text
stringlengths 94
188k
| metadata
list |
---|---|
Translations Chinese (6) Chinese (6) Czech (6) English (6) French (6) German (6) Italian (6) Polish (6) Russian (6) Spanish (6) Turkish (6) Ukrainian (6) Brazilian Portuguese (5) Dutch (5) Hungarian (5) License OSI-Approved Open Source (6) GNU General Public License version 2.0 (2) Academic Free License (1) Adaptive Public License (1) Affero GNU Public License (1) GNU General Public License version 3.0 (1) GNU Library or Lesser General Public License version 2.0 (1) GNU Library or Lesser General Public License version 3.0 (1) Creative Commons Attribution License (1) Creative Commons Attribution ShareAlike License V2.0 (1) Creative Commons Attribution ShareAlike License V3.0 (1) Programming Language C++ (4) ALGOL 68 (1) APL (1) ASP (1) AWK (1) ActionScript (1) C (1) C# (1) Delphi/Kylix (1) Object Pascal (1) Pascal (1) XSL (1) Status 5 - Production/Stable (6) 1 - Planning (1) 2 - Pre-Alpha (1) 3 - Alpha (1) 4 - Beta (1) 6 - Mature (1) OS Grouping and Descriptive Categories (6) 64-bit MS Windows (4) 32-bit MS Windows (3) All POSIX (3) 32-bit MS Windows (2) OS Portable (2) All BSD Platforms (1) Classic 8-bit Operating Systems (1) OS Independent (1) Project is OS Distribution-Specific (1) Project is an Operating System Distribution (1) Project is an Operating System Kernel (1) Modern (6) Windows 7 (5) Linux (4) WinXP (4) Win2K (3) FreeBSD (2) OS X (2) Windows 8 (2) NetBSD (1) OpenBSD (1) Solaris (1) Windows (6) Emulation and API Compatibility (4) WINE (3) MinGW/MSYS (2) Cygwin (1) DOSEMU (1) EMX (1) Fink (1) Linux (4) BSD (3) Other Operating Systems (3) Microsoft Windows Server 2003 (3) AmigaOS (1) Apple Mac OS Classic (1) BSD/OS (1) BeOS (1) Console-based Platforms (1) GNU Hurd (1) HP-UX (1) Haiku (1) IBM AIX (1) IBM AS/400 (1) IBM OS/2 (1) MS-DOS (1) Microsoft Windows 3.x (1) MorphOS (1) Freshness Recently updated (3) Top Apps | [
{
"key": "website_description",
"type": "global",
"value": "This website is a web service that offers software consumers a centralized online location to control and manage open-source software projects and research business software. It provides source code repository hosting, bug tracking, mirroring of downloads for load balancing, a wiki for documentation, developer and user mailing lists, user-support forums, user-written reviews and ratings, a news bulletin, micro-blog for publishing project updates, and other features."
}
] |
Sam Ee, Membership executive at Evolve mma | SlideShare
× × × × × × Sam Ee
Work Membership Executive
About "Dear Lord. Thank you for giving me the strength and the conviction to complete the task you entrusted to me. Thank you for guiding me straight and true through the many obstacles in my path. And for keeping me resolute when all around seemed lost. Thank you for your protection and your many signs along the way. Thank you for any good that I may have done, I’m so sorry about the bad. Thank you for the friend I made. Please watch over her as you watched over me. Thank you for finally allowing me to rest. I’m so very tired, but I go now to my rest at peace. I fought the good fight, I finished the race, I kept the faith."
- Eli (The Book of Eli, 2010)
When you are sad, pray and look to | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American hosting service, now owned by Scribd, for professional content including presentations, infographics, documents, and videos. Users can upload files privately or publicly in PowerPoint, Word, PDF, or OpenDocument format."
}
] |
Every Day Holds The Potential Purple Quotes Art Print A1 60 x 90 CM 10159 | eBay
Details about Every Day Holds The Potential Purple Quotes Art Print A1 60 x 90 CM 10159
Every Day Holds The Potential Purple Quotes Art Print A1 60 x 90 CM 10159
372276578800
Purple Vintage Art Prints,
Kitchen Purple Art Prints,
Artist Purple Art Prints,
Purple Engraving Art Prints | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational e-commerce corporation based in San Jose, California, that facilitates consumer-to-consumer and business-to-consumer sales through its website."
}
] |
Amazon.com : Revlon Age Defying Firming and Lifting Makeup, Medium Beige : Beauty
12 Colors: Medium Beige
Revlon Age Defying Firmin... has been added to your Cart
This item:Revlon Age Defying Firming and Lifting Makeup, Medium Beige $11.29
Revlon Photoready Concealer, Medium, 0.11 Oz $6.97 Add-on Item
Revlon Age Defying Powder, Medium
Inspired by the latest advances in anti-aging, the Revlon Age Defying Firming and Lifting Makeup is an all-in-one formula that combines hyaluronic acid, Revlon's exclusive Triple Lift Complex, and moisturizing ingredients. This make-up relaxes the look of expression lines, smooth skin, and boost hydration 3X for a rejuvenated look*. 93% of women saw noticeably improved skin**. Protects your skin with SPF 15. Available in 12 shades. (*Skin feels tighter after (4) weeks, rejuvenated after (1) week. **After just (8) weeks.)
Revlon Age Defying Firming and Lifting Makeup features an all-in-one formula that combines hyaluronic acid, Revlon's exclusive Triple Lift Complex, and moisturizing ingredients to relax expression lines, smooth skin, and boost hydration!
Revlon Products You May Like to Complete Your Look…
Product Dimensions: 1.2 x 1.2 x 4.1 inches
UPC: 309974531405 787461465653 077348863574 787734681506 798813408174
Item model number: 4531-40
Amazon Best Sellers Rank: #30,814 in Beauty & Personal Care (See Top 100 in Beauty & Personal Care)
#464 in Beauty & Personal Care > Makeup > Face > Foundation
5.0 out of 5 starsLasting Foundation
ByKay E. Vailon August 5, 2017
Love all Revlon foundation products that I have tried. The liquid ColorStay is the most reliable for staying on all day. Totally satisfied with this purchase.
BySarah J. Gentryon August 7, 2017
Color: Bare Buff|Verified Purchase
Great moisture and foundation color! Leave skin feeling smooth and soft.
1.0 out of 5 starsmask like
ByLeeon November 16, 2016
This goes on with ghastly red tones. It is not what I expected. It looks like I am wearing a mask. Tossed it.
5.0 out of 5 starsthis converage is perfect for my fair skin and I will order again
this converage is perfect for my fair skin and I will order again! and cheaper on amazon than in the local drug store!
BySusan S.on March 13, 2017
I've used Revlon for years. When I try something else, I always go back.
Byelizabeth glennon July 7, 2015
Love the lighweightiness
3.0 out of 5 starsmakeup at a good price.
ByPamela Jo Andrewson August 4, 2017
Darker than I expected. A little thick.
5.0 out of 5 starsRevlon Age Defying Makeup is great.
ByShakespeareon July 23, 2017
I have been using this makeup for many years. I like it.
Been using it for years. Very hapy with this product
5.0 out of 5 starsGreat makeup!
Published 1 month ago by Verena Zagni
5.0 out of 5 starsit doesn't feel like it will crack on your face
Coverage is not heavy, but gives the face a finished look, it doesn't feel like it will crack on your face.
Published 1 month ago by Judith M Stinson
5.0 out of 5 starsGood coverage and color
I ordered multiple bottles of this foundation as it was discontinued in the store. Good coverage and color.
Published 2 months ago by Crowley
This item: Revlon Age Defying Firming and Lifting Makeup, Medium Beige
$11.00 - $50.99
Revlon Age Defying Foundation with DNA Advantage, 1 Fluid Ounce
$10.90 - $143.09
Revlon Age Defying Makeup with Botafirm for Dry Skin, Cool Beige, 1.25 Ounce
Revlon Age Defying Powder, 0.42 Oz
Pages with related products. See and discover other items: line of makeup, foundation makeup, cosmetic revlon, revlon cosmetic, revlon cosmetics, revlon make up | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational technology company which focuses on e-commerce, cloud computing, digital streaming, and artificial intelligence."
}
] |
284,633 listings
1993 Volvo 240 Wagon Classic Odometer Cluster K 39200 Built In Tachometer Used
2002-2004 Lexus ES300 ES330 Speedometer Odometer Instrument Cluster Gauge Used
1984 Volvo 244 OEM Original Odometer Cluster Speedometer r0,980 Used
+C $33.04 shipping < 5 km from 20147
1980 Mercedes Benz 240D Instrument Gauge Cluster 123 Body used
+C $209.84 shipping < 5 km from 20147
2009-2013 Infiniti G37x Odometer Cluster Used 50K Miles
1989 Volvo 240 OEM Original Odometer Cluster K 40168 Used
+C $19.83 shipping < 5 km from 20147
2009 Infiniti G37X Sedan Speedometer Cluster 50K Miles Used
Odometer Label for Replaced Odometer / Speedometer
1983-1986 FORD MUSTANG EXPORT SSP POLICE 180 KMH / 115 MPH SPEEDOMETER - CANADA
LEXUS 2006-2008 IS250 AWD Speedometer Cluster 28k Miles
+C $19.83 shipping 20 km from 20147
1998 Mercedes-Benz C280 OEM speedometer/instrument cluster.
2001 2002 2003 Acura CL OEM instrument/speedometer cluster.
Chevrolet GM OEM 12-13 Impala Instrument Panel Dash-Center Bezel 22777989
Maple,#6 in the Diagram, Genuine OE
Chevrolet GM OEM Malibu Instrument Panel Dash-Lower Insulator Right 22807565
Buick GM OEM 13-16 Enclave Instrument Panel Dash-Trim Bezel Right 22862692
2007 MERCEDES CLK550 CONVERTIBLE OEM INSTRUMENT CLUSTER
+C $26.43 shipping 20 km from 20147
08 09 MERCEDES CLK320 CLK500 CLK55 INSTRUMENT CLUSTER
VW Passat Speedometer Cluster OEM
05 07 MERCEDES CLK320 CLK350 CLK500 INSTRUMENT CLUSTER
2005 2006 2007 2008 2009 Volvo S60 Genuine Factory Speedometer Cluster OEM
BMW 540I Speedometer Cluster OEM
VW Volkswagen Vanagon Center Lower Dash Panel Cover - 251 259 135 A 251259135 A
+C $15.07 shipping 20 km from 20147
2001-2002 Kia Sportage Instrument Cluster for Kias w/ Automatic Transmission
1999-2004 OEM Ford Mustang GT Instrument Cluster / 150mph / 8000 RPM Tachometer
HONDA OEM Cluster Switches-Visor Screw 9390344480
HONDA OEM 2012 Civic Cluster Switches-Power Outlet Cap 39620SZH003
NISSAN OEM Cluster Switches-Ring Protector 253369B92A
NISSAN OEM 12-15 NV3500 Instrument Panel Dash-Air Vent Grille Right 687501PA0A
NISSAN OEM 13-14 Altima Cluster Switches-Cluster Assembly 248103TA0C
1 SIEMENS VDO TACHOGRAPH SPEEDOMETER for M915/916/917/918/920 series trucks
NEW IN ORIGINAL SHIPPING BOX WITH ACCESSORIES
09 10 11 12 13 14 VW Jetta Wagon Avant 2.5L OEM Speedometer Cluster 5K0920961B
VDO Vision Electrical Oil Pressure Gauge Pelican Parts
+C $83.32 shipping 30 km from 20147
BMW E30 M3 Instrument Cluster Coding Plug 1380873 - S14 Specific 8k RPM
Chevrolet GM OEM 13-15 Malibu Instrument Panel Dash-Bin 23465053
Titanium,#12 in the Diagram, Genuine OE
Chevrolet GM OEM 14-15 Caprice Instrument Panel Dash-Knee Bolster 92275647
GM OEM Fuel-Resistor 88951182
Chevrolet GM OEM 14-15 Impala Instrument Panel Dash-Knee Bolster 23191254
GM OEM Instrument Panel Dash-Knee Bolster 23184400
GM OEM Cluster Switches-Blank Cover 15734687
GM OEM Cluster Switches-Power Outlet Retainer 20983936
Chevrolet GM OEM 11-12 Cruze Instrument Panel Dash-Air Vent Grille Left 95488440
GM OEM Cluster Switches-Switch Bezel 25810643
GM OEM Instrument Panel Dash-Trim Plate Left 25807743
GM OEM Instrument Panel Dash-Insulator Left 25887693
Chevrolet GM OEM Cruze Instrument Panel Dash-Air Vent Grille Right 95919071
GM OEM Instrument Panel Dash-Knee Bolster 22774196
GM OEM Instrument Panel Dash-Hole Cover 15882902
Oil pressure gauge ATY 113715
BMW E30 325e Instrument Cluster Coding Pin Plug 1377368
(233,876)
(142,013)
Keyless4u (28,836)
LKQonline (6,191)
genuinepartswarehouse (6,012)
GlowShift Gauges (3,945)
This page was last updated: 29-Jul 01:06. Number of bids and bid amounts may be slightly out of date. See each listing for international shipping options and costs. | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational e-commerce corporation based in San Jose, California, that facilitates consumer-to-consumer and business-to-consumer sales through its website."
}
] |
Chosen on location and familiarity has benefits - Review of Holiday Inn Moscow Lesnaya, Moscow, Russia - TripAdvisor
“Located is very convenient, and although the room...”
“Hotel is good Only negative is rooms are noisy”
“There are also good cafés and restaurants in the...”
“Recommended: The restaurant offering I thought was...”
“Near the metro station and you will get good...”
“Still no free WiFi in the room, but the lobby has...”
“This hotel is a 30 minute walk to red square...”
Chosen on location and familiarity has... - Holiday Inn Moscow Lesnaya
“Chosen on location and familiarity has benefits”
Chosen on location and familiarity has benefits
It is always misleading to write a review when you have been upgraded to the executive floor, which happened on this visit. We stay at Holiday Inn, Lesnaya about 3 times a year and as regular visits we were upgraded on this occasion, nice surprise. Very good room - more space and exclusive use of a 8th floor lounge providing light food and more importantly a breakfast. No complaints and of course I will be back in May. I should add the staff were attentive and helpful. General decor looking tired otherwise would have given 5 stars.
Ask Martyn H about Holiday Inn Moscow Lesnaya
Julia_Vorobyeva, Marketing coordinator at Holiday Inn Moscow Lesnaya, responded to this reviewResponded March 11, 2014
Thank you for staying at Holiday Inn Moscow Lesnaya and taking time to share your experience. It is always a great pleasure for us to get such an honorable feedback from a loyal guest. We are happy that you appreciated our helpful and polite staff. We do utmost to make your stay comfortable and pleasant.
We would be happy to welcoming you again in Holiday Inn Moscow Lesnaya in May.
All reviews metro station sheremetyevo airport red square business district executive floor direct train nice hotel circle line walking distance hotel located business hotel convenient location rooms are clean taxi service minute walk rooms are big short stay
229 - 235 of 1,148 reviews
Right in the middle of Moscow
I stayed here for 2 nights last week on business and found the hotel to be very adequate for a business trip and would probably work well for a weekend break. The rooms are big and light and feel very comfortable. The breakfast is very good and the bar area relaxing. Overall a good solid hotel.
Ask Phileasafy about Holiday Inn Moscow Lesnaya
1 Thank Phileasafy
Julia_Vorobyeva, Marketing coordinator at Holiday Inn Moscow Lesnaya, responded to this reviewResponded March 4, 2014
Dear Phileasafy,
Thank you for staying at Holiday Inn Moscow Lesnaya during your business trip and taking time to share your experience. We are glad to know that you liked our big, bright and comfortable rooms. It is a pleasure to hear that you enjoyed tasty breakfasts in “Red & White” restaurant. Your valuable comments are of great importance for us.
Just as with my previous stay, the comments here are simple - this is an excellent no frills, business oriented hotel.
The breakfast is pretty decent, and the downstairs bar has a good selection of snack.
Long story short - a definite repeat, when the price is right.
Ask DrSavant about Holiday Inn Moscow Lesnaya
Julia_Vorobyeva, marketing coordinator at Holiday Inn Moscow Lesnaya, responded to this reviewResponded February 25, 2014
Thank you for staying at Holiday Inn Moscow Lesnaya during your visit to Moscow and taking time to share your comments. It is a pleasure to know that you enjoyed tasty and always fresh breakfasts in our restaurant and the variety of snacks in our bar. We do utmost to make your stay pleasurable.
EXCELLENT TRANSIT LOCATION
I picked especially to travel to Sheremetyevo airport with minimum hassle avoiding infamous Moscow traffic jams. Aeroexpress terminal is just around the corner, max. 10-15 minutes to get into a train.
The hotel is brand new and accordingly smells nice and clean. Not much facilities in the hotel, but plenty in the walking distance.
Ask Al C about Holiday Inn Moscow Lesnaya
Thank you for staying at Holiday Inn Moscow Lesnaya during your visit to Moscow and taking time to give a feedback. It is a pleasure to know that you enjoyed hotel’s convenient location at a walking distance to Belorusskaya metro station.
they ready to give your key to anyone
I sent below e-mail to IHG and want to share this with you - please think before staying at this hotel...
Thing is to achieve my goal in the Big Win promotion I need to stay at three IHG brands. I already had two brands covered and decided to spend the night in Moscow HI Lesnaya hotel on my home town, since hotel is located 10 min drive from my house. I checked in on Saturday at 3 pm – got upgrade from Executive room I booked to Executive Suite, since hotel was almost empty, room was fine, nothing fancy. I arrived with my friend, who wasn’t checked in with me and hotel didn’t get any of his details/passport/name or anything in their system. After we got to the room and I unpacked I understood that I forgot remote control from my digital TV player at home, which I took with me to see the movies, so I asked my friend to stay in the room while I go back home. I left hotel and got back in 30 minutes. While I was away my companion decided to go to executive lounge and to check the gym. But when he got to the gym floor and was trying to get back to the room his key card wasn’t working. So he went back downstairs, reception stuff team changed at that time, so they never saw this guy – for them he was a person who just came upon reception from somewhere at the hotel. So he asked for his key to be renewed and give the room number. Reception stuff (3 people present) didn’t bother to check his ID, or ask name of the person staying in the room or did ANYTHING to protect the privacy of the room occupant. He got the key and went back. I arrived to hotel – my key wasn’t working now, because he got new one, which I didn’t know of course, so I came to reception myself to get new key and same story happen again. I was very surprised and since I’m staying a lot in the hotel I asked front desk supervisor if this is a normal practice for them to give up the key to any person who asked for the keys, stuff wasn’t sure. When I found out when I got back to the room that exactly same situation happen with my friend 10 minutes ago and reception stuff without any ID or any authorization gave the key to my room to total stranger I went down to see the manager on duty.
Room Tip: cheap furniture, not sure if this place worth the money...
Ask FedyaInMoscow about Holiday Inn Moscow Lesnaya
Julia_Vorobyeva, General Manager at Holiday Inn Moscow Lesnaya, responded to this reviewResponded February 19, 2014
The hotel has already replied you directly when you were staying with us.
It looks that a heart gesture of hospitality was wrongly treated by you and i am very upset about it. All further actions of yours like trying to intimidate and taint the hotel's reputation are not appreciated.
For those who read this review i'd like to comment that front desk person was right near when you and your guest (who was standing behind you at check-in and then you went together to the elevators) were checking-in and this is the only reason why you and your guest didn't face a formal procedure.
All guest corridors and elevator halls are covered by our security cameras and access to the floors and rooms is only possible with the guest's keycard.
Making sure that hotel guests feel safe and comfortable is our top priority and our guests may be assured that their security in the hotel is 100% guaranteed.
We look forward to welcoming our guests in Holiday Inn Moscow Lesnaya hotel.
The hotel is very convenient located, everything is in walking distance. Being an elite member of the priority club I got an upgrade to a junior suite which was excellent. The room vas very clean and the bed (king size) very comfortable.
The staff is very friendly, polite and helpful. I highly recommend this hotel to anyone.
Room Tip: join the priority club to get upgrades
Ask Rainer S about Holiday Inn Moscow Lesnaya
Svetlana S, Marketing coordinator at Holiday Inn Moscow Lesnaya, responded to this reviewResponded February 18, 2014
Thank you for staying at Holiday Inn Moscow Lesnaya during your visit to Moscow and taking time to share your experience. It is a pleasure to know that you were satisfied with your clean room with comfortable bed. We are glad to hear that you liked not only the convenient location of our hotel in a walking distance to the Belorusskaya Metro Station, but also friendly, kind and attentive hotel’s staff.
Nicer than Holiday Inns in America
We got an excellent price online- less than $200 a night- for this centrally located American style hotel on Lesnaya during late January. It's within easy walking distance of Belorusskaya Metro station, which is on the green line (Domodedovo Airport is on this line) and the circle line, providing easy access to many points around the city. Red Square, for example, is 2 stops away. The rooms are clean, spacious and quiet. Customer service was excellent: we arrived from another city early one morning by bus and they graciously accommodated us many hours before official check in for a reduced price. Free internet service is available in the lobby and for a fee in the rooms. There is a cafe/bar in the lobby which serves breakfast, but there are several restaurants and cafes catering for all meals within 2-3 blocks of the hotel. They were also willing to secure our bags after check out while we explored the city for a few more hours. Overall, it was a seamless, stress free experience for an American who was a bit nervous about what to expect from a Russian hotel
outside of the Ritz-Carlton/Four Seasons class. We definitely recommend it!
Ask skdavids about Holiday Inn Moscow Lesnaya
1 Thank skdavids
Julia_Vorobyeva, Marketing coordinator at Holiday Inn Moscow Lesnaya, responded to this reviewResponded February 3, 2014
Dear skdavids,
Thank you for staying at Holiday Inn Moscow Lesnaya during your visit to Moscow and taking time to share your experience. It is a pleasure to know that you enjoyed hotel’s convenient location at a walking distance to Belorusskaya metro station. We are happy to hear, that you were satisfied with clean, spacious room and with the quality of our service.
We are also glad to inform you that Wi-Fi is now available for free throughout the hotel for all IHG Rewards Club members. If you are not a member yet, you can easily start receiving club bonuses by registering on the official web-site.
TripAdvisor is proud to partner with Hotels.com, Booking.com, Agoda, Ctrip TA, Expedia, IHG, Cancelon, Travelocity, Orbitz, TripOnline SA, Hotwire and HotelQuickly so you can book your Holiday Inn Moscow Lesnaya reservations with confidence. We help millions of travelers each month to find the perfect hotel for both vacation and business trips, always with the best discounts and special offers. | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American online travel company that operates a website and mobile app with user-generated content and a comparison shopping website."
}
] |
The reverse polarity protection circuit 32 comprises diodes 40 and 41 one terminal each of which is connected to respective terminals 43 (T1) and 44 (R1) of switch 16 so as to be normally connected through the switch to the telephone company tip and ring lines. The other terminal of both diodes is connected to a voltage input line 46 of the device. The cathodes of the diodes are connected together and to the voltage input line 46 so that the remote isolation device operates from a positive voltage on either or both the tip 36 and ring 37 lines and is protected from a negative voltage on either or both of those lines, although the device could be structured to operate from a negative voltage in which case the anodes of the diodes will be connected together to line 46. Other polarity protection circuits could also be used.
Patent CitationsCited PatentFiling datePublication dateApplicantTitleUS29499 *Aug 7, 1860 Condenser for steam-enginesUS3636280 *Sep 17, 1970Jan 18, 1972Gen Telephone Co Of CaliforniaTelephone line testing from remote locationsUS3725589 *Feb 14, 1972Apr 3, 1973Golden MRemote-control system for intelligence-recording apparatus with control tone eliminating switchingUS3725613 *Feb 25, 1971Apr 3, 1973Rochester Tel CorpApparatus for protecting and testing telephone networkUS3739107 *Oct 13, 1970Jun 12, 1973Superior Continental CorpOn premise telephone loop testerUS3766336 *Oct 12, 1972Oct 16, 1973Wikholm ICircuit isolating switching arrangementUS3773986 *Dec 13, 1971Nov 20, 1973Comm Systems CorpTelephone line test isolation apparatusUS3814870 *Sep 19, 1972Jun 4, 1974Western Electric CoTelephone subscriber line terminating test circuitUS3829616 *May 14, 1973Aug 13, 1974Int Mobile MachinesRinger blocking attachment for telephonesUS3843848 *Jan 12, 1973Oct 22, 1974Magnetic Controls CoTelephone looptest systemUS3849764 *May 29, 1973Nov 19, 1974Quindar ElectronicsProgrammable frequency decoderUS3852537 *Feb 22, 1973Dec 3, 1974San Bar CorpTelephone station disconnect deviceUS3860769 *Nov 1, 1972Jan 14, 1975Gte Lenkurt IncMethod and apparatus for testing the operation of a communication systemUS3867588 *Jun 1, 1973Feb 18, 1975Terra CorpQuick disconnect for telecommunication linesUS3902016 *Jul 1, 1974Aug 26, 1975Int Mobile MachinesRinger blocking attachment for telephonesUS3912882 *Dec 7, 1973Oct 14, 1975Tm SystemsRemote loop-back terminating unit for testing telephoneUS3919487 *Jun 14, 1974Nov 11, 1975San Bar CorpTelephone instrument disconnect circuitUS3920935 *Sep 28, 1973Nov 18, 1975Vierling OskarMethod for measuring the frequency-dependent attenuation of a telecommunications line, especially a two-wire lineUS3922508 *Jan 14, 1974Nov 25, 1975Magnetic Controls CoCoded telephone line testing equipmentUS3943305 *Nov 11, 1974Mar 9, 1976Magnetic Controls CompanyTelephone line control systemUS3947753 *Jul 18, 1974Mar 30, 1976Canon Kabushiki KaishaVoltage regulator including an LED to provide a reference voltageUS4041255 *Sep 29, 1976Aug 9, 1977Northern Telecom LimitedSwitching circuit for telecommunications linesUS4054759 *Nov 15, 1976Oct 18, 1977Northern Telecom LimitedSubscriber loop verification device and methodUS4068104 *May 14, 1976Jan 10, 1978Digital Communications CorporationInterface for in band SCPC supervisory and signalling systemUS4070554 *Jun 30, 1976Jan 24, 1978L.M. Ericcson Pty. Ltd.Digital testing and power control in a digital communication systemUS4086448 *Apr 18, 1977Apr 25, 1978Bell Telephone Laboratories, IncorporatedLoop-around test circuit for telecommunications linesUS4112414 *Jan 3, 1977Sep 5, 1978Chevron Research CompanyHost-controlled fault diagnosis in a data communication systemUS4126771 *Jul 27, 1977Nov 21, 1978Proctor & Associates CompanyTelephone line lifting apparatusUS4143250 *Dec 13, 1976Mar 6, 1979Tii CorporationTelephone isolation systemUS4169220 *Oct 2, 1978Sep 25, 1979Fields Gary CTelephone instrument connection block with remotely actuated line testUS4197435 *Feb 24, 1978Apr 8, 1980Jackson Amos RTelephone line monitoring circuit and methodUS4209667 *Feb 16, 1978Jun 24, 1980Tii Industries, Inc.Subscriber drop-connected circuitsUS4258236 *Apr 4, 1979Mar 24, 1981Conklin Instrument CorporationRemote telephone line switching and testingUS4304967 *Jun 4, 1979Dec 8, 1981Irwin GretczkoRemote control apparatusUS4350849 *Jan 15, 1981Sep 21, 1982Tii Industries Inc.Varying impedance line test termination device* Cited by examinerNon-Patent CitationsReference1 *Advertisement for Cidcomm International for Remote Line Disconnectors, Bulletin No. 1005.2 *Advertisement of Proctor for Line Test Unit (LTU).3 *Advertisement of TII Industries for Combination Tip Party Identifier and Ring Isolator, Issue No. 7, Aug. 1982.4 *Advertisement of TII Industries for Combination Tip Party Identifier and Ringer Isolator, Issue No. 3, Aug. 1982.5 *Advertisement of TII Industries for Remote Isolation Devices and Line Termination Devices.6 *Advertisement of TII Industries for TII 805 Remote Isolation Device (Time Release) Issue No. 6, Oct. 1981.7 *Advertisement of TII Industries for TII 810 3 Ringer Isolator (Pat. No. 4,209,667), Issue No. 3, Aug. 1982.8 *Advertisement of TII Industries for TII 811 Tip Party Identifier Issue No. 4, Aug. 1982.9 *Advertisement of TII Industries for TII 815 Tip Party Identifier Issue No. 4, Aug. 1982.10 *Advertisement of TII Industries for TII 855 Super Fire Fly Isolation Device, Issue No. 1, Aug. 1982.11Advertisement of TII Industries for TII-811 Tip Party Identifier Issue No. 4, Aug. 1982.12Advertisement of TII Industries for TII-815 Tip Party Identifier Issue No. 4, Aug. 1982.* Cited by examinerReferenced byCiting PatentFiling datePublication dateApplicantTitleUS4661969 *May 3, 1985Apr 28, 1987Communications Technology CorporationCommunication lines with terminate and leave capability-VF data bridgeUS4686696 *Dec 2, 1985Aug 11, 1987Keptel, Inc.Transmission line signal sensing circuit employing means for conserving power, especially for use with a telephone disconnect circuit, and associated methodUS4807277 *May 15, 1987Feb 21, 1989Keptel, Inc.Remotely activated switching apparatusUS5065424 *Mar 21, 1989Nov 12, 1991Miller Arthur OApparatus for servicing telephones from a remote locationUS5359654 *May 12, 1992Oct 25, 1994Raychem CorporationTelecommunications network interface assemblyUS5463680 *Feb 15, 1994Oct 31, 1995Siemens-Albis AgSwitching arrangement for activating electrical devicesUS5504801 *Feb 9, 1994Apr 2, 1996Harris CorporationUser-controlled electronic modification of operating system firmware resident in remote measurement unit for testing and conditioning of subscriber line circuitsUS5953391 *Oct 19, 1993Sep 14, 1999Canon Kabushiki KaishaData communication apparatus having automatic data reception informing systemsUS6498836Apr 19, 1999Dec 24, 2002Canon Kabushiki KaishaData communication apparatusEP0372877A2 *Dec 4, 1989Jun 13, 1990Canon Kabushiki KaishaData communication apparatusEP0663754A1 *Jan 11, 1995Jul 19, 1995Alcatel Business SystemsDevice for activating data receiving in a telephone terminal capable of receiving data transmitted via the telephone line before off-hookWO2004100518A1Apr 30, 2004Nov 18, 2004Behruz VazvanA communication method, system, devices and software arranged to operate in this system and devices* Cited by examinerClassifications U.S. Classification379/102.01, 379/27.06International ClassificationH04M3/30, H04M11/00Cooperative ClassificationH04M11/007, H04M3/301European ClassificationH04M11/00B, H04M3/30CLegal EventsDateCodeEventDescriptionOct 28, 1997FPExpired due to failure to pay maintenance feeEffective date: 19970820Aug 17, 1997LAPSLapse for failure to pay maintenance feesMar 25, 1997REMIMaintenance fee reminder mailedJun 12, 1995ASAssignmentOwner name: ANTEC CORP., ILLINOISFree format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KEPTEL, INC.;REEL/FRAME:007526/0405Effective date: 19950531Feb 8, 1993FPAYFee paymentYear of fee payment: 8Feb 10, 1989FPAYFee paymentYear of fee payment: 4Apr 24, 1984ASAssignmentOwner name: KEPTEL, INC., 1800 BRIELLE AVENUE OCEAN INDUSTRIALFree format text: ASSIGNMENT OF ASSIGNORS INTEREST.;ASSIGNOR:PERRY, STEVEN B.;REEL/FRAME:004268/0774Effective date: 19840417RotateOriginal ImageGoogle Home - Sitemap - USPTO Bulk Downloads - Privacy Policy - Terms of Service - About Google Patents - Send FeedbackData provided by IFI CLAIMS Patent Services©2012 Google | [
{
"key": "website_description",
"type": "global",
"value": "This website is a search engine provided by Google. Handling over 3.5 billion searches per day, it has a 92% share of the global search engine market."
}
] |
_.tk=function(){this.R=[];this.H=[]};_.f=_.tk.prototype;_.f.ef=function(){return this.R.length+this.H.length};_.f.Ce=function(){return _.Eb(this.R)&&_.Eb(this.H)};_.f.clear=function(){this.R=[];this.H=[]};_.f.contains=function(a){return _.Db(this.R,a)||_.Db(this.H,a)};_.f.remove=function(a){var b=this.R;var c=(0,_.ub)(b,a);0<=c?(_.Gb(b,c),b=!0):b=!1;return b||_.Hb(this.H,a)}; _.f.Je=function(){for(var a=[],b=this.R.length-1;0<=b;--b)a.push(this.R[b]);var c=this.H.length;for(b=0;bAimed Web Solutions - Google+Press question mark to see available shortcut keysHomeCollectionsJoin Google+Send FeedbackHelpRegionPrivacy Policy - Terms of Service - Maps Terms©2017 GoogleSearchSign inAboutSearchSign inAimed Web Solutions2,769 followers - Targeting the Audience to Visit your WebsiteTargeting the Audience to Visit your Website2,769 followersAboutAimed Web Solutions's posts Post has attachmentAimed Web SolutionsPublicFeb 19, 2015In the competition of website promotion,SEO plays a major role. #Aimedwebsolutions providing the Best #SEO #Services in #Hyderabad .The websites with good SEO with Responsive Design will occupy the best position in the search engine rankings now-a-days. http://aimedwebsolutions.com/seo-services-hyderabad.htmlSEO Services Hyderabad | SEO Companies in Hyderabadaimedwebsolutions.com one plus one 1 no comments no shares Post has attachmentAimed Web SolutionsPublicFeb 9, 2015Continuing our speed and dedication towards Clients work & Now became one of the Best #Webdesigningcompanyhyderabad. Make sure to utilize our best and innovative skills for your websites. We are awaiting and will take it as an honour to work on your projects. Yours @aimedwebsolutions. #webdesigncompanyWeb Designing Company in Hyderabadaimedwebsolutions.com one plus one 1 no comments no shares Post has attachmentAimed Web SolutionsPublicJan 30, 2015Aimed Web Solutions offers #Digital #Marketing #Services in #India with low cost & high quality promotional activities. We are providing 30% discount on all of our digital marketing services like SEO, PPC, SMO, Email Marketing etc,.Digital Marketing Services India - Aimed Web Solutionsaimedwebsolutions.com 2 plus ones 2 no comments no shares Post has attachmentAimed Web SolutionsPublicJan 28, 2015#Responsive #Web #Design became a trend now-a-days. For this reason we started doing #responsivewebdesign for all of our clients .Responsive Web Design India - Aimed Web Solutionsaimedwebsolutions.com 2 plus ones 2 no comments no shares Post has shared contentAimed Web SolutionsPublicJan 28, 2015Originally shared by Aimed Web Solutions#Responsive #Web #Design became a trend now-a-days. For this reason we started doing #responsivewebdesign for all of our clients .. http://aimedwebsolutions.com/responsive-web-design-india.htmlResponsive Web Design India - Aimed Web Solutionsaimedwebsolutions.com 2 plus ones 2 no comments no shares Post has attachmentAimed Web SolutionsPublicJan 28, 2015#Responsive #Web #Design became a trend now-a-days. For this reason we started doing #responsivewebdesign for all of our clients .. http://aimedwebsolutions.com/responsive-web-design-india.htmlResponsive Web Design India - Aimed Web Solutionsaimedwebsolutions.com no plus ones no comments one share 1 Post has attachmentAimed Web SolutionsPublicJan 28, 2015#Responsive #Web #Design became a trend now-a-days. For this reason we started doing #responsivewebdesign for all of our clients .Responsive Web Design India - Aimed Web Solutionsaimedwebsolutions.com 3 plus ones 3 no comments no shares Post has attachmentAimed Web SolutionsPublicJan 27, 2015As a #Webdesigningcompanyinhyderabad , We are creating a Light weight, User & SEO Friendly Websites to our clients.Web Designing Company in Hyderabad - Aimed Web Solutionsaimedwebsolutions.com 2 plus ones 2 no comments no shares Post has attachmentAimed Web SolutionsPublicJan 6, 2015#PHP #Web #Development #Company #India came up with innovative good looking designs. Lowest Prices offer on Web Designing and Development services, Upto 40% Discount Offer for the next 10 Customers from today onwards till 15th January 2015.PHP Web Development Company India - Aimed Web Solutionsaimedwebsolutions.com 2 plus ones 2 no comments no shares Post has attachmentAimed Web SolutionsPublicJan 5, 2015#HTML #Web #Design company in hyderabad offering the latest HTML5 technology based webdesigns for your websites. We develop a light weight and error free coding websites. #htmlwebdesign.@aimedwebsolutionsHTML Web Design - Aimed Web Solutionsaimedwebsolutions.com 2 plus ones 2 no comments no sharesLooks like you've reached the endLooks like you've reached the endUnable to load more. RetryWait while more posts are being loaded | [
{
"key": "website_description",
"type": "global",
"value": "This website ."
}
] |
We could hear dialogue between Raoul Moat and police, say residents | UK news | The Guardian
• Residents overhear police negotiations with Moat
• Gunman seen holding shotgun to his own neck
Onlookers in Rothbury during the police operation to find Raoul Moat. Photograph: Chris Radburn/PA
Friday 9 July 2010 20.59 EDT
First published on Friday 9 July 2010 20.59 EDT
After a week in the public eye, residents of Rothbury last night told how they had been able to listen to the negotiations between gunman Raoul Moat and police taking place, and expressed relief that their ordeal was at last at an end.
In the early hours of this morning the standoff which had lasted for six hours came to an end when Moat shot himself.
It appears that over the course of the past week Moat had not strayed far from his apparent base near Wagtail Farm, the scene of a reported break-in on Tuesday, and in fact had managed to remain undetected right under the noses of more than 200 police officers and the combined resources of 15 forces.
One resident, James Matthews, had watched the action unfold closely enough to overhear the fraught negotiations taking place. He said: "Moat kept saying that nobody cares about me."
The police negotiating team had repeatedly addressed Moat as "Raoul", and continually reassured him he would not come to any harm, Matthews added.
"They clearly are trying to coax him out of whatever position he's in. He's being promised that he will not be hurt.
"I can hear a woman's voice [one of the negotiators]. Moat sounds quite animated and emotional. They are trying to lay their hands on him throughout the process of negotiations."
Sarah Brown, who was drinking at the Queen's Head pub, 600 metres from the place where Moat had been cornered, said there had been a collision between two police cars outside the pub and right afterwards they were ordered by police to remain inside. "A couple of police cars crashed in the streets and suddenly it was all mayhem. The police are saying go inside, but no one is taking any notice," she said.
Chris Robertson, watching from his mother's home overlooking the riverbank where Moat was apprehended, said: "I saw the suspect with what looked like a sawn-off shotgun. It was pointing at him and he looked like he was going to blow himself away.
"I was ushered inside by the police and then two police cars came down to the riverside. It's a standoff situation. He's pinned down by about 20 marksmen."
Reacting to Moat being caught, Eileen Turnbull, who was with her daughter Bridget, 15, said: "It feels like a shadow has been lifted." Christine Williams, who lives with a family just 20 yards from where Moat was caught, said "I'm just so glad it's all over. But I hope they aren't too hard on him. He's obviously got issues."
A former special constable, Bob Herdman, who watched the early stages of the capture unfold from his allotment, said that Moat was lying on his stomach with eight weapons pointing at him.
"He looked very calm and later dropped into a sitting position, probably because he was uncomfortable," he said.
Steven Williams, the husband of Christine, said that the relief among residents was palpable, and he praised the police for doing such a great job in containing Moat. Like many others, he had feared that the fugitive had slipped the police net.
He said: "The police have been excellent, they've kept us really informed throughout and have been particularly friendly. You'd have thought Moat would have moved on, but as it happens he was right on our doorstep. Our home was one of the closest to where he was hiding.
"You imagine he might be in our garden, which he basically was, and that makes you think that, now it's ended, we're just very grateful for the expertise of the police."
As night fell, police continued to stream into the village with a number of marked police cars breaking through the tight cordons surrounding the spot where Moat continued to negotiate with specially trained officers. At 10.40pm a convoy of civilian cars sped through the police cordon. Among their occupants was a close friend of Moat's, Tony Laidler, who had offered to assist in negotiations.
Elsewhere, local radio stations broadcast a number of calls from Moat's friends. One, Jade Dobson, said: "He's not a bad person. He's been painted as the devil.
"He's obviously got a lot of issues going through his head." | [
{
"key": "website_description",
"type": "global",
"value": "This website is a British news and media website owned by the Guardian Media Group. It contains nearly all of the content of the newspapers The Guardian and The Observer, as well as a substantial body of web-only work produced by its own staff, including a rolling news service."
}
] |
Laxdæla saga - Wikipedia, the free encyclopedia
(Redirected from Laxdaela Saga)
Laxdæla saga (Icelandic pronunciation: [ˈläːks.täi̯lɐ ˈsaːɣa] ( listen)); also Laxdœla saga, Laxdoela saga, Laxdaela saga, or The Saga of the People of Laxárdalr) is one of the Icelanders' sagas. Written in the 13th century, it tells of people in the Breiðafjörður area of Iceland from the late 9th century to the early 11th century. The saga particularly focuses on a love triangle between Guðrún Ósvífrsdóttir, Kjartan Ólafsson and Bolli Þorleiksson. Kjartan and Bolli grow up together as close friends but the love they both have for Guðrún causes enmity between them and, in the end, their deaths.
Second only to Njáls saga in the number of medieval manuscripts preserved, Laxdæla saga remains popular and appreciated for its poetic beauty and pathetic sentiment.
3.2 Love triangle
3.3 Death and vengeance
As is the case with the other Icelanders' sagas, the author of Laxdæla saga is unknown. Since the saga has often been regarded as an unusually feminine saga, it has been speculated that it was composed by a woman.[1] The extensive knowledge the author shows of locations and conditions in the Breiðafjörður area show that the author must have lived in Western Iceland.[2] Internal evidence shows that the saga must have been composed sometime in the period 1230-1260.[3]
On several occasions, Laxdæla saga explicitly cites what appear to be written sources. It twice refers to the writings of Ari Þorgilsson, once to a lost Þorgils saga Höllusonar and once to a Njarðvíkinga saga, perhaps an alternative name for Gunnars þáttr Þiðrandabana.[4] The author was also likely familiar with a number of other written historical sources .[5] Nevertheless the main sources of the author must have been oral traditions, which he or she fleshed out and shaped according to his or her tastes.[6]
Laxdæla saga is preserved in numerous manuscripts. The oldest manuscript to contain the saga in its entirety is Möðruvallabók dating to the mid-14th century. There are also five vellum fragments, the oldest dating to ca. 1250, and numerous young paper manuscripts, some of which are valuable for textual criticism of the saga.[7]
Scholars have divided the manuscripts into two groups, the Y group, which includes Möðruvallabók, and the Z group, which includes the oldest fragment. The greatest divergence between the groups is that the Y group contains an addition of ten chapters to the saga. These chapters were not written by the original author and are regarded by scholars as a separate work, Bolla þáttr Bollasonar. Another difference between the groups is that the theft of Kjartan's sword is narrated in two different ways. Most other differences between the manuscripts are minor variations in wording.[8]
Laxdæla saga begins in Norway in the late ninth century as Ketill Flatnose and his children leave Norway to escape the tyranny of Harald Fairhair. The saga focuses in particular on Ketill's daughter Unnr the Deep-Minded. Unnr leaves Norway to travel with her family to Iceland. Later in the saga when she hears that her father and her son are dead, she has a ship built so that she can take all of her surviving kinsmen as well as a great deal of wealth to safety. Unnr goes on to travel to Scotland and the Orkney and Faroe Islands before claiming lands in Breiðafjörður in Western Iceland. Later in life, Unnr decides to leave her wealth to Olaf, the youngest of Thorstein's children. She decided to leave her inheritance to him because he was very good looking and likable. The saga describes Unnr's dignified death and her ship burial.[9]
The next principal character is Höskuldr Dala-Kollsson, great-grandson of Unnr. He travels to Norway to acquire wood for house-building. While abroad, he purchases a mute but beautiful and expensive slave-girl. He also meets King Hákon the Good, who gives him wood, as well as a ring and a sword. Höskuldr then travels back to Iceland. Höskuldr and the slave-girl have a child named Olaf, later nicknamed Olaf the Peacock. One day, when Olaf is two years old, Höskuldr finds Olaf and his mother talking by a stream. Höskuldr tells the slave-girl that she can no longer pretend to be mute and asks for her name. She reveals that she is Melkorka, daughter of King Mýrkjartan of Ireland, and that she was taken captive at the age of fifteen. Höskuldr also fights the reanimated Hrappurstadir. This is one of the earliest, textual mentions of reanimation of the physical body. [10]
Olaf the Peacock grows up to be a handsome and well-mannered man. When he is eighteen years old he travels abroad. He first goes to Norway where he pays his respects to King Harald Greycloak and befriends his mother, | [
{
"key": "website_description",
"type": "global",
"value": "This website is the English-language edition of the free online encyclopedia Wikipedia. It was founded on 15 January 2001 as Wikipedia's first edition and, as of October 2021, has the most articles of any edition, at 6,412,521."
}
] |
ios - iPod software version too high? - Stack Overflow
I bought a new iPod touch today and I installed iOS 7 on it in order to beta test my new designs, color schemes, and speed enhancements. I'm running OSX 10.6.8 with Xcode 4.2 Build 4C199 (iOS 5). When I plugged my iPod in and pressed "use for development" in the xcode organizer I got an error saying that I couldn't use the iPod because the software version was too high. What should I do?
ios ipod-touch ios7 share|improve this question asked Aug 12 '13 at 19:12
Use Xcode 5, which you can get from the same place you got iOS 7 from (provided you're a registered developer).
I cannot because I don't have a high enough OSX
XCode 5 runs on MacOS 10.6.8, b.t.w.
Regardless of the iOS version, you can not build to an iOS version higher than that of the SDK you have installed. Update your Xcode to the version that comes with the SDK that matches the iOS version you wish to build to.
@Coder404 Sorry, but you might have to upgrade. I haven't been able to find any evidence that this Xcode version can be persuaded to run on that OS X version.
This isn't entirely true. I have iOS 7 beta on a test device and once it was used with Xcode 5, I had no further issues using Xcode 4.6 (and a Base SDK of iOS 6.1) to debug apps on the iOS 7 device. This is a great way to test existing iOS 6 apps to be sure they will work as-is under iOS 7.
You need to download and install the Xcode 5 beta
1,5822522
Yup. I just went through that. Had to upgrade my OSX before I could upgrade my Xcode before I could debug with my upgraded iOS. Didn't want to upgrade my OSX because I wanted to wait for 10.9, but Apple left me no choice.
Not the answer you're looking for? Browse other questions tagged ios ipod-touch ios7 or ask your own question. asked
Check iPod touch generation programatically | [
{
"key": "website_description",
"type": "global",
"value": "This website is a question and answer website for professional and enthusiast programmers. It is the flagship site of the Stack Exchange Network, created in 2008 by Jeff Atwood and Joel Spolsky."
}
] |
Dragon Actually by G A Aiken - New, Rare & Used Books Online at Alibris Marketplace
Dragon Actually by
Dragon Actually – Mass-market paperback
Title: Dragon Actually (Dragon Kin, Book 1)
Reviews of Dragon Actually
Discussions about Dragon Actually
Subjects related to Dragon Actually | [
{
"key": "website_description",
"type": "global",
"value": "This website is is an online store that sells new books, used books, out-of-print books, rare books, and other media through an online network of independent booksellers."
}
] |
Amazon.com: Pirelli Diablo Rosso II Rear Tire - 240/45ZR-17/--: Automotive
Pirelli Diablo Rosso II Rear Tire - 240/45ZR-17/--
Pirelli Enhanced Patch Technology EPT optimizes the contact patch for improved grip
Functional Groove Design FGD to optimize wet road riding behavior
3 new from $190.88
Pirelli Diablo Rosso II Tire - Rear - 140/70ZR-17 , Tire Type: Street, Tire
ModelDiablo Rosso II Rear Tire
Manufacturer Part Number871-1148
Section Width 240
Aspect Ratio 45 inches
ASINB0055B45A0
#1,222,585 in Automotive (See top 100)
Pirelli Diablo Rosso II Rear Tire Pirelli is setting the new standard with the Diablo Rosso II rear motorcycle tire. New and updated features give this tire excellent grip, great mileage and confidence. Bi-Compound design gives long lasting mileage on the road and superb grip at full leanPirelli Enhanced Patch Technology EPT optimizes the contact patch for improved gripFunctional Groove Design FGD to optimize wet road riding behaviorRead the MotorcycleUSA.com review of the Pirelli Diablo Rosso II Tire here Pirelli Diablo Rosso II Tire Review | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational technology company which focuses on e-commerce, cloud computing, digital streaming, and artificial intelligence."
}
] |
Five share punts that might make you a mint | Daily Mail Online
Tips for the gamblers: Five share punts that might make you a mint ... but only the brave need apply By
and This Is Money
20:01 EST, 23 July 2013
07:34 EST, 24 July 2013
Any type of investing has some risk — and it can also be quite dull. Putting money in the stockmarket for your retirement or for the children’s school fees is a long game. And you certainly don’t want to gamble with this type of cash that’s so vital for your financial future.So once in a while — and only if you have cash to spare — it’s fun to have a punt and try to pick the companies that could turn you into a millionaire. After all, everyone wants to say they got in early for the next big thing. And with world stockmarkets picking up, now could be the time to take a wild gamble. Money Mail asked a host of stockpickers to pull out some firms to consider. But remember, all of these shares are very high risk. And you should only place a bet on them if you can afford to lose your stake. The budget airline bonanza in Africa At 4.50pm tomorrow a flight for budget airline Fastjet will take off from Zanzibar, in Tanzania, to Kilimanjaro, home to Africa’s highest peak. The 250-mile journey will take a little over an hour and cost passengers an average 96,000 Tanzanian shillings or £38.These cheap daily flights are proving so popular that London stock market-listed Fastjet is expanding.Last month, the Tanzanian firm — backed by Easyjet founder Stelios Haji-Ioannou — was given the green light to fly new routes to South Africa, Zambia and Rwanda. It will also create a low-cost airline inside Nigeria with local operator Red 1 Airways. Fastjet already has ten aircraft serving nearly 30 destinations within Africa. More...
Top 20 most reliable investment trusts over last ten years
Travel is becoming big business because of the sheer size of the continent. Africa measures 6,700km at its widest from Senegal to Somalia, and 7,300km at its longest from Tunisia in the north to South Africa.And there are other reasons for optimism. Some nations have a growing middle class, and there is, for the first time in a long time, relative political stability and peace in many countries. Rival budget airline Kenya-based Fly540 has nearly tripled its revenues since 2007, to £18 million. Its domestic flights from Nairobi to Mombasa, and cross-border flight to Zanzibar in neighbouring Tanzania, are popular.Last month, South African Comair put in an order for four more Boeing 737s for kulula.com — a low-cost subsidiary. Mango, another South African low-cost carrier, is also expanding its fleet.But the success of budget airlines is far from assured. Many governments demand huge taxes on air fuel and sales of tickets, and leases on fleets of planes can cost African companies three times as much. In 2011, low-cost carrier Velvet Sky launched in South Africa, but closed a year later after becoming embroiled in corruption.Ben Yearsley, head of investment research at Charles Stanley Direct stockbroker, says: ‘The potential for growth in this market is breath-taking.‘As — it’s to be hoped — the continent moves towards a more peaceful future, the potential for growth as more governments allow investment and infrastructure is enormous. Concern over corrupt business practices will always be a big worry in Africa, so be prepared for setbacks which can strike at any time.’FastJet: Share price, data and announcementsFEAR FACTOR: 5/5 INVESTING IN SHARES VS FUNDS AND TRUSTSInvesting in shares directly has long been a popular option and can be very rewarding, but is a path laid with traps. If
you do decide to pick individual shares then make sure you research companies very carefully, learn to understand how to read their balance sheets and financial statistics.
classic share investor’s mistake is to buy too few different companies.
A report by specialist magazine Investors Chronicle says the ideal number of shares for a portfolio is 15, spread across different sectors.
simple way around this is to invest in either active funds or investment trusts, where a fund manager chooses a basket of shares for you, or in passive tracker funds or exchange traded funds, which follow an index up or down.
Fund managers will tell you that the advantage of an active fund is their expertise but you actually have to choose the right manager to benefit from this. Many consistently fail to
beat their benchmark and still levy their fees - a handful do actually outperform year after year. [Read our guide to low-cost index tracker funds and the cheapest around]
Chinese mums who want safe baby milkFive years ago, six babies in China died and hundreds of thousands fell ill after baby milk became contaminated by melamine — a chemical added to the formula. Since the national outcry, millions of worried Chinese parents have turned to baby products from overseas. This has created enormous demand for branded Western baby milk — a market recently estimated to be worth £8 billion a year.Demand in China has ballooned by 25 per cent since 2012. There are nearly 85 million under-fives in China, and fewer than a third of children under the age of six months are breast-fed, United Nations figures show.A report from researcher Euromonitor forecasts that demand for formula in China will double by 2017 to £16.5 billion. The nation could use half the world’s supply.So putting your money into a company that makes or sells baby formula looks likely to be a good bet. Tim Cockerill, head of research at wealth manager Rowan Dartington says: ‘There’s nothing as potent as a parent’s fears for a child’s safety — and any firm which can allay those concerns is going to be able to reap a great dividend.’ Tipped is French multinational Danone, which makes Aptamil and Cow & Gate baby milk powder sold in the UK. Already popular in China, it has also struck a partnership with Chinese producer Mengniu.Danone has also upped its production in European factories to ensure it meets demand. And to further help the cause, taxes on baby milk imports to China have dropped from 20 per cent to 5 per cent.FEAR FACTOR: 1/5 Cash in on the Russian credit boomFears of political meddling, corruption and dodgy deals mean only the most stout-hearted should invest in Russia.However, it can be home to sturdy businesses equivalent to blue-chips in the UK. Sberbank, a giant bank with more than 10,000 branches across the country, is Russia’s biggest lender — and poised for even further growth.It has grabbed more than a fifth of the country’s credit card market — in a nation where fewer than one in five people have plastic in their wallets.And household debt in Russia is two or even three times lower than other developing economies such as Turkey or the Czech Republic.Sberbank also provides home loans to nearly half the nation. As President Vladimir Putin tries to foster a less chilly business climate for overseas investors — forcing Russian firms to pay 25 per cent of profits as dividends — a roll of the dice on a bank could prove profitable.Elena Shaftan, manager of Jupiter Emerging European Opportunities fund, says: ‘Sberbank has been my largest holding for the past ten years and is likely to be for another five. Although it has already returned more than 1,000 per cent over ten years to the end of June, it still remains an excellent investment.’FEAR FACTOR: 4/5BUYING OVERSEAS SHARESInvestors more often than not look only at investments from their home country, but spreading your wings further afield can help you find different types of company, wider opportunities and even better quality firms.The drawback is that you are exposing yourself to currency risk. Your profit or loss will not just depend on what happens to that company's share price, but also what happens to the relationship between the pound and the currency the shares are priced in. You may win or lose on this.Buying foreign shares is far easier and cheaper in the modern world of DIY investing platforms, but will invariably cost more than purchasing UK shares.If you do decide to target some overseas investments, this is one place where a fund, investment trust or tracker can pay off.
Rich pickings from shale gas miners Last week, Chancellor George Osborne proposed huge tax breaks for firms drilling for shale gas — a process known as fracking. This new resource could supply the UK with power for the next 40 years.Fracking involves sending a drill 10,000 ft into the earth to reach a thin layer of rock, called shale. Next, a pump shoots in millions of gallons of water, sand and chemicals to create small explosions. This splits the rock and releases gas, which travels to the surface via a special pipe. This can then be used to supply energy.Fracking is already big business in the U.S., where it has helped to halve the cost of gas, and is now being explored by India and China. So far, the only company with a permit to drill in the UK is Cuadrilla, which is privately-owned so you cannot buy shares. But British Gas has agreed to invest up to £160 million in exploration in the Lancashire area. French oil firm Total says it would also like to explore in Britain. One of the few fracking-related companies with shares you can buy is IGas Energy. It is listed on the Alternative Investment Market (AIM) for small start-ups. But there are huge risks. Drilling for shale must stop immediately if earthquake tremors larger than 0.5 magnitude are registered.Many have fears of fracking chemicals leaking into public water supplies, as well as swathes of the countryside turning into a wasteland. If this happens, whole operations could stop instantly.Patrick Connolly, an independent financial adviser at wealth manager Chase de Vere, says: ‘With only a handful of shares available to ordinary investors, this is to be approached with enormous caution. ‘Right now, at an exploratory stage, it is extremely risky to invest in small fracking firms.’ IGas Energy: Share prices, data and announcementsFEAR FACTOR: 2/5 Tussle at the top: BT is not just battling for the nation's phone lines and broadband, but has also signed up the rights to show top flight football.
Web TV could be the future The future of television viewing could well be online. The sight of aerials and satellite dishes hanging off our homes may soon be a thing of the past.One in three TV sets now being made can be connected to the internet — allowing you to watch programmes or surf the web.Film and box-set rental firms such as Netflix and LoveFilm have been booming, and most households have now got to grips with on-demand services such as BBC iPlayer.With this demand comes an increasing need for fast broadband — and the best way this can be delivered is by cable.In Europe, cable telecoms companies have been soaring — in terms of growth and share price rises — compared to their traditional phone rivals.In Germany, in the three years to May 2013, traditional telecoms firm Deutsche Telekom’s share price had barely moved while Kabel’s had more than doubled. It’s a similar tale in France with firms such as Iliad, and Ziggo in the Netherlands, racing ahead of rivals France Telecom and KPN respectively.However, the disparity won’t always be so big. For instance, in the UK while Virgin Media was once the king of cable, firms such as BT now offer an alternative.John Karadis, telecoms analyst at Oriel Securities, says: ‘The big names are rolling out their own fibre-optic cable. ‘And while you can argue there’s a strong case for backing cable companies, you also have to ask yourself if there’s going to be a need for such fast speeds and data use.’ BT shares: Prices, data and announcementsFEAR FACTOR: 1/5
SHARE PUNT OF THE WEEK: Premium drinks maker Distil Exotic and risky bets that can beat Footsie: Are you brave enough to take a punt on frontier markets? | [
{
"key": "website_description",
"type": "global",
"value": "This website is the website of the Daily Mail, a newspaper in the United Kingdom, and of its sister paper The Mail on Sunday. MailOnline is a division of dmg media, which is owned by Daily Mail and General Trust plc."
}
] |
Marvel Universe X-force 3 Pack | eBay Skip to main contenteBayShop bycategoryEnter your search keywordAll Categories Advanced or register':' style="margin-right:3px">Hi, #USER#!'.replace(/#USER#/,a))+"")}catch(b){document.write("")}})();Hi, (Sign in to bid or buy)Daily DealsSellCustomer SupportMy eBayExpand My eBayNotifications
Marvel Universe X-force 3 Pack
View all Marvel Universe X-force
Marvel Universe x Force Pack
Marvel Universe X-force Wolverine
Marvel Universe x Force Warpath
Marvel Universe Future Foundation
Marvel Universe Classic Avengers
Marvel Universe Warpath
Marvel Universe 3 Pack
Promoted item:Marvel Universe X-Force 3 Pack Deadpool Wolverine Warpath
Marvel Universe X-Force 3 Pack Deadpool Wolverine Warpath
For sale is Marvel Universe X-Force 3 pack including Deadpool, Wolverine, and Warpath. Item is brand new in packaging and in good condition.
Seller id ohyuppie Seller feedback score 99% Positive Feedback
ohyuppie (163
Marvel Universe X-Force (3) Pack - never opened
You are bidding on a Marvel Universe Three Pack featuring X-Factor. Set includes Deadpool, Wolverine and Warpath all in their gray and black X-Factor uniforms. Package has never been opened. 6d 3h 4m left
Warpath from Marvel Universe X-Force 3 pack
TALE OF THE TAPE:From HASBRO'S MARVEL UNIVERSE LINE. Loose figures are an excellent way to grow or complete your collection and they are a super value compared to their carded counterparts. 12d 14h 56m left
Warpath X-Force 3 Pack Marvel Universe 3 3/4" Figure 3.75" w/ Knife
Up for sale is a Warpath Series 2 #003 Marvel Universe Figure. He only comes with his knife. This will make a great display piece or figure to play with. The figure measures approximately 3 3/4" tall.
Marvel Universe 3 Pack X-Force Wolverine Loose
Item Description: Up for auction is marvel Universe Xforce Wolverine from 3 pack. Very hard to find, complete and mint. How long do i have to pay for my item(s)? If payment is not received, i will fil...
Marvel Universe Deadpool Complete 3.75 Figure X-Force 3 Pack Black & Grey Suit
Loose Figure. Loose Figure. Check out our Store for more Toys. Click here to get eBay image hosting at Auctiva.com. The item will come with a Customs Number. So you can track where the item is, once i...
Marvel Universe 3 Pack - X Force - Deadpool Warpath Wolverine
Marvel Universe 3 Pack - X Force - Deadpool Warpath Wolverine - Sealed, never opened - Package is in excellent condition - Pictures are of actual item you will receive - If you require a more detailed...
MARVEL UNIVERSE 3-PACK X FORCE DEADPOOL, WOLVERINE, WARPATH Deadpool - wolvorine - warpath. - new - factory sealed - mint -
marvel universe x-men x-force warpath from 3 pack 19d 11h 47m left
Marvel Universe 3.75" X-Force 3 Pack Wolverine Deadpool Warpath MISB
From the very popular Marvel Universe 3.75 line, figure is sealed on card. Please see pics for a better look, thank you. All figures come from smoke free home. 6d 12h 24m left
Buy It Now MARVEL UNIVERSE LEGENDS 2012 SDCC EXCLUSIVE UNCANNY X-FORCE 3-PACK SEALED NICE!!
This listing is for one (1) 2012 MARVEL UNIVERSE LEGENDS SAN DIEGO COMIC CON INTERNATIONAL EXCLUSIVE UNCANNY X-FORCE The Fall Of Archangel 3-pack figures by Hasbro Toys. Set includes 6-inch Archangel,...
Marvel Universe WARPATH (X-Force 3 Pack) 100% Complete! X-Men!
Item Description: Up for auction is Marvel Universe Warpath 3 Pack Version. Very hard to find, complete and mint. How long do i have to pay for my item(s)? If payment is not received, i will file a no...
Marvel Universe Warpath "X-Force 3-Pack" ~ Complete
Up for sale is a loose Marvel Universe Warpath "X-Force 3-Pack" figure. He comes complete with both knives. Warpath is in excellent condition with tight joints and no play wear. 29d 5h 59m left
Marvel Universe WOLVERINE x-force complete x-men boxed 3 pack 4 gray black suit
Marvel Universe 2011 DEADPOOL gray black x-force suit 3 4 multi pack complete
DEADPOOL in x-force suit. CLICK HERE for nearly the ENTIRE "MARVEL UNIVERSE" line of figures and. Hasbro MARVEL UNIVERSE. Combined shipping costs for the USA:3.95 for as many figures you purchase . 5d 14h 48m left
Marvel Universe Wolverine "X-Force 3-Pack" ~ 100% Complete
Up for sale is a loose Marvel Universe Wolverine "X-Force 3-Pack" figure. He comes complete with all accessories. Wolverine is in excellent condition with tight joints and no paint wear. 22d 9h 40m left
Marvel Universe Battles X FORCE Deadpool,Warpath,Wolverine 3 Figure Pack IN HAND
"Marvel Universe 3 Figure Packs" All figures will be Packed Very Well!!!! *In Hand Now * We Ship World Wide. In the usa. "up for auction" *mint condition / factory sealed box*
Marvel Universe 3 Pack X-Force Deadpool Wolverine Warpath Mint Unopened
A Marvel Universe 3 pack of X-Force figures that contains Deadpool, Wolverine, and Warpath in their X-Force costumes. Package is unopened and in perfect shape.
MARVEL UNIVERSE X-FORCE TRIPLE PACK,DEADPOOL,WOLVERINE,WARPATH 3 3/4 FIGURES
MARVEL UNIVERSE MARVEL UNIVERSE X-FORCE TRIPLE PACK,DEADPOOL,WOLVERINE,WARPATH 3 3/4 FIGURES 3 3/4 FIGURES Figure is mint in its original packaging Visit my Store Batcave Treasures for new items liste...
Marvel Universe 3 3/4" X-Force WOLVERINE Action Figure LOOSE Complete 3 Pack
Marvel Universe X-FORCE Team Pack Deadpool, Wolverine, Warpath 3 3/4"
Deadpool Figure 9d 15h 0m left
Marvel Universe 2011 WARPATH x-force 3 pack multi #760
15d 16h 14m left
Hasbro Marvel Universe 3-pack - WOLVERINE. DEADPOOL, and WARPATH -Team X- Force
Marvel Universe WARPATH x-force complete gray grey black suit boxed 3 4 pack
Marvel Universe 2011 WARPATH grey black x-force suit compelte x-men 4 3 pack pak
This page was last updated: Mar-17 04:57. Number of bids and bid amounts may be slightly out of date. See each listing for international shipping options and costs. | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational e-commerce corporation based in San Jose, California, that facilitates consumer-to-consumer and business-to-consumer sales through its website."
}
] |
World Map of Y-DNA Haplogroups [3000×1800] : MapPornjump to contentmy subredditsannouncementsArtAskRedditaskscienceawwblogbookscreepydataisbeautifulDIYDocumentariesEarthPornexplainlikeimfiveFitnessfoodfunnyFuturologygadgetsgamingGetMotivatedgifshistoryIAmAInternetIsBeautifulJokesLifeProTipslistentothismildlyinterestingmoviesMusicnewsnosleepnottheonionOldSchoolCoolpersonalfinancephilosophyphotoshopbattlespicsscienceShowerthoughtsspacesportstelevisiontifutodayilearnedTwoXChromosomesUpliftingNewsvideosworldnewsWritingPromptsedit subscriptionsfront-all-random | gadgets-sports-gaming-pics-worldnews-videos-AskReddit-aww-Music-funny-news-movies-books-history-food-philosophy-television-Jokes-Art-DIY-space-Documentaries-Fitness-askscience-nottheonion-todayilearned-personalfinance-gifs-listentothis-IAmA-TwoXChromosomes-creepy-nosleep-GetMotivated-WritingPrompts-LifeProTips-EarthPorn-explainlikeimfive-Showerthoughts-Futurology-photoshopbattles-mildlyinteresting-dataisbeautiful-tifu-OldSchoolCool-UpliftingNews-InternetIsBeautiful-sciencemore » MapPorncommentsrelatedother discussions (6)want to join? sign in or create an account in seconds|Englishlimit my search to /r/MapPornuse the following search parameters to narrow your results:subreddit:subredditfind submissions in "subreddit"author:usernamefind submissions by "username"site:example.comfind submissions from "example.com"url:textsearch for "text" in urlselftext:textsearch for "text" in self post contentsself:yes (or self:no)include (or exclude) self postsnsfw:yes (or nsfw:no)include (or exclude) results marked as NSFWe.g. subreddit:aww site:imgur.com dogsee the search faq for details.advanced search: by author, subreddit...this post was submitted on 04 Feb 2014775 points (93% upvoted)shortlink: remember mereset passwordloginSubmit a new linkMapPornsubscribeunsubscribe224,628 readers454 users here nowSFWPORN NETWORK
created by Petrarch1603a community for 3 yearsmessage the moderatorsMODERATORSPetrarch1603jaxspiderJaraxokjoneslolPornOverlordsoupyhandskreiusgreatyellowsharkagentlame...and 8 more »774775776World Map of Y-DNA Haplogroups [3000×1800] (upload.wikimedia.org)submitted 1 year ago by tedliptak170 commentssharecancelsorry, this has been archived and can no longer be voted onloading...sorted by: besttopnewhotcontroversialoldrandomq&ayou are viewing a single comment's thread.view the rest of the comments →[–][deleted] 17 points18 points19 points 1 year ago (4 children)sorry, this has been archived and can no longer be voted onThat is what I was getting at with "blue admixture."
permalinkembedparent[–]concretepigeon 3 points4 points5 points 1 year ago (0 children)sorry, this has been archived and can no longer be voted onYeah I thought you were, just trying to clear it up in my head.
permalinkembedparent[–]offensive_noises 0 points1 point2 points 1 year ago (2 children)sorry, this has been archived and can no longer be voted onA lot of Afro-Americans their skin is lighter than most West Africans. Is that also due to white/native American admixture?
permalinkembedparent[–][deleted] 0 points1 point2 points 1 year ago (1 child)sorry, this has been archived and can no longer be voted onAfrican Americans are on average 20% White. I know that 20% is not a possible amount for an individual to be, but the average one is.
permalinkembedparentaboutblogaboutteamsource codeadvertisejobshelpsite rulesFAQwikireddiquettetransparencycontact usapps & toolsAlien Blue iOS appreddit AMA appmobile betabuttons<3reddit goldreddit storeredditgiftsreddit.tvradio redditUse of this site constitutes acceptance of our User Agreement and Privacy Policy. © 2015 reddit inc. All rights reserved.REDDIT and the ALIEN Logo are registered trademarks of reddit inc.create a new accountusername:password:verify password:email: (optional)remember meget the best of reddit emailed to you once a week. learn morecreate accountsign inusername:password:remember mereset passwordsign inWe care about your privacy, and we never spam. By creating an account, you agree to reddit's User Agreement and Privacy Policy. We're proud of them, and you should read them.English [en]العربية [ar]Беларуская мова [be]български език [bg]Bosanski [bs]català [ca]česky [cs]dansk [da]Deutsch [de]Ελληνικά [el]English (Australia) [en-au]English (Canadian) [en-ca]English (Great Britain) [en-gb]English [en-us]Esperanto [eo]español [es]español [es-ar]eesti keel [et]Euskara [eu]فارسی [fa]suomi [fi]français [fr]Gàidhlig [gd]עברית [he]मानक हिन्दी [hi]hrvatski [hr]Magyar [hu]Հայերեն լեզու [hy]Bahasa Indonesia [id]íslenska [is] (*)italiano (Italy) [it]日本語 [ja]ಕನ್ನಡ [kn_IN]한국어 [ko]Latin [la]1337 [leet]LOL [lol]lietuvių kalba [lt]latviešu valoda [lv]Nederlands [nl]Nynorsk [nn]Norsk [no]Arrrrrrrr! [pir]polski [pl]português [pt] (*)português [pt-pt]português brasileiro [pt_BR]română [ro]русский [ru]slovenčina [sk]slovenščina [sl]српски језик [sr]Srpski [sr-la]Svenska [sv]தமிழ் [ta]ภาษาไทย [th]Türkçe [tr]українська мова [uk]Tiếng Việt [vi]中文 [zh] (*) incomplete volunteer to translateπ Rendered by PID 14338 on app-69 at 2015-05-04 06:37:27.178240+00:00 running f2e002a country code: US. | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American social news aggregation, web content rating, and discussion website. Registered members submit content to the site such as links, text posts, images, and videos, which are then voted up or down by other members."
}
] |
Download My PDF and Then Take A Quick Look Through My Virtual Selling System With The Largest Collection Of Internet Marketing Video Tutorials Available Online.
"The Virtual Selling System Provides You With Easy To Follow Checklists and Videos That Reveal The Fast Way Around The Obstacles That Have Been Holding You Back"
It's a complete archive of all the video courses, screen captures, training sessions, teleclasses and written material I've created. These are the same tactics, strategies and processes that I use to run my business today.
It's designed specifically for
... organized into complete step-by-step courses that guide you along the way.
...that are available for immediate viewing so you have private access to all of this easy to learn and easy to act on information.
Plus the special "Hub and Spoke" marketing videos that guide you step-by-step through the entire system. It's easy to succeed when everything you need to do is in one place and has been broken up into easy to use sections. Internet Marketing Can Be Easy To Learn!
Today the Internet Marketing Videos Library Contains Over 1000 Multimedia Training Sessions - Covering EVERY Aspect of Marketing Your Small Business Online.
You get full access the whiteboard, audio and screen capture sessions from Every Single One Of My Standalone Courses: I've included a complete list of the first 42 courses below, but here's a quick peek at some of the course titles: Get Ranked First On Google, 52 Products In 52 Days, Multimedia E-books, 52 Secrets My Mom Never Told Me About Internet Marketing, Joint Venture Traffic Secrets, List Building Secrets, Face To Face Selling, Selling For Entrepreneurs, and new topics like; MiniCourse Profits, Auto Responder Sequences, Screen Capture Profits.... plus much more.
