observed that a deficiency of pcsk9 is associated with significantly lowered plasma triglycerides both in the clinical setting (26) and in genetically altered mice (27). the complex of ldl - c / ldlr normally enters cells through clathrin heavy chain - coated vesicles, followed by its dissociation in the acidic environment of endosomes to ldlr and and ldl - c. ldlr is usually recycled back to the cell surface, whereas the ldl - c is degraded in lysosomes, where the recovered cholesterol is reutilized in the cell (fig., the complex of ldlr - pcsk9, which also enters the cells through the clathrin - coated vesicles, does not dissociate and is degraded in lysosomes, via some unknown mechanism (29). pcsk9 is shown to direct ldlr for degradation through intracellular pathways 48 and also after its secretion extracellularly by binding to the ldlr (30). while there is ample evidence for these two pathways in hepatocytes, it is not clear if the two pathways are operational in other cells where pcsk9 is expressed. the cys / his - rich domain present at the c - terminus of pcsk9 appears to be essential for the intracellular and the extracellular ldlr degradation pathways mediated by pcsk9 (31). it has been suggested that the acidic environment of endosomes causes his residues of chrd domain to be positively charged, making its interaction with the negatively charged ligand - binding domain of ldlr stronger and facilitating its targeting to lysosomes for degradation (fig. 1) (32). even though it has been suggested that the amyloid precursor - like protein 2 (aplp-2) participates in the targeting of pcsk9-ldlr complex to lysosomes, through its interaction with chrd at the surface (33), knockdown of aplp-2 had no effect on pcsk9-mediated ldlr degradation, either via the intracellular or extracellular pathways (18). interaction of plasma ldl, in particular, the apob component of ldl, can bind to circulating pcsk9 and compromise its ability to bind with cell surface ldlr. thus several players influence the pcsk9-mediated targeting and degradation of ldlr, including protein x, apob, and sec24a, although the mechanistic details of these regulations are not entirely clear. thus, there is a positive correlation between circulating pcsk9 and ldl - c, as increased levels of pcsk9 lead to ldlr degradation, rendering the cells unable to import ldl - c from circulation. by contrast, binding to ldlr followed by intracellular clearance seems to be the major route for the removal of pcsk9 from circulation, as demonstrated in ldlr - ko mice (34) and in homozygous familial hypercholesterolemia patients (35). following its discovery by seidah (17), mutations in pcsk9 were found to be associated with familial hypercholesterolemia in a french family and a realization that these are gain - of - function mutations (16,36), led to the hypothesis that loss - of - function mutations and inhibition of pcsk9 activity can be beneficial in curtailing dyslipidemia (fig. gain - of - function mutations of pcsk9 cause an increased level of this protein in circulation and thus elevated ldl - c. it was also noted that d374y mutant pcsk9 has a much higher affinity for ldlr as compared with the wild - type pcsk9 and subjects with this mutation are found to be highly susceptible to develop premature coronary heart disease (23) with severe form of familial hypercholesterolemia and are also less responsive to statins (37). another gain - of - function mutation, r218s, was found to significantly decrease pcsk9 catabolism, thus promoting its increased circulation time and also high cholesterol levels (38). besides the gain - of - function mutations, mutations that led to its loss of function were also identified and were found to be beneficial. thus, it was observed that carriers of two nonsense pcsk9 variants, y142x and c679x, decreased plasma ldl - c by ~1.0 mm and the incidence of cvd in these subjects was reduced by ~88%. similarly, another pcsk9 variant, r46l, is known to be associated with an ldl - c reduction of 0.5 mm, and a 47% reduction in cvd risk (39). protein stability of r46l mutant pcsk9 is reported to be decreased with increased degradation, as well as its affinity for ldlr (40). thus, y142x and c679x mutations are seen in 2% of african - americans whereas r46l is present in 24% of caucasian populations (41). other losses of function pcsk9 mutations are the truncating mutations w428x and l82x (43). in an interesting case of compound heterozygous woman, y142x mutation of pcsk9 was inherited from the mother and c290 - 292 delgcc mutation was from the father. the woman had no detectable pcsk9 in circulation with only 0.36 mm ldl - c and lived a healthy normal life, indicating that pcsk9 is not necessary for normal life (44). a specific french - canadian mutation q152h, which causes loss of function of pcsk9, has been shown to prevent the autocatalytic processing of propcsk9, leading to the formation of a dominant negative form of pcsk9, which reduces the circulating levels of pcsk9 and also ldl - c by ~50% (45). several strategies have been examined to develop pcsk9 antagonists because of the promise they hold as therapeutic agents against dyslipidemia and associated cvd. attempts to develop small molecule inhibitors, peptidomimetics, were not successful because of specificity and accessibility issues. to date it appears that monoclonal antibodies against pcsk9 are the best approach to block pcsk9 function (fig. many pharmaceutical companies such as sanofi (gentilly, france) and amgen (thousand oaks, ca, usa) have developed different therapeutic monoclonal antibodies against pcsk9 (evolocumab, alirocumab and bococizumab), which have been clinically tested in several trials and found to be safe and efficacious in reducing ldl - c and also triglycerides. evolocumab (amg145), developed by amgen, is a fully human monoclonal antibody inhibitor of pcsk9 and several meta - analyses recently have shown that this mab is well tolerated and more efficacious than statins in patients with familial hypercholesterolemia (47,48). evolocumab was also found to reduce cardiovascular outcomes in statin treated patients (49). alirocumab (sar236553/regn727), also a fully humanized monoclonal antibody was developed by sanofi and is found to be almost equipotent as evolocumab in controlling ldl - c, triglycerides and also cardiovascular outcomes (49). clinical experience with the anti - pcsk9-monoclonal antibodies indicates that these therapeutic agents are safe and well tolerated, without any major safety issues and serious drug - related adverse events (50). the most common adverse events were nasopharyngitis, upper respiratory tract infections, influenza - like symptoms and back pain (51). even though treatment related adverse effects were not noted in patients receiving pcsk9 mabs, caution needs to be exercised for possible hypocholesterolemia associated adverse effects such as cognitive impairment as well as hemorrhagic stroke (49). more clinical data are needed to ascertain if these are potential problems or of not much concern. plasma level of ldl - c is a major risk factor for atherosclerosis and cvd. the most commonly used statin therapy is effective in reducing dyslipidemia and preventing cardiovascular events only in about half of the patient population and these drugs are not effective in patients with familial hypercholesterolemia, to meet the required goals of lower ldl - c, to reduce the cvd risk. the finding of pcsk9, which promotes ldlr breakdown and association of pcsk9 gain of mutations with familial hypercholesterolemia and loss of mutations with reduced levels of ldl - c, led to the identification of pcsk9 as a new therapeutic target for lowering ldl - c and dyslipidemia associated cvd. monoclonal antibodies against pcsk9 are currently being tested in clinical trials and have been found to be safe without any major adverse effects and efficacious in countering the activity of pcsk9 and thus control the plasma ldl - c and triglycerides even in statin - non responsive patients and protect against dyslipidemia - related cvd. further research is needed to clearly establish their protective effect against cvd and related mortality. | it is well recognized that the elevated plasma level of low - density lipoprotein - cholesterol (ldl - c) is a major risk factor for atherosclerosis and cardiovascular disease (cvd). deposition of pro - atherogenic ldl - c, on the intima of arterial wall, contributes to plaque formation and atherosclerosis, which further leads to lowered blood flow to vital organs and increased risk of cvd. the most commonly used statin therapy is effective in reducing dyslipidemia and preventing cardiovascular events only in about half of the patient population. however, in patients with familial hypercholesterolemia, these drugs were not effective to meet the required goals of lower ldl - c, and to reduce the cvd risk. furthermore, many patients even develop intolerability to statins and resistance. the identification of pro - protein convertase subtilisin / kexin type 9 (pcsk9) and the association of pcsk9 mutations with familial hypercholesterolemia led to the identification of pcsk9 as a new therapeutic target for lowering ldl - c and dyslipidemia - associated cvd. pcsk9 is found to promote the degradation of ldl - receptor (ldlr), thus rendering it unavailable for recycling to hepatocyte plasma membrane, leading to elevated levels of circulating ldl - c, as it can not be taken up into cells. while gain - of - function mutations aggravate the degradation of ldlr as in familial hypercholesterolemia whereas loss of function mutations reduce the ability of pcsk9 to promote the degradation of ldlr and thus lower the plasma level of ldl - c and dyslipidemia. monoclonal antibodies against pcsk9 are currently being tested in clinical trials and are found to be efficacious in countering the activity of pcsk9 and thus control the plasma ldl - c and triglycerides even in statin non - responsive patients and protect against dyslipidemia - related cvd. |
a 87-year - old bedridden woman for 6 months who followed due to severe dementia and monitored in neurology clinic with the diagnosis of alzheimer s disease, was consulted to our clinic because of pruritus and bleeding of her left ear. she was suffering from itching in her left ear for nearly a month and bleeding for 2 days. on her physical examination, then the patient was brought into the operating room for otomicroscopic examination external ear canal was irrigated with 10% lidocaine spray, and 70% ethanol to restrict the movements of larvae. under microscopic guidance, 7 white - colored, thick, and segmented larvae with a mean length of 10 - 15 mm were extracted from inside the external ear canal with the aid of an aspirator, and alligator clamps (figure 2). an area of perforation on the posterior quadrant of the tympanic membrane was observed. external ear canal, and middle ear were irrigated with physiologic saline. topical antibiotherapy was initiated with a mixture of hydrogen peroxide and boric acid solution one week later larvae were not encountered within her external ear canal. because of her advanced age, and mental health state tympanoplasty operation was not conceived. myiasis can be seen in various regions, skin, body cavities, and organs. aural myiasis can manifest itself in various forms including ophthalmomyiasis, nasal myiasis, urogtenital myiasis, intestinal myiasis, and cutaneous myiasis [3 - 6 ]. only one species of dipterous larva can involve more than one anatomical region or different species can be seen in the same region. literature reviews have detected its presence generally in children, people with poor hygiene or those having predisposing factors. among these predisposing factors mental retardation, immobilization, immunosuppression, and diabetes mellitus can be enumerated. besides chronic otorrhea is considered as a risk factor in healthy, and ambulatory patients. our case was a bedridden patient for nearly 6 months with a limited interaction with her environment. these patients can present with complaints of sensation of foreign substance in the ear, aural itching, pain, bleeding, tinnitus, hearing loss, and vertigo [8, 9 ]. in our case, however aural pruritus was not considered as an important symptom by her relatives, and the patient was not consulted to an ent specialist till her left ear bled. this otorrhagic symptom was thought to be related to frequent scratchings, and the patient was fastened to her bed. since in cases with otomyiasis early diagnosis is thought to be very important, especially in patients with predisposing factors, persistent ear itching should lead the physician to be suspicious of otomyiasis, and the patients should be evaluated with meticulous otoscopic examination. in literature reviews, the most frequently encountered species of parasites in cases with aural myiasis are cochliomyia hominivorax, wohlfahrtia magnifica, chrysomya bezziana, chrysomya megacephala, and parasarcophaga crassipalpis. in our case segmented larvae measuring approximately 10 - 15 mm covered with bands of irregularly, and however during this period because of both mechanical effects of larvae, and collagenases they secrete, they induce many complications in the patient. these complications can include perforation of the tympanic membrane, destruction of the middle ear, and mastoid cavity, and fatal central nervous system invasion. the most important point in the prevention of complications is early diagnosis, and eradication of the larvae as soon as possible. this procedure should be performed under microscope is especially important in the evaluation of the middle ear in cases with tympanic membrane perforation. following mechanical cleaning irrigation of the ear canal with 70% ethanol, 10% chloroform or physiologic saline, urea, dextrose, creatinine, and topical ivermectin is recommended so as to get rid of the remaining larvae. in addition, in cases with suspect furuncle or secondary infection, topical antibiotherapy can be prescribed [8 - 10 ]. in conclusion, persistent ear itching, and pain, and irritability especially in patients with predisposing factors as mental retardation, dementia, and immunosuppression, oto myiasis should be kept in mind. | myiasis is the infestation of live vertebrates with dipterous larvae. aural myiasis involves infestation of the external ear and/or middle ear. it is a rare clinical state that usually occurs in patients who have mental or physical disabilities. although myiasis is a self - limiting disease, it can be associated with fatal complications like penetration within the central nervous system. we present a 87-year - old patient suffering from alzheimer s disease with aural myiasis and also discuss the clinical presentation and efective therapies with a review of the literature. |
