id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
84 | https://bio-protocol.org/en/bpdetail?id=84&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Thioglycollate Induced Peritonitis
Zheng Liu
In Press
Published: Jun 20, 2011
DOI: 10.21769/BioProtoc.84 Views: 33367
Ask a question
Favorite
Cited by
Abstract
Intraperitoneal (i.p.) injection of thioglycollate elicits a robust influx of neutrophils into peritoneal cavity. The trafficking of the cells is believed to be mediated by chemokines CXCL1, CXCL2, and CXCL8 (Call et al., 2001; Cacalano et al., 1994). Thus this model can be used to test the ability of neutrophils to migrate towards these chemokines in bioengineered mouse strains (e.g. knockout or transgenic mice) or the ability of certain molecules to inhibit the chemoattractive activities of these chemokines (e.g. small molecules or inhibitory antibodies). This protocol has been used by the author successfully to test the functions of a viral multi-chemokine inhibitor.
Keywords: Mouse model Peritonitis Inflammation Thioglycollate
Materials and Reagents
Antibodies
Rat anti-mouse Gr-1 PE (BD Biosciences, catalog number: 553129 )
Rat anti-mouse CD11b FITC (Southern Biotech, catalog number: 1560-02 )
Other materials
Mice
PBS
4% sterile thioglycollate (Sigma-Aldrich, catalog number: 70157 ) in ddH2O
Note: Thioglycollate solution needs to be wrapped with aluminum foil to avoid light and be placed at room temperature to age for several weeks until it turns to brown in color. The aging process is critical to the ability of thioglycollate to induce peritonitis.
Equipment
6G1/2 needle
18G1/2 needle connected with a 10 ml syringe
BD LSR II flow cytometer
Procedure
Inject intraperitoneally mice with 1 ml of 4% sterile thioglycollate.
Two hour later, anesthetize the mice.
The influx of neutrophils is at peak around this time point. Users need to wait for 48 h before they anesthetize the mice, should they wish to observe monocyte influx.
Cut a small opening at the lower abdomen to expose the underneath muscle.
Note: Do not compromise the integrity of peritoneal cavity.
Slowly inject 10 ml ice cold PBS into peritoneal cavity using a 26G1/2 needle.
Note: Some protocols suggest using PBS containing low concentrations of EDTA to achieve maximal yield of peritoneal cells.
Remove the needle.
Hold the mouse by tail and swish around for 3 min to wash peritoneal cavity extensively.
Lay the mouse by the side and insert an 18G1/2 needle connected with a 10 ml syringe.
Retrieve maximal amount of PBS by slowly pulling out the plunge.
Record the volume of PBS retrieved.
Spin down the cells at 1,200 RMP at 4 °C for 5 min.
Discard supernatant and resuspend cells with 100 μl of 3% FBS containing 1: 200 anti-GR-1 PE and anti-CD11b FITC.
Incubate at room temperature for 15 min.
Wash with 1 ml PBS and spin down at 1,200 RMP at 4 °C for 5 min.
Discard supernatant and resuspend cells with 200 μl PBS.
Acquire the entire 200 μl of cells on flow cytometer.
Calculate the numbers of Gr-1highCD11bhigh cells and adjust the numbers to the volume of retrieved PBS.
I.e. if the volume of retrieved PBS is 9 ml, then the total number of neutrophils per peritoneal cavity = (calculated number of Gr-1highCD11bhigh cells x 10 ml)/9 ml
Notes
Some protocols prefer to decide cell numbers simple by counting cells using hemocytometer. The numbers obtained by such method may not accurately reflect the number of neutrophils because there are other types of cells such as B1 B cells and macrophages in peritoneal cavity.
Acknowledgments
This protocol was developed or modified in Dr. Anne Davidson’s lab at Feinstein Institute for Medical Research, NY, USA. This work was supported by grants from the NY SLE Foundation (RB), Rheuminations, NIH AI082037 and AR 049938-01, NIH (PO1 AI51392 and the Flow Cytometry and Protein Expression and Tetramer Cores of PO1 AI51392).
References
Call, D. R., Nemzek, J. A., Ebong, S. J., Bolgos, G. L., Newcomb, D. E. and Remick, D. G. (2001). Ratio of local to systemic chemokine concentrations regulates neutrophil recruitment. Am J Pathol 158(2): 715-721.
Cacalano, G., Lee, J., Kikly, K., Ryan, A. M., Pitts-Meek, S., Hultgren, B., Wood, W. I. and Moore, M. W. (1994). Neutrophil and B cell expansion in mice that lack the murine IL-8 receptor homolog. Science 265(5172): 682-684.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Immunology > Animal model > Mouse
Immunology > Immune cell function > Cytokine
Cell Biology > Cell movement > Cell migration
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
840 | https://bio-protocol.org/en/bpdetail?id=840&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extravillous Trophoblast Migration and Invasion Assay
MA Magdalena Angelova
HM Heather L. Machado
KS Kenneth F. Swan
CM Cindy Morris
DS Deborah E. Sullivan
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.840 Views: 10746
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Oct 2012
Abstract
Extravillous trophoblast (EVT) migration and invasion through the decidualized endometrium is essential to successful placentation. SGHPL-4 cells, an EVT cell line derived from first trimester placenta, is a widely used model of cytotrophoblast differentiation into an invasive phenotype. Here we describe a quantitative cell migration assay that can be modified to also measure cell invasion. SGHPL-4 cells were seeded into BD Fluoroblok cell culture inserts constructed with an 8 μm porous membrane and allowed to migrate towards epidermal growth factor, a known chemoattractant for EVTs. To assess EVT invasion, Fluoroblok inserts were first coated with Matrigel, a basement membrane matrix. SGHPL-4 cells were labeled with calcein AM and cells that had invaded and/or migrated across the membrane were quantified by a bottom-reading fluorescence plate reader. The advantage of the Fluoroblok inserts over other migration/invasion assays is that they allow nondestructive detection of migrated cells.
Materials and Reagents
SGHPL-4 cells (Kindly provided by Dr. Guy Whitley, St. George’s University of London)
Ham’s F10 Nutrient Mix (Life Technologies, InvitrogenTM, catalog number: 11550-043 )
Fetal bovine serum (FBS)
Dulbecco’s Phosphate-Buffered Saline (DPBS) without Ca2+ and Mg2+ (Life Technologies, InvitrogenTM, catalog number: 14190 )
TrypLE Express (Life Technologies, InvitrogenTM, catalog number: 12604013 )
Matrigel, Growth Factor Reduced, Phenol Red Free (BD Biosciences, catalog number: 356231 )
Recombinant Human Epidermal Growth Factor (hEGF) (BD Biosciences, catalog number: 354052 )
BD Falcon HTS FluoroBlok Inserts (BD Biosciences, catalog number: 35112 )
Calcein AM (Life Technologies, InvitrogenTM, catalog number: C3100MP )
Hank’s balanced salt soution (HBSS) (Life Technologies, InvitrogenTM, catalog number: 14025 )
Equipment
Centrifuge
37 °C, 5% CO2 Cell culture incubator
Inverted Fluorescent Microscope
Fluorescent plate reader
Procedure
DAY 1
For Invasion Assay, pre-Coat Fluoroblok Filter (8 μm porous membrane)
Prechill Fluoroblok inserts, companion plates and pipet tips to help maintain Matrigel in the liquid state.
Place desired number of prechilled inserts into a 24-well companion plate.
Add 50 μl of 1:10 Matrigel (diluted in HamF10) to each transwell insert.
Incubate at 37 °C, 3 h.
Serum starve cultures (70-75% confluent) for 24 h in 0.5% FBS/HamF10
Aspirate media.
Wash with 7 ml warm DPBS (without Ca2+ and Mg2+).
Add 12 ml warm 0.5% FBS/HamF10.
Incubate cells for 24 h at 37 °C.
DAY 2
Prepare cells (Upper Chamber)
Rinse cells once with 10 ml DPBS (without Ca2+ and Mg2+); add 3 ml TrypLE Express and incubate at 37 °C for 3-5 min; add 7 ml 0.5% FBS/HamF10 →10 ml total.
Count cells using a hemacytometer.
In a 50 ml conical tube, centrifuge cells at 300 x g for 10 min.
Remove supernatant and resuspend cells in 0% FBS/HamF10 to obtain a cell suspension concentration of 1.2 x 106 cells/ml (or 1,250 cells/μl).
Cap tube and store at room temperature till ready to load in chamber.
Prepare the chemoattractant (Treatments in Bottom Chamber)
Dilute desired chemoattractant in 0% FBS/HamF10. You will need 800 μl per well.
Prepare 10 ng/ml EGF as positive control.
Add 800 μl of chemoattractant to the bottom of each well. Avoid bubbles.
Assemble invasion chamber
Using a forceps, carefully remove insert from empty well.
Add 200 μl of cells (2.5 x 105 for Invasion Assay or 5 x 104 for Migration Assay) to Matrigel-coated (for Invasion Assay) or uncoated insert (for Migration Assay).
Lower the insert at an angle into the well containing the chemotactic substance. Check for bubbles by looking under the plate. If there are bubbles, remove insert and try again.
Incubate at 37 °C for 12 h for Cell Migration Assay or 20-22 h for Cell Invasion Assay.
DAY 3
After invasion period, label invaded cells (on lower side of filter) with Calcein AM. For each well, add 2 μl of Calcein AM to 500 μl of HBSS.
Carefully aspirate the media from the insert, without disturbing the Matrigel layer.
Transfer the insert to a fresh well containing Calcein AM/HBSS solution.
Incubate at 37 °C for 1 h in the dark.
Read plate on fluorescent plate reader at 520 nm or take pictures using an epifluorescent microscope.
Acknowledgments
This protocol is adapted from Angelova et al. (2012).
References
Angelova, M., Zwezdaryk, K., Ferris, M., Shan, B., Morris, C. A. and Sullivan, D. E. (2012). Human cytomegalovirus infection dysregulates the canonical Wnt/beta-catenin signaling pathway. PLoS Pathog 8(10): e1002959.
LaMarca, H. L., Ott, C. M., Honer Zu Bentrup, K., Leblanc, C. L., Pierson, D. L., Nelson, A. B., Scandurro, A. B., Whitley, G. S., Nickerson, C. A. and Morris, C. A. (2005). Three-dimensional growth of extravillous cytotrophoblasts promotes differentiation and invasion. Placenta 26(10): 709-720.
Warner, J. A., Zwezdaryk, K. J., Day, B., Sullivan, D. E., Pridjian, G. and Morris, C. A. (2012). Human cytomegalovirus infection inhibits CXCL12- mediated migration and invasion of human extravillous cytotrophoblasts. Virol J 9: 255.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Angelova, M., Machado, H. L., Swan, K. F., Morris, C. and Sullivan, D. E. (2013). Extravillous Trophoblast Migration and Invasion Assay. Bio-protocol 3(15): e840. DOI: 10.21769/BioProtoc.840.
Download Citation in RIS Format
Category
Cell Biology > Cell movement > Cell migration
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Spherical Invasion Assay: A Novel Method to Measure Invasion of Cancer Cells
Stephen D. Richbart [...] Piyali Dasgupta
Feb 20, 2022 3603 Views
Cell-derived Matrix Assays to Assess Extracellular Matrix Architecture and Track Cell Movement
Kendelle J. Murphy [...] David Herrmann
Dec 20, 2022 1551 Views
Analysis of Mouse Brain Sections by Live-cell Time-lapse Confocal Microscopy
Tao Yang [...] Bing Ye
Apr 5, 2023 736 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
841 | https://bio-protocol.org/en/bpdetail?id=841&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo Neurogenesis
Désirée R. M. Seib
Ana Martin-Villalba
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.841 Views: 13249
Reviewed by: Lin Fang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cell Stem Cell Feb 2013
Abstract
This protocol shows how to characterize the dynamics of hippocampal neurogenesis in the adult mouse by describing preparation of brain tissue, immunofluorescence of brain sections and confocal stereotactic cell counting.
Materials and Reagents
Mice
5-Bromo-2′-deoxyuridine (BrdU) (Sigma-Aldrich, catalog number: B5002 )
0.9% sterile sodium chloride (NaCl) (Fresenius Kabi)
Ketamine hydrochloride (Ketavet, 100 mg/ml) (Pfizer)
Xylazine hydrochloride (Rompun, 20 mg/ml Xylazine) (Bayer)
4% Paraformaldehyde in phosphate buffer (4% Roti-Histofix) (Roth, catalog number: P087.1 )
Hank’s balanced salt solution (HBSS) (Life Technologies, InvitrogenTM, catalog number: 14170-138 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 31434 )
Sodium phosphate dibasic heptahydrate (Na2HPO4.7H2O) (Sigma-Aldrich, catalog number: S9390 )
Sodium phosphate monobasic monohydrate (NaH2PO4.H2O) (Roth, catalog number: K300.2 )
Potassium chloride (KCl) (AppliChem GmbH, catalog number: A3582 )
Potassium phosphate monobasic (KH2PO4) (GERBU Biotechnik GmbH, catalog number: 2018 )
Hydrochloric acid (HCl, 37%) (Sigma-Aldrich, catalog number: 30721 )
Trizma base (Sigma-Aldrich, catalog number: T1503 )
Horse serum (Biochrom, catalog number: S9135 )
Triton X-100 (Sigma-Aldrich, catalog number: X-100 )
Boric acid (Fluka, catalog number: 15660 )
Sodium tetraborate decahydrate (Sigma-Aldrich, catalog number: S9640 )
Hoechst (33342) (dilute with H2O to 10 mg/ml) (Biotrend, catalog number: 40047 )
Sodium azide (Sigma-Aldrich, catalog number: S2002 )
Superglue
Antibodies (see Table 1 and 2)
Agarose (AppliChem GmbH, catalog number: A8963 )
Phosphate buffered saline (PBS) (20x) (see Recipes)
TBS (10x) (see Recipes)
TBS++ (see Recipes)
Boric buffer (see Recipes)
0.1 M Phosphate buffer (PB) (see Recipes)
Mowiol (Merck/Calbiochem, catalog number: 475904 ) (see Recipes)
Equipment
Syringe (1 ml syringe 27 G for i.p. injections)
0.5 ml Eppendorf Safelock tubes
15 ml and 50 ml Falcon tubes
Petri dish
Micro dissecting scissors
Forceps
Leica VT1200 Vibratome
Brush to transfer slices
Netwell carriers and plates (Corning Incorporated, catalog number: 3477 and 3520 )
Rocking platform
Tube roller mixer
Microscope glass slides
Cover slips
Confocal microscope
Shaker
Centrifuges
Software
ImageJ
Procedure
BrdU administration
Mice are injected intraperitoneal (i.p.) with 300 mg/kg bodyweight BrdU (15 mg/ml diluted in 0.9% NaCl) and perfused after 24 h to analyze proliferation of neural progenitor cells.
Alternatively, to study survival and differentiation of new-born cells mice are injected i.p. on three consecutive days with 300 mg/kg bodyweight per day BrdU and perfused 4 weeks after to analyse BrdU-positive cells.
Transcardial perfusion
Animals are anesthetized with an overdose of Rompun (14 mg/kg bodyweight) and Ketavet (100 mg/kg bodyweight) in 0.9% NaCl.
Mice are transcardially perfused with 30 ml HBSS followed by 10 ml of 4% paraformaldehyde (PFA) dissolved in 0.1 M phosphate buffer pH 7. For transcardial perfusion the thorax cavity is opened, and the right auricle cut with a scissor to allow bleeding. A butterfly cannula is introduced into the left ventricle and mice are perfused with 30 ml HBSS followed by fixation with 10 ml 4% PFA.
Brains are removed and post-fixed overnight in 10 ml 4% PFA in 0.1 M phosphate buffer pH 7 in a 15 ml Falcon tube on a tube roller mixer at 4 °C.
Tissue is washed twice with PBS and may be stored in PBS with 0.01% sodium azide for up to a year.
Vibratome cutting
For coronal vibratome sections (see Figure 1)
The cerebellum is cut, removed.
The brain glued upright with the cutting site using superglue onto the holder plate of the vibratome.
Coronal sections may have a thickness of 50 μm or 100 μm.
Note: The NeuN antibody does not very well penetrate 100 μm thick sections. If you have to use 100 μm thick sections primary antibody incubation should be 72 h.
For sagittal brain sections (see Figure 1)
Sagittal brain sections are embedded in 2% agarose in PBS.
The brain is then glued in a solid gel block on the lateral side to the holder plate.
Sagittal sections are cut 100 μm thick.
Agarose can be removed from the slices after cutting or may be kept during the staining process in order to stabilize the tissue (especially olfactory bulbs).
Sections are stored in PBS with 0.01% sodium azide at 4 °C. Tissue might be used for up to one year after perfusion.
Figure 1. Overview of neurogenic niches in coronal and sagittal brain sections (SVZ: subventricular zone; DG: dentate gyrus)
Immunofluorescence staining
For each mouse, 6 coronal brain slices (50 μm thick) 250 μm apart are stained, starting from the first slice, when both, upper and lower blade of the DG, are present on the slice. If saggital sections are used, 3 slices from each hemisphere 3 slices (300 μm) apart are used. Brain sections are placed in net carriers in 12 well plates (2 slices per well) filled with 4 ml 0.1 M Tris buffer (pH 7.4) supplemented with 0.8% NaCl (TBS). The sections are washed three times in TBS each 15 min at RT on a rocking platform (50 rpm).
BrdU staining
BrdU staining requires DNA denaturization by incubating the brain sections in 2 N HCl (always prepare fresh) at 37 °C on a shaker for 30 min.
Thereafter, sections are neutralized by washing in Boric buffer for 10 min on a shaker at RT.
Next, sections are washed six times in TBS for 15 min each at RT.
Blocking of unspecific antibody binding is performed by incubating sections for 1 h in TBS++ in net carriers at RT.
Sections are transferred to 0.5 ml Eppendorf Safelock tubes (2 sections per tube) containing 200 μl TBS++ and the diluted primary antibodies, and incubated at 4 °C for 24-72 h. For this 12 tubes are put in a 50 ml Falcon and rotated at 4 °C on a tube roller mixer. A selection of primary antibodies is listed in Table 1.
Table 1. Primary Antibody list
Antibody
Host species
Manufacturer
Catalog number
Dilution
anti-BrdU
rat
AbD Serotec
OBT0030CX
1:500
anti-cleaved Caspase-3
rabbit
Cell Signaling
9661
1:200
anti-DCX (C-18)
goat
Santa Cruz
sc-8066
1:250
anti-GFAP
mouse
Millipore
MAB360
1:400
anti-GFAP
rabbit
Millipore
AB5804
1:400
anti-GFP
chicken
Aves
GFP-1020
1:1,000
anti-NeuN
mouse
Millipore
MAB377
1:200
anti-S100β
mouse
Sigma-Aldrich
S2532
1:200
anti-Sox2
rabbit
Abcam
ab92494
1:500
anti-Tbr2 (Eomes)
rabbit
Abcam
ab23345
1:500
Tbr2 Antibody: Some lots work for paraffin sections, others work for the vibratome sections that are used here (see Figure 2). Ask Abcam for information about that or order 2-3 vials to test different lots.
After incubation sections are transferred back to net carriers in 12 well plates, washed three times with TBS at RT.
After blocking in TBS++ for 30 min at RT sections are transferred again into 0.5 ml Eppendorf Safelock tubes containing the diluted secondary antibody mix in TBS++. Sections in Eppdorf tubes in Falcons are incubated in secondary antibodies at 4 °C on a tube roller mixer for 2 h. Secondary antibodies are listed in Table 2. Hoechst 33342 (1:10,000) is used to counterstain DNA and added to the secondary antibody mix.
Table 2. Secondary Antibody list
Antibody
Manufacturer
Catalog number
Dilution
donkey anti-chicken DyLight488
Dianova
703-485-155
1:400
donkey anti-goat Alexa 488
Invitrogen
A-11055
1:400
donkey anti-goat Alexa 456
Invitrogen
A11057
1:400
donkey anti-goat Alexa 647
Dianova
705-605-147
1:400
donkey anti-mouse DyLight488
Dianova
715-485-150
1:400
donkey anti-mouse Alexa 546
Invitrogen
A10036
1:400
donkey anti-rabbit DyLight488
Dianova
711-485-152
1:400
donkey anti-rabbit DyLight 649
Dianova
711-495-152
1:400
donkey anti-rat Alexa 488
Dianova
712-545-150
1:400
donkey anti-rat rhodamine red
Dianova
712-296-150
1:400
Finally sections are placed back into net carriers in 12 well plates washed three times for 15 min with TBS and additionally 4 times for 1 min in TBS at RT.
Sections are floated in 0.1 M PB in a Petri dish, mounted on glass slides and embedded with 100 μl Mowiol.
Confocal microscopy
Confocal microscope pictures can be taken with a 20x, 40x or 60x objective on a confocal microscope.
Cell numbers can be counted manually or by using the Cell counter plug in of ImageJ.
Cell numbers are normalized to the volume of the DG granule cell layer measured by ImageJ.
Representative data
Not all Tbr2 Eomes antibody (AB) lots work for this protocol. Below are representative pictures and sample lots that show a specific staining (A) of Tbr2 in vibratome sections and antibody lots that give only unspecific background staining (B). Red arrows in A show Tbr2 staining. The green arrows indicate unspecific background staining of glia-like cells that might appear in the specific antibody lots. This background staining is however very well distinguishable from the nuclear Tbr2 staining.
Figure 2. A specific staining (A) of Tbr2 in vibratome sections and antibody lots that give only unspecific background staining (B).
Recipes
PBS (20x)
NaCl
160 g/L
Na2HPO4
23 g/L
Na2HPO4
28.84 g/L
KCl
4 g/L
KH2PO4
4 g/L
Adjust pH to 7.4 with HCl and fill volume up to 1 L with dH2O.
TBS (10x)
Trizma base
24.23 g/L
NaCl
80.06 g/L
Mix in 800 ml ultra-pure water, adjust pH to 7.6 with pure HCl and fill up to 1 L.
TBS ++
TBS
100 ml
Horse serum
3 ml
Triton X-100
0.25 ml
Boric buffer
Boric acid
3.1 g/L
Sodium tetraborate
4.75 g/L
Mix in 800 ml ultra pure water, adjust pH to 7.6 and fill up to 1 L.
0.1 M Phosphate buffer
0.2 M Monobasic Stock
NaH2PO4.H2O
13.9 g/500 ml
0.2 M Dibasic stock
Na2HPO4.7H2O
53.65 g/L
Combine indicated amounts of 0.2 M monobasic and 0.2 M dibasic stock solutions and bring volume up to 600 ml.
0.2 M Monobasic Stock
0.2 M Dibasic Stock
pH
57 ml
243 ml
7.4
Mowiol
1x PBS
40 ml
Mowiol
10 g
→ stir for 24 h
Add Glycerol
20 ml
→ stir for 24 h
Centrifuge 15 min at 5,000 rpm, RT
Aliquot and store at -20 °C
Acknowledgments
This protocol is adapted from Seib et al. (2012).
References
Seib, D. R., Corsini, N. S., Ellwanger, K., Plaas, C., Mateos, A., Pitzer, C., Niehrs, C., Celikel, T.nd Martin-Villalba, A. (2013). Loss of Dickkopf-1 restores neurogenesis in old age and counteracts cognitive decline. Cell Stem Cell 12(2): 204-214.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Seib, D. R. M. and Martin-Villalba, A. (2013). In vivo Neurogenesis. Bio-protocol 3(15): e841. DOI: 10.21769/BioProtoc.841.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Animal model
Stem Cell > Adult stem cell > Neural stem cell
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
In vivo Electroporation of Skeletal Muscle Fibers in Mice
Steven J. Foltz [...] Hyojung J. Choo
Jul 5, 2023 497 Views
Isolation and Culture of Neural Stem/Progenitor Cells from the Hippocampal Dentate Gyrus of Young Adult and Aged Rats
Mina Afhami [...] Koorosh Shahpasand
Oct 5, 2023 644 Views
Cochlear Organ Dissection, Immunostaining, and Confocal Imaging in Mice
Chenyu Chen [...] Dongdong Ren
Jan 20, 2025 1598 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
842 | https://bio-protocol.org/en/bpdetail?id=842&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Neuronal Morphology Analysis
Désirée R. M. Seib
Ana Martin-Villalba
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.842 Views: 11721
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cell Stem Cell Feb 2013
Abstract
This protocol describes how to visualize neuronal morphology and how to determine neuronal complexity of immature and mature hippocampal neurons in the mouse in vivo including tissue preparation, staining of brain sections and confocal cell analysis.
Materials and Reagents
Mice
0.9% sterile sodium chloride (NaCl) (Fresenius Kabi)
Ketamine hydrochloride (Ketavet, 100 mg/ml) (Pfizer)
Xylazine hydrochloride (Rompun, 20 mg/ml Xylazine) (Bayer)
4% Paraformaldehyde in phosphate buffer (4% Roti-Histofix) (Roth, catalog number: P087.1 )
Hank’s balanced salt solution (HBSS) (Life Technologies, InvitrogenTM, catalog number: 14170-138 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 31434 )
Sodium phosphate dibasic heptahydrate (Na2HPO4.7H2O) (Sigma-Aldrich, catalog number: S9390 )
Sodium phosphate monobasic monohydrate (NaH2PO4.H2O) (Roth, catalog number: K300.2 )
Potassium chloride (KCl) (AppliChem GmbH, catalog number: A3582 )
Potassium phosphate monobasic (KH2PO4) (Gerbu, catalog number: 2018 )
Sodium azide (Sigma-Aldrich, catalog number: S2002 )
Hydrochloric acid (HCl, 37%) (Sigma-Aldrich, catalog number: 30721 )
Trizma base (Sigma-Aldrich, catalog number: T1503 )
Horse serum (Biochrom, catalog number: S9135 )
Triton X-100 (Sigma-Aldrich, catalog number: X-100 )
Chicken anti-GFP antibody (Aves, catalog number: GFP-1020 )
Goat anti-Doublecortin antibody (DCX, C18) (Santa Cruz, catalog number: sc-8066 )
Mouse anti-NeuN antibody (EMD Millipore, catalog number: MAB377 )
Donkey anti-chicken DyLight488 antibody (Dianova, catalog number: 703-485-155 )
Donkey anti-goat Alexa 647 antibody (Dianova, catalog number: 705-605-147 )
Donkey anti-mouse Alexa 546 antibody (Life Technologies, InvitrogenTM, catalog number: A10036 )
Hoechst (33342) (Biotrend, catalog number: 40047 )
Gelatine to coat glass slides (Sigma-Aldrich, catalog number: G7041 )
Chromium (III) potassium sulfate dodecahydrate (Sigma-Aldrich, catalog number: 60152 )
Bromothymol Blue sodium salt (Sigma-Aldrich, catalog number: 114421 )
FD Rapid GolgiStainTM Kit (FD NeuroTechnologies, catalog number: PK401 )
Millipore water
Ethanol (Sigma-Aldrich, catalog number: 459844 )
Xylene (Sigma-Aldrich, catalog number: 33817 )
Eukitt (Fluka, catalog number: 03989 )
Agarose (AppliChem GmbH, catalog number: A8963 )
Phosphate buffer saline (PBS) (20x) (see Recipes)
TBS (10x) (see Recipes)
TBS++ (see Recipes)
0.1 M Phosphate buffer (see Recipes)
Gelatine to coat glass slides (see Recipes)
Mowiol (Merck/Calbiochem, catalog number: 475904 ) (see Recipes)
Equipment
Syringe (1 ml syringe 27 G for i.p. injections)
0.5 ml Eppendorf Safelock tubes
15 ml and 50 ml Falcon tubes
Micro dissecting scissors
Forceps
Leica VT1200 Vibratome
Brush to transfer slices
Netwell carriers and plates (Corning Inc., catalog numbers: 3477 and 3520 )
Rocking platform
Tube roller mixer
Hot plate stirrer
Staining containers
Microscope glass slides
Cover slips
Confocal microscope
Centrifuge
Software
Amira Filament Editor Analysis (Visage Imaging) or other neuron morphology analysis software
Procedure
Tissue preparation
Transcardial perfusion
Animals are anesthetized with an overdose of Rompun (14 mg/kg bodyweight) and Ketavet (100 mg/kg bodyweight) in 0.9% NaCl.
Mice are transcardially perfused with 30 ml HBSS followed by 10 ml of 4% paraformaldehyde (PFA) dissolved in 0.1 M phosphate buffer pH 7. For transcardial perfusion the thorax cavity is opened, and the right auricle cut with a scissor to allow bleeding. A butterfly cannula is introduced in the left ventricle and mice are perfused with 30 ml HBSS followed by fixation with 10 ml 4% PFA.
Brains are removed and post-fixed overnight in 10 ml 4% PFA in 0.1 M phosphate buffer pH 7 in a 15 ml Falcon tube on a tube roller mixer at 4 °C.
Tissue is washed twice with PBS and may be stored in PBS with 0.01% sodium azide for up to a year.
Neuronal morphology analysis of immature dentate gyrus neurons
Vibratome cutting
For coronal vibratome sections (see Figure 1), the cerebellum is cut, removed and the brain glued upright with the cutting site using superglue onto the holder plate of the vibratome. Coronal sections may have a thickness of 50 μm or 100 μm.
Note: The NeuN antibody does not very well penetrate 100 μm thick sections. If you have to use 100 μm thick sections primary antibody incubation should be 72 h.
For sagittal sections (see Figure 1) brains are embedded in 2% agarose in PBS. The brain is then glued in a solid gel block on the lateral side to the holder plate. Sagittal sections are cut 100 μm thick. Agarose can be removed from the slices during cutting or may be kept during the staining process in order to stabilize the tissue (especially olfactory bulbs).
Sections can be stored in PBS with 0.01% sodium azide at 4 °C. Tissue might be used for up to one year after perfusion.
Figure 1. Overview of neurogenic niches in coronal and sagittal brain sections (SVZ: subventricular zone; DG: dentate gyrus).
Immunofluorescence staining
For each mouse, 4 brain slices (50 or 100 μm thick, 250 μm or 300 μm apart, respectively) are stained. Brain sections are placed in net carriers in 12 well plates (2 slices per well) filled with 4 ml 0.1 M Tris Buffer pH 7.4 supplemented with 8% NaCl (TBS). The sections are washed three times in TBS each 15 min at RT on a rocking platform (50 rpm).
Blocking of unspecific antibody binding is performed by incubating sections for 1 h in TBS++ at RT.
Sections are transferred to 0.5 ml Eppendorf Safelock tubes (2 sections per tube) containing 200 μl TBS++ and the diluted primary antibodies, and incubated at 4 °C for 24-72 h. For this 12 tubes are put in a 50 ml Falcon and rotated at 4 °C on a tube roller mixer.
For staining of GFP/YFP of either genetically or retrovirally labeled immature neurons sections are stained with the primary chicken anti-GFP antibody (1:1,000).
Otherwise non-labeled immature neurons are stained with the goat anti-Doublecortin antibody (1:200). Mouse anti-NeuN (1:200) might be used as additional marker to determine cell maturity.
After incubation sections are transferred back to net carriers in 12 well plates, washed three times with TBS at RT.
After blocking in TBS++ for 30 min at RT sections are transferred again into 0.5 ml Eppendorf Safelock tubes containing the diluted secondary antibody mix in TBS++. Sections in Eppdorf tubes in Falcons are incubated in secondary antibodies at 4 °C on a tube roller mixer for 2 h.
Secondary antibodies are diluted 1:400: Donkey anti-chicken DyLight488, donkey anti-goat Alexa 647 or donkey anti-mouse Alexa 546.
Hoechst 33342 (1:10,000) is used to counterstain DNA and added to the secondary antibody mix.
Finally, sections are placed back into net carriers in 12 well plates, washed three times for 15 min with TBS and additionally 4 times for 1 min in TBS at RT.
Sections are floated in 0.1 M PB in a Petri dish, mounted on glass slides and embedded with 100 μl Mowiol.
Confocal microscope pictures are taken with a 40x objective on a confocal microscope. Branching points and total dendrite length are measured using Amira Filament Editor Analysis (Visage Imaging).
Neuronal morphology analysis of mature hippocampal neurons
For analysis of neuronal morphology of mature CA or DG neurons PFA fixed brains are cut in two hemispheres and stained with the FD Rapid GolgiStainTM Kit.
Hemispheres are incubated in impregnation solution (A and B) for 2 weeks at RT in the dark.
After that tissue is transferred into solution C and stored for five days at 4 °C protected from light.
The tissue is cut in 100 μm thick coronal sections floating in solution C with a Leica VT1200 vibratome and mounted on gelatine coated glass slides. To coat glass slides 1.5 g gelatine and 0.25 g chromium potassium sulfate are mixed with 500 ml distilled water, a few crystals of bromthymol blue are added as preservative, heated up to 60 °C in order to dissolve gelatine and then glass slides are dipped into the solution and the lower part of the slide is cleaned with a tissue. Coated slides are dried overnight at RT.
Mounted slides are washed 2x for 2 min in Millipore water.
Sections are stained for 10 min in staining solution (40 ml solution D, 40 ml solution E and 80 ml Millipore water) at RT.
Sections are washed 2 x 4 min in Millipore water, once for 4 min in 50% ethanol (EtOH), once for 4 min in 75% EtOH, once for 4 min in 95% EtOH and four times for 4 min in 100% EtOH at RT.
Finally slices are washed three times for 4 min in xylene and embedded with Eukitt.
Neurons of the dentate gyrus and CA regions can be analysed with this method. Stacks can be recorded on a confocal microscope with a 40x objective. Branching points and total dendrite length are measured using Amira Filament Editor Analysis (Visage Imaging) (see Figure 2).
Representative data
Figure 2. Light microscope (A) and confocal microscope picture (B) of Golgi stained neurons. Picture shown in B (left panel) was used for image analysis with Amira (right panel).
Recipes
PBS (20x)
NaCl
160 g/L
Na2HPO4
23 g/L
NaH2PO4
28.84 g/L
KCl
4 g/L
KH2PO4
4 g/L
Adjust pH to 7.4 with HCl and fill volume up to 1 L with dH2O.
TBS (10x)
Trizma base
24.23 g/L
NaCl
80.06 g/L
Mix in 800 ml ultra-pure water, adjust pH to 7.6 with pure HCl and fill up to 1 L.
TBS ++
TBS
100 ml
Horse serum
3 ml
Triton X-100
0.25 ml
0.1 M Phosphate buffer
0.2 M Monobasic Stock
NaH2PO4.H2O
13.9 g/500 ml
0.2 M Dibasic Stock
Na2HPO4.7H2O
53.65 g/L
Combine indicated amounts of 0.2 M monobasic and 0.2 M dibasic stock solutions and bring volume up to 600 ml.
0.2 M Monobasic Stock
0.2 M Dibasic Stock
pH
57 ml
243 ml
7.4
Gelatine to coat glass slides
Gelatine
1.5 g
Chromium (III) potassium sulfate dodecahydrate
0.25 g
Add a few crystals of bromthymol blue as a preservative
Fill up to 500 ml with H2O and heat up to 60 °C to dissolve gelatin.
Mowiol
1x PBS
40 ml
Mowiol
10 g
→ stir for 24 h
Add Glycerol
20 ml
→ stir for 24 h
Centrifuge 15 min at 5,000 rpm, RT
Aliquot and store at -20 °C
Acknowledgments
This protocol is adapted from Seib et al. (2012).
References
Seib, D. R., Corsini, N. S., Ellwanger, K., Plaas, C., Mateos, A., Pitzer, C., Niehrs, C., Celikel, T. and Martin-Villalba, A. (2013). Loss of Dickkopf-1 restores neurogenesis in old age and counteracts cognitive decline. Cell Stem Cell 12(2): 204-214.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Seib, D. R. M. and Martin-Villalba, A. (2013). Neuronal Morphology Analysis. Bio-protocol 3(15): e842. DOI: 10.21769/BioProtoc.842.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Live-cell imaging
Stem Cell > Adult stem cell > Neural stem cell
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
In vivo Electroporation of Skeletal Muscle Fibers in Mice
Steven J. Foltz [...] Hyojung J. Choo
Jul 5, 2023 497 Views
Isolation and Culture of Neural Stem/Progenitor Cells from the Hippocampal Dentate Gyrus of Young Adult and Aged Rats
Mina Afhami [...] Koorosh Shahpasand
Oct 5, 2023 644 Views
Cochlear Organ Dissection, Immunostaining, and Confocal Imaging in Mice
Chenyu Chen [...] Dongdong Ren
Jan 20, 2025 1598 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
843 | https://bio-protocol.org/en/bpdetail?id=843&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Ferric Chelate Reductase Activity in the Arabidopsis thaliana Root
Emre Aksoy
HK Hisashi Koiwa
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.843 Views: 15344
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Plant Journal Jan 2013
Abstract
Plants have developed two distinct mechanisms, i.e., strategy I (reduction strategy) and II (chelation strategy), to mobilize insoluble Fe(III) in the rhizosphere and transport it through the plasma membrane. Arabidopsis thaliana and other dicots rely on strategy I. In this strategy, the rhizosphere is first acidified by a PM-localized H+-ATPase, AHA2. Then, FERRIC CHELATE REDUCTASE 2 (FRO2) reduces Fe(III) to soluble Fe(II). Finally, the reduced Fe is taken up by a high-affinity transporter, IRON-REGULATED TRANSPORTER 1 (IRT1). Root ferric chelate reductase activity can be quantified spectrophotometrically by the formation of Purple-colored Fe(II)-ferrozine complex in darkness.
Keywords: Arabidopsis thaliana Ferric chelate reductase FRO Enzyme activity Root
Materials and Reagents
Arabidopsis thaliana plants [wild-type Col-0 and T-DNA insertion line of FERRIC REDUCTASE DEFECTIVE 3 (frd3-1) are used as examples below]
Murashige and Skoog (MS) salts
Ethylenediaminetetraacetic acid ferric sodium salt [Fe(III)-EDTA] (Sigma-Aldrich, catalog number: E6760 )
3-(2-Pyridyl)-5,6-diphenyl-1,2,4-triazine-4’,4”-disulfonic acid sodium salt (Ferrozine) (Sigma-Aldrich, catalog number: P9762 )
Assay solution (see Recipes)
Equipment
1.5 ml Eppendorf tubes
Spectrophotometer (Shimadzu, model: UV-1700 )
Procedure
Col-0 and frd3-1 seeds were placed on media containing 1/4 Murashige and Skoog (MS) salts, 50 μM Fe-EDTA, 0.5% sucrose, and 1.5% agar (basal medium).
After stratification for 2 days at 4 °C, the plates were kept in a growth incubator under a long-day photoperiod (16 h light, 8 h darkness) at 25 °C.
Fe deficiency was applied by transferring 7-day-old seedlings to basal medium without Fe-EDTA but containing 300 μM ferrozine [3-(2-pyridyl)-5,6-diphenyl-1,2,4-triazine sulfonate]. Then, the plants were grown for additional three days on this medium.
700 μl of assay solution is placed in a 1.5 ml eppendorf tube, tube is placed onto scale and the weight of the tube is tared (zeroed).
Both primary and lateral roots of five plants are soaked totally in this assay solution in order to prevent their drying, the tube is weighed again and the fresh weight of the sample is recorded.
Notes:
The assay solution should be kept at dark during the experiment.
Maximum fresh weight of the roots recommended for this assay is 200 mg.
Roots are not cut into pieces.
The tube is mixed by tapping several times for increasing the contact of roots with assay solution, and incubated for 30 min in darkness at room temperature.
At the end of the incubation, purple-colored Fe(II)-ferrozine complex formation is observed around the roots in the solution (Figure 1a).
Note: Much deeper purple color formation is observed around the roots of the plants treated with Fe deficiency (Figure 1b).
Figure 1. Purple-colored Fe(II)-ferrozine complex formation of assay solution before and after Fe deficiency.
The absorbance of the assay solution is determined in a spectrophotometer at 562 nm against an identical assay solution without any plants (blank).
Purple-colored Fe(II)-ferrozine complex formation is quantified using a molar extinction coefficient of 28.6 mM-1 cm-1 as in the equation of
The experimental results are presented in the unit of μM Fe(II)/g root FW/hr as the mean of three biological repeats with six technical replicates each (Figure 2).
Figure 2. Ferric Chelate Reductase activity in roots of Col-0 and frd3-1 under Fe-sufficient or -deficient conditions.
Recipes
Assay solution
The assay solution is composed of 0.1 mM Fe(III)-EDTA and 0.3 mM ferrozine in distilled water. Prepare fresh before each experiment and kept at dark.
Acknowledgments
This protocol is adapted from Yi and Guerinot (1996).
References
Yi, Y. and Guerinot, M. L. (1996). Genetic evidence that induction of root Fe(III) chelate reductase activity is necessary for iron uptake under iron deficiency. Plant J 10(5): 835-844.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Activity
Cell Biology > Cell staining > Iron
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Semi-throughput Procedure for Assaying Plant NADP-malate Dehydrogenase Activity Using a Plate Reader
Kevin Baudry and Emmanuelle Issakidis-Bourguet
Aug 20, 2023 320 Views
An in vitro Assay to Probe the Formation of Biomolecular Condensates
Yu Zhang and Shen Lisha
Sep 5, 2023 1441 Views
Immunofluorescence for Detection of TOR Kinase Activity In Situ in Photosynthetic Organisms
Ana P. Lando [...] Giselle M. A. Martínez-Noël
Dec 20, 2024 312 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
844 | https://bio-protocol.org/en/bpdetail?id=844&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Retrovirus Mediated Malignant Transformation of Mouse Embryonic Fibroblasts
Huei San Leong
Marnie Blewitt
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.844 Views: 10696
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Mar 2013
Abstract
Cellular transformation is a widely used method to artificially induce cells to form tumours in vivo. Here, we describe the methodology for malignant transformation of mouse embryonic fibroblasts (MEFs) for transplantation into immunodeficient nude mice, as used in Leong et al. (2013). The two-step process involves: 1) down-regulation of Trp53 expression using a short hairpin RNA (shRNA); and 2) overexpression of the oncogenic HRasV12 protein. Reduction of Trp53 expression leads to cell immortalisation, and the subsequent overexpression of oncogenic HRasV12 results in malignant transformation of a cell.
Keywords: Transformation Mouse embryonic fibroblasts HRasv12 P53 knockdown
Materials and Reagents
Source of tissue: body of embryonic day 13.5 mouse embryos, harvested fresh from pregnant females
Dulbecco’s Modified Eagle’s Medium (DMEM) (Life Technologies, Gibco®, catalog number: 41965-039 )
Fetal Calf Serum (FCS) (Life Technologies, Gibco®, catalog number: 10437-028 )
Trypsin (Life Technologies, Gibco®, catalog number: 25200056 )
Dulbecco’s Phosphate Buffered Saline (PBS), without Ca2+ and Mg2+ (Life Technologies, Gibco®, catalog number: 14190-144 )
Retroviral supernatant containing LMP-p53.1224 shRNA construct (Dickins et al., 2005)
Retroviral supernatant containing pWZL-HRasV12 cDNA construct (Serrano et al., 1997)
Hygromycin B (Life Technologies, catalog number: 10687-010 )
Puromycin (Sigma-Aldrich, catalog number: P9620-10ML )
Hexadimethrine bromide/Polybrene (Sigma-Aldrich, catalog number: H9268 )
Polybrene (1,000x stock) (see Recipes)
Equipment
Tissue culture flasks T75 (Greiner Bio-One, catalog number: 658175 )
10-cm tissue culture dishes (BD Biosciences, Falcon®, catalog number: 353003 )
21-gauge needles
5 ml syringes
37 °C 10% CO2 cell culture incubator
Table-top centrifuge
Procedure
Retroviral supernatants are prepared as previously described, at a titer of 106 to 107 viral particle per ml of viral supernatant (Pear et al., 1993).
Note: Do not freeze/thaw supernatant, and use within 6 months.
Primary MEFs are generated from embryonic day 13.5 (E13.5) embryos by passing the embryonic body (excluding head, liver and intestines) through a 21-gauge needle and syringe followed by repeated pipetting into a 10-cm tissue culture dish (1 embryo per dish) in 1 ml of DME medium containing 10% (v/v) FCS (DMEM/FCS). It is not necessary to obtain a single cell suspension at this stage, as trypsinisation at later stages will produce a single cell suspension and excessive manipulation at this stage promotes cell death. Add 9 ml of DMEM/FCS and mix to combine.
Primary MEFs are then incubated in 10% CO2 incubator at 37 °C for 2-3 days undisturbed.
MEFs are washed once in PBS, trypsinised, trypsin inhibited with DMEM/FCS and pelleted at 485 g for 5 minutes.
MEFs are split ~1:2 into a T75 tissue culture flask and incubated in 10% CO2 incubator at 37 °C overnight so that cells are ~60-70% confluent the following day.
On the next morning, aspirate the supernatant and wash once with PBS. Combine the retroviral supernatant containing LMP-p53.1224 shRNA, DMEM/FCS and polybrene using the following recipe:
Retroviral supernatant 1.5 ml (i.e., ~1:7 dilution)
DMEM/FCS 8.5 ml
Polybrene (1,000x stock) 10 μl (4 μg/ml)
Total 10 ml
After ~7-8 h of infection, repeat step 6, and leave the fresh retroviral supernatant overnight.
On the next day, aspirate the supernatant, wash cells once with PBS, replace with fresh DMEM/FCS, and incubate at 37 °C overnight.
On the following day, replace medium with fresh DMEM/FCS containing 5 μg/ml puromycin (LMP-p53.1224 shRNA construct has a puromycin selectable marker), and leave for 2 days, if not confluent. Otherwise, split as necessary.
At the end of puromycin selection on day 3, cells are washed once with PBS, trypsinised and seeded so that cells are ~60-70% confluent in a T75 flask the following day. Culture cells in DMEM/FCS without puromycin and incubate overnight at 37 °C.
On the next day, repeat steps 6-8, but with retroviral supernatant containing pWZL-HRasV12 cDNA. The two tranductions should be performed sequentially, as suggested, so that p53 knockdown and immortalization precedes HRasV12 overexpression. This ensures the best efficiency of transformation since HRasV12 overexpression with inefficient p53 knockdown results in senescence.
On the following day, replace medium with fresh DMEM/FCS containing 300 μg/ml hygromycin (pWZL-HRasV12 cDNA construct has a hygromycin selectable marker) for 6 days. Replace with fresh hygromycin after 3 days, and split cells when necessary.
At the end of hygromycin selection on day 7, replace with fresh DMEM/FCS without hygromycin.
Passage cells as necessary for another 10-14 days to allow HRasV12 to drive cell proliferation. These transformed cells can now be used for in vitro or in vivo experiments. For example, cells can be injected subcutaneously into the flank of nude mice to assess tumour growth rate in vivo. The cells can be frozen and stored in liquid nitrogen, or can be continuously passaged, however extended passaging will result in additional genetic aberrations based on the knockdown of p53.
Recipes
1,000x stock polybrene (4 mg/ml)
Mix 0.2 g of hexadimethrine bromide with 50 ml Milli Q H2O
Filter sterilize (0.22 μm)
Aliquot and store at -20 °C.
Acknowledgments
This protocol was previously used and adapted from Leong et al. (2013).
References
Dickins, R. A., Hemann, M. T., Zilfou, J. T., Simpson, D. R., Ibarra, I., Hannon, G. J. and Lowe, S. W. (2005). Probing tumor phenotypes using stable and regulated synthetic microRNA precursors. Nat Genet 37(11): 1289-1295.
Leong, H. S., Chen, K., Hu, Y., Lee, S., Corbin, J., Pakusch, M., Murphy, J. M., Majewski, I. J., Smyth, G. K., Alexander, W. S., Hilton, D. J. and Blewitt, M. E. (2013). Epigenetic regulator Smchd1 functions as a tumor suppressor. Cancer Res 73(5): 1591-1599.
Pear, W. S., Nolan, G. P., Scott, M. L. and Baltimore, D. (1993). Production of high-titer helper-free retroviruses by transient transfection. Proc Natl Acad Sci U S A 90(18): 8392-8396.
Serrano, M., Lin, A. W., McCurrach, M. E., Beach, D. and Lowe, S. W. (1997). Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88(5): 593-602.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Leong, H. S. and Blewitt, M. (2013). Retrovirus Mediated Malignant Transformation of Mouse Embryonic Fibroblasts. Bio-protocol 3(15): e844. DOI: 10.21769/BioProtoc.844.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays > Cellular transformation
Cell Biology > Cell isolation and culture > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Lentiviral shRNA Screen to Identify Epithelial Integrity Regulating Genes in MCF10A 3D Culture
Elsa Marques and Juha Klefström
Dec 5, 2016 10649 Views
Automated Analysis of Cell Surface Ruffling: Ruffle Quantification Macro
Nicholas D. Condon [...] Adam A. Wall
Jan 20, 2020 4045 Views
Microscopic Detection of DNA Synthesis in Early Mitosis at Repetitive lacO Sequences in Human Cells
Kazumasa Yoshida [...] Masatoshi Fujita
Sep 5, 2022 1342 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
845 | https://bio-protocol.org/en/bpdetail?id=845&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assay of Blood Brain Barrier and Placental Barrier Permeability
SA Saurabh Kumar Agnihotri *
PS Poonam Singh *
BK Balawant Kumar
PS Pankaj Singh
SJ Swatantra Kumar Jain
MT Mahesh Chandra Tewari
SK Sadan Kumar
Monika Sachdev
RT Raj Kamal Tripathi
(*contributed equally to this work)
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.845 Views: 11900
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS ONE Dec 2012
Abstract
Evans blue dye solution was used to observe the effect of a viral protein on two pre-defined barriers of the body i.e. the blood brain barrier (BBB) and the placental barrier (PB). This dye has strong affinity for serum albumin and does not cross these barriers under natural conditions. As all the dye gets bound to albumin, all the neural tissues and embryonic tissues remain unstained. When the BBB and PB are compromised due to the breach of these barriers, albumin-bound Evans blue enters the CNS and the placenta.
Materials and Reagents
Pregnant Sprague Dawley rats
Protein of Interest: Recombinant Nef
Evans blue dye (Sigma-Aldrich)
NaCl (Sigma-Aldrich)
Phosphate buffer saline (PBS) (Sigma-Aldrich)
Equipment
Homogenizer (Coleparmer)
Centrifuge (Eppendorf)
Weighing Balance (Mettler Toledo)
Spectrophotometer (Gene Quant)
Procedure
2% Evans Blue dye was dissolved in normal saline (0.85% sodium chloride). 500 μl of dye containing recombinant protein was injected intravenously in the tail vein of fourteen days pregnant Sprague Dawley rats.
Recombinant protein in the range 50-500 μg was used to identify the threshold value needed for the breach of both the barriers. Un-injected animals were used for the normalization of the data.
One hour after inoculation all the rats including the un-injected ones were anaesthetized and dissected immediately to avoid any blood clotting; complete uterus and the brain were removed carefully in normal saline.
The fetal tissues; uterus, placenta, amniotic membrane and embryo were separated cautiously and collected in PBS to measure the weight of these organs separately.
Each fetal tissue was measured by weight and then homogenized in 200 μl of PBS (pH 7.4), the final volume was measured again and the mg/ml concentration was calculated.
The homogenized tissue was centrifuged at ~9,000 x g at 4 °C for 15 min and the clear supernatant was collected.
The absorbance of Evans blue dye was measured at OD590nm from the brain as well as fetal tissues associated with blood-brain barrier and placental barrier respectively.
The absorbance (OD) per mg of tissue weight was determined from the supernatant at 590 nm for the quantitative analysis of Evans blue dye.
Absorbance was considered as an average of four animals and the actual absorbance was calculated after normalizing the background values from the un-injected control set of tissues.
Figure 1 explains the breach of these blood barriers in the presence of the recombinant protein, whereas no breach was observed in the absence of the recombinant protein.
If the blood barriers breaches, the absorbance was found to be higher and the dye permeability was observed, whereas if the blood barrier is intact then the absorbance was comparatively lower and no permeability was observed for the dye.
Figure 1. Quantification of Evans blue dye (OD at 590) present (within an hour) in brain and different fetal tissue isolates from 14 day pregnant Sprague Dawley rats injected intravenously without and with recombinant Nef and ASK-1 protein. (A) Brain (B) Uterus (C) Placenta (D) Amniotic membrane. Three different bars in each set represent 0, 250 and 500 μg of recombinant Nef and 500 μg of ASK-1 injected intravenously along with Evans blue dye in the experimental animals. As data represent ±SEM of 3 separate experiments in duplicate and changes were considered as significant at *p ≤ 0.05,**p ≤ 0.01 and ***p ≤ 0.001.
Acknowledgments
This protocol is adapted from Chaturverdi et al. (1991); Singh et al. (2012) and Thumwood et al. (1988).
References
Chaturvedi, U. C., Dhawan, R., Khanna, M. and Mathur, A. (1991). Breakdown of the blood-brain barrier during dengue virus infection of mice. J Gen Virol 72 ( Pt 4): 859-866.
Singh, P., Agnihotri, S. K., Tewari, M. C., Kumar, S., Sachdev, M. and Tripathi, R. K. (2012). HIV-1 Nef breaches placental barrier in rat model. PLoS One 7(12): e51518.
Thumwood, C. M., Hunt, N. H., Clark, I. A. and Cowden, W. B. (1988). Breakdown of the blood-brain barrier in murine cerebral malaria. Parasitology 96 ( Pt 3): 579-589.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cell Biology > Cell staining > Protein
Cell Biology > Tissue analysis > Tissue isolation
Cell Biology > Tissue analysis > Tissue staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Immunofluorescent Staining Assay of 3D Cell Culture of Colonoids Isolated from Mice Colon
Trisha Mehrotra [...] Didier Merlin
Mar 5, 2024 936 Views
Protocol for the Implantation of Scaffolds in a Humanized Mouse Cutaneous Excisional Wound Healing Model
Dina Gadalla [...] David G. Lott
Sep 20, 2024 299 Views
Cochlear Organ Dissection, Immunostaining, and Confocal Imaging in Mice
Chenyu Chen [...] Dongdong Ren
Jan 20, 2025 1598 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
846 | https://bio-protocol.org/en/bpdetail?id=846&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
CAMP-Membrane Interactions Using Fluorescence Spectroscopy
RS Ron Saar-Dover
YS Yechiel Shai
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.846 Views: 7977
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Sep 2012
Abstract
The molecular mechanism by which peptide antibiotics (also referred as cationic antimicrobial peptides-CAMPs) penetrate through the bacterial wall barrier, interact with, and disrupt their membrane is complex. It depends mainly on the peptide properties (structure, length, charge and hydrophobicity), on the characteristics of the cell wall matrix and the membrane itself.
Here, we present two fluorescence spectroscopic techniques, one for tracking the interaction of CAMPs with membranes, and the other for evaluating the ability of a peptide to cross the bacterial cell-wall and reach the membrane. The fluorescence approach is relatively simple, highly sensitive, non-invasive and allows time-scale investigation. It can be applied to lipid vesicles or intact bacteria. For membrane model systems such as liposomes, it allows to determine the binding kinetics of a peptide to vesicle and to assess the depth of penetration. By using bacterial strains carrying different mutations in their cell wall components, but not in their membrane, we can investigate how a specific element may affect the cell wall permeability to CAMPs (Saar-Dover et al., 2012).
In order to track the peptide-membrane interaction we conjugate a lipid environmentally sensitive NBD (7-nitrobenz-2-oxa-1, 3-diazole-4-yl) fluorophore to peptides. NBD fluorescence can increase up to approximately 10-fold upon interaction with membranes. Its high excitation wavelength (467 nm) and the high quantum yield reduce significantly the contribution of light scattering. NBD-labeled peptides exhibit fluorescence emission maxima around 540 nm in hydrophilic solution (Shai, 1999). However, upon interaction with lipid component such as the bacterial membrane, relocation of the NBD group into a more hydrophobic environment results in an increase in its fluorescence intensity and a blue shift of the emission maxima (Chattopadhyay and London, 1987). The first property is used to determine the binding constant of the peptide to the membrane. The second property is exploited to evaluate the depth of penetration (Merklinger et al., 2012; Zhao and Kinnunen, 2002). Here, we will focus on how to determine the binding constant. The advantage of the NBD moiety conjugation is that it allows the use of experimental conditions in which the lipid: peptide molar ratio range from < 100:1 up to > 15,000:1. The addition of NBD does not change the biological function of most of the peptide, as was found for different antimicrobial peptides such as paradaxin (Rapaport and Shai, 1992), dermaseptins (Pouny et al., 1992), cecropins (Gazit et al., 1994) and cathelicidin LL-37 (Oren et al., 1999). However, pre-examination must be done for each newly investigated peptide.
Keywords: Peptide–membrane interaction Fluorescence spectroscopy Antimicrobial peptide Liposomes Cell wall penetration
Materials and Reagents
Peptides were synthesized by an Fmoc solid-phase method (Merrifield et al., 1982) on Rink amide-4-methylbenzhydrylamine hydrochloride salt (MBHA) resin. Fluorescent labeling with 4-chloro-7-nitrobenz-2-oxa-1, 3-diazole fluoride (NBD-F) or 5-(and-6)-carboxytetra-methylrhodamine succinimidyl ester (Rhodamine) was followed by peptide cleavage from the resin and purification by reverse phase high-performance liquid chromatography (RP-HPLC). See detailed methods in Oren et al. (1999) and Avrahami et al. (2001).
Liposome suspension stock at total lipid concentration of 12.5 mM. For liposome preparation see Kliger et al. (1997)
Bacterial suspension (OD600 nm adjusted to 4)
Fluorescently labeled peptides solution (see Note 1)
Double Distilled water (DDW) or Milli-Q reagent grade water
Phosphate buffered saline (PBS) (pH 7.4)
70% (v/v) ethanol
5 x 5 mm quartz cuvette
Equipment
Automatic peptide synthesizer ABI 433A (Applied Biosystems)
Reverse phase high-performance liquid chromatography (RP-HPLC) Agilent HPLC 1100 (Hewlett Packard)
SLM-Aminco Bowman series 2-luminescence spectrophotometer FA-355 (SLM-Aminco)
Procedure
Binding of NBD-labeled peptide to membranes
The binding constant of a peptide is calculated from a titration of lipid vesicles, either small-unilamellar vesicles (SUVs, 10-50 μm size) or large-unilamellar vesicles (LUVs, 50-100 μm size) into NBD-peptide solution. To achieve an accurate result, at least 20 points should be recorded for each curve. An accepted dilution factor of the peptide solution is up to 10% and therefore no more than 40 μl of vesicle solution should be added. All assays were performed in room temperature (22-24 °C).
Dissolve NBD-peptide of the requested solution (such as DDW or PBS) to a final concentration of 0.1 μM (see Note 2). Each measurement uses 400 μl of peptide solution, therefore prepare 810 μl for two repetitions.
Set the spectrophotometer to spectrum mode with excitation wavelength of 467 nm and emission wavelength of 500-600 nm. In our device, slits are usually set to 5-10 nm. Using wider slits will improve sensitivity but can increase background noise and therefore should be individually determined for each peptide.
Add 400 μl peptide solution to a pre-cleaned cuvette (magnetic stirrer can be used) and read the signal output. Measure again every few minutes until no change is detected. This is the basal signal of the labeled peptide in the absence of membrane compounds.
Add 1 μl from the LUVs suspension stock to the cuvette to reach an initial peptide/lipid ratio of 1:312 and read again. Calculation of ratio: 12.5 mM lipid is 12,500 μM that are being diluted 1:400 in a solution containing 0.1 μM peptide. Therefore, when 1 μl are added the ratio is 1:312 (12,500/401*10). When another 1 μl will be added the ratio will be 1: 622 and so on.
Re-measure the signal intensity every 1 min until no change in the signal is detected. This will indicate that binding has reached equilibrium.
Repeat step 1-d successively until no change in the peak maxima (around 530 nm) can be detected.
Clean the cuvette by washing it three times with 70% (v/v) ethanol. Trace ethanol in the cuvette should be removed by rinsing with DDW.
To account for background, the emissions of the vesicles alone at the same wavelength should be monitored and subtracted. Therefore, repeat steps 1-c~f using the same solvents but without dissolving peptide in it.
Cell-wall permeability assay
The assay is designed to compare the ability of a given peptide to penetrate the cell wall of a given bacterial strain and interact with its membrane (Saar-Dover et al., 2012). The relative elevation in NBD emission should be calculated for each strain and compared.
Grow you bacteria to an exponential stage, concentrate cells from the culture by centrifuging 5 ml at 1,300 x g), 3 min. Wash and re-centrifuge pallet twice with PBS. Adjust your bacterial suspension to OD600 nm = 4 in PBS.
Dissolve NBD-peptide in PBS solution to a final concentration of 0.1-1 μM (use concentration that does not disrupt the cellular integrity, this can be determined separately using a SYTOX green assay (Saar-Dover et al., 2012).
Set the spectrophotometer to kinetic mode with excitation wavelength of 467 nm and emission wavelength of 530 nm. In our device, SLM-Aminco Bowman series 2-luminescence spectrophotometer, slits are usually set to 5-10 nm. Using wider slits will improve sensitivity but can increase background noise and therefore should be individually determined for each peptide.
Add 400 μl peptide solution to a pre-cleaned cuvette (magnetic stirrer can be used) and read the signal output until it stabilizes. This is the basal signal of the labeled peptide in the absence of membrane compounds.
Add 10 μl from the bacterial suspension to the cuvette. Track the change in signal intensity with time until equilibrium is reached.
Clean the cuvette by washing it three times with 70% (v/v) ethanol. Trace ethanol in the cuvette should be removed by rinsing with DDW.
To account for background, the emissions of bacteria alone at the same wavelength should be monitored and subtracted. Therefore, repeat steps 2-c~e using the same solvents but without dissolving peptide in it.
The signal intensity can be affected by oligomerization of the labeled peptide over the bacterial surface and self-quenching (reduced intensity). We therefore assess the level of peptide oligomerization by repeating the experiment using Rhodamine labeled peptides. Rhodamine is highly sensitive to quenching but unlike NBD, its emission is not affected strongly by the polarity of its environment.
Calculations
For binding of NBD-labeled peptide to membranes:
Prepare a table of titration results- emission (Y) versus lipid concentration (X).
Subtract the baseline value (solution only) from each Y value to correct for background.
You should get a saturation curve, meaning a non-linear curve (Figure 1). Use a non-linear equation program solver (such as GraphPad Prism) to extract the best fitted equation.
Figure 1. Binding of NBD-labeled peptide to membranes. A representative saturation curve describing an increase in NBD fluorescence upon titration of phosphatidylcholine: cholesterol (9:1) large unilamellar lipid vesicles (LUVs) into 0.2 μM NBD conjugated peptide (NBD-gp41 TMD). Nonlinear least-squares analysis was used to determine the affinity constant (Ka).
Calculate the Ka (association constant). You can also determine the peptide: lipid ratio at saturation.
Alternatively, a less preferable but still applicable way will be to calculate the slope from the linear part of you curve, as long as there are at least 10 points in that region.
See more details in Rosenfeld et al. (2006).
For cell-wall permeability assay:
Subtract the bacterial basal emission from the final emission value recorded after bacteria were added to peptide and the signal has stabilized.
Calculate (in percentage) how much the addition of bacteria increased the emission relatively to the basal peptide emission.
Compare the degree of change between any given bacterial strains (wild type versus mutants for example) to evaluate the role of a given component to cell-wall permeability to peptides.
See more details in Saar-Dover et al. (2012).
Notes
Peptide concentration (C) in molar units is determined spectroscopic using the Beer–Lambert equation:
Where A is the actual absorbance at 467 nm (NBD) and at 530 nm (rhodamine). The molar absorption coefficient (ε) of NBD is 16,000 [cm/M], and that of rhodamine is 38,000 [cm/M]. L is the cuvette path length in centimeter.
Peptide concentration for the experiment should be at the low micromolar rang to reach very low peptide/lipid ratio and is also dependent on the labeling and purification quality. We generally use a concentration range of 0.1-1 μM of labeled peptides.
References
Avrahami, D., Oren, Z. and Shai, Y. (2001). Effect of multiple aliphatic amino acids substitutions on the structure, function, and mode of action of diastereomeric membrane active peptides. Biochemistry 40(42): 12591-12603.
Chattopadhyay, A. and London, E. (1987). Parallax method for direct measurement of membrane penetration depth utilizing fluorescence quenching by spin-labeled phospholipids. Biochemistry 26(1): 39-45.
Gazit, E., Lee, W. J., Brey, P. T. and Shai, Y. (1994). Mode of action of the antibacterial cecropin B2: a spectrofluorometric study. Biochemistry 33(35): 10681-10692.
Kliger, Y., Aharoni, A., Rapaport, D., Jones, P., Blumenthal, R. and Shai, Y. (1997). Fusion peptides derived from the HIV type 1 glycoprotein 41 associate within phospholipid membranes and inhibit cell-cell Fusion. Structure-function study. J Biol Chem 272(21): 13496-13505.
Merklinger, E., Gofman, Y., Kedrov, A., Driessen, A. J., Ben-Tal, N., Shai, Y. and Rapaport, D. (2012). Membrane integration of a mitochondrial signal-anchored protein does not require additional proteinaceous factors. Biochem J 442(2): 381-389.
Merrifield, R. B., Vizioli, L. D. and Boman, H. G. (1982). Synthesis of the antibacterial peptide cecropin A (1-33). Biochemistry 21(20): 5020-5031.
Oren, Z., Lerman, J. C., Gudmundsson, G. H., Agerberth, B. and Shai, Y. (1999). Structure and organization of the human antimicrobial peptide LL-37 in phospholipid membranes: relevance to the molecular basis for its non-cell-selective activity. Biochem J 341 ( Pt 3): 501-513.
Pouny, Y., Rapaport, D., Mor, A., Nicolas, P. and Shai, Y. (1992). Interaction of antimicrobial dermaseptin and its fluorescently labeled analogues with phospholipid membranes. Biochemistry 31(49): 12416-12423.
Rapaport, D. and Shai, Y. (1992). Aggregation and organization of pardaxin in phospholipid membranes. A fluorescence energy transfer study. J Biol Chem 267(10): 6502-6509.
Rosenfeld, Y., Papo, N. and Shai, Y. (2006). Endotoxin (lipopolysaccharide) neutralization by innate immunity host-defense peptides. Peptide properties and plausible modes of action. J Biol Chem 281(3): 1636-1643.
Saar-Dover, R., Bitler, A., Nezer, R., Shmuel-Galia, L., Firon, A., Shimoni, E., Trieu-Cuot, P. and Shai, Y. (2012). D-alanylation of lipoteichoic acids confers resistance to cationic peptides in group B Streptococcus by increasing the cell wall density. PLoS Pathog 8(9): e1002891.
Shai, Y. (1999). Mechanism of the binding, insertion and destabilization of phospholipid bilayer membranes by alpha-helical antimicrobial and cell non-selective membrane-lytic peptides. Biochim Biophys Acta 1462(1-2): 55-70.
Zhao, H. and Kinnunen, P. K. (2002). Binding of the antimicrobial peptide temporin L to liposomes assessed by Trp fluorescence. J Biol Chem 277(28): 25170-25177.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbe-host interactions > Bacterium
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Bacterial Pathogen-mediated Suppression of Host Trafficking to Lysosomes: Fluorescence Microscopy-based DQ-Red BSA Analysis
Mădălina Mocăniță [...] Vanessa M. D'Costa
Mar 5, 2024 392 Views
Purification of Native Dentilisin Complex from Treponema denticola by Preparative Continuous Polyacrylamide Gel Electrophoresis and Functional Analysis by Gelatin Zymography
Pachiyappan Kamarajan [...] Yvonne L. Kapila
Apr 5, 2024 377 Views
Calibrating Fluorescence Microscopy With 3D-Speckler (3D Fluorescence Speckle Analyzer)
Chieh-Chang Lin and Aussie Suzuki
Aug 20, 2024 401 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
847 | https://bio-protocol.org/en/bpdetail?id=847&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Epidermal Growth Factor (EGF) Receptor Endocytosis Assay in A549 Cells
SR Sabrina Rizzolio
LT Luca Tamagnone
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.847 Views: 18310
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Nov 2012
Abstract
The following endocytosis assay has been optimized to assess EGF-stimulated EGFR endocytosis; but could be modified to assess other ligand-stimulated endocytosis of plasma membrane receptors (for which fluorochrome-conjugated ligands are available to track their receptor internalization). In brief, cells are treated with fluorescent EGF at 4 °C to allow binding to the receptor, but not internalization; then, endocytosis is allowed at 37 °C for different timepoints. For the setting up of this protocol we are really indebted to Dr. Letizia Lanzetti (Lanzetti et al., 2000).
Keywords: Internalization Signaling Egfr Mammalian cells Fluorescence
Materials and Reagents
A549 non-small lung carcinoma cells (ATCC)
D-MEM medium (Sigma-Aldrich)
10% serum RPMI medium (Sigma-Aldrich)
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3912 )
Fluorescent EGF-555 (Life Technologies, InvitrogenTM, catalog number: E35350 )
100% Acetic acid
5 M NaCl solution
Paraformaldehyde (Fluka)
Phosphate buffer saline (PBS)
Coverslip-Slide Mounting solution (Fluoromonut, Southern Biotech)
4',6-diamidino-2-phenylindole (DAPI) (F. Hoffmann-La Roche)
Saponin (Sigma-Aldrich, catalog number: S4521 )
Acid wash (see Recipes)
4% PAF in PBS (see Recipes)
Equipment
Round glass cover slips
6-well and 24-well dishes for mammalian cell culture (Corning, Costar®)
Lipofectamine2000 (Life Technologies, InvitrogenTM)
Leica TCS SP2 AOBS confocal laser-scanning microscope (Leica Microsystems)
4 °C refrigerator
Cell culture incubator humidified 5% CO2 atmosphere
pH-meter
Software
ImageJ software (free download from http://rsb.info.nih.gov/ij/)
Procedure
Day 1
Seed the appropriate number of cells (see Note 2) on top of glass coverslips placed (one per well) in 24-well cell culture dishes. Alternatively, if it is required to transfect cells prior to performing the endocytosis assay, seed cells on top of 5-6 coverslips placed in each well of 6-well culture dishes. You should prepare at least one independent multi-well dish per each time point in your experiment, plus two for controls (e.g. four dishes for an experiment with control cells plus two different times of endocytosis).
Day 2 (optional)
Cell DNA-transfection with Lipofectamine2000, according to manufacturer’s protocol. On the day of the endocytosis assay, transfer the coverslips with cells into 24-well cell culture dishes. Transfection could be needed when you need to modulate proteins putatively involved in the internalization of the receptor.
Day 3-4
Endocytosis assay (or Day 2-3, if no cell transfection needed prior to the assay), by the following steps (see Figure 1 for the protocol scheme).
Figure 1. Schematic representation of experimental flow
Remove cell culture medium and incubate cells with 400-500 μl of serum-free DMEM medium containing 0.3% BSA for at least 1 h (extendable up to 3 h) at 37 °C in cell culture incubator, in order to deprive cells of serum-contained stimuli.
Replace cell medium with the appropriate dilution of the fluorescent ligand EGF (2 ng/ml) into 400 μl of DMEM 0.3% BSA (per well).
Incubate the cells on ice for 1 h, in the dark (by covering the dish with aluminium foil).
Wash two multi-well dishes with ice-cold PBS three times and leave them on ice (control condition = ligand binding without endocytosis, at 4 °C binding ligand receptor is allowed, while internalization is blocked).
On one of the two dishes above, perform an acidic wash (to remove non-internalized ligand) by incubating the cells with an acetic acid buffer on ice for 6 min. Rinse with ice-cold PBS three times and leave on ice.
Transfer the other cell culture dishes at 37 °C to elicit endocytosis for different periods (optimal time points need to be set for the specific cellular model and ligand stimulation; in our experience, for example, 12 and 25 min for EGF 2 ng/ml to A549 cells).
At the end of each incubation, block endocytosis by moving dishes on ice.
Wash 3 times with ice-cold PBS and proceed with acid wash on ice as described in step 5 (to detach all the ligand bound to the receptor at the plasma membrane and allow detection of internalized ligand only).
After acidic wash, rinse each well 3 times with cold PBS.
Fix cells on every coverslip by incubation with 4% PFA in PBS for 10 min at room temperature and then wash 3 times with PBS. Fixed cells may be stored for several days in the refrigerator at this stage.
Permeabilize cell membranes by incubating fixed cells on coverslips with a solution of 0.01% saponin in PBS 1% BSA for 5-10 min on ice (in alternative, you may use 0.1% Triton in PBS 1% BSA).
Wash permeabilized cells three times with PBS.
(Optional) If Immunofluorescence analysis (IFA) is planned, non-specific binding may be blocked by incubation with PBS 1% BSA for 30 min, followed by immunostaining with specific antibodies.
Counterstain cell nuclei by incubating with DAPI 5 min at room temperature (a dilution 1:10,000 of a stock of 1 μg/μl).
Finally, wash once coverslips in PBS, then rinse with water and fix them inverted on microscope glass slides by including a mounting medium.
Analysis of fluorescent signals should be done with a confocal microscope with a 63x magnification, such as Leica TCS SP2 AOBS confocal laser-scanning microscope (see Figure 2 for representative images).
Quantify endocytosed fluorescent signal acquired with ImageJ software.
Figure 2. Representative pictures of endocytosis assay on A549. On the left, control cells treated with fluorescent EGF 1 h at 4 °C and subjected to acidic wash to clear out all EGF bound to plasmamembrane; no fluorescent signal from the plasmamembrane. On the right, cells treated with fluorescent EGF 1 h at 4 °C, subjected to acidic wash and then shifted to 37 °C (internalization); fluorescent signal from internalized EGF.
Notes
I settled this protocol on A549 cells, other cell lines may require optimization of experimental conditions (such as different timing of endocytosis induction at 37 °C). A549 should be grown in 10% serum RPMI medium.
Grow cells on coverslips in their optimal culture medium to reach 50-80% confluency on the day of the assay. Remember to have in separate multiwell dishes the coverslips that will have to undergo the different incubation times or control conditions.
In the meanwhile of step 2 (cell incubation with 0.3% BSA solution), prepare fluorochrome-conjugated ligand solution at the desired final concentration in DMEM 0.3% BSA, considering 400-500 μl per each well (in 24-well dishes). Remember to keep ligand-containing solutions always in the dark (covered with aluminium foil).
Put a plastic box (large enough to contain all multiwell dishes) with one inch of water on the bottom to warm up at 37 °C in the cell incubator that you will use for the assay. This will serve to speed up the temperature change between 4 °C and 37 °C to allow accurate timing for endocytosis in the different conditions.
Pay attention not to put the acidic wash solution directly on cells to avoid causing their detachment, but instead gently pour it on the side of the wells.
Do not exceed 6 min incubation with acidic wash. Acidic wash for coverslips always kept on ice, will provide the negative control of the experiments: In fact, after acidic wash, you should not detect any fluorescent signal from the ligand associated with the cells. On the other hand, there should still be strong signal on PBS-washed cells not subjected to acidic wash, indicating that ligand binding to the receptor indeed occurred.
It is good rule to acquire at least 50 different microscopic fields per each condition, from at least three independent experiments (applying constant detection parameters at the confocal microscope). Mean fluorescence intensity of the fields should then be quantified from image files (e.g. by ImageJ software).
Recipes
Acid wash
0.2 M acetic acid
0.5 M NaCl (pH 2.8)
For 100 ml
1.2 ml 100% acetic acid
10 ml 5 M NaCl
88.8 ml H2O
4% PFA in PBS
4 g paraformaldehyde in 100 ml PBS
Heat PBS (shaking) for 30 min until it reaches 60 °C
Add paraformaldehyde
Clarify by dropwise addiction of 5 M NaOH
Cool down temperature while shaking
Adjust pH at 7.4 (with 5 M NaOH/6 N HCl)
Bring to final volume with PBS
Shake again the solution
Aliquote
Keep at -20 °C
Acknowledgments
This protocol was initially developed for the study Rizzolio et al. (2012). Previous reports analyzing receptors internalization that have been used as reference to set up this procedure include: Lanzetti et al. (2000); Sawamiphak et al. (2010) and Popovic et al. (2012). Correlated research activity in the authors’ lab was funded by the University of Torino-Compagnia di San Paolo, Grant ORTO11RKTW (RETHE). The authors are indebted to Dr. Letizia Lanzetti (University of Torino) for her expert support in setting up this protocol.
References
Lanzetti, L., Rybin, V., Malabarba, M. G., Christoforidis, S., Scita, G., Zerial, M. and Di Fiore, P. P. (2000). The Eps8 protein coordinates EGF receptor signalling through Rac and trafficking through Rab5. Nature 408(6810): 374-377.
Popovic, D., Akutsu, M., Novak, I., Harper, J. W., Behrends, C. and Dikic, I. (2012). Rab GTPase-activating proteins in autophagy: regulation of endocytic and autophagy pathways by direct binding to human ATG8 modifiers. Mol Cell Biol 32(9): 1733-1744.
Rizzolio, S., Rabinowicz, N., Rainero, E., Lanzetti, L., Serini, G., Norman, J., Neufeld, G. and Tamagnone, L. (2012). Neuropilin-1-dependent regulation of EGF-receptor signaling. Cancer Res 72(22): 5801-5811.
Sawamiphak, S., Seidel, S., Essmann, C. L., Wilkinson, G. A., Pitulescu, M. E., Acker, T. and Acker-Palmer, A. (2010). Ephrin-B2 regulates VEGFR2 function in developmental and tumour angiogenesis. Nature 465(7297): 487-491.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Rizzolio, S. and Tamagnone, L. (2013). Epidermal Growth Factor (EGF) Receptor Endocytosis Assay in A549 Cells. Bio-protocol 3(15): e847. DOI: 10.21769/BioProtoc.847.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Fluorescence
Cell Biology > Cell-based analysis > Cytosis > Endocytocis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Assessment of Human Dendritic Cell Antigen Uptake by Flow Cytometry
Ana Luque [...] Josep M. Aran
Nov 20, 2013 17462 Views
Characterizing ER Retention Defects of PDZ Binding Deficient Cx36 Mutants Using Confocal Microscopy
Stephan Tetenborg [...] John O`Brien
Jul 20, 2024 337 Views
Calibrating Fluorescence Microscopy With 3D-Speckler (3D Fluorescence Speckle Analyzer)
Chieh-Chang Lin and Aussie Suzuki
Aug 20, 2024 401 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
848 | https://bio-protocol.org/en/bpdetail?id=848&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Total RNA Isolation after Laser-capture Microdissection of Human Cervical Squamous Epithelial Cells from Fresh Frozen Tissue
SW Saskia M Wilting
RS Renske DM Steenbergen
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.848 Views: 10629
Reviewed by: Lin Fang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Oncogene Jan 2013
Abstract
As most tissue specimens contain a mixture of different cell types including epithelial cells, stromal cells and immune cells, selection of the cells of interest is of utmost importance for the accurate determination of gene/microRNA expression. Laser capture microdissection enables the researcher to obtain homogeneous ultrapure cell selections from heterogeneous starting material. The following protocol was optimized for the isolation of total RNA from cervical (premalignant) squamous epithelial cells from fresh frozen biopsy specimens.
Keywords: LCM RNA Fresh frozen
Materials and Reagents
Fresh frozen tissue specimens stored in liquid nitrogen
Tissue-Tek O.C.T. (Sakura Finetek Europe B.V., catalog number: 4583 )
Mayers’ Haematoxylin
Ethanol
Xylene
Liquid nitrogen or dry ice
TRIzol (Life Technologies, catalog number: 15596-026 ) or a preferred alternative RNA isolation method
Glycogen (F. Hoffmann-La Roche, catalog number: 10901393001 )
Chloroform
Isopropanol (Isopropyl alcohol)
RNase-free water
Equipment
21-26 gauge needle
PEN foil 2.0 UM covered slides (Leica, catalog number: 11505158 )
50 ml tubes with screw cap (Greiner Bio-one, catalog number: 210261 )
Cryotome (rotary microtome in a frozen section environment)
Leica Laser Microdissection system (AS LMD, model: LMD6500 or LMD7000 )
Centrifuge
-80 °C freezer for sample storage
Procedure
Take all necessary precautions for RNA handling throughout the whole procedure.
Wear gloves at all times.
Only use RNase free equipment, plastics and reagents.
Pretreat the PEN foil slides with UV light for 15 min to reduce static electricity.
Note: We use a UV source of 50 Hz and 26 Watt.
Cut 8-10 μm thick sections from the frozen tissue specimens (embedded in Tissue-Tek) and apply sections directly to the PEN foil covered side of the slide.
Notes:
More than one section can be applied to the same slide depending on the size of the specimen.
Make sure that all sections are within the rectangle where the foil is not glued to the slide.
Keep sections dry and cold at all times (store in a closed 50 ml tube at -80 °C and transport in liquid nitrogen or on dry ice).
In addition a 4 μm section for standard H&E staining can be made to allow for demarcation of the tissue area/cells of interest by a pathologist or other expert.
Slides containing tissue sections should be stored in a closed 50 ml tube and kept cold at all times (store at -80 °C and transport in liquid nitrogen or on dry ice).
Note: The use of 50 ml tubes avoids condensation on the slide thereby keeping the tissue dry which reduces RNA degradation.
Stain sections with Mayers’ Haematoxylin for 1 min at room temperature (RT).
Notes:
Before staining let slides come to RT while still in the closed 50 ml tube.
Be careful not to lose the tissue section. Staining is best done by pipetting the haematoxylin directly on the slide.
Carefully rinse slide in sterile (RNase free) water.
Dehydrate tissue sections by subsequent rinsing for 1 min each in 50%, 70% and 100% ethanol (can be done in 50 ml tubes) and an 8 min incubation in Xylene (use a glass container).
Store slides in a closed 50 ml tube at -80 °C or continue with the microdissection.
Add a little (10-20 μl) TRIzol to the tube cap in which the microdissected tissue will fall.
Notes:
Let slides come to room temperature while in the 50 ml tube right before starting the microdissection procedure for that slide.
If an alternative RNA isolation method is preferred, TRIzol should be substituted by the first reagent used in that method.
Microdissect all areas/cells of interest from the slide using at a 10x magnification (see Figure 1) using the following settings:
Intensity: 46
Speed: 5 (or lower)
Offset: 5
Aperture diff: 6
Figure 1. Example picture of a cervical tissue section before (upper panel) and after (lower panel) laser capture microdissection of the dysplastic epithelium. The microdissected tissue in the cap is shown in the left panel.
Add another 80-90 μl of TRIzol (or alternative isolation reagent) to the 0.2 ml tube containing the microdissected tissue and transfer tissue and TRIzol/alternative isolation reagent to a 1.5 ml tube.
Note: If preferred by the researcher an alternative RNA isolation method can be used. However, this protocol was optimized using TRIzol.
Add TRIzol to the tube to obtain a total volume of 1 ml.
Note: Store at -80 °C or continue with RNA isolation.
Add 1 μl glycogen and mix well (vortex for 10 seconds).
Disrupt the tissue/cells and shear the genomic DNA with 10 passes through a 21-26 gauge needle.
Add 0.2 ml of chloroform and vortex for 30 sec.
Spin down for 5 min at full speed (12,000 x g) at RT.
Transfer the aqueous phase to a clean tube.
Add 0.5 ml of isopropanol to the aqueous phase and mix well.
Incubate samples for at least 1 h at -20 °C for optimal precipitation of the RNA.
Spin down for 15 min at full speed (12,000 x g) at RT.
Discard supernatant
Note: Careful not to disturb the pellet containing your RNA.
Wash pellet with 200 μl of 70% ethanol.
Spin down at full speed for 10 min at RT.
Discard supernatant.
Repeat steps 20-22.
Note: This time it is important to completely remove the supernatant.
Airdry the pellet.
Note: If all supernatant in removed in step 23 this should only take a few minutes.
Resuspend the pellet in 10-30 μl RNase free water.
Store at -80 °C.
Acknowledgments
This protocol was optimised with the help of Elza de Bruin (de Bruin et al., 2005) and Muriel Verkuijten. This work was supported by the Centre for Medical Systems Biology (CMSB) in the framework of the Netherlands Genomic Initiative, Royal Netherlands Academy of Arts and Sciences, the VUMC-CCA institute of the VU University Medical Center, Amsterdam, The Netherlands (grant number CCA20085-04) and the Dutch Cancer Society (KWF, grant number VU2010-4668).
References
de Bruin, E. C., van de Pas, S., Lips, E. H., van Eijk, R., van der Zee, M. M., Lombaerts, M., van Wezel, T., Marijnen, C. A., van Krieken, J. H., Medema, J. P., van de Velde, C. J., Eilers, P. H. and Peltenburg, L. T. (2005). Macrodissection versus microdissection of rectal carcinoma: minor influence of stroma cells to tumor cell gene expression profiles. BMC Genomics 6: 142.
Wilting, S. M., de Wilde, J., Meijer, C. J., Berkhof, J., Yi, Y., van Wieringen, W. N., Braakhuis, B. J., Meijer, G. A., Ylstra, B., Snijders, P. J. and Steenbergen, R. D. (2008). Integrated genomic and transcriptional profiling identifies chromosomal loci with altered gene expression in cervical cancer. Genes Chromosomes Cancer 47(10): 890-905.
Wilting, S. M., Snijders, P. J., Verlaat, W., Jaspers, A., van de Wiel, M. A., van Wieringen, W. N., Meijer, G. A., Kenter, G. G., Yi, Y., le Sage, C., Agami, R., Meijer, C. J. and Steenbergen, R. D. (2013). Altered microRNA expression associated with chromosomal changes contributes to cervical carcinogenesis. Oncogene 32(1): 106-116.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
RNA Extraction from Ears and Draining Lymph Nodes of Mice Infected with Leishmania amazonensis
Emilie Giraud and Evie Melanitou
Jun 5, 2020 4166 Views
Mechanical Fractionation of Cultured Neuronal Cells into Cell Body and Neurite Fractions
Ankita Arora [...] J. Matthew Taliaferro
Jun 5, 2021 4026 Views
Updated Pseudo-seq Protocol for Transcriptome-Wide Detection of Pseudouridines
Yi Pan [...] Paul L. Boutz
May 5, 2024 331 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
849 | https://bio-protocol.org/en/bpdetail?id=849&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Heat Shock Treatment of Chlamydomonas reinhardtii and Chlorella Cells
Stephanie Chankova
Zhana Mitrovska
Nadezhda Yurina
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.849 Views: 9106
Reviewed by: Ru Zhang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Gene Mar 2013
Abstract
The protocol is very reliable and simple for inducing heat shock in unicellular green algae cells. The main purpose was to compare cellular response of three Chlorella species, isolated from different habitats: Chlorella vulgaris 8/1- thermophilic, Chlorella kesslery- mesophilic and C. vulgaris- extremophilic. Species were isolated from different habitats and differ in their temperature preferences and tolerance. Temperature induced stress response was measured as cell survival, induction of chloroplast HSP70B and DSBs induction and rejoining.
Materials and Reagents
Species:
Three Chlorella species were used: C. vulgaris, isolated from soil samples of Livingston Island, the South Shetland Archipelago, Antarctic; C. vulgaris strain 8/1, isolated in 1968 from thermal springs in the region of Rupite, Bulgaria, and cultivated in our laboratory since 1975 and Chlorella kesslery a mesophile, from the Trebon collection.
Cultivation: Chlorella species were cultivated on Tris Acetate Phosphate (TAP) medium under continuous light of 60 μmol/m2/s and a temperature of 23 °C ± 0.1 °C in a Phytotron GC 400 growth chamber. The species were cultivated at this temperature because it is well known, that eurythermal algae, could be grown at a wide range of temperatures.