Internet Marketing Video Library by James Maduk
Internet Marketing Video LibraryNotes area Contents My Internet Marketing Video Library..........................................13 Everything You Need… all in One Place!...........................13 **Special Note For MySmallBiz Marketing Clients and Customers**........................................................................14 Earn Money Giving Away Copies:......................................14 Getting The Most Out of This Book........................................14 Do things right the first time!..............................................15 Disclaimer.....................................................................................16 Video Library Details...................................................................17 MoneySpokes Course Details.......................................................18 Video: Stop Working Start Earning..........................................19 Video: Complete Your Opportunity Research.........................20 Video: Setup Your Online Business.........................................21 Video: Install Your Sales Engine.............................................22 Video: Easy Product Creator....................................................23 Video: Multiple Streams Of Traffic.........................................24 Video: Automatic List Building...............................................25 Video: Dripped Messages........................................................26 Video: Sales And Conversion Secrets......................................27 Video: The Biggest Marketing Secret......................................28 52 Secrets Course Detail!.............................................................30 Pick The Right Niche Course Details...........................................35 The Key...............................................................................36 Video: Pick The Right Niche! .................................................40 Video: A Niche Is Never Enough! ..........................................41 Video: Avoid This Niche Marketing Mistake..........................42 Video: 10 Characteristics of a Great Niche! ...........................43 Video: The Real Reason To Niche Market! ............................44 Video: Easy Ways To Find Good Niche Markets ...................45 Research Resources & Tools...............................................45 Video: Verify Your Niche Before You Start ............................50 Video: WordTracker Tips and Tricks ......................................51 Video: Verify Your Market - Before You Start! ......................52 Video: Advertising Rates and Market Potential ......................53 Video: Alexa Rankings = AQuick Shortcut ............................54 Video: How Much Competition Will You Have? ...................55 2
Chapter - Video: Hidden Treasure In Every Niche Market ....................56 Notes area Video: The Biggest Niche Secret.............................................57 Video: Explode Your Sales With Niches .................................58 Video: 9 Steps to A Create A Profitable Niche! ......................59 Video: Niche Marketing Resources My eBook ..................60 Video: Create Keyword Rich Domain Names! .......................61Web Hosting Course Details.........................................................64 Video: Your Hosting Control Panel cPanel..............................66 Video: Getting Around cPanel................................................67 Video: Add New Domains.......................................................68 Video: DNS Settings For New Domains.................................69 Video: How to Transfer Sites...................................................70 Video: Introduction to FileZilla...............................................71 Video: Install and Check Your Frontpage Extensions.............72 Video: How To Upload A Site By FTP....................................73 Video: Point 2 Domain Names to 1 Web Site..........................74 Video: Redirects Protect Your Affiliate Links.........................75 Video: Sub-Domains For Deep Affiliate Links........................76 Video: How To Get Rid of eMail Spam...................................77 Video: Send The Same Email To Multiple Recipients.............78 Video: Access to Your mySQL Databases...............................79 Video: Adjust Your Mailbox Sizes To Stop Bounces...............80 Video: Setting Up Your Email Accounts..................................81 Video: Protect Web Folders From Being Browsed..................82 Video: Fantastico Installed Applications.................................83 Video: The Basics of Hosting And FTP...................................84 Video: GoDaddy Domains and MySmallBiz Hosting.............85Blogging Secrets Course Details..................................................88 Why is A Blog So Important to Your Business…?.............88 Applying My Blogging Secrets Will: .................................89 Video: Sell More In Less Time................................................93 Video: What is a Blog?............................................................94 Audio: How Blogs Fit Into Your Marketing............................95 TeleClass 1..........................................................................95 TeleClass 2..........................................................................95 Bonus Blogging Interview from JV Alert...........................96 Video: Why Blogging for Marketers?......................................97 Video: 4 Ways To Earn Money With Blog!.............................98 Video: Blogging and Three Stages of Trust.............................99 3
Internet Marketing Video LibraryNotes area Start A Blog In Under 10 Minutes.........................................100 Video: Steps For Great Blog Posts!.......................................101 Video: Different Persuasive Posting Strategies.....................101 Video: Make It Big Marketing With Your Blog.....................102 Video: Step by Step BloggingGame Plan..............................103 Video: Be A Blogging Celebrity............................................104 Video: RSS Magic..................................................................105 Video: Ping Your Way to More Web Traffic..........................106 Video: Tons Of Traffic With This Technique.........................107 Video: Get Listed On Yahoo For Free ..................................108 Video: Use Blogs to Find JV Partners ..................................109 Video: RSS vs. Direct 2 Desktop Marketing.........................110 Video: Avoid Blog Spam........................................................112 Video: Install and Use an RSS Reader...................................113 Video: Subscribe To RSS Feeds.............................................114 Video: Start A Free Blog At MySmallBizPress......................115 Video: Blogging Goes Multimedia........................................116 Video: Market Your Business with PodCasts.........................117 WordPress Mastery Course Details............................................119 Video: WordPress Mastery.....................................................120 Video: 30 Second WordPress Install......................................121 Video: WordPress Admin Login............................................122 Video: Put an End To Comment Spam..................................123 Video: Change the Name Of Your Blog.................................124 Video: WordPress Admin Dashboard Tour............................125 Video: Posts and Pages Explained.........................................126 Video: WordPress Pages Revealed.........................................127 Video: Create Menus..............................................................128 Video: Control The Page Ordering........................................129 Video: Quick Edits for Pages.................................................130 Video: Controlling User Profiles...........................................131 Video: Add Web Links...........................................................132 Video: Organize Your Links Into Categories.........................133 Video: Admin Tricks You Can Use With Lists......................134 Video: Create A Custom Header............................................135 Video: Install and Activate New Themes...............................136 Video: Setup and Configure Your New Theme......................137 Video: Use Page Templates....................................................138 Video: Widgets For Your Blog...............................................139 4
Chapter - Video: Plugin New Features .................................................140 Notes area Video: Monetize Your Blog with Adsense.............................141 Video: PlugIns Everyone Should Install................................142 Video: How To Use The Media Library................................143 Additional Resources.............................................................144 Add Your Site....................................................................144 Free Software....................................................................144 Forums...............................................................................144 Cool Google Tool Sites.....................................................144 Check Your Link Popularity..............................................144 Newsletters:.......................................................................145 Other Cool Resource Sites................................................145 Live Search Results...........................................................146Membership Site Secrets Course Details....................................147 Video: How MySmallBizU Was Originally Setup.................150 Video: Easy Membership Sites Introduction ........................151 Video: Today Is The Time for Membership Sites .................152 Video: Get Your Membership Site Setup ..............................153 Video: Harness The Power of Content ..................................154 Video: Finding The Right Target Member ............................155 Video: How To Promote Your Membership Site ..................156 Video: Live Tour Of A Working Membership Site ...............157 Video: WordPress vs. Joomla Membership Site ...................158 Video: Joomla, Community Builder and Amember ..............159My First Site Course Details.......................................................160 Video: Front Page Logins......................................................161 Video: Start With A Template...............................................162 Video: Open Your Template...................................................163 Video: Publish Your Site In Seconds.....................................164 Video: Update Your Live Site................................................165 Video: Page Names and Navigation......................................166 Video: Sales Pages With Tables.............................................167 Video: Add Pictures and Graphics.........................................168 Video: Domains Names Available?........................................169 Video: Adding A Popup Window...........................................170 Video: Install The Popup........................................................171 Video: Search Engine Friendly Pages....................................172 Video: Adding Audio To Pages..............................................173 Video: Clickbank Affiliate Links...........................................174 5
Internet Marketing Video LibraryNotes area Video: Buy Now Links..........................................................175 Video: Adding A PayPal Button.............................................176 Video: Clickbank To Sales Pages...........................................177 Video: How To Hide Pages and Folders................................178 Video: Meta Tags and Page Properties...................................179 Video: Choose The Host........................................................180 Video: Using cPanel...............................................................181 Video: Web Forms..................................................................182 Video: Updating Existing Forms...........................................183 Video: Get A Quick Start.......................................................184 Joint Venture Traffic Course Details...........................................186 Guarantee Traffic and New Customers With Simple No Cost… JOINT VENTURES!............................................186 What Youll Learn..............................................................189 Video: If You Dont Have Your Own Traffic.........................191 Video: What is a Joint Venture? How Does It Work?............193 Video: Set Up Your Business So That You Can Use JVs......194 Video: Give Me One Good Reason.......................................195 Video: What Are The Different Types Of JVs?.....................196 Video: How To Structure Every Joint Venture.......................197 Video: How/Who Should You Approach?.............................198 Video: How To Approach Potential JV Partners....................199 Video: Your Joint Venture Checklist!.....................................200 Video: Joint Venture Trends...................................................201 Start A Newsletter Course Details..............................................202 Get Ranked First On Google Course..........................................205 Video: The Real Way To Get Ranked 1st...............................206 Video: Find Out How Well You Know Your Customers........207 Video: How Google Decides To Rank You............................208 Video:How To Use and Present Content................................209 Video: Page Rank and Linking Strategies.............................210 Video: Google Gates A Search Magnet..................................211 Video: Organize Your Google Gates......................................212 Video: Create A Theme Map..................................................213 Video: A “Site Mesh” Ties Your Sites Together.....................214 Video: Advanced Linking Strategies.....................................215 Video: Tempted By Quick Fixes?..........................................216 Video: Get Ready To Rank....................................................217 Video: Watch The Google Dance...........................................218 6
Chapter - Video: Boost Your Rankings With Sub Domains..................219 Notes area Video: Useless Google Tricks................................................220 Video: The Right Reasons To Rank.......................................221 Video: Advanced Site Mesh Topics.......................................222 Video: Fastest Way To Get Sites Indexed..............................223 Video: Spoon Feed Google....................................................224 Video: The Worst Way To Get Ranked..................................225 Video: Rank 1st Locally.........................................................226 Video: Googles Golden Triangle...........................................227 Additional Resources.............................................................228 Add Your Site....................................................................228 Free Software....................................................................228 Forums...............................................................................228 Cool Google Tool Sites.....................................................228 Check Your Link Popularity..............................................228 Newsletters:.......................................................................229 Other Cool Resource Sites................................................229 Live Search Results...........................................................230Pay-Per-Click Course Details.....................................................231 Instant Targeted Traffic – For A Price...............................231 What Youll Learn..............................................................234 Video: What is Pay Per Click Advertising?...........................236 Video: The Advantages of PPC..............................................237 Video: Avoid the Hidden Danger of PPC...............................238 Video: The Main PPC Network.............................................239 Video: Secondary PPC for Niche Marketers.........................240 Video: Key PPC Uses for Marketers.....................................241 Video: Signup For Google Adwords?....................................242 Video: How To Use Google Adwords....................................243 Video: How To Create Your First PPC Campaign.................244 Video: How to Write Your First PPC Ad...............................245 Video: PPC Ad Copy Limitations..........................................246 Video: PPC Ad Scores...........................................................247 Video: Gauge Your Traffic with PPC Estimates....................248 Video: PPC Keyword Match Types.......................................249 Video: Why PPC Negative Keywords Work.........................250 Video: Set Your PPC Budgets and Bids.................................251 Video: Organize PPC Spending With Ad Groups..................252 Video: Understanding PPC Content Networks......................253 7
Internet Marketing Video LibraryNotes area Video: How To Track PPC Conversions................................254 Video: PPC Campaign Tweaks..............................................255 Video: Are Your Customers Ready To Buy?..........................256 Video: How To Write Killer Ads............................................257 Video: When To Use Other PPC Networks...........................258 Video: PPC Traffic Wrap Up.................................................259 Twitter Traffic Course Details....................................................260 Video: Twitter Traffic.............................................................261 Video: Add OOMPH To Your Tweets....................................262 Video: AutoFeed Your Twitter Account.................................263 Video: Auto Tweet with Twitterfeed......................................264 Video: Automate Finding People to Follow...........................265 Video: Twitter Traffic System Tips........................................266 Additional Resources.............................................................267 Twitter Backgrounds.........................................................267 Follow Me Buttons............................................................267 Mobile Social Media Marketing Course.....................................268 Video: Mobile Social Media Marketing Revealed.................269 Video: Social Media Marketing Mistakes..............................270 Video: Mobile Social Media Secrets......................................271 Video: Mobile Social Media Activities..................................272 Video: Mobile Social Media Marketing Apps.......................273 Video: Mobile Social Media Marketing Blogs......................274 Video: Mobile Social Media Distribution..............................275 Video: Microsoft Live Services and Network.......................276 Video: Google Tools and Social Network..............................277 Video: Mobile Marketing With Facebook.............................278 Video: Mobile Micro-Blogging With Twitter........................279 Video: Mobile Marketers Get LinkedIN................................280 Video: YouTube Is A Search Engine......................................281 Video: Check-In For Real Time Mobile Marketing Profits...282 Video: Skype The Next Best Thing To Being There.............283 Video: Do You Have Any Klout?...........................................284 Video: BIG Traffic With Scribd.............................................285 Video: Share Your Slides For Traffic.....................................286 Video: MindMap Persuasion..................................................287 Video: Mobile Marketing Other Peoples Content.................288 Video: Stopping Mobile Social Media Overwhelm...............289 Video: Where Social Media Began........................................290 8
Chapter - Video: 10 Key Mobile Social Media Strategies.....................291 Notes area Video: 4 Rinse & Repeat Steps..............................................293Integrated Marketing Secrets Course..........................................29452 Products in 52 Days Course Details......................................296 Create an Info Product Every Day!...................................296 Video: Create 52 Products in 52 Days ..................................300 Video: Create A Library Of Digital Assets............................301 Video: Leverage Multimedia.................................................302 Video: Free Tools and Low-Cost Resources..........................303 Video: Simple Multimedia Ebook Products..........................304 Video: Create Products With Events......................................305 Video: Putting It All Together................................................306 Video: Should You Be Using Multimedia?............................307 Video: Bonus Multimedia Ebooks.........................................308 Multimedia Resources...........................................................309 Hardware...........................................................................309 Commercial Software........................................................309Screen Capture Secrets Course Details.......................................310 Video: Capture Edit and Sell your Screen Captures..............311 Video: Record Screens With Camtasia Recorder...................312 Video: Screen Size and Output Formats................................313 Video: Annotate and Edit Screen Your Captures ..................314 Video: Add Professional Menu’s...........................................315Multimedia eBooks Course Details............................................317 Having Your Own Multimedia Ebooks Means.. ..............317 Multimedia eBooks Generate Huge Profits .....................318 In summary, here is what you get: ....................................320 Video: Author & Profit Multimedia eBooks .........................321 Video: What Are Different Audio Formats............................322 Video: Which Media Format Is Best......................................323 Video: What Your Customers Need.......................................324 Video: What Is Streaming?....................................................325 Video: Privacy Issues.............................................................326 Video: Overcoming Viewer Technical Issues........................327 Video: Start With This Free Software?..................................328 Video: Creation Multimedia on Autopilot.............................329 Video: Video Distribution Secrets..........................................330 Video: A Step-by-Step Quick Start Guide.............................331 Video: What Content Works Best..........................................332 9
Internet Marketing Video LibraryNotes area Video: Create Instant Products With A Phone.......................333 Edit Your Media Files For Free..............................................334 Video: Make Your Files Tiny.................................................335 Video: What Is A Codec?.......................................................336 Video: Embed Your Files In Your Ebook...............................337 Video: Protect Your Multimedia............................................338 Video: Where To Store Your Media Files..............................339 Video: Profit With Multimedia eBooks.................................340 Video: Avoid These 4 Multimedia Traps...............................341 Video: Storage Questions You Should Ask............................342 Video: Multimedia Trends.....................................................343 Build My List Course Details.....................................................345 A word of Warning............................................................352 Video: Introduction to Build My List....................................354 Video: Some Basic Assumptions...........................................355 Video: List Building Homework............................................356 Video: Why People Give You Their Email............................357 Video: What Type of List Should You Have?........................358 Video: Introducing the List Matrix!.......................................359 Video: The Magic Quadrant of List Building........................360 Video: Designing Your List Matrix........................................361 Video: Implementing Your Tactics.........................................362 Video: Things to Avoid..........................................................363 Video: List Building Action Steps.........................................364 Video: Common List Building Questions .............................365 How Do I Convert My List Into Cash...............................365 How do I get Through Spam Filters?................................365 How Do I Get Started Collecting Email Addresses?.........366 Can you give me some examples of good email capture pages?................................................................................367 Minicourse Profits Course Details..............................................368 Video: How To Profit With Mini-Courses.............................369 Video: Grow Your Business With Mini-Courses...................370 Video: Minicourse Trust Builder...........................................371 Video: Trust For Online Sales................................................372 Video: Increase Opt-ins..........................................................374 Sales Page Secrets.......................................................................375 Speed Selling Course Details! ...................................................378 What The Speed Selling E-book Covers….......................381 10
Chapter - Video: An Introduction To Persuasion For Entrepreneurs.....383 Notes area Video: Understanding Why People Really Buy ....................384 Video: Expose Your Customers Decision Scale....................385 Video: Influence Tools...........................................................386 Video: Simple Non Manipulative Sales Process....................387 Video: Attention Grabbers For Stubborn Prospects...............388 Video: Easy To Ask Questions...............................................389 Video: Compelled To Buy......................................................390 Video: Close Sales Without Asking.......................................391 Video: This Glue Cements Any Sale......................................392 Video: The SPEED Selling Checklist....................................393Customer Blueprinting Course Details.......................................394 Video:Read Your Customers Like A Book............................399 Video: Personality Types Explained......................................400 Video: The Selling Matrix......................................................401 Video: Personality Stereotyping Traps...................................402 Video: Create Your Own Customer Blueprint.......................403Handle Any Objection Course....................................................404 Video: Set The Stage – Steps 1 Thru 5..................................406 Video: Convert The Objection...............................................407 Video: Wrapping Up Sales Objections..................................408 Video: Objection or Stall?......................................................409 Video: Cold Calling Secrets (MP3 File)................................410Sell In Tough Markets Course Details .......................................411 Video: How To Sell In Tough Times......................................413Selling to Big Business Course Details......................................415 Video: Architect? – Every Big Sale Has One!......................417 Video: Gain Access To The Architect!...................................419 Video: Persuade and Influence The Architect!......................420How to Build A Lead Factory Course!.......................................421 Video: How To How To Build A Lead Factory......................422 Video: Automating Your Timing and Touches.......................426Goal Setting and Achieving........................................................428Free Bonus Downloads...............................................................431Video Library..............................................................................432 11
Internet Marketing Video LibraryNotes area My Internet Marketing Video Library Hi, I’m James Maduk and since 1996 I’ve been earning a living by selling Information Products and Professional Services online. The step by step process that I created to run my Online Business gives me a new found personal freedom and lifestyle that I’d like to share with you. Do you want to learn the same techniques I use to create profit pulling web sites and enjoy the free time and extra cash that comes with owning a successful web business? • How To Set Up Your Online Business The Right Way – When You Start • How To Create, Publish and Sell Information Products Online • How To Generate A Steady Stream Of Targeted Web Traffic From Your Online and Offline Marketing • How To Write Compelling Web Copy That Turns Browsers Into Buyers • Plus Links To All The Tools and Resources You Need To Succeed Everything You Need… all in One Place! The Internet Marketing Video Library – is packed with the information, resources, services and tools that any Independent Professional or Service business needs to sell online. Learn today from over 1000 training Videos, Live TeleClasses and Webinars. Get Started Today Whether your company is a one person show or part of a growing corporation, All of my materials include relevant, easy to follow tips, tricks, secrets and techniques that will help you profit online. Learn from my 20 years of sales and marketing experience, the 1000 training videos I’ve created, the 42 e-books I’ve written or the articles that I write for magazines like Entrepreneur, Small Business, and Small Office – Home Office.The video links are password protected; you’ll need to create a user-name and password before viewing the multimedia tutorials. 12
Chapter -My Internet Marketing Video LibraryCreate Your Username and Password - Click The Get Started Link! Notes areaIf you have already purchased a copy of “Internet Marketing VideoLIbrary” and this is a new release for you, your existing user-name andpassword will allow you login and view the videos.**Special Note For MySmallBiz Marketing Clients and Customers**If you are a current MySmallBiz Marketing client with an activeWebHosting, AutoResponder or MySmallBiz Show account, YOU CANUSE YOUR EXISTING EMAIL ADDRESS AND PASSWORD TO LOGINEarn Money Giving Away Copies:You earn a 50% Commission when you distribute all of my InternetMarketing Video Library Ebooks. Give Away Copies Of This Book toEarn A 50% CommissionGetting The Most Out of This BookRead listen/watch every page. Skipping over sections is the same astrying to bake a cake without using all of the ingredients.WARNING: Don’t start implementing the ideas in this multimedia ebookuntil you go through the entire program once. Doing so guarantees thatsome of the work that you do will be a waste of your time and perhapsmoney. While it can take time to get really great at recognizingpersonality types and selling more with less effort, it has been myexperience that doing things right the first time will pay big dividends inthe both the short and long term. 13
Internet Marketing Video LibraryNotes area Do things right the first time! 1. Don’t skip any of the chapters. * 2. Listen to all of the multimedia sessions – that’s where the meat is! 3. Do The Work! REMEMBER: If I haven’t answered a question that you need answered in this version of the “Internet Marketing Video Library” e-book join the live teleclasses and webinars at MySmallBizU.com! This ebook is really a “Multimedia E-book”. When you start the first lesson, you’ll know what I mean. You need to be online to access the audio/video content and additional resources each book contains. Every book includes hours of multimedia content. Each lesson has up to three choices: Screen Capture, Whiteboard and Audio or Audio Only. I teach each lesson in a Virtual Classroom format, which means you literally join me in front of a whiteboard at a live seminar. Watch as I visually diagram out strategies. Listen, as I provide a complete explanation and key points in full detail. It’s exactly the same as being in the room with me. Send your questions to me via the forum at http://www.msmallbizu.com/ and I’ll add it to the next release. Anyone who buys the “Internet Marketing Video Library” multimedia e-book gets lifetime updates! If you have any trouble with the user-name and password please visit the support desk at MySmallBizU Support. 14
Chapter -Disclaimer Notes areaDisclaimerThis Book has been purchased from James Maduk or an affiliate ofJames Maduk and MySmallBizAffiliates.If you purchase a recommended product or purchase access to thevideos contained in this multimedia ebook the affiliate may make acommission on you purchase for access to the video tutorialsYou are free to distribute this multimedia ebook, in fact I encourage it!The publisher nor author assumes any responsibility for errors,omissions or interpretation of the use of the subject matter contained.This multimedia ebook contains the opinions and ideas of the authorand is intended for informational purposes only.Neither the author nor publisher shall be held liable for any loss or otherdamages resulting from this publication.This ebook is the result of over 20 years as a speaker, trainer, authorand 23 years of sales trial and error.I’ve made every attempt to include the most current and up to date salesinformation. I’m relaying the most current published information and myexperience.While the text may remain static, I update the whiteboard and audioportion of this multimedia e-book on a continuing basis.You can earn a steady referral fee by giving away copies of this bookusing your affiliate ID. 15
Internet Marketing Video LibraryNotes area Video Library Details Learn The Overlooked Marketing Process Removes the largest roadblock to online Success, plus learn how simple it can be to replace your full-time income selling digital products and services online. Its not hard to see that now is the best time to catapult your business to unprecedented heights. Dont let your competitors beat you to it, or they could use this simple process to run you out of business. So Lets Get Started! - Unlock The Videos: 16
Chapter -MoneySpokes Course Details Notes areaMoneySpokes Course DetailsLearn How To Earn Money Without A JobRemoves the largest roadblockto online Success, plus learnhow simple it can be to replaceyour full-time income sellingdigital products and servicesonline.Its not hard to see that now isthe best time to catapult yourbusiness to unprecedentedheights. Dont let yourcompetitors beat you to it, orthey could use this simpleprocess to run you out ofbusiness. So Lets Get Started On The Next Page! 17
Internet Marketing Video LibraryNotes area Video: Stop Working Start Earning Running Time: 30 Minutes Description: Dont miss this video. Its a short form beginners version of the Hub and Spoke Marketing Process designed specifically for someone who is just starting out. Youll learn how all 10 steps fit together and starting an online business a reality. Before you viewing this video PLEASE make sure to download the interactive Earn Money Without A Job process MindMap using the link below. The video relates specifically to the images and ideas found in the MindMap. Downloads: • Download The Process Mind Map More MySmallBiz Marketing Resources: • MySmallBizMarketing.com – Everything You Need! • MySmallBizHosting.com - $10 Web Hosting • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – BroadCast Your Own Live Show • MySmallBizUniversity.com – Live Coaching Software Resources: • Rapid Action Profits • Digital Access Pass • Amember 18
Chapter -MoneySpokes Course Details Notes areaVideo: Complete Your Opportunity ResearchRunning Time: 30 MinutesDescription: Dont miss this video. Its a short form beginners versionof the Hub and Spoke Marketing Process designed specifically forsomeone who is just starting out. Youll learn how all 10 steps fittogether and starting an online business a realityDownloads: • Download The Research MapMore MySmallBiz Marketing Resources: • MySmallBizMarketing.com – Everything You Need! • MySmallBizHosting.com - $10 Web Hosting • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – BroadCast Your Own Live Show • MySmallBizUniversity.com – Live CoachingSoftware Resources: • Rapid Action Profits • Digital Access Pass • Amember 19
Internet Marketing Video LibraryNotes area Video: Setup Your Online Business Running Time: 30 Minutes Description: Running a business online doesnt mean that you can do it for free. Youll have to spend a bit of money to get setup - specifically for your RAP software and some basic tools. This video walks you thru the exact tools that you need to start earning money online. Map Downloads: • Download The Business Setup Map More MySmallBiz Marketing Resources: • MySmallBizMarketing.com – Everything You Need! • MySmallBizHosting.com - $10 Web Hosting • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – BroadCast Your Own Live Show • MySmallBizUniversity.com – Live Coaching Software Resources: • Rapid Action Profits • Digital Access Pass • Amember 20
Chapter -MoneySpokes Course Details Notes areaVideo: Install Your Sales EngineRunning Time: 30 MinutesDescription: The RAP software (Rapid Action Profits) is the glue thatholds this entire system together. Set it up and configure it properlywith the settings that I reveal in this video and youll have the engine thatgives you the time to NOT WORK!Make sure to download a copy of the Rapid Action Profits Software!Downloads: • Download The Web Sites MapMore MySmallBiz Marketing Resources: • MySmallBizMarketing.com – Everything You Need! • MySmallBizHosting.com - $10 Web Hosting • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – BroadCast Your Own Live Show • MySmallBizUniversity.com – Live CoachingSoftware Resources: • Rapid Action Profits • Digital Access Pass • Amember 21
Internet Marketing Video LibraryNotes area Video: Easy Product Creator Running Time: 30 Minutes Description: Forget what you may have heard! You need your own products - or ones that you can call your own"! Find out why and how to create them in this powerful video tutorial Downloads: • Download The Products Map More MySmallBiz Marketing Resources: • MySmallBizMarketing.com – Everything You Need! • MySmallBizHosting.com - $10 Web Hosting • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – BroadCast Your Own Live Show • MySmallBizUniversity.com – Live Coaching Software Resources: • Rapid Action Profits • Digital Access Pass • Amember 22
Chapter -MoneySpokes Course Details Notes areaVideo: Multiple Streams Of TrafficRunning Time: 30 MinutesDescription: List building doesnt have to be hard. List building doesnthave to be hit and miss. List building is something that happens whenyou have your business setup the right way.List building is something you have to do if you setup your business thewrong way. Watch this video for details.Downloads: • Download The Traffic MapMore MySmallBiz Marketing Resources: • MySmallBizMarketing.com – Everything You Need! • MySmallBizHosting.com - $10 Web Hosting • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – BroadCast Your Own Live Show • MySmallBizUniversity.com – Live CoachingSoftware Resources: • Rapid Action Profits • Digital Access Pass • Amember 23
Internet Marketing Video LibraryNotes area Video: Automatic List Building Running Time: 30 Minutes Description: Your contact list is another Digital Asset. Like any asset it has to be managed properly. Find out how in this video. Downloads: • Download The Contacts Map More MySmallBiz Marketing Resources: • MySmallBizMarketing.com – Everything You Need! • MySmallBizHosting.com - $10 Web Hosting • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – BroadCast Your Own Live Show • MySmallBizUniversity.com – Live Coaching Software Resources: • Rapid Action Profits • Digital Access Pass • Amember 24
Chapter -MoneySpokes Course Details Notes areaVideo: Dripped MessagesRunning Time: 30 MinutesDescription: You dont have to do the work when you leveragesoftware. RAP and MySmallBizMail makes things easy.Downloads: • Download The Drip Marketing MapMore MySmallBiz Marketing Resources: • MySmallBizMarketing.com – Everything You Need! • MySmallBizHosting.com - $10 Web Hosting • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – BroadCast Your Own Live Show • MySmallBizUniversity.com – Live CoachingSoftware Resources: • Rapid Action Profits • Digital Access Pass • Amember 25
Internet Marketing Video LibraryNotes area Video: Sales And Conversion Secrets Running Time: 30 Minutes Description: Find out how your virtual salesperson works online. Learn the secrets of online selling, persuasion and tracking your results in this video. Downloads: • Download The Conversion Map More MySmallBiz Marketing Resources: • MySmallBizMarketing.com – Everything You Need! • MySmallBizHosting.com - $10 Web Hosting • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – BroadCast Your Own Live Show • MySmallBizUniversity.com – Live Coaching 26
Chapter -MoneySpokes Course Details Notes areaVideo: The Biggest Marketing SecretRunning Time: 30 MinutesDescription: Dont forget this aspect of your sales game. Real powercomes from understanding the hidden power of YOU.Downloads: • Download The A MoneySpokes Secret MapMore MySmallBiz Marketing Resources: • MySmallBizMarketing.com – Everything You Need! • MySmallBizHosting.com - $10 Web Hosting • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – BroadCast Your Own Live Show • MySmallBizUniversity.com – Live Coaching 27
Internet Marketing Video LibraryNotes area 28
Chapter -52 Secrets Course Detail! Notes area52 Secrets Course Detail!If you are a small business owner trying tofind out how to earn money online, you aregoing to need something. Good Luck!Do you believe me?Do a search on Amazon.com for “InternetMarketing for Small Business”. You will findsix titles with one remotely close to beingon target. Why did I look? Frankly, I wasembarrassed. As a sales trainer andprofessional speaker I have been a studentof selling for 20 years and until recentlyhave not been able to generate anyrevenue with my online efforts.This book outlines the steps that I have researched, tried and testedover the last 6years. I have subscribed to, purchased, interviewed andtested the ideas that top Internet marketers, small business owners justlike you, are using today to earn more than a living online. I have takenthose steps and mapped out a process that will work for any smallbusiness.They work for me, a small business owner, and they will work for you.Why for the Small Business Owner?Because the small business owner has finally wrestled control awayfrom an IT department, we are no longer waiting a month or two forsimple changes to show up on our websites. The creative geniusesdon’t want us to muck up their fancy interface and snazzy graphics.Whoever is ultimately responsible for generating revenues from thewebsite has the control! If this is not the case in your small business,the time is now. Ask yourself a simple question, “If your website were asalesperson, would you fire it?”When businesses really started getting involved with websites it was theinformation technologists who ruled the roost. Technical gurus worriedabout web servers, bandwidth, firewalls, feeds and speeds andexpensive software solutions to manage all the data and the hardwareand software was the mantra of the technical gurus. We need javaserver pages, and big databases to take care of this flood, let’s build arobust technical solution that makes it easy for us to manage. The“sales and marketing types’ were just happy to have a site.Companies reasoned that the robust technical infrastructure and alogical presentation of all the information would give the smart and well- 29
Internet Marketing Video LibraryNotes area educated buyers all they needed to make an informed decision. Larger companies sunk tons of money into preparing for the windfall of traffic and sales. You may have heard a saying in the high tech industry, “if we build it they will come”. With the advancing technologies came the web designers with cool implementations of bleeding edge graphics and design. Every site turned into an attempt to do something bigger and better than the competition. Flash animations, landing pages, complex navigation hierarchy and a highly graphical interface became the rage. A company was often judged by the “look and feel” of its site, not by the value that it provided. People in the marketing department finally had a say in what happened on the website, except it took a month before they saw anything change. Then it took a creative artist and the technical department to manage the site. We all know what happened for most Internet businesses that followed the standard evolution. • They raised a ton of money. • They hired or contracted out a big technical firm or web development shop to build a really cool site. • Next, they made sure that the infrastructure was prepared to handle the avalanche of money that would flow from the site. The companies that did not learn fast enough are gone. The ones that did make it got big enough to turn into a big business with traditional big business advertising and marketing budgets. And then there are the small businesses. They do not have the money to sink into large advertising budgets. They do not want to give outside experts control over part of their business. They are willing to experiment continually until they find what works and they have a passion for what they do. What You Will Need Forget about “Build it and they will come”! I wrote this book for the small business owners who want to earn money with their websites. They want their online businesses to be a vital part of how they sell and market their products and services. Good Looks vs. Good Results I am asking you to make a decision right off the bat. You can pay to have a site that looks good and does not sell, or you can follow the steps in this program, create, and manage a website that earns you money. 30
Chapter -52 Secrets Course Detail!The first time I went to see a motivational speaker he talked at great Notes arealength about how some people choose pleasing methods over pleasingresults. If you have a goal of earning money with your website thenfollow the steps. If you are more interested in looking good and beingon the bleeding edge of technology then this program is not for you.Internet marketing is the process of carefully testing the market withmeasured-results strategies until it “clicks” and makes a nice profit.When you have the right strategies for your business, you simplyduplicate the process over and over and over.Think of it as fishing. You try different “bait” until the fish start biting likecrazy. Then you stick with what you know is working. At that point, it isup to you to decide how many times you want to cast your line.Most web developers do not want the sites that they create for you to bemeasured by sales results. Can you imagine that? A web developmentand graphic artist wants to win awards for “art” – they created with yourtime and money – that may or may not sell anything. If you thinkotherwise ask one if they would accept payment through the proceedsof the website sales.Internet marketing for small business is meant to be effective. It is notdesigned to win artistic awards. It is simply created to work as your“virtual salesperson” and make you rich. So the approach that we’ll learnin this book is more like this: Build it, then publish valuable informationabout your area of expertise, send specially formatted e-mail and sellyour products and services online.Your InvestmentSelling online requires an investment on your part.You have to be comfortable around a computer. In fact, I am going tosuggest that you learn how to alter and manage your own websites.You have to invest a little bit of your money. There are some costsinvolved. Internet marketing is not free. However, it can be inexpensiveto start and maintain. We will look at great ways for you to leveragewhat you already know and do, and convert that valuable informationinto customers.You have to invest some of your time. Your website will work 24 hours aday 7 days a week, yet that doesn’t mean you have to spend that muchtime with it. Recognize that the more time you do spend, the faster youlearn what works for your business.Let’s Clear Up Some Misconceptions First • You have to be technically competent: You do not have to be a technical guru to create, alter and manage your own websites. If you can write a letter with a word processor, you can design 31
Internet Marketing Video LibraryNotes area and manage your own websites. • Everyone is getting rich online: Not everyone is getting rich with Internet marketing. In fact, the opposite is true, especially if you try to follow the footsteps of the big businesses you surf and read about. There is a special Internet marketing process. The business’ that are actually earning money online use it and that is what we’ll cover. • You need a web designer to create websites: I have heard it thousands of times. Create a sticky, interactive site to build community and a relationship with your visitors. Make sure the site is interactive. Build a brand and then customers will come to your e-commerce catalog and order online. Rubbish! All you need is a simple, clean content-rich site that captures e-mail addresses and search engines. • All you have to do to sell online is become a member of one of those “Small Business e-commerce Malls”: Your ISP has a large portal with a small business marketplace. As part of your monthly Internet access fee, they give you a free e- commerce enabled spot in the mall. Do not join the mall. The only ones who are making money with online malls are the mall owners. Joining a virtual marketplace with other small business is a no-no. Not only will you be billed for the privilege, not all the traffic that is promised to be in the mall is going to end up in your shop. Do not waste your time or your money. These are just some of the ideas that we will cover over the next 68 mp3 files. Remember everything that follows is something that I am using in my business or have personally tested. Will it work for you? Yes! It’s a process that can be duplicated and works for sure. Every small business that I looked at used the same steps. How each business implemented the steps was different. That part is up to you. I will provide you with the tools but it is up to you if you want to use them. 32
Chapter -52 Secrets Course Detail! Notes area I Want Lifetime Access To Your Internet Marketing Video Library""Instead of a purchasing each courseindividually (and having to purchase anynew courses that are added) you can nowhave a Lifetime Internet Marketing VideoLibrary Membership.This means that a single, one time paymentof just $197 gives you instant access toevery course today and in the future!Your MySmallBiz Marketing MembershipIncludes: • Immediate Access To All Existing Marketing Tutorials = 1000+ Audio/Video/Screen Captures • Instant Access To ANY NEW Marketing Tutorials Added • A Free MySmallBiz University Campus Pass!Remember....Its REAL TRAINING: You are joining me in a real classroomenvironment online.Learn From A PROFESSIONAL: Ive been selling online full-time since2000.You Wont Find Training Like This ANYWHERE ELSE: Try and findsomeone else training in a Virtual Classroom like I am - but dont wastetoo much timeIve got Proven Killer CONTENT: Youll find everything you need tosucceed online here.Its a Complete System: MySmallbiz Marketing support includs Hosting,Email Autoresponders, Tracking, Coaching, Community! 33
Internet Marketing Video LibraryNotes area Pick The Right Niche Course Details Never-Before-Seen, step-by-step videos taken in my "home office" show you exactly how to research, quantify and then verify a profitable niche market for your business The number one reason online marketers fail is because they didnt take the time to select a profitable niche - BEFORE THEY START TO MARKET THEIR ONLINE BUSINESS. How do I know? Because I Made The Same Mistake! I was even foolish enough to make the same mistake more than once. Now the very first question that I ask when Im coaching other small business owners is: "Have you found, quantified and verified a profitable niche?" It took me a while but after 120 profitable web sites in a variety of profitable niche markets Im in a position to show you a fool proof way to … Overcome the #1 Reason Most Internet Marketers Fail I think the real reason so many new online marketers are struggling is that they rush through the most important part of the marketing process. In fact they actually go about getting ready to start marketing online the wrong way. Following the masses and using a traditional approach to your online business guarantees only one thing – failure. Im assuming youre online for a reason. Perhaps youve read about other success stories and you want to get in on the action so you can get your piece of the pie... Wouldnt it be great If you knew exactly what to sell and that youd be able to sell it... • ... before you commit to hosting a website! • ... before you commit to buying a domain name and creating a website! • ... before you commit to paying a copywriter to create a compelling sales page! • ... before you commit to paying for solo ads or setting up an 34
Chapter -Pick The Right Niche Course Details affiliate program! Notes area • ... before you commit to spending a fortune on resale rights on a product that you dont own!You get the picture?And lets be honest, you might have already done all of these things butcant seem to get things right. The fact is - If you dont know how find theright kind of profitable niche youll spend more than money, you end upwasting your most valuable commodity - YOUR PERSONAL TIME.On the other hand, some online marketers have followed a system thatlets them do things the right way, the first time.How can you tell?Its easy. Find someone who has a network of profitable sites thatcovers a particular theme or market and youll have found someone thatis using a "marketing system". They dont leave the most importantwork to chance, they know how much theyll earn BEFORE they do allthe work.The Key Finding A Profitable Niche Before You Start Marketing Online Is The Key To Any Online Marketing SystemWhat ever your situation is, having a hungry crowd of ready to buycustomers asking for your help is what picking the right niche is allabout. And who wouldnt want to find out if you were going to besuccessful before you did all the hard and expensive work.Wouldnt that be great!The bad news is that the major stumbling block remains "doing yourhomework first".You know you NEED a profitable niche, but you dont know how to getstarted - the right way.And the reason its still a stumbling block is the lack of organizedinformation. Until now no one has put together a comprehensive systemthat SHOWED YOU HOW to find, quantify and then verify your marketthe right way in the first place.Im going to remove that last roadblock for YOU right now...How Would You Like To Get an "Online Selling Expert" with 120 WebSites Under His Belt To Show You Exactly How He Decide Whether orNot Hes Going To Enter A Market?My name is James Maduk. With 120 web sites in my online business 35
Internet Marketing Video LibraryNotes area networks and 20 years of sales and marketing experience, Ive been helping folks just like you start and grow Internet businesses since 1997. Ive created over 800 video training products that help tens of thousands of customer’s worldwide do just what you want to do. I dont say any of that to brag, but rather to let you know that I am very familiar with what it takes to setup and grow an Internet business. This "niche market" idea really is the missing link for most internet marketers. I mean, you simply cannot sell online without knowing WHO is spending money on what first. Since I usually try and add a new web site and product to my online business each week, I decided that I was going to put together a course that video taped the process I use to find, quantify and then verify a market before I get started with any of the traditional marketing activities. Better yet Id narrate the video as I went along, so you would get all of your questions answered while I was doing what I was talking about. If someone watched the videos there would be no excuse for not having found a profitable niche market for themselves. I didnt want to go half way either. I wanted the videos so complete that there was no possible way someone could say they couldnt do the same thing after watching the videos. And because Ive already done this hundreds of times, Im in a position to show you exactly how to do it yourself. Id be answering your questions for you ... before you even asked them. Who wouldnt want to watch those videos? If you were trying to build your first web site they would be extremely helpful, right? So I completed over 4 hours of video - to show you exactly how to find a profitable niche! Everything you need to know in order to find the niche market thats right for you is SHOWN in step-by-step format. Things like... • How To Create a Profitable Niche in Nine Simple Steps • The Difference Between A Niche Market And A Profitable Niche. • How To Make Your Competition Disappear. • How To Attract Paying Customers In Droves. • How Playing To Your Strengths Increases revenue, profits, and Productivity. 36
Chapter -Pick The Right Niche Course Details • How To Have Your Business Perceived As "The Only Solution" Notes area To Their Problem. • How To Develop Essential Passive Recurring Income From a Small But Deep Niche. • How To Create A Web Business That I Fad Proof. • How To Develop Client Loyalty, Return Business, and a Steady Stream Of Generous Referrals.Better yet, you get free updates to the course (over 4 hours of tutorialsare available today). This means that each time I add a video that walksyou through every step of the process you get immediate access to it.Its The Best Way I Know How To Save YourselfMonths of Time and Avoid Costly MistakesAfter my first couple of web site disasters I only wish these videos hadbeen around when I was starting out. It was costing me an arm and aleg to create web sites that werent selling a thing! (I spent $3500 fornavigation buttons and a header for my first web site in 1996!)These videos would have saved me many long nights of frustrationtrying to figure it out on my own!I didnt have the choice when I started. I was stuck having to learneverything by "trial and error" ... but you dont!When you learn how to find the right niche market with the "StartMarketing Online" video tutorials... • Save your most valuable asset - months of time! Ive already spent that time for you. learn from my mistakes. Theres no need for you to spend the same time trying to figure out all of the steps Ive already taken to get things going online. Learn from my experience with a detailed, step-by-step training course that walks you through EVERY LOGICAL step from beginning to end. • $$$$ Avoid costly mistakes! Dont miss out! Why risk making mistakes that force you to start all over again (or worse yet, spend more money) when you can have an expert who has done this dozens of times show you how to get it done right the first time? • You can watch instead of read! Why read another e-book that "tells" you how to do it -- and then youve still got to figure out how to do what youve been told! -- when you can watch someone show you exactly how to take action and get your business up and running today? 37
Internet Marketing Video LibraryNotes area • You can learn at your own pace! With these videos you can pause them, rewind them, fast forward them, jump to whatever step you want, anytime you want! It really is the ultimate way to learn. Heres the thing: No matter what youve been told, finding the right market to sell to isnt optional. If you want a successful online business you MUST follow these action steps. If youre going to Start Marketing Online, you might as well do it the right way now instead of learning the hard way later. Unlock the videos and watch them as many times as you want. Thats right, you cant wear them out so watch them as often as you like, and build as many web sites as you like. And if you arent completely satisfied after 30 days of using these easy to follow videos, simply email me and Ill promptly refund your entire purchase amount. No hard feelings!. I am so confident that these videos will teach you exactly what you want to know about finding the right niche market for your business, that Ill give you a full 30 days to decide for yourself. So, register your email address and you can be viewing these videos in a matter of minutes... Its not hard to see that now is the best time to catapult your business to unprecedented heights. Dont let your competitors beat you to it, or they could use Pick The Right Niche to run you out of business. So Lets Get Started! 38
Chapter -Pick The Right Niche Course Details Notes areaVideo: Pick The Right Niche!Duration: 14 MinutesDescription: Still struggling with this "niche" thing? Do you have abunch of keywords picked out but still arent sure that youve got awinner? Do you want to make sure that the business that youve pickedhas the right kind of customer to make it a success?Heres the outline of the Start Marketing Online Course. Learn how topick the right Niche market - before you invest too much.Other MySmallBiz Resources: • MySmallBizUniversity.com – Live Classes and Webinars • MySmallBizHosting.com - $10 Web Hosting • MySmallBiz Domains – Cheap Domain Names • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – Internet Radio • MySmallBizisMobile.com – Take The Mobile Marketing Test • MySmallBizVideos.com – 1000 Video Tutorials 39
Internet Marketing Video LibraryNotes area Video: A Niche Is Never Enough! Duration: 15 Minutes Description: A Niche Is Never Enough To Succeed! Marketing profitably online is like a coin, you have to have both sides. On One Side We Have The Market: People who have a specific want and need for a particular information, product, or service and are willing to pay repeatedly for it. This is the part of Niche Marketing that most small business should owners focus on. Often its hard though, when it seems you have to exclude other parts of your business that you may enjoy or feel that you have to continue to market to existing customers. What about the other side? Is there another side of the coin? Do you need more than one kind of market to be successful online? Is a single niche market enough? In dont think so! Find out why in this video. Other MySmallBiz Resources: • MySmallBizUniversity.com – Live Classes and Webinars • MySmallBizHosting.com - $10 Web Hosting • MySmallBiz Domains – Cheap Domain Names • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – Internet Radio • MySmallBizisMobile.com – Take The Mobile Marketing Test • MySmallBizVideos.com – 1000 Video Tutorial 40
Chapter -Pick The Right Niche Course Details Notes areaVideo: Avoid This Niche Marketing MistakeDuration: 13 Minute Whiteboard SessionDescription: Im convinced niche marketing is often a waste of time!Let me explain. Im a big fan of niche markets, Im continually on thelookout for profitable niches that include what I call the MISSINGINGREDIENT.It seems that everyone is talking about niche markets. Proponents ofniche marketing tell you to find a market with hungry buyers and nocompetition. Theyll even show you how to use free tools to researchpotential markets and find a business model that meets the nichecriteria.But theres a big problem with this standard approach. Unfortunately, theproblem doesnt show up until after youve committed to marketingto the profitable niche you have discovered.Theres a lot more to a successful business than finding a profitableniche. Find out what I mean in this 13 minute training session.Other MySmallBiz Resources: • MySmallBizUniversity.com – Live Classes and Webinars • MySmallBizHosting.com - $10 Web Hosting • MySmallBiz Domains – Cheap Domain Names • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – Internet Radio • MySmallBizisMobile.com – Take The Mobile Marketing Test • MySmallBizVideos.com – 1000 Video Tutorials 41
Internet Marketing Video LibraryNotes area Video: 10 Characteristics of a Great Niche! Duration: 30 Minutes Format: Whiteboard and Audio Description: Still struggling with this "niche" thing? Do you have a bunch of keywords picked out but still arent sure that youve got a winner? Do you want to make sure that the business that youve picked has the right kind of customer to make it a success? Then watch this video where I go over the 10 Characteristics of a great niche market. Once youve watched this make sure to use the Niche Marketing tools and resources Ive included for you. This saves you time and money up front and in the long run. Other MySmallBiz Resources: • MySmallBizUniversity.com – Live Classes and Webinars • MySmallBizHosting.com - $10 Web Hosting • MySmallBiz Domains – Cheap Domain Names • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – Internet Radio • MySmallBizisMobile.com – Take The Mobile Marketing Test • MySmallBizVideos.com – 1000 Video Tutorials 42
Chapter -Pick The Right Niche Course Details Notes areaVideo: The Real Reason To Niche Market!Running Time: 12 MinutesDescription: Niche marketing has to be the most hyped and poorlyimplemented internet business strategy ever invented. Everyone istalking about with good reason - it works!The problem is that most marketers take a short term view of the "NicheMarketing" strategy.Watch the video and youll find yourself thinking differently about yourmarkets and your business.Other MySmallBiz Resources: • MySmallBizUniversity.com – Live Classes and Webinars • MySmallBizHosting.com - $10 Web Hosting • MySmallBiz Domains – Cheap Domain Names • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – Internet Radio • MySmallBizisMobile.com – Take The Mobile Marketing Test • MySmallBizVideos.com – 1000 Video Tutorials 43
Internet Marketing Video LibraryNotes area Video: Easy Ways To Find Good Niche Markets Running Time: 17 Minutes Description: I hear it all the time... Im not creative, Im not an expert, I dont know where to find a good niche! Give me a break! Profitable niches are all over - they even let you know when they are profitable. If you know what to look for. Watch this video and learn the places I go to find PROFITABLE niches. This is the first part of the process, getting some markets staked out. Great ideas are staring you right in the face at the grocery checkout, the book store, the magazine rack even TV. Keep youre notepad handy, you have to start doing your homework if you want to win. Research Resources & Tools Free Keyword Tools • Google Adwords Keyword Tool https://adwords.google.com/select/KeywordToolExternal • Webmaster Toolkit Keyword Research Tool http://www.webmaster-toolkit.com/keyword-research-tool.shtml • SEO 20/20 => http://www.seo2020.com/seo-tools/keyword- research/keyword-research-tool/ • WordTracker FREE Keyword Tool => http://freekeywords.wordtracker.com/ • Digital Point => http://www.digitalpoint.com/tools/suggestion/ • Nichebot Classic => http://www.nichebotclassic.com/ • DomainCountry Keyword Tool => http://www.domaincountry.com/ • NicheTaxi 44
Chapter -Pick The Right Niche Course Details => http://www.nichetaxi.com/ Notes area • WordPot => http://www.wordpot.com/ • Freeaddlink => http://freeaddlink.com/domain/research.php2. Trends • Google Trends => http://www.google.com/trends • TrendWatching => http://www.trendwatching.com/trends/3. Directories • Open Directory Project => http://www.dmoz.org/ • Yahoo Directory => http://dir.yahoo.com/4. Ideas Generator • Google Suggest => http://www.google.com/webhp?complete=1&hl=en • Lycos Movers and Shakers => http://50.lycos.com/ • Alexa Top 500 Movers and Shakers => http://alexa.com/site/ds/top_sites?ts_mode=global〈=none • Amazon Bestsellers => http://amazon.com/gp/bestsellers/books • WikiSuccess => http://www.wikisuccess.org/wiki/Main_Page • Barnes and Nobles BestSellers => http://www.barnesandnoble.com/gateway/bestsellers.asp? z=y • 43 Things => http://www.43things.com/ • Squidoo Top Lenses 45
Internet Marketing Video LibraryNotes area => http://www.squidoo.com/browse/top_lenses • Magazine.com => http://www.magazines.com/ncom/mag?redirect=1 • Ebay Pulse => http://pulse.ebay.com/ • Shopping.com Top Searches => http://www10.shopping.com/top_searches • Yahoo Recreational Hobbies => http://dir.yahoo.com/recreation/hobbies • Google Groups => http://groups.google.com/ • Yahoo Groups => http://groups.yahoo.com/ • Google Blogsearch => http://blogsearch.google.com/ • BlogCatalog => http://www.blogcatalog.com/ • Google Catalogs => http://catalogs.google.com/ • Yahoo Buzz Index => http://buzz.yahoo.com/ • Technorati Top Searches => http://www.technorati.com/ • Thesauraus, Dictionary, and Encyclopedia => http://thesauraus.reference.com/ 5. Affiliate Programs • AzoogleAds => http://www.azoogleads.com/corp/index.php • Joe Bucks => http://www.joebucks.com/ • MoreNiche => http://www.moreniche.com/ • ClickBank Marketplace => https://www.clickbank.com/marketplace.htm? s=&method=Sort&c=65&keywords=# 46
Chapter -Pick The Right Niche Course Details • PayDotCom Notes area => http://www.paydotcom.com/homepage.php • FreeIQ => http://beta.freeiq.com/index.dhtml?a=1 • Associate Programs => http://www.associateprograms.com/ • LifeTimeCommissions => http://www.lifetimecommissions.com/ • 2 Tier => http://2-tier.com/ • Affiliate Directory => http://www.affiliatesdirectory.com/ • 5 Star Affiliate Program => http://www.5staraffiliateprograms.com/ •6. “How To” and Self Help • eHow => http://www.ehow.com/ • WikiHow => http://www.wikihow.com/Main-Page • AnswerBag => http://www.answerbag.com/ • How Stuff Works => http://www.howstuffworks.com/ • So You Wanna? => http://www.soyouwanna.com/ • About.com => http://www.about.com/ • Yedda => http://yedda.com/ • Yahoo Answers => http://answers.yahoo.com/ • Tips and Answers => http://www.tipsanswers.com/ • 47
Internet Marketing Video LibraryNotes area 7. Article Directories • EzineArticles => http://ezinearticles.com/ • iSnare => http://www.isnare.com/ • Associated Content => http://www.associatedcontent.com/ • SearchWarp => http://searchwarp.com/ • Article Dashboard => http://www.articledashboard.com/ • GoArticles => http://www.goarticles.com/ • ArticleBase => http://www.articlesbase.com/ • MySmallBiz Articles => http://www.MySmallBizArticles.com/ • ArticleCity => http://www.articlecity.com/ 48
Chapter -Pick The Right Niche Course Details Notes areaVideo: Verify Your Niche Before You StartDuration:15 Minute Video Screen CaptureDescription: This is an older tool that isn’t available any longer howeverthe principals explained in the tool still apply.Niche Marketing Homework - It always pays to do your homework!Watch this video for detailed instructions on how to use theOverture.com Search Term Suggestion Tool. ( Yahoo no longer supportsthis tool)Why?Because theres nothing worse than doing a bunch of work for nothing.Find a hungry market first and then sell them what they are willing tobuy for the price they are willing to pay. This tool gives you the researchinformation you need as you start to build your online business.Other MySmallBiz Resources: • MySmallBizUniversity.com – Live Classes and Webinars • MySmallBizHosting.com - $10 Web Hosting • MySmallBiz Domains – Cheap Domain Names • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – Internet Radio • MySmallBizisMobile.com – Take The Mobile Marketing Test • MySmallBizVideos.com – 1000 Video Tutorials 49
Internet Marketing Video LibraryNotes area Video: WordTracker Tips and Tricks Duration:11 Minute Video Screen Capture Description: WordTracker keyword help Sometimes its hard to come up with all the words, phrases and related names associated with the market that you are considering. Thats why its a great idea to run through the 4 step WordTracker process. Ive included the link to the site below. Other MySmallBiz Resources: • MySmallBizUniversity.com – Live Classes and Webinars • MySmallBizHosting.com - $10 Web Hosting • MySmallBiz Domains – Cheap Domain Names • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – Internet Radio • MySmallBizisMobile.com – Take The Mobile Marketing Test • MySmallBizVideos.com – 1000 Video Tutorials 50
Chapter -Pick The Right Niche Course Details Notes areaVideo: Verify Your Market - Before You Start!Running Time: 12 MinutesDescription: How can you tell if a market exists - without entering themarket?Look for clues.Without actually doing all the work of preparing and then entering aparticular market niche there is a simple way to get some feedbackabout the quality of the potential opportunity.Find out what are the other advertisers doing?Watch this screen capture and Ill show you a simple way to find outwhat advertisers are "saying today" to place ads in the niche that youare considering.Other MySmallBiz Resources: • MySmallBizUniversity.com – Live Classes and Webinars • MySmallBizHosting.com - $10 Web Hosting • MySmallBiz Domains – Cheap Domain Names • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – Internet Radio • MySmallBizisMobile.com – Take The Mobile Marketing Test • MySmallBizVideos.com – 1000 Video Tutorials 51
Internet Marketing Video LibraryNotes area Video: Advertising Rates and Market Potential Running Time: 6 Minutes Description: While Id like to guarantee you that a profitable market exists - before you get into it - I cant. What I can do though is give you some guidelines. Some averages that apply to most markets. If you remember from the screen capture above, some advertisers can get crazy when it comes to paying for new customers. Remember the mortgage company thats paying $11. for every click! Watch the video and Ill give you a quick checklist to follow. Youll have three options Pass - Market is too small Go - Market has potential Pass - Too much competition Heres the simple rule to remember: "Under 50 - Over 2" Other MySmallBiz Resources: • MySmallBizUniversity.com – Live Classes and Webinars • MySmallBizHosting.com - $10 Web Hosting • MySmallBiz Domains – Cheap Domain Names • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – Internet Radio • MySmallBizisMobile.com – Take The Mobile Marketing Test • MySmallBizVideos.com – 1000 Video Tutorials 52
Chapter -Pick The Right Niche Course Details Notes areaVideo: Alexa Rankings = AQuick ShortcutDuration: 15 MinutesDescription: If youve ever wondered what Alexa rankings really meant,watch this session. Recently purchased by Amazon and classified byspyware catching software as "spyware", many marketers rely on their"Alexa Rankings" as a measure of their success.Should you?Find out what they really mean and how you should use the AlexaToolbar and your sites Alex Ranking to improve your online business.Other MySmallBiz Resources: • MySmallBizUniversity.com – Live Classes and Webinars • MySmallBizHosting.com - $10 Web Hosting • MySmallBiz Domains – Cheap Domain Names • MySmallBizTracking.com - Live Web Site Tracking • MySmallBizMail.com – Our Email Marketing Service • MySmallBizShow.com – Internet Radio • MySmallBizisMobile.com – Take The Mobile Marketing Test • MySmallBizVideos.com – 1000 Video Tutorials 53 | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American hosting service, now owned by Scribd, for professional content including presentations, infographics, documents, and videos. Users can upload files privately or publicly in PowerPoint, Word, PDF, or OpenDocument format."
}
] |
Patent US4820933 - Control circuit for liquid crystal rear-vision mirror - Google Patents
A circuit for controlling a liquid crystal rear-vision mirror is disclosed. The liquid crystal rear-vision mirror is equipped in an automobile to sense the amount of lights incident upon the mirror itself from a headlight of another automobile following behind. When the level of incident lights goes...http://www.google.com/patents/US4820933?utm_source=gb-gplus-sharePatent US4820933 - Control circuit for liquid crystal rear-vision mirror
Publication number US4820933 A
Application number US 07/139,736
Publication number 07139736, 139736, US 4820933 A, US 4820933A, US-A-4820933, US4820933 A, US4820933A
Inventors Suk-Kwon Hong, Ho-Yol Bang, Hyun-Jun Shin
Patent Citations (11), Referenced by (247), Classifications (10), Legal Events (4)
US 4820933 A
US4620322 * Dec 16, 1982 Nov 4, 1986 Andre M. Eggenschwiler Electro-optic welding lens assembly
US7427889 * Apr 28, 2006 Sep 23, 2008 Ememory Technology Inc. Voltage regulator outputting positive and negative voltages with the same offsets
US7806002 * Mar 25, 2008 Oct 5, 2010 Lear Corporation Capacitive sensing in an automotive mirror
US9397492 * Aug 1, 2011 Jul 19, 2016 Hottinger Baldwin Messtechnik Gmbh Protective circuit
US20070252640 * Apr 28, 2006 Nov 1, 2007 Yen-Tai Lin Voltage regulator outputting positive and negative voltages with the same offsets
U.S. Classification 307/10.1, 359/604, 349/195
International Classification B60R1/08, B60R1/04, G02F1/13, G02F1/133, G09G3/18 | [
{
"key": "website_description",
"type": "global",
"value": "This website is a search engine provided by Google. Handling over 3.5 billion searches per day, it has a 92% share of the global search engine market."
}
] |
Texas defensive coordinator Vance Bedford breaks down Cal - Cal - Scout
Taylor Estes Texas defensive coordinator Vance Bedford breaks down CalRyan Gorcey09/16/2016Texas defensive coordinator Vance Bedford previews Saturday's game at Cal.Read select takeaways and watch Bedford's press conference here.
Share on Facebook Share on TwitterTrending on ScoutEx-Auburn RB: Tow Saban's helicopter!Three-and-out: NFL’s best matchups of Week 14Big bowls: The hidden price of WSU successPac-12 Recruiting NotebookMensch MadnessBears Offer Aumavae's Protege Full StoryBearTerritory.net Top StoriesBearTerritory Gift Subscriptions Are Here!Give the gift that keeps on giving all year long: purchase an Annual BearTerritory.net gift membership plus one-year subscription to Sports Illustrated for just $69.95!by Ryan GorceyBearTerritory.netYesterday at 11:03 PMMensch MadnessCal will host Jewish Heritage Night on Saturday, and if there's anything that stands as a tenet to Jewish culture, it's family, and Bears point guard Sam Singer has found another…by Ryan GorceyBearTerritory.netYesterday at 10:30 AMBears Offer Aumavae's ProtegeCal offensive line coach Brandon Jones offered lifelong Bears fan Max Barth out of Stockton (Calif.) St. Mary's on Thursday.by Ryan GorceyBearTerritory.netThursday at 9:02 PMCal Baseball Schedule Has West Coast FlavorThe furthest Cal will travel this season will be Lubbock, Tex., as the Bears will face Pepperdine, Long Beach State and Gonzaga in non-conference play.by Ryan GorceyBearTerritory.netThursday at 5:06 PMTop 15 Pac-12 assistant coaching salariesIn a season where Cal had one of the worst defenses in the entire nation, Bears defensive coordinator Art Kaufman was one of the highest-paid assistants in the Pac-12.by StaffScout CFBThursday at 1:06 AMOne Visit Down, Four To Go For WacaserScottsdale (Ariz.) Saguaro three-star offensive tackle Jax Wacaser took his first official visit last weekend and is set to hit the road again Friday before the start of the dead…by Blair AnguloScout FootballWednesday at 10:00 PMThree Takeaways: Cal vs. Seton HallDespite a game-high 22 points from Jabari Bird, Cal can't find a rhythm in the second half, and falls to Seton Hall, 57-60.by Ryan GorceyBearTerritory.netWednesday at 6:16 PMScout 300 DB Sets Pac-12 visitBuena Park (Calif.) defensive back Elijah Gates will take his third official visit this weekend when he heads to the Northwest.by Greg BigginsScout FootballWednesday at 4:29 PMBrennan Jackson's First Offer is a Big OneTemecula (Calif.) Great Oak defensive end Brennan Jackson joined his friend Jack Lamb with a Cal offer on Tuesday, and the two have thought about playing together at the next level…by Ryan GorceyBearTerritory.netTuesday at 11:01 PMJhevon Hill Talks Cal OfferAfter scoring with two Ground Zero defensive backs in the last two recruiting cycles, Cal offered another in 2018 prospect Jhevon Hill.by Ryan GorceyBearTerritory.netTuesday at 9:04 PMGame Clips of 3-Star 2018 O-LinemanARLINGTON, Texas -- Scout provides game footage of 2018 offensive lineman Trey Stratford, a three-star prospect who could possibly play multiple spots at the next level.by Gabe BrooksScout FootballTuesday at 8:56 PMJack Lamb Scores First Pac-12 OfferCal offers the Southwest League's leading tackler in Temecula (Calif.) Great Oak linebacker Jack Lamb.by Ryan GorceyBearTerritory.netTuesday at 7:00 PMLoad More | [
{
"key": "website_description",
"type": "global",
"value": "This website is an integrated sports publishing company that produces Internet content covering hundreds of professional and college teams across America. The company was founded in 2001 and was acquired by Fox Sports in 2005."
}
] |
In Focus: Bobo, Dawgs Back to Practice - Georgia - Scout
In Focus: Bobo, Dawgs Back to PracticeDean Legge12/17/2014ATHENS - Dawg Post's photos of Georgia's bowl practice on December 17, 2014. Share on Facebook Share on TwitterTrending on ScoutWatch Zamir White Pick UGALegge's Thoughts: Zamir White Commits to UGA5-Star RB Zamir White Picks UGAGators are first time National ChampsWhat is UGA Getting in 5-Star RB Zamir White?Share & EmbedLegge's Thoughts: Zamir White Commits to UGA Full StoryDawg Post Top Stories2019 DL Rashad Cheney talks UGA recruiting:2019 DL Rashad Cheney explains why he committed to Georgiaby Matt DeBaryDawg PostYesterday at 1:43 PMBreaking NewsLegge's Thoughts: Zamir White Commits to UGAI’d go ahead and buckle that seat belt - things are about to take off.by Dean LeggeDawg PostMonday at 8:29 PMBreaking News5-Star RB Zamir White Picks UGALAURINBURG, NC - Zeus is loose and heading to Athens.by Dean LeggeDawg PostMonday at 7:33 PMBreaking NewsWhat is UGA Getting in 5-Star RB Zamir White?What are the Bulldogs getting in 5-star RB Zamir White?by Matt DeBaryDawg PostMonday at 7:00 PMWhat We Are HearingIt is an important week of recruiting at UGA, and we anticipate at least some good news this week.by Dean LeggeDawg PostSunday at 2:42 PMDawg Post Commitment Breakdown: Jaevon BectonDawg Post breaks down commitment Jeavon Becton and what it means for Georgia moving forward.by Matt DeBaryDawg PostSaturday at 12:59 PMJacob Eason Fulfills Lifelong DreamThibodaux, LA - This fulfilled one of UGA quarterback Jacob Eason’s lifelong dreams.by Dean LeggeDawg PostFriday at 6:26 PM2019 TE Plans Visit to Georgia:Dawg Post gives an update on recruiting in the state of Georgiaby Matt DeBaryDawg PostFriday at 8:14 AMThe Noise Surrounding Zamir WhiteLAURINBURG, NC - Every Friday in the fall, just before Scotland tees it up, Shanee White visits Scotland Bling to buy her outfit for the night.by Dean LeggeDawg Post06/17/2017Breaking NewsWatch Zamir White Pick UGALAURINBURG, N.C. - Zeus is loose and heading to Athens. Watch him commit here...by Dean LeggeDawg PostTuesday at 9:29 AMNo. 1 RB White ready to make callLaurinburg (N.C.) Scotland running back Zamir White will make his college commitment tomorrow.by Michael ClarkScout FootballMonday at 8:47 PM2019 DB Jordan Huff Talks Upcoming Visits:Morgan County (GA) defensive back Jordan Huff is a top 2019 prospect and spoke with Dawg Post about upcoming visits.by Matt DeBaryDawg PostMonday at 11:00 AMLoad More | [
{
"key": "website_description",
"type": "global",
"value": "This website is an integrated sports publishing company that produces Internet content covering hundreds of professional and college teams across America. The company was founded in 2001 and was acquired by Fox Sports in 2005."
}
] |
3 Exercise Books 10mm Squared 20 5cm x 16 5cm Blue | eBay Please enable JavaScript Our new search experience requires JavaScript to be enabled. Please enable JavaScript on your browser, then try again.
View: Gallery view 3 Exercise Books 10mm Squared 20 5cm x 16 5cm Blu: 3 Exercise Books 10mm Squared 20 5cm x 16 5cm Blue0 results. You may also like
3 Exercise Books - 5mm Squared, 20.5cm x 16.5cm (Yellow)
2 Exercise Books - 20cm x 16.5cm "Practice Counting" Books, 10mm Squared (Rhino)
3 Exercise Books - 10mm Squared, 20.5cm x 16.5cm (green)
+ £9.65 postage School Infant Exercise Books 10mm Squared Pack of 3
+ £9.65 postage 4 x A5 SCHOOL EXERCISE BOOKS (40 x "1cm squared" pages) top quality books
+ £12.06 postage 5 x A5 School Maths 20mm squared Exercise books assorted coloured cover 40 pages
+ £9.65 postage 5 x A5 - 10mm squared Exercise / Practice books assorted coloured cover 40 pages
+ £9.65 postage 10 x Maths exercise books. 15mm squared, 32 pages each
+ £15.20 postage 3 Exercise Books - A5, 5mm Squared (Orange)
+ £12.79 postage OXFORD EXERCISE BOOKS 4 TYPES TEACHING SUPPLIES/ SQUARED RULED BOOKS WRITING £1.49 to £74.99
School Exercise Squared Books Large 10mm Squares Green Pack of 3
Blue A4 maths exercise new book with 64 pages 5mm squared paper JOBLOT 25 Books
+ £9.65 postage Exercise books! 10mm SQUARED. 80 page! MATHS! School/Office/Work!
+ £9.65 postage 3 Hamelin Maths Exercise Books 1cm squared 80 pages A5 (229x178mm)
+ £9.65 postage School Exercise Books Green Squared x 2
School Exercise Books Orange Squared x 2
+ £9.65 postage Exercise Books Maths Large 10mm Squares A5 [Pack Of 8]
+ £11.45 postage 3 DARK GREEN EXERCISE BOOKS - 48 PAGE 203mm X 165mm SQUARED PAPER SCHOOL OFFICE
+ £12.06 postage 100 Hamelin Maths Exercise Books 1cm squared 80 pages A5 (229x178mm)
+ £12.06 postage Hamelin maths red squared Margin Exercise Book 80 Page 40 Sheet 23 cm x 17.5 cm
+ £10.44 postage 10 x SCHOOL EXERCISE BOOKS MATHS LARGE 10mm SQUARES A5 - LIGHT GREEN COVER
+ £12.06 postage Maths 5mm Squared Exercise Books x 4
+ £8.80 postage 10 x SCHOOL EXERCISE BOOKS MATHS SMALL 5mm SQUARES 48 Page A5
+ £5.99 postage 50 DARK GREEN EXERCISE BOOKS - 48 PAGE 203mm X 165mm SQUARED PAPER SCHOOL OFFICE
10 x SCHOOL EXERCISE BOOKS MATHS LARGE 10mm SQUARES A5 - LIGHT GREEN COVER
+ £12.06 postage 4 x SCHOOL EXERCISE BOOKS MATHS LARGE 10mm SQUARES A5 - LIGHT GREEN COVER
+ £4.99 postage Oxford Exercise Books 2 Styles Squared / Ruled Teaching Supplies [25 /100 Packs]
4 x SCHOOL EXERCISE BOOKS MATHS LARGE 10mm SQUARES A5 - LIGHT GREEN COVER
+ £4.99 postage Pk 10 Orange 48 page Exercise/Maths Books A5 5mm Squared/Quadrille 229mm x 178mm
+ £12.45 postage 10 x SCHOOL EXERCISE BOOKS MATHS SMALL 5mm SQUARES GREEN COVER 48 Page A5
+ £5.99 postage 25 x Blue School Exercise Books A5 Squared Maths Note pad 40 sheet Art kids - R4
School Exercise Books 80 pages Large 10mm Squares pack of 3
10 x SCHOOL EXERCISE BOOKS MATHS SMALL 5mm SQUARES 80 Page A5
+ £12.06 postage Pk 5 Pink Exercise/Note/Maths Books 32 Page 10mm Squared/Quadrille 203mm x 102mm
+ £4.89 postage 7 mm SQUARED Exercise books! 80 page! MATHS! School/Office/Work!
+ £9.65 postage Pk10 Yellow Exercise/Maths Books A5 48 Page 7mm Squared/Quadrille 203mm x 165mm
+ £9.90 postage SCHOOL EXERCISE BOOKS 8mm LINES A5 48 Page 165 X 203mm BLUE COVER 10 Pack £9.91
Pk 10 Yellow Exercise/Maths Books A5 48 Page 7mm Squared/Quadrille 229mm x 178mm
+ £12.45 postage Pk 10 Yellow Exercise/Math Books A5 80 Page 7mm Squared/Quadrille 203mm x 165mm | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational e-commerce corporation based in San Jose, California, that facilitates consumer-to-consumer and business-to-consumer sales through its website."
}
] |
Buy Mother's Day Oval Fine Diamond Rings | eBay
Mother's Day Oval Fine Diamond Rings
£1,907.39
Ladies Diamonds Black and White Cocktail Ring Beautiful Modern Deco Styling
Oval Smoky Quartz Ring in 14kt White gold White Diamond Halo
14 K White Gold With. 60 Dia.Cts. Genuine Smokey Quartz Oval Pineapple cut Center Stone Comfort fit lady's Ring. Size 7 One of a kind.
£2,839.62
14k Solid White Gold Natural Diamond halo semi mount ring 0.40 carats. Gold content : 14K. All gold and diamond are 100% genuine and natural. Diamond Weight: 0.40 carats. Diamond Clarity : Si1. Diamond color : G.
Cut: ExcellentStyle: SignetClarity: SI2
Brand: Le VianCut: ExcellentStyle: Statement
P ink Diamond. 1.41 carats, Fancy Light Pink GIA Cert.
£122,661.76
Occasion: Mother's DayCertification: GIA
3.00ct Oval Cut Halo Engagement Ring 14K White Gold Over Designer Cocktail Ring
DIAMOND CLARITY: VVS1 - DIAMOND COLOUR: D. GEM TYPE: Swarovski Zirconia. • 18k white / yellow gold. •Is there a problem?.
Top Rated PlusBrand: M & MStyle: ClusterMetal: White Gold
Engagement Oval Fine Diamond Rings
Oval Anniversary Fine Diamond Rings
Birthday Oval Fine Diamond Rings
Christmas Oval Fine Diamond Rings | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational e-commerce corporation based in San Jose, California, that facilitates consumer-to-consumer and business-to-consumer sales through its website."
}
] |
Related Citations for PubMed (Select 21549076) - PubMed - NCBI
Display Settings:Summary,20 per page,Sorted by Link RankingFormatSummarySummary (text)AbstractAbstract (text)MEDLINEXMLPMID ListItems per page5102050100200Sort byLink RankingPub DateFirst AuthorLast AuthorJournalTitleRelevanceApplySend to:Choose DestinationFileClipboardCollectionsE-mailOrderMy BibliographyCitation managerFormatSummary (text)Abstract (text)MEDLINEXMLPMID ListCSVSort byLink RankingPub DateFirst AuthorLast AuthorJournalTitleRelevanceCreate FileRelated Citations for PubMed (Select 21549076)FormatSummarySummary (text)AbstractAbstract (text)MEDLINEXMLPMID ListMeSH and Other DataSort byLink RankingPub DateFirst AuthorLast AuthorJournalTitleRelevanceNumber to send5102050100200Start from citationE-mailSubjectAdditional textE-mail"SPAM" filtering software noticeAdd to ClipboardAdd to CollectionsOrder articlesAdd to My BibliographyGenerate a file for use with external citation management software.Number to send5102050100200Start from citationCreate File
Select item 215490761.Vascular Ehlers-Danlos syndrome: a case with fatal outcome.Morais P, Mota A, Eloy C, Lopes JM, Torres F, Palmeiro A, Tavares P, Azevedo F.Dermatol Online J. 2011 Apr 15;17(4):1.PMID: 21549076 [PubMed - indexed for MEDLINE] Free ArticleRelated citations Select item 195439012.A novel point mutation at donor splice-site in intron 42 of type III collagen gene resulting in the inclusion of 30 nucleotides into the mature mRNA in a case of vascular type of Ehlers-Danlos syndrome.Okita H, Ikeda Y, Mitsuhashi Y, Namikawa H, Kitamura Y, Hamasaki Y, Yamazaki S, Hatamochi A.Arch Dermatol Res. 2010 Jul;302(5):395-9. doi: 10.1007/s00403-009-0970-6. Epub 2009 Jun 20.PMID: 19543901 [PubMed - indexed for MEDLINE] Related citations Select item 151277383.Vascular Ehlers-Danlos syndrome.Germain DP, Herrera-Guzman Y.Ann Genet. 2004 Jan-Mar;47(1):1-9. Review.PMID: 15127738 [PubMed - indexed for MEDLINE] Related citations Select item 120165384.Clinical and genetic features of vascular Ehlers-Danlos syndrome.Germain DP.Ann Vasc Surg. 2002 May;16(3):391-7. Epub 2002 May 21. Review.PMID: 12016538 [PubMed - indexed for MEDLINE] Related citations Select item 172516785.Genetic aspects of the vascular type of Ehlers-Danlos syndrome (vEDS, EDSIV) in Japan.Watanabe A, Kosho T, Wada T, Sakai N, Fujimoto M, Fukushima Y, Shimada T.Circ J. 2007 Feb;71(2):261-5.PMID: 17251678 [PubMed - indexed for MEDLINE] Free ArticleRelated citations Select item 207203626.Ehlers-Danlos syndrome type IV, vascular type, which demonstrated a novel point mutation in the COL3A1 gene.Sadakata R, Hatamochi A, Kodama K, Kaga A, Yamaguchi T, Soma T, Usui Y, Nagata M, Ohtake A, Hagiwara K, Kanazawa M.Intern Med. 2010;49(16):1797-800. Epub 2010 Aug 13.PMID: 20720362 [PubMed - indexed for MEDLINE] Free ArticleRelated citations Select item 194773917.Vascular Ehlers-Danlos syndrome--all three coronary artery spontaneous dissections.Nakamura M, Yajima J, Oikawa Y, Ogasawara K, Uejima T, Abe K, Aizawa T.J Cardiol. 2009 Jun;53(3):458-62. doi: 10.1016/j.jjcc.2008.09.007. Epub 2008 Nov 8.PMID: 19477391 [PubMed - indexed for MEDLINE] Free ArticleRelated citations Select item 205187838.Clinical and genetic features of 20 Japanese patients with vascular-type Ehlers-Danlos syndrome.Shimaoka Y, Kosho T, Wataya-Kaneda M, Funakoshi M, Suzuki T, Hayashi S, Mitsuhashi Y, Isei T, Aoki Y, Yamazaki K, Ono M, Makino K, Tanaka T, Kunii E, Hatamochi A.Br J Dermatol. 2010 Oct;163(4):704-10. doi: 10.1111/j.1365-2133.2010.09874.x.PMID: 20518783 [PubMed - indexed for MEDLINE] Related citations Select item 98417129.Multiple vascular and bowel ruptures in an adolescent male with sporadic Ehlers-Danlos syndrome type IV.Collins MH, Schwarze U, Carpentieri DF, Kaplan P, Nathanson K, Meyer JS, Byers PH.Pediatr Dev Pathol. 1999 Jan-Feb;2(1):86-93.PMID: 9841712 [PubMed - indexed for MEDLINE] Related citations Select item 2214327910.Vascular Ehlers-Danlos syndrome: pathophysiology, diagnosis, and prevention and treatment of its complications.Beridze N, Frishman WH.Cardiol Rev. 2012 Jan-Feb;20(1):4-7. doi: 10.1097/CRD.0b013e3182342316. Review.PMID: 22143279 [PubMed - indexed for MEDLINE] Related citations Select item 1867261011.Ehlers-Danlos syndrome type IV with gastric adenocarcinoma.Kanechorn Na Ayuthaya R, Patthamapasphong N, Sura T, Niumpradit N, Trachoo O.J Med Assoc Thai. 2008;91 Suppl 1:S166-71.PMID: 18672610 [PubMed - indexed for MEDLINE] Related citations Select item 807195612.The clinical features of Ehlers-Danlos syndrome type VIIB resulting from a base substitution at the splice acceptor site of intron 5 of the COL1A2 gene.Carr AJ, Chiodo AA, Hilton JM, Chow CW, Hockey A, Cole WG.J Med Genet. 1994 Apr;31(4):306-11.PMID: 8071956 [PubMed - indexed for MEDLINE] Free PMC ArticleRelated citations Select item 1157737113.Haploinsufficiency for one COL3A1 allele of type III procollagen results in a phenotype similar to the vascular form of Ehlers-Danlos syndrome, Ehlers-Danlos syndrome type IV.Schwarze U, Schievink WI, Petty E, Jaff MR, Babovic-Vuksanovic D, Cherry KJ, Pepin M, Byers PH.Am J Hum Genet. 2001 Nov;69(5):989-1001. Epub 2001 Sep 27.PMID: 11577371 [PubMed - indexed for MEDLINE] Free PMC ArticleRelated citations Select item 1902316314.Vascular type of Ehlers-Danlos syndrome.Watanabe A, Shimada T.J Nippon Med Sch. 2008 Oct;75(5):254-61. Review.PMID: 19023163 [PubMed - indexed for MEDLINE] Free ArticleRelated citations Select item 2348942915.A new COL3A1 mutation in Ehlers-Danlos syndrome type IV.Eder J, Laccone F, Rohrbach M, Giunta C, Aumayr K, Reichel C, Trautinger F.Exp Dermatol. 2013 Mar;22(3):231-4. doi: 10.1111/exd.12105.PMID: 23489429 [PubMed - indexed for MEDLINE] Related citations Select item 2121985116.A novel mutation screening system for Ehlers-Danlos Syndrome, vascular type by high-resolution melting curve analysis in combination with small amplicon genotyping using genomic DNA.Naing BT, Watanabe A, Shimada T.Biochem Biophys Res Commun. 2011 Feb 18;405(3):368-72. doi: 10.1016/j.bbrc.2011.01.011. Epub 2011 Jan 8.PMID: 21219851 [PubMed - indexed for MEDLINE] Related citations Select item 2063540017.Arterial rupture in classic Ehlers-Danlos syndrome with COL5A1 mutation.Borck G, Beighton P, Wilhelm C, Kohlhase J, Kubisch C.Am J Med Genet A. 2010 Aug;152A(8):2090-3. doi: 10.1002/ajmg.a.33541.PMID: 20635400 [PubMed - indexed for MEDLINE] Related citations Select item 1692899418.Aneurysm syndromes caused by mutations in the TGF-beta receptor.Loeys BL, Schwarze U, Holm T, Callewaert BL, Thomas GH, Pannu H, De Backer JF, Oswald GL, Symoens S, Manouvrier S, Roberts AE, Faravelli F, Greco MA, Pyeritz RE, Milewicz DM, Coucke PJ, Cameron DE, Braverman AC, Byers PH, De Paepe AM, Dietz HC.N Engl J Med. 2006 Aug 24;355(8):788-98.PMID: 16928994 [PubMed - indexed for MEDLINE] Free ArticleRelated citations Select item 1764039119.Ehlers-Danlos syndrome type IV.Germain DP.Orphanet J Rare Dis. 2007 Jul 19;2:32. Review.PMID: 17640391 [PubMed - indexed for MEDLINE] Free PMC ArticleRelated citations Select item 1880495020.Concurrent splenic peliosis and vascular Ehlers-Danlos syndrome.van Bon AC, Kristinsson JO, van Krieken JH, Wanten GJ.Ann Vasc Surg. 2009 Mar;23(2):256.e1-4. doi: 10.1016/j.avsg.2008.02.004. Epub 2008 Sep 19.PMID: 18804950 [PubMed - indexed for MEDLINE] Related citations << First< PrevPage of 9Next >Last >> | [
{
"key": "website_description",
"type": "global",
"value": "This website is part of the United States National Library of Medicine , a branch of the National Institutes of Health . It is approved and funded by the government of the United States."