reference strain ev9 hill (ev9) was obtained from the national institute for public health and the environment (rivm, bilthoven, the netherlands). cvb3 nancy (cvb3) was provided by r. kandolf (university of tbingen, tbingen, germany). production of virus stocks and virus titrations were performed on buffalo green monkey cells as previously described. serial 10-fold dilutions were tested in 96-well microtiter plates, and 50% tissue culture infective doses were calculated as previously described (28). human and porcine pancreatic islets were isolated in pittsburgh as previously described (29). human islets were obtained from deceased anonymous donors procured by the center for organ recovery and education (core) (pittsburgh, pa), and islets were isolated using a modification of the semiautomated method described by ricordi (29,30). batches of islets used in this study were obtained from four adult human pancreata and three porcine donors, cultured for a minimum of 36 days in connaught medical research laboratories (cmrl)-1066 medium containing 10% fcs, 2 mmol / l l - glutamine, 100 units / ml penicillin, and 0.1 mg / ml streptomycin (complete cmrl) at 37c in an atmosphere of 5% co2. islet viability was estimated by dual - fluorescence viability dyes (calcein - am and propidium iodide ; invitrogen, eugene, or) and was higher than 80% in all batches. after culture for 36 days, the islets were sent to nijmegen as free - floating islets and cultured in complete cmrl in ultra - low attachment culture plates (corning) at 37c in 5% co2. islets were cultured in nijmegen for a maximum of 2 days before the start of the experiments. merja roivainen and dr. per bendix jeppesen and were cultured in dulbecco 's modified eagle 's medium (gibco) supplemented with 15% fcs, ciproxin, and 50 mol / l -mercaptoethanol at 37c in 5% co2. islets and min6 cells were infected in a small volume of cmrl-1066 or dulbecco 's modified eagle 's medium, respectively, at indicated multiplicity of infection (moi) for 1 h at 37c. subsequently, cells were washed and viral titers were determined at different time points as described above. in some experiments, supernatant from infected cultures was harvested at indicated time postinfection and cleared from cell debris by centrifugation before stimulation of other cells. mature dcs were obtained by stimulating cells with poly(i : c) (20 g / ml). stimulation of dcs with supernatant from min6 cells or from dc / min6 co - cultures was performed using a 1:2 dilution of supernatant. to block the actions of type i ifns, cells were stimulated in the presence or absence of neutralizing anti - human ifn antibodies (1:75, iivari, kaaleppi, or bovine serum ; courtesy of dr. julkunen, national public health institute, helsinki, finland) (33). for infection, stimulated or unstimulated dcs were harvested using cold pbs and infected in rpmi. after 60 min incubation at 37c, cells were washed and viral titers were determined as described above. human and porcine pancreatic islets or min6 cells were labeled using pkh26 (sigma - aldrich) according to the manufacturer 's instructions and infected with cvb3 at an moi of 10. dcs were labeled using carboxyfluorescein diacetate succinimidyl ester (cfse) (invitrogen) according to the manufacturer 's instructions. pkh - labeled cells were added to cfse - labeled dc cultures at a ratio of 1:1. alternatively, labeled, infected min6 cells were incubated for 48 h and subsequently harvested and resuspended in fresh medium at a density of 5 10 cells / ml prior to placing them at 20c until further use. freeze - thawed cell preparations were subsequently used in dc co - cultures at a 1:1 ratio and resulted in similar inductions of isgs and innate responses compared with co - culture with viable cells (supplemental fig. these cell preparations were also used for ribonuclease (rnase) treatment prior to dc stimulation. for that purpose, min6 cell preparations were exposed to a mixture of rnase a, rnase vi, and rnase i (all ambion) or an equal volume of pbs for a period of 30 min at 37c prior to addition to dcs. uptake of islets or min6 cells by dcs was analyzed using flow cytometry and confocal microscopy. in some experiments, phagocytosis was inhibited using cytochalasin d (cytd) (2.5 g / ml), or endosomal acidification was inhibited using chloroquine (cq) (10 mol / l). dcs were pretreated for 30 min with cytd or cq, and subsequently stimuli were added. both treatments had no effect on cell viability as assessed by trypan blue exclusion 8 h after stimulation. staining and visualization of dcs human islets were adhered onto fibronectin - coated coverslips for 2 h at 37c in islet medium and subsequently fixed in 2% paraformaldehyde. cells were blocked in pbs containing 100 mmol / l glycine and 2% goat serum, permeabilized using tx-100, and stained with mouse anti - vp1 (dakocytomation) and rabbit anti-3a (35) followed by incubation with goat anti - mouse igg alexa 488 and goat anti - rabbit igg alexa 594. reference strain ev9 hill (ev9) was obtained from the national institute for public health and the environment (rivm, bilthoven, the netherlands). cvb3 nancy (cvb3) was provided by r. kandolf (university of tbingen, tbingen, germany). production of virus stocks and virus titrations were performed on buffalo green monkey cells as previously described. serial 10-fold dilutions were tested in 96-well microtiter plates, and 50% tissue culture infective doses were calculated as previously described (28). human and porcine pancreatic islets were isolated in pittsburgh as previously described (29). human islets were obtained from deceased anonymous donors procured by the center for organ recovery and education (core) (pittsburgh, pa), and islets were isolated using a modification of the semiautomated method described by ricordi (29,30). batches of islets used in this study were obtained from four adult human pancreata and three porcine donors, cultured for a minimum of 36 days in connaught medical research laboratories (cmrl)-1066 medium containing 10% fcs, 2 mmol / l l - glutamine, 100 units / ml penicillin, and 0.1 mg / ml streptomycin (complete cmrl) at 37c in an atmosphere of 5% co2. islet viability was estimated by dual - fluorescence viability dyes (calcein - am and propidium iodide ; invitrogen, eugene, or) and was higher than 80% in all batches. after culture for 36 days, the islets were sent to nijmegen as free - floating islets and cultured in complete cmrl in ultra - low attachment culture plates (corning) at 37c in 5% co2. islets were cultured in nijmegen for a maximum of 2 days before the start of the experiments. merja roivainen and dr. per bendix jeppesen and were cultured in dulbecco 's modified eagle 's medium (gibco) supplemented with 15% fcs, ciproxin, and 50 mol / l -mercaptoethanol at 37c in 5% co2. islets and min6 cells were infected in a small volume of cmrl-1066 or dulbecco 's modified eagle 's medium, respectively, at indicated multiplicity of infection (moi) for 1 h at 37c. subsequently, cells were washed and viral titers were determined at different time points as described above. in some experiments, supernatant from infected cultures was harvested at indicated time postinfection and cleared from cell debris by centrifugation before stimulation of other cells. mature dcs were obtained by stimulating cells with poly(i : c) (20 g / ml). stimulation of dcs with supernatant from min6 cells or from dc / min6 co - cultures was performed using a 1:2 dilution of supernatant. to block the actions of type i ifns, cells were stimulated in the presence or absence of neutralizing anti - human ifn antibodies (1:75, iivari, kaaleppi, or bovine serum ; courtesy of dr. julkunen, national public health institute, helsinki, finland) (33). for infection, stimulated or unstimulated dcs were harvested using cold pbs and infected in rpmi. after 60 min incubation at 37c, cells were washed and viral titers were determined as described above. human and porcine pancreatic islets or min6 cells were labeled using pkh26 (sigma - aldrich) according to the manufacturer 's instructions and infected with cvb3 at an moi of 10. dcs were labeled using carboxyfluorescein diacetate succinimidyl ester (cfse) (invitrogen) according to the manufacturer 's instructions. pkh - labeled cells were added to cfse - labeled dc cultures at a ratio of 1:1. alternatively, labeled, infected min6 cells were incubated for 48 h and subsequently harvested and resuspended in fresh medium at a density of 5 10 cells / ml prior to placing them at 20c until further use. freeze - thawed cell preparations were subsequently used in dc co - cultures at a 1:1 ratio and resulted in similar inductions of isgs and innate responses compared with co - culture with viable cells (supplemental fig. these cell preparations were also used for ribonuclease (rnase) treatment prior to dc stimulation. for that purpose, min6 cell preparations were exposed to a mixture of rnase a, rnase vi, and rnase i (all ambion) or an equal volume of pbs for a period of 30 min at 37c prior to addition to dcs. uptake of islets or min6 cells by dcs was analyzed using flow cytometry and confocal microscopy. in some experiments, phagocytosis was inhibited using cytochalasin d (cytd) (2.5 g / ml), or endosomal acidification was inhibited using chloroquine (cq) (10 mol / l). dcs were pretreated for 30 min with cytd or cq, and subsequently stimuli were added. both treatments had no effect on cell viability as assessed by trypan blue exclusion 8 h after stimulation. human islets were adhered onto fibronectin - coated coverslips for 2 h at 37c in islet medium and subsequently fixed in 2% paraformaldehyde. cells were blocked in pbs containing 100 mmol / l glycine and 2% goat serum, permeabilized using tx-100, and stained with mouse anti - vp1 (dakocytomation) and rabbit anti-3a (35) followed by incubation with goat anti - mouse igg alexa 488 and goat anti - rabbit igg alexa 594. human pancreatic islets were found to be susceptible to infection by cvb3 as indicated by the profound increase in virus titer, cytopathic effects, and immunofluorescence staining against viral proteins 3a and vp1 (fig. infected cells mainly resided at the outer layers of the islets, where cells might be more accessible for the virus (fig. previously it was shown that such a productive infection results in impaired islet function (36). cvb replicates in human and porcine pancreatic islets, and dcs can phagocytose islets, resulting in induction of isgs. a and b : human islet cells were infected with cvb3 at an moi of 10, and at indicated time points replication was analyzed (a) and at 48 h postinfection (p.i.) images were taken (b). after 24-h incubation, islets were adhered onto fibronectin - coated coverslips and stained using 3a (red)- and vp1 (green)-specific antibodies. d : human islets were pkh labeled and infected with cvb3 at an moi of 10 and cultured for 48 h before addition to cfse - labeled dcs. uptake of islets either mock - infected (m) or cvb - infected (cvb) was analyzed by flow cytometry 24 h after co - culture. e : human islets were pkh labeled and infected as in d and co - cultured with unlabeled dcs for 24 h. subsequently, dcs were harvested, stained using cd86-specific antibodies (green), and analyzed using confocal microscopy. f : human islets were infected with cvb3 at an moi of 10 for 48 h prior to addition to dcs. expression of rig - i, mda5, and pkr mrna in dcs was analyzed using qpcr. g : porcine islets were prepared and co - cultured as in f and isg - induction was analyzed at indicated times. in some experiments (f and g), freeze - thawed preparations of islets were used, but these yielded similar results compared with using viable cells. islet / cvb, cvb - infected human islets ; islet / m, mock - infected human islets ; med, medium, i.e., unstimulated dcs ; porc islet / cvb, cvb - infected porcine islets ; porc islet / m, mock - infected porcine islets. (a high - quality color representation of this figure is available in the online issue.) to investigate whether human dcs can phagocytose human pancreatic islets, pkh - labeled human islets were mock or cvb3 infected for 48 h and subsequently co - cultured with cfse - labeled dcs. cvb3 has no direct effect on human dcs and is incapable of infecting dcs (28). mock- and cvb3-infected islets were taken up with equal efficiency as indicated by the number of dcs that became pkh positive (fig. confocal analysis confirmed uptake of human pancreatic islets material by dcs. the dc plasma membrane was stained with cd86-specific antibodies (green), and pkh - positive islet cells (red) were observed within the dcs (fig. 1e). to examine whether and how dcs respond to virus - infected human islets, we studied activation of innate immune response pathways by measuring levels of isgs, such as rig - i, mda5, protein kinase r (pkr), and irf-7 following phagocytosis of infected cells. quantitative pcr (qpcr) revealed induction of isgs after engulfment of cvb3-infected islets ; moreover, increased expression was observed for all isgs tested (fig. importantly, stimulation of dcs with mock - infected human islets alone did not induce any isgs (fig. furthermore, stimulation with cvb3 alone also did not induce isgs (28), suggesting that the induction depends on the presence of virus or viral products within phagocytosed cells. cvb3 was not able to replicate in dcs upon entry via phagocytosis, as determined by end point titration at several times after the start of co - cultures (data not shown). in some experiments, freeze - thawed mock- or cvb - infected cells were used. this had no effect on either phagocytosis or isg induction (see below). at this stage, we were unable to discriminate whether the isgs were upregulated in dcs or in the islets themselves. therefore, we performed experiments using porcine islets, which have been shown as useful models for studies on the interaction of cvbs with -cells (37). to discriminate between isgs in porcine islets and human dcs, primers were used that specifically recognize human, but not porcine, isg sequences. infection and uptake of porcine islets by dc was similar as described above for the human islets (data not shown). phagocytosis of cvb - infected porcine islets resulted in a profound increase in human isgs (fig. thus, using porcine islets, we confirmed induction of isgs in human dcs upon uptake of cvb3-infected human islets, and, additionally revealed that isg expression is increased in the human dc population. to further investigate the underlying mechanism of dc responses upon uptake of islets, we selected the murine min6 cell line as a model for pancreatic -cells. min6 cells retain the physiological characteristics of normal -cells and respond to glucose within the physiological range (32). these islet - like cells grow in patches (fig. 2b, left panel) and were confirmed to express several -cell associated mrnas (e.g., gad65, islet - specific glucose-6-phosphatase catalytic subunit - related protein [igrp ], insulinoma - associated