TAP medium (see Recipes)
Sager–Granick medium (see Recipes)
Equipment
Phytotron GC 400 growth chamber (NUVE Ankara/Turkey 2009)
Microscope
Bürker chamber
Circulating water bath
Procedure
Cultivation
Cultivate for 4-5 days algae strains or species on TAP medium (Harris, 1989) under continuous light of 60 μmol/m2/s and a temperature of 23 °C ± 0.1 °C in a Phytotron GC 400 growth chamber to the end of exponential and early stationary phase of growth.
Check under the microscope whether cell culture is not contaminated.
Count cell number under the microscope using Bürker chamber.
Centrifuge certain volume (depending on the cell density, counted in step A-3) of cell suspension at 1,200 x g by RT, resuspend in Sager-Granick medium or other appropriate medium, so to get 10 ml of cell suspension with a density of 1 x 106 cells/ml for every sample.
Temperature treatment
Keep 10 ml cell culture with a density 1 x 106 cells/ml in an incubator under continuous shaking, at different temperatures:
t = 39 °C for 30 min
t = 42 °С for 5 min
t = 45 °С for 5 min
Notes:
The same heating procedure could be done in a circulating water bath at the same three temperatures: t = 39 °С for 30 min, t = 42 °С for 5 min, and t = 45 °С for 5 min.
Use 50 ml flasks to comply with the requirement that volume of the cell culture must be not more than 1/3 of the volume of the flask.
Place on ice to stop the heating process.
For HSP70B analysis keep cells for 2 and 4 h after the step II-2 at t = 23 °C ± 0.1 °C to allow cells to recover.
Centrifuge 10 ml cell suspension at 1,200 x g for 5 min.
Recipes
TAP medium
Stock solution for 1 L of TAP media
1 M Tris base
20 ml
Phosphate Buffer II (see 1-a)
1.0 ml
Solution A (see 1-b)
10.0 ml
Hutner's trace elements (see 1-c)
1.0 ml
Glacial acetic acid (pH to 7.0)
1.0 ml
Phosphate buffer II (Stock solution)
Component (For 100 ml)
K2HPO4
10.8 g
KH2PO4
5.6 g
Solution A
Component (For 500 ml)
NH4Cl
20 g
MgSO4·7H2O
5.0 g
CaCl2·2H2O
2.5 g
Hutner's trace elements
Dissolve 50 g of acid free EDTA in 250 ml of deionized. Heat to dissolve.
Dissolve the following one by one in order. Heating to approximately 100 °C in 500 ml deionized H2O.
Component
Quantity
H3BO3
11.4 g
ZnSO4·7H2O
22.0 g
MnCl2·4H2O
5.06 g
FeSO4·7H2O
4.99 g
CoCl2·6H2O
1.61 g
CuSO4·5H2O
1.57 g
Mo7O24(NH4)6·4H2O
1.1 g
Mix the two solutions together. The resulting solution should be blue-green.
Heat to 100 °C. Cool slightly, but don't let the temperature drop below 80 °C – 90 °C.
Adjust pH to 6.5–6.8 with 20% KOH (approximately 83 ml).
Sager and Granick medium (adjust pH 6.8-7.0)
Component
In 1 L stock
For 1 L media
Trace elements*
--
1 ml
NaCitrate·2H2O
100 g
5 ml
FeCl3·6H2O
10 g
1 ml
CaCl2·6H2O
58 g
1 ml
MgSO4·7H2O
100 g
3 ml
NH4NO3
100 g
3 ml
KH2PO4
100 g
1 ml
K2HPO4
100 g
1 ml
*Trace Elements
Component
In 1 L stock
H3BO3
1.0 g
ZnSO4·7H2O
1.0 g
MnSO4·H2O
0.303 g
CoCl2·6H2O
0.2 g
Na2MoO4·2H2O
0.2 g
CuSO4·5H2O
0.063 g
References
Chankova, S. G., Yurina, N. P., Dimova, E. G., Ermohina, O. V., Oleskina, Y. P., Dimitrova, M. T. and Bryant, P. E. (2009). Pretreatment with heat does not affect double-strand breaks DNA rejoining in Chlamydomonas reinhardtii. J Ther Biol 34(7): 332-336.
Chankova, S., Mitrovska, Z., Miteva, D., Oleskina, Y. P. and Yurina, N. P. (2013). Heat shock protein HSP70B as a marker for genotype resistance to environmental stress in Chlorella species from contrasting habitats. Gene 516(1): 184-189.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Chankova, S., Mitrovska, Z. and Yurina, N. (2013). Heat Shock Treatment of Chlamydomonas reinhardtii and Chlorella Cells. Bio-protocol 3(15): e849. DOI: 10.21769/BioProtoc.849.
Download Citation in RIS Format
Category
Plant Science > Phycology > Cell analysis
Cell Biology > Cell signaling > Stress response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Using Arabidopsis Mesophyll Protoplasts to Study Unfolded Protein Response Signaling
Yan Bao and Diane C. Bassham
Dec 5, 2018 5227 Views
Insect Feeding Assays with Spodoptera exigua on Arabidopsis thaliana
Yanrong You [...] Chuanyou Li
Mar 5, 2020 4009 Views
Detection and Quantification of Programmed Cell Death in Chlamydomonas reinhardtii: The Example of S-Nitrosoglutathione
Lou Lambert and Antoine Danon
Aug 5, 2024 404 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
85 | https://bio-protocol.org/en/bpdetail?id=85&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Dharmacon siRNA Transfection of HeLa Cells
YC Yanling Chen
Published: Vol 2, Iss 4, Feb 20, 2012
DOI: 10.21769/BioProtoc.85 Views: 25493
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Small Interfering RNA (siRNA) is a class of double-stranded RNAs of 20-25 nucleotides that play important roles in many biological processes (Hamilton and Baulcombe, 1999). siRNAs act by “neutralizing” the mRNA of the target protein, facilitating degradation of the mRNA and hence altering the biological effect of the protein (reviewed in Hannon and Rossi, 2004). siRNAs may also change the intracellular levels of regulatory RNAs. Use of siRNAs for manipulating the expression of genes of interest in biological research is commonly referred to as RNA interference or knockdown technique (Elbashir et al., 2001). Synthetic siRNAs are an emerging tool that are now widely used in these studies. A variety of algorithms are employed by different companies for the design of siRNA products, which differ in efficacy, specificity and cost among other criteria. An example protocol of siRNA knockdown is explained here using the siGENOME SMARTpool reagents from Dharmacon.
Materials and Reagents
Human cervix epithelial carcinoma cell line Hela (ATCC, catalog number: CCL-2 ™)
Eagle's Minimum Essential Medium (ATCC, catalog number: 30-2003 ™)
Fetal bovine serum (FBS) (ATCC, catalog number: 30-2020 ™)
5x siRNA buffer (GE Healthcare Dharmacon, catalog number: B-002000-UB-100 )
DharmaFECT 1 siRNA Transfection Reagent (GE Healthcare Dharmacon, catalog number: T-2001-01 )
siGENOME SMARTpool reagents (GE Healthcare Dharmacon)
Glyceral-dehyde-3-phosphate dehydrogenase (GAPD) (GE Healthcare Dharmacon, catalog number: D-001140-01 )
Non-targeting siRNA control pool (GE Healthcare Dharmacon, catalog number: D-001206-13 )
Equipment
12-well polystyrene tissue culture plate (BD Biosciences, Falcon®, catalog number: 353043 )
Cell culture incubator: 37 ºC and 5% CO2
Procedure
Carry Hela cells in Eagle's Minimum Essential Medium with 10% FBS.
Trypsinize, count cells and reseed cells 12-16 h before knockdown (see Note 1).
Resuspend siRNA in 1x siRNA buffer to reach a final concentration of 5 μM.
Add 5 μl of the 5 μM siRNA to 95 μl of serum-free medium in a low-adhesion tube 1, mix by gently tapping the tube or pipetting up and down.
Add 0.5~5 μl DharmaFECT 1 reagent (see Note 2) to 99 μl of serum-free medium in a separate tube 2, mix by gently tapping the tube or pipetting up and down (see Note 3).
The two tubes in steps 4-5 are incubated at room temperature for 5 min.
Add the content of tube 1 from step 4 to tube 2 from step 5 (siRNA into DharmaFECT), mix gently by pipetting up and down, and incubate at room temperature for an additional 20 min.
Add 800 μl of complete medium to the resulting mixture of step 7 (final siRNA concentration is 25 nM.).
Remove culture medium from the 12-well tissue culture plate. Add the medium mixture of step 8 (total of 1 ml) to each well (see Note 4).
Grow Hela cells for additional 24-48 h before mRNA analysis, or >48 h for protein analysis.
Cytotoxicity should always be carefully monitored throughout the knockdown process. Experimental conditions should always be determined empirically.
Each experiment should have “control groups” including Non-treated cells, Positive control siRNA (e.g., GAPD), Negative control siRNA (e.g., “Non-targeting”). Perform experiments in triplicates as a minimum.
Notes
Optimal cell seeding density for each cell type should always be determined empirically. For Hela cells, the cell density should reach ~50% confluence at the beginning of the knockdown procedure.
1 μl of DharmaFECT reagent was found to yield good knockdown results.
Use different DharmaFECT Transfection reagent for different cell lines. Check www.dharmacon.com for details.
For steps 8-9: Alternatively, one can also replenish the original medium in the well with 800 μl of fresh complete medium, followed by evenly “dropping” the 200 μl reagent mixture of step 7 into each well.
Acknowledgments
This protocol was developed in the Department of Immunology, Scripps Research Institute, La Jolla, CA, USA and adapted from Elbashir et al. (2001), Hamilton and Baulcombe (1999) and Hannon and Rossi (2004). The work was funded by NIH grants CA079871 and CA114059, and Tobacco-Related Disease, Research Program of the University of California, 15RT-0104 to Dr. Jiing-Dwan Lee [see Chen et al. (2009)].
References
Chen, Y., Lu, B., Yang, Q., Fearns, C., Yates, J. R., 3rd and Lee, J. D. (2009). Combined integrin phosphoproteomic analyses and small interfering RNA--based functional screening identify key regulators for cancer cell adhesion and migration. Cancer Res 69(8): 3713-3720.
Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K. and Tuschl, T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411(6836): 494-498.
Hamilton, A. J., Baulcombe, D. C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286(5441): 950-952.
Hannon, G. J. and Rossi, J. J. (2004). Unlocking the potential of the human genome with RNA interference. Nature 431(7006): 371-378.
Article Information
Copyright
© 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Chen, Y. (2012). Dharmacon siRNA Transfection of HeLa Cells. Bio-protocol 2(4): e85. DOI: 10.21769/BioProtoc.85.
Download Citation in RIS Format
Category
Molecular Biology > RNA > RNA interference
Molecular Biology > RNA > Transfection
Molecular Biology > RNA > Transcription
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
What is the function of GAPD (Glyceral-dehyde-3-phosphate dehydrogenase ), what is the positive control for in KD experiments?
0 Answer
5 Views
Aug 14, 2023
Related protocols
Targeting the Expression of Long Noncoding RNAs in Murine Satellite Cells from Single Myofibers
Martina Macino [...] Chiara Mozzetta
Nov 5, 2021 2200 Views
TGIRT-seq Protocol for the Comprehensive Profiling of Coding and Non-coding RNA Biotypes in Cellular, Extracellular Vesicle, and Plasma RNAs
Hengyi Xu [...] Alan M. Lambowitz
Dec 5, 2021 3842 Views
Accurate Measurement of Cell Number–Normalized Differential Gene Expression in Cells Treated With Retinoic Acid
Nina Weichert-Leahey [...] Brian J. Abraham
Nov 5, 2024 389 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
850 | https://bio-protocol.org/en/bpdetail?id=850&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Western Blot Analysis of Chloroplast HSP70B in Chlorella Species
Stephka Chankova
Zhana Mitrovska
Nadezhda Yurina
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.850 Views: 10154
Reviewed by: Ru Zhang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Gene Mar 2013
Abstract
Western blotting allows for the specific detection of proteins by an antibody of interest. This protocol utilizes isolation of total proteins protocol for Chlorella vulgaris prior to gel electrophoresis. After electrophoresis, the selected antibodies are used to detect and quantify levels of chloroplast HSP70B.
Materials and Reagents
Species
Three Chlorella species were used: C. vulgaris, isolated from soil samples of Livingston Island, the South Shetland Archipelago, Antarctic; C. vulgaris strain 8/1, isolated in 1968 from thermal springs in the region of Rupite, Bulgaria, and cultivated in our laboratory since 1975 and Chlorella kesslery a mesophile, from the Trebon collection.
Cultivation
Chlorella species were cultivated on TAP (Tris Acetate Phosphate) medium under continuous light of 60 μmol/m2/s and a temperature of 23 °C ± 0.1 °C in a Phytotron GC 400 growth chamber. The species were cultivated at this temperature because it is well known, that eurythermal algae, could be grown at a wide range of temperatures.
Rabbit polyclonal antibody HSP70B cytoplasmic (Agrisera, catalog number: AS06 175 )
Goat anti-rabbit IgG(H&l) HRP conjugated (Agrisera, catalog number: AS09 602 )
Coomassie brilliant blue G 250
Orthophosphoric acid (Valerus, catalog number: N 4420 )
Trichloroacetic acid (TCA)
Bovine serum albumin (BSA) (Applichem GmbH, catalog number: 1391 0025 )
Albumin fraction V (pH 7.0)
Medium Pure Nitrocellulose (NCM) (0.45 μm) (Bio-Rad Laboratories, catalog number: 162-0115 )
Filter paper
Sponge
4CN (4-chloro-naphthol) (Bio-Rad Laboratories, catalog number: N170-6535 )
N,N′ N′ Tetramethylethylendiamine (TEMED) (Alfa Aesar, catalog number: N12536 )
Laemmli sample buffer (see Recipes)
Reagent of Bradford (see Recipes)
5x Laemmli buffer (see Recipes)
Running buffer (see Recipes)
Transfer buffer (see Recipes)
SDS-PAGE gel (see Recipes)
30% Acrylamide/N,N’-methylenebisacrylamide (AA/MBA) (see Recipes)
10% SDS (see Recipes)
10% Ammonium Persulfate (see Recipes)
1.5 M Tris HCl buffer (pH 8.8) (see Recipes)
1.0 M Tris HCl buffer (pH 6.8) (see Recipes)
4 M NaCl (see Recipes)
1.0 M Tris HCl buffer (pH 7.5) (see Recipes)
20% Tween 20 (see Recipes)
Blocking buffer (see Recipes)
Staining solution (see Recipes)
5% CH3COOH (see Recipes)
Washing solution (see Recipes)
50 mM TBS-T buffer (see Recipes)
HRP color development solution (see Recipes)
Equipment
Motor
Silica quartz sand 0.6 mm (Valerus, catalog number: N 1760 )
Centrifuge (Sigma-Aldrich, model: 1-15 K)
Electrophoresis chamber Transfer unit Hoefer miniVE electrophotesis and electrotransfer unit (Hoefer, model: SE300-10A-1.0 )
Mini Rocker Shaker MR-1
Software
Image J program
Procedure
Cells lysis
Add 100 μl Lisys Solution (LS) to the pellet (Chankova et al., 2013b) transfer to a chilled mortar, add two spatulas of silica sand, grind in the mortar for 3 min, add 200 μl LS in the mortar to wash and transfer the material into an Eppendorf tube of 2 ml.
Centrifuge material from step 1 for 10 min at 14,500 x g.
Separate the supernatant and heat the supernatant for 5 min at t = 90 °С.
Centrifuge for 5 min at 14,500 x g.
Split the supernatant in 2 samples: The first one use for the determination of protein concentration; the second one keep at t = -20 °С.
Determination of protein concentration (Bradford)
Add 30 μl 20% TCA to 30 μl supernatant.
Centrifuge for 5 min at 14,500 x g.
Add 60 μl 0.1 N NaOH to the pellet and mix thoroughly. To obtain best result add twice 30 μl of 0.1 N NaOH.
Take 14 μl, add 86 μl 0.15 М NaCl and 3 ml reagent of Bradford.
Use calibration curve for quantity of protein (Table 1).
For calibration curve:
Stock solution – 0.5 mg/ml BSA
Use Table 1 to determine every point of standard curve add 3 ml reagent of Bradford.
Table 1. Calibration curve for quantity of protein
N
BSA (μg)
BSA (0.5 mg/ml) vol (μl)
NaCl (0.15 M) vol (μl)
1
0
0
100
2
5
10
90
3
10
20
80
4
15
30
70
5
20
40
60
6
25
50
50
7
30
60
40
8
35
70
30
9
40
80
20
10
45
90
10
11
50
100
0
Protein electrophoresis
Put about 100 ml of the 1x Laemmli buffer into cuvettes of electrophoresis module.
Remove the comb and rinse the wells with buffer of SDS-PAGE gel.
Pipet 10 μg protein into every well: adjust volumes so equal amount of protein is loaded (example: 10 μg protein are contained in 10 μl sample).
Put the rest buffer in a bath of electrophoresis chamber (the volume must be always above minimum.).
Run electrophoresis using the following parameters: 120 V and 16 mA for 3.5 h.
When the electrophoresis is completed, remove the gel carefully.
Note: The order of the dropping of the samples. Concentrated gel should be released.
Transfer of proteins on the NCM
Soak the gel for 15 min in buffer.
Soak sponge and filter paper for sandwich in transfer buffer.
Cut NCM. The size should be such as the size of the gel. Put NCM for 5 min in transfer buffer.
Note: Mark the order of samples on the membrane! Label the membrane with a pencil.
Make a sandwich.
The stack is assembled on the black cathode side (see Figure 1):
Center a packing sponge on the black cathode side.
Center a packing sponge on the black catode (a).
Lay one piece of wet filter paper on the sponge (b).
Position the equilibrate gels on the filter paper(c).
Lay the membrane on the gel (d).
Lay one piece of wet filter paper on the membrane (e).
Lay two packing sponges on the filter paper (f).
A second transfer stack if added, is placed between these two sponges.
Figure 1. Assembling a transfer stack (this is an original figure taken from the Technical Guide available at www. hoeferinc.com)
Different parts of the sandwich press very well, to avoid bubbles.
Different parts of the sandwich should be well moistened. You can "roll" them with a tube.
Close the apparatus. Put in a chamber transfer buffer.
Run blotting with the following parameters: 35 V and 250 mA for 2 h.
Western blot
After the transfer of proteins, place the membrane in blocking buffer at t = 4 °C. Incubate on a rocker platform for 1 h (following this step we have obtained the best results).
Place gels in staining solution for 4-5 h.
Wash for 3-4 h the gel with washing solution.
Dilute primary antibody in blocking buffer (1:10,000) and incubate according to manufacturer’s instructions. Incubate on a rocker platform at t = 4 °C overnight.
Wash the membrane in TBS-T buffer on a rocker platform in a following way: twice for 2 min (2 х 2 min), after that twice for 10 min (2 x 10 min).
Prepare secondary antibody in blocking buffer (1:20,000) and incubate according to manufacturer’s instructions. Incubate on a rocker platform at RT for 2 h.
Wash the membrane in TBS-T buffer on a rocker platform in a following way: Twice for 2 min (2 х 2 min), after that three times for 5 min (3 x 5 min).
Visualize using HRP Color Development Solution, 4CN according manufacturer’s instructions.
Scan the membrane. Calculate protein amount using Image J program.
Recipes
Laemmli sample buffer
2% SDS
5% 2-mercaptoehtanol
10% glycerol
0.002%(w/v) bromophenol blue
62.5 mM Tris HCl (pH 6.8)
Reagent of Bradford
Dissolve 100 mg Coomassie brilliant blue G 250 and 50 ml 96% alcohol in a stirrer for 15 min. Add 94.5 ml 90% orthophosphoric acid.
Add 900 ml deionized H2O and stir gently.
Filtering through a folded filter paper and make up to 1 L with deionized water.
Keep in a fridge at t = 4 °C.
5x Laemmli buffer
15 g TRIS base
72 g Glycine in 1 L deionized H2O
Running Buffer
Add 200 ml 5x Laemmli buffer + 10 ml 10% SDS to 1 L deionized H2O
Transfer Buffer
Add 200 ml 5x Laemmli buffer + 2 ml 10% SDS to + 200 ml ethanol to 1 L deionized H2O
SDS-PAGE gel
Note: Glass tiles should be cleared well with alcohol before preparing SDS-PAGE gel.
Separating gel (12.5%) (Table 2)
Table 2. Preparing of separating gel solution
Number of mini-gels
1
2
Deionized H2O
3.2 ml
6.4 ml
Acrilamide/bisacrilamide (30%)
4 ml
8.0 ml
1.5 M Tris HCl buffer, pH 8.8
2.6 ml
5.2 ml
10% SDS
100 μl
200 μl
10% APS
100 μl
200 μl
TEMED
10 μl
20 μl
Mix very carefully the components in a 50 ml Falcon tube to avoid bubbles.
Insert separating gel between two glass plates of the chamber (about 1 cm below the boundary of tiles).
Add deionized H2O carefully as a thin film using a syringe and wait about 15 min.
Carefully remove the water; Wipe the water drops in the ends with filter paper.
Stacking gel (Table 3)
Table 3. Preparing of 4% stacking gel solution
Number of mini-gels
1
2
Deionized H2O
1,370 μl
2,740 μl
Acrilamide/bisacrilamide (30%)
330 μl
660 μl
1.0 M Tris HCl buffer, pH 6.8
250 μl
500 μl
10% SDS
20 μl
40 μl
10% APS
20 μl
40 μl
TEMED
2 μl
4 μl
Put the concentrated gel, insert the comb and wait until the gel polymerize.
For an electrophoresis is better to prepare about 1,250 ml 1x Laemmli buffer. It can be used twice.
30% AA/MBA
29.0 g + 1.0 g MBA dissolve in 72.5 ml deionized H2O, make up the volume to 100 ml, filter using 0.45 μm filter
Keep at t = 4 °C less than 1 month.
10% SDS
Dissolve 10 g SDS in 100 ml deionized H2O
10% Ammonium Persulfate
Dissolve 1 g in 10 ml deionized H2O
Keep at t = 4 °C less than 1 month.
1.5 M Tris HCl Buffer pH 8.8
Dissolve 18.5 g Tris base in 80 ml deionized H2O, adjust to pH = 8.8 with concentrated HCl and make up the volume to 100 ml.
1.0 M Tris HCl Buffer pH 6.8
Dissolve 12.114 g Tris base in 80 ml deionized H2O, adjust to pH= 6.8 with concentrated HCl and make up the volume to 100 ml.
50 mM TBS-T buffer
1.0 M Tris HCl buffer (pH 7.5)
200 mM NaCl
0.1% Tween 20
4 M NaCl
Dissolve 23.376 g NaCl in100 ml deionized H2O
1.0 M Tris HCl buffer (pH 7.5)
Dissolve 12.114 g TRIS base in 80 ml deionized H2O, adjust to pH 7.5 with concentrated HCl and make up to the 100 ml.
20% Tween 20
20 ml Tween make up to 100 ml deionized H2O.
Blocking buffer
Dissolve 5% fatless dry milk in 100 ml TBS-T buffer.
Staining solution
0.2% Coomassie Brilliant blue R- 250
40% C2H5OH
5% CH3COOH
Dissolve 2 g Coomassie Brilliant blue R- 250, 400 ml C2H5OH and 50 ml CH3COOH and make up to 1 L with deionized H2O.
Washing solution
40% C2H5OH
5% CH3COOH
HRP Color Development Solution
Dissolve 60 mg of 4-chloro-naphtol into 20 ml of methanol.
Disolve immediately before use and protect solution from light.
Immediately prior to use, add 60 μl of ice cold 30% H2O2 to 100 ml TBS. Mix both solutions at RT. Use immediately.
References
Chankova, S., Mitrovska, Z., Miteva, D., Oleskina, Y. P. and Yurina, N. P. (2013a). Heat shock protein HSP70B as a marker for genotype resistance to environmental stress in Chlorella species from contrasting habitats. Gene 516(1): 184-189.
Chankova, S., Mitrovska, Z. and Yurina, N. (2013b). Heat Shock Treatment of Chlamydomonas reinhardtii and Chlorella Cells. Bio-protocol 3(15): e849.
Chankova, S. G., Yurina, N. P., Dimova, E. G., Ermohina, O. V., Oleskina, Y. P., Dimitrova, M. T. and Bryant, P. E. (2009). Pretreatment with heat does not affect double-strand breaks DNA rejoining in Chlamydomonas reinhardtii. J Thermal Biol 34(7): 332-336.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Phycology > Protein
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
MAPK Phosphorylation Assay with Leaf Disks of Arabidopsis
Pascale Flury [...] Sebastian Bartels
Oct 5, 2013 12507 Views
Capillary Nano-immunoassay for Quantification of Proteins from CD138-purified Myeloma Cells
Irena Misiewicz-Krzeminska [...] Norma C. Gutiérrez
Jun 20, 2019 5714 Views
Far-western Blotting Detection of the Binding of Insulin Receptor Substrate to the Insulin Receptor
Jinghua Peng [...] Ling He
Feb 20, 2023 1081 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
851 | https://bio-protocol.org/en/bpdetail?id=851&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pulmonary Myeloperoxidase Activity
TO Tammy Regena Ozment
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.851 Views: 10406
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Oct 2012
Abstract
Neutrophils are considered one of the first responders of the innate immune response. Their primary activities are to migrate to sites of infection by chemotaxis and trans-migration across the endothelium (Gaines et al., 2005). Once at the site of infection, they phagocytize microbes and kill them. Critical to the neutrophil’s ability to kill microbes are the multiple degradative enzymes contained within granules. The activity of these enzymes is non-specific, and therefore, neutrophils also contribute to tissue damage at the site of infection (Gaines and Berliner, 2005). Measurement of neutrophil infiltration into tissues is one way to gauge the severity of infection, inflammation, and tissue damage (Ayala et al., 2002). Myeloperoxidase is found in the primary granules of neutrophils and is an effective measure of neutrophil infiltration into tissues (Gaines and Berliner, 2005).
Keywords: Neutrophil Inflammation Lung injury
Materials and Reagents
Fresh or snap-frozen tissues
Liquid nitrogen
MPO Fluoremetric Detection Kit (Assay Designs, catalog number: 907-029 )
N-ethylmaleimide (Sigma-Aldrich, catalog number: E2068 )
Hexadecyltrimethylammonium (Sigma-Aldrich, catalog number: 52366 )
Deionized water
DMSO (Sigma-Aldrich, catalog number: D8418 )
Assay buffer (see Recipes)
Hydrogen Peroxide (see Recipes)
Detection Reagent (see Recipes)
Reaction cocktail (see Recipes)
Equipment
14 ml Polystyrene test tubes
2 ml Microfuge tubes
Black-welled 96 well plates
Polytron homogenizer
Sonicator
Fluorescent plate reader
Refrigerated centrifuge
Procedure
Weigh out 50 mg tissue into polycarbonate test tubes containing 0.5-1 ml ice cold 1x assay buffer with 10 mM N-ethylmaleimide.
Homogenize to just disrupt the tissue by placing the tip of the homogenizer in the bottom of the tube and switching the machine on, agitating the tube to move the tip of the homogenizer throughout the liquid and then switching the machine off after approximately one sec. Repeat until the tissues are just disrupted, usually 9 more times for a total of 10 pulses.
Centrifuge at 500 x g for 10 min at 4 °C.
Discard supernatant, add 500 μl ice cold 1x assay buffer containing 0.5% hexadecyltrimethylammonium to the pellet and transfer to a 2 ml microfuge tube.
Homogenize to lyse the cells by placing the tip of the homogenizer in the bottom of the tube and switching the machine on, agitating the tube to move the tip of the homogenizer throughout the liquid and then switching the machine off after approximately 5 sec. Repeat 9 times for a total of 10 pulses. Place on ice.
Sonicate to further lyse the cells at 50% power for 10 sec. Place on ice. Repeat 2 times for a total of 3 pulses.
Snap freeze in liquid nitrogen and thaw at room temperature by placing in liquid nitrogen, immediately removing from the nitrogen and leave the samples at room temperature until completely thawed. Repeat snap freeze and thaw once.
Store at -80 °C until assayed.
Prior to assay, serially dilute the included MPO standard in assay buffer.
To assay, add 50 μl of sample or the MPO standard to the bottom of a black 96 well plate. Add 50 μl Reaction Cocktail provided by the kit. All samples and standards should be run in duplicate.
Incubate at room temperature in the dark for 30 min.
Read the fluorescence at 550 nm excitation and 595 nm emission every 10 min until 60 min incubation.
Plot the standard concentration vs. the maximum relative fluorescence units to create a standard curve (Figure 1).
Figure 1. Representative Standard Curve
Determine the concentration of the unknowns from the standard curve.
Recipes
1x Assay buffer
4 ml MPO assay buffer concentrate
36 ml deionized water
Hydrogen Peroxide
22.7 μl 3% hydrogen peroxide
977 μl deionized water
Detection Reagent
Supplied vial
500 μl DMSO
Reaction cocktail
50 μl detection reagent
5 μl hydrogen peroxide
4.875 ml 1x assay buffer
Acknowledgments
This protocol is adapted from Ozment et al. (2012).
References
Ayala, A., Chung, C. S., Lomas, J. L., Song, G. Y., Doughty, L. A., Gregory, S. H., Cioffi, W. G., LeBlanc, B. W., Reichner, J., Simms, H. H. and Grutkoski, P. S. (2002). Shock-induced neutrophil mediated priming for acute lung injury in mice: divergent effects of TLR-4 and TLR-4/FasL deficiency. Am J Pathol 161(6): 2283-2294.
Gaines, P., Chi, J. and Berliner, N. (2005). Heterogeneity of functional responses in differentiated myeloid cell lines reveals EPRO cells as a valid model of murine neutrophil functional activation. J Leukoc Biol 77(5): 669-679.
Ozment, T. R., Ha, T., Breuel, K. F., Ford, T. R., Ferguson, D. A., Kalbfleisch, J., Schweitzer, J. B., Kelley, J. L., Li, C. and Williams, D. L. (2012). Scavenger receptor class a plays a central role in mediating mortality and the development of the pro-inflammatory phenotype in polymicrobial sepsis. PLoS Pathog 8(10): e1002967.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Ozment, T. R. (2013). Pulmonary Myeloperoxidase Activity. Bio-protocol 3(15): e851. DOI: 10.21769/BioProtoc.851.
Ozment, T. R., Ha, T., Breuel, K. F., Ford, T. R., Ferguson, D. A., Kalbfleisch, J., Schweitzer, J. B., Kelley, J. L., Li, C. and Williams, D. L. (2012). Scavenger receptor class a plays a central role in mediating mortality and the development of the pro-inflammatory phenotype in polymicrobial sepsis. PLoS Pathog 8(10): e1002967.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Lymphocyte
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
An Automated pre-Dilution Setup for Von Willebrand Factor Activity Assays
Tobias Schachinger [...] Peter L. Turecek
Sep 5, 2024 338 Views
Measurement of the Activity of Wildtype and Disease-Causing ALPK1 Mutants in Transfected Cells With a 96-Well Format NF-κB/AP-1 Reporter Assay
Tom Snelling
Nov 20, 2024 270 Views
Quantitative Measurement of the Kinase Activity of Wildtype ALPK1 and Disease-Causing ALPK1 Mutants Using Cell-Free Radiometric Phosphorylation Assays
Tom Snelling
Nov 20, 2024 254 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
852 | https://bio-protocol.org/en/bpdetail?id=852&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunolabeling of Proteins in situ in Escherichia coli K12 Strains
NB Nienke Buddelmeijer
MA Mirjam Aarsman
TB Tanneke den Blaauwen
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.852 Views: 12300
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Molecular Microbiology Mar 2013
Abstract
This protocol was developed to label proteins in bacterial cells with antibodies conjugated to a fluorophore for fluorescence microscopy imaging. The procedure is optimized to minimize morphological changes and also to minimize the amount of antibodies needed for the staining. The protocol can also be used with primary antibodies conjugated to a fluorophore. The method has been verified extensively (van der Ploeg et al., 2013), but it should be noted that one case in Caulobacter crescentus (Hocking et al., 2012) has been reported in which the localization of a protein changed upon fixation by formaldehyde/glutaraldehyde. However, the localization of the same protein in E. coli did not change.
Keywords: Protein localization Fixation Imaging Fluorescence Bacteria
Materials and Reagents
Gram-negative bacteria (the protocol is developed for Escherichia coli, but it also works on other species)
Formaldehyde (FA) (Sigma-Aldrich, catalog number: 47608 )
Glutaraldehyde (GA) (Merck KGaA, catalog number: 1-04239-0250 )
Tween-20 (Sigma-Aldrich, catalog number: P9416-100ml )
Triton X-100 (Merck KGaA, catalog number: 1.08643.1000 )
EDTA (Sigma-Aldrich, catalog number: ED255 )
Lysozyme (Sigma-Aldrich, catalog number: L6876 )
Note: The lysozyme is dissolved at 100 μg/ml in the PBS pH 7.2 with 5 mM EDTA ready to use 1 ml aliquots and stored at -20 °C. After using it the leftover is discarded.
Blocking reagents (F. Hoffmann-La Roche, catalog number: 1096176 ))
Cy3-AffiniPure Donkey Anti-Rabbit IgG (H + L) (Jackson ImmunoResearch, catalog number: 711-165-152 )
Note: Minimal cross-reaction to Bovine, Chicken, Goat, Guinea, Pig, Syrian Hamster, Horse, Human, Mouse, Rat and Sheep serum proteins. The in buffer freeze-dried Cy3 labeled secondary antibodies are dissolved in H2O to a final concentration of 1.5 mg/ml and aliquoted as 20 μl samples. Once thawed the secondary antibodies are stored at 4 °C. After one month take a new sample from the -20 °C.
PBS buffer (pH 7.2) (see Recipes)
Equipment
Shaking incubator to grow bacteria
500 μl or 1 ml tubes (Eppendorf)
50 ml Tubes (Greiner Bio-One GmbH, catalog number: 227261 ) (Alternative Sorval SS34 tubes)
Eppendorf centrifuge 5804 R (Alternative Sorval centrifuge for SS32 rotor)
Eppendorf centrifuge (cooled)
Shaking incubation block for eppendorf tubes
Procedure
Permeabilization of the cells
Escherichia coli cells (LMC500 strains) are grown in medium at 28-42 °C and fixed in 2.8% FA and 0.04% GA as follows: 12.2 ml culture with OD450 of 0.2 (or OD600 of 0.3) is mixed by addition of a pre-mixture of 1 ml 37% FA and 21 μl 25% GA while shaking in the water bath used for growth. Transfer the culture to 50 ml Greiner centrifuge tubes.
Note: It is recommended keeping the OD600 below 0.3 for optimal exponential growth in rich medium and the OD450 below 0.2 for minimal medium.
Incubate15 min at room temperature (RT) standing and centrifuge at 4,000 x g for 10 min at RT.
Wash the cells once in 1 volume PBS (pH 7.2).
Resuspend the pellet in 150 μl PBS pH 7.2 and transfer the cells to 500 μl Eppendorf tubes.
Pellet the cells by centrifugation at 4,500 x g (7,000 rpm) for 5 min (RT or 4 °C) and wash twice in 150 μl PBS (pH 7.2). The cells can be stored up to a month at 4 °C.
All subsequent steps are performed in 150 μl (less is also possible) and all centrifugation steps are at 4,500 x g (7,000 rpm) for 5 min at RT or 4 °C.
Incubate the cells in 0.1% Triton X-100/PBS pH 7.2 standing for 45 min at RT.
Wash the cells three times in PBS (pH 7.2).
Incubate the cells in PBS (pH 7.2) containing 100 μg/ml lysozyme and 5 mM EDTA for 45 min (or 30 min in case of cell wall mutants) at room temperature.
Wash the cells three times in PBS (pH 7.2).
Labeling procedure
Block non-specific binding sites by incubating the cells standing or shaking in 0.5% (w/v) blocking reagents in PBS (pH 7.2) for 30 min at 37 °C.
Incubate with primary antibody (rule of thumb 10 times more concentrated than needed for immunoblotting) diluted in blocking buffer, 1-2 h at 37 °C in shaking incubator (minimal incubation time 30 min, maximal incubation time over night at 4 °C depending on the antibodies).
Wash the cells three times in PBS (pH 7.2) containing 0.05% (v/v) Tween-20.
Incubate with secondary antibody donkey-α-rabbit-CY3 (guarantee no cross reactivity against E. coli) diluted in blocking buffer (1:600) for 30 min at 37 °C.
Note: Centrifuge the antibody in blocking solution for 1 min at max speed to remove clumps of dye before adding it to the cells.
Wash the cells three times in 150 μl PBS (pH 7.2)/0.05% Tween-20.
Wash the cells once in in 150 μl PBS.
Resuspend the cells in PBS.
Notes:
Adjust the volume to the amount of cells (usually 20 μl), i.e. the cell concentration should be high enough for the microscopic analysis.
Antisera against E. coli proteins can very conveniently be separated from contaminating IgG by incubating the serum against a strain that has the gene of interest deleted using the same procedure as above. Subsequently the non-bound IgG is used for the incubation with the wild type strain. If the protein of interest is essential, the serum has to be affinity purified against the pure protein of interest.
Notes
Fixation of the bacterial culture (either by formaldehyde/glutaraldehyde or by ethanol or methanol), which is essential for the immunolabelling procedure, gives an osmotic shock to the cells. The localization of membrane bound or membrane associated proteins or of cytosolic proteins is not affected by the osmotic shock. However, freely in the periplasm diffusing proteins can be shocked to the cell poles during fixation. Therefore, we do advise to verify the localization of periplasmic freely diffusing protein by analysis of the localization of fluorescent protein fusions to these proteins in combination with life imaging.
Recipes
PBS buffer (pH 7.2) (per L)
140 mM NaCl
27 mM KCl
10 mM Na2HPO4.2H2O
2 mM KH2PO4
Note: PBS should always be super-sterile.
Acknowledgments
The protocol described has been used in the following publications: Blaauwen et al. (1999); Aarsman et al. (2005); Potluri et al. ( 2010); Typas et al. (2010); Banzhaf et al. (2012); van der Ploeg et al. (2013) and Egan et al. (2014).
References
Aarsman, M. E., Piette, A., Fraipont, C., Vinkenvleugel, T. M., Nguyen-Disteche, M. and den Blaauwen, T. (2005). Maturation of the Escherichia coli divisome occurs in two steps. Mol Microbiol 55(6): 1631-1645.
Banzhaf, M., van den Berg van Saparoea, B., Terrak, M., Fraipont, C., Egan, A., Philippe, J., Zapun, A., Breukink, E., Nguyen-Disteche, M., den Blaauwen, T. and Vollmer, W. (2012). Cooperativity of peptidoglycan synthases active in bacterial cell elongation. Mol Microbiol 85(1): 179-194.
Den Blaauwen, T., Buddelmeijer, N., Aarsman, M. E., Hameete, C. M. and Nanninga, N. (1999). Timing of FtsZ assembly in Escherichia coli. J Bacteriol 181(17): 5167-5175.
Egan, A. J., Jean, N. L., Koumoutsi, A., Bougault, C. M., Biboy, J., Sassine, J., Solovyova, A. S., Breukink, E., Typas, A., Vollmer, W. and Simorre, J. P. (2014). Outer-membrane lipoprotein LpoB spans the periplasm to stimulate the peptidoglycan synthase PBP1B. Proc Natl Acad Sci U S A 111(22): 8197-8202.
Hocking, J., Priyadarshini, R., Takacs, C. N., Costa, T., Dye, N. A., Shapiro, L., Vollmer, W. and Jacobs-Wagner, C. (2012). Osmolality-dependent relocation of penicillin-binding protein PBP2 to the division site in Caulobacter crescentus. J Bacteriol 194(12): 3116-3127.
Potluri, L., Karczmarek, A., Verheul, J., Piette, A., Wilkin, J. M., Werth, N., Banzhaf, M., Vollmer, W., Young, K. D., Nguyen-Disteche, M. and den Blaauwen, T. (2010). Septal and lateral wall localization of PBP5, the major D,D-carboxypeptidase of Escherichia coli, requires substrate recognition and membrane attachment. Mol Microbiol 77(2): 300-323.
Typas, A., Banzhaf, M., van den Berg van Saparoea, B., Verheul, J., Biboy, J., Nichols, R. J., Zietek, M., Beilharz, K., Kannenberg, K., von Rechenberg, M., Breukink, E., den Blaauwen, T., Gross, C. A. and Vollmer, W. (2010). Regulation of peptidoglycan synthesis by outer-membrane proteins. Cell 143(7): 1097-1109.
van der Ploeg, R., Verheul, J., Vischer, N. O., Alexeeva, S., Hoogendoorn, E., Postma, M., Banzhaf, M., Vollmer, W. and den Blaauwen, T. (2013). Colocalization and interaction between elongasome and divisome during a preparative cell division phase in Escherichia coli. Mol Microbiol 87(5): 1074-1087.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Buddelmeijer, N., Aarsman, M. and den Blaauwen, T. (2013). Immunolabeling of Proteins in situ in Escherichia coli K12 Strains. Bio-protocol 3(15): e852. DOI: 10.21769/BioProtoc.852.
Download Citation in RIS Format
Category
Biochemistry > Protein > Immunodetection > Immunostaining
Microbiology > Microbial cell biology > Cell staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Colony Immunoblotting Assay for Detection of Bacterial Cell-surface or Extracellular Proteins
Timo A. Lehti and Benita Westerlund-Wikström
Sep 5, 2013 28149 Views
Biofilm Assays on Fibrinogen-coated Silicone Catheters and 96-well Polystyrene Plates
Cristina Colomer-Winter [...] Ana L. Flores-Mireles
Mar 20, 2019 6134 Views
Immunofluorescence for Detection of TOR Kinase Activity In Situ in Photosynthetic Organisms
Ana P. Lando [...] Giselle M. A. Martínez-Noël
Dec 20, 2024 312 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
853 | https://bio-protocol.org/en/bpdetail?id=853&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Growth Cones from Mouse Brain
Iryna Leshchyns’ka
Vladimir Sytnyk
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.853 Views: 11116
Reviewed by: Xuecai Ge Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Neuroscience Jan 2013
Abstract
Growth cones are motile structures at the tips of growing neurites, which play an essential role in regulation of growth and navigation of growing axons and dendrites of neurons in the developing nervous system. This protocol describes isolation of growth cones from the brain tissue from young mice. Growth cones isolated using this protocol have been extensively characterized using electron microscopy (Pfenninger et al., 1983) and may be used for any kind of subsequent biochemical and/or functional analyses, including Western blot analysis of protein expression (Westphal et al., 2010), analysis of the activity of growth cone-accumulated enzymes (Leshchyns’ka et al., 2003; Li et al., 2013), and analysis of the endocytosis and exocytosis rates (Chernyshova et al., 2011).
Keywords: Neurons Growth cone Neurite outgrowth Differential centrifugation Biochemical analysis
Materials and Reagents
Mouse brains extracted from 1-3 days old mice, frozen in liquid nitrogen and kept at -80 °C (for up to 1 year)
Sucrose
Purified (e.g. using Milli-Q system from Millipore) water kept at 4 °C
Mini EDTA-free Protease Inhibitor Cocktail Tablets (Roche Applied Science, catalog number: 05892791001 )
PMSF (Sigma-Aldrich, catalog number: P7626 )
Ethanol
80% sucrose (see Recipes)
Homogenization buffer (see Recipes)
0.75 M sucrose buffer (see Recipes)
1 M sucrose buffer (see Recipes)
2.33 M sucrose buffer (see Recipes)
Equipment
Potter homogenizer (Thermo Fisher Scientific, catalog number: 08-414-14A )
1 ml plastic pipette (Sarstedt, model: 86.1180 )
Bench top centrifuge with an angle rotor, for example Allegra X-15R (Beckman Coulter)
Ultracentrifuge with a swing rotor, for example L-60 ultracentrifuge with SW40Ti rotor (Beckman) or HIMAC CP100WX ultracentrifuge with P40ST rotor (Hitachi)
Centrifuge tube 13PA (Hitachi, catalog number: 332901A )
Procedure
Prepare 80% sucrose in advance and keep it at 4 °C.
Prepare buffers for homogenization and centrifugation immediately before preparation of growth cones and place them on ice.
Take 10 brains from the -80 °C freezer and place them on ice. Proceed immediately to the next step.
Transfer brains to the Potter homogenizer and add homogenization buffer. Use 1 ml of buffer for homogenization per 1 brain.
Homogenize brains.
Note: If you isolate growth cones from several experimental groups, use the same numbers of strokes to homogenize brains in each group.
Centrifuge homogenate at 1,660 x g for 15 min at 4 °C using the bench top centrifuge.
Collect the supernatant.
Prepare a discontinuous 0.75/1.0/2.33 M sucrose density gradient. To prepare the gradient, carefully pipette into a centrifuge tube 1 ml of ice cold 2.33 M sucrose buffer (bottom), then 3 ml of ice cold 1.0 M sucrose buffer, and then 4 ml of ice cold 0.75 M (top) sucrose buffer. Volumes are given for the centrifuge tube 13PA. To prevent intermixing of the sucrose layers during the gradient preparation, tilt the tube and place the tip of the pipette against the wall of the tube at the top of the tube (Figure 1). Release the solutions to the tube slowly.
Figure 1. Position of the centrifuge tube and pipette during formation of a sucrose gradient
Load the supernatant on top of the gradient and centrifuge at 242,000 x g for 60 min at 4 °C.
Collect the growth cone enriched fraction at the interface between the load and 0.75 M sucrose (Figure 2A). The growth cone depleted fraction can be collected between 0.75 M and 1.0 M sucrose (Figure 2A) and may be used as non-growth cone membranes. To collect the growth cone-enriched fraction, squeeze the bulb of a 1 ml plastic pipette, then carefully place the tip of the pipette into the layer of the sucrose gradient containing growth cones (Figure 2B), and then slowly release the bulb of the pipette to allow the growth cone-containing solution to flow into the pipette. Then carefully remove the pipette containing growth cones from the centrifuge tube and release the growth cone fraction into a clean centrifuge tube. Repeat if required.
Figure 2. Collection of the growth cone enriched fraction from a sucrose gradient. A: Distribution of the sucrose layers and the interfaces containing fractions enriched in growth cones and non-growth cone membranes in the centrifuge tube after the centrifugation. B: Position of the tip of a plastic pipette during collection of the growth cone-enriched fraction.
Re-suspend the growth cone fraction in the buffer for homogenization by adding this buffer to the tube to fill it to capacity. Centrifuge at 100,000 x g for 40 min at 4 °C.
Collect the pellet containing growth cones, re-suspend it in 50 μl of the homogenization buffer and freeze at -80 °C. Important, the homogenization buffer has to contain protease inhibitors as described in the section Recipes. Growth cones thus obtained can be stored at -80 °C for up to 1 week for Western blot analysis. Growth cones for functional analyses (e.g. analysis of exo- and endocytosis) have to be used immediately and cannot be frozen.
Note: To check the growth cone isolation efficiency, the growth cone enriched fraction can be analyzed by Western blot. The growth cone fraction have to be enriched in growth-associated protein (GAP-43) and the neural cell adhesion molecule (NCAM) when compared to brain homogenates and non-growth cone membranes. Non-growth cone membranes, which also contain Golgi membranes, have to be enriched in Golgi matrix protein GM130, while the growth cone fraction should have only low levels of this protein due to the presence of Golgi-derived vesicles in growth cones.
Recipes
80% sucrose
For 500 ml of the solution
Weigh 400 g of sucrose in a clean 500 ml Erlenmeyer flask.
Fill the flask with water up to a 500 ml mark.
Put the flask on a magnetic stirrer hotplate and mix with a magnetic stirrer until the sucrose is dissolved. You may heat the solution up to 50 °C to increase the sucrose solubility.
The solution can be stored at 4 °C for up to 1 month.
Homogenization buffer
5 mM Tris-HCl
0.32 M sucrose
1 mM MgCl2
For 100 ml of buffer
13.6 ml of 80% sucrose
0.1 ml of 1 M MgCl2
0.5 ml of 1 M Tris-HCl buffer (pH 7.4)
85.8 ml of water
Mix well and keep on ice. Add protease inhibitors just before usage. Use one tablet of the EDTA-free protease inhibitor cocktail and 10 μl of 1 mM PMSF for 10 ml of buffer. Tablets require some time to be dissolved.
0.75 M sucrose
For 100 ml of buffer
32 ml of 80% sucrose
0.1 ml of 1 M MgCl2
0.5 ml of 1 M Tris-HCl buffer (pH 7.4)
67.4 ml of water
Mix well and keep on ice.
1 M sucrose
For 100 ml of buffer
42.7 ml of 80% sucrose
0.1 ml of 1 M MgCl2
0.5 ml of 1 M Tris-HCl buffer (pH 7.4)
56.7 ml of water
Mix well and keep on ice.
2.33 M sucrose
For 100 ml of buffer
99.4 ml of 80% sucrose
0.1 ml of 1 M MgCl2
0.5 ml of 1 M Tris-HCl buffer (pH 7.4)
Mix well and keep on ice.
References
Chernyshova, Y., Leshchyns'ka, I., Hsu, S. C., Schachner, M. and Sytnyk, V. (2011). The neural cell adhesion molecule promotes FGFR-dependent phosphorylation and membrane targeting of the exocyst complex to induce exocytosis in growth cones. J Neurosci 31(10): 3522-3535.
Leshchyns'ka, I., Sytnyk, V., Morrow, J. S. and Schachner, M. (2003). Neural cell adhesion molecule (NCAM) association with PKCbeta2 via betaI spectrin is implicated in NCAM-mediated neurite outgrowth. J Cell Biol 161(3): 625-639.
Li, S., Leshchyns'ka, I., Chernyshova, Y., Schachner, M. and Sytnyk, V. (2013). The neural cell adhesion molecule (NCAM) associates with and signals through p21-activated kinase 1 (Pak1). J Neurosci 33(2): 790-803.
Pfenninger, K. H., Ellis, L., Johnson, M. P., Friedman, L. B. and Somlo, S. (1983). Nerve growth cones isolated from fetal rat brain: subcellular fractionation and characterization. Cell 35(2 Pt 1): 573-584.
Westphal, D., Sytnyk, V., Schachner, M. and Leshchyns'ka, I. (2010). Clustering of the neural cell adhesion molecule (NCAM) at the neuronal cell surface induces caspase-8- and -3-dependent changes of the spectrin meshwork required for NCAM-mediated neurite outgrowth. J Biol Chem 285(53): 42046-42057.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Leshchyns’ka, I. and Sytnyk, V. (2013). Isolation of Growth Cones from Mouse Brain. Bio-protocol 3(15): e853. DOI: 10.21769/BioProtoc.853.
Li, S., Leshchyns'ka, I., Chernyshova, Y., Schachner, M. and Sytnyk, V. (2013). The neural cell adhesion molecule (NCAM) associates with and signals through p21-activated kinase 1 (Pak1). J Neurosci 33(2): 790-803.
Download Citation in RIS Format
Category
Neuroscience > Development > Neuron
Cell Biology > Organelle isolation > Fractionation
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Detection of Cytoplasmic and Nuclear Circular RNA via RT-qPCR
Ke-En Tan [...] Yat-Yuen Lim
Sep 5, 2023 1413 Views
Cochlear Organ Dissection, Immunostaining, and Confocal Imaging in Mice
Chenyu Chen [...] Dongdong Ren
Jan 20, 2025 1598 Views
Primary Neuronal Culture and Transient Transfection
Shun-Cheng Tseng [...] Eric Hwang
Jan 20, 2025 337 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
854 | https://bio-protocol.org/en/bpdetail?id=854&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein Flotation Assay to Isolate Lipids Rafts from Soft Tissue or Cells
Catherine Lemaire-Vieille
Jean Gagnon
JC Jean-Yves Cesbron
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.854 Views: 10965
Reviewed by: Xuecai Ge Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Neuroscience Jan 2013
Abstract
The arrangement in eukaryotic cell membranes of liquid-ordered states surrounded by liquid-disordered phases allows for the existence of organized membrane microdomains called rafts. Rafts play a crucial role in signal-transduction events, in lipid transport and in various internalization processes, and for all these reasons need to be purified for further characterization.
Materials and Reagents
Optiprep® (Optiprep® is a 60% solution of iodixanol in water, density = 1.32 g/ml) (Sigma-Aldrich, catalog number: 079K1726 )
Sodium chloride (NaCl)
Tris hydrochloride (Tris-HCl)
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: ED255 )
Triton X-100 (Sigma-Aldrich, catalog number: T-8532 )
Methanol/chloroform
Lysis buffer (see Recipes)
Gradient buffer (see Recipes)
Equipment
Pellet pestles (Sigma-Aldrich, catalog number: Z359963-1EA )
Sorvall® WX90 ultracentrifuge (Thermo Fisher Scientific, catalog number: 46901 )
Sorvall® TH-641 swinging bucket rotor (Thermo Fisher Scientific, catalog number: 54295 )
Ultracentrifuge tubes: Beckman Coulter® open-top Ultra-ClearTM tubes (dimension: 14 x 89 mm, nominal volume: 12 ml) (Beckman Coulter®, catalog number: 344059 )
1 ml pipette
Western Blotting apparatus
Procedure
Extract appropriate tissue homogenates for 2 h on ice in cold lysis buffer (total protein: 1 mg in 1 ml). Soft tissue (or cell pellet) is hand-disrupted in microcentrifuge tubes with a pestle. Pestle end mates well with 1.5 ml microtubes and shaft allows gentle manual back-and-forth rotation.
Assemble the gradient
Prepare all solutions extemporaneously and kept on ice.
Prepare a 30% Optiprep® solution in gradient buffer (1 volume of Optiprep® in 1 volume gradient buffer).
Prepare a 5% Optiprep® solution in gradient buffer (1 volume of Optiprep® in 11 volumes gradient buffer).
Mix the extracts (1 ml in lysis buffer) with two volumes (2 ml) of cold 60% Optiprep® to reach a final concentration of 40%.
Load the extracts (3 ml in 40% Optiprep®) at the bottom of the ultracentrifuge tubes, add very slowly 6 ml of 30% Optiprep® onto the lysate and then add very slowly 2.5 ml of 5% Optiprep® onto the 30% Optiprep®.
Note: It is important to avoid mixing of the interfaces. A good way is to let the pipet tip barely touch the surface and slowly overlay the solution while the tip is brought up along the side of the tube.
Make sure the tubes (including buckets and caps) are equilibrated. Put the tubes in the buckets of the Sorvall TH-641 rotor pre-cooled at 4 °C, and screw the caps on the buckets. Spin at 100,000 x g for 24 h at 4 °C.
Analyze the gradient
Collect the fractions (1 ml) by gentle and slow aspiration from the meniscus at the top of the tube with an automatic 1 ml pipette, making sure that the tip of the pipette follows the lowering meniscus. Rafts should be present within the low-density fractions 2 to 4 which is the interface between the 30 and the 5% density.
The equivalent of 300 μl is precipitated by the methanol/chloroform method and processed for Western Blotting. The fractions can be stored at -80 °C for up to 6 months. The protocol used for precipitation is that described in Aboulaich (2011).
Always check on the distribution of raft markers in the gradient to confirm that the centrifugation has achieved a satisfactory resolution and recovery of rafts, Flotillin-1 which has been shown to be enriched in lipid rafts is the most widely used. For brain tissue, we have used prion protein which is also present in lipid rafts.
Recipes
Lysis buffer
150 mM NaCl
25 mM Tris–HCl (pH 7.4)
5 mM EDTA
1% Triton X-100
Filter sterilize and keep at 4 °C.
Gradient buffer
150 mM NaCl
25 mM Tris–HCl (pH 7.4)
5 mM EDTA
Filter sterilize and keep at 4 °C.
Acknowledgments
This protocol is adapted from Lemaire-Vieille et al. (2013).
References
Aboulaich, N. (2011). Protein precipitation from detergent-containing samples. Bio-protocol 1(5): e40.
Lemaire-Vieille, C., Bailly, Y., Erlich, P., Loeuillet, C., Brocard, J., Haeberle, A. M., Bombarde, G., Rak, C., Demais, V., Dumestre-Perard, C., Gagnon, J. and Cesbron, J. Y. (2013). Ataxia with cerebellar lesions in mice expressing chimeric PrP-Dpl protein. J Neurosci 33(4): 1391-1399.
Persaud-Sawin, D. A., Lightcap, S. and Harry, G. J. (2009). Isolation of rafts from mouse brain tissue by a detergent-free method. J Lipid Res 50(4): 759-767.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Protein > Isolation and purification
Biochemistry > Lipid > Lipid raft
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Real-Time Monitoring of ATG8 Lipidation in vitro Using Fluorescence Spectroscopy
Wenxin Zhang [...] Sharon A. Tooze
Jan 5, 2024 648 Views
Chromogranin B Purification for Condensate Formation and Client Partitioning Assays In Vitro
Anup Parchure and Julia Von Blume
Oct 20, 2024 283 Views
Mouse-derived Synaptosomes Trypsin Cleavage Assay to Characterize Synaptic Protein Sub-localization
Jasmeet Kaur Shergill and Domenico Azarnia Tehran
Jan 20, 2025 230 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
855 | https://bio-protocol.org/en/bpdetail?id=855&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Zymogram Assay for the Detection of Peptidoglycan Hydrolases in Streptococcus mutans
DD Delphine Dufour
Céline M. Lévesque
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.855 Views: 14490
Reviewed by: Fanglian HeLin Fang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Bacteriology Jan 2013
Abstract
Peptidoglycan hydrolases or autolysins are enzymes capable of cleaving covalent bonds in bacterial peptidoglycan cell wall layer. They can participate in the cell division process, in the release of turnover products from peptidoglycan during cell growth, and in cell autolysis induced under particular conditions. The protocol for zymogram presented below should enable the identification of such enzymes through their separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis containing bacterial cells as substrate.
Keywords: Peptidoglycan Murein hydrolase Streptococcus mutans Oral streptococci Zymogram
Materials and Reagents
Bacterial strain (S. mutans UA159 wild-type strain or other S. mutans strains)
Todd-Hewitt broth (BD Biosciences)
Yeast-Extract (BioShop)
Tris Base
NaCl
Sodium dodecyl sulfate (SDS)
Triton X-100
KOH
MgCl2
Glycine
Glycerol
Bromophenol blue
Methylene blue
40% Acrylamide/Bis solution (37.5:1 acrylamide:bisacrylamide) (BioShop)
Ammonium persulfate (Sigma-Aldrich)
TEMED (BioBasic, Inc.)
Ethanol
Isopropanol
dH2O
Filter paper
Precision Plus Protein Prestained Standards (Bio-Rad Laboratories)
THYE broth (see Recipes)
20 mM Tris, 100 mM NaCl (pH 7.4) (see Recipes)
1.5 M Tris (pH 8.8) (see Recipes)
0.5 M Tris (pH 6.8) (see Recipes)
SDS-PAGE loading buffer (see Recipes)
Tris-Glycine SDS running buffer (see Recipes)
Zymogram renaturing buffer (see Recipes)
Staining solution (see Recipes)
10% separating gel solution (see Recipes)
4% stacking gel solution (see Recipes)
Equipment
15-ml canonical tubes
Flasks
1.5 ml microcentrifuge tubes
Refrigerated centrifuge
Refrigerated microcentrifuge
CO2 incubator
Spectrophotometer
Disposable plastic cuvettes
Protein mini gel cassettes
Heating block module
Power supply
Orbital shaker
37 °C temperature chamber
Procedure
Preparation of the bacterial substrates incorporated into the gel
Start 5 ml culture of S. mutans UA159 wild-type strain (or other S. mutans strains) in THYE broth into a 15-ml canonical tube and incubate overnight statically at 37 °C in air with 5% CO2.
Inoculate 300 ml of fresh THYE broth with 1% of the overnight preculture into a 500-ml flask.
Incubate the culture statically at 37 °C in air with 5% CO2 until an optical density at 600 nm (OD600) of 0.2 is reached.
Harvest the cells by centrifugation at 10,000 x g for 10 min at 4 °C.
Wash the cells using 5 ml of 20 mM Tris, 100 mM NaCl buffer (pH 7.4) and resuspend the cell pellet in 1.0 ml of 1.5 M Tris buffer (pH 8.8).
Keep the cells at -20 °C until used.
Preparation of bacterial whole-cell extracts
Start 5 ml overnight culture of S. mutans UA159 wild-type strain (or other S. mutans strains) in THYE broth into a 15-ml canonical tube and incubate statically at 37 °C in air with 5% CO2. Whole cell extract of a mutant strain deficient in the peptidoglycan hydrolase under study can also be analyzed concomitantly as negative control to confirm the specificity of the hydrolytic band(s) observed.
Inoculate 10 ml of fresh THYE broth with 1% of the overnight preculture into a 15-ml canonical tube.
Incubate the culture statically at 37 °C in air with 5% CO2 until the desired OD600 is reached. If the expression profile of the targeted peptidoglycan hydrolase is not known, we recommend to harvest cells at different optical densities corresponding to early log, mid-log, early stationary, and late stationary phase of growth.
Harvest the cells by centrifugation at 10,000 x g for 10 min at 4 °C.
Keep the cell pellet at -20 °C until used.
Resuspend the cell pellet in 20 μl of SDS-PAGE loading buffer freshly prepared.
Heat the samples at 95 °C for 10 min. Keep the samples on ice until loading.
Preparation of the zymogram gel
Clean glass plates, spacers, and combs with ethanol and completely dry before use. Assemble the gel cassette following the manufacturer’s instructions.
Prepare 10% separating gel solution (see Recipe 9).
Transfer the separating gel solution (approx. 3.8 ml per small gel) to the casting chamber between the glass plates and fill up to about 0.7 cm below the bottom of the comb when the comb is in place.
Add a small layer of isopropanol to the top of the gel prior to polymerization to straighten the level of the gel. Once the gel has polymerized, remove the isopropanol layer by several washes with dH2O, and dry with filter paper.
Prepare 4% stacking gel solution (see Recipe 10).
Pour the stacking gel solution (approx. 2.5 ml per small gel) on top of the separating gel until the space is full, and then insert the appropriate comb. Once the gel has polymerized, carefully remove comb.
Remove the gel cassette from the casting stand and place it in the electrode assembly as recommended by the manufacturer.
Pour Tris-Glycine SDS running buffer into the opening of the casting frame between the gel cassettes. Add enough buffer the fill the wells of the gel. Fill also the region outside of the frame.
Load the samples (from Section II, step B-7) into each well as well as 5 μl of the Precision Plus Protein Prestained Standards.
Connect the electrophoresis tank to the power supply. Run the gel at a constant voltage between 125-200 volts until the dye front is near the bottom of the gel.
Peptidoglycan hydrolase detection
Remove the gel from the electrophoresis chamber, allow the gel to peel away and gently drop into a container. Wash the gel twice in 100 ml of dH2O for 30 min at room temperature under constant agitation.
Incubate the gel in 100 ml of zymogram renaturing buffer for 30 min at room temperature under constant agitation. This step is necessary to renature the peptidoglycan hydrolases.
Replace the zymogram renaturing buffer with fresh zymogram renaturing buffer and incubate the gel at 37 °C in a temperature chamber under constant agitation until clear hydrolytic band(s) appear, usually between 16 h and 48 h. The proteolytic activity appears as clear bands against a white background.
Optional staining step: Decant the buffer and add 100 ml of staining solution, and incubate the gel at room temperature under constant agitation between 15 min and 2 h. Regions without staining are indicative of lysis (Figure 1). The proteolytic activity appears as clear bands against a blue background.
Figure 1. Zymogram activity gel after methylene blue staining. Heat-killed cells of S. mutans were used as substrate and were incorporated into a 10% SDS-PAGE gel. (1) Molecular size marker (Precision Plus Protein Prestained Standards). (2) Whole-cell extract of S. mutans UA159 wild-type strain. The two hydrolytic bands (arrows) observed correspond to the unprocessed (upper) and processed (lower) forms of the AtlA autolysin.
Recipes
THYE broth
Dissolve 15 g of Todd-Hewitt and 1.5 g of Yeast Extract in 400 ml of dH2O
Once dissolved, bring up to a final volume of 500 ml with dH2O
Autoclave for 20 min at 120 °C
Store at room temperature
20 mM Tris, 100 mM NaCl buffer (pH 7.4)
Dissolve 2.42 g of Tris Base, and 5.84 g NaCl in 800 ml of dH2O
Once dissolved, adjust the pH to 7.4, and then bring up to a final volume of 1 L with dH2O
Store at 4 °C
1.5 M Tris pH 8.8 buffer
Dissolve 181.71 g of Tris Base in 800 ml of dH2O
Once dissolved, adjust the pH to 8.8, and then bring up to a final volume of 1 L with dH2O
Store at 4 °C
0.5 M Tris pH 6.8 buffer
Dissolve 60.57 g of Tris Base in 600 ml of dH2O
Once dissolved, adjust the pH to 6.8, and then bring up to a final volume of 1 L with dH2O
Store at 4 °C
SDS-PAGE loading buffer (0.25 M Tris pH 6.8, 2% SDS, 10% glycerol, bromophenol blue)
Dissolve 0.3 g of Tris Base, 0.2 g SDS, 1.0 ml glycerol, and traces of bromophenol blue in 7 ml of dH2O
Once dissolved, bring up to a final volume of 10 ml with dH2O
Tris-Glycine SDS running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS)
Dissolve 3.03 g of Tris Base, 14.4 g glycine, and 1 g SDS in 800 ml of dH2O
Once dissolved, bring up to a final volume of 1 L with dH2O
Store at 4 °C
Zymogram renaturing buffer (20 mM Tris, 50 mM NaCl, 20 mM MgCl2, 0.5% Triton X-100, pH 7.4)
Dissolve 2.42 g of Tris Base, 2.92 g NaCl, and 4.06 g MgCl2 in 800 ml of dH2O
Adjust the pH to 7.4
Add 5 ml of Triton X-100, and bring up to a final volume of 1 L with dH2O
Store at 4 °C
Staining solution (0.1% methylene blue, 0.01% KOH)
Dissolve 0.1 g of methylene blue and 0.01 g KOH in 100 ml of dH2O
Store at room temperature
10% separating gel solution
Mix the following reagents in a clean flask (total volume for 4 small gels):
7.4 ml dH2O
3.7 ml 40% acrylamide/bis
4 ml of bacterial substrate (from Section A, step A-6) boiled for 10 min just prior use
100 μl 10% SDS
50 μl 10% ammonium persulfate
5 μl TEMED
4% stacking gel solution
Mix the following reagents in a clean flask (total volume for 4 small gels):
6 ml dH2O
2.5 ml 0.5 M Tris (pH 6.8)
1.0 ml 40% acrylamide/bis
100 μl 10% SDS
100 μl 10% ammonium persulfate
25 μl TEMED
References
Berg, K. H., Ohnstad, H. S. and Havarstein, L. S. (2012). LytF, a novel competence-regulated murein hydrolase in the genus Streptococcus. J Bacteriol 194(3): 627-635.
Dufour, D. and Lévesque, C. M. (2013). Cell death of Streptococcus mutans induced by a quorum-sensing peptide occurs via a conserved streptococcal autolysin. J Bacteriol 195(1): 105-114.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Dufour, D. and Lévesque, C. M. (2013). Zymogram Assay for the Detection of Peptidoglycan Hydrolases in Streptococcus mutans. Bio-protocol 3(16): e855. DOI: 10.21769/BioProtoc.855.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein > Activity
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
In vitro Nitrate Reductase Activity Assay of Mycolicibacterium smegmatis Crude Extract
Wei Tan [...] Guo-Ping Zhao
Jul 20, 2021 2209 Views
Assay for Protealysin-like Protease Inhibitor Activity
Igor M. Berdyshev [...] Ilya V. Demidyuk
Oct 5, 2022 843 Views
H2 Production from Methyl Viologen–Dependent Hydrogenase Activity Monitored by Gas Chromatography
Nuttavut Kosem
Dec 5, 2023 560 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
856 | https://bio-protocol.org/en/bpdetail?id=856&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Reverse Zymmogram Analysis for the Detection of Protease Inhibitor Activity
LB Lilia Bernal *
FG Florencia García-Campusano *
EN Edgar Nájera
Felipe Cruz-García
(*contributed equally to this work)
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.856 Views: 11489
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Jan 2013
Abstract
This protocol describes a gel-based procedure to detect protease inhibitor activity. In this method gelatin is used as a substrate for proteolysis and is copolymerized within the polyacrylamide matrix. Protein extracts are fractioned by SDS-PAGE and then the gel is treated with the protease of interest, which degrades gelatin, except in the areas where inhibitory activity is present. Inhibition of protease activity appears as colored bands against a clear background after staining with Coomassie Brilliant Blue (Figure 1). The effectiveness of the assay is dependent on the capacity of the protease inhibitor to refold after SDS-PAGE fractionation. Alternatively, it can be performed using native (PAGE) gels. Although the protocol presented here has been standardized to test for subtilisin inhibitory activity, it can easily be adapted to test other proteases and protease inhibitors.
Figure 1. Protease inhibitor activity by zymogram analysis of different purified fractions and a protein crude extract. Zymogram was performed after SDS-PAGE. One microgram of protein was loaded to each lane. CE: Crude extract; QS: Fraction from anion exchange chromatography (Q-sepharose); Fractions 35-36: Obtained after a size exclusion chromatography (Superdex 200). M: Molecular markers. Arrows indicate inhibition activity.
Materials and Reagents
Protein extract or purified protein (1-5 μg)
Aprotinin (Sigma-Aldrich, catalog number: A-3886 )
Subtilisin (Sigma-Aldrich, catalog number: P-5380 )
30% Acrylamide stock (29:1 acrylamide:bisacrylamide) (Bio-Rad Laboratories)
TEMED (Sigma-Aldrich)
Ammonium persulfate (Bio-Rad Laboratories)
SDS (Bio-Rad Laboratories)
Tris base (Sigma-Aldrich)
Gelatin (Sigma-Aldrich)
Bromophenol Blue (Sigma-Aldrich)
β-mercaptoethanol (Sigma-Aldrich)
Glycine (Sigma-Aldrich)
EDTA (JT Baker)
Glycerol (JT Baker)
Pre-stain Protein Standard (Bio-Rad Laboratories)
Coomassie blue G250 (Sigma-Aldrich)
Ethanol (JT Baker)
Phosphoric acid (Sigma-Aldrich)
Triton X-100 (Sigma-Aldrich)
Separating gel buffer (8x) (see Recipes)
Stacking gel buffer (4x) (see Recipes)
Gelatin-SDS-PAGE Separating gel (see Recipes)
Stacking gel (see Recipes)
Sample loading buffer (see Recipes)
Laemmli Reservoir buffer (see Recipes)
Stain solution (4 L) (see Recipes)
Equipment
Protein mini gel cassettes (Bio-Rad Laboratories)
Power supply
Orbital shaker
Incubator
Procedure
Preparation of the gelatin-SDS-PAGE gel
Clean and completely dry glass plates, combs, spacers (0.75-1 mm), and assemble the gel cassette.
Dissolve 1% gelatin in dH2O by heating, and keep warm to avoid gelling.
Prepare the 12.5% separating gel, replacing the corresponding volume of water with the gelatin solution to a final concentration of 0.1%. Mix well and quickly transfer to the casting chamber to avoid the uneven gelling of the gelatin. Add a small layer of water or isopropanol prior to polymerization to level the gel.
Once the gel has polymerized remove the water or isopropanol layer and dry off as much as possible by using a filter paper. Prepare and pour the stacking solution into the casting chamber and insert the comb.
Sample Preparation.
Add the same volume of 2x protein sample loading buffer to each protein extract to be tested, and mix. Do not heat at any time.
Use a protein-based protease inhibitor as a positive control for the reaction, such as: aprotinin for subtilisin, or trypsin inhibitor for trypsin and load it at a similar concentration to the protein samples tested.
Electrophoresis. Performed at 100 V for approximately 2.5 h at 4 °C.
Eliminating SDS from the gel. SDS in the gel may interfere with activity of the protease inhibitor to be tested, so it must be removed from gel before treating the gel with the protease. Removal is carried out by:
Rinsing twice with 30 ml of 2.5% (v/v) Triton X-100 solution, for 10 min each with agitation.
Rinsing twice with 30 ml of 2.5% (v/v) Triton X-100 + 50 mM Tris-HCl (pH 7.4) solution, for 10 min each with agitation.
Rinsing with 30 ml of 50 mM Tris-HCl (pH 7.4), for 10 min with agitation.
For protein digestion, incubate the gel for 2 h at 37 °C, in a buffer solution containing 1.4 U of subtilisin in 50 ml of 50 mM Tris-HCl (pH 7.4), 200 mM NaCl.
For fixation, place the gel in a 10% methanol, 10% acetic acid solution with gentle shaking for 30 min. Discard the solution.
Detection of proteolysis inhibitors. Stain the gel with Coomassie Brilliant Blue, by adding approximately 100 ml of stain solution and leaving it in an orbital shaker overnight. Discard the stain and rinse the gel with water until the background gel becomes clear, which indicates the efficient degradation of the copolymerized gelatin. The presence of stained bands indicates areas where gelatin was protected from degradation by the activity of a protease inhibitor (hence “protection bands”).
Commonly a twin gel, lacking gelatin is run in parallel as a control.
If an antibody for the tested protease inhibitor is available, the digested gel can be transferred and an immunoblot assay can be performed.
Recipes
Separating gel buffer (8x)
3 M Tris-HCl (pH 8.8)
Stacking gel buffer (4x)
0.5 M Tris-HCl (pH 6.8)
Gelatin-SDS-PAGE Separating gel
Add the following solutions (total volume: 5 ml)
30% acrylamide/bisacrylamide
2.08 ml
dH2O
1.72 ml
Separating gel buffer (8x)
0.625 ml
20% SDS
25 μl
1% gelatin solution
0.5 ml
10% ammonium persulfate
25 μl
TEMED (add it right before pouring the gel)
5 μl
Stacking gel (total volume: 2.5 ml)
30% acrylamide/bisacrylamide
0.5 ml
dH2O
1.375 ml
Stacking gel buffer (4x)
0.625 ml
20% (w/v) SDS
15 μl
10% ammonium persulfate
15 μl
TEMED
5 μl
Sample loading buffer
0.12 M Tris
10% 2-mercaptoethanol
20% (v/v) glycerol
2 mg/ml Bromphenol blue
Laemmli Reservoir buffer
25 mM Tris base
0.192 M Glycine
0.1% (w/v) SDS
pH around 8.3
Should not require adjustment
Store at room temperature
Stain solution (4 L)
Coomassie blue R250
3.2 g
Ethanol
800 ml
Phosphoric acid
64 ml
Ammonium sulphate
320 g
Dissolve Coomassie blue G250 in ethanol and add phosphoric acid. Dissolve the ammonium sulphate in water and add to the mix. Adjust final volume with water.
Acknowledgments
This protocol is adapted from Jimenez-Duran et al. (2013).
References
Jimenez-Duran, K., McClure, B., Garcia-Campusano, F., Rodriguez-Sotres, R., Cisneros, J., Busot, G. and Cruz-Garcia, F. (2013). NaStEP: a proteinase inhibitor essential to self-incompatibility and a positive regulator of HT-B stability in Nicotiana alata pollen tubes. Plant Physiol 161(1): 97-107.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227(5259): 680-685.
Lantz, M. S. and Ciborowski, P. (1994). Zymographic techniques for detection and characterization of microbial proteases. Methods Enzymol 235: 563-594.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Electrophoresis
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Semi-throughput Procedure for Assaying Plant NADP-malate Dehydrogenase Activity Using a Plate Reader
Kevin Baudry and Emmanuelle Issakidis-Bourguet
Aug 20, 2023 320 Views
An in vitro Assay to Probe the Formation of Biomolecular Condensates
Yu Zhang and Shen Lisha
Sep 5, 2023 1441 Views
Immunofluorescence for Detection of TOR Kinase Activity In Situ in Photosynthetic Organisms
Ana P. Lando [...] Giselle M. A. Martínez-Noël
Dec 20, 2024 312 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
857 | https://bio-protocol.org/en/bpdetail?id=857&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Surface Protein Biotinylation and Analysis
AT Anna Tarradas
ES Elisabet Selga
HR Helena Riuró
Fabiana S. Scornik
RB Ramon Brugada
Marcel Vergés
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.857 Views: 32107
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS ONE Jan 2013
Abstract
A great way to specifically isolate and quantify proteins in the cell surface membrane is to take advantage of the biotinylation technique. It consists of labeling cell surface proteins with a biotin reagent before lysing the cells, and isolating these tagged proteins by NeutrAvidin pull-down. Then, the samples are subjected to SDS-PAGE separation, transferred to PVDF membranes and probed with specific antibodies. Quantification of cell surface expression is accomplished by densitometric measurement of the bands corresponding to the protein of interest and subsequent normalization by a membrane protein (as control).
Keywords: Cell surface protein biotinylation Sds-page electrophoresis Western blotting Membrane proteins
Materials and Reagents
Human embryonic kidney HEK293 cells (Health Protection Agency Culture Collections, catalog number: 96121229 )
Biotin reagent: EZ-link Sulfo-NHS-LC-LC-biotin (Thermo-Pierce, catalog number: 21338 )
Electrophoresis grade Glycine (Sigma-Aldrich, catalog number: G8898 )
Immobilized/NeutrAvidin Ultralink Resin (Thermo-Pierce, catalog number: 53150 )
PierceTM BCA Protein Assay Kit (Thermo-Pierce, catalog number: 23227 )
Polyvinylidene difluoride (PVDF) membrane (GE Healthcare Life Sciences, catalog number: RPN303F )
Nonfat dry milk (AppliChem GmbH, catalog number: A0830 )
Chemiluminescence substrate: Super signal west femto maximum sensitivity substrate (Thermo Fisher Scientific, catalog number: 34096 )
X-ray films: Amersham Hyperfilm ECL (GE Healthcare Life Sciences, catalog number: 28-9068-35 )
Primary antibodies
Rabbit anti-human Nav1.5 antibody (Alomone Labs, catalog number: ASC-013 )
Mouse anti-Na+/K+ ATPase (Abcam, catalog number: ab7671 )
Secondary antibodies
Stabilized Goat Anti-Mouse IgG (H + L), Peroxidase Conjugated (10 μg/ml) (Thermo Fisher Scientific, catalog number: 32430 )
Stabilized Goat Anti-Rabbit IgG (H + L), Peroxidase Conjugated (10 μg/ml) (Thermo Fisher Scientific, catalog number: 32460 )
Protease inhibitors Cocktail (Roche Tablets, catalog number: 11 836 170 001 )
DPBS with calcium and magnesium (DPBS+) (see Recipes)
Lysis buffer LB1, LB2, LB3 (see Recipes)
Phosphate-Buffered Saline (PBS) (see Recipes)
Saline washing solution (SWS) (see Recipes)
3x Gel loading buffer (see Recipes)
SDS-PAGE gel (see Recipes)
5x Running buffer (see Recipes)
10x Western blot transfer buffer (see Recipes)
Equipment
35 mm Dish (Thermo Fisher Scientific, catalog number: 153066 )
6-well cell culture plate (BD Biosciences, catalog number: 353046 )
Cell scrapers (VWR International, catalog number: 734-2603 )
96-well Microtest Plate (Sarstedt, catalog number: 82.1581 )
OrbitTM LS Low Speed Shaker (LABNET, catalog number: S-2030-LS )
Rotating wheel (Noria R NR50, Ovan, catalog number: 10000-00062 )
Microcentrifuge R5415 (Eppendorf, catalog number: 022621425 )
Digital heat block (VWR International, catalog number: 460-3267 )
Microplate Reader Benchmark plus (Bio-Rad Laboratories, catalog number: 170-6936 )
Mini-PROTEAN Tetra Cell (Bio-Rad Laboratories, catalog number: 165-8000 )
Mini Trans-Blot Module (Bio-Rad Laboratories, catalog number: 170-3935 )
PowerPac HC Power Supply (Bio-Rad Laboratories, catalog number: 164-5052 )
Software
ImageJ software (available at http://rsb.info.nih.gov/ij ) (National Institute of Health, NIH)
Procedure
Biotinylation
Note: Perform all incubations on ice.
Remove growth media from the cells that you want to study, cultured in 35 mm plates.
Note: We used Human Embryonic Kidney HEK293 cells as experimental model. Cells were maintained in Dulbecco's Modified Eagle's Medium supplemented with 10% fetal bovine serum, 1% Penicilin-streptomycin and 1% Glumtamax at 37 °C and 5% CO2.
We plated approximately 2.1 x 105 HEK293 cells in 35 mm dishes, but this value may vary depending on how fast your cell line grows (this will result in 70% of confluence 24 h later, which is the day of the transfection). Forty-eight hours after transfection we performed the Cell Surface Protein Biotinylation protocol.
Wash cells twice with 1 ml of ice cold DPBS+.
Incubate cells for 30 min on ice in the cold room with gentle rocking with 400 μl per plate of the biotin solution (2.5 mg/ml biotin reagent in DPBS+).
Wash each plate for 5 min three times with 1 ml of cold 100 mM Glycine in DPBS+, on ice in the cold room with gentle rocking.
Wash each plate for 5 min twice with 1 ml of cold 20 mM Glycine in DPBS+, as above.
Lyse with 200 μl of lysis buffer LB3 into each plate and use cell scrapers to detach the cells. Collect the cell lysates in 1.5 ml tubes.
For lysis, place the tubes in a rotating wheel at slow speed 1 h in the cold room.
While the lysis is performed, prepare the Immobilized/ NeutrAvidin Ultralink beads: For each sample, take 40 μl of NeutrAvidin beads at 50% slurry and wash the beads twice with 0.5 ml DPBS+ and twice again with 0.5 ml LB2 (for washing, centrifuge 30 sec at 3,000 x g at 4 °C and remove the supernatant). After the last wash, resuspend the precipitated beads with 20 μl of LB3.
Spin lysates at 16,000 x g (maximum speed) for 15 min at 4 °C.
Transfer the supernatants (solubilized material) to 1.5 ml tubes. Keep 10-15% of each supernatant in another tube and store at -80 °C (these are the INPUT samples, and the rest of the supernatant will be referred to as PULL-DOWN samples).
Incubate the pull-down samples with the 40 μl of NeutrAvidin beads prepared in step 8 overnight in the rotating wheel at slow speed in the cold room.
Centrifuge the samples at 16,000 x g, 30 sec at 4 °C.
Wash beads once with LB3, twice with LB2, twice with SWS and once with LB1. Each time, add 1 ml of the appropriate solution and centrifuge at 16,000 x g, 30 sec at 4 °C.
Resuspend the precipitated proteins in 25 μl of 2x gel loading buffer.
Heat the samples at 70 °C for 10 min in the heat block.
Keep pull-down samples at -20 °C until SDS-PAGE and Western blot.
Western blot
Use part of the input samples to quantify the protein using the BCA Protein Assay Reagent alongside BSA standards, following the manufacturer's directions. From each input sample, transfer equal amounts of protein to a new tube and mix with 3x gel loading buffer. Heat the samples at 70 °C for 10 min.
Note: Other protein quantification methods can be used and are equally efficient.
Load in an SDS-PAGE gel the aliquots of the inputs prepared in step B-1 and the total volume of the pull-down samples (without the beads). Before loading, spin down the samples to pellet the beads.
Run the gel at 40 V until samples have run through the stacking gel (30 min approximately). At that point, increase voltage to 100 V until the blue dye front has nearly run out of the gel.
Prepare the sandwich: Soak the gel 15 min shaking in Western blot transfer buffer. Activate the Polyvinylidene difluoride (PVDF) membrane by soaking it for 10 sec with methanol, then twice with water and 10 min with Western blot Transfer Buffer. Also, wet two sheets of filter paper and two fiber pads with Western blot Transfer Buffer. Construct the sandwich with the gel on the cathode side and the membrane on the anode side, with a sheet of filter paper and a fiber pad at each side.
Transfer the proteins to the PVDF membrane at 80 V for 2 h in the cold room.
Remove the membrane from the sandwich and block it with 5% nonfat milk in PBS with 0.1% Tween-20 1 h at room temperature.
Note: All Western blot incubations were performed in a shaker at low speed.
Incubate the membrane with primary antibody overnight at 4 °C.
Note: We used antibodies against human Nav1.5 (protein of interest; rabbit polyclonal, at 1:1,000 in 5% non-fat milk in PBS with 0.1% Tween-20) and Na+/K+ ATPase (membrane protein used as control, mouse, at 1:5,000 in 5% non-fat milk in PBS with 0.1% Tween-20).
Wash three times with PBS with 0.1% Tween-20 to completely cover the membrane (approximately 20 ml), 10 min each, at room temperature.
Incubate with the appropriate secondary antibody 1 h at room temperature.
Note: We used peroxidase conjugated- goat anti-rabbit or anti-mouse IgG antibodies for Nav1.5 and Na+/K+ ATPase, respectively (at 1:2,000 in 5% non-fat milk-PBS with 0.1% Tween-20).
Wash twice with PBS with 0.1% Tween-20 to completely cover the membrane (approximately 20 ml), 10 min each, at room temperature.
For signal development, use the chemiluminescence substrate and follow the manufacturer's instructions. Remove excess reagent and cover the membrane in transparent plastic wrap.
Detect the protein of interest by exposure to X-ray films (Figure 1).
Note: For normalization purposes, a membrane protein should also be assessed as control.
Figure 1. Western Blot detection of Nav1.5 and Na+/K+ ATPase proteins performed after cell surface biotinylation from WT and mutant cells
Quantification
Scan the films in high resolution using the transparency mode.
Use the ImageJ software for band quantification. Follow the user's guide instructions to determine intensity values for each band as the integrated density (sum of pixel values) within a fixed area.
Note: When the aim is to compare WT and mutant conditions within multiple replicates, proceed as follows:
Determine intensity values for the bands corresponding to WT and mutant conditions for the membrane protein used as control (ICWT and ICMUT, respectively) and WT and mutant condition for the protein of interest (IWT and IMut, respectively).
Calculate the ratio between ICWT and ICMUT to obtain the normalization factor (Nf):
ICWT/ICMUT = Nf
Multiply IMut by the normalization factor calculated in the previous step to obtain the corrected mutant condition intensity value (IC Mut):
IMut x Nf = IC Mut
Divide IC Mut by IWT to obtain the expression of the mutant condition relative to IWT.
IC Mut/IWT = mutant relative expression
Calculate the average of the mutant relative expression values for all the replicates and perform statistical analysis to assess possible differences with respect to the WT (Figure 2).
Figure 2. Bar graph shows the average of the intensity values obtained for each condition
Recipes
Note: All chemical reagents were obtained from Sigma-Aldrich unless stated otherwise.
DPBS+ (For 2 L)
0.2 g of CaCl2
0.4 g KCl
0.4 g KH2PO4
0.2 g MgCl2.6H2O
16 g NaCl
4.32 g Na2HPO4.7H2O
To avoid forming an insoluble precipitate, add everything except CaCl2, and have it stirring in the cold room close to correct volume. While stirring and when cold, add CaCl2, and continue stirring for at least 10 min until the solution becomes clear. Add milli-Q water to the final volume of 2 L.
LB1
50 mM Tris/HCl (pH 7.4)
150 mM NaCl
1 mM EDTA
LB2
LB1 plus 1% (w/v) Triton X-100
To mix well, place the solution 1 h in cold room in the rotating wheel at slow speed.
LB3
For every 10 ml of solution LB2, add 1 tablet of protease inhibitors Cocktail right before use.
1x PBS
8 g NaCl
0.2 g KCl
1.44 g Na2HPO4
0.24 g KH2PO4
Add mili-Q water for bring the final volume to 1 L.