}
] |
Fiction WW II Espionage
Non Fiction Biography France Nadar
Non Fiction Literature Biography Henry Davis Thoreau
Non Fiction Naval History Attack Submarine
NY state cetificate of authority TF-4804454 Shipping Terms | [
{
"key": "website_description",
"type": "global",
"value": "This website is an e-commerce global online marketplace with seven websites that offer books, fine art, and collectables from sellers in over 50 countries. Launched in 1996, it specialises in used, rare and out-of-print books."
}
] |
Warplanes mount fresh airstrikes in Idlib area: Syrian Observatory | world news | Hindustan Times
world Updated: Apr 05, 2017 12:59 IST
A Syrian child receives treatment following a suspected toxic gas attack in Khan Sheikhun, a rebel-held town in the northwestern Syrian Idlib province, on April 4.(AFP Photo) | [
{
"key": "website_description",
"type": "global",
"value": "This website is an Indian English-language daily newspaper introduced and founded in 1924 by Sunder Singh Lyallpuri, founder-father of the Akali movement and the Shiromani Akali Dal in the Punjab Province. It played integral roles in the Indian independence movement as a nationalist daily."
}
] |
Listen to Audiobooks narrated by Stephen Strader | Audible.com
Stephen Strader
1-15of15results Previous 1 Next
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F067585%2Fbk_acx0_067585_sample.mp3+flashcontentZB77HZ3J41G841NP65RD0
Business Branding: 10 Proven Steps to Creating a Successful Business Brand and Attracting Customers
By Jerry Kershen
Narrated By Stephen Strader, The Voice Ranger
4.6 (34 ratings)
Are you leaving money on the table and letting customers choose your competitors instead of you? How do you make your business stand out from others and become the obvious choice? Does your marketing leave doubt in your customers' minds about who you really are and what your company stands for?
AMIL_GAOUL says: "Straight Forward overview on all aspects of branding."
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F090244%2Fbk_acx0_090244_sample.mp3+flashcontentZB77HZ3J41G841NP65RD1
Marriage Counseling: Simple Relationship Advice to Help Bring Intimacy Back into Your Love Life
By K. Connors
Narrated By Stephen Strader
Do you struggle with understanding your spouse or significant other? Are they just impossible to understand no matter how hard you try? Has your relationship lost its spark and excitement? Well, you're not alone! Lucky for you, I have laid out in this audiobook exactly what you need to do in order to fix your relationship. Take a closer look into why he acts the way he does and why she says the things she says. No more guessing, no more games. Get that new and exciting feeling back that you had when you first met!
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F090479%2Fbk_acx0_090479_sample.mp3+flashcontentZB77HZ3J41G841NP65RD2
How to Understand Men: Emotional Availability, Attraction, and Getting Him to Obsess Over You
Release Date: 07-12-17
Do you struggle with understanding your man, or just men in general? Do you have a hard time talking to him or getting him to show his feelings and emotions? You're not alone! Millions of women struggle with this every single day, and the wort part is they think you're the complicated one! Have no fear, as I have laid out in this book exactly what you need to know when it comes to understanding men. Find out what really makes men tick and obsess over you.
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F097219%2Fbk_acx0_097219_sample.mp3+flashcontentZB77HZ3J41G841NP65RD3
Learn Python: The Ultimate Guide to Learning One of the Most Useful Programming Languages
Whether you're learning how to code for the first time, or just trying to add to your programming arsenal, you're in the right place. Python is one of, if not the most, widely used programming language today, whether you're at a large corporation or at home developing a game. It doesn't matter if you're into game development or mobile app engineering; Python is a great choice either way. The structure of the language doesn't require lengthy code to be written, and its comprehensive standard library allows it to support multiple programming paradigms.
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F093636%2Fbk_acx0_093636_sample.mp3+flashcontentZB77HZ3J41G841NP65RD4
Be a Boss: The Ultimate Guide for New Leaders and Experienced Entrepeneurs
Do you know what it's like to be the boss? If not, have you always wondered? Being a boss is much more than just delegating tasks and hiring/firing employees. It tasks specific characteristics and traits to become a successful and effective leader in management. If your company rewards those who put themselves forward and take the lead, then it's time to show them what you're capable of. If your company does not, then it's time to show them what they're missing!
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F086906%2Fbk_acx0_086906_sample.mp3+flashcontentZB77HZ3J41G841NP65RD5
Flipping Houses: The Complete Guide on How to Buy, Sell, and Invest in Real Estate
By K Connors
Thinking about investing in real estate? Or have you already started and it's not quite working out the way you planned? Whichever the reason may be, I'm glad you've taken an interest in my book. While there are many different forms of real estate investing, nothing quite compares to the art of flipping houses. In this book, I will teach you the proven steps on how to start flipping houses, how to flip more houses quicker, and how to get larger returns on your initial investment.
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F086918%2Fbk_acx0_086918_sample.mp3+flashcontentZB77HZ3J41G841NP65RD6
Rental Properties: The Proven Guide to Creating Passive Income Through Real Estate Investing
UNABRIDGED (1 hr and 25 mins)
Thinking about investing in real estate? Or have you already started and it's not quite working out the way you planned? Whatever the reason may be, I'm glad you've taken an interest in my book. Buy and hold rental property investing is one of the best ways, if not the best way, to generate passive income and build long-term wealth. In this book, I will teach you the proven steps, based off personal experience, on how to research, buy, rent, and manage your very own rental properties.
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F089574%2Fbk_acx0_089574_sample.mp3+flashcontentZB77HZ3J41G841NP65RD7
How to Understand Women: The Secret Behind How They Think and What They Really Want
Do you struggle with understanding your lady, or just women in general? Is she just impossible to understand no matter how hard you try? I get it, none of what she does or says makes sense, ever... But somehow, it's your fault! Well, you're not alone! Lucky for you, I have laid out in this audiobook exactly what you need to know when it comes to understanding women. Find out the method to her madness and learn the true meaning behind why she does the things she does!
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F087745%2Fbk_acx0_087745_sample.mp3+flashcontentZB77HZ3J41G841NP65RD8
Real Estate Investing, 2 Manuscripts: Flipping Houses and Rental Properties
Thinking about investing in real estate? Or have you already started and it's not quite working out the way you planned? Whichever the reason may be, I'm glad you've taken an interest in my book. While there are many different forms of real estate investing, nothing quite compares to the art of flipping houses and renting out property. In this book, I will teach you the proven steps on how to start investing in real estate, how to scale up quicker, and how to get larger returns on your initial investment.
says: "Very basic"
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F095137%2Fbk_acx0_095137_sample.mp3+flashcontentZB77HZ3J41G841NP65RD9
Build a Business: Discover the True Earning Potential of Self Employment by Building a Business the Profitable Way
Have you ever thought about starting a business but don't know where to begin? Or, do you have a great product or service idea with limited resources to get it off the ground? Maybe you just want to be the boss and that's it? If you're just like how I was many years ago with tons of ambition and no clue where to start, then this is the book for you. I have designed a thorough step by step guide through actual experience which will teach you how to build your own business from the ground up or through buying a franchise.
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F091952%2Fbk_acx0_091952_sample.mp3+flashcontentZB77HZ3J41G841NP65RD10
Start Your Own Business: Learn How Successful Entrepreneurs Can Turn Any Idea into a Profit
Release Date: 07-27-17
Starting your own business can be a scary, yet very exciting time in your life. Sometimes, it raises more questions than answers and leaves you wondering if the risk is worth the potential reward. I'm here to tell you that it is. From personal experience, the earning potential alone, coupled with being your own boss and scheduling your own hours, far outweighs the risks associated with starting your own business.
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F076020%2Fbk_acx0_076020_sample.mp3+flashcontentZB77HZ3J41G841NP65RD11
Hoarding: Break the Cycle and Stop Hoarding Now
By Albert Rogers
Release Date: 12-23-16
3.0 (4 ratings)
Do you know a hoarder or are you one? Then this book is for you. With the help of this book, you can start your road to recovery. Solutions, insights, and root causes are all in here.
TESSA says: "Don't waste your Audible credits!"
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F083774%2Fbk_acx0_083774_sample.mp3+flashcontentZB77HZ3J41G841NP65RD12
Odd and Unusual Tales from the Old West
Release Date: 04-06-17
Western writer Alton Pryor has brought forth a collection of important moments in history. These vignettes present a virtual digest of historical happenings that are fun and educational as well. Listeners will learn about the poignant story of the Seven Little Indians. When a tribe stole a band of horses, Indian fighters killed the Indians that stole them. In doing so, they found seven little Indian babies on their hands.
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F098669%2Fbk_acx0_098669_sample.mp3+flashcontentZB77HZ3J41G841NP65RD13
Python Programming: The Ultimate Beginners Guide to the Python Programming Language
If you were to ask the online programming community what language to pursue, depending on your use, the answer will more than likely be a resounding "Python!" There's more than one reason for this, including its ease of use, comprehensive standard library, and its ability to support multiple programming paradigms. Whether you're new to the coding scene or a seasoned veteran, this is the place to be.
https%3A%2F%2Fsamples.audible.com%2Fbk%2Facx0%2F098459%2Fbk_acx0_098459_sample.mp3+flashcontentZB77HZ3J41G841NP65RD14
Computer Programming for Beginners: Learn How to Code Step by Step
Narrated By Stephen Strader - The Voice Ranger
Learning to program can be a very daunting and intimidating task. I know, I was once in your shoes trying to figure out how the heck I was going to do this crazy thing called code! I remember asking myself questions like where to start, what computer to buy, what language to learn, what books to get, and everything else that went with it. I know the struggle, and that's why I wrote this book to streamline the process and answer all those questions for those individuals just like me. | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American online audiobook and podcast service that allows users to purchase and stream audiobooks and other forms of spoken word content. This content can be purchased individually or under a subscription model where the user receives \"credits\" that can be redeemed for content monthly and receive access to a curated on-demand library of content."
}
] |
jeremy clarke - The Toronto WordPress Group (Toronto, ON) - Meetup
http://photos2.meetupstatic.com/photos/member/8/7/6/f/member_7714671.jpeg
http://www.meetup.com/WPToronto/members/2336532/
I am one of the organizers of WordCamp Montreal. Spoke at WordCamp Toronto 2009 and had a great time. Excited for this new WordCamp!
programmer and designer, I do it all. What do you mainly use WordPress for? (eg. blogging, personal website, professional or corporate website, etc.)
I do professional consulting full time but also use it for my personal sites.
Since 2005, version 1.2. What are you hoping to get from The Toronto WordPress Meetup Group?
Good times talking WordPress.
Jeremy, Thanks so much for the talk last night. It was excellent - clear, concise and very informative. Appreciate your taking the time. Best regards, Nancy Boyle, TheGrowingVine.com Nov 30, 2010 8:06 AM
Jeremy, welcome to the group. If you have questions on WordCamp Montreal, please let me know! Sep 14, 2010 10:35 AM | [
{
"key": "website_description",
"type": "global",
"value": "This website is a service used to organize online groups that host in-person and virtual events for people with similar interests. It was founded in 2002 by Chairman Scott Heiferman and four co-founders."
}
] |
Massachusetts Beautiful by Wallace - AbeBooks
Massachusetts Beautiful by Wallace
Item Description: Bonanza Books, NY. Hard Cover. Book Condition: Near Fine. Dust Jacket Condition: Good-. Author (illustrator). Later Printing. This is a gorgeous 301 page book on the diverse regions of Massachusetts, illustrated with 304 illustrations from the famed artist. Undated reprint from the 1923 original, presumably circa 1972. Near Fine in an about good DJ with edge wear and dings at top, but it is currently in a Brodart jacket protector. Size: 8vo - 7¾" - 9¾" Tall. Bookseller Inventory # 003093
Massachusetts Beautiful: Illustrated by the author with 304 pictures covering all the counties in Massachusetts.
Published by Old America Company, Framingham, Massachusetts (1923)
Item Description: Old America Company, Framingham, Massachusetts, 1923. Hardcover. Book Condition: Good+. Dust Jacket Condition: No Dust Jacket. Formerly property of the library, with pocket at rear and white lettering on spine. With drawings and attractive b&w plates. In green cloth-covered boards. Lacks a dust jacket. A good copy, with minor cover discoloration and edgewear. Interior clean and firm, but front free endpaper has been torn out.; Ex-Library; Small 4to 9" - 11" tall; 301 pages. Bookseller Inventory # 75750
Published by Garden City Publishing (1935)
Item Description: Garden City Publishing, 1935. Book Condition: Gd+. Dust Jacket Condition: No DJ. clean, tight, prev owner name on front end paper, spine somewhat soiled, brown cloth covered boards. Bookseller Inventory # P638
Published by Bonanza Books New York 1923 (1923)
Item Description: Bonanza Books New York 1923, 1923. Good + 8vo = over 9" Good DJ 301pp Reprint. Cloth covers are Good. Dj is soiled. 304 illus. Bookseller Inventory # NF124
Published by Garden City Publishing Co., Inc., Garden City, NY (1935)
Item Description: Garden City Publishing Co., Inc., Garden City, NY, 1935. Hardcover. Later printing. Includes numerous illustrations by Nutting of all the counties in Massachusetts. An about near fine copy in cloth. Lacking the dust jacket. Bookseller Inventory # 115507
Item Description: Bonanza Books New York 1923, 1923. Wallace Nutting (illustrator). Near Fine Book Club Edition 12mo = 7-9" Very Good+ DJ 301pp Blue cloth over hardcover, gilt lettering on spine. Very clean inside and out, crisp and very white pages, binding is tight and square, only one page has some lines underlined, red jacket has very slight shelf wear. Over 300 illustrations, 0517-k02484. Bookseller Inventory # NF31151
Published by Bonanza Books (1973)
Item Description: Bonanza Books, 1973. Hardcover. Book Condition: NF. Dust Jacket Condition: NF. Not ex-lib. Hardcover in green cloth, in b/w photo-illustrated red jacket, 8vo. Facsimile reprint edition. 301pp. Index, line drawings, b/w plates on paper throughout. NF/NF. Book has hint of spine slant toward upper end only with no effect on strong binding; foxing to upper page edges and occasonally to endpapers; prev. owner's bookplate front pastedown. Cloth bright and sharp. pages and plates clean and unmarked. Jacket has mild toning to white background of rear panel; else Fine: clean and bright in Brodart. Bookseller Inventory # 028831
Published by Garden City Publishing Co Inc, New York (1935)
Item Description: Garden City Publishing Co Inc, New York, 1935. Hardcover. Book Condition: Good. No Jacket. Nutting, Wallace (illustrator). 254pp in brown cloth board cover (sunned), which has had the spine neatly repaired with red tape. A sound binding, the book contains many black and white photographs and line drawings depicting this US state. Neat owners name on FEP. A heavier book that may incur increased shipping costs. Prompt processing of all orders received, with delivery from the UK. 254 p. Book. Bookseller Inventory # 001562
Item Description: Bonanza Books. Hardcover. Book Condition: Very Good. Dust Jacket Condition: Very Good. VG/VG, later reprint by Bonanza books. Bookseller Inventory # 3235
Nutting, Wallace; Illustrated By Wallace Nutting
Published by Garden City Publishing Co., Inc., Garden City (1935)
Item Description: Garden City Publishing Co., Inc., Garden City, 1935. Hardcover. Book Condition: Very Good. Dust Jacket Condition: Fair. Garden City: Garden City Publishing Co., Inc., 1935. Second edition, 1935. Very good in fair dustjacket. Tan cloth printed in brown and gilt, 254 pages, illustrated dustjacket. The book is in good condition with little external wear, sound text block, good hinges, age-toned endpapers, some scattered foxing (heaviest at title page and frontis), no names or other markings. The mylar protected dustjacket is not priceclipped and has soil and age-toning, some chips, about five percent paper loss overall. Hard Cover. Very Good/Fair. 4to - over 9¾" - 12" tall. Bookseller Inventory # 011795
Item Description: Garden City Publishing Co., Inc., Garden City, 1935. Hardcover. Book Condition: Good. Dust Jacket Condition: Fair. Garden City: Garden City Publishing Co., Inc., 1935. Second edition, 1935. Near very good in fair dustjacket. Tan cloth printed in brown and gilt, 254 pages, illustrated dustjacket. The book is in very good condition with little external wear, sound text block, good hinges, a small daub of white paint at rear cover, no names or other markings. The mylar protected dustjacket is not priceclipped and is in fair condition, has extensive crease rubbing to its outer right edge and rear spine panel side, front right bottom corner surface worn and corner torn, chipping to the bottom of spine panel, less than five percent paper loss altogether. Hard Cover. Good/Fair. 4to - over 9¾" - 12" tall. Bookseller Inventory # 014332
Published by GARDEN CITY PUBLISHING, GARDEN CITY, NEW YORK (1935)
Item Description: GARDEN CITY PUBLISHING, GARDEN CITY, NEW YORK, 1935. HARD BACK BROWN. Book Condition: FAIR. Spine discoloration. Previous owner signed front free endpaper. All edges and pages browning. Black and white photographs. DATE PUBLISHED: 1935 EDITION: 254. Bookseller Inventory # 039911
Published by Bonanza, New York (1923)
Item Description: Bonanza, New York, 1923. Hardcover. Book Condition: Very Good. Dust Jacket Condition: Very Good. Very Good/Very Good condition. Previous owner's markings on front free end paper. Bookseller Inventory # 25941
Massachusetts Beautiful : Illustrated By the Author with Three Hundred and Four Pictures Covering All the Counties in Massachusetts
Item Description: Old America Company, Framingham, Massachusetts, 1923. Hardcover. Book Condition: Very Good. Dust Jacket Condition: None. First Edition. Framingham, Massachusetts: Old America Company, 1923. First edition, 1923. A photographic tour of the state, its scenery, older homes and landmarks, supplemented with engravings. Oive green cloth, 301 pages. Some light external wear, mainly a bit of light rubbing to the spine ends, some unevenness to the cloth on the spine (pretty typical for first edition Nutting books), good hinges, sound text block, very clean pages with an address label on the front pastedown, no other markings. First Edition. Hard Cover. Very Good/None. 8vo - over 7¾" - 9¾" tall. Bookseller Inventory # 010765
Published by Old America, Farmingham, Mass. (1923)
Item Description: Old America, Farmingham, Mass., 1923. Hardcover. Book Condition: Very Good. Dust Jacket Condition: No Dust Jacket. 1st Edition. Front panel of the DJ is laid in. Green boards are frayed at head & heel of spine, at corner tips. It is clean, with a solid squared binding. Solid hinges. Clean textblock with mellow tone. B&W illustrations throughout. Bookseller Inventory # 031614
Published by Old America Co., MA (1923)
Item Description: Old America Co., MA, 1923. Hardcover. Book Condition: Very Good. First edition. 7 x 10 in. Cloth boards. Condition is VERY GOOD ; minor wear, spine toned. Binding tight and text unmarked. New Eng. Stax. Bookseller Inventory # 30627
Published by Old America Company, Farmingham (1923)
Item Description: Old America Company, Farmingham, 1923. Hardcover. Book Condition: Near Fine. No Jacket. Publisher's Green cloth blind-stamped with gilt titles. Bindings tight and square. Text clean, light even toning. Minimal handling wear. 4to; 301 pages, Photographic illustrations with index. 10.25 inches tall. States Beautiful Series. ---------- A Historical photographic tour highlighting the scenery, older homes and landmarks, supplemented with engravings. Bookseller Inventory # 008986
Published by Garden City 1935 (1935)
Item Description: Garden City 1935, 1935. HB, DJ: none. The beauty of Massachusetts illustrated by many b/w photos Very Good. Smallred stain on back cover. Bookseller Inventory # 5136
Published by Old America Company Framingham 1923 (1923)
Item Description: Old America Company Framingham 1923, 1923. Very Good 8vo = over 9" No DJ Some soling to green cloth boards. Slight edgewear. "Illustrated by the author with three hundred and four pictures covering all the counties in Massachusetts.". Bookseller Inventory # NF23565
Item Description: Garden City Publishing, Garden City, 1935. Hardcover. Book Condition: Very Good+. Browning and occasional foxing. Slight creasing to front pages; Illustrating and describing each county in Massachusetts ; B&W Photographs; 4to 11" - 13" tall; 254 pages. Bookseller Inventory # 13609
Published by Bonanza Books, New York (1923)
Item Description: Bonanza Books, New York, 1923. Hardcover. Book Condition: Very Good+. Dust Jacket Condition: Very Good. DJ spine a bit sunned ; B&W Photographs; 4to 11" - 13" tall; 301 pages. Bookseller Inventory # 9389
Published by Old America Co. Framingham, MA 1923 (1923)
Item Description: Old America Co. Framingham, MA 1923, 1923. Nutting, Wallace (illustrator). Good 8vo = over 9" No DJ 301pp Cloth covers are soiled, slightly shaken. Corners & top/bottom of spine is worn, tear on back edge of spine. Tape remainders on inside of covers. Front hinge is cracked. Illustrated by the author with three hundred and four pictures covering all the Counties in Massachusetts. Bookseller Inventory # NF2562
Massachusetts Beautiful, by Wallace Nutting; Illustrated by the Author with Three Hundred and Four Pictures Covering all the Counties in Massachusetts
Published by Framingham, Old America Company (1923)
Item Description: Framingham, Old America Company, 1923. First Edition. Near fine copy in the original gilt-blocked cloth. Slightest suggestion only of dust-dulling to the spine bands and panel edges. Remains particularly well-preserved overall; tight, bright, clean and strong. ; 301 pages; Description: 2 p. L. , 3-301 p. Incl. Illus. , plates. 26 cm. Subjects: Historic buildings--Massachusetts. Massachusetts--Description and travel. Massachusetts--Pictorial works. 2 Kg. 301 pp. Bookseller Inventory # 82127
Published by Old American Company, Framingham, Ma (1923)
Item Description: Old American Company, Framingham, Ma, 1923. Cloth. First edition. 301 pp. Illus. with 304 b/w photos. Some staining and wrinkling (as common for this title) to back board, otherwise a very good crisp copy. No dust jacket. Bookseller Inventory # 22854
Item Description: Bonanza Books. Hardback. Book Condition: Very Good. Dust Jacket Condition: Very Good. Very good condition in an almost very good dustwrapper. Originally compiled in 1923. Green cloth, dark title to spine. B/w illustrations and photos. Wrapper unevenly faded. [S]. Bookseller Inventory # 630336
Massachusetts Beautiful, Illustrated by the Author with 304 Pictures of All the Counties of Massachusetts
Published by Old American Company Framingham, 1923 (1923)
Item Description: Old American Company Framingham, 1923, 1923. Hardcover. Book Condition: Good. No Jacket. G+ cloth hardback, gilt lettering, no DJ. Cover with worn spine edges, spine darkened, front edge slightly crinkled, back cover crinkled. Binding tight. End papers and pp are VG, lightly tanned. Sml 4to, 301 pp with illustrations and index. Because of size and weight of the book(s), please contact us to arrange for priority mail or for shipping outside the continental USA. Bookseller Inventory # 3464
Published by Old America Company, Publishers, Framingham (1923)
Item Description: Old America Company, Publishers, Framingham, 1923. Book Condition: Near Fine. First edition. Near fine, slightly cocked with previous owner's inscription on the front fly. Lacking the dustwrapper. Bookseller Inventory # 275214
Published by New York : Bonanza Books (1923)
Item Description: New York : Bonanza Books, 1923. First Edition. Fine cloth copy in an equally fine dw. Particularly and surprisingly well-preserved; tight, bright, clean and especially sharp-cornered. ; 8vo 8" - 9" tall; 301 pages; Description: 2 p. L. , 3-301 p. Incl. Illus. , plates. 26 cm. Subjects: Historic buildings --Massachusetts. Massachusetts --Description and travel. Massachusetts --Pictorial works 1 Kg. 301 pp. Bookseller Inventory # 160401
Published by Old America Company, Publishers, Framingham, MA (1923)
Item Description: Old America Company, Publishers, Framingham, MA, 1923. Hardcover. Book Condition: VG. 1st Edition. First Edition in very good condition. Small bumps to the corners. Fadi ng and soiling to the spine with rubs to its tips. Some wrinkling on t he rear cover. Name inked at the upper right corner of the front fly. No dust jacket. Bookseller Inventory # 61860 | [
{
"key": "website_description",
"type": "global",
"value": "This website is an e-commerce global online marketplace with seven websites that offer books, fine art, and collectables from sellers in over 50 countries. Launched in 1996, it specialises in used, rare and out-of-print books."
}
] |
The 10 best campsites in the Dominican Republic | Booking.com
Search campsites - Top regions in the Dominican Republic
The 10 Best Campsites in the Dominican Republic
Check out our pick of great camping sites in the Dominican Republic
Casa de Arbol, Rancho Tierra Alta has garden views, free WiFi and free private parking, situated in Jarabacoa, 11 km from Salto de Jimenoa.
Campsite in Hacienda Estrella
Set in Hacienda Estrella, Hacienda ANA MARIA offers accommodation with an outdoor pool, a shared lounge and a garden.
A children's playground and a sun terrace are featured at the camping.
Santo Domingo is 28 km from Hacienda ANA MARIA.
Campsite in Bavaro, Punta Cana
Situated in Punta Cana with Arena Gorda Beach nearby, Cap cana features accommodation with free WiFi and free private parking.
Dolphin Island Park is 11 km from Cap cana, while freshwater lagoons is 31 km from the property.
Campsite in Paraíso
Located in Paraíso, 300 metres from Paraiso Beach, Kasiman Village provides accommodation with air conditioning and access to a garden with a terrace.
Campsite in Santa Bárbara de Samaná
Set in Santa Bárbara de Samaná with La Playita Beach nearby, Rincón Paraíso offers accommodation with free private parking.
Las Galeras Beach is 2.3 km from Rincón Paraíso, while Samana Port is 30 km from the property.
Casa de Pampaña y Paella frente al mar
Campsite in El Eslabón
With sea views, Casa de Pampaña y Paella frente al mar is located in El Eslabón and has free WiFi.
Bávaro is 40 km from the camping.
Chappy's Bungalows
Campsite in Anamuya
Providing garden views, Chappy's Bungalows in Anamuya provides accommodation, a garden and a terrace.
Punta Cana is 42 km from the camping, while Bávaro is 34 km away.
Campsite in Pedro Brand
Situated in Pedro Brand, 23 km from Santo Domingo, Sandoval Casa de Campo features free bikes and free WiFi.
Campsite in La Romana
Located 11 km from Marina de Casa de Campo, HOPE APARTMENT offers a shared lounge, a private beach area and air-conditioned accommodation with a balcony and free WiFi.
Guests at the camping can enjoy a à la carte or an American breakfast.
Casita en Los Sumideros
Campsite in Mata Chalupe
Situated in Mata Chalupe, Casita en Los Sumideros features accommodation with free private parking.
Bávaro is 47 km from the camping.
Most booked campsites in the Dominican Republic this month
Popular with guests booking campsites in the Dominican Republic
Campsite in Lajas
1001440,997600|4,1002900,835220,998200,996820,971080,863580,1000050 | [
{
"key": "website_description",
"type": "global",
"value": "This website is a Dutch online travel agency for lodging reservations & other travel products, and a subsidiary of Booking Holdings. It is headquartered in Amsterdam.The website has over 28 million listings."
}
] |
9780813935737: Sounding the Break: African American and Caribbean Routes of World Literature (New World Studies) - AbeBooks - Jason Frydman: 0813935733
ISBN 13: 9780813935737
1. SOUNDING THE BREAK (P)
Book Description University of North Carolina Press. Book Condition: New. Brand New. Bookseller Inventory # 0813935733
2. Sounding the Break: African American and Caribbean Routes of World Literature (Paperback)
Book Description University of Virginia Press, United States, 2014. Paperback. Book Condition: New. New. Language: English . Brand New Book. The idea of world literature has served as a crucial though underappreciated interlocutor for African diasporic writers, informing their involvement in processes of circulation, translation, and revision that have been identified as the hallmarks of the contemporary era of world literature. Yet in spite of their participation in world systems before and after European hegemony, Africa and the African diaspora have been excluded from the networks and archives of world literature. In Sounding the Break, Jason Frydman attempts to redress this exclusion by drawing on historiography, ethnography, and archival sources to show how writers such as W. E. B. Du Bois, Zora Neale Hurston, Alejo Carpentier, Derek Walcott, Maryse Conde, and Toni Morrison have complicated both Eurocentric and Afrocentric categories of literary and cultural production. Through their engagement with and revision of the European world literature discourse, he contends, these writers conjure a deep history of literary traffic whose expressions are always already cosmopolitan, embedded in the long histories of cultural and economic exchange between Africa, Asia, and Europe. It is precisely the New World American location of these writers, Frydman concludes, that makes possible this revisionary perspective on the idea of (Old) World literature. Bookseller Inventory # AAC9780813935737
3. Sounding the Break
Book Description Book Condition: New. Bookseller Inventory # 20803059-n
4. Sounding the Break: African American and Caribbean Routes of World Literature (Paperback)
5. Sounding the Break: African American and Caribbean Routes of World Literature (New World Studies)
Book Description University of Virginia Press, 2014. Paperback. Book Condition: New. Never used!. Bookseller Inventory # 0813935733
6. Sounding the Break African American and Caribbean Routes of World Literature New World Studies
Book Description University of Virginia Press. Paperback. Book Condition: New. Paperback. 192 pages. Dimensions: 8.8in. x 6.0in. x 0.8in.The idea of world literature has served as a crucial though underappreciated interlocutor for African diasporic writers, informing their involvement in processes of circulation, translation, and revision that have been identified as the hallmarks of the contemporary era of world literature. Yet in spite of their participation in world systems before and after European hegemony, Africa and the African diaspora have been excluded from the networks and archives of world literature. In Sounding the Break, Jason Frydman attempts to redress this exclusion by drawing on historiography, ethnography, and archival sources to show how writers such as W. E. B. Du Bois, Zora Neale Hurston, Alejo Carpentier, Derek Walcott, Maryse Cond, and Toni Morrison have complicated both Eurocentric and Afrocentric categories of literary and cultural production. Through their engagement with and revision of the European world literature discourse, he contends, these writers conjure a deep history of literary traffic whose expressions are always already cosmopolitan, embedded in the long histories of cultural and economic exchange between Africa, Asia, and Europe. It is precisely the New World American location of these writers, Frydman concludes, that makes possible this revisionary perspective on the idea of (Old) World literature. This item ships from multiple locations. Your book may arrive from Roseburg,OR, La Vergne,TN. Paperback. Bookseller Inventory # 9780813935737
Book Description University of Virginia Press, 2014. Paperback. Book Condition: New. book. Bookseller Inventory # M0813935733
8. Sounding the Break: African American and Caribbean Routes of World Literature (Paperback)
Book Description Paperback. Book Condition: New. Paperback. Shipping may be from multiple locations in the US or from the UK, depending on stock availability. 192 pages. 0.272. Bookseller Inventory # 9780813935737
9. Sounding the Break: African American and Caribbean Routes of World Literature (New World Studies)
Book Description University of Virginia Press. Paperback. Book Condition: New. New copy - Usually dispatched within 2 working days. Bookseller Inventory # B9780813935737
10. Sounding the Break: African American and Caribbean Routes of World Literature
Book Description University of Virginia Press, 2014. PAP. Book Condition: New. New Book. Shipped from UK in 4 to 14 days. Established seller since 2000. Bookseller Inventory # CE-9780813935737 | [
{
"key": "website_description",
"type": "global",
"value": "This website is an e-commerce global online marketplace with seven websites that offer books, fine art, and collectables from sellers in over 50 countries. Launched in 1996, it specialises in used, rare and out-of-print books."
}
] |
Madeleine Albright and the New American Diplomacy by Thomas W. Lippman | Hardcover | Barnes & Noble
Madeleine Albright and the New American Diplomacy by
Overview Selected by President Clinton as the first woman to be Secretary of State, Madeleine Albright rode into office on a wave of popularity. She was an instant celebrity in Washington and around the world, recognized everywhere and widely admired for her blunt style and dramatic personal history. Facing a Congress controlled by the opposition and an unruly world where the rules of the Cold War no longer applied, this tough-talking grandmother and Democratic political insider adopted the highest profile of any Cabinet ...
Selected by President Clinton as the first woman to be Secretary of State, Madeleine Albright rode into office on a wave of popularity. She was an instant celebrity in Washington and around the world, recognized everywhere and widely admired for her blunt style and dramatic personal history. Facing a Congress controlled by the opposition and an unruly world where the rules of the Cold War no longer applied, this tough-talking grandmother and Democratic political insider adopted the highest profile of any Cabinet official since Henry Kissinger as she struggled to convert her personal stature into foreign policy success. Inside the State Department, she grappled with an entrenched bureaucracy to force new issues such as women’s rights and international crime onto the foreign policy agenda.As a reporter for the Washington Post, Thomas Lippman spent two and a half years travelling with Albright around the world, from crisis to crisis, to compile this inside account of her campaign to reshape American diplomacy for the new century.
ISBN-13: 9781402894244
Pages: 368Product dimensions: 6.14 (w) x 9.27 (h) x 1.01 (d)
1 I Look Pretty Good in a Stetson
2 They Can Call Me Madeleine
3 A Marine Corps Kind of Girl
4 I Was Queen of the May
5 We Stand Ready for a Dialogue
6 I Somehow Lost My Instincts
7 We Did Not Blow It
9 This Is What People Care About
10 Freedom Is America's Purpose | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American bookseller. It is a Fortune 1000 company and the bookseller with the largest number of retail outlets in the United States."
}
] |
Smartphones are the new detergents | gadgets | Hindustan Times
Smartphones are the new detergents
With the Android operating system designed to proliferate the handset and the tablet as a generic than as a brand, the industry is “commoditised” to a point where if you take out the newest patented features, an inspired manufacturer can go far in giving the average consumer good value for money.
gadgets Updated: Oct 27, 2013 23:29 IST
About three decades ago, a little-known brand called Nirma challenged the mighty Surf, owned by Hindustan Lever (since renamed Hindustan Unilever) and created history. Surf steadily lost market share in India’s detergent market, and local brands including Ghari and Nirma made the roaring multinational tiger look like a purring cat.
I was reminded of that when I saw advertisements for Micromax Canvas Turbo mobile phones, featuring Hollywood’s Australian-born star Hugh Jackman as its stunning, handsome model.
The message was unmistakable. Here was a Gurgaon company showing some sleek engineering, product features and design and announcing — or trying to announce to the world — that it was not just any cut-price competitor.
Also there was Noida-based Lava International showcasing its Iris handsets with a catchy slogan: “We put the art in the smart.”
Only time can tell if these products will match up to their ads, but one thing is clear. In the smartphone and tablet industry led by Apple’s pioneering style and Samsung’s challenging demeanour, the field is more crowded than we care to admit.
The reason is simple. With the Android operating system designed to proliferate the handset and the tablet as a generic than as a brand, the industry is “commoditised” to a point where if you take out the newest patented features, an inspired manufacturer can go far in giving the average consumer good value for money.
After all, most of the manufacture takes place in China or Taiwan in the hands of seasoned contract manufacturers who can stick any brand on the products!
The scene is strikingly similar to the washing-powder industry, in which the “blue detergent” is what most people are buying, and most of the differentiation lies in minor tweaks, add-ons, marketing, packaging and advertising.
Your handphone/tablet is now the 21st Century detergent powder. The game is shifting to what the device can do for your life and lifestyle. For the bulk of India’s 700 million-odd mobile phone subscribers, the journey from the plain feature phone to smartphones is not about ultra-cool gizmos but simpler things like getting on to the Net and doing the basics of email, social networking and using apps for videos, education, news, music and ticket-booking.
What we can expect in this game next is a series of new winners that focus on the lifestyles of the simple consumer. Losers may be big brands with too much of attitude and pride in their past. | [
{
"key": "website_description",
"type": "global",
"value": "This website is an Indian English-language daily newspaper introduced and founded in 1924 by Sunder Singh Lyallpuri, founder-father of the Akali movement and the Shiromani Akali Dal in the Punjab Province. It played integral roles in the Indian independence movement as a nationalist daily."
}
] |
4.5 out of 5 stars (180 Reviews)
$1.19 Straight-Edge Ruler with Books of the Bible
$0.59 Pocket Prayers: 40 Simple Prayers That Bring Peace and Rest
$2.49 How to Study The Bible
$5.00 God, I Need to Talk to You about My Bad Temper
$1.49 A Life God Rewards: Why Everything You Do Today Matters Forever
$2.99 A Shepherd Looks at Psalm 23, Mass Market Edition
$2.99 God, I Need to Talk to You About Talking Back
$0.99 The Promise of Security, Booklet
Format: PaperbackNumber of Pages: 96Vendor: Barbour PublishingPublication Date: 2008Dimensions: 6.88 X 4.19 (inches)ISBN: 1602600147ISBN-13: 9781602600140Availability: In Stock
Retail: $1.49 Save 34% ($0.50) 4.5 Stars Out Of 5 223 Reviews Availability: In Stock CBD Stock No: WW897044 Add To Cart
Retail: $3.99 Save 38% ($1.50) 4.5 Stars Out Of 5 269 Reviews Availability: In Stock CBD Stock No: WW82640 Related Products
Page 1 of 36 12345 Next |Last Great
This book was purchased for Outreach Ministry bus trip to see Samson at Sight & Sound. Perfect gift.
I use this book on prayer night at church and it comes in very handy and is a great tool to use, Thank you for this book
Very helpful book on prayer
John Wesley's thought on prayer are truly powerful! Helpful little book. | [
{
"key": "website_description",
"type": "global",
"value": "This website is a Christian catalog and internet retailer.\nChristian Book Distributors was started in 1978 by Stephen Hendrickson, 19 years old and a sophomore at Central Bible College in Springfield, Missouri, out of his parents’ home in Lynn, Massachusetts."
}
] |
mirandoII: Sanjuro: Galleries: Digital Photography Review
mirandoII
Features1.34KShooting ExperienceWith greater clarity: Nikon D810498Camera reviewPanasonic Lumix DMC-FZ1000 Review619In-depth reviewNikon 1 V3: One step ahead63Mountain MagicShooting in the Lofoten Islands1.89KFeatureWhat is equivalence?226Dive In2014 Waterproof Camera RoundupSmugMug FilmsJoel Grimes: Master of illusionsIn-depth reviewObject of desire? Fujifilm X-T1In-depth ReviewSmaller, faster ... better? Canon G1 X Mark II104Updated GalleryLeica T Typ 701 real-world samplesSmaller, lighter, FasterHands-on: GoPro Hero 3+ Black Edition725In-Depth Camera ReviewSony Cyber-shot RX100 IIIConversationsDPReview talks with industry executivesTips from travel photographer Steve Davey More accurate color with camera calibration 163What's old is new againThe Lomography Petzval 85mm lens50MP medium-format beastPentax 645Z hands on Underwater surpriseSwimming with jellyfishIn-depth reviewPanasonic Lumix GM1: Sizing it upPhotographer profileEngineering a Dream: Benjamin Von Wong Is it sharp wide open?Fujifilm XF 56mm F1.2 R samples gallery | [
{
"key": "website_description",
"type": "global",
"value": "This website is a website about digital cameras and digital photography, established in November 1998. The website provides comprehensive reviews of digital cameras, lenses and accessories, buying guides, user reviews, and forums for individual cameras, as well as general photography forums."
}
] |
Patent US5776298 - Tissue preparation apparatus and method - Google Patents
An apparatus for mounting a tissue specimen on a chuck for sectioning in a cryostat including a base, a clamp for receiving a tissue preparation slide, a chuck holder secured to the base for holding the chuck in a predetermined orientation relative to the clamp, a support secured to the base and extending...http://www.google.com/patents/US5776298?utm_source=gb-gplus-sharePatent US5776298 - Tissue preparation apparatus and method
Publication number US5776298 A
Application number US 08/690,298
Publication number 08690298, 690298, US 5776298 A, US 5776298A, US-A-5776298, US5776298 A, US5776298A
Inventors James W. Franks
Original Assignee Franks; James W.
Patent Citations (11), Non-Patent Citations (30), Referenced by (21), Classifications (16), Legal Events (7)
Tissue preparation apparatus and method
US 5776298 A
An apparatus for mounting a tissue specimen on a chuck for sectioning in a cryostat including a base, a clamp for receiving a tissue preparation slide, a chuck holder secured to the base for holding the chuck in a predetermined orientation relative to the clamp, a support secured to the base and extending therefrom and terminating in a distal end, and, means for slideably securing said clamp to said support. The clamp is positionable between a first location in which the clamp is at a minimum distance from the chuck holder and a second location in which the clamp is at a maximum distance from the chuck holder. A method for using the apparatus is likewise disclosed.
1. An apparatus for mounting a tissue specimen on a tissue mounting surface of a tissue chuck for sectioning in a cryostat, said apparatus comprising:
a clamp for receiving a glass tissue preparation slide having at least one face;
a chuck holder secured to said base for holding said tissue mounting surface of said chuck in a predetermined orientation relative to said clamp;
a support secured to said base and extending therefrom and terminating in a distal end; and,
means for slideably securing said clamp to said support comprising a rail fixedly secured to said support, a conveyor block movably secured to said rail and constrained by said rail to travel along a linear path, said block including means for preventing rotation of said block relative to said rail, said block fixedly secured to said clamp; and,
means for providing a predetermined force acting on said clamp, comprising a pulley rotatably mounted adjacent said distal end and having an annular channel therein, a cable having a first end connected to said clamp and a second end connected to a counterweight, said cable received within said channel, said predetermined force tending to move said clamp from said first position to said second position;
wherein said clamp is positionable between a first location in which the clamp is at a minimum distance from said chuck holder and a second location in which the clamp is at a maximum distance from said chuck holder, and said one face of said tissue mounting slide is substantially parallel to said tissue mounting surface of said chuck at said first location, said second location, and all locations therebetween.
2. The apparatus of claim 1 wherein said clamp comprises
at least one first arm extending away from said block, said first arm fixed relative to said block,
at least one second arm,
a hinge, said second arm secured to said hinge, said hinge providing for rotation of said second arm relative to said block, said one second arm rotatable between a first position proximate said first arm and a second position distant therefrom, and
means for locking said one second arm in said first position.
3. The apparatus of claim 2 wherein said means for locking said second arm in said first position comprise a slot extending away from said block, a hinge support slideably received in said slot, said hinge support positionable relative to said hinge so as to prevent rotation of said second arm.
4. The apparatus of claim 3 wherein said hinge support includes an adjustable bearing cap which is selectively adjustable to increase or decrease interference between the bearing cap and the hinge.
5. The apparatus of claim 2 wherein said clamp includes two first arms in spaced relation to each other, each of said first arms having a lower surface facing said base, said lower surfaces defining a first reference plane, and said first reference plane is perpendicular to said linear path.
6. The apparatus of claim 5 wherein said means for locking said second arm in said first position comprise a slot extending away from said block, a hinge support slideably received in said slot, said hinge support positionable relative to said hinge so as to prevent rotation of said second arm.
7. The apparatus of claim 6 wherein said hinge support includes an adjustable bearing cap which is selectively adjustable to increase or decrease interference between the bearing cap and the hinge.
8. The apparatus of claim 2 wherein said clamp includes two second arms in spaced relation to each other, and rotation of said second arms defines two second reference planes, and said chuck holder is located between said second reference planes.
9. The apparatus of claim 8 wherein said means for locking said one second arm in said first position comprise a slot extending away from said block, a hinge support slideably received in said slot, said hinge support positionable relative to said hinge so as to prevent rotation of said second arm.
10. The apparatus of claim 9 wherein said hinge support includes an adjustable bearing cap which is selectively adjustable to increase or decrease interference between the bearing cap and the hinge.
11. The apparatus of claim 8 wherein said clamp includes two first arms in spaced relation to each other, each of said first arms is located between said second reference planes, each of said first arms having a lower surface facing said base, said lower surfaces defining a first reference plane, and said first reference plane is perpendicular to said linear path.
12. The apparatus of claim 11 wherein said means for locking said one second arm in said first position comprise a slot extending away from said block, a hinge support slideably received in said slot, said hinge support positionable relative to said hinge so as to prevent rotation of said second arm.
13. The apparatus of claim 12 wherein said hinge support includes an adjustable bearing cap which is selectively adjustable to increase or decrease interference between the bearing cap and the hinge.
This invention relates to the preparation of tissue samples for sectioning, and specifically to preparation for tissue sectioning incidental to the Mohs tissue surgical technique.
The Mohs tissue surgical technique, which was developed by Frederic E. Mohs of Madison, Wis., is a method of removing skin tumors such as cutaneous malignancies and certain major carcinomas, and evaluating sections (very thin slices) of the tissue under a microscope. In order for Mohs surgery to be successful, high quality horizontally cut frozen tissue sections must be produced and microscopically reviewed to determine whether any residual tumor has spread beyond the tissue sample.
The Mohs process begins with the excising of a tissue sample which includes the skin tumor. The tissue sample is then marked for orientation purposes, for example, by scoring with a scalpel and marking the sample immediately left or right of the score with ink, to allow the surgeon to determine where additional excisions must occur should the results of an inspection of a microscopic section of tissue sample indicate that the tumor has spread beyond the excised tissue sample. If residual tumor is indicated by the microscopic inspection, additional tissue is excised, and the procedure is repeated until there are no indications that the tumor has spread beyond the excised tissue samples.
The surface of the excised tissue to be inspected is the curved, generally bowl-shaped surface that results from the passage of the scalpel below the surface of the skin. This bowl-shaped surface must be converted to a planar surface in order to be sliced by a device known in the art as a microtome. The microtome is typically located in a refrigerated unit, called a cryostat, which is capable of maintaining an internal temperature of -20 degrees Celsius or below.
To enable this sectioning or slicing, the tissue must be mounted on a cryostat chuck with the flattened or planar surface exposed and perpendicular to the long axis of the cryostat chuck. The chuck and attached tissue sample are then placed into a chuck fixture in the cryostat where the tissue is cut into frozen sections having a thickness of only five to seven micrometers. Each section is then placed on a microscope slide and the section is stained by dipping the slide in solvents and various dye solutions. After the desired amount of staining is achieved, a clear glue-like substance is used to attach a thin layer of glass called a "cover slip".
The dye causes cell walls, cell contents, and also extra-cellular material within the section, which would normally appear transparent, to be readily visible when viewed under a microscope for the presence of malignant cells and also for a host of inflammatory reaction to those malignant cells. If the surgeon determines that carcinoma cells are present in the section, further excision of tissue from the patient is necessary.
As those skilled in the art will readily appreciate, if the first section does not include all of the formerly bowl-shaped surface, which may occur if the planar surface is not parallel to the path of relative movement between the cryostat knife and the tissue sample, then the surgeon must review subsequent deeper sections until a determination can be made that all of the formerly bowl-shaped surface has been evaluated. This can be a time consuming effort, since each section must be stained and microscopically examined and interpreted by the surgeon before a determination can be made as to whether further excision of tissue is necessary. Therefore, orientation of the mounted tissue sample so that the planar surface is parallel to the path of the cryostat knife is key to ensuring that the cutting time involved in sectioning the tissue sample will be a minimum, since that means that the first tissue section may be the only one that the surgeon needs to evaluate.
The prior art discloses various methods and/or devices which attempt to solve this problem of flattening the bowl-shaped surface to obtain a perfect section (as defined herein below). The first method, referred to as the American Optical Heat Extractor, involves use of a copper jig to hold a cryostat chuck, and a solid metal cylinder which is movably attached to the jig. (This type of jig and metal cylinder was initially offered on cryostats manufactured by American Optical, and currently standard equipment on most cryostats regardless of the manufacturer.) The jig, chuck and cylinder are maintained at cryostat temperatures (-20 degrees C.), and O.C.T. fluid (a clear, tissue mounting fluid such as this is sold under the brand name Tissue Tek II O.C.T. Compound, by Miles Laboratories, Inc.) is placed onto the tissue mounting surface of the chuck. (The O.C.T. has the general consistency and viscosity of egg whites, and freezes at a temperature below that at which the tissue samples freeze.) A tissue sample is then immediately placed onto the liquid O.C.T. with the bowl-shaped surface facing away from the tissue mounting surface of the chuck. The metal cylinder is then lowered onto the tissue sample, sandwiching the specimen between the chuck and the metal cylinder and extracting heat from both the tissue specimen and the O.C.T. After 30 seconds or so when both the tissue specimen and the O.C.T. are frozen, the cylinder is somehow jarred to free it from the tissue specimen and the O.C.T., leaving the tissue specimen and the O.C.T. frozen to the chuck. Once frozen, the O.C.T. acts as a glue by bonding the tissue to the chuck, and also surrounding and supporting the tissue sample so it can be subsequently sliced by the microtome within the cryostat. Unfortunately, the first tissue section produced using this method often fails to include the complete periphery of the tissue specimen, requiring the review of multiple sequential tissue sections to ensure that no tumor is present on the formerly bowl-shaped surface.
A second method, referred to as the American Optical Tissue Presser, is a variation on the American Optical Heat Extractor, but includes a spring that partially supports the metal cylinder so that the full weight of the cylinder does not rest on the tissue specimen. Unfortunately, this method also often fails to produce first tissue sections which include the complete periphery of the tissue specimen. Accordingly, the review of multiple sequential tissue sections to ensure that no tumor is present on the formerly bowl-shaped surface is often required.
A third method, referred to as the Bard Parker scalpel handle method, involves freezing the tissue specimen to the chuck while using the flat handle of a metal scalpel to flatten the bowl shaped surface while the temperature drops. The surgeon moves the scalpel handle back and forth across the tissue sample and "eyeballs" the relative flatness of the bowl-shaped surface. The scalpel is removed before it has a chance to stick to the freezing O.C.T. and tissue sample. This line-of-sight method becomes less exact when the edges of the tissue sample curl under or sink lower than the back-and-forth path of the scalpel handle. As a result, this method also often fails to produce first tissue sections which include the complete periphery of the tissue specimen.
A fourth method, referred to as the glass slide method, is the same as the Bard Parker scalpel handle method, except that a glass microscope slide is substituted for the scalpel handle. Alternately, the tissue specimen may be frozen to the glass slide, a drop of O.C.T. placed on the tissue, and then the slide is inverted and frozen to the chuck using the line-of-sight method. A fifth method, referred to as the forceps method, is the same as the Bard Parker scalpel handle method, except that a forceps handle is substituted for the scalpel handle. Both the fourth and fifth methods suffer from the same reliance on the "eyeball" method of the Bard Parker method, and accordingly, each method also often fails to produce first tissue sections which include the complete periphery of the tissue specimen.
A sixth method, referred to as the Miami Special, involves a specially designed pair of pliers having a chuck holder attached to one jaw and a flat metal plate attached to the other jaw. The bowl-shaped surface of the tissue specimen is frozen to the flat metal plate, and then a tissue chuck with O.C.T. on the tissue mounting surface thereof is placed into the chuck holder with the tissue mounting surface of the chuck facing the tissue specimen. The jaws are then closed, sandwiching the tissue specimen and O.C.T. between the tissue mounting surface of the chuck and the flat metal plate. A coolant is then used to freeze the O.C.T., usually by immersing the end of the pliers holding the tissue sample in liquid nitrogen. While the Miami Special represents a significant improvement over the "eyeball" methods discussed above, the flat metal plate is only parallel to the tissue mounting surface of the chuck at one position of the jaws, and therefore the Miami Special almost always yields a flattened, formerly bowl-shaped surface that is at a slant relative to the tissue mounting surface of the chuck. Accordingly, the Miami Special also often fails to produce first tissue sections which include the complete periphery of the tissue specimen.
A seventh method involves use of a cryostat chuck, a polished metal disk, and a two-part metal jig. The bowl-shaped surface of the tissue sample is flattened by cooling the metal disk to -20 degrees Celsius and rolling the bowl-shaped surface against the metal disk. The tissue freezes to the metal disk which prevents return of the original bowl-shape, and the disk and tissue are placed in a cryostat to prevent thawing of the tissue. While the metal disk and attached tissue are maintained at a subfreezing temperature, a warm cryostat chuck is covered with O.C.T. fluid, and placed into a fixed portion of a jig located in the cryostat. When solidification of the O.C.T begins, the metal disk is placed in a mobile portion of the jig, and brought into apposition with the partially solidified O.C.T. compound by sliding the mobile portion of the jig onto the fixed portion of the jig, and allowing all components to stabilize at -20 degrees Celsius. The mobile jig is then removed, and the metal disk is "popped" off leaving the tissue sample on the cryostat chuck. An alternate version of this method involves the use of a nitrogen cooled, polished metal disk to eliminate the need to work within the confines of the cryostat when flattening the tissue sample.
An eighth method, involves a Cryomold, something akin to a clear, thin plastic envelope in the shape of an ice cube tray for a single cube. A thin layer of O.C.T. is added to the inside bottom of the Cryomold, which is then placed against the bowl-shaped surface of the tissue sample to be examined. The Cryomold is placed on the freezing bar within the cryostat, and, working within the confines of the Cryostat, the surgeon flattens the tissue sample with forceps as the O.C.T. and tissue sample freeze. Additional O.C.T. is then added to fill the Cryomold. The tissue chuck then is placed on the gelatinous surface, and the entire arrangement, including the tissue sample, is allowed to freeze in the cryostat. After freezing is complete, the plastic envelope is peeled away and the tissue sample is ready for sectioning.
One problem with the Cryomold is that, because the Cryomold is flexible, it must be remain on a hard, flat surface (such as the freezing bar in the cryostat) until the tissue sample has been flattened and frozen to the Cryomold with the O.C.T., and therefore actual freezing of the tissue sample to the bottom of the Cryomold cannot be directly observed. Since the O.C.T. on the bottom freezes uniformly, when the O.C.T. freezes at the positions where the peripheral edge is being held to the bottom, it is also freezing at those positions where the periphery is not being held to the bottom, so that when the surgeon seeks to freeze these other positions of the edge to the bottom, the O.C.T. has solidified and cannot be squeezed out, thereby supporting the edge off the bottom at these positions. When additional O.C.T. (at room temperature) is added to the Cryomold, the frozen tissue can thaw and curl at the peripheral edge, and due to the relatively large volume of O.C.T. which is required to fill the Cryomold, the freezing of the O.C.T. to the tissue chuck takes considerably longer than many other methods known in the art. If the tissue sample floats or curls into undesirable positions before complete freezing of the tissue sample and O.C.T. occurs, the tissue sample and O.C.T. must be thawed and the embedding process repeated until the tissue sample is frozen to the bottom of the Cryomold. Once frozen, the surgeon may raise the Cryomold from the freezing bar and view the bowl-shaped surface of the tissue sample to determine whether the entire periphery has been frozen to the inside bottom of the Cryomold. If the surgeon determines that the entire periphery of the bowl-shaped surface is not frozen to the bottom of the Cryomold, the tissue sample and O.C.T. must be thawed and the embedding process repeated until the entire periphery is visible. Since the Cryomold method uses O.C.T., which is clear (at room temperature, white when frozen), to bond the bowl-shaped surface of the tissue sample to the bottom of the Cryomold, it may not be readily apparent whether the entire periphery is located is a single plane as desired, or whether pockets of O.C.T. have lifted portions of the bowl-shaped surface off the bottom of the Cryomold. As a result of the foregoing, the surgeon may need to remove in excess of 300 microns of tissue before obtaining a perfect section.
In a ninth method, a variation of the American Optical Heat Extractor referred to as the cork method, a frozen tissue "well" is prepared by making a ring of O.C.T. compound around a rubber stopper on a glass slide at -20 degrees Celsius. Upon freezing of the O.C.T., the stopper is removed, and the bottom of the well is warmed with a fingertip and the excess O.C.T. is removed with a cotton swab. The excised tissue is placed into the well with the bowl-shaped surface facing the slide and allowed to freeze inside the cryostat at -20 degrees Celsius while a metal probe is used to press the bowl-shaped surface against the glass slide during the freezing process. After the tissue is completely frozen, the well is filled with additional O.C.T. and a metal heat sink is applied for approximately 3 minutes to speed the freezing process and help flatten the tissue. The frozen tissue sample is then gently pushed off the slide after warming the undersurface of the slide with the fingertips. The tissue sample is then inverted and mounted onto a metal chuck with additional O.C.T. and the heat extractor at -20 degrees Celsius for approximately 1 minute, and when broken away is ready for sectioning. When mounting the tissue sample to the grooved surface of the tissue chuck, the surface to be cut is visually aligned during freezing, again with the goal, often not attained, of mounting the flattened, formerly bowl-shaped surface of the specimen so that it is parallel to the grooved mounting surface of the tissue chuck.
A tenth method, referred to as the Motley method, uses a cylindrical chuck holder within a sleeve which is vertically oriented and slideably positioned thereabout. The chuck holder includes a pipe for delivering liquid nitrogen into the sleeve (from a source which is controlled by a foot-actuated valve), and vent holes for allowing the gaseous nitrogen to escape from within the sleeve. The top of the sleeve defines a plane which is parallel to the plane in which the tissue chuck is held by the chuck holder. A microscope slide is placed on the top of the sleeve so as to form a bridge, and the bowl-shaped surface of the tissue sample is pressed into contact with the slide with forceps while liquid nitrogen is sprayed on the opposite side of the slide via the pipe, thus freezing the tissue sample to the slide. The slide and sleeve are lifted away from the chuck holder, and a tissue chuck having O.C.T. thereon (at room temperature) is then placed in the chuck holder. The slide is then inverted (so that the tissue sample is now frozen to the lower surface of the slide) and the sleeve and slide are then placed back over the chuck holder and, using both hands to support the sleeve and hold the slide to the top thereof, the surgeon slides the sleeve down over the chuck holder until the tissue sample rests in the O.C.T. on the tissue chuck. The foot pedal is then actuated to spray liquid nitrogen against the underside of the chuck until the O.C.T. freezes. The surgeon's finger is then used to warm the slide until the tissue separates therefrom.
One drawback to the Motley method is that as the tissue sample is being pressed down onto the top side of the microscope slide, liquid nitrogen is sprayed against the bottom side, and so completeness of attachment of the tissue sample peripheral edge to the slide cannot be determined until the after the tissue sample is completely frozen and the slide can be flipped over and viewed, by which time frozen condensation will likely frost the slide, making inspection difficult. If inspection does reveal incomplete attachment, the tissue sample must be melted and the attachment process repeated. Slide breakage may occur due to the relatively large diameter of the sleeve and the force required to press some tissue samples flat against the slide, and because there is no seal between the microscope slide and the sleeve, escaping nitrogen gas blows out the top of the sleeve towards the surgeon and may splatter O.C.T. in the direction of the surgeon. Additionally, since the frozen tissue sample begins to warm as soon as the nitrogen spray ceases, time is of the essence in lowering the sleeve below the chuck holder, placing the chuck with O.C.T. thereon into the chuck holder, raising the sleeve, placing the slide with frozen tissue on top of the sleeve and lowering the sleeve until the tissue sample rests in the O.C.T. If this process takes too long, the tissue will melt away from the slide, and the chuck (with dripping O.C.T.) must be removed from the chuck holder and the process of freezing the tissue sample to the slide must be repeated. As the device is used, excess O.C.T. is likely to find its way between the chuck holder and the sleeve making raising and lowering of the sleeve more difficult. If the O.C.T. freezes to the sleeve and chuck holder, it may be impossible to remove the sleeve prior to removing the frozen chuck and tissue sample, making their removal difficult. If the O.C.T. freezes to the chuck and chuck holder, it may be impossible to remove the chuck from the chuck holder.
An eleventh method, referred to as the cooled embedding head, eliminates the need to operate within the confines of the cryostat by utilizing an embedding head having a polished, planar metal surface which is cooled by CO2 to sub-freezing temperatures. The bowl-shaped surface of the tissue sample is flattened by manipulating the tissue to adhere to the cold metal of the polished surface so the once bowl-shaped surface is flattened down onto the head. With the tissue sample frozen to the embedding head, O.C.T. fluid is poured over the frozen tissue and, due to the temperature of the embedding head, the O.C.T. immediately begins to freeze. A tissue chuck received within a spring loaded tissue chuck holder and having a grooved mounting surface at room temperature is lowered by a system of levers, so that the grooved surface of the tissue chuck is brought into contact with the O.C.T. as is freezes. An additional nozzle through which CO2 gas can be sprayed is directed at the tissue chuck to facilitate rapid cooling of the tissue chuck and freezing of the O.C.T. to the tissue chuck. When the O.C.T. solidifies, the plane of the tissue chuck is parallel to that of the polished, planar metal surface of the embedding head and the tissue which is adhering to it. If the O.C.T. sufficiently adheres to the grooved surface of the tissue chuck, then the attached tissue sample embedded in the O.C.T. is forcibly separated from the polished, planar metal surface of the embedding head. The chuck with frozen tissue is then placed in the cryostat for tissue sectioning.
One of the disadvantages of this latter method is that the surgeon has no way to determine whether the tissue sample is properly flattened against the embedding head until after the tissue sample is separated therefrom. Therefore, if for any reason the tissue sample failed to completely flatten against the embedding head (e.g. a crease is formed in the bowl-shaped surface during flattening of the sample, an air bubble is trapped between the embedding head and the tissue sample during the process of attaching the tissue sample to the embedding head, etc.), tissue sections cut from the tissue sample will not include the entire surface of the formerly bowl-shaped surface. If this situation goes undetected, the tissue section may not include cancerous material which was otherwise detectable. If the surgeon is somehow able to detect a crease or bubble in the tissue sample after freezing the tissue sample to the embedding head, the tissue sample must be thawed, rinsed and refrozen to the embedding head. However, such excessive thawing and refreezing of the tissue sample causes cell lysis, (breakage of the cell walls in the tissue sample and leakage of cell contents) which significantly changes the tendency of cells to absorb stain during the staining process described above, and gives cells a deflated and less defined architecture. This varied stain absorption and shrinkage of cells can make interpretation of the finished slides more difficult and error prone. Another disadvantage of this latter process is that once the O.C.T. is placed on top of the frozen tissue sample and embedding head, it immediately begins to cool, which leads to both condensation of humidity on the exposed surfaces of the O.C.T. and a dramatic increase in the viscosity of the O.C.T. As those skilled in the art will readily appreciate, the condensation becomes a frost which creates an interface between the tissue chuck and the O.C.T., and the increased viscosity reduces the tendency of the O.C.T. to flow into the voids of the textured surface of the tissue chuck, both of which may result in inadequate bonding of the O.C.T. to the tissue chuck and subsequent detachment of the tissue sample from the tissue chuck when the surgeon attempts to forcibly break away the frozen tissue sample and O.C.T. from the embedding head. Quickly lowering the tissue chuck onto the O.C.T. immediately after placing the O.C.T. on the embedding head can alleviate some of the effects of condensation and increased viscosity, but it may not allow adequate time for air present in the voids of the textured surface of the tissue chuck to escape, thereby preventing the O.C.T. from flowing into the voids and producing inadequate bonding of the O.C.T. to the chuck and the attendant problem described above. Likewise, placing an excess amount of O.C.T. on the embedding head and tissue sample while keeping the heat transfer rate of the embedding head constant will allow the surgeon a little more time for the O.C.T. to flow into voids of the textured surface of the tissue chuck (due to the sheer volume of the O.C.T.), but if the excess O.C.T. flows down the sides of the embedding head and bonds thereto, problems associated with separation of the tissue sample and O.C.T. from the embedding head may be aggravated when this O.C.T. freezes in the form of icicles. So dealing with the problems of attaching the chuck to the tissue and rapidly freezing the O.C.T. on the embedding head can cause additional problems when the time comes to remove the chuck, tissue sample, and O.C.T. from the embedding head. Thus, timing and the skill of the operator (whether a surgeon or a technician) becomes critically important to the tenth method.
Although problems associated with detachment of the tissue sample from the tissue chuck (when the surgeon attempts to forcibly break away the frozen tissue sample and O.C.T. from the embedding head) can be addressed by wiping a film of oil (such as petroleum jelly) on the embedding head prior to flattening the bowl-shaped surface thereto, this obviously makes it more difficult to get the tissue to adhere to the embedding head in the first place since the purpose of the oil is to reduce the tendency of the tissue sample to adhere to the embedding head. In addition, it adds one more step to the tissue sample preparation, since the embedding head must be re-oiled for each tissue sample. (Of course, if the embedding head becomes nicked or scratched during the course of normal use, this separation problem will be further aggravated.)
Most importantly, any method of preparing tissue samples which requires forcibly separating the flattened, formerly bowl-shaped surface of the tissue sample from the object to which it is adhered has the inherent risk that, when the tissue sample is separated therefrom, the very cancer cells which the surgeon is searching for may remain adhered to that object, and therefore not appear on the tissue slices produced in the cryostat. The nature of cancer cells increases the likelihood for the occurrence of this problem, because cancer cells are delicate and friable, and have no significant structural support as compared to healthy skin tissue. Furthermore, any method which relies on warming of such object to release the formerly bowl-shaped surface of the tissue sample therefrom introduces the problems associated with cell lysis described above.
An eleventh method is disclosed in U.S. Pat. No. 4,752,347 issued to Rada on Jun. 21, 1988, which is hereby incorporated by reference. Rada discloses a method and apparatus in which a tissue sample is placed onto a polished disk platform and covered with a flexible plastic membrane, such as polyethylene plastic sheet material. A vacuum source is activated, which evacuates air from between the membrane and the platform, drawing the bowl-shaped surface of the tissue sample toward the platform. Liquid nitrogen is then used to freeze the tissue sample to the platform, and once the tissue sample is frozen to the platform, the membrane is peeled away from the platform and the tissue sample. In one embodiment, O.C.T. is applied to the platform on which the tissue sample is located and to a corrugated platform such as a tissue chuck. After the O.C.T. has partially solidified, the platforms are mated together and the O.C.T. is allowed to solidify. Then the platforms are forcibly separated, or heated if need be, to remove the tissue sample from the platform to which it was originally frozen and leave it frozen to the corrugated platform. Unfortunately, since the invention disclosed in Rada relies on heat or force to free the tissue sample from the platform to which it was originally mounted, it suffers from the same problems associated therewith and described above.
As those skilled in the art will readily appreciate, in order to obtain a perfect section (i.e. a tissue slice which includes the entire flattened, formerly bowl-shaped surface, including the epidermal periphery thereof) the plane in which the flattened, formerly bowl-shaped surface lies must be substantially parallel to the plane in which the cryostat knife moves relative to the tissue sample. For example, to obtain a perfect section having a thickness of only 5 micrometers from a tissue sample having a flattened, formerly bowl-shaped surface measuring 1 centimeter in diameter, the acute cutting angle between the flattened, formerly bowl-shaped surface and the plane in which the cryostat knife moves relative to the tissue sample must be less than 30 thousandths of a degree (i.e. the arctangent of 5×10-6 /1×10-2). For tissue samples having a larger diameter, the angle must be even less. The relatively low percentages of perfect sections produced by the prior art indicate that none consistently provides a cutting angle within the acceptable tolerance.
Adjustable chuck fixtures are available within most cryostats to assist orientation of the planar surface in those situations where initially the planar surface is not parallel to the path of relative movement between the cryostat knife and the tissue sample. However, adjustable fixtures are expensive, and adjustment of the fixture can be dangerous due to the close proximity of the cryostat knife. Further, the fixture must still be adjusted to be within the cutting angle tolerance described above, and adjusting the fixture to the correct orientation is an iterative process that can consume a considerable amount of time. Adjusting the fixture to an angle for a specific tissue sample means that the next tissue sample will likely require adjustment of the fixture as well. If done incorrectly, this may require evaluation of many subsequent slices in order to view all of the formerly bowl-shaped surface.
Cryostats are generally designed such that when the chuck is placed within a chuck fixture within the cryostat, the tissue mounting surface of the chuck is parallel to the path of relative movement between the cryostat knife and the chuck. Therefore, as long as the planar surface is parallel to the path of relative movement between the cryostat knife and the tissue sample, the first slice should be the only section that need be evaluated. Unfortunately, despite the various methods and devices disclosed in the prior art to assist in obtaining a perfect tissue section, the problem persists.
What is needed is a quick, inspectable means and method of mounting a tissue sample to a cryostat chuck such that the planar, formerly bowl-shaped surface is consistently parallel to the tissue mounting surface of the chuck, does not require forcible removal of the tissue sample from an object or warming of the object to obtain separation of the tissue sample therefrom, and which does not require the timing or level of operator skill required by the prior art.
It is therefore an object of the present invention to provide an improved apparatus for preparing tissue samples for sectioning by a cryostat.
Another object of the present invention is to provide an apparatus which precisely orients tissue samples for optimum sectioning.
Another object of the present invention is to provide for visual inspection of the flattened bowl-shaped surface of the tissue sample prior to contact with the O.C.T. compound.
Another object of the present invention is to provide an apparatus which facilitates manipulation of the tissue sample for optimum sectioning.
Another object of the present invention is to provide an apparatus which is time and cost effective, so as to reduce the overall surgical time and expense necessary to effect the total excision of a malignancy.
Another object of the present invention is to provide an apparatus which is relatively simple to use, economical to manufacture, and particularly well adapted for the proposed usage thereof.
Another object of the present invention to provide an improved method for preparing tissue samples for sectioning by a cryostat.
According to the present invention, an apparatus for mounting a tissue specimen on a chuck for sectioning in a cryostat is disclosed, which apparatus comprises a base, a clamp for receiving a glass tissue preparation slide, a chuck holder secured to the base for holding the chuck in a predetermined orientation relative to the clamp, a support secured to the base and extending therefrom and terminating in a distal end, and, means for slideably securing said clamp to said support. The clamp is positionable between a first location in which the clamp is at a minimum distance from the chuck holder and a second location in which the clamp is at a maximum distance from the chuck holder. Additionally, the present invention discloses a method for mounting a tissue specimen on a tissue mounting surface of a tissue chuck for sectioning in a cryostat or the like comprising providing a chuck holder for holding the tissue mounting surface of the chuck essentially parallel to a primary reference plane. The primary reference plane is defined by primary arms of a clamp that is slideably moveable with respect to the chuck holder without changing the relative orientation of the chuck holder to the primary reference plane. The chuck is secured into the chuck holder such that the tissue mounting surface of the chuck is substantially parallel to the primary reference plane, and a puddle of tissue mounting fluid is placed on the tissue mounting surface of the chuck. A surface of the tissue specimen to be sectioned is then frozen to one face of a glass tissue preparation slide, and the glass tissue preparation slide is received within the clamp such that the one face is parallel to the primary reference plane. The clamp is then slid towards the chuck holder until the tissue sample is immersed in the tissue mounting fluid, and coolant is then sprayed on the slide, freezing the tissue mounting fluid to the tissue mounting surface of the chuck, the one face of the slide, and the tissue sample. The slide is then removed from the tissue sample and frozen tissue mounting fluid.
FIG. 1 is a perspective view of the apparatus of the present invention, showing a cut-away view of the support.
FIG. 2 is a perspective view of the support, and conveyor block of the present invention, showing a cut-away view of one of the loop paths.
FIG. 3 is a perspective view of the apparatus of the present invention, showing the clamp at the first location and a partially cut-away view of the freezing chamber above the slide.
FIG. 4 is a perspective view of the apparatus of the present invention, showing the clamp at the second location.
FIG. 5 is the perspective view of FIG. 2, showing the hinge support in a retracted position.
FIG. 6 is a partial cut-away view of the adjustable bearing cap of the present invention.
FIG. 7 is a perspective view of the tissue chuck and chuck holder used in the present invention.
FIG. 8 shows a tissue sample being frozen to a microscope slide for use with the apparatus of the present invention.
The apparatus 10 of the present invention as shown in FIG. 1 includes a base 12 having a planar base surface 14, to which is secured a chuck holder 16 and a hollow clamp support 18. The support 18 extends from the base surface 14 and terminates in a distal end 20. The present invention further includes a clamp 22 for receiving a tissue preparation slide 24 of the type known in the art and typically made of glass. The tissue mounting slide has two faces 25,27 which are parallel to each other, and an edge 29 which defines the perimeter of the two faces 25,27.
The clamp 22 is fixedly secured to a conveyor block 26, preferably by bolts 28 which extend through holes (not shown) in the clamp 22 that are slightly larger than that diameter which would be necessary to simply accommodate the shaft of the bolt 28 extending therethrough. This slightly larger diameter allows for minor adjustments in the relative orientation between the clamp 22, and both the conveyor block 26 and the chuck holder 16. A rail 30 that is perpendicular to the base surface 14 is fixedly secured to the support 18 by bolts, screws or other manner known in the art, and the conveyor block 26 is movably secured to the rail 30. As shown in FIG. 2, in the preferred embodiment of the present invention the conveyor block 26 has two internal loop paths 32, and the rail 30 has two longitudinally extending rail grooves 34 on opposite sides of the rail 30. (Although only one of the loop paths 32 and one of the rail grooves 34 is shown in FIG. 2, it is to be understood that the conveyor block 26 and rail 30 are symmetric about the length of the rail 30.) Each of the loop paths 32 is located adjacent one of the rail grooves 34, and a portion of each loop path 32 is parallel to, and opens into, the groove 34 adjacent thereto.
The open portion of each loop path 32 constitutes a loop groove 36 which has the same dimensions, and opposes the rail groove 34 adjacent thereto. Ball bearings 38 having diameters only slightly less than the minimum width 40 of each loop path 32 are located therein, and the quantity of ball bearings 38 is such that the portion of each loop path 32 which is open to the rail groove 34 adjacent thereto is substantially filled with ball bearings 38 along the length thereof. Thus, as the conveyor block 26 moves along the rail 30, each ball bearing 38 rolling in each loop path 32 rolls into the open portion thereof and into the adjacent rail groove 34, rolls in the rail groove 34 along the length of the loop groove 36, and then rolls back into the closed portion of the loop path 32.
Each loop path 32 contains a sufficient quantity of ball bearings 38 such that the portion of each loop path 32 between the rail groove 34 and the loop groove 36 always has ball bearings 38 extending substantially along the entire length thereof, thereby interlocking the conveyor block 26 and the rail 30. Additionally, the gap 42 between each rail groove 34 and the adjacent loop groove 36 opposed thereto is sized such that the gap 42 is essentially equal to the diameter of the ball bearings 38. As those skilled in the art will readily appreciate, such a design allows the conveyor block 26 to move freely along the rail 30, but provides no degrees of freedom of rotation of the conveyor block 26 with respect the rail 30.