protein 2, insulin, [data not shown ]). analogous to human and porcine islets, min6 cells were susceptible to infection with cvb3 as shown by the increase in virus titer (fig. uptake of mock- and cvb3-infected min6 cells by dcs was very efficient (up to 75%) as shown by flow cytometry and confocal analysis (fig. 2c and d). min6 cells are a good model for primary pancreatic cells, are phagocytosed by dcs, and induce innate antiviral immune responses. a and b : min6 cells were infected with cvb3 at an moi of 10, and replication was analyzed at indicated time points (a) and images were taken at 48 h postinfection (p.i.) (b). c : min6 cells were pkh - labeled and infected with cvb3 at an moi of 10. after 24-h incubation, cells were harvested and added to cfse - labeled dcs at a 1:1 ratio. after 24-h co - culture, cells were harvested and uptake was determined using flow cytometry. d : min6 cells were prepared as in c and co - cultured with unlabeled dcs for 24 h, after which dcs were harvested, stained as in fig. e and f : min6 cells were prepared as in c, and after 48-h incubation, cells were harvested and added to dcs at a 1:1 ratio or dcs were stimulated with 20 g / ml poly (i : c) or left untreated. at 5 h after addition (e), or 5 h and 8 h after addition (f), mrna induction of isgs was determined as described. g : protein expression of rig - i, mda5, and pkr was analyzed by western blot 24 h after stimulation of dcs as described for panel e. h : dcs were stimulated as in e, and after 24-h co - culture cells were harvested and infected with ev9 at an moi of 1. at indicated times postinfection, ev9 replication was analyzed. poly (i : c) was used as a positive control (34). in some experiments, freeze - thawed cell populations were used but these yielded similar results compared with using viable cells (supplemental fig. 1). data shown are representative (a d, g, and h) or averages (e and f) of at least three independent experiments. med, medium, i.e., unstimulated cells ; m6/cvb, cvb - infected min6 cells ; m6/m, mock - infected min6 cells ; n.s., not significant. (a high - quality color representation of this figure is available in the online issue.) upon engulfment of cvb - infected min6 cells, ifn- and isgs were strongly induced in dcs (fig. 2e and f), reaching a greater than 100-fold increase compared with unstimulated dcs in the case of rig - i, while mda5 and pkr showed increases of up to 20- and 10-fold, respectively (fig. the induction of isgs following uptake of infected min6 cells was confirmed at the protein level by western blotting (fig. no isg signal was observed in mock- or cvb3-infected min6 cells alone (data not shown), excluding that the observed protein induction in dc / min6 co - cultures is due to detection of min6 cell proteins. in some experiments, 1). ifns and isgs induce an antiviral state that restricts virus replication (38). to determine whether upregulation of isgs following uptake of cvb3-infected min6 cells protects dcs from subsequent infection, dcs that had taken up min6 cells were infected with ev9, an enterovirus strain that replicates in dcs (28) but not in min6 cells (data not shown). uptake of mock - infected cells had no influence on replication of ev9 in dcs. in contrast, phagocytosis of cvb - infected min6 cells strongly protected the dcs from ev9 replication (fig isgs can be upregulated through both ifn - dependent and ifn - independent pathways (39,40). to investigate whether secreted cytokines such as ifn-/ were involved in isg induction, we stimulated fresh dcs with cell - free supernatant from dc / min6 co - cultures. an increase in isgs was observed upon stimulation of dcs with supernatant from co - cultures of dcs plus cvb - infected min6 cells but not of dcs plus mock - infected min6 cells (fig. moreover, the induction of isgs after uptake of cvb - infected cells was markedly reduced in the presence of neutralizing ifn-/ antibodies at both the mrna (fig. 3c [compare lanes 6 and 7 ]), implying that isg induction strongly depends on ifns. a : dcs were stimulated with cleared supernatants from stimulated dc and dc / min6 co - cultures (harvested 24 h after co - culture started and used at a 1:2 dilution) and mrna induction of rig - i, mda5, and pkr were determined using qpcr 8 h after stimulation. b : min6 cells were infected with cvb3 at an moi of 10 and incubation cells were harvested and added to dcs at a 1:1 ratio after 48 h. stimulations were performed in the absence or presence of neutralizing antibodies (iivari, kaaleppi, and bovine anti after 8 h, mrna expression levels of rig - i, mda5, and pkr were determined using qpcr. c : dcs were treated as in b and protein expression of rig - i, mda5, and pkr was analyzed by western blotting after 24 h. d : dcs were stimulated with 100 units / ml mifn or cleared supernatants from min6 cells (harvested 48 h postinfection and used at a 1:2 dilution), and isg mrna induction was determined after 8 h. data shown are representative of two (c) or average of three (a, b, and d) independent experiments. ic, poly (i : c) ; med, medium, i.e., unstimulated cells ; m6/cvb, cvb - infected min6 cells ; m6/m, mock - infected min6 cells ; mifna, murine recombinant ifn- ; n.s., not significant ; sup, supernatant ; w / o ab or w ab, without or with neutralizing anti ifn-/ antibodies, respectively. p < 0.05. to determine whether ifns produced by dcs or the infected min6 cells were responsible for isg upregulation, supernatants from infected min6 cultures were added to dcs, after which isg induction was monitored. although recombinant murine ifn- induced isg expression in dcs, supernatant of either mock- or cvb - infected min6 cells did not (fig. thus, cytokines potentially produced by infected min6 cells are not responsible for isg expression in dcs. collectively, these data imply that dcs induce an innate immune response upon uptake of cvb3-infected min6 cells and that this induction depends on ifn induction by dcs themselves. both prrs located on the cell surface and those with intracellular localization may mediate the observed responses in dcs. to investigate whether phagocytosis of cells is required for the induction of isgs or whether extracellular exposure to infected cells might initiate isg responses in dcs (e.g., via tlrs on the plasma membrane), phagocytosis was inhibited using cytd. dcs pretreated with cytd and subsequently stimulated with cvb3-infected min6 cells did not show any induction of isgs, indicating that phagocytosis is required for isg induction. similar decreases in isg induction were observed when using cvb - infected primary porcine islets (data not shown). poly (i : c)-induced isgs were also reduced upon cytd treatment, as has been previously reported (41). importantly, lipopolysaccharide (lps)-induced responses were not abrogated in the presence of cytd, proving that cytd has no adverse effects on dc viability or isg induction (fig. induction of innate immune responses in dcs after min6/cvb uptake requires (viral) rna within min6 cells. a : dcs were pretreated with cytd for 30 min prior to stimulation with tlr ligands or min6 cells. after 8 h, mrna expression levels of rig - i, mda5, and pkr were determined using qpcr. b : dcs were pretreated with cq for 30 min, stimulated as in a, and mrna expression was determined as in a. c : min6 cell preparations were exposed to a mixture of rnase a, rnase vi, and rnase i prior to addition to dc cultures as described. expression of rig - i, mda5, and pkr in dcs was analyzed using qpcr 5 h after addition of min6-cell preparations. d : dcs were co - cultured with min6-cell preparations as described for panel a, and protein expression of rig - i, mda5, and pkr was analyzed by western blotting 24 h after the start of co - culture. data are representative of two (d) or the average of two (a c) independent experiments. in these experiments, ic, poly (i : c) ; med, medium unstimulated cells ; m6/cvb, cvb - infected min6 cells ; m6/m, mock - infected min6 cells ; n.s., not significant ; w / o rnase or w rnase, without or with rnase treatment of min6 cell preparations prior to co - culture. phagocytosed cells are localized to so - called phagosomes, which subsequently mature via fusion with the endosomal / lysosomal compartments, followed by progressive decrease in ph (20,43). intracellular tlrs (tlr3, 7, 8, and 9) are also recruited to these compartments, enabling interaction with potentially released pamps such as dsrna, which occurs in a ph - dependent fashion (44). alternatively, phagocytosed material might be translocated into the cytoplasm, where, for example, the rlhs (rig - i and mda5) can interact with viral rna. to determine whether endosomal acidification is required for the induction of isgs following uptake of infected cell preparations, we pretreated dcs with cq, a chemical that blocks acidification of these compartments. pretreatment of dcs with cq markedly decreased cvb - infected min6-induced mrna expression of rig - i, mda5, and pkr (fig. 4b), suggesting that endosomal acidification is critical for dc responses upon phagocytosis of infected cells. similar decreases in isg induction were observed when using cvb - infected primary porcine islets (data not shown). flowcytometric analysis showed that phagocytosis of min6 cells was not inhibited due to cq treatment (data not shown). poly (i : c) induction, known to require endosomal acidification, was also decreased (41,44). lps - induced responses do not require endosomal acidification (41,44). as expected, lps - induced isg and interleukin-6 expression was not decreased, indicating that viability and intracellular signaling to induce cytokines were unaltered upon cq treatment (fig. 4b and data not shown). using rnases, we investigated the contribution of (viral) rna in our cvb - infected cells to dc responses. for this, freeze - thawed min6 cell preparations were used because viable cells with an intact plasma membrane will make degradation of intracellular rna impossible. rnase treatment of freeze - thawed min6 cell preparations prior to addition to dcs reduced upregulation of rig - i, mda5, and pkr at both the mrna and protein levels (fig. 4c and d [compare lane 4 and lane 6 ]), demonstrating the important role of viral rna present in infected cells for the induction of innate immunity. together, our data show that phagocytosis of cvb - infected cells is required and that subsequent signaling requires endosomal acidification and depends on the presence of viral rna. human pancreatic islets were found to be susceptible to infection by cvb3 as indicated by the profound increase in virus titer, cytopathic effects, and immunofluorescence staining against viral proteins 3a and vp1 (fig. infected cells mainly resided at the outer layers of the islets, where cells might be more accessible for the virus (fig. previously it was shown that such a productive infection results in impaired islet function (36). cvb replicates in human and porcine pancreatic islets, and dcs can phagocytose islets, resulting in induction of isgs. a and b : human islet cells were infected with cvb3 at an moi of 10, and at indicated time points replication was analyzed (a) and at 48 h postinfection (p.i.) images were taken (b). after 24-h incubation, islets were adhered onto fibronectin - coated coverslips and stained using 3a (red)- and vp1 (green)-specific antibodies. d : human islets were pkh labeled and infected with cvb3 at an moi of 10 and cultured for 48 h before addition to cfse - labeled dcs. uptake of islets either mock - infected (m) or cvb - infected (cvb) was analyzed by flow cytometry 24 h after co - culture. e : human islets were pkh labeled and infected as in d and co - cultured with unlabeled dcs for 24 h. subsequently, dcs were harvested, stained using cd86-specific antibodies (green), and analyzed using confocal microscopy. f : human islets were infected with cvb3 at an moi of 10 for 48 h prior to addition to dcs. expression of rig - i, mda5, and pkr mrna in dcs was analyzed using qpcr. g : porcine islets were prepared and co - cultured as in f and isg - induction was analyzed at indicated times. in some experiments (f and g), freeze - thawed preparations of islets were used, but these yielded similar results compared with using viable cells. islet / cvb, cvb - infected human islets ; islet / m, mock - infected human islets ; med, medium, i.e., unstimulated dcs ; porc islet / cvb, cvb - infected porcine islets ; porc islet / m, mock - infected porcine islets. (a high - quality color representation of this figure is available in the online issue.) to investigate whether human dcs can phagocytose human pancreatic islets, pkh - labeled human islets were mock or cvb3 infected for 48 h and subsequently co - cultured with cfse - labeled dcs. cvb3 has no direct effect on human dcs and is incapable of infecting dcs (28). mock- and cvb3-infected islets were taken up with equal efficiency as indicated by the number of dcs that became pkh positive (fig. confocal analysis confirmed uptake of human pancreatic islets material by dcs. the dc plasma membrane was stained with cd86-specific antibodies (green), and pkh - positive islet cells (red) were observed within the dcs (fig. 1e). to examine whether and how dcs respond to virus - infected human islets, we studied activation of innate immune response pathways by measuring levels of isgs, such as rig - i, mda5, protein kinase r (pkr), and irf-7 following phagocytosis of infected cells. quantitative pcr (qpcr) revealed induction of isgs after engulfment of cvb3-infected islets ; moreover, increased expression was observed for all isgs tested (fig. importantly, stimulation of dcs with mock - infected human islets alone did not induce any isgs (fig. furthermore, stimulation with cvb3 alone also did not induce isgs (28), suggesting that the induction depends on the presence of virus or viral products within phagocytosed cells. cvb3 was not able to replicate in dcs upon entry via phagocytosis, as determined by end point titration at several times after the start of co - cultures (data not shown). in some experiments, freeze - thawed mock- or cvb - infected cells were used. this had no effect on either phagocytosis or isg induction (see below). at this stage, we were unable to discriminate whether the isgs were upregulated in dcs or in the islets themselves. therefore, we performed experiments using porcine islets, which have been shown as useful models for studies on the interaction of cvbs with -cells (37). to discriminate between isgs in porcine islets and human dcs, primers were used that specifically recognize human, but not porcine, isg sequences. infection and uptake of porcine islets by dc was similar as described above for the human islets (data not shown). phagocytosis of cvb - infected porcine islets resulted in a profound increase in human isgs (fig. thus, using porcine islets, we confirmed induction of isgs in human dcs upon uptake