SWS
0.1% Triton X-100 in PBS (pH 7.4)
350 mM NaCl
5 mM EDTA
3x gel loading buffer
180 mM Tris/HCl (pH 6.8)
7.5% SDS
30% glycerol
0.051% Bromophenol blue
150 mM DTT
SDS-PAGE gel (for 2 gels 1.5 mm thick)
Stacking (4%)
4.65 ml H2O
1.88 ml 0.5 M Tris (pH 7.4)
0.75 ml Acrylamide: Bisacrylamide 30% solution 37.5:1
75 μl 10% SDS
45 μl 10% Ammonium persulfate
15 μl N, N, N', N'-tetramethylethylenediamine (TEMED)
Resolving (4%)
9.35 ml H2O
3.75 ml 1.5 M Tris (pH 8.8)
1.46 ml Acrylamide: 30% Bisacrylamide solution 37.5:1
150 μl 10% SDS
69 μl Ammonium persulfate 10%
23.1 μl N, N, N', N'-tetramethylethylenediamine (TEMED)
5x Running buffer (For 1 L)
5 g SDS
144 g glycine
30 g Tris
10x Western blot transfer buffer (For 1 L)
10 g SDS
24.24 g Tris
111.75 g glycine
Before use, make up 1x and add 20% Methanol.
Acknowledgments
The protocol was used in: Riuró et al. (2013); and Tarradas et al. (2013), but was adapted from a previously published paper: Cuartero et al. (2012). Funding sources at the time the protocol was developed included a grant from the Spanish Ministerio de Sanidad y Consumo to M. Verges (PI07/0895); Fellowship from the Príncipe Felipe Research Center (CIPF) to Y. Cuartero (PR 01/2007); and Ramón y Cajal contract from the Spanish Ministerio de Educación y Ciencia to M. Verges. Funding when it was implemented imcluded “La Caixa” Foundation to R. Brugada; Centro Nacional de Investigaciones Cardiovasculares (CNIC) Translational to R. Brugada (CNIC-03-2008); Ministerio de Sanidad y Consumo to R. Brugada (PI08/1800); Ministerio de Sanidad y Consumo fellowships or contracts (FI09/00336, CD09/00055, CD10/00275, CD11/00063 and PI2008/1800); Univ. of Girona fellowships to H. Riuró (BR2012/47); Ministerio de Sanidad y Consumo: Red Cooperativa de Insuficiencia Cardiaca (REDINSCOR) RD06/03/0018; and Sociedad Española de Cardiología (2011, Investigación Básica).
References
Cuartero, Y., Mellado, M., Capell, A., Alvarez-Dolado, M. and Verges, M. (2012). Retromer regulates postendocytic sorting of beta-secretase in polarized Madin-Darby canine kidney cells. Traffic 13(10): 1393-1410.
Riuró, H., Beltran‐Alvarez, P., Tarradas, A., Selga, E., Campuzano, O., Vergés, M., Pagans, S.,Iglesias, A., Brugada, J. and Brugada, P. (2013). A missense mutation in the sodium channel β2 subunit reveals SCN2B as a new candidate gene for brugada syndrome. Hum Mutat 34(7):961-966.
Tarradas, A., Selga, E., Beltran-Alvarez, P., Perez-Serra, A., Riuro, H., Pico, F., Iglesias, A.,Campuzano, O., Castro-Urda, V., Fernandez-Lozano, I., Perez, G. J., Scornik, F. S. and Brugada, R.(2013). A novel missense mutation, I890T, in the pore region of cardiac sodium channel causes brugada syndrome. PLoS One 8(1): e53220.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Tarradas, A., Selga, E., Riuró, H., Scornik, F., Brugada, R. and Vergés, M. (2013). Cell Surface Protein Biotinylation and Analysis. Bio-protocol 3(16): e857. DOI: 10.21769/BioProtoc.857.
Download Citation in RIS Format
Category
Cell Biology > Cell structure > Cell surface
Biochemistry > Protein > Isolation and purification
Biochemistry > Protein > Labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Flow Cytometry Analysis of Microglial Phenotypes in the Murine Brain During Aging and Disease
Jillian E. J. Cox [...] Sarah R. Ocañas
Jun 20, 2024 1048 Views
Chromogranin B Purification for Condensate Formation and Client Partitioning Assays In Vitro
Anup Parchure and Julia Von Blume
Oct 20, 2024 283 Views
Mouse-derived Synaptosomes Trypsin Cleavage Assay to Characterize Synaptic Protein Sub-localization
Jasmeet Kaur Shergill and Domenico Azarnia Tehran
Jan 20, 2025 230 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
858 | https://bio-protocol.org/en/bpdetail?id=858&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sodium Current Measurements in HEK293 Cells
HR Helena Riuró
AT Anna Tarradas
ES Elisabet Selga
RB Ramon Brugada
Fabiana Scornik
GP Guillermo Pérez
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.858 Views: 13397
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS ONE Jan 2013
Abstract
This protocol is used to measure sodium currents from heterologously transfected cells lines, such as HEK293 cells. Standard whole cell patch clamp technique is used to assess ion channel function. This protocol has been used to study cardiac type Nav1.5 sodium channel, and in particular to compare wild-type and mutant channels related to Brugada Syndrome (BrS). Mutations related to BrS provoke a loss of function of the cardiac sodium channel. This is evidenced by a reduction of sodium current density and/or alterations of the activation or inactivation kinetic parameters, such as a slow recovery from inactivation. These effects could explain the alteration of the cardiac action potential that leads to the characteristic ST elevation observed in the electrocardiogram of the Brugada Syndrome patients. This protocol, with some variations, is suitable for studying other cardiac arrhythmias related to alterations in the cardiac type sodium channel function as well as for studying other voltage-dependent sodium channels.
Keywords: Sodium current Patch clamp Heterologous transfection Ion channels Whole cell current
Materials and Reagents
Human embryonic kidney HEK293 cells (Health Protection Agency Culture Collections, catalog number: 96121229 )
Vector/s: mammalian expression vectors harboring the cDNA of interest (i.e. pcDNA3 + SCN5A)
Dulbecco’s Modified Eagle’s Medium (DMEM) (Sigma-Aldrich, catalog number: D6546 )
Fetal Bovine Serum (Sigma-Aldrich, catalog number: F4135 )
Penicillin-streptavidin (Life Technologies, Gibco®, catalog number: 15140-122 )
GlutaMAXTM (Life Technologies, Gibco®, catalog number: 35050-038 )
0.05% Trypsin-EDTA (Life Technologies, Gibco®, catalog number: 25300-062 )
Dulbecco’s Phosphate Buffered Saline (Sigma-Aldrich, catalog number: D8662 )
GeneCellinTM Transfection Reagent (BioCellChallenge, catalog number: GC-1000 )
Opti-MEM® Reduced Serum Media + GlutaMAXTM (Life Technologies, Gibco®, catalog number: 31985-062 )
Sticky wax in bars (Cera de Reus, catalog number: 25005001 )
Sodium chloride (NaCl) (Sigma-Aldrich)
Potassium chloride (KCl) (Sigma-Aldrich)
Cesium chloride (CsCl) (Sigma-Aldrich)
Calcium chloride (CaCl2) (Sigma-Aldrich)
Magnesium chloride (MgCl2) (Sigma-Aldrich)
N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid (HEPES) (Sigma-Aldrich)
Ethylene glycol-bis (2-amino-ethylether)-N,N,N’,N’-tetra-acetic acid (EGTA) (Sigma-Aldrich)
Adenosine 5′-triphosphate magnesium salt (ATP-Mg2+) (Sigma-Aldrich)
Sodium hydroxide (NaOH) (Sigma-Aldrich)
Cesium hydroxide (CsOH) (Sigma-Aldrich)
Glucose (Sigma-Aldrich)
Bath solution (see Recipes)
Pipette solution (see Recipes)
Equipment
Inverted microscope Nikon Eclipse Ti fitted for epifluorescence (Nikon Instruments Inc.)
Glass capillary PC-10 Puller (Narishige International USA Inc.)
Micromanipulator MP-285 (Sutter Instrument Co.)
Vapor pressure Osmometer VAPOR 5520 (Wescor Inc.)
Axopatch 200B Capacitor Feedback Patch Clamp Amplifier (Molecular Devices)
Axon Digidata 1440A Data Acquisition System (Molecular Devices)
CO2 incubator
Nunclon® cell culture dishes 35 x 10 mm (Sigma-Aldrich, catalog number: D7804 )
Glass capillaries (Brand GmbH + CO KG, catalog number: 7493-21 )
Software
pCLAMP 10.2 Electrophysiology Data Acquisition and Analysis Software (Molecular Devices)
OriginPro 8 software (OriginLab Corporation)
Procedure
Cell culture and transfection
The day before transfection, plate HEK293 cells in 35 mm dishes at a density that will result in 70% confluence 24 h later (this is 2.1 x 105 cells but it may vary depending on how fast your cell line grows), and maintain in a CO2 incubator at 37 °C in DMEM supplemented with 10% Fetal Bovine Serum, 1% Penicillin-streptomycin and 1% GlutaMAXTM.
Perform the transfection for each 35 mm dish of HEK293 cells with a mix of 200 μl Opti-MEM® Medium, 3 μg (in total) of the vectors of interest and 4 μl of GeneCellinTM Transfection Reagent. The inclusion of a vector harboring the cDNA encoding a fluorescent protein will allow the identification of transfected cells.
Note: Other transfection reagents and methods have been successfully used for transfecting sodium channels.
Twenty-four hours after transfection, wash the each dish with 1.5 ml DPBS, then add 0.2 ml 0.05% Trypsin-EDTA and incubate at 37 °C for 2 min, cells should look separated from each other, add 1.5 ml of DMEM to the dish, disperse with a fine tip pipette and plate 200-300 μl in a new dish with 1.5 ml of media.
Note: You should get individual cells for recording.
Patch-clamp procedure (48 h after transfection)
Pull pipettes from glass capillaries and finely coat the tip with melted dental wax (be careful not to occlude the tip hole). Their resistance should range from 2 to 4 MΩ when filled with the Pipette solution.
Remove DMEM from the transfected cells dish that you will use and, after rinsing the cells twice with the Bath solution (approximately 3 ml in total), fill it to about one third of the height with the same solution.
Choose the cells that you will record from individual fluorescent cells.
Fill the pipette with the pipette solution and place it in the electrode holder. Lower the pipette to place it in the Bath solution. After compensating offsets, approach the pipette to the chosen cell with the help of the remote micromanipulator to form a high resistance cell-attached seal.
Once the seal is formed and the whole cell configuration is established, compensate series resistance at 80-90%.
Wait five minutes before starting to record. This allows the cell content to equilibrate with the pipette solution.
For acquisition, set your filter at 5 kHz and your sampling rate at 20-25 kHz.
Sodium measurements protocols
Macroscopic sodium current: Currents are elicited by 50 ms depolarizing steps (from -80 to +80 mV in 5 mV increments) from a holding potential of -120 mV.
Steady-state inactivation (h∞): Current is measured with -20 mV pulses (20 ms), following 50 ms pre-pulses to different potentials (-140 to +5 mV in 5 mV increments).
Recovery from inactivation: current is elicited by a -20 mV, 20 ms, pulse (P2), preceded by a 50 ms depolarizing pre-pulse to -20 mV (P1) from a holding potential of -120 mV, followed by a hyperpolarizing pulse to -120 mV of increasing duration (1-100 ms).
Slow inactivation: Double pulse protocol 1: Current is measured with a test pulse to -20 mV during 20 ms (P2), preceded by a depolarizing pulse from -120 mV to -20 mV (P1) of increasing duration (10-100 ms in 10 ms increments), followed by a hyperpolarizing pulse to -120 mV during 20 ms, to remove fast inactivation. Double pulse protocol 2: This protocol is the same as the previous one except for that the duration of the first depolarizing pulse to -20 (P1) runs from 100 to 2,000 ms in 200 ms increments.
Sodium measurements analysis (pClamp 10.2 and OriginPro 8 software)
Current density-voltage (pA/pF): The measured peak current at the different voltages applied is normalized by the cell capacitance.
Activation curve: Whole cell conductance (G) is obtained from the current- density relationship (I-V) by dividing the peak current obtained at each potential by the driving force (V-Eion) at each potential. These values are normalized to the maximum conductance (Gmax) and plotted against each voltage. Data is fitted to a Boltzmann equation of the form G=Gmax/ (1 + exp[(V1/2-V)/k]) where V is the applied potential, V1/2 is the voltage at which half of the channels are activated, and k is the slope factor.
Inactivation time constants: time constants (t), tslow and tfast, are obtained from fitting the currents elicited with the macroscopic sodium current protocol to a second order exponential function. At some voltages, when the current is either too fast or too small, it is not possible to fit a second order exponential. In this case a first order exponential is used. The region analyzed to obtain the time constants is comprised from the peak of the current to a point where the current has reached a plateau near zero. tslow and tfast are plotted against voltage.
Steady-state inactivation curve: Peak current amplitude (I) is normalized to the maximum peak current amplitude (Imax). The I/Imax values from the test pulse are plotted against the voltage during the pre-pulse. Experimental data is fitted to a Boltzmann equation of the form I = Imax/ (1 + exp[(V-V1/2)/k]), where V is the applied voltage, V1/2 is the voltage at which half of the channels are inactivated and k is the Boltzmman constant.
Recovery from inactivation: Recovery current values are obtained by dividing the peak current from P2 by the peak current at P1. P2/P1 ratios are plotted against the recovery interval times. The recovery from inactivation curve is fitted to a mono-exponential function to obtain the time constants (t).
Slow inactivation: Peak current is measured at P2 and P1. The P2/P1 ratio is plotted against the depolarizing pulse interval times. The slow inactivation curve is fitted to a mono-exponential function to obtain the slow inactivation constant (t).
Recipes
Bath solution
140 mM NaCl
3 mM KCl
10 mM HEPES
1.8 mM CaCl2
1.2 mM MgCl2
The pH is adjusted to 7.4 with NaOH
Osmolality is adjusted by the addition of glucose to approximately 325 mOsm.
Pipette solution
130 mM CsCl
1 mM EGTA
10 mM HEPES
10 mM NaCl
2 mM ATP-Mg2+
The pH is adjusted to 7.2 with CsOH
Osmolality is adjusted by the addition of glucose to approximately 308 mOsm.
Note: The difference in osmolality between Pipette and Bath solutions should be near 5%.
Acknowledgments
This protocol is adapted from Riuro et al. (2013) and Tarradas et al. (2013).
References
Riuró, H., Beltran‐Alvarez, P., Tarradas, A., Selga, E., Campuzano, O., Vergés, M., Pagans, S.,Iglesias, A., Brugada, J. and Brugada, P. (2013). A Missense Mutation in the Sodium Channel β2 Subunit Reveals SCN2B as a New Candidate Gene for Brugada Syndrome. Hum Mutat 34(7):961-966.
Tarradas, A., Selga, E., Beltran-Alvarez, P., Perez-Serra, A., Riuro, H., Pico, F., Iglesias, A., Campuzano, O., Castro-Urda, V., Fernandez-Lozano, I., Perez, G. J., Scornik, F. S. and Brugada, R. (2013). A novel missense mutation, I890T, in the pore region of cardiac sodium channel causes Brugada syndrome. PLoS One 8(1): e53220.
Additional suggested bibliography
Sakmann, Bert and Neher, Erwin. (1995). Single-Channel Recording. Springer-Verlag, 2nd Edition. New York.
Molleman, Areles (reprinted 2008). Patch Clamping. An Introductory guide to patch clamp electrophysiology. John Wiley and Sons Ltd. England: West Sussex.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Riuró, H., Tarradas, A., Selga, E., Brugada, R., Scornik, F. and Pérez, G. (2013). Sodium Current Measurements in HEK293 Cells. Bio-protocol 3(16): e858. DOI: 10.21769/BioProtoc.858.
Download Citation in RIS Format
Category
Cell Biology > Cell-based analysis > Ion analysis > Sodium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Flow Cytometric Analysis of Calcium Influx Assay in T cells
Sun-Hwa Lee
Sep 20, 2013 20159 Views
A Protocol for Measurement of Intracellular pH
Iman Saramipoor Behbahan [...] Siavash K. Kurdistani
Jan 20, 2014 22307 Views
Analyzing the Quenchable Iron Pool in Murine Macrophages by Flow Cytometry
Michael Riedelberger and Karl Kuchler
Mar 20, 2020 4850 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
859 | https://bio-protocol.org/en/bpdetail?id=859&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bronchoalveolar Lavage and Lung Tissue Digestion
Hongwei Han
SZ Steven F. Ziegler
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.859 Views: 34338
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Immunology Feb 2013
Abstract
Bronchoalveolar lavage (BAL) is a simple but valuable and typically performed technique commonly used for studying the pathogenesis of lung diseases such as asthma and COPD. Cell counts can be combined with new methods for examining inflammatory responses, such as ELISA, Flow cytometric analysis, immunohistochemistry, quantitative polymerase chain reaction, and HPLC to assess cellular expression for inflammatory cytokines and growth factor. Here we describe a basic procedure to collect BAL fluid and digest lung tissue for assessing a number of pulmonary components.
Keywords: Mouse Lung function Pulmonary disease Immune cell function Mucosal immunology
Materials and Reagents
Mice
Avertin (Sigma-Aldrich, catalog number: T48402 )
PBS (Sigma-Aldrich, catalog number: D8537 )
RPMI-1640 (Sigma-Aldrich, catalog number: R8758 )
FACS buffer (PBS/0.5% BSA)
Diff-Quick stain kit (Dade Behring, catalog number: B4132-1A )
Single Cytology Funnels (Biomedical Polymers, Inc., catalog number: BMP-CYTO-S50 )
Superfrost slides (Thermo Fisher Scientific, catalog number: 22-034-979 )
Liberase Blendzyme (F. Hoffmann-La Roche, catalog number: 05401119001 )
DNase (F. Hoffmann-La Roche, catalog number: 10104159001 )
Trypan blue (Life Technologies, InvitrogenTM, catalog number: 15250-061 )
Mouse Fc block (BD Biosciences, PharmingenTM, catalog number: 553141 )
Antibodies for T cells (CD3+)
Antibodies for B cells (B220+)
Antibodies for eosinophils (Siglec-F+CD11c-)
Antibodies for alveolar macrophages (AMs, Siglec-F+CD11c+CD11bintF4/80+)
Antibodies for interstitial macrophages (Ims, Siglec-F-CD11c-CD11b+F4/80+)
Antibodies for neutrophils (Siglec-F-CD11c-CD11b+Ly6G+)
Antibodies for dendritic cells (DCs) (Siglec-F-CD11chiMHCIIhi)
Erythrocyte lysis buffer (see Recipes)
Tissue digestion solution (see Recipes)
Equipment
1 ml, 3 ml, and 10 ml sterile syringes
21 gauge lavage tube
21 gauge sterile needles
Cotton thread No. 40
50 ml flask
15 ml and 50 ml conical tubes
Microtubes
100 Micron cell strainer (BD Biosciences, Falcon®, catalog number: 352360 )
Hemocytometer
Centrifuge (Beckman Coulter, model: AllegraTM 6R )
Cytospin cytocentrifuge (Thermo Fisher Scientific/Shandon, model: A7830002 )
Microscope
BD LSR II flow cytometer
3-Way Stopcocks (Bio-Rad Laboratories, model: 732-8103 )
Magnetic stir bar (VWR International, model: 58949-006 )
Multi-Position Magnetic Stirrers (VWR International, model: 12621-042 )
Procedure
Anesthetize the mouse by intraperitoneal injection of 1 ml 2.5% Avertin in PBS.
Using scissors to expose thoracic cage and neck. Dissect tissue from neck to expose trachea.
Proceed to open the diaphragm by cutting the rib cage to expose both the heart and lungs. Take caution not to pierce heart or lungs.
Use forceps to slide 1 inch long piece of thread underneath trachea.
Make a small incision in the trachea, to allow passage of 21 gauge lavage tube into trachea. The distance between the proximal end of the trachea and the tracheal incision is 2-3 mm.
Note: Do not cut trachea all the way through.
Cut a 1-1.5 inch segment of 21 gauge tube, carefully pass a 21 gauge needle into the tubing. Insert tubing into trachea and tie thread into single knot around tubing in trachea.
Slowly inject 1 ml cold PBS with 0.1 mM EDTA into lungs using “input” 3 ml syringe via 3-way stopcocks: Watch lungs inflating and do not overinflate.
Collect ~1 ml BAL fluid (BALF) from lungs using “output” 3 ml syringe into microtubes on ice.
Repeat steps 7-8 for 3 washes per animal, each using 1 ml PBS/0.1 mM EDTA through 3-way stopcocks. Remove syringe from needle, inject recovered lavage fluid to 15 ml falcon tube on ice.
Note: For lung tissue digestion, please go to step 22.
Centrifuge microtubes containing ~1 ml BAL at 1,500 rpm for 5 min with brake.
Pipet supernatant (BALF) from these tubes into fresh microtubes, store at -80 °C until ready to perform ELISA.
Pipet 500 μl PBS to resuspend cell pellet in centrifuged microtubes and add all cells back into 15 ml conical tubes.
Centrifuge 15 ml conical tubes at 1,500 rpm for 5 min with brake and resuspend cells with 1 ml erythrocyte lysis buffer and keep on ice for 5 min.
Centrifuge the cells at 1,500 rpm for 5 min.
Discard supernatant and resuspend BAL cells in 500 μl RPMI or FACS buffer.
Add 50 μl of trypan blue to 50 μl saved aliquot, mix well and count cells using a hemocytometer. Calculate and record cell concentration.
Note: Dark blue cells are dead and should not be counted.
Compute volume needed for 0.5-1 x 105 cells for each slide.
Pre-wet cytospin funnels by spinning with 300 μl PBS onto glass slides (reusable) at 600 rpm for 5 min.
Prepare microtubes containing 0.5-1 x 105 cells in 300 μl total volume. Spin BAL cells onto fresh labeled glass slides at 600 rpm for 10 min.
Remove all slides from the cytospin apparatus, and allow to air dry at least 2 h.
After dry, stain slides using Diff-Quick stain kit as follows:
25 sec in fixative solution
15 sec in solution I
15 sec in solution II
rinse the slide in distilled water.
Perform differential cell counts under microscope at 100x magnification using oil-immersion lens (Figure 1).
Figure 1. Photograph of cytospun BAL cells stained with Diff-Quick. (A) Control BAL; (B) BAL from asthmatic mice.
The following protocol is for lung tissue digestion. Immediately after lavage, perfuse the lung vascular bed using a 10 ml syringe filled with 5 ml PBS. Make a small incision in the left ventricle and connect a 21 G needle and insert needle into the right ventricle. Accurate perfusion will result in a color change to white.
Transfer lung lobes to a petri dish and chop it to small digestible pieces using a razor blade.
Transfer grounded lung tissue into a 50 ml flask containing 20 ml/lung of tissue digestion solution and magnetic stir bar. Incubate, stirring at regular speed, at 37 °C for 30-45 min.
Note: This can be performed in 37 °C incubator.
Disperse the suspension by repeated aspiration through a 10 ml syringe, transfer to a 50 ml conical tube and centrifuge for 5 min at 1,500 rpm at 4 °C.
Lyse remaining erythrocytes by suspension in erythrocyte lysis buffer for 2 min at room temperature. Wash cells with 10 ml cold PBS/0.5% BSA and centrifuge for 5 min at 1,500 rpm at 4 °C.
Wash cells twice with 10 ml cold PBS/0.5% BSA, and filter through a 100-μm cell strainer.
Resuspend 1 millions cells in 50 μl of 1:200 Fc block in FACS buffer and incubate for 10 min on ice.
Wash the cells with 1 ml of PBS/0.5% BSA and spin down the cells for 5 min at 4 °C.
Discard the supernatant and stain cells with antibodies (1:100 in FACS buffer) and incubate for 30 min on ice.
Note: All the fluorochrome-conjugated mAbs were purchased from eBioscience or Biolegend.
Wash the cells with 1 ml of PBS/0.5% BSA and spin down the cells for 5 min at 4 °C.
Resuspend the cells in 500 μl PBS/0.5% BSA and analyze the cells using BD LSR II flow cytometer (Figure 2).
Figure 2. Gating strategy for lung digested cells. This strategy also applies to BAL cells.
Recipes
Erythrocyte lysis buffer
NH4Cl 16.4 g
KHCO3 2 g
EDTA 0.5 M 400 μl
2 L ddH2O
Titrate with HCl to pH 7.2-7.4
Tissue digestion solution
Serum-free RPMI 1640
0.13 mg/ml Liberase Blendzyme
20 U/ml DNase
Acknowledgments
We thank the members of the Ziegler laboratory for discussion.
References
Han, H., Headley, M. B., Xu, W., Comeau, M. R., Zhou, B. and Ziegler, S. F. (2013). Thymic stromal lymphopoietin amplifies the differentiation of alternatively activated macrophages. J Immunol 190(3): 904-912.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Immunology > Immune cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
86 | https://bio-protocol.org/en/bpdetail?id=86&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Calcium Phosphate Transfection of Eukaryotic Cells
YC Yanling Chen
Published: Feb 5, 2012
DOI: 10.21769/BioProtoc.86 Views: 64627
Download PDF
Ask a question
Favorite
Cited by
Abstract
Transfection of DNA into cells is an indispensible protocol in molecular biology. While plenty of lipid-based transfection reagents are commercially available nowadays, a quick, simple, efficient and inexpensive method is to transfect eukaryotic cells via calcium phosphate co-precipitation with DNA (Graham and van der Eb, 1973). The insoluble calcium phosphate precipitate with the attached DNA adheres to the cell surface and is brought into the cells by endocytosis. Calcium phosphate transfection has been optimized and widely used with many adherent and nonadherent cell lines (Jordan et al., 1996). Calcium phosphate transfection can result in transient expression of the delivered DNA in the target cell, or establishment of stable cell lines (the latter requires a drug selection process). This protocol is also widely used for co-expression of plasmids for packaging viruses. Efficiency of transfection can be close to 100% depending on the cell lines used. Here, a calcium phosphate transfection protocol is described using a GFP plasmid and the HEK293 cell line.
Materials and Reagents
HEK-293 cells (ATCC, catalog number: CRL-1573 ™)
Eagle's minimum essential medium (ATCC, catalog number: 30-2003 ™)
Fetal bovine serum (FBS) (ATCC, catalog number: 30-2020 ™)
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C5670 )
HEPES (Sigma-Aldrich, catalog number: H4034 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S5886 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S5136 )
pEGFP-Actin plasmid (this is an example plasmid; Clontech, catalog number: PT3265-5 )
Note: The pEGFP-Actin Vector expresses the EGFP-Actin fusion protein in mammalian cells; this protein is incorporated into growing actin filaments and allows for visualization of actin-containing subcellular structures in living and fixed cells. http://www.clontech.com/images/pt/dis_vectors/PT3265-5.pdf
2x HBS buffer (see Recipes)
Solution-A (see Recipes)
Solution-B (see Recipes)
Equipment
Tissue culture plates (e.g., 35 mm polystyrene)
Cell culture incubator: 37 ºC and 5% CO2
Procedure
Prepare 2 M CaCl2 solution in water, filter sterilize and keep at room temperature.
Prepare the 2x HBS buffer (see Recipes).
Carry HEK-293 cells in Eagle's Minimum Essential Medium with 10% FBS.
24 h before transfection, trypsinize and reseed log-phase cells into 35 mm tissue culture dishes. For seeding density, cells should reach 60-70% confluence for transfection.
Note: Best confluence for different cell lines differ. For HEK-293 cells, 60-70% confluence is suggested.
3 h before transfection, replenish cells with fresh medium.
For each DNA transfection, prepare mixtures in two separate tubes (Solution-A and Solution-B, see Recipes)
Add Solution-B slowly (drop-wise) into Solution-A while mixing Solution-A.
Note: This is the most important step for forming DNA/calcium phosphate co-precipitate. Mix gently but thoroughly to allow formation of precipitates evenly.
After mixing the two solutions, incubate at room temperature for 20-30 min (a shorter incubation time may be used for different cell types; please determined empirically). The solution will become opaque while precipitates being formed.
Gently tap the mixture. Add the mixture directly to cells by dripping slowly and evenly into medium (a good way is to let tip touch medium surface).
Gently tilt the plate back-and-forth a couple of times to allow even distribution of added precipitate on the cell surface.
Incubate the cells at 37 ºC with 5% CO2 for 24 h and then replenish medium.
Notes
GFP expression, if used as your positive, can be detected usually after 24-48 h of cell growth.
Transfection efficiency (when using HEK293 cells and the above mentioned sample plasmid) can reach up to 90-100%.
Recipes
2x HBS buffer
50 mM
HEPES
280 mM
NaCl
1.5 mM
Na2HPO4
Adjust pH to 7.0 using HCl. Filter sterilize. The solution can be freezed/thawed once for future use.
Solution-A
100 μl 2x HBS
Solution-B
1-5 μg DNA (e.g., pEGFP-Actin plasmid as suggested above)
12.2 μl of 2 M CaCl2
ddH2O to bring volume up to 100 μl, pipet gently to mix
Note: Titration of DNA should be carried out to obtain the best efficiency of transfection.
Acknowledgments
This protocol was developed in the Department of Immunology, Scripps Research Institute, La Jolla, CA, USA and adapted from Graham and van der Eb (1973) and Jordan et al. (1996). The work was funded by NIH grants CA079871 and CA114059, and Tobacco-Related Disease, Research Program of the University of California, 15RT-0104 to Dr. Jiing-Dwan Lee [see Chen et al. (2009)].
References
Chen, Y., Lu, B., Yang, Q., Fearns, C., Yates, J. R., 3rd and Lee, J. D. (2009). Combined integrin phosphoproteomic analyses and small interfering RNA--based functional screening identify key regulators for cancer cell adhesion and migration. Cancer Res 69(8): 3713-3720.
Graham, F. L. and van der Eb, A. J. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52(2): 456-67.
Jordan, M., Schallhorn, A. and Wurm, F. M. (1996). Transfecting mammalian cells: optimization of critical parameters affecting calcium-phosphate precipitate formation. Nucleic Acids Res 24(4): 596-601.
Article Information
Copyright
© 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Molecular Biology > DNA > Transfection
Cell Biology > Cell-based analysis > Cytosis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
860 | https://bio-protocol.org/en/bpdetail?id=860&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorescence in situ Hybridization to the Polytene Chromosomes of Anopheles Mosquitoes
AX Ai Xia
AP Ashley Peery
MK Maryam Kamali
JL Jiangtao Liang
MS Maria V. Sharakhova
IS Igor V. Sharakhov
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.860 Views: 12237
Reviewed by: Fanglian HeYoko EguchiLin Fang
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Oct 2012
Abstract
Fluorescence in situ hybridization (FISH) is a method that uses a fluorescently labeled DNA probe for mapping the position of a genetic element on chromosomes. A DNA probe is prepared by incorporating Cy-3 or Cy-5 labeled nucleotides into DNA by nick-translation or a random primed labeling method. This protocol was used to map genes (Sharakhova et al., 2010) and microsatellite markers (Kamali et al., 2011; Peery et al., 2011) on polytene chromosomes from ovarian nurse cells and salivary glands of malaria mosquitoes. Detailed physical genome mapping performed on polytene chromosomes has the potential to link DNA sequences to specific chromosomal structures such as heterochromatin (Sharakhova et al., 2010). This method also allows comparative cytogenetic studies (Sharakhova et al., 2011; Xia et al., 2010), and reconstruction of species phylogenies (Kamali et al., 2012).
Keywords: Mosquito Chromosome Mapping Genome FISH
Materials and Reagents
Early fourth instar Anopheles larvae
Female Anopheles mosquitoes
Template DNA
Fisherfinest* Premium Extra-Thick Frosted Microscope Slides (Double frosted coating) (Thermo Fisher Scientific, catalog number: 12-544-6 )
Fisherfinest* Premium Cover Glasses (22 x 22 mm) (Thermo Fisher Scientific, catalog number: 12-544-10 )
50% Propionic acid in water
Razor blade
Liquid nitrogen
Ethanol, molecular biology grade
Microscope slide staining jar with lid
Random Primed DNA Labeling Kit (Roche Applied Science, catalog number: 11004760001 )
Random Primers DNA Labeling System (Life Technologies, InvitrogenTM, catalog number: 18187-013 )
Formamide (Super pure) (Fisher Bioreagent, catalog number: BP228-100 )
Dextran Sulfate Sodium salt from Leuconostoc spp. (Sigma-Aldrich, catalog number: D8906 )
Prolong® Gold antifade reagent (Life Technologies, InvitrogenTM, catalog number: P36930 )
Cy3-dUTP (GE Healthcare, catalog number: PA53022 )
Cy5-dUTP (GE Healthcare, catalog number: PA55022 )
YOYO®-1 Iodide (491/509)–1 mM Solution in DMSO (Life Technologies, InvitrogenTM, catalog number: Y3601 )
Paraformaldehyde (Sigma-Aldrich, catalog number: F8775 )
DNA polymerase I (Fermentas, catalog number: EP0041 )
DNase I (Fermentas, catalog number: EN0521 )
QIAquick® Gel Extraction Kit (QIAGEN, catalog number: 28704 )
QIAquick® PCR purification Kit (QIAGEN, catalog number: 28104 )
Carnoy's solution (see Recipes)
20x SSC (see Recipes)
3 M NaAC (see Recipes)
1x PBS (see Recipes)
Hybridization buffer (see Recipes)
Equipment
1.5 ml microcentrifuge tubes
Forceps
Disposable transfer pipette
Dissecting needles
Research stereo microscope (Leica, model: VA-OM-E194-354 )
Phase contrast compound microscope with 10x, 20x, 40x and 100x objective lenses
Thermal cycler
Vacufuge® vacuum concentrator (Eppendorf, model: 022820001 )
Incubator
Water Bath
Vortexer
Confocal Microscope or Fluorescence Microscope
Procedure
Polytene chromosome preparation
A-1 Salivary gland chromosome preparation
Preserve early fourth instar larvae in Carnoy's Solution and keep at -20 °C.
Remove one fourth-instar larva from the vial with a pair of forceps and place it on a dust-free microscope slide with back upward, then put a drop of fresh Carnoy's solution onto it immediately (Figure 1a).
Note: Continue adding drops of Carnoy's solution when needed to prevent drying out until dipping 50% Propionic acid onto the gland.
While firmly holding the larva with one dissecting needle, gently pull the head away from thorax with another needle (Figure 1b). Insert a needle from the middle rear of the thorax just underneath the cuticle, and gently move forward to break the thorax cuticle along the mid dorsal line (Figure 1c). Carefully open up the thorax and separate the salivary gland from connecting tissue (Figure 1d and 1e). Remove the carcass and other tissue from slide and put one drop of fresh 50% Propionic acid onto the gland (Figure 1f).
Figure 1. Dissection of salivary glands in 4th instar larva of An. Sinensis
Cover gland with a dust-free coverslip and leave them for about 5 min. After 5 min, place a piece of filter paper over the coverslip, hold the four edges still with fingers. Gently tap it with a pencil eraser to release the polytene chromosomes from the salivary gland.
Examine the banding pattern and spread of polytene chromosomes using a phase-contrast microscope.
Place slides with good chromosomal preparations in a humid chamber with 4x SSC in the bottom of the chamber, at 60 °C for 15-20 min. After heating, put slides at 4 °C overnight or until immersing the slides in liquid nitrogen. Heating can be done on the Thermobrite machine with the absorbent strips soaked in distilled water.
Note: Slides can dry out if left at 4 °C for extended periods of time. Leaving them at 4 °C for longer than overnight is not recommended.
While holding one corner of the slide with forceps or a gloved hand, dip chromosome preparation into the liquid nitrogen so that the coverslip is completely immersed. Hold slide in liquid nitrogen until the bubbling stops (usually 10-15 sec). Take it out of the liquid nitrogen and immediately remove the coverslip with a razor blade from one corner. It sometimes helps to put the slide on a flat surface when trying to remove the cover slip. Put slide in a slide jar with prechilled 50% Ethanol (-20 °C) and keep at 4 °C for at least 2 h.
Dehydrate the preparations in slide jar with an ethanol series of 70%, and 90% for 5 min each at 4 °C and then 100% ethanol for 5 min at room temperature. Air dry, and keep slides in slide box until ready for use in in situ hybridization (Figure 2).
Note: Slides that are kept protected from dust and debris can be used for FISH at least within a year after the preparations are made.
Figure 2. Polytene chromosomes from salivary glands of An. sinensis
A-2 Chromosome preparation from Anopheles ovaries
Dissect the ovaries of Anopheles mosquitoes from half gravid females 18-33 h after 2nd or 3rd blood feeding (Christophers' III stage) and keep 4-5 ovaries in a vial with 1 ml of Carnoy's sollution. After fixing the ovaries for 24 h at room temperate, transfer the vials to -20 °C for storage.
Note: Females should be bloodfed and lay eggs at least once before bloodfeeding again and dissecting ovaries for chromosomal preparations.
To make the chromosome preparations, take one ovary out of the vials with a pair of forceps (or a transfer pipet) and place it into a drop of Carnoy's solution on microscope slide. After carefully removing tissues, trachea and blood, quickly separate the follicles from one ovary into 2-4 pieces. Up to four preparations can be made from one ovary.
Note: While dissecting, the ovaries should never be allowed to dry. Continue adding drops of Carnoy's solution when needed to prevent drying of the ovaries.
On 4-8* microscope slides, add each of the pieces of divided ovary and one drop of 50% propionic acid on a separate slide. Let the pieces of ovary rest in propionic acid for about 5 min until follicles become clear, and swell to about twice their original size.
*number of slides you need depends of how many pieces each ovary is divided into.
For each slide, use a dissecting microscope to separate the cleared follicles from each other and any other tissue or debris on the slide. Remove tissue and debris by wiping it away with a piece of paper towel, and apply a fresh drop of 50% propionic to the separated follicles.
Do the same as steps 3-7 in "Salivary gland chromosome preparation".
Probe preparation and labeling
If using PCR products as probe, purify the PCR product from an agarose gel or from the PCR reaction using a QIAquick® Gel Extraction Kit or QIAquick® PCR purification Kit. Similar kits that remove excess nucleotides can also be used. However, when using a kit, dissolve the DNA in double distilled water instead of the elution buffer suggested in the final step.
B-1 Random Primer labeling protocol for fragments shorter than 1 kb (Random Primed DNA Labeling kit from Roche
Add 25 ng template DNA into double distilled water to a final volume of 13.5 μl in a microcentrifuge tube.
Denature the DNA by heating in a boiling water bath for 10 min at 95 °C and chilling quickly in an ice bath.
Add the following to the freshly denatured probes on ice:
dGTP, 1.0 mM
1 μl
dCTP, 1.0 mM
1 μl
dATP, 1.0 mM
1 μl
Reaction Mixture (Vial 6)
2 μl
Klenow enzyme (Vial 7)
1 μl
Cy3 or Cy5-dUTP, 1.0 mM
0.5 μl
Mix and centrifuge briefly.
Incubate for 1 h to 20 h (overnight) at 37 °C.
Add 1/10 volume of 3 M NaAC and 2.5-3 volume of 100% ethanol. And mix by inverting the tubes. Keep at -80 °C or -20 °C for at least 3 h or until probes are needed for hybridization. If necessary, probes can be left in the freezer for long-term storage.
B-2 Random Primer labeling protocol for fragments shorter than 1 kb (Random Primers DNA Labeling System from Invitrogen)
Mix 1 μl DNA and 10 μl 2.5x Random Primer Solution and 2.5 μl sterile water well.
Denature 5 min in boiling water or heating block, immediately cool on ice.
Add 1.25 μl 1.0 mM dNTP mix (without a labeled dNTP), 8.75 μl water and 1 μl Klenow Fragment, mix gently but thoroughly.
Add 0.5 μl Cy3 or Cy5-dUTP fluorescent nucleotide to each tube, when finished, tube must be covered immediately to protect from light. Mix well and incubate at 37 °C for 1.5 h.
Do the same as step 5 in Section II-1 "Random Primer labeling protocol for fragments shorter than 1 kb (Random Primed DNA Labeling kit from Roche)".
B-3 Nick Translation labeling for fragment longer than 1 kb (1-150 kb)
Prepare the following reaction mixture on ice:
10x buffer for DNA Polymerase I
5 μl
1.0 mM dATP, dCTP, dGTP and 0.3 mM dTTP mixture
5 μl
DNase I freshly diluted to 0.02 units/μl
4 μl**
DNA Polymerase I
1 μl**
Template DNA
1 μg
Cy3- or Cy5-dUTP
1 μl
BSA diluted to 0.5 mg/ml
5 μl
Add water to final volume 50 μl
Note: This protocol can be scaled down by 1/2 to accommodate 500 ng of template DNA.
**Final concentrations of DNase I and DNA Polymerase I have to be optimized based on factors including initial size of template DNA, template DNA concentration and reaction time. Larger template size and greater template concentration generally require more DNase.
Incubate the mix at 15 °C for 2-3 h.
Run 3 μl of reaction mixture on an agarose gel to determine the size of digested fragments. Fragments should be 100-600 bp for best hybridization results. If fragments are still larger than this, incubate at 15 °C for additional time.
To terminate the reaction and precipitate labeled probes, do the same as step 5 in Section B-2 "Random Primer labeling protocol for fragments shorter than 1 kb (Random Primed DNA Labeling kit from Roche)"
Note: Fluorescently labeled probes should be protected from light! In the steps following, even where it is not explicitly stated, make efforts to protect probes from light.
Chromosomal fixation
Do step C-2 and C-3 if slides are more than two months old. Otherwise, go to step C-4.
Fix slides in 1:3 glacial acetic acid: methanol at RT for 10 min and air-dry.
Dehydrate slides in 100% ethanol for 10 min and air dry again.
Immerse slides in 1x PBS for 20 min at RT.
Fix slides at room temperature in 4% paraformaldehyde for 1 min.
Note: Paraformaldehyde is hazardous and should be handled carefully. Avoid breathing gas or dust during preparation: wear gloves and other PPE when handling. Paraformaldehyde solution should not be dumped down drains.
Dehydrate the slides through an ethanol series of 50%, 70%, 90%, 2x 100% for 5 min each at RT.
Air-dry the slides.
In situ hybridization
Centrifuge the tubes of labeled probes at 20,817 x g for 10 min. Carefully remove the supernatant and vacumfuge the tubes for 20 min to dry pellets.
Dissolve dry probes in hybridization buffer prewarmed to 37 °C. The amount of hybridization buffer used to dissolve depends on the total amount of DNA you are dissolving. Dissolve 1 μg of DNA in 20-40 μl of warmed hybridization buffer.
In a clean microcentrifuge tube, combine at least 250 ng each of one blue (Cy5 labeled) and one red (Cy3 labeled) probes. In situ hybridization is efficient if at least 500 ng of DNA is hybridized on the slide. Vortex and centrifuge the tube of combined probe briefly.
Transfer the above prepared solution of combined probes to a chromosome preparation slide and cover with a 22 x 22 mm coverslip. Remove any large air bubbles with gentle pressure.
Denature the target and probe DNA by placing the slides on the Thermobrite machine at 90 °C for 10 min. Thermobrite machine does not need to be humid.
Seal edges of cover slip with rubber cement.
Transfer the slides to pre-warmed humid chambers with 4x SSC at the bottom of the chambers and incubate at 39 °C for interspecies (e.g An. gambiae probe to An. stephensi chromosomes) or 42 °C for intraspecies hybridization for 3-18 h (usually overnight).
Note: Because there are fluorescently labeled probes on the slide, humid chambers should be impermeable to light.
Washing
Carefully remove rubber cement with forceps and coverslip.
In a slide jar covered with aluminum foil, wash the slides with 1x SSC at 39 °C after interspecies or 0.2x SSC at 42 °C after intraspecies hybridization for 20 min in 50 ml without shaking.
Wash the slides with 1x SSC after interspecies or 0.2x SSC after intraspecies hybridization at RT for 20 min in 50 ml without shaking.
Dilute fluorescent dye YOYO-1 100 times in 1x PBS to make a stock solution. Mix 10 μl of 100x diluted YOYO-1 with 90 μl 1x PBS for each slide that you want to stain. The working solution of YOYO-1 is 1,000x diluted relative to original concentration.
After washing in SSC for 20 min at room temperature, rinse slide in 1x PBS, and add 100 μl of YOYO-1 in PBS on each slide. Cover with parafilm. Leave at RT for 10 min inside of a slide box or somewhere dark.
Rinse in 1x PBS and add 10 μl Prolong Gold antifade reagent, place coverslip on slide and blot out bubble. Keep in the slide box at 4 °C.
Signal detection
Detect the signals using a confocal or fluorescence microscope and map them to the polytene chromosomes of Anopheles mosquitoes (Figure 3).
Figure 3. Fluorescence in situ hybridization and mapping of DNA probes on polytene chromosomes from ovarian nurse cells of An. stephensi
Recipes
Carnoy's solution: Methanol:Glacial Acetic Acid = 3:1
Note: Carnoy's solution should be used with good ventilation or in a fume hood. Gloves should also be worn while using Carnoy's solution and it should not be disposed of down the drain.
1x PBS (1 L)
NaCl
8.01 g
KCl
0.20 g
NaH2PO4 (anhydrous)
1.15 g
KHP2O4 (anhydrous)
0.20 g
20x SSC (500 ml)
Sodium chloride
87.5 g
Sodium citrate
44 g
Add 1 N HCl to pH 7.0
Hybridization buffer (2 ml)
20x SSC
120 μl
Dextran sulfate
0.2 g
Formamide
1.2 ml
Water
580 μl
3 M NaAC
Dissolve 24.61 g of Sodium Acetate (anhydrous) in 100 ml water.
Acknowledgments
The protocol was adapted from previously published papers: Sharakhova et al. (2010) and Kamali et al. (2012). We thank the Chinese Centre for Disease Control and Prevention, Shanghai, China for providing an Anopheles sinensis colony. This work was supported by a National Natural Science Foundation of China (31301877) to AX and by a National Institutes of Health (Bethesda, MD, U.S.A.) grant (5R21AI094289) to IVS. AP and IVS were supported in part by the Institute for Critical Technology and Applied Science (ICTAS) and the NSF award 0850198.
References
Kamali, M., Sharakhova, M. V., Baricheva, E., Karagodin, D., Tu, Z. and Sharakhov, I. V. (2011). An integrated chromosome map of microsatellite markers and inversion breakpoints for an Asian malaria mosquito, Anopheles stephensi. J Hered 102(6): 719-726.
Kamali, M., Xia, A., Tu, Z. and Sharakhov, I. V. (2012). A new chromosomal phylogeny supports the repeated origin of vectorial capacity in malaria mosquitoes of the Anopheles gambiae complex. PLoS Pathog 8(10): e1002960.
Peery, A., M. V. Sharakhova, Antonio-Nkondjio, C., Ndo, C., Weill, M., Simard, F., and I. V. Sharakhov. 2011. Improving the population genetics toolbox for the study of the African malaria vector Anopheles nili: microsatellite mapping to chromosomes. Parasites and Vectors 4:202.
Sharakhova, M. V., Xia, A., Tu, Z., Shouche, Y. S., Unger, M. F. and Sharakhov, I. V. (2010). A physical map for an Asian malaria mosquito, Anopheles stephensi. Am J Trop Med Hyg 83(5): 1023-1027.
Sharakhova, M. V., George, P., Brusentsova, I. V., Leman, S. C., Bailey, J. A., Smith, C. D. and Sharakhov, I. V. (2010). Genome mapping and characterization of the Anopheles gambiae heterochromatin. BMC Genomics 11: 459.
Sharakhova, M. V., Antonio-Nkondjio, C., Xia, A., Ndo, C., Awono-Ambene, P., Simard, F. and Sharakhov, I. V. (2011). Cytogenetic map for Anopheles nili: application for population genetics and comparative physical mapping. Infect Genet Evol 11(4): 746-754..
Xia, A., Sharakhova, M. V., Leman, S. C., Tu, Z., Bailey, J. A., Smith, C. D. and Sharakhov, I. V. (2010). Genome landscape and evolutionary plasticity of chromosomes in malaria mosquitoes. PLoS One 5(5): e10592
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Xia, A., Peery, A., Kamali, M., Liang, J., Sharakhova, M. V. and Sharakhov, I. V. (2013). Fluorescence in situ Hybridization to the Polytene Chromosomes of Anopheles Mosquitoes. Bio-protocol 3(16): e860. DOI: 10.21769/BioProtoc.860.
Kamali, M., Xia, A., Tu, Z. and Sharakhov, I. V. (2012). A new chromosomal phylogeny supports the repeated origin of vectorial capacity in malaria mosquitoes of the Anopheles gambiae complex. PLoS Pathog 8(10): e1002960.
Download Citation in RIS Format
Category
Cell Biology > Cell structure > Chromosome
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Preparation of Drosophila Polytene Chromosomes, Followed by Immunofluorescence Analysis of Chromatin Structure by Multi-fluorescence Correlations
Terra M. Kuhn [...] Maya Capelson
Jul 5, 2020 7735 Views
Labeling and Tracking Mitochondria with Photoactivation in Drosophila Embryos
Sayali Chowdhary and Richa Rikhy
Mar 5, 2022 2563 Views
Evaluation of Mitochondrial Turnover Using Fluorescence Microscopy in Drosophila
Felipe Martelli
Sep 5, 2022 1399 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
861 | https://bio-protocol.org/en/bpdetail?id=861&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Drug Sensitivity Assay of Xanthomonas citri subsp. citri Using REMA Plate Method
Isabel C. Silva
HF Henrique Ferreira
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.861 Views: 10076
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Bacteriology Jan 2013
Abstract
Resazurin Microtiter Assay (REMA) is a simple, rapid, reliable, sensitive, safe and cost-effective measurement of cell viability. Resazurin detects cell viability by converting from a nonfluorescent dye to the highly red fluorescent dye resorufin in response to chemical reduction of growth medium resulting from cell growth (Palomino et al., 2002). The REMA assay can be used as a fluorogenic oxidation-reduction indicator in a variety of cells, including bacteria, yeast and eukaryotes (Silva et al., 2013).
Keywords: Citrus canker Plant pathogen Antibacterial
Materials and Reagents
Chemicals: Synthetic esters of gallic acids (Ximenes et al., 2010)
Bacterial strain: Wild type Xanthomonas citri subsp citri strain 306 (Schaad et al., 2005)
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
Kanamycin (Sigma-Aldrich, catalog number: K4000 )
Luria-Bertani broth (LB) culture medium
Resazurin sodium salt (Sigma-Aldrich, catalog number: R7017 )
Equipment
96-well plate, polystyrene, with clear flat bottom wells (Greiner Bio-one, catalog number: 655101 )
SPECTRAfluor Plus (Tecan) microfluorimeter
Multichannel pipetman (Eppendorf)
Procedure
Prepare stock solutions of chemicals (dried-powder samples) dissolving in 10% in DMSO (diluted in sterile water).
Add 100 μl of water to columns 1 and 12 to avoid evaporation (Table 1).
Dilute the stock solutions in LB medium directly in a 96-well plates using a 2-fold scheme (final volume of 100 μl per a well); after serial dilution, the most concentrated sample should have maximum 1% DMSO.
Cells were grown in LB medium at 30 °C under rotation (200 rpm) until OD600 0.6 ( log phase).
Add 10 μl of bacterial inoculum (standardized to 105 CFU/well).
Negative control: 1% DMSO dissolved in LB.
Positive control: Kanamycin at 15.6 μg/ml.
Table 1. Example for setup of REMA 96-well assay plate
Incubate the test plates at 30 °C for 6 h.
Add 15 μl of a 0.01% (w/v) resazurin solution, and incubate at 30 °C for 2 h.
Measure fluorescence at 530 nm (excitation) and 590 nm (emission) using a fluorescence scanning.
Percentage of inhibition is defined as:
[(average FU negative control) - (average FU test)]/(average FU negative control) x 100
FU: Fluorescence Units
Figure 1. Example for calculation of growth inhibition
Note: Three independent experiments should be conducted, and the data is used to construct plots of chemical concentration versus cell growth inhibition in order to determine the MIC* (Figure 1).
*The minimum inhibitory concentration (MIC) is defined as the lowest concentration of the antibiotic able to inhibit the growth of 90% of organisms.
Acknowledgments
This work was supported by FAPESP research grants 2004/09173-6, 2010/05099-7, and 2011/07458-7. This protocol was adapted from a previous work by Palomino et al. (2002).
References
Palomino, J. C., Martin, A., Camacho, M., Guerra, H., Swings, J. and Portaels, F. (2002). Resazurin microtiter assay plate: simple and inexpensive method for detection of drug resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother 46(8): 2720-2722.
Schaad, N. W., Postnikova, E., Lacy, G. H., Sechler, A., Agarkova, I., Stromberg, P. E., Stromberg, V. K. and Vidaver, A. K. (2005). Reclassification of Xanthomonas campestris pv. citri (ex Hasse 1915) Dye 1978 forms A, B/C/D, and E as X. smithii subsp. citri (ex Hasse) sp. nov. nom. rev. comb. nov., X. fuscans subsp. aurantifolii (ex Gabriel 1989) sp. nov. nom. rev. comb. nov., and X. alfalfae subsp. citrumelo (ex Riker and Jones) Gabriel et al., 1989 sp. nov. nom. rev. comb. nov.; X. campestris pv malvacearum (ex smith 1901) Dye 1978 as X. smithii subsp. smithii nov. comb. nov. nom. nov.; X. campestris pv. alfalfae (ex Riker and Jones, 1935) dye 1978 as X. alfalfae subsp. alfalfae (ex Riker et al., 1935) sp. nov. nom. rev.; and "var. fuscans" of X. campestris pv. phaseoli (ex Smith, 1987) Dye 1978 as X. fuscans subsp. fuscans sp. nov. Syst Appl Microbiol 28(6): 494-518.
Silva, I. C., Regasini, L. O., Petronio, M. S., Silva, D. H., Bolzani, V. S., Belasque, J., Jr., Sacramento, L. V. and Ferreira, H. (2013). Antibacterial activity of alkyl gallates against Xanthomonas citri subsp. citri. J Bacteriol 195(1): 85-94.
Ximenes, V. F., Lopes, M. G., Petronio, M. S., Regasini, L. O., Silva, D. H. and da Fonseca, L. M. (2010). Inhibitory effect of gallic acid and its esters on 2,2'-azobis(2-amidinopropane)hydrochloride (AAPH)-induced hemolysis and depletion of intracellular glutathione in erythrocytes. J Agric Food Chem 58(9): 5355-5362.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Silva, I. C. and Ferreira, H. (2013). Drug Sensitivity Assay of Xanthomonas citri subsp. citri Using REMA Plate Method. Bio-protocol 3(16): e861. DOI: 10.21769/BioProtoc.861.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell viability
Cell Biology > Cell viability > Cell death
Cell Biology > Cell staining > Whole cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Determination of Survival of Wildtype and Mutant Escherichia coli in Soil
Yinka Somorin and Conor O'Byrne
Jul 20, 2017 7789 Views
Plaque Assay to Determine Invasion and Intercellular Dissemination of Shigella flexneri in TC7 Human Intestinal Epithelial Cells
Atin Sharma and Andrea Puhar
Jul 5, 2019 4778 Views
Shipment of Cyanobacteria by Agarose Gel Embedding (SCAGE)—A Novel Method for Simple and Robust Delivery of Cyanobacteria
Phillipp Fink [...] Karl Forchhammer
Dec 5, 2024 219 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
862 | https://bio-protocol.org/en/bpdetail?id=862&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Metabolic Labeling of Yeast Sphingolipids with Radioactive D-erythro-[4,5-3H]dihydrosphingosine
TK Takefumi Karashima
KK Kentaro Kajiwara
KF Kouichi Funato
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.862 Views: 9444
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Molecular Microbiology Dec 2012
Abstract
Yeast sphingolipids can be metabolically labeled with exogenously added radioactive precursors. Here we describe a method to label ceramides and complex sphingolipids of Saccharomyces cerevisiae with a radioactive ceramide precursor, D-erythro-[4, 5-3H]dihydrosphingosine. This protocol is used to study the biosynthesis, transport and metabolism of sphingolipids in yeast.
Keywords: Sphingolipids Yeast Metabolism Radioactive precusor Dihydrosphingosine
Materials and Reagents
Yeast strain (Saccharomyces cerevisiae)
D-erythro-[4,5-3H]-dihydrosphingosine ([3H]DHS) (60 Ci/mmol) (American Radiolabeled Chemicals, catalog number: ART-46 )
Sodium fluoride (NaF) (Sigma-Aldrich, catalog number: S1504 )
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: S2002 )
Glass beads (0.5 mm) (Yasui Kikai, catalog number: YGB05 )
Chloroform (Sigma-Aldrich, catalog number: 05-3400 )
Methanol (Sigma-Aldrich, catalog number: 19-2410 )
1-Butanol (Sigma-Aldrich, catalog number: 03-4560 )
Ammonium hydroxide (Sigma-Aldrich, catalog number: 221228 )
Acetic acid (Sigma-Aldrich, catalog number: 01-0280 )
Thin layer chromatography silica gel 60 (TLC plate) (aluminium sheet 20 x 20 cm ) (Merck KGaA, catalog number: 105553 )
N2 gas
Distilled water (H2O)
Dextrose (D-glucose) (Sigma-Aldrich, catalog number: 07-0680 )
Yeast extract (Oriental Yeast, catalog number: OYC42008000 )
Polypeptone (Wako Chemicals USA, catalog number: 513-76611 )
Yeast nitrogen base without amino acids and ammonium sulfate (BD DifcoTM, catalog number: 233520 )
Adenine (Sigma-Aldrich, catalog number: A9126 )
Leucine (Nacalai Tesque, catalog number: 20327-62 )
Histidine (Nacalai Tesque, catalog number: 18116-92 )
Lysine (Sigma-Aldrich, catalog number: L5626 )
Uracil (Nacalai Tesque, catalog number: 35824-82 )
Ammonium sulfate (Sigma-Aldrich, catalog number: A2939 )
Tryptophan (Nacalai tesque, catalog number: 35607-32 )
Yeast extract-peptone dextrose (YPD) liquid medium (see Recipes)
Synthetic minimal dextrose (SD) liquid medium (see Recipes)
Water-saturated 1-butanol (see Recipes)
Equipment
Tritium-sensitive imaging plate (Fujifilm, catalog number: BAS-TR2040 )
Microcentrifuge tube
Shaking incubator (TAITEC, model: BR-43FL.MR )
Swinging bucket centrifuge (TOMY, model: LC-201 )
Microcentrifuge (TOMY, model: MX-301 )
Water bath shaker (TAITEC, model: PERSONAL-11 )
Bath-type ultrasonic cleaner (AS ONE, model: US-2R )
Pressure gas blowing concentrator (EYELA, model: MGS-2200 )
TLC developing tank
Hair dryer
FLA-7000 imaging system (GE Healthcare Life Sciences, model: Typhoon FLA 7000 )
Software
FLA-7000 image software (ImageQuant TL analysis)
Procedure
Cell culture and metabolic labeling
Inoculate yeast cells in YPD liquid medium at 25 °C with gyratory shaking at 175-200 rpm overnight.
Dilute the culture with SD liquid medium to an OD600 of 0.01-0.02 and culture with gyratory shaking at 175-200 rpm overnight.
When the OD600 of the culture is 0.2-0.6, transfer the culture to a 50 ml conical tube.
Spin down yeast cells by a swinging bucket centrifuge at 2,000 x g for 5 min at room temperature (RT) and remove supernatant.
Resuspend the pellet in 20 ml SD liquid medium, spin down at 2,000 x g for 5 min at RT and remove supernatant. Repeat this step at least three times.
Resuspend cells in SD liquid medium to get an OD600 of 20 and transfer 0.5 ml of cell suspension to a new 50 ml conical tube.
Incubate at 25 °C for 20 min with reciprocal shaking.
Add 4 μCi of [3H] DHS to the cell culture and incubate at 25 °C for 1-4 h with reciprocal shaking. If necessary, lipid synthesis inhibitors are added before the labeling.
Lipid extraction and alkaline hydrolysis
To stop metabolic labeling, chill the 50 ml conical tube on ice and add 250 mM NaF and 250 mM NaN3 to a final concentration of 10 mM.
Transfer the labeled culture to a 1.5 ml microcentrifuge tube (tube #1).
Collect yeast cells by a microcentrifuge at 20,000 x g for 5 min at 4 °C, remove supernatant and resuspend yeast cells in 1 ml cold water. Repeat this step at least three times.
Adjust volume of cell suspension to 66 μl with cold water and vortex well.
Add 0.3 g of glass beads and vortex well at low temperature (vortex for 30 sec and chill on ice for 1-2 min, repeat at least three times).
Add 440 μl of chloroform-methanol (CM; 1/1, v/v), vortex well and centrifuge at 20,000 x g for 5 min at RT.
Transfer the supernatant to a new 1.5 ml microcentrifuge tube (tube #2).
In order to extract the radiolabeled lipids remaining in tube #1, add 200 μl of chloroform-methanol-water (CMW; 10/10/3, v/v/v) in tube #1, sonicate for approximately 5-10 min in bath-type ultrasonic cleaner until the pellet is completely suspended, centrifuge at 20,000 x g for 5 min at RT and transfer the supernatant to tube #2.
Dry the combined supernatants in tube #2 completely with N2 gas using pressure gas blowing concentrator.
Add 80 μl of CMW, vortex well and centrifuge at 20,000 x g for 1 min at RT.
To deacylate glycerophospholipids by mild alkaline hydrolysis, add 16 μl of 0.6 N NaOH in methanol, vortex well and incubate at 30 °C for 3 h.
Centrifuge at 20,000 x g for 1 min at RT.
To neutralize, add 16 μl of 0.6 N acetic acid in methanol, vortex well and centrifuge at 20,000 x g for 1 min at RT.
Dry the reaction mixture completely with N2 gas using pressure gas blowing concentrator.
To desalt, add 100 μl of water to tube #2, vortex well and spin down at 20,000 x g for 1 min at RT.
Further add 200 μl of water-saturated 1-butanol, vortex well, centrifuge 20,000 x g for 5 min at RT and transfer the butanol (upper) phase containing sphingolipids to a new 1.5 ml microcentrifuge tube (tube #3).
In order to collect the radiolabeled sphingolipids remaining in tube #2, add 200 μl of water-saturated 1-butanol to tube #2, vortex well, centrifuge 20,000 x g for 5 min at RT and transfer the butanol phase to tube #3. Repeat this step one more time.
Add 100 μl of water to the combined butanol phase in tube #3, vortex well, centrifuge 20,000 x g for 5 min at room temperature and transfer the butanol phase to a new 1.5 ml microcentrifuge tube (tube #4).
Dry the butanol phase in tube #4 completely with N2 gas using pressure gas blowing concentrator.
Lipid separation and analysis
Add 25 μl of CMW to tube #4, vortex well and centrifuge at 20,000 x g for 1 min at RT.
Then load total sample on TLC plate.
Place the plate in a glass TLC developing tank and develop with chloroform-methanol-4.2 N ammonium hydroxide (9/7/2, v/v/v) solvent mixture.
When wetting front reaches within 1 cm of the top of TLC plate, remove the plate from the tank and dry it at RT.
When the plate is completely dried with a hair dryer, set it in exposure cassette and expose it to a tritium-sensitive imaging plate for few hours-few days.
Capture image and quantify signals with FLA-7000 image analyzer and software (Figure 1A).
Ceramide extraction and analysis
Add a few drops of water on the area containing ceramides of TLC plate, which is in 2 or 3 cm inside from the top edge of the plate.
Collect the silica of the area by scraping with a spatula and transfer to a 1.5 ml microcentrifuge tube (tube #5).
Add 400 μl of CM, sonicate for approximately 5 min in bath-type ultrasonic cleaner until the silica is completely suspended, centrifuge at 20,000 x g for 5 min at RT and transfer the supernatant to a new 1.5 ml microcentrifuge tube (tube #6).
Add 200 μl of CM to tube #5, vortex well, centrifuge at 20,000 x g for 5 min at RT and transfer the supernatant to tube #6.
Dry the combined supernatants in tube #6 completely with N2 gas using pressure gas blowing concentrator.
Add 100 μl of water to tube #6, vortex well and spin down at 20,000 x g for 1 min at RT.
Further add 200 μl of water-saturated 1-butanol, vortex well, centrifuge 20,000 x g for 5 min at RT and transfer the butanol phase containing ceramides to a new 1.5 ml microcentrifuge tube (tube #7).
In order to collect the radiolabeled ceramides remaining in tube #6, add 200 μl of water-saturated 1-butanol to tube #6, vortex well, centrifuge 20,000 x g for 5 min at RT and transfer the butanol phase to tube #7. Repeat this step one more time.
Dry the butanol phase in tube #7 completely with N2 gas usng pressure gas blowing concentrator.
Add 25 μl of CMW to tube #7, vortex well and centrifuge at 20,000 x g for 1 min at RT.
Then load total sample on TLC plate.
Place the plate in a glass TLC developing tank and develop with chloroform-methanol-acetic acid (190/9/1, v/v/v) solvent mixture.
When wetting front reaches within 1 cm of the top of TLC plate, remove the plate from the tank and dry it at RT.
When the plate is completely dried with a hair dryer, set it in exposure cassette and expose it to a tritium-sensitive imaging plate for few hours-few days.
Capture image and quantify signals with FLA-7000 image analyzer and software (Figure 1B).
Figure 1. Captured images showing the distribution of complex sphingolipids (A) and ceramides (B) on TLC plates and quantified data. Wild-type cells were labeled with [3H]DHS at 25 °C for 3 h in the absence or presence of 2 μg/ml aureobasidin A (AbA), a specific inositol phosphorylceramide (IPC) synthase inhibitor (Funato and Riezman, 2001; Kajiwara et al., 2012). The labeled lipids were extracted, subjected to mild alkaline hydrolysis and analyzed by TLC with chloroform-methanol-4.2 N ammonium hydroxide (9/7/2, v/v/v) solvent mixture (A). Fractions containing ceramides in (A) (Funato and Riezman, 2001) were collected by scraping, and the radiolabeled ceramides were extracted from the silica and analyzed by TLC with chloroform-methanol-acetic acid (190/9/1, v/v/v) solvent mixture (B). Incorporation of [3H]DHS into complex sphingolipids (IPC-A,-B,-C,-D, MIPCs and M(IP)2Cs) and into ceramides (Cer-A, -B and -C) was quantified and determined as percentage of the total radioactivity in (A). IPC-A,-B,-C,-D and Cer-A,-B,-C are different IPC subclasses and ceramide species, respectively (Haak et al., 1997). The complex sphingolipids and ceramides can be identified by using mutants defective in the biosynthesis of specific sphingolipid species (Haak et al., 1997), by chemical treatment of isolated radiolabeled lipids (Puoti et al., 1991; Funato and Riezman, 2001) or by using the lipid standards that are isolated from [3H] inositol labeled sphingolipids (Puoti et al., 1991; Haak et al., 1997). MIPC, mannosyl inositolphosphorylceramide; M(IP)2C, mannosyl di(inositolphosphoryl)ceramide.
Recipes
YPD liquid medium
20 g Dextrose
10 g Yeast extract
20 g Polypeptone
40 mg Uracil
40 mg Adenine
40 mg Tryptophan
Add H2O to 1 L
Sterilize by autoclaving.
SD liquid medium
20 g Dextrose
1.7 g Yeast nitrogen base without amino acids and ammonium sulfate
5.0 g Ammonium sulfate
80 mg Uracil
80 mg Adenine
80 mg Leucine
80 mg Histidine
80 mg Lysine
Dissolve in 800 ml H2O
Adjust pH to 5.8-6.0 with 1 M NaOH
Adjust volume to 990 ml with H2O
Sterilize by autoclaving
Add 10 ml of tryptophan solution (8 mg/ml) sterilized by filtration.
Water-saturated 1-butanol
Mix equal volumes of 1-butanol and H2O
Shake overnight at RT and leave
The resulting upper phase is water-saturated 1-butanol.
Acknowledgments
This protocol was adapted from Kajiwara et al. (2012). This work was supported by a grant from the Graduate School of Biosphere Science (Hiroshima University) to Kajiwara K. and by Grants-in-Aid for Scientific Research from the Japan Society for the Promotion of Science and from the Ministry of Education, Culture, Sports, Science, and Technology of Japan to Funato K.
References
Funato, K. and Riezman, H. (2001). Vesicular and nonvesicular transport of ceramide from ER to the Golgi apparatus in yeast. J Cell Biol 155(6): 949-959.
Haak, D., Gable, K., Beeler, T. and Dunn, T. (1997). Hydroxylation of Saccharomyces cerevisiae ceramides requires Sur2p and Scs7p. J Biol Chem 272(47): 29704-29710.
Kajiwara, K., Muneoka, T., Watanabe, Y., Karashima, T., Kitagaki, H. and Funato, K. (2012). Perturbation of sphingolipid metabolism induces endoplasmic reticulum stress-mediated mitochondrial apoptosis in budding yeast. Mol Microbiol 86(5): 1246-1261.
Puoti, A., Desponds, C. and Conzelmann, A. (1991). Biosynthesis of mannosylinositolphosphoceramide in Saccharomyces cerevisiae is dependent on genes controlling the flow of secretory vesicles from the endoplasmic reticulum to the Golgi. J Cell Biol 113(3): 515-525.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Karashima, T., Kajiwara, K. and Funato, K. (2013). Metabolic Labeling of Yeast Sphingolipids with Radioactive D-erythro-[4,5-3H]dihydrosphingosine. Bio-protocol 3(16): e862. DOI: 10.21769/BioProtoc.862.
Download Citation in RIS Format
Category
Microbiology > Microbial metabolism > Lipid
Cell Biology > Cell metabolism > Lipid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Metabolite and Fatty Acid Analysis of Yeast Cells and Culture Supernatants
Liwei Chen and Wei Ning Chen
Sep 5, 2014 16461 Views
Sterol Analysis in Kluyveromyces lactis
Yvetta Gbelska [...] Alexandra Konecna
Sep 5, 2017 6573 Views
Mass Spectrometry-based Lipidomics, Lipid Bioenergetics, and Web Tool for Lipid Profiling and Quantification in Human Cells
Liang Cui [...] Kuan Rong Chan
Aug 20, 2023 1333 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
863 | https://bio-protocol.org/en/bpdetail?id=863&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ex vivo Natural Killer Cell Cytotoxicity Assay
Lee-Hwa Tai
Christiano Tanese de Souza
Andrew P. Makrigiannis
Rebecca Ann C. Auer
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.863 Views: 19573
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Oct 2010
Abstract
Natural Killer (NK) cells are cytotoxic lymphocytes that constitute a major component of the innate immune system. Immunosurveillance of the host by NK cells for malignant and virally-infected cells results in direct cytotoxicity and the production of cytokines to enhance the immune response. This protocol will describe the “gold standard” chromium release assay for measuring the target cell killing capacity of NK cells. Key features of this cytotoxicity assay are that it is performed with sorted NK cells as the effectors and any Major Histocompatibility Class I (MHC-I)-low or deficient tumor cell line can be used as the target cells.
Keywords: Cytotoxicity Natural killer cells Tumors Preclinical studies Innate immunity
Materials and Reagents
Lympholyte-M (Cedarlane, catalog number: CL5035 )
RPMI 1640 (Hyclone, catalog number: SH300027.01 )
Chromium-51 (PerkinElmer, catalog number: NEZ030001MC )
Poly (I:C) (Sigma-Aldrich, catalog number: P1530 )
Source of mouse spenocytes: C57Bl/6 mice (Charles Rivers, strain code: 0 27 )
NK sensitive target cell lines: YAC-1, ATCC, TIB 160
1x sterile PBS (Hyclone, catalog number: 21-031-CV )
Running buffer (Miltenyi Biotech, catalog number: 130-091-221 )
Washing buffer (Miltenyi Biotech, catalog number: 130-092-987 )
AutoMACS pro columns (Miltenyi Biotech, catalog number: 130-021-101 )
AutoMACS buffer (see Recipes)
Complete RPMI (see Recipes)
NK cell media (see Recipes)
Equipment
50 ml tubes (BD Biosciences, Falcon®, catalog number: 352098 )
15 ml tubes (BD Biosciences, Falcon®, catalog number: 352096 )
96 V well plates (Corning, Costar®, catalog number: 3894 )
AutomacsPro Separator (Miltenyi biotech, model: 130-092-545 )
Gamma counter (PerkinElmer, model: 2470 )
Incubator (5% CO2, 37 °C) (Sanyo)
Centrifuge (when parameters of brakes are unspecified, maxmal acceleration and deceleration are used) (Thermo Fisher Scientific, model: ST40R )
Dissection instruments (small forceps, scissors)
Cell strainers 70 μm (Thermo Fisher Scientific, catalog number: 22363548 )
DX5 (CD49b) microbeads (Miltenyi Biotech, catalog number: 130-052-501 )
Procedure
In vivo stimulation of NK cells
NK cells need to be stimulated in vivo in order to be able to kill. Poly (I: C) (TLR3 agonist) injection is the gold standard method of activating NK cell killing ability.
3 C57Bl/6 mice (6-8 weeks of age, each weighing approximately 20 g) are usually sufficient in order to get enough NK cells. However, for any in vivo treatment (i.e. virus infection) that might result in lymphopenia or lymphocyte migration to the periophery, 4-5 mice may be needed.
Inject mice intraperitoneal (i.p.) with 150 μg Poly (I: C) (stored at -20 °C, stock is 10 mg/ml) diluted in 1x PBS (15 μl stock + 185 μl 1x PBS) 18 h before euthanizing the mice (e.g. inject at 2:00 PM if you plan on euthanizing mice at 8:00 AM the following day).
Prepare dissection instruments harvesting splencoytes.
Harvest splenocytes
1 h before starting assay, remove Lympholyte from 4 °C. Lympholyte needs to be used at room temperature and protected from light (handle under biosafety cabinet with lights off).
Prepare one 50 ml tube and two 15 ml tubes for each spleen. Place a 70 μm cell strainer on each opened 50 ml tube. Prime each strainer with 1 ml of cold 1x PBS. Add 5 ml of Lympholyte into each 15 ml tube (protect tubes from light).
Note: 1 spleen will need two 15 ml tubes, each containing 5 ml Lympholyte.
Euthanize mice by cervical dislocation, remove spleen and place on 70 μM strainer
Crush 1 spleen on a cell strainer over 50 ml tube, rinse twice with 10 ml of 1x PBS (I often rinse the underside of the filters as well if visible clumps of red spleen are observed). Filter again with 10 ml of 1x PBS using the same filter if needed. Spin tubes containing splenocytes at 500 x g, 5 min, 4 °C.
Discard supernatant and resuspend splenocyte pellet in 10 ml 1x PBS. Carefully layer 5 ml of resuspended splenocytes on top of the Lympholyte layer (5 ml of the 1st 15 ml tubes, then the remaining 5 ml on the 2nd 15 ml tube). Spin 1,500 x g, 15 min, room temperature, acceleration at 1, deceleration at 2 (minimal speed).
Carefully pipet lymphocyte layer (blurry interface layer between Lympholyte at the bottom and PBS on top) and transfer to a new 50 ml tube. Carry-over of small amounts of lympholyte and PBS layers are acceptable because of washing procedure in steps 7 and 8. You can combine mice treatments here (i.e. all the same treatments together).
Fill 50 ml tube with 1x PBS (first wash to remove excess Lympholyte). Spin down 500 x g, 5 min 4 °C.
Discard supernatant. Resuspend pellet in 10 ml AutoMACS buffer. Spin down as in step B-7. During spin, harvest target cells. Discard supernatant.
NK cell sort (with DX5 microbeads)
Resuspend splenocytes pellet in 300 μl AutoMACS buffer per spleen (we usually pool 3 spleens per tube).
Add 100 μl of DX5 microbeads per spleen (manufacturer recommends 100 μl beads volume for 1 x 108 cells or less) and mix well. Incubate for 15 min at 4 °C. During incubation, start target cell labeling with chromium.
Add 10 ml of AutoMACS buffer to stop DX5 microbead incubation. Spin as in step B-7.
Discard supernatant. Resuspend pellet in 500 μl AutoMACS buffer per spleen (e.g. 1.5 ml for 3 pool spleens).
Proceed to sort. Turn AutoMACS Pro sorter on during last spin and do a rinse before starting.
Place tubes (input in row A, negative fraction in row B, positive fraction in row C) of rack holder. The size of the tubes used for sort depends on the AutoMACS rack holder used. Usually a standard 50 ml tube for the 3 holder rack, 15 ml tube for 5 holder rack, and 5 ml flow cytometry tubes for 6 holder rack.
Note: “Input” = tube which contain cells to be sorted; “negative fraction” = eluate after sort containing DX5- non-NK cells; “positive fraction” = eluate after sort containing DX5+ NK cells.
Select program: Possel with a quick rinse (qrinse) between each tube and rinse after the last tube. Start the sort. It will take approximately 5-7 min per sort with a 2 min qrinse in between.
After the sort, count the number of cells in the positive fraction tube (2 ml total volume) and determine the cell concentration. Spin down as in step B-7. During spin, prepare 96 V-well plate (add 100 μl NK cell medium to all wells that need it: 3 minimum release wells, and all wells containing 25, 12 and 6 E: T ratios).
Resuspend sorted NK cells at concentration of 1.5 x 106 cells/ml in NK cell medium.
Plate NK effector cells in 100 μl for the top two ratios (50:1 and 25:1), then dilute 2 fold downwards to 12:1 and 6:1 E: T ratios). Scheme: each 50:1 E: T wells contain 1.5 x 105 NK cells; each 25:1 E: T wells contain 7.5 x 104 NK cells; each 12:1 E: T wells contain 3.75 x 104 NK cells; each 6:1 E: T wells contain 1.875 x 104 NK cells .
Note: All treatments and controls are plated in triplicate wells in 100 μl.
Overlay effector cells with target cells (as prepared in step IV) from a solution of 30,000 cells/ml (3,000 cells/well) in 100 μl.
Add 100 μl of 10x SDS to maximal release wells.
Incubate 4 h in 37 °C, 5% CO2. Spin plate at 500 x g and 4 °C, transfer 100 μl of supernatant to test tubes for CPM counting. Proceed to gamma counter previously calibrated for 51Cr.
% Release measurement.
(experimental release-average of minimal release)/(average of minimal release-average of maximal release) x 100
Calculate % for each well.
Target cell labeling
Harvest YAC-1 target cells during last spin before the addition of the DX5 microbeads.
Note: YAC-1 target cells are grown in cRPMI and are non-adherent. They should be passaged for 1.5 weeks prior to use in killing assay.
Start the 51Cr labeling during the 15 min incubation of the splenocytes with the DX5 microbeads.
The 1 h incubation should be done while you are plating your NK effector cells.
Wash three times (twice in cRPMI, final wash in NK cell media), count and resuspend cells at a 30,000 cells/ml concentration.
Recipes
AutoMACS buffer in 500 ml
PBS
2.5 g Bovine Serum Albumin
2 ml of 5 mM EDTA
Complete RPMI in 500 ml
500 ml of RPMI-1640
50 ml Heat-inactivated Fetal Bovine Serum
5 ml of Pencillin-Streptomycin 10,000 U each/ml
NK cell media
500 ml of cRPMI
5 ml 1 M HEPES
5 ml 100 mM Sodium Pyruvate
5 ml 100x Non-Essential Amino Acids
0.5 ml of 2-mercaptoethanol for final concentration of 5 x 10-5 M
Acknowledgments
This protocol was adapted from the following paper: Patel et al. (2010). This study was supported by Canadian Cancer Society Research Institute, Ontario Regional Biotherapeutics (ORBiT) program, Private Donor (D.H.) Ottawa Hospital Foundation, (R.A. Auer) and Fonds de Recherche Sante Quebec (L.-H. Tai and S. Belanger).
References
Patel, R., Belanger, S., Tai, L. H., Troke, A. D. and Makrigiannis, A. P. (2010). Effect of Ly49 haplotype variance on NK cell function and education. J Immunol 185(8): 4783-4792.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Tai, L., Souza, C. T. D., Makrigiannis, A. P. and Auer, R. A. C. (2013). Ex vivo Natural Killer Cell Cytotoxicity Assay. Bio-protocol 3(16): e863. DOI: 10.21769/BioProtoc.863.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Cytotoxicity
Cell Biology > Cell viability > Cell death
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
T-Cell-Based Platform for Functional Screening of T-Cell Receptors Identified in Single-Cell RNA Sequencing Data Sets of Tumor-Infiltrating T-Cells
Aaron Rodriguez Ehrenfried [...] Rienk Offringa
Apr 20, 2024 3775 Views
Quantification of Autophagosomes in Human Fibroblasts Using Cyto-ID® Staining and Cytation Imaging
Barbara Hochecker [...] Jörg Bergemann
Jul 5, 2024 517 Views
Microfluidic Cultures of Basal Forebrain Cholinergic Neurons for Assessing Retrograde Cell Death by Live Imaging
Srestha Dasgupta [...] Wilma J. Friedman
Jan 5, 2025 243 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
864 | https://bio-protocol.org/en/bpdetail?id=864&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Natural Killer Cell Transfer Assay
Lee-Hwa Tai
Christiano Tanese de Souza
Andrew P. Makrigiannis
Rebecca Ann C. Auer
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.864 Views: 12035
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Jan 2013
Abstract
Natural Killer (NK) cells are cytotoxic lymphocytes that constitute a major component of the innate immune system. Immunosurveillance of the host by NK cells for malignant and virally-infected cells results in direct cytotoxicity and the production of cytokines to enhance the immune response. This protocol will describe the adoptive transfer of purified NK cells into NK cell-deficient tumor bearing mice in order to establish the intrinsic functionality of NK cells.
Keywords: Innate immunology Natural killer cells Adoptive transfer assays Cell intrinsic
Materials and Reagents
Lympholyte-M (Cedarlane, catalog number: CL5035 )
Source of mouse NK cells: C57Bl/6 mice (Charles Rivers, strain code: 027 )
NK-deficient mice (Jackson Labs, strain name: B6.129S4-Il2rgtm1Wjl/J, strain number: 003174 )
Gluteraldehyde
Potassium ferrocyanide
Potassium ferricyanide
Bovine serum albumin (BSA)
100x non-essential amino acids
Fetal bovine serum (FBS)
Sodium pyruvate
Deoxycholate
B16F10lacZ melanoma tumor cells, grown in complete DMEM (Dr. K. Graham, London Regional Health Centre, London ON)
1x sterile PBS (Hyclone, catalog number: 21-031-CV )
X gal (Bioshop Canada Inc., catalog number: XGA001-1 )
Running buffer (Miltenyi Biotech, catalog number: 130-091-221 )
Washing buffer (Miltenyi Biotech, catalog number: 130-092-987 )
AutoMACS pro columns (Miltenyi Biotech, catalog number: 130-021-101 )
RPMI 1640 (Hyclone, catalog number: SH300027.01 )
AutoMACS buffer (see Recipes)
Complete RPMI (see Recipes)
NK cell media (see Recipes)
LacZ staining solutions (see Recipes)
Equipment
50 ml tubes (BD Biosciences, Falcon®, catalog number: 352098 )
15 ml tubes (BD Biosciences, Falcon®, catalog number: 352096 )
Insulin syringe 27G1/2” (Terumo Medical Corporation, catalog number: SS05M2713 )
AutomacsPro Separator (Miltenyi biotech, model: 130-092-545 )
Incubator (5% CO2, 37 °C) (Sanyo)
Centrifuge (when parameters of brakes are unspecified, maximal acceleration and deceleration are used), (Thermo Fisher Scientific, model: ST40R )
Dissection instruments (small forceps, scissors)
Light microscope (Leica)
Cell strainers 70 µm (Thermo Fisher Scientific, catalog number: 22363548 )
DX5 (CD49b) microbeads (Miltenyi Biotech, catalog number: 130-052-501 )
Procedure
Treatment of donor mice – mouse model of surgical stress
Donor mice (6-8 weeks of age, each weighing approximately 20 g) were treated with abdominal left nephrectomy (surgical stress) 18 h prior to harvesting spleen NK cells for transfer into recipient mice.
3 C57Bl/6 mice are usually sufficient in order to get 2.0 x 106 NK cells. However, for any in vivo treatment (i.e. in vivo virus infection) that might result in lymphopenia or lymphocyte migration to the periophery, more mice may be needed.
Prepare dissection instruments for harvesting splenocytes.
Harvest donor splenocytes
1 h before starting the harvest, remove Lympholyte from 4 °C. Lympholyte needs to be used at room temperature and protected for light (handle under biosafety cabinet with lights off).
Prepare one 50 ml tube and two 15 ml tubes for each spleen. Place a 70 μM cell strainer on each opened 50 ml tube. Prime each strainer with 1 ml of cold 1x PBS. Add 5 ml of Lympholyte into each 15 ml tube (protect tubes from light).
Note: 1 spleen will need two 15 ml tubes, each containing 5 ml Lympholyte.
Euthanize mice by cervical dislocation, remove spleen and place on 70 μM strainer
Crush 1 spleen on a 70 μM cell strainer over a 50 ml tube, rinse twice with 10 ml of 1x PBS (I often rinse the underside of the filters as well if visible clumps of spleen are observed). Filter again with 10 ml of 1x PBS using the same filter if needed. Spin at 500 x g, 5 min, 4 °C.
Discard supernatant and resuspend splenocyte pellet in 10 ml 1x PBS. Carefully layer 5 ml of resuspended splenocytes on top of the Lympholyte layer (5 ml of the 1st 15 ml tubes, then the remaining 5 ml on the 2nd 15 ml tube). Spin 1,500 x g, 15 min, room temperature, acceleration at 1, deceleration at 2 (minimal speed).
Carefully pipet lymphocyte layer (blurry interface layer between Lympholyte at the bottom and PBS on top) and transfer to a new 50 ml tube. You can combine mice treatments here (e.g. all the same treatments together).
Fill 50 ml tube with 1x PBS (first wash to remove excess Lympholyte). Spin down 500 x g, 5 min, 4 °C.
Discard supernatant. Resuspend pellet in 10 ml AutoMACS buffer. Spin down as in step B-7. Discard supernant.
NK cell sort (with DX5 microbeads)
Resuspend splenocytes pellet in 300 μl AutoMACS buffer per spleen (we usually pool 3 spleens per tube).
Add 100 μl of DX5 microbeads per spleen (manufacturer recommends 100 μl beads volume for 1 x 108 or less cells) and mix well. Incubate for 15 min at 4 °C.
Add 10 ml of AutoMACS buffer to stop DX5 incubation. Spin as in step B-7.
Discard supernatant. Resuspend pellet in 500 μl AutoMACS buffer per spleen (e.g. 1.5 ml for 3 pool spleens).
Proceed to sort. Turn AutoMACS Pro sorter on during last spin and do a rinse before starting.
Place tubes (input in A, negative fraction in B, positive fraction in C) in rack holder. The size of the tubes used for sort depends on the AutoMACS rack holder used. Usually a standard 50 ml tube for the 3 holder rack, 15 ml tube for 5 holder rack, and 5 ml flow cytometry tubes for 6 holder rack. “Negative fraction” denotes the eluate after the sort, which contains DX5- non-NK cells. “Positive fraction” denotes the eluate after the sort, which contains DX5+ NK cells.
Select program: Possel with a quick rinse (qrinse) between each tube and rinse after the last tube. Start the sort.
After the sort, count the number of DX5+ cells in the positive fraction tube (2 ml total volume) and determine the cell concentration. Spin down. NK cell purity as determined by flow cytometry (DX5+, TCRb-) is usually > 90%.