Thus the conveyor block 26 is slideably secured to the support 18 by the rail 30 and constrained thereby to travel along a linear path 44 that is perpendicular to the base surface 14, while the conveyor block 26 and the ball bearings 38 therein cooperate with the rail grooves 34 to prevent rotation of the block 26 relative to the rail 30. At the end 46 of the rail 30 opposite the base 12, a stop 48 is provided to prevent the conveyor block 26 from sliding off that end 46. The clamp 22 is thus positionable between a first location 50, as shown in FIG. 3, in which the clamp 22 is at a minimum distance from the chuck holder 16, (and may in fact be in contact therewith), and a second location 52 in which the conveyor block 26 contacts the stop 48 and the clamp 22 is at a maximum distance from the chuck holder 16, as shown in FIGS. 1 and 4.
In the preferred embodiment of the present invention, a pulley 54 having an annular channel 56 therein is rotatably mounted in the support 18 adjacent the distal end 20. A cable 58 received within the channel 56 has a first end connected to the conveyor block 26, and a second end connected to a counterweight 60 that is suspended within the hollow support 18. Consequently, the counterweight 60 provides a predetermined force which acts on the clamp 22, through cable 58 and the conveyor block 26, to provide a predetermined force acting on the clamp 22 which tends to move the clamp 22 from the first location 50 to the second location. In the preferred embodiment of the present invention, the counterweight 60 is substantially equal to the combined weight of the conveyor block 26, the clamp 22, the bolts 28 that secure the clamp 22 to the conveyor block 26, and a typical glass microscope slide 24 with a tissue sample 62 secured thereto. Thus, once the slide 24 is released from the clamp 22, as described herein below, the weight of the counterweight 60 exceeds the combined weight of the conveyor block 26, the clamp 22, the bolts 28.
Referring again to FIG. 1, the clamp 22 of the present invention includes two primary arms 64 in spaced relation to each other and extending away from the conveyor block 26. These primary arms 64 are fixed relative to the conveyor block 26, and preferably are integral with the portion of the clamp 22 which is bolted to the conveyor block 26. Referring to FIG. 3, a wall 37 extends between the primary arms 64, as does a hood 39 which extends away from the wall 37 and is integral with the primary arms 64. The wall 37 has a terminal edge 41 which is integral with a land 43. A slide stop 35 extends from the land 43 adjacent to each of the primary arms 64 to aid in proper positioning of the microscope slide 24, as described below. The wall 37 is preferably offset from each slide stop 35 by 1/8 to 1/4 of an inch, so that when a slide 24 is positioned within the clamp 22 against the slide stops 35, the slide 24, primary arms 64, wall 37, and hood 39 form a swirl pocket 45 immediately adjacent the slide 24.
Referring back to FIG. 1, the clamp 22 further includes a hinge 66 below the primary arms 64, and two secondary arms 68, in spaced relation to each other, are secured to the hinge 66. Thus, the hinge 66 provides for rotation of the secondary arms 68 relative to the conveyor block 26, such that the secondary arms 68 are rotatable between a first position 70 proximate the primary arms 64, as shown in FIG. 1, and a second position 72 distant therefrom at which the arms may be parallel to the rail 30, as shown in FIG. 4.
The clamp 22 has a locking mechanism 74 therein for locking the secondary arms 68 in the first position 70 (proximate the primary arms 64) for the purpose of clamping a microscope slide 24 between the primary and secondary arms 64,68. The locking mechanism 74, shown in cross-section in FIGS. 2 and 5, comprises a dovetail slot 76 in the clamp 22 extending away from the block 26, and a dovetail hinge support 78 slideably received in the dovetail slot 76. A positioning handle 80 is provided to facilitate selective positioning of the dovetail hinge support 78. As shown in FIG. 2, by sliding the dovetail hinge support 78 away from the support 18, the dovetail hinge support 78 is positionable relative to the hinge 66 so as to prevent rotation of the secondary arms 68 away from the primary arms 64, thus locking the secondary arms 68 in place. Conversely, as shown in FIG. 5, by sliding the dovetail hinge support 78 toward the support 18, the dovetail hinge support 78 is positionable relative to the hinge 66 so as to allow rotation of the secondary arms 68 away from the primary arms 64. As shown in FIG. 6, an adjustable bearing cap 200 is attached to one end of the dovetail hinge support 78. The bearing cap 200 is secured to the dovetail hinge support 78 by two small screws 202 which are threaded into the cap 200 but are not threaded into the dovetail hinge support 78. Sandwiched between the head 204 of each screw 202 and the dovetail hinge support 78 is an "O-ring" 206 made of neoprene or a similar material to allow the cap 200 to be tilted slightly with respect to the dovetail hinge support 78. A third screw 208, which is preferably an allen head screw, is threaded into the dovetail hinge support 78 but does not extend into the bearing cap 200. Instead, the third screw 208 bears on the underside 210 of the bearing cap 200, such that advancing the third screw 208 raises the leading edge 212 of the bearing cap 200. This adjustable feature of the bearing cap 200 allows for increasing or decreasing interference between the bearing cap 200 and the hinge 66 through adjustment of the relative position of the bearing cap 200 to the hinge 66 which compensates for any wear which might occur due to rubbing of the bearing cap 200 against the hinge 66.
Each of the secondary arms 68 preferably includes an "O-ring" 82 made of neoprene or a similar material to act both as a cushion between the secondary arms 68 and the microscope slide 24, and to provide a frictional force to hold the slide 24 securely in place when the clamp 22 is in the locked position, as shown in FIG. 1.
The chuck holder 16 serves the purpose of holding a cryostat chuck 84 in a predetermined orientation relative to the clamp 22, such that as shown in FIG. 4, the mounting surface 86 of the chuck 84 is essentially parallel to a primary reference plane 88 described in greater detail below. It is to be understood that the mounting surface 86 of the chuck 84 is textured or grooved to maximize the adherence of the tissue sample 62 to the mounting surface 86, and that therefore the mounting surface 86 is not actually planar. Accordingly, the term "essentially parallel to the primary reference plane 88" as used herein means that the mounting surface 86, excluding such texturing, lies within a plane that is substantially parallel to the primary reference plane 88. As those skilled in the art will readily appreciate, the presence of the "O-rings" 82 ensure that when a slide 24 is secured in the clamp 22, the slide 24 will be parallel to the primary reference plane 88 even if the secondary arms 68 are not exactly parallel to the primary arms 64.
Referring now to FIG. 7, the chuck holder 16 preferably is a solid cylinder 90 of rigid material having a coefficient of heat transfer less than most metals. A shaft hole 100, which has a diameter sized to receive the shaft 102 of the chuck 84, extends from the upper surface 94 of the chuck holder 16 along the centerline 96 thereof, which is parallel to the rail 30. The diameter of the upper surface 94 is preferably smaller than the diameter of the tissue mounting surface 86 of the chuck 84 to facilitate removal of the chuck 84 from the chuck holder 16. The chuck 84 typically includes a lip 300 made of a material such as neoprene to allow for easier, and more comfortable, handling of the chuck 84 when it has been cooled to sub-freezing temperatures. An orifice 118 in the chuck holder 16, as shown in FIG. 1, intersects the shaft hole 100 to provide access to the end 120 of the shaft 102 within the chuck holder 16 for the purpose of facilitating removal of the chuck 84 from the chuck holder 16 by pressing upwards on the end 120 of the shaft 102. This orifice 118 is appropriately sized so as to permit insertion of a thumb or finger.
Referring again to FIG. 4, rotation of the secondary arms 68 defines two secondary reference planes 122,124, and the chuck holder 16 is located between the secondary reference planes 122,124. Thus, rotation of the secondary arms 68 is not subject to interference with the chuck holder 16. Each of the primary arms 64 has a lower surface 126 facing the base 12, and together the lower surfaces 126, the terminal edge 41, and the land 43, as shown in FIG. 3, all lie in the same plane and define the primary reference plane 88. The primary reference plane 88 is perpendicular to the linear path 44 along which the conveyor block 26 is constrained to travel. As those skilled in the art will readily appreciate, since the microscope slide has two faces 25,27 which are parallel to each other, and one face 27 of the slide lies flush against the lower surfaces 126 of the primary arms 64 when the slide 24 is received within the clamp 22, both faces 25,27 are parallel to the primary reference plane 88 when the slide 24 is received within the clamp 22. Therefore, the clamp 22 is positionable between the first location 50 and a second location 52, and both faces 25,27 of the tissue mounting slide 24 are substantially parallel to the tissue mounting surface 86 of the chuck 84 at the first location 50, the second location 52, and all locations therebetween. Additionally, the primary arms 64 of the clamp 22 are slideably moveable with respect to the chuck holder 16 without changing the relative orientation of the primary arms 64 to the chuck holder 16.
Preferably the primary arms 64, as shown in FIG. 4, are centered over the chuck holder 16 and the spacing 128 between the primary arms 64 is less than the diameter of the mounting surface 86 of the chuck 84 in the chuck holder 16, so that movement of the clamp 22 towards the chuck holder 16 necessarily ceases when the primary arms 64 contact the mounting surface 86 of the chuck 84 when no slide 24 is present in the clamp 22, and when a slide 24 is present in the clamp 22, the interaction of the primary arms 64 and the mounting surface 86 of the chuck 84 does not produce a significant bending moment in the slide 24 and thereby cause breakage of the slide 24.
In operating the apparatus of the present invention, the clamp 22 is raised away from the chuck holder 16 and a chuck 84 is placed therein. The surgeon excises the skin tumor from the patient using the Mohs technique described above, producing a tissue sample 62 having a bowl-shaped surface 130. As shown in FIG. 8, the bowl-shaped surface 130 is pressed onto one face of a glass microscope slide 24 while a coolant such as liquid nitrogen is sprayed on the opposite face of the slide 24. As the bowl-shaped surface 130 is pressed against the nitrogen chilled slide 24, the bowl-shaped surface 130 freezes to the slide 24. By judiciously working around the periphery of the tissue sample 62 while pressing the sample 62 against the slide 24 (and intermittently spraying the opposite side of the slide 24 with nitrogen to maintain the slide 24 below freezing temperature), the entire bowl-shaped surface 130 can be frozen to the slide 24, thus flattening the surface which had been bowl-shaped. Because the surgeon can directly view the bowl-shaped surface of the sample 62 as the surgeon is freezing the sample 62 to the slide, the surgeon can ensure that the bowl-shaped surface does not become creased as it is pressed against the slide 24 and that no air bubbles become trapped between the sample 62 and the slide 24.
A small puddle of O.C.T. or similar tissue mounting fluid is deposited at the center of the mounting surface 86 of the chuck 84. With the surface of the slide 24 on which the tissue sample 62 is mounted facing the chuck 84 as shown in FIG. 1, the microscope slide 24 is then positioned against the lower surfaces 126 of the primary arms 64 and slid towards the rail 30 until the slide 24 contacts each of the slide stops 35. Using the positioning handle 80, the surgeon raises the secondary arms 68 into contact with the slide 24 by extending the dovetail support 78 from the dovetail slot 76 until the dovetail support 78 moves bearing cap 200 so that bearing cap 200 contacts and rotates the hinge 66 into the position at which the secondary arms 68 swing up and contact the slide 24, sandwiching the slide 24 between the primary and secondary arms 64,68. If necessary, the slide 24 is adjusted to center the tissue sample 62 over the puddle of O.C.T., and the dovetail support 78 is extended slightly further to support the hinge 66 and prevent the secondary arms 68 from rotating away from the primary arms 64.
As those skilled in the art will readily appreciate, since the slide 24 is flat, and the mounting surface 86 of the chuck 84 is parallel to the primary reference plane 88 defined by the lower surfaces 126 of the primary arms 64, clamping the slide 24 firmly against the lower surfaces 126 of the primary arms 64 necessarily positions the lower face 25 of the slide 24 in a plane that is substantially parallel to the plane in which the tissue mounting surface 86 of the chuck 84 is located. During the process that follows, liquid nitrogen may be sprayed onto the upper surface of the slide 24 (into the swirl pocket 45 between the primary arms 64) as needed to keep the tissue sample 62 frozen to the slide 24.
As shown in FIG. 3, the slide 24 is lowered into contact with the O.C.T. fluid on the mounting surface 86 of the chuck 84, so that the tissue sample 62 is immersed in the O.C.T. Coolant such as liquid nitrogen is then sprayed into the swirl pocket 45 until the O.C.T. freezes. As those skilled in the art will readily appreciate, since the slide 24 is being held firmly against the land 43 and the lower surface 126 of each of the primary arms 64, as long as the coolant is sprayed directly into the pocket 45, no splattering of the O.C.T. will occur as a result of the coolant spray, since the slide 24 shields the O.C.T. from the blast of the coolant spray.
Once the tissue sample 62 has been frozen to the mounting surface 86 of the chuck 84, the secondary arms 68 are rotated downward to clear the slide 24 as shown in FIG. 4, by retracting the dovetail support 78 into the dovetail slot 76 until the bearing cap 200 of the dovetail support 78 no longer contacts the hinge 66. The entire clamp 22 is then moved up and away from the slide 24 by a gentle upward tap on the clamp pin 132. The chuck 84, with attached tissue sample 62 and slide 24, can then be removed from the chuck holder 16 by reaching into the second orifice 118 of the chuck holder 16 with a finger and pressing upward on the end 120 of the chuck shaft 102. Further spraying of the slide 24 with liquid nitrogen causes the slide 24 to release from the sample 62 due to the relative differences in the coefficients of thermal expansion between the glass slide 24 and the water-based tissue sample 62. Thus, the tissue sample 62 is freed from the slide 24 without thawing the sample 62 or forcibly removing it therefrom, thereby avoiding the problems discussed above associated with these methods of releasing the sample 62 from the object to which it is attached. The resulting tissue sample 62 is frozen to the chuck 84 such that the formerly bowl-shaped surface is now parallel to the mounting surface 86 of the chuck 84. The chuck 84 can then be placed in a cryostat, and the tissue sample 62 sliced parallel to the mounting surface 86, sectioning the entire formerly bowl-shaped surface, including the peripheral edge thereof, with a single slice of the cryostat knife.
As those skilled in the art will readily appreciate, the first or second slice of tissue will produce a section of the tissue sample 62 that, through examination under a microscope, will indicate whether the tumor has spread beyond the tissue sample 62. Accordingly, the surgeon can quickly determine whether additional tissue must be removed to excise all of the tumor.
The present invention provides a quick, inspectable means and method of mounting a tissue sample to a cryostat chuck such that the planar, formerly bowl-shaped surface is consistently parallel to the tissue mounting surface of the chuck. Additionally, the present invention does not require the application of force or heat to the tissue sample to obtain removal of the tissue sample from the object to which it has been frozen. As a result, the present invention does not require the timing or level of operator skill required by the prior art to obtain consistently perfect tissue sections.
US3552733 * Dec 19, 1968 Jan 5, 1971 Pickett John E P Microtome chuck adapter for histologic tissue receptacle
1 B. Leshin, S. Cook, D. Frye, "Cryomold: A Device for Tissue Embedding in Mohs Micrographic Surgery", 1991, pp. 234-236, J. Dermatol. Surg. Oncol., vol. 17.
2 * B. Leshin, S. Cook, D. Frye, Cryomold: A Device for Tissue Embedding in Mohs Micrographic Surgery , 1991, pp. 234 236, J. Dermatol. Surg. Oncol. , vol. 17.
3 * C. Hanke, H. Menn, J. O Brian, Chemosurgical Reports: Frozen Section Processing with the Miami Special , Apr., 1983, pp. 260 262, J. Dermatol. Surg. Oncol. , vol. 9 No. 4.
4 C. Hanke, H. Menn, J. O'Brian, "Chemosurgical Reports: Frozen-Section Processing with the Miami Special", Apr., 1983, pp. 260-262, J. Dermatol. Surg. Oncol., vol. 9 No. 4.
5 C. Hanke, M. Lee, "Cryostat Use and Tissue Processing in Mohs Micrographic Surgery", Jan. 1989, pp. 29-32, J. Dermatol. Surg. Oncol., vol. 15 No. 1.
6 * C. Hanke, M. Lee, Cryostat Use and Tissue Processing in Mohs Micrographic Surgery , Jan. 1989, pp. 29 32, J. Dermatol. Surg. Oncol. , vol. 15 No. 1.
7 D. Gormley, "Evaluation of a Method for Controlled Tissue Embedding for Histologic Evaluation of Tumor Margins", 1987, pp. 308-315, Am. J. Dermatopathol., vol. 9 No. 4.
8 * D. Gormley, Evaluation of a Method for Controlled Tissue Embedding for Histologic Evaluation of Tumor Margins , 1987, pp. 308 315, Am. J. Dermatopathol. , vol. 9 No. 4.
9 G. Koehn, "A New Modification for Preparing Tissue Blocks for Cryostat Sectioning", 1992, pp. 485-486, J. Dermatol. Surg. Oncol., vol. 18.
10 * G. Koehn, A New Modification for Preparing Tissue Blocks for Cryostat Sectioning , 1992, pp. 485 486, J. Dermatol. Surg. Oncol. , vol. 18.
11 H. Randle, J. Zitelli, D. Brodland, R. Roenigk, "Histologic Preparation for Mohs Micrographic Surgery", 1993, pp. 522-524, J. Dermatol.Surg. Oncol., vol. 19.
12 * H. Randle, J. Zitelli, D. Brodland, R. Roenigk, Histologic Preparation for Mohs Micrographic Surgery , 1993, pp. 522 524, J. Dermatol.Surg. Oncol. , vol. 19.
13 J. Concepcion, "Letters to the Editor--How to Prepare Tissue Blocks", Feb. 1986, pp. 112-113, J. Dermatol. Surg. Oncol., vol. 12 No. 2.
14 * J. Concepcion, Letters to the Editor How to Prepare Tissue Blocks , Feb. 1986, pp. 112 113, J. Dermatol. Surg. Oncol. , vol. 12 No. 2.
15 L. Miller, Z. Argenyi, D. Whitaker, "The Preparation of Frozen Sections for Micrographic Surgery", 1993, pp. 1023-1029,, J. Dermatol.Surg. Oncol., vol. 19.
16 * L. Miller, Z. Argenyi, D. Whitaker, The Preparation of Frozen Sections for Micrographic Surgery , 1993, pp. 1023 1029,, J. Dermatol.Surg. Oncol. , vol. 19.
17 M. Dogan, S. Snow, J. Lo, "Rapid Skin Edge Elevation Using the OCT Compound Droplet Technique to Obtain Horizontal Microsections in Mohs Micrographic Surgery", 1991, pp. 857-860, J. Dermatol. Surg. Oncol., vol. 17.
18 * M. Dogan, S. Snow, J. Lo, Rapid Skin Edge Elevation Using the OCT Compound Droplet Technique to Obtain Horizontal Microsections in Mohs Micrographic Surgery , 1991, pp. 857 860, J. Dermatol. Surg. Oncol. , vol. 17.
19 N. Honda, D. Friedman, "A Simple Method of Tissue Embedding for Mohs Micrographic Surgery", May 1989, pp. 502-504, J. Dermatol. Surg. Oncol., vol. 15 No. 5.
20 * N. Honda, D. Friedman, A Simple Method of Tissue Embedding for Mohs Micrographic Surgery , May 1989, pp. 502 504, J. Dermatol. Surg. Oncol. , vol. 15 No. 5.
21 * Operations Manual, Cryo Hist , Date Unknow, pp. 1 15.
22 Operations Manual, Cryo Hist, Date Unknow, pp. 1-15.
23 R. Motley, P.Holt, "A simple device for optimal tissue preparation for Mohs micrographic surgery", 1992, pp. 57-59, British Journal of Dermatology, vol. 126.
24 * R. Motley, P.Holt, A simple device for optimal tissue preparation for Mohs micrographic surgery , 1992, pp. 57 59, British Journal of Dermatology , vol. 126.
25 * Reference Manual, AO Reichert Model 975C and 976C Histostat Cryostat Microtome , 1984, pp. 7 9.
26 Reference Manual, AO Reichert Model 975C and 976C Histostat™ Cryostat Microtome, 1984, pp. 7-9.
27 V. Carter, "A New Method for Preparing Tissue Blocks for Cryostat Sectioning", Jul. 1985, pp. 687-689, J. Dermatol. Surg. Oncol., vol. 11 No. 7.
28 * V. Carter, A New Method for Preparing Tissue Blocks for Cryostat Sectioning , Jul. 1985, pp. 687 689, J. Dermatol. Surg. Oncol. , vol. 11 No. 7.
29 W. Soohoo, B. Ruebner, P. Vogt, D. Wiese, "Orientation of Small, Flat, Frozen-Section Specimens", 1988, pp. 573-574, Am. J. Surg. Pathol., vol. 12, No. 7.
30 * W. Soohoo, B. Ruebner, P. Vogt, D. Wiese, Orientation of Small, Flat, Frozen Section Specimens , 1988, pp. 573 574, Am. J. Surg. Pathol. , vol. 12, No. 7.
US6387653 * Apr 9, 1999 May 14, 2002 Culterra, Llc Apparatus and method for automatically producing tissue slides
US7059139 * May 9, 1998 Jun 13, 2006 Marsing Jacquelyn D System for preparing cutaneous tissue samples for oncological histology study and diagnosis
US7237392 Jul 15, 2005 Jul 3, 2007 Richard Lynn Marsing System for preparing cutaneous tissue samples for oncological histology study and diagnosis
US7257953 * Apr 21, 2005 Aug 21, 2007 Rada David C Apparatus and method for preparing frozen tissue specimens
US8597565 * Mar 31, 2010 Dec 3, 2013 Fei Company Method for forming microscopic 3D structures
US20050247068 * Jul 15, 2005 Nov 10, 2005 Marsing Richard L System for preparing cutaneous tissue samples for oncological histology study and diagnosis
US20120058509 * Sep 8, 2010 Mar 8, 2012 Eric Jeffords Leininger Apparatus and method for affixing frozen tissue sections to glass or membrane microscope slides
CN102116713A * Dec 6, 2010 Jul 6, 2011 山西医科大学 Embedding bottom box special for embedding total larynx gross specimen through collodion
U.S. Classification 156/390, 83/915.5, 269/254.0MW, 156/80, 269/257, 156/498, 264/28, 269/909
International Classification G01N1/06, G01N1/42, G01N1/36
Cooperative Classification G01N1/06, Y10S269/909, G01N1/42, G01N1/36
Dec 26, 2005 FPAY Fee payment | [
{
"key": "website_description",
"type": "global",
"value": "This website is a search engine provided by Google. Handling over 3.5 billion searches per day, it has a 92% share of the global search engine market."
}
] |
exchange of fire in hebron. the obama administration has unveiled new rules to combat corporate tax inversions or companies move overseas to dodge u.s. taxes. companies like burger king, medtronic and the drugmaker abbvie have announced plans to relocate after buying foreign firms. critics say the rules announced monday by treasury secretary jack lew are not enough to end the practice, without involvement from congress. the obama administration is increasing the u.s. nuclear arsenal despite president obama's public championing of disarmament. when obama won the nobel peace prize in 2008, the nobel committee cited his steps toward reducing nuclear stocks around the world. but the "new york times" reports obama is overseeing extensive rebuilding of nuclear weapons at home, including at a new plant in kansas city, dedicated last month, which is larger than the pentagon, and employs thousands of people. according to a recent federal study, the u.s. is poised to spend up to $1.1 trillion over the next three decades on modernizing nuclear weapons. this is democracy now!, democracynow.org,
exchange of fire in hebron. the obama administration has unveiled new rules to combat corporate tax inversions or companies move overseas to dodge u.s. taxes. companies like burger king, medtronic and the drugmaker abbvie have announced plans to relocate after buying foreign firms. critics say the rules announced monday by treasury secretary jack lew are not enough to end the practice, without involvement from congress. the obama administration is increasing the u.s. nuclear arsenal despite...
investations into the alleged war crimes and the obama administration quietly closed its own inquiry last year without releasing its findings. after the massacre, dostum left afghanistan for many years but returned in 2009 to help hamid karzai win re-election. since then he has served in the largely ceremonial role as commander in chief of the afghan national army. we are joined now by two guests who have closely followed the story of the 2001 massacre as well as the rise of abdul rashid dostum. jamie doran is an independent documentary filmmaker who directed the 2002 film, "afghan massacre -- the convoy of death." in 2003, democracy now! became the first u.s. news outlet to air the film. he joins us by democracy now video stream from england. and with us in boston is susannah sirkin, director of international policy at physicians for human rights, the group that discovered the site of the mass graves of the taliban pow's. susannah sirkin, let's start with you. talk about what happened in 2001, why you are so deeply concerned about the new vice president of afghanistan. >> a large group o
investations into the alleged war crimes and the obama administration quietly closed its own inquiry last year without releasing its findings. after the massacre, dostum left afghanistan for many years but returned in 2009 to help hamid karzai win re-election. since then he has served in the largely ceremonial role as commander in chief of the afghan national army. we are joined now by two guests who have closely followed the story of the 2001 massacre as well as the rise of abdul rashid...
Democracy Now! : LINKTV : September 15, 2014 8:00am-9:01am PDT
another british captive, getty photographer alan henning. the obama administration has tripled its estimate of isil fighters in iraq and syria. haveia says the group may 31,500 fighters between the two countries up from an initial estimate of 10,000. pentagon spokesperson john kirby said the numbers to not change the mission. and thatrs got bigger has intensified the scope of the enemy you are facing. i do not think there is a direct line between that and the duration of the conflict or the difficulty of the conflict. everybody here at the pentagon those of me are up against and is taking it seriously. >> president obama met with a dozen columnists and pundits ahead of his speech last week declaring expanded strikes on the islamic state. according to the huffington post, the group includes david brooks and thomas friedman, george packer, and jeffrey goldberg. we will have more on the administration's expanded war on isil after headlines. in syria, dozens have reportedly been killed in government airstrikes. the attack reportedly killed at least 42 people, including seven children.
another british captive, getty photographer alan henning. the obama administration has tripled its estimate of isil fighters in iraq and syria. haveia says the group may 31,500 fighters between the two countries up from an initial estimate of 10,000. pentagon spokesperson john kirby said the numbers to not change the mission. and thatrs got bigger has intensified the scope of the enemy you are facing. i do not think there is a direct line between that and the duration of the conflict or the...
came as the obama administration announced it would implement new economic sanctions on russia over its handling of ukraine. a new round of european sanctions on russia takes effect today. human rights watch has found israel committed war crimes by attacking schools where displaced residents were sheltering gaza. the report looked at three attacks on united nations-run shelters this summer which killed at least 45 people, 17 of them children. it came a day after israel said it had opened criminal probes into two of the most publicized killings of palestinian civilians during this summer's assault, including one of the school attacks. but human rights watch noted quote "israel has a long record of failing to undertake credible investigations into alleged war crimes." south african olympian and double-amputee oscar pistorius, known around the world as "the blade runner," has been found guilty of culpable homicide, the equivalent of manslaughter, for killing his girlfriend. pistorius was acquitted of murder. judge taka-zee-la ma-see-pa accepted pistorius' claim he mistook reeva steenka
came as the obama administration announced it would implement new economic sanctions on russia over its handling of ukraine. a new round of european sanctions on russia takes effect today. human rights watch has found israel committed war crimes by attacking schools where displaced residents were sheltering gaza. the report looked at three attacks on united nations-run shelters this summer which killed at least 45 people, 17 of them children. it came a day after israel said it had opened...
Democracy Now! : KCSM : September 26, 2014 12:00pm-1:01pm PDT
university law school arguing fee obama administration had the right to kill u.s. citizens who belonged to al qaeda. >> some have argued the president is required to get permission from a federal court before taking action against a united states citizen who is a senior operational leader of al qaeda or associated forces. this is in play not accurate. -- simply not accurate. due process and judicial process are not one and the same, particularly when it comes to national security. the constitution guarantees due process, it does not guarantee judicial process. look, he is obviously sulying judicial predicates for what he felt was a righteous response by the president. there are those of us who severely and strongly disagree with that. who would suggest that there are other alternatives available. departmente official, as the headlong give or so to speak or lock keeper, his role is one that is divided. he is responsible to the broader american public. that is why the attorney general's office is the most independent of cap member -- cabinet member appointments and on the other hand serving
university law school arguing fee obama administration had the right to kill u.s. citizens who belonged to al qaeda. >> some have argued the president is required to get permission from a federal court before taking action against a united states citizen who is a senior operational leader of al qaeda or associated forces. this is in play not accurate. -- simply not accurate. due process and judicial process are not one and the same, particularly when it comes to national security. the...
administration. >> well, the peace movement was camey decimated when obama in and has been trying to rebuild ever since, but now i think we have to think of all of us as the peace movement. now if the time to say that if you are an environmentalist, you had better understand that were is the greatest polluter on the planet. if you care about having money for youth groups or for infrastructure, or for green energy, you had better understand that sucking money into the military -- we are now paying $7.5 million for just the bombing in iraq. imagine if we start going into syria. we cannot afford this. if you care about money in politics, this is the time to get out there and say this is part of the subsidy to the military-industrial complex. this is an issue for all of us out there now, and we have to get on the phones, into the streets, demand town hall meetings, get our present it is, and say to them, -- representatives, and say to them we want you to vote and say no. >> president obama vowed it would not repeat the recent wars. >> i want the american people to understand how these ef
administration. >> well, the peace movement was camey decimated when obama in and has been trying to rebuild ever since, but now i think we have to think of all of us as the peace movement. now if the time to say that if you are an environmentalist, you had better understand that were is the greatest polluter on the planet. if you care about having money for youth groups or for infrastructure, or for green energy, you had better understand that sucking money into the military -- we are...
see the obama administration being drawn more and more into the conflicts. >> we have to ask ourselves because we don't fully know. obama disappears in moments like this and reappears and says kind of big nomadic things. but are we being drawn into it or are we driving these things? it has been through ever since nato was created [indiscernible] this also true nato is deeply divided on the ukrainian issue. there's a war party, and the war party is led by poland and the three baltic states -- to a certain extent, romania, but not so much -- and britain. then there is a party that wants to accommodate russia, that thinks this is not entirely russia's fault. moreover, the germans, the french, the spanish, the at times, depend on russia in many ways for their economic prosperity. they want to negotiate, not punish, russia. where is obama? it would appear nowhere except occasionally he comes in as he given estonia and seem to a speech that favors the war party. >> let's go to the, the president obama when he was in the former soviet republic of estonia, blaming russia for the issu
see the obama administration being drawn more and more into the conflicts. >> we have to ask ourselves because we don't fully know. obama disappears in moments like this and reappears and says kind of big nomadic things. but are we being drawn into it or are we driving these things? it has been through ever since nato was created [indiscernible] this also true nato is deeply divided on the ukrainian issue. there's a war party, and the war party is led by poland and the three baltic...
Democracy Now! : KCSM : September 17, 2014 12:00pm-1:01pm PDT
adegbile in march. in an interview with the having to post, he said the obama administration did not expect such scrutiny over that case -- and the john dean catherine t macarthur foundation has announced its list of 20 when jean grant winners for 2014. among the grantees are filaker joshua oppenheimer and aijen poo, director of the national domestic workers alliance. the winnerthe winners will recee $625,000 to spend however they choose. to see our past interviews, you can go to democracynow.org. and those are some of the headlines. this is democracy now!, democracynow.org, the war and peace report. i'm amy goodman. we turns the latest on the plan to expand will intense -- to fight the militants. >> these american forces will not have a combat mission. we will not get dragged into another ground war in iraq. >> president obama speaking a week ago, vowing not to send ground troops into iraq to fight the islamic state. on tuesday, the most senior u.s. military officer revealed ground troops may be needed. general martin dempsey, chair of the u.s. military's joint chiefs of staff, testified b
adegbile in march. in an interview with the having to post, he said the obama administration did not expect such scrutiny over that case -- and the john dean catherine t macarthur foundation has announced its list of 20 when jean grant winners for 2014. among the grantees are filaker joshua oppenheimer and aijen poo, director of the national domestic workers alliance. the winnerthe winners will recee $625,000 to spend however they choose. to see our past interviews, you can go to...
Democracy Now! : LINKTV : September 18, 2014 8:00am-9:01am PDT
the islamic state. the senate is expected to pass a legislation today. the obama administration has lobbied heavily for the measure as part of its ramped up offensive against the islamic state which has claimed swaths of both iraq and syria. the vote came as president obama sought to provide reassurance the offensive will not involve ground troops in iraq. be clear.to the american forces that have been played to iraq do not and will not have a combat mission. support iraqi forces on the ground as they fight for their own country against these terrorists. as your commander-in-chief, i will not commit you and the rest of our armed forces to fighting another ground war in iraq. >> obama's comments came one day after general martin dempsey, of the joint chiefs of staff, acknowledged ground troops may be needed in iraq in the future. the islamic state has released a video that appears to warn the united states of the violent fate awaiting u.s. troops if they deployed to iraq. it was released they tuesday after dempsey's comments. secretary of state john kerry appeared before the senate f
the islamic state. the senate is expected to pass a legislation today. the obama administration has lobbied heavily for the measure as part of its ramped up offensive against the islamic state which has claimed swaths of both iraq and syria. the vote came as president obama sought to provide reassurance the offensive will not involve ground troops in iraq. be clear.to the american forces that have been played to iraq do not and will not have a combat mission. support iraqi forces on the ground...
Democracy Now! : LINKTV : September 4, 2014 8:00am-9:01am PDT
forceful public repudiation to date of the obama administration's policy by palestinian leader tied to president abbas. shows hamashis week has surged in palestinian public opinion since the israeli assault on gaza. according to the palestinian center for policy and survey research, hamas would defeat abb marginah party by what if national elections were held today. comments come days after israel approved its largest seizure of palestinian land in three decades, nearly 1000 acres in the occupied west bank. at a news briefing, the u.s. ambassador to the u.n. samantha power criticized israel's decision. >> the u.s. position on settlement activity is very well-known. we have long made clear our opposition to settlement activity. we're deeply concerned by the reports of expanded settlement activity over the last few days. we call on the government of israel to reverse its decision. i think these actions are contrary to israel's stated goal of achieving a permanent status agreement with the palestinians. >> despite saying it opposes israeli settlements, the obama administration has previou
forceful public repudiation to date of the obama administration's policy by palestinian leader tied to president abbas. shows hamashis week has surged in palestinian public opinion since the israeli assault on gaza. according to the palestinian center for policy and survey research, hamas would defeat abb marginah party by what if national elections were held today. comments come days after israel approved its largest seizure of palestinian land in three decades, nearly 1000 acres in the...
Democracy Now! : LINKTV : September 2, 2014 8:00am-9:01am PDT
a spouse or partner can obtain u.s. asylum. the ruling came after the obama administration abandoned a long-running federal stance in the case of an abuse victim from guatemala. president obama has vowed to take executive action on immigration reform by the end of the summer in the absence of congress, but he has reportedly considered a delay until after the midterm elections. "the new york times" reports he is deciding whether to put off action until november in a bid to help vulnerable senate democrats. the author and reporter charles bowden has died at the age of 69. he reported extensively for newspapers and magazines and altered 11 books to my many about drug violence in mexico after the passage of nafta. cartoonist max cannon told "the tucson sentinel" -- in 2010, charles bowden spoke to democracy now! about his views on how to end drug violence and massive migration in mexico. nafta.ave to negotiate we can have a peaceful country were destroys the livelihood of the people. you have to have the right to organize a union, decent wages. realize the war on drugs is a disaster. it
a spouse or partner can obtain u.s. asylum. the ruling came after the obama administration abandoned a long-running federal stance in the case of an abuse victim from guatemala. president obama has vowed to take executive action on immigration reform by the end of the summer in the absence of congress, but he has reportedly considered a delay until after the midterm elections. "the new york times" reports he is deciding whether to put off action until november in a bid to help...
concert in central park on saturday night. cuba has to announce the obama administration for extending the more than 50 euros bar go. extended these trade and barter for another year. the cuban foreign minister said u.s. restrictions on cuba have worsened under president obama. >> the state department has again included cuba and its unilateral an arbitrary list of states that sponsor international terrorism. increase the persecution about international financial transactions in the whole world and justify the blockade policy. under the president's administration, there's been unprecedented tightening of extraterritorial character of the blockade. with remarkable and unheard of emphasis on financial transactions through the imposition of multimillion fines on banking institutions of third countries. >> the united nations general sibley has voted overwhelmingly to condemn the u.s. embargo against cuba each year for more than two decades. protests continue in ferguson, missouri, called for the arrest of darren wilson. the officer who killed the unarmed african-american teenager michael brown.
concert in central park on saturday night. cuba has to announce the obama administration for extending the more than 50 euros bar go. extended these trade and barter for another year. the cuban foreign minister said u.s. restrictions on cuba have worsened under president obama. >> the state department has again included cuba and its unilateral an arbitrary list of states that sponsor international terrorism. increase the persecution about international financial transactions in the whole...
, what do you think the obama administration has done since his first administration? and what do you think he ought to be doing differently, on the question of israel-palestine and, in particular, his response to this most recent military assault on gaza? >> look, i have written about this for years now. it's not all that complicated. it is quite clear that, left to its own devices, if israel -- if the united states says to the palestinians, "hey, you guys have got to talk not to us -- you've got to talk to the palestinians, to the israelis, and you have to come to an understanding that's how peace is made, but we can't interfere. you know, we cannot tell israel what to do" -- left to their own devices, there will never be a palestinian state. and the question is -- i have very serious doubts that we have not gone beyond the point where a palestinian state is possible. the purpose of the settlement movement was to make it impossible. and i believe they have succeeded -- that project has achieved its goal. >> the jewish settlements. >> the jewish settlers have achieved the irreversibi
, what do you think the obama administration has done since his first administration? and what do you think he ought to be doing differently, on the question of israel-palestine and, in particular, his response to this most recent military assault on gaza? >> look, i have written about this for years now. it's not all that complicated. it is quite clear that, left to its own devices, if israel -- if the united states says to the palestinians, "hey, you guys have got to talk not to us...
Democracy Now! : KCSM : September 19, 2014 12:00pm-1:01pm PDT
has voted 78-22 in favor of a plan by the obama administration to train and equip syrian rebels as part of an offensive against militants known as the islamic state. just 10 democrats and 12 republicans voted against the plan. the measure passed the house of representatives earlier this week, but 85 democrats and 71 republicans voted against it. president obama praised congress for its rare i partisan action. >> as i said last week, i believe that we are strongest as a nation with the president and congress work together, and i want to thank leaders in congress for the speed and which they with approach this urgent issue, in keeping with the bipartisanship that is the hallmark of american foreign-policy at its best. >> the measure passed by congress does not actually have any funding attached to pay for arming and training the rebels. after passing the bills thursday, the senate adjourned for six weeks until after midterm election in november. the vote in the senate came as islamic state militants claimed threatened the kurdish city of kobani in northern syria after seizing 21 vill
has voted 78-22 in favor of a plan by the obama administration to train and equip syrian rebels as part of an offensive against militants known as the islamic state. just 10 democrats and 12 republicans voted against the plan. the measure passed the house of representatives earlier this week, but 85 democrats and 71 republicans voted against it. president obama praised congress for its rare i partisan action. >> as i said last week, i believe that we are strongest as a nation with the...
Democracy Now! : KCSM : September 9, 2014 12:00pm-1:01pm PDT
obama administration has acknowledged conducting economic spying, but denies it does so to benefit u.s. companies. report from the office of director of national intelligence published by the intercept news site reveals concerns about potential challenges to u.s. corporations from foreign that -- multinationals. it suggests using cyber operations against research facilities in a foreign country and then assessing "whether and how the findings would be useful to us industry." forrmer portfolio manager sac capital has been sentenced to nine years in prison for what the government has called the largest insider trading case in history. matthew martoma was charged with conducting illegal trades based on inside information about the development of an alzheimer's drug, netting two under 76 main dollars in profits and averted losses for sac capital. baltimore ravens runningback ray rice has been cut by his football team and indefinite suspended by the national football league after a video thend him punching his fiancÉe into unconsciousness. a warning to our tv viewers, the video is graphic.
obama administration has acknowledged conducting economic spying, but denies it does so to benefit u.s. companies. report from the office of director of national intelligence published by the intercept news site reveals concerns about potential challenges to u.s. corporations from foreign that -- multinationals. it suggests using cyber operations against research facilities in a foreign country and then assessing "whether and how the findings would be useful to us industry." forrmer...
Democracy Now! : LINKTV : September 16, 2014 8:00am-9:01am PDT
, the war and peace report. i'm amy goodman. the obama administration launched what it calls the first strikes of its expanded military campaign against the islamic state. the pentagon says u.s. warplanes bombed isis positions south of baghdad in support of iraqi forces under fire. the u.s. had carried out previous strikes under the stated mission of safeguarding u.s. personnel, helping refugees, and protecting infrastructure. the strikes in iraq come as the u.s. won pledges to fight isis at an international summit in paris. some 30 countries signed on to a statement vowing to defeat isis "by any means necessary." the u.s. did not invite iran to the summit, but confirmed it had reached out with an unspecified offer of cooperation against isis will stop there many in government rejected the u.s. overture as "hollow and self-serving" and marred by "evil intentions." france had wanted to invite iran to the talks in paris, but secretary state john kerry said saudi arabia and the united arab emirates would have boycotted. secretaryh foreign said iran could still play a role. >> having a com
, the war and peace report. i'm amy goodman. the obama administration launched what it calls the first strikes of its expanded military campaign against the islamic state. the pentagon says u.s. warplanes bombed isis positions south of baghdad in support of iraqi forces under fire. the u.s. had carried out previous strikes under the stated mission of safeguarding u.s. personnel, helping refugees, and protecting infrastructure. the strikes in iraq come as the u.s. won pledges to fight isis at an...
Democracy Now! : LINKTV : September 11, 2014 8:00am-9:01am PDT
administration wants us to support, one of them sold him between $25,000 to $50,000 to isis, and that is the reason he was captured. to coincide with obama's speech, the white house announced saudi arabia will host a training program for "the " to,ate syrian opposition isil. saudi arabia is one of the largest sources of funding for jihadist groups. we will have more on president obama's reach and his plan to attack islamic state forces after headlines. dozens of people have been arrested in ferguson, missouri in a protest over the police shooting of michael brown. a crowd of over 100 gathered wednesday to block a state highway in a call for the replacement of st. louis county attorney robert mcculloch in favor of a special prosecutor. >> [indiscernible] the demonstrators were blocked from entering the highway by a larger number of police in riot gear, who arrested about 35 people for failure to disperse. a handful of demonstrators threw objects at police. organizers said a plan to stage more blockade's until the officer who killed brown, darren wilson, is indicted. new figures show the o
administration wants us to support, one of them sold him between $25,000 to $50,000 to isis, and that is the reason he was captured. to coincide with obama's speech, the white house announced saudi arabia will host a training program for "the " to,ate syrian opposition isil. saudi arabia is one of the largest sources of funding for jihadist groups. we will have more on president obama's reach and his plan to attack islamic state forces after headlines. dozens of people have been... | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American digital library with the stated mission of \"universal access to all knowledge\". It provides free public access to collections of digitized materials, including websites, software applications/games, music, movies/videos, moving images, and millions of books."
}
] |
Wally / Discussion / Open Discussion:A few suggestions
Creator: asaf
First of, great product, I would like to have a more complex searching option
Taking only most popular (100 views and up), taking the more quality things or what-not.
Also, I would really like to see a warning when an image provider (website, such as pikeo) might have adult pictures, because there was no warning for any of those. If you would like to refer to this comment somewhere else in this project, copy and paste the following link:
search complexity will be added in Wally 3.0, actually I'm just maintaining Wally regarding bug fixes.
Regarding warning, a disclaimer is prompted anytime you install Wally for the first time, or upgrade from a previous version. Finally, I preferred the disclaimer solution, cause all the engines (but flickr) have this problem. Even if you use strict filters, there's always a rare chance that something goes "through" their filters.
So, better warn at the beginning, and that's all. Of course, if you switch off "adult" photos filter when expected, an additional warning is shown. | [
{
"key": "website_description",
"type": "global",
"value": "This website is a web service that offers software consumers a centralized online location to control and manage open-source software projects and research business software. It provides source code repository hosting, bug tracking, mirroring of downloads for load balancing, a wiki for documentation, developer and user mailing lists, user-support forums, user-written reviews and ratings, a news bulletin, micro-blog for publishing project updates, and other features."
}
] |
Columbia to Fort Leonard Wood Flights: Cheap Flights from COU to TBN | Expedia
Cheap Flights from Columbia to Fort Leonard Wood Flight onlyFlight + Hotel HotelsPlease correct the errors belowDestinationCheck-inCheck-outRooms123456789+Adults (18+)1234567891011121314Children (0-17)0123456Child 1: Age <11234567891011121314151617Child 2: Age <11234567891011121314151617Child 3: Age <11234567891011121314151617Child 4: Age <11234567891011121314151617Child 5: Age <11234567891011121314151617Child 6: Age <11234567891011121314151617Room 1Adults (18+)1234567891011121314Children (0-17)0123456Child 1: Age <11234567891011121314151617Child 2: Age <11234567891011121314151617Child 3: Age <11234567891011121314151617Child 4: Age <11234567891011121314151617Child 5: Age <11234567891011121314151617Child 6: Age <11234567891011121314151617Room 2Adults (18+)1234567891011121314Children (0-17)0123456Child 1: Age <11234567891011121314151617Child 2: Age <11234567891011121314151617Child 3: Age <11234567891011121314151617Child 4: Age <11234567891011121314151617Child 5: Age <11234567891011121314151617Child 6: Age <11234567891011121314151617Room 3Adults (18+)1234567891011121314Children (0-17)0123456Child 1: Age <11234567891011121314151617Child 2: Age <11234567891011121314151617Child 3: Age <11234567891011121314151617Child 4: Age <11234567891011121314151617Child 5: Age <11234567891011121314151617Child 6: Age <11234567891011121314151617Room 4Adults (18+)1234567891011121314Children (0-17)0123456Child 1: Age <11234567891011121314151617Child 2: Age <11234567891011121314151617Child 3: Age <11234567891011121314151617Child 4: Age <11234567891011121314151617Child 5: Age <11234567891011121314151617Child 6: Age <11234567891011121314151617Room 5Adults (18+)1234567891011121314Children (0-17)0123456Child 1: Age <11234567891011121314151617Child 2: Age <11234567891011121314151617Child 3: Age <11234567891011121314151617Child 4: Age <11234567891011121314151617Child 5: Age <11234567891011121314151617Child 6: Age <11234567891011121314151617Room 6Adults (18+)1234567891011121314Children (0-17)0123456Child 1: Age <11234567891011121314151617Child 2: Age <11234567891011121314151617Child 3: Age <11234567891011121314151617Child 4: Age <11234567891011121314151617Child 5: Age <11234567891011121314151617Child 6: Age <11234567891011121314151617Room 7Adults (18+)1234567891011121314Children (0-17)0123456Child 1: Age <11234567891011121314151617Child 2: Age <11234567891011121314151617Child 3: Age <11234567891011121314151617Child 4: Age <11234567891011121314151617Child 5: Age <11234567891011121314151617Child 6: Age <11234567891011121314151617Room 8Adults (18+)1234567891011121314Children (0-17)0123456Child 1: Age <11234567891011121314151617Child 2: Age <11234567891011121314151617Child 3: Age <11234567891011121314151617Child 4: Age <11234567891011121314151617Child 5: Age <11234567891011121314151617Child 6: Age <11234567891011121314151617Adults (18+)9101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566676869707172737475767778798081828384858687888990919293949596979899Children (0-17)0123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566676869707172737475767778798081828384858687888990919293949596979899Search Search Flights Please correct the errors below.RoundtripOne WayMultiple DestinationsLeaving fromGoing toDepartingReturningAdults (18+) 123456Children (0-17) 0123456Flight 1Flying fromFlying to Departing Flight 2Flying fromFlying toDepartingFlight 3Flying fromFlying toDeparting Flight 4Flying fromFlying toDepartingFlight 5Flying fromFlying toDepartingAdults (18+) 123456Children (0-17) 0123456Child 1Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 2Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 3Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 4Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 5Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 6Age<1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Children under 2 must either sit in laps or in seats.In lapIn seatAdvanced optionsAdvanced optionsNonstopRefundable flight Preferred airline No preference Tigerair Australia with BagTigerair Singapore with BagTigerair TaiwanAir BurkinaAeroGalMaya Island AirAir Choice OneSilver AirwaysBoutique AirLATAM Airlines ArgentinaInterjetGermanwingsCemairSun Air ExpressEra AlaskaInsel Air InternationalPAN AM World Airways DominicanaInsel Air ArubaMyanmar Airways InternationalPacific Coastal AirlinesCape AirTropic AirAir MoldovaAvior AirlinesJet AirwaysSouthern AirwaysAegeanAmerican AirlinesairberlinAir CanadaAzulAir FranceAir IndiaAeromexicoAerolineas ArgentinasAlaska AirlinesRoyal Air MarocAviancaFinnairAlitaliaLa CompagnieJetBlue AirwaysBritish AirwaysSeaborne AirlinesFlybeRoyal Brunei AirlinesAir BotswanaEVA AirwaysAir BalticCaribbean AirlinesAir ChinaAirlines of Papua New GuineaChina AirlinesCopaCathay PacificChina Southern AirlinesCondorDeltaSenegal AirlinesTAAG Angola AirlinesNorwegian Air ShuttleAer LingusEmiratesEllinairAir DolomitiTameEthiopian AirlinesEurowingsEtihad AirwaysEtihad RegionalFrontier AirlinesIcelandairFiji AirwaysFireflyGOL Linhas Aereas InteligentesGaruda IndonesiaGulf AirAirAsia with baggageSky AirlinesHawaiian AirlinesNikiHainan AirlinesHong Kong AirlinesUzbekistan AirwaysIberiaSolomon AirlinesMeridiana flyTigerair Taiwan without bagAzerbaijan AirlinesLATAM Airlines BrasilJapan AirlinesAdria AirwaysAir SerbiainterCaribbean AirwaysAir AstanaKorean AirKLMAir MaltaKenya AirwaysPenAirCayman AirwaysLATAM Airlines GroupLuxairLufthansaLiatLOT-Polish AirlinesLATAM Airlines PeruLACSASwiss International Air LinesEL AL Israel AirlinesAir MadagascarMiddle East AirlinesXiamen AirlinesMalaysia AirlinesAir MauritiusCOMAIR LTD.EgyptairThomas Cook AirlinesChina Eastern AirlinesAll Nippon AirwaysSpirit AirlinesAir New ZealandBoliviana De AviacionAir OnixCzech AirlinesMIAT-Mongolian AirlinesAustrian AirlinesAsiana AirlinesProflight ZambiaPascan AviationPeruvian AirlinesPorter AirlinesPakistan International AirlinesPhilippine AirlinesPlus Ultra Lineas Aereas S. A.PrecisionAirSurinam AirwaysQantas AirwaysQatar AirwaysLao AirlinesAserca AirlinesNepal AirlinesRoyal JordanianTarom-Romanian Air TransportSATA International-Azores Airlines S.A.South African AirwaysShandong AirlinesXL AirwaysSASBrussels AirlinesSingapore AirlinesCorsairAeroflot-Russian AirlinesSaudi Arabian AirlinesTACA AirlinesJetairflyThai Airways InternationalTradewind AviationTurkish AirlinesAir Tahiti NuiTAP PortugalAir TransateasyJetUral AirlinesUnitedVistaraSriLankan AirlinesTransaero AirlinesUtair AviationAir EuropaVision AirlinesVirgin AustraliaVivaAerobusVietnam AirlinesTACV-Cabo Verde AirlinesVirgin AtlanticAeromar AirlinesVirgin AmericaLC PeruWindward Island Airways InternationalWestJetWOW airOman AirLATAM Airlines EcuadorVolarisGreat Lakes AirlinesPegasus AsiaPreferred class First Class BusinessEconomy Premium EconomySearchSearch Flight + Hotel Please correct the errors below. Leaving from Going to DepartingReturningRooms 1 2 3 Adults (18 +) 123456Children (0 - 17) 0123456Child 1:Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 2:Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 3:Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 4:Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 5:Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 6:Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Room 2Adults (18 - 64)123456Children (0 - 17)0123456Child 1-?- <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 2-?- <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 3-?- <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 4-?- <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 5-?- <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 6-?- <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Room 3Adults (18 - 64)123456Children (0 - 17)0123456Child 1Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 2Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 3Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 4Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 5Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Child 6Age <1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Children under 2 must either sit in laps or in seats.In lapIn seatI only need a hotel for part of my trip Check-inCheck-outSearch
Whether you’re flying for business or jet-setting on your personal time, you’ve come to the right place. Here at Expedia.com, we’ll pair you up with COU to TBN flights that won’t make your bank account wince. Ready to temporarily leave behind Columbia for new horizons? Browse through our cheap airfare, and filter by flight times and dates until you find just what you had in mind. From flights without layovers to ones that arrive early in the morning, you’ll come across plane tickets that suit your travel preferences. You can even bundle your flight to TBN with hotels and car rentals to score even bigger savings.All set to hit the clouds? Book your travel arrangements with us today and have left-over money to put toward your travel outings and adventures. | [
{
"key": "website_description",
"type": "global",
"value": "This website is an online travel agency owned by Expedia Group, an American online travel shopping company based in Seattle."
}
] |
Northway Ford Lincoln Ltd: Company Profile - Bloomberg
Northway Ford Lincoln Ltd was founded in 1967. The Company's line of business includes the retail sale of new and used automobiles.
Phone: 0001-51975386
Fax: 0001-51975394
Web url: www.northwayfordlincoln.com | [
{
"key": "website_description",
"type": "global",
"value": "This website is an international news agency headquartered in New York City and a division of Bloomberg L.P. Content produced by Bloomberg News is disseminated through Bloomberg Terminals, Bloomberg Television, Bloomberg Radio, Bloomberg Businessweek, Bloomberg Markets, Bloomberg.com, and Bloomberg's mobile platforms. Since 2015, John Micklethwait has served as editor-in-chief."
}
] |
Select an option Navy Blue ($1.70) Pink ($1.70) Purple ($1.70) Set Of Four ($6.13) Turquoise ($1.70)
For this shop (4,918)
Rich Armstrong Dec 5, 2019
Really quick delivery. Pretty pens that the person they are for are sure to love
Cream Color Triangle Gel Pen - Kawaii Pens, Cute Stationery, pen,MUJI pens
Cute Color Gel Pen - Kawaii Pens, Cute Stationery, pen,MUJI pens
11313 favorites | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American e-commerce company focused on handmade or vintage items and craft supplies."
}
] |
Ageratina - Wikipedia
Sticky Snakeroot (Ageratina adenophora)
Genus: Ageratina
About 250; see text.
Ageratina (snakeroot) is a genus of more than 330[1][2][3][4] perennials and rounded shrubs in the family Asteraceae.
These plants grow mainly in the warmer regions of the Americas and West Indies. Over 150 species are native to Mexico.[5] Some flourish in the cooler areas of the eastern United States. Two Mexican species have become a pest in parts of Australia and Taiwan.[4] Ageratina used to belong to the genus Eupatorium, but it has been reclassified.
The genus name Ageratina means "like Ageratum"[6] and consists of Ageratum and -ina, the feminine form of the Latin adjectival suffix -inus.
The inflorescence consists of multiple fluffy, red or pinkish-white capitula in clusters. These lack the typical ray flowers of the composites.
They have multiple, much-branched woody stems. The petioles are rather long. The leaves are triangular, serrate and opposite with a foul-smelling, musky scent.
Ageratina amblyolepis
Ageratina atrocordata
Ageratina beamanii
Ageratina bellidifolia
Ageratina blepharilepis
Ageratina brandegeana
Ageratina brevipes
Ageratina calophylla
Ageratina campylocladia
Ageratina capillipes
Ageratina cerifera
Ageratina chazaroana
Ageratina chiapensis
Ageratina choricephala
Ageratina collodes
Ageratina concordiana
Ageratina conspicua
Ageratina crassiramea
Ageratina cremastra
Ageratina cronquistii
Ageratina cuencana
Ageratina cylindrica
Ageratina deltoidea
Ageratina dendroides
Ageratina dolichobasis
Ageratina enixa
Ageratina espinosarum
Ageratina etlensis
Ageratina flourensifolia
Ageratina geminata
Ageratina gentryana
Ageratina glabrata
Ageratina glauca
Ageratina glischra
Ageratina gonzalezorum
Ageratina grashoffii
Ageratina gypsophila
Ageratina halbertiana
Ageratina hasegawana[5]
Ageratina helenae
Ageratina henzium
Ageratina heterophylla
Ageratina huahuapana[5]
Ageratina irrasa
Ageratina isolepis
Ageratina jaliscensis
Ageratina jalpana
Ageratina jolotepecana
Ageratina josepaneroi
Ageratina kochiana
Ageratina lasia
Ageratina lasioneura
Ageratina leiocarpa
Ageratina lemmonii
Ageratina leptodictyon
Ageratina liebmannii
Ageratina lucida
Ageratina macbridei
Ageratina macdonaldii
Ageratina macvaughii
Ageratina malacolepis
Ageratina manantlana
Ageratina megacephala[5]
Ageratina miahuatlana
Ageratina moorei
Ageratina muelleri
Ageratina neohintonorium
Ageratina nesomii
Ageratina oaxacana
Ageratina oligocephala
Ageratina oreithales
Ageratina ozolotepecana[5]
Ageratina parayana
Ageratina pazcuarensis
Ageratina pendula
Ageratina pelotropha
Ageratina petiolaris
Ageratina photina
Ageratina potosina
Ageratina pringlei
Ageratina pseudochilca
Ageratina queretaroana
Ageratina ramireziorum
Ageratina ramonensis
Ageratina resiniflua
Ageratina rhomboidea
Ageratina rhypodes
Ageratina robinsoniana
Ageratina rubicaulis
Ageratina salicifolia
Ageratina saltillensis
Ageratina scordonioides
Ageratina sodiroi
Ageratina sousae
Ageratina sundbergii
Ageratina tomentella
Ageratina triangulata
Ageratina triniona
Ageratina vernalis
Ageratina viburnoides
Ageratina viejoana
Ageratina villarrealii[7]
Ageratina viscosissima
Ageratina warnockii
Ageratina zunilana
Further information: Milk sickness
Milk from cows that have eaten snakeroot can cause illness if ingested because the milk becomes toxic. Symptoms of milk sickness include vomiting.
Ageratina pichinchensis is a traditional Mexican treatment for superficial fungal infections of the skin. These plant extracts contain encecalin which has activity to inhibit and kill the fungus. Studies have compared its effectiveness in treating toenail fungus with ciclopirox.[8][9][10]
Long used in India to treat snakebite, epilepsy, mental disorders. It was also discovered to be useful in regulating hypertension discovered in 1949, but it causes various side effects. Used to treat schizophrenia due to the alkaloid reserpine it contains.[citation needed]
^ "Ageratina". The Plant List. Version 1.1. 2013. Retrieved 2016-09-19.
^ Nesom, Guy L. (2006). "Ageratina". In Flora of North America Editorial Committee. Flora of North America North of Mexico (FNA). 21. New York and Oxford – via eFloras.org, Missouri Botanical Garden, St. Louis, MO & Harvard University Herbaria, Cambridge, MA.
^ Ulloa Ulloa, Carmen; Jørgensen, Peter Møller. "Ageratina". Árboles y arbustos de los Andes del Ecuador [Trees and shrubs of the Andes of Ecuador] (in Spanish) – via eFloras.org, Missouri Botanical Garden, St. Louis, MO & Harvard University Herbaria, Cambridge, MA.
^ a b Peng, Ching-I; Chung, Kuo-Fang; Li, Hui-Lin. "Ageratina". Flora of Taiwan – via eFloras.org, Missouri Botanical Garden, St. Louis, MO & Harvard University Herbaria, Cambridge, MA.
^ a b c d e Turner, B. L. (2010). "Four new species of Ageratina (Asteraceae): Eupatorieae) from Oaxaca, Mexico" (PDF). Phytologia. 92 (3): 388–99. Archived from the original (PDF) on July 27, 2011.
^ Keil, David J. (2012). "Ageratina". In Jepson Flora Project. Jepson eFlora. The Jepson Herbarium, University of California, Berkeley.
^ Turner, B. L. (2010). "Ageratina villarrealii (Asteraceae: Eupatorieae), A new species from Sierra de Zapaliname, Coahuila, Mexico" (PDF). Phytologia. 92 (3): 362–65. Archived from the original (PDF) on July 27, 2011.
^ "Snakeroot leaf extract, proven as toenail fungus natural treatment". curestoenailfungus.com. May 17, 2010. Archived from the original on 2010-06-02. CS1 maint: Unfit url (link)
^ Romero-Cerecero, Ofelia; Román-Ramos, Rubén; Zamilpa, Alejandro; Jiménez-Ferrer, Jesús Enrique; Rojas-Bribiesca, Gabriela; Tortoriello, Jaime (2009). "Clinical trial to compare the effectiveness of two concentrations of the Ageratina pichinchensis extract in the topical treatment of onychomycosis". Journal of Ethnopharmacology. 126 (1): 74–78. doi:10.1016/j.jep.2009.08.007. PMID 19683043.
^ Romero-Cerecero, Ofelia; Zamilpa, Alejandro; Jiménez-Ferrer, Jesús; Rojas-Bribiesca, Gabriela; Román-Ramos, Rubén; Tortoriello, Jaime (2008). "Double-Blind Clinical Trial for Evaluating the Effectiveness and Tolerability ofAgeratina pichinchensisExtract on Patients with Mild to Moderate Onychomycosis. A Comparative Study with Ciclopirox". Planta Medica. 74 (12): 1430–1435. doi:10.1055/s-2008-1081338. PMID 18671197.
Media related to Ageratina at Wikimedia Commons
Data related to Ageratina at Wikispecies
Wikidata: Q2704494
Wikispecies: Ageratina
APDB: 187881
APNI: 77879
EoL: 36948
EPPO: 1AAKG
FNA: 100803
FoC: 100803
GBIF: 5400194
GRIN: 298
iNaturalist: 64116
ITIS: 36464
NCBI: 102749
NZOR: cdd6ea4c-18e7-4603-817a-af54a0a2d6bf
PLANTS: AGERA2
POWO: urn:lsid:ipni.org:names:30003158-2
VASCAN: 787
VicFlora: 7d62bd65-7f52-4c3c-9c1c-58c98c546776
Retrieved from "https://en.wikipedia.org/w/index.php?title=Ageratina&oldid=857433994"
This page was last edited on 31 August 2018, at 17:30 (UTC). | [
{
"key": "website_description",
"type": "global",
"value": "This website is the English-language edition of the free online encyclopedia Wikipedia. It was founded on 15 January 2001 as Wikipedia's first edition and, as of October 2021, has the most articles of any edition, at 6,412,521."
}
] |
May Day by Jess Lourey - New, Rare & Used Books Online at Alibris Marketplace
May Day by
Minneapolitan Mira James has been taking it easy since college graduation - too easy. Due to a dead-end job and a cheating boyfriend, the Twin Cities ...
Minneapolitan Mira James has been taking it easy since college graduation - too easy. Due to a dead-end job and a cheating boyfriend, the Twin Cities have lost their charm, and Mira decides to begin a new life in rural Battle Lake. Right away she is offered jobs as an assistant librarian and part-time reporter, and falls into an unexpected romance with a guy who seems to be the perfect man - until he turns up dead between the reference stacks her tenth day on the job. Anxious to learn more about the man who had briefly stolen her heart, Mira delves into the hidden mysteries of Battle Lake, including a old land deed with ancient Ojibwe secrets, an obscure octogenarian crowd with freaky social lives, and a handful of thirtysomething high school buddies who hold bitter, decades-old grudges. Mira soon discovers that unknown dangers are concealed under the polite exterior of this quirky small town, and revenge is a tator-tot hotdish best served cold. A hip, humorous, and gripping account of small-town murder, this novel is the first in a series of cozies featuring Mira James, an urban woman with rural Minnesota roots.
May Day – Trade paperback
ISBN-13: 9780738708386
Title: May Day (Murder-By-Month Mysteries, No. 1)
Fair. Save a book! Readable condition, lots of creases and wear. Trade paperback (US). Glued binding. 226 p. Contains: Illustrations, black & white. Murder-By-Month Mysteries, 1.
Description: New. 0738708380 Ships Within 24 Hours. Tracking Number...
New. 0738708380 Ships Within 24 Hours. Tracking Number available for all USA orders. Excellent Customer Service. Upto 15 Days 100% Money Back Gurantee. Try Our Fast! ! ! ! Shipping With Tracking Number.
Title: May Day (the Murder-By-Month Mysteries)
Description: Good. May Day (The Murder-By-Month Mysteries) This book is in...
Good. May Day (The Murder-By-Month Mysteries) This book is in Good condition. Buy with confidence. We ship from multiple location.
Reviews of May Day
Discussions about May Day
Subjects related to May Day | [
{
"key": "website_description",
"type": "global",
"value": "This website is is an online store that sells new books, used books, out-of-print books, rare books, and other media through an online network of independent booksellers."
}
] |
The molecular basis of antigenic cross-reactivity between the group... - PubMed - NCBI
Display Settings: AbstractFormatSummarySummary (text)AbstractAbstract (text)MEDLINEXMLPMID ListApplySend to:Choose DestinationFileClipboardCollectionsE-mailOrderMy BibliographyCitation managerFormatSummary (text)Abstract (text)MEDLINEXMLPMID ListCSVCreate File1 selected item: 11398074FormatSummarySummary (text)AbstractAbstract (text)MEDLINEXMLPMID ListMeSH and Other DataE-mailSubjectAdditional textE-mailDidn't get the message? Find out why...Add to ClipboardAdd to CollectionsOrder articlesAdd to My BibliographyGenerate a file for use with external citation management software.Create File
See comment in PubMed Commons belowJ Allergy Clin Immunol. 2001 Jun;107(6):977-84.The molecular basis of antigenic cross-reactivity between the group 2 mite allergens.Smith AM1, Benjamin DC, Hozic N, Derewenda U, Smith WA, Thomas WR, Gafvelin G, van Hage-Hamsten M, Chapman MD.Author information1Asthma & Allergic Diseases Center, Department of Medicine, University of Virginia Health System, Charlottesville, VA 22908-1355, USA.AbstractBACKGROUND: Mite group 2 allergens Der p 2, Der f 2, and Eur m 2 are 14-kDa proteins of unknown function that share 83% to 85% amino acid sequence identity. Isoforms of the allergens within each genus have been identified which differ by 3 or 4 amino acids, but little is known of the influence of group 2 polymorphisms on human IgE antibody binding.OBJECTIVE: The purpose of this study was to investigate the importance of interspecies and isoform substitutions on murine mAb and IgE antibody binding and on the molecular structure of the group 2 allergens.METHODS: Site-directed mutagenesis was used to incorporate the isoform amino acid substitutions onto the Der p 2.0101 sequence. Recombinant allergens were expressed and purified from Escherichia coli and used to evaluate antibody binding by enzyme-linked immunosorbent assay (ELISA). Molecular modeling of the tertiary structure was used to analyze structural differences between the various group 2 allergens.RESULTS: The substitution of asparagine for aspartic acid at position 114 restored mAb binding of rDer p 2.0101; the other Der p 2 isoforms and the 3 rDer f 2 isoforms also reacted in the 2-site ELISA. The correlation of IgE binding to the Der p 2 isoforms was excellent and tended to be higher in the isoforms with the asparagine 114 substitution (r (2) = 0.87 vs r (2) = 0.95). rEur m 2.0101 bound to all mAb except 7A1; when compared with rDer p 2 for IgE binding, rEur m 2.0101 gave a correlation coefficient of r (2) = 0.68. Molecular modeling revealed that Eur m 2 and the storage mite homologs Lep d 2 and Tyr p 2 retain the tertiary fold of Der p 2. Eur m 2 has a conserved surface, whereas Lep d 2 and Tyr p 2 present most of the amino acid substitutions on this surface. Lep d 2 and Tyr p 2 did not react with mAb or with sera from patients with IgE to Dermatophagoides species.CONCLUSION: The isoform substitutions of rDer p 2 can be distinguished by mAb. The allergenic cross-reactivity between Der p 2, Der f 2, and Eur m 2 is a direct result of the conserved antigenic surface, whereas the lack of cross-reactivity with Lep d 2 and Tyr p 2 is a result of the multiple substitutions across this surface.PMID: 11398074 [PubMed - indexed for MEDLINE] SharePublication Types, MeSH Terms, Substances, Grant SupportPublication TypesResearch Support, U.S. Gov't, P.H.S.MeSH TermsAmino Acid SequenceAmino Acid SubstitutionAnimalsAntibodies, Monoclonal/immunology*Antibodies, Monoclonal/metabolismAntigens, DermatophagoidesCross ReactionsEpitopes/immunology*Glycoproteins/chemistryGlycoproteins/genetics*Glycoproteins/immunology*Glycoproteins/metabolismHumansHypersensitivity, Immediate/immunologyImmunoglobulin E/metabolismMites/immunology*Models, MolecularMolecular Sequence DataProtein Isoforms/chemistryProtein Isoforms/metabolismRecombinant Proteins/geneticsRecombinant Proteins/metabolismSubstancesAntibodies, MonoclonalAntigens, DermatophagoidesEpitopesGlycoproteinsProtein IsoformsRecombinant ProteinsImmunoglobulin EGrant SupportAI20565/AI/NIAID NIH HHS/United StatesAI32557/AI/NIAID NIH HHS/United StatesAI34607/AI/NIAID NIH HHS/United StatesLinkOut - more resourcesFull Text SourcesElsevier ScienceGale DatabasesOvid Technologies, Inc.Other Literature SourcesAccess more work from the authors - ResearchGateMolecular Biology DatabasesRelated Immune Epitope Information - Immune Epitope Database and Analysis ResourcePubMed Commons home | [
{
"key": "website_description",
"type": "global",
"value": "This website is part of the United States National Library of Medicine , a branch of the National Institutes of Health . It is approved and funded by the government of the United States."
}
] |
Simple indicator Jobs, Employment | Freelancer
Simple indicator jobs
6,815 simple indicator jobs found, pricing in USD
Private project or contest #18788061 6 days left
Private project or contest #18785678 6 days left
...want a VBA expert build a project timeline /gantt using VBA in excel. This tool will enable the user to build a gantt/project timeline automatically, which takes data from a simple data set in another tab. The columns in the data set are: - Project / workstream name - the name of the entry - start date - finish date Milestones will be displayed
ZigZag indicator adjustment 5 days left
I need a ZigZag indicator adjusted so it counts the calendar days between highs and lows not the Bar Days.
Develop TradeStation Indicator in Easy Language 4 days left
Private project or contest #18768992 4 days left
-writing an efs indicator for esignal 4 days left
Private project or contest #18766665 4 days left
RGS CNC MACHINE DIANOSTICS 3 days left
I have a problem with an RGS CN...it back to life. Problem : Our main problem with our RGS machine is that there is a light indicator on the punching bit. In order for the punching bit(broken) to be changed the light indicator must shift to another bit. Now we cannot get the light indicator to switch to another bit for us to change the broken bit.
Private project or contest #18759698 3 days left
Add alert to custom pinescript tradingview indicator 3 days left
...orders: Buy Limit Sell limit Buy Limit Sell limit together Buy Stop Sell Stop Buy Stop Sell Stop together ----------------- 3 - automatic entry with two stochastic indicator one before the ferm and one after the ferris ----------------- 4 - Account system: 1 - Pips. 2 - Cash. 3 - Determine the percentage of profit from Equity. -----------------
Private project or contest #18754157 2 days left
create expert by source code indicator 2 days left
Update/finish Pine Script indicator 1 day left
using corporate governance indicator and financial ratios in predicting corporate failure 21 hours left
Private project or contest #18740404 18 hours left
Private project or contest #18738286 9 hours left
Modyfication in Trading View Indicator , pine script 1 hour left
ADD ALERT TO A NINJA 8 INDICATOR Ended
D8Nite is going to disrupt the babysitter industry. We...each letter/number alternates, or top half blue or pink and the bottom half the other color. I'd like to see simple line drawing of a small child sitting on the end of the "e". Perhaps a smart phone could be underneath showing a location indicator to imply the connection with signing up online.
Private project or contest #18730500 Ended
writing an efs indicator for esignal Ended
Private project or contest #18721298 Ended
Private project or contest #18715774 Ended
Create an indicator in pine script Ended
Private project or contest #18711563 Ended
Private project or contest #18706839 Ended
Private project or contest #18701852 Ended
Private project or contest #18692660 Ended
...tradingview: [login to view URL] The indicator will scan for TD9 buy or sell setups on the 1D, 2H, 1H, 30m and 15m timeframes (from top to bottom). Timeframes can be customized in the settings. The indicator will scan for TD13 Countdown and TD 9-13-9 Combo sequential buy or sell setups on the 1D
TO MODIFY MY INDICATOR Ended
Ninja Trader 7 Indicator. Ninja script. Ended
Other jobs related to simple indicator
simple flash slideshow , simple sendmail , site templates simple bank , simple flash maze , simple mysql import , simple flash game , simple echoserver java , simple flash gallery , simple php gallery , simple photogallery php , simple coldfusion customer database , simple shopping carts , simple mp3 upload indicator , simple flash activity indicator , simple online offline javascript indicator , simple indicator metatrader , mt4 simple indicator , gbpjpy simple indicator , simple activity indicator , mql simple indicator , simple indicator mql4 , simple range indicator , simple atr indicator , simple stop indicator mt4 , simple position size calculator indicator | [
{
"key": "website_description",
"type": "global",
"value": "This website is an Australian freelance marketplace website, which allows potential employers to post jobs that freelancers can then bid to complete. Founded in 2009, its headquarters is located in Sydney, Australia, though it also has offices in Vancouver, London, Buenos Aires, Manila, and Jakarta."
}
] |
R. M. Katz - Semantic Scholar
R. M. Katz
LanAnh T Do2
Lee E Sheinkopf2
Asif W Rafi2
William B Klaustermeyer2
2Stephen J Galli
2Bernhard F Gibbs
2William B Klaustermeyer
2Gian Galeazzo Riario-Sforza
R. M. Katz, David Jowett
William E. Berquist, Gary S Rachelefsky, +4 authors Marvin E. Ament
Forty of 82 patients with recurrent pneumonias and/or clinical asthma were found to have gastroesophageal reflux (GER) by the criteria of two or more of five tests positive for GER. Of 36 patients… (More)
Cell-mediated immunity after thermal injury.
Andrew M. Munster, Karinh E J Eurenius, R. M. Katz, Lidia Canales, Fritz Foley, Richard F. Mortensen
The microbiology of chronic sinus disease in children with respiratory allergy.
M J Goldenhersh, Gary S Rachelefsky, +7 authors Ellen Jo Baron
Chronic maxillary sinusitis is common in children with respiratory allergy and is associated with increased morbidity. The bacteriology of chronic sinus disease in these children has not been… (More)
Sinus disease in children with respiratory allergy.
Gary S Rachelefsky, Kenneth Y. Goldberg, +6 authors Sharon Crane Siegel
J. H. Greenberg, T. L. Smith, R. M. Katz
Correlation between A-mode ultrasound and radiography in the diagnosis of maxillary sinusitis.
Annette Rohr, Sidney Spector, Sharon Crane Siegel, R. M. Katz, Gary S Rachelefsky
A-mode ultrasound examination of the maxillary sinuses with the Echosine and Sinusvu 2500 units was compared with roentgenographic examination in the diagnosis of maxillary and frontal sinusitis.… (More)
Compliance of patients with asthma with an experimental aerosolized medication: implications for controlled clinical trials.
Sidney Spector, Robert A. Kinsman, +4 authors Annette Rohr
A Nebulizer Chronolog, a portable device that houses a standard nebulizer canister, was used in a unique method to measure compliance with aerosolized medication. Each actuation is tabulated to… (More)
Darren M Burton, Seth M. Pransky, R. M. Katz, Donald B. Kearns, Awole Seid
Creatine phosphokinase activity in central nervous system disorders and infections.
R. M. Katz, William M Liebman | [
{
"key": "website_description",
"type": "global",
"value": "This website is an artificial-intelligence backed search engine for academic publications developed at the Allen Institute for AI and publicly released in November 2015. It uses advances in natural language processing to provide summaries for scholarly papers."
}
] |
Oral history interview with Rita Singer ... oral history transcript 1991 (Archival material, 1991) [WorldCat.org]
http://www.worldcat.org/oclc/28733909
Title: Oral history interview with Rita Singer ... oral history transcript 1991
Author: Rita Singer; Malca Chall; Bancroft Library. Regional Oral History Office; State Government Oral History Program (Calif.)
OCLC:28733909
Oral history interview with Rita Singer ... oral history transcript 1991
Rita Singer; Malca Chall; Bancroft Library. Regional Oral History Office.; State Government Oral History Program (Calif.)