of cvb3-infected human islets, and, additionally revealed that isg expression is increased in the human dc population. to further investigate the underlying mechanism of dc responses upon uptake of islets, we selected the murine min6 cell line as a model for pancreatic -cells. min6 cells retain the physiological characteristics of normal -cells and respond to glucose within the physiological range (32). these islet - like cells grow in patches (fig. 2b, left panel) and were confirmed to express several -cell associated mrnas (e.g., gad65, islet - specific glucose-6-phosphatase catalytic subunit - related protein [igrp ], insulinoma - associated protein 2, insulin, [data not shown ]). analogous to human and porcine islets, min6 cells were susceptible to infection with cvb3 as shown by the increase in virus titer (fig. uptake of mock- and cvb3-infected min6 cells by dcs was very efficient (up to 75%) as shown by flow cytometry and confocal analysis (fig. 2c and d). min6 cells are a good model for primary pancreatic cells, are phagocytosed by dcs, and induce innate antiviral immune responses. a and b : min6 cells were infected with cvb3 at an moi of 10, and replication was analyzed at indicated time points (a) and images were taken at 48 h postinfection (p.i.) (b). c : min6 cells were pkh - labeled and infected with cvb3 at an moi of 10. after 24-h incubation, cells were harvested and added to cfse - labeled dcs at a 1:1 ratio. after 24-h co - culture, cells were harvested and uptake was determined using flow cytometry. d : min6 cells were prepared as in c and co - cultured with unlabeled dcs for 24 h, after which dcs were harvested, stained as in fig. e and f : min6 cells were prepared as in c, and after 48-h incubation, cells were harvested and added to dcs at a 1:1 ratio or dcs were stimulated with 20 g / ml poly (i : c) or left untreated. at 5 h after addition (e), or 5 h and 8 h after addition (f), mrna induction of isgs was determined as described. g : protein expression of rig - i, mda5, and pkr was analyzed by western blot 24 h after stimulation of dcs as described for panel e. h : dcs were stimulated as in e, and after 24-h co - culture cells were harvested and infected with ev9 at an moi of 1. at indicated times postinfection, ev9 replication was analyzed. poly (i : c) was used as a positive control (34). in some experiments, freeze - thawed cell populations were used but these yielded similar results compared with using viable cells (supplemental fig. 1). data shown are representative (a d, g, and h) or averages (e and f) of at least three independent experiments. med, medium, i.e., unstimulated cells ; m6/cvb, cvb - infected min6 cells ; m6/m, mock - infected min6 cells ; n.s., not significant. (a high - quality color representation of this figure is available in the online issue.) upon engulfment of cvb - infected min6 cells, ifn- and isgs were strongly induced in dcs (fig. 2e and f), reaching a greater than 100-fold increase compared with unstimulated dcs in the case of rig - i, while mda5 and pkr showed increases of up to 20- and 10-fold, respectively (fig. the induction of isgs following uptake of infected min6 cells was confirmed at the protein level by western blotting (fig no isg signal was observed in mock- or cvb3-infected min6 cells alone (data not shown), excluding that the observed protein induction in dc / min6 co - cultures is due to detection of min6 cell proteins. in some experiments, freeze - thawed mock- or cvb - infected cells 1). ifns and isgs induce an antiviral state that restricts virus replication (38). to determine whether upregulation of isgs following uptake of cvb3-infected min6 cells protects dcs from subsequent infection, dcs that had taken up min6 cells were infected with ev9, an enterovirus strain that replicates in dcs (28) but not in min6 cells (data not shown). uptake of mock - infected cells had no influence on replication of ev9 in dcs. in contrast, phagocytosis of cvb - infected min6 cells strongly protected the dcs from ev9 replication (fig. isgs can be upregulated through both ifn - dependent and ifn - independent pathways (39,40). to investigate whether secreted cytokines such as ifn-/ were involved in isg induction, we stimulated fresh dcs with cell - free supernatant from dc / min6 co - cultures. an increase in isgs was observed upon stimulation of dcs with supernatant from co - cultures of dcs plus cvb - infected min6 cells but not of dcs plus mock - infected min6 cells (fig. moreover, the induction of isgs after uptake of cvb - infected cells was markedly reduced in the presence of neutralizing ifn-/ antibodies at both the mrna (fig. 3c [compare lanes 6 and 7 ]), implying that isg induction strongly depends on ifns. a : dcs were stimulated with cleared supernatants from stimulated dc and dc / min6 co - cultures (harvested 24 h after co - culture started and used at a 1:2 dilution) and mrna induction of rig - i, mda5, and pkr were determined using qpcr 8 h after stimulation. b : min6 cells were infected with cvb3 at an moi of 10 and incubation cells were harvested and added to dcs at a 1:1 ratio after 48 h. stimulations were performed in the absence or presence of neutralizing antibodies (iivari, kaaleppi, and bovine anti ifn-/ ; see research design and methods). after 8 h, mrna expression levels of rig - i, mda5, and pkr were determined using qpcr. c : dcs were treated as in b and protein expression of rig - i, mda5, and pkr was analyzed by western blotting after 24 h. d : dcs were stimulated with 100 units / ml mifn or cleared supernatants from min6 cells (harvested 48 h postinfection and used at a 1:2 dilution), and isg mrna induction was determined after 8 h. data shown are representative of two (c) or average of three (a, b, and d) independent experiments. ic, poly (i : c) ; med, medium, i.e., unstimulated cells ; m6/cvb, cvb - infected min6 cells ; m6/m, mock - infected min6 cells ; mifna, murine recombinant ifn- ; n.s., not significant ; sup, supernatant ; w / o ab or w ab, without or with neutralizing anti ifn-/ antibodies, respectively. p < 0.05. to determine whether ifns produced by dcs or the infected min6 cells were responsible for isg upregulation, supernatants from infected min6 cultures were added to dcs, after which isg induction was monitored. although recombinant murine ifn- induced isg expression in dcs, supernatant of either mock- or cvb - infected min6 cells did not (fig. thus, cytokines potentially produced by infected min6 cells are not responsible for isg expression in dcs. collectively, these data imply that dcs induce an innate immune response upon uptake of cvb3-infected min6 cells and that this induction depends on ifn induction by dcs themselves. both prrs located on the cell surface and those with intracellular localization may mediate the observed responses in dcs. to investigate whether phagocytosis of cells is required for the induction of isgs or whether extracellular exposure to infected cells might initiate isg responses in dcs (e.g., via tlrs on the plasma membrane), phagocytosis was inhibited using cytd. dcs pretreated with cytd and subsequently stimulated with cvb3-infected min6 cells did not show any induction of isgs, indicating that phagocytosis is required for isg induction. similar decreases in isg induction were observed when using cvb - infected primary porcine islets (data not shown). poly (i : c)-induced isgs were also reduced upon cytd treatment, as has been previously reported (41). importantly, lipopolysaccharide (lps)-induced responses were not abrogated in the presence of cytd, proving that cytd has no adverse effects on dc viability or isg induction (fig. induction of innate immune responses in dcs after min6/cvb uptake requires (viral) rna within min6 cells. a : dcs were pretreated with cytd for 30 min prior to stimulation with tlr ligands or min6 cells. after 8 h, mrna expression levels of rig - i, mda5, and pkr were determined using qpcr. b : dcs were pretreated with cq for 30 min, stimulated as in a, and mrna expression was determined as in a. c : min6 cell preparations were exposed to a mixture of rnase a, rnase vi, and rnase i prior to addition to dc cultures as described. expression of rig - i, mda5, and pkr in dcs was analyzed using qpcr 5 h after addition of min6-cell preparations. d : dcs were co - cultured with min6-cell preparations as described for panel a, and protein expression of rig - i, mda5, and pkr was analyzed by western blotting 24 h after the start of co - culture. data are representative of two (d) or the average of two (a c) independent experiments. in these experiments, ic, poly (i : c) ; med, medium unstimulated cells ; m6/cvb, cvb - infected min6 cells ; m6/m, mock - infected min6 cells ; n.s., not significant ; w / o rnase or w rnase, without or with rnase treatment of min6 cell preparations prior to co - culture. phagocytosed cells are localized to so - called phagosomes, which subsequently mature via fusion with the endosomal / lysosomal compartments, followed by progressive decrease in ph (20,43). intracellular tlrs (tlr3, 7, 8, and 9) are also recruited to these compartments, enabling interaction with potentially released pamps such as dsrna, which occurs in a ph - dependent fashion (44). alternatively, phagocytosed material might be translocated into the cytoplasm, where, for example, the rlhs (rig - i and mda5) can interact with viral rna. to determine whether endosomal acidification is required for the induction of isgs following uptake of infected cell preparations, we pretreated dcs with cq, a chemical that blocks acidification of these compartments. pretreatment of dcs with cq markedly decreased cvb - infected min6-induced mrna expression of rig - i, mda5, and pkr (fig. 4b), suggesting that endosomal acidification is critical for dc responses upon phagocytosis of infected cells. similar decreases in isg induction were observed when using cvb - infected primary porcine islets (data not shown). flowcytometric analysis showed that phagocytosis of min6 cells was not inhibited due to cq treatment (data not shown). poly (i : c) induction, known to require endosomal acidification, was also decreased (41,44). as expected, lps - induced isg and interleukin-6 expression was not decreased, indicating that viability and intracellular signaling to induce cytokines were unaltered upon cq treatment (fig. 4b and data not shown). using rnases, we investigated the contribution of (viral) rna in our cvb - infected cells to dc responses. for this, freeze - thawed min6 cell preparations were used because viable cells with an intact plasma membrane will make degradation of intracellular rna impossible. rnase treatment of freeze - thawed min6 cell preparations prior to addition to dcs reduced upregulation of rig - i, mda5, and pkr at both the mrna and protein levels (fig. 4c and d [compare lane 4 and lane 6 ]), demonstrating the important role of viral rna present in infected cells for the induction of innate immunity. together, our data show that phagocytosis of cvb - infected cells is required and that subsequent signaling requires endosomal acidification and depends on the presence of viral rna. although diabetes pathogenesis and the possible role of apcs such as dcs therein have been investigated in mice (14,15), to our knowledge, no studies have been performed that examined the interaction between islets and dcs in humans. in this study, we show for the first time that cvb - infected human islets are efficiently phagocytosed by human dcs resulting in a rapid rna- and ifn - dependent innate antiviral response by dcs. the response of dcs was further characterized with use of porcine islets and murine min6 cells. mock - infected cells did not induce innate responses, even though, surprisingly, their phagocytosis was as efficient. the reason for equal uptake of mock- and cvb - infected cells is unknown ; islets/-cells may display enhanced molecular signals that mediate phagocytosis (eat me signals, such as phosphatidyl serines [pss ]) (45), possibly caused by endoplasmic reticulum stress inherent to massive insulin production (46). preliminary data revealed that pss are higher expressed on the outer cell surface of steady - state insulin producing min6 cells when compared with other steady - state cell lines that are not efficiently phagocytosed (e.g., hela, l929, bgm, and vero) (data not shown). whether pss or other eat me signals are present on isolated primary human pancreatic islets and facilitate their engulfment requires further investigation. nevertheless, equal uptake of mock- and cvb - infected cells enabled us to make a good comparison of dc responses because only the infection status of islets or min6 cells or islets differed. phagocytosis of cvb - infected islets and min6 cells invariably resulted in an increase in isgs. importantly, this ifn - dependent isg increase was sufficient to completely protect dcs from subsequent ev9 infection. this reveals a mechanism by which dcs may protect themselves when attracted to an environment with ongoing infection, ensuring their functional integrity. viral rna is known to be an important inducer of antiviral immunity by triggering prrs from the tlr and rlh family. in this study, we show that induction of innate responses in dcs requires endosomal acidification and is largely dependent on the presence of rna within the infected cells. possibly part of the rna might be shielded within intact virus particles and therefore may be inaccessible for rnases. this residual viral rna may have triggered isg induction when recognized in endosomes and/or lysosomes following phagocytosis. although we favor the idea that viral rna present in cvb - infected cells triggers antiviral immunity, we can not exclude that viral proteins or modified host proteins contribute to the observed antiviral responses. interestingly, engulfment of cvb - infected cells resulted in the development of type 1 diabetes in a susceptible mouse model (14). in that study, resident apcs in the pancreas were shown to engulf cvb - infected -cells, and these apcs were able to subsequently stimulate antigen - specific t - cell proliferation and trigger diabetes, demonstrating that the (infectious) microenvironment may drive innate, as well as adaptive, and autoimmune responses in vivo. we studied human dc maturation in vitro and our preliminary data on the induction of co - stimulatory molecules showed no consistent upregulation, even though isg induction was consistently observed. in some donors, upregulation of cd80 and cd86 and production of tumor necrosis factor (tnf)- and interleukin-12 were observed in dcs upon uptake of cvb3-infected min6 cells ; however, in the majority of dc donors, no increases were observed. obviously, during phagocytosis of infected cells by dcs in vivo, other cell populations are present that can interact with dcs. these cells, including macrophages, plasmacytoid dcs, and natural killer cells, and