NK cell transfer and tumor injection
Resuspend 1.0 x 106 DX5+ NK cells in sterile 1x PBS cells and inject via tail vein injection (100 μl total volume) into NK-deficient mice.
1 h post NK cell injection, 3 x 105 B16lacZ tumor cells resuspended in 100 μl serum free DMEM (greater than 90% viability as determined by trypan blue), inject via tail vein injection (100 μl total volume) into the same NK-deficient mice.
Note: For mouse model of surgical stress experiments, recipient NK-deficient mice received NK cells from surgically stressed and untreated control donor mice.
Allow mice to survive for 3 days post tumor cell injection.
B16lacZ lung tumor quantification
3 days post NK and tumor cell injection, euthanize recipient mice and extract all 5 lobes of the lungs.
To extract lungs, expose the thorax by cutting through the skin and subcutaneous layer along the ventral midline of the chest cavity of the mouse. Next, make lateral incisions through skin and tissue on each side up to the neck of the mouse. Then, gently grasp lungs with surgical forceps and gently dissected by snipping away the connective tissue above and below the lungs.
Rinse lungs in Phosphate buffer (pH 7.3).
Place lungs into scintillating vial containing 5 ml ice-cold Phosphate buffer (pH 7.3). Keep on ice until next step.
Pour out Phosphate buffer, being careful not to lose lungs. Fix lungs for 20 min by adding in fixative solution (8 ml/vial).
Wash twice for 10 min in wash buffer solution (8 ml/vial).
Stain with X gal overnight at 37 °C (12-18 h–2 ml/vial).
Wash once with wash buffer (5 ml/vial for 10 min), then add fresh wash buffer (10 ml/vial) and store at 4 °C overnight. Staining will intensify.
Aspirate wash buffer and add 15 ml/vial of 10% buffered Formalin for preservation.
Quantify lung metastases with light microscope.
See Figure 1: Representative lung picture depicting B16lacZ lung metastases at day 3 post tumor cell intravenous injection is shown.
Figure 1. Representative lung pictures showing B16lacZ lung tumor metastases at day 3 post-tumor cell intravenous injection
Recipes
Automacs buffer in 500 ml
PBS
2.5 g Bovine Serum Albumin
2 ml of 5 mM EDTA
Complete RPMI in 500 ml
500 ml of RPMI-1640
50 ml Heat-inactivated Fetal Bovine Serum
5 ml of Pencillin-Streptomycin 10,000 U each/ml
NK cell media
500 ml of cRPMI
5 ml 1 M HEPES
5 ml 100 mM Sodium Pyruvate
5 ml 100x Non-Essential Amino Acids
0.5 ml of 2-mercaptoethanol for final concentration of 5 x 10-5 M
LacZ staining working solutions
0.1 M Phosphate buffer in 5 L at pH 7.3
15.87 g Sodium Phosphate Monobasic (MW 137.99)
54.67 g Sodium Phosphate Dibasic (MW 141.96)
Dissolve into 5 L of dH2O
Fixative solution in 900 ml
45 ml 100 mM EGTA (pH 7.3)
1.8 ml 1 M Magnesium Chloride
846 ml 0.1 M Phosphate buffer (pH 7.3)
Prepare the stock solution without gluteraldehyde
Aliquot 1.8 ml of 25% gluteraldehyde into 223.3 ml of stock when you are ready to use
This will allow you to prepare 225 ml of fresh fixative solution.
Wash buffer in 3.6 L
7.2 ml 1 M Magnesium Chloride
36 ml 1% Deoxycholate
36 ml 2% Nonidet-P40
3,520.8 ml 0.1 M Phosphate buffer (pH 7.3)
25 mg/ml X gal stock
1 g of X gal in 40 ml of DMSO
X gal stain in 1 L
40 ml of 25 mg/ml X gal stock
2.12 g Potassium Ferrocyanide (MW 422.2)
1.64 g Potassium Ferricyanide (MW 329.2)
960 ml Wash buffer
Acknowledgments
This protocol was adapted from the following paper: Kirstein et al. (2009). This study was supported by Canadian Cancer Society Research Institute, Ontario Regional Biotherapeutics (ORBiT) program, Private Donor (D.H.) Ottawa Hospital Foundation, (R.A. Auer) and Fonds de Recherche Sante Quebec (L.-H. Tai and S. Belanger).
References
Kirstein, J. M., Graham, K. C., Mackenzie, L. T., Johnston, D. E., Martin, L. J., Tuck, A. B., MacDonald, I. C. and Chambers, A. F. (2009). Effect of anti-fibrinolytic therapy on experimental melanoma metastasis. Clin Exp Metastasis 26(2): 121-131.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Tai, L., Souza, C. T. D., Makrigiannis, A. P. and Auer, R. A. C. (2013). Natural Killer Cell Transfer Assay. Bio-protocol 3(16): e864. DOI: 10.21769/BioProtoc.864.
Download Citation in RIS Format
Category
Cancer Biology > Tumor immunology > Animal models > Cell transfer therapy
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Adoptive Transfer of Myeloid-Derived Suppressor Cells and T Cells in a Prostate Cancer Model
Libo Yan and Yan Xu
Aug 20, 2015 8789 Views
Functional Phenotyping of Lung Mouse CD4+ T Cells Using Multiparametric Flow Cytometry Analysis
Céline M. Maquet [...] Bénédicte D. Machiels
Sep 20, 2023 1343 Views
T-Cell-Based Platform for Functional Screening of T-Cell Receptors Identified in Single-Cell RNA Sequencing Data Sets of Tumor-Infiltrating T-Cells
Aaron Rodriguez Ehrenfried [...] Rienk Offringa
Apr 20, 2024 3775 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
865 | https://bio-protocol.org/en/bpdetail?id=865&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Maize Embryo Transient Transformation by Particle Bombardment
MJ Matilde Jose-Estanyol
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.865 Views: 9013
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Molecular Biology Oct 2012
Abstract
Particle bombardment has been shown to be a useful method to study gene promoter regulatory elements by transient transformation of maize embryos with different constructions of gene promoters fused to a gene reporter. DNA to transfer is coated to high density gold microparticles and introduced into cells when accelerated by a helium pulse. This method allows a first rapid approach, avoiding time consuming stable transformation of maize plants and also allows quantitative promoter expression analysis by a histochemical or fluorometric assay.
Keywords: Particle bombardment Maize embryos Promoter expression Quantitative analysis
Materials and Reagents
Plant Material: Maize plants from W64A pure inbred line
Ethanol absolute, gradient HPLC grade (Scharlau, S.A. UN1170)
1.0 μm Gold Microcarriers (Bio-Rad Laboratories, catalog number: 165-2263 )
Rupture Disks 900 psi (Bio-Rad Laboratories, catalog number: 165-2328 )
Macrocarriers (Bio-Rad Laboratories, catalog number: 165-2335 )
Stopping Screens (Bio-Rad Laboratories, catalog number: 165-2336 )
Murashige and Skoog medium (M&S) with vitamins (Duchefa, catalog number: M0222 )
Spermidine free base (Sigma-Aldrich, catalog number: S-2626 )
Sodium hypochlorite, solution 5-9% Cl active (Carlo Erba, catalog number: CH0223 )
Cell culture dishes 60 mm x 15 mm Style treated polystyrene (Corning Inc., catalog number: 430166 )
X-GlcA sodium trihydrate (Duchefa, catalog number: X-1406 )
X-glucuronide: 5 bromo-4-chloro-3-indolyl-β-D-glucoronic sodium salt 3H2O
N,N-dimethylformamid for spectroscopy (Merck KGaA, catalog number: 102937 )
MUG: 4 methyl-umbelliferyl-B-D-glucuronide hydrate C (Sigma-Aldrich, catalog number: M9130 )
Potassium hexacyanoferrate (III) (Merck KGaA, catalog number: 104973 )
Potassium hexacyanoferrate (II) trihydrate (Merck KGaA, catalog number: 104984 )
4-Methylumbelliferone sodium salt (4-MU) (Sigma-Aldrich, catalog number: M-1508 )
Luciferase Assay Reagent (Promega Corporation, catalog number: E1500 )
CDTA: trans-1,2-diaminocyclohexane-N,N,N′,N′-tetraacetic acid (Sigma-Aldrich, catalog number: D0922 )
Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, catalog number: 500-0006 )
Histochemical analysis detection buffer (see Recipes)
Fluorometric lysis buffer (see Recipes)
Fluorometric analysis reaction buffer (see Recipes)
Fluorimetric analysis stopping buffer (see Recipes)
MSO medium (see Recipes)
1x Luciferase lysis buffer (see Recipes)
Equipment
BIORAD PDS-1000/He system (Biolistic Delivery Systems)
Laminar Flow Cabinet Telstar AH-100
Vacuum pump Telstar 50/60 Hz
Cylinder compressed helium gas (UN1046) 117 Kg (LYNDE)
RAYPA Bathwater sonicator 50 W
MINI-SECOEUR IKA MS2 minishaker with a support that allows simultaneous agitation of different Eppendorf tubs
MiniSpin eppendorf centrifuge
ND-1000 Spectrophotometer (NanoDrop)
Spectra Max M3 apparatus (bioNova cientifica S.L.)
Olimpus Stereomicroscope SZX16
Screw cylinder polypropylene microtube with attached O-Ring cap and conical base (Sarstedt, catalog number: 72.693.105 )
Procedure
Embryo excision from the maize kernel
Submerge and wash maize ears 16-18 days after manual pollination (dap) successively in different solutions as follows at room temperature:
1 min with ethanol 96%. Discard.
10 min with 25% Sodium hypochlorite. Discard.
5 min sterile water (x 3 times). Discard.
Detach grains with gloved hands from the washed ears and embryos from the grains with the help of a sterile cutter in a sterile Petri glass dish. Place 9 embryos/dish in a 3 x 3 array in the center of cell culture dishes (60 mm diameter) containing MSO medium. The embryo axis side in contact with the medium. Manipulations are done under a Laminar Flow Cabinet.
Maintain plates at 21-23 °C for 24 h in the dark before bombardment to allow embryos to be recovered of excision treatment. The described conditions have been shown not to alter the embryogenesis programme of the studied maize embryos (Jose-Estanyol et al., 2012).
Microcarrier stock preparation (at room temperature)
Add 1 ml ethanol (HPLC) to 60 mg of Gold Microcarriers in a cylinder microtube with attached ring cap and a conic base. Vortex at 2,200 rpm with the minishaker for 10 min. Avoid the use of hydrated ethanols.
Centrifuge in the MiniSpin Eppendorf Centrifuge for 1 min at 10,000 rpm.
Remove the Ethanol with a pipette, without removing microcarriers sediment. Discard ethanol.
Add 1 ml sterile water. Vortex 1 min. Sediment by centrifugation as in step 2-b. Discard water (Repeat 3 times).
Suspend microcarriers in 1 ml of water. Vortex 1 min. Make aliquots (30 μl) in conical tubes from the homogeneous suspension.
Store at -20 °C.
Microcarriers coating with the plasmid DNA of interest
Quantify DNA stocks (prepared by using a commercial plasmid prep kit) of plasmids sharing the studied promoters fused to a gene reporter, usually the beta-glucoronidase enzyme, with a nanodrop Spectrophotometer.
Sonicate defreezed microcarrier aliquots for 3 min in a bathwater sonicator.
Add succesivelly to the microcarrier aliquots:
12.5 μl DNA in TE buffer (1 μg/μl)
95 μl of water
125 μl CaCl2 2.5 M (while vortexing: Open the tube and decrease speed to avoid sample lost while you add solutions)
25 μl spermidine 0.1 M (while vortexing)
Vortex for 3-5 min.
Allow sedimentation on ice to minimize ethanol evaporation for 15-20 min.
Discard solution without disturbing microcarrier sediment as in step 2-c.
Add 500 μl ethanol (HPLC). Vortex 10-20 sec. Allow sedimentation during 15-20 min on ice.
Discard ethanol as in step 2-c.
Repeat with 200 μl ethanol (HPLC).
Discard ethanol as in step 2-c.
Finally add 40 μl ethanol (HPLC).
Sonicate in the bathwater sonicator 3 sec (Repeat 3 times).
Vortex 3 min.
Distribute the 40 μl homogenous solution of DNA coated microcarriers in ethanol (HPLC) (step 3-j) between the surface center of three macrocarriers (≈ 10 μl/macrocarrier) on a flat leveled surface. Macrocarriers have been washed in 70% ethanol and dried, beforehand. Let dry. This will allow the bombardment of three different samples (three cell culture dishes, each with 9 embryos in MSO medium).
When microcarriers have dried on macrocarriers surface (5-10 min), they are introduced inside previously autoclaved macrocarriers holders and are ready to be used for maize embryo bombardment.
Maize embryos 16-18 dap particle bombardment
Wash stopping screens and rupture disks with 70% ethanol. Locate in the adaptor the stopping screen and the macrocarrier holder with microcarriers attached to the macrocarrier. Locate the rupture disk at the end of the acceleration tube.
Proceed to the bombardement of the cell culture dishes with the maize embryos in MSO medium with the microcarriers coated with the different studied plasmids following PDS-100/He System instructions (http://www.Bio-Rad.com/biolostics).
Bombardement parameters are as follows:
Gap distance
1.0 cm
Macrocarrier travel distance
1.5 cm
Target distance
9.5 cm
Gold microcarriers
1.0 μm
Camera partial vacuum
0.1 atm
Rupture Disks
900 psi
Helium pressure at the regulator
1,100 psi
After bombardment and before the quantitative fluorometric or histochemical analysis, Petri dishes are incubated in the dark at 21-23 °C for 24 h to allow expression of the reporter gene. Fluorometric assay is very useful for strong promoters but for low or medium ones, the histochemical analysis can be more sensitive and avoid dilution of the signal (present mainly in the scutellum first cell layer of the bombarded embryos, penetration depth). In histochemical analysis better quantification can be achieved when both the number and the diameter of blue spots (see Figure 1) are quantified (for example: twelve basic units for spots with 80 μm diameter, six basic units for spots with 40 μm diameter, 3 basic units for spots with 20 μm diameter and one basic unit for spots with less than 20 μm diameter).
The validity of results is evaluated by the reproducibility of the results. This is achieved by the mean value of different experiments (3 to 4) and their standard deviation.
Finally significant differences between constructs or conditions (p-value) are calculated from the means of different experiments in a Student’st test (http://www.physics.csbsju.edu).
Different efficiency has been observed in different maize varieties. Efficiency has shown to be in an inverse rapport with the scutellar hydration level degree of the different maize varieties during embryo development.
Quantitative histochemical analysis
Embryos from each bombarded dish are transferred to 2 ml eppendorf tubes with 1 ml of histochemical analysis detection buffer and incubated overnight at 37 °C.
Blue spots of different intensity appear as result of the precipitation of product derivates reaction, see Figures 1-2 (This reaction is greatly enhanced by using an oxidation catalyst such as a potassium ferricyanide/ferrocyanide mixture).
To avoid diffusion of the blue spots on the surface of the embryos, they are transferred to a 50% glycerol solution in water. Blue spots are quantified by observation with an OLYMPUS Stereomicroscope SZX16. Stained embryos are stored at 4 °C.
As control one set of embryos can be bombarded with a constitutive promoter for monocots, such as OsActine: GUS-nos ter, to easily evaluate the efficiency of the microcarrier batch and of each specific experiment.
Histochemical analysis examples:
Figure 1. Maize embryos bombarded with a promoter with a medium-low expression level
Figure 2. Set of maize embryos bombarded with OsActine::Gus-nos terconstitutive strong promoter
Quantitative fluorometric analysis
Embryos from each bombarded dish are frozen in liquid N2 and stored at -80 °C until analysis.
The nine frozen embryos from a bombarded dish are grinded in 300 μl fluorometric lysis buffer.
Centrifuge 15 min 13,000 rpm in the MiniSpin Eppendorf Centrifuge at 4 °C.
Freeze the clear extract solution at -80 °C in aliquots of 40 μl, until beta-glucoronidase quantification. Sediment is rejected.
For fluorometric analysis 20 μl of clean extract are added to 80 μl fluorometric analysis reaction buffer and warmed at 37 °C.
Aliquots of 20 μl are taken at different time courses (10 (zero), 60, 180, 360 min).
Reaction is stopped by an addition of 180 μl of fluorimetric analysis stopping buffer to each taken aliquot and stored 4 °C until analysis.
Samples are transferred to a microtiter plate to measure fluorescence emission of the beta-glucoronidase enzyme product 4-MU (4-methylumbelliferone) in a plate fluorescence lector, Spectra Max M3 apparatu (excitation 365 nm, emission 455 nm).
After analysis defreezed samples can not be refreezed and are discarded.
4-Methylumbelliferone (4-MU) standards are used to calibrate the system.
Protein concentration in the extracts is measured using the Bradford assay in a Spectra Max M3 apparatus.
Internal control in fluorometric studies, Two different internal controls are suggested
Samples are cobombarded with a construction of luciferase enzyme fused to a constitutive promoter as maize ubiquitin (pUBI::LUC-nos-ter) to control homogenous bombardment of the different samples in an experiment.
Freeze the embryos in liquid nitrogen after 24 h of bombardment, grind all the frozen tissue to a powder and resuspend by homogenization in 300 μl Luciferase lysis buffer (1x) previously tempered to room temperature.
Sediment debris by brief centrifugation at 13,000 rpm with the MiniSpin Eppendorf Centrifuge at 4 °C and transfer supernatant to a new tube. Maintain on ice until analysis.
Mix 10 μl of cell lysate with 100 μl of Luciferase Assay Reagent in a microtiter plate and quickly measure the light produced in a Spectra Max M3 apparatus.
Make 40 μl aliquots with the remaining extract and freeze at -80 °C. Then proceed from step 6-e to do the fluorometric analysis of the studied promoters.
Alternatively samples can be cobombarded with a mixture of two constructions that express two maize complementary transcriptional factors, the maize myb factor C1 (35S::I-C1) and the myc factor B-Peru (35S::I-B-Peru) involved in the anthocyanin biosynthesis. In these constructions the expression of these factors is under the control of the cauliflower mosaic virus (CAMV) 35S constitutive promoter and the first intron enhancer of the maize Adh1 (alcohol dehydrogenase 1). Expression of both factors results in red/bronze spots on the surface of the embryos that can be visually compared by observation with a stereomicroscope. Then proceed from step 6-a to do the fluorometric analysis of the studied promoters.
Recipes
Histochemical analysis detection buffer (10 ml)
1 ml sodium phosphate 1 M (pH 8.0)
27 mg (final concentration, 5 mM) Potassium hexacyanoferrate (III)
21 mg (final concentration, 5 mM) Potassium hexacyanoferrate (II)
6 μl Triton X-100
1.5 ml X-Gluc from stock (20 mg/ml in N,N-dimethylformamid)
Fluorometric lysis buffer
50 mM sodium phosphate (pH 7.0)
10 mM EDTA (pH 8.0)
10 mM BME (beta-Mercaptoethanol)
0.1% SDS (v/v)
0.1% Triton X-100 (v/v)
Fluorometric analysis reaction buffer (4 ml)
3 ml lysis buffer
1 ml methanol
1,764 mg MUG
Fluorimetric analysis stopping buffer
0.2 M Na2CO3
MSO medium(1 L)
4.5 g M&S medium with vitamins (pH 5.8 with KOH 1 M)
30 g sucrose
2.4 g Gelrite
1x Luciferase lysis buffer
25 mM Tris-phosphate (pH 7.8)
2 mM DTT
2 mM CDTA:1,2-diaminocyclohexane-N,N,N′,N′-tetraacetic acid
10% glycerol
1% Triton® X-100
Acknowledgments
This protocol is adapted from Jose-Estanyol and Puigdomenech (2012).
References
Jose-Estanyol, M. and Puigdomenech, P. (2012). Cellular localization of the embryo-specific hybrid PRP from Zea mays, and characterization of promoter regulatory elements of its gene. Plant Mol Biol 80(3): 325-335.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Jose-Estanyol, M. (2013). Maize Embryo Transient Transformation by Particle Bombardment. Bio-protocol 3(16): e865. DOI: 10.21769/BioProtoc.865.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Bombardment
Molecular Biology > DNA > Transformation
Cell Biology > Cell imaging > Fixed-tissue imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Cellulase and Macerozyme-PEG-mediated Transformation of Moss Protoplasts
Rituraj Batth [...] Henrik Toft Simonsen
Jan 20, 2021 3322 Views
A Fast and Easy Method to Study Ralstonia solanacearum Virulence upon Transient Gene Expression or Gene Silencing in Nicotiana benthamiana Leaves
Wenjia Yu and Alberto P. Macho
Aug 5, 2021 3192 Views
Agrobacterium-mediated Genetic Transformation of Cotton and Regeneration via Somatic Embryogenesis
Alka Srivastava [...] Praveen C. Verma
May 20, 2023 1856 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
866 | https://bio-protocol.org/en/bpdetail?id=866&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Germination Percentage in Wheat
HM Harish Manmathan
NL Nora L.V. Lapitan
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.866 Views: 21075
Reviewed by: Ru Zhang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Experimental Botany May 2013
Abstract
Knowledge of the viability of seeds is a prerequisite for establishing the seeding rate in crop production and for germination-related trait evaluation in crop plants. This method explains a simple procedure to establish germination percentage in wheat seeds.
Materials and Reagents
Wheat seeds
Sterile deionized water
Filter paper (Whatman No.1)
Permanent marker
Lab wipes and gloves
5% (w/v) Sodium hypochlorite
Equipment
Forceps
Laminar flow hood
Timer
70% Alcohol and flame
Metal forceps
Ruler
Petri dishes (11 cm diameter)
Procedure
Obtain a representative sample (i.e. seeds of a particular variety or cultivar) of your wheat seeds. Random selection within this sample is required to avoid any bias. The rest of the procedure is done under Laminar flow hood.
Wipe the working area with alcohol and alcohol/flame sterilize the forceps.
Spread fresh Whatman paper 1 on the petri dish and moisten until thoroughly damp (~2 ml water is added in our case). Avoid standing water above the Whatman paper 1.
The seeds are placed in petri dishes, covered with disinfecting (5% (w/v) sodium hypochlorite) for 15 min, stirred, drained, and washed four times with sterile deionized water.
Gently place the seeds spread out in the petri dish with a sterile forceps and record time. Use four replicates of five seeds per dish. It is advisable to have extra sets in case of microbial contamination.
Place the petri dishes with seeds in a dark place with stable room temperature (~73 °F).
Seeds are considered to be germinated when radicle has emerged approximately ≥ 2 mm (Figure 1). Germination percentage is recorded every 24 h for 6 days. Keep an eye for contamination. Do not let the whatman 1 paper dry out (Periodically inspect the moisture level with the help of a timer. In our case every 12 h, ~1 ml sterile water was added under aseptic conditions to each of the petri dishes).
Figure 1. Germinated wheat seeds at the 4th day of germination initiation
Germination rate is estimated by using the following formula:
Germination Percentage = seeds germinated/total seeds x 100
Acknowledgments
This protocol is adapted from Manmathan et al. (2013).
References
Maynard, Donald N. and George J. Hochmuth. 1997. Knotts Handbook for Vegetable Growers, 4th Edition.
Manmathan, H., Shaner, D., Snelling, J., Tisserat, N. and Lapitan, N. (2013). Virus-induced gene silencing of Arabidopsis thaliana gene homologues in wheat identifies genes conferring improved drought tolerance. J Exp Bot 64(5): 1381-1392.
New York: John Wiley and Sons, Inc. Yaklich, R.W., Editor. (1985). Rules for Testing Seeds, J Seed Technol. Lansing, Michigan: Association of Official Seed Analysts. Vol. 6, No. 2.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Manmathan, H. and Lapitan, N. L. (2013). Measuring Germination Percentage in Wheat. Bio-protocol 3(16): e866. DOI: 10.21769/BioProtoc.866.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Accelerated Snowmelt Protocol to Simulate Climate Change Induced Impacts on Snowpack Dependent Ecosystems
Laura T. Leonard [...] Jonathan O. Sharp
Mar 20, 2020 3460 Views
Quantification of Ethylene Production in Leaf and Bud Tissue of the Subtropical Tree Crop Litchi (Litchi chinensis Sonn.) Using Gas Chromatography and Flame Ionization Detection
Regina B. Cronje and Arnoldus J. Jonker
Mar 20, 2023 571 Views
Bi-directional Dual-flow-RootChip for Physiological Analysis of Plant Primary Roots Under Asymmetric Perfusion of Stress Treatments
Claudia Allan [...] Claudia-Nicole Meisrimler
Aug 5, 2023 509 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
867 | https://bio-protocol.org/en/bpdetail?id=867&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Rapid Induction of Water Stress in Wheat
HM Harish Manmathan
NL Nora L.V. Lapitan
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.867 Views: 11304
Reviewed by: Ru Zhang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Experimental Botany May 2013
Abstract
Traditional water stress evaluation studies in wheat are time consuming and can take up to several months to finish. A rapid phenotypic screening for water stress is important for accommodating time-bound water stress studies such as transient gene silencing studies in wheat. This method explains a procedure to induce water stress in young wheat plants within three weeks.
Materials and Reagents
Wheat seeds
Permanent marker pen
Green house handling gloves
Equipment
Plastic pots and potting mixture
Volumetric beaker (500 ml)
Petri dishes (11 cm diameter)
Growth chamber
Light incubators/Green house facility
Weighing scale
Procedure
We have to calculate the field capacity (FC) of the experimental set up to maintain proper water stress. FC is the amount of water in the soil remaining after water is removed by gravity following water saturation. For the purpose of estimating the FC for the experimental set up.
Plastic pots holding 500 g of potting mixture are fully saturated with water, drained by gravity for 3 h and weighed.
These pots are allowed to fully dry over a period of 12 days. These pots are weighed again and the difference in weight constitutes the water held by soil in pot after gravitational drainage. This constitutes the approximation of FC for these pots. An average reading from 10 pots is assumed as the field capacity for this experimental setup (in our case FC was 245 g).
Once we establish the FC for our system, achieving 50% FC is the goal for inducing water stress
50% FC corresponds to half of the amount of water (measured in weight) for the calculated FC. This FC is achieved in our pots by maintaining the weight of the pots at a level equal to weight of dried down pots (with soil) plus half of the measured FC (measured as weight of water) calculated for these pots. Control plants were kept at 100% FC. In this experiment 100% FC can be achieved by adding the water equal the calculated FC to the dried down pots. All the pots are periodically (twice a day) weighed to maintain the water level (50% FC and 100% FC).
Preparation of wheat plants
Sterilization and germination of wheat seeds: The wheat seeds are placed in petri dishes, covered with disinfecting (5% (w/v) sodium hypochlorite) for 15 min, stirred, drained, and washed four times with sterile deionized water. These seeds are placed on moist filter paper in petri dishes. Store these petri dishes in a dark place (preferably in a growth chamber) with stable room temperature (~25 °C).
These seeds that germinated (~48 h) are then transplanted (3 seeds in a pot) into pots holding 500 g of potting mixture in a temperature-controlled growth room at 22–25 °C and relative humidity of 60% with a 12 h photoperiod with light intensity ranging from 300 to 400 μE/m2/s. Prophylactic measures (disease free seeds, clean water for treatment, pest and pathogen free environment etc) are taken to maintain the plants disease and pest free.
The ideal age to start this experiment is found to be 3-5 leaf stage in wheat (~15 days from germination initiation). The sample size (number of plants) is determined by the experimental design. This experiment used 24 plants in each treatment.
For this experiment, two subsets of plants (well watered set and water stressed set) are maintained.
One set of plants (well watered set) is maintained at 100% field capacity (FC).
The second set of plants is water stressed plants. Water stress is imposed on this set of plants by withholding water until 50% FC weight is achieved. Soil moisture regimes are monitored gravimetrically by weighing the pots every day. It was found that withholding water continuously for ~3 days could achieve a water level of 50% FC in our experimental setup.
No other enclosure for pots are necessary as evapotranspiration from the pots under study was found to be statistically similar in all pots as conditions in the two treatments were identical (plant growth stage, pot size and growing conditions), except the treatment (water stress).
Withholding water up to 50% FC is found to induce the water stress phenotype in the experimental plants placed in 500 g of potting mix within the time frame of three weeks.
The 100% field capacity (FC) plants would give the control phenotype for well watered plants and 50% field capacity (FC) plants would show the water stressed phenotype (Figure 1).
Figure 1. The phenotype of well watered (100% field capacity) and water stressed (50% field capacity) plants after 7 days of stress induction. Plastic covers are used to prevent evaporation from high light during photography.
Stunted growth and chlorosis are observed in water stressed plants in comparison with well watered plants. To confirm and measure the water status in the plant, leaf relative water content (RWC) is estimated according to the method of Ekanayake et al., (1993).
Acknowledgments
This protocol is adapted from Ekanayake et al. (1993) and Manmathan et al. (2013).
References
Ekanayake, I., De Datta, S. and Steponkus, P. (1993). Effect of water deficit stress on diffusive resistance, transpiration, and spikelet desiccation of rice (Oryza sativa L.). Ann Bot 72(1): 73-80.
Loresto, G., Chang, T. and Tagumpay, O. (1976). Field evaluation and breeding for drought resistance. Philippine J Crop Sci 1(1): 36-39.
Manmathan, H., Shaner, D., Snelling, J., Tisserat, N. and Lapitan, N. (2013). Virus-induced gene silencing of Arabidopsis thaliana gene homologues in wheat identifies genes conferring improved drought tolerance. J Exp Bot 64(5): 1381-1392.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant physiology > Abiotic stress
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Simple Sonication Method to Isolate the Chloroplast Lumen in Arabidopsis thaliana
Jingfang Hao and Alizée Malnoë
Aug 5, 2023 597 Views
A Plate Growth Assay to Quantify Embryonic Root Development of Zea mays
Jason T. Roberts [...] David M. Braun
Oct 20, 2023 939 Views
Detection and Quantification of Programmed Cell Death in Chlamydomonas reinhardtii: The Example of S-Nitrosoglutathione
Lou Lambert and Antoine Danon
Aug 5, 2024 404 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
868 | https://bio-protocol.org/en/bpdetail?id=868&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Primary Culture of SVZ-derived Progenitors Grown as Neurospheres
JV Julien Vernerey
KM Karine Magalon
PD Pascale Durbec
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.868 Views: 11915
Reviewed by: Xuecai Ge Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Neuroscience Feb 2013
Abstract
SVZ-derived progenitors grown as neurospheres is a well-known model to study neural stem cell and progenitor functions such as proliferation, differentiation/self-renewal, and migration (Durbec and Rougon, 2001). This protocol is for preparing a culture of SVZ-derived progenitors from 8 early postnatal mouse brains (P0 to P3). One week after cell plating, we can observe round floating neurospheres, each resulting from the clonal expansion of a single EGF/FGF responsive neural progenitor.
Keywords: Nervous system Adult brain Stem cells Subventricular zone Primary culture
Materials and Reagents
New born mice
Phosphate Buffered Saline (PBS) (Life Technologies, catalog number: 14040-091 )
Hank's Balanced Salt Solution (HBSS) (Life Technologies, catalog number: 14170-088 )
Dulbecco's Modified Eagle Medium (DMEM) (Life Technologies, catalog number: 61965-026 )
Ham’s F-12 nutrient mix (F12) (Life Technologies, catalog number: 31765-027 )
Trypsin (Sigma-Aldrich, catalog number: T5266 )
Insulin (Sigma-Aldrich, catalog number: I1882 )
Holo-transferrin (Sigma-Aldrich, catalog number: T0665 )
Putrescine (Sigma-Aldrich, catalog number: P5780 )
Progesterone (Sigma-Aldrich, catalog number: P8783 )
Sodium selenite (Selenium) (Sigma-Aldrich, catalog number: S5261 )
Penicillin-streptomycin (Life Technologies, catalog number: 15140-130 )
Fetal Bovine Serum (FBS) (Life Technologies, catalog number: 10106-169 )
B27 (Life Technologies, catalog number: 17504-044 )
rhFGFbasic (Peprotech, catalog number: 167 100-18B-B )
rhEGF (Peprotech, catalog number: 167 AF-100-15A )
Neurospheres defined medium (see Recipes)
Trypsin (see Recipes)
Equipment
Sterilin Universal Container (Thermo Fisher Scientific, catalog number: 128A/P )
Standard TC BD Falcon 60 mm cell culture dish (BD Biosciences, Falcon®, catalog number: 353002 )
Vibratom (Microm, model: HM450 )
Stereoscopic Microscope
Cell culture Hood and Incubator
Scissors, fine forceps, spatula, micro knives
Ice bucket
Fire-polished glass Pasteur pipettes
Water bath
Procedure
Dissect the brain from new born mice.
Cut 400 μm thick coronal sections of the brain in ice cold PBS with a Vibratom (Figure 1A) (from the olfactory bulb to the anterior horn of the lateral ventricle). Keep the first two sections of each brain containing the lateral wall of the lateral ventricles and place them in ice cold HBSS.
Figure 1. Dissection of the neonatal mouse SubVentricular Zone. A. Illustration of a newborn mice sagittal section showing the cut window when using the vibratome. B. Coronal section showing parts to dissect to isolate lateral ventricules’ tissues. C. Neurospheres obtained after 1 week long culture. Scale bar, 500 μm.
Under the microscope, dissect out the lateral walls of the lateral ventricles (Figure 1B). Take a forceps with one hand to handle slice and keep it on the bottom of the dish, and a micro knife with the other to cut out the zone of interest. Discard the rest of the slice after each dissection.
Cut the tissues into small cubes (400 μm cubes) using sterile micro knives.
Pipette the tissues within a volume of 800 μl HBSS and place them in a 30 ml Sterilin Universal Container. Add 200 μl of trypsin 12.5 mg/ml. Incubate 5 min at 37 °C in a water bath.
Add 10 volumes of 10% HBSS-FBS. Using fire-polished glass Pasteur pipettes, gently pipet up and down to help the dissociation. Take of a droplet regularly and check under the microscope whether the dissociation is complete.
Centrifuge at 800 x g for 7 min at room temperature (RT), discard the supernatant, and resuspend the pellet in 10 ml of fresh HBSS. Take of a sample and count the number of cells.
Centrifuge the cell suspension at 800 x g for 7 min at RT, discard the supernatant, and resuspend in Standard TC BD Falcon 60 mm cell culture dishes at the concentration of 25,000 cells/ml in neurospheres defined medium, supplemented with 2% B27, bFGF (20 ng/ml) and EGF (20 ng/ml).
Every 3 days, add a half-volume of doubly-supplemented [4% B27, bFGF (40 ng/ml) and EGF (40 ng/ml)] neurospheres defined medium. To avoid any sphere attachment to the bottom of the culture dish, don’t extend the culture beyond 1 week (Figure 1C).
Recipes
Neurospheres defined medium
DMEM/F12, 3:1 volumes respectively
5 g/ml Insulin
100 g/ml Holo-transferrin
100 M Putrescine
20 nM Progesterone
30 nM Selenium
1% Penicillin-streptomycin (100 IU/ml and 100 g/ml, respectively)
Trypsin (prepare each time a new aliquot)
Dissolve 12.5 mg of Trypsin in 1 ml of ice cold HBSS
Acknowledgments
This protocol is adapted from Durbec and Rougon (2001) and Vernerey et al. (2013).
References
Durbec, P. and Rougon, G. (2001). Transplantation of mammalian olfactory progenitors into chick hosts reveals migration and differentiation potentials dependent on cell commitment. Mol Cell Neurosci 17(3): 561-576.
Vernerey, J., Macchi, M., Magalon, K., Cayre, M. and Durbec, P. (2013). Ciliary neurotrophic factor controls progenitor migration during remyelination in the adult rodent brain. J Neurosci 33(7): 3240-3250.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Vernerey, J., Magalon, K. and Durbec, P. (2013). Primary Culture of SVZ-derived Progenitors Grown as Neurospheres. Bio-protocol 3(16): e868. DOI: 10.21769/BioProtoc.868.
Vernerey, J., Macchi, M., Magalon, K., Cayre, M. and Durbec, P. (2013). Ciliary neurotrophic factor controls progenitor migration during remyelination in the adult rodent brain. J Neurosci 33(7): 3240-3250.
Download Citation in RIS Format
Category
Neuroscience > Development > Neuron
Stem Cell > Adult stem cell > Neural stem cell
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Generation of Human Induced Pluripotent Stem Cell (hiPSC)-Derived Astrocytes for Amyotrophic Lateral Sclerosis and Other Neurodegenerative Disease Studies
Katarina Stoklund Dittlau [...] Ludo Van Den Bosch
Feb 20, 2024 2293 Views
An In Vitro Model of Murine Osteoclast-Mediated Bone Resorption
Xiaoyue Sun [...] Lingxin Zhu
Nov 5, 2024 397 Views
Primary Neuronal Culture and Transient Transfection
Shun-Cheng Tseng [...] Eric Hwang
Jan 20, 2025 337 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
869 | https://bio-protocol.org/en/bpdetail?id=869&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
PTEN-lipid Binding Assay
SK Sridhar Kavela
SS Swapnil R. Shinde
SM Subbareddy Maddika
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.869 Views: 10602
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Jan 2013
Abstract
The lipid and protein interactions are an integral and important part of many cellular signaling pathways. The understanding of the selective and specific interaction of the given lipid molecule with the target protein is required for studying cellular signaling. In this assay, different lipids are spotted onto a nitrocellulose membrane to which they attach. Then the membrane is incubated with a lipid binding protein possessing an epitope tag. The protein binds to the lipid which is detected by immunoblotting with an antibody recognizing the epitope tag (see Figure 1). PTEN is an important tumor suppressor which functions as both protein and lipid phosphatase. The primary physiological substrate of PTEN is signaling lipid PtdIns (3, 4, 5) P3, by dephosphrylating PtdIns (3, 4, 5) P3 to PtdIns (4, 5) P2 PTEN negatively regulates PI3K signaling and mediates its tumor-suppressor function by inactivating downstream oncogenic AKT-mediated signaling. The PTEN lipid binding assay is conducted to study the specific binding of PTEN to different lipid molecules.
Keywords: Kavela Swapnil Maddika
Figure 1. Key steps of the PTEN-lipid binding assay
Materials and Reagents
Lyophilized lipids:
PE (Sigma-Aldrich, catalog number: P0890 )
PC (Sigma-Aldrich, catalog number: P1652 )
Hybond C-extra nitrocellulose membrane (Amersham Hybond-ECL, catalog number: RPN303D )
Bacterially Purified GST-fusion protein (GST-PTEN)
Anti-GST monoclonal antibody (Santa Cruz, catalog number: SC-138 )
HRP-conjugated anti mouse secondary antibody (Jackson Immuno Research, catalog number: 315035048 )
ECL (Thermo Scientific Prod, catalog number: 34080 )
Methanol
Chloroform
1x TBST buffer (see Recipes)
Blocking buffer (see Recipes)
Equipment
Shaker
Film developer
Procedure
Reconstitute the lyophilized lipids in a 2:1:0.8 solution of chloroform: methanol: water to make the required stock (all lipids were constituted to make stock of 1 mM).
Dilute the lipids to get the required working concentration (the working concentration used was 1 nM).
Spot 1 nM of the lipid dilution onto the Hybond C-extra nitrocellulose membrane (each spot is separated by ~1 cm).
Allow to dry at room temperature (RT) for 1 h.
Incubate the membrane with gentle rocking in blocking buffer for 1 h at RT.
Incubate the membrane overnight at 4 °C with gentle rocking in the fresh blocking buffer containing 20-100 nM of the GST-fusion protein (or other epitope tagged protein).
Wash the membrane 10 times over 50 min in TBST (use adequate volume of TBST which will cover the membrane ~10 ml).
Incubate the membrane for 1 h at RT with 1:1,000 dilution of the anti-GST monoclonal antibody in blocking buffer.
Wash the membrane 10 times over 50 min in TBST.
Incubate the membrane for 1 h with a 1:10,000 dilution of the HRP-conjugated antimouse secondary antibody in blocking buffer at RT.
Wash the membrane 12 times over 60 min in TBST.
Detect the lipid binding protein bound to the membrane by ECL according to manufacturer’s instructions (see Figure 2).
Figure 2. A blot representing the effect of PNUTS on the lipid binding property of PTEN. Nitrocellulose membranes spotted with phophatidylserine (PS) or phosphatidylethanolamine (PE) or phosphatidylcholine (PC) or PS: PE: PC mix (1:1:1) in triplicate was incubated with indicated recombinant proteins. Bound PTEN was detected with anti-GST antibody (adapted from Kavela et al., 2013)
Recipes
1x TBST solution (1 L)
50 mM Tris-HCl
150 mM NaCl
0.1% Tween 20
Adjust pH 8 make up to 1 L
Blocking buffer
3% BSA in 1x TBST
Acknowledgments
This protocol is adapted from Kavela et al. (2013).
References
Kavela, S., Shinde, S. R., Ratheesh, R., Viswakalyan, K., Bashyam, M. D., Gowrishankar, S., Vamsy, M., Pattnaik, S., Rao, S., Sastry, R. A., Srinivasulu, M., Chen, J. and Maddika, S. (2013). PNUTS functions as a proto-oncogene by sequestering PTEN. Cancer Res 73(1): 205-214.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Lipid > Lipid-protein interaction
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Quantitative Analysis of Cellular Diacylglycerol Content
Fikadu G. Tafesse [...] Hidde L. Ploegh
Aug 5, 2014 11685 Views
Optogenetic Tuning of Protein-protein Binding in Bilayers Using LOVTRAP
Doug Tischer and Orion D. Weiner
Sep 5, 2020 4331 Views
A Fluorescence Dequenching-based Liposome Leakage Assay to Measure Membrane Permeabilization by Pore-forming Proteins
Javier Aguilera [...] Jianjun Sun
May 20, 2021 5178 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
870 | https://bio-protocol.org/en/bpdetail?id=870&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Retrograde and Anterograde Tracing of Neural Projections
Takehiro Kudo
Masahiko Watanabe
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.870 Views: 19502
Reviewed by: Xuecai Ge Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Neuroscience Dec 2012
Abstract
Neurons consist of four elements, the soma, dendrite, axon and terminal. They work in concert as the input (soma and dendrite) and output (axon and terminal) parts of neuronal transmission. To function and maintain neuronal activity and metabolisms, proteins and organelles should be transported from soma to terminal via anterograde axonal transport, and also from terminal to soma via retrograde transport. By utilizing these transport systems, neural projection is traced by injecting tracers into local sites of interest. Furthermore, neurochemical properties, such as glutamatergic and GABAergic, can be determined by combining retrograde and anterograde tracing with fluorescent in situ hybridization and immunofluorescence.
Keywords: In situ hybridization Neuronal tracer Immunohistochemistry
Materials and Reagents
Chloral hydrate
Instant glue
Biotinylated dextran amine (BDA) (3,000 molecular weight, 10% solution in PBS) (Life Technologies, InvitrogenTM, catalog number: D-7135 )
Alexa Fluor 488-conjugated cholera toxin subunit b (Alexa488-CTb, 0.5% solution in saline) (Life Technologies, InvitrogenTM, catalog number: C-34775 )
Distilled H2O (dH2O)
Pentobarbital
Sodium azide
Phosphate-buffered saline (PBS)
Alexa Flour 594-conjugated streptavidin (Life Technologies, InvitrogenTM, catalog number: S-11227 )
Normal donkey serum (10% solution in PBS) (Jackson Immuno Research, catalog number: 017-000-121 )
Primary antibodies for immunofluorescence
Note: We almost use self-made antibodies (Kudo et al., 2012).
Secondary antibodies
Note: We use products from Invitrogen and/or Jackson Immuno Research, whose host are donkey.
Acetic anhydrate
Triethanolamine-HCl
Formadime
Tris(hydroxymethyl) aminomethane (TRIS)
Ficoll
Polyvinylpyrrolidone
Bovine serum albumin (BSA)
tRNA
Ethylenediaminetetraacetic acid (EDTA)
N-Lauroylsarcosine sodium salt (NLS)
Dextran sulfate
cRNA probes (Kudo et al., 2012; Yamasaki et al., 2010)
Sodium citrate
Lodoamide
DIG blocking reagent (Roche Applied Science, catalog number: 11096176001 )
Normal sheep serum (Chemicon, catalog number: S22-100ML )
Maleic acid
Tyramide signal amplification (TSA) blocking reagent (PerkinElmer Life and Analytical Science, catalog number: FP1020 )
Peroxidase-conjugated anti-DIG antibody (1:1,000 in DIG blocking buffer) (Roche Diagnostics, catalog number: 11207733910 )
Cyanine 3 (Cy3) Amplification Reagent (PerkinElmer Life and Analytical Science, catalog number: FP1170 )
1x Plus Amplification Diluent (PerkinElmer Life and Analytical Science, catalog number: FP1135 )
H2O2
Anti-Alexa Fluor 488 antibody for detection of Alexa488-CTb (raised in rabbit) (1:1,000 dilution) (Invitrogen, catalog number: A-11094 )
TOTO-3 iodide (642/660) (1:50 in PBS) (Life Technologies, InvitrogenTM, catalog number: T3604 )
Primary antibody solution (1 μg/ml in PBS-T)
Fluorophore-linked secondary antibody solution (1:200 in PBS-T)
Digoxigenin (DIG)-labeled cRNA probes
Dimethyl sulfoxide (DMSO)
Blocking reagent (Roche Applied Science, catalog number: 11096176001)
Saline (see Recipes)
3.5% chloral hydrate (see Recipes)
0.1 M PB (see Recipes)
5 N NaOH (see Recipes)
4% Paraformaldehyde (PFA) (see Recipes)
20% Tween-20 (see Recipes)
PBS containing 0.1% Tween-20 (PBS-T) (see Recipes)
0.25% acetic anhydrate in 0.1 M triethanolamine-HCl (pH 8.0) (see Recipes)
1 M Tris-HCl (pH 7.4 or 8.0) (see Recipes)
5 M NaCl (see Recipes)
0.5 M ethylenediaminetetraacetic acid (EDTA) (see Recipes)
Hybridization buffer (see Recipes)
Standard saline citrate (SSC) (see Recipes)
NaCl-Tris-EDTA (NTE) buffer (see Recipes)
Tris-NaCl-Tween (TNT) buffer (see Recipes)
20 mM iodoamide in NTE buffer (see Recipes)
DIG blocking solution (see Recipes)
0.5% TSA blocking buffer (see Recipes)
Cy3-TSA amplification solution (see Recipes)
Equipment
Scissors
Surgical knife
Note: We use set of stainless-steel mess handle (Feather, No.3) and stainless-steel spare blade (Feather, No.14).
Syringe
Syringe needle
Stereotaxic instrument (Narishige, model: SR-5M )
Surgical cotton
Pneumatic pump (Pneumatic Picopump) (World Precision Instruments, model: PV800 )
Puller (Narishige, model: PC-10 )
Glass pipette (Narishige, model: G-1.2 )
Peristaltic pump (ATTO Corporation, model: SJ-1211H )
Cork board
Microslicer (Leica Microsystems, model: VT1000S )
Razor blade
10 ml tube
Confocal laser-scanning microscope (Olympus, model: FV1000 )
Hybridization oven (Bellco, model: 7930-00110 )
Water bath
Fluorescence microscope
Note: Fluorescence signals of Alexa Fluor 488 and Cy3 or Alexa Fluor 594 are observed through fluorescence mirror units (Olympus, model: U-MWIBA3 , U-MWIG3 ).
Aspirator
Software
Confocal software (Olympus, FV10-ASW, ver.1.7)
Procedure
Injection of anterograde or retrograde tracer
Prepare the tracer solution and all equipment needed (scissors, surgical knife, syringe needles etc).
Note: BDA and Alexa488-CTb are used as an anterograde or retrograde tracer, respectively. Spin down tracer solutions before use.
Anesthetize an animal with 3.5% chloral hydrate (350 mg/kg body weight, i.p.).
Check the animal being anesthetized by loss of righting reflex and lack of response to hitching its paws.
Place the anesthetized animal on stereotaxic instrument with locking the nose and ears.
Note: First, insert the auxiliary ear bar into the mouse ear canal and fix it tightly, but be careful not to insert it too deeply to injure the inner ear. Next, align the vertical level of the nose clamp and hook the mouse tooth on it, and then hold down the nose. Check whether the mouse head do not move wobbly to finish fixation.
Shave the hair and incise the scalp along the rostro-caudal axis.
Clip the incised scalp using syringe needles bent into a hook and remove lamina.
Note: To remove lamina, snick it by scissors and wipe the surface of the skull bone by surgical cottons.
Using a surgical knife cut the skull bone and make a square hole at the position of tracer injection.
Prepare a glass pipette using a puller.
Fill a glass pipette with ~1 μl of the tracer solution by a capillary phenomenon and attach it to a tube connected with a pneumatic pump.
Note: If the tip of the pipette is too fine to draw the tracer solution by a capillary phenomenon, snap the tip slightly. Moreover, too fine tip often prevents smooth injection as tiny concomitants get jammed in the pipette.
Position the tip of the glass pipette on the bregma and then stereotaxically insert the pipette into the target region.
Note: To make injection space, insert the pipette 0.1 mm deeper and turn back to the target region.
Inject the tracer solution by air pressure at 10 psi with 5 sec intervals for 1 min.
Leave the pipette inserted for 15 min, and then pull out it carefully.
Replace the removed skull bone on the square hole and suture the scalp.
Note: Instant glue is used for closing incision site as substitute for a surgical suture.
Release and place the animal back into a home cage.
Keep the animal for several days until fixation.
Note: Determine the period of survival depending on the distance of projection.
In our experiments (between the bed nucleus of the stria terminalis (BST) and the ventral tegmental area (VTA)), BDA-injected and Alexa488-CTb-injected animals are incubated for at least 4 and 2 days, respectively (Kudo et al., 2012).
Perfusion and section preparation
Place a beaker containing 4% PFA fixative solution (100 ml for each mouse) in ice bath. Set on peristaltic pump a silicone tube with one end put into the fixative beaker and the other end equipped with a 25 G syringe needle.
Prepare all equipment needed (scissors, forceps, syringe needles to impale hands/feet etc).
Run the peristaltic pump and fill up tubes and the syringe needle with the fixative solution.
Deeply anesthetize the animal with overdosed pentobarbital (100 mg/kg of body weight, i.p.).
After confirming the animal asleep, impale the animal’s hands and feet on a cork board with syringe needles.
Open the abdominal cavity by horizontal cutting of the belly skin and muscles. Then cut the skin of the chest along the midline up to the jaw, and detach the skin from the chest wall.
Cut the diaphragm to open the thoracic cavity, and then cut both sides of the chest wall to expose the heart. It is important not to injure the internal thoracic artery, which runs vertically along the sternum.
Snick the wall of the right auricle by sharp scissors or the pit of syringe needle, and prick the left ventricle with a syringe needle connecting to the fixative beaker.
Start transcardial perfusion for 10 min, so that 3 fixative volumes of the body weight run in 10 min.
Excise a fixed brain and post-fix it for 2 h. Using a razor blade, divide the brain into two blocks with one containing a tracer-injected site and another containing neural regions of interest.
Note: In our experiments, we divided the brain into two parts containing the BST and VTA, respectively, by coronal cutting between the hypothalamus and mammillary body (Kudo et al., 2012).
Prepare sections of the fixed brain (50 μm in thickness) using a microslicer, whose buffer bath is filled with 0.1 M PB.
Note: Especially in free-floating in situ hybridization experiment, the fixed brain block and sections should be kept in PB. When PBS is used for buffer, detection sensitivity of mRNA signal tends to be lowered.
Collect sections in 24-well plate and store in 0.1 M PB containing 0.1% sodium azide.
Anterograde tracing combined with fluorescence immunohistochemistry
Note: This method is used to determine neurochemical properties of axon terminals, which are projected from anterograde tracer-injected regions. Vesicular glutamate transporters (VGluTs) and vesicular inhibitory transporter (VIAAT) are frequently used as excitatory (glutamatergic) and inhibitory (GABAergic and glycinergic) terminal markers, respectively (Kudo et al., 2012; Figure 1 in this manual). By using other neurochemical markers for combination with anterograde tracing, one can also determine whether the projection is cholinergic, serotonergic, dopaminergic, adrenergic, histeminergic, or peptidergic.
Prepare sections from BDA-injected brains.
Select sections containing the injected region and visualize BDA signals by incubation in Alexa Flour 594-conjugated streptavidin (1:500 in PBS) for 10 min. Photograph the injection site of BDA using a fluorescence microscope.
Submerge 1~3 sections for neurochemical testing in a 10 ml tube containing PBS containing 0.1% Tween-20 (PBS-T) for 10 min.
Block with 10% normal donkey serum in PBS for 20 min.
Note: Blocking and antibody solutions are ~0.5 ml per tube, and washing solutions are ~10 ml per tube in each wash. Solution exchange is efficient by using aspirator, but should be carefully done not to aspirate or dry up sections.
Incubate in primary antibody solution (1 μg/ml in PBS-T) overnight.
Wash with PBS-T for 5 min three times.
Incubate in fluorophore-linked secondary antibody solution (1:200 in PBS-T) for 2 h for neurochemical marker detection.
Wash with PBS-T for 5 min three times.
Wash with PBS briefly.
Incubate in Alexa Flour 594-conjugated streptavidin (1:500 in PBS) for 10 min for BSA detection.
Wash with PBS for 5 min three times.
Mount sections on glass slides, make coverslip, and observe using a fluorescence microscope.
Note: Images are captured using a confocal laser scanning microscope, digitized at 12 bit resolution into an array of 640 x 640 pixels (pixel size, 0.1 μm). To investigate the neurochemical characteristic of BDA-labeled axon terminals, take images (x60 magnifications, x3 zoom) of the traced region from each slice. For analysis, we counted terminal marker-positive boutons whose center point matched with that of BDA labeling. Bouton-like structures which are only labeled with BDA are often observed. If they are not labeled with other terminal markers, they should not be used for counting (Figure 1).
Figure 1. Combined anterograde tracer labeling and immunofluorescence. BDA is injected into the bed nucleus of the stria terminalis (BST) and anterogradely transported to the ventral tegmental area (VTA). In sections containing the VTA, BDA staining (red) and immunofluorescence for type 2 vesicular glutamate transporter (VGluT2; green) and vesicular inhibitory amino acid transporter (VIAAT; blue) are performed. Images are used for counting (x60 magnifications, x3 zoom). VGluT2-positive BDA axon terminals (arrows) and VIAAT-positive BDA axon terminals (arrowheads) are identified as glutamatergic and GABAergic afferents from the BST, respectively. Scale bars: 10 μm.
Retrograde tracing combined with free-floating fluorescent in situ hybridization (FISH)
Note: This method is used to determine neurochemical properties of neurons, which project their axons to retrograde tracer-injected regions. It is recommended to prepare sections and start FISH incubation on the same day, because detection sensitivity is drastically decreased after sectioning. Expression of VGluTs and glutamic acid decarboxylase (GAD) (or VIAAT) mRNAs are used to determine the neurochemical properties of excitatory and inhibitory neurons, respectively (Kudo et al., 2012; Figure 2 in this paper).
Prepare sections from Alexa488-CTb-injected brains.
Check the injection site of Alexa488-CTb using a fluorescence microscope.
Submerge a single section in a 10 ml tube containing PB.
Note: It is recommended that one tube is used for one section, because more than two sections per tube decrease reaction sensitivity. For free-floating FISH, solutions for hybridization, antibody reaction, inactivation of peroxidases, fluorescence detection and counterstaining are ~0.5 ml per tube, and washing solutions are ~10 ml per tube in each wash. Solution exchange is efficient by using aspirator, but should be carefully done not to aspirate or dry up sections.
Acetylate sections with 0.25% acetic anhydrate in 0.1 M triethanolamine-HCl (pH 8.0) for 10 min.
Note: Prepare the solution at time of use.
Prehybridize in hybridization buffer for 1 h.
Hybridize in hybridization buffer supplemented with digoxigenin (DIG)-labeled cRNA probes at a dilution of 1:1,000, performed at 63.5 °C for 12 h.
Note: Preparation of DIG-labeled cRNA probes is described in previous our reports (Kudo et al., 2012; Yamasaki et al., 2010). Hybridization is performed in a hybridization oven. Cover the tube tip with parafilm to avoid drying off.
Wash with 5x SSC for 30 min, 4x SSC containing 50% formamide (Formamide 1) for 40 min, 2x SSC containing 50% formamide (Formamide 2) for 40 min and 0.1x SSC for 15 min, performed at 61 °C.
Note: Solutions are prewarmed at 61 °C in hot bath, and washing steps are performed in hot bath.
Incubate in 0.1x SSC for 15 min, NTE buffer for 20 min, 20 mM iodoamide in NTE buffer for 20 min, NTE buffer for 10 min and TNT buffer for 10 min, performed at room temperature (RT).
Note: All subsequent steps are performed at RT.
Block sections with DIG blocking buffer for 30 min and 0.5% TSA blocking buffer for 30 min.
Incubate in peroxidase-conjugated anti-DIG antibody in DIG blocking buffer (1:1,000) for 2 h.
Wash with TNT buffer for 15 min twice.
Detect signals for peroxidase using Cy3-TSA plus amplification kit system (see Recipe 20) for 10 min, performed in shade.
Wash with TNT buffer for 5 min three times.
For inactivation of residual peroxidase activities, incubate in 3% H2O2 in TNT buffer for 30 min.
Note: This inactivation step is important to enhance contrast of signals. If this step is skipped, background signals remain strong as well as true-positive signals.
Wash with TNT buffer for 5 min three times.
Check the fluorescence signals for target mRNAs using a fluorescence microscope.
Note: Because the fluorescence of Alexa488-CTb becomes weak and readily extincts after hybridization and the post-hybridization wash, the tracer should be detected by immunofluorescence using anti-Alexa Fluor 488 antibody, as shown in Procedure III.
After immunofluorescence for Alexa488-CTb, counterstain with TOTO-3 (1:50 in PBS) for 20 min.
Mount sections on glass slides and observe using a fluorescence microscope.
Note: To investigate the neurochemical composition of retrogradely traced neurons, collect tiled images to cover the whole traced region (x20 magnifications, x1.3 zoom), and counted the number of positive cells having the nucleus (show TOTO-3 signal) (Figure 2).
Figure 2. Combined retrograde tracer labeling and fluorescence in situ hybridization. Alexa488-CTb is injected into the VTA and retrogradely transported to the BST. In sections containing the BST, immunofluorescence for Alexa Fluor 488 (green), fluorescence in situ hybridization for GAD mRNA (red) and counterstaining by TOTO-3 (blue) are performed. The top image is a part of tiled image used for counting (x20 magnifications, x1.3 zoom) and bottom images are higher magnification (x60 magnifications, x1.0 zoom). Neurons co-labeled for GAD mRNA and CTb (arrows) are identified as VTA-projecting GABAergic neurons. Scale bar: top, 100 μm; bottom, 30 μm.
Recipes
Saline
NaCl 9 g/L of dH2O
3.5% chloral hydrate
Chloral hydrate 1.75 g/50 ml of dH2O
0.1 M PB
To make 1 L of 0.1 M PB
Mix 2.95 g of NaH2PO4.2H2O and 29 g of Na2HPO4.12H2O
Add dH2O to 1 L and stir ~ 30 min
Store at 4 °C
5 N NaOH
NaOH 40 g/200 ml of dH2O
4% PFA
To make 1 L of PFA
Make 500 ml of 8% PFA (Solution (a))
Heat 500 ml dH2O to 80 °C (Do NOT boil)
Add 40 g of PFA powder and stir ~10 min
Add 250 μl of 5 N NaOH and keep stirring until the solution gets clear
Next, make 500 ml of 0.2 M PB (Solution (b)) in another beaker
Mix 2.95 g of NaH2PO4.2H2O and 29 g of Na2HPO4.12H2O
Add dH2O to 500 ml and stir ~ 30 min
Mix solution (a) and solution (b) and stir ~5 min
Filtrate and store at 4 °C
PBS
To make 1 L of 10x PBS stock solution
Mix 87 g of NaCl, 3.1 g of NaH2PO4.2H2O and 28.7 g of Na2HPO4.12H2O
Add dH2O to1 L and stir ~ 2 h
Store at RT
Dilute this 10x stock solution by 1/10 using dH2O
20% Tween-20
Mix 20 ml of Tween-20 with 80 ml of ddH2O by stirring
Store at 4 °C
PBS containing 0.1% Tween-20 (PBS-T)
Add 2.5 ml of 20% Tween-20 with 500 ml of PBS
Store at RT
0.25% acetic anhydrate in 0.1 M triethanolamine-HCl (pH 8.0)
To make 100 ml of acetylation solution
Mix triethanolamine-HCl with 100 ml of dH2O by stirring
Add 950 μl of 5 N NaOH and make sure that pH is 8.0
Add 250 μl of acetic anhydride (*add just before use) and stir ~3 min
1 M Tris-HCl (pH 7.4 or 8.0)
To make 1 L of Tris-HCl buffer
Mix 121.1 g of Tris base (tris(hydroxymethyl)aminomethane) with 800 ml of dH2O
pH to 7.4 or 8.0 with HCl
Add dH2O to 1 L
Autoclave and then store at RT
5 M NaCl
To make 1 L of 5 M NaCl
Mix 292.2 g of NaCl with 800 ml of dH2O by stirring
Add dH2O to 1 L and stir until they dissolve completely
Autoclave and then store at RT
0.5 M ethylenediaminetetraacetic acid (EDTA)
To make 500 ml of 0.5 M EDTA
Mix 93.1 g of EDTA with 400 ml of dH2O
pH to 8.0 with 5 N NaOH
Add dH2O to 500 ml
Autoclave and then store at RT
Hybridization buffer
To make 500 ml of hybridization buffer
Autoclave two 500 ml beakers; one is filled with 250 ml of dH2O and another is empty
After beakers cool down, pour 80 ml of autoclaved dH2O and 250 ml of formamide into the empty beaker
Add reagents described on the following table
ReagentQuantity
1 M Tris-HCl (pH 8.0)
16.5 ml
tRNA
100 mg
100x Denhardt's*
5 ml
5M NaCl
60 ml
0.5 M EDTA
1 ml
NLS
0.5 g
Dextran sulfate
50 g
*100x Denhardt's
Reagent
Quantity (for 50 ml)
Final concentration (100x)
Ficoll
1 g
2% (w/v)
polivinylpyrrolidone
1 g
2% (w/v)
BSA
1 g
2% (w/v)
dH2O
to 50 ml
Add autoclaved dH2O to 500 ml and then dissolve on shaking for ~24 h.
Filtrate and then store at -30 °C.
Standard saline citrate (SSC)
To make 1 L of 20x SSC stock solution
Mix 175.3 g of NaCl and 88.2 g of sodium citrate
Add dH2O to1 L and stir ~ 2 h
Autoclaved and then store at RT
Dilute this 20x stock solution as described on the following table
5x SSC
(for 1 L)
0.1x SSC
(for 1 L)
Formamide 1
(for 150 ml)
Formamide 2
(for 150 ml)
20x SSC
250 ml
5 ml
30 ml
15 ml
20% Tween-20
25 μl
25 μl
7.5 μl
7.5 μl
formamide
--
--
75 ml
75 ml
dH2O
to 1 L
to 1 L
to 150 ml
to 150 ml
Store at RT
NaCl-Tris-EDTA (NTE) buffer
To make 1 L of NTE buffer
Mix 100 ml of 5 M NaCl, 10 ml of 1 M Tris-HCl (pH 8.0), 10 ml of 0.5 M EDTA and 25 μl of 20% Tween-20
Add dH2O to1 L and store at RT
Tris-NaCl-Tween (TNT) buffer
To make 1 L of TNT buffer
Mix 30 ml of 5 M NaCl, 100 ml of 1 M Tris-HCl (pH 7.4) and 25 μl of 20% Tween-20
Add dH2O to1 L and store at RT
20 mM iodoamide in NTE buffer
Iodoacetamide 0.37 g/100 ml of NTE buffer
DIG blocking solution
Normal sheep serum: 10% blocking reagent*: TNT buffer = 1:1:8
*10% blocking reagent (for 10 ml)
Prepare maleic acid buffer
To make 500 ml of maleic acid buffer
Mix 58.1 g of maleic acid and 43.9 g of NaCl with 400 ml of dH2O
pH to 7.5 with 5 N NaOH
Dissolve 1 g of blocking reagent to 10 ml with the maleic acid buffer with shaking and heating
Autoclave and then store at -80 °C
0.5% TSA blocking solution
Add 0.5 g of blocking reagent to 100 ml of TNT buffer
To dissolve the blocking reagent, heat to 60 °C for 1 h with stirring
Store at -20 °C
Cy3-TSA amplification solution
Add 60 μl of DMSO to Cy3 Amplification Reagent (Cy3 solution; store at 4 °C)
Dilute this Cy3 solution in 1x Plus Amplification Diluent (1:200)
Acknowledgments
This protocol is adapted from Kudo et al. (2012).
References
Kudo, T., Uchigashima, M., Miyazaki, T., Konno, K., Yamasaki, M., Yanagawa, Y., Minami, M. and Watanabe, M. (2012). Three types of neurochemical projection from the bed nucleus of the stria terminalis to the ventral tegmental area in adult mice. J Neurosci 32(50): 18035-18046.
Yamasaki, M., Matsui, M. and Watanabe, M. (2010). Preferential localization of muscarinic M1 receptor on dendritic shaft and spine of cortical pyramidal cells and its anatomical evidence for volume transmission. J Neurosci 30(12): 4408-4418.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Kudo, T. and Watanabe, M. (2013). Retrograde and Anterograde Tracing of Neural Projections. Bio-protocol 3(16): e870. DOI: 10.21769/BioProtoc.870.
Kudo, T., Uchigashima, M., Miyazaki, T., Konno, K., Yamasaki, M., Yanagawa, Y., Minami, M. and Watanabe, M. (2012). Three types of neurochemical projection from the bed nucleus of the stria terminalis to the ventral tegmental area in adult mice. J Neurosci 32(50): 18035-18046.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Animal model
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Laser Capture Microdissection (LCM) of Human Skin Sample for Spatial Proteomics Research
Qiyu Zhang [...] Ling Leng
Mar 5, 2023 929 Views
In vivo Electroporation of Skeletal Muscle Fibers in Mice
Steven J. Foltz [...] Hyojung J. Choo
Jul 5, 2023 497 Views
Cochlear Organ Dissection, Immunostaining, and Confocal Imaging in Mice
Chenyu Chen [...] Dongdong Ren
Jan 20, 2025 1598 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
871 | https://bio-protocol.org/en/bpdetail?id=871&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative Methylation Specific PCR (qMSP)
TL Triantafillos Liloglou
GN Georgios Nikolaidis
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.871 Views: 34176
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Nov 2012
Abstract
Detection of low copies of methylated DNA targets in clinical specimens is challenging. The quantitative Methylation-Specific PCR (qMSP) assays were designed to specifically amplify bisulphite-converted methylated DNA target sequences in the presence of an excess of unmethylated counterpart sequences. These qMSP assays are real-time PCR assays utilizing, sequence-specific primers and an intervening, also sequence specific, Taqman probe to cover an amplicon of approximately 100 bp in length. The use of Taqman probes bearing a minor groove binding (MGB) allow for the use of shorter probes and therefore facilitate design and significantly increases the analytical specificity of the reaction. In the context of the biomarker discovery program of the Liverpool Lung Project (LLP), ten gene promoters were selected. qMSP assays were developed, validated and used to screen 655 bronchial washings from patients with lung cancer and age/sex matched controls with non malignant lung disease (Nikolaidis et al., 2012).
Materials and Reagents
TaqMan® Universal Master Mix II no UNG (Life Technologies, catalog number: 4440039 )
TaqMan MGB probes (custom synthesis) (Life Technologies)
EZ DNA Methylation-GoldTM kit (ZymoResearch, catalog number: D5006 )
The methylation-specific primer and probe sequences (see Recipes)
Equipment
PCR cabinet
PCR plates
Centrifuge (Sigma-Aldrich)
PCR thermal cycler (Life Technologies/Applied Biosystems, model: 9700 )
Real time PCR machine (Life Technologies/Applied Biosystems, model: 7500 FAST )
Procedure
Primer/probe design
Note: Primer/probe design is of major importance for the specificity of the reaction, i.e. to amplify only methylated bisulphite-converted target in the presence of excess unmethylated target. The primers should include 3-5 CG dinucleotides. The inclusion of at least two such CGs within the six 3’ end of the primer significantly increases specificity. This is in addition to the usual rules on primer stability, GC content and secondary structure avoidance apply in real time PCR assay design.
One μg DNA was converted by sodium bisulphite using the EZ DNA Methylation-GoldTM kit and following the supplier’s protocol but eluting in 50 μl elution buffer (instead of the recommended 10 μl).
The qMSP reactions contained 1x TaqMan® Universal Master Mix II non-UNG, 250 nM probe, 300-900 nM primers (Table 1) and 2 μl eluate from the bisulphite treated DNA sample.
Note: The primer concentration is an important determinant of analytical sensitivity/specificity and has to be ascertained experimentally In other words the analytical sensitivity threshold is set to the dilution that has an overlapping 95% Confidence Interval with the unmethylated control reaction. In practical terms, the highest sensitivity one can use is the one that is always at least 2 ΔCt. lower than the unmethylated control.
Table 1. Primer-probe concentrations for oligo mixes
Primer/probe mix
Final concentration (nM)
Fwd primer
Rev Primer
Probe
p16
700
700
250
TERT
250
250
250
RASSF1
700
700
250
TMEFF2
900
900
250
CYGB
300
300
250
RARb
500
500
250
DAPK1
250
250
250
p73
250
250
250
WT1
750
750
250
CDH13
250
250
250
ACTB
900
900
250
PCR plates were sealed and span at 4,000 x g for 1 min prior to be placed in the thermal cycler in order to bring all the reaction volume to the bottom and ensure removal of bubbles from the reaction mix.
The reactions were performed in duplicate on a 7500 FAST real time cycler under the following thermal profile: 95 °C for 10 min activation step followed by 50 cycles consisted of denaturation at 95 °C for 15 sec, annealing and extension at 58 °C–65 °C (Table 2, depending on the assay) for 1 min.
Table 2. Annealing information for qMSP optimised conditions
Genes
Annealing temp (°C)
Time (sec)
p16
60
60
RASSF1
60
60
CYGB
64
5
61
55
RARB
65
5
62
55
TERT
65
5
62.5
55
WT
62
60
ACTB
58
20
60
40
CDH13
64
5
61
55
DAPK
65
5
62.5
55
P73
65
5
62.5
55
TMEFF
58
20
60
40
Recipes
The methylation-specific primer and probe sequences are listed in Table 3. In the initial steps of assay development it became apparent that probes bearing minor groove binding moiety (Taqman MGB probes) provided significantly higher assay specificity. In addition, due to their smaller size, they allow for a more flexible assay design.
Table 3. Nucleotide sequences of methylation specific primers and probes for the qMSP assays utilised in the BW screening. The ACTB assay is methylation-independent acting as DNA input control.
Primer/probe name
Sequence 5’ →3’
Modification
p16meth_F
GGAGGGGGTTTTTTCGTTAGTATC
p16meth_R
CTACCTACTCTCCCCCTCTCCG
p16meth_P
AACGCACGCGATCC
FAM-MGB
RASSF1meth_F
GTGGTGTTTTGCGGTCGTC
RASSF1meth_R
AACTAAACGCGCTCTCGCA
RASSF1_P
CGTTGTGGTCGTTCG
FAM-MGB
TMEFF2meth_F
GGAGAGTTAAGGCGTTTCGTAGTTC
TMEFF2meth_R
CGTGGGAAGAGGTAGTCGGG
TMEFF2meth_P
GTTTTTAGTTCGTTCG
FAM-MGB
TERTmeth_F
TTGGGAGTTCGGTTTGGTTTC
TERTmeth_R
CACCCTAAAAACGCGAACGA
TERTmeth_P
AGCGTAGTTGTTTCGG
FAM-MGB
CYGBmeth_F
GTGTAATTTCGTCGTGGTTTGC
CYGBmeth_R
CCGACAAAATAAAAACTACGCG
CYGBmeth_P
TGGGCGGGCGGTAG
FAM-MGB
RARbmeth_F
GATTGGGATGTCGAGAACGC
RARbmeth_R
ACTTACAAAAAACCTTCCGAATACG
RARbmeth_P
AGCGATTCGAGTAGGGT
FAM-MGB
DAPK1meth_F
CGAGCGTCGCGTAGAATTC
DAPK1meth_R
ACCCTACAAACGAACTAACGACG
DAPK1meth_P
AGCGTCGGTTTGGTAG
FAM-MGB
p73meth_F
TTGTTTTTTGGATTTTAAGCGTTTC
p73meth_R
CACCCGAATCTCTCCTAACCG
p73meth_P
TAACGCTAAACTCCTCG
FAM-MGB
WT1meth_F
GAGGAGTTAGGAGGTTCGGTC
WT1meth_R
CACCCCAACTACGAAAACG
WT1meth_P
AGTTCGGTTAGGTAGC
FAM-MGB
CDH13meth_F
CGTGTATGAATGAAAACGTCGTC
CDH13meth_R
CACAAAACGAACGAAATTCTCG
CDH13meth_P
CGTTTTTAGTCGGATAAAA
FAM-MGB
ACTBmgb_F
GGGTGGTGATGGAGGAGGTT
ACTBmgb_R
TAACCACCACCCAACACACAAT
ACTBmgb_P
TGGATTGTGAATTTGTGTTTG
VIC-MGB
Cycle threshold (Ct) values for each target were normalized for DNA input by calculating the ΔCt=Ct(Target)-Ct(ACTB). The values for al samples were transformed to relative quantity (RQ) compare to the calibrator (0.5% standard methylated DNA dilution) included in all experiments using the following type:
RQsample = 2-ΔΔCt, whereΔΔCt = ΔCtsample - ΔCtcalibrator.
Note: qMSP is a challenging version of real-time PCR and one needs to gain a very good understanding of the latter prior to engaging in qMSP experiments. The main additional challenge is the use of bisulphite DNA which is of lower quality but most importantly of lower complexity. This significantly affects the thermodynamic behavior of this template in the reaction. The authors are very happy to provide assistance to colleagues if needed; please email Dr. T Liloglou ([email protected]).
Acknowledgments
This protocol is adapted from Nikolaidis et al. (2012).
References
Liloglou, T., Bediaga, N. G., Brown, B. R., Field, J. K. and Davies, M. P. (2012). Epigenetic biomarkers in lung cancer. Cancer Lett 342(2): 200-212.
Nikolaidis, G., Raji, O. Y., Markopoulou, S., Gosney, J. R., Bryan, J., Warburton, C., Walshaw, M., Sheard, J., Field, J. K. and Liloglou, T. (2012). DNA methylation biomarkers offer improved diagnostic efficiency in lung cancer. Cancer Res 72(22): 5692-5701.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Liloglou, T. and Nikolaidis, G. (2013). Quantitative Methylation Specific PCR (qMSP). Bio-protocol 3(16): e871. DOI: 10.21769/BioProtoc.871.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays > DNA structure and alterations
Systems Biology > Epigenomics > DNA methylation
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Genomic 8-oxo-7,8-dihydro-2'-deoxyguanosine Quantification
Antonio Sarno
Sep 5, 2013 8544 Views
End-synapsis Assay
Jessica Cottarel and Patrick Calsou
Sep 20, 2013 8184 Views
Nucleosome Positioning Assay
Zhongliang Zhao and Holger Bierhoff
May 20, 2017 11067 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
872 | https://bio-protocol.org/en/bpdetail?id=872&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Radiolabeled Poliovirus Particles from H1 HeLa Cells
AR Alexsia Richards
WJ William Jackson
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.872 Views: 7653
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Nov 2012
Abstract
The following protocol describes the isolation of radioactive viral and subviral particles from infected cells. This protocol has been written for isolation of poliovirus particles from H1 HeLa cells. Infection protocol and timing of [35S] methionine labeling and particle collection should be tailored to the virus of interest. Following isolation of the viral particles, the viral proteins present in these particles may be separated by gel electrophoresis and visualized by autoradiography.
Materials and Reagents
H1 HeLa cells
Poliovirus
Sucrose (Life Technologies, InvitrogenTM, catalog number: 15503-022 )
Methionine free DMEM (Life Technologies, Gibco®, catalog number: 21013 )
MEM (Life Technologies, Gibco®, catalog number: 11095-080 )
[35S] Methionine (PerkinElmer, catalog number: NEG772002MC )
Mineral oil (Sigma-Aldrich, catalog number: M5904 )
SDS-PAGE gel
Nonidet P-40 (NP-40) (Sigma-Aldrich, catalog number: N-6507 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P3075-1G )
40 U RNAsin® Ribonuclease Inhibitor (Promega Corporation, catalog number: N2111 )
4x Laemelli loading buffer
Tris buffer (see Recipes)
Lysis buffer (see Recipes)
Gel Fixative (see Recipes)
Phosphate Buffered Saline (PBS) (see Recipes)
PBS+ (see Recipes)
Equipment
Centrifuge tubes (Beckman Coulter, catalog number: 344059 )
1.5 ml Eppendorf tubes
Peristaltic Pump (Bio-Rad Laboratories, model: 731-9001EDU )
Ultracentrifuge (Beckman Coulter, model: Optima L-90K )
SW41 Ti rotor (Beckman Coulter, model: 331362 )
Fraction collection system (Beckman Coulter, catalog number: 270-331580 )
Gradient maker (Biocomp Gradient Master, model: 107 )
Liquid scintillation counter (Beckman Coulter, model: LS6000IC )
Gel dryer (Bio-Rad Laboratories, model: 583 )
Procedure
Isolation of viral and subviral particles
Infect adherent cells in 10 cm dish at a MOI of 50. The virus should be diluted in 500 μl of PBS+. Incubate cells with virus alone for 30 min at 37 °C prior to the addition of 8 ml MEM. Cells should be approximately 80% confluent at the time of infection.
Prepare [35S] methionine-DMEM by adding 100 μCi [35S] methionine per milliliter of methionine free DMEM.
At 3 h post-infection remove media from cells, add 3 ml methionine free DMEM to cells then remove. Repeat this process for two additional washes, then add 6 ml of the [35S] methionine DMEM prepared in step A-2 to cells.
At desired collection time points, remove [35S] methionine DMEM from cells. Wash cells 3x with 3 ml PBS and add 1 ml of lysis buffer to the plate. Remove the cells from the plate by pipetting up and down several times. Then transfer the lysate (cells & lysis buffer) to a 1.5 ml tube.
Remove nuclei from this lysate by centrifugation at 4,500 x g for 10 min at 4 °C (store lysate on ice until it is added to the gradient).
Prepare 15% (w/v) and 30% (w/v) sucrose solutions using Tris buffer.
Follow gradient maker instructions for pouring a 15-30% sucrose gradient.
Apply 500 μl of lysate to the top of the gradient. Add approximately 200 μl of mineral oil over the radiolabeled lysate.
Spin tube in ultracentrifuge for 3 h at 27,500 rpm, 15 °C. The ultracentrifuge should be programmed for slow acceleration and deceleration with no brake.
Place tube in fraction collection system.
Turn on pump, to begin pumping air on top of the gradient. Immediately puncture the tube to allow sucrose to flow out of the bottom of the centrifuge tube.
Collect 0.5 ml fractions from the gradient into 1.5 ml tubes. The entire gradient should be collected. Fractions may be stored at -20 °C for up to one year.
Determine radioactivity in fractions using a liquid scintillation counter.
Visualization of labeled proteins in fractions
Mix 15 μl of each fraction with 5 μl of 4x Laemelli loading buffer.
Heat sample to 95 °C.
Separate proteins by SDS-PAGE using a 12% SDS-acrylamide gel.
Fix gel overnight in gel fixative at room temperature with shaking.
Dry gel using gel dryer.
Visualize proteins using standard autoradiography techniques.
Recipes
Tris buffer
10 mM Tris (pH 7.4)
10 mM NaCl
1.5 mM MgCl2
Lysis buffer
10 ml Tris Buffer
1% NP-40
1 μM PMSF
40 U RNAsin
Gel Fixative
50% methanol
10% acetic acid in distilled H2O
PBS (makes 1 L)
137 mM NaCl
2.7 mM KCl
10 mM Na2HPO4
1.8 mM KH2PO4
Dissolve reagents in 800 ml ddH2O, adjust pH to 7.5, and then add ddH2O to 1 L.
To prepare PBS+ add 1 mM CaCl2.2H2O and 0.5 mM MgCl2.6H2O.
Acknowledgments
This protocol is adapted from Richards and Jackson (2012).
References
Richards, A. L. and Jackson, W. T. (2012). Intracellular vesicle acidification promotes maturation of infectious poliovirus particles. PLoS Pathog 8(11): e1003046.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Preparation of Respiratory Syncytial Virus with High or Low Content of Defective Viral Particles and Their Purification from Viral Stocks
Yan Sun and Carolina B. López
May 20, 2016 17071 Views
Purification and Identification of Novel Host-derived Factors for Influenza Virus Replication from Human Nuclear Extracts
Kenji Sugiyama and Kyosuke Nagata
Sep 20, 2016 9943 Views
Selective Isolation of Retroviruses from Extracellular Vesicles by Intact Virion Immunoprecipitation
Tyler Milston Renner [...] Marc-André Langlois
Sep 5, 2018 10522 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
873 | https://bio-protocol.org/en/bpdetail?id=873&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bioassay to Screen Pathogenesis-associated Genes in Alternaria brassicicola
YC Yangrae Cho
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.873 Views: 7728
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Oct 2012
Abstract
Alternaria brassicicola is a necrotrophic fungus that causes black spot disease of most plants in the Brassicaceae, including cultivated Brassica species and weedy Arabidopsis species. Since the concept of transformation constructs of linear minimal elements was developed (Cho et al., 2006), we have produced over 200 strains of loss-of-function mutants with an aid of selectable marker genes. Pathogenicity assays are a time-consuming step in screening pathogenesis-associated genes among targeted gene mutants. Here we describe a method for pathogenesis assays of A. brassicicola. Using this method, we have discovered pathogenesis-associated genes and were able to further characterize the functions of selected gene (Cho et al., 2013; Cho et al., 2012; Srivastava et al., 2012).
Materials and Reagents
Host plants (Brassica oleraceae and Arabidopsis thaliana)
Fungal conidia (Alternaria Brassicicola)
Potato dextrose agar (PDA)
Miracle-Gro (The Scotts Company LLC, U.S.A.) It is a nitrogen based fertilizer. Any fertilizer would work
PDA with 30 ng/ml Hygromycin B (see Recipes)
Equipment
Centrifuge (Eppendorf, model: 5180R or equivalent)
Water spray bottle
Hemocytometer
Sterile 50 ml tubes with screw caps
Tube holder(s) for 50 ml-sized tubes
Miracloth (Calbiochem, catalog number: 475855 )
Funnel for filtration of conidia
Glass “hockey stick” for conidial harvest
Petri plates
Petri dish
Fluorescence light, 30 W household lights
Procedure
Preparation of host plants
Fill a plastic pot (3 inch x 3 inch) with a mix of half local soil and half commercially available potting mix; pack the soil by pushing on the top by hand or using a flat plate.
Note: Do not autoclave soil mix.
Place 24 pots containing the soil in a plastic tray with small drainage holes in the bottom. Soak the soil with tap water by gently sprinkling it with water. Gentle sprinkling will keep the soil from spilling out of the pot. Let excess water drain from the soil for about 2 h.
Use a stick to make a hole about 1-cm deep in the soil of each pot.
Put one seed of commercially available (e.g., Jonny’s, Winslow, ME) green cabbage (Brassica oleracea) in the hole and cover with soil. For Arabidopsis thaliana, broadcast several seeds on top of the soil and spray water later; gradually remove all but one plant from each pot during growth.
Place the pots at room temperature under fluorescence light with a 14-h light, 10-h dark cycle for the green cabbage, and a 10-h light, 14-h dark cycle for Arabidopsis. The seeds will take about one week to germinate at room temperature. If the tray is covered with semi-transparent plastic cover, they germinate faster.
Grow the plants for 5 to 6 weeks under the same conditions. Keep the soil moist by adding tap water when the soil surface becomes dry.
Note: Do not overwater or leave the pot sitting in a water-filled tray.
(Optional) If seedlings 4 weeks old or older show symptoms of nitrogen deficiency (yellowing of older leaves), dissolve 1 teaspoon of Miracle-Gro in 1 gallon of water. Pour about 70 ml of the solution or enough amounts to soak the soil in each of 48 pots. Similar nitrogen-based fertilizer would have similar effects.
A-1 (Option 1) Detached leaf assay. Bioassays are more convenient with detached leaves than whole plants. It is easy to inoculate and measure the size of lesions on detached leaves. In addition, this method requires less space than the other method.
Select 6-week-old cabbage plants of similar heights and with similar-sized leaves for each assay. Harvest healthy leaves from the 4th to 8th position on the stem, counting from the bottom.
Place two disks of paper towel covering the bottom of a Petri dish 150 mm diameter x 15 mm high. Soak the disks with deionized water, creating a mini-moist chamber.
Remove the waxy surface of each leaf by misting with water from a spray bottle. Do not touch the surface of the leaves with bare hands, which results in bigger lesions than usual for the wild type. In addition, nonpathogenic mutants of a gene became pathogenic in our previous work. Place leaves in the mini-moist chambers and randomly arrange them on a laboratory bench for the assay.
After inoculation, cover the Petri dish with a lid to keep the relative humidity close to 100%.
Note: This assay can be performed with various cabbage species and varieties. Leaves of Arabidopsis thaliana, however, are too thin for this procedure.
A-2 (Option 2) Whole plant assay. I did not encounter any mutants that showed significant differences in the results of bioassays between detached leaves and whole plants. I, however, anticipate identifying genes with mutants showing different results. I recommend to perform assays three times on detached leaves and twice on whole plants.
Line a semi-transparent plastic trough (90 cm x 50 cm x 50 cm or similar size) with water-soaked paper towels and mist the inside wall of the trough with water.
Place potted plants in the plastic trough. Any Brassica species or ecotypes of A. thaliana are suitable for whole plant assays.
After inoculation, seal the troughs and plants with plastic wrap to keep the relative humidity close to 100%. Plastic wrap can be purchased at most grocery stores. Keep the trough and plants at room temperature for about a week with periodic observation of lesion development.
Inoculum preparation
Perform two rounds of single-spore isolation for each strain of A. brassicicola. Harvest conidia from the second single-spore isolation in ~3 ml of 20% glycerol. Dispense 50 μl of the glycerol plus conidia (glycerol stock of conidia) into 1.5 ml aliquot tubes. Freeze and maintain the glycerol stock at -80 °C until use. Harvest conidia from PDA plates in a biosafety cabinet to protect researchers and prevent environmental contamination.
Transfer 10 μl of the glycerol stock to a fresh PDA plate with an appropriate selection reagent in a biosafety cabinet.
Incubate plates in the dark for 5 days at 25 °C in a growth chamber. This can be done in a light-tight cardboard box at room temperature.
In a biosafety cabinet, add 5 ml of sterile water to each plate and gently rub the conidial mat with a sterilized glass hockey stick. If the conidia are released gently, aerial hyphae will not contaminate the conidial suspension and you can proceed directly to the next step. If the suspension contains too many hyphal fragments or chains or clumps of conidia, however, it will be necessary to filter the suspension through a layer of Miracloth or cheese cloth until most are removed. A funnel can be used at this step.
Transfer the 3-5 ml of conidia suspended in water to a 50 ml conical tube with a cap. Fill the tube with sterile water.
Centrifuge the tube for 5 min at 3,000 rpm. If a centrifuge is not available, leave the tube on the bench until conidia precipitate. It takes about 15 min.