Singer discusses her law school experience in the 1930s as one of very few women; people in the Bureau of Indian Affairs including John Collier, William Brophy, Phileo Nash and handling Indian claims litigation in Alaska; World WarII and Franklin D. Roosevelt and Harry Truman; Department of Interior issues and people including Harold Ickes, Stewart Udall, Cecil Andrus; the Bureau of Reclamation and the 160-acre limit, power and electrical utility law, water issues, the Westlands contract; the state of California Department of Water Resources and Ronald Robie.
Andrus, Cecil D., -- 1931-
Brophy, William A. -- (William Aloysius), -- 1903-1962.
Cecil D Andrus; William A Brophy; Felix S Cohen; John Collier; Harold L Ickes; Ronald B Robie; Franklin D Roosevelt; Harry S Truman; Stewart L Udall; Cecil D Andrus; William A Brophy; Felix S Cohen; John Collier; Harold L Ickes; Ronald B Robie; Franklin D Roosevelt; Harry S Truman; Stewart L Udall
152 leaves, bound ; 28 cm
by Malca Chall.
Add tags for "Oral history interview with Rita Singer ... oral history transcript 1991".
<http://www.worldcat.org/oclc/28733909>library:oclcnum"28733909"library:placeOfPublication<http://id.loc.gov/vocabulary/countries/cau>dcterms:identifier"cau"rdf:typeschema:Placerdf:typeschema:CreativeWorkrdf:typelibrary:ArchiveMaterialschema:about<http://viaf.org/viaf/145957339>rdf:typeschema:Organizationschema:name"United States. Department of the Interior."schema:about<http://experiment.worldcat.org/entity/work/data/230872349#Person/collier_john>rdf:typeschema:Personschema:familyName"Collier"schema:givenName"John"schema:name"Collier, John."schema:about<http://viaf.org/viaf/18731012>rdf:typeschema:Personschema:birthDate"1931"schema:familyName"Andrus"schema:givenName"Cecil D."schema:name"Andrus, Cecil D., 1931-"schema:about<http://id.worldcat.org/fast/1204155>rdf:typeschema:Placeschema:name"United States."schema:about<http://experiment.worldcat.org/entity/work/data/230872349#Topic/water_resources_development_california>rdf:typeschema:Intangibleschema:name"Water resources development--California."@enschema:about<http://experiment.worldcat.org/entity/work/data/230872349#Place/california>rdf:typeschema:Placeschema:name"California"schema:about<http://experiment.worldcat.org/entity/work/data/230872349#Event/since_1951>rdf:typeschema:Eventschema:name"Since 1951"schema:about<http://viaf.org/viaf/29601090>rdf:typeschema:Personschema:birthDate"1874"schema:deathDate"1952"schema:familyName"Ickes"schema:givenName"Harold L."schema:name"Ickes, Harold L. (Harold LeClair), 1874-1952."schema:about<http://viaf.org/viaf/262597869>rdf:typeschema:Personschema:familyName"Udall"schema:givenName"Stewart L."schema:name"Udall, Stewart L."schema:about<http://viaf.org/viaf/29542759>rdf:typeschema:Personschema:birthDate"1882"schema:deathDate"1945"schema:familyName"Roosevelt"schema:givenName"Franklin D."schema:name"Roosevelt, Franklin D. (Franklin Delano), 1882-1945."schema:about<http://viaf.org/viaf/61561827>rdf:typeschema:Personschema:birthDate"1884"schema:deathDate"1972"schema:familyName"Truman"schema:givenName"Harry S."schema:name"Truman, Harry S., 1884-1972."schema:about<http://viaf.org/viaf/145346890>rdf:typeschema:Organizationschema:name"United States. Bureau of Indian Affairs."schema:about<http://viaf.org/viaf/73013767>rdf:typeschema:Personschema:birthDate"1903"schema:deathDate"1962"schema:familyName"Brophy"schema:givenName"William A."schema:name"Brophy, William A. (William Aloysius), 1903-1962."schema:about<http://viaf.org/viaf/128924906>rdf:typeschema:Organizationschema:name"United States. Bureau of Reclamation."schema:about<http://id.worldcat.org/fast/1204928>rdf:typeschema:Placeschema:name"California."schema:about<http://id.worldcat.org/fast/1069781>rdf:typeschema:Intangibleschema:name"Political science."@enschema:about<http://id.worldcat.org/fast/1171955>rdf:typeschema:Intangibleschema:name"Water resources development."@enschema:about<http://experiment.worldcat.org/entity/work/data/230872349#Place/united_states>rdf:typeschema:Placeschema:name"United States"schema:about<http://viaf.org/viaf/39444778>rdf:typeschema:Personschema:birthDate"1907"schema:deathDate"1953"schema:familyName"Cohen"schema:givenName"Felix S."schema:name"Cohen, Felix S., 1907-1953."schema:about<http://viaf.org/viaf/38422060>rdf:typeschema:Personschema:familyName"Robie"schema:givenName"Ronald B."schema:name"Robie, Ronald B."schema:contributor<http://viaf.org/viaf/124617551>rdf:typeschema:Organizationschema:name"State Government Oral History Program (Calif.)"schema:contributor<http://viaf.org/viaf/123692410>rdf:typeschema:Organizationschema:name"Bancroft Library. Regional Oral History Office."schema:contributor<http://viaf.org/viaf/11338318>rdf:typeschema:Personschema:familyName"Chall"schema:givenName"Malca"schema:name"Chall, Malca."schema:creator<http://viaf.org/viaf/305919239>rdf:typeschema:Personschema:birthDate"1915"schema:familyName"Singer"schema:givenName"Rita"schema:name"Singer, Rita, 1915-"schema:datePublished""schema:datePublished"1991"schema:description"Singer discusses her law school experience in the 1930s as one of very few women; people in the Bureau of Indian Affairs including John Collier, William Brophy, Phileo Nash and handling Indian claims litigation in Alaska; World WarII and Franklin D. Roosevelt and Harry Truman; Department of Interior issues and people including Harold Ickes, Stewart Udall, Cecil Andrus; the Bureau of Reclamation and the 160-acre limit, power and electrical utility law, water issues, the Westlands contract; the state of California Department of Water Resources and Ronald Robie."@enschema:exampleOfWork<http://worldcat.org/entity/work/id/230872349>schema:genre"Oral histories"@enschema:inLanguage"en"schema:name"Oral history interview with Rita Singer ..."@enschema:publication<http://www.worldcat.org/title/-/oclc/28733909#PublicationEvent/1991>rdf:typeschema:PublicationEventschema:startDate""wdrs:describedby<http://www.worldcat.org/title/-/oclc/28733909>rdf:typegenont:InformationResourcerdf:typegenont:ContentTypeGenericResourceschema:about<http://www.worldcat.org/oclc/28733909>void:inDataset<http://purl.oclc.org/dataset/WorldCat>Content-negotiable representationsTurtle (text/turtle)JSON-LD (application/ld+json)RDF/XML (application/rdf+xml)N-TRIPLES (text/plain)HTML+RDFa (text/html)
Oral history interview with Rita Singer ... oral history transcript 1991/Rita Singer; Malca Chall; Bancroft Library. Regional Oral History Office.; State Government Oral History Program (Calif.); [1991?] | [
{
"key": "website_description",
"type": "global",
"value": "This website is a union catalog that itemizes the collections of 15,637 libraries in 107 countries that participate in the OCLC global cooperative. It is operated by OCLC, Inc."
}
] |
Rules of Engagement: A Big Bust (Season 6: Ep. 9) (2011): Video on Demand by VUDU : Walmart.com Track Order Please complete both fields.
Audrey's (Megyn Price) neighbors are annoyed to learn that money they donated has paid for a cosmetic surgery for her housekeeper. Timmy (Adhir Kalyan) trains for a marathon with a beautiful woman as Russell (David Spade) tries to win her over. Inspired b | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational retail corporation that operates a chain of hypermarkets , discount department stores, and grocery stores from the United States, headquartered in Bentonville, Arkansas."
}
] |
Excel Data Analysis: Your Visual Blueprint for Analyzing Data, Charts, and PivotTables (Paperback) - Free Shipping On Orders Over $45 - Overstock.com - 15012946
Excel Data Analysis: Your Visual Blueprint for Analyzing Data, Charts, and PivotTables (Paperback)
ITEM# 15012946
ITEM#: 15012946
Paul Mcfedries (Toronto, Ontario) runs Logophilia Limited, a technical writing company, and has been writing computer books for more than 17 years. He is the author or coauthor of more than 60 books that have sold more than 3 million copies worldwide. Paul is also the proprietor of Wordspy.com, a website that tracks new words and phrases as they enter the language.
Professional-level coverage and techniques for Excel power usersAimed at Excel power users who appreciate logical, clean explanations of techniques, this visual guide features numerous screenshots and easy-to-follow numbered steps in order to show you how to perform professional-level modeling, charting, data sharing, data access, data slicing, and other functions. You'll find super techniques for getting the most out of Excel's statistical and financial functions, Excel PivotTables and PivotCharts, Excel Solver, and more.Demonstrates how to crunch and analyze Excel data the way the professionals do in an uncluttered, visual style Offers a clear look at power-using the new Excel 2013, the latest version of the world's leading spreadsheet application from MicrosoftExpands your Excel knowledge and helps you use Excel data more efficientlyExplains how to retrieve data from databases; cut, slice, and pivot data using PivotTables; model data and chart data; and use advanced formulasExplores all features and functions in two-color pages packed with screenshots, numbered steps, and other visual graphics that clearly show you how to accomplish tasksIncludes practical examples, tips, and advice to help you get the most out of Excel's features and functionsLearn the full power of Excel 2013 with this helpful guide!
9781118517147
Excel Data Analysis: Your Visual Blueprint for Analyzing Data, Charts, and PivotTables (Paperback) Today: | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American internet retailer selling primarily furniture headquartered in Midvale, Utah, near Salt Lake City."
}
] |
Latin American Liaison job - THINKERS - Leesburg, VA | Indeed.com
Latin American Liaison jobs
- THINKERS jobs
Thinkers is committed to shorten the average amount of time it takes disadvantaged
minorities to actively participate in the development of these essential elements:
behaviors and resources needed to advance their quality of life and their pursuit of
La Plaza.net is the brainchild of Thinkers Inc., a non-profit organization that was created for the sole purpose of developing disadvantaged minorities through education. Powering La Plaza.net is Dextro, LLC, a consulting, online training, and IT provider with a customer base made up primarily of Hispanics.
La Plaza.net has joined forces with the White House Initiative on Educational Excellence for Hispanics to create a unique online experience aimed at providing valuable resources and networking opportunities for the Hispanic community.
La Plaza.net goal is to become a one-stop resource for the Hispanic community. La Plaza is a space where friends can catch up, professionals can network, and ideas can be heard. Given its unique connection to the White House, users of La Plaza will have a direct link to top decision makers regarding programs, policies, and new ideas to implement within the United States.
We are looking for a person who is energetic and passionate for the Hispanic community in the US. This person will have exceptional skills to take initiative on a range of outreach and communication projects.
This is an outstanding opportunity to interact and voice Latin American embassies and consulates in the US through LaPlaza.net.
Manage and develop interaction with Latin American Embassies and consulates through laplaza.net
Conduct research to expand the Latin American Embassies/consulates database
Enhance "Mi Otro Pais" section
Communicating and interacting through laplaza.net blog/forum posts
Building and managing relationships with embassies and consulates
Developing post ideas
Bloggers outreach and interaction, as needed
Increasing organization's interactions on social media
Understanding of the Hispanic Community in the US
Able to communicate in Spanish (writing)
Enjoyment in blogging and/or reading blogs
Be willing to perform other online and offline tasks when needed
Latin American Liaison jobs in Leesburg, VA
Jobs at THINKERS in Leesburg, VA
Latin American Liaison salaries in Leesburg, VA
SPECIAL EVENTS AND OPERATIONS INTERNSHIP
Miss California Latina - | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American worldwide employment website for job listings launched in November 2004. It is a subsidiary of Japan's Recruit Co."
}
] |
Dadasaheb Jindattsurjini Puja Stavan Ane Tunk Jivan Charitra. : Digital Library of India : Free Download, Borrow, and Streaming : Internet Archive
Dadasaheb Jindattsurjini Puja Stavan Ane Tunk Jivan Charitra.
[archiveorg in.ernet.dli.2015.253754 width=560 height=384 frameborder=0 webkitallowfullscreen=true mozallowfullscreen=true]
Book Source: Digital Library of India Item 2015.253754
dc.date.accessioned: 2015-07-19T20:54:17Z
dc.date.available: 2015-07-19T20:54:17Z
dc.date.digitalpublicationdate: 2011/03/08
dc.identifier.barcode: 99999990871773
dc.identifier.origpath: /data58/upload/0073/490
dc.identifier.uri: http://www.new.dli.ernet.in/handle/2015/253754
dc.title: Dadasaheb Jindattsurjini Puja Stavan Ane Tunk Jivan Charitra.
Identifier in.ernet.dli.2015.253754
Identifier-ark ark:/13960/t6xw9z957 | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American digital library with the stated mission of \"universal access to all knowledge\". It provides free public access to collections of digitized materials, including websites, software applications/games, music, movies/videos, moving images, and millions of books."
}
] |
S.P. Satria Sdn. Bhd.: Private Company Information - Bloomberg
S.P. Satria Sdn. Bhd. engages in material handling equipment supply and maintenance. The company was founded in 2003 and is based in Kota Kinabalu, Malaysia. The company operates as a subsidiary of Suria Capital Holdings Bhd.
Lot 9CF 02, 9th FloorBlock C, Kompleks KaramunsingKota Kinabalu, 88300MalaysiaFounded in 2003
Phone: 60 8 831 6696
Fax: 60 8 823 1086
www.spsatria.com.my
Key Executives for S.P. Satria Sdn. Bhd.
S.P. Satria Sdn. Bhd. does not have any Key Executives recorded. Similar Private Companies By Industry
To contact S.P. Satria Sdn. Bhd., please visit www.spsatria.com.my. Company data is provided by S&P Global Market Intelligence. Please use this form to report any data issues. | [
{
"key": "website_description",
"type": "global",
"value": "This website is an international news agency headquartered in New York City and a division of Bloomberg L.P. Content produced by Bloomberg News is disseminated through Bloomberg Terminals, Bloomberg Television, Bloomberg Radio, Bloomberg Businessweek, Bloomberg Markets, Bloomberg.com, and Bloomberg's mobile platforms. Since 2015, John Micklethwait has served as editor-in-chief."
}
] |
SEWING PATTERN Girls Bloomers Pattern Baby Bloomers Pattern
A cute and frilly baby bloomers pattern for little baby girls.
The pattern is a basic bloomers pattern with two added frilly ruffles around the waist, like an added ruffle skirt. It is finished with elastic leg bands on leg hems .
It is a nice roomy design and will fit over all types of nappies/ diapers.
The waistband has an elastic also.
This pattern is suitable for confident beginners, some sewing experience is recommended.
3 months, 6 months, 9 months, to fit heights of 62, 68 and 74 cm or 24.5, 26.5, 29 inches
The pattern includes step by step instructions, a cutting layout, and full sized pattern sheets.
PDF Pattern - Bloomers - Babies/Toddlers - Sizes Premie to 5-6T - Instant Download - Easy Photo Tutorial | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American e-commerce company focused on handmade or vintage items and craft supplies."
}
] |
Patent US6179831 - Method of cryoablating benign prostate hyperplasia - Google PatentsSearch Images Maps Play YouTube News Gmail Drive More »Advanced Patent Search | Sign inAdvanced Patent SearchPatentsA method for treating benign prostate hyperplasia is provided. The method is effected by (a) inserting a cystoscope into a prostatic urethra portion of a urethra of a patient having benign prostate hyperplasia; (b) guiding a probe of a cryoprobe having an operating tip through a channel of the cystoscope...http://www.google.com/patents/US6179831?utm_source=gb-gplus-sharePatent US6179831 - Method of cryoablating benign prostate hyperplasiaPublication numberUS6179831 B1Publication typeGrantApplication numberUS 09/301,576Publication dateJan 30, 2001Filing dateApr 29, 1999Priority dateApr 29, 1999Fee statusLapsedAlso published asCA2307277A1, CA2307277C, DE60023982D1, DE60023982T2, EP1048272A1, EP1048272B1Publication number09301576, 301576, US 6179831 B1, US 6179831B1, US-B1-6179831, US6179831 B1, US6179831B1InventorsMordechai BliweisOriginal AssigneeGalil Medical Ltd.Export CitationBiBTeX, EndNote, RefManPatent Citations (6), Referenced by (40), Classifications (17), Legal Events (7) External Links: USPTO, USPTO Assignment, EspacenetMethod of cryoablating benign prostate hyperplasiaUS 6179831 B1Abstract A method for treating benign prostate hyperplasia is provided. The method is effected by (a) inserting a cystoscope into a prostatic urethra portion of a urethra of a patient having benign prostate hyperplasia; (b) guiding a probe of a cryoprobe having an operating tip through a channel of the cystoscope to an portion of the prostatic urethra; (c) navigating the operating tip through a wall of the prostatic urethra into at least one location at a time of a prostate of the patient; and (d) operating the cryoprobe thereby cooling the operating tip and producing an ice-ball of prostate tissue around the operating tip, so as to locally freeze a portion of the prostate, yet substantially avoid freezing the prostatic urethra.
Patent CitationsCited PatentFiling datePublication dateApplicantTitleUS5522870Jan 7, 1994Jun 4, 1996State Of Israel, Ministry Of Defense, Rafael-Armaments Development AuthorityFast changing heating-cooling device and methodUS5531676 *Sep 27, 1994Jul 2, 1996Vidamed, Inc.Medical probe device and methodUS5540062Feb 14, 1994Jul 30, 1996State Of Israel, Ministry Of Defence, Rafael Armaments Development AuthorityControlled cryogenic contact systemUS5741248 *Jun 7, 1995Apr 21, 1998Temple University-Of The Commonwealth System Of Higher EducationFluorochemical liquid augmented cryosurgeryUS6102886 *May 27, 1998Aug 15, 2000Vidamed, Inc.Steerable medical probe with styletsUS6106517 *Sep 24, 1997Aug 22, 2000Situs CorporationSurgical instrument with ultrasound pulse generator* Cited by examinerReferenced byCiting PatentFiling datePublication dateApplicantTitleUS6648907Oct 4, 2001Nov 18, 2003Seacoast Technologies, Inc.Neurosurgical device for thermal therapyUS6652566Oct 4, 2001Nov 25, 2003Seacoast Technologies, Inc.Neurosurgical device for thermal therapy including spiral elementUS6660026Oct 4, 2001Dec 9, 2003Seacoast Technologies, Inc.Multi-tipped cooling probeUS6706037 *May 21, 2001Mar 16, 2004Galil Medical Ltd.Multiple cryoprobe apparatus and methodUS6743200Oct 4, 2001Jun 1, 2004Seacoast Technologies, Inc.Expandable device for thermal therapyUS6899726Oct 4, 2001May 31, 2005Seacoast Technologies, Inc.Expandable device for thermal therapy including spiral elementUS6923826Sep 11, 2003Aug 2, 2005Seacoast Technologies, Inc.Neurosurgical device for thermal therapyUS7015253Jul 9, 2002Mar 21, 2006American Medical Systems, Inc.Regimen for treating prostate tissue and surgical kit for use in the regimenUS7083612Jan 14, 2004Aug 1, 2006Cryodynamics, LlcCryotherapy systemUS7118591 *Apr 19, 2004Oct 10, 2006The University Of ChicagoHeat transfer probeUS7150743Sep 12, 2003Dec 19, 2006Galil Medical Ltd.Multiple cryoprobe apparatus and methodUS7273479Sep 27, 2004Sep 25, 2007Cryodynamics, LlcMethods and systems for cryogenic coolingUS7389653Sep 15, 2005Jun 24, 2008The University Of ChicagoMedical ice slurry production deviceUS7407501Feb 11, 2005Aug 5, 2008Galil Medical Ltd.Apparatus and method for compressing a gas, and cryosurgery system and method utilizing sameUS7410484Jan 14, 2004Aug 12, 2008Cryodynamics, LlcCryotherapy probeUS7437194 *Oct 31, 2003Oct 14, 2008Medtronic, Inc.Stimulating the prostate glandUS7507233Jun 6, 2006Mar 24, 2009Cryo Dynamics, LlcCryotherapy systemUS7510536Dec 16, 2004Mar 31, 2009University Of WashingtonUltrasound guided high intensity focused ultrasound treatment of nervesUS7520856Oct 29, 2004Apr 21, 2009University Of WashingtonImage guided high intensity focused ultrasound device for therapy in obstetrics and gynecologyUS7591996Aug 17, 2005Sep 22, 2009University Of WashingtonUltrasound target vessel occlusion using microbubblesUS7621873Aug 17, 2005Nov 24, 2009University Of WashingtonMethod and system to synchronize acoustic therapy with ultrasound imagingUS7670291Sep 16, 2005Mar 2, 2010University Of WashingtonInterference-free ultrasound imaging during HIFU therapy, using software toolsUS7686763Feb 2, 2004Mar 30, 2010University Of WashingtonUse of contrast agents to increase the effectiveness of high intensity focused ultrasound therapyUS7722539Aug 18, 2005May 25, 2010University Of WashingtonTreatment of unwanted tissue by the selective destruction of vasculature providing nutrients to the tissueUS7846154 *Dec 6, 2004Dec 7, 2010Galil Medical Ltd.Gas-heated gas-cooled cryoprobe utilizing electrical heating and a single gas sourceUS7850626Oct 30, 2007Dec 14, 2010University Of WashingtonMethod and probe for using high intensity focused ultrasoundUS7882841Jan 2, 2008Feb 8, 2011Procept CorporationMinimally invasive methods and devices for the treatment of prostate diseasesUS7921657Aug 28, 2007Apr 12, 2011Endocare, Inc.Methods and systems for cryogenic coolingUS8007847Aug 7, 2006Aug 30, 2011Eytan BidermanFeeding formula applianceUS8016757Sep 29, 2006Sep 13, 2011University Of WashingtonNon-invasive temperature estimation technique for HIFU therapy monitoring using backscattered ultrasoundUS8066697Dec 18, 2006Nov 29, 2011Galil Medical Ltd.Multiple cryoprobe delivery apparatusUS8197409Feb 23, 2009Jun 12, 2012University Of WashingtonUltrasound guided high intensity focused ultrasound treatment of nervesUS8206299Sep 21, 2010Jun 26, 2012University Of WashingtonImage guided high intensity focused ultrasound treatment of nervesUS8211017Sep 21, 2010Jul 3, 2012University Of WashingtonImage guided high intensity focused ultrasound treatment of nervesUS8337434Nov 15, 2010Dec 25, 2012University Of WashingtonMethods for using high intensity focused ultrasound and associated systems and devicesUS8387402Mar 11, 2011Mar 5, 2013Cryodynamics, LlcMethods and systems for cryogenic coolingUS8414494Sep 15, 2006Apr 9, 2013University Of WashingtonThin-profile therapeutic ultrasound applicatorsUS20100233191 *Jun 14, 2006Sep 16, 2010James Thomas BuckleyMethod of treating or preventing benign prostatic hyperplasia using modified pore-forming proteinsEP2311398A1Jan 15, 2004Apr 20, 2011Cryodynamics, LLC.Cryotherapy probe and systemWO2008083407A1Jan 2, 2008Jul 10, 2008Procept CorpMinimally invasive methods and devices for the treatment of prostate diseases* Cited by examinerClassifications U.S. Classification606/21, 606/24International ClassificationA61B18/02, A61B19/00, A61B18/00, A61F7/12, A61B17/00Cooperative ClassificationA61B2018/00547, A61B2017/00274, A61B2017/00092, A61B18/02, A61B2018/00041, A61B2019/5276, A61B2018/00636, A61B2018/0268, A61B2019/5231European ClassificationA61B18/02Legal EventsDateCodeEventDescriptionMar 19, 2013FPExpired due to failure to pay maintenance feeEffective date: 20130130Jan 30, 2013LAPSLapse for failure to pay maintenance feesOct 3, 2012ASAssignmentOwner name: SILICON VALLEY BANK, AS AGENT, CALIFORNIAEffective date: 20120928Free format text: SECURITY AGREEMENT;ASSIGNOR:GALIL MEDICAL LTD.;REEL/FRAME:029073/0335Sep 10, 2012REMIMaintenance fee reminder mailedJun 4, 2008FPAYFee paymentYear of fee payment: 8Jun 17, 2004FPAYFee paymentYear of fee payment: 4Apr 29, 1999ASAssignmentOwner name: GALIL MEDICAL LTD., ISRAELFree format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:BLIWEIS, MORDECHAI;REEL/FRAME:009929/0296Effective date: 19990428RotateOriginal ImageGoogle Home - Sitemap - USPTO Bulk Downloads - Privacy Policy - Terms of Service - About Google Patents - Send FeedbackData provided by IFI CLAIMS Patent Services©2012 Google | [
{
"key": "website_description",
"type": "global",
"value": "This website is a search engine provided by Google. Handling over 3.5 billion searches per day, it has a 92% share of the global search engine market."
}
] |
Iam Michael Franzese, a former made boss in the Columbo Crime family starting in the early 80's. AMA. I'll begin answering questions at 2pm Eastern. : IAmAjump to contentmy subredditsAdviceAnimalsannouncementsAskRedditaskscienceawwbestofblogbooksEarthPornexplainlikeimfivefunnygaminggifsIAmAmoviesMusicnewspicssciencesportstechnologytelevisiontodayilearnedvideosworldnewsedit subscriptionsfront-all-random | pics-funny-gaming-AskReddit-worldnews-news-videos-IAmA-todayilearned-aww-technology-AdviceAnimals-science-Music-movies-bestof-books-EarthPorn-explainlikeimfive-gifs-television-askscience-sports-mildlyinteresting-LifeProTips-woahdude-Unexpected-reactiongifs-Showerthoughts-food-Jokes-photoshopbattles-firstworldanarchists-FoodPorn-HistoryPorn-WTF-leagueoflegends-cringepics-twitchplayspokemon-4chan-MakeupAddiction-pokemon-pcmasterrace-gentlemanboners-politics-atheism-nba-Bitcoin-DotA2-soccermore » IAmAcommentsrelatedother discussions (2)want to join? login or register in seconds|Englishlimit my search to /r/IAmAuse the following search parameters to narrow your results:subreddit:subredditfind submissions in "subreddit"author:usernamefind submissions by "username"site:example.comfind submissions from "example.com"url:textsearch for "text" in urlselftext:textsearch for "text" in self post contentsself:yes (or self:no)include (or exclude) self postsnsfw:yes (or nsfw:no)include (or exclude) results marked as NSFWe.g. subreddit:aww site:imgur.com dogsee the search faq for details.advanced search: by author, subreddit...this post was submitted on 08 Jan 20143,578 points (58% like it)12,400 upvotes 8,822 downvotesshortlink: remember mereset passwordloginSubmit a new text postIAmAunsubscribesubscribe5,014,911 readers5,142 users here nowSubmit an AMA
created by 32bitesa community for 4 yearsmessage the moderatorsMODERATORSkarmanautKennyLog-inParadoxSupermanV2IAmAModsAutoModeratorsquatlyOoeriamasidebarroastedbagel...and 13 more »1357735783579Iam Michael Franzese, a former made boss in the Columbo Crime family starting in the early 80's. AMA. I'll begin answering questions at 2pm Eastern. (self.IAmA)submitted 2 months ago* by MichaelFranzeseUPDATE: I'm here! Time to answer your questions! Thanks so much for all this, looking forward to it.
UPDATE 2: There is a lot of interest in some of my longer stories that there just isn't time to type out. I have a few books out that I go into great detail: http://www.amazon.com/Michael-Franzese/e/B001KIXYD6
UPDATE 3: My friends, I had a great time. Thanks for the amazing questions. I'm going to answer a couple more then I got to head out. I hope to interact with reddit more in the future!
Hi redditors, I'm Michael Franzese. I'm here to answer your questions. I am the son of one of the most feared Mafia bosses to ever walk the streets of NY. He was an enforcer known to be cold blooded and extremely deadly. I followed in my dad's footsteps and took on the mob life. As a made member I made money for the mob; tons of money.
A quote about me from Life Magazine:
"From the time he took a blood oath that bound him body and soul to New York's Colombo crime family, Franzese became a force to be reckoned with in organized crime. Named one of the biggest moneymakers in the mob since Al Capone by Vanity Fair, he quickly crept into the upper echelon of Mafia authority in this country. At age 35, he was the youngest mobster listed on Fortune Magazine's survey of the 50 most powerful and wealthy Mafia bosses in America. Franzese hit the list at number 18, only five spots behind the infamous John Gotti. At the height of his operation, federal authorities claim Franzese generated close to a billion dollars a year in a gas-tax scheme he masterminded..... Then defying common sense and the covenant that bound him to the Colombo family, Michael did the unthinkable - HE QUIT THE MOB...
There's an old saying that the only way to leave the Mafia is in a coffin. Michael Franzese was willing to take that risk. He will not betray his former crime associates and then disappear into the witness protection program... If he holds to what he has promised it will mark the first time that a high ranking member of the Mafia will publicly walk away from his past - and live!"
That was then -- A young Christian woman I met on the set of a movie changed my life and caused a transformation in me that only God could have engineered. My story is currently featured on three cable networks. Discovery, The History Channel and National Geographic Network and a movie about my life will be released in theaters in the Fall. A Documentary I am featured in titled IMPACT delivers a strong message to at-risk youth and has won Best Documentary Awards in 2013 at 2 major film festivals.
I know the mob life as well or better then most. I am also a person of strong faith. I'm ready to answer ALL your questions. Ask me anything you like. No bounds, no limits. I have been asked everything under the sun. If I choose not to answer I know how to take the fifth. I've done that many times in my former mob life. But I assure you I won't this time. So join me today and fire away!
Proof: https://twitter.com/MichaelFranzese/status/418088239379906560
3655 commentssharecanceltop 200 commentsshow 500sorted by: bestbesttopnewhotcontroversialoldrandom[+]weeever 543 points544 points545 points 2 months ago (38 children)[–]weeever 543 points544 points545 points 2 months agoWhat was it like walking away from the mafia, was it accepted or were you threatened or hounded in any way? Also what were the actual logistics of your gas tax scam. how were neither the irs or any federal agency not able to successfully audit you? permalink[+]MichaelFranzese[S] 888 points889 points890 points 2 months ago (37 children)[–]MichaelFranzese[S] 888 points889 points890 points 2 months agoI struggled mightily for years after walking away. my father disowned me. the family put a hit on me. the feds tried to make me a witness. lots of pressure. very tough. and very tough for me personally. even though i didn't hurt anyone, i felt like i betrayed my oath and it really troubled me. only God and time were able to fix that. gas tax scheme was complicated, but we were way ahead of the authorities, they could not figure out what we were doing. if my partner didn't turn snitch, they would never figured out the scam.
permalinkparent[+]lost_and_crowned 324 points325 points326 points 2 months ago (19 children)[–]lost_and_crowned 324 points325 points326 points 2 months agosooo did the family just cancel the hit on you? was the hit like a 2 year contract considered null and void if you weren't killed within the 2 year term? i kid, but seriously, how is the mob ok with you walking away and ultimately telling stories about what it's like? that seems like you're breaking rule #1...
permalinkparent[+]TheDroidUrLookinFor 420 points421 points422 points 2 months ago (4 children)[–]TheDroidUrLookinFor 420 points421 points422 points 2 months agoIt's just like Grand Theft Auto. He just has to wait and hide in his apartment. Then he is clear to go. permalinkparent[+]lost_and_crowned 29 points30 points31 points 2 months ago (0 children)[–]lost_and_crowned 29 points30 points31 points 2 months agoya know, that's what i figured. i just needed to hear it. thanks.
permalinkparentload more comments (3 replies)[+]Teds101 127 points128 points129 points 2 months ago* (4 children)[–]Teds101 127 points128 points129 points 2 months ago*He says nearly all the guys he associated with are dead or in jail. And the guys on the street now wouldn't be friends with him because it wouldn't look good on their part. He then said he could never go back to Brooklyn or live anywhere in NY in general. permalinkparentload more comments (4 replies)[+]Stylux 151 points152 points153 points 2 months ago (5 children)[–]Stylux 151 points152 points153 points 2 months agoThe rest of them are in jail.
permalinkparentload more comments (5 replies)load more comments (3 replies)load more comments (17 replies)[+]eime8498 653 points654 points655 points 2 months ago (378 children)[–]eime8498 653 points654 points655 points 2 months agoAny fears about your safety today?
permalink[+]MichaelFranzese[S] 1397 points1398 points1399 points 2 months ago (376 children)[–]MichaelFranzese[S] 1397 points1398 points1399 points 2 months agoi can't go back to brooklyn to live, or in NY in general. wouldn't last. but i don't live in fear. i am a person of strong faith now. God has had my back. remember, i am the only made man, a caporegime, that i know of who has walked away from the life, publicly, not entered a witness protection program and lived. it's a God thing, my friend. not coincidence.
permalinkparent[+]moochmasta 2161 points2162 points2163 points 2 months ago (121 children)[–]moochmasta 2161 points2162 points2163 points 2 months agoif you listen closely, you can hear the sound of thousands of redditors brains imploding
permalinkparent[+]DaRizat 55 points56 points57 points 2 months ago (0 children)[–]DaRizat 55 points56 points57 points 2 months agoCapo goes in, Capo goes out. Can't explain that.
permalinkparent[+]houseQM 2023 points2024 points2025 points 2 months ago (37 children)[–]houseQM 2023 points2024 points2025 points 2 months agoCheckmate, atheists. permalinkparentload more comments (37 replies)load more comments (82 replies)[+]noraamitt 232 points233 points234 points 2 months ago (5 children)[–]noraamitt 232 points233 points234 points 2 months ago
remember, i am the only made man, a caporegime, that i know of who has walked away from the life, publicly, not entered a | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American social news aggregation, web content rating, and discussion website. Registered members submit content to the site such as links, text posts, images, and videos, which are then voted up or down by other members."
}
] |
C.4.5 Changes in release 3.23.55 (23 Jan 2003) for Mysql
P. 1MysqlMysqlRatings: 5.0 (1)|Views: 56,950|Likes: 232Published by carlos mettalMore info: categoriesTypes, How-To Guides/ManualsPublished by: carlos mettal on Sep 05, 2009Copyright:Attribution Non-commercialAvailability:Read on Scribd mobile: iPhone, iPad and Android.Free download as PDF, TXT or read online for free from ScribdFlag for inappropriate content|Add to collectionSee MoreSee lesshttp://www.scribd.com/doc/19432738/Mysql10/23/2012pdftextoriginal MySQL Reference Manual | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American e-book and audiobook subscription service that includes one million titles."
}
] |
Arlington, Virginia. Big gun at Fort Woodbury | Library of Congress
Photo, Print, Drawing Arlington, Virginia. Big gun at Fort Woodbury
JPEG (5.7 KB) GIF (17.6 KB) JPEG (69.7 KB) JPEG (137.5 KB) TIFF (20.1 MB) TIFF (79.0 MB)
JPEG (6.1 KB) GIF (19.0 KB) JPEG (71.7 KB) JPEG (144.3 KB) TIFF (20.6 MB) TIFF (78.8 MB)
Arlington, Virginia. Big gun at Fort Woodbury
- Caption from negative sleeve: Big Gun at Fort Woodbury, VA.
- Two plates form left (LC-B811-2319A) and right (LC-B811-2319B) halves of a stereograph pair.
- Corresponding print is in LOT 4166-H.
LC-B811- 2319 [P&P] LOT 4166-H (corresponding photographic print)
cwpb 01509 https://hdl.loc.gov/loc.pnp/cwpb.01509
cwpb 01510 https://hdl.loc.gov/loc.pnp/cwpb.01510
2018670651
LC-DIG-cwpb-01509 (digital file from original neg. of left half) LC-DIG-cwpb-01510 (digital file from original neg. of right half)
Reproduction Number: LC-DIG-cwpb-01509 (digital file from original neg. of left half) LC-DIG-cwpb-01510 (digital file from original neg. of right half)
Call Number: LC-B811- 2319 [P&P] LOT 4166-H (corresponding photographic print)
Arlington, Virginia. Big gun at Fort Woodbury . United States, None. [Between 1861 and 1869] Photograph. https://www.loc.gov/item/2018670651/.
Arlington, Virginia. Big gun at Fort Woodbury . United States, None. [Between 1861 and 1869] [Photograph] Retrieved from the Library of Congress, https://www.loc.gov/item/2018670651/.
Arlington, Virginia. Big gun at Fort Woodbury . [Between 1861 and 1869] Photograph. Retrieved from the Library of Congress, <www.loc.gov/item/2018670651/>. | [
{
"key": "website_description",
"type": "global",
"value": "This website is the research library that officially serves the United States Congress and is the de facto national library of the United States. It is the oldest federal cultural institution in the United States."
}
] |
4,714 articles topics write iphone jobs found, pricing in USD
Hello, i need content-article writers for my web site: edni.net I will give the topics. I need 50 article, 400 words per one. Ending left | [
{
"key": "website_description",
"type": "global",
"value": "This website is an Australian freelance marketplace website, which allows potential employers to post jobs that freelancers can then bid to complete. Founded in 2009, its headquarters is located in Sydney, Australia, though it also has offices in Vancouver, London, Buenos Aires, Manila, and Jakarta."
}
] |
Bill Rowan - definition of Bill Rowan by The Free Dictionary
https://www.thefreedictionary.com/Bill+Rowan
Dictionary, Encyclopedia and Thesaurus - The Free Dictionary 11,639,258,335 visitors served
(redirected from Bill Rowan)
(Athletics (Track & Field)) the Comrades Marathon South African an annual long-distance race run every year on the 16th of June from Durban to Pietermaritzburg, a distance of approximately 90 kilometres (56 miles). Often shortened to: the Comrades
Indian national Mohamed Idris, 46, is an avid runner, whose time of eight hours and 56 minutes in the 89-km South African Comrades Marathon, earned him the Bill Rowan medal, which is awarded to all runners who complete the race in under nine hours and is named after the first winner in 1921.
For that, Bill Rowan, president of Sunbelt Industrial Trucks, a Dallas-based Komatsu dealer, offers this simple trick for parked IC trucks: park them over cardboard.
Maintain while parked: even idle lift trucks need attention if you expect to put them back to work
BILL Rowan and his family suffer at the hands of rowdy teenagers on a daily basis.
YOBS MAKE MY LIFE A MISERY; tennagers drive around in stolen cars | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American online dictionary and encyclopedia that aggregates information from various sources."
}
] |
Skip to main contenteBayShop by categoryShop by categoryEnter your search keywordAll CategoriesAlcohol & FoodAntiquesArtBabyBooks, MagazinesBusinessCamerasCars, Bikes, BoatsClothing, Shoes, AccessoriesCoinsCollectablesComputers/Tablets & NetworkingCraftsDolls, BearsElectronicsGift CardsHealth & BeautyHome & GardenHome AppliancesHome EntertainmentIndustrialJewellery & WatchesMoviesMusicMusical InstrumentsPet SuppliesPhones & AccessoriesPottery, GlassServicesSporting GoodsStampsTickets, TravelToys, HobbiesVehicle Parts & AccessoriesVideo Games & ConsolesLots More...AdvancedG'day (Sign in to bid or buy) eBay Deals Sell Help & Contact My eBayExpand My eBay My eBay Summary Bids/Offers Watch List Wish List All Lists Purchase History Selling/sold My Collections Followed searches My messagesNotification {"url":"http://ir.ebaystatic.com/cr/v/c1/thirtysevens.jpg","maxViews":4,"imgSize":37,"expiry":300000,"timeout":250} Related: washer and dryer combination washing machine washing machine and dryer washer dryer washer dryer washer machine and dryer large fridge pool table clothes dryer
Yay! You're now following washer and dryer in your eBay Feed.You'll receive email alerts for new listings. Don't send me e-mail alerts.
**10 PACK** DEXTER WASHER AND DRYER COIN DROP SWITCH KITS Part #9732-126-001 NEW
AU $8,609.92
ELECTROLUX 7 Kg FRONTLOADER WASHING MACHINE AND DRYER WITH STACKING KIT
Washer and Dryer Set Portable Washing Machine 11lbs Auto Camping Home RV Laundry
See more like thisWasher and Dryer Set Portable Washing Machine 11lbs Auto Camping Home RV Laundry
Midea dishwasher And 2 in 1 2.0 Cu. Ft. Combination Washer/Dryer Combo Ventless
See more like thisMidea dishwasher And 2 in 1 2.0 Cu. Ft. Combination Washer/Dryer Combo Ventless
DEXTER WASHER AND DRYER COIN DROP SWITCH KIT Part #9732-126-001 NEW
6.6LB Portable MINI Washer and Spin Dryer Electric Combo with Spin Dry Basket
Bosch 300 Series Front Load Washer and Dryer set + Stacking Kit Images
See more like thisBosch 300 Series Front Load Washer and Dryer set + Stacking Kit Images
Washer And Dryer Set With Pedestals!!!
+AU $48.77 postage Only 1 left!
See more like thisMy First Kenmore Washer and Dryer Set Wooden Laundry Set Pretend Play Pink
Currently Unavailable-Stackable Compact Washer and Compact Short Dryer Set
Currently unavailable-Stackable Compact Washer and Compact Standard Dryer Set
AU $2,304.71
See more like thisSplendide WD2100XC Washer And Dryer Combo Vented Machine RV Parts
Electric Portable Washer & Spin Dryer, Mini Washing Machine and Spin Drying Twi
Acme refrigerator magnets clothes washer and dryer 1992
Vintage Westinghouse washer dryer salt and pepper 2 sets
LG WASHER AND DRYER excellent condition
See details... AU $2,138.55
See more like thisGE Frontload Electric Dryer and Frontload Washer Set
Washer and Dryer Set Kenmore Dryer Wooden Laundry Set Pretend Play
See more like thisWasher and Dryer Set Kenmore Dryer Wooden Laundry Set Pretend Play
Used - Whirlpool Imperial Series, Washer and Dryer Set
GE Profile Washer and Dryer Electric
+AU $247.32 postage From United States
Washer And Dryer Pedestals With Storage Drawers
Washer Dryer Combo Money Back guaranty Discount Appliances 8 web street Dandi
Beko 8kg/5kg Front Load Washer/Dryer - WDA8514AT
+AU $30.71 postage BOSCH MAXX 800 Front Loader Washing Machine And Fisher And Paykel Dryer
+AU $49.00 postage Genuine Electrolux Washer Dryer Drain Pump EWW1273 EWW12832 EWW14791W EWW14912
+AU $25.00 postage Genuine Electrolux Washer Dryer Combo Drain Pump EWD1477 EWN14991W EWW14791W
Beko 7kg Front Load Washer - WMY7046LB2*Bonus Cashback*
See more like thisBeko 7kg Front Load Washer - WMY7046LB2*Bonus Cashback*
Beko 8kg Front Load Washer - WMY8046LB2*Bonus Cashback*
See more like thisBeko 8kg Front Load Washer - WMY8046LB2*Bonus Cashback*
+AU $33.00 postage Euromaid 5.5kg Top Load Washer Model HTL55 RRP $549.00
Beko 9kg Front Load Washer - WMY9046LB2*Bonus Cashback*
See more like thisBeko 9kg Front Load Washer - WMY9046LB2*Bonus Cashback*
LG 9.5kg Topload Washing Machine WT-H9556,18 moths old
See more like thisSPECIAL SALE - Brand New Smart STWM801 8kg Top Loader Washer w/6 Programs - VIC
+AU $8.00 postage New Ironing Mat Compact Portable Ironing Board Travel Dryer Washer Iron Anywhere
Beko 9kg Front Load Washer - WMY9048LB1*Bonus Cashback*
See more like thisBeko 9kg Front Load Washer - WMY9048LB1*Bonus Cashback*
Miele Washer W3985 & Condenser Dryer T8685c | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational e-commerce corporation based in San Jose, California, that facilitates consumer-to-consumer and business-to-consumer sales through its website."
}
] |
Reptile Vet in Asheville, North Carolina with Reviews & Ratings - YP.comFind People•Advertise With UsBrowseFind PeopleFeatured CollectionsRestaurantsAutomotiveHome ImprovementHealth & WellnessAttorneysPeople Searched For...Mission Memorial HospitalMovie TheatersUsed Car DealersRoofing ContractorsChinese RestaurantsDrug Abuse & Addiction CentersFuel OilsIndoor PlaygroundsMoversMobile Home ParksPaving ContractorsPawn ShopsHeating Contractors & SpecialtiesFloristsBlack Hair Salons24 Hour LaundromatsChinese DeliveryInsurancePiercing PlacesPersonal Injury Law AttorneysProm DressesRock And Gem ShopsPet Boarding KennelsAre you alocal business owner?Advertise with YPor call 888-367-2194What do you want to find?Search by business name, or keywordnearWhere? Address, ZIP Code, or NeighborhoodMy current locationSearchSign In•JoinHomeAsheville, NCReptile VetAsheville Reptile VetSort:DefaultDefaultDistanceRatingName (A - Z)FiltersFiltersMore NeighborhoodsBear CreekCharlotte StreetClaxton CommunityDowntown AshevilleHaw CreekKensington PlaceMalvern HillsMills River VillageOakleySouth French BroadWedgewoodDoneClear AllMore CategoriesAnimal Health ProductsDog & Cat Grooming & SuppliesDog TrainingHolistic PractitionersKennelsLivestock Equipment & SuppliesPet Boarding & KennelsPet FoodPet GroomingPet ServicesPet Sitting & Exercising ServicesPet Specialty ServicesPet StoresPet Supplies & Foods-Wholesale & ManufacturersVeterinarian Emergency ServicesVeterinariansVeterinarians Equipment & SuppliesVeterinary Clinics & HospitalsVeterinary Information & Referral ServicesVeterinary LabsVeterinary Specialty ServicesDoneClear AllCategoryVeterinariansVeterinary Clinics & HospitalsVeterinary Specialty ServicesMore »FeaturesBook a TableCouponsBook an AppointmentNeighborhoodsDowntown AshevilleKensington PlaceCharlotte StreetMore »Sponsored LinksAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection1. Haw Creek Animal Hospital(5)1007 Tunnel RdAsheville, NC 28805(828) 298-1678VeterinariansWebsiteVirtual TourDirectionsMore InfoDr. Sinclair is the best of the best. Extremely knowledgeable, thorough, trained in homeopathy and acupuncture as well. Recently we needed an urge…Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection2. Carolina Pet Care Pa485 Old County Home RdAsheville, NC 28806(828) 348-5594VeterinariansPet FoodWebsiteVirtual TourYP AdDirectionsMore InfoAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection3. Sunvet Animal Wellness ClinicServices(5)251 Haywood St Ste AAsheville, NC 28801(828) 254-2221VeterinariansWebsiteYP AdDirectionsMore Info Dr. Davis is a warm, compassionate veterinarian. Her gift of animal communication, along with the alternative treatment modalities she uses, mak…Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection4. Sweeten Creek Animal And Bird HospitalServices3131 Sweeten Creek RdAsheville, NC 28803(828) 684-8875VeterinariansWebsiteYP AdDirectionsMore InfoFrom Business: Caring for traditional and a wide variety of small exotic pets since 1988. Laser surgery, K Laser therapy, Vet. Orthopedic manipulation.Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection5. Pet Vet on PattonServices2 Hansel AveAsheville, NC 28806(828) 232-9990VeterinariansKennelsWebsiteDirectionsMore InfoFrom Business: Our full-service animal hospital, a newly constructed 5,500-square-foot facility, features a state-of-the-art surgical suite, lab and pharmacy, along with boarding,…Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection6. REACH Of Asheville(17)677 Brevard RdAsheville, NC 28806(828) 665-4399VeterinariansWebsiteVirtual TourYP AdDirectionsVideoMore InfoWhat a pleasure. Dr. Justy is an amazing cardiologist and we are so thrilled to have her in Ashevile. The staff could not have been more friendly, h…Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection7. Mountain Valley Veterinary Hospital348 New Leicester HwyAsheville, NC 28806(828) 338-6479VeterinariansWebsiteDirectionsMore InfoFrom Business: We honor CareCredit which allows payment over time without interest or fees. This can be applied for and approved in just a few minutes in our office or from the pr…Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection8. Asheville Veterinary Assoc South(2)1275 Sweeten Creek RdAsheville, NC 28803(828) 318-8091VeterinariansWebsiteVirtual TourDirectionsMore InfoDr. Vigee is the finest veterinarian that has ever treated my many pets. Although I live in another county and can no longer use his services on a …Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection9. All Pets Animal Hospital & Rehabilitation Center(1)7 Reynolds Mountain BlvdAsheville, NC 28804(828) 552-5641VeterinariansWebsiteDirectionsMore InfoI brought my sick kitty Moonbeam to All Pets and received such compassionate care from not only the Drs but staff as well. I really felt like they t…Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection10. Asheville Veterinary(2)22 New Leicester HwyAsheville, NC 28806(828) 348-1194VeterinariansWebsiteVirtual TourDirectionsMore InfoDr Scott is the best vet in Asheville,professional staff and very friendly atmosphere.I couldnt say enough nice things about this place. Nice facili…Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection11. Cat Care ClinicServices(1)364 Weaverville RdAsheville, NC 28804(828) 645-7711VeterinariansWebsiteDirectionsMore InfoWhat an wonderful experience I had with this vet. They took such gentle care with my cat who was very stressed. They spoke quietly, held him calmly …Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection12. Charlotte Street Animal HospitalServices(3)208 Charlotte StAsheville, NC 28801(828) 333-7356VeterinariansWebsiteDirectionsMore InfoThe experience here was wonderful. I will never go to another vet hospital as long as I live in Asheville. Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection13. Animal Hospital Of North Asheville Inc(7)1 Beaverdam RdAsheville, NC 28804(828) 253-3393VeterinariansI've taken my pets here for 20 years. I'm always happy with the care my pets get and am always amazed at how the doctors here are on the cutting edg…Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection14. Sinclair, Heather DVM(3)1007 Tunnel RdAsheville, NC 28805(828) 298-1678Veterinary Clinics & HospitalsI have three dogs and Heather St. Clair is the only vet I have ever used in the six years I have lived here and she is the only vet I will ever use.…Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection15. Redwood Animal Hospital1 Crockett AveAsheville, NC 28805(828) 298-1846Veterinary Clinics & HospitalsAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection16. Fox Run Veterinary Services(2)130 Weaverville RdAsheville, NC 28804(828) 645-2908VeterinariansFox Run and Meg Presley don't just talk the talk - they walk the walk when it comes to truly caring for animals. You get the best for less than any…Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection17. Banfield Pet HospitalView all 2 Locations150 Bleachery BlvdAsheville, NC 28805(828) 298-1800Veterinary Clinics & HospitalsFrom Business: Banfield Pet Hospital® - Our veterinarians are proud to partner with you to proactively monitor the health and wellness of the pets you love. From thorough physical…Add to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection18. Genorah L Warner DVM1588 Patton AveAsheville, NC 28806(828) 252-8644VeterinariansAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection19. Christoph, John B932 Hendersonville Rd Ste 106Asheville, NC 28803(828) 277-6823VeterinariansAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection20. Biltmore Veterinary ClinicServices932 Hendersonville Rd Ste 106Asheville, NC 28803(828) 277-6823VeterinariansAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection21. Asheville Veterinary Assoc WestServices50 New Leicester HwyAsheville, NC 28806(828) 253-0451Veterinary Clinics & HospitalsAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection22. People & Pets Acupuncture16 Harris AveAsheville, NC 28806(828) 254-2773Veterinary Specialty ServicesAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection23. Kuhn, Thomas BServices1275 Tunnel RdAsheville, NC 28805(828) 298-6585VeterinariansPet Boarding & KennelsAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection24. Animal Hospital South1306 Hendersonville RdAsheville, NC 28803(828) 277-0600Veterinary Clinics & HospitalsAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection25. Humane Alliance231 Haywood StAsheville, NC 28801(828) 252-2079VeterinariansAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection26. Animal Medical Mobile Veterinary Services14 Ora StAsheville, NC 28801(828) 575-9247VeterinariansAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection27. Scott, Robert DVM22 New Leicester HwyAsheville, NC 28806(828) 253-0451VeterinariansAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection28. Emergency Animal Hospital677 Brevard RdAsheville, NC 28806(828) 665-4399Veterinary Clinics & HospitalsAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection29. Asheville Equine681 Brevard RdAsheville, NC 28806(828) 684-0000Veterinary Clinics & HospitalsAdd to mybookRemove from mybookAdded to your pets collection!Error when adding to pets collectionThis business was removed from the pets collection30. Klesius Elaine DVM1275 Sweeten Creek RdAsheville, NC 28803(828) 274-0646VeterinariansSponsored LinksShowing1-30
of 153results12345NextAdd a New CollectionOops! There was a problem saving the new custom collection.Please try again.Collection Name cannot be emptyUpload a Photo(optional)Remaining Characters: 100Remaining Characters: 500CancelSaveMap ViewFeatured Veterinariansin Asheville, North CarolinaVCA Animal Hospitals(30)Find a Location(855) 451-8649Get Coupon for Pet's First Visit!WebsiteCouponsSpecial OffersMore InfoFeatured Veterinariansin Asheville, North CarolinaREACH Of Asheville(17)677 Brevard Rd, Asheville, NC 28806(828) 665-4399WebsiteVirtual TourYP AdDirectionsVideoMore InfoAnimal Hospital at Reems Creek32 Reems Creek Rd, Weaverville, NC 28787(828) 658-0099WebsiteYP AdDirectionsMore InfoSwannanoa Valley Animal Hospital100 Martin Rd, Swannanoa, NC 28778(828) 785-4766WebsiteDirectionsVideoMore InfoAnimals R US Veterinary Clinic725 Crest Rd, Flat Rock, NC 28731(828) 435-2295Servicing all breeds of pets & farm animalsWebsiteVirtual TourDirectionsMore InfoCarolina Pet Care Pa485 Old County Home Rd, Asheville, NC 28806(828) 348-5594Just off Leicester HwyWebsiteVirtual TourYP AdDirectionsMore InfoAsheville Veterinary(2)22 New Leicester Hwy, Asheville, NC 28806(828) 348-1194Providing Quality Care Since 1972WebsiteVirtual TourDirectionsMore InfoAsheville Veterinary Assoc South(2)1275 Sweeten Creek Rd, Asheville, NC 28803(828) 318-8091Providing Quality Care Since 1972WebsiteVirtual TourDirectionsMore InfoHaw Creek Animal Hospital(5)1007 Tunnel Rd, Asheville, NC 28805(828) 298-1678WebsiteVirtual TourDirectionsMore InfoMeridian Animal Hospital1829 Hendersonville Rd, Ashe, NC 20704(828) 575-2244WebsiteVirtual TourDirectionsMore InfoVCA Animal Hospitals(30)Find a Location(855) 451-8649Get Coupon for Pet's First Visit!WebsiteCouponsSpecial OffersMore InfoSweeten Creek Animal And Bird Hospital3131 Sweeten Creek Rd, Asheville, NC 28803(828) 684-8875WebsiteYP AdDirectionsMore InfoMountain Valley Veterinary Hospital348 New Leicester Hwy, Asheville, NC 28806(828) 338-6479Providing Compassionate Care for over 25 YearsWebsiteDirectionsMore InfoPet Vet on Patton2 Hansel Ave, Asheville, NC 28806(828) 232-9990WebsiteDirectionsMore InfoAll Pets Animal Hospital & Rehabilitation Center(1)7 Reynolds Mountain Blvd, Asheville, NC 28804(828) 552-5641WebsiteDirectionsMore InfoCountry Lane Animal Hospital(1)9019 Carolina Blvd, Clyde, NC 28721(828) 627-9100WebsiteDirectionsMore InfoWNC Vet Hospital(1)2 Pond St, Arden, NC 28704(828) 676-6980WebsiteDirectionsMore InfoMills River Animal Clinic(2)200 Turnpike Rd, Horse Shoe, NC 28742(828) 435-2219Compassionate Care For Your 4 Legged Animal.WebsiteDirectionsMore InfoSunvet Animal Wellness Clinic(5)251 Haywood St Ste A, Asheville, NC 28801(828) 254-2221WebsiteYP AdDirectionsMore InfoSmokey Park Veterinary Hospital(2)7 Pisgah Hwy, Candler, NC 28715(828) 665-1001Contact Us for InformationDirectionsMore InfoCandler Veterinary Clinic(1)911 Smoky Park Hwy, Candler, NC 28715(828) 667-0247Contact Us for InformationWebsiteDirectionsMore InfoCat Care Clinic(1)364 Weaverville Rd, Asheville, NC 28804(828) 645-7711Contact Us for InformationWebsiteDirectionsMore InfoAll Animals Veterinary HospitalServing the Asheville area.(706) 216-8387Full Service Vet, Boarding & GroomingWebsiteYP AdMore InfoWhite Oak Veterinary Hospital PC3336 Hendersonville Rd, Fletcher, NC 28732(828) 687-2803Contact Us For InformationWebsiteDirectionsMore InfoAll Pets Animal Hospital & Rehabilitation Center(1)7 Reynolds Mountain Blvd, Asheville, NC 28804(828) 919-9972WebsiteDirectionsMore InfoAppalachian Animal Hospital68 N Main St, Weaverville, NC 28787(828) 482-9943WebsiteDirectionsMore InfoAppalachian Animal Hospital68 N Main St, Weaverville, NC 28787(828) 459-6977WebsiteDirectionsMore InfoCharlotte Street Animal Hospital(3)208 Charlotte St, Asheville, NC 28801(828) 333-7356WebsiteDirectionsMore InfoCharlotte Street Animal Hospital(3)208 Charlotte St, Asheville, NC 28801(828) 423-0967WebsiteDirectionsMore InfoCharlotte Street Animal Hospital(3)208 Charlotte St, Asheville, NC 28801(828) 333-7437WebsiteDirectionsMore InfoDidn't find what you were looking for?magnifying glassPlease help others by helping us do better.Suggest a BusinessHelpful Reviews Asheville Veterinary Assoc Southpugsmom40 ratedWonderfulWe had a ick dog that we were concerned about. He wa not acting him elf. I called thi office and they an wered all our que tion , told u about how much to expect to pay and we got him een that evening. Everyone wa o nice The Vet li tened to u and gave u adivce that ...morewa very helpful. I will go back to thi office again. I rate it at EXCEPTIONAL!!view lessAnimal Hospital Of North Asheville Incbenweller ratedSo glad I found thi vetMy wife and i recently moved to the A heville area. We tried vet after vet, but none of them could give my dog the pecial care he need . I finally tried Animal Ho pital of North A heville and now we will never go anywhere el e. They have all the technology my dog need and ...morethey are al o very nice and affordable.view lessAsheville Veterinary Assoc SouthJacque G. ratedDr. Vigee i the fine t veterinarian that ha ever treated my many pet . Although I live in another county and can no longer u e hi ervice on a regular ba i he remain my peciali t and ha my deepe t re pect. Hi brilliance i equal to hi compa ion and under tanding....more He ha been a ble ing to my life. view lessAboutAbout UsSite FeedbackContact UsAdvertise with UsCareers - We're HiringCorporate BlogEngineering BlogLegal | [
{
"key": "website_description",
"type": "global",
"value": "This website is a United States-based web site operated by YP Holdings that provides listings for local businesses. In 2013 it was re-branded as YP.com or simply \"YP\"."
}
] |
Amazing portrait and I love the short depth of filed. But the image could look even better with some post production work; the blacks look i bit grey to me.
Fujifilm X-Pro2 Fujifilm XF 18mm F2 R Fujifilm XF 60mm F2.4 R Macro Fujifilm XF 35mm F2 R WR | [
{
"key": "website_description",
"type": "global",
"value": "This website is a website about digital cameras and digital photography, established in November 1998. The website provides comprehensive reviews of digital cameras, lenses and accessories, buying guides, user reviews, and forums for individual cameras, as well as general photography forums."
}
] |
REGENT TAIPEI $172 ($̶2̶4̶7̶) - Updated 2018 Prices & Hotel Reviews - Zhongshan District - TripAdvisor
#91 of 142 Hotels in Zhongshan District
Traveler (1865)
4.5 2,908 reviews
{"BOOKING_FEATURES": ["IB_IRG_RATE_VERIFICATION","IB_STREAMLINED_SELECTED_ROOM","IB_POST_BOOKING_LOGIN_US","IB_SHOW_EMAIL_FOR_INSECURE_LOGIN","RCMS_INLINE_ROOM_GRID_MAX_OCC","IB_POST_BOOKING_LOGIN","IB_IRG_PERFORMANCE_METRICS","IB_IRG_MATCH_META","MOB_BOOKING_EMAIL_AGREE_HIDE","CHILDREN_SEARCH","IB_EXPRESS_BOOK","HR_IB_EXCLUDE_TAXES_AND_FEES","IB_DW_CCNAME_WITH_AUTOCOMPLETE","IB_IRG_PERFORMANCE_METRICS_MOBILE","IB_BOOKNOW_CLEAN_WITH_ICON_SHORT_BTN","STORED_CARDS","IB_PRICE_WINS_COPY","IB_PRICES_OUTSIDE_ROOM_BUTTON","IB_EXIT_INTERRUPTER","IB_SHOW_AMENITIES_AS_ICONS","META_AIR","IB_REVIEW_BOOKING_BUTTON","IB_INLINE_ROOM_GRID","IBEX_HIGH_EQUITY_BRANDING","IB_PRICE_WINS_POST_TX","IB_BOOKING_FORM_FAVICON","IB_KIPLINGER_AWARD","IB_URGENCY_BLOCK"] , "IMPRESSION_KEY": "2d94328410234cc99dfdde8654002535", "roomSelectionModel": {"partnerInfos":[],"multiplePartners":false,"polling":{"locationId":301429,"bookingSessionId":null,"detailedAvailabilityKey":null,"commerceContentIds":[37322129],"additionalContentIds":[],"pollCount":0,"checkin":{"day":28,"month":10,"year":2018},"checkout":{"day":29,"month":10,"year":2018},"adults":2,"child_rm_ages":"","rooms":1,"display_rooms":300,"entryPrice":211,"entryCurrency":"USD","complete":true,"formKey":"","showAllRooms":true,"genNewBookingSessionId":false,"winningProviderAtClick":"","selectedRoomKey":"","impressionKey":"2d94328410234cc99dfdde8654002535","navArea":null,"referringServlet":"Hotel_Review","highestMetaPrice":212,"lowestMetaPrice":197,"additionalPartner":false,"highestMetaPriceDisplay":212,"roomsToVerify":[],"clazz":null},"summary":null,"unavailable":false,"metaOffers":[],"mismatchCheckModel":null,"totalMediaCount":0,"hotelPhotos":[],"noticeHeaderMessage":null,"moreProviders":null,"lowestPricePartner":null,"showAllRooms":true,"isMetaCheaper":false,"isBookingLessThanOrEqualToMeta":null,"avgHistoricalPrice":0.0,"avgHistoricalDisplayPrice":null,"expressBookState":null,"highestMetaPrice":212,"lowestMetaPrice":197,"highestMetaPriceDisplay":212,"hotelName":"Regent Taipei","hasSpecialTimeOfStayTaxes":false,"trackingTree":null,"trackingTreeId":null,"showPriceHoverTooltip":false,"trackingContext":"eyJzdGF0ZSI6IkhPVEVMX0FVQ1RJT04iLCJwIjoiSFJfTWFpbkNvbW1lcmNlIiwiaWRzIjp7IkJGSyI6IjJkOTQzMjg0MTAyMzRjYzk5ZGZkZGU4NjU0MDAyNTM1IiwiQUlLIjoiMDQwZDk2ZWJmN2ExNGE3NmE2Mzc1NGM1ZDA1YjA2YmEifSwiZW50cnlTZXJ2bGV0IjoiSG90ZWxfUmV2aWV3In0=","cheaperPricesExist":false,"enableLPF":false,"priceDropPercent":0,"canExpandRooms":false,"expandRoomsToAllPartners":false,"roomSelectionKey":null,"useSupplierDirectTreatment":false,"isSupplierDirect":false,"showProviderSeparator":false,"clazz":null,"seeMoreMessage":null,"seeMoreIFrameMessage":null,"isPricelineCom":false,"isPriceDrawerEnabled":false,"isMetaMarketingLandOnBookingFormEnabled":false}, "ibAvailability": true, "metaAvailability": true, "topOfferIsIB": false, "numHacTries": 1, "checkIn": "10/28/2018", "checkOut": "10/29/2018", "lowestPrice": "$197", "hasDates": true, "hacComplete": true, "contentIdMappings": {"37322129":"BookingCom"}, "pollingEnabled": false, "preventScroll": false, "offerClickToken": null, "conditionalUpdate": false, "mightGetRooms": false, "divClasses": "ppr_rup ppr_priv_resp_hr_room_grid", "singlePartnerRoomGridWidget": {"containerClass":null,"containerAttributes":null,"widget":{"divClasses":"prw_rup prw_ibex_room_grid_responsive","js":{"handlers":"(ta.prwidgets.getjs(this,'handlers'))","tracking":"(ta.prwidgets.getjs(this,'tracking'))"},"dust":{"sub_header":"ibex_room_grid_responsive__sub_header"},"name":"ibex_room_grid_responsive","template":"ibex_room_grid_responsive__widget","moduleList":["handlers","tracking"]},"scriptFlags":null}, "multiPartnerRoomGridWidget": null, "mismatchMessage": {"containerClass":null,"containerAttributes":null,"widget":{"divClasses":"prw_rup prw_ibex_mismatch_message","js":{"handler":"(ta.prwidgets.getjs(this,'handler'))"},"dust":{},"name":"ibex_mismatch_message","template":"ibex_mismatch_message__widget","moduleList":["handler"]},"scriptFlags":null}, "maxRoomsToShow": 300, "isTablet": false, "roomGridRowWidget": {"containerClass":null,"containerAttributes":null,"widget":{"divClasses":"prw_rup prw_ibex_room_grid_row_responsive","js":{},"dust":{"amenities":"ibex_room_grid_row_responsive__amenities","occupancy":"ibex_room_grid_row_responsive__occupancy","condition_col":"ibex_room_grid_row_responsive__condition_col","price_text":"ibex_room_grid_row_responsive__price_text","reservation_col":"ibex_room_grid_row_responsive__reservation_col"},"name":"ibex_room_grid_row_responsive","template":"ibex_room_grid_row_responsive__widget","moduleList":[]},"scriptFlags":null}, "mismatchMessageLightbox": null, "deviceInfo": "OtherOS OtherBrowser", "bookOnTripAdvisor": "Book on <img class=\"ibHeaderImg\" alt=\"TripAdvisor\" src=\"https:\/\/static.tacdn.com\/img2\/branding\/rebrand\/TA_logo_primary.png\"\/>"}
Japanese (1,142)
Chinese (Trad.) (864)
All reviews tai pan breakfast buffet business trip concierge desk rooftop pool club floor star hotel special thanks spacious room wonderful hotel duty manager beef noodles hotel lobby convenient location mrt station night market olivia
Teresadragon
Teresa Rodrigues Baptista
Very good location and service the hotel services is very kindly and helpfully. Hotel location is very center and have so many foot massage for relaxing after your shopping. I recommend to come and stay in this Hotel ❤️
Thank Teresadragon
Luxurious. Absolutely wonderful experience. From check-in to checkout, the facilities, hygiene, the restaurant, the service everything was spot on. The view from my 15th floor room was spectacular. Large bathroom. Prefect bed with really comfortable mattress and pillowsMore
Response from SimonRegent, Managing Director at Regent TaipeiResponded 4 days ago
Dear sudeepdasD, Thank you for your valuable comments, we are very glad to hear you enjoyed your time here. Your comments will be shared with the team. We look forward to having the pleasure of welcoming you back soon. Warm Regards, Simon Wu Managing Director...More
Even if you don't stay, check out their bar, spa and restaurants!
Amazing stay! Great staff - we told them it was our anniversary and they prepared balloons, cake, champagne... wow! The spa was excellent, the breakfast was good, the bar was nice and well-priced... what can I say? The best stay I have had in Taiwan....More
Thank WilliamPH
Dear WilliamPH, Thank you for your valuable comments, we are very glad to hear you enjoyed your time here. Your comments will be shared with the team. We look forward to having the pleasure of welcoming you back soon. Warm Regards, Simon Wu Managing Director...More
My family stayed at the Regent initially for 3 nights, then we extended for a further 2 nights due to our flights being cancelled on us. The staff there were exceptional in accomodating us for the extra 2 nights. It was my birthday on one...More
Dear Jason Y, Thank you for the great comments following your recent stay with us; to hear that we have contributed to your pleasant stay in Taipei is very inspiring to our team. We look forward to providing you another wonderful experience in the near...More
Derriel T
Top quality service, food, and great location
I have stayed here many times, usually for two weeks at a time. The service is always 5 star and tue food is delicious. There is high end shopping in the hotel and many normal shopping centers nearby. The hotel has Michellin ratated restaurants and...More
Thank Derriel T
Dear Derriel T, Thank you for sharing this, your feedback made our day! We are so happy to hear that you enjoyed the breakfast and azie. Once again, thank you for choosing Regent Taipei and we look forward to seeing you again very soon! Warm...More
Regent Taipei has 538 of the most spacious and attractively designed rooms in Taiwan. Standard amenities include the pressure relieving Wellspring Bed, a pillow menu, feather duvet, large marbled …More bathroom with deep soaking tub and separate shower, 24-hour room service, complimentary wireless Internet, satellite TV, stereo, in-room safe, and mini-bar. On the top floors of Regent Taipei is TAI PAN Residence & Club, an all-butler hotel that coalesces the traditional Oriental milieu with contemporary comfort, where one can Experience Modern Chinese Lifestyle. Also found in the hotel are the Wellspring Spa urban resort, the state-of-the-art Health Club & Sauna, complete meeting and banqueting facilities, a rooftop pool, the Regent Galleria that provides a world-class shopping venue to cater to the needs of global luxury travelers, and eight world-class restaurants that offer traditional and innovative cuisines. Less
Traveler (1,865)
"Very excellent and clean very good location many foot massage for relaxing. Hotel breakfast is very..."
"go high for an incredible view. From floor 12 I could see Taipei 101."
687armandd | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American online travel company that operates a website and mobile app with user-generated content and a comparison shopping website."
}
] |
I bought these for a holiday in Florida, fantastic product, very impressed, great fit, comfy, looked good, quick drying.
£4.99 Womens Floral Swimming Shorts Ladies Summer Beach Surf Board Bottoms Pants S-XXL
Brook Haven Raven Womens Swimming Hot Pants Shorts
£7.99 Mountain Warehouse Womens Plain Boardshorts Swim Surf Pool Beach Summer Shorts
£4.99 Mountain Warehouse Rash Vest UV Protection Womens Swimming Diving Surfing Top
Amazon Bestsellers Rank: 932 in Clothing (See Top 100 in Clothing)
£4.99 Mountain Warehouse Womens Plain Boardshorts Swim Surf Pool Beach Summer Shorts
£8.75 Womens / Girls Floral Print Swim Shorts - Beach Surf Board - 941
£3.99 Brook Haven Raven Womens Swimming Hot Pants Shorts
9 of 9 people found the following review helpfulPerfect for the pool and beach
8 of 8 people found the following review helpfullooking ready for the pool
13 of 14 people found the following review helpfulIMPORTANT: READ BEFORE YOU BUY
on 12 July 2013Colour Name: TurquoiseSize: UK Size 12-14
A lovely pair of lightweight shorts, that are a perfect fit and very comfortable. Have ordered a second pair already!
3 of 3 people found the following review helpfulBoard Shorts
on 18 April 2013Colour Name: TurquoiseSize: UK Size 12-14
Fantastic wee pair of shorts, my daughter loves them! practical and quite thick material as well.Would recommend this product.
on 26 July 2013Colour Name: PinkSize: UK Size 8-10
Love them. Bloody good value.
Always go a size up was too small
Many thanks for shorts. Very fast delivery service.
Published 17 days ago by Dawn Tague
Published 17 days ago by gladiator
Published 18 days ago by B. Kennedy
Published 20 days ago by Natalya
Published 20 days ago by elizabeth workman
Published 21 days ago by Ms. Ashley Howaniec
Okay if your looking for cheap and cheerful. String came out very quickly
Published 23 days ago by Honor Tennant | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational technology company which focuses on e-commerce, cloud computing, digital streaming, and artificial intelligence."
}
] |
Wahl Pets - Walmart.com
Free store pickupas soon as todaywith •Free store pickupas soon as 9/24with Pedigree Marrobone Real Beef Flavor Dog Snacks & Treats, 24 oz
Free store pickupas soon as todaywith •Free store pickupas soon as 9/24with Pedgree Small Breed 15.9 lb.
Free store pickupas soon as todaywith •Free store pickupas soon as 9/24with Pedigree Healthy Weight Dog Food, 15 lb
Free store pickupas soon as todaywith •Free store pickupas soon as 9/24with Wahl Pet-Pro, Complete Pet Clipper Kit
Free store pickupas soon as todaywith •Free store pickupas soon as 9/24with Clinically proven to reduce up to 80 percent of tartar build-upProven to reduce plaque build-up
Free store pickupas soon as todaywith •Free store pickupas soon as 9/24with Pedigree Healthy Joints Dog Food, 15 lb
Free store pickupas soon as todaywith •Free store pickupas soon as 9/24with Pedigree Active Nutrition Dog Food with Chicken, Rice & Vegetab… | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational retail corporation that operates a chain of hypermarkets , discount department stores, and grocery stores from the United States, headquartered in Bentonville, Arkansas."
}
] |
http://www.overstock.com/Home-Garden/Fabric-Dining-Chairs-Set-of-2/5315955/product.html?recommendation_id=fa78ed28-d279-46a3-b31d-7fe2fccdf07f&rcmndsrc=2&atcError=3 | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American internet retailer selling primarily furniture headquartered in Midvale, Utah, near Salt Lake City."
}
] |
Destiny 2: Decision of The Next Generation by Blue Saffire, Evei Lattimore |, Paperback | Barnes & Noble® B&N Top 100 NY Times Bestsellers
by Blue Saffire, Evei LattimoreBlue Saffire
Destiny 2: Decision of The Next Generation Book 2 in Destiny the Series
From the time, she walked in our home I saw myself, my past, my hurts. I told Alex what would happen and I knew in my heart she would change our family forever. I just didn't know how. I didn't expect to fall in love with her like she was my very own daughter. I also didn't know my heart wouldn't be the only one she would capture.
It only took one night for me to lose everything. However, in losing it all I gained the world. A new world. When he opened the door, I didn't know I was staring at a future I wouldn't be able to deny. His father's temper would be the only thing that could keep us apart, because he is his father's son in every way. It doesn't matter what our hearts want when the universe insists on having its way.
My name is Meliyah Santos, they knew me as Mellie in the Towers, but I left that world behind or so I thought. It seems my Dad's world would always tug at me no matter where I landed. I just had to decide which world I wanted to be mine. Would history repeat itself? Or could I finally find a happy ever after.
*This is Book 2 in the bestselling Destiny series from the bestselling, award-winning author Blue Saffire. This Book is from the Evei Collection. They are not connected to the other Blue Saffire books outside of the collection. This book was once released as Destiny 2 Next Generation by Evei Lattimore as a sweet novel. This is a re-release with revisions and the signature Blue Safire heat and new bonus chapters.
Destiny 3: Lost Hope: Alex coming soon...
9781941924730
Perceptive Illusions Publishing, In
star lee johnson
Ballers 2 : His Final Play Book 2 in the Ballers SeriesNico has lost everything ...
Ballers 2 : His Final Play Book 2 in the Ballers SeriesNico has lost everything he once held dear to save his nieces' life. It was the right decision for him and he would do it again, no question. Especially ...
Award winning Author Blue Saffire presents Brothers Black: Wyatt the Heartbreaker Book 1 in Brothers ...
Award winning Author Blue Saffire presents Brothers Black: Wyatt the Heartbreaker Book 1 in Brothers Black SeriesI'm the giant that they should've left sleeping. Touch my family that's a problem, touch my woman that's your life. That woman has been ...
Using increasingly sophisticated levels of artificial intelligence (AI) and embodied intelligence (EI), a new generation ...
Using increasingly sophisticated levels of artificial intelligence (AI) and embodied intelligence (EI), a new generation of robots is being designed to look, act and even think like humans. Hubots, or human-inspired robots, are expanding the boundaries of what robots can ...
Shannon's whole world changed seven months ago. She has never felt more lost. All the ...
Shannon's whole world changed seven months ago. She has never felt more lost. All the insecurities she has grown up with and tried to hide are roaring to the forefront as she feels like her identity has been rubbed from ...