the cytokines they produce can greatly influence the microenvironment and dc responses. for instance, ifns can, besides their function in innate immunity, also influence adaptive immunity. the amount of ifns, timing of encountering ifns, but also possible synergy with other prr stimuli can greatly influence dc maturation (47,48). moreover, other pancreas constituents, such as duct cells, may influence dc function. for example, duct cells produce tnf- upon cvb3 infection (g. vreugdenhil, f.j.m.v.k., j.m.d.g., and d. pipeleers, unpublished observations), and duct cell derived further in - depth investigation of adaptive immune responses in dcs from healthy control subjects upon encountering cvb - infected islets and the interplay with other cell types and cytokines would be extremely valuable. most human infections with enteroviruses are efficiently controlled due to adequate antiviral immune responses. prolonged or successive enterovirus infections have been suggested to play a role in the development of type 1 diabetes (50,51), raising the possibility that individuals susceptible to type 1 diabetes may have impaired antiviral defenses. for example, polymorphisms in mda5, the rna sensor that recognizes picornavirus rna (52), have been associated with type 1 diabetes development (25,53). alterations in mda5 function may affect adequate sensing of viral infections and thus hamper antiviral immunity. cvb infection in a genetically susceptible individual might therefore progress to chronic inflammation in the pancreas. in this proinflammatory environment where self - antigens and viral antigens are encountered by dcs, autoimmunity might develop or accelerate, ultimately resulting in type 1 diabetes. in conclusion, this study shows that cvb - infected human islets, porcine islets, and min6 cells are phagocytosed by human dcs and that this results in an rna- and ifn - dependent antiviral state in dcs. these events may alter the programming of dcs and thus influence the development of treg and/or effector t - cell populations. these novel findings provide important new insights into the possible role of dcs during human type 1 diabetes development. | objectivetype 1 diabetes is a chronic endocrine disorder in which enteroviruses, such as coxsackie b viruses and echoviruses, are possible environmental factors that can trigger or accelerate disease. the development or acceleration of type 1 diabetes depends on the balance between autoreactive effector t - cells and regulatory t - cells. this balance is particularly influenced by dendritic cells (dcs). the goal of this study was to investigate the interaction between enterovirus - infected human pancreatic islets and human dcs.research design and methodsin vitro phagocytosis of human or porcine primary islets or min6 mouse insuloma cells by dcs was investigated by flow cytometry and confocal analysis. subsequent innate dc responses were monitored by quantitative pcr and western blotting of interferon - stimulated genes (isgs).resultsin this study, we show that both mock- and coxsackievirus b3 (cvb3)-infected human and porcine pancreatic islets were efficiently phagocytosed by human monocyte derived dcs. phagocytosis of cvb3-infected, but not mock - infected, human and porcine islets resulted in induction of isgs in dcs, including the retinoic acid inducible gene (rig)-i like helicases (rlhs), rig - i, and melanoma differentiation associated gene 5 (mda5). studies with murine min6 insuloma cells, which were also efficiently phagocytosed, revealed that increased isg expression in dcs upon encountering cvb - infected cells resulted in an antiviral state that protected dcs from subsequent enterovirus infection. the observed innate antiviral responses depended on rna within the phagocytosed cells, required endosomal acidification, and were type i interferon dependent.conclusionshuman dcs can phagocytose enterovirus - infected pancreatic cells and subsequently induce innate antiviral responses, such as induction of rlhs. these responses may have important consequences for immune homeostasis in vivo and may play a role in the etiology of type 1 diabetes. |
pairwise sequence alignment algorithms are based on metrics derived from edit distance,1 which share the assumption of statistical independence among the single - nucleotide mutation events used to explain the differences between the two sequences under comparison. unfortunately, this assumption does nt hold in case of tandem duplications which involve more than one nucleotide at the time, resulting in the so - called tandem repeats (trs). the application of traditional alignment algorithms to sequences containing trs might lead to alignments which are not biologically sound.2 since the impact of these events is not marginal, as short tandem duplications ranging from 1 to 100 base pairs account for the majority of insertion events in human genome,3 it is mandatory to develop sequence alignment methods capable of taking them into account as underlying biological mechanisms. any tr is the effect of subsequent duplications of a repeat unit, called motif. during the evolutionary process, random mutation events can occur at any time possibly affecting one or more repeat units, making them different from the original motif. mutated repeat units are called variants, while trs containing more variants are called approximate trs. the variability of trs is not limited to the random mutations of the motif, but it is also caused by dna replication slippage which alters the number of repetitions.5,6 the high instability of trs is a well known fact which is exploited by using polymorphic tandem repeat loci (also known as variable number tandem repeats, vntr) as genetic markers.7 in spite of the worth of taking into account multi - nucleotide duplications during the comparison of biological sequences, even the definition of tr is not universally accepted and it is particularly controversial in case of approximate trs. the lack of a common agreed definition impacts the detection of trs and it has determined the development of different detection algorithms4,811 leading to different results.12 the regular structure of trs can be exploited to reduce the size of the representation. for instance, berard use macro - characters to represent each motif (and its variants) and apply run - length encoding (rle) to the sequence of macro - characters. 7 in general, compression techniques have the two - fold objective of reducing memory requirements and speeding up comparison. there are two levels of granularity at which repeat - aware sequence comparison can be performed. the coarse - grained problem consists of aligning two sequences that possibly contain trs, the fine - grained problem consists of aligning two trs. the first problem has been tackled by means of modified dynamic programming algorithms13 with time complexity o(n) and space complexity o(n) (or with time complexity o(n) and space complexity o(n)), where n is the length of the input strings. solutions to the second problem have been proposed that allow the comparison of trs according to different evolutionary events, including operations on single characters and more complex operations on substrings of the given sequences (eg, excisions and rearrangements).7,15 trs to be used as input for this category of algorithms are usually represented as sequences of macro - characters belonging to a super - alphabet which encode possible variants of a given repeat (for instance, in the representation of minisatellite maps obtained by means of pcr - based methods).16 within this framework, two solutions have been proposed which differ in the type of evolutionary model they handle which, in turn, impacts algorithmic complexity. berard proposed an algorithm for the comparison of minisatellite maps whose time complexity is o (p + ||p), where is the alphabet, s and r are the original maps under comparison, s and r are their rle compressed versions, |.| denotes either the cardinality of a set or the length of a sequence, p = max(|s|,|r|), and p = max(|s|,|r|). sammeth and stoye introduced an algorithm with time and space complexity exponential in the length of input sequences s and r.15 the exponential complexity is paid for accounting for a more complex evolutionary model where several variants could be duplicated in a single event. in summary, while solutions to the coarse - grained problem incur heavy computational burdens and make simplifying assumptions on the mutation type and order ; solutions to the fine - grained problem are compatible with more accurate evolutionary models but they rely on the availability of predefined trs. taking a different approach, a common practice (called repeat masking)17 consists of pre - processing the sequences under comparison in order to mask the tandem repeats which might impair the biological significance of the alignment. traditional algorithms based on edit distance can be applied downstream to the repeat - masked sequences, thus overcoming the issue of repeat - aware alignment. since none of the proposed approaches clearly outperforms the others in all possible contexts, a methodology for driving the choice of the most appropriate algorithm to be adopted to tackle a specific problem has been recently proposed.18 it makes use of significance metrics which represent the evolutionary likelihood of the results provided by the candidate sequence alignment algorithms. a monte carlo approach can be adopted in order to conduct a sensitivity analysis in the parameter space. this paper presents a new solution to the coarse - grained problem which resembles repeat - masking techniques, in that it addresses exactly the same issues and it entails a lossy compression mechanism which provides approximate representations of the sequences under comparison. the algorithm aims at reducing the original input sequences (that contain repeats) into sequences without exact trs (hereafter also denoted as repeat - free sequences) by iterative collapsing of repeats of increasing length. after the overall procedure the sequences retain, up to a given degree, enough informative content for the significance of their comparison, while not being affected by the problem of duplication (as they are repeat - free by construction). the proposed compression algorithm has o(n) worst case time complexity and o(n) average case time complexity. experimental results show that the new method outperforms both pure edit distance and repeat - masking techniques in terms of quality metrics18 when applied to the alignment of sequences highly affected by duplication events. this section introduces an iterative algorithm which provably turns a sequence containing trs into a sequence which does nt contain any. this opens the way to a new (approximate) representation of the original sequences that can be then compared by means of traditional alignment algorithms, thus circumventing the problem of statistical independence in duplication - rich regions. after having settled preliminary definitions, the repeat collapsing algorithm is outlined and its correctness and complexity are proved. in the following we use tr to implicitly denote, with a slight abuse of notation, exact tandem repeats. given a string s, a substring s of s with length l and position p is denoted by s = s[p, p + l 1 ]. a tr with n repeat units of size l starting from position p in s is denoted by tr(s, l, p, n). in symbols the k - th repeat unit of t is tk = t[k l, k l + l 1 ] = s[p + k l, p + k l + l 1 ]. repeat unit t0 is the template of t. tr t is said to be the first tr with template of length l in s, denoted by ftr(s, l), if there are no trs of size l in s with position lower than p. definition : the collapsing of tr t = tr(s, l, p, n) is the transformation of string s into a shorter string s (hereafter called residual string) obtained by excising all the repeat units of t but the template. in symbols : definition : the size - l collapsing of string s is the transformation of string s into a string s with no trs of size l, obtained by iteratively collapsing trs of size l. an algorithm for performing the size - l collapsing of a string is shown in figure 1. the algorithm spans the original string (s) with a sliding window of size l, which points out, at each iteration, the substring to be considered as the putative template of a size - l tr. the putative template at position i is then compared with the substring starting at i + l. if they match, a tr is found and the algorithm looks forward to count the number of occurrences of the repeat unit after the template (k) until a mismatch is encountered. the i - th character of s is then copied in the output string s, and the sliding window is shifted from i to i + 1 + k l. if a tr was found, then k > 0 and the window is moved to the second character of the last occurrence of the repeat unit, thus causing a single occurrence of the template to be copied in s, according to the collapsing rules of equation 2. if no tr was found in position i, then the window is shifted by 1 position only. theorem : algorithm collapse(s, l) of figure 1 performs a size - l collapsing of string s with worst - case complexity o(n l) and average - case complexity o(n), where n is the length of the original string and l is the size of the repeats to be found and collapsed. the size - l collapsing of a string s could be iteratively performed by collapsing its first tr of size l, ftr(s, l), and by repeating the process on the residual string until it contains no more trs. if we denote by s the residual string obtained after h iterations, and by p the position of ftr(s, l), than it can be easily shown that p > p for any h > 0. in fact, the collapsing of a tr in position p can not cause the emergence of trs in the previous substring. hence, the first p characters of residual string s do not need to be processed at step h since they have been collapsed at previous steps. according to this observation, the iterative process outlined at the beginning of this proof the algorithm spans the original string and performs, at each position, a comparison between two substrings of size l. since substring comparison stops as soon as a difference is encountered, the number of steps involved in each comparison ranges from 1 to l, depending on the length (w) of the coincident prefixes of the substrings under comparison. if the two substrings are identical, the comparison takes o(l). however, this is not the worst case for the collapse algorithm, since whenever a tr is encountered, the loop counter is incremented by l, saving l iterations. as a consequence, the o(l) complexity of substring comparison can be regarded as distributed over the l skipped iterations, bringing to a constant average complexity per iteration. the true worst case occurs when there are no trs and the first difference between the two substrings under comparison is found, on average, after l/2 characters, leading to an