Replace the water with 50 ml of fresh sterile water and centrifuge for 5 min at 3,000 rpm. Floating water can be removed either by draining or pipetting. The tube can be filled by carefully pouring 50 ml of water.
Count the conidia under a microscope using a hemocytometer. Always agitate the conidial suspension rigorously before loading the hemocytometer.
Repeat step B-6.
Adjust the conidial concentration to 2 x 105 in 1 ml water. Count the number of spores to confirm the concentration. This is a time-consuming process and requires experience. An approximate spore count is usually sufficient for identifying genes that are required for pathogenicity or greatly affect virulence. Accurate quantification of virulence changes requires accurate spore counting. Pathogenicity factor mutants are normally nonpathogenic regardless the numbers of conidia.
Directly inoculate the right side of each leaf with conidial suspension (2,000 conidia in 10 μl of water) of wild-type A. brassicicola and the left side of the same leaf with 2,000 conidia of the experimental mutant strain in 10 μl water. This method aligns the control and experimental specimen in a symmetrical manner on both sides of the central vein. It is important to agitate the inoculum frequently or the internal variation in lesion size will increase. Do not make wound before inoculation. Nine leaves originated in three plants are sufficient to produce statistically robust results. I recommend at least three rounds of bioassay to get reliable and consistent results. Plant conditions and age of conidia are important factors that affect the result of assays.
Spray the inside of the Petri dish lid with water and cover the dish.
Incubate the whole plants in the plastic trough or detached leaves Petri dish inoculated with fungal strains for 5 days at room temperature. Keep the light and dark cycle similar to the one used for plant growth.
Measure lesion diameters at 5 days postinoculation. Calculate the virulence of each mutant relative to the wild type using the formula (∑(Dmi-Dwi)/∑(Dwi)) x 100, where Dwi is the lesion diameter created by the wild type for the ith sample and Dmi is the lesion diameter created by the mutant for the ith sample.
Analyze lesion sizes among the wild type and mutants using various statistics methods, such as the Student t-test, two-way analysis of variance (ANOVA) in Excel or in the Statistical Analysis System (SAS Institute, Cary, NC).
Recipes
PDA with 30 ng/ml Hygromycin B
Add 19.5 g of potato dextrose agar in 500 ml water
Shake and mix the powder and autoclave it for 20 min
Cool down the PDA broth to 50 °C
Add 300 μl of 50 mg/ml hygromycin B and mix well
Pour in 90 mm x 15 mm Petri dish
Acknowledgments
This protocol is adapted from previously published papers (Cho et al., 2013; Cho et al., 2012; Srivastava et al., 2012).
References
Cho, Y., Ohm, R. A., Grigoriev, I. V. and Srivastava, A. (2013). Fungal-specific transcription factor AbPf2 activates pathogenicity in Alternaria brassicicola. Plant J 75(3): 498-514.
Cho, Y., Davis, J. W., Kim, K. H., Wang, J., Sun, Q. H., Cramer, R. A., Jr. and Lawrence, C. B. (2006). A high throughput targeted gene disruption method for Alternaria brassicicola functional genomics using linear minimal element (LME) constructs. Mol Plant Microbe Interact 19(1): 7-15.
Cho, Y., Srivastava, A., Ohm, R. A., Lawrence, C. B., Wang, K. H., Grigoriev, I. V. and Marahatta, S. P. (2012). Transcription factor Amr1 induces melanin biosynthesis and suppresses virulence in Alternaria brassicicola. PLoS Pathog 8(10): e1002974.
Srivastava, A., Ohm, R. A., Oxiles, L., Brooks, F., Lawrence, C. B., Grigoriev, I. V. and Cho, Y. (2012). A zinc-finger-family transcription factor, AbVf19, is required for the induction of a gene subset important for virulence in Alternaria brassicicola. Mol Plant Microbe Interact 25(4): 443-452.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Cho, Y. (2013). Bioassay to Screen Pathogenesis-associated Genes in Alternaria brassicicola. Bio-protocol 3(16): e873. DOI: 10.21769/BioProtoc.873.
Cho, Y., Srivastava, A., Ohm, R. A., Lawrence, C. B., Wang, K. H., Grigoriev, I. V. and Marahatta, S. P. (2012). Transcription factor Amr1 induces melanin biosynthesis and suppresses virulence in Alternaria brassicicola. PLoS Pathog 8(10): e1002974.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vivo model > Plant
Microbiology > Microbial cell biology > Cell isolation and culture
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
An Assay to Study Botrytis cinerea-infected Grapevine Leaves Primed with Pseudomonas fluorescens
Charlotte Gruau [...] Aziz Aziz
Oct 5, 2016 11729 Views
Assessment of Wheat Resistance to Fusarium graminearum by Automated Image Analysis of Detached Leaves Assay
Alexandre Perochon and Fiona M. Doohan
Dec 20, 2016 11299 Views
Quantification of the Composition Dynamics of a Maize Root-associated Simplified Bacterial Community and Evaluation of Its Biological Control Effect
Ben Niu and Roberto Kolter
Jun 20, 2018 8589 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
874 | https://bio-protocol.org/en/bpdetail?id=874&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ultra-low Background DNA Cloning System
Yukio Nagano
KG Kenta Goto
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.874 Views: 17506
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS ONE Feb 2013
Abstract
We have developed a method to clone DNA fragments into the E. coli plasmid vectors with almost 100% efficiency (Goto and Nagano, 2013). This method is based on highly efficient yeast-based in vivo cloning, and the subsequent cloning of the constructed plasmids into E. coli. Our method is useful for various applications: multifragment DNA cloning, cloning of large DNA fragments, and cloning into large plasmid vectors. Furthermore, the sites at which DNA fragments are joined are not always located at the restriction ends in the plasmid vector, thus making the cloning method more flexible. Our system does not require manipulation for assembling or joining DNA fragments in a test tube, the efficiency of which may sometimes depend on the reaction conditions or the skills of the person performing the procedure. Therefore, both success rate and efficiency are extremely high. However, our system has a disadvantage in that it requires 2 steps for transformation. Our method is an improved version of previously developed methods (Iizasa and Nagano, 2006; Nagano et al., 2007). Next figure shows the flowchart of our method.
Keywords: Plasmid Vector Gene manipulation Yeast E. coli
Figure 1. Flowchart of our method
Materials and Reagents
Plasmids/nucleic acids
Plasmid pSU32 (http://www.iac.saga-u.ac.jp/lifescience/su32/index.htm) (Figure 2)
Figure 2. Plasmid pSU32
E. coli plasmid vector containing the Ampr gene (bla gene) (e.g., pUC, pBluescript, and the other many types of commonly-used plasmid vectors)
DNA fragment to be cloned
PCR primers (the pSU30-14 and pSU30-23 pair for the preparation of the conversion cassette SU32, and primer pair for the preparation of the DNA fragment to be cloned)
the primer pair for the preparation of the conversion cassette SU32
pSU30-14
5'-CAGGTGGCACTTTTCGGGGAAATGTG-3'
pSU30-23
5'-ATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGA
AGTTTTAAATCAATCTAAAGTATATATGAGTAAACT-3'
Example: Primer pair for the preparation of the DNA fragment to be cloned
(in this case, the GFPuv gene was cloned into pUC19 plasmid. The crossover regions (the sequences to be joined) are underlined).
pUCGFPF
5'-GAGCGGATAACAATTTCACACAGGAAACAGCTATGGCTAGCA
AAGGAGAAGAACT-3'
pUCGFPR
5'-TTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTTATTTG
TAGAGCTCATCCA-3'
Kits
(Optional) PCR Purification kit
In our paper (Goto and Nagano, 2013), we used the MonoFas DNA Purification Kit I (GL Sciences, Tokyo, Japan). However, this kit currently does not work well in our laboratory. Instead, we are now using the NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, Düren, Germany).
Plasmid DNA purification kit for E. coli
We used a Mini-M Plasmid DNA Extraction System (Viogene, Taipei, Taiwan) (Goto and Nagano, 2013).
Suspension buffer (in the case of Mini-M Kit, we use 200 μl of MX1 buffer)
Enzymes
Proofreading DNA polymerase such as Prime STAR GXL DNA Polymerase (TAKARA BIO, Ohtsu, Japan)
Restriction enzymes (New England Biolabs)
Cells
Yeast cells (commonly used strains containing the genotype trp1, such as YPH499)
Electro-competent E. coli cells
We used the E. coli HST08 Premium Electro-Cells (TAKARA BIO, Ohtsu, Japan) (Goto and Nagano, 2013). However, these cells currently do not work well in our laboratory. Instead, we are now making electrocompetent cells ourselves according to Molecular Cloning (4th edition, pages 177-182).
Plates
LB agar containing 100 μg/ml ampicillin (Molecular Cloning, 4th edition, page 1100)
Synthetic complete plates lacking tryptophan (The Gietz Lab, University of Manitoba, http://home.cc.umanitoba.ca/~gietz/ or Gietz and Woods, 2002)
Ampicillin (sodium salt)
Others
Plating beads
Acid-washed glass beads (350-500 μm)
We are making acid-washed glass beads ourselves. However, Acid-washed glass beads (425–600 μm) can be obtained from SIGAMA-ALDRICH (catalog number: G8772).
Agarose gel (Molecular Cloning, 4th edition, pages 94-98)
Materials and Reagents required for yeast transformation (The Gietz Lab, University of Manitoba, http://home.cc.umanitoba.ca/~gietz/ or Gietz and Woods, 2002)
Equipment
Thermal Cycler
Agorose gel electrophoresis device
Centrifuge
Optional: Picofuge
Incubators (30 °C and 37 °C)
Vortex machine
Optional: FastPrep FP100A (MP Biomedical)
Heat block (70 °C)
Electroporation device and cuvette
Polyacrylamide gel electrophoresis devices
Glass beads (350-500 μm)
Procedure
Preparation of conversion cassette SU32
Prepare the conversion cassette SU32 by PCR using a plasmid pSU32 as template. To obtain this template, visit the following webpage.
http://www.iac.saga-u.ac.jp/lifescience/su32/index.htm
For PCR amplification, the primer pair was pSU30-14 and pSU30-23 (40 cycles of 98 °C for 10 sec, 55 °C for 15 sec, and 68 °C for 75 sec using Prime STAR GXL DNA Polymerase) (Goto and Nagano, 2013). When we conduct the PCR reaction, we use Prime STAR GXL DNA Polymerase, but you can use the other proofreading DNA polymerases.
Note: Although we purified the amplified conversion cassette in our paper (Goto and Nagano, 2013), this purification step is not essential (purification is required for DNA quantification).
Confirm the amplification by 1% agarose gel electrophoresis. The amplicon size is about 2.7 kb (2,651 bp) (Figure 3).
Figure 3. Conversion cassette SU32
Preparation of the linearized E. coli plasmid vector
Digest the E. coli plasmid vector within the crossover region by using restriction enzyme.
Notes:
The required restriction ends can be located anywhere within the crossover regions of the vector. You can use both blunt-end restriction enzyme and sticky-end restriction enzyme, because restriction ends are not positions where joining reactions occur.
This E. coli plasmid vector must contain the Ampr gene.
PCR amplification of the E. coli plasmid vector is another way to prepare the linearized E. coli plasmid vector.
Although we purified the digested plasmid in our paper (Goto and Nagano, 2013), this purification step is not essential.
Confirm the digestion by 1% agarose gel electrophoresis.
Next Figure shows one of the examples of the restriction digestion (Figure 4 also shows how to join the DNA fragments).
Figure 4. pUC19 digested by EcoRI-HF and XbaI
Preparation of the DNA fragment to be cloned.
Amplify a DNA fragment of interest by PCR using proofreading DNA polymerase such as Prime STAR GXL DNA Polymerase.
Notes:
PCR primers should be designed to carry the sequences with more than 20 bp of homology to the crossover region. We often use the sequences with 30-40 bp of homology to the crossover region. For the highest efficiency, we recommend you to use PCR primers purified by polyacrylamide gel electrophoresis. However, the PAGE purification is not essential.
Although we purified the DNA fragment of interest in our paper (Goto and Nagano, 2013), this purification step is not essential.
Confirm the amplification by agarose gel electrophoresis.
Transformation of DNA fragments into yeast.
Transform these 3 DNA fragments into yeast by TRAFO protocol (Gietz and Woods, 2002). TRAFO protocol is available on the following webpage.
http://home.cc.umanitoba.ca/~gietz/
Notes:
In our laboratory, we perform the transformation procedure at half or quarter scale of this method.
The molar ratio of the 3 DNA fragments was 1:1:1. However, this ratio is not important (Goto and Nagano, 2013). (Ten-fold variation of the ratio probably does not affect the efficiency.) Required amount of the conversion cassette SU32 is < 50 ng.
Select the transformants by incubating yeast cells on synthetic complete plates lacking tryptophan at 30 °C for 2 or 3 days.
Purification of plasmid from yeast.
Note: To purify plasmid DNAs from yeast, we use a Mini-M Plasmid DNA Extraction System, but you can use the other Plasmid DNA Extraction Kit for E. coli.
Scrape all colonies from the plates with plating beads, and collect yeast cells by the centrifuge. Using the microfuge, centrifuge cells at 14,000 x g for 5 sec (We often use the picofuge at a maximum speed for 30 sec). Remove the supernatant.
Add the suspension buffer (in the case of Mini-M Kit, we use 200 μl of MX1 buffer), and suspend the yeast cells by vortexing.
Scoop equal amounts of acid-washed glass beads (350–500 μm) to the suspended solution using 1.5 ml tube, add glass beads into tube containing the suspended solution, and then disrupt yeast cells by shaking 3 times for 20 sec at speed 5.5 using the FastPrep FP100A. Alternatively, vortex 5 times for 1 min at maximum speed. Next pictures show these experimental steps.
Add denaturation buffer (in the case of Mini-M Kit, we use 250 μl of MX2 buffer), and gently mix.
Punch a hole in the bottom of the tube by needle (18 gauge). Next pictures show these experimental steps.
Attach another tube to the bottom of the tube, and centrifuge them to recover the denatured solution in the bottom tube. Next pictures show these experimental steps.
For subsequent procedures, follow the manufacturer’s instructions. However, use elution solution preheated to 70 °C. Because DNA concentration of the eluted solution is low, you cannot determine the concentration of DNA by agarose gel electrophoresis or spectrophotometer. However, the DNA concentration of the eluted solution is sufficient for next procedures. Therefore, the condensation of the eluted solution is not required.
Pretreatment of the eluted solution (Optional)
For the highest efficiency, digest 5 μl of the recovered plasmids (the eluted solution) with small amounts (e.g. 0.2 μl) of an appropriate restriction enzyme by directly adding the enzyme to the eluted DNA solution.
Note: Because the principle of this method is complicated, read our paper (Goto and Nagano, 2013) carefully. Do not add an enzyme reaction buffer, because the salt may affect the next electroporation step.
Incubate the tube at an appropriate temperature for more than 1 h.
Transformation of the eluted solution into E. coli.
Transform the eluted solution into E. coli electro-competent cells by electroporation and plate them on LB agar containing 100 μg/ml ampicillin.
Analyze E. coli transformants by various methods.
Acknowledgments
This protocol was adapted from previously published paper, Goto and Nagano, (2013). Part of this work was supported by A-STEP (FS-stage) from the Japan Science and Technology Agency (JST) and by a Grant-in-Aid for Challenging Exploratory Research from the Japan Society for the Promotion of Science.
References
Gietz, R. D. and Woods, R. A. (2002). Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Methods Enzymol 350: 87-96.
Goto, K. and Nagano, Y. (2013). Ultra-low background DNA cloning system. PLoS One 8(2): e56530.
Iizasa, E. and Nagano, Y. (2006). Highly efficient yeast-based in vivo DNA cloning of multiple DNA fragments and the simultaneous construction of yeast/Escherichia coli shuttle vectors. Biotechniques 40(1): 79-83.
Nagano, Y., Takao, S., Kudo, T., Iizasa, E. and Anai, T. (2007). Yeast-based recombineering of DNA fragments into plant transformation vectors by one-step transformation. Plant Cell Rep 26(12): 2111-2117.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Nagano, Y. and Goto, K. (2013). Ultra-low Background DNA Cloning System. Bio-protocol 3(16): e874. DOI: 10.21769/BioProtoc.874.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
High-throughput Site-directed Scanning Mutagenesis Using a Two-fragment PCR Approach
Franziska M. Heydenreich [...] Dmitry B. Veprintsev
Jan 5, 2020 5156 Views
Implementing Novel Designs in pET Expression Plasmids that Increase Protein Production
Patrick J. Shilling and Daniel O. Daley
Aug 20, 2021 6736 Views
Faster Bacterial Gene Cloning Using the Brick into the Gateway (BiG) Protocol
Flaviani G. Pierdoná [...] Fabio T. S. Nogueira
Dec 20, 2022 1125 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
875 | https://bio-protocol.org/en/bpdetail?id=875&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Nitrate Uptake and Accumulation Using 15N in Rice Seedlings
Zhong Tang
Guohua Xu
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.875 Views: 8083
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Dec 2012
Abstract
Nitrogen-15 is a rare stable isotope of nitrogen. This isotope is often used in agricultural research. For example, Nitrogen-15 is used to trace mineral nitrogen compounds and translocate the nitrogen molecule in plants. This protocol is used to determine nitrate uptake and accumulation in rice seedlings by using Nitrogen-15.
Materials and Reagents
Rice seedlings: Four weeks old seedlings
NH4NO3 (catalog number: 6484-52-2 )
KH2PO4 (catalog number: 7778-77-0 )
K2SO4 (catalog number: 7778-80-5 )
CaCl2.2H2O (catalog number: 94248-52-9)
MgSO4.7H2O (catalog number: 10034-99-8 )
Na2SiO3 (catalog number: 1344-09-8 )
NaFeEDTA (catalog number: 7720-78-7; 139-33-3)
H3BO3 (catalog number: 10043-35-3 )
MnCl2.4H2O (catalog number: 20603-88-7)
CuSO4.5H2O (catalog number: 7758-99-8 )
ZnSO4.7H2O (catalog number: 7446-20-0 )
Na2MoO4.2H2O (catalog number: 7631-95-0 )
CaSO4.2H2O (catalog number: 10101-41-4 )
IRRI nutrient solution (see Recipes)
0.1 mM CaSO4 solution (see Recipes)
K15NO3 (catalog number: 57654-83-8 ) (see Recipes)
Equipment
Isotope Ratio Mass Spectrometer (Thermo Fisher Scientific, model: MAT253 )
Elemental Analyzer (Thermo Fisher Scientific, model: Flash EA1112 HT )
Procedure
The rice seeds were surface sterilized with 10% (v/v) hydrogen peroxide for 30 min and then rinsed thoroughly with deionized water. The sterilized seeds were germinated on plastic supporting netting (mesh of 1 mm2) mounted in plastic containers for 1 week. Uniform seedlings were selected and then transferred to a tank containing 7 L of International Rice Research Institute (IRRI) nutrient solution for 4 weeks and then deprived of N (IRRI nutrient solution without NH4NO3) for 1 week. All the plants were grown in a growth room with a 16-h-light (30 °C)/8-h-dark (22 °C) photoperiod, and the relative humidity was controlled at approximately 70%.
The plants were transferred first to a container with 7 L washing solution (0.1 mM CaSO4) for 1 min, then to a new container with 7 L complete nutrient solution containing 0.5 mM K15NO3 (atom% 15N: 80.25%) for 5 min uptake, and finally to washing solution (0.1 mM CaSO4) again for 1 min. Make sure the whole root system were socked in the solution.
For analyzing the nitrate accumulation, the N-starved seedlings were transferred to an IRRI nutrient solution containing 0.5 mM K15NO3 (atom% 15N: 80.25%) for 24 h before the harvest.
Harvest the roots and shoots respectively and grinding in liquid N, the powder was dried to a constant weight at 70 °C. About 10 mg of powder of each sample was analyzed using the Isotope Ratio Mass Spectrometer system.
Influx or accumulation of 15NO3- was calculated from the 15N concentrations of the roots.
Recipes
IRRI nutrient solution
1.25 mM NH4NO3
0.3 mM KH2PO4
0.35 mM K2SO4
1 mM CaCl2.2H2O
1 mM MgSO4.7H2O
0.5 mM Na2SiO3
20 μM NaFeEDTA
20 μM H3BO3
9 μM MnCl2.4H2O
0.32 μM CuSO4.5H2O
0.77 μM ZnSO4.7H2O
0.39 μM Na2MoO4.2H2O
pH 5.5
0.1 mM CaSO4 solution (1 L)
0.0172 g CaSO4.2H2O
Add ddH2O to final volume
K15NO3
0.5 mM K15NO3
Acknowledgments
This protocol is adapted from Delhon et al. (1995) and Tang et al. (2012).
References
Delhon, P., Gojon, A., Tillard, P. and Passama, L. (1995). Diurnal regulation of NO3- uptake in soybean plants I. Changes in NO3- influx, efflux, and N utilization in the plant during the day/night cycle. J Exp Bot 46(10): 1585-1594.
Tang, Z., Fan, X., Li, Q., Feng, H., Miller, A. J., Shen, Q. and Xu, G. (2012). Knockdown of a rice stelar nitrate transporter alters long-distance translocation but not root influx. Plant Physiol 160(4): 2052-2063.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant physiology > Nutrition
Plant Science > Plant metabolism > Nitrogen
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Fabrication and Use of the Dual-Flow-RootChip for the Imaging of Arabidopsis Roots in Asymmetric Microenvironments
Claire E. Stanley [...] Guido Grossmann
Sep 20, 2018 8034 Views
Visualization of Nitric Oxide, Measurement of Nitrosothiols Content, Activity of NOS and NR in Wheat Seedlings
Sandeep B. Adavi [...] Shailendra K. Jha
Oct 20, 2019 4716 Views
A Quick Method to Quantify Iron in Arabidopsis Seedlings
Chandan Kumar Gautam [...] Wolfgang Schmidt
Mar 5, 2022 2601 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
876 | https://bio-protocol.org/en/bpdetail?id=876&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Net NO3- Flux in Rice Plants with the SIET System
Zhong Tang
Guohua Xu
Published: Vol 3, Iss 16, Aug 20, 2013
DOI: 10.21769/BioProtoc.876 Views: 7741
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Dec 2012
Abstract
SIET (scanning ion-electrode technique) is a new technique to study the flow rate of the ions and molecules in real time in living biomaterials by using microelectrodes and microsensor. This technique allows non-invasive, simultaneous measurement of fluxes of specific ions at the surface of an intact plant. It has high temporal and spatial resolutions. This protocol uses the SIET system for the measurement of ions flux rate in rice plants.
Keywords: Nitrate transporter Root SIET system Nitrate flux Rice
Materials and Reagents
Rice seedlings: Three weeks old seedlings
Plastic supporting netting
Tributylchlorosilane (Fluka, catalog number: 90796 )
NH4NO3
KH2PO4
K2SO4
CaCl2.2H2O
MgSO4.7H2O
Na2SiO3
NaFeEDTA
H3BO3
MnCl2.4H2O
CuSO4.5H2O
ZnSO4.7H2O
Na2MoO4.2H2O
International Rice Research Institute (IRRI) nutrient solution (see Recipes)
Calibrate solution (see Recipes)
Measuring solution (see Recipes)
Equipment
Small plastic dish (6 cm diameter)
Measuring chamber
Ion-selective electrodes (Clark Electromedical, model: GC150-10 )
BIO-IM (NMT-YG-100, Younger USA LLC, Amherst, model: MA01002 ) with ASET 2.0
Software
ASET 2.0 (Sciencewares, Falmouth, catalog number: MA 02540)
iFluxes 1.0 (YoungerUSA, LLC, Amherst, catalog number: MA 01002) software
Procedure
Rice seeds were surface sterilized with 10% (v/v) hydrogen peroxide for 30 min and then rinsed thoroughly with deionized water.
The sterilized seeds were germinated on plastic supporting netting (mesh of 1 mm2) mounted in plastic containers for 1 week in a growth room with a 16-h-light (30 °C)/8-h-dark (22 °C) photoperiod, and the relative humidity was controlled at approximately 70%. Uniform seedlings were selected and then transferred to IRRI nutrient solution.
Rice seedlings were grown in IRRI nutrient solution for 2 weeks and then deprived of N (IRRI nutrient solution without NH4NO3) for 3 d. All the plants were grown in a growth room with a 16-h-light (30 °C)/8-h-dark (22 °C) photoperiod, and the relative humidity was controlled at approximately 70%.
The roots of seedlings were equilibrated in measuring solution 1 (without NO3-) for 20 to 30 min before measuring at room temperature (24 °C–26 °C).
The equilibrated seedlings were then transferred to the measuring chamber, and a small plastic dish (6 cm diameter) was filled with 10 ml of fresh measuring solution 2 containing 0.25 mM NO3-.
Ion-selective Electrodes were made from 1.5 mm (external diameter) borosilicate blanks. The blanks were pulled to < 1 μm diameter tips using a vertical pipette puller and then silanized with tributylchlorosilane. The tips of electrode blanks were broken to a diameter of 2–3 μm, and then back-filled with appropriate solutions. The back-filling solutions for NO3- were 0.5 M KNO3 and 0.1 M KCl. The electrodes were calibrated with calibrate solution 1 (0.05 mM NO3-) and calibrate solution 2 (0.5 mM NO3-) prior to flux measurements.
When the root became immobilized at the bottom of the dish, the microelectrode was vibrated in the measuring solution between two positions, 5 and 35 μm from the primary root surface, along an axis perpendicular to the root meristem zone. The background was recorded by vibrating the electrode in measuring solution not containing roots. The measuring lasted for 15 min.
The data obtained were analyzed and converted into NO3- influx (negative) (pmol cm-2s-1) using the MageFlux program (http://www.xuyue.net/mageflux). The ion flux assay around each type of transformed cells was replicated independently five times.
Recipes
IRRI nutrient solution
1.25 mM NH4NO3
0.3 mM KH2PO4
0.35 mM K2SO4
1 mM CaCl2.2H2O
1 mM MgSO4.7H2O
0.5 mM Na2SiO3
20 μM NaFeEDTA
20 μM H3BO3
9 μM MnCl2.4H2O
0.32 μM CuSO4.5H2O
0.77 μM ZnSO4.7H2O
0.39 μM Na2MoO4.2H2O
pH 5.5
Calibrate solution
Calibrate solution 1
H+ (pH 6.5)
0.05 mM NO3-
0.025 mM Ca(NO3)2
0.1 mM CaCl2
0.1 mM NaCl
0.1 mM MgSO4
0.3 mM MES
pH 6.5
Calibrate solution 2
H+ (pH 5.5)
0.5 mM NO3-
0.25 mM Ca(NO3)2
0.1 mM CaCl2
0.1 mM NaCl
0.1 mM MgSO4
0.3 mM MES
pH 5.5
Measuring solution
Measuring solution 1
0.2 mM CaCl2
0.1 mM NaCl
0.1 mM MgSO4
0.3 mM MES
pH 6.0
Measuring solution 2
0.125 mM Ca(NO3)2
0.1 mM CaCl2
0.1 mM NaCl
0.1 mM MgSO4
0.3 mM MES
pH 6.0
Acknowledgments
This protocol is adapted from Xu et al. (2006); Sun et al. (2009); and Tang et al. (2012).
References
Sun, J., Chen, S., Dai, S., Wang, R., Li, N., Shen, X., Zhou, X., Lu, C., Zheng, X., Hu, Z., Zhang, Z., Song, J. and Xu, Y. (2009). NaCl-induced alternations of cellular and tissue ion flues in roots of salt-resistant and salt-sensitive poplar species. Plant Physiol 149(2): 1141-1153.
Tang, Z., Fan, X., Li, Q., Feng, H., Miller, A. J., Shen, Q. and Xu, G. (2012). Knockdown of a rice stelar nitrate transporter alters long-distance translocation but not root influx. Plant Physiol 160(4): 2052-2063.
Xu, Y., Sun, T. and Yin, L. P. (2006). Application of non-invasive microsensing system to simultaneously measure both H+ and O2 fluxes around the pollen tube. J Plant Biol 48(7): 823-831.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant physiology > Ion analysis
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
High-throughput Quantification of Ammonium Content in Arabidopsis
Izargi Vega-Mas [...] Daniel Marino
Aug 20, 2015 10582 Views
Putrescine Biosynthesis Inhibition in Tomato by DFMA and DFMO Treatment
Emma Fernández-Crespo [...] Gemma Camañes
Nov 5, 2016 8278 Views
Quantification of the Humidity Effect on HR by Ion Leakage Assay
Musoki Mwimba and Xinnian Dong
Apr 5, 2019 4960 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
877 | https://bio-protocol.org/en/bpdetail?id=877&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
C1q Binding to and Uptake of Apoptotic Lymphocytes by Human Monocyte-derived Macrophages
MB Marie E. Benoit
Elizabeth V. Clarke
AT Andrea J. Tenner
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.877 Views: 8994
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Immunology Jun 2012
Abstract
To characterize macrophage gene expression profiles during the uptake of autologous apoptotic cells, we developed a unique, more physiologic system using primary human monocyte derived macrophages purified via a nonactivating isolation procedure (and in the absence of contaminating platelets, which can release stimulating signals if activated) and autologous lymphocytes as a source of apoptotic cells. The use of autologous cells as the apoptotic target rather than transformed cell lines avoids antigenic stimulation from “nonself” structures at the HLA level but also from “altered self” signals due to the transformation inherent in cell lines.
Keywords: Apoptotic cell clearance Autoimmunity Macrophages Human C1q
Materials and Reagents
Human peripheral blood
RPMI1640 + L-Glutamine + HEPES (Life Technologies, catalog number: 22400-105 )
FBS (inactivate for 30 min at 56 °C) (Hyclone defined FBS, catalog number: SH30070.03 )
Penicillin/Streptomycin (Life Technologies, catalog number: 15070-063 )
L-Glutamine (200 mM) (Life Technologies, catalog number: 25030-081 )
0.4% Trypan blue Solution (Sigma-Aldrich, catalog number: T8154 )
HBSS (Corning/Cellgro, catalog number: MT-21-023-CV )
PBS
25% Human Serum Albumin (HSA) (Plasbumin®-25) (Talecris Biotherapeutics, NDC number: 13533-684-20 )
Recombinant human IL-2 (Peprotech, catalog number: 200-02 )
Recombinant human M-CSF (Peprotech, catalog number: 300-25 )
Bovine Serum Albumin (BSA) (albumin from bovine serum, lyophilized powder, ≥ 96%) (Sigma-Aldrich, catalog number: A2153-100G )
C1q (Comptech, Texas, catalog number: A099 )
PKH26 Red Fluorescent Cell Linker Kit for General Cell Membrane Labeling (Sigma-Aldrich, catalog number: PKH26GL )
CellStripper Dissociation Reagent (Thermo Fisher Scientific, catalog number: 25-056-CI )
Apoptosis detection kit (BioVision, catalog number: K101-100 )
Anti-human C1q (Quidel, catalog number: A201 )
FITC conjugated anti-mouse IgG (Jackson Immunoresearch, catalog number: 115-096-006 )
FcR blocking reagent human (Miltenyi, catalog number: 130-059-901 )
FITC conjugated anti-human CD11b (Life Technologies, catalog number: CD11B01 )
FITC mouse IgG1 isotypes (Life Technologies, catalog number: MG101 )
Fluorescein phalloidin (Life Technologies, catalog number: F432 )
Stericup (Thermo Fisher Scientific, catalog number: SCGVU11RE )
Prolong gold antifade reagent (Life Technologies, catalog number: P36930 )
Ammonium Chloride (anhydrous)
Potassium bicarbonate
Disodium EDTA
NaN3
Trypsin
Complete media (see Recipes)
Phagocytosis buffer (see Recipes)
ACK buffer (see Recipes)
FACS buffer (see Recipes)
Equipment
50 ml conical tubes (Thermo Fisher Scientific, catalog number: 339653)–important as monocytes stick to other tubes
12 x 75 mm polypropylene round bottom sterile tube (Thermo Fisher Scientific, catalog number: 14-956-1D )
12 x 75 mm polystyrene round bottom tubes (Thermo Fisher Scientific, catalog number: 14-961-13 )
Tissue culture plates and vented flasks (any size)
Eppendorf microfuge tubes
12 mm cover slips (Thermo Fisher Scientific, catalog number: GG12 ), sterilize by soaking in 70% Ethanol for 2 x 5 min
Non tissue culture treated 100 mm petri dish (Thermo Fisher Scientific, catalog number: 0875712 )–referred to as petri dishes
Tissue culture hood
Gamma-irradiator
5% CO2, 37 °C Humidified incubator
Centrifuge for 50 ml conical tubes and 5 ml bottom round tubes
Centrifuge with swinging bucket rotor for plates (Sorvall, model: RT7000 or equivalent)
Optic and confocal fluorescence microscopes
Hemocytometer
Flow cytometer
Automatic pipettes (full range volumes)
Tips (full range volumes)
24-well plates
Procedure
Lymphocyte isolation, staining and apoptosis induction.
Collect the first two 50 ml effluent tubes from the elutriation, which contain lymphocytes (monocytes are retained in the elutriation chamber).
Centrifuge lymphocyte suspension 10 min at 700 rpm (100 x g), RT (room temperature) to remove majority of platelets.
Discard supernatant and pool cell pellets in 10 ml ACK buffer (to remove residual red cells). Incubate 2-5 min RT.
Add 20 ml complete media.
Centrifuge cell suspension 10 min at 700 rpm (100 x g), RT.
Discard supernatant and resuspend the cell pellet in 20 ml HBSS. Count viable cell number using 0.4% Trypan blue solution, a hemocytometer chamber and an optic microscope.
Centrifuge cell suspension 10 min at 700 rpm (100 x g), RT.
Resuspend the lymphocytes at 1 million/ml in complete media in a vented tissue culture flask.
Add 100 U/ml recombinant human IL-2.
Incubate at 37 °C, 5% CO2 for 7 days.
Centrifuge lymphocyte cell suspension 5 min 1,200 rpm (300 x g).
Discard supernatant and wash cell pellet with 10 ml HBSS. Count viable cell number using 0.4% Trypan blue solution, a hemocytometer chamber and an optic microscope
Centrifuge cell suspension 5 min 1,200 rpm (300 x g).
Discard supernatant and resuspend 20 million lymphocytes in 1 ml diluent C of PKH26 Red Fluorescent Cell Linker Kit.
Dilute 4 μl PKH26 dye in 1 ml diluent C (4 μM).
Mix dye and cells (PKH26 at 2 μM final), invert the tube gently and incubate for 5 min RT.
Add 2 ml FBS. Mix well. Incubate 1 min RT.
Add 16 ml complete media. Mix well by inversion. Centrifuge cell suspension 10 min 1,200 rpm (300 x g).
Discard supernatant and resuspend cell pellet in 10 ml complete media. Centrifuge cell suspension 10 min 1,200 rpm (300 x g).
Repeat step 19 twice for a total of 3 washes.
Count viable cell number using 0.4% Trypan blue solution, a hemocytometer chamber and an optic microscope.
Resuspend PKH26-labeled lymphocytes at 2 million/ml (up to 50 million in 25 ml) in RPMI1640 media without FBS in a T25 vented tissue culture flask.
Induce apoptosis by exposing lymphocytes to γ-irradiation (10 Gy).
Incubate lymphocytes overnight 5% CO2, 37 °C in either complete media (for early apoptotic cells) RPMI without serum for late apoptotic cells at 2 million/ml.
Isolation and culture of monocytes
After recovering monocytes from elutriation chamber, wash in HBSS, count, and resuspend at 0.5 million/ml in complete media (Day 0).
Add 10 ml per 100 mm petri dish.
Add recombinant human M-CSF to a final concentration of 25 ng/ml.
Place at 37 °C, 5% CO2.
After 3-4 days, add 5 ml fresh complete media (containing 25 ng/ml M-CSF) per plate.
On day 6-8, discard media from plates and wash adherent cells twice with 5 ml HBSS.
Discard last HBSS wash and add 5 ml CellStripper to the plates, incubate 20-30 min RT.
Pipet up and down to detach the cells and transfer to 50 ml conical tube containing 25 ml prewarmed complete media (one tube = 5 plates, final volume 50 ml).
Centrifuge cell suspension 1,200 rpm (300 x g), 5 min RT.
Wash cell pellet twice with 10 ml HBSS, centrifuge cell suspension 5 min 1,200 rpm (300 x g).
Count viable cell number using 0.4% Trypan blue solution, a hemocytometer chamber and an optic microscope.
Plate human monocyte derived macrophages (HMDM) at 0.25 million/ml in complete media, 500 cells/mm2. For immunocytochemistry (ICC), plate cells in 24-well plates containing 12 mm coverslips (0.5 ml).
Incubate at 37 °C, 5% CO2 overnight.
C1q binding to apoptotic lymphocytes
Transfer apoptotic lymphocytes to conical tube. Assess apoptosis by flow cytometry using the apoptosis detection kit from Biovision.
Centrifuge cell suspension 5 min 1,200 rpm (300 x g).
Discard supernatant and carefully resuspend lymphocytes in 10 ml prewarmed HBSS. Count ALL cells (viable and permeable) using 0.4% Trypan blue solution, a hemocytometer chamber and an optic microscope.
Centrifuge cell suspension 5 min, 1,200 rpm (300 x g).
Resuspend cell pellet at 5 x 106 cells/ml in HBSS/1%HSA in sterile 12 x 75 mm round bottom tube.
Depending on the number of C1q coated apoptotic cells desired, add human purified C1q to a final concentration of 150 μg/ml. Pipet gently up and down or invert to mix.
Incubate for 1 h at 37 °C, gently shake tubes every 15 min.
Add 2 ml HBSS per tube and centrifuge cell suspension 5 min, 1,200 rpm (300 x g).
Discard supernatant, add 2 ml HBSS per tube and centrifuge cell suspension 5 min, 1,200 rpm (300 x g).
Resuspend cell pellet at desired concentration in phagocytosis buffer for uptake assay. Set aside 2 x 105 apoptotic lymphocytes +/- C1q to assess C1q binding efficiency as described below.
C1q binding efficiency
Resuspend 2 x 105 apoptotic lymphocytes +/- C1q in 100 μl FACS buffer.
Add 1-2 μl murine anti-human C1q and incubate for 30 min on ice.
Add 2 ml FACS buffer, centrifuge cell suspension 5 min 1,200 rpm (300 x g), 4 °C.
Discard supernatant and resuspend cell pellet in 100 μl FACS buffer.
Add 1 μl FITC conjugated anti-mouse IgG and incubate for 30 min on ice in the dark.
Add 2 ml FACS buffer, centrifuge cell suspension 5 min 1,200 rpm (300 x g), 4 °C.
Discard supernatant and resuspend cell pellet in 200 μl FACS buffer.
Analyze by flow cytometry to determine C1q binding efficiency to apoptotic lymphocytes. Percentage of apoptotic cells binding C1q should be greater than 50%.
Uptake assay
Recover human monocyte derived macrophages (HMDMs) plate from Section C. Discard media and wash adherent cells twice with HBSS.
Recover apoptotic lymphocytes from step IV-10. Add apoptotic lymphocytes +/- C1q at a 5:1 ratio (for example 5 x 105 apoptotic lymphocytes for 1 x 105 HMDMs in phagocytosis buffer in a final total volume of 2 ml per a 6-well plate well).
Centrifuge the plate 3 min at 700 rpm (100 x g).
Incubate for 1 h at 37 °C.
To assess uptake by flow cytometry:
Discard media and wash adherent cells twice with HBSS.
Add 0.5 ml 0.05% trypsin and incubate 2 min 37 °C. Pipet cells up and down and transfer into 12 x 75 mm tubes (microscopically check that all macrophages have been recovered).
Centrifuge cells 5 min 1,200 rpm (300 x g), RT.
Discard supernatant and resuspend cell pellet in 100 ml FACS buffer.
Add 5 μl CD11b-FITC antibodies per 1 x 106 cells, incubate 45 min in the dark on ice.
Add 2 ml FACS buffer, spin down 5 min 1,200 rpm (300 x g) 4 °C.
Centrifuge cells 5 min 1,200 rpm (300 x g), RT.
Discard supernatant and resuspend in 300 μl FACS buffer to read.
Analyze by flow cytometry.
To assess uptake by ICC (using 12 mm coverslips placed in a 24-well plate).
After step E-5, discard media and wash adherent cells twice with 0.5 ml HBSS.
Fix cells with 3.7% formaldehyde (300 μl/well), 10 min RT.
Note: Do not use methanol or acetone as it can disrupt the PKH26 membrane labeling of apoptotic lymphocytes.
Wash cells twice with PBS.
Stain cells with 4U FITC-phalloidin per well diluted in 250 μl PBS for 20 min RT.
Wash cells twice with PBS.
Mount coverslips with a drop of prolong gold antifade reagent.
Analyze by fluorescence or confocal microscopy.
Recipes
Complete media
RPMI1640 + L-Glutamine + HEPES (500 ml)
50 ml (10%) heat-inactivated FBS
5 ml (1%) Penicillin/Streptomycin
5 ml (1%) 200 mM L-Glutamine
Phagocytosis buffer
RPMI1640 + L-Glutamine + HEPES
25 mM HEPES
5 mM MgCl2
ACK buffer
To 450 ml milliQ water add
4.145 g Ammonium Chloride (anhydrous)
0.5 g potassium bicarbonate
18.6 mg disodium EDTA
Adjust pH to 7.4
Bring final volume to 500 ml with milliQ water
Filter sterilize using stericup
FACS buffer
500 ml HBSS (no phenol red)
0.2% NaN3
0.2% BSA
Acknowledgments
Human peripheral blood lymphocytes and monocytes are isolated by counterflow elutriation using a modification of the technique of Lionetti et al. (1980) as described previously (Bobak et al., 1986).
References
Benoit, M. E., Clarke, E. V., Morgado, P., Fraser, D. A. and Tenner, A. J. (2012). Complement protein C1q directs macrophage polarization and limits inflammasome activity during the uptake of apoptotic cells. J Immunol 188(11): 5682-5693.
Bobak, D. A., Frank, M. M. and Tenner, A. J. (1986). Characterization of C1q receptor expression on human phagocytic cells: effects of PDBu and fMLP. J Immunol 136(12): 4604-4610.
Lionetti, F. J., Hunt, S. M., Valeri, C. R. (1980). Methods of Cell Separation. New York: Plenum Publishing Corp.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Immunology > Immune cell function > Lymphocyte
Immunology > Immune cell function > Macrophage
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
In vitro Assessment of Efferocytic Capacity of Human Macrophages Using Flow Cytometry
Ana C.G. Salina [...] Larissa D. Cunha
Dec 20, 2023 2813 Views
Quantification of Macrophage Cellular Ferrous Iron (Fe2+) Content using a Highly Specific Fluorescent Probe in a Plate-Reader
Philipp Grubwieser [...] Christa Pfeifhofer-Obermair
Feb 5, 2024 754 Views
T-Cell-Based Platform for Functional Screening of T-Cell Receptors Identified in Single-Cell RNA Sequencing Data Sets of Tumor-Infiltrating T-Cells
Aaron Rodriguez Ehrenfried [...] Rienk Offringa
Apr 20, 2024 3775 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
878 | https://bio-protocol.org/en/bpdetail?id=878&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Genomic 8-oxo-7,8-dihydro-2'-deoxyguanosine Quantification
AS Antonio Sarno
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.878 Views: 8545
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS ONE Feb 2013
Abstract
8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dGuo) is among the most common reactive oxygen species-induced DNA lesions and can be used as a biomarker for oxidative stress. The lesion has been linked to several biological processes and diseases, including colorectal cancer, Huntington’s disease, estrogen-induced gene expression, and thymine dimer repair (reviewed in Delaney et al., 2012). The following assay is used to quantify 8-oxo-dGuo levels in DNA as described in Sousa et al. (2013).
Materials and Reagents
NH4HCO3 (reagent grade ≥ 99% purity)
MgCl2 (reagent grade ≥ 99% purity)
CaCl2 (reagent grade ≥ 99% purity)
DNase I from bovine pancreas (F. Hoffmann-La Roche, catalog number: 04716728001 )
Nuclease P1 from P. citrinum (Sigma-Aldrich, catalog number: N8630-1VL )
Phosphodiesterase I from C. adamanteus venom (Sigma-Aldrich, catalog number: P3242-1VL )
Alkaline phosphatase from E. coli (Sigma-Aldrich, catalog number: P5931-100UN )
8-hydroxy-2’-deoxyguanosine (8-oxo-dGuo) (Sigma-Aldrich, catalog number: H5653-1MG )
[15N5]-8-hydroxy-2’-deoxyguanosine (Cambridge Isotope Laboratories, catalog number: NLM-6715-0 ) (this is the internal standard)
DNeasy® Blood & Tissue Kit (QIAGEN, catalog number: 69506 )
LC/MS-grade methanol
Hydrolysis buffer (see Recipes)
Solvent A (see Recipes)
Solvent B (see Recipes)
Equipment
Vortexer
Microcentrifuge
Vacuum centrifuge
LC/MS/MS: We used an LC-20AD HPLC system (Shimadzu Corporation) coupled to an API 5000 triple-quadrupole mass spectrometer (Applied Biosystems)
Zorbax SB-C18 reverse phase chromatography column (2.1 x 150 mm, i.d., 3.5 μm) (Agilent Technologies)
Procedure
DNA isolation
DNA can be isolated using a variety of methods. We used the DNeasy® Blood Tissue Kit from QIAGEN, but other analogous kits are likely to yield similar results so long as they are not phenol based. Phenol-based DNA isolation has been shown to oxidize DNA in vitro and therefore overestimate 8-oxo-dGuo (Hamilton et al., 2001). Moreover, the final DNA elution step should be performed with water because most elution buffers contain EDTA, which inhibit nucleases.
Enzymatic hydrolysis of DNA
In 40 μl hydrolysis buffer, add
1 U DNase I
0.2 mU phosphodiesterase I
0.1 U alkaline phosphatase
1.25 pmol [15N5]-8-hydroxy-2’-deoxyguanosine internal standard
(this gives a final concentration of 10 nM on the LC/MS/MS)
0.5-5 μg DNA
Incubate at 37 °C for 6 h to overnight.
Add five volumes of ice-cold methanol to the samples and mix well by vortexing. This step precipitates enzymes and salts prior so that (1) they don’t interfere with analyte ionization and (2) they don’t precipitate upon exposure to organic mobile phase during chromatography, which can cause clogs.
Centrifuge samples at 16,000 x g for 20 min at 4 °C.
Transfer the supernatant to new tubes. The pellet contains precipitated enzymes and salts that can interfere with analysis and can be discarded.
Vacuum centrifuge the supernatant until dry.
Dissolve the resulting residue in 25 μl 5% methanol in water.
Inject 20 μl sample into the LC/MS/MS for analysis.
A standard curve was made in 5% methanol in water containing 0.1-500 nM 8-oxo-dGuo, containing 10 nM internal standard.
HPLC program (flow rate 300 μl/min)
5% solvent A for 0.5 min.
Ramp to 90% solvent B over 6 min.
Hold at 90% solvent B for 1.5 min.
Re-equilibrate with 5% solvent A for 5 min.
MS/MS program
MS/MS acquisition should be used with positive electrospray ionization in multiple reaction monitoring mode.
Note: The mass spectrometer settings are instrument specific and are therefore not included in this protocol.
Mass transition for 8-hydroxy-2’-deoxyguanosine: 284.1 -> 168.2.
Mass transition for [15N5]-8-hydroxy-2’-deoxyguanosine: 289.2 -> 173.1.
Quantification
Integrate the area under the peaks.
Divide the 8-oxo-dGuo peak area by the internal standard peak area for all samples.
Make a standard curve from the standards of known concentrations.
Use the slope and y-intercept from the standard curve to calculate the concentration of the unknowns.
(Optional) Deoxynucleoside quantification
Dilute 1 μl of sample prior to MS injection 1:1,000 in 5% methanol in water. The reason for the dilution is that the canonical deoxynucleosides are much more abundant than 8-oxo-dGuo and would saturate the mass spectrometer’s detector if injected undiluted.
Inject 20 μl of diluted sample for LC/MS/MS analysis of deoxynucleosides.
Use the same HPLC program as for 8-oxo-dGuo.
Mass transitions for deoxyguanosine, deoxycytidine, deoxyadenosine, and thymidine: 252.1 ->136.1, 228.1 -> 112.1, 268.1 -> 152.0, and 243.1 -> 127.0, respectively.
Use standard curves to quantify deoxynucleoside concentrations.
Use the following formula to calculate 8-oxo-dGuo per 106 nucleosides:
(mol 8-oxo-dGuo/[mol dAdo + dGuo + dCyd + Thd]) x 1,000,000
Recipes
Hydrolysis buffer
100 mM NH4HCO3 (pH 7.6)
10 mM MgCl2
1 mM CaCl2
Solvent A
0.1% formic acid in water
Solvent B
0.1% formic acid in methanol
Notes
Hydrolysis procedure. The hydrolysis procedure used here is one of many viable alternatives. When choosing a hydrolysis method for nucleoside analysis one must consider the following:
Does the method affect the bases? DNA can be chemically hydrolyzed, but this is more risky because the bases themselves are subject to damage. Some enzymes also have unintended activity. For example, commercial alkaline phosphatase has been shown to contain deaminase activity (or contamination by deaminases) (Dong and Dedon, 2006; Dong et al., 2003).
How important is a short hydrolysis reaction time? Some nucleoside modifications can arise spontaneously in water and a short hydrolysis reaction time is therefore worth the extra cost and effort necessary. Our group has also measured genomic uracil, which can arise spontaneously from cytosine deamination in water. We therefore developed a method to hydrolyze DNA in 50 min instead of 6 h (Galashevskaya et al., 2013). Adding even more enzymes, one can lower the reaction time to 15-30 min at room temperature (using DNase I, SVPD, micrococcal nuclease, omnicleave, benzonase, alkaline phosphatase, and Antarctic phosphatase; unpublished results by Sarno, 2013). Note that adding more enzymes significantly increases the reaction cost.
Cleanliness. Mass spectrometry is a very sensitive technique, so great care should be taken to maintain a clean laboratory environment. Depending on the instrument and reagent quality, the assay can detect down to 0.1-0.5 fmol analyte. Thus, always ensure that all equipment and surfaces are clean and autoclaved if possible (e.g. pipettes, tips, tubes, centrifuges, etc.). Note that dust collects on surfaces over time, so even though a laboratory space may be contaminated even though it has not been used for some time. It is usually enough to wipe equipment and surfaces down with a laboratory wipe and deionized or milliQ water followed by either ethanol or isopropanol.
Yield. We have performed the assay with 0.5-5 μg DNA and have always measured 8-oxo-dGuo above the assay’s limit of quantification. Nevertheless, one should always attempt to use as much DNA as possible (up to 5 μg) to ensure that there is enough measureable 8-oxo-dGuo. Regarding DNA yield: We have obtained an average of ~3 μg DNA per 106 cells from a multiple myeloma cell line using the DNeasy kit.
Replicates. One should optimally have three technical replicates per sample. Thus, when analyzing 5 μg DNA, one should have at least 15 μg for three runs of 5 μg each. Additionally, one should always perform three independent experiments. Thus, one should have 3 x 15 μg per result.
Quantification. Although it is possible to normalize the amount of 8-oxo-dGuo measured to μg DNA used in the initial hydrolysis reaction, it is more accurate and reproducible to compare 8-oxo-dGuo per (106) deoxynucleoside. This involves a single additional step and no extra material.
Figure 1. Typical chromatograms in 8-oxo-dGuo analysis. A. 50 nM 8-oxo-dGuo and 10 nM internal standard dissolved in 5% methanol in water. B. 8-oxo-dGuo from 5 μg commercially obtained salmon sperm DNA containing 10 nM internal standard.
Note that the peaks that don’t co-elute with the internal standard are discarded as contaminants.
Figure 2. Visualized summary of the method.
Acknowledgments
This protocol is adapted from Sousa et al. (2013).
References
Delaney, S., Jarem, D. A., Volle, C. B. and Yennie, C. J. (2012). Chemical and biological consequences of oxidatively damaged guanine in DNA. Free Radic Res 46(4): 420-441.
Dong, M., Wang, C., Deen, W. M. and Dedon, P. C. (2003). Absence of 2'-deoxyoxanosine and presence of abasic sites in DNA exposed to nitric oxide at controlled physiological concentrations. Chem Res Toxicol 16(9): 1044-1055.
Dong, M. and Dedon, P. C. (2006). Relatively small increases in the steady-state levels of nucleobase deamination products in DNA from human TK6 cells exposed to toxic levels of nitric oxide. Chem Res Toxicol 19(1): 50-57.
Galashevskaya, A., Sarno, A., Vagbo, C. B., Aas, P. A., Hagen, L., Slupphaug, G. and Krokan, H. E. (2013). A robust, sensitive assay for genomic uracil determination by LC/MS/MS reveals lower levels than previously reported. DNA Repair (Amst) 12(9): 699-706.
Hamilton, M. L., Guo, Z., Fuller, C. D., Van Remmen, H., Ward, W. F., Austad, S. N., Troyer, D. A., Thompson, I. and Richardson, A. (2001). A reliable assessment of 8-oxo-2-deoxyguanosine levels in nuclear and mitochondrial DNA using the sodium iodide method to isolate DNA. Nucleic Acids Res 29(10): 2117-2126.
Sousa, M. M., Zub, K. A., Aas, P. A., Hanssen-Bauer, A., Demirovic, A., Sarno, A., Tian, E., Liabakk, N. B. and Slupphaug, G. (2013). An inverse switch in DNA base excision and strand break repair contributes to melphalan resistance in multiple myeloma cells. PLoS One 8(2): e55493.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Sarno, A. (2013). Genomic 8-oxo-7,8-dihydro-2'-deoxyguanosine Quantification. Bio-protocol 3(17): e878. DOI: 10.21769/BioProtoc.878.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays > DNA structure and alterations
Biochemistry > Other compound > Reactive oxygen species
Molecular Biology > DNA > DNA damage and repair
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
baculovirus expressing hACE2?
1 Answer
53 Views
Jun 23, 2022
Related protocols
End-synapsis Assay
Jessica Cottarel and Patrick Calsou
Sep 20, 2013 8184 Views
Nucleosome Positioning Assay
Zhongliang Zhao and Holger Bierhoff
May 20, 2017 11067 Views
Quantification of Chromosomal Aberrations in Mammalian Cells
Inés Paniagua and Jacqueline J. L. Jacobs
Aug 20, 2023 1216 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
879 | https://bio-protocol.org/en/bpdetail?id=879&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA Isolation From Meloidogyne Spp. Galls
AG Alejandra García
Marta Barcala
JC Javier Cabrera
Carmen Fenoll
Carolina Escobar
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.879 Views: 9345
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in New Phytologist mar 2013
Abstract
We describe an efficient method to obtain a sufficient quantity of RNA from nematode-induced galls with a high quality and integrity, proved to be appropriate for transcriptomic analysis, i.e. real time PCR, microarray hybridization or second generation sequencing. This protocol is efficient for small quantities of galls (organs with high protein and sugar contents). The protocol allows obtaining an RNA yield of 5-15 μg total RNA from 250-300 hand dissected galls at 3 days post infection (dpi) (Figure 1). It was proved particularly for Arabidopsis and tomato.
Keywords: Galls Meloidogyne Efficient RNA extraction Transcriptomics High quality RNa
Figure 1. 3 dpi Arabidopsis gall from M. javanica. Blue lines indicate the collected material, galls with a small portion of roots (that allows easy handling), frozen and processed for RNA extraction.
Materials and Reagents
Arabidopsis infected by M. javanica (3 dpi or 7 dpi)
TRI Reagent (Molecular Research Centre, MRC, catalog number: TR-118 )
Chloroform (Scharlau, catalog number: CL02031000 )
Isopropanol (Merck KGaA, catalog number: 0 9634 )
Sodium citrate (Sigma-Aldrich, catalog number: s4641 )
Sodium chloride (Duchefa, catalog number: S0520 )
NaOH (Duchefa, catalog number: s0523 )
Ethanol (Merck KGaA, catalog number: 100986 )
Diethylpyrocarbonate (DEPC) (Sigma-Aldrich, catalog number: D5758 )
RNase-free water
Acetone (Thermo Fisher Scientific, catalog number: A/0600/17 )
Liquid nitrogen
RNeasy Mini Kit (QIAGEN, catalog number: 74104 ))
RNase-Free DNase Set (QIAGEN, catalog number: 79254 )
High salt precipitation solution (see Recipes)
Equipment
Centrifuges
Microfuge
1.5 ml Eppendorf® tubes
Porcelain mortar and pestles, textured surface on bowl interior, 60 mm diameter
Fume hood
Procedure
Note: Use gloves and goggles for all procedure.
Gall collection: To perform the RNA isolation from galls with a good efficiency, 250-300 hand dissected galls at 3 days post infection (3 dpi) or 100-150 galls at 7 dpi, should be collected. Collect galls and rapidly freeze them to a 1.5 ml Eppendorf® tube in liquid nitrogen.
Note: If scaled down, the RNA yield is not proportional to the amount of tissue. You can accumulate galls from independent collection events in the same Eppendorf®.
Store at -80 °C until further processing (step C).
Homogenization:
Clean mortar and pestles with acetone, let them dry on the bench and autoclaved to avoid RNase activity. CAUTION: Check that mortar, pestle and pipettes used during the extraction have not been in contact with RNases. Sometimes it is preferable to keep material exclusively for RNA extraction.
Add liquid nitrogen into the mortar with the pestle to cold them down.
Add the galls into the mortar and proceed into a fume hood.
When liquid nitrogen is nearly evaporated, add TRI Reagent® (500-750 μl/200-300 galls at 3 dpi); the total volume should not exceed 10% of the volume of TRI Reagent used for homogenization, as suggested by the TRI Reagent® protocol.
Grind galls with a mortar and pestle. TRI Reagent solution initially becomes frozen, but it will melt gradually as a result of the homogenization. Proceed until a liquid appearance is observed and no visible tissue pieces are identified within the Reagent solution.
Note: Do not leave traces of galls without homogenizing, since this step can be limiting for good efficiency.
Transfer the gall homogenate with a pipette to a 1.5 ml Eppendorf® tube and place it on ice while you homogenize the rest of the samples.
Phase separation
Centrifuge at 12,000 x g for 10 min at 4 °C and transfer the supernatant containing the RNA to a new 1.5 ml Eppendorf® tube.
Note: The resulting pellet contains membranes, polysaccharides and high molecular weight DNA while the supernatant contains RNA. All insoluble material should be removed from the homogenate.
Add 100 μl of chloroform per 500 μl of TRl Reagent® in a fume hood. Cap sample tubes securely.
Shake tubes vigorously by hand for 15 s and incubate them at room temperature (RT) for 5 to 10 min.
Note: Do not use vortex.
Centrifuge the samples at 12,000 x g for 15 min at 4 °C.
Transfer the upper aqueous phase to a new tube.
RNA precipitation
Add 125 μl of isopropanol and 125 μl of high salt buffer per 500 μl of TRl Reagent®. Mix the solution and store it for 5-10 min at RT.
Note: The high salt precipitation solution removes contaminating compounds as proteoglycan and polysaccharide from the isolated RNA.
Centrifuge at 12,000 x g for 8 min at 4 °C.
Discard the supernatant.
RNA Wash
Wash the RNA pellet with 1 ml of 75% ethanol and mix by inversion several times.
Centrifuge at 7,500 x g for 5 min at 4 °C and discard the supernatant.
Repeat steps E-1 and 2.
Spin 10 sec in a microfuge and discard carefully the remaining liquid.
Air dry the pellet for 3-5 min. Do not let the RNA over-dry, as this will make it difficult to dissolve. The white RNA pellet will turn clear when it dries out.
Add 100 μl DEPC-water or RNase-free water immediately after the pellet becomes clear.
Dissolve RNA by incubating for 10 min at 37 °C followed by 5 min at 60 °C.
Store RNA solution at -80 °C or continue with further RNA Cleanup by DNase digestion.
Combined in column DNase I Digestion and RNA Cleanup. This procedure is based on the combined use of two different commercial kits (RNase-Free DNase Set and RNeasy Mini Kit). Please, use handling instructions of all buffers and reagents following their recommendations.
Note: Buffers as RPE, RTL, RW1, RDD are supplied by the companies within the kits. Before starting RNA cleanup, make sure the DNase I and Buffer RPE are ready to use.
Preparation of DNase I stock solution: Inject 550 μl RNase-free water into the lyophilized DNase I vial using an RNase-free needle and syringe. Mix gently by inverting the vial and divide it in 10 μl single-use aliquots. Store at -20 °C for up 9 months.
Preparation of Buffer RPE: Add 4 volumes of 96-100% ethanol (44 ml) as indicated in the bottle.
Adjust the RNA sample volume to 100 μl with RNase-free water.
Add 350 μl of Buffer RLT and mix well by pipetting.
Add 250 μl EtOH, mix well by pipetting.
Transfer the sample to an RNeasy Mini spin column placed in a 2 ml collection tube. Close the lid gently and centrifuge at 8,000 x g for 15 sec. Discard the flow-through.
Add 350 μl buffer RW1 to the RNeasy spin column. Close the lid gently and centrifuge at 8,000 x g for 15 sec. Discard the flow-through.
Add 70 μl buffer RDD (supplied with the RNase-Free DNase Set) to 10 μl DNase I stock solution. Mix gently by inverting the tube.
Note: Do not vortex.
Add 80 μl of the DNase I incubation Mix to the RNeasy spin column, and place on the bench at RT for 15 min.
Note: Add the Mix directly to the center of the RNeasy spin column membrane.
Add 350 μl buffer RW1 to the RNeasy spin column. Close the lid gently and centrifuge at 8,000 x g for 15 sec. Discard the flow-through.
Add 500 μl buffer RPE to the RNeasy spin column. Close the lid gently and centrifuge at 8,000 x g for 15 sec. Discard the flow-through.
Add 500 μl buffer RPE to the RNeasy spin column. Close the lid gently and centrifuge at 8,000 x g for 2 min.
Note: The long centrifugation dries the spin column membrane, eliminating ethanol contamination.
Quickly remove the RNeasy spin column from the collection tube so that the column does not contact the flow through.
Place the RNeasy spin column in a new 2 ml collection tube. Close the lid gently and centrifuge at full speed for 1 min.
Note: It is important to eliminate any possible buffer RPE carryover.
Place the RNeasy spin column in a new 1.5 ml collection tube. Add 30 μl RNase-free water or DEPC-water to the center of the spin column membrane. Incubate 1 min at RT. Close the lid gently and centrifuge at 8,000 x g for 1 min to elute the RNA.
Add 20 μl RNase free water or DEPC-water to the center of spin column membrane to elute the maximum RNA. Incubate 1 min at RT. Close the lid gently and centrifuge at 8,000 x g for 1 min.
Use Nanodrop and/or Bioanalyzer to test the RNA quantity and quality. You should get 5-10 μg total RNA from 250-300 collected galls at 3 dpi of a high quality.
Store the RNA sample in -80 °C for future use.
Recipes
High salt precipitation solution
0.8 M sodium citrate
1.2 M NaCl
Acknowledgments
This protocol is adapted from Barcala et al. (2010) and Portillo et al. (2013).
References
Barcala, M., Garcia, A., Cabrera, J., Casson, S., Lindsey, K., Favery, B., Garcia-Casado, G., Solano, R., Fenoll, C. and Escobar, C. (2010). Early transcriptomic events in microdissected Arabidopsis nematode-induced giant cells. Plant J 61(4): 698-712.
Portillo, M., Cabrera, J., Lindsey, K., Topping, J., Andres, M. F., Emiliozzi, M., Oliveros, J. C., Garcia-Casado, G., Solano, R., Koltai, H., Resnick, N., Fenoll, C. and Escobar, C. (2013). Distinct and conserved transcriptomic changes during nematode-induced giant cell development in tomato compared with Arabidopsis: a functional role for gene repression. New Phytol 197(4): 1276-1290.
Portillo, M., Fenoll. C. and Escobar C. (2006). Evaluation of different RNA extraction methods for small quantities of plant tissue: Combined effects of reagent type and homogenisation procedure on RNA quality-integrity and yield. Physiol Plantarum 128 (1): 1-7.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant physiology > Endosymbiosis
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Updated Pseudo-seq Protocol for Transcriptome-Wide Detection of Pseudouridines
Yi Pan [...] Paul L. Boutz
May 5, 2024 331 Views
In Vitro Hyphal Branching Assay Using Rhizophagus irregularis
Takaya Tominaga and Hironori Kaminaka
Aug 20, 2024 634 Views
A Highly Efficient System for Separating Glandular and Non-glandular Trichome of Cucumber Fruit for Transcriptomic and Metabolomic Analysis
Lei Sun [...] Xingwang Liu
Jan 5, 2025 187 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
88 | https://bio-protocol.org/en/bpdetail?id=88&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Arabidopsis Pollen Tube Aniline Blue Staining
Yongxian Lu
In Press
Published: Jun 20, 2011
DOI: 10.21769/BioProtoc.88 Views: 26666
Ask a question
Favorite
Cited by
Abstract
The aim of this experiment is to track pollen tube growth in vivo in the female tissues after pollination. This can be used to phenotype pollen germination, tube growth and guidance, and reception.
Materials and Reagents
Stock solutions:
Acetic acid
Ethanol
NaOH
K2HPO4
KH2PO4
Aniline blue (Thermo Fisher Scientific)
Glycerol
Working solutions:
10% acetic acid in EtOH (fixative)
0.01% aniline blue in KPO4 buffer (dye)
KPO4 buffer made with 50% glycerol (mounting media)
KPO4 buffer (see Recipes)
Equipment
Microscope with UV light
Procedure
Submerge pistil tissue in 250 µl acetic acid and fix it for 1.5 h or more in an Eppendorf tube. Tissue can be fixed overnight if necessary.
Soften tissue by submerging it in 1 M NaOH overnight.
Wash 3 times with KPO4 buffer (tissue is fragile at this stage).
Stain with 200 µl aniline blue for 5-10 min or as long as 10 h.
Transfer to a slide, add mounting media and observe under UV. Squash if necessary.
Recipes
50 mM KPO4 buffer (pH 7.5)
4.17 ml 1 M K2HPO4
0.83 ml 1 M KH2PO4
995 ml H2O
References
Lu, Y., Chanroj, S., Zulkifli, L., Johnson, M. A., Uozumi, N., Cheung, A. and Sze, H. (2011). Pollen tubes lacking a pair of K+ transporters fail to target ovules in Arabidopsis. Plant Cell 23(1): 81-93.
Modified from the online protocol on Dr. Daphne Preusss’s lab (Univ of Chicago).
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cell Biology > Tissue analysis > Tissue staining
Plant Science > Plant cell biology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
880 | https://bio-protocol.org/en/bpdetail?id=880&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Pre- and Post-synaptic Density Fraction from Mouse Cortex
CS Chengyong Shen
YC Yong-Jun Chen
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.880 Views: 14043
Reviewed by: Xuecai Ge Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Nature Neuroscience Mar 2013
Abstract
The understanding of the organization of postsynaptic signaling systems at excitatory synapses has been aided by the identification of proteins in the postsynaptic density (PSD) fraction, a subcellular fraction enriched in structures with the morphology of PSDs. Here we described an efficient way to isolate the crude synaptosome, presynaptic fraction, and PSD fraction. It helps to identify the location of synaptic protein and find the potential synaptic complex.
Materials and Reagents
Sucrose
Protease inhibitor cocktail (1:100) (Sigma-Aldrich, catalog number: P8340-5ml )
20 mM HEPES (pH 7.0)
Triton X-100
KCl
NaHCO3
MgCl2
CaCl2
Tris-HCl
SDS
Glycerol
2-mercaptoethanol
BPB
Solution A (see Recipes)
SDS-PAGE sample buffer (see Recipes)
Equipment
Eppendorf table centrifuge
Swinging bucket rotor (model: SW51Ti )
Fixed-angle rotor
Dounce mini-homogenizer
Procedure
Note: PSD fraction of mouse cortex was prepared according to modified protocol.
Corticles are taken in the cold PBS under microscope. Could store at -80 °C if not using immediately. Brain is homogenized in Dounce mini-homogenizer, 50 strokes. Dissect 1 half cortex (or 2 Hipp), add 4 ml buffer to homogenize to looks milky and no obvious pieces of tissue.
If not indicated below, all experiments are performed at 4 °C.
The homogenates were centrifuged at 470 x g for 2 min.
Resultant supernatants (S1 fraction) were centrifuged at 10,000 x g for 10 min to obtain mitochondria- and synaptosome-enriched pellets (P2) and supernatants (S2 fraction) containing soluble proteins.
P2 fractions were resuspended in 3.75 ml of 0.32 M sucrose, which was then layered onto 0.8 M sucrose. Centrifuge at 9,100 x g for 15 min in a swinging bucket rotor.
After centrifugation, synaptosomes (most of the loose pellets) were collected from 0.8 M sucrose layer (Figure 1) and resuspended with equal volume of 20 mM HEPES (pH 7.0), 2% Triton X-100 and 150 mM KCl.
Figure 1. Sucrose ultracentrifugation of PSD fraction.
Samples were centrifuged at 20,800 x g for 45 min using a fixed-angle rotor, and resulting supernatants were collected as presynaptic fraction.
Pellets were resuspended in a solution of 1% Triton X-100 and 75 mM KCl using a Dounce mini-homogenizer and centrifuged again at 20,800 x g for 30 min to yield final pellets (PSD fraction, which be identified by marker PSD95), which were washed with 20 mM HEPES and dissolved in 1x SDS-PAGE sample buffer.
Recipes
Solution A
0.32 M sucrose
1 mM NaHCO3
1 mM MgCl2
0.5 mM CaCl2
1 mM PMSF and protease inhibitors
SDS-PAGE sample buffer
0.125 M Tris-HCl (pH 6.8)
4% SDS
20% Glycerol
10% 2-mercaptoethanol
0.2% BPB
Acknowledgments
This work was supported in part by grants from American Heart Association (C.Y). Methods are previously simply described in Tao et al. (2013).
References
Tao, Y., Chen, Y. J., Shen, C., Luo, Z., Bates, C. R., Lee, D., Marchetto, S., Gao, T. M., Borg, J. P., Xiong, W. C. and Mei, L. (2013). Erbin interacts with TARP gamma-2 for surface expression of AMPA receptors in cortical interneurons. Nat Neurosci 16(3): 290-299.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Shen, C. and Chen, Y. (2013). Preparation of Pre- and Post-synaptic Density Fraction from Mouse Cortex. Bio-protocol 3(17): e880. DOI: 10.21769/BioProtoc.880.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Organelle isolation > Fractionation
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Isolation and Enrichment of Major Primary Neuroglial Cells from Neonatal Mouse Brain
Santosh Kumar Samal [...] Jayasri Das Sarma
Jan 20, 2024 1428 Views
Microfluidic Cultures of Basal Forebrain Cholinergic Neurons for Assessing Retrograde Cell Death by Live Imaging
Srestha Dasgupta [...] Wilma J. Friedman
Jan 5, 2025 243 Views
Cochlear Organ Dissection, Immunostaining, and Confocal Imaging in Mice
Chenyu Chen [...] Dongdong Ren
Jan 20, 2025 1598 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
881 | https://bio-protocol.org/en/bpdetail?id=881&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Heterologous Production and Anaerobic Purification of His- and StrepII-tagged Recombinant Proteins
Jens Noth
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.881 Views: 15022
Reviewed by: Ru Zhang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Biological Chemistry Feb 2013
Abstract
This protocol describes the heterologous expression and purification of proteins related to anoxic hydrogen production of Chlamydomonas reinhardtii (Noth et al., 2013). For this, the bacterial expression hosts Escherichia coli BL21 (DE3) ΔiscR (Akhtar MK et al., 2008) and Clostridium acetobutylicum ATCC 824 are used, which are grown either aerobic or anaerobic with glucose. Two standard chromatographic methods for purification were applied using His- and StrepII-tagged proteins (Figure 1). All procedures have been performed in an anaerobic tent to avoid the access of oxygen.
Keywords: Fermentation Protein Isolation Hydrogenase Iron Sulfur Cluster Chlamydomonas reinhardtii
Figure 1. Coomassie stained SDS-PAGE of purified, heterologously expressed proteins from C. reinhardtii. M: MW marker PageRuler Prestained Protein Ladder 10-170 kDa; a) purified PFR1 loaded onto a 10% SDS-polyacrylamidgel; b) purified [2Fe2S] ferredoxin (PetF) loaded onto a 15% SDS-polyacrylamidgel; c) purifiedhydrogenase (HydA1) loaded onto a 10% SDS-polyacrylamidgel. Different amounts of protein are loaded onto each gel.
Materials and Reagents
Expression vector (pASK-IBA)
LB medium (Lennox) (Carl Roth)
Vogel Bonner minimal medium (homemade) (Vogel HJ et al., 1956)
Thiamin hydrochlorid (Carl Roth)
Resazurin (Riedel-de Haën)
Immidazole (Alfa Aesar)
Escherichia coli BL21 (DE3) ΔiscR
Clostridium acetobutylicum ATCC 824
Ni Sepharose 6 Fast Flow (GE Healthcare)
Strep-Tactin Superflow (IBA Gmb)
Ampicillin
Anhydrotetracycline
Glucose
Sodium dithionite (laboratory reagent grade > 85%)
Avidin (Affiland)
Strep tactin
Glycerol
d-desthiobiotin (≥ 98%, TLC)
Thiamine pyrophosphate
PageRuler Prestained Protein Ladder 10-170 kDa (Thermo Fisher Scientific, catalog number: 26616 )
0.1 M Tris buffer (pH 8) (see Recipes)
Pre-equilibrated gravity flow Ni-NTA (see Recipes)
Equipment
Airtight vial
Sonicator: Branson Sonifier 250 (Branson)
Ultracentrifuge
Anaerobic tent (1% H2, 99% N2) (Toepffer Lab Systems)
0.2 μm pore size sterile filter (Sarstedt AG & Co.)
NanoDrop (Paqlab, Germany)
Batch fermenter (Infors HT, CH)
Procedure
Anaerobic expression of pyruvate: ferredoxin oxidoreductase (Noth et al., 2013)
Electroporation (Sambrook et al., 2006) of 100 μl E. coli BL21 (DE3) ΔiscR (Akhtar et al., 2008) with ~100 ng expression vector (pASK-IBA).
Inoculation of 200 ml LB and aerobic growth of a preculture over night at 37 °C (180 rpm).
Inoculation of 4 L Vogel Bonner medium (8 x 500 ml; 2,000 ml Erlenmeyer flasks) supplemented with 100 μg/ml ampicillin, 50 μM thiamin hydrochlorid and 0.2 μM resazurin using 15 ml preculture each.
Aerobic growth at 37 °C and 180 rpm until the culture reaches the anaerobic phase at A600 of 0.6. At that point, the redox indicator resazurin within the medium turns from blue to pink.
Each 2 L of culture are induced by adding 0.2 μg/ml anhydrotetracycline and transferred into sterile 2 L Schott flasks containing 50 ml 20% glucose (5 g/L).
Protein expression is carried out over night at 8 °C without stirring.
Cells are anaerobically harvested by centrifugation for 20 min at 7,500 x g, resuspended in Tris-HCl (pH 8.0), 10% glycerol and stored at -20 °C until purification.
Anaerobic purification of pyruvate: ferredoxin oxidoreductase (His-tag)
For purification the pellet (2 L of culture) is thawed at room temperature and lysed by sonication while keeping the cells cooled on ice.
Note: Five times for 30 sec; output, 25; Branson Sonifier 250.
Sedimentation of cell debris at 200,000 x g for 60 min and 4 °C in an ultracentrifuge.
The soluble fraction is filtered using a pore size of 0.2 μm to get rid of unwanted material which clogs the column.
Then, the sample is loaded on a pre-equilibrated (100 mM Tris-HCl, pH 8.0, 10 mM imidazole, 0.5 mM thiamine pyrophosphate) gravity flow Ni-NTA fast-flow column with a bed volume of 4 ml.
Protein purification is achieved via increasing the imidazole concentration from 10 to 20 mM during washing each with 40 ml buffer.
The His-tagged PFR1 protein is eluted from the column with 10 ml buffer containing 100 mM imidazole. Nine elution fractions each 1.1 ml are collected.
The protein concentration of the brownish main elution fractions 3 and 4 are immediately determined using A280.
Aerobic expression of [2Fe2S] ferredoxins (Jacobs et al., 2009; Winkler et al., 2009) with minor changes
E. coli BL21 (DE3) ΔiscR containing the expression plasmid pASK-IBA7-FDX is grown in Vogel Bonner minimal medium for 4 h after induction at A600 of 0.6.
Cells are harvested, washed in Tris-HCl (pH 8.0), sedimented again and stored at -20 °C until purification.
Anaerobic expression of HydA1 (Girbal et al., 2005; von Abendroth et al., 2008)
Expression plasmid containing C. acetobutylicum ATCC 824 strain is grown in CGM-medium and a glucose concentration of 60 g/L anaerobically in a batch fermenter over night at 35-37 °C and 100 rpm.
Cells are harvested in an anaerobic tent analog to E. coli, resuspended in Tris-HCl (pH 8.0), 10% glycerol containing 10 mM sodium dithionite and stored at -20 °C until purification.
Anaerobic expression of bacterial 2[4Fe4S] ferredoxin analog to HydA1 (Girbal et al., 2005; von Abendroth et al., 2008, Noth et al., 2013)
Expression plasmid containing C. acetobutylicum ATCC 824 strain is grown in CGM-medium and a glucose concentration of 60 g/L anaerobically in a batch fermenter over night at 35-37 °C and 100 rpm.
Cells are harvested in an anaerobic tent analog to E. coli, resuspended in Tris-HCl (pH 8.0), 10% glycerol containing 10 mM sodium dithionite and stored at -20 °C until purification.
Anaerobic purification of StrepII-tagged proteins (C-E)
All buffers used contain 2 mM sodium dithionite.
For purification the cell pellet is thawed at room temperature and lysed by sonication while keeping the cells cooled on ice.
Note: Five times for 30 sec; output, 25; Branson Sonifier 250.
Sedimentation of cell debris at 200,000 x g for 60 min and 4 °C in an ultracentrifuge.
Supernatant (40 ml) is incubated for 1 hour with 3.5 mg Avidin (Stock 50 mg.ml-1) at 4 °C.
The soluble fraction is filtered using a poresize of 0.2 μm to get rid of biotinylated, complexed proteins and unwanted material which clogs the column.
Then, the filtered solution is loaded on a Tris-HCl (pH 8.0) equilibrated 2 ml strep tactin gravity flow column.
The unbound proteins are washed from the column using 80 ml Tris-HCl (pH 8.0).
Elution is performed with 10 ml Tris-HCl (pH 8.0), d-desthiobiotin (0.8 mg/ml) in fractions of 1 ml.
Recipes
0.1 M Tris buffer (pH 8) (1,000 ml)
Mix 12.114 g of Tris base with 800 ml dH2O
Add 100 ml Glycerol
pH to 8 with HCl
Add ddH2O to 1,000 ml
Autoclave for 20 min at 121 °C
Store at 4 °C
Pre-equilibrated gravity flow Ni-NTA
0.1 mM Tris-HCl (pH 8)
10 mM imidazole
0.5 mM thiamine pyrophosphate
Acknowledgments
Aerobic expression of [2Fe2S] ferredoxins was adapted from Jacobs et al. (2009). Anaerobic expression and purification of the 2[4Fe4S] bacterial type ferredoxin was done according to the previously published isolation of [FeFe]-Hydrogenase HydA1 from Chlamydomonas reinhardtii by Girbal et al. (2005) and von Abendroth et al. (2008), which is also presented here. Research on the pyruvate:ferredoxin oxidoreductase from C. reinhardtii was scientifically supported by Anja Hemschemeier and Thomas Happe.
References
Noth, J., Krawietz, D., Hemschemeier, A. and Happe, T. (2013). Pyruvate:ferredoxin oxidoreductase is coupled to light-independent hydrogen production in Chlamydomonas reinhardtii. J Biol Chem 288(6): 4368-4377.
Akhtar, M. K. and Jones, P. R. (2008). Deletion of iscR stimulates recombinant clostridial Fe-Fe hydrogenase activity and H2-accumulation in Escherichia coli BL21(DE3). Appl Microbiol Biotechnol 78(5): 853-862.
Girbal, L., von Abendroth, G., Winkler, M., Benton, P. M., Meynial-Salles, I., Croux, C., Peters, J. W., Happe, T. and Soucaille, P. (2005). Homologous and heterologous overexpression in Clostridium acetobutylicum and characterization of purified clostridial and algal Fe-only hydrogenases with high specific activities. Appl Environ Microbiol 71(5): 2777-2781.
Jacobs, J., Pudollek, S., Hemschemeier, A. and Happe, T. (2009). A novel, anaerobically induced ferredoxin in Chlamydomonas reinhardtii. FEBS Lett 583(2): 325-329.
Sambrook, J. and Russell, D. W. (2006). Transformation of E. coli by Electroporation. CSH Protoc 2006(1).
Vogel, H. J. and Bonner, D. M. (1956). Acetylornithinase of Escherichia coli: partial purification and some properties. J Biol Chem 218(1): 97-106.
von Abendroth, G., Stripp, S., Silakov, A., Croux, C., Soucaille, P., Girbal, L. and Happe, T. (2008). Optimized over-expression of [FeFe] hydrogenases with high specific activity in Clostridium acetobutylicum. Inter J Hydrogen Energy 33(21): 6076-6081.
Winkler, M., Kuhlgert, S., Hippler, M. and Happe, T. (2009). Characterization of the key step for light-driven hydrogen evolution in green algae. J Biol Chem 284(52): 36620-36627.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Noth, J. (2013). Heterologous Production and Anaerobic Purification of His- and StrepII-tagged Recombinant Proteins . Bio-protocol 3(17): e881. DOI: 10.21769/BioProtoc.881.
Noth, J., Krawietz, D., Hemschemeier, A. and Happe, T. (2013). Pyruvate:ferredoxin oxidoreductase is coupled to light-independent hydrogen production in Chlamydomonas reinhardtii. J Biol Chem 288(6): 4368-4377.
Download Citation in RIS Format
Category
Plant Science > Phycology > Protein > Expression
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Assay for Phytaspase-mediated Peptide Precursor Cleavage Using Synthetic Oligopeptide Substrates
Sven Reichardt [...] Andreas Schaller
Feb 5, 2023 463 Views
Autolysin Production from Chlamydomonas reinhardtii
Justin Findinier
Jul 5, 2023 528 Views
A Simple Sonication Method to Isolate the Chloroplast Lumen in Arabidopsis thaliana
Jingfang Hao and Alizée Malnoë
Aug 5, 2023 597 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
882 | https://bio-protocol.org/en/bpdetail?id=882&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pyruvate:ferredoxin Oxidoreductase (PFR1) Activity Assays Using Methyl Viologen as Artificial Electron Acceptor
Jens Noth
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.882 Views: 12219
Reviewed by: Ru Zhang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Biological Chemistry Feb 2013
Abstract
Here we describe the activity measurements of heterologous expressed pyruvate:ferredoxin oxidoreductase (Noth et al., 2013) (Noth et al.,2013) from Chlamydomonas reinhardtii. This enzyme catalyzes the reversible reaction (I) from pyruvate to acetyl CoA and CO2 generating low potential electrons which are in vivo transferred to ferredoxin.
In this assay we use methyl viologen as artificial electron acceptor which turns into dark violet (ε604 = 13.6 mM-1 cm-1) (Mayhew, 1978) in its reduced state (Figure 1).
Keywords: Fermentation Oxidoredutase Activity Assay Iron Sulfur Cluster Chlamydomonas reinhardtii
Figure 1. Activity assay using pyruvate, coenzyme A and methyl viologen (Ctrl+). In the absence of pyruvate, no methyl viologen reduction occurs (Ctr-).
Materials and Reagents
Note: All Reagents are dissolved freshly in an anaerobic tent.
Purified pyruvate: ferredoxin oxidoreductase (PFR1)
Sodium pyruvate (≥ 99%, Stock 500 mM) (Sigma-Aldrich)
Sodium coenzyme A (≥ 85%, Stock 20 mM) (Sigma-Aldrich)
Thiamine pyrophosphate (≥ 95%, Stock 250 mM) (Sigma-Aldrich)
Methyl viologen (98%, Stock 1 M) (Sigma-Aldrich)
Dithioerythriol (≥ 99%, Stock 100 mM) (Carl Roth)
0.1 M Tris-HCl buffer (pH 8.0) (see Recipes)
Equipment
Anaerobic tent (1% H2, 99% N2) (Toepffer Lab Systems)
96 well plate reader (Beckman Coulter, catalog number: Paradigm1113 )
PC running Multimode analysis software (Beckman Coulter)
NanoDrop (Paqlab)
Procedure
Protein concentration of heterologous expressed and purified PFR1 from 2 L of cell culture is measured at A280nm using NanoDrop. (ref bio-protocol: Heterologous Production and Anaerobic Purification of His- and StrepII-tagged Recombinant Proteins).
All reduction assays are performed under anaerobic atmosphere (1% H2, 99% N2) at room temperature.
The reaction mixture contains 10 mM sodium pyruvate, 2 mM sodium coenzyme A, 5 mM thiamine pyrophosphate, 10 mM methyl viologen and 16 mM dithioerythritol in 0.1 mM Tris-HCl (pH 8).
To start catalysis a final concentration of 1.4 μM PFR1 is added to the reaction mixture and absorbance (A604, 96 well plate reader) can be monitored time resolved every 30 seconds until saturation is reached.
To determine enzyme activity the molar extinction coefficient ε604 = 13.6 mM-1 cm-1 (Mayhew, 1978) can be used applying Lambert Beer Law (Eq.I). One unit was defined as the conversion of 1 mol of pyruvate or CoA and the reduction of 2 mol of methyl viologen, respectively, per minute.
Eλ = ελ . c . d (Eq.I)
Eλ: extinction
ελ: extinction coefficient
c: concentration
d: layer thickness
Recipes
0.1 M Tris-HCl buffer (pH 8.0) (1,000 ml)
Mix 12.114 g of Tris base with 800 ml dH2O
Adjust pH to 8 with HCl
Add ddH2O to 1,000 ml
Autoclave for 20 minutes at 121 °C
Store at 4 °C
Acknowledgments
Kinetics for enzyme dependent methyl viologen reduction is adapted from Zeikus et al. (1977). Research on the pyruvate:ferredoxin oxidoreductase from C. reinhardtii was scientifically supported by Anja Hemschemeier and Thomas Happe.
References
Mayhew, S. G. (1978). The redox potential of dithionite and SO-2 from equilibrium reactions with flavodoxins, methyl viologen and hydrogen plus hydrogenase. Eur J Biochem 85(2): 535-547.
Noth, J., Krawietz, D., Hemschemeier, A. and Happe, T. (2013). Pyruvate:ferredoxin oxidoreductase is coupled to light-independent hydrogen production in Chlamydomonas reinhardtii. J Biol Chem 288(6): 4368-4377.
Noth, J. (2013). Heterologous production and anaerobic purification of His- and StrepII-tagged recombinant proteins. Bio-protocol 3(17): e881.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Phycology > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Assay of the Carboxylase Activity of Rubisco from Chlamydomonas reinhardtii
Hemanth P. K. Sudhani [...] Joaquín Moreno
Dec 5, 2015 9324 Views
Determination of Recombinant Mannitol-1-phosphatase Activity from Ectocarpus sp.
Agnès Groisillier and Thierry Tonon
Aug 20, 2016 8292 Views
Determination of Recombinant Mannitol-1-phosphate Dehydrogenase Activity from Ectocarpus sp.