Hush: Family Secrets
Hush : Family Secrets Book 1 in SeriesUri Donati is like a ghost and not ...
Hush : Family Secrets Book 1 in SeriesUri Donati is like a ghost and not your friendly variety. If he finds you, you are as good as ghost. He is the Donati family's weapon. So it is clear that he ...
Legally Bound 3 His Law Book 3 in SeriesNathaniel Briggs has met his match in ...
Legally Bound 3 His Law Book 3 in SeriesNathaniel Briggs has met his match in every way. When it comes to the bedroom Pamela Kemble is a pint size version of himself. She is determined to play by her own ...
The Legally Bound Series is the winner of the Swirl Awards Best Series of 2015 ...
The Legally Bound Series is the winner of the Swirl Awards Best Series of 2015 Legally Bound 5.1 Tasha Illegal Dealings Book 5.1 in the SeriesLegally Bound 5.1My name is Monique Natasha Gabriel. My life is going just as I've ... | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American bookseller. It is a Fortune 1000 company and the bookseller with the largest number of retail outlets in the United States."
}
] |
Allen, Georgia Filmography
1997, role: actress , character name: Lucille Wright
1997, role: actress , character name: Mary Irene Tatum
1995, role: actress , character name: Rose, Cleaning Woman
1994, role: actress , character name: Airport Arrivals Clerk
1992, role: actress , character name: Nurse Janet
1991, role: actress , character name: Suzanne
1991, role: actress , character name: Seagraves' Maid
The Avenue of Our Years
1990, role: actress , character name: Lucretia Andrews
1989, role: actress , character name: Mrs. Jamais
1989, role: actress , character name: Black Woman
1987, role: actress , character name: Landlord's Lawyer
1987, role: actress , character name: Mrs. Rambaugh
1987, role: actress , character name: Nurse #2
1985, role: actress , character name: A.F.M.
1983, role: actress , character name: Carrie Carter
1982, role: actress , character name: Judge Alice Hailey
1980, role: actress , character name: Sister Carmella
1979, role: actress , character name: Mrs. Gurney
1979, role: actress , character name: Mrs. Carter
1977, role: actress , character name: Mrs. Jones
1972, role: actress , character name: Gus's Mother
1993, role: actress , character name: Donna Strachan
1989, role: actress , character name: Geraldine
Latest News for: georgia allen
Andrew Young's love song for Atlanta, past, present and future
When former Atlanta Mayor Andrew Young received Georgia Tech’s Ivan Allen Jr. Prize in Social Courage on Sept. 13, he turned it into a love song for Atlanta – past, present and future ... ....
Authority Chairman Sam Allen said hospital officials received the documents from the Joint Commission some time during the day Wednesday and only has 30-45 days to address the concerns outlined in the survey ... there are no disruptions to services and facilities at South Georgia Medical Center ... Allen said he is confident SGMC will beat the deadline....
By the end of last October, Tom Allen had grown incredulous. It seemed that every week produced a new injury for his Indiana football team to overcome, sapping depth and forcing Allen to retool on the fly ... But in a quarter century of coaching, Allen had never seen anything like it. So when he revamped IU’s strength and conditioning staff in December, Allen did so with injury prevention in mind ... Allen also hopes to get Nworah back soon....
The German Institute Taipei criticised the shop for its logo design earlier this week. In a statement on 18 September, it said ... Reporting by Kerry Allen ... Church protests halt Georgia cannabis law ... ....
Boyd gets its fill of Blanke at Russell
Sophomore Lena Blanke perked the Lady Devils up with two second-half goals and Kynidee Allen supplied another hat trick as Russell defeated Boyd County, 5-1, in a 63rd District tilt at the Russell Soccer Complex on Tuesday night ... Allen continued her torrid scoring pace with two tallies in the first eight minutes. Georgia Arrington connected with Allen on a through ball and the senior went far post for the score....
Too bad it looks like Georgia doesn’t feel the same way about in-state opponents ... That started this year when they went to Georgia State and lost 24-20 in a game they likely should have won ... That includes Georgia, who coach Brian Bohannon said he has reached out to. After all, he is a former Bulldog and a former teammate of current Georgia coach Kirby Smart ... Allen Smith ... The folks at Georgia State agree and are open to a rematch....
A second man from Georgia has been arrested in connection with a series of armed home-invasion robberies where one suspect reportedly wore a scary mask ... Allen, 30, of McDonough, Georgia, made his first appearance in Douglas County District Court on Monday, after being booked into the jail late Friday night. Allen is charged with seven crimes in all ... Judge James George set Allen’s bond at $125,000 and appointed him an attorney....
Jack Cline Sr., 83, passed this life on Sunday, Sept. 16, 2018 in Riverside Methodist Hospital in Columbus after a brief illness. Mr. Cline was born on Monday, Aug. 26, 1935 to the late John Allen and Georgia (Bundy) Cline in Mansfield and was a lifelong resident ... Keith Bradford, eight siblings, Bernice Cash, Catherine Clark, Donald Cline Sr, Oliver Cline Sr., Allen “Buddy” Cline, Georgia Dye, Barbara Davis and his twin Jacquelyn Wilkson....
Harris breaks open Hoosiers' win over Ball State
BLOOMINGTON — When J-Shun Harris tore his ACL for the third time in as many seasons last year in the eighth game against Maryland, Indiana coach Tom Allen was certain he had seen his gutty wide receiver play for the final time of his career ... His previous punt returns for touchdowns were from 44 yards against Virginia and 70 yards against Georgia Southern....
BROCKINGTON, MARK
BROCKINGTON, Mark, age 65, of Richmond, departed this life September 8, 2018. He is survived by his mother, Georgia Brockington; two sisters, Lynetta Thompson and Georgette Graves; one brother, Will Brockington; two aunts, Georgia A. Brown and Rosetta Allen; a .......
Russell Dee-light: Allen nets four goals as Lady Devils rally past Rowan
MOREHEAD Kynidee Allen didn’t notch her second three-goal game on Thursday ... Allen beat the Lady Vikings’ goalkeeper in the 34th, 39th, 74th and 80th minutes. Bowlers would call Allen’s quadruple a “four-bagger;” Allen said she hasn’t done it since rec ball. “Six or seven years,” Allen said ... Junior Georgia Arrington’s pass from about 40 yards away found Allen surrounded by three Vikings ... Of course Allen delivered it.... | [
{
"key": "website_description",
"type": "global",
"value": "This website is a news aggregator founded in March 1995 and launched online in 1998. In 2003, Search Engine Watch praised the service for its \"Special Reports\", and called it \"an interesting alternative\" to other news aggregation services."
}
] |
inauguration of barack obama. he came here four years ago amid high hopes and great expectations. but the second time around, well, there will definitely be a different feel as he takes the podium and in gnawing rated four more years, delivers his speech. many will be watching to see where this nation goes the next four years. >> i barack hussein obama do solemnly swear. >> he carried the hopes and dreams of the millions who voted for him. excitement, wonder and passion electrified the packed crowd on the national mall. >> i stand here today humbled by the task before us, grateful for the trust you have bestowed, mindful of the sacrifices borne by our an seft ors. >> the mood in washington that night ecstatic as the new president and his beautiful wife celebrated a victory for the ages. the new administration was the toast of the town. but storm clouds were hovering. a recession and financial crisis gripped the country with unemployment soon to hit 10%. a bailout of some financial giants and massive stimulus plan occupied his early days in office. but against heavy opposition, th CBS This Morning Saturday
for barack obama's second inauguration as president of the united states. >> once every four years this fiercely political town briefly sets us up part shn ship. welcome. i'm rebecca jarvis. >> i'm anthony may sis. here's what's coming un. the majesty of the inauguration and what those first few moments may tell us about the next four years. >> we'll also remember a great american whose legacy is being celebrated today with the national day of service. 50 years after he led a march on washington. we'll discuss the dreams of reverend martin luther king jr. >> i have a dream that one day this nation will rise up live up to the meaning. >> martin luther king iii joins us. >>> we'll find out what the white house is like for sasha and malia obama and those other rare americans who spent their childhood there. >>> and as the mo town legend smokey robinson prepares for the president, he sits down with us to explain why this inauguration is personal. ♪ and we'll be free ♪ >> that and so much more on "cbs this morning saturday," january 19th, 2013. captioning fun [untitled]
with guns during president obama's final four years in office it is estimated that 40,000 americans will be killed with guns, the same amount of people killed in vietnam. says the shooting in arizona which killed six people including a nine-year-old and seriously injured than congresswoman-- as the city we should continue to lead the way to advocate for and pass policies that protect the general well-being of the society. Presidential Inauguration Coverage
of four years ago as barack obama walked through the capital, nearly 2 million people anxiously stood by to witness history. >> so help me god. >> congratulations, mr. president. >> with the completion of the oath, the new president is greeted with the traditional 21-gun salute hail to the chief, and the majesty and responsibility of the most powerful office on earth. a presidential inauguration can set the tone for an entire four-year term with consequences that make an indelible mark on history. so let's take a look at some of the most consequential inaugurations of the past with the help of presidential historian and cbs consultant douglas brinkley. welcome. >> thank you. this is very inspiring. >> it is inspiring. the whole backdrop is inspiring when you see it live in person. what do you think? how much of a harbinger are the things to come with what the president gives. >> i think the mastercraft and states craft is the second inauguration. you don't hear much about it but it was 1937. the first one was we have nothing to fear but fear itself. here h Book TV
at the obama campaign recently, particularly obama, used amazingly -- for today's world, sophisticated ways of deciding who is going to vote for what, when, where. >> host: professor, looking ten years from now, are we going to look back at the obama campaign and laugh at how simplistic? >> guest: yes, i believe that's true. we'll say this is a watershed, but compared to what's going on now, we say in 2020, that was baby steps. the kinds of things that people will be able to do with our data, we can't imagine right now -- we can but it will seem silly. the real interesting question is, if it's political, can they do stuff that even the government will say is not acceptable for regular markets? political speech. does date a marketing for politics considered political speech and so is offlimits to any kind of regulation? that's a question we have not resolved yet. >> host: what are the privacy implications. >> guest: it departments on what you mean by privacy. the real interesting question is americans have a hard time grappling with the notion of privacy bus it's very tough to understand wha News Public Affairs
the fashion statement she made four years ago, alina cho takes a look back. >> first lady michele obama. >> when first lady michele obama walked out on stage in that memorable white gown by jason wu, overnight, the designer became a household name. >> so take me to that moment, where she walked out. >> i was screaming at the top of my lungs. that's me. >> who will be the lucky one four years later? >> it's really brilliant what she's done in keeping a secret i have to say. in the previous administrations while there was always interest in what the first lady wore, there was never this kind of red carpet moment. >> reporter: sources close to the process say what started out as a 20 designer field for the inaugural gown has whittled down to two. two designers who have a shot at worldwide fame. so who are they? likely a new york based designer and quite possibly one who is emerging versus a established. around thanksgiving, designers submit sketches. garments are made. there are fittings and more fittings. the gowns are actually shuttled back and forth between new york and d.c. and because Book TV
Jan 13, 2013 1:15pm EST
, looking ten years from now or even 20 years, are we going to look back at the obama campaign and laugh at how simplistic -- >> guest: yes, i believe that's true. we'll say this was a watershed, but compare today what's going on now we say in 2020 that was baby steps. the kinds of things that people will be able to do with our data we can't imagine right now, or we can, but it will seem silly. and the real interesting question is if it's political, can they do stuff that even the government will say is not acceptable for regular marketers? in other words, political speech. does data marketing for politics, is that considered political speech and so is off limits to any kind of regulation? that's a question we haven't resolved yet. >> host: so what are the privacy implications of the -- >> guest: we've just been talking about it. it just depends what you mean by privacy. the interesting question is americans have a hard time grappling with the notion of privacy because it's very tough to understand what's happening. if you go to a site and it says you can disable the cookies but if you d News4 Today
new orleans. like four years ago, president obama has asked people nationwide to join his family and celebrate by serving. this year the president's request is especially timely. it's just the second time inauguration has coincided with the martin luther king jr. holiday weekend. at the rock creek conservancy, volunteers will be cutting back an invasive vine. from one labor of love to the next. organizers in the convention center are setting the stage for tonight's children concert. >> we'll be putting the touches on the infrastructure for that. >> reporter: after the concert, crews will transform the space, setting the scene for the two official inaugural balls, down from ten in 2009. altogether, a handful of artists will perform throughout the weekend. security will be tight. hundreds of thousands of visitors flock to d.c. to take part in history. president obama will be sworn in a private ceremony tomorrow. then monday thousands of people will be back here at the national mall for the public ceremony and parade to follow. reporting live near capitol hill, i'm danielle lee. >> NBC Nightly News
is not the only one in the spotlight for the past four years. we have seen sasha and malia obama grow up right before our eyes. malia is now a high school freshman and her little sister, sasha, is in her first year of medical school -- not medical school. middle school. she didn't grow up that fast. >> maybe one day. >> maybe. never know. she's smart enough. nbc's kristen welker is live at the white house with a look at the first daughters. hello, kristen. >> reporter: hey, alex. well, good afternoon. it is amazing how much they have grown, though, and those who know the family well say these next four years will bring new challenges and some new perks. >> and now, the president of the united states. >> reporter: the night belonged to their father. but when malia and sasha stepped onto the stage at grant park election night it was hard not to marvel at how much they had matured. >> even i was struck on election night this year just seeing how much they have grown from four years ago. >> reporter: they were so young when they moved into the white house. sasha just 7 and malia 10. now at 11 and Fox 5 News at Ten
age you more quickly than everyone else? we'll look at president obama after four years in the oval office. >>> up next, your real estate questions answered including whether it's ever a good idea to walk away from your mortgage. i've discovered gold. [ female announcer ] new roc® retinol correxion max. the power of roc® retinol is intensified with a serum. it's clinically shown to be 4x better at smoothing lines and deep wrinkles than professional treatments. roc® max for maximum results. and "i have no idea what i'm doing," you need a hand. well, walgreens is innovating to help. by making prescription refills this easy. and we're bringing our pharmacists out front to answer your questions. at walgreens, we'll do more than help you get well. we'll help you stay well and live well. because that's what it really means to be at the corner of happy and healthy. very interesting. cool. i like "success." joy. i got cracker chips. [ laughing ] chocolatey pretzel. mmmm.... special k! [ female announcer ] snack and stay on track with special k. i like "confidence." i am a confident lady. Washington Journal
remember that inspiring call from president obama exactly four years, to end partisan politics. if you were keeping score, and we are, that promise would actually fall into the incomplete category. promises considered, mostly clept, more jobs and a middle class tax break, ending the wars in iraq and afghanistan and, of course, making health care accessible for all. tomorrow morning the president will be making even more promises. the question though, can he keep them? back with me now bill schneider, resident fellow for the think tank and lynn sweet of the chicago sun times." bill, your organization spends a fair amount of time on important issues of the day. what promises can we expect to hear from president obama tomorrow? >> immigration reform. i mean, that's something he neglected in his first term and didn't give it any real priority, and it's very important. really helped him get elected, re-elected rather. guns will come up, i think, because the mood is right for that. i'm not sure how far he'll be able to go with that because of the resistance in the house, but he'll fight the good The Kudlow Report
budgets they have gone up under president obama and have held at $3.5 billion each year. >> i got to go. we can continue it another time. >> but it is also economic growth which it self might be a function of taxes and spending. if this economy were growing, you would have a substantially lower budget deficit. gentlemen we will welcome you back another time. >> there is at least one state in the northeast that gets it. natural gas shale and it is pennsylvania and the republican governor tom corebet is about to join us. he picks up support from chuck schumer who didn't get an apology for the anti-israel statements. if we were growing at 5% instead of 2% we would be close to a balanced budget today. i'm kudlow we will be right back. at 1:45, the aflac duck was brought in with multiple lacerations to the wing and a fractured beak. surgery was successful, but he will be in a cast until it is fully healed, possibly several months. so, if the duck isn't able to work, how will he pay for his living expenses? aflac. like his rent and car payments? aflac. what about gas and groceries? aflac. cel The Cycle
are -- we have a divided government now. it has been a difficult four years but i think president obama is a natural. i think he will make that a big theme of his second term. i think you will hear some of that tomorrow. host: this is from this morning's "the washington post" who writes a new term, a new obama. he points out and draws an aanalogy to f.d.r. and eisenhower. guest: the roosevelt second inaugural address is interesting to read. it really is at peace with the first inaugural address. this is a president saying i came in with a huge crisis, we're on the right path, we're going to keep going. he has a phrase in there, have we found our happy val valley? i -- valley. i don't read it as being an aggressive speech. he was speaking to the whole country but he wasn't in campaign mode. roosevelt was very good in that way and eisenhower never sounded like he was in campaign mode. guest: i think that speech is recognized as one of the better second inaugurals. i think it does echo some of the themes of president obama. one of the lines in that speech, i see a nation ill clothed -- 1/3 Capital News Today
obama will be administered the oath of office. this will be done for years ago and his son traditionally by supreme court justice john roberts and there will be to god who sees this time. first is the the lincoln bible used by the president four years ago for initial screen and the same bible used by president lincoln when he was sworn in the first time in 1861 and that will be on top of the king family bible graciously provided for the ceremony by the king family. sees me. kelley clarkson will then see my country to sedate before poet public reacher blinker reads a poem written specifically for this occasion. we are very excited he will be joining us. he's the youngest ever and not drool appellate, and the first latino to not hero poet. barbara lewis liana st. john's church here in mafia part will be overseen the traditional st. john's service to kickstart the the presidents' day on monday offered the benediction in the ceremony will end with beyond anything in the nationally and done. one quick thing on the bibles. these are very, very historic rivals and symbolic typos as we head into Tonight From Washington
in in the macrofor president obama four years ago and with absolutely no idea what we are doing i can tell you that the folks regardless of who the chair is in the folks at gtf are there ready for you when you walk in the door and really gives a lot of logistical lift on this. is their job to make sure the presidents in print is put on some of these events. one of the ways we do that is in the parade along with all of these military elements there are 58 different groups, 58 different vehicles from all 50 states. they are everything from the virginia military institute across the river of virginia in southern virginia which is marched in another of not grow growth rates all the way through one of my favorites, a group from maine a group of unicyclers that will be joining us and called the gym dandies. and gym in this case. the president will stand and watch the entire thing and enjoy the parade along with thousands of folks who come down and are watching from along the parade route. one seconds the president goes inside and the official part of his day is done. and he gets ready for the nod ro Public Affairs
for president obama four years ago and we had no idea what we were doing, i can tell you the folks, regardless of who the chair is and the folks at j.t.f. are there ready for you when you walk in the door and do the logistical lift. we make sure the president's imprint is put on one of these events. in the parade as the colonel mentioned along with all of these military elements, there are 58 different groups. 58 different groups, floats and vehicles. these are from all 50 states. they are everything from the virginia military institute just across the river in virginia, down in southern virginia, which has marched in a number of inaugural parades through a group of maine of unicyclists, which are called the jim dandies. they will pass review in front of the white house. the president will stand and watch the entire review and enjoy the parade along with thousands of folks who will come down and be watching from along the parade route. once that ends, the president goes inside and the official part of his day is done. and he gets ready for the inaugural balls. as you have seen and reported, th 11 News Sunday Morning
. we will ex mravenlt >> president obama gets ready for another four years of public service with a day of service. that story is coming up. >>> temperature is okay today but much colder as we go into the week even a chance of snow tomorrow. we will have the details coming up. >> welcome back. thank you for joining us. >> actually the morning right now is not that bad. temperatures in the 40s. normally we should be in the 20s. i think that puts it into perspective. yesterday we hit the low 50s in the afternoon. this is the nice weather before the cold bottoms in for the next couple days. we have 41 degrees at the airport. cold air to the northwest currently at 39. temperatures climb up to 50 degrees some of you in the mid 40z. a cold front is coming this way. that will produce a couple you clouds into the afternoon and breezy winds behind us. watch those temperatures thall down. we will show you that in the 7 day. >> president obama's public inauguration this year falls on the federal holiday remembering martin luther king jr. >> in order to keep the spirit of the holiday the president The Rachel Maddow Show
obama faces tough national security challenges over the next four years. guarding against plots by terrorist groups certainly a top priority for the president, but the u.s. also faces the possibility of cyber attacks. attacks that could really disrupt communication and banking and transportation, and our pentagon correspondent chris lawrence has an in-depth look into those threats to national security. >> reporter: terror risks are emotionalizing in mali, which could become the next launching pad for plots against america. a new challenge for national security. keep us safe. sounds simple. but over the next four years, america's security could be tested in complex ways. forget the wold care. not even a centralized al qaeda in one country. >> there are still tariearrorisn hard to reach countries planning attacks against us. >> reporter: mali and somali, hoping they don't sfwurn the safehavens al qaeda had. but outside afghanistan, the obama administration has been hesitant to put more boots on the ground. so they'll continue to rely heavily on drones. >> predators and reapers are Politics Public Policy Today
" after which president obama will be administered the oath of office to be done like it was four years ago and to be done by supreme court justice roberts. the first was the lincoln bible used by the president four years ago and the same bible used by president lincoln when he was sworn in in 1861 on top of the king family bible which has been graciously provided for this ceremony by the king family. excuse me, kelly clarkson will then sing "my country 'tis of thee" then a pome -- a poem written specifically for this occasion. the youngest ever inaugural poet and first glbt inaugural poet and latino poet. then overseeing the st. john's service will be offering the benediction and the servicewill end with beyonce singing the national anthem. obviously these are very short bibles and symbolic bibles as we head into the 150th anniversary of the emancipation proclamation and the 30th anniversary of the march on washington, d.c. with that i would like to hand it over to our partners at j.t.f. and what will take place after the lunch matt discussed. >> thank you. as i said, i'm colonel miche Moyers Company
of confidence on the part of investors in foreign governments? i mean, even three years ago barack obama expressed concern about the long term debt and the confidence of people in the u.s. government. take a listen. >> there may be some tax provisions that can encourage businesses to hire sooner rather than sitting on the sidelines. so we're taking a look at those. i think it is important, though, to recognize that if we keep on adding to the debt, even in the midst of this recovery, that at some point, people could lose confidence in the us economy in a way that could actually lead to a double-dip recession. >> i remember that well. and at the time it was going on, i do occasionally find myself in meetings with very serious people myself. i guess i am personally one now and then. there was this widespread view among people, and not all of it venal, not all of it self-interested, that somehow things were hanging by a thread. that any day now we could have a run on u.s. government debt, which was wrong. but, okay, i can see how people could for a while have believed that. but a lot of tim Morning Joe
is making -- >> now these apps that 4-year-olds can use after these commercials that target the obama children politically, those numbers, i think, are going to continue to break. i'm telling you, robert gibbs, these people are causing serious damage to their brand and more importantly to the cause of the second amendment. >> i absolutely don't disagree. i mean, i think they have done more so set back their own cause. but let's peer through some of the twisted logic in some of what they've done. i mean, the notion from wayne lapierre that the only way to match a bad guy with a gun is a good guy with a gun, why do we provide the bad guys with the type of weapons that they use in afghanistan? why are we -- why are we dependent upon having a good guy with a gun? we're depending on that, in their logic, because we've decided that what we -- what we hunt the taliban with is okay to have in your neighborhood. that doesn't make any sense. >> and by the way, robert, on that front -- >> i'll say this. you and i are from the south, right? >> right. >> hunting is important. i was never a hunter, Search Results 0 to 49 of about 106 (some duplicates have been removed)First<12 3 >Last | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American digital library with the stated mission of \"universal access to all knowledge\". It provides free public access to collections of digitized materials, including websites, software applications/games, music, movies/videos, moving images, and millions of books."
}
] |
Class IIa histone deacetylases link cAMP signaling to the myelin transcriptional program of Schwann cells. - PubMed - NCBI
Search: Casillas-Bajo A[au]
J Cell Biol. 2018 Apr 2;217(4):1249-1268. doi: 10.1083/jcb.201611150. Epub 2018 Feb 22.
Class IIa histone deacetylases link cAMP signaling to the myelin transcriptional program of Schwann cells.
Gomis-Coloma C1,2, Velasco-Aviles S1,2, Gomez-Sanchez JA1,3, Casillas-Bajo A1,2, Backs J4,5, Cabedo H6,2.
Instituto de Neurociencias de Alicante, Universidad Miguel Hernández and Consejo Superior de Investigaciones Científicas, Sant Joan, Alicante, Spain.
Instituto de Investigación Sanitaria y Biomédica de Alicante (ISABIAL) and Fundación para el Fomento de la Investigación Saniatria y Biomédica de la Comunidad Valenciana (FISABIO), Alicante, Spain.
Department of Cell and Developmental Biology, University College London, London, England, UK.
German Center for Cardiovascular Research, Partner Site Heidelberg/Mannheim, Germany.
Instituto de Neurociencias de Alicante, Universidad Miguel Hernández and Consejo Superior de Investigaciones Científicas, Sant Joan, Alicante, Spain [email protected].
Schwann cells respond to cyclic adenosine monophosphate (cAMP) halting proliferation and expressing myelin proteins. Here we show that cAMP signaling induces the nuclear shuttling of the class IIa histone deacetylase (HDAC)-4 in these cells, where it binds to the promoter and blocks the expression of c-Jun, a negative regulator of myelination. To do it, HDAC4 does not interfere with the transcriptional activity of MEF2. Instead, by interacting with NCoR1, it recruits HDAC3 and deacetylates histone 3 in the promoter of c-Jun, blocking gene expression. Importantly, this is enough to up-regulate Krox20 and start Schwann cell differentiation program-inducing myelin gene expression. Using conditional knockout mice, we also show that HDAC4 together with HDAC5 redundantly contribute to activate the myelin transcriptional program and the development of myelin sheath in vivo. We propose a model in which cAMP signaling shuttles class IIa HDACs into the nucleus of Schwann cells to regulate the initial steps of myelination in the peripheral nervous system.
PMC5881490
10.1083/jcb.201611150
J Cell Biol. 2018 Apr 2;217(4):1249-1268.
Ncor1 protein, rat
Casillas-Bajo A[Author] | [
{
"key": "website_description",
"type": "global",
"value": "This website is part of the United States National Library of Medicine , a branch of the National Institutes of Health . It is approved and funded by the government of the United States."
}
] |
Revision as of 18:23, 10 May 2012 by Brissonbankscv (talk | contribs) (added census template with information and links)
England Staffordshire Staffordshire Parishes Abbots Bromley St Nicholas Staffordshire.jpg Contents
Abbots Bromley is an Ancient Parish and a market town in the county of Staffordshire. Other places in the parish include: Bagots Bromley and Bromley Hurst. BROMLEY, ABBOTS (St. Nicholas), a parish, in the union of Uttoxeter, S. division of the hundred of Pirehill, N. division of the county of Stafford, 12½ miles (E.) from Stafford, and 130 (N. W. by N.) from London; there is a place of worship for Independents.[1] Resources
Birth, marriages and deaths were kept by the government, from July 1837 to the present day. The civil registration article tells more about these records. There are several Internet sites with name lists or indexes. A popular site is FreeBMD. See Staffordshire BMD Church records
Deposited parish registers at Staffordshire Record Office Bap 1558-1961 Mar 1558-1992 Bur 1558-1992Lichfield Record Office holdings of Bishop's Transcripts Bap1668-1859 Mar 1668-1859 Bur 1668-1859 Missing 1814,1821,1852-1853 all events
The following MIs were kindly contributed by Alf Beard:
Some Memorial Inscriptions - St. Nicholas' Churchyard
Census records from 1841 to 1911 are available online. For access, see England Census Records and Indexes Online. Census records from 1841 to 1891 are also available on film through a Family History Center or at the Family History Library. The first film number is 474623.
↑ Lewis, Samuel Al, A Topographical Dictionary of England (1848), pp. 395-400. Date accessed: 23 March 2011.
Retrieved from "https://familysearch.org/wiki/en/index.php?title=Abbots_Bromley,_Staffordshire_Genealogy&oldid=991514" Category: Staffordshire Navigation menu | [
{
"key": "website_description",
"type": "global",
"value": "This website is a nonprofit organization and website offering genealogical records, education, and software. It is operated by The Church of Jesus Christ of Latter-day Saints , and is closely connected with the church's Family History Department."
}
] |
Patent US7989206 - High expression Zymomonas promoters - Google PatentsSearch Images Maps Play YouTube News Gmail Drive More »Sign inPatentsIdentified are mutants of the promoter of the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene, which direct improved expression levels of operably linked heterologous nucleic acids. These are high expression promoters useful for expression of chimeric genes in Zymomonas, Zymobacter, and other...http://www.google.com/patents/US7989206?utm_source=gb-gplus-sharePatent US7989206 - High expression Zymomonas promotersAdvanced Patent SearchPublication numberUS7989206 B2Publication typeGrantApplication numberUS 12/410,495Publication dateAug 2, 2011Filing dateMar 25, 2009Priority dateMar 27, 2008Fee statusPaidAlso published asCA2716590A1, CN101981184A, CN101981184B, EP2271755A2, US20090246876, WO2009120730A2, WO2009120730A3Publication number12410495, 410495, US 7989206 B2, US 7989206B2, US-B2-7989206, US7989206 B2, US7989206B2InventorsPaul V. Viitanen, Luan Tao, Yuying Zhang, Perry G. Caimi, Laura Mccole, Min Zhang, Yat-Chen Chou, Carol M. McCutchen, Mary Ann FrandenOriginal AssigneeE.I. du Pont de Nemours and Company Alliance for Sustainable Energy LLCExport CitationBiBTeX, EndNote, RefManPatent Citations (10), Non-Patent Citations (12), Referenced by (15), Classifications (15), Legal Events (2) External Links: USPTO, USPTO Assignment, EspacenetHigh expression Zymomonas promoters
US 7989206 B2Abstract
1. An isolated nucleic acid molecule comprising a Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene promoter that has a base substitution in a position selected from the group consisting of position 116, position 217, or both positions 116 and 217; wherein the position numbers are of SEQ ID NO:1; and wherein at position 116 a T replaces G, and at position 217 a T replaces C.
2. The isolated nucleic acid molecule of claim 1 comprising a sequence selected from the group consisting of SEQ ID NO:4, 5, 6, 7, 8 9, 10, 11, and 12.
3. A chimeric gene comprising the isolated nucleic acid molecule of claim 1 operably linked to a heterologous nucleic acid molecule.
4. The chimeric gene of claim 3 wherein the heterologous nucleic acid molecule encodes a protein or peptide.
5. The chimeric gene of claim 3 wherein the heterologous nucleic acid molecule codes for a regulatory RNA molecule selected from the group consisting of an antisense RNA, a ribozyme, and an interfering RNA.
6. A vector comprising the isolated nucleic acid molecule of claim 1.
7. A vector comprising the isolated nucleic acid molecule of claim 2.
8. A method of transforming a bacterial cell selected from the group consisting of Zymomonas cells and Zymobacter cells comprising introducing into the cell the isolated nucleic acid molecule of claim 1.
9. A method of transforming a bacterial cell selected from the group consisting of Zymomonas cells and Zymobacter cells comprising introducing into the cell the isolated nucleic acid molecule of claim 2.
10. The method according to claim 8 wherein introducing comprises integrating the isolated nucleic acid molecule into the genome of the cell or maintaining on a stably replicating plasmid within the cell. Description
This application claims the benefit of U.S. Provisional Application No. 61/039,871 filed on Mar. 27, 2008, which application is incorporated herein by reference.
The invention relates to the fields of microbiology and genetic engineering. More specifically, new promoters for directing expression of chimeric genes in bacteria were identified.
Production of ethanol by microorganisms provides an alternative energy source to fossil fuels and is therefore an important area of current research. It is desirable that microorganisms producing ethanol, as well as other useful products, be capable of using xylose as a carbon source since xylose is the major pentose in hydrolyzed lignocellulosic materials, and therefore can provide an abundantly available, low cost carbon substrate. Zymomonas mobilis and other bacterial ethanologens which do not naturally utilize xylose may be genetically engineered for xylose utilization by introduction of genes encoding 1) xylose isomerase, which catalyses the conversion of xylose to xylulose; 2) xylulokinase, which phosphorylates xylulose to form xylulose 5-phosphate; 3) transketolase; and 4) transaldolase.
There has been success in engineering Z. mobilis strains for xylose metabolism (U.S. Pat. No. 5,514,583, U.S. Pat. No. 5,712,133, U.S. Pat. No. 6,566,107, WO 95/28476, Feldmann et al. (1992) Appl Microbiol Biotechnol 38: 354-361, Zhang et al. (1995) Science 267:240-243), as well as a Zymobacter palmae strain (Yanase et al. (2007) Appl. Environ. Microbiol. 73:2592-2599). However, typically the engineered strains do not grow and produce ethanol as well on xylose as on glucose. For this engineering, genes encoding the heterologous proteins for xylose metabolism have been expressed from promoters that are active in Z. mobilis cells, typically the promoter of the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene or the promoter of the Z. mobilis enolase gene. Strains engineered for xylose utilization have been adapted by serial passage on xylose medium, resulting in strains with improved xylose utilization as described in U.S. Pat. No. 7,223,575 and commonly owned and co-pending U.S. Patent App. Publication No. US20080286870. However the genetic basis for the improvement had not been determined.
There remains a need for genetically engineered strains of Zymomonas, and other bacterial ethanolagens, having improved xylose utilization. Applicants have discovered mutant promoters having increased activity that can be used for expressing xylose utilization genes, which activity confers to engineered strains comprising these promoters improved xylose utilization. The promoters may be used for expression of other genes.
The present invention relates to isolated, mutant promoters for expression of genes, i.e., that is chimeric genes in Zymomonas, Zymobacter, and related bacteria that direct higher levels of gene expression than levels directed by the natural promoter of the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene (Pgap). The mutant promoters are derivatives of the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene promoter and have increased activity due to the presence of specific mutations. The promoters may be used in genetic engineering for expression of a coding region or of a regulatory RNA. Expression of a coding region for xylose isomerase directed by these promoters led to improved growth of xylose-utilizing Zymomonas mobilis in xylose-containing medium.
Described herein is an isolated nucleic acid molecule comprising a Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene promoter that has a nucleotide substitution in a position selected from the group consisting of position -190, position -89, or both position -190 and -89; wherein the position numbers are with respect to the natural ATG translation initiation codon for glyceraldehyde-3-phosphate dehydrogenase in the CP4 and ZM4 strains of Z. mobilis. Also described herein are the following: a chimeric gene comprising the isolated nucleic acid molecule described above and operably linked to a heterologous nucleic acid molecule; a vector comprising the nucleic acid molecule described above and a method of genetically engineering a bacterial cell comprising introducing into the cell the nucleic acid molecule described above.
The various embodiments of the invention can be more fully understood from the following detailed description, the figures, and the accompanying sequence descriptions, which form a part of this application.
FIG. 1 shows the strategies for enzyme assays of transketolase (A), transaldolase (B), xylose isomerase (C), and xyulokinase (D).
FIG. 2 shows a graph of xylose isomerase (XI) and xylulokinase (XK) activities in T2C, T3C, T4C, and T5C lines transformed with PgapxylAB.
FIG. 3 shows a graph of transaldolase (TAL) and transketolase (TKT) activities in T2C, T3C, T4C, and T5C lines transformed with PgapxylAB.
FIG. 4 shows a graph of % theoretical ethanol yield and % xylose utilization of selected adapted xylose-utilizing strain colonies.
FIG. 5 shows a graph of growth of adapted xylose-utilizing strains at 70 hr on RM (rich medium) with 5% xylose (RMX5%) before and after growing 50 generations in RM with 5% glucose (RMG).
FIG. 6 shows plasmid maps of (A) pZB188; (B) pZB188/aadA; and (C) pZB188/aadA-GapXylA; as well as (D) a schematic representation of the E. coli xylose isomerase expression cassette PgapXylA.
FIG. 7 shows plasmid maps of (A) pMOD™-2-<MCS>; (B) pMOD-Linker; and (C) pMOD-Linker-Spec.
FIG. 8 shows a plasmid map of pLDHSp-9WW.
FIG. 9 shows a plasmid map of pMOD-Linker-Spec-801GapXylA.
FIG. 10 shows plasmid maps of (A) pMOD-Linker-Spec-801GapXylA; (B) pZB188/aadA-GapXylA; and (C) pZB188/aadA-801GapXylA.
FIG. 11 shows a graph of growth curves (OD600 versus time) in xylose-containing media for the three strains that harbored the Pgap-E. coli xylose isomerase expression plasmid (X1, X2 and X2) and the three strains that harbored the control plasmid (C1, C2 and C3).
FIG. 12 shows graphs of growth curves (OD600 versus time) of strains ZW641, ZW658, X1 and C1 in xylose-containing media without spectinomycin plotted in (A) on a linear scale, and in (B) on a logarithmic scale.
FIG. 13 shows graphs of growth curves (OD600 versus time) of three strains with integrated 801Pgap-XylA (#8-2, #8-4, #8-5) and of three strains with integrated 641Pgap-XylA (#6-1, #6-3, #6-5) compared to strain ZW658, plotted in (A) on a linear scale, and in (B) on a logarithmic scale.
FIG. 14 shows a plasmid map of pZB188aadA/Gap/Zymo RPI/EcoliSL.
FIG. 15 shows plasmid maps of (A) pZB188aadA/Gap/Zymo RPI/EcoliSL; (B) pZB188aadA-641GapRPI; and (C) pZB188aadA-801GapRPI.
FIG. 16 shows a stained protein gel of whole cell proteins from strains with different promoters expressing RPI.
The following sequences conform with 37 C.F.R. 1.821-1.825 (“Requirements for Patent Applications Containing Nucleotide Sequences and/or Amino Acid Sequence Disclosures—the Sequence Rules”) and are consistent with World Intellectual Property Organization (WIPO) Standard ST.25 (1998) and the sequence listing requirements of the EPO and PCT (Rules 5.2 and 49.5(a-bis), and Section 208 and Annex C of the Administrative Instructions). The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. �1.822.
SEQ ID NO:1 is the nucleotide sequence of the ZmPgap from the CP4 strain of Z. mobilis. SEQ ID NO:2 is the nucleotide sequence of the ZmPgap from the ZM4 strain of Z. mobilis. SEQ ID NO:3 is the nucleotide sequence of the ZmPgap from pZB4, which is also in the PgapxylAB operon of strains ZW641 and 8XL4.
SEQ ID NO:4 is the nucleotide sequence of the improved Pgap from strain ZW658.
SEQ ID NO:5 is the nucleotide sequence of the improved Pgap from strain 8b.
SEQ ID NO:6 is the nucleotide sequence of an improved Pgap with both -190 (ZW658) and -89 (8b) mutations in the pZB4 variant of Pgap.
SEQ ID NO:7 is the nucleotide sequence of an improved Pgap with the -190 mutation from ZW658 in the CP4 variant of Pgap.
SEQ ID NO:8 is the nucleotide sequence of an improved Pgap with the -89 mutation from 8b in the CP4 variant of Pgap.
SEQ ID NO:9 is the nucleotide sequence of an improved Pgap with both -190 (ZW658) and -89 (8b) mutations in the CP4 variant of Pgap.
SEQ ID NO:10 is the nucleotide sequence of an improved Pgap with the -190 mutation from ZW658 in the ZM4 variant of Pgap. SEQ ID NO:11 is the nucleotide sequence of an improved Pgap with the -89 mutation from 8b in the ZM4 variant of Pgap.
SEQ ID NO:12 is the nucleotide sequence of an improved Pgap with both -190 (ZW658) and -89 (8b) mutations in the ZM4 variant of Pgap.
SEQ ID NOs:13 and 14 are the nucleotide sequences of primers for amplification of a DNA fragment containing the glyceraldehyde-3-phosphate dehydrogenase gene promoter (Pgap) from pZB4.
SEQ ID NOs:15 and 16 are the nucleotide sequences of primers for amplification of a DNA fragment containing a tal coding region from pZB4.
SEQ ID NOs:17 and 18 are the nucleotide sequences of primers for amplification of a DNA fragment containing Pgaptal from the Pgap and tal fragments.
SEQ ID NOs:19 and 20 are the nucleotide sequences of primers for amplification of a DNA fragment containing IoxP::Cm from pZB186.
SEQ ID NO:21 is the complete nucleotide sequence for the pMODPgaptaltktCm plasmid.
SEQ ID NOs:22 and 23 are the nucleotide sequences of primers for amplification of a 3 kb DNA fragment containing tal and tkt coding regions in transformants receiving pMODPgaptaltktCm.
SEQ ID NO:24 is the complete nucleotide sequence for the pMODPgapxy/ABCm plasmid.
SEQ ID NOs:25 and 26 are the nucleotide sequences of primers for amplification of a 1.6 kb PgapxylA DNA fragment from the T2C, T3C, T4C and T5C integrants with pMODPgapxy/ABCm.
SEQ ID NOs:27 and 28 are the nucleotide sequences of primers for amplification of a DNA fragment containing the Pgap from ZW641 and ZW658.
SEQ ID NOs:29-31 are the nucleotide sequences for primers for sequencing the Pgap from ZW641 and ZW658.
SEQ ID NOs:32 and 33 are the nucleotide sequences of primers for amplification of a DNA fragment containing a Specr-cassette.
SEQ ID NO:34 is the complete nucleotide sequence of the xylose isomerase expression cassette PgapXylA.
SEQ ID NOs:35 and 36 are the nucleotide sequences of oligonucleotides used to substitute a different multi-cloning site in pMOD2-<MCS>.
SEQ ID NOs:37 and 38 are the nucleotide sequences of primers for amplification of the PgapxylA regions from strains ZW801-4 and ZW641 for insertion into pMOD-Linker-Spec to yield plasmids pMOD-Linker-Spec-801 GapXylA and pMOD-Linker-Spec-641 GapXylA, respectively.
SEQ ID NOs:39 and 40 are the nucleotide sequences of primers for amplification of a Pgap from pZB188/aadA-641GapXylA and including the first 15 bp of the Z. mobilis RPI open reading frame.
SEQ ID NOs:41 and 42 are the nucleotide sequences of primers for amplification of the Z. mobilis RPI open reading frame
SEQ ID NO:43 is the complete nucleotide sequence of the RPI expression cassette that is in plasmid pZB188aadA/Gap/Zymo RPI/EcoliSL.
SEQ ID NOs:44 and 45 are the nucleotide sequences of primers for amplification of a DNA fragment containing the Pgap from 8XL4 and 8b.
SEQ ID NO:46 is the complete nucleotide sequence of a primer for sequencing the Pgap from 8XL4 and 8b.
SEQ ID NO:47 is the nucleotide sequence of a portion of ZmPgap of CP4, ZM4, and pZB4 with SEQ ID NOs:1, 2, and 3, respectively, containing position -190.
SEQ ID NO:48 is the nucleotide sequence of a portion of ZmPgap of CP4, ZM4, and pZB4 with SEQ ID NOs:1, 2, and 3, respectively, containing position -89.
Described herein are new promoters that may be used for expression of chimeric genes in bacterial cells. Applicants have discovered that each of two different mutations of the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene promoter separately increases the level of expression directed by the promoter. One mutation is at the -190 position, and the second mutation is at the -89 position, both with respect to the natural ATG translation initiation codon for glyceraldehyde-3-phosphate dehydrogenase in the CP4 and ZM4 strains of Z.: mobilis. A Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene promoter containing either or both of these mutations may be used for expression of heterologous, operably linked DNA sequences in bacterial cells.
“Gene” refers to a nucleic acid fragment that expresses a specific protein or functional RNA molecule, which may include regulatory sequences preceding (5′ non-coding sequences) and following (3′ non-coding sequences) the coding sequence. “Native gene” or “wild type gene” refers to a gene as found in nature with its own regulatory sequences. “Chimeric gene” refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. “Endogenous gene” refers to a native gene in its natural location in the genome of an organism. A “foreign” gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes.
The term “genetic construct” refers to a nucleic acid fragment that encodes for expression of one or more specific proteins or functional RNA molecules. In the gene construct the gene may be native, chimeric, or foreign in nature. Typically a genetic construct will comprise a “coding sequence”. A “coding sequence” refers to a DNA sequence that encodes a specific amino acid sequence.
The term “expression”, as used herein, refers to the transcription and stable accumulation of coding (mRNA) or functional RNA derived from a gene. Expression may also refer to translation of mRNA into a polypeptide. “Antisense inhibition” refers to the production of antisense RNA transcripts capable of suppressing the expression of the target protein. “Overexpression” refers to the production of a gene product in transgenic organisms that exceeds levels of production in normal or non-transformed organisms. “Co-suppression” refers to the production of sense RNA transcripts or fragments capable of suppressing the expression of identical or substantially similar foreign or endogenous genes (U.S. Pat. No. 5,231,020).
The term “heterologous” means not naturally found in the location of interest. For example, a heterologous gene refers to a gene that is not naturally found in the host organism, but that is introduced into the host organism by gene transfer. For example, a heterologous nucleic acid molecule that is present in a chimeric gene is a nucleic acid molecule that is not naturally found associated with the other segments of the chimeric gene, such as the nucleic acid molecules having the coding region and promoter segments not naturally being associated with each other.
As used herein, an “isolated nucleic acid molecule” is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid molecule in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
The term “Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene promoter” and “ZmPgap” refer to a nucleic acid molecule with promoter activity that has a nucleotide sequence that naturally occurs upstream of the glyceraldehyde-3-phosphate dehydrogenase coding region in the Z. mobilis genome. These terms refer to the promoters of strains of Z. mobilis such as the CP4 and ZM4 strains (SEQ ID NOs:1 and 2, respectively) and to variants in sequence and/or length that direct expression at a level that is not substantially different, such as the ZmPgap of pZB4 (SEQ ID NO:3).
Discovery of Improved Glyceraldehyde-3-Phosphate Dehydrogenase Gene Promoters
A natural promoter of the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene (ZmPgap or Pgap) has been used for expression of chimeric genes in Zymomonas mobilis and Zymobacter palmae. When a ZmPgap has been used to express genes for xylose metabolism, the resulting xylose utilization typically has not been as effective as desired. A recombinant Z. mobilis strain engineered to express the four xylose metabolism enzymes (xylose isomerase, xylulokinase, transketolase, and transaldolase) with limited xylose utilizing ability was further adapted on xylose medium for improved xylose utilization (described in commonly owned and co-pending U.S. Pat. App. Publication. No. US20080286870).
Applicants have discovered, as described in Example 3 herein, that the improved xylose-utilizing strain called ZW658 (ATCC #PTA-7858) has increased expression of the xylose isomerase and xylulokinase enzymes that were integrated into the genome as an operon expressed from ZmPgap (PgapxylAB operon). Applicants have further discovered that there is a single new nucleotide change in the promoter of the PgapxylAB operon that is responsible for the promoter directing increased expression of operably linked coding regions. The nucleotide change is new with respect to the sequence of the Pgap of the PgapxylAB operon in strain ZW658 as compared to the sequence of the ZmPgap of the PgapxylAB operon in a precursor strain to ZW658 that did not have increased xylose isomerase and xylulokinase activities. Thus the Pgap having this single nucleotide change is an improved promoter.
Applicants have in addition discovered that a Z. mobilis strain that was separately engineered with the genes encoding the four xylose utilization enzymes and separately adapted for improved xylose utilization (strain 8b, described in U.S. Pat. No. 7,223,575) also has increased expression of the xylose isomerase and xylulokinase enzymes that were integrated into the genome as a PgapxylAB operon. Applicants have further discovered that there is a single new nucleotide change in the Pgap of the PgapxylAB operon in the 8b strain that is at a different position than the nucleotide change of the ZW658 Pgap. Based on the increased expression of the xylose isomerase and xylulokinase enzymes encoded by the PgapxylAB operon, the mutant Pgap of the PgapxylAB operon also provides an improved promoter.
The identified new nucleotide changes in the Pgap of the ZW658 and 8b strain PgapxylAB operons are at positions-190 and -89, respectively, with respect to the natural ATG translation initiation codon for glyceraldehyde-3-phosphate dehydrogenase in the CP4 and ZM4 strains of Z. mobilis. The discovered nucleotide change at position -190 is from G to T, and at position -89 is from C to T.
The sequence context of the base changes are the important factor, as the position number may change due to sequence variations.
The -190 position is in the sequence context:
(SEQ ID NO: 47) AACGGTATACT G GAATAAATGGTCTTCGTTATGGTATTGATGTTTTT which is a portion of ZmPgap of CP4, ZM4, and pZB4 with SEQ ID NOs:1, 2, and 3, respectively, where the bold and underlined G is the base changed to T by the mutation. This position is -190 in the ZmPgap sequence of the CP4 and ZM4 strains, but position -189 in pZB4 since in the promoter sequence in pZB4 there is a deletion of T at position -21.
The -89 position is in the sequence context:
(SEQ ID NO: 48) CGGCATCACGAA C AAGGTGTTGGCCGCGATCGCCGGTAAGTCGGC which is a portion of ZmPgap of CP4, ZM4, and pZB4 with SEQ ID NOs:1, 2, and 3, respectively, where the bold and underlined C is the base changed to T by the mutation. This position is -89 in the ZmPgap sequence of the CP4 and ZM4 strains, but position -88 in pZB4 since in the promoter sequence in pZB4 there is a deletion of T at position -21. Promoters of the present invention have a nucleotide change in ZmPgap at position -190, at position -89, or at both of these positions. Preferably the changes are a G to T change at position -190 and a C to T change at position -89. The present promoters comprising these modifications are improved Pgaps.
Changes to other nucleotides at the -190 and -89 positions may provide improved activity of ZmPgap. In addition, nucleotide changes at other positions within ZmPgap may provide improved activity of promoters.
The naturally occurring sequence of ZmPgap is not a single sequence, but may have some variation in sequence that has no substantial effect on promoter function. Having no substantial effect on promoter function means that the promoter sequence directs an expression level that is substantially similar to the level of expression directed by a ZmPgap present in a natural Zymomonas mobilis strain. Variation in sequence may naturally occur between different isolates or strains of Zymomonas mobilis, such as the difference between the CP4 and ZM4 strains at position -29 with respect to the natural ATG translation initiation codon for glyceraldehyde-3-phosphate dehydrogenase (SEQ ID NOs:1 and 2, respectively), where in CP4 there is an A and in ZM4 there is a G.
In addition to naturally occurring sequence variations, nucleotide changes that do not substantially affect function may occur during routine manipulation procedures including PCR, cloning, transformation, and strain growth as is known to one skilled in the art. An example is the ZmPgap of pZB4, which has a deletion of T at position -21.
Any nucleotide changes in the ZmPgap sequence, occurring in different natural or engineered strains, that do not substantially affect promoter function, may be present in the sequence of a Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene promoter such as the deletion of a T after position -21 that is in the ZmPgap of pZB4 (SEQ ID NO:3). Thus the mutations at positions -190 and -89 described above that do affect promoter function, that is, that substantially improve promoter function, may be made in any of the ZmPgap sequences with substantially similar activity (natural level) and can co-occur with variations not affecting function.
Examples of improved Pgap sequences with the described mutations at positions -89 and/or -88 include the promoter sequence from strain ZW658 (SEQ ID NO:4), from strain 8b (SEQ ID NO:5), and a double mutation of the same ZmPgap variant which is from pZB4 (SEQ ID NO:6). Additional examples of improved Pgap sequences are the -190, -89, or double mutation in the ZmPgap variant from CP4 (SEQ ID NOs:7, 8, and 9, respectively) and the -190, -89, or double mutation in the ZmPgap variant from ZM4 (SEQ ID NOs:10, 11, and 12, respectively).
In addition, variations in the length of the ZmPgap occur that do not substantially affect promoter function. The present invention includes improved Pgaps having the described mutations at position -190 and/or -89 with respect to the natural ATG translation initiation codon for glyceraldehyde-3-phosphate dehydrogenase in the CP4 and ZM4 strains of Z. mobilis in ZmPgaps of varying length that have no substantial change in activity prior to addition of the -190 and/or -89 mutations.
Preparing an Improved Pgap
The described mutations at positions -190 and/or -89 may be introduced into a ZmPgap nucleic acid molecule by any method known to one skilled in the art. For example, an oligonucleotide having the mutation and surrounding DNA sequence may be synthesized and cloned into a larger promoter DNA fragment, substituting for a segment without the mutation. Primers containing the mutation and some adjacent promoter sequence may be synthesized and used in PCR to prepare the promoter fragment. An entire promoter DNA fragment may be synthesized as multiple oligonucleotides that are ligated together. Site-directed mutagenesis may be used to introduce the mutation(s). In addition, the mutant promoters may be prepared as PCR amplified DNA fragments using DNA from the ZW658 or 8b strain as template.
Improved Pgap in Chimeric Genes and Vectors, Introduction into Bacterial Cells
A promoter of the present invention may be operably linked to a heterologous nucleic molecule that is to be expressed in a bacterial cell, forming a chimeric nucleic acid molecule, or chimeric gene of the present invention. The designing and construction of chimeric genes are well known to one skilled in the art. A chimeric gene typically includes a promoter, a heterologous nucleic acid molecule to be expressed, and a 3′ termination control region. Termination control regions may be derived from various genes, and are often taken from genes native to a target host cell. The operably linked heterologous nucleic acid molecule may be any nucleic acid molecule whose expression is desired in a bacterial cell, including, for example, a coding region for a protein or peptide, or a nucleic acid for expression of a functional RNA. Functional RNAs include, for example, antisense RNAs, ribozymes, and interfering RNAs. In addition an operon may be constructed that comprises the promoter described herein and multiple coding regions expressed from the promoter.
The promoters described herein may be used in chimeric genes for expression in bacteria belonging to Zymomonas or Zymobacter. The chimeric genes may be used for expression of any protein involved in production of a product of Zymomonas or Zymobacter. For example, one or more enzymes involved in synthesis of an amino acid such as alanine or of sorbitol or xylitol may be expressed from a chimeric gene having these promoters. The chimeric genes may be expressed in a natural Zymomonas or Zymobacter strain that does not utilize xylose, or in a xylose-utilizing strain. Also the promoters described herein may be used for expression of enzymes related to xylose metabolism or another metabolic pathway.
The chimeric genes described herein are typically constructed in or transferred to a vector for further manipulations. Vectors are well known in the art. Certain vectors are capable of replicating in a broad range of host bacteria and can be transferred by conjugation. The complete and annotated sequence of pRK404 and three related vectors: pRK437, pRK442, and pRK442(H) are available. These derivatives have proven to be valuable tools for genetic manipulation in gram-negative bacteria (Scott et al., Plasmid 50(1):74-79 (2003)).
Other well-known vectors may be used in different target host cells. Examples of vectors useful for different hosts are described in co-owned and co-pending US Patent Application Publication #US20070092957 A1, pp 11-13, which is hereby incorporated herein by reference. Particularly useful for expression in Zymomonas are vectors that can replicate in both E. coli and Zymomonas, such as pZB188 which is described in U.S. Pat. No. 5,514,583. Vectors may include plasmids for autonomous replication in a cell, and plasmids for carrying constructs to be integrated into bacterial genomes. Plasmids for DNA integration may include transposons, regions of nucleic acid sequence homologous to the target bacterial genome, or other sequences supporting integration. An additional type of vector may be a transposome produced using, for example, a system that is commercially available from EPICENTRE�. It is well known how to choose an appropriate vector for the desired target host and the desired function.
A promoter described herein may also be constructed in a vector without an operably linked nucleic acid molecule for expression, and integrated adjacent to an endogenous coding region to replace an endogenous promoter in a bacterial genome or to add a promoter, for example to a coding region within an operon. Chromosomal promoter replacements may be accomplished using methods such as described by Yuan et al (Metab. Eng. (2006) 8:79-90), and White et al. (Can. J. Microbiol. (2007) 53:56-62).
Vectors comprising a promoter described herein may be introduced into a bacterial cell by well known methods, such as using freeze-thaw transformation, calcium-mediated transformation, electroporation, or conjugation.
Expression of Heterologous Nucleic Acid Molecules Using Improved Pgap
Increased levels of chimeric gene expression may be obtained using an improved Pgap described herein. A chimeric gene constructed with an improved Pgap and a xylose isomerase coding region that was integrated into the genome was shown herein in Example 8 to allow improved growth in xylose medium of Z. mobilis cells engineered to express genes encoding proteins for xylose metabolism. Improved growth on xylose was shown herein in Examples 3 and 10 to be related to expression of higher levels of xylose isomerase activity and xylulokinase activities. Strains of xylose-utilizing Z. mobilis adapted for better growth on xylose and having an improved Pgap directing expression of xylose isomerase and xylulokinase had improved xylose utilization. Xylose isomerase and xylulokinase activities were about 4 to 5 times higher than in strains without an improved Pgap directing expression of xylose isomerase and xylulokinase.
Increased level of expression of a chimeric gene containing an improved Pgap of the present invention and located on a stable plasmid was also shown herein, in Example 9. A chimeric gene having an improved Pgap operably linked to a heterologous sequence encoding ribose 5-phosphate isomerase (RPI) produced a higher amount of RPI protein as compared to the amount produced from a chimeric gene containing a ZmPgap.
The Examples illustrate the inventions described herein.
The meaning of abbreviations is as follows: “kb” means kilobase(s), “bp” means base pairs, “nt” means nucleotide(s), “hr” means hour(s), “min” means minute(s), “sec” means second(s), “d” means day(s), “L” means liter(s), “ml” means milliliter(s), “μL” means microliter(s), “μg” means microgram(s), “ng” means nanogram(s), “mM” means millimolar, “μM” means micromolar, “nm” means nanometer(s), “μmol” means micromole(s), “μmol” means picomole(s), “Cm” means chloramphenicol, “Cmr” means chloramphenicol resistant, “Cms” means chloramphenicol sensitive, “Spr” means spectinomycin resistance, “Sps” means spectinomycin sensitive, “XI” is xylose isomerase, “XK” is xylulokinase, “TAL” is transaldolase, “TKT” is transketolase, “EFT” means elapsed fermentation time, “RM” means rich medium containing 10 g/L yeast extract plus 2 g/L KH2PO4, “MM” means mating medium containing 10 g/L yeast extract, 5 g/L tryptone, 2.5 g/L (NH4)2SO4 and 0.2 g/L KH2PO4.
Cells were grown in 50 ml of RM+2% glucose at 30� C. overnight to an OD600 of 1.0-1.2. Cells were harvested by centrifugation at 4500 rpm for 10 min at 4� C. The supernatant was discarded and the cell pellet washed with 25 ml ice-cold sonication buffer (10 mM Tris, pH 7.6, 10 mM MgCl2), followed by centrifugation at 4500 rpm for 10 min. The pellet was resuspended in 2.0-2.5 ml sonication buffer plus 1 mM dithiothreitol. A 500 μL aliquot was centrifuged for 1 min in an eppendorf centrifuge at 4� C. Most of supernatant was discarded, leaving about 10-20 μL behind to keep the pellet from drying out. The cells were frozen and stored at about 80� C. until assayed. Prior to assay, the cells were thawed and resuspended with 500 μL of sonication buffer plus 1 mM dithiothreitol. The mix was sonicated 2� for 45 seconds at 62% duty cycle and an output control of 2 using a Branson sonifier 450, letting samples cool about 3-5 min between sonications. Samples were centrifuged at 14,000 rpm for 60 min in a Beckman microfuge at 4� C. The supernatant was transferred to a new tube and kept at 4� C. The Pierce BCA assay was used for determining protein concentrations.
The transketolase (TKT) assay was usually performed first since this enzyme is more labile than the others. A diagram of the TKT assay is shown in FIG. 1A.
In a microplate assay, 20 μL of cell free extract was added to each well in a reaction mix, at 30� C., that included the following final concentrations of components: 0.37 mM NADP, 50 mM TrisHCl pH 7.5, 8.4 mM Mg Cl2, 0.1 mM TPP ((thiamine pyrophosphate chloride), 0.6 mM E4P (erythrose-4-phosphate), 4 mM BHP (betahydroxypyruvate), 4 U/ml PGI (phosphoglucose isomerase), and 4 U/ml G6PD (glucose-6-phosphate dehydrogenase). The A340 was read on a plate reader for 3-5 min. TKT activity was calculated as follows:
1 unit corresponds to the formation of 1 μmol of D-fructose 6-phosphate/min at 30� C.
U(μmole/min)=slope(dA 340/min)*volume of reaction(μL)/6220/0.55 cm(moles of NADP→NADPH is 6220 A 340 per mole per L in a 1 cm cuvette)(pathlength of 200 μL per well in microplate=0.55 cm)
Specific Activity(μmole/min−mg)=μmole/min/protein concentration(mg)
The basis of the transaldolase (TAL) assay is shown in FIG. 1B. In a microplate assay, 20 μL of cell free extract was added to each well in a reaction mix, at 30� C., that included the following final concentrations of components: 0.38 mM NADH, 87 mM triethanolamine, 17 mM EDTA, 33 mM F6P (fructose-6-phosphate), 1.2 mM E4P (erythrose-4-phosphate), 2.0 U/ml GDH (Glycerol-3-phosphate dehydrogenase), and 20 U/ml TPI (Triose phosphate isomerase). The plate was incubated for 5 min., then the A340 was read for 3-5 min. TAL activity was calculated as follows:
1 unit corresponds to the formation of 1 μmol of D-glyceraldehyde per minute at 30� C.
U(μmole/min)=slope(dA 340/min)*volume of reaction(μL)/6220/0.55 cm(moles of NADH→NAD is 6220 A 340 per mole per L in a 1 cm cuvette)(pathlength of 200 μL per well in microplate=0.55 cm)
Specific Activity(μmole/min−mg)=μmole/min/protein
The basis of the xylose isomerase (XI) assay is shown in FIG. 1C. In a microplate assay, 20 μL of cell free extract was added to each well in a reaction mix, at 30� C., that included the following final concentrations of components: 0.256 mM NADH, 50 mM xylose, 10 mM MgSO4, 10 mM triethanolamine, and 1 U/ml SDH (sorbitol dehydrogenase). The A340 was read on a plate reader for 3-5 min. XI activity was calculated as follows:
1 unit of XI corresponds to the formation of 1 μmole of D-xylulose per minute at 30� C.
U(μmole/min)=slope(dA 340/min)*volume of reaction(μL)/6220/0.55 cm(moles of NADHP→NAD is 6220 A 340 per mole per L in a 1 cm cuvette)(pathlength of 200 μl per well in microplate=0.55 cm)
The basis of the xylulokinase (XK) assay is shown in FIG. 1D. In a microplate assay, 20 μL of cell free extract was added to each well in a reaction mix, at 30� C., that included the following final concentrations of components: 0.2 mM NADH, 50 mM Tris HCl pH 7.5, 2.0 mm MgCl2-6H2O, 2.0 M ATP 0.2 M PEP (phosphoenolpyruvate), 8.5 mM D-xylulose, 5 U/ml PK (pyruvate kinase), and 5 U/ml LDH (lactate dehydrognase). The A340 was read on a plate reader for 3-5 min. XI activity was calculated as follows:
1 unit corresponds to the formation of 1 μmole of D-xylulose to D-xylulose-5-phosphate per minute at 30� C.
The analysis was done with an Agilent 1100 series HPLC and Agilent ChemStation software for LC 3D. The column was BioRad Aminex HPX-87H (HPLC Organic Analysis Column 125-0140) with BioRad Micro-Guard Cartridge Cation-H (125-0129). The operating conditions were:
0.01 N H2SO4 Stop Time
Temp Control @ 10� C. or 4� C.
Refractive Index (40� C.)
Construction of Xylose-Fermenting Zymomonas mobilis Strains
As described in commonly owned and co-pending U.S. App. Pub. No. US20080286870, strains of xylose-fermenting Zymomonas mobilis were constructed by integrating two operons, PgapxylAB and Pgaptaltkt, containing four xylose-utilizing genes encoding xylose isomerase, xylulokinase, transaldolase and transketolase, into the genome of ZW1 (ATCC #31821) via sequential transposition events, followed by adaptation on selective media containing xylose. Previously, a xylose-fermenting Zymomonas mobilis strain called 8b was constructed, as described in U.S. App. Pub. No. 20030162271, by integrating the two operons PgapxylAxylB and Penotaltkt, along with selectable antibiotic markers, into the genome of Zymomonas mobilis 5C via a combination of homologous recombination and transposon approaches followed by adaptation and NTG mutagenesis. In the preparation of new strains, transposition (Epicentre's EZ::Tn in vitro transposition system) was used, as opposed to site specific homologous recombination, because this approach offers the advantages of multiple choices of integration sites and relatively high insertion frequency. The four genes encoding the xylose utilization enzymes were arranged and cloned as two separate operons: PgapxylAB and Pgaptaltkt for the integration. An antibiotic resistance marker, a chloramphenicol resistance (Cmr) gene flanked by two P1 phage Cre-recombinase recognition sequences (loxP), was attached to each operon for the selection of integrants. The integration of the two operons was accomplished in a two-step, sequential manner: Pgaptaltkt followed by PgapxylAB. Cm resistance selection was used in both integration events, since it was removed by expressing a Cre recombinase on a plasmid followed by curing of the plasmid after each integration. This process allowed the use of the same antibiotic marker for selection multiple times. More importantly, it allowed the removal of the antibiotic marker introduced for selection of the integration of the operons. This process eliminated the negative impact of antibiotic resistance gene(s) on the fermentation strain for commercial use.
Construction of pMODPgaptaltktCm for Transposition
As described in U.S. App. Pub. No. 20030162271 (Example 9 therein), a 2.2 kb DNA fragment containing the transketolase (tkt) coding region from E. coli was isolated from pUCtaltkt (U.S. App. Pub. No. 20030162271) by BglII/XbaI digestion and cloned in a pMOD (Epicentre Biotechnologies, Madison, Wis.) vector digested with BamHI/XbaI, resulting in pMODtkt. A PCR fragment named Pgaptal was generated by fusing the promoter region of the Zymomonas mobilis gap (Pgap; glyceraldehyde-3-phosphate dehydrogenase) gene to the coding region of E. coli transaldolase (tal) as follows. A Pgap fragment was amplified from pZB4, the construction of which is described in U.S. Pat. No. 5,514,583 (Example 3), using primers with SEQ ID NOs:13 and 14. pZB4 contains a PgapxylA/xylB operon and a Peno-tal/tkt operon. A tal coding region fragment was amplified from pZB4 using primers with SEQ ID NOs:15 and 16. A Pgaptal fragment was amplified using the Pgap and tal fragments as template using primers with SEQ ID NOs:17 and 18. This fragment was digested with XbaI and cloned into the plasmid pMODtkt, upstream of the tkt coding region. A loxP::Cm fragment was generated by PCR using Cmlox(F,sfi) and Cmlox(R,sfi) primers (SEQ ID NOs:19 and 20) and pZB186 as the template. pZB186 is a combination of a native Z. mobilis plasmid and pACYC184, described in U.S. Pat. No. 5,514,583 (Example 3) and Zhang et al. ((1995) Science 267:240-243). Finally, the loxP::Cm PCR fragment was inserted in the SfiI site of the plasmid containing Pgaptaltkt to form the integrative plasmid pMODPgaptaltktCm. In this plasmid, the Pgaptaltkt loxP::Cm fragment was inserted between two mosaic ends (transposase binding sites) in the pMOD vector. The complete nucleotide sequence for the pMODPgaptaltktCm plasmid is given as SEQ ID NO:21.
Transposition and Transformation of pMODPgaptaltktCm in ZW1
Plasmid pMOD is a pUC-based vector, and therefore is a non-replicative vector in Zymomonas. Plasmid pMODPgaptaltktCm was treated with transposase in the presence of Mg2+ at room temperature for one hour and used to transform ZW1 cells by electroporation (using a BioRad Gene Pulser set at 200 ohms, 25 μF and 16 kV/cm). Electroporated cells were incubated in a mating medium (MM), which consists of 10 g/L yeast extract, 5 g/L tryptone, 2.5 g/L (NH4)2SO4, 0.2 g/L K2HPO4) supplemented with 50 g/L glucose and 1 mM MgSO4 for 6 hours at 30� C. The transformation mixture was plated on agar plates containing 15 g/L Bacto agar in MM supplemented with 50 g/L glucose and 120 μg/mL chloramphenicol and incubated anaerobically at 30� C. The transformants were visible after about 2 days. The transformation/transposition frequency was approx. 3�101/μg DNA.
A total of 39 Cmr transformant colonies was obtained. Twenty-one colonies were picked and further analyzed by PCR and enzymatic activity assays. PCR using primers SEQ ID NOs:22 and 23 confirmed the presence of a 3 kb DNA fragment containing tal and tkt coding regions in the transformants. Back transformation with plasmid DNA from the 21 integrant colonies generated no back transformants in E. coli suggesting the tal and tkt were integrated in the genome of ZW1. These integrants were tested for transaldolase and transketolase activities using protocols modified for microplates (General Methods). The Pierce BCA protein assay was used for the determination of protein concentrations. The transformants were grown up in RM medium containing 2% (w/v) glucose supplemented with 120 μg/ml chloramphenicol) in 50 ml conical centrifuge tubes at 30� C. The control strains 8b and ZW1 were grown up as well (RM plus 2% glucose was used for ZW1) for enzymatic assays. Cells were harvested when the OD600 reached 1.0. Cells were washed once and resuspended in sonication buffer (10 mM Tris-HCl, pH 7.6 and 10 mM MgCl2). Enzymatic assays were conducted as described in U.S. App. Pub. No. 20030162271. Units are given as μmole/min-mg. All samples had transaldolase and transketolase activities except for one.
Southern hybridization was performed on genomic and plasmid DNA of selected integrants digested with PstI using a tkt probe. ZW1 DNA did not hybridize with the tkt probe. A common 1.5 kb band was visible in all integrant genomic DNA samples, which is the expected DNA fragment between a PstI site in tkt and a PstI site in tal. A second visible high molecular weight (6 kb or greater) band was unique between independent lines T2, T3, T4 and T5 indicating a separate genomic integration site in each line. Interestingly, both plasmid and genomic DNA of T5 hybridized with the tkt probe indicating it was likely that Pgaptaltkt was also integrated in T5 on the native plasmid. These four strains (T2, T3, T4 and T5) were selected for further Cre treatment to remove the Cmr marker.
Cre Treatment to Remove Cmr Marker from taltkt Integrants
To remove the Cmr marker from the chromosome, T2, T3, T4 and T5 were transformed with pZB188/Spec-Cre. This plasmid is a derivative of the Zymomonas-E. coli shuttle vector pZB188 [Zhang et al. (1995) Science 267:240-243; U.S. Pat. No. 5,514,583] that contains an expression cassette for Cre Recombinase. pZB188/Spec-Cre is identical to the Cre Expression vector that is described In Example 10 (pZB188/Kan-Cre), except that it has a spectinomycin-resistance gene instead of a kanamycin-resistance gene. The transformants were selected on MM agar plates supplemented with 2% glucose and 200 μg/ml spectinomycin). Spr resistant colonies were picked onto RM agar plates supplemented with 2% glucose and 200 μg/ml spectinomycin and RM agar plates supplemented with 2% glucose and 120 μg/mL Cm. One hundred percent of the colonies picked were Cms indicating the high efficiency excision of Cmr by Cre. SprCms transformants were cultured in RM plus 2% glucose at 37� C. for 2 to 5 daily transfers to cure pZB188aadACreF. At each transfer, cells were diluted and plated on RM plus 2% glucose agar plates for picking onto additional plates of the same medium with or without 200 μg/mL Sp. Sps colonies were analyzed by PCR to confirm the loss of pZB188aadACreF. The plasmid-cured descendents of the integrants were named T2C, T3C, T4C and T5C. To examine whether these transposition integrants were stable, these 4 strains were grown in RM plus 2% glucose and then transferred to 10 ml of the same medium and grown at 37� C. in duplicate test tubes. Cells were transferred daily for ten days, or approximately 100 generations. Colonies were diluted and plated onto RMG plates for colony isolation after the 1st and 10th transfers. Twelve colonies from each transfer of each strain tested positive for the presence of Pgaptaltkt by colony PCR using 5′ Pgap and 3′ tkt primers (SEQ ID NOs; 13 and 23). Transaldolase and transketolase activities were also measured for isolates after the 1st and 10th transfers (as described in General Methods). All 4 integrants had similar levels of both TAL and TKT activities after 100 generations on the non-selective medium, suggesting that these integrants were genetically stable.
Construction of pMODPgapxylABCm for Transposition
The next step was to further integrate the PgapxylAB loxP::Cm operon into the ZW1::Pgaptaltkt integrants (T2C, T3C, T4C and T5C). The integrative plasmid pMODPgapxylABCm was constructed based on the plasmid pMODPgaptaltktCm (described above). The Pgaptaltkt DNA fragment was removed by SacI/SfiI digestion. An adaptor fragment containing SacI, NotI, and SfiI restriction sites was introduced by ligation. A NotI fragment of PgapxylAB, that was isolated from pZB4 (U.S. Pat. No. 5,514,583), was then cloned in the NotI site of the adaptor. Xylose isomerase (XI) is encoded by xylA and xylulokinase (XK) is encoded by xylB. The complete nucleotide sequence for the pMODPgapxylABCm plasmid is given as SEQ ID NO:24.
Transposition and Transformation of pMODPgapxylABCm in T2C, T3C, T4C and T5C
Using a similar approach to the integration of PgaptaltktCm, T2C, T3C, T4C and T5C were transformed/transposed with pMODPgapxylABCm (described above) treated with transposase. Six integrants (T3CCmX1, T3CCmX2, T3CCmX3, T4CCmX1, T5CCmX1, T5CCmX2) were obtained in 2 transformation/transposition experiments following Cm selection. All were confirmed for the presence of xylAB by PCR using two sets of primers: SEQ ID NOs:25, and 26, and SEQ ID NOs:15 and 16 except for T2CcmX1 and T2CcmX6 from which no PCR fragment was detected using the primers SEQ ID NOs:25 and 26.
The integrants, including the 2 PCR negative lines, were assayed for XI, XK, TAL and TKT activities (General Methods). The results shown in FIGS. 2 and 3 indicated that the six xylAB integrants T3CCmX1, T3CCmX2, T3CCmX3, T4CCmX1, T5CCmX1, and T5CCmX2 all had XI, XK, TAL and TKT activities. XI and XK activities were newly acquired as compared to the negative parental controls (FIG. 2). TAL and TKT activities were maintained as in the parental controls. All results indicated that the proteins were made and functional. Enzyme activity levels varied, with TI and XK activities similar to those of ZW1 integrants transformed/transposed with the same plasmid. The levels of activities of XI, XK, TAL and TKT were lower than those in strain 8b.
The integration of the xylAB operon was confirmed by Southern hybridization. Both genomic and plasmid DNA of the 6 lines were digested with SphI and hybridized to a digoxenin labeled xylB probe. A common band of about 3 kb, which is generated from an SphI site in xylB and another SphI site in the adjacent cloning sites on the pMOD vector, was present in all genomic DNA samples, and in addition, higher molecular weight hybridizing bands in the genomic DNA samples indicated that there were four sites of integration for the PgapxylAB operon in the chromosome. T3CCmX1 and T3CCmX2 appear to have the same integration site, T3CCmX3 and T4CCmX1 may have the same integration site, and T5CCmX1 and T5CCmX2 each have a separate integration site. Digestion of the same DNA with PstI followed by Southern hybridization with the tkt probe demonstrated that each integrant had the same hybridization pattern as its respective parental strain.
Adaptation of the ZW1::Pgaptaltkt PgapxylAB Cm Integrants on Xylose Media
Despite the presence of all four enzymatic activities for xylose utilization, previous observations (U.S. App. Pub. No. 20030162271) indicated that the integrants may not grow on xylose immediately. Growth on xylose may occur after prolonged incubation on xylose medium (either in test tubes or on plates), a process called adaptation.
The strains were adapted as follows. ZW1::PgaptaltktPgapxylABCm integrant strains were inoculated into test tubes containing RMX (containing 10 g/l yeast extract, 2 g/l KH2PO4, 20 g/l or 2% (w/v) xylose as well as onto MMGX or MMX plates (10 g/L yeast extract, 5 g/L of tryptone, 2.5 g/L of (NH4)2SO4, 0.2 g/L K2HPO4, 1 mM MgSO4, 1.5% (w/v) agar, 0.025% (w/v) glucose and 4% (w/v) xylose or just 4% (w/v) xylose). The low level of glucose was used to support initial growth to increase the chance of mutation during adaptation. One of at least five attempts at adaptation on xylose in both cultures and plates was successful. After 10 days of anaerobic incubation at 30� C., 17 and 19 colonies were visible on MMGX plated with T3CCmX1 and T3CCmX2 cells, respectively. The colonies were small and looked unhealthy (transparent) on the plates. Twelve colonies (four from T3CCmX1 plating: T3CCmX11, T3CCmX12, T3CCmX13 and T3CCmX110; eight from T3CCmX2 plating: T3CCmX24, T3CCmX25, T3CCmX26, T3CCmX27, T3CCmX28, T3CCmX29, T3CCmX211 and T3CCmX212) were inoculated in RMGCm120 and transferred into 3 ml RMX for further adaptation to obtain lines that were able to grow faster on xylose.