overall complexity of o(n l). average - case complexity of the comparison between strings of size l can be computed by taking into account the probability of finding the first mismatch in position w, that can be expressed as a function of the probability p of finding two matching characters, under the simplifying assumption of base independence : where pr(w) denotes the probability of finding the first mismatch in position w. if we extend to infinity the summation of equation 3 and we exploit its known sum we obtain a constant upper bound for the complexity of strncmp : since the average case complexity of the inner loop has a constant upper bound, the overall collapse algorithm executes in linear time o(n). definition : a string s is said to be a tr - free string if it contains no trs of any size. algorithm collapse_all of figure 2 iteratively invokes collapse(s, l) to remove trs of increasing size l. the following theorem states that the output it returns is a tr - free string. theorem : algorithm collapse_all(s) of figure 2 always returns a tr - free string, with worstcase complexity o(n) and average - case complexity o(n), where n is the length of s. proof [correctness ]. since we know, from theorem 2, that collapse(s, l) produces a string with no trs of size l and it is invoked by collapse all(s) for increasing values of l, here we need only to prove that the execution of collapse(s, l) does nt cause the emergence of trs of size j < l in the residual string if the input string contains no trs shorter than l. let s assume, by contradiction, that the input string of collapse(s, l) contains no trs shorter than l, while the output string contains a tr (denoted by tx) of size j < l. since tx was not present in the input string, its occurrence has to be regarded as the effect of the collapsing of some tr of size let s use x and y to denote the templates of tx and ty, respectively. without loss of generality, we consider x as composed of three substrings :,, and. using the dot to denote string concatenation we can write x =... according to our assumption, the output string contains a substring of the form x.x =...... that was not in the input string because of the presence of ty. since the collapsing of ty has the only effect of reducing a substring of the form y.y..... y to a substring of the form y, we start from the result of collapsing (i.e. x.x) and we look for a suitable template y the duplication of which has the effect of masking tx. notice that y has to be contained in x.x in order for the collapsing of ty to affect tx. hence, we restrict our search of y among the substrings of x.x. moreover, we know that y is longer than x. the only candidate solution is y =..., which may cause an original string containing a substring of the form.y.y. to become x.x after collapsing : notice, however, that the input string contains two adjacent copies of substring, which form a tr of size || < l : a contradiction. since the above example is representative of all possible cases, there are no size - l trs the collapsing of which can cause the emergence of a tr of size j < l starting from a string with no trs shorter than l. hence, if collapse(s, l) is first invoked for l = 1 and then iteratively invoked for increasing lengths, the result is a tr - free string. worst - case and average - case complexities come from those of collapse(s, l), which is repeatedly invoked by collapse all(s) for l ranging from 1 to the maximum size of the possible repeat units, which is upper bounded by n/2. in the worst case, no trs are found and the inner procedure is invoked n/2 times, so that the overall complexity is given by the following sum : in the average case, some trs are found, so that the length of the residual string decreases over time and the number of iterations of the main loop is lower than n/2. however, both the length of the residual strings (which determines the average - case complexity of collapse(s, l) according to theorem 2) and the number of iterations are still proportional to n, so that the overall complexity is o(n). the behavior of algorithm collapse_all is exemplified in figure 3a, which shows a sequence of 36 bases containing several nested repeats, which is reduced to a repeat - free sequence of 11 bases in three collapsing steps for repeat lengths ranging from 1 to 3. figure 3b shows, for comparison, the result that would be achieved by invoking the collapse algorithm in reverse order, ie, for repeat length decreasing from 3 to 1. in fact, it is of 17 bases and it contains three replicas of the acg motif. even starting from a longer repeat length the reverse collapsing procedure does not guarantee to remove all tandem repeats. this is shown in figure 3c, which starts from repeat length 5 (which is the length of the longer motif found in the original sequence) to achieve a collapsed sequence of 14 bases with two replicas of the acg motif. we point out here that the identification of exact trs could be solved by means of suffix trees data structures very efficiently with o(nlogn), being n the length of the string and z the number of occurrences of the trs.19 in principle, our approach could also be extended to take advantage of these results. notice however that we need to collapse tandem repeats iteratively, starting from the shortest ones, and the search for longer trs has to be repeated at each step (in fact, collapsing of short trs can determine the emergence of longer ones). hence, the benefits coming from the usage of suffix trees could be exploited only within the collapse procedure, which is invoked o(n) times within the inner loop of collapse all, leading to an overall time complexity of o(n logn), which is better than the worst - case complexity of the proposed algorithm, but worse than its average - case complexity. it is also worth noticing that the computational efficiency of collapsing is not the main concern, since in a database search setting entries could be compressed off - line once and for all, thus reducing the impact of collapsing algorithm on runtime performance. notably, an interesting by - product of our approach is the possibility of reducing the complexity of a query search in the database by virtue of compression. we point out here that the identification of exact trs could be solved by means of suffix trees data structures very efficiently with o(nlogn), being n the length of the string and z the number of occurrences of the trs.19 in principle, our approach could also be extended to take advantage of these results. notice however that we need to collapse tandem repeats iteratively, starting from the shortest ones, and the search for longer trs has to be repeated at each step (in fact, collapsing of short trs can determine the emergence of longer ones). hence, the benefits coming from the usage of suffix trees could be exploited only within the collapse procedure, which is invoked o(n) times within the inner loop of collapse all, leading to an overall time complexity of o(n logn), which is better than the worst - case complexity of the proposed algorithm, but worse than its average - case complexity. it is also worth noticing that the computational efficiency of collapsing is not the main concern, since in a database search setting entries could be compressed off - line once and for all, thus reducing the impact of collapsing algorithm on runtime performance. notably, an interesting by - product of our approach is the possibility of reducing the complexity of a query search in the database by virtue of compression. the compression algorithm described so far has been conceived to be applied as a pre - processing step in order to increase the performance of traditional alignment algorithms based on edit distance when applied to sequences rich of trs. the benefits of the rc approach have been evaluated by following a specific methodology recently introduced to assess the quality of repeat - aware alignment algorithms.18 in particular, three metrics have been used to quantify the biological - significance of the results provided by the alignment algorithm : significance ratio (r), which is the ratio between the number of aligned bases / residues coming from the same base / residue of a common ancestor, and the length of the shortest of the two sequences under alignment ; selectivity (s), which is defined as the probability for a database entry se to be ranked first by the alignment algorithm used to search among the m entries of a database with a query string sq, provided that se is the only entry in the database homologous to sq ; ranking error (e), which is the normalized position of se in the ranking produced by the alignment algorithm when sq is used as a query : e = (rank(se) 1)/(m 1). the three metrics are to be evaluated on a set of synthetic benchmarks randomly generated by means of a monte carlo approach which simulates the evolution process according to the following statistical parameters : the probability of single - nucleotide insertion (pins), deletion (pdel), and mutation (pm), the probability of duplication (pd), the probability of extension of an existing tr (pe), the maximum size of a repeat unit (l), the number of evolution epochs (t), the number of known ancestors generated at each run (m), and their average length (n). in order to test the proposed rc approach against a significant set of monte carlo experiments, we applied all the settings that were originally used to test the sensitivity of the quality metrics.18 in particular, we run 200 monte carlo experiments in the neighborhood of a representative point of the parameter space (hereafter called baseline) summarized in table 1. it is worth noticing that the computation of the quality metrics entailed 8,000,000 pairwise alignments of sequences of about 200 bases each. the adoption of this experimental setup provides the additional advantage of making our results directly comparable with those of the alternative approaches used as a case study in the paper were the quality metrics were originally introduced,18 namely, bare edit distance (ed) and different flavors of repeat masking (rm) performed by mreps.9 comparative results are provided in tables 24. column labeled rc refers to the proposed approach, column ed refers to bare edit distance, while column best rm refers to the repeat masking technique which provided the best results according to previous work.18 in order to enable a thorough evaluation of the sensitivity of the results from the parameters adopted to run monte carlo simulations, pearson correlations were also computed and reported in the results tables. table 2 shows that rc significantly outperforms both ed and best rm in terms of significance ratio (0.73 on average for rc versus 0.58 and 0.67 of ed and rm respectively). best rm in table 2 refers to the masking obtained by filtering out all exact trs including the small ones (mreps parameter settings res = 0 and allowsmall = true, denoted by m.0).18,9 the higher robustness of rc against trs is also demonstrated by its lower sensitivity to the probabilities of duplication (pd) and extension (pe). on the other hand, the quality of the results provided by rc is highly affected by mutation probability (pm) since it might reduce the effectiveness of collapsing by changing exact trs into approximate ones which are not targeted by the proposed approach. notice however that the high sensitivity to mutation probability is common to all repeat - aware techniques, including rm which shows a correlation to pm higher than ed. table 3 shows that the selectivity (s) of rc is remarkably higher than that of ed and slightly higher than that of best rm (0.89 on average for rc versus 0.75 and 0.87 for ed and rm, respectively). in this case best rm refers to the masking obtained by filtering out all approximate trs up to resolution 2 but the small ones (this corresponds to mreps settings res = 2 and allowsmall = false, denoted by m.n2).18,9 from the correlation analysis we can observe that the spread between rc, ed, and best rm in terms of sensitivity grows as duplication and extension probabilities increase (pd, pe), while it reduces for larger values of mutation probability (pm). finally, table 4 shows that rc significantly outperforms ed in terms of ranking error (e), while it performs slightly better than best rm, which refers to the same masking strategy which was used as a term of comparison in table 3. as already mentioned for r and s, rc has the lowest sensitivity to the probabilities of duplication (pd) and extension (pe), while it is more sensitive to mutation probability (pm). in this case it is also worth noticing a lower sensitivity to the number of evolutionary epochs (t). the results presented in this section clearly provide the evidence of the improved quality of rc - based alignments in terms of r, s, and e. interestingly, rc is a lossy compression technique which can also provide benefits in terms of computational and memory complexity. most important, the improved quality of the alignments obtained from tr - free sequences demonstrates that the compression technique has the capability of retaining the substrings which are more significant for the alignment. the statistical significance of the comparative results provided in tables 24, was assessed by performing the wilcoxon signed rank test14 on the outcomes of the 200 monte carlo experiments. the test returns a so - called p - value which represents the probability for the pairwise difference between two approaches (as returned by the monte carlo experiments) to be only explained by random sampling rather than by the actual difference in the distributions of their parent populations. hence, the lower the p - value the higher the statistical significance of the comparative results. all the p - values were lower than 10, demonstrating the statistical significance of the experiments. further evidence of the different performance of the three methods is provided by the scatter plots of figures 46, which report, for each metric, the value achieved by ed and rm, plotted against those achieved by rc. the solid line in each graph represents the bisector of the cartesian plane, plotted as a reference, while dashed lines represent the linear regressions of the corresponding sets. figure 4 clearly shows the superior quality of rc in terms of significance ratio, since all the points are well below the bisector. figure 5 confirms that the selectivity of rc is much higher than that of ed (the points of which are all below the bisector) and slightly, but consistently higher than that of rm. finally, figure 6 shows that the ranking error of rc is much lower than that of ed (the points of which are all above the bisector) and slightly lower than that of rm. in order to evaluate the capability of the proposed approach of leading to significant alignments between biological sequences we used a dataset commonly adopted for benchmarking,20,21 composed of the