Agnès Groisillier and Thierry Tonon
Nov 5, 2016 8215 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
883 | https://bio-protocol.org/en/bpdetail?id=883&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Plant Endo-β-mannanase Activity Assay
Yunjun Zhao
Laigeng Li
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.883 Views: 9212
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Plant Journal May 2013
Abstract
Endo-β–mannanases in plant require post-translational modification, such as N-glycosylation and disulfide-linked dimerization, for their catalytic activity. Determination of the plant endo-β–mannanase activity needs to modify the assay conditions for optimizing their enzymatic reaction. Here, we describe a modified method for plant endo-β–mannanase assay. A high-salt buffer without thiol reductants is required for effective extraction of the enzyme. The enzyme is able to digest water-insoluble AZCL galactomannan to release water soluble dyed fragments, which is detected through measurement of absorbance at 590 nm wavelength. Increase in absorbance at 590 nm is correlated directly with enzyme activity.
Keywords: Endo-ß-mannanse Poplar AZC L-galactomannan PtrMAN6
Materials and Reagents
Liquid nitrogen
BCA Reagent (Tiangen Biotech, catalog number: PA115-01 )
Bovine serum albumin
AZC L-galactomannan (Megazyme, catalog number: I-AZGMA )
Commercial Aspergillus niger endo-β-mannanase (Megazyme, catalog number: E-BMANN )
100 mM phenylmethanesulfonyl fluoride (PMSF) (see Recipes)
0.5 M ethylene diaminete traacetic acid (EDTA) (see Recipes)
Extraction buffer (see Recipes)
0.1 M sodium acetate buffer (pH 5.0) (see Recipes)
Equipment
Mortar and pestle
10,000 Mr cut-off filter (EMD Millipore, catalog number: UFC801096 )
Centrifuge
Incubator shaker
Water bath
Microplate reader or Spectrophotometer
Procedure
Samples (~ 10 g developing xylem or leaves from one-year-old poplar) are ground in liquid nitrogen to a fine powder and homogenized at 4 °C in 1.5-volume fold of extraction buffer for 1 h (strong enzymatic activity can be detected in developing xylem).
The homogenate is centrifuged at 10,000 x g for 30 min at 4 °C.
The supernatant is then passed through a 10,000 Mr cut-off filter and dehydrated to < 500 μl, then the protein is diluted to ~1 μg/μl in 0.1 M sodium acetate buffer (pH 5.0) at 4 °C.
The protein extraction is measured by BCA Reagent using bovine serum albumin as a standard.
200 μl of reaction mixture containing 100 μl of 1% AZC L-galactomannan (w/v, in 0.1 M sodium acetate buffer, pH 5.0) and 20 μg of extracted proteins or heated inactive proteins (100 °C 10 min, as control) is incubated at 40 °C for 2 h with continuous shake.
The reaction mixture is boiled at 100 °C for 5 min and centrifuged at 12,000 x g for 5 min.
The absorbance (A) of the supernatant at 590 nm is determined. The background values (A0) obtained using heated inactive proteins are subtracted from values (A1) obtained using active extract (A = A1 - A0).
Standardization
Enzyme activity of a serial dilutions of a commercial Aspergillus niger endo-β-mannanase (E-BMANN, Megazyme) is determined under the conditions: 200 μl of reaction mixture containing 100 μl of 1% AZC L-galactomannan and E-BMANN is incubated at 40 °C for 2 h.
A standard curve correlated with E-BMANN activity is shown in Figure 1. For absorbance values in a range of 0.05~0.9, these values can be calculated by reference to the equation: Y = SX + C. Where:
Y = endo-β-Mannanase activity (in micro-Units/assay, i.e. per 200 μl)
S = Slope of the calibration graph
X = Absorbance of the reaction at 590 nm (A)
C = Intercept on the Y-axis
According to the manufacturer’s instruction, one Unit of activity is defined as the amount of enzyme required to release one micromole of mannose reducing-sugar equivalents per minute under the defined assay conditions (1 micro-Unit = 1 pmol/min).
Calculation of enzyme activity: endo-β-Mannanase activity in the sample is determined by reference to the standard curve to convert absorbance values to micro-Units per assay (Y), then further to micro-Units per μg protein (Y/[20 μg protein], pmol/min/[μg protein]).
Figure 1. Endo-β-mannanase standard curve on the commercial endo-β-mannanase.
Recipes
100 mM Phenylmethanesulfonyl fluoride (PMSF) 10 ml
Mix 0.174 g of PMSF with 10 ml isopropanol
Store in small aliquots at -20 °C
0.5 M Ethylene diamine tetraacetic acid (EDTA) (pH 8.0) (1 L)
Dissolve 186.1 g EDTA-Na.2H2O in 800 ml dH2O
Adjust pH to 8.0 with NaOH (~20 g NaOH particles)
Add dH2O to 1 L
Autoclave at 121 °C for 20 min
Store at RT
Extraction buffer (1 L)
1 M sodium acetate buffer (pH 5.0)
10 mM EDTA
10 mM sodium azide
3 mM PMSF
Mix 57 ml glacial acetic acid (1.05 g/ml) and 20 ml 0.5 M EDTA with 800 ml dH2O
Adjust pH to 5.0 with NaOH
Add 0.65 g sodium azide
Add dH2O to 1 L
Add 30 μl of 100 mM PMSF per ml extraction buffer immediately before use
Note: Do not add the sodium azide until pH is adjusted. Acidification of sodium azide will release a poisonous gas.
0.1 M sodium acetate buffer (pH 5.0)
Mix 5.7 ml glacial acetic acid (1.05 g/ml) with 800 ml dH2O
Adjust pH to 5.0 with NaOH
Add 0.65 g sodium azide
Add dH2O to 1 L
Acknowledgments
This protocol was adapted from Zhao et al. (2013).
References
Zhao, Y., Song, D., Sun, J. and Li, L. (2013). Populus endo-beta-mannanase PtrMAN6 plays a role in coordinating cell wall remodeling with suppression of secondary wall thickening through generation of oligosaccharide signals. Plant J 74(3): 473-485.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Zhao, Y. and Li, L. (2013). Plant Endo-β-mannanase Activity Assay. Bio-protocol 3(17): e883. DOI: 10.21769/BioProtoc.883.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein > Activity
Biochemistry > Protein > Activity
Plant Science > Plant biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
An in vitro Assay to Probe the Formation of Biomolecular Condensates
Yu Zhang and Shen Lisha
Sep 5, 2023 1441 Views
Streamlining Protein Fractional Synthesis Rates Using SP3 Beads and Stable Isotope Mass Spectrometry: A Case Study on the Plant Ribosome
Dione Gentry-Torfer [...] Federico Martinez-Seidel
May 5, 2024 698 Views
Immunofluorescence for Detection of TOR Kinase Activity In Situ in Photosynthetic Organisms
Ana P. Lando [...] Giselle M. A. Martínez-Noël
Dec 20, 2024 312 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
884 | https://bio-protocol.org/en/bpdetail?id=884&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Seed Germination and Viability Test in Tetrazolium (TZ) Assay
Pooja Verma
Manoj Majee
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.884 Views: 61886
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Mar 2013
Abstract
Tetrazolium (TZ) assay is the fast evaluation for seed viability and alternative quick method for seed’s germinability (Porter et al., 1947; Wharton, 1955). All respiring tissues are capable of converting a colourless compound, TZ (2,3,5 triphenyl tetrazolium chloride) to a carmine red coloured water-insoluble formazan by hydrogen transfer reaction catalysed by the cellular dehydrogenases. TZ enters both living and dead cells but only living cells catalyse the formation of formazan which being non-diffusible stains the viable seeds red whereas the absence of respiration prevents formazan production making the dead seeds (aged tissue) remain unstained.
The brief description of this protocol has been reported in Verma et al., 2013.
Materials and Reagents
Arabidopsis thaliana (Columbia-0) seeds were used in our study
2,3,5 triphenyl tetrazolium chloride (Sigma-Aldrich, catalog number: T8877 )
Commercial bleach (Sodium hypochlorite)
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Autoclaved distilled water
Lactic acid
Phenol
Glycerine
Whatman no.1 filter paper
1% Tetrazolium (TZ) solution (see Recipes)
Scarification solution (see Recipes)
Clearing agent (lactophenol solution) (see Recipes)
Equipment
30 °C incubator
Shaker at RT
Weighing balance
pH meter
Stereo Microscope
Culture room (22 °C ± 2, 16 h light 200 μmol/m2/s/8 h dark)
(any instrument which provides above mentioned conditions will work)
Procedure
Scarify the Arabidopsis seeds by soaking approximately 100 seeds (in three replicates) in 1 ml scarification solution for 15 min under shaking conditions at RT. Wash at least five times with distilled water to remove the bleach.
Note: Perform steps 1-3 under sterile conditions.
After scarification, remove excess water and incubate the seeds with 1% TZ solution at 30 °C for 24 to 48 h in dark (observe the seeds after 24 h and proceed with step 3 if stain appears). Take heat killed (100 °C, 1 h) seeds as negative control.
After staining, wash the seeds 2-3 times with distilled water.
Immerse the stained seeds in clearing agent for 1-2 h.
Follow step 4, if the pigment within the seed coat prevents clear vision after staining.
Observe the seeds under stereo microscope.
Evaluate the seeds on the basis of staining pattern and colour intensity. Among stained seeds, seeds with bright red staining are completely viable while partially stained seeds may produce either normal or abnormal seedlings. Pink or greyish red stain indicates dead tissue. Completely unstained seeds are non-viable. Figure 1 shows TZ staining pattern in viable (normal), abnormal and dead or non-viable seeds.
Figure 1. Different pattern of TZ staining showing visable, abnormal and dead or non-viable seeds
In parallel, place about 100 seeds without scarification on two layers of Whatman no.1 filter paper soaked with distilled water in culture room for germination assay (perform the germination assay in triplicate). Score the seed germination by considering radicle protrusion beyond testa as germinated seeds. To score the germination, count the no. of seeds with radicle protrusion as germinated seeds and calculate the percentage germination against total no. of seeds.
Recipes
1% Tetrazolium (TZ) solution
Add 1 g 2,3,5 triphenyl tetrazolium chloride in 100 ml autoclaved distilled water in amber colour bottle.
Mix well and store in dark at 4 °C (can be kept for several months under such conditions).
Scarification solution
20 ml commercial bleach and 100 μl Triton X-100 in 100 ml autoclaved distilled water. Mix well and store under sterilized conditions (prepare fresh).
Clearing agent (lactophenol solution)
Mix lactic acid: phenol: glycerine: water in a ratio of 1:1:2:1. Use if the pigment within the seed coat prevents clear vision after staining (prepare fresh).
Notes
The pH of the TZ staining solution should be 7. Solution with pH > 8 or pH < 4 would result in either intense staining or would not stain even viable seed tissues. If water is out of neutral range then use phosphate buffer with pH 7 to dissolve TZ.
TZ assay can be used for seeds of legume, cotton and grasses. The incubation time varies with seed type and morphology. Remove the seed coats of larger seeds (like legume seeds) before examination.
The dicot seeds can be germinated further as the stained seeds are not damaged.
When performed appropriately, the percentage of viable seeds obtained by tetrazolium assay is very close to the percentage of seed germination expected under most favourable conditions.
Acknowledgments
This protocol was adapted from Porter et al. (1947) and Wharton (1955). This work was supported by the Department of Biotechnology (grant no. BT/PR10262/GBD/27/77/2007) and National Institute of Plant Genome Research, Government of India.
References
Porter, R., Durrell, M. and Romm, H. (1947). The use of 2, 3, 5-triphenyl-tetrazoliumchloride as a measure of seed germinability. Plant Physiol 22(2): 149.
Verma, P., Kaur, H., Petla, B. P., Rao, V., Saxena, S. C. and Majee, M. (2013). PROTEIN L-ISOASPARTYL METHYLTRANSFERASE2 is differentially expressed in chickpea and enhances seed vigor and longevity by reducing abnormal isoaspartyl accumulation predominantly in seed nuclear proteins. Plant Physiol 161(3): 1141-1157.
Wharton, M. J. (1955). The use of tetrazolium test for determining the viability of seeds of the genus Brassica. Proc Int Seed Test Assoc 20: 81-88.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Verma, P. and Majee, M. (2013). Seed Germination and Viability Test in Tetrazolium (TZ) Assay. Bio-protocol 3(17): e884. DOI: 10.21769/BioProtoc.884.
Verma, P., Kaur, H., Petla, B. P., Rao, V., Saxena, S. C. and Majee, M. (2013). PROTEIN L-ISOASPARTYL METHYLTRANSFERASE2 is differentially expressed in chickpea and enhances seed vigor and longevity by reducing abnormal isoaspartyl accumulation predominantly in seed nuclear proteins. Plant Physiol 161(3): 1141-1157.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Tissue analysis
Plant Science > Plant physiology > Plant growth
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Targeting Ultrastructural Events at the Graft Interface of Arabidopsis thaliana by A Correlative Light Electron Microscopy Approach
Clément Chambaud [...] Lysiane Brocard
Jan 20, 2023 1114 Views
Quantification of Ethylene Production in Leaf and Bud Tissue of the Subtropical Tree Crop Litchi (Litchi chinensis Sonn.) Using Gas Chromatography and Flame Ionization Detection
Regina B. Cronje and Arnoldus J. Jonker
Mar 20, 2023 571 Views
Bi-directional Dual-flow-RootChip for Physiological Analysis of Plant Primary Roots Under Asymmetric Perfusion of Stress Treatments
Claudia Allan [...] Claudia-Nicole Meisrimler
Aug 5, 2023 509 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
885 | https://bio-protocol.org/en/bpdetail?id=885&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Three-dimensional Invasion Assay
Wen-Hao Yang
Muh-Hwa Yang
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.885 Views: 12030
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Nature Cell Biology Apr 2012
Abstract
The invasive ability of cancer cells is a crucial function for cancer metastasis and the surrounding microenvironment of cancer cells in living tissues is three-dimension (3D). Therefore, to establish an in vitro invasion assay in a 3D system to predict cancer invasive ability is valuable in the research for cancer metastasis. Here, we describe a 3D invasion assay for observing the morphology and comparing the invasive ability of cancer cells in artificial 3D environments (Yang et al., 2012). Collagen I gels are used to cover on the top of cancer cells attached on coverslip glass dish and medium containing FBS is added as a chemoattractant. After incubation for a suitable time, the cells are fixed and stained. The invasion index can be calculated and the morphology can be imaged with a laser confocal microscope.
Keywords: 3D invasion Collagen gel Invasion index
Materials and Reagents
Cell lines: OECM-1(Huang et al., 2004) and FaDu (ATCC® HTB-43 TM)
0.1% Trypsin-EDTA (Life Technologies, Gibco®, catalog number: 15400 )
0.1 mg/ml poly-L lysine (Sigma-Aldrich, catalog number: P9404-25MG )
PBS
FBS (Thermo Fisher Scientific, catalog number: SH30071.03 )
PureCor® bovine collagen solution (Advance Biomatrix Inc., catalog number: 5005-B )
1 M NaOH solution
5x RPMI medium
3% Paraformaldehyde (Sigma-Aldrich, catalog number: P6148-500G )
0.5% Triton X100 (Bionovas, catalog number: 56-81-5 )
Alexa Fluor® 488 Phalloidin (Life Technologies, catalog number: A12379 )
DAPI (Sigma-Aldrich, catalog number: D8417 )
1% BSA in PBS
1.8 mg/ml collagen I mix solution (see Recipes)
Equipment
Lab-Tek® chambered #1.0 coverglass system (NUNC, catalog number: 155383 )
Laser confocal microscope with 60x oil lens (Olympus, model: FV1000 )
CO2 incubator
Software
Olympus FV10-ASW 1.7 software
Procedure
Day 1
Treat Lab-Tek® chambered #1.0 coverglass system with 300 μl of 0.1 mg/ml poly-L lysine solution for one hour at 37 °C.
Aspirate the poly-L lysine solution and wash one time with PBS.
Trypsinize cells and 2 x 105 cells in 500 μl medium were plated on coverglass system for attachment.
After attachment time for 3 to 6 h, prepare the appropriate volume of collagen I mix solution (final concentration 1.8 mg/ml) on ice then carefully remove the medium from coverglass system (avoid to wash cells again) and add 500 μl of collagen I mix solution to coverglass system.
Cells were incubated at 37 °C, 5% CO2 for 2 h.
Overlay with 400 μl of medium containing with 15% FBS on collagen gels.
Incubate at 37 °C, 5% CO2 for 24 to 48 h.
Day 2 or 3
Carefully aspirate medium from wells and rinse wells including collagen gel invaded by cells with PBS once.
Carefully pour 400 μl of 3% paraformaldehyde in PBS for 40 min at RT to fix cells.
Carefully rinse two times with 400 μl PBS.
Permeabilization in 400 μl of 0.5% Triton X-100 in PBS for 40 min at RT.
Carefully rinse two times with 400 μl PBS.
Incubate cells with 400 μl of 1% BSA in PBS for 40 min at RT.
Stain cells with 500 μl of Alexa Fluor® 488 Phalloidin diluted to 1 units/ml in PBS for 90 min at RT.
Carefully rinse two times with PBS.
Stain cells with 500 μl of 2 μg/ml DAPI in PBS for 30 min.
Wash three times with 400 μl PBS and aspirate all PBS.
Samples can be stored at 4 °C for 2 weeks or ready to be imaged by a laser confocal microscope. Imaging and quantification.
Use an Olympus FV1000 laser confocal microscope with 60x oil lens to capture images. The volume of observation is xyz = 210 x 210 x 50 μm3.
Confocal Z slices are collected each well at 50 μm from the bottom of the well and z interval is set to 1 μm.
Images of sequential Z sections were obtained and reconstructed by Olympus FV10-ASW 1.7 software.
Figure 1. Representative image of FaDu overexpressing Twist1 cells that invaded into collagen after 24 h (please refer to Reference 1 for the detail)
The invasion index is quantified as the number of cells existing at the distance from the bottom of slide between 30 to 50 μm divided by the total number of cells.
Note: The cells that are partially fallen into the range of 30-50 μm can also be counted.
The data are presented as the percentage of the invasion index of the control sample and representative vertical sections.
Recipes
1.8 mg/ml Collagen I mix solution
1.7 ml PureCor® bovine collagen solution (3 mg/ml)
0.6 ml 5x RPMI
18 μl 1 M NaOH
Add dH2O to 3 ml
All buffers must be on ice before polymerization in the tissue culture incubator. This mix solution must be prepared freshly to use.
Acknowledgments
This protocol was carried out as described in Sanz-Moreno et al. (2008) with minor modifications. The establishment of this protocol was funded by the National Health Research Institutes (NHRI-EX100-10037BI to M-H.Y.; NHRI-EX100-9931BI to K-J.W.); the National Science Council (NSC 99-2314-B-010-007-MY3 and 100-2321-B-010-015 to M-H.Y.; NSC 100-2321-B-039-002 to M-C.H.); Taipei Veterans General Hospital (VGH 100-C-088, 101-C-005 to M-H.Y.); Veterans General Hospitals University System of Taiwan Joint Research Program (VGHUST101-G7-4-1 to M-H.Y.); a grant from the Ministry of Education, Aim for the Top University Plan (to M-H.Y.); a grant from the Department of Health, Center of Excellence for Cancer Research (DOH100-TD-C-111-007 to M-H.Y; DOH101-TD-C-111-005 to M-C.H.); and the Sister Institution Fund of China Medical University and Hospital and MD Anderson Cancer Center.
References
Huang, G. C., Liu, S. Y., Lin, M. H., Kuo, Y. Y. and Liu, Y. C. (2004). The synergistic cytotoxicity of cisplatin and taxol in killing oral squamous cell carcinoma. Jpn J Clin Oncol 34(9): 499-504.
Yang, W. H., Lan, H. Y., Huang, C. H., Tai, S. K., Tzeng, C. H., Kao, S. Y., Wu, K. J., Hung, M. C. and Yang, M. H. (2012). RAC1 activation mediates Twist1-induced cancer cell migration. Nat Cell Biol 14(4): 366-374.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Yang, W. and Yang, M. (2013). Three-dimensional Invasion Assay. Bio-protocol 3(17): e885. DOI: 10.21769/BioProtoc.885.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Tumor microenvironment > Cell migration
Cancer Biology > Invasion & metastasis > Cell biology assays > Cell invasion
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Studying Chemotactic Migration in Dunn Chamber: An Example Applied to Adherent Cancer Cells
Khedidja Benseddik and Kossay Zaoui
Feb 5, 2022 1872 Views
Spherical Invasion Assay: A Novel Method to Measure Invasion of Cancer Cells
Stephen D. Richbart [...] Piyali Dasgupta
Feb 20, 2022 3603 Views
An Experimental Protocol for the Boyden Chamber Invasion Assay With Absorbance Readout
Kathleen C. Brown [...] Piyali Dasgupta
Aug 5, 2024 581 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
886 | https://bio-protocol.org/en/bpdetail?id=886&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Mouse Spinal Cord Injury
Oneil G. Bhalala
Liuliu Pan
HN Hilary North
TM Tammy McGuire
JK John A. Kessler
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.886 Views: 20043
Reviewed by: Xuecai GeLin Fang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Neuroscience Dec 2012
Abstract
Spinal cord injury (SCI) is a debilitating injury with significant morbidity and mortalitiy. Understanding the pathogensis of and developing treatments for SCI requires robust animal models. Here we describe a method for generating an efficient and reproducible contusion model of SCI in adult mice.
Keywords: Spinal cord injury Contusion Mouse Nervous system Reproducible
Materials and Reagents
C57BL/6 Mouse, 8 weeks old
Baytril (Enrofloxacin) Antibacterial injectable solution 2.27% (Bayer HealthCare)
Buprenex (Buprenorphine hydrochloride) stock (0.3 mg/ml) (Reckitt Benckiser Healthcare)
Isothesia (Isoflurare, USP) (Butler Schein)
0.9% sodium chloride (NaCl) solution
100% oxygen (O2)
Surgical iodine
70% Ethanol
0.015 mg/ml Baytril in 0.9% NaCl (see Recipes)
0.01 mg/ml Buprenex in 0.9% NaCl (see Recipes)
Equipment
IH-0400 Impactor (Precision Systems and Instrumentation, LLC)
1.25 mm Impactor Tip
Note: This is the standard-size mouse tip. A 2.5 mm tip size is available for rat procedures. The company can also make custom sized tips.
PC running Windows 95+ with 9-pin serial port
Sterile cotton tip applicators
Razor blades
Graefe micro dissecting tissue forceps (Roboz, catalog number: RS-5150 )
Noyes micro dissecting spring scissors (Roboz, catalog number: RS-5676 )
Operating scissors (Pakistan Scissors Industries, catalog number: PS-13-120 )
AUTOCLIP 9 mm wound clips (BD Biosciences) and applier
VetEquip rodent anesthesia machine
Electrical heat pad
Hamilton SafeAire laminar flood hood (Fisher Hamilton)
Procedure
Autoclave Impactor tip, spinal cord stabilizing forceps, dissecting forceps, AUTOCLIP wound clips and applier prior to surgery.
Set up surgical area
Impactor with computer should be placed on lab bench near surgery area (Figure 1).
Figure 1. Impactor and computer setup. Computer running IH-0400 software. A is setup on lab bench next to Impactor apparatus. B. The lab bench is direclty opposite the surgical site (not shown) to facilitate movement of mouse.
Screw in Impactor tip of desired size into Impactor machine.
Reassemble support arms on Impactor stage each time to ensure smooth function.
Screw in spinal cord stabilizing forceps (Figure 2).
Figure 2. Impactor setup. (A) Impactor tip is screwed into Impactor rod. (B) Spinal cord stabilizing forceps are screwed into support arms. Mouse is placed on Impactor stage after laminectomy and prior to impaction.
Anesthetize one 8 weeks old mouse with 2.5% isoflurane in 100% O2. Until indicated, all steps below are performed under anesthesia.
Use a razor blade to shave the fur to expose the skin above the thoracic and few segments of the lumbar vertebrae.
Disinfect surfaces with surgical iodine followed by 70% ethanol.
Administer 2.5 mg/kg Baytril (diluted in 0.9% NaCl – see Recipes) subcutaneously (Figure 3).
Figure 3. Preparing mouse for surgery. After anaesthesia induction, dorsal fur is removed and sterilzed with surgical iodine and 70% ethanol. Prior to incision, 2.5 mg/kg Baytril is injected subcutaneously.
Make an incision in overlying skin, fascia and muscle to expose vertebral column. This is performed in the laminar flow hood to maintain sterility.
With dissecting forceps and scissors, perform a laminectomy of T10 to T12 to expose the spinal cord. Sterile cotton tip applicators may be used to gently remove debris and clean area.
Note: When the animal is in the lying flat with dorsal-side up, T12 is located at the apex of the vertebral curvature and T10 is located two vertebrae rostral (Figure 4).
Figure 4. Laminectomy site identification. After skin is removed, muscle overlying vertebral column is exposed. T12 can be identified at the apex of the dorsal aspect of the vertebral curvature (arrow). T10 is two vertebral segments rostral. Overlying muscle and fascia will need to be removed to visualize segments.
Position the mouse on the Impactor stage with front and hind limbs extended.
Apply spinal cord stabilizing forceps to the lateral processes of the vertebral column immediately rostral and caudal to the laminectomy site. Ensure that the dorsal surface of the spinal cord is parallel to the surface of the Impactor tip (Figure 5).
Figure 5. Impaction setup. After laminectomy, mouse is placed on Impactor stage. Spinal cord stabilizing forceps (A) are placed rostral and caudal to laminectomy site. Vertebral column must be positioned such that the dorsal surface of the spinal cord is parallel to Impactor tip surface (B).
Lower Impactor tip to a few millimeters above spinal cord tissue to ensure that it is properly centered above T11.
Set injury parameters accordingly in the software. For severe SCI in C57BL/6 mice, “Experiment Mode” = Force, “Force” = 70, “Velocity” = 1 and “Dwell Time” = 60.
Note: For other strains, ages, or injury severities, Force and Dwell Time may need to be adjusted. For example a lesser Force will be needed to produce a mild or moderate SCI. As CD-1 mice are typically larger than C57BL/6, a larger diameter Impactor tip may be necessary to fully impact the spinal cord at T11.Conversely, younger mice may require a smaller Impactor tip and less impaction force to produce severe injuries.
Click “Start Experiment”.
Wait for impaction to finish. “Displacement v Time” and “Force v Time” graphs will appear with data from the actual impaction (see Figure 6 for an example).
Figure 6. Example readout after aumotaed SCI. Data from the tip sensor will be displayed as “Displacement vs. Time” and “Force vs. Time” graphs. The set paraments (in this case Force = 70, Velocity = 1 and Dwell Time = 60) as well as the actual values are also displayed.
Raise Impactor tip and gently release spinal cord stabilizing forceps from vertebral column.
Suture skin using 9 mm AUTOCLIPS.
Administer 0.05 mg/kg Buprenex (diluted in 0.9% NaCl – see Recipes) subcutaneously.
Remove mouse from anesthesia and place in a mouse cage on highly absorbent soft bedding warmed by electrical heating pad (Figure 7).
Figure 7. Post-impaction care. After impaction is complete, skin is sutured using AUTOCLIPS. Mouse is removed from anaesthesia and placed on soft-bedding warmed by an electric heating pad. After mouse is conscious, further post-operative care is carried out (see step 19).
Monitor mouse and provide post-operative care. Post-operative care includes monitoring animals for pain and infection, providing heat support (with heating pad) until animals are ambulatory, and diet gel liquid food packs for easy consumption. Water bottles should also be placed in cage with long sipper tubes to facilitate hydration. Animals are given 2.5 mg/kg Baytril once daily for seven days, and longer as needed. 0.05 mg/kg Buprenex for the first 48 h post-surgery and thereafter, as needed. Bladders must be manually expressed twice daily until animals can self-void. Urine should be clear to yellow in appearance. If there are signs of infection (cloudy, red-tinged), Baytril is given for five days or until infection is cleared, whichever is longer.
Recipes
0.015 mg/ml Baytril in 0.9% NaCl
500 μl stock Baytril
9,500 μl 0.9% NaCl
0.01 mg/ml Buprenex in 0.9% NaCl
670 μl stock Buprenex
19,330 μl 0.9% NaCl
Acknowledgments
This project was supported by National Institutes of Health Grants R01 NS 20013 and R01 NS 20778.
References
Bhalala, O. G., Pan, L., Sahni, V., McGuire, T. L., Gruner, K., Tourtellotte, W. G. and Kessler, J. A. (2012). microRNA-21 regulates astrocytic response following spinal cord injury. J Neurosci 32(50): 17935-17947.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Bhalala, O. G., Pan, L., North, H., McGuire, T. and Kessler, J. A. (2013). Generation of Mouse Spinal Cord Injury . Bio-protocol 3(17): e886. DOI: 10.21769/BioProtoc.886.
Bhalala, O. G., Pan, L., Sahni, V., McGuire, T. L., Gruner, K., Tourtellotte, W. G. and Kessler, J. A. (2012). microRNA-21 regulates astrocytic response following spinal cord injury. J Neurosci 32(50): 17935-17947.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Simplified Paradigm of Late Gestation Transient Prenatal Hypoxia to Investigate Functional and Structural Outcomes from a Developmental Hypoxic Insult
Elyse C. Gadra and Ana G. Cristancho
Oct 5, 2022 760 Views
Conditioned Lick Suppression: Assessing Contextual, Cued, and Context-cue Compound Fear Responses Independently of Locomotor Activity in Mice
Youcef Bouchekioua [...] Yu Ohmura
Dec 5, 2022 602 Views
In situ Microinflammation Detection Using Gold Nanoclusters and a Tissue-clearing Method
Fayrouz Naim [...] Masaaki Murakami
Apr 5, 2023 967 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
887 | https://bio-protocol.org/en/bpdetail?id=887&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
3H-Penciclovir (3H-PCV) Uptake Assay
TS Thillai V Sekar
RP Ramasamy Paulmurugan
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.887 Views: 8296
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Gene Therapy May 2013
Abstract
Thymidine Kinase from human Herpes simplex virus type 1 (HSV1-TK) in combination with specific substrate prodrug nucleotide analogue ganciclovir (GCV) has been widely used as suicidal therapeutic gene for cancer gene therapy. HSV1, and its mutant (HSV1-sr39TK) with improved substrate specificity, were used as reporter genes for PET-imaging of various biological functions in small animals, by combining with radiolabeled substrates such as 18F-FHBG and 124I-FIAU. 3H-Penciclovir (PCV) uptake assay is a method of choice used to determine the expression level of HSV1-TK in mammalian cells and tissues. HSV1-TK phosphorylate PCV and result in the formation of penciclovir monophosphate, and its subsequent phopsphorylation by cellular TK lead to the formation of penciclovir triphosphate, which is trapped selectively in cells express HSV-TK. 3H-Penciclovir enables the detection of penciclovir uptake of mammalian cells and tissues by radioactive procedures such as scintillation counting. Here we describe the protocol to carry out 3H-Penciclovir uptakes in mammalian cells.
Materials and Reagents
Control and experimental cells (HEK293T and HEK293T-sr39TK)
Dulbecco's Modified Eagle Medium (DMEM) (Life technologies, catalog number: 11965-084 )
3H-Penciclovir (specific activity 14.9 ci mmol-1) (Moravek Biochemicals, La Brea, CA, USA)
Sodium hydroxide (NaOH) (0.1 N)
Phosphate buffered saline (PBS) (pH 7.4) (Life technologies, catalog number: 10010-056 )
Glass Scintillation vials
Cytoscint Scintillation fluid (Acros Organics, Geel, Belgium)
Cell culture plates (Greiner Bio-One, USA)
Bradford protein assay reagent (Bio-Rad Laboratories, Hercules, CA)
BSA (Sigma-Aldrich, catalog number: A9418 )
Wash solution (Ice cold PBS) (pH 7.4)
Equipment
37 °C 5% CO2 Cell culture incubator (Themo Fisher Scientific, model: Napco 8000)
Scintillation counter (Beckman Coulter, Brea, CA)
Shaker (Boekel scientific, Model: 260350 )
Radioactive Chemical hood (Hamilton, Two Rivers, WI)
Pipettes (Gilson, Middleton, WI)
Disposal (As per Environment and Health safety regulation)
Spectrophotometer (Varian Inc, model: Varian Cary 50 )
Procedure
Mammalian HEK293T and HEK293T cells stably expressing sr39-HSV1-TK (HEK293T-sr39TK) should be plated at a confluency of 60-80% in 12 well culture plates (150,000 cells/well in 1 ml DMEM). Incubate at 37 °C with 5% CO2 for 24 h.
Twenty-four hours after initial plating remove the medium and add 0.5 μl of 3H-Penciclovir/well (0.5 mCi/ml of 8-3H-Penciclovir; specific activity 14.9 ci mmol-1) in 0.5 ml of respective culture medium.
Incubate at 37 °C for 3 h. Maintain the incubation time consistent between samples.
Keep the same cells (HEK293T) plated in equal number express no HSV1-TK as control.
After 3 hours of incubation remove the medium carefully without disturbing cells, and wash the plates twice with 0.5 ml each of ice cold PBS. Pool the medium and wash solutions from respective well to measure the remaining total activities.
Add 0.5 ml of 0.1 N NaOH to each well and leave it for 10 min at room temperature in a shaker to lyse the cells.
Transfer 20 μl of homogenous cell lysate to measure total protein concentration by using Bradford protein assay reagent. In brief, to each 20 μl of cell lysate add 1 ml of 1x Bradford protein assay reagent and read the absorbance at 595 nm (A595) 5 min after incubation at room temperature in a spectrophotometer. Use standard graph prepared with the standards (BSA) diluted in 0.1 N NaOH to calculate the total protein present in 0.5 ml of cell lysate.
Transfer the remaining cell lysate (480 μl) to scintillation vial and 5 ml of biodegradable scintillation fluid (Cytoscint fluid). Cells lacking HSV1-TK expression exposed to 3H-Penciclovir serve as negative control.
The total remaining activity from each sample should be measured by using 480 μl of solution taken from the pooled medium and the wash solution, and also measured from 0.5 μl of 3H-Penciclovir diluted in 480 μl of medium.
Measure the radioactivity from different samples in a Scintillation counter by taking an average reading/min by reading for 5 min. Normalize the results with protein concentration and relate with total activity.
Results should be expressed as the percentage conversion of 3H-PCV per milligram of protein/total count, or as the conversion of 3H -PCV in moles per milligram of protein/total activity (Radioactivity within cells/[Radioactivity remained in medium + Radioactivity within cells]).
Acknowledgments
We thank Dr Sanjiv Sam Gambhir, Chairman, Department of Radiology, Stanford University for providing helpful support and facility for conducting this research. We thank the Department of Radiology, Stanford University for funding support (R. Paulmurguan), and thank the Canary Center at Stanford for providing the facilities. We also thank NIH-NCI RO1CA161091 (R. Paulmurugan) for partial funding support.
References
Sekar, T. V., Foygel, K., Willmann, J. K. and Paulmurugan, R. (2013). Dual-therapeutic reporter genes fusion for enhanced cancer gene therapy and imaging. Gene Ther 20(5): 529-537.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cancer Biology > General technique > Cancer therapy
Cell Biology > Cell signaling > Stress response
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
An Automated pre-Dilution Setup for Von Willebrand Factor Activity Assays
Tobias Schachinger [...] Peter L. Turecek
Sep 5, 2024 338 Views
Measurement of the Activity of Wildtype and Disease-Causing ALPK1 Mutants in Transfected Cells With a 96-Well Format NF-κB/AP-1 Reporter Assay
Tom Snelling
Nov 20, 2024 270 Views
Quantitative Measurement of the Kinase Activity of Wildtype ALPK1 and Disease-Causing ALPK1 Mutants Using Cell-Free Radiometric Phosphorylation Assays
Tom Snelling
Nov 20, 2024 254 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
888 | https://bio-protocol.org/en/bpdetail?id=888&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Colony Immunoblotting Assay for Detection of Bacterial Cell-surface or Extracellular Proteins
Timo A. Lehti
Benita Westerlund-Wikström
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.888 Views: 28150
Reviewed by: Salma HasanFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Molecular Microbiology Mar 2013
Abstract
This simple protocol describes how to detect antigens from agar-grown bacterial colonies transferred to nitrocellulose using specific antibodies. The protocol is well suitable for detection of bacterial proteins exposed on the cell surface or secreted to the extracellular space and it can be modified also for detection of intracellular proteins. The assay can distinguish bacterial clones with different expression rates (high, medium and low) from colonies that do not express target protein. We used this assay for screening of Mat fimbriae-producing Escherichia coli mutants obtained by mini-Tn5 transposon mutagenesis and immunomagnetic separation (Lehti et al., 2013).
Keywords: Protein expression Screening Colony Blotting Agar plate
Materials and Reagents
Bacteria (e.g. Escherichia coli)
Sterile toothpicks or pipette tips
Circular Protran BA85 nitrocellulose membrane, 0.45 μm, 82 mm in diameter (Whatman, catalog number: 10401116 )
Albumin from bovine serum (BSA) (Sigma-Aldrich, catalog number: A7906 )
Tween 20 (Sigma-Aldrich, catalog number: P1379 )
Unconjugated primary antibody/antiserum (e.g. Polyclonal rabbit antiserum against Mat fimbriae of E. coli (Pouttu et al., 2001))
Alkaline phosphatase-conjugated secondary antibody (e.g. Alkaline phosphatase-conjugated swine anti-rabbit immunoglobulins (Dako, catalog number: D0306 ))
1-Step BCIP/NBT solution (Pierce Antibodies, catalog number: 34042 )
Distilled water
Bacto Tryptone (BD Biosciences, catalog number: 211705 )
Bacto Yeast extract (BD Biosciences, catalog number: 212750 )
Bacto Agar (BD Biosciences, catalog number: 214010 )
10% (w/v) SDS solution in distilled water
0.5 M NaOH, 1.5 M NaCl in distilled water
0.5 M Tris-HCl pH 7.5, 1.5 M NaCl in distilled water
2x SSC (see Recipes)
LB agar plates(see Recipes)
Phosphate buffered saline (PBS) (see Recipes)
Blocking buffer: 2% (w/v) BSA in PBS (see Recipes)
Antibody dilution buffer: 1% (w/v) BSA in PBS (or the buffer as recommended in the antibody datasheet)(see Recipes)
Washing buffer: 0.05% (v/v) Tween 20 in PBS (see Recipes)
Equipment
3 mm paper (Whatman 3MM, catalog number: 3030-6185 )
Petri dishes, 90 mm (Sterilin®, catalog number: 101RT )
Beaker, 1,000 ml (Pyrex Corning, catalog number: 1000-1L )
Incubator (Termaks)
Belly dancer laboratory shaker (Stovall Life Science)
Sterile 18-gauge needle (BD Biosciences)
Tweezers (Bochem)
Procedure
Place identical orientation marks in three asymmetric locations on the exterior wall of two fresh agar plates (e.g. LB agar for Escherichia coli). Be sure to include orientation marks on the bottom plate (i.e. not on the lid).
Pick each fresh colony to be tested with a sterile toothpick or pipette tip and make a short streak of about 0.5 cm in length onto the test agar plate and then onto the master agar plate. To keep the colonies in a clear physical order use a grid pattern (see Figure 1) under the plates and streak each colony in an identical position on both plates. A colony density of 100 colonies per plate (9 cm diameter) is optimal and minimizes possibility of cross-contamination between colonies. It is recommended to include a negative and positive control colony onto the plates.
Figure 1. A grid template for precise orientation of 100 cell colonies on two agar plates. A single grid with 85 mm in diameter is used for a 90 mm Petri dish (the original picture size 19 cm x 10 cm is suitable for printing).
To grow the bacteria, invert the plates and incubate them at an appropriate temperature overnight (e.g. for Escherichia coli at 37 °C). To minimize cross-contamination among neighboring colonies, avoid overgrowth and potential formation of satellite colonies.
Using two tweezers, place a circular nitrocellulose membrane (82 mm in diameter) carefully and evenly on top of the colonies on the test plate for 10-60 sec.
Pre-cool the test plate at 4 °C for approximately 30 min before placing the membrane on its surface so that the agar will not adhere onto the membrane.
To ensure contact with the colonies, take care to avoid introducing air bubbles between the membrane and the agar surface. Hold the membrane at opposite edges with two tweezers and bend it slightly, and then allow the curved membrane to make contact with the center of the plate. Finally, lower the sides gently onto the agar surface. To avoid cross-contamination and smearing of colonies, do not reorientate the membrane once it has been applied.
Mark the membrane orientation according to the three marks on the test plate by stabbing through the membrane with a sterile 18-gauge needle.
Save the master plate in 4 °C for later use.
Using tweezers, peel off the membrane from the agar and transfer the membrane colony-side up to a beaker.
Pour 100 ml of blocking buffer into beaker. Place the beaker on laboratory shaker (Belly dancer) and shake at speed setting 3-4 at room temperature for 5 min to remove excess of colony material.
Decant the blocking buffer.
Repeat steps 5a and 5b two more times.
Pour 100 ml of blocking buffer into beaker and incubate in blocking buffer for 45 min with gently agitation on laboratory shaker (Belly dancer, speed setting 2-3) to ensure complete blocking of unoccupied protein binding sites.
Care should be taken to prevent the membrane from drying out during incubation. Multiple membranes can be placed in a single beaker.
Note: If working with intracellular proteins, cells should be lysed before blocking. To lyse the cells, transfer the membrane colony-side up from the test plate to a Petri dish containing a sheet of 3 mm (Whatman 3 MM) paper moistened with 2-3 ml of 10% (w/v) SDS solution. Avoid introducing air bubbles. After 5 min incubation, place the membrane on top of the 3 mm paper saturated with 0.5 M NaOH, 1.5 M NaCl for 5 min. Then, neutralize by incubating two times for 5 min on the 3 mm paper soaked with 0.5 M Tris-HCl (pH 7.5), 1.5 M NaCl. Finally, place the membrane on top of the 3 mm paper saturated with 2x SSC for 15 min. Transfer the membrane colony-side up to a beaker and continue with the blocking step 5d.
Prepare a primary antibody dilution in antibody dilution buffer and transfer the membrane to a Petri dish containing the diluted primary antibody (one membrane per Petri dish).
For each 82 mm-diameter membrane, use 7-10 ml of diluted primary antibody. Ensure the membrane is adequately covered with the solution to prevent it from drying out during incubation.
The antibody dilution and incubation conditions depend on your primary antibody; please refer to primary antibody datasheet. It is recommended to start with the same conditions used for Western blotting. For optimal results, perform a titration experiment (e.g. 1:100-1:3,000) and optimize the dilution according to the results.
A serum dilution of 1:500-1:1,000 (5-10 μl in 10 ml) and incubation for 1 hour with gently agitation at room temperature will normally be sufficient.
Wash the membrane three times in 10 ml of washing buffer for 5 min each to remove unbound antibodies.
Prepare a secondary antibody dilution in antibody dilution buffer and replace the washing buffer with the diluted secondary antibody.
Use 7-10 ml of diluted alkaline phosphatase-conjugated secondary antibody per 82 mm-diameter membrane.
Please refer to secondary antibody datasheet for recommended antibody dilution buffer and recommended antibody dilution.
Typically 1:500 to 1:2,000 dilutions of the commercial conjugates are appropriate. Incubate as in step 6.
Wash as in step 7.
To visualize positive colonies reacting with the primary antibodies, replace the washing buffer with 5-10 ml of BCIP/NBT solution and incubate with gentle agitation at room temperature until the desired color develops (usually 2 to 5 min) or background colour begin to appear. The positive control should be dark purple-coloured (see Figure 2).
Figure 2. A representative colony immunoblotting membrane of Mat fimbriae expression in Escherichia coli MG1655-Rif derivatives. Bacteria subjected to mini-Tn5 transposon mutagenesis and enrichment with immunomagnetic particles coated with anti-Mat antibodies (available from previous work (Pouttu et al., 2001)) were grown overnight on LB agar plates at 37 °C, and colonies transferred onto a nitrocellulose membrane were left to react with anti-Mat antibodies (a dilution of 1:500) and detected with alkaline phosphatase-conjugated secondary antibodies (a dilution of 1:2,000). Colony-represents MG1655-Rif, a negative control for Mat fimbriae expression (Lehti et al., 2013). Colony + indicates IHE3034 matA(A536C) (ptet-matA), a positive control of Mat fimbriae expression (Lehti et al., 2013). Colonies 1 to 4 are candidate Mat-fimbriated MG1655-Rif Tn5 mutants.
Stop the reaction by rinsing the membrane several times in distilled water.
Allow the membrane to air dry in the dark.
Find the desired colonies by matching the colonies on the master plate to the reaction spots in the membrane by using orientation marks. Prepare pure cultures of the reactive colonies onto fresh agar plates.
Recipes
2x SSC
0.3 M NaCl, 0.03 M sodium citrate (pH 7.0) in distilled water
LB agar plates (1 L) (approximately 40-45 plates)
Add to 800 ml of H2O
10 g Tryptone
5 g Yeast extract
5 g NaCl
15 g Agar
If needed, adjust pH to 7.1 with NaOH
Add H2O to final volume of 1 L and sterilize by autoclaving (20 min, 121 °C).
Cool down to 55 °C and supplement with appropriate antibiotics.
Dispense approximately 20 ml per 90 mm-diameter Petri dish.
Store at 4 °C for up to 2 months
Phosphate-buffered saline (PBS) (pH 7.4) (1 L)
Add to 800 ml of H2O
8 g of NaCl
0.2 g of KCl
1.44 g of Na2HPO4
0.24 g of KH2PO4
Adjust the pH to 7.4 with HCl.
Add H2O to a total volume of 1 L and sterilize by autoclaving (20 min, 121 °C).
Store at room temperature
Blocking buffer
Add 10 g BSA to 500 ml of PBS and mix well.
Store at 4 °C.
Antibody dilution buffer
Add 0.2 g BSA to 20 ml of PBS and mix well. Alternatively, mix 10 ml of blocking buffer with 10 ml of PBS to make 1% BSA in PBS.
Store at 4 °C.
Washing buffer
Add 50 μl Tween 20 to 100 ml of PBS and mix well.
Store at room temperature
Acknowledgments
This protocol was modified from Sambrook, J. and Russell, D. (2001) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory). The authors would like to acknowledge University of Helsinki, Viikki Graduate School in Biosciences, the Academy of Finland (ERA-NET PathoGenoMics grant number 118982) and the European Network of Excellence in EuroPathoGenomics EPG (CEE LSHB-CT-2005-512061) for financial support.
References
Lehti, T. A., Bauchart, P., Kukkonen, M., Dobrindt, U., Korhonen, T. K. and Westerlund-Wikstrom, B. (2013). Phylogenetic group-associated differences in regulation of the common colonization factor Mat fimbria in Escherichia coli. Mol Microbiol 87(6): 1200-1222.
Pouttu, R., Westerlund-Wikstrom, B., Lang, H., Alsti, K., Virkola, R., Saarela, U., Siitonen, A., Kalkkinen, N. and Korhonen, T. K. (2001). matB, a common fimbrillin gene of Escherichia coli, expressed in a genetically conserved, virulent clonal group. J Bacteriol 183(16): 4727-4736.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Lehti, T. A. and Westerlund-Wikström, B. (2013). Colony Immunoblotting Assay for Detection of Bacterial Cell-surface or Extracellular Proteins. Bio-protocol 3(17): e888. DOI: 10.21769/BioProtoc.888.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein > Immunodetection
Biochemistry > Protein > Immunodetection > Immunostaining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Analysis of Direct Interaction between Viral DNA-binding Proteins by Protein Pull-down Co-immunoprecipitation Assay
Ana Lechuga [...] Modesto Redrejo-Rodríguez
Jan 5, 2018 10327 Views
Biofilm Assays on Fibrinogen-coated Silicone Catheters and 96-well Polystyrene Plates
Cristina Colomer-Winter [...] Ana L. Flores-Mireles
Mar 20, 2019 6134 Views
Construction of a Highly Diverse mRNA Library for in vitro Selection of Monobodies
Taishi Kondo [...] Hiroshi Murakami
Aug 20, 2021 2504 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
889 | https://bio-protocol.org/en/bpdetail?id=889&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein Extraction, Acid Phosphatase Activity Assays, and Determination of Soluble Protein Concentration
VK Vicki Knowles
William Plaxton
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.889 Views: 22352
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Experimental Botany Nov 2012
Abstract
Acid phosphatases (APases) catalyze the hydrolysis of inorganic phosphate (Pi) from a broad range of Pi-monoesters with an acidic pH optimum. The liberated Pi is reassimilated into cellular metabolism via mitochondrial or chloroplastic ATP synthases of respiration or photosynthesis, respectively. Eukaryotic APases exist as a wide variety of tissue- and/or cellular compartment-specific isozymes that display marked differences in their physical and kinetic properties. Increases in intracellular (vacuolar) and secreted APase activities are useful biochemical markers of plant nutritional Pi deficiency. The protocols for protein extraction, APase activity determination and measurement of soluble protein concentration from plant tissues or cell suspension cultures are presented.
Materials and Reagents
Plant tissues
Sodium acetate (Bioshop, catalog number: SAA305 )
EDTA (Bioshop, catalog number: EDT001 )
Dithiothreitol (DTT) (Bioshop, catalog number: DTT 002 )
Phenylmethyl sulfonyl fluoride (PMSF) (G-Biosciences, catalog number: 786-0555 )
Thiourea (Sigma-Aldrich, catalog number: T-7875 )
Polyvinyl (polypyrrodlidone) (PVPP) (Sigma-Aldrich, catalog number: P-6755 )
β-nicotinamide adenine dinucleotide reduced form (NADH) (Bioshop, catalog number: NAD002 )
Phosphoelnolpyryvate (PEP) (Biovectra, catalog number: 2552 )
MgCl2 ((Biolynx, catalog number: 18641 )
Rabbit muscle lactate dehydrogenase (LDH) (Sigma-Aldrich, catalog number: L-2500 )
para-nitrophenyl-phosphate (pNPP, phosphatase substrate) (Sigma-Aldrich, catalog number: P-4744 )
Coomassie Brilliant blue G-250 (Serva, catalog number: 35050 C.!.42655 )
Bovine gamma globulin (BGG) (2.0 mg/ml) (Thermo Fisher Scientific, catalog number: 23212 )
NaOH
Extraction buffer (EB) (see Recipes)
Bradford working solution (see Recipes)
Acid phosphatase enzyme assay mix #1 (see Recipes)
Acid phosphatase enzyme assay mix #2 (see Recipes)
Bradford assay stock (see Recipes)
Equipment
Whatman #1 filter paper
1.5 ml microfuge tubes
10 and 25 μl Hamilton syringes
Pipetor
Small mortar and pestle
Eppendorf microfuge
96 well polystyrene microtitre plate (flat bottom)
A computer supported microplate spectrophotometer (Spectromax Plus, Molecular Devices, Sunnyvale)
Procedure
Extraction
This protocol applies to extraction of intracellular (vacuolar) APases from plant tissues and suspension cell cultures (e.g., Tran et al., 2010a; Veljanovski et al., 2006). Refer to Tran et al. (2010b) and Robinson et al. (2012) for information on the isolation and analysis of plant cell wall localized and secreted APase isoforms.
Weigh tissue and freeze in liquid N2. Store at -80 °C until use.
Place a small spatula of sea sand into the mortar, add small amount of liquid N2, followed by frozen tissue, and grind to a powder. Carefully add more liquid N2 if needed to keep frozen.
Invert tube with extraction buffer (EB) to mix and add to sample at a ratio of 1:2, w/v (e.g. 0.5 g powdered tissue + 1.0 ml EB) although this may need to be increased to 1:3 for leaf tissue and 1:4 for roots. Grind for several minutes and place in 1.5 ml microfuge tubes.
Centrifuge 5 min at 4 °C and 11,000 x g. Remove supernatant (clarified extract) to a fresh microfuge tube and keep it on ice. Measure APase activity immediately at room temperature (24 °C). Aliquots of clarified extracts can be snap frozen in liquid N2 and stored at -80 °C for future use.
APase activity assay 1
Conveniently measure APase activity by coupling the hydrolysis of phosphoenolpyruvate (PEP) to pyruvate to the lactate dehydrogenase (LDH) reaction at 24 °C and using a spectrophotometer to continuously monitor NADH oxidation at 340 nm. PEP seems to be an excellent APase substrate for since it occupies the highest position on the thermodynamic scale of phosphorylated intermediates (and thus its P atom is an excellent leaving group). For every PEP molecule hydrolyzed to pyruvate, one NADH molecule is oxidized to NAD+ by LDH as shown in Figure 1.
Figure 1. APase activity can be conveniently deterdmined by coupling the hydrolysis of PEP to pyruvate to the lactate dehydrogenase (LDH) reaction and using a spectrophotometer to continuously monitor NADH oxidation to NAD+ at 340 nm
Accurately pipette 1-10 μl of clarified extract into a microplate well. We prefer to use a 10 or 25 μl Hamilton syringe as opposed to automated pipetors for accurate pipetting of enzyme protein extracts into wells of the microtitre plate.
Use repeat pipetor to add 200 μl APase assay mix #1 to each well and immediately place in microplate spectrophotometer. Continuously monitor NADH oxidation to NAD+ as a decline in absorbance at 340 nm (A340), taking readings every 5-10 sec for up to 5 min.
Correct for background NADH oxidation by omitting PEP from the reaction mixture. Ensure that the decline in A340 (amount of NADH being oxidized; ε340 = 6,220/M/cm) is proportional to assay time and concentration of enzyme assayed. Dilution of clarified extract in extraction buffer (lacking PVPP) may be necessary for samples containing abundant APase activity.
Note: One international unit (U) of enzyme activity is defined as the amount of enzyme resulting in the hydrolysis of 1 μmol of substrate (e.g. one μmol of NADH oxidized to NAD+) per min at 24 °C. APase activity in (U/ml clarified extract) = (ΔA340/min x clarified extract dilution factor)/6.22. Thus, if 2.0 μl of clarified extract mixed with 200 μl of APase reaction mixture yields a ΔA340/min of 0.1 at 340 nm, then the APase activity = (0.1 x 100)/6.22 U/ml = 1.6 U/ml.
APase activity assay 2
This is a ‘stopped-time’ APase assay based upon the hydrolysis of the synthetic substrate, para-nitrophenyl-phosphate (pNPP), to para-nitrophenol (pNP) and Pi (Figure 2). The pNP product forms a yellow color at alkaline pH (λmax = 410 nm; extinction coefficient = ε410 = 18.2/mM/cm; meaning a 1 mM solution of pNP should have an A410 of 18.2). The amount of yellow color formed is thus directly proportional to the amount of pNP produced and is therefore an indicator of the APase activity. This assay tends to be more popular in the APase literature. However, care needs to be taken to ensure that the amount of pNP being formed is proportional to the assay time and volume of clarified extract being assayed.
Figure 2. APase activity is often assayed spectrophotometrically at 410 nm by determining the amount of pNP produced following the hydrolysis of Pi from pNPP. Addition of NaOH after a specified assay time (e.g., 10 min) serves to stop the APase reaction while simultaneously converting the product p-nitrophenol into the yellow colored p-nitrophenolate (λmax = 410 nm).
Accurately pipette 1-10 μl of clarified enzyme extract into a well of the microtitre plate. Add 200 μl of APase assay mix #2 to each well containing enzyme extract and incubate for 10 min at room temperature (24 °C).
At t = 10 min, add 50 μl of 3 M NaOH to each well containing APase reactions. This stops the reaction (denatures APase) while simultaneously converting pNP product into the yellow colored p-nitrophenolate.
Determine ΔA410/min for each well to determine the amount (μmol) of pNP formed per min.
Bradford Assay of Soluble Protein Concentration
Prepare standard curve using the template below:
Well #
Vol BGG (0.4 mg/ml)
Amt Protein (BGG)
Vol H2O
(μl)
(μg)
(μl)
1a
0
0
25 (blank)
1b
2
0.8
23
1c
4
1.6
21
1d
8
3.2
17
1e
12
4.8
13
1f
16
6.4
9
1g
20
8.0
5
1h
25
10.0
0
2a
0
0
25 (blank)
Pipette 2-20 μl of the clarified extract (dilute as necessary) and adjust final volume to 25 μl in each well with H2O. Dilute sample if necessary to remain in linear range of standard curve. A 25 μl Hamilton syringe is more accurate than automated pipetors for pipetting of BGG standard and clarified extract into wells of the microtitre plate.
Add 250 μl of Bradford working solution to each well using a repeat pipetor and read A595 of protein standards and unknowns. Ensure that A595 values of clarified extract samples aliquot falls within range of A595 values of the BGG standards. The absorbance maximum for an acidic solution of Coomassie Brilliant blue G-250 shifts from 465 nm to 595 when protein binding occurs. Determine amount of protein in clarified extract aliquot from the standard curve (if 2 μl aliquot of clarified extract yields an A595 value equivalent to 5 μg of protein, then the extract would have a protein concentration of 2 mg/ml).
Recipes
Extraction buffer (EB, keep on ice)
50 mM Na-acetate (pH 5.6)
1 mM EDTA
1 mM DTT
1 mM PMSF (prepare 100 mM stock in absolute ethanol and store at -20 °C, add fresh to EB immediately prior to tissue extraction as PMSF is unstable in aqueous solution)
5 mM thiourea
1% (w/v) PVPP
APase assay #1 reaction mixture (prepare freshly and keep at room temperature)
50 mM Na-acetate (pH 5.6)
10 mM MgCl2
0.2 mM NADH
5 mM PEP
3 U/ml rabbit muscle LDH (Desalt LDH by centrifuging an aliquot 3 min at 11,000 x g. Discard supernatant and resuspend the pellet in an equal volume of EB).
APase assay #2 reaction mixture
10 mM pNPP (sodium salt), dissolved in 50 mM acetate-KOH (pH 5.8)
3 M sodium hydroxide (NaOH) also needed to stop the reaction
Bradford assay stock
100 ml 95% EtOH
200 ml 88% H3PO4
350 mg Brilliant blue G-250
Bradford working solution
30 ml Bradford Stock
425 ml H2O
15 ml EtOH
30 ml 88% H3PO4
Filter through Whatman #1 filter paper and store in brown or dark glass bottle.
Protein assay solutions are stable for months at room temperature.
Bradford Protein standard
Dilute bovine Gamma Globulin with H2O to 0.4 mg/ml
Store 100 μl aliquots at -20 °C.
Acknowledgments
Research in our laboratory has been generously funded by research and equipment grants from The Natural Sciences and Engineering Research Council of Canada (NSERC) and Queen’s Research Chairs program to William Plaxton.
References
Robinson, W. D., Park, J., Tran, H. T., Del Vecchio, H. A., Ying, S., Zins, J. L., Patel, K., McKnight, T. D. and Plaxton, W. C. (2012). The secreted purple acid phosphatase isozymes AtPAP12 and AtPAP26 play a pivotal role in extracellular phosphate-scavenging by Arabidopsis thaliana. J Exp Bot 63(18): 6531-6542.
Tran, H. T., Hurley, B. A. and Plaxton, W. C. (2010a). Feeding hungry plants: the role of purple acid phosphatases in phosphate nutrition. Plant Sci 179(1): 14-27.
Tran, H. T., Qian, W., Hurley, B. A., She, Y. M., Wang, D. and Plaxton, W. C. (2010b). Biochemical and molecular characterization of AtPAP12 and AtPAP26: the predominant purple acid phosphatase isozymes secreted by phosphate-starved Arabidopsis thaliana. Plant Cell Environ 33(11): 1789-1803.
Veljanovski, V., Vanderbeld, B., Knowles, V. L., Snedden, W. A. and Plaxton, W. C. (2006). Biochemical and molecular characterization of AtPAP26, a vacuolar purple acid phosphatase up-regulated in phosphate-deprived Arabidopsis suspension cells and seedlings. Plant Physiol 142(3): 1282-1293.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Knowles, V. and Plaxton, W. (2013). Protein Extraction, Acid Phosphatase Activity Assays, and Determination of Soluble Protein Concentration. Bio-protocol 3(17): e889. DOI: 10.21769/BioProtoc.889.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein > Activity
Biochemistry > Protein > Isolation and purification
Plant Science > Plant biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
An in vitro Assay to Probe the Formation of Biomolecular Condensates
Yu Zhang and Shen Lisha
Sep 5, 2023 1441 Views
Streamlining Protein Fractional Synthesis Rates Using SP3 Beads and Stable Isotope Mass Spectrometry: A Case Study on the Plant Ribosome
Dione Gentry-Torfer [...] Federico Martinez-Seidel
May 5, 2024 698 Views
Immunofluorescence for Detection of TOR Kinase Activity In Situ in Photosynthetic Organisms
Ana P. Lando [...] Giselle M. A. Martínez-Noël
Dec 20, 2024 312 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
89 | https://bio-protocol.org/en/bpdetail?id=89&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
DNA Extraction from Dried Plant Tissues Using 96-well Format (cTab Method)
Yongxian Lu
In Press
Published: Jul 5, 2011
DOI: 10.21769/BioProtoc.89 Views: 18155
Ask a question
Favorite
Cited by
Abstract
This high throughput DNA isolation protocol is used to extract DNA of high quality from plant tissues for various genetics studies, like genotyping, and mapping etc. This protocol uses the well-established CTAB extraction procedure, and has been adapted to be used with 96-well plates.
Materials and Reagents
Hexadecyltrimethyl Ammonium Bromide (CTAB) (Thermo Fisher Scientific)
Sodium bisulfite
Tungsten carbide beads
Sodium chloride
EDTA
Tris-HCl (pH 8.0)
β-mercapto-ethanol (BME)
Chloroform
Octanol
Isopropanol
Ethanol
Sodium-acetate
Ammonium-acetate
TE (pH 8.0)
100 ml of CTAB (see Recipes)
Equipment
Centrifuges (Eppendorf)
Mixer mill
Glass beaker
Water bath
96-square well blocks
Procedure
Tissue grounding:
Before this step, the plant tissue should have been dried (either air-dried or vacuum dried).
Add tungsten carbide beads to freeze-dried samples. These will grind the sample.
Grind leaf samples four times in the mixer mill, reversing orientations of the trays and switching shaker arms between grinds. Make sure the sample is ground into a fine powder (this influences yield).
Add 350 μl of CTAB (don’t forget the β-mercaptoethanol). Grind the sample again in the mixer mill.
Wrap the boxes with tape and incubate in the 60 °C water bath for 30 min, shaking them gently every 10 min (be sure the caps on the tubes are secure before shaking-the pressure from heating the tubes can pop them off).
Sit the tubes on the bench for 10 min to allow them to return to room temperature.
Spin the samples in the tabletop centrifuge for a few seconds to get the leaf tissue off the lid.
Phase separation:
Add 350 μl of chloroform: octanol (24:1) to the tubes (use a 1 L glass beaker for the chloroform: octanol). Shake the tubes continuously for 5 min under the fume hood.
* Use new caps during this step.
Spin the samples in the tabletop centrifuge for twenty minutes at 3,250 rpm.
Add 200 μl of chloroform: octanol (24:1) to a new set of tubes and label the tubes.
Remove the upper (aqueous) phase to the new tubes. Try to get about 200 μl of fluid, but less is okay.
Shake the tubes continuously for 5 min under the fume hood.
Spin in the tabletop centrifuge for 20 min at 3,250 rpm. The upper (aqueous) phase will be used in the following steps.
DNA precipitation:
Add 150 μl of -20 °C isopropanol to a set of 96-square well blocks (deep well, V-bottom).
Collect the upper (aqueous) phase from tubes after step 6 in the phase separation section to the square blocks. Try to get 12-150 μl of fluid, but less is okay. Gently mix the solution by swirling the trays.
To increase the yield, let the DNA precipitate overnight at -20 °C.
Set the tabletop centrifuge to 4 °C. Once it has cooled down, spin the DNA samples in the tabletop centrifuge for 15 min at 3,250 rpm.
Pour out isopropanol into sink and very gently tap out trays over a paper towel.
DNA wash:
Add 500 μl of 76% ethanol/0.2 M sodium-acetate. Let the samples sit in this solution for 20 min.
Spin in the tabletop centrifuge for 10 min at 3,250 rpm.
Pour out the 76% ethanol/0.2 M sodium-acetate and very gently tap out the trays over a paper towel.
Add 250 μl of 76% ethanol/10 mM ammonium-acetate. Let the samples sit for 2 min.
Spin in the tabletop centrifuge for 10 min at 3.250 rpm.
Pour out the 76% ethanol/10 mM ammonium-acetate and very gently tap out the trays over a paper towel.
Air dry on the bench for 10-15 min or until dry.
Add TE (pH 8.0) to the trays. Place in the cold room at 4 °C overnight to let DNA re-suspend.
50 μl TE for corn (40x concentration)
200 μl TE for Arabidopsis (working concentration)
Recipes
100 ml of CTAB
2 g CTAB
1 g sodium bisulfite
28 ml 5 M sodium chloride
4 ml 0.5 M EDTA
10 ml 1.0 M Tris-HCl (pH 8.0)
1.0 ml BME right at time of use
References
Saghai-Maroof, M. A., Soliman, K. M., Jorgensen, R. A. and Allard, R. W. (1984). Ribosomal DNA spacer-length polymorphisms in barley: mendelian inheritance, chromosomal location, and population dynamics. Proc Natl Acad Sci U S A 81(24): 8014-8018.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Molecular Biology > DNA > DNA extraction
Plant Science > Plant molecular biology > DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
890 | https://bio-protocol.org/en/bpdetail?id=890&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Total and Soluble Inorganic Phosphate
VK Vicki Knowles
William Plaxton
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.890 Views: 14797
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Jul 2010
Abstract
A simple, rapid, and sensitive colorimetric microassay for inorganic phosphate (Pi) relies upon the absorption at 660 nm of a molybdenum blue complex that forms upon reduction of an ammonium molybdate-Pi complex in acid. The method for determination of total Pi uses plant tissues that have been ashed at 500 °C, whereas quantification of soluble Pi is performed with tissues extracted under mild acid conditions (which preserves acid-labile phosphate ester bonds).
Materials and Reagents
Plant tissues
17.5 M Glacial acetic acid
12 M Concentrated HCl
16 M Concentrated HNO3
Sodium phosphate, monobasic (NaH2PO4) (Bioshop, catalog number: SPM400 )
Ascorbic acid (Bioshop, catalog number: AS0704 )
Ammonium molybdate (Bioshop, catalog number: AMN333 )
Zinc acetate (Sigma-Aldrich, catalog number: Z0625 )
Quartz crucibles (Thermo Fisher Scientific, catalog number: 08-072 series)
Acid extraction solution (see Recipes)
Pi stock (for standard curve) (see Recipes)
Pi assay reagent (see Recipes)
Equipment
Crucible
Drying oven
Repeat pipetor
Isotemp Muffle Furnace (Thermo Fisher Scientific, model: 10-650-14 )
Microcentrifuge
A computer supported microplate spectrophotometer (e.g., Spectromax Plus, Molecular Devices, Sunnyvale)
Procedure
Total Pi (Hurley et al., 2010)
Acid wash crucibles by incubating for at least 1 h in 0.1 N HCl at room temperature, then rinse with dH2O and dry.
Pre-weigh crucibles and place at least 60 mg (fresh weight) of tissue in each.
Dry in oven at 50-80 °C for at least 16 h (e.g., overnight), and then record tissue’s dry weight (mg) in each crucible.
Ash the tissue in the furnace using a temperature ramp program (20 min at 150 °C, 1 h at 250 °C, and 3 h at 500 °C).
Weigh crucible and ash. Add 25 μl of acid extraction solution per mg of ash, mix well, and centrifuge at 11,000 x g for 10 min.
Dilute the supernatant 50-fold in dH2O.
Assay Pi using the Drueckes et al. (1995) protocol as modified for plant tissues (Bozzo et al., 2006) by preparing a standard curve over the range 1-133 nmol of Pi using the following template.
Well #
Vol of Pi stock (3.3 mM)
Volume of dH2O
Amount of Pi added
(μl)
(μl)
(nmol)
1A
0
40
0
1B
2
38
6.6
1C
4
36
13.2
1D
8
32
26.4
1E
12
28
39.6
1F
16
24
52.8
1G
20
20
66.0
1H
24
16
79.2
2A
30
10
99.9
2B
35
5
116.6
2C
40
0
133.2
Pipette 1-40 μl of unknown(s) into adjacent wells(s). Add dH2O to bring each well to 40 μl final volume.
Add 200 μl of Pi assay reagent to each well using a repeat pipetor.
Incubate at 37 °C for 30 min.
Measure A660 values and use the Pi calibration (standard) curve to determine Pi content of unknowns.
Express the data as: nmol Pi mg-1 dry weight.
Soluble Pi (Bozzo et al., 2006)
Extract snap-frozen tissues (1:5, w/v) with 1% (v/v) glacial acetic acid.
Centrifuge samples at 11,000 x g for 10 min.
Assay the supernatant for Pi as described above.
Esterified-Pi is calculated from the difference between total and free Pi concentrations.
Recipes
Acid extraction solution
30 ml 12 M concentrated HCl
10 ml 16 M concentrated HNO3
60 ml dH2O
Pi stock (for standard curve)
3.3 mM NaH2PO4
Pi assay reagent
Ammonium molybdate reagent
Ammonium molybdate is added to an aqueous solution of 15 mM zinc acetate to give a 10 mM solution of molybdate. The solution is then adjusted to pH 5.0 with HCl. This solution is stored at 4 °C in the dark and is stable for several months.
Reducing reagent
A 10% (w/v) solution of ascorbic acid is adjusted to pH 5.0 with NaOH.
Note: This solution must be prepared fresh daily.
The Pi assay reagent is prepared by mixing one part of the ammonium molybdate reagent with four parts of the reducing reagent (prepare fresh daily).
Acknowledgments
Research in our laboratory has been generously funded by research and equipment grants from The Natural Sciences and Engineering Research Council of Canada (NSERC) and Queen’s Research Chairs program to William Plaxton.
References
Bozzo, G. G., Dunn, E. L. and Plaxton, W. C. (2006). Differential synthesis of phosphate‐starvation inducible purple acid phosphatase isozymes in tomato (Lycopersicon esculentum) suspension cells and seedlings. Plant Cell Environ 29(2): 303-313.
Drueckes, P., Schinzel, R. and Palm, D. (1995). Photometric microtiter assay of inorganic phosphate in the presence of acid-labile organic phosphates. Anal Biochem 230(1): 173-177.
Hurley, B. A., Tran, H. T., Marty, N. J., Park, J., Snedden, W. A., Mullen, R. T. and Plaxton, W. C. (2010). The dual-targeted purple acid phosphatase isozyme AtPAP26 is essential for efficient acclimation of Arabidopsis to nutritional phosphate deprivation. Plant Physiol 153(3): 1112-1122.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant biochemistry > Other compound
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Extraction and Quantification of Poly P, Poly P Analysis by Urea-PAGE
Maria R. Gomez Garcia
May 5, 2014 9218 Views
Extraction and Quantification of Polyphosphate in the Budding Yeast Saccharomyces cerevisiae
David Canadell [...] Joaquín Ariño
Jul 20, 2016 11468 Views
Isolation of Intact Vacuoles from Arabidopsis Root Protoplasts and Elemental Analysis
Chuanfeng Ju [...] Zhenqian Zhang
Mar 5, 2023 717 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
891 | https://bio-protocol.org/en/bpdetail?id=891&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chemosensitivity Assay
Haixia Zhang
Yan Zhang
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.891 Views: 11688
Reviewed by: Fanglian HeLin Fang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Stem Cells Mar 2013
Abstract
Chemoresistance is one of the special properties of cancer stem cells, which is the main cause of chemotherapy failure and plays an important role in the recurrence of various cancers including osteosarcoma. The most widely used assay for evaluating chemoresistance is the modified cell proliferation assay. An equal number of cells are seeded onto 96-well culture plates or 24-well plates, and then different concentrations of anti-cancer drugs are added into each well. After that, measure the cell density or cell activity to observe the effect of anti-cancer drugs to cancer cells or cancer stem cells. The chemoresistance of cells is stronger, the cell density or cell activity is higher. Here, we describe chemosensitivity assays for osteosarcoma cells and osteosarcoma stem-like cells.
Keywords: Cancer stem cell Chemosensitivity Serum-free culture Sphere MTT assay
Materials and Reagents
Osteosarcom cell line MNNG/HOS# from the cell bank of the Chinese Academy of Sciences (Shanghai, China)
Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12 Ham (DF) (Sigma-Aldrich, catalog number: D8900 )
Fetal Bovine Serum (FBS) (Hyclone, catalog number: GUC SH30084 )
NaCl (Wako Chemicals USA, catalog number: 191-01665 )
KCl (Wako Chemicals USA, catalog number: 163-03545 )
Na2HPO4 (Wako Chemicals USA, catalog number: 197-02865 )
KH2PO4 (Wako Chemicals USA, catalog number: 169-04245 )
Trypsin (0.05%) (Sigma-Aldrich, catalog number: T4799 )
EDTA (0.04%) (Sigma-Aldrich, catalog number: E6758 )
Trypsin inhibitor (0.05%) (Sigma-Aldrich, catalog number: T9128 )
CellTiter 96® AQueous One Solution Cell Proliferation Assay kit (Promega Corporation, catalog number: G3582 )
Cisplatin (Sigma-Aldrich, catalog number: P4394 )
Adriamycin (Sigma-Aldrich, catalog number: D1515 )
Agarose (Sigma-Aldrich, catalog number: A9539 )
Type I collagen (Life Technologies, Gibco®, catalog number: 17100-017 )
Collagenase I (Sigma-Aldrich, catalog number: C3867 )
Collagenase IV (Life Technologies, Gibco®, catalog number: 17104-019 )
Insulin (Sigma-Aldrich, catalog number: I5500 )
Apo-Transferrin (Sigma-Aldrich, catalog number: T2252 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M7522 )
Ethanolamine (Sigma-Aldrich, catalog number: E0135 )
Sodium selenite (Sigma-Aldrich, catalog number: S5261 )
BSA (Sigma-Aldrich, catalog number: A6003 )
Oleic acid (Sigma-Aldrich, catalog number: O1383 )
Heparin (Sigma-Aldrich, catalog number: H3149 )
L-Ascorbic acid 2-phosphate trisodium salt (Wako Chemicals USA, catalog number: 323-44822 )
Milli Q water
TGF-β1 signaling inhibitor SB431542 (Biovision, catalog number: 1674-1 )
Dimethyl Sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D5879 )
PBS without Ca2+ and Mg2+ (see Recipes)
Serum-Free medium (see Recipes)
Cancer stem cell medium (see Recipes)
Equipment
Centrifuge (Thermo Heraeus Megafuge 1.0)
CO2 cell culture incubator (NuAire, model: nu8700E )
Microscope (Nikon corporation Japan, model: Nikon Eclipse Ti-U )
Microplate Reader 680 (Bio-Rad Laboratories, model: 168-1001 )
Coulter Counter (Beckman Coulter, model: Z1 )
Volume adjustable micropipet (Gilson 1-10 μl, model: FA10002M ; 10-100 μl, model: FA10004M ; 100-1,000 μl, model: FM10006M )
Multichannel pipettor (BIOHIT mline pipettor, model: 725140 )
10 ml Glass pipette (BrandTech, model: 27713 )
Electric pipette (BrandTech, model: accu-jet pro 2026330 )
96-well culture plate (Greiner Bio-One GmbH, catalog number: 655180 )
24-well plate (Greiner Bio-One GmbH, catalog number: 665180 )
50 ml centrifuge tube
Procedure
For serum cultured monolayer cells in 96-well plate
Maintain stock culture of monolayer cells in DF medium supplemented with 10% FBS (Figure 1).
Figure 1. Osteosarcoma cells MNNG/HOS#
When monolayer cells are 80~90% confluent, discard medium and wash cells once with 2 ml 1x PBS, and then digest cells with 1 ml trypsin-EDTA for 2-5 min at 37 °C.
Check cell status under microscope. When the cells are disassociated, terminate digestive reaction with the same volume of FBS.
Pipette cells into 50 ml centrifuge tube, and collect cells by centrifugation at 800 rpm for 5 min.
Suspend cell pellet by DF medium without antibiotics. DF medium used for chemosensitivity assay are antibiotics free.
Count the cells by Coulter Counter.
Adjust cell density at 50,000 cells/ml by DF medium supplemented with 5% FBS.
Dispense 100 μl of cell suspension (50,000 cells/ml) in a 96-well plate.
Incubate the cells for 24 h in a humidified incubator (at 37 °C, 5% CO2).
Add 1 μl of various concentrations of adriamycin or cisplatin into each well of the 96-well assay plate containing the cells, and shake the 96-well plate horizontally to mix the drugs (do not need to change the medium).
Incubate the cells for 72 h in a humidified incubator (at 37 °C, 5% CO2).
Thaw the CellTiter 96® AQueous One solution reagent. It should take approximately 90 minutes at room temperature, or 10 min in a water bath at 37 °C, to completely thaw the 20 ml size.
Pipette 20 μl of CellTiter 96® AQueous One solution reagent into each well of the 96-well assay plate containing the cells in 100 μl of culture medium, and shake the 96-well plate horizontally to mix the reagent (Do not need to change the medium).
Incubate the plate at 37 °C for 2 h in a humidified incubator (at 37 °C, 5% CO2).
Record the absorbance at 490 nm using a Microplate Reader 680.
For serum-free cultured monolayer cells in 24-well plate
Preparation for 24-well plate:
Prepare 1% type I collagen solution with chilled 1x PBS.
Add 0.5 ml collagen solution into each well of 24-well plate.
Stand 24-well plate for 1 h at room temperature.
Aspirate excess collagen solution, and rinse the well with 1x PBS once.
Aspirate 1x PBS completely.
Maintain stock culture of monolayer cells in DF medium supplemented with 10% FBS.
When monolayer cells are 80~90% confluent, discard medium and wash cells once in 2 ml 1x PBS.
Digest cells with 1 ml trypsin-EDTA for 2-5 min at 37 °C.
Check cell status under microscope. When the cells are disassociated, terminate digestive reaction with the same volume of trypsin inhibitor.
Pipette cells into 50 ml centrifuge tube, and collect cell by centrifugation at 800 rpm for 5 min.
Suspend cell pellet by DF medium without antibiotics. DF medium used for chemoresistance assay are antibiotics free.
Count the cells by Coulter Counter.
Adjust cell density at 20,000/ml by serum free DF medium.
Add 1 ml cell solution onto each well of 24-well plate.
Incubate the cell for 24 h.
Add various concentrations of adriamycin or cisplatin into each well of 24-well plate containing the cells, and shake the 24-well plate horizontally to mix the drugs (do not need to change the medium).
Incubate cells for another 3 days.
Discard supernatant, rinse each well by 1x PBS.
Add 0.5 ml trypsin-EDTA to each well.
Collect disassociated cells, and count cell number by Coulter Counter.
For spheroid cells
Preparation for 96-well plate:
Dissolve agarose powder in Milli Q water.
Prepare 0.7% agarose solution, sterilized by autoclave for use.
Dispense 20 μl of 0.7% agarose into each well of 96-well plate.
Stand 96-well plate for 20 min at room temperature.
The 96-well plate could be used after agarose solidification.
Maintain stock culture of osteosarcoma spheroid cells in cancer stem cell medium (Figure 2).
Figure 2. Osteosarcoma spheres. The spheroid cells are suspended cultured in cancer stem cell medium.
When spheres reach 100 μm in diameter, pipette spheres into 50 ml centrifuge tube and collect cells by centrifugation at 500 rpm for 3 min.
Discard the supernatant; digest spheres with the mixture of trypsin (0.05%), collagenase I (0.1%) and collagenase IV (0.1%) for 2 min at 37 °C.
When spheres are digested to be single cells, terminate digestive reaction with 0.05% trypsin inhibitor.
Collect cells by centrifugation at 800 rpm for 5 min. Suspend cell pellet by cancer stem cell medium without antibiotics. Cancer stem cell medium used for chemosensitivity assay are antibiotics free.
Count the cells by Coulter Counter.
Adjust cell density at 50,000 cells/ml by cancer stem cell medium.
Dispense 100 μl of cell suspension (50,000 cells/ml) onto each agarose coated well of 96-well plate.
Incubate the cells for 24 h in a humidified incubator (at 37 °C, 5% CO2).
Add 1 μl of various concentrations of adriamycin or cisplatin into each well of 96-well plate containing the cells, and shake the 96-well plate horizontally to mix the drugs (do not need to change the medium).
Incubate the cells for 72 h in a humidified incubator (at 37 °C, 5% CO2).
Thaw the CellTiter 96® AQueous One solution reagent.
Pipette 20 μl of CellTiter 96® AQueous One solution reagent into each well of the 96-well plate containing the cells in 100 μl of culture medium, and shake the 96-well plate horizontally to mix the reagent (Do not need to change the medium).
Incubate the plate at 37 °C for 2 h in a humidified incubator (at 37 °C, 5% CO2).
Record the absorbance at 490 nm using a Microplate Reader 680.
For spheroid cells which are pre-treated with TGF-β1 signaling inhibitor SB431542.
Preparation for 96-well plate:
Dissolve agarose powder in Milli Q water.
Prepare 0.7% agarose solution, sterilized by autoclave for use.
Dispense 20 μl of 0.7% agarose into each well of 96-well plate.
Stand 96-well plate for 20 min at room temperature.
The 96-well plate could be used after agarose solidification.
Maintain stock culture of osteosarcoma spheroid cells in cancer stem cell medium.
Osteosarcoma spheroid cells are pre-treated with 376 nM SB431542 (dissolved in 0.01% DMSO) for 3 days (or pre-treated with 0.01% of DMSO for control) in cancer stem cell medium.
Pipette spheres into 50 ml centriguge tube and collect cells by centrifugation at 500 rpm for 3 minutes.
Discard the supernatant; digest spheres with the mixture of trypsin (0.05%), collagenase I (0.1%) and collagenase IV (0.1%) for 2 min at 37 °C.
When spheres are digested to be single cells, terminate digestive reaction with 0.05% trypsin inhibitor.
Collect cells by centrifugation at 800 rpm for 5 min. Suspend cell pellet by cancer stem cell medium without antibiotics. Cancer stem cell medium used for chemoresistance assay are antibiotics free.
Determine cell number by Coulter Counter.
Adjust cell density at 50,000 cells/ml by cancer stem cell medium.
Dispense 100 μl of cell suspension (5,000 cells/well) onto each agarose coated well of 96-well plate.
Incubate the cells for 24 h in a humidified incubator (at 37 °C, 5% CO2).
Add 1 μl of various concentrations of adriamycin or cisplatin into each well of 96-well plate containing the cells, and shake the 96-well plate horizontally to mix the drugs (do not need to change the medium).
Incubate the cells for 72 h in a humidified incubator (at 37 °C, 5% CO2).
Thaw the CellTiter 96® AQueous One solution reagent.
Pipette 20 μl of CellTiter 96® AQueous One solution reagent into each well of the 96-well plate containing the cells in 100 μl of culture medium, and shake the 96-well plate horizontally to mix the reagent (Do not need to change the medium).
Incubate the plate at 37 °C for 2 h in a humidified incubator (at 37 °C, 5% CO2).
Record the absorbance at 490 nm using a Microplate Reader 680.
Recipes
PBS without Ca2+ and Mg2+
8 g/L NaCl
0.2 g/L KCl
1.42 g/L Na2HPO4
0.27 g/L KH2PO4
Serum-Free medium
2.5 mg/L Insulin
5 mg/L apo-Transferrin
1 mM 2-mercaptoethanol
1 mM Ethanolamine
1 μM Sodium selenite
Cancer stem cell medium
Insulin (10 mg/L)
Apo-Transferrin (5 mg/L)
2-mercaptoethanol (1 mM)
Ethanolamine (1 mM)
Sodium selenite (2 μM)
BSA (9.4 mg/L)
Oleic acid (1.88 mg/L)
Heparin (150 μg/L)
L-Ascorbic acid 2-phosphate trisodium salt (10 mg/L)
Acknowledgments
This study was supported in part by a grant from the program of the State High-Tech Development Project (No. 2008AA092604), National Basic Research Program (No. 2009CB945400) and Guangdong Planning Project of Science and Technology (No. 2009B030803037).
References
Adhikari, A. S., Agarwal, N., Wood, B. M., Porretta, C., Ruiz, B., Pochampally, R. R. and Iwakuma, T. (2010). CD117 and Stro-1 identify osteosarcoma tumor-initiating cells associated with metastasis and drug resistance. Cancer Res 70(11): 4602-4612.
Ginestier, C., Liu, S., Diebel, M. E., Korkaya, H., Luo, M., Brown, M., Wicinski, J., Cabaud, O., Charafe-Jauffret, E., Birnbaum, D., Guan, J. L., Dontu, G. and Wicha, M. S. (2010). CXCR1 blockade selectively targets human breast cancer stem cells in vitro and in xenografts. J Clin Invest 120(2): 485-497.
Haraguchi, N., Ishii, H., Mimori, K., Tanaka, F., Ohkuma, M., Kim, H. M., Akita, H., Takiuchi, D., Hatano, H., Nagano, H., Barnard, G. F., Doki, Y. and Mori, M. (2010). CD13 is a therapeutic target in human liver cancer stem cells. J Clin Invest 120(9): 3326-3339.
Zhang, H., Wu, H., Zheng, J., Yu, P., Xu, L., Jiang, P., Gao, J., Wang, H. and Zhang, Y. (2013). Transforming growth factor beta1 signal is crucial for dedifferentiation of cancer cells to cancer stem cells in osteosarcoma. Stem Cells 31(3): 433-446.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Zhang, H. and Zhang, Y. (2013). Chemosensitivity Assay. Bio-protocol 3(17): e891. DOI: 10.21769/BioProtoc.891.
Download Citation in RIS Format
Category
Cancer Biology > Cell death > Drug discovery and analysis > Cell viability
Cancer Biology > General technique > Cell biology assays > Chemoresistance
Cell Biology > Cell viability > Cell proliferation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Fluorescence Imaging of 3D Cell Models with Subcellular Resolution
Indra Van Zundert [...] Susana Rocha
Jul 20, 2022 3491 Views
A Fast and Reliable Method to Generate Pure, Single Cell-derived Clones of Mammalian Cells
Zhe Han [...] Varun Kumar
Aug 20, 2022 2586 Views
Microscopic Detection of DNA Synthesis in Early Mitosis at Repetitive lacO Sequences in Human Cells
Kazumasa Yoshida [...] Masatoshi Fujita
Sep 5, 2022 1342 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
892 | https://bio-protocol.org/en/bpdetail?id=892&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Mouse Tumor-Infiltrating Leukocytes by Percoll Gradient Centrifugation
Ying Liu
KC Keqiang Chen
CW Chunyan Wang
WG Wanghua Gong
TY Teizo Yoshimura
JW Ji Ming Wang
ML Mingyong Liu
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.892 Views: 42917
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Jan 2013
Abstract
A hallmark of cancer-associated inflammation is the infiltration of leukocytes into tumors, which is believed to be recruited by chemokines. Some infiltrating leukocytes such as macrophages often promote tumor growth by producing growth-inducing and angiogenic factors. Here, we described a method of isolating tumor-infiltrating leukocytes with Percoll density gradient, because Percoll possesses a low viscosity, a low osmolarity and no toxicity to cells. Different leukocyte populations are isolated based on their density and collected at the interface between 40% and 80% discontinuous Percoll gradient.