Adaptation of integrants in test tubes containing 3 ml RMX was conducted at 30� C. OD600 was constantly monitored in a Spectronic 601 spectrophotometer. When the growth reached mid-log phase, the cultures were transferred into fresh tubes of RMX. This process was continued for 7 transfers. The growth rates and final ODs (non-linear readings) were improved over the transfers.
At the 6th transfer, the cultures were streaked out on RMX plates to isolate single colonies. Three integrants grew faster than others on RMX streaked plates: T3CCmX13, T3CCmX26 and T3CCmX27, which are referred to as X13, X26 and X27 in the tables and discussion below. To screen for the best xylose growers, four large (L1-4) and four small (S1-4) colonies each for TX13, X26 and X27 were selected and grown in RMX test tubes so that growth, sugar utilization, and ethanol production could be monitored. Colonies were grown overnight at 30� C. followed by inoculation of OD600=0.05 into 3 ml of RMX in test tubes in duplicates. X27 grew more slowly in RMG than the other cultures and was inoculated again 6.5 hrs later. After 69 hrs (62.5 hrs for X27), samples were taken for HPLC analysis (General Methods). FIG. 4 charts the average ethanol yield (% of theoretical yield) and xylose utilization (%) for cultures at 69 hours (62.5 hr for all X27 cultures). There was no significant difference between the large and small colonies. Although the performance of X27 was better as compared to X26 on xylose, it showed slower growth on glucose. Therefore, the top performers, large colonies of X13 (X13L3) and X26 (X26L1), were chosen for further evaluation in pH-controlled fermentations. The fermentations were conducted in RMG (6% glucose), RMX (6% xylose) and RMGX (8%:4%; glucose:xylose) at 37� C. for strains X13L3 and X26L1, as well as the control strain 8b. Fermentation of glucose by X13L3 and X26L1 grown in RMG (6%) and RMGX (8%:4%) proceeded rather quickly. The fermentation of xylose in the RMGX (8%:4%) was slower for both X13L3 and X26L1 as compared to that of strain 8b. In addition, growth on RMX (6%) at 37� C. occurred after a long lag for both X13L3 and X26L1. Several isolates, X13b, X13c and X13FL, were recovered from RMX (6%) fermentations. These isolates along with the original strains X13a (an isolate of X13L3) and X26 were subjected to Cre treatment, as described previously in this Example, to remove the Cmr marker from ZW1::PgaptaltktPgapxylABCm strains. The resulting Cre treated, Cmr-free integrants were named: X13aC, X13bC, X13cC, X13FLC and X26C.
Adaptation and Selection of Strain ZW658
As described earlier, adaptation of the initial ZW1::PgaptaltktPgapxylABCm strains on RMX at 30� C. greatly improved the growth of strains in these conditions. However, the adapted strains suffered a long lag during growth and fermentation in RMX (6%) at 37� C. To further improve the integrants for xylose fermentation at preferred process conditions including higher sugar concentration and temperature, the evolutionary or adaptation process was continued in RMX (5%) at 37� C. Serial transfers were conducted and the best growers were selected. Integrants used in this process included X13aC, X13bC, X13cC, X26C and X13FLC. These 5 strains were grown in RMX at 30� C. for 6 transfers before being transferred to RMX (5%) at 37� C. for another 5 to 16 transfers. During and after all the transfers cultures were streaked on RMX plates and incubated at 37� C. to isolate single colonies. Large colonies were further streaked on RMX plates and incubated at 37� C. for 3 to 4 times to purify the colonies. Final large colonies were selected for growth testing in RMX (5%) at 37� C.
Evaluation of Strains from Adaptation in RMX (5%) Medium at 37� C.
Eighteen colonies isolated after adaptation with serial transfers were tested in RMX (5%) test tubes at 37� C. initially. Twelve strains were selected for a 2nd test tube evaluation. Strain 8b was included in all the evaluations for comparison. The 18 colonies were grown up in RMG at 37� C. overnight, centrifuged and the cells were inoculated into 4 ml of RMX (5%) at 37� C., statically in test tubes for the 1st evaluation. Based on the growth (OD600, non-linear) and end point HPLC results (low residual xylose and high ethanol), 12 strains were selected for the 2nd evaluation.
One of the purposes of the 2nd evaluation was to test the stability of improved growth on xylose and xylose utilization capability of the strains. All 12 strains were subjected to a stability study to see whether the adapted strains were stable after being exposed to a non-selective medium in which they were serially transferred in at 37� C. for 50 generations. Cultures before and after RMG (5%) transfers were inoculated in RMX (5%) test tubes and grown at 37� C. for evaluation. The non-linear ODs were monitored by direct reading of test tubes in a Spectronic 601 spectrophotometer. The ODs at the 70th hour of growth in RMX (5%) before and after 50 generations of growth in RMG are plotted in FIG. 5. The results indicated that most strains were stable after 50 generations in RMG at 37� C. The endpoint (at stationary phase) supernatants were also analyzed by HPLC for xylose and ethanol concentrations. The low residual xylose and high ethanol concentrations in these cultures supported the fact that the strain grew and fermented xylose well.
Based on the results from the above test tube evaluation (low residual xylose, high ethanol concentration and higher OD) and a subsequent microtiter plate growth screening with high concentrations of glucose and/or xylose (up to 20%) and mixtures of glucose and xylose with acetate to select better growers in high sugars and in the presence of acetate, such as strain #26, designated as ZW658, which exhibited the best overall performance
Assay of Pentose Phosphate Pathway Enzyme Activities
The activities of the four xylose utilization enzymes encoded by integrated genes (described in Example 1) were measured as described in the General Methods for three of the strains selected for adaptation at high sugar and 37� C. (of Example 1) and were compared to activities of the same enzymes in the further adapted strain ZW658 (of Example 2). The results, expressed as μmoles product/mg protein/minute are shown in Table 1.
Enzyme activities in different xylose-utilizing adapted Z. mobilis strains
0.033 +/− 0.013
1.15 +/− 0.13
1.66 +/− 0.5
0.22 +/− 0.02
ZW658
0.25 +/− 0.033
4.41 +/− 0.21
2.67 +/− 1.0
0.19 +/− 0.05
The activity levels for both members of the xylAB operon were increased by about 4 to 8 fold in the further adapted strain ZW658 as compared to levels in the partially adapted precursor strains. There was little or no change in the expression level of enzymes from the tal/tkt operon between ZW658 and the partially adapted precursor strains.
Sequence Comparison of the Promoter Regions of the XylAB Operons in a Partially Adapted Strain and in ZW658
Since a clear change in the enzyme activity levels of the products of both genes under the control of the GAP promoter (Pgap) driving xylAB was a noted outcome of the adaptation that led to ZW658, the promoter region of that operon from a partially adapted strain (of Example 1; subsequently given the strain number ZW641) and from ZW658 were amplified by PCR and sequenced. A PCR fragment was prepared using a forward PCR primer (PC11; SEQ ID NO:27) from the recG coding region where the PgapxylAB operon was integrated and a reverse primer from the xylA coding region (PC12; SEQ ID NO:28). The resulting 961 bp PCR product was sequenced using primers LM121, LM122, and LM123 (SEQ ID NOs:29, 30, and 31). The promoter sequence from ZW641 is given in SEQ ID NO:3 and that from ZW658 in SEQ ID NO:4. These promoter sequences were both found to differ at one position from the published sequence of the Pgap in the Z. mobilis strain CP4 (SEQ ID NO:1): a 1 base deletion (of a T) after position -21, counting towards the 5′ end starting upstream of the ATG start codon for the GAP coding region. This sequence change does not contribute to any difference in expression between the Pgap of ZW641 and Pgap of ZW658 since it is present in both strains. In addition to this common change—there was also a single base pair difference between the ZW641 and ZW658 Pgap sequences. The G at position -189 with respect to the coding region start ATG for XylA in the sequence from the ZW641 strain was replaced by a T in the sequence from ZW658. No other changes between the two sequences were noted and it seemed possible that a change in expression level due to this single base change in the GAP promoter region might be responsible for the increased enzyme activities found for both proteins encoded by genes under the control of that promoter.
Construction of a Xylose Isomerase Expression Vector for Z. mobilis that has the Same Pgap that Drives the XylA/B Operon in Z. mobilis ZW641
A plasmid construct that confers resistance to spectinomycin and expression of E. coli xylose isomerase in Z. mobilis (pZB188/aada-GapXylA; where Gap represents the promoter) was generated as described below using an E. coli/Z. mobilis shuttle vector (pZB188) as starting material (FIG. 6A). Steps involved in the construction of pZB188 are disclosed in U.S. Pat. No. 5,514,583. Briefly, this 7008 bp plasmid is able to replicate in E. coli and Z. mobilis because it has two different origins of replication, one for each bacterial species. pZB188 also contains a DNA fragment that confers resistance to tetracycline (i.e. a Tcr-cassette). The first step in the construction of pZB188/aada-GapXylA, was to remove the Tcr-cassette from pZB188 and replace it with a DNA fragment that confers resistance to spectinomycin (i.e. Specr-cassette). To excise the Tcr-cassette from pZB188, the plasmid was cut with ClaI and BssHII and the resulting large vector fragment was purified by agarose gel electrophoresis as described in more detail below. The Specr-cassette was generated by PCR using plasmid pHP15578 (Cahoon et al, (2003) Nature Biotechnology 21: 1082-1087) as a template and Primers 1 (SEQ ID NO:32) and 2 (SEQ ID NO:33). Plasmid pHP15578 contains the complete nucleotide sequence for the Specr-cassette and its promoter, which is based on the published sequence of the Transposon Tn7 aadA gene (GenBank accession number X03043) that codes for 3′ (9)-O-nucleotidyltransferase.
CTACTCATTTatcgatGGAGCACAGGATGACGCCT Primer 2
CATCTTACTacgcgtTGGCAGGTCAGCAAGTGCC The underlined bases of Primer 1 (forward primer) hybridize just upstream from the promoter for the Specr-cassette (to nts 4-22 of GenBank accession number X03043), while the lower case letters correspond to a ClaI site that was added to the 5′ end of the primer. The underlined bases of Primer 2 (reverse primer) hybridize about 130 bases downstream from the stop codon for the Specr-cassette (to nts 1002-1020 of GenBank accession number X03043), while the lower case letters correspond to an AflIII site that was added to the 5′ end of the primer. The 1048 bp PCR-generated Specr-cassette was double-digested with ClaI and AflIII, and the resulting DNA fragment was purified using the QIAquick PCR Purification Kit (Qiagen, Cat. No. 28104) and the vendor's recommended protocol. In the next step, plasmid pZB188 (isolated from E. coli SSC110 (dcm−, dam−) in order to obtain non-methylated plasmid DNA for cutting with ClaI (which is sensitive to dam methylation) was double-digested with ClaI and BssHII to remove the Tcr-cassette, and the resulting large vector fragment was purified by agarose gel electrophoresis. This DNA fragment and the cleaned up PCR product were then ligated together, and the transformation reaction mixture was introduced into E. coli JM110 using chemically competent cells that were obtained from Stratagene (Cat. No. 200239). Note that BssHII and AflIII generate compatible “sticky ends”, but both sites are destroyed when they are ligated together. Transformants were plated on LB medium that contained spectinomycin (100 μg/ml) and grown at 37� C. A spectinomycin-resistant transformant that contained a plasmid with the correct size insert was identified by restriction digestion analysis with NotI, and the plasmid that was selected for further manipulation is referred to below as pZB188/aadA. A circle diagram of this construct is shown in FIG. 6B.
In the next step, an E. coli xylose isomerase expression cassette was inserted between the NcoI and AclI sites of pZB188/aadA after cutting the latter with both enzymes, and purifying the large vector fragment by agarose gel electrophoresis. The ˜2 Kbp DNA fragment that served as the E. coli xylose isomerase expression cassette was isolated from plasmid pZB4 by cutting the latter construct with NcoI and ClaI, and purifying the relevant DNA fragment by agarose gel electrophoresis. Plasmid pZB4 is described in detail in U.S. Pat. No. 5,514,583, and a schematic representation of the E. coli xylose isomerase expression cassette PgapXylA (SEQ ID NO:34) is shown in the boxed diagram in FIG. 6D.
The fragment containing the E. coli xylose isomerase expression cassette has an NcoI site and a ClaI site at its 5′ and 3′ ends respectively. As described in more detail in U.S. Pat. No. 5,514,583, this fragment contains the strong, constitutive Z. mobilis glyceraldehyde 3-phosphate dehydrogenase (GAP) promoter (nts 316-619), which is precisely fused to the complete open reading frame of the E. coli xylA open reading frame (nts 620-1942) that codes for xylose isomerase. It also contains the small stem-loop region that immediately follows the xylose isomerase stop codon (nts 1965-1999). The E. coli xylose isomerase expression cassette was inserted between the NcoI and AclI sites of pZB188/aadA in a standard ligation reaction. Note that ClaI and AclI generate compatible “sticky ends”, but both sites are destroyed when they are ligated together. The ligation reaction mixture was then electroporated into E. coli SSC110 (dcm−, dam−) to obtain non-methylated plasmid DNA for subsequent transformation of Z. mobilis, and the transformed cells were plated on LB medium that contained 100 μg/ml of spectinomycin; growth was at 37� C. Spectinomycin-resistant transformants that had a plasmid with a correct size insert were identified by restriction digestion analysis with NotI, NcoI and AclI. The plasmid that was selected for further manipulation and overexpression of E. coli xylose isomerase in the Z. mobilis ZW641 strain is referred to below as “pZB188/aadA-641GapXylA”; a circle diagram of this plasmid construct is shown in FIG. 6C.
It is important to note that the nucleotide sequence of SEQ ID NO:34 is not identical to the nucleotide sequence that is described in SEQ ID NO:34 in co-owned and co-pending U.S. App. Pub. Nos. US20080286870 and US20080187973, even though it corresponds to the same E. coli xylose isomerase expression cassette (PgapXylA). The DNA sequence disclosed in SEQ ID NO: 34 in the present work has a 1-bp deletion in the Pgap that corresponds to nt 599 of SEQ ID NO:34 in U.S. App. Pub. Nos. US20080286870and US20080187973. The nucleotide sequence that was reported in the earlier patent applications was based on the published DNA sequence of the Pgap for the Z. mobilis strain CP4 (Conway et al. J. Bacteriol. 169 (12):5653-5662 (1987)) and the promoter was not resequenced at that time. Recently, however, we have discovered that the Pgap in pZB4 is also missing the same nucleotide, and the E. coli xylose isomerase expression cassette (PgapXylA) that was used for all three patent applications was derived from this plasmid as noted above.
Generation of an E. coli Xylose Isomerase Expression Vector that has the Same Pgap that Drives the XylA/B Operon in Z. mobilis ZW658 and ZW801-4
Plasmid pZB188/aadA-801GapXylA is identical to pZB188-aadA-641GapXylA (FIG. 6C) but has a single bp substitution in the Pgap that corresponds to the G->T mutation that is present at position -189 in the Pgap that drives expression of the E. coli XylA/B operon in ZW658. The same point mutation is also present in strains ZW800 and ZW801-4, which were sequentially derived from ZW658 as described below. The construction and characterization of ZW800 and ZW801-4 are described in great detail in commonly owned and co-pending U.S. App. Pub. No. US20080286870. ZW800 is a derivative of ZW658 which has a double-crossover insertion of a spectinomycin resistance cassette in the sequence encoding the glucose-fructose oxidoreductase (GFOR) enzyme that inactivates this activity. ZW801-4 is a derivative of ZW800 in which the spectinomycin resistance cassette was deleted by site-specific recombination leaving an in-frame stop codon that prematurely truncates the protein. None of these manipulations altered the nucleotide sequence of the mutant Pgap promoter that drives the XylA/B operon in ZW658. Thus, the “801GAP promoter” refers to the promoter sequence that is present in the following strains: ZW658, ZW800, and ZW801-4.
The steps and plasmid intermediates that were used to generate pZB188/aadA-801GapXylA are described below in chronological order starting with the plasmid pMOD-Linker.
Construction of pMOD-Linker
The precursor for plasmid pMOD-Linker was the pMOD™-2<MCS> Transposon Construction Vector (Cat. No. MOD0602) that is commercially available from EPICENTRE�. As shown in FIG. 7A, pMOD™-2<MCS> has an ampicillin resistance gene (ampR), an E. coli origin of replication (ori), and a multi-cloning site that is situated between the two mosaic ends (ME) that Tn5 transposase interacts with. The first step in the construction of pMOD-Linker was to remove the original multi-cloning site in pMOD2-<MCS> and replace it with a new multi-cloning site that has unique restriction sites for AsiSi, FseI and SbfI. This was done by cutting the plasmid with EcoRI and HindIII and purifying the large (about 2.5 Kbp) vector fragment by agarose gel electrophoresis. The new multi-cloning site was then generated by annealing together two synthetic oligonucleotides, Linker B (SEQ ID NO:35) and Linker T (SEQ ID NO:36) that were both phosphorylated at their 5′ end.
Linker B:
aattCTACCTGCAGGAGTAGGCCGGCCATGAGCGATCGCA
Linker T:
agctTGCGATCGCTCATGGCCGGCCTACTCCTGCAGGTAG
These oligonucleotides are complimentary to each other, and when annealed together form a double stranded linker that has single-stranded overhangs at both ends (lower case letters), which allow the DNA fragment to be ligated between the EcoRI and HindIII sites of the large pMOD™-2<MCS> vector fragment described above. As noted above this synthetic linker also contains three unique restriction sites (AsiSi, FseI and SbfI) that can be used for subsequent cloning steps. The SbfI site is underlined with a thin line, the FseI site is underlined with a thick line and the AsiSi site is underlined with two thin lines. Linker B and Linker T were annealed together and the resulting DNA fragment was inserted between the EcoRI and HindIII sites of pMOD™-2<MCS> in a standard ligation reaction. The ligation reaction mixture was used to transform E. coli DH10B and the transformed cells were plated on LB media that contained 100 μg/ml of ampicillin. Plasmid DNA was then isolated from a representative ampicillin-resistant colony that contained the new multi-cloning site. A circle diagram of the resulting plasmid construct (referred to below as “pMOD-Linker”) is shown in FIG. 7B.
Construction of pMOD-Linker-Spec
A DNA fragment that confers resistance to spectinomycin (Specr) and has a wild type loxP site at both ends was inserted between the AsiSi and FseI sites of the pMOD-Linker construct described above. The source of the loxP-flanked Specr cassette was plasmid pLDHSp-9WW (FIG. 8), which is described in great detail in U.S. application Ser. No. 11/862,566. In the first step, MOD-Linker plasmid DNA was sequentially digested with FseI and AsiSI, and the large vector fragment was purified using a DNA Clean & Concentrator™-5 spin column kit that was purchased from Zymo Research Corporation (Cat. No. D04003). Next, plasmid pLDHSp-9WW was also double-digested with the same two enzymes and the small (about 1.1 Kbp) DNA fragment that contained the loxP-flanked Specr cassette was purified by agarose gel electrophoresis. The two DNA fragments of interest were then ligated together, and the transformation reaction mixture was introduced into E. coli DH10B using electroporation. Transformants were plated on LB media that contained ampicillin (100 μg/ml) and spectinomycin (100 μg/ml) and growth was at 37� C. Plasmid DNA was then isolated from one of the ampicillin-resistant colonies that contained a DNA fragment with the correct size and this was used for subsequent manipulations. A circle diagram of this construct (referred to below as “pMOD-Linker-Spec”) is shown in FIG. 7C.
Construction of pMOD-Linker-Spec-801GapXylA and pMOD-Linker-Spec-641GapXylA
A DNA fragment that contains the entire Pgap, the XylA coding region, and the stem-loop region that is between the XylA and XylB open reading frames was PCR-amplified from ZW801-4 using Primers 3 and 4 (SEQ ID NOs:37 and 38, respectively) and resuspended cells as a template. As already noted, DNA sequence analysis has shown that ZW801-4 has the same G->T point mutation at position -189 in the Pgap promoter that drives the expression of the integrated E. coli XylA/B operon as ZW658 and that the Pgap in both strains are identical.
Primer 3
TCACTCATggccggccGTTCGATCAACAACCCGAATCC Primer 4
CTACTCATcctgcaggCCGATATACTTATCGATCGTTCC The underlined bases of Primer 3 (forward primer) hybridize to the first 22 bases of the Pgap (and to nts 316-337 of SEQ ID NO:34, while the lower case letters correspond to an FseI site that was added to the 5′ end of the primer. The underlined bases of Primer 4 (reverse primer) hybridize just downstream from the stem-loop region that is after the XylA stop codon (and to the last 12 nts of SEQ ID NO:34), while the lower case letters correspond to an SbfI site that was added to the 5′ end of the primer.
The PCR product was double-digested with FseI and SbfI, and purified using a DNA Clean & Concentrator™-5 spin column kit that was purchased from Zymo Research Corporation (Cat. No. D04003). Next, plasmid pMOD-Linker-Spec was cut with the same two enzymes and the resulting large vector fragment was purified using the same procedure. The two DNA fragments of interest were then ligated together, and the transformation reaction mixture was introduced into E. coli DH10B using electroporation. The cells were plated on LB media that contained ampicillin (100 μg/ml) and spectinomycin (100 μg/ml) and growth was at 37� C. Transformants that contained a plasmid with a correct size insert were identified by PCR using Primers 3 and 4 and resuspended colonies as a template (“colony PCR”). The plasmid that was selected for further manipulation is referred to below as pMOD-Linker-Spec-801GapXylA, and a circle diagram of this construct is shown in FIG. 9.
The same steps described above were used to generate another plasmid that is referred to below as “pMOD-Linker-Spec-641GapXylA”, except the template that was used for PCR-amplification of the Pgap-XylA gene DNA fragment was a cell suspension of ZW641. pMOD-Linker-Spec-641GapXylA and pMOD-Linker-Spec-801 GapXylA are identical except for the G->T substitution in the Pgap that distinguishes ZW658 (and ZW801-4) from ZW641.
Construction of pZB188-aadA-801GapXylA
As described in the first paragraph of Example 6, pZB188-aadA-801GapXylA is an E. coli Xylose Isomerase expression vector for Z. mobilis that is identical to pZB188-aadA-641GapXylA, but it has the same G->T substitution in the Pgap that drives expression of the integrated Pgap-XylA/B operon in ZW658 (and ZW801-4). To construct this plasmid, pMOD-Linker-Spec-801GapXylA (FIG. 10A) was double digested with MluI and SalI and the smaller DNA fragment (about 1100 bp) was purified using agarose gel electrophoresis and the Zymoclean Gel DNA Recovery Kit (catalog #D4001, Zymo Research). This fragment contains the Pgap G->T substitution and part of the XylA ORF and was used to replace the corresponding fragment in pZB188-aadA-641GapXylA (FIG. 10B), after cutting the latter construct with the same two enzymes and purifying the large vector fragment by agarose gel electrophoresis. The two fragments of interest were then ligated together and the ligation reaction mixture was introduced into E. coli DH10B using electroporation. Transformants were plated on LB media that contained spectinomycin (100 μg/ml) and growth was at 37� C. Plasmid DNA was isolated from a spectinomycin-resistant colony and the presence of the Pgap promoter G->T substitution was confirmed by DNA sequence analysis. The plasmid used for subsequent manipulations, (“pZB188-aadA-801GapXylA”) is shown in FIG. 10C.
Overexpression of E. coli Xylose Isomerase in ZW641
The enzyme activity measurements in Table I show that xylose isomerase and xylulokinase activities increased dramatically during the transition from ZW641 to ZW658. To test the hypothesis that xylose isomerase is the rate-limiting enzyme for growth on xylose in ZW641, the enzyme was overexpressed in this strain using the multicopy plasmid, pZB188/aadA-641GapXylA (FIG. 6C). The control for this experiment was ZW641 transformed with the multicopy plasmid pZB188/aadA, which lacks the Pgap-E. coli xylose isomerase expression cassette (FIG. 6B). The construction of both of these plasmids is described in Example 5, and the transformation protocol was essentially as described in Example 5 of commonly owned and co-pending U.S. App. Pub. No. US20080187973. Briefly, non-methylated plasmid DNA (isolated from E. coli SSC110, which is a dcm− and dam− strain) was introduced into ZW641 using electroporation, and the transformed cells were plated on LB media that contained 200 μg/ml spectinomycin. After a 48-hr growth period at 30� C. under anaerobic conditions, three primary transformants were randomly selected for each plasmid, and these were patched (transferred) onto agar plates that contained the same growth media for further characterization.
FIG. 11 shows growth curves (OD600 versus time) in xylose-containing media for the three strains that harbored the 641Pgap-E. coli xylose isomerase expression plasmid (X1, X2 and X2) and the three strains that harbored the control plasmid (C1, C2 and C3). This experiment was performed at 30� C. in shake flasks (5-ml cultures in 15-ml tubes at 150 rpm), and the growth media was mRM3-X10 (10 g/L yeast extract, 2 g/L KH2PO4, 1 g/L MgSO4 and 100 g/L xylose) that also contained spectinomycin (200 μg/ml). The cultures were started with a loop of cells from the patched plate described in the above paragraph and the initial OD600 in each case was about 0.13. Similar to ZW641, the three strains with the control plasmid barely grew on xylose. In marked contrast, both the rate and extent of growth (final OD600 values) on xylose were dramatically improved when ZW641 was transformed with the 641Pgap-E. coli xylose isomerase expression plasmid, pZB188/aadA-641GapXylA. Since all three strains that had this plasmid behaved the same in the experiment that is shown in FIG. 11, only the X1 strain and C1 strain were subjected to further characterization.
FIG. 12 shows a side-by-side comparison of ZW641, ZW658, X1 and C1 in the same xylose containing growth media without spectinomycin. The conditions for this experiment were identical to those described above but the 20-ml cultures were grown in 50-ml tubes and the initial OD600s were about 4-fold lower (0.035). The growth curves shown in FIG. 12A are plotted on a linear scale (OD600 versus Time), while FIG. 12B shows the same experimental data plotted on a logarithmic scale (log OD600 versus Time) in order to compare exponential growth rates. It is apparent from this experiment that the exponential growth rate of X1 is almost as fast as the xylose-adapted strain ZW658, and that this strain grows much better on xylose than the parent strain ZW641 with or without the control plasmid. Thus, high expression of xylose isomerase in ZW641 (driven by a 641Pgap promoter from a multicopy plasmid) has a similar effect on growth on xylose as the increase in xylose isomerase activity had on ZW658 (shown in Table 1). Although the final biomass yield for X1 is about 2-fold lower than that obtained with ZW658, it is clear from this data that the rate-limiting enzyme for growth on xylose in ZW641 is xylose isomerase. The experiments shown in FIGS. 11 and 12 further suggest two other interesting possibilities: (1) that the large increase in xylose isomerase activity that occurred during the transition from ZW641 to ZW658 (Table I) was largely responsible for the better growth on xylose that occurred during the “xylose adaptation” process; and (2) that the increase in xylose isomerase activity might have resulted from the G->T substitution in the Pgap promoter that drives expression of the chromosomally-integrated Pgap-XylA/B operon that is present in ZW658.
Transposon-Mediated Integration of E. coli Xylose Isomerase in ZW641
ZW641 and two plasmid constructs (pMOD-Linker-Spec-801GapXylA and pMOD-Linker-Spec-641GapXylA) were used to test the hypothesis that the Pgap promoter with the G->T substitution that drives expression of the integrated XylA/B operon in ZW658 (henceforth referred to as the “801GAP promoter”) is stronger than the corresponding promoter in ZW641 (henceforth referred to as the “641GAP promoter”). ZW641 was selected for these experiments since it's barely able to grow on xylose, and because overexpression of xylose isomerase in this strain results in faster growth on xylose (Example 7, FIGS. 11 and 12). The basic idea was to introduce an extra copy of the E. coli xylose isomerase gene (driven by the 641GAP promoter or the 801GAP promoter) into the chromosome of ZW641 and see which construct would result in the fastest growth on xylose. Chromosomal integration of the two chimeric genes was accomplished using Epicentre's transposome technology.
As already indicated, pMOD-Linker-Spec-641GapXylA and pMOD-Linker-Spec-801GapXylA are identical plasmids except for the G->T point mutation that is present in the Pgap promoter in the latter construct. The transposable element used for random insertion into DNA in both cases consisted of the two 19-bp mosaic ends (MEs) and the entire DNA fragment that is sandwiched between them. As shown in FIG. 9, this element, which is referred to as the transposon, contains a spectinomycin-resistance cassette (Specr) and a downstream Pgap-E. coli xylose isomerase expression cassette. The protocol that was used to form the transposomes was essentially the same as that described in Epicentre's instruction manual for the EZ::TN™ pMOD™-2<MCS> Transposon Construction Vector (Cat. No. MOD0602). The 8-μL reaction contained 1.5 μL of 5′-phosphorylated, blunt-ended transposon DNA that was free of Mg++ ions (about 250 ng/μL), 4 μL of Epicentre's EZ::TN Transposase and 2.5 μL of 80% (v/v) glycerol. The control transposome reaction mixture was identical but 4 μL of sterile water was substituted for the transposase. The reactions were incubated at room temperature for 30 min and were then transferred to 4� C. for a 2- to 7-day incubation period that is required for the slow isomerization step, which results in the formation of the active transposome; using this procedure the transposomes are stable for at least 3 months at −20� C.
The transposomes were electroporated into ZW641 essentially using the same transformation protocol that is described in U.S. Pat. No. 5,514,583. Briefly, the 40-μL transformation reactions contained about 1010 cells/ml in 10% (v/v) glycerol, 1 μL of Epicentre's TypeOne™ Restriction Inhibitor (Cat. No. TYO261H) and 1 μL of the control or transposome reaction mixture. The settings for the electroporator were 1.6 kv/cm, 200Ω, and 25 μF, and the gap width of the cuvette was 0.1 cm. Following electroporation, the transformation reactions were diluted with 1.0 ml of MMG media (50 g/L glucose, 10 g/L yeast extract, 5 g/L of tryptone, 2.5 g/L of (NH4)2SO4, 0.2 g/L K2HPO4, and 1 mM MgSO4) and the cells were allowed to recover for about 3 hours at 30� C. The cells were then harvested by centrifugation at room temperature (13,000�g, 5 min) in sterile 1.5-ml microfuge tubes and the supernatant was carefully removed. Cell pellets were resuspended in 200 μL of liquid MMG media and a 100-μL aliquot of each cell suspension was plated on MMG media that contained 1.5% agar and 200 μg/ml of spectinomycin. After a 72-hr incubation period at 30� C. under anaerobic conditions, 3 colonies were on the control plate, 13 colonies were on the 641GapXylA transposome plate and 18 colonies were on the 801GapXylA transposome plate. Six colonies from both transposome plates were randomly selected for further characterization, and these were patched onto agar plates that contained MMX media and 200 μg/ml of spectinomycin; the growth conditions were as described above. MMX media is the same as MMG media, but contains 50 g/L of xylose instead of glucose. After a second round of growth on a fresh MMX plus spectinomycin plate, the six strains that grew the best on xylose (three for each transposome) were used for the experiment described below.
FIG. 13A shows linear growth curves for the three ZW641 strains that were obtained with the 641Gap-XylA transposome (#6-1, #6-3 and #6-5) and the three that received the 801Gap XylA transposome (#8-2, #8-4 and #8-5) in xylose-containing media. The same data is plotted on a log scale in FIG. 13B. This experiment was performed at 30� C. in shake flasks (7-ml cultures in 15-ml tubes at 150 rpm), and mRM3-X10 (10 g/L yeast extract, 2 g/L KH2PO4, 1 g/L MgSO4 and 100 g/L xylose) was the growth media. The cultures were started with a loop of cells from the patched plate described above and the initial ODs were very similar (about 0.02-0.03). The control for this experiment was the xylose-adapted strain ZW658, which has the G->T substitution in the Pgap that drives the chromosomally-integrated E. coli XylA/B operon.
Similar to the parent strain (ZW641) the three strains that had an extra chromosomally-integrated copy of the 641GapXylA expression cassette grew very poorly in xylose-containing media, although it was apparent that there were some minor improvements in both the growth rate and biomass yield (OD600), especially for strain #6-5 (compare FIG. 12A and FIG. 13A). In contrast, all three of the strains that were obtained with the 801GapXylA transposon grew much better on xylose than the parent strain (FIGS. 13A and 13B). In fact, two of the transformants (#8-4 and #8-5) grew almost as well on this sugar as ZW658 and the ZW641 transformants that harbored the multi-copy plasmid pZB188/aadA-GapXylA, which contains a 641GapXylA expression cassette (compare FIG. 12 and FIG. 13). Since transposition is a random event and all six strains have the 641GapXylA or 801GapXylA expression cassette inserted at different locations in the chromosome, differences in foreign gene expression that were observed in this experiment using the same transposome are likely to be due to positional effects. For example, position effects may account for the better growth of #6-5 than of #6-1 and #6-3, and for the poorer growth of #8-2 than of #8-4 and #8-5. Nevertheless, despite the small size of the population that was analyzed, the results that are shown in FIG. 13 strongly support the notion that the G->T mutation that is present in the Pgap promoter that drives the E. coli XylA/B operon in ZW658 and ZW801-4 is responsible for the higher xylose isomerase activity and better growth on xylose that is observed with these strains, compared to the parent strain ZW641.
The 801GAP Promoter Directs Higher Expression Levels of Ribose 5-Phosphate Isomerase in Z. mobilis than the 641GAP Promoter
If the 801GAP promoter is really stronger than the 641GAP promoter, its stimulatory effect on expression should not be restricted to the E. coli xylose isomerase gene, and enhanced expression of other proteins with this promoter would also be expected. To address this important issue, the Z. mobilis gene that codes for ribose 5-phosphate isomerase (RPI) was fused to both promoters, and the chimeric genes were inserted into a multi-copy plasmid that replicates in Z. mobilis. The resulting Pgap-RPI expression plasmids (pZB188/aadA-641GapRPI and pZB188/aadA-801GapRPI) were introduced into Z. mobilis and RPI expression levels were analyzed by SDS-PAGE as described below.
Construction of pZB188aadA/Gap/Zymo RPI/EcoliSL
Plasmid pZB188aadA/Gap/Zymo RPI/EcoliSL was an in important intermediate in the construction of the two Pgap-RPI expression plasmids that were used in the present invention. As shown in FIG. 14, this plasmid contains an expression cassette for the Z. mobilis ribose 5-phosphate isomerase (RPI) gene that is located between the unique NcoI and XhoI sites. An overlap PCR technique described below was used to generate the RPI expression cassette, which is a chimeric gene that contains the full-length 641GAP promoter sequence (nts 316-619 of SEQ ID NO:34) and the entire open reading frame of the Z. mobilis RPI gene. The RPI ORF corresponds to nts 1224730-1225203 of the Z. mobilis genome (GenBank accession number AE008692), and the initiation codon of RPI is directly fused to the 3′-end of the 641GAP promoter.
The template for the 641Gap promoter was pZB188/aadA-641GapXylA, and a 320-bp DNA fragment was amplified from this plasmid using Primers 5 and 6 (SEQ ID NOs:39 and 40, respectively) in a PCR reaction. The resulting PCR product contains the 641GAP promoter and the first 15 bp of the Z. mobilis RPI ORF that are attached to its 3′-end starting with the GTG initiation codon. This fragment also has a unique NcoI site at its 5′-end (lower case letters) that was added to the 5′-end of Primer 5 for cloning purposes.
Primer 5
CATGccatggGAGCTCGTTCGATCAACAACCCGAATCCTA
Primer 6
CACAGCAGAGGTCACGTTTATTCTCCTAACTTATTAAGTAGC
In a separate PCR reaction, Primers 7 and 8 (SEQ ID NOs:41 and 42, respectively) were used to generate a 473-bp fragment that contains the entire ORF of the native Z. mobilis RPI gene. The template that was used for amplification was genomic DNA that was isolated from the Z. mobilis strain ZW801-4. Note that the 5′-end of Primer 7 has 15 bp of an overlap sequence that can hybridize to the 3′-end of the 320-bp 641 GAP promoter fragment, and that an XhoI site (lower case letters) was added to the 5′-end of Primer 8 for cloning purposes.
Primer 7
GTTAGGAGAATAAACGTGACCTCTGCTGTGCCATCAAA
Primer 8
CCGctcgagCTAGATATTGAACTGAGGATTCGAAA
The two fragments described above were then subjected to an overlap PCR reaction using Primers 5 and 8 (SEQ ID NOs:39 and 42, respectively), and this manipulation resulted in the generation of the RPI expression cassette. The latter is a 778-bp fragment that contains the 641GAP promoter fused directly to the start codon of the Z. mobilis RPI ORF. The PCR product was then cut with NcoI and XhoI, and the resulting fragment was inserted into the NcoI and XhoI sites of a plasmid that was ultimately derived from pZB188/aada-641GapXylA (FIG. 6C) to yield the final product pZB188aadA/Gap/Zymo RPI/EcoliSL (FIG. 14). It is important to note that this plasmid, which is an RPI expression vector for Z. mobilis, also contains the stem-loop region that is present in the intergenic region of the E. coli XylA/B operon, and that this stabilizing element is located between the XhoI and NotI sites just downstream from the RPI stop codon. The nucleotide sequence of the RPI expression cassette that is in plasmid pZB188aadA/Gap/Zymo RPI/EcoliSL (including the XylA stem-loop structure) is disclosed in SEQ ID NO:43. The nucleotide sequence that is shown corresponds to the DNA fragment that is located between the NcoI and NotI sites, and includes both restriction sites.
Construction of pZB188/aadA-641GapRPI and pZB188/aadA-801GapRPI
pZB188/aadA-641GapRPI and pZB188/aadA-801GapRPI are Pgap-RPI expression plasmids for Z. mobilis that are identical, except the latter construct has the G->T substitution that distinguishes the 801GAP promoter from the 641GAP promoter. A 1240-bp DNA fragment that originated from pZB188aadA/Gap/Zymo RPI/EcoliSL was used to convert pZB188/aadA-641GapXylA (FIG. 6C) to pZB188/aadA-641GapRPI (FIG. 15B) and pZB188/aadA-801GapXylA (FIG. 10C) to pZB188/aadA-801GapRPI (FIG. 15C). This piece of DNA was generated by cutting pZB188aadA/Gap/Zymo RPI/EcoliSL with AsiSI and NheI, and purifying the smaller fragment by agarose gel electrophoresis. As shown in FIG. 15A, pZB188aadA/Gap/Zymo RPI/EcoliSL has unique AsiSI and NheI restriction sites, and the same sites are also present in pZB188/aadA-641GapXylA and pZB188/aadA-801GapXylA. Note that AsiSI cleaves all three of these plasmids in the Pgap downstream from the G->T substitution that distinguishes the 801GAP promoter from the 641GAP promoter, and that NheI cuts the plasmid backbone about 700 bp downstream from the XylA or RPI stop codons. The 1240-bp DNA fragment that was obtained from pZB188aadA/Gap/Zymo RPI/EcoliSL therefore contains a small stretch of DNA that the 641Gap promoter and 801Gap promoter share in common, the entire RPI open reading frame and the stabilizing XylA stem-loop region.
In the next step in the construction of pZB188/aadA-641GapRPI and pZB188/aadA-801GapRPI, the 1240-bp DNA fragment described above was inserted between the AsiSI and NheI sites in pZB188/aadA-641GapXylA and pZB188/aadA-801GapXylA in two separate ligation reactions, after cutting both of these plasmids with AsiSI and NheI and purifying the larger vector fragments. Both ligation reaction mixtures were introduced into E. coli DH10B using electroporation, and transformants were plated on LB media that contained spectinomycin (100 μg/ml); growth was at 37� C. Finally, pZB188/aadA-641GapRPI (FIG. 15B) and pZB188/aadA-801GapRPI (FIG. 15C) plasmid DNA was isolated from colonies that contained the correct construct (as confirmed by DNA sequence analysis), and both plasmids were then introduced into E. coli SCS110 (dam−, dcm−) to generate non-methylated plasmid DNA for transformation of Z. mobilis. Expression of RPI with the 641GAP Promoter and the 801GAP Promoter
The two Pgap-RPI expression vectors described above (pZB188/aadA-641GapRPI and pZB188/aadA-801GapRPI) were introduced into the wild type Z. mobilis strain ZW1 using electroporation and non-methylated plasmid DNA. The transformed cells were grown anaerobically at 30� C. on 1.5% agar plates that contained MMG media (50 g/L glucose, 10 g/L yeast extract, 5 g/L of tryptone, 2.5 g/L of (NH4)2SO4, 0.2 g/L K2HPO4, and 1 mM MgSO4) and 200 μg/ml of spectinomycin. Two randomly selected colonies that contained the 641GAP-RPI plasmid (641gapRpi #1 and 641gapRpi #2) and two that harbored the 801GAP-RPI plasmid (801gapRpi #1 and 801gapRpi #2) were patched onto a 1.5% agar plate that contained the same growth media, and the plate was incubated for about 24 hr at 30� C. under anaerobic conditions. This plate was used to start seed cultures for the RPI expression experiment.
The seed cultures were started with a loop of cells and were grown at 30� C. (150 rpm) in 15-ml capped tubes that contained 5 ml of MMG media and spectinomycin (200 μg/ml). The control for this experiment (the parent strain, ZW1) was grown under the same conditions, but the growth media lacked spectinomycin. The seed cultures were allowed to reach saturation, and were then used to start 20-ml cultures in 50-ml capped tubes, using the same growth media and conditions described above. The initial OD600 values were about 0.12 in all cases. Aliquots of the cultures (500-μL) were harvested during the exponential phase (OD600 about 1.1) by centrifugation (15,000�g, 10 min), and the cell pellets were resuspended in 250 μL of 1�SDS-PAGE sample buffer. All reagents for electrophoresis were obtained from Invitrogen. One milliliter of 1�SDS-PAGE sample buffer contains 250 μL NuPAGE™ LDS 4� Sample Buffer (Cat. No. N0007), 100 μL NuPAGE™ Sample Reducing Agent (Cat. No. NP0004) and 650 μL distilled water. The samples were heated for 10 min at 80� C., and particulate debris was removed by centrifugation (15,000�g, 10 min). Aliquots of the clarified samples (20 μL) were then subjected to SDS-PAGE, using a NuPAGE™ 12% Bis-Tris gel (Cat. No. NP0341) and the NuPAGE™ MES SDS Running Buffer (Cat. No. NP0002) protocol for reduced samples as recommended by the vendor. The gel was run at room temperature at constant voltage (180 V) for about 1 hr and was stained with Invitrogen SimplyBlue SafeStain (Cat. No. LC6060) as recommended by the manufacturer.
The molecular mass of the Z. mobilis RPI protein is 16927.37 Da based on the DNA sequence of the open reading frame. As shown in FIG. 16, several lightly stained protein bands migrated in the polyacrylamide gel in this region (i.e. between the 17 kDa and 19 kDa molecular weight standards) for the parent strain, ZW1 (Lanes 2 and 7). Visual inspection of the gel revealed that the intensity of one of the stained bands (indicated with an arrow) increased at least 2-fold when the 641GAP-RPI expression plasmid was introduced into ZW1 (Lanes 3 and 5), indicating that this is the RPI protein. Furthermore, it is quite evident in FIG. 12 that the intensity of the Z. mobilis RPI band increased far more dramatically for the two strains that harbored the 801GAP-RPI expression plasmid (Lanes 4 and 6). These results provide compelling evidence that the 801GAP promoter is a stronger promoter than the 648GAP promoter, and that the latter is useful tool for expressing foreign genes at very high levels.
Enzyme Activity and Sequence Comparison the Transgene GAP Promoter Regions of Independently Adapted Strains of Xylose Utilizing Z. mobilis Since strain 8b (Example 1 and US App. Pub. No. 20030162271) was obtained using a similar course of gene introduction and strain adaptation as was ZW658, the transgene activities of the pentose phosphate pathway and the sequence of the PgapxylAB operon were also compared in partially and more fully adapted strains of this independent strain production. Enzyme activities for products of the PgapxylAB operon in a partially adapted strain 8XL4 and the final adapted strain 8b were measured using the techniques described in General Methods and the results expressed as μmoles product/mg protein/minute are shown in Table 2.
Enzyme activities in different xylose-utilizing
adapted Z. mobilis strains
Xyulose kinase
0.027 +/− 0.004
1.10 +/− 0.41
0.142 +/− 0.057
5.76 +/− 0.43
As with the adaptation that occurred when the strains preceding ZW658 picked up mutations that allowed enhanced growth on xylose, strain 8b had increased activity for products of both genes in the xylAB operon over its predecessor strain 8XL4. Once again the increase in measured enzyme activity was about five fold increased over the less adapted strain.
The Pgap directing expression of the xylAB operon was sequenced in the 8b and 8XL4 strains. A PCR fragment was prepared using a forward PCR primer (GAP-F8; SEQ ID NO:44) from the 5′ end of the promoter and a reverse primer from the xylA coding region (XylAB851R; SEQ ID NO:5). The resulting PCR product was sequenced using primers GAP-F8, XylAB449R, and XylAB851R (SEQ ID NOs:44, 46, and 45). The promoter sequence from ZW8XL4 is given in SEQ ID NO:3 and that from 8b in SEQ ID NO:5. These promoter sequences also both had the one difference with the published sequence of the Pgap of strain CP4 as in the Pgap of the xylAB operon in ZW641 and ZW658. In addition to these common changes there was also a single base pair difference between the ZW641 and ZW658 Pgap sequences. While the G to T change at -189 to the start ATG was not present in the comparison of 8XL4 and 8b, a C to T change did occur at position -89 with respect to the start ATG.
As with the promoter sequence of the PgapxylAB operon in strain ZW658, the promoter sequence of the PgapxylAB operon in strain 8b changed during adaptation to a new sequence which allowed production of more of the protein from the coding regions under its control than did the sequence of the same promoter from the partially adapted strain.
Patent CitationsCited PatentFiling datePublication dateApplicantTitleUS5231020Mar 29, 1990Jul 27, 1993Dna Plant Technology CorporationGenetic engineering of novel plant phenotypesUS5514583Apr 15, 1994May 7, 1996Midwest Research InstituteRecombinant zymomonas for pentose fermentationUS5712133Apr 14, 1995Jan 27, 1998Midwest Research InstitutePentose fermentation by recombinant zymomonasUS6566107Nov 1, 2000May 20, 2003Midwest Research InstituteRecombinant Zymomonas mobilis with improved xylose utilizationUS7223575Apr 27, 2002May 29, 2007Midwest Research InstituteZymomonas pentose-sugar fermenting strains and uses thereofUS20030162271Apr 27, 2002Aug 28, 2003Min ZhangZymomonas pentose-sugar fermenting strains and uses thereofUS20070092957Oct 25, 2006Apr 26, 2007Donaldson Gail KFermentive production of four carbon alcoholsUS20080187973Sep 27, 2007Aug 7, 2008Viitanen Paul VEthanol production using xylitol synthesis mutant of xylose-utilizing zymomonasUS20080286870Sep 27, 2007Nov 20, 2008Viitanen Paul VXylitol synthesis mutant of xylose-utilizing zymomonas for ethanol productionWO1995028476A1Apr 17, 1995Oct 26, 1995Midwest Research InstRecombinant zymomonas for pentose fermentationNon-Patent CitationsReference1Cahoon et al., Metabolic Redesign of Vitamin E Biosynthesis in Plants for Tocotrienol Production and Increased Antioxidant Content, Nature Biotechnology, 2003, vol. 21:1082-1087.2Conway et al., Glyceraldehyde-3-Phosphate Dehydrogenase Gene From Zymomonas mobilis: Cloning, Sequencing, and Identification of Promoter Region, J. Bacteriol., 1987, vol. 169:5653-5662.3Feldmann et al., Pentose Metabolism in Zymomonas mobilis Wild-Type and Recombinant Strains, Appl. Microbiol. Biotechnol., 1992, vol. 38:354-361.4 *Kobayashi et al. Nucleic Acids Research. 1990; 18:7367-7372.5National Center for Biotechnology Information General Identifier No. 43692, Oct. 23, 2008, M. E. Fling et al., Nucleotide Sequence of the Transposen TN7 Gene Encoding an Aminoglycoside-Modifying Enzyme, Accession No. X03043.1.6National Center for Biotechnology Information General Identifier No. 56542470, Jul. 25, 2005, J. S. Seo, et al., Zymomonas mobilis Subsp. Mobilis ZM4, Complete Genome, Accession No. AE008692.7Scott et al., Sequences of Versatile Broad-Host-Range Vectors of the RK2 Family, Plasmid, 2003, vol. 50:74-79.8U.S. Appl. No. 11/862,566, filed Sep. 27, 2007, Applicant: Paul V. Vitanen.9White et al., An Efficient System for Marketless Gene Replacement Applicable in a Wide Variety of Enterobacterial Species, Can. J. Microbiol., 2007, vol. 53:56-62.10Yanase et al., Genetic Engineering of Zymobacter palmae for Production of Ethanol From Xylose, Appl. Environ. Microbiol., 2007, vol. 73:2592-2599.11Yuan et al., Chromosomal Promoter Replacement of the Isoprenoid Pathway for Enhancing Carotenoid Production in E. coli, Metab. Eng., 2006, vol. 8:79-90.12Zhang et al., Metabolic Engineering of a Pentose Metabolism Pathway in Ethanologenic Zymomonas mobilis, Science, 1995, vol. 267:240-243.* Cited by examinerReferenced byCiting PatentFiling datePublication dateApplicantTitleUS8623623Jun 16, 2011Jan 7, 2014E I Du Pont De Nemours And CompanyXylose utilization in recombinant ZymomonasUS8679822Jun 16, 2011Mar 25, 2014E I Du Pont De Nemours And CompanyXylose utilization in recombinant zymomonasUS8697426Jun 15, 2012Apr 15, 2014E I Du Pont De Nemours And CompanyContaminant control in Zymomonas fermentation using virginiamycinUS8722373Dec 10, 2013May 13, 2014E I Du Pont De Nemours And CompanyContaminant control in Zymomonas fermentation using virginiamycinUS8759069Jun 15, 2012Jun 24, 2014E I Du Pont De Nemours And CompanyContaminant control in Zymomonas fermentation using hop acidsUS8846357Dec 20, 2012Sep 30, 2014E I Du Pont De Nemours And CompanyStabilized chlorine dioxide for contamination control in Zymomonas fermentationUS9139818Sep 26, 2013Sep 22, 2015E I Du Pont De Nemours And CompanyHigh expression Zymomonas promotersWO2013096366A1Dec 19, 2012Jun 27, 2013E. I. Du Pont De Nemours And CompanyGene inactivation allowing immediate growth on xylose medium by engineered zymomonasWO2013106172A1Dec 19, 2012Jul 18, 2013E. I. Du Pont De Nemours And CompanyPnp gene modification for improved xylose utilization in zymomonasWO2014099509A1Dec 11, 2013Jun 26, 2014E. I. Du Pont De Nemours And CompanyStabilized chlorine dioxide for contamination control in zymomonas fermentationWO2014164581A1Mar 11, 2014Oct 9, 2014E. I. Du Pont De Nemours And CompanyGradient pretreatment of lignocellulosic biomassWO2015048208A1Sep 25, 2014Apr 2, 2015E. I. Du Pont De Nemours And CompanyProduction of ethanol and recycle water in a cellulosic fermentation processWO2015048213A1Sep 25, 2014Apr 2, 2015E. I. Du Pont De Nemours And CompanyProduction of ethanol with reduced contaminants in a cellulosic biomass based process with rectification column and molecular sievesWO2015048243A1Sep 25, 2014Apr 2, 2015E. I. Du Pont De Nemours And CompanyHigh expression zymomonas promotersWO2015200429A1Jun 24, 2015Dec 30, 2015E. I. Du Pont De Nemours And CompanyEnhancing d-xylose and l-arabinose utilization in zymomonas cellsClassifications U.S. Classification435/471, 536/23.1, 536/23.4, 536/23.7, 435/320.1, 435/476, 435/252.3, 536/24.1International ClassificationC12N15/74, C07H21/02, C12N1/20, C12N15/00, C07H21/04Cooperative ClassificationC12N15/74European ClassificationC12N15/74Legal EventsDateCodeEventDescriptionJul 9, 2009ASAssignmentOwner name: ALLIANCE FOR SUSTAINABLE ENERGY LLC, COLORADOFree format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ZHANG, MIN;CHOU, YAT-CHEN;FRANDEN, MARY ANN;REEL/FRAME:022932/0185Effective date: 20090514Owner name: E. I. DU PONT DE NEMOURS AND COMPANY, DELAWAREFree format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:VIITANEN, PAUL V.;TAO, LUAN;ZHANG, YUYING;AND OTHERS;REEL/FRAME:022932/0171;SIGNING DATES FROM 20090422 TO 20090608Owner name: E. I. DU PONT DE NEMOURS AND COMPANY, DELAWAREFree format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:VIITANEN, PAUL V.;TAO, LUAN;ZHANG, YUYING;AND OTHERS;SIGNING DATES FROM 20090422 TO 20090608;REEL/FRAME:022932/0171Jan 14, 2015FPAYFee paymentYear of fee payment: 4RotateOriginal ImageGoogle Home - Sitemap - USPTO Bulk Downloads - Privacy Policy - Terms of Service - About Google Patents - Send FeedbackData provided by IFI CLAIMS Patent Services | [
{
"key": "website_description",
"type": "global",
"value": "This website is a search engine provided by Google. Handling over 3.5 billion searches per day, it has a 92% share of the global search engine market."
}
] |
Sorry, no products matched "" Check your spelling Use different keywords and try again Contact your local store Compute- app-5482506-2-59046594, DC- prod-dfw2, ENV- prod-a, Ver- 44.0.0, SHA- 4ccde6630b54173e13bf9646401e57ff2c4cccd4, Log- 3b10bfdc-6f1a-15626dfc140000 Site Information Be the first to save! Email Address Sign up Privacy Policy Stay connected Mobile apps Help Feedback MoneyCenter Privacy & Security CA Privacy Rights Terms of Use Financial services Walmart MoneyCenter Walmart Credit Card Apply Now Manage Card Account Product Care Plans Walmart Pay Get to know us About Walmart.com Corporate Suppliers Marketplace Careers @WalmartLabs Walmart.com Terms of Use About Our Ads Affiliate Program CA Privacy Rights Privacy & Security Customer service Returns Policy Product Recalls Int’l Customers Tax Exempt Program Contact Us Feedback Store Pickup In the spotlight Expand Baby Cribs Strollers Diapers Baby Feeding Car Seats Expand Electronics Cut the Cable Computers TVs iPads & Tablets Expand Fitness Exercise Machines Vitamins Ellipticals Treadmills Fitbit Expand Keep Cool Air Conditioners Fans Swimming Pools Pool Toys Expand International Sites Argentina Brazil Canada Chile China Japan Mexico United Kingdom © Walmart Stores, Inc. To ensure we’re able to help you as best we can, please include your reference number: Ref: | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational retail corporation that operates a chain of hypermarkets , discount department stores, and grocery stores from the United States, headquartered in Bentonville, Arkansas."
}
] |
Patent US4453226 - Method and apparatus for particle size determination in a host material - Google PatentsSearch Images Maps Play YouTube News Gmail Drive More »Sign inPatentsA method and apparatus for determining the size distribution of certain particles, of a particular composition, such as iron sulfide (pyrites), in a sample of host material, such as coal. Data representative of the amount of at least one predetermined elemental constituent of the particles is obtained...http://www.google.com/patents/US4453226?utm_source=gb-gplus-sharePatent US4453226 - Method and apparatus for particle size determination in a host materialAdvanced Patent SearchPublication numberUS4453226 APublication typeGrantApplication numberUS 06/283,599Publication dateJun 5, 1984Filing dateJul 15, 1981Priority dateJul 15, 1981Fee statusLapsedPublication number06283599, 283599, US 4453226 A, US 4453226A, US-A-4453226, US4453226 A, US4453226AInventorsRobert H. Hobbs, Peter R. SolomonOriginal AssigneeUnited Technologies CorporationExport CitationBiBTeX, EndNote, RefManPatent Citations (5), Non-Patent Citations (2), Referenced by (27), Classifications (9), Legal Events (6) External Links: USPTO, USPTO Assignment, EspacenetMethod and apparatus for particle size determination in a host material
US 4453226 AAbstract
1. Apparatus for determining the size distribution of particles of a particular composition in a sample of host material comprising:means for stimulating the emission of X-ray radiation from the elemental constituents of numerous subsamples of said host material sample, said subsamples of said host material each being of substantially the same size and substantially all including at least two of said particles, each said elemental constituent emitting X-rays having a respective characteristic energy level, the magnitude of said emitted X-rays being indicative of the amount of said elemental constituent; means for sensing said X-rays having energy levels characteristic of at least a respective one of the elemental constituents of said particles of said particular composition for each said subsample and for providing elemental constituent amount signals indicative of the amount of a respective elemental constituent for each said subsample; and signal processing means responsive to said elemental constituent amount signals for sorting each said elemental constitutent amount signal as a function of the elemental constituent amount it represents and entering a unit count data signal in a respective one of a plurality of data bins each representing a respective elemental constituent amount value range, for summing in each said bin the unit count data signals accumulated in the respective said bin to provide respective sum signals and for fitting a preselected multi-parameter distribution function to the collective sum signals thereby to yield a plurality of parameters which jointly describe the underlying size distribution of said particles in said sample. 2. The apparatus of claim 1 wherein the host material is coal and said particles are iron sulfide (pyrites).
3. A method for determining the size distribution of certain particles of a particular composition in a sample of host material utilizing data signals representative of the amount of a predetermined at least one elemental constituent of said certain particles for each of numerous subsamples of said sample, said subsamples each being of substantially the same size, comprising the steps of:preselecting the size of said subsamples such that each of substantially all of said subsamples includes at least two said particles; sorting said constituent amount data signals into a plurality of data bins each representative of a respective constituent amount value range in a series of successive constituent amount value ranges; providing respective signals representative of the sum of said constituent amount data signals accumulated in each said data bin, said signals representative of the sum of data signals in each said data bin collectively providing a histogram; and fitting a preselected multi-parameter distribution function to the collective sum signals forming said histogram, the underlying size distribution of said certain particles in said sample being represented by the resulting values for at least two of the parameters of said function upon achieving a best fit within selected limits. 4. The method of claim 3 wherein said host material is coal.
The penetration depth, d, of electron beam 12 and the absorption length of the emerging X-rays, a, are such that for relatively small particles (2r≦d) the X-ray intensity is proportional to the volume of the particle, while for relatively large particles (2r>>d), the intensity is proportional to the cross-sectional area of the particle. Thus, for a distribution of pyrite particle sizes g(r) it is possible to relate the signal, s, for an element of an individual particle to its radius, r, the depth D of the particle in the coal matrix, the efficiency of the detection process, w, by the following approximate relations, jointly designated Equation 1: ##EQU1## This relation assumes that the density of pyrite particles in a subsample is sufficiently low that the possible shadowing of one particle by another may be ignored. From these relations it is possible to consider a distribution, f(s), of signals from individual particles. In view of the relationship expressed in Equation 1, and because typical beam penetration depth, d, of 1-2 microns are in the same general range as typical pyrite particle sizes, although some particles may be much larger and some much smaller, further reference to the intensity of an X-ray signal, s or S, herein is intended to signify detection of an "amount" of the responding elemental constituent. Thus, the "amount" of the constituent refers to its cross-sectional area and/or to its volume as determined by the relationships of Equation 1.
Patent CitationsCited PatentFiling datePublication dateApplicantTitleUS3919050 *May 28, 1974Nov 11, 1975Lahey Clinic Foundation IncMicroparticle analysisUS3982183 *Feb 20, 1975Sep 21, 1976Coulter Electronics, Inc.Particle sizing apparatusUS4037101 *Nov 19, 1975Jul 19, 1977Agency Of Industrial Science & TechnologyMethod and apparatus for analyzing fine grained substancesUS4090074 *Oct 15, 1976May 16, 1978Australian Atomic Energy CommissionAnalysis of coalUS4318180 *Jun 11, 1979Mar 2, 1982Svenska TraforskningsinstitutetMethod and apparatus for indicating the size distribution of particles in a flowing medium* Cited by examinerNon-Patent CitationsReference1"New Method for Sulphur Concentration Measurements in Coal and Char" by Solomon et al., Published in Fuel, vol. 56, Oct. 1977, pp. 393-396.2 *New Method for Sulphur Concentration Measurements in Coal and Char by Solomon et al., Published in Fuel, vol. 56, Oct. 1977, pp. 393 396.* Cited by examinerReferenced byCiting PatentFiling datePublication dateApplicantTitleUS4652755 *Jan 10, 1985Mar 24, 1987Advanced Fuel Research, Inc.Method and apparatus for analyzing particle-containing gaseous suspensionsUS4732157 *Aug 18, 1986Mar 22, 1988Massachusetts Institute Of TechnologyMethod and apparatus for quantifying beat-to-beat variability in physiologic waveformsUS4817446 *Feb 13, 1987Apr 4, 1989Toa Medical Electronics Co. Ltd.Particle size distribution analysisUS4933884 *Feb 1, 1988Jun 12, 1990Contraves AgMethod of and apparatus for determining threshold values for the analysis of particles contained in a liquidUS5022062 *Sep 13, 1989Jun 4, 1991American Science And Engineering, Inc.Automatic threat detection based on illumination by penetrating radiant energy using histogram processingUS5604431 *Sep 29, 1995Feb 18, 1997The United States Of America As Represented By The Secretary Of The Air ForceIntegrated grid particle impact detectorUS5734740 *Oct 31, 1994Mar 31, 1998University Of FloridaMethod for automated radiographic quality assuranceUS6931335 *Nov 8, 2002Aug 16, 2005Agilent Technologies, Inc.Jitter histogram approximationUS7639777Dec 29, 2009United Technologies Corp.Computed tomography systems and related methods involving forward collimationUS7876875Jan 25, 2011United Technologies Corp.Computed tomography systems and related methods involving multi-target inspectionUS7888647Apr 30, 2008Feb 15, 2011United Technologies Corp.X-ray detector assemblies and related computed tomography systemsUS8238521Aug 7, 2012United Technologies Corp.X-ray collimators, and related systems and methods involving such collimatorsUS8467590Jun 18, 2013Institute For Medical InformaticsMicroscopy analysis techniqueUS8901494 *Sep 25, 2013Dec 2, 2014Jeol Ltd.Sample analyzerUS20030007600 *Mar 26, 2001Jan 9, 2003J.E. BatemanProportional gas countersUS20030191592 *Nov 8, 2002Oct 9, 2003Marcus MuellerJitter histogram approximationUS20050161612 *Dec 22, 2004Jul 28, 2005Council For The Research Laboratory Of The Research ConcilsProportional gas countersUS20090213984 *Feb 26, 2008Aug 27, 2009United Technologies Corp.Computed Tomography Systems and Related Methods Involving Post-Target CollimationUS20090213994 *Feb 26, 2008Aug 27, 2009United Technologies Corp.Computed Tomography Systems and Related Methods Involving Forward CollimationUS20090225954 *Mar 6, 2008Sep 10, 2009United Technologies Corp.X-Ray Collimators, and Related Systems and Methods Involving Such CollimatorsUS20090257552 *Apr 9, 2008Oct 15, 2009United Technologies Corp.Computed Tomography Systems and Related Methods Involving Multi-Target InspectionUS20090272908 *Apr 30, 2008Nov 5, 2009United Technologies Corp.X-Ray Detector Assemblies and Related Computed Tomography SystemsUS20090274264 *Apr 30, 2008Nov 5, 2009United Technologies Corp.Computed Tomography Systems and Related Methods Involving Localized BiasUS20100202591 *Mar 22, 2010Aug 12, 2010United Technologies CorporationX-ray collimators, and related systems and methods involving such collimatorsUS20140091216 *Sep 25, 2013Apr 3, 2014Jeol Ltd.Sample AnalyzerCN100486518CJun 1, 2007May 13, 2009南开大学Method for improving optical coherent tomographic imaging qualityCN101706406BNov 3, 2009Jun 8, 2011武汉钢铁(集团)公司Method for determining optimal particle size of finely ground gas coal participating in coking and coal blending* Cited by examinerClassifications U.S. Classification702/29, 324/71.4, 377/11International ClassificationG01N15/02, G01N33/22Cooperative ClassificationG01N15/02, G01N33/222European ClassificationG01N33/22B, G01N15/02Legal EventsDateCodeEventDescriptionJul 15, 1981ASAssignmentOwner name: UNITED TECHNOLOGIES CORPORATION, HARTFORD, CT. AFree format text: ASSIGNMENT OF ASSIGNORS INTEREST.;ASSIGNORS:HOBBS, ROBERT H.;SOLOMON, PETER R.;REEL/FRAME:003906/0525Effective date: 19810714Nov 16, 1987FPAYFee paymentYear of fee payment: 4Oct 31, 1991FPAYFee paymentYear of fee payment: 8Jan 9, 1996REMIMaintenance fee reminder mailedJun 2, 1996LAPSLapse for failure to pay maintenance feesAug 13, 1996FPExpired due to failure to pay maintenance feeEffective date: 19960605RotateOriginal ImageGoogle Home - Sitemap - USPTO Bulk Downloads - Privacy Policy - Terms of Service - About Google Patents - Send FeedbackData provided by IFI CLAIMS Patent Services | [
{
"key": "website_description",
"type": "global",
"value": "This website is a search engine provided by Google. Handling over 3.5 billion searches per day, it has a 92% share of the global search engine market."
}
] |
Translations English (14) French (2) German (2) Basque (1) Belarusian (1) Brazilian Portuguese (1) Catalan (1) Chinese (1) Chinese (1) Czech (1) Danish (1) Finnish (1) Galician (1) Hungarian (1) Italian (1) License OSI-Approved Open Source (16) GNU General Public License version 2.0 (8) GNU Library or Lesser General Public License version 2.0 (3) BSD License (2) MIT License (2) Artistic License (1) Open Software License 3.0 (1) Other License (1) Programming Language C++ (6) C (4) PHP (4) Java (2) Python (2) ASP (1) Delphi/Kylix (1) Free Pascal (1) JavaScript (1) Lazarus (1) Object Pascal (1) Pascal (1) Visual Basic (1) Status 5 - Production/Stable (10) 4 - Beta (5) 2 - Pre-Alpha (4) 3 - Alpha (2) 6 - Mature (2) 1 - Planning (1) 7 - Inactive (1) OS Linux (17) Modern (17) Linux (15) Win2K (12) OS X (11) Solaris (5) Windows 7 (5) Vista (3) FreeBSD (2) NetBSD (2) OpenBSD (2) Other Operating Systems (17) AmigaOS (3) IBM OS/2 (3) Apple Mac OS Classic (2) Other (2) BSD/OS (1) Console-based Platforms (1) MorphOS (1) SGI IRIX (1) Windows (17) Grouping and Descriptive Categories (16) All POSIX (16) 32-bit MS Windows (13) All 32-bit MS Windows (13) All BSD Platforms (6) OS Independent (4) 64-bit MS Windows (3) OS Portable (3) 32-bit MS Windows (2) BSD (14) Mac (13) Freshness Recently updated (4) Development Software | [
{
"key": "website_description",
"type": "global",
"value": "This website is a web service that offers software consumers a centralized online location to control and manage open-source software projects and research business software. It provides source code repository hosting, bug tracking, mirroring of downloads for load balancing, a wiki for documentation, developer and user mailing lists, user-support forums, user-written reviews and ratings, a news bulletin, micro-blog for publishing project updates, and other features."
}
] |
Top 10 Broumov Hotels Near Broumov Cemetery | Czech Republic | Hotels.comEnglish (United States)Book online or call 800-246-8357This call is free. 24 hours a day; 7 days a week.HotelsHotel DealsPackages & FlightsGroupsGift CardsHelpWebsite feedbackSign in & AccountSign inCreate an accountYour bookingsReview a hotelHotels.com® RewardsYour bookingsHotelsHotels in Czech RepublicBroumov HotelsHotels near Broumov Cemetery, BroumovHotels near Broumov CemeterySearch hotels near Broumov Cemetery in BroumovCity, landmark, hotel name, address or zip codeCheck inCheck out I don’t know my datesRooms123456789+Room 1:Adults12345678Aged 18+Children01230-17Age at check in:Child 1:-?-<11234567891011121314151617Show dealsGet Secret Prices on select hotelsThese prices aren’t available to everyone.Unlock nowTrending now in BroumovHotels within 5 miles of Broumov CemeteryMost bookedPenzion ZámecekNo Guest Reviews yet3 reviewsHotels.com® RewardsFor every 10 nights, get 1 free! 7 people looked at this hotel in the last hourHotels within 11 miles of Broumov CemeteryVilla Carmen & SPAExcellent 4.3 / 5( 3 genuine reviews )58 reviewsHotels.com® RewardsFor every 10 nights, get 1 free! 14 people looked at this hotel in the last hourHotel Kudowa Manufaktura RelaksuExcellent 4.5 / 5( 2 genuine reviews )66 reviewsHotels.com® RewardsFor every 10 nights, get 1 free! 11 people looked at this hotel in the last hourHotels within 12 miles of Broumov CemeteryPalac Jugowice LUXURY HOTELExcellent 4.3 / 5( 10 genuine reviews )76 reviewsHotels.com® RewardsFor every 10 nights, get 1 free! 14 people looked at this hotel in the last hourMost recent review"Rooms are well designed and very clean, paid attention to details for comfort stay. Hotel staff is very friendly and helpful. Also the restaurant serves excellent food - not many choices but perhaps this is good for keeping the high standard. Access to the hotel may not be so convenient, instead ..."A Traveller, Dec 2016, GBPenzion BorOutstanding 5.0 / 5( 3 genuine reviews )5 reviewsHotels.com® RewardsFor every 10 nights, get 1 free! 8 people looked at this hotel in the last hourMost recent review"We had a wonderful stay at Family Sedlacek's place. Beautiful place, wonderful family in a nice tucked away location near the Czech/Poland border. Plenty of space, great beds and a wonderful local breakfast the next morning. Thank you also for the dinner recommendation at Bonato, fabulous dinner..."A Traveller, Jan 2017, USHotels within 13 miles of Broumov CemeteryDĘBOWY HOTEL|EVENT|SPAOutstanding 5.0 / 5( 1 genuine review )44 reviewsHotels.com® RewardsFor every 10 nights, get 1 free! 12 people looked at this hotel in the last hourHotel ImpresjaExcellent 4.6 / 5( 9 genuine reviews )57 reviewsHotels.com® RewardsFor every 10 nights, get 1 free! 8 people looked at this hotel in the last hourMost recent review"Rooms are comfortable, beds are soft, breakfast is great and the price was very low relative to what you get. Recommended."A Traveller, May 2016, ILTommy - Congress & Relax CenterExcellent 4.0 / 5( 6 genuine reviews )44 reviewsHotels.com® RewardsFor every 10 nights, get 1 free! 7 people looked at this hotel in the last hourGosciniec Nowa WioskaFair 2.3 / 5( 3 genuine reviews )9 reviewsHotels.com® RewardsFor every 10 nights, get 1 free! 7 people looked at this hotel in the last hourHotels within 14 miles of Broumov Cemeteryibis Styles WalbrzychExcellent 4.6 / 5( 64 genuine reviews )229 reviewsHotels.com® RewardsFor every 10 nights, get 1 free! 17 people looked at this hotel in the last hourMost recent review"One stay only but very smooth booking, check in & ckeck out, nice dinner & breakfast and clean room."A Traveller, Dec 2016, INSee more hotels near Broumov Cemetery, BroumovRecently bookedHotel Davídek4 starsfrom $65Pay now or later on most roomsFree cancellation on most roomsPrice GuaranteeMap of hotels near Broumov CemeteryLandmarksBenedictine Monastery of St. VojtechBenedictine Abbey of St. WenceslasHotels in Broumov near Broumov CemeteryBroumov Cemetery in the Broumov area, Czech Republic
Are you looking for a cheap Broumov Cemetery hotel, a 5 star Broumov Cemetery hotel or a family friendly Broumov Cemetery hotel? You just landed in the best site to find the best deals and offers on the most amazing accommodations for your stay.
When you search for hotels near Broumov Cemetery with Hotels.com, you need to first check our online map and see the distance you will be from Broumov Cemetery, Czech Republic.
Our maps are based on hotel search and display areas and neighborhoods of each hotel so you can see how close you are from Broumov Cemetery and refine your search within Broumov or Czech Republic based on closest public transportation, restaurants and entertainment so you can easily get around the city. All the hotels details page show an option for free or paid onsite parking.
If you wish to see the hotels with the highest featuring discounts and deals near Broumov Cemetery, simply filter by price/ average nightly rate. We recommend you filter by star rating and read our genuine guest reviews so you can get the best quality hotel with the best discount.
One of the new features on Hotels.com guest reviews is that also show reviews from Expedia for Broumov Cemetery hotels and the TripAdvisor Broumov Cemetery hotels reviews so you can make sure that you checking with a reliable source. See the review scores on our Broumov hotel information pages.
Make the most out of your family vacation when you book your accommodation with Hotels.com – book your hotel near Broumov Cemetery, Broumov after reviewing the facilities and amenities listed for each hotel.
After booking your hotel near Broumov Cemetery, expect to receive your reservation confirmation in the mail in less than 10 minutes. The confirmation email contains more information on all nearby attractions, local directions and weather forecast, so you can better plan the days during your trip.
After getting the best hotel rates you can still save more by winning 1 free night! That’s right, book 10 nights in any hotel near Broumov Cemetery, Broumov and after you sign up for the Welcome Rewards program, you are eligible hotel you receive 1 night free* The best hotel deals are here: We have Broumov Cemetery hotel deals, Broumov Cemetery last minute deals and offers to get you the cheapest Broumov Cemetery hotel with our lowest price guarantee.See more hotels near Broumov Cemetery, BroumovChoose one of the following to unlock Secret Prices and pay less on select hotels.EmailSign up for our latest offersHotels.com appDownload the app and book on the goHotels.com® RewardsJoin now! Collect 10 nights, get 1 free*Top DestinationsHotels in New York, New YorkHotels in Las Vegas, NevadaHotels in Chicago, IllinoisHotels in San Francisco, CaliforniaHotels in Washington, District of ColumbiaHotels in Boston, MassachusettsHotels in San Diego, CaliforniaHotels in Orlando, FloridaHotels in London, United KingdomHotels in New Orleans, LouisianaHotels in Los Angeles, CaliforniaHotels in San Antonio, TexasHotels in Paris, FranceHotels in Seattle, WashingtonHotels in Atlanta, GeorgiaHotels in Philadelphia, PennsylvaniaHotels in Austin, TexasHotels in Atlantic City, New JerseyHotels in Rome, ItalyHotels in Myrtle Beach, South CarolinaHotels in Dallas, TexasHotels in Houston, TexasHotels in Denver, ColoradoHotels in Miami, FloridaSupport & FAQsYour bookingsFAQsContact usWebsite feedbackReview a hotelFor Suppliers, Affiliates and the MediaAdd HotelAffiliate with usPrivate LabelPromote with UsTravel AgentsPress OfficeUser Terms and Privacy PolicyTerms & ConditionsPrivacy PolicyCookie PolicyAbout our adsAbout UsJobsTravel GuidesTop 50 CitiesAll countriesAll hotelsSite index© 2017 Hotels.com, L.P. All rights reserved.Hotels.com and the Hotels.com logo are trademarks or registered trademarks of Hotels.com, LP in the U.S. and/or other countries. All other trademarks are property of their respective owners.* Learn more about Hotels.com® RewardsABOUT SSL CERTIFICATES | [
{
"key": "website_description",
"type": "global",
"value": "This website is a website for booking hotel rooms online and by telephone. The company has 85 websites in 34 languages, and lists over 325,000 hotels in approximately 19,000 locations."
}
] |
0340769416
The Millionaires, Large type / large print.
0446529958
0340769394
The Millionaires, Export ed.
0340769408
Brad Meltzer, Tony Goldwyn (Read by)
1586212060
1594835764
The Millionaires, Abridged.
1586212052
1602527687
The Millionaires, Large Print edition. Large type / large print.
0708994512
ANOTHER HIT BY MELTZER Mar 31, 2011
Charlie is my hero!! May 6, 2008
See all reviews of The Millionaires by Brad Meltzer | [
{
"key": "website_description",
"type": "global",
"value": "This website is is an online store that sells new books, used books, out-of-print books, rare books, and other media through an online network of independent booksellers."