mitochondrial dna sequences of 15 species with lengths ranging from 16295 bp (mus musculus) to 16797 bp (halichoerus grypus). both the rc and ed alignment methodologies (as defined in section 3) were applied to compute the pairwise distances among all the 15 sequences. the resulting distance matrices were then used to derive phylogenetic trees by means of neighbor joining.22 in the following we use rc - tree and ed - tree to denote the results obtained with and without repeat collapsing. in order to evaluate the quality of the phylogenetic trees we computed their robinson - foulds distance (rfd)23 from the gold standard adopted by ferragina for the same data set. the rfd is a metric commonly used in computational phylogenetics for the topological comparison of trees. the value it takes is defined between 0 and 4n 10, where n is the number of taxa of the trees under comparison and 0 corresponds to isomorphic trees. for our benchmark rfd was defined in the interval and was computed by means of the tree - dist- sym-dif.pl perl script provided in the kolmogorov library.21 the distance from the gold standard resulted to be 3 for rc - tree and 9 for ed - tree, confirming the capability of the collapsing strategy to reduce the noise (caused by the improper assumption of statistical independence of adjacent bases) which might impair the results of sequence alignment in presence of trs. it is worth noticing that rfd = 3, which is the partition distance from the gold standard achieved by the rc - tree, is in line with the best results achieved by compression - based techniques.21 in particular, only 2 out of the 75 techniques tested by ferragina obtained rfd = 3, while all others obtained partition distances between 5 and 23 (see table 6 of ferragina).21 needless to say, this is a simple case study which does nt provide any general validation. rather, it complements the results already obtained in terms of significance metrics computed on synthetic benchmarks, as discussed in section 3. the statistical significance of the comparative results provided in tables 24, was assessed by performing the wilcoxon signed rank test14 on the outcomes of the 200 monte carlo experiments. the test returns a so - called p - value which represents the probability for the pairwise difference between two approaches (as returned by the monte carlo experiments) to be only explained by random sampling rather than by the actual difference in the distributions of their parent populations. hence, the lower the p - value the higher the statistical significance of the comparative results. all the p - values were lower than 10, demonstrating the statistical significance of the experiments. further evidence of the different performance of the three methods is provided by the scatter plots of figures 46, which report, for each metric, the value achieved by ed and rm, plotted against those achieved by rc. the solid line in each graph represents the bisector of the cartesian plane, plotted as a reference, while dashed lines represent the linear regressions of the corresponding sets. figure 4 clearly shows the superior quality of rc in terms of significance ratio, since all the points are well below the bisector. figure 5 confirms that the selectivity of rc is much higher than that of ed (the points of which are all below the bisector) and slightly, but consistently higher than that of rm. finally, figure 6 shows that the ranking error of rc is much lower than that of ed (the points of which are all above the bisector) and slightly lower than that of rm. in order to evaluate the capability of the proposed approach of leading to significant alignments between biological sequences, we also tested it on real data. to this purpose we used a dataset commonly adopted for benchmarking,20,21 composed of the mitochondrial dna sequences of 15 species with lengths ranging from 16295 bp (mus musculus) to 16797 bp (halichoerus grypus). both the rc and ed alignment methodologies (as defined in section 3) were applied to compute the pairwise distances among all the 15 sequences. the resulting distance matrices were then used to derive phylogenetic trees by means of neighbor joining.22 in the following we use rc - tree and ed - tree to denote the results obtained with and without repeat collapsing. in order to evaluate the quality of the phylogenetic trees we computed their robinson - foulds distance (rfd)23 from the gold standard adopted by ferragina for the same data set. the rfd is a metric commonly used in computational phylogenetics for the topological comparison of trees. the value it takes is defined between 0 and 4n 10, where n is the number of taxa of the trees under comparison and 0 corresponds to isomorphic trees. for our benchmark rfd was defined in the interval and was computed by means of the tree - dist- sym-dif.pl perl script provided in the kolmogorov library.21 the distance from the gold standard resulted to be 3 for rc - tree and 9 for ed - tree, confirming the capability of the collapsing strategy to reduce the noise (caused by the improper assumption of statistical independence of adjacent bases) which might impair the results of sequence alignment in presence of trs. it is worth noticing that rfd = 3, which is the partition distance from the gold standard achieved by the rc - tree, is in line with the best results achieved by compression - based techniques.21 in particular, only 2 out of the 75 techniques tested by ferragina obtained rfd = 3, while all others obtained partition distances between 5 and 23 (see table 6 of ferragina).21 needless to say, this is a simple case study which does nt provide any general validation. rather, it complements the results already obtained in terms of significance metrics computed on synthetic benchmarks, as discussed in section 3. this paper has presented a new approach to the problem of duplication - aware sequence alignment. the proposed method hinges upon a preprocessing that takes original sequences and computes a repeat - free version of them. directly working on such approximate representation provides the attractive advantage of speeding up comparison while increasing edit- distance significance because of the enhanced properties of statistical independence between adjacent residues (which is usually impaired by duplication events). an efficient algorithm for repeat collapsing has been presented and its properties have been formally proved. the capability of the proposed approach to enhance the quality of pairwise alignments has been evaluated in terms of the significance metrics recently introduced to assess the quality of duplication - aware alignment algorithms. comparative results obtained from monte carlo simulations have confirmed the effectiveness of the proposed approach, which has also proved its effectiveness in reconstructing a phylogenetic tree starting from a biological dataset. | in spite of the recognized importance of tandem duplications in genome evolution, commonly adopted sequence comparison algorithms do not take into account complex mutation events involving more than one residue at the time, since they are not compliant with the underlying assumption of statistical independence of adjacent residues. as a consequence, the presence of tandem repeats in sequences under comparison may impair the biological significance of the resulting alignment. although solutions have been proposed, repeat - aware sequence alignment is still considered to be an open problem and new efficient and effective methods have been advocated. the present paper describes an alternative lossy compression scheme for genomic sequences which iteratively collapses repeats of increasing length. the resulting approximate representations do not contain tandem duplications, while retaining enough information for making their comparison even more significant than the edit distance between the original sequences. this allows us to exploit traditional alignment algorithms directly on the compressed sequences. results confirm the validity of the proposed approach for the problem of duplication - aware sequence alignment. |
scarring can result from inflammatory damage to connective tissue of the skin affected by acne. eighty to ninety percent of people with acne scars have associated loss of collagen (atrophic scars), whereas a minority exhibit hypertrophic scars and keloids. severe scarring caused by acne is associated with physical and psychological distress, particularly in young adults, and often results in decreased self - esteem and diminished quality of life. unfortunately, acne scarring can be a difficult problem to address satisfactorily, and treatment usually requires the use of several different approaches over multiple sessions. a number of treatments are available that reduce the appearance of acne scars, but general guidelines for optimizing acne scar treatment are unavailable. there are multiple management options, both medical and surgical, and treatment with laser devices achieve significant improvement. in fact, facial resurfacing with fractional ablative lasers currently appears to be one of the most effective treatment options for facial scars. these lasers abrade the surface of the skin and also help tighten the collagen fibers underneath. fractional ablative lasers treat only a fraction, or column, of the affected skin, leaving intervening areas of skin untreated. these untreated areas help to achieve rapid re - epithelialization of the skin, and minimize the chance of prolonged and serious adverse effects. the punch instrument is a circular blade which is used for many diagnostic and therapeutic purposes in different medical and surgical specialties. punch elevation may entail punch excision of a small acne scar with a punch biopsy instrument of equal or slightly greater diameter. this method is used on deep boxcar scars that have sharp edges and bases that appear normal. in the punch elevation procedure, the same tool used in punch excisions is used to remove only the base (not the walls) of the scar. after the skin heals, it is more even and the pitted or pockmarked look is greatly reduced. when the scar tissue base has been sufficiently punched, the base of the scar becomes parallel to its outline or the outer walls surrounding the scar, meaning the scar base is elevated. a comparative side - by - side clinical study on the efficacy and safety of combining fractional carbon dioxide (co2) resurfacing with punch elevation for the treatment of acne scars has not been previously conducted. therefore, the aim of this study was to compare the clinical effectiveness and side effects of fractional co2 laser resurfacing combined with punch elevation with fractional co2 laser resurfacing alone in the treatment of atrophic acne scars. forty - two iranian patients aged 1855 years with fitzpatrick skin types iii to iv and moderate to severe atrophic acne scars on both cheeks, as assessed using the goodman and baron grading scale, were enrolled in the study. the isfahan university of medical sciences ethical committee, isfahan, iran, approved the study protocol. the trial was registered with the code irct2014080218647n1 in the iranian registry of clinical trials, which is a primary registry in the world health organization (who) registry network. exclusion criteria were pregnancy, lactation, active inflammatory acne, immunocompetence, history of deep chemical peeling or filler injection in the previous 6 months, history of hypertrophic scars and keloids, use of isotretinoin in the previous 6 months, allergy to anesthesia, active infection in the treatment area, premalignant or malignant lesions in the treatment area, bleeding tendencies, and history of herpes simplex or herpes zoster infection on the face. the researchers determined which side of the patient 's face was to be treated using the 10600-nm fractional co2 laser alone (m7000/stamp type, daeshin, south korea) and with the fractional co2 laser plus punch elevation (2.53 mm biopsy disposable punches) using random allocation software. initially, punch elevation using 2.5 or 3 mm biopsy punches was performed on one side of the face. secondly, 24 h after punch elevation, a full face co2 laser treatment session was performed. the laser device used on each side of the face was the same in the two treatment sessions. standardized digital photography was performed using a camera (canon : 8.5 megapixels.). anesthetic cream (2.5% lidocaine / prilocaine, xyla - p tehran chemie pharmaceutical company, iran) was applied to the treatment area under occlusion 1 h before laser treatment. the researcher performed the intervention on each side of the patient 's face according to the prepared randomized sequence. the parameters set on the fractional co2 laser were 12 - 14 w, 48 - 56 mj / mtz / pulse, 13% density, pulse interval 35 ms. patients received prophylactic antibiotic and antiviral medications 1 day prior to treatment and continued the medications for 1 week. after treatment, patients applied an spf 30 sunscreen cream with oil - free base and washed their face with mild soap. clinical evaluation was done 1 and 4 months after the second treatment session was completed. first, two dermatologists blinded to treatment side evaluated clinical improvement of acne scars by comparing the photographs taken before treatment with those taken 1 and 4 months after the last treatment session. the grading scale was structured as follows : 1 = 75% (excellent) improvement. second, patients were asked to evaluate their satisfaction with the treatment using a visual analog scale (vas ; a rating of 0 was no satisfaction, and a rating of10 was the best possible satisfaction). side effects, including pain score (0 no pain, to 10 the most pain), pruritus, erythema, edema, bleeding, burning, duration of facial erythema, facial dryness, infection, ulceration, scar formation, dyspigmentation, were recorded. statistical comparison of the effectiveness and side effects of the two treatment sides was conducted using t - tests. forty - two iranian patients aged 1855 years with fitzpatrick skin types iii to iv and moderate to severe atrophic acne scars on both cheeks, as assessed using the goodman and baron grading scale, were enrolled in the study. the isfahan university of medical sciences ethical committee, isfahan, iran, approved the study protocol. the trial was registered with the code irct2014080218647n1 in the iranian registry of clinical trials, which is a primary registry in the world health organization (who) registry network. exclusion criteria were pregnancy, lactation, active inflammatory acne, immunocompetence, history of deep chemical peeling or filler injection in the previous 6 months, history of hypertrophic scars and keloids, use of isotretinoin in the previous 6 months, allergy to anesthesia, active infection in the treatment area, premalignant or malignant lesions in the treatment area, bleeding tendencies, and history of herpes