Materials and Reagents
Mice with tumors
Collagenase, type IV (Sigma-Aldrich, catalog number: C5138 )
DNase, type IV (Sigma-Aldrich, catalog number: D5025 )
Fungizone Antimycotic (Life Technologies, InvitrogenTM, catalog number: 15290-026 )
Hank's Balanced Salt Solution (HBSS), without Calcium Chloride or Magnesium Chloride (Lonza, catalog number: 10-547F )
Hyaluronidase, Type V (Sigma-Aldrich, catalog number: H6254 )
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A4503 )
0.5 M EDTA (Quality Biological Inc, catalog number: qb351-027-721 )
Percoll (GE Healthcare, catalog number: 17-0891-01 )
Dulbecco’s Modified Eagle’s Medium High glucose with stable L-glutamine (DMEM) (Lonza, catalog number: 12-614F )
Fetal Bovine Serum (FBS) (Thermo Fisher Scientific, catalog number: SH30070-03 )
10x PBS (Life Technologies, Gibco®, catalog number: 70011 )
ACK lysing buffer (Lonza, catalog number: 10-548E )
10x Triple Enzyme Stock Solution (see Recipes)
Wash buffer (see Recipes)
40% Percoll (see Recipes)
80% Percoll (see Recipes)
Equipment
25 ml canted Neck and Blue Plug Seal Cap, non-vented tissue culture flasks (BD Biosciences, Falcon®, catalog number: 353018 )
Shaker (Lab-Line, model: 1314 )
Centrifuge
100 mm Petri dish
Procedure
Dissect Lewis Lung Cancer (LLC) tumors (tumor volume ~1,000 mm3/tumor, tumor weight: 0.5~0.8 g/tumor) grown on mice.
Place one tumor into a 100 mm Petri dish and add 5-10 ml HBSS at room temperature (RT).
Quickly mince tumors with scalpels into fragments small enough to be aspirated into a 5 ml pipette without getting stuck at RT.
Transfer tumor tissue suspension into 50 ml non-vented tissue culture flasks.
Rinse Petri dish with up to 40 ml HBSS and transfer the suspension into the flask. Total volume in the flask is 45 ml.
Add 5 ml 10x Triple Enzyme Mix to the flask, and shake the flask at 80 rpm at RT for 1-3 h on a shaker.
Repeatedly pipet the tumor cell suspension to further dissociate cells, centrifuge the cell suspension at 50 x g at RT for 10 min and collect the supernatant. Discard the bigger pellets in the bottom of the tube and centrifuge the supernatant at 200 x g for 5 min.
Wash cell pellets with 10 ml wash buffer at 200 x g for 5 min once.
Suspend the cell pellet with 2 ml ACK lysing buffer for 1 min to deplete red blood cells (observe the cell suspension under a microscope to determine whether red blood cells are depleted completely. If there are still too many red blood cells, add more ACK lysing buffer until there are very few red blood cells).
Centrifuge at 200 x g and remove the supernatant.
Re-suspend cells in 15 ml 40% Percoll and add into a 50 ml tube.
Lay slowly 15 ml 80% Percoll with a syringe and a long needle (#16 gauge) to the bottom of the above 50 ml tube.
Centrifuge at 325 x g at RT for 23 min (ascending rate: 5; descending rate: 5).
Collect the cells at the interface between 40% and 80% Percoll, which should mostly be leukocytes and directly pass the cell suspension through a 40 μm nylon strainer. Wash the strainer with wash buffer and centrifuge the cell suspension at 425 x g at RT for 10 min.
Note: After centrifugation, approximately 1.5-2.0 x 105 leukocytes could be obtained from a total of 1 x 106 cells from tumor depending on the tumor type. By discontinuous Percoll isolation, tumor cells will be in the bottom layer after centrifugation (Figure 1).
Re-suspend the cells in desired buffer for further experiments, such as phenotyping with flow cytometry and measurement of functions.
Figure 1. Schematic illustration of the isolation of tumor infiltrating-leukocytes by discontinuous Percoll gradient. Left tube shows that before centrifugation, 80% Percoll is laid under the total cells suspended in 40% Percoll. Right tube shows that after centrifugation, leukocytes are located at the interface between 40% and 80% Percoll, tumor cells are in the bottom of the tube.
Recipes
10x Triple Enzyme stock solution (100 ml)
Mix 1 g Collagenase IV, 100 mg Hyaluronidase and 20,000 Units DNase IV into 80 ml HBSS
Add HBSS to 100 ml
Filter (0.22 μm) sterilize the stock solution
Store 5 ml aliquots at -20 °C
Thaw at RT (NOT 37 °C) before use.
Wash buffer (1,000 ml)
Mix 1 g BSA and 2 ml 0.5 M EDTA with 800 ml HBSS
Add HBSS to 1,000 ml
40% Percoll, 5 ml
Mix 0.6 ml 10x PBS, 5.4 ml Percoll and 9 ml DMEM
80% Percoll, 15 ml
Mix 1.2 ml 10x PBS, 10.8 ml Percoll and 3 ml DMEM
Acknowledgments
This protocol is adapted from Liu et al. (2013).
References
Liu, Y., Chen, K., Wang, C., Gong, W., Yoshimura, T., Liu, M. and Wang, J. M. (2013). Cell surface receptor FPR2 promotes antitumor host defense by limiting M2 polarization of macrophages. Cancer Res 73(2): 550-560.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Liu, Y., Chen, K., Wang, C., Gong, W., Yoshimura, T., Wang, J. M. and Liu, M. (2013). Isolation of Mouse Tumor-Infiltrating Leukocytes by Percoll Gradient Centrifugation. Bio-protocol 3(17): e892. DOI: 10.21769/BioProtoc.892.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays > Cell isolation and culture
Cancer Biology > Tumor immunology > Biochemical assays > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Isolation of Murine Alveolar Type II Epithelial Cells
Fan Sun [...] Zhaoxia Qu
May 20, 2017 11317 Views
Soft Agar Colony Formation Assay as a Hallmark of Carcinogenesis
Feng Du [...] Daiming Fan
Jun 20, 2017 28825 Views
A Fast and Reliable Method to Generate Pure, Single Cell-derived Clones of Mammalian Cells
Zhe Han [...] Varun Kumar
Aug 20, 2022 2586 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
893 | https://bio-protocol.org/en/bpdetail?id=893&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Macrophage Differentiation by Induction with Macrophage Colony-Stimulating Factor
Ying Liu
KC Keqiang Chen
CW Chunyan Wang
WG Wanghua Gong
TY Teizo Yoshimura
JW Ji Ming Wang
ML Mingyong Liu
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.893 Views: 13241
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Jan 2013
Abstract
Macrophages are differentiated from circulating blood monocytes and act as tissue-resident professional phagocytes. Macrophages function in both innate and adaptive immune systems of vertebrate animals. The cytokine macrophage colony-stimulating factor (M-CSF) is essential for the proliferation and differentiation of monocytes. Here, we described a simple method to induce the differentiation of mouse bone marrow-derived myeloid precusor cells into macrophages in the presence of M-CSF.
Keywords: Monocytes Differentiation Macrophages
Materials and Reagents
Mice of interest
1x DPBS (Lonza, catalog number: 17-512F )
ACK lysing buffer (Lonza, catalog number: 10-548E )
Dulbecco’s Modified Eagle’s Medium with high glucose and without L-glutamine (DMEM) (Lonza, catalog number: 12-614F )
Fetal Calf Serum (FCS) (Thermo Scientific, catalog number: SH30070.03 )
Murine M-CSF (Peprotech, catalog number: 315-02 )
100x Penicillin/Streptomycin (Invitrogen, catalog number: 10378-016 )
Complete DMEM medium (see Recipes)
Equipment
40 μm nylon strainer (BD Falcon, catalog number: 352340 )
Needle (Gauge #25)
Centrifuge
Procedure
Mouse bone marrow (BM) cells are harvested from femurs by syringe and needle (Gauge #25) with 5 ml 1x DPBS. (Cut two ends of femurs and rinse out the cells by 1x DPBS)
Centrifuge the cell suspension at 200 x g at room temperature (RT) for 5 min.
Remove the supernatant and suspend the cell pellet with 2 ml ACK lysing buffer for 1 min to deplete red blood cells.
The cell suspension is directly filtered through a 40 μm nylon strainer (observe the cell lysate under the microscope to determine whether red blood cells are depleted completely. If there are still too many red blood cells, add more ACK lysing buffer until there are very few red blood cells).
Wash the strainer with 2 ml 1x DPBS and centrifuge the filtered cell suspension at 200 x g at RT for 5 min.
The cell pellet is washed once again with 1x DPBS and re-suspended in 15 ml complete DMEM medium with 20 ng/ml murine M-CSF in a 100 mm Petri dish (one femur cells per dish) in an incubator (37 °C, 5% CO2).
After 3 days, half of the medium is replaced with fresh complete DMEM medium.
On Day 4, the cells containing more than 80% CD11b+/F4/80+ macrophages are ready for further characterization and functional experiments.
Recipes
Complete DMEM medium (505 ml)
100 ml FCS
5 ml 100x Penicillin/Streptomycin
400 ml DMEM
Acknowledgments
This protocol has been adapted from Liu et al. (2013).
References
Liu, Y., Chen, K., Wang, C., Gong, W., Yoshimura, T., Liu, M. and Wang, J. M. (2013). Cell surface receptor FPR2 promotes antitumor host defense by limiting M2 polarization of macrophages. Cancer Res 73(2): 550-560.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Liu, Y., Chen, K., Wang, C., Gong, W., Yoshimura, T., Wang, J. M. and Liu, M. (2013). Mouse Macrophage Differentiation by Induction with Macrophage Colony-Stimulating Factor . Bio-protocol 3(17): e893. DOI: 10.21769/BioProtoc.893.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Maintenance and differentiation
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Streamlined Methods for Processing and Cryopreservation of Cell Therapy Products Using Automated Systems
Ye Li [...] Annie C. Bowles-Welch
Dec 20, 2023 1824 Views
Dissociation and Culture of Adult Mouse Satellite Glial Cells
Raquel Tonello [...] Temugin Berta
Dec 20, 2023 858 Views
Isolation of Human Bone Marrow Non-hematopoietic Cells for Single-cell RNA Sequencing
Hongzhe Li [...] Stefan Scheding
Jun 20, 2024 642 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
894 | https://bio-protocol.org/en/bpdetail?id=894&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pectin Methylesterase Activity Assay for Plant Material
KM Kerstin Mueller
Sebastian Bartels
AK Allison R. Kermode
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.894 Views: 13402
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Jan 2013
Abstract
Homogalacturonans, the most abundant pectins of the plant cell wall, can be methylesterified at the C-6 position of the galacturonic acid residues. Demethylesterification of cell wall pectins is catalyzed by apoplastic pectin methylesterases (PMEs). Several plant developmental processes and plant-environment interactions involve PME-mediated cell wall modification, as it promotes the formation of Ca2+cross-links along the stretches of the demethylesterified galacturonic acid residues (Wolf et al., 2009; Müller et al., 2013), and thus influences the biophysical properties of plant cell walls. Here, we describe a protocol that can be used to estimate the activity of PMEs in a total soluble protein extract from plant or seed tissues. Soluble protein is extracted from the plant/seed materials, and a coupled enzyme assay is performed, according to a procedure modified from Grsic-Rausch and Rausch (2004). The methanol released from methylesterified pectins as a result of PME activity is oxidized to formaldehyde by alcohol oxidase. The formaldehyde is then used as an electron donor by formaldehyde dehydrogenase to reduce NAD+ to NADH. The formation of NADH from NAD+ is followed spectrophotometrically, and used to estimate the PME activity in the protein extract.
Materials and Reagents
Arabidopsis thaliana plant or seed materials
Liquid nitrogen
100 mM sodium phosphate buffer (pH 7.5)
0.5% (w/v) Pectin (in dH2O) (Sigma-Aldrich, catalog number: P-9135 )
0.1 U/μl Alcohol oxidase (in 100 mM phosphate buffer) (pH 7.5) (Sigma-Aldrich, catalog number: A2404 )
0.5 U/μl Formaldehyde dehydrogenase (in 100 mM phosphate buffer) (pH 7.5) (Sigma-Aldrich, catalog number: F1879 )
0.4 mM NAD+ (in 100 mM phosphate buffer) (pH 7.5) (Sigma-Aldrich, catalog number: N8410 )
PME from orange peel (Sigma-Aldrich, catalog number: P5400 )
Protease inhibitor cocktail (1x) (contains 100 mM PMSF, 2 mM Bestatin, 0.3 mM Pepstatin A, and 0.3 mM E-64) (abmGood, catalog number: G135 )
Protein extraction buffer (see Recipes)
Master mix (see Recipes)
Equipment
Eppendorf tubes
Mortar and pestle
Vortexer
Centrifuge with cooling function
96 well microplates
Microplate reader
Procedure
Plant or seed tissue (Arabidopsis thaliana) is weighed. Use about 100 mg per extraction.
Tissues are ground to a fine powder in liquid nitrogen using a mortar and pestle. The tissue must be kept frozen during grinding.
Twice the fresh weight (w/v) of extraction buffer is added to the powder, and the powder allowed to thaw in the buffer.
Vortex for 10 sec.
Extracts are rotated at 4 °C for 30 min and centrifuged at 11,500 x g at 4 °C for 20 min.
The supernatant is the soluble protein extract. Use fresh supernatants immediately for the PME enzyme assay, as the activity can be affected by freezing.
Four replicates of each sample (10 μl each) are pipetted into microplate wells. For the negative control, use protein extraction buffer only. For a positive control, use a solution of commercially available PME in protein extraction buffer.
Master mix (180 μl) is added to each well and mixed by pipetting up and down. Avoid the formation of bubbles.
To start the reaction, add 10 μl of the pectin solution to the samples, the negative and the positive control, but not to the background controls. Mix well by pipetting up and down.
Immediately put the plate into the microplate reader. If bubbles have formed during the mixing process, shake plate for 5 sec. Record the changes in absorption at 340 nm over 15 min at room temperature.
The change in absorption per unit time over the linear part of the reaction is calculated for each well, and used to calculate the increase in concentration of NADH. The NADH concentration is calculated using Lambert-Beer's law with the extincion coefficient ε340 for NADH (6,220 M-1cm-1). One nkat PME activity is defined as 1 nmol NADH formed per second.
The activities of the triplicates are averaged.
Recipes
Protein extraction buffer
100 mM Tris-HCl (pH 7.5)
500 mM NaCl
1x protease inhibitor cocktail
Master Mix (per sample)
20 μl pectin solution
2 μl alcohol oxidase solution
2 μl formaldehyde dehydrogenase solution
156 μl NAD+ solution
Acknowledgments
This work was supported by the Swiss National Science Foundation (grant 31003A_127563; to TB) and by stipends to SB from the European Molecular Biology Organisation (EMBO: ALTF 61-2010) and the Leopoldina Fellowship Programme of the National Academy of Science Leopoldina (LPDS 2009-35).
References
Grsic-Rausch, S. and Rausch, T. (2004). A coupled spectrophotometric enzyme assay for the determination of pectin methylesterase activity and its inhibition by proteinaceous inhibitors. Anal Biochem 333(1): 14-18.
Mueller, K., Levesque-Tremblay, G., Bartels, S., Weitbrecht, K., Wormit, A., Usadel, B., Haughn, G. and Kermode, A. R. (2013). Demethylesterification of cell wall pectins in Arabidopsis plays a role in seed germination. Plant Physiol 161(1): 305-316.
Wolf, S., Mouille, G. and Pelloux, J. (2009). Homogalacturonan methyl-esterification and plant development. Mol Plant 2(5): 851-860.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Mueller, K., Bartels, S. and Kermode, A. R. (2013). Pectin Methylesterase Activity Assay for Plant Material. Bio-protocol 3(17): e894. DOI: 10.21769/BioProtoc.894.
Mueller, K., Levesque-Tremblay, G., Bartels, S., Weitbrecht, K., Wormit, A., Usadel, B., Haughn, G. and Kermode, A. R. (2013). Demethylesterification of cell wall pectins in Arabidopsis plays a role in seed germination. Plant Physiol 161(1): 305-316.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > Morphogenesis
Plant Science > Plant biochemistry > Protein > Activity
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Semi-throughput Procedure for Assaying Plant NADP-malate Dehydrogenase Activity Using a Plate Reader
Kevin Baudry and Emmanuelle Issakidis-Bourguet
Aug 20, 2023 320 Views
An in vitro Assay to Probe the Formation of Biomolecular Condensates
Yu Zhang and Shen Lisha
Sep 5, 2023 1441 Views
Immunofluorescence for Detection of TOR Kinase Activity In Situ in Photosynthetic Organisms
Ana P. Lando [...] Giselle M. A. Martínez-Noël
Dec 20, 2024 312 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
897 | https://bio-protocol.org/en/bpdetail?id=897&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Targeted Occlusion of Individual Pial Vessels of Mouse Cortex
ZT Zachary J. Taylor
AS Andy Y. Shih
Published: Vol 3, Iss 17, Sep 5, 2013
DOI: 10.21769/BioProtoc.897 Views: 9765
Reviewed by: Xuecai Ge Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Nature Neuroscience Jan 2013
Abstract
Targeted photothrombosis is a method to occlude individual arterioles and venules that lie on the surface of the cerebral cortex. It has been used to study collateral flow patterns within the pial vascular network following occlusion of single surface vessels (Schaffer et al., 2006; Blinder et al., 2010; Nguyen et al., 2011), as well as to generate localized ischemic strokes following occlusion of single penetrating vessels (Nishimura et al., 2007; Drew et al., 2010; Shih et al., 2013). The intravascular clot is formed by irradiation of a target vessel with a focused green laser after injection of a circulating photosensitizing agent, Rose Bengal (Watson et al., 1985). We briefly describe modifications of custom-designed and commercial two-photon imaging systems required to introduce a green laser for photothrombosis. We further provide instructions on how to occlude a single penetrating arteriole within the somatosensory cortex of an anesthetized mouse.
Keywords: Two-photon imaging Microinfarct Blood flow Microvessel Photothrombosis
Materials and Reagents
Mouse with cranial window implant
Buprenorphine hydrochloride (Buprenex®) (Butler Schein, catalog number: 031919 )
Isoflurane (Butler Schein, catalog number: 029405 )
Ophthalmic ointment (Butler Schein, catalog number: 039886 )
Cover Glass (no. 0 thickness) (Thomas Scientific, catalog number: 6661B40 )
Filter paper (Thermo Fisher Scientific, catalog number: S47573B )
60 mm Culture dish (Thermo Fisher Scientific, catalog number: 130181 )
Distilled water
Glucose (Sigma-Aldrich, catalog number: G8270 )
HEPES (Sigma-Aldrich, catalog number: H7006 )
Artificial cerebral spinal fluid (ACSF) (see Recipes)
FITC-dextran (Sigma-Aldrich, catalog number: FD2000S ) solution (see Recipes)
Rose Bengal (Sigma-Aldrich, catalog number: 632-69-9 ) solution (see Recipes)
Equipment
Insulin syringe, 0.3 ml volume with 29.5 gauge needle (Thermo Fisher Scientific, catalog number: 309301 )
Green laser, 532 nm (Beta Laser, catalog number: MGM20 )
Heating pad with feedback regulation
Temperature control system (FHC Inc., catalog number: 40-90-8 )
Rectal thermistor (FHC Inc., catalog number: 40-90-5D-02 )
Heat pad for mouse (FHC Inc., catalog number: 40-90-2-07 )
Isoflurane vaporizer (IsoTec4; Datex-Ohmeda) (GE Healthcare)
Induction chamber (VetEquip, model: 941444 )
Objective lens, 4x, 0.16-NA (UplanSApo) (Olympus, or equivalent for your system)
Objective lens, 20x, 1.0-NA water immersion (XLUMPlanFI) (Olympus, or equivalent for your system)
Two-Photon Microscope, adapted for targeted photothrombosis (custom-designed or commercial, i.e. Sutter Movable Objective Microscope)
Microscope setup
With a custom-designed two-photon imaging system (Tsai et al., 2002), a green laser beam is introduced into the imaging beam path with dichroic mirror 1 (625 DRLP) (Figure 1) (Shih et al., 2011). The beam is adjusted to pass through a 3.5 mm diameter clearing etched in the dielectric coating of dichroic mirror 2 (700 DCXRU) (Figure 1). This allows transmission of the green laser to the back aperture of the objective lens, while still reflecting > 90% of emitted light from the sample toward the photomultiplier tubes (PMTs). The result is a fixed green laser beam, focused within the center of the imaging field. A shutter placed within the green laser path (LS3Z2 Uniblitz and VMM-D1 driver) will allow control over its on-off time. During occlusion of a vessel, irradiation can be periodically interrupted for brief epochs of imaging. Typically 1 frame (0.2 sec per frame) every 1 sec for an 80% duty cycle. This permits real time observation of the formation of the clot (Schaffer et al., 2006).
Figure 1. Schematic of custom-designed two-photon system modified to introduce a continuous wave green laser beam. (CW) continuous wave, (PMT) photomultiplier tube. The beam control module for the green laser refers to a neutral density filter to attenuate the laser intensity to a level suitable for photothrombosis. A ~ 3.5 mm diameter hole is etched in the coating of dichroic mirror 2 to allow the green laser to pass while the PMT assembly is in place, thereby allowing visualization of clot formation in real-time. Components and instructions to adapt a custom-designed two-photon system (Tsai et al., 2002) for targeted photothrombosis are provided in Shih et al. (2011).
For the enclosed design of commercial two-photon imaging systems, there is often limited space within the microscope for additional optomechanical components. Here we illustrate how the green laser may be introduced through the camera port of a Sutter Movable Objective Microscope (MOM), using a custom green laser module described by Sigler et al. 2008. The port is located above the ocular lenses, as is the case for most commercial microscope systems (Figure 2a). This path leads to a movable mirror (mirror 2) already located within the Ti-Sapphire imaging beam path between the scan and tube lenses. The green laser is then deflected toward the back aperture of the objective. When transitioning from two-photon to wide-field imaging mode with the MOM system, built-in servo-motors move mirror 2 into the beam path and move the primary dichroic above the objective out of the path synchronously (Figure 2a). This allows the green laser to pass to the objective. In this configuration, however, one will be not be able to visualize the formation of the clot in real-time. Rather, the extent of clot is monitored in between epochs of continuous irradiation (30 sec), by transitioning back to two-photon imaging mode when the green laser is off (Figure 2b). Finally, while not discussed here, another entry point for the green laser is through an epifluorescence filter slot, as described in detail by Sigler et al. (2008).
Figure 2. Schematic of commercial two-photon system (Sutter Movable Objective Microscope) modified to introduce a continuous wave green laser beam through the camera port. The beam control module refers to a neutral density filter to attenuate the laser intensity to a level suitable for photothrombosis, and a polarizing filter on a rotation mount for finer adjustments of intensity (see Sigler et al., 2008 for detailed instruction for green laser assembly for camera port). A single plano convex lens, rather than the lens doublet described by Sigler et al. 2008, is added to the optical cage assembly to ensure that the beam is collimated after it passes through the tube lens of the microscope. The beam control module and lens are housed in an optical cage generated from Newport parts, which is bolted to a C-mount adaptor that fits into the camera port. The PMT assembly is moved out of the imaging beam path to allow the green laser to pass.
With both custom and commercial two-photon imaging systems, additional optics may be necessary to adjust the power of the green laser and modify the diameter of the beam, depending upon the system. Power control is typically achieved by adding a neutral density filter and/or polarizer filter on a rotation mount (Sigler et al., 2008; Shih et al., 2011). The power of the green laser at its focus after the microscope objective should range between 0.5–1 mW. The green laser beam should under fill the back aperture of the microscope objective, in order to generate a relatively large 3 to 5 μm diameter region of photoactivation within the center of the imaging plane. The beam should also be collimated to ensure that the green laser is focused at the imaging plane. It may therefore be necessary to add lenses to alter the beam diameter and/or adjust for convergence/divergence of the green laser caused by other lenses within the beam path. For example, with the Sutter MOM system an additional plano convex lens (LA1978-A) was added to reduce convergence caused by the tube lens (Figure 2a; located within optical cage system). All necessary optics can be housed together with the green laser using cage systems available from ThorLabs or Newport, and then mounted on the camera port as a single unit, similar to that described by Sigler et al. (Figure 2a) (Sigler et al., 2008).
We now describe the procedures involved in occluding a single penetrating arteriole in mouse cortex using a green laser beam coupled through the camera port of a Sutter MOM.
Procedure
Targeting the green laser
Before imaging, locate the focus of the green laser within the imaging plane by bleaching a piece of filter paper soaked with FITC-dextran solution.
Cut a 1 x 1 cm piece of filter paper and place it in a culture dish. Cover the paper with 50 μl of FITC-dextran and overlay it with a coverslip. Place a drop of distilled water onto the surface of the cover glass and bring the filter paper into focus at the eyepiece.
Use the same objective lens that you would use for photothrombosis (i.e., 20x, 1.0-NA). Use the translation stage to find an area free of bubbles. Turn off the PMTs and transition to wide-field mode. Ensure the cameral port is open and that the green laser passes through the objective.
Irradiate the sample for 30 sec and then deactivate the beam. Transition back to two-photon imaging mode. An area of the filter paper should now be bleached, marking the focus of the green laser beam.
Place a clear piece of tape on the computer screen over the bleached area. Use a pen to mark the location of where the laser is focused. Repeat the bleaching procedure in a different location to ensure that the location of irradiation is consistent.
Photothrombosis
This procedure requires optical access to the brain either through a skull-removed, which has been described in detail in past publications (Mostany and Portera-Cailliau, 2008; Drew et al., 2010; Shih et al., 2012a; Shih et al., 2012b) or thinned skull cranial window (Holtmaat, 2009). A method of fixing the head of the mouse for imaging is also required (Shih et al., 2012b).
Anesthetize the mouse with isoflurane and affix the animal’s head in the optical imaging apparatus. The apparatus should have a method of delivering isoflurane continuously to provide anesthesia throughout the procedure.
Administer 25 μl of FITC-dextran through the tail vein or retro-orbital vein to label the blood serum.
Using a low magnification objective (i.e., 4x, 0.16-NA), take an image stack (200 μm deep, 5 μm steps) of the pial vasculature through the cranial window. A maximally projected image of this stack is used as a map to provide guidance when using higher magnification objectives (Figure 3a).
Figure 3. Generation of cortical microinfarct by targeted photothrombosis in mouse cortex. a. low magnification, maximally projected image of pial vasculature visualized through a thinned skull PoRTS window (Drew, 2010). The vasculature is labeled with intravenous FITC-dextran. A single penetrating arteriole within the window is identified for photothrombosis (inset). b. Green laser irradiation of a single penetrating arteriole (left panel) immediately following intravenous administration of Rose Bengal leads to localized clotting (right panel). After successful photothrombosis, a dark clot is seen at the site of irradiation and the vessel becomes brighter upstream due to stagnation of red blood cell flow. c. Post-mortem immunohistochemistry with the pan-neuronal marker NeuN demarcates the boundaries of the resulting microinfarct (yellow-dotted line), as observed 48 hours following occlusion.
Exchange the low magnification lens for a high magnification objective (i.e., 20x, 1.0-NA). Place a drop of distilled water over the cranial window and bring the pial surface into focus. Navigate within the cranial window using the image made with the low magnification objective. Locate the neck of a penetrating arteriole just before it descends into the cortex. Penetrating arterioles branch from the surface arteriolar network and descend into the brain (Blinder, 2010; Shih, 2013). To confirm the identity of the target, use two-photon microscopy to image deeper layers of cortex and ensure that it penetrates into the brain. Once verified, return to the pial surface and maneuver the location of the green laser focus into the lumen of the target vessel by moving the microscope stage.
Inject 50 μl of Rose Bengal solution through the tail vein or retro-orbital vein. Immediately irradiate the vessel with the green laser focus for 30 sec. Return to two-photon imaging mode. The vessel should now be occluded. A successfully occluded vessel will show no dark streaks caused by the movement of red blood cells. There will typically be a dark thrombus with a bright region of stagnant serum directly upstream (Figure 3b, right panel). If the vessel fails to occlude, the photothrombotic procedure may be repeated. Irradiation must be performed within 5 to 10 min after intravenous injection of Rose Bengal as the dye is quickly extravasated from circulation (Zhang and Murphy, 2007). The vessel should be re-examined after 1 h to ensure the vessel has not de-occluded. De-occlusion can sometimes occur with large penetrating arterioles.
The occlusion of a single penetrating arteriole will result in a columnar region of ischemia in mouse cortex ranging from 300 to 500 μm in diameter and can often span the entire depth of cortex (Drew et al., 2010). This region of ischemia will eventually become infarcted and the discrete boundary between viable and infarcted tissue can be delineated with post-hoc immunohistology (Figure 3c).
Recipes
Artificial cerebral spinal fluid (ACSF)
Prepared from:
125 mM NaCl
5 mM KCl
10 mM glucose
3.1 mM CaCl2
1.3 mM MgCl2
10 mM HEPES (pH 7.4)
Sterile filter and maintain as aliquots at 4 °C (Kleinfeld and Delaney, 1996)
FITC-dextran solution
Prepare a 5% solution (w/v) in sterile PBS
Maintain as aliquots at -20 °C
Rose Bengal solution
Prepare a 1.25% solution (w/v) in PBS
Maintain as aliquots at -20 °C
Acknowledgments
Our work is generously supported by grants to A.Y.S. from the NINDS (NS085402), the Dana Foundation, and South Carolina Clinical and Translational Institute (UL1TR000062).
References
Blinder, P., Shih, A. Y., Rafie, C. and Kleinfeld, D. (2010). Topological basis for the robust distribution of blood to rodent neocortex. Proc Natl Acad Sci U S A 107(28): 12670-12675.
Drew, P. J., Shih, A. Y., Driscoll, J. D., Knutsen, P. M., Blinder, P., Davalos, D., Akassoglou, K., Tsai, P. S. and Kleinfeld, D. (2010). Chronic optical access through a polished and reinforced thinned skull. Nat Methods 7(12): 981-984.
Kleinfeld, D. and Delaney, K. R. (1996). Distributed representation of vibrissa movement in the upper layers of somatosensory cortex revealed with voltage-sensitive dyes. J Comp Neurol 375(1): 89-108.
Mostany, R. and Portera-Cailliau, C. (2008). A method for 2-photon imaging of blood flow in the neocortex through a cranial window. J Vis Exp(12).
Nguyen, J., Nishimura, N., Fetcho, R. N., Iadecola, C. and Schaffer, C. B. (2011). Occlusion of cortical ascending venules causes blood flow decreases, reversals in flow direction, and vessel dilation in upstream capillaries. J Cereb Blood Flow Metab 31(11): 2243-2254.
Nishimura, N., Schaffer, C. B., Friedman, B., Lyden, P. D. and Kleinfeld, D. (2007). Penetrating arterioles are a bottleneck in the perfusion of neocortex. Proc Natl Acad Sci U S A 104(1): 365-370.
Schaffer, C. B., Friedman, B., Nishimura, N., Schroeder, L. F., Tsai, P. S., Ebner, F. F., Lyden, P. D. and Kleinfeld, D. (2006). Two-photon imaging of cortical surface microvessels reveals a robust redistribution in blood flow after vascular occlusion. PLoS Biol 4(2): e22.
Shih, A. Y., Mateo, C., Drew, P. J., Tsai, P. S. and Kleinfeld, D. (2012). A polished and reinforced thinned-skull window for long-term imaging of the mouse brain. J Vis Exp (61).
Shih, A. Y., Driscoll, J. D., Drew, P. J., Nishimura, N., Schaffer, C. B. and Kleinfeld, D. (2012). Two-photon microscopy as a tool to study blood flow and neurovascular coupling in the rodent brain. J Cereb Blood Flow Metab 32(7): 1277-1309.
Shih. A.Y., Nishimura. N., Nguyen. J., Friedman. B., Lyden. P.D., B. S.C., Kleinfeld, D. (2011). Optically Induced Occlusion of Single Blood Vessels in Neocortex. In: Imaging in Neuroscience: A Laboratory Manual (Helmchen F, Konnerth A, Yuste R, eds), p. New York: Cold Spring Harbor Laboratory Press, Chapter 85, 939-948.
Shih, A. Y., Blinder, P., Tsai, P. S., Friedman, B., Stanley, G., Lyden, P. D. and Kleinfeld, D. (2013). The smallest stroke: occlusion of one penetrating vessel leads to infarction and a cognitive deficit. Nat Neurosci 16(1): 55-63.
Sigler, A., Goroshkov, A. and Murphy, T. H. (2008). Hardware and methodology for targeting single brain arterioles for photothrombotic stroke on an upright microscope. J Neurosci Methods 170(1): 35-44.
Tsai, P.S., Nishimura, N., Yoder, E.J., Dolnick, E.M., White, G.A., Kleinfeld, D. (2002). Principles, design, and construction of a two photon laser scanning microscope for in vitro and in vivo brain imaging. In: In Vivo Optical Imaging of Brain Function (Frostig RD, ed), pp 113-171. Boca Raton: CRC Press.
Watson, B. D., Dietrich, W. D., Busto, R., Wachtel, M. S. and Ginsberg, M. D. (1985). Induction of reproducible brain infarction by photochemically initiated thrombosis. Ann Neurol 17(5): 497-504.
Zhang, S. and Murphy, T. H. (2007). Imaging the impact of cortical microcirculation on synaptic structure and sensory-evoked hemodynamic responses in vivo. PLoS Biol 5(5): e119.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Taylor, Z. J. and Shih, A. Y. (2013). Targeted Occlusion of Individual Pial Vessels of Mouse Cortex. Bio-protocol 3(17): e897. DOI: 10.21769/BioProtoc.897.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Cell Biology > Tissue analysis > Tissue isolation
Cell Biology > Cell imaging > Fixed-tissue imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
LiverQuant: An Improved Method for Quantitative Analysis of Liver Pathology
Dominick J. Hellen and Saul Joseph Karpen
Jul 20, 2023 1270 Views
Simple Rescue of Opaque Tissue Previously Cleared by iDISCO
Haylee Mesa [...] Qi Zhang
Mar 5, 2024 823 Views
Cochlear Organ Dissection, Immunostaining, and Confocal Imaging in Mice
Chenyu Chen [...] Dongdong Ren
Jan 20, 2025 1598 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
899 | https://bio-protocol.org/en/bpdetail?id=899&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Flower Cuticular Waxes and Cutin Monomers
Anna Smirnova
JL Jana Leide
MR Markus Riederer
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.899 Views: 9535
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Jul 2007
Abstract
Here we describe procedures for the flower cuticular waxes extraction, modification and subsequent qualitative and quantitative analysis by gas-chromotography-mass spectrometry (GC-MS) and gas-chromotography with flame ionization detector (GC-FID), accordingly. To characterize flower cutin monomers two experimental setup are described: (i) analysis of enzymatically isolated cuticles in order to determine the relative proportions of cutin monomers; (ii) analysis of freeze-dried material for quantitative estimation of the cutin content. This report is an adaptation of the earlier published protocols developed for the chemical analysis of the cuticles in vegetative organs (Leide et al., 2007).
Keywords: Cuticular waxes Cutin Flower GC-MS GC-FID
Materials and Reagents
Chloroform (Carl Roth, catalog number: 7331.2 )
Heptatriacontane (Fluka, catalog number: 51848 )
Dotriacontane (Fluka, catalog number: 44253 )
N,O-bis-trimethylsilyl-trifluoroacetamide (BSTFA) (Macherey-Nagel, catalog number: 701220.201 )
Pyridine (Merck, catalog number: 1074630500 )
1.25 M methanol-HCl (Fluka, catalog number: 17935 )
Sodium chloride-saturated aqueous solution (Applichem, catalog number: A2824 )
Anhydrous sodium sulfate salt (Applichem, catalog number: A1048 )
Pectinase (Trenolin Super D) (Erbsloh, catalog number: 20312 )
Cellulase (Cellulast) (Novo Nordisk AIS, catalog number: CA451088 )
Citric acid monohydrate (Sigma-Aldrich, catalog number: C1909 )
Liquid nitrogen
20 mM citrate buffer, pH 3.0 supplemented with 1 mM sodium azide (see Recipes)
Equipment
Freeze-drier
Nitrogen cylinder and blow-down system
Block heater with supports for glass scintillation vials
Glass scintillation vials (for volume 15-20 ml)
Glass vials with conic bottom (for volume 1-1.5 ml)
Glass vials (with volume 1.5 ml) and glass inserts for them (with volume 0.2 ml)
Glass funnels and glass Pasteur pipette
Screw caps with Teflon or PTFE liners for the glass vials
Glass syringes (for volumes 1,000, 100, 50 and 10 μl)
Paper filters
Nylon filters (with pores 41 μm) (EMD Millipore, model: NY4102500 )
Glass filtration apparatus
GC-MS: Temperature controlled capillary gas chromatograph (Agilent Technologies, model: 6890N ) with on-column injection (J&W Scientific; 30 m DB-1, 320 μm i.d., df = 1 mm) and a mass spectrometric detector (Agilent Technologies, model: 5973N ; 70 eV; m/z 50–750)
GC-FID: Capillary gas chromatography (Hewlett-Packard, model: 5890 II ) and flame ionization detection
Procedure
Wax analysis
Flowers of Solanum lycopersicum L. cv. MicroTom were collected in anthesis and frozen in liquid nitrogen. Plant material was freeze-dried overnight.
About 10 to 30 mg of freeze-dried material was submersed in 10 ml chloroform containing 3 mg of heptatriacontane (internal standard) in 15 ml vessels for 1 min and then filtered through a paper filter.
The filtrate was evaporated under a flow of nitrogen to volume 1 ml and transferred into glass-vials with conic bottom and volume 1-1.5 ml. The solvent was totally evaporated under a flow of nitrogen.
Hydroxyl-containing compounds were transformed into the corresponding trimethylsilyl derivatives using 10 μl BSTFA and 10 μl pyridine. The mixtures were incubated at 70 °C for 30 min and then dissolved in 50-100 μl of chloroform.
Solution was transferred into the glass inserts, which were placed in glass vials with volume 1.5 ml.
The qualitative composition was identified with temperature controlled capillary gas chromatography and on-column injection with helium carrier gas inlet pressure programmed at 50 kPa for 5 min, 3.0 kPa min-1 to 150 kPa, and at 150 kPa for 40 min. Separation of the wax mixtures was achieved using an initial temperature of 50 °C for 2 min, raised by 40 °C min-1 to 200 °C, held at 200 °C for 2 min, and then raised by 3 °C min-1 to 320 °C and held at 320 °C for 30 min. These parameters are universal for analysis of the cuticular waxes and allow good peak resolution for samples derived from diverse plant species. Individual compounds were identified according to their retention times and mass-spectra obtained from commercially available and domestic libraries.
Quantitative composition of the mixtures was studied using capillary gas chromatography and flame ionization detection under the same gas chromatographic conditions as above, but with hydrogen as carrier gas. Single compounds were quantified against the heptatriacontane. Wax load was calculated to dry weight of freeze-dried flowers.
Cutin analysis
For the cutin analysis freeze-dried material (a) or enzymatically isolated cuticles (b) were used.
About 25 mg of freeze-dried flowers were briefly washed with chloroform at room temperature and then with a new chloroform portion at 50 °C for 30 min. Afterwards samples were incubated for one week in chloroform changed daily (at room temperature). Wax-free material was air dried and stored on silica.
Cuticles from fresh flowers were isolated enzymatically with pectinase and cellulose in the citrate buffer supplemented with sodium azide. Material was incubated for 4 weeks in the enzymatic solution with occasional shaking. Every week material was collected on the nylon filter and then replaced into fresh portion of enzymatic solution. Isolated cuticles were washed with water and dried out under an air stream. Then cuticles were delipidated by chloroform and again air dried.
Subsequent isolation of cutin monomers and their analysis did not differ for two types of samples. Dried samples were trans-esterified with 1 ml of 1.25 M methanol/HCl at 80 °C overnight to release methyl esters of cutin acid monomers and phenolics.
Afterwards 1 ml of sodium chloride-saturated aqueous solution, 2 ml of chloroform spiked with 20 μg of dotriacontane (internal standard) were added to the reaction mixture. All components were intermingled by shaking and then allowed to segregate into two phase.
Lower phase represented by chloroform with depolymerized transmethylated cutin components was collected with the glass syringe and transferred into a glass vial.
New 2 ml portion of chloroform was added to the reaction mixture. All components were intermingled by shaking and then allowed to segregate into two phase.
Lower phase was again collected with the glass syringe and pooled with the extract from step 11.
New 2 ml portion of chloroform was added to the reaction mixture. All components were intermingled by shaking and then allowed to segregate into two phase.
Lower phase was again collected with the glass syringe and pooled with the extract from step 11. Thus, the extraction was performed thrice.
The combined organic phases were dried over anhydrous salt of sodium sulfate. For this the salt was added to the solution in small portions till the salt stopped conglomerate. The amount required depends on the amount of water in the solvent solution, and it varies from experiment to experiment. The solution should be dried out until salt crystals float free.
The solution was filtered via paper filters to get rid of the salt and the organic solvent was evaporated under a continuous flow of nitrogen.
Hydroxyl-containing compounds were transformed into the corresponding trimethylsilyl derivatives like waxes and then dissolved in 250 μl of chloroform.
Solution was transferred to into the glass inserts, which were placed in glass vials with volume 1.5 ml.
GC-MS and GC-FID of the cutin components was conducted with the use of the same equipment, but different conditions. Inlet pressure programmed at 50 kPa for 60 min, 10.0 kPa min-1 to 150 kPa. Initial temperature of 50 °C for 2 min, raised by 10 °C min-1 to 150 °C, held at 150 °C for 2 min, and then raised by 3 °C min-1 to 320 °C and held at 320 °C for 30 min. Single compounds were quantified against the dotriacontane. Relative proportion of the cutine components were calculated to dry weight of isolated wax-free cuticles. Quantitative cutine composition was calculated was calculated to the dry weight of delipidated freeze-dried flowers.
Recipes
20 mM citrate buffer, pH 3.0 supplemented with 1 mM sodium azide
2,000 ml distilled water
20 ml Cellulast (Cellulase)
20 ml Trenolin Super D (Pectinase)
0.13 g sodium azide
Store at room temperature
Acknowledgments
This report is an adaptation of earlier published protocols developed for the chemical analysis of cuticles in vegetative organs (Leide et al., 2007).
References
Leide, J., Hildebrandt, U., Reussing, K., Riederer, M. and Vogg, G. (2007). The developmental pattern of tomato fruit wax accumulation and its impact on cuticular transpiration barrier properties: effects of a deficiency in a beta-ketoacyl-coenzyme A synthase (LeCER6). Plant Physiol 144(3): 1667-1679.
Smirnova, A., Leide, J. and Riederer, M. (2013). Deficiency in a very-long-chain fatty acid beta-ketoacyl-coenzyme a synthase of tomato impairs microgametogenesis and causes floral organ fusion. Plant Physiol 161(1): 196-209.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Smirnova, A., Leide, J. and Riederer, M. (2013). Analysis of Flower Cuticular Waxes and Cutin Monomers. Bio-protocol 3(18): e899. DOI: 10.21769/BioProtoc.899.
Leide, J., Hildebrandt, U., Reussing, K., Riederer, M. and Vogg, G. (2007). The developmental pattern of tomato fruit wax accumulation and its impact on cuticular transpiration barrier properties: effects of a deficiency in a beta-ketoacyl-coenzyme A synthase (LeCER6). Plant Physiol 144(3): 1667-1679.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Lipid
Biochemistry > Lipid > Extracellular lipids
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Qualitative Analysis of Lipid Peroxidation in Plants under Multiple Stress Through Schiff’s Reagent: A Histochemical Approach
Jay Prakash Awasthi [...] Sanjib Kumar Panda
Apr 20, 2018 13198 Views
GC-MS-Based Analysis of Methanol: Chloroform-extracted Fatty Acids from Plant Tissues
Manish Kumar Patel [...] Jitendra Kumar Thakur
Sep 20, 2018 13734 Views
Sorghum bicolor Extracellular Vesicle Isolation, Labeling, and Correlative Light and Electron Microscopy
Deji Adekanye [...] Jeffrey L. Caplan
Oct 5, 2024 267 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
90 | https://bio-protocol.org/en/bpdetail?id=90&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Extract Genomic DNA from Arabidopsis Leaves (Can be Used for Other Tissues as Well)
Yongxian Lu
In Press
Published: Jul 5, 2011
DOI: 10.21769/BioProtoc.90 Views: 30530
Ask a question
Favorite
Cited by
Abstract
This is a simple protocol for isolating genomic DNA from fresh plant tissues. DNA from this experiment can be used for all kinds of genetics studies, including genotyping and mapping. This protocol uses Edward’s extraction buffer to isolate DNA.
Materials and Reagents
Ethanol (EtOH)
Isopropanol
NaCl
EDTA
SDS
Tris (pH 7.5)
Edward buffer (see Recipes)
Equipment
Ceramic mortar and pestles
Centrifuges (Eppendorf)
Vortex (VWR International)
Procedure
Add 400 μl Edward extraction buffer to a 1.5 μl tube.
Take 2-3 small leaves or 1 big leaf, grind with pestle (2-3 weeks old).
Vortex 5 sec, set at room temperature until all preps are ready.
Spin at 16,000 rpm for 2 min.
Transfer 300 μl of suspension to a fresh tube.
Add 300 μl of isopropanol at room temperature for 2 min.
Spin 5 min, wash pellet with 70% EtOH, and dry at room temperature.
Resuspend in 100 μl H2O and store at -20 °C.
Use 2 - 4 μl for PCR reaction to validate the presence of target DNA.
Recipes
Edward buffer
200 mM Tris (pH 7.5)
250 mM NaCl
25 mM EDTA
0.5% SDS
References
Lu, Y., Chanroj, S., Zulkifli, L., Johnson, M. A., Uozumi, N., Cheung, A. and Sze, H. (2011). Pollen tubes lacking a pair of K+ transporters fail to target ovules in Arabidopsis. Plant Cell 23(1): 81-93.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Molecular Biology > DNA > DNA extraction
Plant Science > Plant molecular biology > DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
900 | https://bio-protocol.org/en/bpdetail?id=900&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
End-synapsis Assay
J Jessica Cottarel
PC Patrick Calsou
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.900 Views: 8185
Reviewed by: Lin FangTie LiuFanglian He
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Cell Biology Jan 2013
Abstract
Many environmental agents induce double-strand breaks (DSBs) in DNA. Unrepaired or improperly repaired DSBs can lead to cell death or cancer. Nonhomologous end joining is the primary DNA double-strand break repair pathway in eukaryotes. During NHEJ pathway, several proteins recognize and bind DNA ends, bring the ends in a synaptic complex and, finally, process and ligate the ends.
Briefly, NHEJ starts with Ku protein. Ku binds the broken DNA ends and recruits the catalytic subunit of DNA dependent protein kinase (DNA-PKcs) forming DNA-PK. After processing, the XRCC4/Ligase IV complex executes the final ligation stimulated by Cernunnos-XLF.
Here, we describe an end-synapsis assay. This assay can be used in order to delineate which proteins are necessary to bring the DNA ends in a stable synaptic complex during NHEJ. Briefly, NHEJ competent extracts from human cells were incubated with both a double-stranded DNA fragment bound to streptavidin-coated magnetic beads and the same soluble radio-labeled fragment. The beads were then washed in mild salt buffer and the radioactivity recovered with the beads was measured by scintillation counting. Control experiments without extracts or with DNA-free beads were run in parallel to determine unspecific background.
Keywords: DNA double-strand breaks Non homologous end-joining DNA repair
Materials and Reagents
NHEJ competent human cells (e.g. AHH1 lymphoblastoid cells, Nalm6 pre-B cells, HeLa epithelial cells, MRC5SV fibroblasts, etc.)
~500 bp double-stranded DNA fragments amplified by PCR, biotinylated at one end or non-biotinylated
[32P]-ATP
T4 polynucleotide kinase
Streptavidin paramagnetic beads (Dynabeads M280 streptavidin) (Life Technologies, Invitrogen™, catalog number: 112.06D )
Glucose
Hexokinase (Calbiochem, catalog number: 376811 )
PBS
Triethanolamine
Magnesium acetate
Dithiothreitol
BSA (e.g. enzymatic restriction reaction grade)
Potassium acetate
EJ buffer (see Recipes)
Equipment
PCR thermal cycler
Scintillation counter
Heat block (Eppendorf Thermomixer® comfort)
Procedure
First, PCR is used to synthesize a ~500 bp dsDNA fragment (e.g. from pBluescript plasmid) with a non-biotinylated or biotinylated reverse primer and a non-biotinylated forward primer, producing a fragment biotinylated at one end (500 bio) or not. The non biotinylated fragment was then radiolabeled with T4 polynucleotide kinase in the presence of [32P]-ATP (500*).
Next, beads associated with biotinylated DNA fragments were prepared: per point, 0.5 pmol of 500 bio dsDNA fragment were immobilized on 10 μl streptavidin paramagnetic beads as recommended by the manufacturer.
In parallel, NHEJ competent cells extracts from human cells were used (Bombarde et al., 2010). Briefly, exponentially growing cells were lysed through three freeze/thaw cycles in lysis buffer containing protease and phosphatase inhibitor cocktail, then lysates were incubated at 4 °C for 20 min, cleared by centrifugation, and dialyzed against dialysis buffer as described (Bombarde et al., 2010). Protein concentration was determined using the Bradford assay and end-joining extracts were stored at -80 °C. Here, 40 μg extracts were incubated for 10 min at 30 °C with 2 mM glucose and 0.2 U hexokinase. Glucose and hexokinase is an ATP consuming system used to prevent any ligation activity (Calsou et al., 2003).
Note: DNA end-synapsis is an early step of NHEJ which relies on protein/DNA interactions and is reversible (e.g. by washing with high salts or detergent) while ligation is the final step and is irreversible (resistant to harsh washes). Ligation has to be prevented to focus the analysis on synapsis.
10 μl of mocked (control) or DNA-treated beads were washed twice in 100 μl of 0.5x PBS.
Wet mocked or DNA-treated beads were mixed at 16 °C for 30 min in 10 μl EJ buffer containing 0.1 pmol of radioactive 500* DNA fragment and 40 μg of NHEJ competent cell extracts pre-incubated as above. The beads were gently hand-agitated by every 5 min.
After incubation, supernatant was removed for storage and wet beads were washed twice in 50 μl 0.5x PBS.
The washes were pooled with the supernatant.
Radioactivity associated with supernatants and beads were measured in a scintillation counter.
Results are expressed as the % of radioactivity pulled down after subtraction of the counts in the sample without 500 bio on the beads (Figure 1).
Figure 1. Quantification of the specific radioactivity pulled-down under synapsis conditions in vitro with extracts of Nalm6 or N114 cells. N114 cells have a defect in Lig4 expression which impacts on synapsis formation.
Recipes
EJ buffer
50 mM Triethanolamine (pH 8.0)
0.5 mM magnesium acetate
1 mM dithiothreitol
0.1 mg/ml BSA
60 mM potassium acetate
Acknowledgments
The end-synapsis protocol was adapted from a reported assay (DeFazio et al., 2002) This work was partly supported by grants from La Ligue Nationale Contre le Cancer (Equipe labellisée), Electricité de France (EDF, Conseil de Radioprotection) and the Institut National Contre le Cancer (XXL-screen program). J. Cottarel was supported by a PhD fellowship from La Ligue Nationale Contre le Cancer. P. Calsou is a scientist from INSERM, France.
References
Bombarde, O., Boby, C., Gomez, D., Frit, P., Giraud-Panis, M. J., Gilson, E., Salles, B. and Calsou, P. (2010). TRF2/RAP1 and DNA-PK mediate a double protection against joining at telomeric ends. EMBO J 29(9): 1573-1584.
Calsou, P., Delteil, C., Frit, P., Drouet, J. and Salles, B. (2003). Coordinated assembly of Ku and p460 subunits of the DNA-dependent protein kinase on DNA ends is necessary for XRCC4-ligase IV recruitment. J Mol Biol 326(1): 93-103.
Cottarel, J., Frit, P., Bombarde, O., Salles, B., Negrel, A., Bernard, S., Jeggo, P. A., Lieber, M. R., Modesti, M. and Calsou, P. (2013). A noncatalytic function of the ligation complex during nonhomologous end joining. J Cell Biol 200(2): 173-186.
DeFazio, L. G., Stansel, R. M., Griffith, J. D. and Chu, G. (2002). Synapsis of DNA ends by DNA-dependent protein kinase. EMBO J 21(12): 3192-3200.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cancer Biology > General technique > Biochemical assays
Cancer Biology > Genome instability & mutation > Biochemical assays
Molecular Biology > DNA > DNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Homologous Recombination Assay
Yvan Canitrot and Didier Trouche
Sep 20, 2013 18072 Views
Nucleosome Positioning Assay
Zhongliang Zhao and Holger Bierhoff
May 20, 2017 11067 Views
SMART (Single Molecule Analysis of Resection Tracks) Technique for Assessing DNA end-Resection in Response to DNA Damage
Angela Altieri [...] Alfano Luigi
Aug 5, 2020 4425 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
901 | https://bio-protocol.org/en/bpdetail?id=901&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chromatin Immunoprecipitation (ChIP), Streptavidin and ATP-agarose Mediated Pull-down Analyses
CL Cheng-Der Liu
YC Ya-Lin Chen
YM Yi-Ly Min
BZ Bo Zhao
CC Chi-Ping Cheng
MK Myung-Soo Kang
SC Shu-Jun Chiu
EK Elliott Kieff
Chih-Wen Peng
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.901 Views: 14372
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Dec 2012
Abstract
Epstein-Barr virus (EBV) nuclear antigen 2 (EBNA2) induces expression of both viral and cellular genes in virus infected B cells by mimicking activated Notch receptors (Notch-IC) that mediate transcription activation through binding to the repressing domain of the recombining binding protein suppressor of hairless (RBP-Jκ). In general, chromatin immunoprecipitation (ChIP) assays, electrophoresis mobility shift assays (EMSA), streptavidin-agarose mediated DNA pull-down assays, together with cell-based transcription reporter assays were conducted to verify whether the query protein is involved in EBNA2-dependent transcription. The ATP-bound state of nuclear chaperone nucleophosmin (NPM1) has been implicated in pleiotropic biological processes. An ATP-agarose-mediated pull-down protocol was developed to monitor the formation of the pre-initiation complex that is induced by ATP-bound NPM1. According to EBNA2 and Notch-IC have been shown to be partially interchangeable with respect to activation of target genes in B cell lines, it is conceivable that EBNA2 is a biological equivalent of an activated Notch IC.
Part I: ATP Depletion
Materials and Reagents
Glucose (-) RPMI 1640 (Life Technologies, catalog number: 11879020 )
10% Fetal Calf Serum (Life Technologies, Gibco®)
Penicillin/streptomycin (Life Technologies, catalog number: 15140-122 )
Glutamine (Life Technologies, catalog number: 25030-081 )
Deoxyglucose (Sigma-Aldrich, catalog number: D6134 )
Antimycin A (Sigma-Aldrich, catalog number: A8674 )
RPMI 1640 (Life Technologies, catalog number: 31800089 )
ATP depletion medium (see Recipes)
Culture medium for IB4 LCL (see Recipes)
Equipment
CO2 incubator (Thermo Fisher Scientific Forma CO2 incubator)
Centrifuge (Eppendorf, model: 5810R )
Procedure
Pellet 5 x 106 of lymphoblastoid cells and replenish with 5 ml of ATP-depletion medium.
Incubate cells at CO2 incubator (37 °C) for two hours.
Collect cells by spin at 1,050 rpm (220 x g; Eppendorf 5810R) for 5 min.
Wash cells twice with 1x PBS and save for further experimental purpose.
Recipes
ATP depletion medium
Glucose (-) RPMI 1640 was supplemented with:
10% Fetal Calf Serum
100 U/ml Penicillin/100 μg/ml streptomycin
2 mM Glutamine
2 mM deoxyglucose
300 nM antimycin A
Culture medium for IB4 LCL
RPMI 1640 was supplemented with:
10% Fetal Calf Serum
100 U/ml Penicillin/100 μg/ml streptomycin
2 mM Glutamine
References
Liu, C. D., Chen, Y. L., Min, Y. L., Zhao, B., Cheng, C. P., Kang, M. S., Chiu, S. J., Kieff, E. and Peng, C. W. (2012). The nuclear chaperone nucleophosmin escorts an Epstein-Barr Virus nuclear antigen to establish transcriptional cascades for latent infection in human B cells. PLoS Pathog 8(12): e1003084.
Part II: Streptavidin-agarose Mediated DNA Pull-down Assay
Materials and Reagents
DNA template (In this case: LMP1 promoter reporter plasmid)
Note: Transcription of LMP1 promoter is essential for EBV latent infection.
Biotin-labeled primers (Vita Genomics)
IB4 lymphoblastoid cells (LCL)
DNA elution column (Geneaid Biotech)
Streptavidin-conjugated agarose (Life Technologies, catalog number: SA100-04 )
2x SDS sample buffer
NP-40 (Sigma-Aldrich, catalog number: I8896 )
Pepstatin A (Sigma-Aldrich, catalog number: P5318 )
Aprotinin (Sigma-Aldrich, catalog number: A1153 )
Leupeptin (Sigma-Aldrich, catalog number: L2884 )
Phenylmethanesulfonyl fluoride (Sigma-Aldrich, catalog number: P7626 )
Lysis buffer (see Recipes)
Protease inhibitors (see Recipes)
Equipment
PCR product elution column (Geneaid Biotech)
Centrifuge (Eppendorf, model: 5810R )
Centrifuge (Eppendorf, model: 5415R )
Rocker (Tube rotator)
PCR machine (MJ Research, model: PTC 200 Thermal Cycler )
Gel electrophoresis equipment (Embi Tec, model: RunOneTM Electrophoresis System )
Western blot equipment (Bio-Rad, model: Mini-protean 3 )
Procedure
Amplify the biotin or non-biotin labeled DNA fragments of the query promoter in a 100 μl reaction volume by PCR.
Elute PCR product by passing through an elution column with 100 μl elution buffer and take 5 μl DNA (5% input DNA) for performing gel electrophoresis.
Take 1 x 107 lymphoblastoid cells to be lysed with 1 ml of lysis buffer, put the reaction tubes on a rocker and incubate at 4 °C for 1 h. Collect supernatant by spining at 13,200 rpm (16,100 x g; Eppendorf 5415R), 4 °C.
Add desired biotin-labelled or non-biotin-labelled DNA to supernatant and put tubes onto the rocker and incubate at 4 °C for another hour.
Add 40 μl streptavidin-conjugated agarose to each tube and put the tubes onto the rocker again, and wait for 30 min to allow the affinity binding of streptavidin with biotin to complete.
Harvest biotin-labelled DNA by spining at 1,050 rpm (220 x g; Eppendorf 5810R), 4 °C for 5 min.
Wash the collected streptavidin-conjugated agarose beads with 500 μl lysis buffer five times and add 40 μl 2x SDS sample buffer to each sample and use them for western blot analysis.
Recipes
Lysis buffer (for 1 L)
1% NP-40
2 mM EDTA
10% Glycerol
50 mM Tris-HCl
150 mM NaCl
Protease inhibitors
1 μg/ml Pepstatin A
1 μg/ml Aprotinin
1 μg/ml Leupeptin
0.5 mM Phenylmethanesulfonyl fluoride
*Lysis buffer is supplemented with the indicated protease inhibitors
References
Liu, C. D., Chen, Y. L., Min, Y. L., Zhao, B., Cheng, C. P., Kang, M. S., Chiu, S. J., Kieff, E. and Peng, C. W. (2012). The nuclear chaperone nucleophosmin escorts an Epstein-Barr Virus nuclear antigen to establish transcriptional cascades for latent infection in human B cells. PLoS Pathog 8(12): e1003084.
Part III: ATP-agarose Mediated Pull-down Analyses
Materials and Reagents
IB4 LCL cells
Adenosine 5′-triphosphate-Agarose (Sigma-Aldrich, catalog number: A2767-1 ml )
2x SDS sample buffer
Glucose (-) RPMI 1640 (Life Technologies, catalog number: 11879020 )
Fetal Calf Serum (Life Technologies, Gibco®)
Penicillin/streptomycin (Life Technologies, catalog number: 15140-122 )
Deoxyglucose (Sigma-Aldrich, catalog number: D6134 )
Antimycin A (Sigma-Aldrich, catalog number: A8674 )
RPMI 1640 (Life Technologies, catalog number: 31800089 )
Glutamine (Life Technologies, catalog number: 25030-081 )
Pepstatin A (Sigma-Aldrich, catalog number: P5318 )
Aprotinin (Sigma-Aldrich, catalog number: A1153 )
Leupeptin (Sigma-Aldrich, catalog number: L2884 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
ATP-depletion culture medium (see Recipes)
Lysis buffer (see Recipes)
Protease inhibitor cocktail (see Recipes)
Culture medium for IB4 LCL (see Recipes)
Equipment
CO2 incubator
Centrifuge (Eppendorf, model: 5415D )
Centrifuge (Eppendorf, model: 5810R )
Centrifuge (Eppendorf, model: 5415R )
Rocker
Western blot equipment (Bio-Rad Laboratories)
Procedure
Collect 1 x 107 of IB4 LCL cells by spin at 1,050 rpm (220 x g; Eppendorf 5810R) and replenish with 5 ml of ATP-depletion culture medium and incubate at CO2 incubator (37 °C) for 2 h.
Harvest cells and wash them twice with 1x PBS.
Lyse cells in 0.5 ml of lysis buffer and put the reaction tubes on a rocker and incubate at 4 °C for 1 h. Collect supernatant (cellular proteins) by spining at 13,200 rpm (16,100 x g; Eppendorf 5415R), 4 °C for 10 min.
Add 50 μl ATP-agarose to pull down cellular protein by sitting on a rocker and incubate at 4 °C for 4 hours.
Collect ATP-agarose beads by spining at 5,000 rpm (2,300 x g; Eppendorf 5415R) for 1 min and wash beads with lysis buffer five times.
Add 40 μl 2x SDS sample buffer to each collected pull-down sample.
Identify the ATP-bound proteins by western blot analysis.
Recipes
Lysis buffer (for 1 L)
1% NP-40
2 mM EDTA
10% Glycerol
50 mM Tris-HCl
150 mM NaCl
Protease inhibitors
1 μg/ml Pepstatin A
1 μg/ml Aprotinin
1 μg/ml Leupeptin
0.5 mM Phenylmethanesulfonyl fluoride
*Lysis buffer is supplemented with the indicated protease inhibitors
ATP-depletion culture medium
Glucose (-) RPMI 1640 was supplemented with:
10% Fetal Calf Serum
100 U/ml Penicillin/100 μg/ml streptomycin
2 mM Glutamine
2 mM deoxyglucose
300 nM antimycin A
Culture medium for IB4 LCL
RPMI 1640 was supplemented with:
10% Fetal Calf Serum
100 U/ml Penicillin/100 μg/ml streptomycin
2 mM Glutamine
References
Liu, C. D., Chen, Y. L., Min, Y. L., Zhao, B., Cheng, C. P., Kang, M. S., Chiu, S. J., Kieff, E. and Peng, C. W. (2012). The nuclear chaperone nucleophosmin escorts an Epstein-Barr Virus nuclear antigen to establish transcriptional cascades for latent infection in human B cells. PLoS Pathog 8(12): e1003084.
Part IV: Chromatin Immunoprecipitation (ChIP) Assay
Materials and Reagents
ATP-depleted Lymphoblastoid cells
IB4 LCL cells (Lymphoblastoid cell lines)
36.5% Formadehyde (Sigma-Aldrich, catalog number: F8775 )
Glycerol (Sigma-Aldrich, catalog number: F8775 )
EDTA (Sigma-Aldrich, catalog number: EDS )
Chromatin Shearing Kit (Active Motif)
DNA nuclease (Active Motif)
Enzyme digestion buffer (Active Motif)
Protein A/G agarose (EMD Millipore, catalog number: IP10-10ML )
Primary antibodies (Ab1, Ab2 and H3-Ac)
In this case:
Ab1: EBV nuclear antigen 2 specific antibody (e.g. Abcam, catalog number: ab49498 )
Ab2: Nucleophosmin antibody (5E3) (Santa Cruz, catalog number: sc-53926 )
Ab3: H3-acetylated antibody (H3-Ac) (EMD Millipore, catalog number: 06599 )
IgG (Dako, catalog number: A0424 )
TE buffer
1 M Tris-HCl
Proteinase K (Life Technologies, catalog number: 25530049 )
Glucose (-) RPMI 1640 (Life Technologies, catalog number: 11879020 )
RPMI 1640 (Life Technologies, catalog number: 31800089 )
Fetal Calf Serum (Life Technologies, Gibco®)
Penicillin/streptomycin (Life Technologies, catalog number: 15140-122 )
Glutamine (Life Technologies, catalog number: 25030-081 )
Deoxyglucose (Sigma-Aldrich, catalog number: D6134 )
Antimycin A (Sigma-Aldrich, catalog number: A8674 )
ChIP lysis buffer (see Recipes)
10x Glycine (see Recipes)
ChIP dilution buffer (see Recipes)
Low Salt Immune Complex Wash Buffer (see Recipes)
High Salt Immune Complex Wash Buffer (see Recipes)
LiCl Immune Complex Wash Buffer (see Recipes)
Elution buffer (see Recipes)
ATP depletion medium (see Recipes)
Culture medium for IB4 LCL (see Recipes)
Enzyme solution (see Recipes)
Protease inhibitors (see Recipes)
Equipment
DNA spin column (Geneaid Biotech)
Douncer apparatus (Tissue grinder) (Thomas scientific)
Centrifuge (Eppendorf, model: 5810R )
Centrifuge (Eppendorf, model: 5415R )
Centrifuge (Eppendorf, model: 5415D )
Rocker (Fisher scientific, model: 05-450-200 )
1.7 ml cryptal vial
Bench top mini centrifuge (Thermo Fisher Scientific)
Illumina Eco Real Time PCR system
Procedure
Take 2 x 106 of ATP-depleted or regular IB4 LCL cells and replenish with 10 ml of ATP-depletion or regular culture medium.
Add 274 μl of 36.5% formaldehyde to 10 ml of cells to make the final concentration as 1% and wait 10 min to allow cross link reaction to complete at room temperature.
Add 1 ml of 10x glycine to 10 ml of cells to quench unreacted formaldehyde and swirl gently and incubate at room temperature for 5 min.
Pellet cells at 2,000 rpm (400 x g; Eppendorf 5415D) for 5 min then aspirate supernatant and wash cells twice with 1 ml ice-cold 1x PBS. Finally, add 1 ml ice-cold ChIP lysis buffer and sit on ice for 30 min.
Break down cells on ice by using a douncer homogenizer with 10 strokes and transfer whole cell lysate to a 1.7 ml cryptal vial. Collect nuclei by spin at 2,300 x g for 5 min. After removal of supernatant, resuspend the isolated nuclei with 260 μl digestion buffer (prewarm at 37 °C for 5 min prior to use).
Add 12.5 μl of enzyme solution and allow enzyme digestion at room temperature for 15 min.
Add 20 μl ice-cold EDTA to stop the reaction and pellet the digested chromatins by spining at 13,200 rpm (16,100 x g; Eppendorf 5415R), 4 °C for 10 min. The digested chromatins will be retained in supernatant (around 300 μl: can be applied for up to 5 IP) and cell debris will be left in pellet. Please keep 50 μl of supernatant as input of chromatin DNA.
Aliquot 50 μl of supernatant into 3 new tubes [3 IP: Ab1, Ab2/H3-Ac (positive control), and IgG], and refill each sample with 950 μl ChIP dilution buffer to make a 1 ml volume. Add 20 μl Protein A/G agarose to preclean the non-specifically bound chromatins by sitting on a rocker for 1 h at 4 °C.
After removal of the preclean protein A/G agarose, add 3 μg of the desire Ab1 (in this case PE2), Ab2 for H3-Aceylated (positive control), or IgG (negative control) to the digested chromatins and immunoprecipitation will be carried out by sitting the ChIP samples on a rocker for 4 h at 4 °C.
Note: Up to 5 IP is allowed.
Add 30 μl Protein A/G agarose to each ChIP sample and allow additional 2 h of reaction at 4 °C. Collect protein A/G agarose by a brief centrifugation using a bench top mini centrifuge.
Wash protein A/G agarose with 1 ml of ice-cold low salt immune complex wash buffer once, 1 ml of ice-cold high salt immune complex wash buffer once, 1 ml of ice-cold LiCl immune complex wash buffer once, and 1 ml of ice-cold TE buffer twice.
Apply 200 μl elution buffer (freshly prepared) for each collected protein A/G agarose sample in order to elute protein by vortexting and incubating at room temperature for 15 min. 200 μl eluent will be obtained for each IP reaction after a brief spin.
Add 8 μl 5 M NaCl to each eluent and incubate at 65 °C from 4 h to overnight to reverse the crosslinking. At this step, the samples can be stored at -20 °C or continue to proceed to the next step.
Add 4 μl 0.5 M EDTA, 8 μl 1 M Tris-HCl, and 1 μl Proteinase K (10 μg/μl) to each sample and incubate at 45 °C for 2 h.
Isolate DNA by using spin columns.
Amounts of DNA will be quantified by performing real time PCR analysis. 5% input DNA will be used as the internal control.
Recipes
ChIP lysis buffer
20 mM Tris-HCl (pH 8.0)
85 mM KCl
0.5% NP40
Note: Need to add protease inhibitors prior to use.
10x Glycine
1.25 M glycine
ChIP dilution buffer
0.01% SDS
1.1% Triton X-100
1.2 mM EDTA
1.67 mM Tris-HCl (pH 8.1)
167 mM NaCl
Low Salt Immune Complex Wash Buffer
0.1% SDS
1% Triton X-100
2 mM EDTA
20 mM Tris-HCl (pH 8.1)
150 mM NaCl
High Salt Immune Complex Wash Buffer
0.1% SDS
1% Triton X-100
2 mM EDTA
20 mM Tris-HCl (pH 8.1)
500 mM NaCl
LiCl Immune Complex Wash Buffer
0.25 M LiCl
1% IGEPAL-CA630
1% deoxycholic acid (sodium salt)
1 mM EDTA
10 mM Tris-HCl (pH 8.1)
Elution buffer
1% SDS
100 mM NaHCO3
ATP depletion medium
Glucose (-) RPMI 1640 was supplemented with:
10% Fetal
Calf Serum
100 U/ml Penicillin/100 μg/ml streptomycin
2 mM Glutamine
2 mM deoxyglucose
300 nM antimycin A
Culture medium for IB4 LCL
RPMI 1640 was supplemented with:
10% Fetal Calf Serum
100 U/ml Penicillin/100 μg/ml streptomycin
2 mM Glutamine
Enzyme solution
0.125 μl Enzyme stock plus 12.375 μl Glycerol
Protease inhibitors
1 μg/ml Pepstatin A
1 μg/ml Aprotinin
1 μg/ml Leupeptin
0.5 mM Phenylmethanesulfonyl fluoride
*Lysis buffer is supplemented with the indicated protease inhibitors
Acknowledgments
This protocol is adapted from Liu et al. (2012).
References
Chen, Y. L., Tsai, H. L. and Peng, C. W. (2012). EGCG debilitates the persistence of EBV latency by reducing the DNA binding potency of nuclear antigen 1. Biochem Biophys Res Commun 417(3): 1093-1099.
Liu, C. D., Chen, Y. L., Min, Y. L., Zhao, B., Cheng, C. P., Kang, M. S., Chiu, S. J., Kieff, E. and Peng, C. W. (2012). The nuclear chaperone nucleophosmin escorts an Epstein-Barr Virus nuclear antigen to establish transcriptional cascades for latent infection in human B cells. PLoS Pathog 8(12): e1003084.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Liu, C., Chen, Y., Min, Y., Zhao, B., Cheng, C., Kang, M., Chiu, S., Kieff, E. and Peng, C. (2013). Chromatin Immunoprecipitation (ChIP), Streptavidin and ATP-agarose Mediated Pull-down Analyses. Bio-protocol 3(18): e901. DOI: 10.21769/BioProtoc.901.
Liu, C. D., Chen, Y. L., Min, Y. L., Zhao, B., Cheng, C. P., Kang, M. S., Chiu, S. J., Kieff, E. and Peng, C. W. (2012). The nuclear chaperone nucleophosmin escorts an Epstein-Barr Virus nuclear antigen to establish transcriptional cascades for latent infection in human B cells. PLoS Pathog 8(12): e1003084.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA-protein interaction
Biochemistry > Protein > Immunodetection > ChIP
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
902 | https://bio-protocol.org/en/bpdetail?id=902&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Choline Uptake Assay in Bacterial Cells
LB Lucas Bukata
CH Claudia K. Herrmann
Diego J. Comerci
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.902 Views: 10187
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Bacteriology Feb 2013
Abstract
Choline is a methylated nitrogen compound that is widespread in nature. It is a precursor of several metabolites that perform numerous biological functions and it is predominantly used for the synthesis of essential lipid components of the cell membranes. Since there is no evidence that prokariotes can synthesize choline de novo and because choline uptake from exogenous sources is energetically more favorable than de novo synthesis, bacteria have evolved different uptake mechanisms for choline transport across the bacterial membrane. This protocol describes an easy and high sensitive method to assess choline uptake in bacteria using as tracer [3H]-choline chloride. The protocol was originally intended for Brucella abortus but could be applied for any bacteria with the corresponding modifications depending on the bacteria growth requirements (composition of the culture medium, temperature for growth, etc.). It can be useful to determine the choline uptake ability of several bacterial species under different growth conditions.
Keywords: Choline Uptake assay Choline transporter Brucella Brucellosis
Materials and Reagents
Brucella abortus or the bacteria species you want to test
Minimal medium (MM) such as M9 or equivalent
In the case of Brucella abortus we use Gerhardt-Wilson (GW) minimum medium (Gerhardt, 1958)
Choline Chloride ([Methyl-3H]-, 250 μCi (9.25 MBq)) (PerkingElmer, catalog number: NET109250UC )
[3H]-choline/cold choline chloride (1:100)
Liquid Scintillation (liquid Optiphase HISAFE 3) (PerkingElmer, catalog number: 1200-437 )
Equipment
Microplate reader or Spectrophotometer
Liquid scintillation spectrometer (Gemini BV, model: WinSpectralTM 1414)
Procedure
For radioactive choline uptake analyses, cultures of bacteria grown in an appropriate minimal medium (MM) at mid log phase were harvested, washed three times with ice-chilled MM and adjusted to an optical density at 600 nm (OD600) of 0.5 with fresh MM.
Note: Bacterial culture is harvested at OD600= 1-1.2 that correspond to a mid log phase for Brucella under this growth conditions.
Reactions were initiated by addition of [3H]-choline chloride (80.6 Ci/mmol) to a final concentration of 3.3 μM, incubated at 37 °C and aliquots (around 300 μl) were taken at different time points (0 to 30 min).
Samples were immediately chilled on ice, washed five times with the same volume of ice-chilled MM, centrifuged at 10,000 x g, 15 min at 4 °C and cell pellets were resuspended in 500 μl of scintillation liquid.
The radioactivity in the cell pellet was determined with a liquid scintillation spectrometer.
To assess uptake kinetics at different choline concentrations, bacteria were incubated 7 min at 37 °C in MM with a mix of [3H]-choline/cold choline (1:100) ranging from 6.25 x 10-2 μM to 64 μM (total choline concentration) and incorporated radioactivity in the cell pellet was determined as describe above.
Acknowledgments
This protocol was adapted from Herrmann et al. (2013).
References
Gerhardt, P. (1958). The nutrition of brucellae. Bacteriol Rev 22(2):81-98.
Herrmann, C. K., Bukata, L., Melli, L., Marchesini, M. I., Caramelo, J. J. and Comerci, D. J. (2013). Identification and characterization of a high-affinity choline uptake system of Brucella abortus. J Bacteriol 195(3): 493-501.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Bukata, L., Herrmann, C. K. and Comerci, D. J. (2013). Choline Uptake Assay in Bacterial Cells . Bio-protocol 3(18): e902. DOI: 10.21769/BioProtoc.902.
Download Citation in RIS Format
Category
Microbiology > Microbial metabolism > Nutrient transport
Cell Biology > Cell-based analysis > Transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Measurement of Proton-driven Antiport in Escherichia coli
Scarlett R. Holdsworth and Christopher J. Law
Nov 5, 2014 8708 Views
Determination of Mn Concentrations in Synechocystis sp. PCC6803 Using ICP-MS
Fabian Brandenburg [...] Marion Eisenhut
Dec 5, 2017 7490 Views
Quantification of Hydrogen Sulfide and Cysteine Excreted by Bacterial Cells
Sergey Korshunov and James A. Imlay
May 20, 2018 6056 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
903 | https://bio-protocol.org/en/bpdetail?id=903&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolating RNA from the Soil
JC Jacqueline M Chaparro
JV Jorge M Vivanco
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.903 Views: 11481
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS ONE Feb 2013
Abstract
Next generation sequencing has allowed for the analysis and ability to identify the microbial communities present in the environment. While DNA extraction from environments (such as soil) have provided a wealth of knowledge regarding microbial communities there are drawbacks that one encounters when using DNA as opposed to RNA. RNA allows for the determination of the identity of the microbes that are active and present at a particular time point and thus gives a clear picture of what these microbes are actually doing at a specific point in time and under a set of conditions. Extracting RNA from soil is challenging due to the inherent inhibitors present in the soil such as humic acids. Here we describe modifications to the MoBio RNA PowerSoilTM total RNA isolation kit to reproducively extract total RNA from the soil.
Materials and Reagents
Fresh soil or soil stored at -80 °C
RNA PowerSoilTM Total RNA Isolation Kit (MO BIO Laboratories, catalog number: 12866-25 )
Phenol/Chloroform/Isoamyl Alcohol 25:24:1 (pH 6.7) (Thermo Fisher Scientific, catalog number: BP1752l-400 )
Diethyl pyrocarbonate (DEPC) (Sigma-Aldrich, catalog number: D5758-50mL )
RNase AWAY® (VWR International, catalog number: 72830-022 )
Disposable Gloves
Ice
DEPC water (see Recipes) or nuclease-free water
Equipment
Fisher Vortex Genie 2 (VWR International, model: 12-812 )
Centrifuge (Sorvall® SuperT21 rotor SL-50T) (for 15 ml centrifuge tubes)
Microcentrifuge (VWR International, model: Galaxy 16 )
Shaker (New Brunswick Scientific, model: G-33 )
Incubator set at 45 °C
5 ml Borosilicated Glass pipette (VWR International, model: 53281-818 )
1,000 μl pipetman
200 μl pipetman
2.5 μl pipetman
-20 °C Freezer
4 °C Incubator
Microcentrifuge Tube Rack (VWR International, model: CBGTR-080 )
15 ml falcon tube holder
Laboratory labeling tape (VWR International, catalog number: 89097-902 )
Spectrophotometer (e.g. Thermo Scientific, model: NanoDrop ND-1000 )
Procedure
Note: Use disposable gloves throughout the protocol and change gloves frequently. Spray gloves with RNase Away to remove RNases from your gloves. You can also use a mouth shield to reduce contaminating your sample with RNase.
Protocol is adapted from RNA PowerSoilTM Total RNA Isolation Kit version 02162010.
RNA Isolation
Make DEPC water at least 2 days prior to use.
On the day of your soil RNA extraction make sure to clean your work bench with RNase Away. This includes all pipetman and stands.
Set out the bead tubes from the RNA PowerSoilTM Total RNA Isolation Kit and add the frozen soil that was stored at -80 °C.
Add 2.5 ml of Bead solution to the bead tube and mix solution by vortexing.
Add 0.25 ml of solution labelled SR1 to the bead tube and mix the solution by vortexing.
Note: Solution at this point should look fairly homogenous and have a muddy consistency.
Add 0.8 ml of solution labelled SR22 to the bead tube and mix the solution by vortexing.
Place tube horizontally on the vortexer and use laboratory label tape to secure the tube on the vortexer.
Vortex tube at maximum speed for 30 min (step modified from original protocol in order to more readily and efficiently remove non-DNA material that would interfere with RNA isolation and lyse cells).
Remove laboratory label tape from the tube and vortexer and place tube in the stand.
Using the 5 ml borosilicated glass pipet add 3.5 ml of phenol: chloroform: isoamyl alcohol, pH 6.7 and mix solution by inverting up and down 10 times.
Secure tube horizontally on a shaker and shake solution for 30 min at 200 rpm (step modified from original protocol in order to prevent RNA shearing that would affect RNA integrity and concentration).
Remove bead tube from the shaker and centrifuge at room temperature for 10 min at 2,500 x g.
Transfer the aqueous (upper) layer using a 1,000 μl pipetman to a new clean 15 ml falcon tube provided in the RNA PowerSoilTM Total RNA Isolation Kit. Ensure that you only take the top layer and it may be best to leave behind some of the aqueous layer to ensure no interphase or lower layer is transferred.
Add 1.5 ml of solution labelled SR3 to the new tube containing the upper aqueous phase. Close tube and invert 10 times.
Incubate the tube for 10 min at 4 °C.
Centrifuge tube at room temperature for 10 min at 2,500 x g.
Sometimes a pellet is formed after this step thus just in case transfer the supernatant to a new 15 ml falcon tube provided using a 1,000 μl pipetman.
Using a 5 ml borosilicated glass pipet transfer 5 ml of solution SR4 to the new collection tube. Close tube and invert 10 times.
Incubate tube at -20 °C for 30 min.
Centrifuge tube at room temperature for 30 min at 2,500 x g.
Decant the supernatant.
Re-centrifuge the tubes at room temperature for 5 min at 2,500 x g.
Using a 1,000 μl pipetman remove any remaining supernatant trying not to disturb the pellet.
Allow tubes to dry for 5 min.
Note: Pellet may be white, gray or light brown in color.
RNA purification
Shake solution SR5.
Once pellet has dried add 1 ml of solution SR5 to the tube and mix by inverting and shaking solution.
If pellet has not dissolved in solution SR5 incubate at 45 °C and check on the tube every 2 min and shake solution.
Repeat until pellet has dissolved in solution SR5.
Note: Solution may be clear or tan in color.
After pellet has dissolved place one RNA capture column in a new 15 ml falcon tube provided.
Shake solution SR5 and add 2 ml of solution SR5 to the RNA capture column.
Allow solution SR5 to gravity flow through the column.
Once solution SR5 has reached the top of the resin in the column add the dissolved pellet to the column and allow it to gravity flow through the column.
Once the dissolved pellet has reached the top of the column resin shake solution SR5 and add 1 ml of solution SR5 to the column and allow it to gravity flow through the column.
Once solution SR5 has reached the top of the column resin, shake solution SR6 and add 1 ml to the column.
Immediately transfer the column to a new 15 ml falcon tube.
Allow solution SR6 to flow through the column.
Transfer the eluted RNA to a 2.2 ml collection tube provided in the kit.
Add 1 ml of solution SR4 to the 2.2 ml collection tube and invert tube to mix 10 times.
Incubate tube at -20 °C for 20 min.
Centrifuge the tube at 4 °C for 15 min at 13,000 x g.
You should be able to see a pellet on the side of your tube. The pellet may be white or tan in color.
Decant the supernatant.
Centrifuge the tube at 4 °C for 5 min at 13,000 x g.
Using a 200 μl pipetman carefully without touching the pellet remove the remaining supernatant from the tube.
Allow the tube to dry in air for 5 min.
Evaluation of RNA samples
Re-suspend the RNA pellet in 30 μl of solution SR7.
Place collection tube on ice.
Determine concentration of RNA using a spectrophotometer for RNA concentration can also monitor A260/280 to determine RNA integrity (if A260/280 between 1.8-2.0 RNA is of good quality for further downstream applications).
Check RNA integrity via the use of an agarose gel.
Recipes
DEPC Water
Add 1 ml of diethyl pyrocarbonate per liter of Millipore water
Stir solution overnight
Autoclave solution for 30 min in liquid cycle
Let solution cool to room temperature
Store at room temperature
Acknowledgments
Work was supported by a grant from the National Science Foundation to J.M.V. (MCB-0950857).
References
Chaparro, J. M., Badri, D. V., Bakker, M. G., Sugiyama, A., Manter, D. K. and Vivanco, J. M. (2013). Root exudation of phytochemicals in Arabidopsis follows specific patterns that are developmentally programmed and correlate with soil microbial functions. PLoS One 8(2): e55731.
MoBio RNA PowerSoil® Total RNA Isolation Kit instruction manual version 02162010
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial genetics > RNA
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
RNA Isolation from Synechocystis
Kirill S. Mironov and Dmitry A. Los
Mar 20, 2015 23141 Views
Purification of Bacterial RNA from Infected Macrophages
Lior Lobel [...] Anat A. Herskovits
Nov 20, 2015 10058 Views
Single Genome Sequencing of Expressed and Proviral HIV-1 Envelope Glycoprotein 120 (gp120) and nef Genes
David J. Nolan [...] Michael S. McGrath
Jun 20, 2017 8779 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
904 | https://bio-protocol.org/en/bpdetail?id=904&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunoprecipitation of ROR1
VB Vincent T. Bicocca
JT Jeffrey W. Tyner
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.904 Views: 7755
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Cell Nov 2012
Abstract
ROR1 is a receptor tyrosine kinase family member studied for its roles in development and cancer. Here we describe a protocol for immunoprecipitation of endogenous ROR1 from t(1;19) (a disease subtype categorized by its chromosome translocation) acute lymphoblastic leukemia immortalized cell lines.
Materials and Reagents
ROR1-positive cells (e.g. RCH-ACV cells, Kasumi-2 cells, 697 cells)
Cell lysis buffer (Cell Signaling Technology, catalog number: 9803 )
Protease inhibitor cocktail (cOmplete Mini EDTA-free) (Roche, catalog number: 04693159001 )
Phosphatase inhibitor cocktail II (Sigma-Aldrich, catalog number: P5726 )
Antibody specific for ROR1 (R&D Systems, catalog number: AF2000 )
Isotype matched control (R&D Systems, catalog number: AB-108-C )
Protein G Agarose beads (EMD Millipore, catalog number: 16-266 )
SDS
BSA
DTT
Equipment
P1000 pipette
Centrifuge
Procedure
107 cells (such as RCH-ACV, Kasumi-2, 697 cells) are pelleted, washed 1x in PBS, pelleted, and thoroughly resuspended in 500 μl ice-cold lyses buffer supplemented with protease inhibitor cocktail and phosphatase inhibitor cocktail II (according to manufacturers’ instruction) using a P1000 pipette.
The lysis reaction is kept on ice and vortexed at max speed 3 times for 3-second bursts. The reaction is kept on ice for 5 min between each vortexing.
Following lysis, samples are centrifuged at max-speed for 15 min at 4 °C.
Following pelleting, the supernatant is transferred to a fresh tube, kept on ice, and subjected to Bradford protein concentration analysis. Lysate is diluted to 2 mg/ml in lysis buffer for IP.
3 μg of antibody specific for ROR1 or an isotype matched control was incubated with cell extracts (500 μl at 2 mg/ml) by rotating overnight.
Protein G Agarose beads were prepared for precipitation by washing twice in lysis buffer and blocking for 1 h (nutating) at 4 °C in lysis buffer containing 0.5% BSA.
Following blocking, beads were pelleted and resuspended in lysis buffer to a 50% slurry, and 40 μl 50% slurry was added to lysate and rocked at 4 °C for 1 h.
Following precipitation, beads were washed in 500 μl lysis buffer 3x by nutating at 4 °C for 20 min.
Proteins were eluted from the beads by boiling in an aqueous solution with 2% SDS and 25 mM DTT.