}
] |
'We were paid less than $1 per hour': Former W Magazine and The New Yorker interns sue Conde Nast over wages | Daily Mail Online
18:20 EST, 17 June 2013
Two former interns are suing Conde Nast for failing to pay them minimum wage during their summer internships.According to the New York Times, Lauren Ballinger, who interned for W Magazine in 2009, and Matthew Leib, who was an intern for The New Yorker in 2009 and 2010, claim that they were paid less than $1 an hour for their services.In a class-action lawsuit filed on Thursday, both assert that Conde Nast, who owns both magazines, violated labor laws by failing to pay them appropriately. Legal action: Lauren Ballinger (left) and Matthew Leib (right) are suing Conde Nast for paying them less than $1 for their summer internships at W Magazine and The New Yorker
They are seeking to recover the wages they say they were entitled to.During the summer of 2009, Ms Ballinger interned in both the accessories and fine jewelry departments at W Magazine.Even though she often worked from eight or nine in the morning until eight or ten at night, the New School graduate, who grew up in San Francisco, was paid just $12 a day.
She explained that one of the editors even commented on the poor working conditions for interns there, comparing it to Anne Hathaway's job in The Devil Wears Prada.Her time at W Magazine was even worse, however, since 'we don't get any makeover at the end,' she said.For Matthew Leib, the hours were not as bad but the problem was just the same.Mr Leib was a cartoon intern for The New Yorker in 2009 and an editorial intern in 2010, working three days a week from 10:30 in the morning until 5:30 in the evening.For his work, which included reviewing submissions for publication, maintaining the online cartoon database and doing research, he was paid between $300 and $500 per summer. Treated unfairly: Ms Ballinger said her internship at W Magazine was like Anne Hathaway's job in The Devil Wears Prada, only worse 'because we don't get a makeover in the end'
The pair's lawsuit,
which was filed by Outten and Golden lawyer Juno Turner in Federal District Court in Manhattan, is one of several that have recently sought
justice for unpaid interns.
Tuesday, a judge ruled in favor of two interns who were not paid for their work on the Black Swan film, a result Ms Turner hopes her case will get, too.
According to United States Labor Department guidelines, unpaid internships are only lawful if they are part of an educational training program, and if they do not benefit the employed directly.The judge in the case of the Black Swan interns ruled that Fox Searchlight classified them 'improperly' as interns, when they were in fact 'employees' under New York labor law and the federal Fair Labor Standards Act. Read more: | [
{
"key": "website_description",
"type": "global",
"value": "This website is the website of the Daily Mail, a newspaper in the United Kingdom, and of its sister paper The Mail on Sunday. MailOnline is a division of dmg media, which is owned by Daily Mail and General Trust plc."
}
] |
Pewter Equestrian Ornaments Set of 3 | eBay
Ships to: United States and many other countries | See details Pewter Equestrian Ornaments Set of 3 NIB See original listing
05:06:23 PST
Set of Two ~ Mario & Princess Peach ~... $19.99
Department 56 Snowpinions Set of... $21.00
Set of 3 Christmas Ornaments Glass... $13.99
PINECONE ORNAMENTS*Hand... $14.99
HAWAIIAN CHRISTMAS GIFT 2" ORNAMENTS... $12.99
SKS Artina Pewter Plate (Meran Series... $99.95
SKS Pewter Horn "Meran Series 1836"... $149.00
SKS PEWTER JAR WITH LID "MERAN SERIES... $149.00
SKS PEWTER DECORATED BOWL... $275.00
SKS PEWTER BOWL WITH HANDLES "HU... $275.00
eBay item number:250953279735
Feb 15, 2012 09:51:05 PST View all revisions
... Read moreabout the condition germanglassandgifts
Beer SteinsChristmas OrnamentsNutcrackersBookendsWine GlassesVasesDecanter SetsCorporate ExecutiveHousewaresFigurinesPewter PlatesAngelsColored CrystalPewter OrnamentsBeer BootsChristmas SantasHousehold ItemCrystalTea SetsFine GlasswareCeramics & PotteryCollectiblesFlower Pots, VasesDecorative PlatesWood CarvingsPewter GiftwareClocksOther
Pewter Ornaments Equestrian Hand Made Set of Three Horseshoe with Rider
Horseshoe with Horsehead NIB
Germany Powered by eBay Turbo Lister The free listing tool. List your items fast and easy and manage your active items. Questions and answers about this item
Equestrian Ornament,
Pewter Ornament,
Seagull Pewter Ornament,
German Pewter Ornament,
Harley Pewter Ornament | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational e-commerce corporation based in San Jose, California, that facilitates consumer-to-consumer and business-to-consumer sales through its website."
}
] |
Words containing deweserpo | Words that contain deweserpo
https://www.thefreedictionary.com/words-containing-deweserpo
Dictionary, Encyclopedia and Thesaurus - The Free Dictionary 10,895,709,083 visitors served
Found 1 words containing deweserpo. Browse our Scrabble Word Finder, Words With Friends cheat dictionary, and WordHub word solver to find words that contain deweserpo. Or use our Unscramble word solver to find your best possible play!
13 letter words containing deweserpoSee also
13 letter words containing deweserpo | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American online dictionary and encyclopedia that aggregates information from various sources."
}
] |
Changes related to "Category:Demolished sports venues in Pennsylvania" - Wikipedia
Changes related to "Category:Demolished sports venues in Pennsylvania"
← Category:Demolished sports venues in Pennsylvania
Show new changes starting from 04:46, 23 August 2017
Retrieved from "https://en.wikipedia.org/wiki/Special:RecentChangesLinked/Category:Demolished_sports_venues_in_Pennsylvania" | [
{
"key": "website_description",
"type": "global",
"value": "This website is the English-language edition of the free online encyclopedia Wikipedia. It was founded on 15 January 2001 as Wikipedia's first edition and, as of October 2021, has the most articles of any edition, at 6,412,521."
}
] |
Saint Clairsville, OH Monro Muffler Brake Service
6. Busted Knuckles Auto Repair and Performance Inc
8. M & R Muffler Service
3367 Belmont StBellaire, OH 43906
9. Ed & Jacks's Muffler Center
10. M & R Tyre
12. Bellaire Tire Sales & Service
13. Asap Auto Care
14. American Tire
15. Mountaineer Auto Repair
16. Schmidt Brothers Auto Service
17. American Tire Inc
18. Mattern Tire
19. Cadiz Muffler & Tire
22. Busy B Muffler
23. Ed's Radiator and Full Automotive Repair Service
800 N Court StSteubenville, OH 43952
From Business: We have been in business since 1989 servicing and repairing radiators and air conditioning and now we are proud to be expanding our service to full automotive rep…
24. Dans Auto Repair
740 Meadowbrook DrFollansbee, WV 26037
this shop is dependable works with you on the bill (cost of fixing vehical) the mechanics work around your schedual so you can drop your vehical off…
26. Johnny's Tire & Auto Service
1520 N Sunset Beach RdClaysville, PA 15323
28. White's Custom Auto
29. Busy Bee Muffler Shop
3241 Main StWeirton, WV 26062
30. C.A.R.S. - Craig's Auto Repair Service | [
{
"key": "website_description",
"type": "global",
"value": "This website is a United States-based web site operated by YP Holdings that provides listings for local businesses. In 2013 it was re-branded as YP.com or simply \"YP\"."
}
] |
China says nothing will stop its long-range air force drills | world news | Hindustan Times
China carried out long-range exercises and said such “normal” drills accord with international law and practices and are part of an “ordinary need” to raise combat abilities and strengthen the military.
world Updated: Aug 25, 2017 09:58 IST
China has displayed 84% of its new weapons including long, medium range missiles, aircraft and tanks which were indigenously developed, according to the military. (Reuters Photo)
The air force carried out further long-range exercises on Thursday, the ministry said late that same day, without giving details of where they happened. Japan said it was concerned about bombers flying close to its territory.
“No matter what obstructions are encountered, the Chinese air force will carry on as before; no matter who flies with us, the Chinese air force will fly a lot and as normal!” the ministry added, citing an air force spokesman.
Japan’s government said six Chinese bombers flying from the East China Sea on Thursday passed close to its islands on route to the Pacific Ocean.
It was the first time we have recorded Chinese military aircraft flying this route,” minister of defence Itsunori Onodera said during a regular press briefing on Friday. “We expressed our concern through diplomatic channels,” he added.
First Published: Aug 25, 2017 09:57 IST | [
{
"key": "website_description",
"type": "global",
"value": "This website is an Indian English-language daily newspaper introduced and founded in 1924 by Sunder Singh Lyallpuri, founder-father of the Akali movement and the Shiromani Akali Dal in the Punjab Province. It played integral roles in the Indian independence movement as a nationalist daily."
}
] |
Flaming Lips UK Tour Poster | eBay Please enable JavaScript Our new search experience requires JavaScript to be enabled. Please enable JavaScript on your browser, then try again.
Items found similar to "Flaming Lips UK Tour Poster"
View: Gallery view Customize... Flaming Lips UK Tour Poster: Items in search results
The Flaming Lips UK 2003 Promo Tour Poster NM Condition!
FLAMING LIPS The Palace 2004 RARE AS Aussie Tour HUGE Billboard Poster From Australia
FLAMING LIPS SPIRTUALIZED CONCERT GIG POSTER PRINT TOUR WAYNE COYNE SOLD OUT
THE FLAMING LIPS 2007 MINNEAPOLIS CONCERT TOUR POSTER
RED HOT CHILI PEPPERS & THE FLAMING LIPS 2003 SAN DIEGO CONCERT TOUR POSTER
FLAMING LIPS 2010 HONG KONG CONCERT TOUR POSTER - RARE!
FLAMING LIPS CLOUDS TASTE METALLIC TOUR POSTER GERMAN TOUR DATES POSTER (APPROX From United Kingdom
FLAMING LIPS - WEEN - BERKLEY - 2006 - JERMAINE ROGERS - WAYNE COYNE TOUR POSTER
FLAMING LIPS Mini POSTER / magazine Pin Up #1 uk RARE
FLAMING LIPS Mini POSTER / magazine Pin Up #7 uk RARE
FLAMING LIPS Mini POSTER / Ad RARE uk #4 Albums of
FLAMING LIPS Mini POSTER / Ad RARE uk #3 At war with
FLAMING LIPS Mini POSTER / magazine Pin Up #6 uk RARE
Flaming Lips/ Tame Impala 'Peace + Paranoia' tour color LP! Out Of Print+ Rare!
FLAMING LIPS - ORIGINAL UNUSED CLOTH PASS - 2003 TOUR $15.00
The Flaming Lips vintage t shirt rock grunge band tour concert 90s size M
WEEN FLAMING LIPS TOUR SCREEN PRINT SIGNED/#'D BY JERMAINE ROGERS MINT COND. $157.50
RARE VINTAGE THE FLAMING LIPS PUNK ROCK INDIE ALTERNATIVE TOUR CONCERT T-SHIRT
Flaming lips tour promo cassette VERY RARE! $11.99
SEALED RARE Flaming Lips BIG DADDY'S HOT SAUCE 3 Drops Of Death 2008 tour 5 oz.
Red Hot Chili Peppers 2003 Tour T-shirt; L; RHCP; Flaming Lips, Mike Watt, WOW!!
Flaming Lips Birds of Avalon tour 2007 KUHN GIG SILK SCREEN ART
2013 The Flaming Lips JAPAN Tour Concert Flyer / handbill / japanese / photo
The Flaming Lips 2006 Summer Tour t-shirt S small Mystic Headspace At War With
vtg Men's the core Black Flaming Lips легализовать марихуану 2008 Tour Tshirt M
CHEW LIPS A3 SIZE UK TOUR POSTER - Glasgow 2012 gig concert poster
Flaming Lips Soft Bulletin Press Kit B&W Photo Tour Dates MORE!
Flaming Lips/Tame Impala FLESH Colored Split - Peace And Paranoia Tour 2013
Flaming Lips Tame Impala Peace and Paranoia Tour 2013 Vinyl Record Store Day RSD
Ween RARE Country Tour Shirt Vintage Boognish Moistboyz Flaming Lips Cake Beck
THE ROLLING STONES UNUSED TOUR TICKET AC/DC GUESS WHO, FLAMING LIPS, SASS JORDAN
Original Poster - The Gathering Nov 11, Portishead, The National, Flaming Lips
FLAMING LIPS 2 DBL- SIDED PROMO POSTER for HIT TO DEATH IN THE FUTURE HEAD LP CD
FLAMING LIPS ORIGINAL PROMO ONLY POSTER for the LATE NIGHT TALES LP CD
The Flaming Lips Mini Poster At War Cool Promo
THE FLAMING LIPS Embryonic Promotional Lithographic Collectible Poster 14 x 28 Time left:
Flaming Lips RARE Poster Set Signed/#ed to 100 London Adam Pobiak Low Matching #
Flaming Lips Wayne Coyne Portrait 11x14 psychedelic rock Artwork print / poster
Obey Shepard Fairey Flaming Lips Beautiful F*cking Exp Print Poster
FLAMING LIPS Hear It Is ORIGINAL Pink Dust white vinyl LIMITED LP with poster!
RARE VINTAGE THE FLAMING LIPS EVIL MUSIC EVIL PEOPLE ROCK POST PUNK TOUR T-SHIRT
The Flaming Lips signed autographed concert gig poster 2011 | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational e-commerce corporation based in San Jose, California, that facilitates consumer-to-consumer and business-to-consumer sales through its website."
}
] |
Jay Z Nabs Nine Grammy Nominations With Timberlake Assist - Bloomberg
Bloomberg Anywhere Remote LoginDownload SoftwareService Center MENU Homepage Markets Stocks Currencies Commodities Rates + Bonds Economics Magazine Benchmark Watchlist Economic Calendar Tech U.S. Global Startups Cybersecurity Digital Media Bloomberg Technology TV Hello World Studio 1.0 Pursuits Cars & Bikes Style & Grooming Spend Watches & Gadgets Food & Drinks Travel Real Estate Art & Design Politics Global Risk Briefing How We’ll Know if Trump Is Making America Great Again Tracking Trump’s Web of Conflicts The Inauguration of Donald J. Trump On the March in Trump’s Capital Opinion View Gadfly Businessweek Subscribe Cover Stories Opening Remarks Etc Features 85th Anniversary Issue Behind The Cover More Science + Energy Graphics Billionaires Game Plan Small Business Personal Finance Live TV Inspire GO The David Rubenstein Show Sponsored Content Bloomberg About The Company Sign In Sign In Subscribe Jay Z Nabs Nine Grammy Nominations With Timberlake Assist
Jay Z, born Shawn Carter, has 17 Grammy awards, the music industry’s top honor. He was nominated yesterday for songwriting, solo performances and collaborations with wife Beyonce and Justin Timberlake, during a CBS telecast from Los Angeles.
The nominations, which featured live performances from Robin Thicke and tag-popping rappers Macklemore & Ryan Lewis, stoke interest ahead of the awards on Jan. 26, and lead to higher music sales, said David Bakula, a senior vice president at researcher Nielsen. Rapper LL Cool J hosted the event, which had remote performances from Katy Perry and Swift.
Jay Z, 44, was nominated for best rap album for “Magna Carta...Holy Grail,” and top rap song, for “Holy Grail.” His duets with Timberlake, who received seven nominations, and Beyonce will compete for best rap/sung collaboration.
Macklemore & Ryan Lewis, whose hit “Thrift Shop” celebrates second-hand bargains, rapper Kendrick Lamar and producer/rapper Pharrell Williams also received seven nominations each, including best new artist for Macklemore & Ryan Lewis and for Lamar.
‘Random Memories’The awards, handed out annually by the Santa Monica, California-based Recording Academy, will be telecast by CBS Corp.’s network from L.A.’s Staples Center. LL Cool J used last night's show to pay tribute to former South African President Nelson Mandela, who died on Dec. 5.
In the Album of the Year category, Swift’s “Red” and Daft Punk, with “Random Access Memories,” are joined by singer-songwriter Sara Bareilles’s “The Blessed Unrest,” Lamar’s “Good Kid, M.A.A.D City,” and Macklemore & Ryan Lewis’s “The Heist.”
Timberlake TourMars, Macklemore & Ryan Lewis, Lorde, Katy Perry and Pink will compete for song of the year, an award that is given for songwriting.
“The way he released two albums that bookended his summer tour was very, very smart,” Bakula said.
Lorde, a 17-year-old musician from New Zealand, broke through this year with the album “Royals,” which gave a female artist the first No. 1 ranking on the rock charts since Tracy Bonham in 1997, Bakula said.
“Lorde’s is an amazing story in a genre that hasn’t been a place for female artists, let alone 17 a year old, for a very long time,” Bakula said.
Dance MusicRiding a wave of popularity fueled by electronic dance music festivals, Daft Punk sold 840,000 copies of “Random Access Memories” in six months, Bakula said.
“Electronic dance music is this big and growing side of the business,” Bakula said. “A lot of people brought into that genre of music were looking for something new just as Daft Punk released its album.”
The industry is down to three major record companies. Vivendi SA’s Universal Music Group acquired EMI’s recorded music business last year. An investor group led by Sony Corp., owner of Sony Music Entertainment, acquired EMI’s publishing business. In 2011, billionaire Len Blavatnik acquired Warner Music Group.
Artists who released albums between Oct. 1, 2012, and Sept. 30, 2013, are eligible for the 56th Annual Grammys. Ballots are due Jan. 8, when they will be tabulated ahead of the awards show, according to the Recording Academy.
NOMINEES IN TOP CATEGORIES:
* “The Blessed Unrest” - Sara Bareilles
* “Random Access Memories” - Daft Punk
* “Good Kid, M.A.A.D City” - Kendrick Lamar
* “The Heist” - Macklemore & Ryan Lewis
* “Red” - Taylor Swift
* “Get Lucky” - Daft Punk & Pharrell Williams
* “Radioactive” - Imagine Dragons
* “Royals” - Lorde
* “Locked Out of Heaven” - Bruno Mars
* “Blurred Lines” - Robin Thicke featuring T.I. & Pharrell
* “Just Give Me A Reason” - Jeff Bhasker, Pink & Nate Ruess,
* “Locked Out of Heaven” - Philip Lawrence, Ari Levine & Bruno
Mars, songwriters (Bruno Mars)
* “Roar” - Lukasz Gottwald, Max Martin, Bonnie McKee, Katy
Perry & Henry Walter, songwriters (Katy Perry)
* “Royals” - Joel Little & Ella Yelich O’Connor, songwriters
* “Same Love” - Ben Haggerty, Mary Lambert & Ryan Lewis,
songwriters (Macklemore & Ryan Lewis featuring Mary Lambert)
* Macklemore & Ryan Lewis | [
{
"key": "website_description",
"type": "global",
"value": "This website is an international news agency headquartered in New York City and a division of Bloomberg L.P. Content produced by Bloomberg News is disseminated through Bloomberg Terminals, Bloomberg Television, Bloomberg Radio, Bloomberg Businessweek, Bloomberg Markets, Bloomberg.com, and Bloomberg's mobile platforms. Since 2015, John Micklethwait has served as editor-in-chief."
}
] |
Joyce E Wilkinson PhD Thesis
P. 1Joyce E Wilkinson PhD ThesisJoyce E Wilkinson PhD ThesisRatings: (0)|Views: 235|Likes: 0Published by Grant Invinzor Ruizo AbejarMore info:Published by: Grant Invinzor Ruizo Abejar on Aug 12, 2012Copyright:Attribution Non-commercialAvailability:Read on Scribd mobile: iPhone, iPad and Android.Free download as PDF, TXT or read online for free from ScribdFlag for inappropriate content|Add to collectionSee MoreSee lesshttp://www.scribd.com/doc/102651864/Joyce-E-Wilkinson-PhD-Thesis01/13/2013pdftextoriginal You're Reading a Free Preview
More From This User Compre Topics
Grant Invinzor Ruizo Abejar | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American e-book and audiobook subscription service that includes one million titles."
}
] |
The Home Depot 3030 SW 8th St, Miami, FL 33135 - YP.com
The Home Depot #277 isn't just a hardware store. We provide tools, appliances, outdoor furniture, building materials to Miami, FL residents. Let us help with your project!
check, company card, amex, discover, master card, visa, financing available, all major credit cards, paypal, debit, cash
Dred S.
This is the WORST home depot in Miami OR ANYWHERE!
- They refused to honor CLEARANCE price of DISCONTINUED items, some of which were broken but salvageable.
- They gave some BS that they were recalls or that there was a glitch in the system.
- If they were recalls why were they not pulled from the shelves?
- A glitch in the system on CLEARANCE items? I don’t think so.
-I’ve seen clearance prices at home depot go down in price over time to get rid of CLEARANCE items.
-The only glitch is the glitch with CUCTOMER SERVICE at this home depot.
-Why bother scouring the CLEARANCE bin if they will not honor the price?
Why bother having a clearance bin at all?
Worst home depot in Miami! I will never return.
I’ve purchased MANY, MANY items over the years totaling in the THOUSANDS OF DOLLARS from home depot, at regular prices and clearance prices.
I will NEVER return to this crappy home depot.
oh, the neighborhood is suspect as well
Willyandariane A.
Is NOT open 24 Hrs
I had an emergency last night a pipe broke at 12:30 am i looked up the 24 hrs home depots, my husband drove all the way from the kendall area to this home depot located on 32 ave and 8 street to find this location was closed! Then went to the 2nd Advertised 24 hr home in Homestead and the same story Closed! Please stop with the false advertising! We wasted our time, gas and at the End we couldnt fix our problem.
You will be discriminated against and not treated right if you don't speak Spanish
Expect to be treated rudely and unfairly if you are not Hispanic. The cashiers and their supervisors let their friends get ahead of other customers in the checkout lines. If you complain the Spanish speaking customer and the employees stick together against you and rudely tell you to get back to your place in the line. When your turn comes to pay, you will be further punished by being made to wait as the cashier won't be able to read the code on one of your items. While you are waiting the cashier and her supervisor (Amelia and Arleny, in my case) will be speaking Spanish among themselves and laughing at you. No manager will be available to help you out. Be prepared for a totally incredibly ugly shopping experience that you won't find anywhere else.
petermcknight
Dante would have created another circle of hell if he would have ever experianced the Home Depot on Calle Ocho. Here is an excersize in futility: try and call this god forsaken operation and attempt to get some one who even remotely has any experiance with hardware or building materials.
The current rating for this operation is a 9.8 reflects either a payoff to some one who operates city search or some one from home depot corparate has influanced the rating on line.
1650 W 37th St, Hialeah, FL
273 SW 27th Ave, Miami, FL
1500 SW 27th Ave, Miami, FL
2851 Nw 27th Ave, Miami, FL
Directions to Speedy Smog & Auto Repair Bakersfield CA
Directions to Oard's Auto & Truck Repair Service Inc Salina KS
Directions to Whaley Paint & Body Shop Nashville TN
Metlife Life Insurance Co Saint Louis MO
Directions to White Davis & White Law Firm PA Anderson SC
Columbia TN Banks Reviews
Directions to Fischer Law Office Watertown WI
Lines Electric Electricians Chandler
Rader Andrew Electric Electricians Thousand Oaks
Electrician Service Fountain Electricians Fountain
Ampere Electric Electricians Bloomfield
Valdosta Electric Co Electricians Valdosta
Empire State Property Services Electricians Brooklyn
Waukesha Electric Systems Inc Electricians Charlotte
Bay Mechanical & Electical Corp Electricians Lagrange
Electricians Domestic Fast Sandy Electricians Draper
Barr Enterprise Electricians Etna
Directions to Peter Luger Steak House Brooklyn NY
Directions to Maricopa County Adult Probation Mesa AZ
Go Kart Racing Near Fort Myers FL
Austin TX Food Stamp Office Reviews
Directions to Solar Nails Port Huron MI
Directions to 23 Post Pawn Oklahoma City OK | [
{
"key": "website_description",
"type": "global",
"value": "This website is a United States-based web site operated by YP Holdings that provides listings for local businesses. In 2013 it was re-branded as YP.com or simply \"YP\"."
}
] |
Latest News for: samhain (band)
Brian Baker played bass in Minor Threat as a teeanger, and since then, he’s been in Government Issue, Dag Nasty, and Samhain ... a new band called Beach Rats....
... Apparent.” (function(d, s, id) { var js, fjs = d.getElementsByTagName(s)[0]; if (d.getElementById(id)) return; js = d.createElement(s); js.id = id; js.src = 'https.//connect.facebook.net/ga_IE/sdk.js#xfbml=1&version=v3.0'; fjs.parentNode.insertBefore(js, fjs); }(document, 'script', 'facebook-jssdk')); Jimi Hendrix with Irish band 'Eire Apparent'....
The band first reformed in 2016 on the Riot Fest stage in Chicago and Denver, marking the first time in 33 years the icons had played together ... Danzig left the popular punk band back in 1983 to form Samhain and and the group has soldiered on in various iterations, usually with Only handling lead vocals ... ....
Lewis County Artist Living the Dream Crafting Nightmarish Characters
“Metal and horror go together in the same vein,” said Dean, who made a set of masks for the band Five Finger Death Punch last summer. He then took the masks with him to a show in Seattle where the band, with their avant garde zombie-apocalypse inspired onstage look, was performing ... Dean’s mask crafting began as a hobby but has since morphed into a small-business known as Samhain Studios....
Glenn Danzig talks new music, fetishes and curating the inaugural Blackest of the Black Fest ...
Orange County-based metal band Atreyu (from left ... For nearly two decades Glenn Danzig, founding member of punk, rock and heavy metal bands the Misfits, Samhain and Danzig, has toyed around with the idea of Blackest of the Black ... “I’m not going to say the name of a band, but I had a friend who went and saw an old punk band and paid $65 to see them at a club,” he said....
'The reason they rejected us? Heavy metal shouldn't be played in church'
the band organiser Conchúir O’Drona plays in. A gig grew into a one-day festival and this year’s event takes place on May 6th with sets from death grind band Abaddon Incarnate, gloomy ambient black metal music from O’Drona’s own From The Bogs of Aughiska, Tipperary “progressive sludge” band Zhora, Dublin experimental duo Deathness Injection and Cork atmospheric band Oiche Samhain among them. Oiche Samhain....
A gig grew into a one-day festival and this year’s event takes place on May 6th with sets from death grind band Abaddon Incarnate, gloomy ambient black metal music from O’Drona’s own From The Bogs of Aughiska, Tipperary “progressive sludge” band Zhora, Dublin experimental duo Deathness Injection, Tipperary/Offaly dark post-rockers Unkindness Of Ravens and Cork atmospheric band Oiche Samhain among them. Oiche Samhain....
Roadburren Fleadh - showcasing the new wave of Irish heavy metal
A gig grew into a one-day festival and this year’s event takes place on May 6th with sets from death grind band Abaddon Incarnate, gloomy ambient black metal music from O’Drona’s own From The Bogs of Aughiska, Tipperary “progressive sludge” band Zhora, Dublin experimental duo Deathness Injection and Cork atmospheric band Oiche Samhain among them ... Streaming services such as Spotify are also helping the discovery of metal bands....
Meanwhile, Danzig, who went on to form Samhain and his eponymous band, and Only – who, with Doyle, formed a group called Kryst the Conqueror – took brutal swipes at each other in the press, as they fought for various rights related to the Misfits legacy ... For Danzig, the decision to move forward with a reunion now is as morbid as one of the band's "hits from hell." ... But it all happened after the band's first run....
Frontman and founder Glenn Danzig dissolved the band in 1983, going on to form, first, Samhain and then the hugely successful Danzig. A decade later, an almighty legal battle for the rights to the band’s name and logo kicked off between the diminutive bellower and bassist Jerry Only, with the latter eventually winning through ... The Misfits are a band, not a brand....
Glenn Danzig to reunite with Misfits after 33 years
The macabre band formed in Lodi in 1977 Watch video ... Danzig, 60, will perform with the band at Riot Fest and Rodeo in Denver on Sept ... band's website. ... He left the band in 1983 ... After leaving the Misfits, Danzig, born Glenn Anzalone, performed with the band Samhain, then Danzig....
Misfits to reunite with 'original' lineup at Riot Fest
This configuration of the New Jersey band, which Riot Fest is billing as “The Original Misfits,” performed together from 1980 to 1983 ... Danzig departed the band in 1983, forming Samhain and later his own eponymous band.... | [
{
"key": "website_description",
"type": "global",
"value": "This website is a news aggregator founded in March 1995 and launched online in 1998. In 2003, Search Engine Watch praised the service for its \"Special Reports\", and called it \"an interesting alternative\" to other news aggregation services."
}
] |
Post.sk Mail
Follow Post.sk Mail to get e-mail alerts and updates on your eBay Feed.
Yay! You're now following Post.sk Mail in your eBay Feed.You will receive email alerts for new listings. Dont send me e-mail alerts.
More items related to Post.sk Mail
[SK-II] SK2 Facial Treatment Clear Lotion 30ml x 2 SK-II "FREE POST!"& NEW
sk54 Mexico Post card Popocatepetl Mexico, Cananea Woodbury NJ 1906
BTS Bangtan Boys SK Telecom Official Student Identity Card Post Card - Jungkook
Bwl Red Light Concentrated Post Therapy Facial Serum 1 Oz
DAISY 880 SEAL KIT, COMPLETE FOR POST 1995 VERSION
1962 Chevrolet Impala SS Call or Message and I will post part SK#7719
OneGrill Cordless Dual Post Open Fire Rotisserie System- 45 Chrome 4SK40
Denso O2 Oxygen Sensor - Downstream - 2006 Chevrolet Avalanche Silverado sk
+ 1875 Trondheim Norway Surch.2 on 1/2Sk Local Private Die Post Braekstad &Co.
Hinkley Lighting 1761SK-LED, Kube Outdoor Post Light In Satin Black
SK-II SK II Men Age Revitalize Moisturizer 50g Men Post-shave Moisturizer NEW
BTS Bangtan Boys SK Telecom Event Official Postcard Post Photo Card - V Taehyung
+ 1870 Denmark Crown Post Horn #18 A6 4sk Copenhagen
REWIND RECORDS Soundmurderer - + SK-1 (2003) NEW SEALED FREE UK POST
T742 NORWAY- LOCAL POST-COV. w. 4 SK. and BYPOST CANCEL
GENUINE SUZUKI SV650S SV650 SV 650 SK4 2004 LEFT RIDERS HANGER *FREE UK POST*
SK-II SK2 Facial Treatment Clear Lotion 60ml◆(30ml x 2)◆SKII "FREE POST!" #1596
2 PCS SK-II Men Age Revitalize Moisturizer 50g x 2= 100g Men Post-shave Homme
SK-II SK II Men Age Revitalize Moisturizer 50g Homme Post-shave Moisturizer#5885
5 x SK-II R.N.A. Power Radical New Age Cream◆2.5g◆Brand New " FREE POST !! "
+ 1871 Denmark Crown Wreath Post Horn #20 A6 16sk used cv$175.
The Last Supper 3D Collector Series Super XOGRAPH Post Card SK-30-23D
BTS Bangtan Boys SK Telecom Event Official Postcard Post Photo Card - Jin
SK-II LXP Ultimate Perfecting Essence◆10ml◆Japan " FREE POST !! " #2030
1958 VIENNA AUSTRIA OE1SK QSL RADIO POST CARD (13)
BTS Bangtan Boys SK Telecom Official Student Identity Card + Post Card - Jimin
Hinkley Lighting 1641SK-LED, Atlantis Outdoor Post Light In Satin Black
+ 1871 Denmark Crown Wreath Post Horn #17 A6 3sk Nr-1-Copenhagen cv$110.
BTS Bangtan Boys SK Telecom Event Official Postcard Post Photo Card Sticker SET | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational e-commerce corporation based in San Jose, California, that facilitates consumer-to-consumer and business-to-consumer sales through its website."
}
] |
TV When -- and Where -- You Want It
New Video Technologies Free Viewers From the Couch
Michael K. Simmons Jr.'s two jobs occupy every day of the week, straining his otherwise loving relationship with TV.
But new technology is here to help. Simmons has learned how to download basketball games from Web sites like ESPN360 and snippets of the Grammy Awards show from Yahoo. He records shows such as "Lost" and "24" to his laptop.
"I pretty much can catch anything I want," he said. Nearly 70 percent of his television viewing is not live. In fact, it is not even done with a TV. Downloadable television keeps the Fort Washington resident tuned into popular culture and water-cooler talk at work.
As media and technology industries offer new modes of watching video, consumers' relationship to television is starting to change. The box in the living room no longer dictates when and where programming is consumed. New products and faster wireless Internet speeds give customers more control, and some say they're exploiting that to make television cater to their lifestyles.
Some watch e-mailed snippets of "Saturday Night Live" on their computers on Monday morning. Instead of waiting for next week's episode, viewers are catching up on entire seasons in one sitting. Some scroll through nine innings of baseball to catch the best 15 minutes of highlights. And who needs commercials? Or program guides? Both are becoming relics of the past for a younger generation of on-demand viewers who cannot imagine being tied to a specific time or place to watch a broadcast.
For Andy Tao, portable television means more entertainment on an otherwise dull 40-minute Red Line Metro commute between Brookland and the National Institutes of Health, where he works as a cancer researcher.
"The good thing about TV shows is that it's about four hours' worth on one DVD, so it lasts me about two days during the commute," said Tao, 28, who caught up on past seasons of "West Wing" on a notepad-size DVD player he received for Christmas. He's also working his way through "Alias," "24" and "Friends," he said. "I even signed up for 'Desperate Housewives' to see what all the hype is about."
The usual keepers of television viewership data -- Arbitron Inc. and Nielsen Media Research Inc. -- have yet to collect data about this kind of alternative and online television viewership. But there is some evidence of a shift; since launching in October, Apple Computer Inc.'s iTunes has sold more than 12 million downloadable videos. Cell phone television provider MobiTV Inc. said it has more than 500,000 subscribers through various carriers.
In a recent report called "The End of Television as We Know It," International Business Machines Corp.'s business consulting group predicted billions of dollars in lost advertising revenue as recorded video becomes the norm. Another study showed that interest in portable television is much more intense among the rising generation of consumers; 48 percent of those ages 13 to 17 said they are interested in watching a feature-length film on their cell phones, compared with 23 percent among those 55 and older, according to a survey by research firm Parks Associates.
In recent months, technology companies such as America Online Inc., Apple, Yahoo Inc., Google Inc. and Microsoft Corp.'s MSN, as well as production studios and networks ABC, CBS and NBC, have announced dozens of initiatives to encourage that transition to watching television on non-television devices.
The shift away from traditional TV came by accident for John Grimes, a physics professor at Towson University.
"Our VCR kicked the bucket a few years ago, and we never replaced it," said Grimes, who turned to his computer to fill the void.
Grimes used to use file-sharing software like BitTorrent, which allowed for free but illegal downloading of movies and shows. But after the Supreme Court last year affirmed digital copyright protections, more commercial sites such as Movielink and Cinemanow have emphasized legal alternatives.
Grimes now pays to download episodes of ABC's "Lost" and SciFi Channel's "Battlestar Galactica." Late last year, Grimes and his wife -- both Boston Red Sox fans -- even signed up for a $50-a-year online service from the Major League Baseball Web site to get streaming video coverage of all Sox games.
"It's surprisingly good. When it first came out, it wasn't that good, but it's finally what I call usable," said Grimes, who sometimes hooks up his laptop to his TV to watch shows on a bigger screen.
More technical improvement and a broader library of online video options are coming, analysts said.
"What you're seeing is that increasingly people want content on their own terms, and on multiple devices," meaning their laptop, desktop, cell phone, handheld device or media player, said Mike McGuire, an analyst with Gartner Inc. "There's a whole world of stuff that's emerging," he said, with better technology, more content and even homegrown content that can compete with the mainstream media outlets.
"It gives me the ability to put TV on my time frame, and not have it dictate my schedule," said Joseph LaRocca, an executive at the National Retail Federation who five months ago purchased a Slingbox, a device that allows him to record shows at home on his TiVo and then transmit them over the Internet for viewing somewhere else.
For some, skipping commercials is worth the price of buying shows online.
"That's one of the big pros -- watching it without commercial interruption," said Jason Novak, whose introduction to downloaded television came after missing an episode of "Lost," which he gladly paid $1.99 to get. Since then, Novak has found himself admiring the video quality on his friend's portable game player and watching a popular "Saturday Night Live" rap skit called "Lazy Sunday" that someone e-mailed to him.
The public's awakening to new forms of video is even prompting Hollywood to think differently about traditional production. AOL, which is trying to market its own media content, recently signed a deal with Mark Burnett Productions Inc. to produce "Gold Rush!", a reality-based, interactive show about a treasure hunt for online viewers.
"To me, the new prime time is 9 a.m. to 5 p.m., because more people have access to a computer then," said Burnett, whose hit shows include "Survivor" and "The Apprentice." The transition to producing more shows for the Internet medium makes basic business sense, he said. "The younger generation is so used to on-demand, there's going to be a different way to watch things." | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American daily newspaper published in Washington, D.C. It is the most-widely circulated newspaper within the Washington metropolitan area, and has a large national audience. Daily broadsheet editions are printed for D.C., Maryland, and Virginia."
}
] |
Sports & Outdoors Sports Fan Shop For the Home Fan Shop Bedding Fan Shop > Refine Price $ to $ Go Top brands NFL Store availability Sort Best sellers Price: low to high Price: high to low Highest rating New $15.99 NFL Micro Raschel Deep Slant 50" x 60" Throw, New England Patriots 5.0 stars (2) ratings Try unlimited 2-day shipping FREE for 30 days See details | Sign up Free shipping on orders over $50 Free store pickup $14.88 NFL Patriots 46x60 Micro Raschel Throw 4.0 stars (8) ratings Try unlimited 2-day shipping FREE for 30 days See details | Sign up Free shipping on orders over $50 Free store pickup $14.88 NFL New England Patriots 50" x 60" Fleece Throw 3.5 stars (4) ratings Try unlimited 2-day shipping FREE for 30 days See details | Sign up Free shipping on orders over $50 Free store pickup Rollback $10.96 Was $17.88 Save $6.92 Patriots Official 15" Toss Pillow 5.0 stars (2) ratings Try unlimited 2-day shipping FREE for 30 days See details | Sign up Free shipping on orders over $50 Free store pickup New $19.94 NFL New England Patriots "Drawback" 55" x 70" Silk Touch Throw Try unlimited 2-day shipping FREE for 30 days See details | Sign up Free shipping on orders over $50 Free store pickup $19.98 Was $24.88 Save $4.90 NFL New England Patriots "Prestige" 60" x 80" Raschel Throw Try unlimited 2-day shipping FREE for 30 days See details | Sign up Free shipping on orders over $50 Free store pickup New $19.99 NFL New England Patriots "Old School" 50" x 60" Mink Sherpa Try unlimited 2-day shipping FREE for 30 days See details | Sign up Free shipping on orders over $50 Free store pickup Rollback $14.98 Was $15.83 Save $0.85 NFL U-Neck Pillow, Patriots Try unlimited 2-day shipping FREE for 30 days See details | Sign up Free shipping on orders over $50 Free store pickup 1 Showing 8 of 8 results Shipping & Pickup Show all Ship to Home FREE Pickup FREE Pickup Today Sports League NFL Category Throws Fan Shop Throws Size 12" 08 Sports Team Seattle Seahawks New York Yankees Kansas City Chiefs Ohio State Buckeyes Dallas Cowboys Texas Rangers Dallas Mavericks Virginia Tech Hokies Georgia Bulldogs New England Patriots Pittsburgh Steelers St. Louis Cardinals Baltimore Ravens New York Giants Boston Red Sox Florida State Seminoles Minnesota Vikings Washington Redskins New York Knicks Miami Heat See more sports teams Retailer Walmart.com Brand NFL Special Offers Rollback New Price $ to $ Go $0 - $15 $15 - $25 $25 - $50 $50 - $75 $75+ Customer Rating 4.0 stars & Up 3.0 stars & Up Color Multi Blue Length 10.0 12.0 12.5 15.0 27.5 7.5 9.5 Lifestage Adult Popular in Bedding Fan Shop Ohio State Comforters 49ers NFL Bedding NCAA Plush Throw Sets NFL Throws NFL Blankets Tapestry Throws NFL Comforter Compute- app-4983975-14-88396424, DC- prod-dfw1, ENV- prod-a, Ver- 46.0.0, SHA- bb3d0941156637d9a4ff37a5e0c3039d98baf1e2, Log- afe1228a-10ac8-156d5c8f917000 Site Information Be the first to save! Email Address Sign up Privacy Policy Stay connected Mobile apps Help Feedback MoneyCenter Privacy & Security CA Privacy Rights Terms of Use Walmart services See All Services Walmart MoneyCenter Walmart Credit Card Product Care Plans Walmart Pay Get to know us About Walmart.com Corporate Suppliers Marketplace Careers @WalmartLabs Walmart.com Terms of Use About Our Ads Affiliate Program CA Privacy Rights Privacy & Security Customer service Returns Policy Product Recalls Int’l Customers Tax Exempt Program Contact Us Feedback Store Pickup In the spotlight Expand Baby Cribs Strollers Diapers Baby Feeding Car Seats Expand Electronics Cut the Cable Computers TVs iPads & Tablets Expand Fitness Exercise Machines Vitamins Ellipticals Treadmills Fitbit Expand Keep Cool Air Conditioners Fans Swimming Pools Pool Toys Popular Products Expand International Sites Argentina Brazil Canada Chile China Japan Mexico United Kingdom © Walmart Stores, Inc. To ensure we’re able to help you as best we can, please include your reference number: Ref: | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational retail corporation that operates a chain of hypermarkets , discount department stores, and grocery stores from the United States, headquartered in Bentonville, Arkansas."
}
] |
Amazon.co.uk: Liz Moore: Books, Biogs, Audiobooks, Discussions
Heft by Liz Moore (28 Mar 2013)
£3.22 new (18 offers) £5.29 used (2 offers) (42)
The Words of Every Song by Liz Moore (10 Jul 2007)
£12.00 new (9 offers) £0.19 used (14 offers) > See search results for author "Liz Moore" in Books | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American multinational technology company which focuses on e-commerce, cloud computing, digital streaming, and artificial intelligence."
}
] |
71 Verified Hotel Reviews of Hotel La Madrugada | Booking.com
Reviews of Hotel La Madrugada This rating is a reflection of how the property compares to the industry standard when it comes to price, facilities and services available. It's based on a self-evaluation by the property. Use this rating to help choose your stay!
Browse Hotel La Madrugada Traveler Photo Gallery
556487,558517,547807,559337,563267,555917,550407,563647,564017,563617,549667,555047,560747|1,557177,548877,550797,563767,560747,554967,542117,563627,533337,555007,552677,563607,551897,558047,563597,558537,554997,562707,563637,555057,418135,563687,558767,559767 | [
{
"key": "website_description",
"type": "global",
"value": "This website is a Dutch online travel agency for lodging reservations & other travel products, and a subsidiary of Booking Holdings. It is headquartered in Amsterdam.The website has over 28 million listings."
}
] |
VideoFootball Insider Live: McNabb struggles continueThe Washington Post's Dan Steinberg, LaVar Arrington, Rick Maese and Jonathan Forsythe discuss the concerns rising from Sunday's win in Chicago, including Donovan McNabb's worst performance to-date for the Redskins.» LAUNCH VIDEO PLAYER
Wednesday, October 27, 2010; 12:14 AM | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American daily newspaper published in Washington, D.C. It is the most-widely circulated newspaper within the Washington metropolitan area, and has a large national audience. Daily broadsheet editions are printed for D.C., Maryland, and Virginia."
}
] |
A suitable job for a princess Cressida takes up teaching | Daily Mail Online
A suitable job for a princess – Cressida takes up teaching By
20:41 EDT, 7 December 2013
04:02 EDT, 8 December 2013
With boyfriend Prince Harry on a charity trek at the South Pole, Cressida Bonas is using the time to train as a teacher. Cressida, a qualified dancer, has decided to pursue a worthy career off the stage and out of the limelight now that she is a Royal girlfriend.The 24-year-old has been helping out at her father’s private tuition agency Bonas Macfarlane Education, in Battersea, South London, with a view to becoming a teacher. ‘She’s keeping herself busy and working hard,’ says a friend. Cressida Bonas is training as a teacher and was seen at a charity carol concert carrying her books
On Wednesday Cressida was seen carrying two books about child psychology and development to a charity carol concert where she was given another job by Claire Van Straubenzee, the mother-in-law of Cressida’s close friend Missy Percy. ‘Cressida, Missy, Chelsy Davy, and Astrid Harbord were given the task of walking up and down the aisles in catwalk formation to collect money for the Henry Van Straubenzee memorial fund,’ said a guest at the event. Cressida and Harry, 29, are planning a romantic getaway to make up for the weeks they will have been forced to spend apart while he completes his Walking With The Wounded trek. ‘They’re looking at either Africa or skiing in Switzerland,’ I’m told. David Hockney wants to show his 2012 ‘video painting’ The Jugglers in China. He believes the way the Chinese read – from right to left – would suit the work, which plays with perspective. ‘The Chinese would see it straight away – they’d see it like a scroll,’ the artist, 76, revealed. The Jugglers consists of a grid of 18 screens showing jugglers moving in front of a static background. It wouldn’t be David’s first visit. In 1993 he released an illustrated diary of a trip he took to China with Stephen Spender. Emily Maitlis was at the Cosmopolitan Ultimate Women awards to present a gong
Work never stops for Newsnight presenter Emily Maitlis, who took it upon herself to go on stage at an awards ceremony on Thursday to announce the death of Nelson Mandela. Emily, 43, was at the Cosmopolitan Ultimate Women awards to present a gong, but told the audience: ‘I’m a news reporter, so I think it’s quite fitting that I should be the one to tell you that in the last few minutes we have learned that Nelson Mandela has sadly passed away. I know some of you have been on your phones and will have seen the news already. He was an incredible man.’ Other guests at the event at the Victoria and Albert Museum included X Factor judge Nicole Scherzinger. | [
{
"key": "website_description",
"type": "global",
"value": "This website is the website of the Daily Mail, a newspaper in the United Kingdom, and of its sister paper The Mail on Sunday. MailOnline is a division of dmg media, which is owned by Daily Mail and General Trust plc."
}
] |
Elevated Protein Carbonylation, and Misfolding in Sciatic Nerve from db/db and Sod1−/− Mice: Plausible Link between Oxidative Stress and Demyelination - Semantic Scholar
Ryan T. Hamilton, Arunabh Bhattacharya, +7 authors Holly van Remmen
DOI: 10.1371/journal.pone.0065725
Sergio Martinez-Hervás, Mercedes Molina Mendez, +5 authors Juan F. Ascaso
Redox homeostasis and age‐related deficits in neuromuscular integrity and function
Michael E. Walsh, Holly Van Remmen
Effects of High Glucose on Cell Viability and Differentiation in Primary Cultured Schwann Cells: Potential Role of ERK Signaling Pathway
Di Liu, Xiaochun Liang, Hong Zhang
Michael E. Walsh, Arunabh Bhattacharya, +5 authors Holly Van Remmen
Michael E Walsh, Lauren B Sloane, Kathleen E Fischer, Steven N Austad, Arlan Richardson, Holly Van Remmen
Kyoung Ah Kang, Mei Jing Piao, +5 authors Jin Won Hyun
L Wang, M Chopp, +8 authors Z G Zhang
AR Chaudhuri, EM de Waal, A Pierce, H Van Remmen, WF Ward
A (2006) A novel approach for screening the proteome for changes in protein
A Pierce, E deWaal, H Van Remmen, A Richardson, Chaudhuri
conformation. Biochemistry
Jenny Fortun, Jocelyn C Go, Jie Li, Stephanie A Amici, William A Dunn, Lucia Notterpek
Jenny Fortun, Jie Li, Jocelyn Go, Ali Fenstermaker, Bradley S Fletcher, Lucia Notterpek
Andreas R Tobler, Ning Liu, Lukas Mueller, Eric M Shooter
Paul Voziyan, Kyle L Brown, Sergei Chetyrkin, Billy Hudson
@inproceedings{Hamilton2013ElevatedPC, title={Elevated Protein Carbonylation, and Misfolding in Sciatic Nerve from db/db and Sod1−/− Mice: Plausible Link between Oxidative Stress and Demyelination}, author={Ryan T. Hamilton and Arunabh Bhattacharya and Michael E. Walsh and Yun Shi and Rochelle Wei and Yiqiang Zhang and Karl A. Rodriguez and Rochelle Buffenstein and Asish Ray Chaudhuri and Holly van Remmen}, booktitle={PloS one}, year={2013} } | [
{
"key": "website_description",
"type": "global",
"value": "This website is an artificial-intelligence backed search engine for academic publications developed at the Allen Institute for AI and publicly released in November 2015. It uses advances in natural language processing to provide summaries for scholarly papers."
}
] |
Patent US7900630 - Gas delivery mask with flexible bellows - Google Patents
A gas delivery mask apparatus is provided. The mask apparatus may include a mask body, a face mask, and a bellows. The mask body may include a tube configured to extend upwardly adjacent a subject's forehead. The face mask may be configured to deliver gas to the subject and may include a flexible cushion...http://www.google.com/patents/US7900630?utm_source=gb-gplus-sharePatent US7900630 - Gas delivery mask with flexible bellows
Publication number US7900630 B2
Application number US 11/155,195
Also published as CA2612382A1, EP1968676A1, US20060283456, WO2006138416A1
Publication number 11155195, 155195, US 7900630 B2, US 7900630B2, US-B2-7900630, US7900630 B2, US7900630B2
Inventors Edward M. Geiselhart, Chris Houghton, Erik Holverson, Brian Woodard, Steve Trebotich
Patent Citations (229), Non-Patent Citations (14), Referenced by (8), Classifications (11), Legal Events (4)
Gas delivery mask with flexible bellows
US 7900630 B2
US4875718 Dec 2, 1988 Oct 24, 1989 Marken Robert E Swivel connector for preventing kinking of flexible medical hoses
US5054482 Sep 26, 1990 Oct 8, 1991 Bales Joseph H Rotatable tracheostomy tube assembly
US5567752 Nov 22, 1995 Oct 22, 1996 General Electric Company Silicon- and nitrogen- containing adhesion promotors and compositions containing them
US5975490 Jan 7, 1998 Nov 2, 1999 Essman Screw Products, Inc. Swivel coupling for hose
US6164829 Apr 13, 1999 Dec 26, 2000 Trw Fahrwerksysteme Gmbh & Co. Kg Bearing shell
US6619570 Jun 14, 2001 Sep 16, 2003 Orbit Irrigation Products, Inc. Telescoping watering wand
US6851428 Jan 8, 2002 Feb 8, 2005 Carnell K. Dennis Respiratory mask
US6886564 Jul 16, 2001 May 3, 2005 Australian Centre For Advanced Medical Technology Ltd. Nasal mask with integral mouldable straps
US6981503 Nov 16, 2004 Jan 3, 2006 Leon Shapiro Hands free-anesthesia mask
US20020157668 Mar 6, 2001 Oct 31, 2002 Michel Bardel Protective equipment with fast fixing head
US20020189616 Apr 13, 2001 Dec 19, 2002 Wolf G. Thomas Oxygen mask
US20030000001 May 24, 2002 Jan 2, 2003 Be Intellectual Property, Inc. Multi-phase headset for pilots
US20030075182 Oct 22, 2002 Apr 24, 2003 Dieter Heidmann Application device for a breathing mask arrangement
US20030084903 Jul 22, 2002 May 8, 2003 Fecteau Keith E. Adjustable mask
US20030087033 Nov 6, 2001 May 8, 2003 Ramsay Bruce Gordon Systems and methods for an angle limiting deposition mask
US20030127096 Jan 8, 2002 Jul 10, 2003 Mcauliffe Patrick J. Flow diverter for controlling the pressure and flow rate in a CPAP device
US20030127101 Jan 8, 2002 Jul 10, 2003 Dennis Carnell K. Respiratory mask
US20030164170 Mar 3, 2003 Sep 4, 2003 Joanne Drew Respiratory mask having gas washout vent and gas washout vent assembly for respiratory mask
US20030217746 Mar 24, 2003 Nov 27, 2003 Fisher & Paykel Healthcare Limited Breathing assistance apparatus
US20040034519 May 15, 2001 Feb 19, 2004 Huitouze Serge Le Dynamic language models for speech recognition
US20040065328 Dec 7, 2001 Apr 8, 2004 Amarasinghe Amal Shirley Mask brace and mask assembly
US20040073989 Jul 29, 2002 Apr 22, 2004 Michael Horn Head harness for a respirator
US20040083534 Mar 28, 2003 May 6, 2004 Ruiz Sherrie E. Headgear apparatus
US20040107964 Apr 9, 2002 Jun 10, 2004 Shaw Geoffrey Mark Continuous positive airway pressure device
US20040118406 Sep 5, 2003 Jun 24, 2004 Lithgow Perry David Cushion for a respiratory mask assembly
US20040182396 Jan 28, 2004 Sep 23, 2004 Dennis Carnell K. Respiratory mask
US20040182398 Jun 23, 2003 Sep 23, 2004 Tom Sprinkle Nasal mask
US20040216746 Feb 25, 2004 Nov 4, 2004 Sunrise Medical Hhg Inc. Adjustable nasal mask
US20050051171 Sep 10, 2003 Mar 10, 2005 Booth Jamie Lee Nose breathing mask for a medical patient; and method
US20050072428 Sep 29, 2004 Apr 7, 2005 Ric Investments, Llc Patient interface with forehead and chin support
US20050081858 Oct 12, 2004 Apr 21, 2005 Resmed Limited Mask assembly
US20050205096 Feb 1, 2005 Sep 22, 2005 Ric Investments, Llc Patient intreface assembly supported under the mandible
US20050205694 Mar 22, 2004 Sep 22, 2005 Jing Mei Industrial Holdings Limited Ball component of ball and socket joint for directable water conduits
US20050279367 Aug 29, 2005 Dec 22, 2005 Klemperer Walter G Mouthpiece, nasal seal, head appliance, apparatus, and methods of treating sleep apnea
US20050284481 Mar 17, 2005 Dec 29, 2005 Dragerwerk Aktiengesellschaft Breathing mask with breathing gas supply through the strap
US20060000476 Jul 1, 2005 Jan 5, 2006 Salem M R Retaining system for securing a ventilation mask
US20060027236 Sep 27, 2005 Feb 9, 2006 Respironics, Inc. Nasal mask and system using same
US20060060200 Sep 16, 2005 Mar 23, 2006 Ric Investments, Llc Cheek-mounted patient interface
US20060090760 Sep 15, 2003 May 4, 2006 Gradon Lewis G Release mechanism for masks
US20060112961 Nov 29, 2004 Jun 1, 2006 Hany Aly Pediatric mask, especially suited for premature infants
US20060118117 Nov 6, 2003 Jun 8, 2006 Michael Berthon-Jones Mask and components thereof
US20060207600 Mar 17, 2006 Sep 21, 2006 Kevin Burrow Face mask strap system
US20060225740 Jun 8, 2006 Oct 12, 2006 Ric Investments, Llc. Patient interface and headgear connector
US20060231102 Jun 19, 2006 Oct 19, 2006 Bordewick Steven S Face mask support
US20060231103 Mar 14, 2006 Oct 19, 2006 Matula Jerome Jr Patient interface device
US20060272646 May 25, 2006 Dec 7, 2006 Ric Investments, Llc. Patient interface device with universal headgear mounting member
US20060283452 Jun 17, 2005 Dec 21, 2006 Brian Woodard Gas exhaust system for a gas delivery mask
US20060283458 Jun 17, 2005 Dec 21, 2006 Brian Woodard System and method for securing a gas delivery mask onto a subject's head
US20070028919 Jul 31, 2006 Feb 8, 2007 Ric Investments, Llc Mask mounting mechanism
US20070044797 Aug 11, 2006 Mar 1, 2007 Ric Investments, Llc. Mask mounting mechanism
US20070062539 Nov 22, 2006 Mar 22, 2007 Resmed Limited Nasal assembly
US20070107723 Nov 15, 2005 May 17, 2007 Maraha Berg Pediatric tracheostomy mask
EP0988869A2 Aug 17, 1999 Mar 29, 2000 Siemens Elema AB Breathing apparatus
EP1025875B1 Feb 3, 2000 Jun 21, 2006 Teijin Limited Nasal resuscitator mask
EP1327458A1 Jan 8, 2003 Jul 16, 2003 Resmed Limited Flow diverter for controlling the pressure and flow rate in a CPAP device
EP1356843B1 Apr 23, 2003 Dec 30, 2009 Resmed Limited Ergonomic and adjustable respiratory mask assembly with elbow assembly
FR1083873A Title not available
JP2000102615A Title not available
JP2003175106A Title not available
WO2001000266A2 Mar 7, 2000 Jan 4, 2001 Mallinckrodt Inc. Device for positioning a breathing apparatus
WO2003028613A2 Sep 5, 2002 Apr 10, 2003 Advanced Circulatory Systems, Inc. Face mask ventilation/perfusion systems and method
WO2005032634A1 Oct 8, 2004 Apr 14, 2005 Fisher & Paykel Healthcare Limited Breathing assistance apparatus
WO2005039680A1 Oct 22, 2004 May 6, 2005 Equipements Medicaux Et Moyens Avances-E.2.M.A (Sa) Holding device for a respiratory mask
1 International PCT Search Report with Written Opinion, PCT/US2006/023090, 19 pages, Mailed Oct. 30, 2006.
2 International PCT Search Report, PCT/US2006/023083, 3 pages, Mailed Oct. 4, 2006.
3 International PCT Search Report, PCT/US2006/023100, 2 pages, Mailed Oct. 17, 2006.
4 International PCT Search Report, PCT/US2006/023234, 3 pages, Mailed Oct. 13, 2006.
5 International Preliminary Report on Patentability PCT/US2006/023083, 7 pages, Jan. 3, 2008.
6 International Preliminary Report on Patentability PCT/US2006/023090, 10 pages, Jan. 3, 2008.
7 International Preliminary Report on Patentability PCT/US2006/023100, 6 pages, Jan. 3, 2008.
8 International Preliminary Report on Patentability PCT/US2006/023234, 7 pages, Jan. 3, 2008.
9 International Search Report with Written Opinion, PCT/US2006/023083, 12 pages, Oct. 4, 2006.
10 International Search Report with Written Opinion, PCT/US2006/023090, 19 pages, Oct. 30, 2006.
11 International Search Report with Written Opinion, PCT/US2006/023100, 10 pages, Oct. 17, 2006.
12 International Search Report with Written Opinion, PCT/US2006/023109, 13 pages, Oct. 6, 2006.
13 International Search Report with Written Opinion, PCT/US2006/023110, 4 pages, Oct. 9, 2006.
14 International Search Report with Written Opinion, PCT/US2006/023234, 11 pages, Oct. 13, 2006.
US9149596 * Mar 24, 2008 Oct 6, 2015 Resmed Limited Release mechanism for patient interface and method for releasing patient interface
U.S. Classification 128/206.24, 128/206.27, 128/205.25, 128/207.11
Cooperative Classification A61M16/0611, A61M16/06, A61M16/0633, A61M16/0683 | [
{
"key": "website_description",
"type": "global",
"value": "This website is a search engine provided by Google. Handling over 3.5 billion searches per day, it has a 92% share of the global search engine market."
}
] |
Best 15 Gardeners, Lawn Care and Sprinklers in Winslow, AR | Houzz
Gardeners & Lawn Care near Winslow
28 Winslow, AR Gardeners, Lawn Care and Sprinklers
Do you get yard envy when you see your Winslow neighbors’ lush garden, and bemoan your lack of a green thumb? If you want a bountiful yard without doing a bounty of yard work, hire a gardener in Winslow, AR! From lawn maintenance to plant cultivation to weeding to general landscaping, Winslow, AR gardeners have the expertise and experience to create an abundant garden for you that will be the cause of neighborhood yard envy! More
Click to call22.1 miles from Winslow, AR
Click to call20.7 miles from Winslow, AR
Click to call16.6 miles from Winslow, AR
Mj Mitchell Enterprises Inc.
Red Wolf Consulting Inc
ABISYSTENS Advanced By Irrigation
Dean Brothers Landscaping & Maintenance Inc
Featured Reviews for Winslow, AR Gardeners, Lawn Care and Sprinklers
Winslow, AR Gardeners, Lawn Care and Sprinklers
If your speed is more “rock garden” than “green garden,” hiring a gardener to tend to your Winslow, AR yard is a no-brainer. They perform a wide range of services, including:
In addition to the maintenance side of gardening, Winslow, AR gardeners can help you with garden design and choosing specific plants and grass types for your climate and area.
Find a Winslow, AR gardener on Houzz. Narrow your search in the Professionals section of the website to Winslow, AR gardeners. You can also look through Winslow, AR photos to find examples of yards that you like, then contact the Arkansas contractor who worked on them.
Before you hire a gardener or lawn care service in Winslow, Arkansas, shop through our network of over 28 local gardeners, lawn care and sprinklers. Read through customer reviews, check out their past projects and then request a quote from the best gardeners, lawn care and sprinklers near you.
Winslow Architects and Building Designers · Winslow Design-Build Firms · Winslow General Contractors · Winslow Home Builders · Winslow Interior Designers and Decorators · Winslow Landscape Architects and Designers · Winslow Landscape Contractors · Winslow Swimming Pool Contractors · Winslow Flooring Contractors · Winslow Hot Tub and Spa Dealers · Winslow Spa and Pool Maintenance Professionals · Winslow Chimney Services · Winslow Carpet Cleaners and Upholstery Cleaners · Winslow Exterior House Cleaning Services · Winslow Air Duct Cleaners · Winslow Glass, Mirror and Shower Door Contractors · Winslow Handyman Services · Winslow House Cleaning Services · Winslow Movers · Winslow Pest Control Services · more... | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American website, online community and software for architecture; interior design and decorating; landscape design and home improvement. It was founded in 2009 and is based in Palo Alto, California."
}
] |
The Quattro Cento and Stones of Rimini: A Different Conception of the Italian Renaissance by Adrian Stokes | NOOK Book (eBook) | Barnes & Noble® B&N Top 100 NY Times Bestsellers
by Adrian StokesAdrian Stokes
English 1351748572
9781351748575 | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American bookseller. It is a Fortune 1000 company and the bookseller with the largest number of retail outlets in the United States."
}
] |
Sportsmail's Jamie Carragher talks to AC Milan legend Paolo Maldini
Maldini reveals how he felt after Champions League final in 2005
Former defender reveals his opinion on the current Milan side
CLICK HERE to read Carragher's interview with the Italian icon
CLICK HERE to read the best 10 quotes from the interview
Published: 17:00 EDT, 22 May 2015 | Updated: 18:54 EDT, 22 May 2015
AC Milan icon Paolo Maldini invited Sportsmail columnist and Liverpool hero Jamie Carragher to his Milan home for an exclusive interview earlier this week.
Here is the full transcript as Maldini reveals all about his Champions League final experiences against Liverpool and his favourite ever Milan side.
AC Milan icon Paolo Maldini (left) sits down for a chat with Sportsmail columnist Jamie Carragher
Maldini, who made 902 appearance for Milan, talks Champions League finals and playing against Liverpool
AC Milan legend Paolo Maldini talks to Jamie Carragher about... Paolo Maldini on not sleeping for three months after... AC Milan legend Paolo Maldini launches Miami FC to play in... Liverpool ace Lucas Leiva includes Steven Gerrard, Luis...
CARRAGHER: Here we are 10 years after we first played against each other in the Champions League final. Now things are very different to 2005 and both of our teams have struggled this season. It hurts me when Liverpool lose - are you the same with Milan?
MALDINI: Of course! I started there when I was 10 and finished when I was 41. My father, Cesare, was captain, my kids are in the academy now. Milan is not just a team for me. It is part of my life. My family loves those colours. But you know what? When I see it (like it is now), I feel sad. We built with other great players something unique and they didn’t realise the importance of the men and the people. You know what? Only Franco Baresi works there now. No other former players. That is sad. Milan have a great tradition and they completely let it go. So the new generation, they do not understand. There is all that history of the club but now it is different.
CARRAGHER: Do you think, when you are watching, that you would like to help?
MALDINI: I would love to! I received a lot of things from my club. I gave them my passion and my body because I cannot walk now (laughs)! But I’d just love to give back something, to give them my experience. The kids are not so bad but they need someone who can give them the right way to follow... but I don’t think it is going to happen.
CARRAGHER: When I was growing up, Milan were the team. I used to watch the teams of Arrigo Sacchi and Fabio Capello on TV all the time. Last week, when I was in Madrid, I saw Sacchi and he was speaking about you and that team. What influence did he have on you?
MALDINI: He was very tough. Training used to be a little bit crazy. He’d work you hard, then work your mind. He would make you repeat the same things over and over, especially defenders. Every day we’d do the same thing. But if me, Baresi, (Alessandro) Costacurta and (Mauro) Tassotti meet each other now, we can still play as we did in the 1990s. It is stuck in your mind. That was one of the secrets of our success. It helped the Milan legend to continue. That team played at that level (raises hand in air) for so long. I won my first Champions League in 1989 and I won my last one 18 years later. But now? It’s a pity.
CARRAGHER: So, Paolo, are we OK to talk about Istanbul?!
MALDINI: Yes, of course! I didn’t sleep for three months after it but, come on, let’s go.
CARRAGHER: Does the game get spoken about in Milan?
MALDINI: Yes, sometimes. If you watch the first half, you cannot imagine we would lose. But sometimes people don’t remember - you will because you were there - it wasn’t only in the first half we played good. It was only six crazy minutes. After that, we started to play again and we had chances to score. I remember Steven Gerrard playing as a defender. People on your team were physically destroyed.
CARRAGHER: I watched the European Cup final when you beat Steaua Bucharest 4-0 in Barcelona in 1989. Your performance was possibly better in Istanbul?
MALDINI: We couldn’t have done anything better. The crazy thing is we arrived in Milan and the supporters were waiting for us. They were screaming: ‘What have you done?!’ We put everything into it. We played maybe our best final, with the exception of 1994 (a 4-0 win over Barcelona). I thought it was my last chance to win it and it had gone. And the game was crazy. I scored - I scored! It was the quickest goal in a final!
CARRAGHER: At half-time, you were leading 3-0. Could you believe how easy it had been?
MALDINI: I know a story came out that we celebrated at half-time. You know that it was impossible. When we got into the locker room it was crazy. People were screaming at each other, like they were fighting. So Ancelotti turns to everyone and says: ‘Shut up! For five minutes, I don’t want to hear any of you! I don’t want to hear one word!’ So we completely shut up, we calmed down and then we started to talk about what we had done good, what was not so good and we started thinking about the second half. That was it. Inside, I thought to myself, ‘We have a big chance’, but I didn’t say anything. Nobody did.
CARRAGHER: If you are losing 3-0 to a team you know you are better than, you always have a chance. But this was AC Milan! I was thinking: ‘4-0 Barcelona; 4-0 Steaua Bucharest; this could be five or six.’ What do you think changed?
MALDINI: You know, something happened in the second half - your fans. They started to sing and sing. Don’t forget usually the stadium is 50-50 but it was 75 per cent Liverpool, 25 per cent Milan. Our fans had sold their tickets to Liverpool fans. I remember the first goal. I could see Gerrard and (Jaap) Stam and I was about to shout: ‘Be careful! He’s coming!’ But then I didn’t say anything. Then the ball comes in and Gerrard scores. I say to myself: ‘Oh s***! Why didn’t you say something?’
CARRAGHER: Was the second goal (from Vladimir Smicer) the turning point for you?
MALDINI: Yeah. That changed a lot. All of a sudden, you are one goal from the tie. But when it got to 3-3, we started again and we had chances. The psychology of the game can change when you get to 3-3. Maybe you started to think you had something to lose.
CARRAGHER: What of Gerrard’s performance in that game? He played three different positions. Do people still talk about him in Italy?
MALDINI: I still remember his face and the pain he was in from cramp but he was still going around tackling everybody. He put everything into it. For you guys, he was an example for all the others.
CARRAGHER: It must have been so difficult when we were celebrating. There is a picture of you shaking my hand. Even after all you had won, I could still see hurt in your face, but you were still able to show class with your reaction.
MALDINI: You have to accept the result, even if it is so sad for you. But we were also lucky because two years later we got a small chance for revenge. We didn’t play that good in Athens but we won.
CARRAGHER: Did you want to play Liverpool again in 2007 then after what had happened?
MALDINI: No. Noooo! We didn’t play well in that final. We had not played well that whole year, in fact, but when we got to the quarter-finals it started to get better. Still, in that final, we had everything to lose. Another defeat by Liverpool would have been a real tragedy. But you cannot choose your opponents. I hadn’t played for three months before and in the final my knee was completely gone. I wasn’t able to play that game and Ancelotti knew it. But I tried. I took so many painkillers in those three months! And it is funny - I don’t remember too much about that game.
CARRAGHER: Neither do I. I’ve never watched the game. Not once. When you lose something that big . . .
MALDINI: All I remember is lifting the cup. We celebrated for 36 hours. After the party finished, I went straight to a surgeon in Belgium. My knee had completely gone. What I do remember most is waking up after the anaesthesia, probably another 24 hours later. I started thinking to myself, ‘Did I win? Did I win?’ Ten seconds later... ‘Yes! We won!’ It was crazy.
CARRAGHER: So that was your eighth final and your fifth win. Which was your best victory?
MALDINI: (Francisco) Gento also played in eight finals (for Real Madrid), but he won six. Still, my record isn’t too bad! Each victory was different. The first was special because it was the first. We played in Barcelona in front of 90,000 AC Milan supporters. Arriving to the stadium was the greatest experience I have had in my life. It was like for you in Istanbul. Great, great. Then Barcelona in Athens was also very good.
CARRAGHER: Which was the best AC Milan team you played in? The 1989 one with Marco van Basten and Ruud Gullit or the one five years later?
MALDINI: Everything started with Sacchi. The three Dutch players coming in. But when Capello came in, we had great, great players. From 1991-94 that was probably the best one. Every year we bought big. We had Gullit on the right with Tassotti behind him. Van Basten, (Daniele) Massaro, (Jean-Pierre) Papin, (Zvonimir) Boban, (Dejan) Savicevic. Wow. It was something else.
CARRAGHER: Is Van Basten the best you played with or against?
MALDINI: Oh yes. Right foot. Left foot. Heading, so strong, fast. He could score, he could pass the ball. He was the best. The way he played was timeless. He had to quit when he was 28. Surgery. Stupid surgery to the ankle. It was such a pity.
CARRAGHER: And how about the best defender? How big an influence was Baresi on you? Was he the boss of the defence? What made him special?
MALDINI: That’s exactly it. He was special. He was a short, skinny guy but so strong. He could jump so high. The way he played on the field was an example for everybody. He wasn’t a big speaker, no, no, no. The way he played, the way he trained was an example. He wasn’t like Stam, a big guy who was strong and fast. He had pace, but he was only 70kg. But let me tell you - when he hit you with a tackle, he was so strong. For me, he was the role model. He was a reference. He was also very good with the ball. Very, very good. It is very hard to find a good defender, who is strong and good with the ball. Very hard.
CARRAGHER: In England, when I was growing up, children who wanted to be defenders would say your name or Baresi. There were others like Lilian Thuram, Marcel Desailly and Fabio Cannavaro. What do you think of the standards now?
maldini: There are no more defenders. A great defender makes the market much more than a striker. Also you know what happened? I used to play at left back. Now a left back is judged only on what he is doing with the ball. They don’t think about what they are doing in defence. They are just watching what you are doing when you are attacking. I know that the hard part is defending. I know it because with Sacchi everyone was defending, from the strikers to the goalkeeper. In Italy, we had a great tradition for defenders, but now we don’t have any more. I don’t know why. I believe that Thiago Silva is the best in the world right now.
CARRAGHER: Did you ever have a chance to come to England and is there any part of you that regrets not coming? Everyone would have been delighted to see you in the Premier League.
MALDINI: I had an offer from Manchester United, but I didn’t speak directly to them. Luca Vialli, when he was Chelsea manager, called me. That was in 1996. We’d had a very bad season. There was also something from Arsenal, but I never spoke to them directly. I would have said no anyway. Vialli was a friend of mine and he was the only one who made me think. I had some problems with my team and the supporters at that time. I thought, just for one day, ‘What if?’ But then, no.
CARRAGHER: You also had the chance to coach at Chelsea.
MALDINI: The offer came only one week after my last game for Milan. I wasn’t ready. I didn’t want to move my family to London. I went there. I spoke to Mr Abramovich. I spoke to Ray Wilkins, who I had played with at Milan. I don’t know. I decided not to do it.
CARRAGHER: So what do you think of football in England then? And do you ever see a time when Italian clubs will dominate like they did in the 1990s?
MALDINI: Yes, I watch. It is still England. You are still physically strong. You have teams like Manchester City and Liverpool and they play the ball. But it is a completely different league to anywhere else. You have great players that cannot play over there because the league is too (physically) strong. For Italian clubs, it is going to take a while. There is less money. Horrible stadiums. You have to cut the problem with violent supporters. Families with their kids don’t go any more. They say Milan are trying to build a new stadium, but I don’t know if it will happen. Also I believe Milan needs a stadium bigger than 45,000. It needs 60,000 at least if you want to go back to that level. The San Siro is still beautiful, but it is very old.
CARRAGHER: But I want to see Milan back - it is just the name, the kit, the history. I feel the same about Liverpool.
MALDINI: I want to see it too, you know. All our historic rivals, Real, Barcelona, Liverpool - I want to see Milan up there. It is nice to play these teams with great histories. It is very sad when you see them going down.
CARRAGHER: If you don’t know what the future holds for Milan, what does it hold for you? You have just launched a project in Miami, but do you see yourself being a manager?
MALDINI: No. I don’t like it. I really don’t like it. I still go to most of the Milan games with my friends. I love football. But I’m probably not going to work with Milan. For the moment, I’m a father full time. But a chance to work again with Milan? For me it would be giving back something. | [
{
"key": "website_description",
"type": "global",
"value": "This website is the website of the Daily Mail, a newspaper in the United Kingdom, and of its sister paper The Mail on Sunday. MailOnline is a division of dmg media, which is owned by Daily Mail and General Trust plc."
}
] |
Become a Badass Manifestor Tickets, Sat, Apr 29, 2017 at 10:00 AM | Eventbrite
by Kelsey J Patel
360 South La Brea Avenue Los Angeles, CA 90036 View Map
You are manifesting right now, whether you know it or not. Your thoughts inform every action building the way your life looks and feels. Are you a conscious or unaware manifestor? That’s the question.What:
During this Saturday morning workshop, Kelsey and Ryan come together to combine their unique talents and guide you through a series of key identifiers, meditation, EFT, reiki and more to help you see the real life you want reflected back to you. You'll look at all the crap getting in the way of how you most want to feel - the things that weigh you down, trigger your anxiety and motivate you to create less than inspired career and relationship choices. They will help you see what you can’t. During the workshop, you will clean out those blocks so you have the space to get clear on what you want, how you want to manifest and where you want to go from here in your life. They will help open you up to more possibility than you may have ever imagined for yourself. From there, you will explore and identify what immediate and long term actions need to be taken. Each participant will receive an energetic crystal to support these actions and shifts, along with a written plan to work with, live by and assist in the manifesting that takes place. The intention:
You, like all of us, are here to recognize that you are so much more than what your brain tells you. You are more than your body, your personality, your past. You are here to remember that you are All of Life. It's up to you to take action accordingly to create the miraculous life you crave and be the badass manifestor that you really are inside. ABOUT RYAN AND KELSEY:
Ryan Weiss is LA's highly sought after Performance Coach for Creatives, leading his clients on a three month journey from anxiety to freedom, self loathing to confidence, sticky blocks to creative inspiration. His methodology combines ancient meditation practices with cutting edge wellness, movement, motivation and psychology to promote powerful thinking and committed action. His clients tap back into WHY they do what they do to access a newfound connection with a creativity that solves the problems at hand. Ryan is a certified Kundalini Yoga and Meditation Teacher as well an expert on the teachings of various wisdom traditions focusing mostly on the metaphysical text A Course In Miracles.
Kelsey J. Patel is one of Hollywood’s leading wellness and reiki experts. She has dedicated her life’s work to helping her clients live vibrant, joy-filled and abundant lives. Through her public speaking, Fortune 500 consulting, workshops, classes, and private client sessions, she utilizes various techniques to bring about healing, clarity, relaxation, purpose, awareness, inspiration and motivation to her clients. Her work includes empowerment coaching, reiki, meditation, intuitive healing, mindfulness exercises and EFT (Emotional Freedom Technique). Read more | [
{
"key": "website_description",
"type": "global",
"value": "This website is an American event management and ticketing website. The service allows users to browse, create, and promote local events."
}
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.