simplex or herpes zoster infection on the face. the researchers determined which side of the patient 's face was to be treated using the 10600-nm fractional co2 laser alone (m7000/stamp type, daeshin, south korea) and with the fractional co2 laser plus punch elevation (2.53 mm biopsy disposable punches) using random allocation software. initially, punch elevation using 2.5 or 3 mm biopsy punches was performed on one side of the face. secondly, 24 h after punch elevation, a full face co2 laser treatment session was performed. the laser device used on each side of the face was the same in the two treatment sessions. standardized digital photography was performed using a camera (canon : 8.5 megapixels.). anesthetic cream (2.5% lidocaine / prilocaine, xyla - p tehran chemie pharmaceutical company, iran) was applied to the treatment area under occlusion 1 h before laser treatment. the researcher performed the intervention on each side of the patient 's face according to the prepared randomized sequence. the parameters set on the fractional co2 laser were 12 - 14 w, 48 - 56 mj / mtz / pulse, 13% density, pulse interval 35 ms. patients received prophylactic antibiotic and antiviral medications 1 day prior to treatment and continued the medications for 1 week. after treatment, patients applied an spf 30 sunscreen cream with oil - free base and washed their face with mild soap. clinical evaluation was done 1 and 4 months after the second treatment session was completed. first, two dermatologists blinded to treatment side evaluated clinical improvement of acne scars by comparing the photographs taken before treatment with those taken 1 and 4 months after the last treatment session. the grading scale was structured as follows : 1 = 75% (excellent) improvement. second, patients were asked to evaluate their satisfaction with the treatment using a visual analog scale (vas ; a rating of 0 was no satisfaction, and a rating of10 was the best possible satisfaction). side effects, including pain score (0 no pain, to 10 the most pain), pruritus, erythema, edema, bleeding, burning, duration of facial erythema, facial dryness, infection, ulceration, scar formation, dyspigmentation, were recorded. statistical comparison of the effectiveness and side effects of the two treatment sides was conducted using t - tests. forty - two iranian patients aged 1855 years with fitzpatrick skin types iii to iv and moderate to severe atrophic acne scars on both cheeks, as assessed using the goodman and baron grading scale, were enrolled in the study. the isfahan university of medical sciences ethical committee, isfahan, iran, approved the study protocol. the trial was registered with the code irct2014080218647n1 in the iranian registry of clinical trials, which is a primary registry in the world health organization (who) registry network. exclusion criteria were pregnancy, lactation, active inflammatory acne, immunocompetence, history of deep chemical peeling or filler injection in the previous 6 months, history of hypertrophic scars and keloids, use of isotretinoin in the previous 6 months, allergy to anesthesia, active infection in the treatment area, premalignant or malignant lesions in the treatment area, bleeding tendencies, and history of herpes simplex or herpes zoster infection on the face. the researchers determined which side of the patient 's face was to be treated using the 10600-nm fractional co2 laser alone (m7000/stamp type, daeshin, south korea) and with the fractional co2 laser plus punch elevation (2.53 mm biopsy disposable punches) using random allocation software. initially, punch elevation using 2.5 or 3 mm biopsy punches was performed on one side of the face. secondly, 24 h after punch elevation, a full face co2 laser treatment session was performed. the laser device used on each side of the face was the same in the two treatment sessions. standardized digital photography was performed using a camera (canon : 8.5 megapixels.). anesthetic cream (2.5% lidocaine / prilocaine, xyla - p tehran chemie pharmaceutical company, iran) was applied to the treatment area under occlusion 1 h before laser treatment. the researcher performed the intervention on each side of the patient 's face according to the prepared randomized sequence. the parameters set on the fractional co2 laser were 12 - 14 w, 48 - 56 mj / mtz / pulse, 13% density, pulse interval 35 ms. patients received prophylactic antibiotic and antiviral medications 1 day prior to treatment and continued the medications for 1 week. after treatment, patients applied an spf 30 sunscreen cream with oil - free base and washed their face with mild soap. clinical evaluation was done 1 and 4 months after the second treatment session was completed. first, two dermatologists blinded to treatment side evaluated clinical improvement of acne scars by comparing the photographs taken before treatment with those taken 1 and 4 months after the last treatment session. the grading scale was structured as follows : 1 = 75% (excellent) improvement. second, patients were asked to evaluate their satisfaction with the treatment using a visual analog scale (vas ; a rating of 0 was no satisfaction, and a rating of10 was the best possible satisfaction). side effects, including pain score (0 no pain, to 10 the most pain), pruritus, erythema, edema, bleeding, burning, duration of facial erythema, facial dryness, infection, ulceration, scar formation, dyspigmentation, were recorded. data were reported as means sd. statistical comparison of the effectiveness and side effects of the two treatment sides was conducted using t - tests. forty - two patients (100% ; 28 with fitzpatrick skin type iii, 14 with type iv ; 23 males, 19 females) completed the two treatment sessions, and all were followed up for 4 months after the last treatment session. acne scars varied from depressed, small, and icepick to larger and concave areas. clinical improvement of facial acne scarring was assessed by two dermatologists blinded to treatment condition. the assessment of the two dermatologists was not significantly different 1 month after treatment (p = 0.56 ; table 1). global acne scarring classification : type of scars making up the classification grades their evaluation indicated that fractional co2 laser treatment combined with punch elevation was more efficacious than fractional co2 laser treatment alone at 4 months after treatment (p = 0.02 ; table 2 ; figures 1 and 2). scar improvement percentage in two methods 1 and 4 months post - treatment (a) atrophic acne scars in 27-year - old female in the check before treatment. (b) follow - up 4 months after treatment of fractional resurfacing plus punch elevation (a) atrophic acne scars in 32-year - old patient in the check before treatment. (b) follow - up 4 months after treatment of fractional resurfacing plus punch elevation patient satisfaction surveys conducted 4 months after the end of the study revealed that there was a statistically significant difference in mean acne scar improvement score between the two treatment approaches (p = 0.009 ; table 3). distribution of patient satisfaction rates in two methods, 1 and 4 months post - treatment there was no statistically significant difference in mean acne scar improvement score between the different types of acne scar at the end of study (p = 0.75). whitney test to evaluate differences in percentage of improvement between sexes, but there was no statistically significant difference between them on either treatment side (p > 0.05). additionally, at - test did not show a significant difference in percentage of improvement across in types on either treatment side (p > 0.05). in 61.9% of the patients, improvement was good or excellent 4 months after the end of the study [figures 1 and 2 ]. the most commonly reported adverse effect was transient erythema [figure 3 ] and crusting lasting for an average of 34 and 47 days, respectively. transient post - treatment burning and erythema was seen in all patients on day 3 after fractional co2 laser treatment on both treatment sides, but this resolved without any treatment. mild post - inflammatory hyperpigmentation after 1 month of treatment mild post - inflammatory hyperpigmentation was observed in 21.4% of subjects hypopigmentation was not evident in any patient at any of the follow - up visits. the pain score on the side that had both punch elevation and fractional co2 laser treatment was higher than on the side that had fractional co2 laser treatment only, but the difference was not significant (p = 0.34) and the pain did not persist more than a few hours. among all side effects, coagulum formation and pruritus 4 days after fractional co2 laser treatment was significant on both sides (p < 0.05 ; figure 4). no infections, ulceration, or scar formation associated with the use of the laser and no hypertrophic scarring following punch elevation were observed. this study demonstrates that ablative 10,600 nm fractional co2 laser treatment combined with punch elevation is an effective treatment approach for acne scars in asian patients. fractional co2 laser treatment was developed in an effort to overcome the short comings of the traditional ablative lasers and non - ablative fractional lasers. its histological and clinical effect in vivo was first reported by hantash. because of the varying types and severity of acne scarring, it is important to keep in mind that the treatment of scarring in any individual patient will likely require some combination of techniques. for example, this may include resurfacing techniques to address superficial irregularities, dermal fillers to replace lost volume in large atrophic areas, and surgical procedures, such as punch excision, to remove deep boxcar or large icepick scars. some types of acne scars can not be comprehensively repaired using conventional acne treatment methods, and some types can not be effectively corrected by a single treatment modality, due to wide variation in their depth and width. a number of studies have been performed that have demonstrated the benefits of fractional co2 laser treatment on acne scarring and have promoted the advantage of selective ablation. although co2 lasers allow for more precise ablation control, some deeper scars require multiple treatment passes that could produce additional scarring. the laser is only effective in approximately the upper 30 m of the skin, which limits the area that can be treated by the laser. johnson (1986) reported punch techniques for the treatment of deep acne scars using cutaneous punches and repair with steri - strips, or other methods. punch excision and punch elevation remain important surgical options for certain types of atrophic acne scars. punch techniques remain the gold standard for large, deep boxcar, and icepick scars. these punch techniques often entail punch excision of a single small acne scar with a punch biopsy instrument of equal or slightly greater diameter. this method is used on deep boxcar scars that have sharp edges and bases that appear normal. in the punch elevation procedure, the same tool used in punch excisions is used to remove only the base (not the walls) of the scar. this method reduces the risk of producing texture or color differences and additional scarring. the punch elevation method is better for improving deep acne scars than depth resurfacing is, and it can be combined with the shoulder technique or depth resurfacing depending on the type of acne scar. therefore, punch elevation techniques have increased the efficacy of treatment of atrophic acne scars. in punch elevation, after the punch is performed the base is elevated and sutured flush with the surrounding normal - appearing skin, and then allowed to heal in place. an obvious advantage to the combination of punch elevation and laser ablation is that the laser acts superficially and punch elevation eliminates the need for multiple laser passes over deep scars. another advantage of combining punch elevation with laser ablation is the ability of the laser to effectively ablate the superficial portion of the scar and remove the epidermal component. this means that punch grafting is not necessary when using this technique, which eliminates complications of transplantation that often require redo grafting. in our study, by combining laser skin resurfacing and punch elevation, all patients improved without any infection or additional scarring. though fractional co2 laser procedures used in isolation can produce very satisfactory results, we found that the combination of multiple approaches, such as the combination of co2 laser treatment with punch elevation, may be necessary to optimize treatment outcome. a larger sample size with a longer period of follow - up may yield even more favorable results. fractional co2 laser treatment in combination with punch elevation improves outcome in the treatment of facial acne scars. this combination provides the benefit of increased patient satisfaction without an increase in side effects. fractional co2 laser treatment in combination with punch elevation improves outcome in the treatment of facial acne scars. | background : a number of treatments for reducing the appearance of acne scars are available, but general guidelines for optimizing acne scar treatment do not exist. the aim of this study was to compare the clinical effectiveness and side effects of fractional carbon dioxide (co2) laser resurfacing combined with punch elevation with fractional co2 laser resurfacing alone in the treatment of atrophic acne scars.materials and methods : forty - two iranian subjects (age range 1855) with fitzpatrick skin types iii to iv and moderate to severe atrophic acne scars on both cheeks received randomized split - face treatments : one side received fractional co2 laser treatment and the other received one session of punch elevation combined with two sessions of laser fractional co2 laser treatment, separated by an interval of 1 month. two dermatologists independently evaluated improvement in acne scars 4 and 16 weeks after the last treatment. side effects were also recorded after each treatment.results:the mean sd age of patients was 23.4 2.6 years. clinical improvement of facial acne scarring was assessed by two dermatologists blinded to treatment conditions. no significant difference in evaluation was observed 1 month after treatment (p = 0.56). their evaluation found that fractional co2 laser treatment combined with punch elevation had greater efficacy than that with fractional co2 laser treatment alone, assessed 4 months after treatment (p = 0.02). among all side effects, coagulated crust formation and pruritus at day 3 after fractional co2 laser treatment was significant on both treatment sides (p < 0.05).conclusion : concurrent use of fractional laser skin resurfacing with punch elevation offers a safe and effective approach for the treatment of acne scarring. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.