Acknowledgments
This protocol was adapted from Bicocca et al. (2012).
References
Bicocca, V. T., Chang, B. H., Masouleh, B. K., Muschen, M., Loriaux, M. M., Druker, B. J. and Tyner, J. W. (2012). Crosstalk between ROR1 and the Pre-B cell receptor promotes survival of t(1;19) acute lymphoblastic leukemia. Cancer Cell 22(5): 656-667.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Individual-nucleotide-resolution UV Cross-linking and Immunoprecipitation (iCLIP) of UPF1
David Zünd and Oliver Mühlemann
Apr 5, 2014 14044 Views
RNA-binding Protein Immunoprecipitation (RIP) to Examine AUF1 Binding to Senescence-Associated Secretory Phenotype (SASP) Factor mRNA
Elise Alspach and Sheila A. Stewart
May 20, 2015 14145 Views
Assessing Self-interaction of Mammalian Nuclear Proteins by Co-immunoprecipitation
Claudia Cattoglio [...] Anders S. Hansen
Feb 20, 2020 7245 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
905 | https://bio-protocol.org/en/bpdetail?id=905&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
ROR1 Flow Cytometry
VB Vincent T. Bicocca
JT Jeffrey W. Tyner
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.905 Views: 7794
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Cell Nov 2012
Abstract
ROR1 is a receptor tyrosine kinase family member studied for its roles in development and cancer. Here we describe a protocol for analysis of ROR1 surface expression in acute lymphoblastic leukemia immortalized cell lines by flow cytometry.
Materials and Reagents
Cells (e.g. RCH-ACV cells, Kasumi-2 cells, REH cells, MHH-CALL-2 cells)
FBS
Antibody specific for ROR1 (R&D Systems, catalog number: AF2000 )
Goat IgG (R&D Systems, catalog number: AB-108-C )
Donkey Anti-goat IgG-Phycoerythrin (R&D Systems, catalog number: F0107 )
Equipment
Centrifuge
FACSAria (BD Biosciences)
Procedure
Actively cultured RCH-ACV, Kasumi-2, REH, and MHH-CALL-2 cells were pelleted and washed once in PBS and then resuspended in PBS wash buffer containing 2% FBS (1 million cells in 50 μl of buffer).
1 x 106 cells were immunostained at room temperature for 30 min with 1 μg of antibody specific for ROR1 or Goat IgG (do not need to rotate the reaction).
Cells were washed 3 times with 500 μl PBS wash buffer.
Cells were stained with Donkey Anti-goat IgG-Phycoerythrin (10 μl Donkey Anti-goat IgG-Phycoerythrin is diluted into 90 μl PBS wash buffer). Incubate at room temperature in the dark for 15 min.
Samples are washed 1x with 500 μl PBS wash buffer and then resuspended in 200 μl PBS wash buffer for analysis.
Samples were analyzed on a BD FACSAria.
Acknowledgments
This protocol was adapted from Bicocca et al. (2012).
References
Bicocca, V. T., Chang, B. H., Masouleh, B. K., Muschen, M., Loriaux, M. M., Druker, B. J. and Tyner, J. W. (2012). Crosstalk between ROR1 and the Pre-B cell receptor promotes survival of t(1;19) acute lymphoblastic leukemia. Cancer Cell 22(5): 656-667.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Bicocca, V. T. and Tyner, J. W. (2013). ROR1 Flow Cytometry. Bio-protocol 3(18): e905. DOI: 10.21769/BioProtoc.905.
Download Citation in RIS Format
Category
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Flow Cytometry Analysis of Microglial Phenotypes in the Murine Brain During Aging and Disease
Jillian E. J. Cox [...] Sarah R. Ocañas
Jun 20, 2024 1048 Views
Quantification of Proliferating and Mitotically Active Retinal Cells in Mice by Flow Cytometry
Hope K. Vanzo-Sparks [...] Cindy L. Linn
Jul 5, 2024 504 Views
Flow-based In Vivo Method to Enumerate Translating Ribosomes and Translation Elongation Rate
Mina O. Seedhom [...] Jonathan W. Yewdell
Jan 20, 2025 1021 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
906 | https://bio-protocol.org/en/bpdetail?id=906&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Enrichment of Golgi membranes from HeLa cells by sucrose gradient ultracentrifugation
JG Josse van Galen
JB Julia von Blume
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.906 Views: 14733
Reviewed by: Lin FangFanglian HeHui Zhu
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Cell Biology Dec 2012
Abstract
This is a protocol to extract intact Golgi Membranes from HeLa cells using sucrose gradient centrifugation. This extraction is very useful for several applications including pull-down of Golgi membrane proteins, electron microscopy and reconstitution of protein transport into an isolated system. Protocol adapted from Balch et al. (1984).
Keywords: Golgi membranes HeLa cells Sucrose gradient cenrifugation
Materials and Reagents
HeLa cells (ATTC, Wesel, Germany)
PBS
1 M Tris (pH 7.4)
100 mM EDTA
Trypan Blue
Protease inhibitor cocktail tablets (Roche, catalog number: 11836153001 )
Breaking buffer (BB) (see Recipes)
29% (w/w) sucrose (see Recipes)
35% (w/w) sucrose (see Recipes)
62% (w/w) sucrose (see Recipes)
Equipment
Cell scrapers
Cell homogenizer (EMBL cell cracker) (EMBLEM Technology Transfer, Heidelberg)
Cell culture microscope
Ultracentrifuge (Beckman Coulter, model: Optima L-100K or equivalent)
Refractometer
SW40Ti rotor
Centrifuge tubes
1 ml syringe with 20/21 G needle
Procedure
Remove medium and wash cells 3x with PBS and 1x with Breaking buffer (BB).
Harvest the cells by scraping and pellet the cells (for instance at 300 x g, 5 min).
Wash pellet 2x in PBS centrifuge cells at 300 x g, 5 min.
Wash 1x in ice-cold BB.
Dilute the pellet 1:5 in ice-cold BB.
Homogenize pellet with an EMBL cell cracker 20x on ice.
Note: Make sure there are no air bubbles during the homogenization.
Mix a few μl of homogenate with a trypan blue solution on a glass slide and cover it with a coverslip. Check homogenization by microscope.
Note: Plasma membrane should not be intact anymore. Cell nuclei should stain blue with Trypan Blue. There should be a lot of membrane fragments and particles in the homogenate, but the nucleus should stay intact.
Mix the homogenate with 62% sucrose
2 ml homogenate
1.83 ml of 62% ice-cold sucrose
41.7 μl of 100 mM EDTA (pH 7.4)
Check the sucrose concentration to 37% +/- 0.5% with a refractometer.
Sucrose gradients: solutions are w/w%.
Check pH of the solutions after dissolving the sucrose.
Run gradient
4 ml homogenate (in 37% sucrose)
4.5 ml 35% sucrose
3.5 ml 29% sucrose (to the top)
Note: Homogenate at the bottom, then add 35% sucrose, then add 29% sucrose.
Centrifugation: SW 40 Ti Rotor, centrifuge for 1.5 h at max speed (x g) at 4 °C.
Pull the Golgi band in 0.4 ml using a 1 ml syringe with 20/21 G needle (the Golgi band is located at the 35%/29% sucrose interphase).
Measure protein concentration and the functional Golgi membranes can now be snap frozen in liquid N2 and stored at -80 °C.
Notes
Avoid salts/ions in the homogenate as it may aggregate the organelles.
Addition of high amount of sucrose affects the pH.
Don’t homogenize too much in step 6 as organelles can break
Proteases can leak out of the lysosomes.
Broken organelles can reseal with other broken organelles.
DNA can be released from nuclei which makes the sample sticky.
The isolated Golgi membranes are in a buffer containing about 30% of sucrose. Therefore, if Golgi membranes need to be pelleted for further analysis, the sucrose needs to be diluted out by addition of 3 volumes of an appropriate buffer such as PBS.
Recipes
Breaking buffer (BB)
250 mM Sucrose
10 mM Tris (pH 7.4)
Add protease inhibitor cocktail tablets
29% (w/w) sucrose
65.08 g sucrose/200 ml
10 mM Tris (pH 7.4)
35% (w/w) sucrose
80.60 g sucrose/200 ml
10 mM Tris (pH 7.4)
62% (w/w) sucrose
161 g sucrose/200 ml
10 mM Tris (pH 7.4)
Note: Check all sucrose solutions with refractometer index and % of sucrose.
Acknowledgments
The protocol was adapted from the original version published by Balch et al. (1984).
References
Balch, W. E., Dunphy, W. G., Braell, W. A. and Rothman, J. E. (1984). Reconstitution of the transport of protein between successive compartments of the Golgi measured by the coupled incorporation of N-acetylglucosamine. Cell 39(2): 405-416.
von Blume, J., Alleaume, A.-M., Kienzle, C., Carreras-Sureda, A., Valverde, M. and Malhotra, V. (2012). Cab45 is required for Ca2+-dependent secretory cargo sorting at the trans-Golgi network. J Cell Biol 199(7): 1057-1066.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Galen, J. V. and Blume, J. V. (2013). Enrichment of Golgi membranes from HeLa cells by sucrose gradient ultracentrifugation. Bio-protocol 3(18): e906. DOI: 10.21769/BioProtoc.906.
von Blume, J., Alleaume, A.-M., Kienzle, C., Carreras-Sureda, A., Valverde, M. and Malhotra, V. (2012). Cab45 is required for Ca2+-dependent secretory cargo sorting at the trans-Golgi network. J Cell Biol 199(7): 1057-1066.
Download Citation in RIS Format
Category
Cell Biology > Organelle isolation > Golgi
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Cell-free Fluorescent Intra-Golgi Retrograde Vesicle Trafficking Assay
Nathanael P. Cottam and Daniel Ungar
Nov 20, 2017 7305 Views
Cell-free Reconstitution of the Packaging of Cargo Proteins into Vesicles at the trans Golgi Network
Xiao Tang [...] Yusong Guo
Mar 5, 2020 3872 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
907 | https://bio-protocol.org/en/bpdetail?id=907&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
iPS Cell Induction from Human Non-T, B cells from Peripheral Blood
KO Keisuke Okita
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.907 Views: 8877
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Stem Cells May 2011
Abstract
The generation of iPS cells gives an opportunity to use patient-specific somatic cells which are a valuable source for disease modeling and drug discovery. To promote these studies, it is important to make iPS cells from easily accessible and less invasive tissues like blood. Here, we describe the basic method to generate human iPS cells from adult peripheral blood. After the isolation of mononuclear cells, a combination of cytokines stimulates the expansion of hematopoietic stem/progenitor population, which is the main target of this protocol. The cells are transduced with plasmid mixture encoding reprogramming factors. In most cases, the plasmids are lost during the establishment of iPS clones.
Materials and Reagents
Fresh anti-coagulated blood (~10 ml)
PBS without Ca2+ and Mg2+ (Nacalai tesque, catalog number: 14249-95 )
Ficoll-paque Plus (GE Healthcare, catalog number: 17-1440-02 )
StemSpan H3000 (STEMCELL Technologies, catalog number: 0 9800 )
Recombinant human Interleukin (IL)-6 (100 μg/ml) (PeproTech, catalog number: AF-200-06 )
Recombinant human Stem Cell Factor (SCF) (300 μg/ml) (PeproTech, catalog number: AF-300-07 )
Recombinant human Thrombopoietin (TPO) (300 μg/ml) (PeproTech, catalog number: AF-300-18 )
Recombinant human Flt3 ligand (300 μg/ml) (PeproTech, catalog number: AF-300-19 )
Recombinant human Interleukin (IL)-3 (10 μg/ml) (PeproTech, catalog number: AF-200-03 )
Recombinant human basic Fibroblast Growth Factor (bFGF) (10 μg/ml) (Wako, catalog number: 064-04541 )
Amaxa Human CD34+ cell Nucleofector Kit (Lonza, catalog number: VPA-1003 )
MEF feeder (Repro Cell, catalog number: RCHEFC003 )
Matrigel growth factor reduced (BD Biosciences, catalog number: 356231 )
Primate ES Cell Medium (Repro Cell, catalog number: RCHEMD001 )
Essential 6 (Life Technologies, catalog number: A1516401 )
Gelatin (Sigma-Aldrich, catalog number: G1890 )
Dulbecco’s Modified Eagle’s Medium (DMEM) High glucose with stable L-glutamine (Nacalai tesque, catalog number: 08459-35 )
Fetal Bovine Serum (FBS) (Life Technologies, catalog number: 10437-028 )
Plasmid set 2 (Life Technologies, catalog number: A15960 )
Blood medium (see Recipes)
Plasmid mixture (see Recipes)
Transfection mixture (see Recipes)
iPS medium 1 (see Recipes)
iPS medium 2 (see Recipes)
0.1% Gelatin solution (see Recipes)
MEF medium (see Recipes)
Equipment
Nucleofector 2b (Lonza, catalog number: AAB-1001 )
6-well tissue culture plate (BD Biosciences, Falcon®, catalog number: 353046 )
15 ml conical tube (BD Biosciences, Falcon®, catalog number: 352196 )
50 ml conical tube (BD Biosciences, Falcon®, catalog number: 352070 )
37 °C 5% CO2 Cell culture incubator
Microscope
Centrifuge
Procedure
Day 0
Culture medium preparation:
Add 2 ml of blood medium containing cytokines to a well of 6-well plate.
Add 2 ml of PBS in the remaining wells of the plate to prevent excess evaporation of the medium and store the plate at 37 °C, 5% CO2.
Purification of mononuclear cells:
To 10 ml of anti-coagulated blood (EDTA), add 10 ml of PBS.
In two 15 ml tubes, add 5 ml Ficoll-Paque and gently add 10 ml of blood + PBS.
Spin tubes at 400 x g for 30 min at 18 °C. Use slow acceleration and slow brake.
Remove the plasma (around 2 ml) for the top fraction without disrupting the mononuclear cells at the interface.
Transfer the cells at interface (1-2 ml) to a 15 ml tube and mix well with 12 ml of PBS.
Spin at 200 x g for 10 min at 18 °C (slow brake).
Resuspend cells in 3 ml of H3000 medium and count cells.
Prepare aliquots of 3 x 106 cells in 1.5 ml tube.
Spin at 200 x g for 10 min at 18 °C (slow brake).
Aspirate supernatant.
Plating:
Resuspend the cells in the medium prepared in step 1.
Store the plate at 37 °C, 5% CO2 for around 6 days. Medium change is not needed during this culture period.
Day 5
Gelatin coat:
Add 1 ml/well of 0.1% gelatin solution to a 6-well plate.
Incubate the plate for at least half an hour at 37 °C.
Preparation of MEF feeder cells:
Thaw MEF feeder cells at 37 °C and count the cell number.
Aspirate excess gelatin solution prepared above.
Seed the MEF feeder cells at 3 x 105 cell/well in MEF medium.
Day 6
Culture medium preparation:
Aspirate the medium from MEF feeder cells.
Add 2 ml/well of blood medium containing cytokines to the plate.
Harvest the cultured cells:
Resuspend the cells in the medium and count cells. Number of live cells is usually around 1 x 106.
Harvest the floating cells into 15 ml tube.
Spin at 200 x g for 10 min at 18 °C (slow brake). During spin, prepare transfection mixture.
Nucleofection:
Aspirate the supernatant of the cells completely by hand using a pipette.
Add transfection mixture and suspend cells, be careful not to create any bubbles.
Perform nucleofection using program U-008.
Plating, 105 to 104 cells per well:
Immediately following nucleofection, add 800 μl of H3000 to the electroporation cuvette, and harvest the cells. Metal ions in the nucleofection solution are toxic to cells!
Plate the cells to MEF feeder plate ranging from 5 x 105 cells to 5 x 104 cells per well.
Day 8, 10, and 12
Add additional 1.5 ml of iPS medium 1 per well. Do not aspirate the existing medium.
Day 14-
Replace medium with 1.5 ml of iPS medium 1 per well.
* Medium replacement is performed every 2 days.
Day 25 to 35
Pick colonies of about 2 mm diameter.
Notes
Frozen peripheral blood mononuclear cells (PBMC) can be used with this protocol. Culture the thawed PBMC directly in blood medium on day 0.
iPSCs can be established in non-feeder condition, but the efficiency is low. For non-feeder condition, use Matrigel coated plate and iPS medium 2 instead of MEF feeder and iPS medium 1. Followings are the procedure to make Matrigel coated plate.
Thaw Matrigel at 4 °C and dilute it equivalent to 2 mg of protein in 6 ml of cooled DMEM.
Add 1 ml/well of the solution to a 6-well plate.
Store at RT for 1 h.
Wash the plate once with PBS before cell seeding.
Recipes
Blood medium
StemSpan H3000, containing following cytokines:
10 ng/ml IL-3
100 ng/ml IL-6
300 ng/ml SCF
300 ng/ml TPO
300 ng/ml Flt3 ligand
Use immediately after preparation
Plasmid mixture (Addgene, http://www.addgene.org/Shinya_Yamanaka)
Use following plasmid mixtures. Set 1 shows higher efficiency. In set 2, we omitted WPRE sequence and replaced shRNA against p53 with dominant negative form of mouse p53, which exist in set 1. Store at -20 °C. Set 2 can be purchased from Life Technologies.
Plasmid set 1
pCXLE-hOCT3/4-shp53-F
0.83 g
pCXLE-hSK
0.83 g
pCXLE-hUL
0.83 g
pCXWB-EBNA1
0.5 g
Plasmid set 2
pCE-hOCT3/4
0.63 g
pCE-hSK
0.63 g
pCE-hUL
0.63 g
pCE-mp53DD
0.63 g
pCXB-EBNA1
0.5 g
Transfection mixture
Amaxa CD34 Solution
81.8 μl
Supplement
18.2 μl
Plasmid mixture (set 1 or 2)
3 μl (3 μg)
Use immediately after preparation
iPS medium 1
Primate ES Cell Medium containing 4 ng/ml bFGF
Store at 4 °C for 1 week in dark
iPS medium 2
Essential 6 containing 100 ng/ml bFGF
Store at 4 °C for 1 week in dark
0.1% (w/v) Gelatin solution
Dissolve 1 g gelatin powder in 100 ml dH2O (1% w/v, 10x concentration), autoclave and store at 4 °C.
To prepare 0.1% (1x) gelatin solution, warm the 10x gelatin stock at 37 °C, add 50 ml of this to 450 ml dH2O. Filter the solution with a bottle-top filter (0.22 μm) and store at 4 °C.
MEF medium
DMEM containing 10% FBS
Acknowledgments
We thank T. Aoi, K. Takahashi, M. Nakagawa and Y. Yoshida for scientific discussion; M. Narita, T. Ichisaka and M. Ohuchi for technical assistance; R. Kato, E. Nishikawa, S. Takeshima, and Y. Ohtsu for administrative assistance; and Drs. H. Niwa (RIKEN) and J. Miyazaki (Osaka University) for the CAG promoter. This study was supported in part by a grant from the Program for Promotion of Fundamental Studies in Health Sciences of National Institute of Biomedical Innovation, a grant from the Leading Project of Ministry of Education, Culture, Sports, Science and Technology (MEXT), a grant from Funding Program for World-Leading Innovative Research and Development on Science and Technology (FIRST Program) of Japan Society for the Promotion of Science, Grants-in-Aid for Scientific Research of Japan Society for the Promotion of Science and MEXT (to S.Y.), and Grants-in-Aid for Scientific Research for Young Scientists B (to K.O.).
References
Mack, A. A., Kroboth, S., Rajesh, D. and Wang, W. B. (2011). Generation of induced pluripotent stem cells from CD34+ cells across blood drawn from multiple donors with non-integrating episomal vectors. PLoS One 6(11): e27956.
Okita, K., Matsumura, Y., Sato, Y., Okada, A., Morizane, A., Okamoto, S., Hong, H., Nakagawa, M., Tanabe, K., Tezuka, K., Shibata, T., Kunisada, T., Takahashi, M., Takahashi, J., Saji, H. and Yamanaka, S. (2011). A more efficient method to generate integration-free human iPS cells. Nat Methods 8(5): 409-412.
Okita, K., Yamakawa, T., Matsumura, Y., Sato, Y., Amano, N., Watanabe, A., Goshima, N. and Yamanaka, S. (2013). An efficient nonviral method to generate integration‐free human‐induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells 31(3): 458-466.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Stem Cell > Pluripotent stem cell > Cell induction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Generating Loss-of-function iPSC Lines with Combined CRISPR Indel Formation and Reprogramming from Human Fibroblasts
Andrew M. Tidball [...] Jack M. Parent
Apr 5, 2018 11058 Views
Protocol for Isolation, Stimulation and Functional Profiling of Primary and iPSC-derived Human NK Cells
Janine E. Melsen [...] Harald M. Mikkers
Dec 5, 2020 5984 Views
Rapid and Simplified Induction of Neural Stem/Progenitor Cells (NSCs/NPCs) and Neurons from Human Induced Pluripotent Stem Cells (hiPSCs)
Ryutaro Kajihara [...] Takumi Era
Feb 5, 2021 4890 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
908 | https://bio-protocol.org/en/bpdetail?id=908&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Mouse Embryo Fibroblasts
MD Marian E Durkin
XQ Xiaolan Qian
NP Nicholas C Popescu
DL Douglas R Lowy
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.908 Views: 19271
Reviewed by: Lin Fang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Nov 2012
Abstract
Preparation of primary cultures of embryo fibroblasts from genetically engineered mouse strains can provide a valuable resource for analyzing the consequences of genetic alterations at the cellular level. Mouse embryo fibroblasts (MEFs) have been particularly useful in cancer research, as they have facilitated the identification of the genetic changes that allow cells to overcome senescence and proliferate indefinitely in culture. The immortalized MEFs can then acquire additional mutations that lead to anchorage-independent growth and the ability to form tumors in mice. Recently we developed an MEF model system for analysis of the role of the tumor suppressor gene DLC1 in cellular transformation (Qian et al., 2012). In this communication we describe a protocol for the isolation of MEFs from day 13.5-day 14.5 mouse embryos. The MEFs obtained by this procedure are suitable for use in biochemical assays and for further genetic manipulations.
Keywords: Mouse embryo fibroblasts DLC1 Primary culture
Materials and Reagents
Mice 13-14 days pregnant
Phosphate buffered saline (PBS), without Ca2+ and Mg2+ (Life Technologies, Gibco®, catalog number: 10010 )
Dulbecco’s Modified Eagle’s Medium (DMEM) containing 4.5 g/L D-glucose (Life Technologies, Gibco®, catalog number: 11960044 or Mediatech, catalog number: 15-017-CV )
Fetal bovine serum (Atlanta Biologicals, catalog number: S11550 )
L-glutamine (Life Technologies, Gibco®, catalog number: 25030-149 )
1x penicillin-streptomycin solution (Gibco, catalog number: 15140-148 )
0.25% trypsin-EDTA (Life Technologies, Gibco®, catalog number: 25200 )
70% ethanol
Note: Prepare in a sterile container with sterile distilled water.
Dimethyl Sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
MEF culture medium with 10% fetal bovine serum (see Recipes)
Equipment
Plastic dissecting board or thick pad of blotting paper (such as Schleicher and Schuell GB004 paper)
Masking tape or push pins
Sterile Fine scissors (at least 3)
Sterile Fine forceps (at least 3)
Sterile 4 x 4 gauze pads (available from vendors of medical supplies)
Sterile scalpel blades or single-edge razor blades
Examination gloves
Petri dishes (100 mm) (BD Biosciences, Falcon®, catalog number: 351029 , or equivalent)
Sterile plastic serological pipettes, 5 and 10 ml
Sterile disposable tubes (50 ml) (BD Biosciences, Falcon®, catalog number: 352070 , or equivalent)
T75 tissue culture flasks (Corning, catalog number: 430641 , or equivalent)
37 °C 5% CO2 tissue culture incubator
Tissue culture hood
Inverted microscope
Cryovials (such as Nunc®, catalog number: 375418 )
Procedure
Harvest embryos from female mice 13-14 days after the appearance of the copulation plug. The female should be obviously pregnant at this stage.
Note: Depending on the viability of the particular strain, 6-10 embryos can be expected from each pregnant female, and they should yield enough MEFs for several experiments.
Euthanize the pregnant female by cervical dislocation (this can be done on the bench top, outside of the tissue culture hood.). Place the mouse on its back on a dissecting board or on a thick pad of blotting paper.
Thoroughly soak the fur of mouse with 70% ethanol. Transfer the board or pad with the mouse to the tissue culture hood.
Make a cut in the skin with scissors, then grab the skin with both hands and pull away to expose the abdominal wall. Use tape (or pins) to attach the feet of the mouse to the board (or pad).
Put 10 ml of 0.25% trypsin-EDTA in one covered Petri dish and put approximately 20 ml PBS in another Petri dish.
Set aside the scissors that were used to cut the fur, and put on a new pair of gloves. With new scissors, cut through the abdominal wall. Use forceps to lift up the uterine horns and cut away the uterus with scissors. Be careful not to let the uterus touch the fur. Place the uterus in the Petri dish with PBS.
Note: Scissors and forceps can be placed in inverted Petri dish lids when not in use, and they can be cleaned by wiping with gauze pads wetted with 70% ethanol.
Separate the embryos by slicing through the uterus in the regions between each embryo. The embryos may pop out spontaneously or they may come out after pressing gently with forceps. If they do not come out easily, carefully cut away the uterine tissue starting at the site where the dark red, disc-shaped placenta is located. If the embryo is still in the yolk sac, gently pull the sac off with forceps.
Transfer the embryos to a new dish with PBS – use one dish of fresh PBS for every 3 embryos. Swirl the dish to remove blood from the embryos.
With one hand, pick up an embryo with forceps and with the other hand, cut off the head above the eyes. Use another pair of forceps to tear out the red tissue (heart and liver). Place the rest of the embryo in the covered Petri dish with 0.25% trypsin-EDTA.
After all the embryos have been isolated and placed in the dish with trypsin, chop up the embryos with scissors, and then use a scalpel blade or razor blade to mince the tissue into pieces of 1-2 mm. Pipet up and down several times with a 10 ml pipet, and then place the dish in the 37 °C tissue culture incubator for 10 min.
Remove the dish from the incubator and pipet the embryo pieces up and down several times with a 5 ml pipet. Return the dish to the incubator for another 5-10 min.
Transfer the cell suspension to a 50 ml tube. Add 20 ml MEF culture medium (see Recipe below) to inactivate the trypsin, and pipet up and down several times. Let the cell suspension sit for about 5 min to allow larger embryo fragments to sink to the bottom of the tube.
Transfer the supernatant, consisting of single cells and cell clusters, to T75 flasks. Each flask should receive a volume of the cell suspension equivalent to 3 embryos. Add MEF culture medium to the flasks so that the total volume is 15-20 ml.
Note: if some cell lysis has occurred, the cell suspension may be viscous, and it may not be possible to avoid transferring the larger fragments to the flasks. This is not a major problem, since some fibroblasts will migrate out from the tissue fragments and attach to the dish.
The following morning, remove the old medium (with dead cells and debris) and replace with fresh medium. Check the cells later in the day; if the culture is very dense, split into 3 T75 flasks. Otherwise, split the cells on the following day or when they reach confluency. This is passage number 1.
When cells are confluent, harvest by trypsinization, spin down, and resuspend the cell pellet in freezing medium (MEF culture medium with 10% fetal bovine serum and 10% DMSO). Aliquot the MEFs into cryovials and freeze the cells using standard methods for mammalian cell cryopreservation.
Note: Some protocols call for 20% fetal bovine serum in the freezing medium, but 10% has worked for us.
The MEFs will senesce faster if plated at low density. As the growth of the cells begins to slow down after several passages, the number of cells transferred per flask should be increased with each passage.
After around 10 passages, the MEFs will reach the crisis phase when cell proliferation has greatly decreased. Immortalized lines can be derived in several weeks by following the protocols of Todaro and Green (Todaro and Green, 1963). We have found that immortalized MEF lines can be obtained after around 18 passages when all of the cells in a dish or flask are harvested and replated in fresh medium every 5 days.
Recipes
MEF culture medium with 10% fetal bovine serum
Mix 450 ml DMEM with 50 ml fetal bovine serum
5 ml 200 mM L-glutamine
5 ml 100x penicillin-streptomycin solution
Acknowledgments
This protocol was based on the method of Todaro and Green (1963) and subsequent modifications of the technique, as described in publications such as Coats et al. (1999). This work was supported by the Intramural Research Program of the Center for Cancer Research, National Cancer Institute, National Institutes of Health.
References
Coats, S., Whyte, P., Fero, M. L., Lacy, S., Chung, G., Randel, E., Firpo, E. and Roberts, J. M. (1999). A new pathway for mitogen-dependent cdk2 regulation uncovered in p27(Kip1)-deficient cells. Curr Biol 9(4): 163-173.
Qian, X., Durkin, M. E., Wang, D., Tripathi, B. K., Olson, L., Yang, X. Y., Vass, W. C., Popescu, N. C. and Lowy, D. R. (2012). Inactivation of the Dlc1 gene cooperates with downregulation of p15INK4b and p16Ink4a, leading to neoplastic transformation and poor prognosis in human cancer. Cancer Res 72(22): 5900-5911.
Todaro, G. J. and Green, H. (1963). Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines. J Cell Biol 17: 299-313.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Durkin, M. E., Qian, X., Popescu, N. C. and Lowy, D. R. (2013). Isolation of Mouse Embryo Fibroblasts. Bio-protocol 3(18): e908. DOI: 10.21769/BioProtoc.908.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
909 | https://bio-protocol.org/en/bpdetail?id=909&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorescence Measurement of Postharvest Physiological Deterioration (PPD) in Cassava Storage Roots
Jia Xu
John K. Fellman
Peng Zhang
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.909 Views: 12244
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Mar 2013
Abstract
Cassava (Manihot esculenta Crantz) is a perennial root crop in the tropics. Within 24-72 hours of harvest the storage roots deteriorate rapidly, thereby necessitating their prompt processing or consumption. Postharvest physiological deterioration (PPD) of cassava storage roots is the result of a rapid oxidative burst, which leads to discoloration of the vascular tissues. The various fluorogenic probes available for in vivo reactive oxygen species (ROS) imaging could reveal complex spatial and temporal dynamics in plant tissues. Fluorescence measurement of PPD became widely used assay for ROS. Most of the ROS probes passively diffuse across cell membranes localize in the mitochondria, and exhibit fluorescence. Due to its high sensitivity to ROS and ease of loading and detection, the Dihydrorhodamine123 probe has been widely used in plants to monitor ROS accumulation in response to various stimuli and range of developmental processes.
Keywords: Cassava Storage root Postharvest physiological deterioration Fluorescence
Materials and Reagents
DMSO (Sangon Biotech, catalog number: D0231 )
Dihydrorhodamine123 (Invitrogen, Molecular Probes®, catalog number: D632 ) (see Recipes)
MitoTracker Deep Red FM (Invitrogen, Molecular Probes®, catalog number: M22426 ) (see Recipes)
0.1 M sodium phosphate buffer (pH 7.0) (see Recipes)
Equipment
48-well plate
Razor blade
Slides
Centrifuge
Confocal laser scanning microscope (Zeiss, model: LSM 510 META )
Procedure
Cut fresh cassava storage roots into smaller segments about 5 x 5 x 0.5 mm in length, width and height by razor blade. The areas (Figure 1):
The center: vascular tissue found within the center of the root cross-section.
The middle: the tissue filled with storage cells with streaks of xylem throughout.
Figure 1. Cassava storage root cross-section (Rickard, 1985). 1: periderm; 2: sclerenchyma; 3: parenchyma; 4: latex tubes; 5: cambium; 6: parenchyma (The middle); 7: xylem vessels (The middle); 8: xylem bundles (The center).
Immersed in the sodium phosphate buffer with Dihydrorhodamine123 or MitoTracker Deep Red FM, stain for 10 and 20 min, respectively in the dark at room temperature.
Afterwards, wash with sodium phosphate buffer once before viewing under the microscope. Use sodium phosphate buffer to mount the sample on slides.
Use a Zeiss LSM (Laser Scanning Microscope) 510 META Confocal with the capturing program LSM 510 equipped with a10x and 20x objective.
Allow the microscope and lasers to warm up for about 20 minutes before use.
The settings used for each stain are as follows:
Dihydrorhodamine123 excitation/emission 488/515 nm.
MitoTracker Deep Red FM excitation/emission 635/680 nm.
First use the visible spectrum to find the sample, after that change to fluorescence spectrum (Figure 2).
Figure 2. Fluorescence determination of PPD in cassava storage roots. a, xylem vessel; b, bundle sheath; Scale bar = 20 μm.
Recipes
0.1 M sodium phosphate buffer, pH 7.0 (100 ml)
Mix 61.5 ml 1 M K2HPO4 and 38.5 ml 1 M KH2PO4
Filter sterilize (0.45 μm)
Store at 4 °C
Dihydrorhodamine123 working solution
50 mM Storage solution
10 mg Dihydrorhodamine123 with 577.4 μl DMSO
50 μM Working solution
Sodium phosphate buffer dilution
Store at -70 °C
MitoTracker Deep Red FM
1 mM Storage solution
50 μg MitoTracker Deep Red FM with 91.98 μl DMSO
250 nM Working solution
Sodium phosphate buffer dilution
Store at -70 °C
Acknowledgments
The protocol was mainly adapted from the publication Xu et al. (2013). This work was supported by grants from the National Natural Science Foundation of China (31271775), the National Basic Research Program (2010CB126605), the National High Technology Research and Development Program of China (2012AA101204), the Earmarked Fund for China Agriculture Research System (CARS-12-shzp) and the BioCassava Plus Program from the Bill & Melinda Gates Foundation.
References
Rickard J. E. (1985). Physiological deterioration in cassava roots. J Sci Food Agric 36: 167-176.
Xu, J., Duan, X., Yang, J., Beeching, J. R. and Zhang, P. (2013). Enhanced reactive oxygen species scavenging by overproduction of superoxide dismutase and catalase delays postharvest physiological deterioration of cassava storage roots. Plant Physiol 161(3): 1517-1528.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Xu, J., Fellman, J. K. and Zhang, P. (2013). Fluorescence Measurement of Postharvest Physiological Deterioration (PPD) in Cassava Storage Roots. Bio-protocol 3(18): e909. DOI: 10.21769/BioProtoc.909.
Xu, J., Duan, X., Yang, J., Beeching, J. R. and Zhang, P. (2013). Enhanced reactive oxygen species scavenging by overproduction of superoxide dismutase and catalase delays postharvest physiological deterioration of cassava storage roots. Plant Physiol 161(3): 1517-1528.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Simple Sonication Method to Isolate the Chloroplast Lumen in Arabidopsis thaliana
Jingfang Hao and Alizée Malnoë
Aug 5, 2023 597 Views
A Plate Growth Assay to Quantify Embryonic Root Development of Zea mays
Jason T. Roberts [...] David M. Braun
Oct 20, 2023 939 Views
Detection and Quantification of Programmed Cell Death in Chlamydomonas reinhardtii: The Example of S-Nitrosoglutathione
Lou Lambert and Antoine Danon
Aug 5, 2024 404 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
91 | https://bio-protocol.org/en/bpdetail?id=91&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Illumina Sequencing Library Construction from ChIP DNA
Wei Zheng
Published: Vol 2, Iss 4, Feb 20, 2012
DOI: 10.21769/BioProtoc.91 Views: 20359
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in BMC Genomics Jan 2009
Abstract
The Illumina sequencing platform is very popular among next-generation sequencing platforms. However, the DNA sequencing library construction kit provided by Illumina is considerably expensive. The protocol described here can be used to construct high-quality sequencing libraries from chromatin immunoprecipitated DNA. It uses key reagents from third-party vendors and greatly reduces the cost in library construction for Illumina sequencing.
Materials and Reagents
QIAquick PCR purification kit (QIAGEN, catalog number: 28104 )
QIAquick gel extraction kit (QIAGEN, catalog number: 28704 )
MinElute PCR purification kit (QIAGEN, catalog number: 28004 ), store the columns at 4 °C.
Gibco UltraPure water (Life Technologies, Gibco®, catalog number: 10977-015 )
End-it DNA End repair kit (Epicentre®, catalog number: ER0720 )
Klenow fragment (3’ ≥ 5’ exo minus) (New England Biolabs, catalog number: M0212S )
100 mM dATP (Life Technologies, Invitrogen™, catalog number: 10216-018 or VWR International, catalog number: PAU1201 )
LigaFast ligation kit (Promega corporation, catalog number: M8221 )
Ethanol
Elution buffer
End repair buffer
Klenow buffer
Cyan/orange loading buffer
2% E-gel, precast agarose gel (Life Technologies, Invitrogen™) (can be replaced by house made 2% agarose gel)
Phusion HF PCR master mix (New England Biolabs, catalog number: F531S or F531L )
Illumina Adapter oligo mix from Illumina sequencing kit, but can be replaced by house made oligo mix using fast denaturation and slow reannealing as described in reference 1. The adapter oligo sequences are:
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina PCR primers 1.1 and 2.1 from Illumina sequencing kit, but can be replaced by ordinary synthesized oligos with the following sequences:
Illum1.1:
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCC
GATCT
Illum2.1:
5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
Equipment
BECKMAN centrifuges and rotor (Beckman Coulter)
PCR thermocycler (PerkinElmer or F. Hoffmann-La Roche)
NanoDrop Micro-Volume UV-Vis Spectrophotometer
Procedure
Purification from ethanol precipitated ChIP DNA. Use QIAquick PCR purification kit, and elute in 50 μl elution buffer. Use 34 μl for library construction and the rest for qPCR verification.
Input DNA needs to be diluted before making library. After purification, measure the concentration of input DNA by Nanodrop. If it reads 20 ng/μl, dilute 5 fold, if close to 40 ng/μl dilute 10 fold.
End-repair:
Mix the following components in a 1.5 ml Eppendorf tube:
34 μl purified ChIP DNA (or add Gibco water up to 34 μl)
5 μl 10x end repair buffer
5 μl 2.5 mM dNTP mix
5 μl 10 mM ATP
1 μl end-repair enzyme mix
50 μl total
Incubate for 45 min at room temperature (RT).
Purify using QIAquick PCR purification column, elute in 34 μl.
Addition of ‘A’ base to the 3’ ends:
Mixing the following components in a 1.5 ml Eppendorf tube:
34 μl ChIP DNA from step 3
5 μl Klenow buffer = NEB buffer 2
10 μl 1 mM dATP
1 μl Klenow fragment (3’-5’ exo minus)
50 μl total reaction volume
(1 mM dATP is diluted from 100 mM dATP stock and aliquoted in 25 μl, freeze-thaw only once)
Incubate 30 min at 37 °C.
Purify using MinElute PCR purification column, elute in 12 μl.
Adaptor ligation:
Mix the following components in a 1.5 ml Eppendorf tube:
11 μl ChIP DNA from step 4
15 μl DNA ligase buffer
1 μl 1:20 diluted adaptor oligo
3 μl DNA ligase
30 μl total
(If doing multiplexing, make sure to add in each reaction with different adaptor, and label clearly.)
Incubate 15 min at RT.
Gel selection to get rid of excessive adaptors:
Dilute cyan/orange loading buffer 10 fold, add 6 μl to the 30 μl reactions from step 5, load in two wells of an E-gel. Also load 20 μl 10-fold diluted 50 bp ladder. Run E-gel for 20 min.
Cut between 150 and 450 bp. Purify the DNA using QIAquick gel extraction kit, elute in 30 μl buffer.
PCR with Illumina primers:
1:1 dilute Illumina PCR primers 1.1 and 2.1 with Gibco water.
Mixing the following components in PCR stripe tubes:
30 μl ChIP DNA from step 4
28 μl Phusion PCR mastermix
1 μl diluted primer 1.1
1 μl diluted primer 2.1
60 μl total reaction volume
Run PCR cycle:
98 °C 30 sec
98 °C 10 sec
65 °C 30 sec
72 °C 30 sec
GOTO step 2 for 15 times
72 °C 5 min
4 °C hold.
Size selection on 2% agarose gel:
Add 1 μl undiluted cyan/orange loading dye to the PCR reaction, load all in 3 wells on E-gel, run for 30 min alongside with 20 μl 1:10 diluted 50 bp ladder and 20 μl 1:10 diluted 100 bp ladder.
Cut between 150 and 450 bp. Take pictures before and after the slice is excised. Make sure to avoid the ~100 bp adaptor band. A good library should have a smear centering at ~200 bp. Strong band at ~100 bp indicates over amplification of adaptors and the library may not be good enough quality.
Purify the DNA using QIAquick gel extraction kit and elute in 30 μl buffer.
Measure DNA concentration:
Use NanoDrop to measure the DNA concentration. A good library should be relatively concentrated (e.g., > 10 ng/μl).
Acknowledgments
The protocol has been tested and optimized by different researchers in the Snyder lab, Stanford University (Lefrancois et al., 2009).
References
Lefrancois, P., Euskirchen, G. M., Auerbach, R. K., Rozowsky, J., Gibson, T., Yellman, C. M., Gerstein, M. and Snyder, M. (2009). Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing. BMC Genomics 10: 37.
Lefrancois, P., Zheng, W. and Snyder, M. (2010). ChIP-Seq using high-throughput DNA sequencing for genome-wide identification of transcription factor binding sites. Methods Enzymol 470: 77-104.
Article Information
Copyright
© 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Systems Biology > Genomics > ChIP-seq
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
ChIP-Seq in Candida albicans
Sadri Znaidi [...] Christophe d’Enfert
Jun 20, 2014 17726 Views
RNA Chromatin Immunoprecipitation (RNA-ChIP) in Caenorhabditis elegans
Germano Cecere and Alla Grishok
Dec 20, 2014 14359 Views
Chromatin Immunoprecipitation (ChIP) Assay for Detecting Direct and Indirect Protein – DNA Interactions in Magnaporthe oryzae
Gang Li [...] Richard A. Wilson
Nov 5, 2015 14553 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
910 | https://bio-protocol.org/en/bpdetail?id=910&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Flow Cytometric Analysis of Calcium Influx Assay in T cells
Sun-Hwa Lee
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.910 Views: 20160
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in mBio Nov 2012
Abstract
Calcium influx is one of the key signaling events upon stimulation of T cell receptors (TCR) and plays an important role for T cell activation, proliferation, and differentiation. Phorbol myristate acetate (PMA) and calcium ionophore ionomycin are commonly utilized as stimulants in a variety of immunologic assays including T cell activation. PMA is a protein kinase C (PKC) activator, resulting in the activation of Ras, a small GPTase. When PMA and ionomycin are used together, TCR signaling downstream of PKC and Ras can be activated without activation of TCR-triggerd signaling events. This protocol describes the flow cytometry analysis of intracellular calcium influx in T cells stimulated with PMA and ionomycin.
Materials and Reagents
Jurkat T cells (ATCC, catalog number: TIB-152 )
DMSO (Sigma-Aldrich, catalog number: 472301 )
RPMI media 1640 (Life Technologies, Gibco®, catalog number: 21875-034 )
Fetal Bovine Serum (FBS) (Life Technologies, Gibco®, catalog number: 16000044 )
Penicillin/streptomycin (pen/strep) (Life Technologies, Gibco®, catalog number: 15140-122 )
PMA (Sigma-Aldrich, catalog number: P1585 ) (Store at -20 °C)
Ionomycin (Sigma-Aldrich, catalog number: I0623 ) (Store at -20 °C)
Calcium Assay Kit (BD Biosciences, catalog number: 640176 )
Complete RPMI media (see Recipes)
PMA stock solution (see Recipes)
Ionomycin stock solution (see Recipes)
Equipment
Centrifuge (Eppendorf, model: 5810R )
37 °C 5% CO2 Cell culture incubator
Cell Counter
BD CantoII FACS machine
5 ml round-bottom FACS tube (BD Biosciences, catalog number: 352003 )
Software
FACS DIVA software
FlowJo software
Procedure
Preparation (For 4 samples)
Preparation of Jurkat T cells:
Count cells growing exponentially (1 x 106 per assay).
Wash cells once with pre-warmed complete RPMI media at 200 x g for 5 min.
Place 1 x 106 cells/250 μl of fresh complete RPMI media into a 5 ml FACS tube.
Preparation of 1x enhancing solution (from Calcium Assay Kit) (2 ml for 4 assays):
Mix 200 μl of 10x enhancing solution with 1.8 ml of assay buffer.
Keep it at room temperature.
Preparation of indicator (from Calcium Assay Kit):
Equilibrate a vial of indicator (stored at -20 °C) at room temperature for 5 min.
Add 100 μl of 100% DMSO.
Mix well by pipetting up and down multiple times.
Store at RT for 10 min to stabilize completely.
Store unused indicator in a small aliquot at -20 °C until use.
Preparation of 1x loading dye:
Mix 2 ml of 1x enhancing solution with 2 μl of indicator prepared above.
Loading dye to cells:
Add 250 μl of 1x loading dye (prepared in step 4) into each tube containing cells.
Incubate tube for 1 h in 37 °C CO2 Incubator.
Cool down tube at RT for 20 min before analysis
FACS analysis
Open the FACS DIVA software.
Draw a dot plot (Time is on the X-axis, and FITC is on the Y-axis).
Place a tube to the FACS machine.
Click “Record Data” for 1 min to obtain the basal level of signal.
Click “Stop Acquiring” and remove the tube from the FACS machine.
Immediately add 1 μl of stimulator [a mixture of PMA (50 ng/ml) and ionomycin (1 μg/ml)].
Vortex briefly and place the tube back to the FACS machine.
Click “Record Data” for additional 3 min.
Click “Append” to attach acquired signal to the 1 min basal level of signal acquired in step 4.
Click “Stop Acquiring” to finish the assay.
Analyze each data with FlowJo software by choosing kinetic mode.
Overlay sample data on the control data to display the difference of signal between the control and sample on one Figure as shown in Figure 1.
Figure 1. Intracellular Ca2+ influx in IKKγ/NEMO-deficient Jurkat T cells stably complemented with Ha-tagged IKKγ/NEMO WT or mutants (S377E, S377A, Y374D, Y374F). Cells were loaded with Ca2+ indicator for 1 h at 37 °C. Intracellular Ca2+ influx upon PMA and ionomycin (P + I) treatment was monitored for 5 min by flow cytometry analysis. Vec stands for vector control.
Recipes
Complete RPMI media
RPMI containing 10% FBS and 1% penicillin/streptomycin
PMA stock solution
50 ng/ml DMSO
Ionomycin stock solution
1 μg/ml DMSO
Acknowledgments
This protocol is adapted from Lee et al. (2012).
References
Lee, S. H., Toth, Z., Wong, L. Y., Brulois, K., Nguyen, J., Lee, J. Y., Zandi, E. and Jung, J. U. (2012). Novel Phosphorylations of IKKγ/NEMO. MBio 3(6): e00411-00412.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Lee, S. (2013). Flow Cytometric Analysis of Calcium Influx Assay in T cells. Bio-protocol 3(18): e910. DOI: 10.21769/BioProtoc.910.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Lymphocyte
Cell Biology > Cell-based analysis > Ion analysis
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Flow Cytometry Analysis of Microglial Phenotypes in the Murine Brain During Aging and Disease
Jillian E. J. Cox [...] Sarah R. Ocañas
Jun 20, 2024 1048 Views
Quantification of Proliferating and Mitotically Active Retinal Cells in Mice by Flow Cytometry
Hope K. Vanzo-Sparks [...] Cindy L. Linn
Jul 5, 2024 504 Views
Flow-based In Vivo Method to Enumerate Translating Ribosomes and Translation Elongation Rate
Mina O. Seedhom [...] Jonathan W. Yewdell
Jan 20, 2025 1021 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
911 | https://bio-protocol.org/en/bpdetail?id=911&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Extracellular Ca2+ Influx and Intracellular H+ Efflux in Response to Glycerol and PEG6000 Treatments
Tao Li
Baodong Chen
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.911 Views: 9429
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in New Phytologist Jan 2013
Abstract
The characteristics of Ca2+ and H+ fluxes may reflect the activities of aquaporins, as the up-regulation of aquaporin activities is directly associated with the decrease in cytoplasmic H+ concentration and increase in cytoplasmic Ca2+ concentration. The higher aquaporin activities can protect cells against osmotic stresses by altering water flow into and out of the cells. In order to confirm the contribution of aquaporins to the cell tolerance to different osmotic stresses, net Ca2+ and H+ fluxes are measured using the noninvasive micro-test technique (NMT). NMT provides the real-time in situ detection of net ion transport across membranes. Here, we describe the protocol of in situ detection of net Ca2+ and H+ fluxes across transformed Pichia pastoris cells in response to glycerol and polyethylene glycol 6000 (PEG6000) treatments. The transformed yeast cells are loaded onto a coverslide pre-processed in the poly-L-lysine solution (0.1% w/v aqueous solution). After cell immobilization, microelectrodes are positioned above a monolayer of attached cell population. Micro-volts differences are measured at two excursion points manipulated by a computer. Micro-volts differences could be converted into ion fluxes using the ASET 2.0 and iFluxes 1.0 Software. The method is expected to promote the application of NMT in microbiology. We are very grateful to Younger USA (Xuyue Beijing) NMT Service Center for their critical reading of the manuscript.
Keywords: Ion flux Glycerol Non-destructive measurement PEG Signal
Materials and Reagents
Transformed Pichia pastoris cells (Invitrogen, catalog number: V200-20 )
Poly-L-lysine solution (0.1% w/v aqueous solution) (Sigma-Aldrich, catalog number: P4707 )
Polyethylene glycol 6000 (PEG6000) (Merck KGaA, catalog number: 807491 )
Glycerol (Sinopharm Chemical Reagent, catalog number: 10010692 )
Yeast extract (Oxoid, catalog number: LP0021 )
Peptone (Oxoid, catalog number: LP0037 )
D-glucose (Sinopharm Chemical Reagent, catalog number: 10010592 )
MES
Standard medium buffer (pH 6.0) (see Recipes)
Yeast extract peptone dextrose (YPD) medium (see Recipes)
Calibration medium buffer (pH 7.0) (see Recipes)
Calibration medium buffer (pH 5.0) (see Recipes)
Equipment
Non-invasive Micro-test System (YoungerUSA, model: NMT100 series )
Shaking incubator (Shanghai Anting Scientific Instrument Factory, model: HZQ-F160 )
Centrifuge (Thermo Fisher Scientific, model: Fresco 21 )
Microplate Reader Spectra (Molecular Devices, model: SpectraMax 190 )
Glass coverslide (20 mm x 20 mm)
Petri dish (35 mm in diameter)
Micropipettor (Eppendorf, 100-1,000 μl and 10-100 μl)
Software
JCal V3.2.1 (a free MS Excel spreadsheet, available at http://www.youngerusa.com or http://www.ifluxes.com)
ASET 2.0 software (available at http://www.youngerusa.com)
iFluxes 1.0 software (available at http://www.youngerusa.com)
Procedure
The transformed cells are incubated in 10 ml YPD at 30 °C in a shaking incubator (200 rpm) for 12 h.
Overnight cultures of different transformed cells are adjusted to an OD600nm of 0.2. OD600nm is monitored using microplate reader spectra.
Fifty microliters of each are taken and added to 10 ml YPD containing a final concentration of 25% PEG6000 or 1 M glycerol or no exogenous osmolytes. The transformed yeast cells are grown to an OD600nm of 1.0 in YPD containing different exogenous osmolytes at 30 °C in a shaking incubator (200 rpm). OD600nm is monitored using microplate reader spectra.
One milliliter of each is taken and pelleted at 2,000 rpm for 5 min at room temperature.
Nine hundred microliters of supernatant are removed, and the cells are resuspended in the rest of YPD media.
The coverslips are immersed in the poly-L-lysine solution (0.1% w/v aqueous solution) for 24 h.
Prior to each flux measurement, the microelectrodes must be calibrated in calibration medium (pH 7.0 and pH 5.0), respectively, following to the same procedure and standards. Only Ca2+ electrodes with Nernstian slope > 26 mV/decade and H+ electrodes with Nernstian slope > 53 mV/decade are used in the protocol. Data are discarded if the post-test calibrations fail.
Ten microliters of transformed cells are loaded on the coverslip for 5 min, washed off with standard medium to ensure a monolayer of attached cells and incubated in the standard medium for 5 min at room temperature.
Microelectrodes are positioned 10 μm above the attached cell population consisting of 15 cells with equal size. Micro-volts differences are measured at two excursion points, one 10 μm above the cell population and the other 20 μm away, at a frequency of 0.05 Hz manipulated by a computer. The kinetics of net Ca2+ and H+ fluxes near each cell population are monitored for 10 min.
For each sample, four clones are incubated in 10 ml YPD, and the resulting four cell populations are measured (see steps 1-9).
Micro-volts differences are exported as raw data before they are converted into net Ca2+ and H+ fluxes by using the JCal V3.2.1. The ion flux assay around each type of transformed cells is replicated independently three times.
Figure 1. Schematic diagram of ion flux detection (www.xuyue.net). The microelectrode tip is filled with liquid ion exchanger (LIX). A voltage gradient (dV) is measured by the electrometer between two positions over the travel range dx. A concentration gradient (dc) is calculated based on dV. Do, ion diffusion constant; J, net ion flux.
Recipes
Standard medium (aqueous solution) buffer (pH 6.0)
0.1 mM CaCl2
0.1 mM KCl
0.3 mM MES
10 mM glucose
pH is adjusted to 6.0 with HCl
Stored at 4 °C
Yeast extract peptone dextrose (YPD) medium (1 L)
1% yeast extract
2% peptone
2% D-glucose (added to the medium after autoclave)
10 g yeast extract
20 g peptone are dissolved in 900 ml of water
The medium is autoclaved for 20 minutes on liquid cycle, cooled to ~55 °C
Mixed with 100 ml of 20% D-glucose
The liquid medium is stored at room temperature
Calibration medium (aqueous solution) buffer (pH 7.0)
0.01 mM CaCl2
0.1 mM KCl
0.3 mM MES
10 mM glucose
pH is adjusted to 7.0 with HCl
The medium is stored at 4 °C
Calibration medium (aqueous solution) buffer (pH 5.0)
0.1 mM CaCl2
0.1 mM KCl
0.3 mM MES
10 mM glucose
pH is adjusted to 5.0 with HCl
The medium is stored at 4 °C
Acknowledgments
The protocol was adapted from our previously published paper Li et al. (2013). We wish to thank Younger USA (Xuyue Beijing) NMT Service Center for the technical support. This research was financially supported by the Knowledge Innovation Program of the Chinese Academy of Sciences (Project no. KZCX2-YW-BR-17) and National Natural Science Foundation of China (41371264, 41401281).
References
Li, T., Hu, Y. J., Hao, Z. P., Li, H., Wang, Y. S. and Chen, B. D. (2013). First cloning and characterization of two functional aquaporin genes from an arbuscular mycorrhizal fungus Glomus intraradices. New Phytol 197(2): 617-630.
McLamore, E. S. and Porterfield, D. M. (2011). Non-invasive tools for measuring metabolism and biophysical analyte transport: self-referencing physiological sensing. Chem Soc Rev 40(11): 5308-5320.
Shabala, L., Ross, T., McMeekin, T. and Shabala, S. (2006). Non-invasive microelectrode ion flux measurements to study adaptive responses of microorganisms to the environment. FEMS Microbiol Rev 30(3): 472-486.
Shabala, L., Ross, T., Newman, I., McMeekin, T. and Shabala, S. (2001). Measurements of net fluxes and extracellular changes of H+, Ca2+, K+, and NH4+ in Escherichia coli using ion-selective microelectrodes. J Microbiol Methods 46(2): 119-129.
Wang, Q., Zhao, Y., Luo, W., Li, R., He, Q., Fang, X., Michele, R. D., Ast, C., von Wiren, N. and Lin, J. (2013). Single-particle analysis reveals shutoff control of the Arabidopsis ammonium transporter AMT1;3 by clustering and internalization. Proc Natl Acad Sci U S A 110(32): 13204-13209.
Xu, R. R., Qi, S. D., Lu, L. T., Chen, C. T., Wu, C. A. and Zheng, C. C. (2011). A DExD/H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana. FEBS J 278(13): 2296-2306.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial cell biology > Cell-based analysis
Cell Biology > Cell-based analysis > Ion analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Bacterial Intracellular Sodium Ion Measurement using CoroNa Green
Yusuke V. Morimoto [...] Tohru Minamino
Jan 5, 2017 9376 Views
Live Cell Measurement of the Intracellular pH of Yeast by Flow Cytometry Using a Genetically-Encoded Fluorescent Reporter
Catherine G. Triandafillou and D. Allan Drummond
Jun 20, 2020 3506 Views
Single Cell Analysis and Sorting of Aspergillus fumigatus by Flow Cytometry
Gareth Howell and Robert-Jan Bleichrodt
Apr 20, 2021 3571 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
912 | https://bio-protocol.org/en/bpdetail?id=912&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Rat Model of Chronic Midthoracic Lateral Hemisection
Victor Arvanian
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.912 Views: 10474
Reviewed by: Xuecai Ge Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Neuroscience Feb 2013
Abstract
Although most spinal cord injuries (SCI) are anatomically incomplete, only limited functional recovery has been observed in people and rats with partial lesions. To address why surviving fibers cannot mediate more complete recovery, it is important to evaluate the physiological and anatomical status of spared fibers. These experiments require use of animal models. Here we describe a midthoracic unilateral spinal cord hemisection (HX; corresponds to Brown-Sequard lesion in humans) in adult rats. This is a useful animal model for partial injuries because there is a clear lesion of one entire side of the cord with intact fibers remaining on the contralateral side. This model allows the study and comparison of how acute and chronic trauma affect function of the surviving fibers.
Materials and Reagents
Adult (~210 g) female Sprague-Dawley rats
1.5% isoflurane
Heated workstation with gas evacuation system and a face mask for induction and maintenance of anesthesia (ProStation Kit) (MIP/Anesthesia Technology, catalog number: AS-01-0491 )
Antibiotic (Baytril)
Analgesic (Buprenorphine)
Sterile lactated Ringer solution
Cotton swap
Buprenorphine
Petrolatum ophthalmic ointment (Dechra Veterinary Products)
4-0 monocryl (Ethicon)
Wound clips
Anatomical tracers
Equipment
Isoflurane induction chamber (1 L)
Water circulating heating pad
Surgical microscope
Iridectomy scissors, faucets, blades, other tools for small animal surgery
Procedure
Note: All procedures were performed on adult female Sprague Dawley rats (~200 g) in compliance with the Institutional Animal Care and Use Committee at SUNY-Stony Brook and Northport VAMC.
After pre-training on the behavioral tasks, rats were deeply anesthetized with 3% isoflurane in 100% O2 in an induction chamber (1 L).
Anesthesia was maintained by administering 1.5% isoflurane in 100% O2 through a face mask. A water circulating heating pad was used to maintain body temperature at 36.5-37 °C during surgeries.
Before surgery, animals received a subcutaneous injection of analgesic Buprenorphine (0.01 mg/kg) to reduce post-operative pain. Petrolatum ophthalmic ointment was applied to the eyes to prevent desiccation.
Dorsal laminectomy (i.e. partial vertebral laminectomy) was performed to expose T10 spinal segment. The spinal level was confirmed by using a vein at T5-T6 as a landmark. The meningeal layer at T10 was slit (1 mm) at the midline longitudinally.
A complete transection of the left hemicord at T10 was carried out with the tip of iridectomy scissors, as follows:
First, while holding the dura and lifting the spinal cord slightly, one tip of the scissors was passed through the entire thickness of the spinal cord dorsal to ventral at the midline;
The left dorsal and ventral columns were then cut from lateral to the midline by closing other tip of scissors;
Finally, while keeping the cord elevated, one tip of the scissors was placed under the ventral surface of the spinal cord (up to the midline) and any uncut tissue in the left dorsal and ventral columns was cut ventral to dorsal up to the midline.
Figure 1. Images of spinal cord following dorsal laminectomy and lateral HX lesion of the spinal cord. A. Image of the exposed spinal cord (at arrow) following a dorsal laminectomy procedure. B. Image of rat brain and spinal cord isolated from the rat that recived HX spinal cord injury (at arrow) 6 weeks erlier.
After surgery, the muscles were closed with 4-0 monocryl suture and skin was closed with wound clips.
Antibiotic (5 mg/kg, sc) and 5 ml of lactated Ringer’s solution were administered subcutaneously. Bladder function was not compromised by this surgery. Injections of antibiotic, analgesic and Ringer`s solution were administered for 3 days post injury.
Horizontal or transverse sections of the spinal cord were used for reconstruction of injury (Figure 2).
Figure 2. Lateral HX spinal cord injury. A. Horizontal section of the rat spinal cord prepared immediately after HX. B. Transverse section of the cord at SCI epicenter prepared 6 weeks after HX; highlighted is area of spared white matter. Scale bar, 100 μm. (Adopted and modified from Garcia-Alias et al., 2011).
As a result of HX SCI, there are clear behavioral impairments revealed by challenging motor tasks and automated Catwalk gait analysis; electrophysiological experiments allow evaluation of the conduction through fibers contralateral to the lesion and the possibility of establishing a functional detour around the lesion following administration of various treatments; moreover, unilateral injections of the anatomical tracers permit visualization of anerogradely labeled midline crossing fibers and retrogradely labeled neurons (Arvanian et al., 2009; Hunanyan et al., 2010; Schnell et al., 2011; Garcia-Alias et al., 2011; Hunanyan et al., 2011; Petrosyan et al., 2013).
Acknowledgments
This protocol was adapted from previously published papers: Arvanian et al. (2009); Hunanyan et al. (2011); García-Alías et al. (2011); Schnell et al. (2011). The research was supported by Merit Review Funding from the Department of Veterans Affairs and the Department of Defense and New York State Spinal Cord Injury Research Board.
References
Arvanian, V. L., Schnell, L., Lou, L., Golshani, R., Hunanyan, A., Ghosh, A., Pearse, D. D., Robinson, J. K., Schwab, M. E., Fawcett, J. W. and Mendell, L. M. (2009). Chronic spinal hemisection in rats induces a progressive decline in transmission in uninjured fibers to motoneurons. Exp Neurol 216(2): 471-480.
Garcia-Alias, G., Petrosyan, H. A., Schnell, L., Horner, P. J., Bowers, W. J., Mendell, L. M., Fawcett, J. W. and Arvanian, V. L. (2011). Chondroitinase ABC combined with neurotrophin NT-3 secretion and NR2D expression promotes axonal plasticity and functional recovery in rats with lateral hemisection of the spinal cord. J Neurosci 31(49): 17788-17799.
Hunanyan, A. S., Garcia-Alias, G., Alessi, V., Levine, J. M., Fawcett, J. W., Mendell, L. M. and Arvanian, V. L. (2010). Role of chondroitin sulfate proteoglycans in axonal conduction in mammalian spinal cord. J Neurosci 30(23): 7761-7769.
Hunanyan, A. S., Alessi, V., Patel, S., Pearse, D. D., Matthews, G. and Arvanian, V. L. (2011). Alterations of action potentials and the localization of Nav1.6 sodium channels in spared axons after hemisection injury of the spinal cord in adult rats. J Neurophysiol 105(3): 1033-1044.
Petrosyan, H. A., Hunanyan, A. S., Alessi, V., Schnell, L., Levine, J. and Arvanian, V. L. (2013). Neutralization of inhibitory molecule NG2 improves synaptic transmission, retrograde transport, and locomotor function after spinal cord injury in adult rats. J Neurosci 33(9): 4032-4043.
Schnell, L., Hunanyan, A. S., Bowers, W. J., Horner, P. J., Federoff, H. J., Gullo, M., Schwab, M. E., Mendell, L. M. and Arvanian, V. L. (2011). Combined delivery of Nogo-A antibody, neurotrophin-3 and the NMDA-NR2d subunit establishes a functional 'detour' in the hemisected spinal cord. Eur J Neurosci 34(8): 1256-1267.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Neuroscience > Nervous system disorders > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Simplified Paradigm of Late Gestation Transient Prenatal Hypoxia to Investigate Functional and Structural Outcomes from a Developmental Hypoxic Insult
Elyse C. Gadra and Ana G. Cristancho
Oct 5, 2022 760 Views
Conditioned Lick Suppression: Assessing Contextual, Cued, and Context-cue Compound Fear Responses Independently of Locomotor Activity in Mice
Youcef Bouchekioua [...] Yu Ohmura
Dec 5, 2022 602 Views
In situ Microinflammation Detection Using Gold Nanoclusters and a Tissue-clearing Method
Fayrouz Naim [...] Masaaki Murakami
Apr 5, 2023 967 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
913 | https://bio-protocol.org/en/bpdetail?id=913&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo Chick Chorioallantoic Membrane (CAM) Angiogenesis Assays
ZC Zhenguo Chen
ZW Zhihua Wen
Xiaochun Bai
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.913 Views: 37261
Reviewed by: Lin FangXuecai Ge Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Oncogene Sep 2014
Abstract
Angiogenesis is the process of formation of new blood vessels from pre-existing vessels or endothelial cell progenitors. It plays a crucial role in tumor growth and metastasis. Tumor angiogenesis have been widely studied as an important target for suppressing tumor growth and metastasis. Here, we describe an in vivo chick embryo chorioallantoic membrane (CAM) model. The chick embryo chorioallantoic membrane is an extraembryonic and is rich of blood vessels. After exposing the vascular zone of the CAM, a sterilized filter-paper disk is employed, which is used as a carrier for being loaded with various chemicals, drugs or virus. Finally, the CAM was fixed and spread on glass slide, and the blood vessels were quantified by counting the number of blood vessel branch points. Compared with the matrigel plug angiogenesis assay, in which tumor cells are mixed with the matrigel gel (expensive) and injected into the mice, subsequently using immunohistochemistry (IHC) staining (time consuming) with the endothelial marker to indicate the presence of the newly formed capillaries, the main advantages of CAM model are its low cost, simplicity, reproducibility, and reliability. Thus, the CAM can be widely used in vivo to study both angiogenesis and anti-angiogenesis.
Keywords: Chick chorioallantoic membrane Angiogenesis Blood vessel branch
Materials and Reagents
Fertilized E6 chicken embryos (from Poultry Center of South China Agricultural University)
0.1% Benzalkonium Bromide (from Guangzhou Chemical Reagent Factory, diluted in sterile water before use)
Methanol and acetone (1:1 in volume)
Filter-paper disk (Whatman, catalog number: 1441150 )
Packing film (Parafilm)
Equipment
Incubator
Glass slide
Ophthalmic forceps
Procedure
Fertilized E6 chicken embryos (48 ± 5 g) were cleaned with 0.1% Benzalkonium Bromide and preincubated at 37.5 °C in 85% humidity for 2 days.
Egg morphology appears like a meta-ellipse, with a relatively larger side and a smaller one, and the air sac is usually located on the larger side right behind the shell. After disinfection of the shell center outside the air sac with 0.1% Benzalkonium Bromide, a hole highlighted with marker pen was buffed and drilled gently over the air sac with a nipper not to break the shell, and the vascular zone was easy to be identified on the CAM (Figure 1).
Figure 1. The vascular zone of the CAM
Two drops of normal saline were then added to moisten the inner shell membrane adjacent to the CAM so that the membrane was easy to be separated from CAM.
After being clamped and raised by ophthalmic forceps, the membrane and the CAM separated unforcedly, and then a 1 x 1 cm window on the membrane was sectioned to expose the vascular zone.
A 5 mm x 5 mm sterilized filter-paper disks, which were used as a carrier for being directly loaded with indicated concentrations of chemicals or virus, were then directly applied and adhere to the vascular zone with right density of vascular.
Upon sealing the openings with sterile flexible packing film, the eggs were further incubated for indicated periods.
Finally, a mix of methanol and acetone (1:1 in volume) was directly added to immerse and fix the blood vessels of the experiment zone.
After being clamped and raised by ophthalmic forceps, the CAM was easy to be separated from the embryo, and it was cut and spread on glass slide, and the blood vessels were viewed, photographed and quantified by counting the number of blood vessel branch points (Figure 2).
Figure 2. Blood vessel branch points on CAM. Arrow indicates new-formed blood vessel branches.
Acknowledgments
This protocol was adapted from the following published papers: Wen et al. (2013); Chen et al. (2014). This work was supported by The State Key Development Program for Basic Research of China (2009CB 918904, 2013CB945203), National Natural Sciences Foundation of China (30870955, 91029727, 30900555) and Program for New Century Excellent Talents in University (NCET-08-0646).
References
Chen, Z., Zhang, Y., Jia, C., Wang, Y., Lai, P., Zhou, X., Wang, Y., Song, Q., Lin, J., Ren, Z., Gao, Q., Zhao, Z., Zheng, H., Wan, Z., Gao, T., Zhao, A., Dai, Y. and Bai, X. (2014). mTORC1/2 targeted by n-3 polyunsaturated fatty acids in the prevention of mammary tumorigenesis and tumor progression. Oncogene 33(37): 4548-4557.
Wen, Z. H., Su, Y. C., Lai, P. L., Zhang, Y., Xu, Y. F., Zhao, A., Yao, G. Y., Jia, C. H., Lin, J., Xu, S., Wang, L., Wang, X. K., Liu, A. L., Jiang, Y., Dai, Y. F. and Bai, X. C. (2013). Critical role of arachidonic acid-activated mTOR signaling in breast carcinogenesis and angiogenesis. Oncogene 32(2): 160-170.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Chen, Z., Wen, Z. and Bai, X. (2013). In vivo Chick Chorioallantoic Membrane (CAM) Angiogenesis Assays. Bio-protocol 3(18): e913. DOI: 10.21769/BioProtoc.913.
Download Citation in RIS Format
Category
Cancer Biology > Angiogenesis > Drug discovery and analysis > Metabolism
Cancer Biology > Cellular energetics > Cell biology assays > Cell viability
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Laser Capture Microdissection (LCM) of Human Skin Sample for Spatial Proteomics Research
Qiyu Zhang [...] Ling Leng
Mar 5, 2023 929 Views
In vivo Electroporation of Skeletal Muscle Fibers in Mice
Steven J. Foltz [...] Hyojung J. Choo
Jul 5, 2023 497 Views
Cochlear Organ Dissection, Immunostaining, and Confocal Imaging in Mice
Chenyu Chen [...] Dongdong Ren
Jan 20, 2025 1598 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
914 | https://bio-protocol.org/en/bpdetail?id=914&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Homologous Recombination Assay
Yvan Canitrot
Didier Trouche
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.914 Views: 18073
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Cell Biology Dec 2012
Abstract
Repair of double strand break by homologous recombination was examined using U2OS cells or RG37 cells harbouring specific substrate developed by Puget et al. (2005) and Dumay et al. (2006), respectively, to measure the repair of DNA double strand breaks by homologous recombination. The substrate is composed of two inactive copies of the GFP gene. The upstream copy is inactive due to the absence of promoter, the downstream copy present a promoter but is inactivated by the insertion of the sequence coding for the recognition site of the I-SceI enzyme. The substrate is stably expressed in cells after its insertion in the genome and present as a unique copy. The unique DNA double strand break is then induced by the expression of the I-SceI enzyme after cell transfection with a plasmid coding for the I-SceI enzyme.
Keywords: DNA double strand break repair Homologous recombination Human cells DNA repair Genetic instability
Materials and Reagents
U2OS or RG37 cell lines
Note: U2OS are osteosarcoma cells with active p53 pathway, RG37 are SV40-immortalized human fibroblasts with inactive p53 pathway. There are cells harbouring the substrate designed to measure Homology Directed repair. However, any cell line in which the HDR substrate has been inserted can be used.
Culture medium (serum-free medium)
siRNA for gene of interest (for example rad51, its depletion decreases the efficiency of repair of a DNA DSB by homologous recombination)
Plasmid pcDNA3myc-NLS-I-SceI (coding for I-SceI created by Puget et al. (2005))
INTERFERin Transfection Reagent (Ozyme, catalog number: POL409-10 )
JetPEI Transfection Reagent (Ozyme, catalog number: POL101-10 )
Trypsin
Glycerol
SDS
Beta-mercaptoethanol
Bromophenol blue
Laemmli buffer (see Recipes)
Phosphate Buffered Saline (PBS) (see Recipes)
Equipment
35 mm tissue culture plate
Tissue culture set up (e.g. 37 °C, 5% CO2 incubator)
Flow cytometer
Western blotting apparatus
Procedure
Plate 100,000 cells (U2OS or RG37) per 35 mm diameter plate at the end of the afternoon. Cells are cultured in humidified atmosphere in a cell incubator at 37 °C with 5% CO2.
Let attach overnight.
Transfect with siRNA using INTERFERin according to the manufacturer’s instructions. Use 10 nM of siRNA mixed in 200 μl of serum-free medium with 8 μl of INTERFERin.
24 h later, change the medium and transfect with the plasmid coding for I-SceI in order to induce DNA double strand breaks in the GFP copy harboring the I-SceI recognition site. Use 1 μg of plasmid per plate. Transfect using JetPEI according to the manufacturer’s instructions by mixing 1 μg of I-SceI plasmid in 200 μl of NaCl (150 mM) with 2 μl of JetPEI.
In the following morning wash the cells with PBS and change the medium.
Let incubate for 48 h after plasmid transfection.
Harvest cells by trypsin treatment.
Separate cells in two tubes. Use half of the cells to prepare cell extracts by adding Laemmli buffer in order to check siRNA effect and I-SceI expression by Western blotting.
Wash the other half of the cells with PBS.
Resuspend in PBS and analyze by flow cytometry to detect GFP positive cells. GFP positive cells represent the cell population in which the DNA double strand break induced at the I-SceI site has been repaired by homologous recombination. Quantify by examining at least 25,000 events per condition.
Note: First, as a negative control use cells not transfected with the I-SceI plasmid in order to define the window for the detection of negative cells for GFP expression. Then, use a sample of cells transfected with the I-SceI plasmid to obtain a sub population of GFP positive cells that are cells having repaired DNA breaks by homologous recombination (Figure 1).
Figure 1. Example of FACS acquisition. Left panel, the majority of the cells are GFP negative only 0.06% are GFP positive. Right panel, cells transfected with the I-SceI plasmid, we observe the appearance of a population of GFP positive cells 1.8% present in the R3 region.
Recipes
Laemmli buffer
Tris HCl pH 6.8 (60 mM)
10% glycerol
2% SDS
5% beta-mercaptoethanol
0.01% bromophenol blue
Phosphate buffered saline (PBS)
135 mM NaCl
2.5 mM KCl
10 mM Na2HPO4
1.75 mM KH2PO4
Acknowledgments
This protocol was adapted from previous works by Dumay et al. (2006) and Puget et al. (2005). We acknowledge the use of the Toulouse Rio Imaging facilities for flow cytometry analysis. This work was supported by grants from the Ligue Nationale Contre le Cancer (D. Trouche; équipe labellisée), the Association de Recherche contre le Cancer (ARC) as a Programme ARC, the Agence Nationale pour la Recherche (Projet 2011 blanc SVSE8 PinGs), and by an Electricité de France grant (Y. Canitrot).
References
Courilleau, C., Chailleux, C., Jauneau, A., Grimal, F., Briois, S., Boutet-Robinet, E., Boudsocq, F., Trouche, D. and Canitrot, Y. (2012). The chromatin remodeler p400 ATPase facilitates Rad51-mediated repair of DNA double-strand breaks. J Cell Biol 199(7): 1067-1081.
Dumay, A., Laulier, C., Bertrand, P., Saintigny, Y., Lebrun, F., Vayssiere, J. L. and Lopez, B. S. (2006). Bax and Bid, two proapoptotic Bcl-2 family members, inhibit homologous recombination, independently of apoptosis regulation. Oncogene 25(22): 3196-3205.
Puget, N., Knowlton, M. and Scully, R. (2005). Molecular analysis of sister chromatid recombination in mammalian cells. DNA Repair (Amst) 4(2): 149-161.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cancer Biology > General technique > Cell biology assays
Cancer Biology > Genome instability & mutation > Biochemical assays
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Measurement of the Intracellular Calcium Concentration with Fura-2 AM Using a Fluorescence Plate Reader
Magdiel Martínez [...] Walter I. Silva
Jul 20, 2017 32112 Views
SMART (Single Molecule Analysis of Resection Tracks) Technique for Assessing DNA end-Resection in Response to DNA Damage
Angela Altieri [...] Alfano Luigi
Aug 5, 2020 4425 Views
Triacylglycerol Measurement in HeLa Cells
Ximing Du and Hongyuan Yang
Dec 20, 2020 2962 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
915 | https://bio-protocol.org/en/bpdetail?id=915&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Neutral Comet Assay
Elisa Boutet-Robinet
Didier Trouche
Yvan Canitrot
Published: Vol 3, Iss 18, Sep 20, 2013
DOI: 10.21769/BioProtoc.915 Views: 36795
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Cell Biology Dec 2012
Abstract
The Comet assay (or Single Cell Gel Electrophoresis assay) is a sensitive technique to detect DNA damage at the level of an individual cell. This technique is based on micro-electrophoresis of cells DNA content. Briefly, cells are embedded in agarose, lysed and submitted to an electric field, before the staining step with a fluorescent DNA binding dye. Damaged DNA (charged DNA) migrates in this field, forming the tail of a “comet”, while undamaged DNA remained in the head of the “comet”. The following document describes the protocol to realize a neutral comet assay. This assay can be applied to different cell types and has been useful for numerous applications in fields of toxicology or DNA damage and repair.
Keywords: Comet assay Genotoxicity DNA damage
Materials and Reagents
Cells to analyze
Low Melting Point (LMP) Agarose (Sigma-Aldrich, catalog number: A9414 )
Seakem® Agarose (Ozyme, catalog number: LON50004 )
PBS (Ca2+ and Mg2+-free phosphate-buffered saline)
5 N NaOH
0.5 M EDTA disodium salt solution (pH 8)
Trisma base
Triton X-100
N-Lauroylsarcosine (Sigma-Aldrich, catalog number: L5125 )
Dimethylsulphoxide (DMSO)
Absolute ethanol
Ethidium bromide (10 mg/ml)
Trypsin/EDTA
Sodium acetate
Lysis solution (see Recipes)
Electrophoresis solution (see Recipes)
Equipment
Microscope Super Frost plus glass slides
Malassez chamber
Microscope coverslips (22 x 22 mm)
Microscope coverslips (24 x 32 mm)
Centrifuges
Electrophoresis tank: Econo-Submarine (20 cm x 30 cm) (C.B.S. Scientific, USA)
Fluorescence microscope, camera and software (e.g. Nikon Eclipse 50i microscope equipped with a Luca S camera and Komet 6.0 software)
Software
Komet 6.0 software (Andor Technology)
Procedure
Prepare agarose solution and slides.
At least 24 h before the experiments:
Prepare 0.8% solution of Seakem® Agarose in PBS.
Pre-coat Super Frost slides by dipping in a vertical jar containing melted agarose, stirred with a magnetic stirrer and kept at 100 °C (Figure 1).
Figure 1. Coating of the slides with agarose
Drain off the agarose in excess by wiping the back of the slides (Figure 2).
Figure 2. Slides coating with agarose. Removing of the agarose on the back of the slides.
Let the slides dry and then store at room temperature until use.
At least 2 h before the experiments: prepare 0.7% solution of LMP agarose in PBS and place it at 37 °C in a water-bath until use.
Prepare cells
The number of harvested cells can be adjusted according to the size of the cells. Cells could be numbered either by an automated cell counter or a counting chamber (e.g. Malassez chamber).
If cells used are adherent, cells must be carefully detached with trypsin/EDTA and isolated before centrifugation and further use.
Embed cells in LMP agarose (in a dark room):
After cell centrifugation, discard the supernatant and resuspend the pellet of cells (150,000 to 200,000 cells) by gently pipetting with 200 μl of 0.7% LMP agarose.
Lay 65 μl of agarose containing the cells on each pre-coated glass slide.
Immediately cover with a 24 x 32 mm coverslip.
Put the slide on an ice-pack for solidification during 5-10 minutes.
Slide off the coverslip to remove it.
Finally cover with 80 μl of LMP agarose (top agarose layer) and cover again with a 24 x 32 mm coverslip.
Put the slide again on an ice-pack for solidification during 5-10 minutes.
Remove the coverslip.
Lysis and electrophoresis (in a dark room):
Place the slides in lysis solution for at least 1 h at 4 °C.
Wash three times for 5 min with the electrophoresis buffer.
Transfer the slides in the electrophoresis tank filled with electrophoresis solution (Figure 3).
Figure 3. Electrophoresis of the slides. Disposition of the slides in the tank. In this case eight slides are subjected to electrophoresis, four by row.
Proceed to electrophoresis at 18 V (0.5 V/cm) during 1 h.
Wash in PBS for 2 x 5 min.
Dehydration, staining and analysis:
Fix the cells with 2 x 10 min washes in absolute ethanol, air-dry for at least 2 hours at room temperature.
Add 50 μl ethidium bromide (2 μg/ml in water) on the microscope slide and cover with a 22 x 22 mm coverslip for staining.
Analyze the cells: score 50 cells per slide, 2 slides per condition with the fluorescence microscope equipped with a camera and adapted software (Figures 4 and 5).
Figure 4. Representing analysis of each cell
a = head length
b = tail length
% tail DNA = fraction of DNA in the tail
Tail moment = % tail DNA x b
Comet tail length can be calculated by different ways depending on the authors. Tail moment is a common parameter used to characterize the comet. For this, the fraction of DNA in the tail is evaluated by the fluorescence in the tail and divided by the total fluorescence (in the head and in the tail) to be expressed in percentage. Tail moment is the product of % tail DNA and tail length.
Figure 5. Images representing nucleus of undamaged cells, negative for the presence of comet (left panel) and nucleus of damaged cells presenting comet (right panel)
As a positive control, cells irradiated with ionizing radiations at 20 Gy and examined just after irradiation are a good control as shown in the photographs above.
Recipes
Lysis solution
2.5 M NaCl
0.1 M EDTA
10 mM Trizma base (pH 10)
1% N-laurylsarcosine
0.5% Triton X-100
10% DMSO final
Keep at 4 °C
Electrophoresis solution
300 mM sodium acetate
100 mM Tris-HCl (pH 8.3) at 4 °C
Acknowledgments
This protocol was adapted from previously published papers (Courilleau et al., 2012; Olive et al., 1990; Ostling and Johanson, 1984; Ostling and Johanson, 1987; Wojewodzka et al., 2002).
References
Courilleau, C., Chailleux, C., Jauneau, A., Grimal, F., Briois, S., Boutet-Robinet, E., Boudsocq, F., Trouche, D. and Canitrot, Y. (2012). The chromatin remodeler p400 ATPase facilitates Rad51-mediated repair of DNA double-strand breaks. J Cell Biol 199(7): 1067-1081.
Olive, D. M., Johny, M. and Sethi, S. K. (1990). Use of an alkaline phosphatase-labeled synthetic oligonucleotide probe for detection of Campylobacter jejuni and Campylobacter coli. J Clin Microbiol 28(7): 1565-1569.
Ostling, O. and Johanson, K. J. (1984). Microelectrophoretic study of radiation-induced DNA damages in individual mammalian cells. Biochem Biophys Res Commun 123(1): 291-298.
Ostling, O. and Johanson, K. J. (1987). Bleomycin, in contrast to gamma irradiation, induces extreme variation of DNA strand breakage from cell to cell. Int J Radiat Biol Relat Stud Phys Chem Med 52(5): 683-691.
Wojewodzka, M., Buraczewska, I. and Kruszewski, M. (2002). A modified neutral comet assay: elimination of lysis at high temperature and validation of the assay with anti-single-stranded DNA antibody. Mutat Res 518(1): 9-20.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Boutet-Robinet, E., Trouche, D. and Canitrot, Y. (2013). Neutral Comet Assay. Bio-protocol 3(18): e915. DOI: 10.21769/BioProtoc.915.
Courilleau, C., Chailleux, C., Jauneau, A., Grimal, F., Briois, S., Boutet-Robinet, E., Boudsocq, F., Trouche, D. and Canitrot, Y. (2012). The chromatin remodeler p400 ATPase facilitates Rad51-mediated repair of DNA double-strand breaks. J Cell Biol 199(7): 1067-1081.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays > DNA structure and alterations
Cancer Biology > Genome instability & mutation > Biochemical assays > DNA structure and alterations
Cell Biology > Single cell analysis > Cell counter
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Homologous Recombination Assay
Yvan Canitrot and Didier Trouche
Sep 20, 2013 18073 Views
Nucleosome Positioning Assay
Zhongliang Zhao and Holger Bierhoff
May 20, 2017 11067 Views
SMART (Single Molecule Analysis of Resection Tracks) Technique for Assessing DNA end-Resection in Response to DNA Damage
Angela Altieri [...] Alfano Luigi
Aug 5, 2020 4425 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
916 | https://bio-protocol.org/en/bpdetail?id=916&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Staphylococcus aureus Killing Assay of Caenorhabditis elegans
AW Amanda C. Wollenberg
OV Orane Visvikis
AA Anna-Maria F. Alves
JI Javier E. Irazoqui
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.916 Views: 12731
Reviewed by: Fanglian HeLin Fang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Jul 2010
Abstract
The Gram-positive bacterium Staphylococcus aureus is a human pathogen that displays virulence towards the nematode Caenorhabditis elegans. This property can be used to discover genes that are important for virulence in humans, because S. aureus possesses common virulence factors that are used in C. elegans and in humans to cause disease. S. aureus colonizes the C. elegans intestine, establishes an infection, and causes pathogenesis of the intestinal epithelium that ultimately kills the infected animal after 3 to 4 days (Sifri et al., 2003; Irazoqui et al., 2008; Irazoqui et al., 2010). The protocol described here is used to establish the rate of S. aureus-induced C. elegans death, which allows the comparison of wild type and mutant strains and thus ultimately aids in the identification of genes required either for S. aureus virulence or for C. elegans host defense. The assay can also be applied for antimicrobial drug discovery.
Materials and Reagents
S. aureus wild type strain (e.g. the commonly-used NCTC8325 with natural Nal resistance, or its Kan-resistant derivative SH1000, Horsburgh et al., 2002) and/or any mutants of interest.
Note: S. aureus is a potential human pathogen that is classified as a Biosafety Level (BSL) 2 organism.
Please see the Center for Disease Control (CDC) resource http://www.cdc.gov/training/QuickLearns/biosafety/ for information on working under BSL2 conditions, including the use of appropriate personal protection equipment, the use of a biological safety cabinet to contain aerosols, and the autoclaving of all trash.
E. coli strain HT115 expressing cdc-25.1 dsRNA (Ahringer Library, Kamath et al., 2000)
E. coli strain OP50
C. elegans wild type strain (most commonly Bristol N2) and/or any mutants of interest (available from the Caenorhabditis Genetics Center at http://www.cbs.umn.edu/cgc)
Bacto Tryptic Soy Broth (TSB) (BD Biosciences, catalog number: 211825 )
Difco Tryptic Soy Agar (TSA) (BD Biosciences, catalog number: 236950 )
Luria Broth (LB) (MP Biomedicals, catalog number: 3002-021 )
Luria Broth Agar (MP Biomedicals, catalog number: 3002-231 )
Nalidixic acid sodium salt (Nal) (Sigma-Aldrich, catalog number: N4382 )
Carbenicillin disodium salt (Carb) (Sigma-Aldrich, catalog number: C1389 )
5-fluorodeoxyuridine (FUDR) (Sigma-Aldrich, catalog number: F0503 )
Nalidixic Acid (Nal) 1,000x stock solution (10 mg/ml) (see Recipes)
Carbenicillin 1,000x stock solution (100 mg/ml) (see Recipes)
TSB (see Recipes)
LB (see Recipes)
Large TSA + Nal (10 μg/ml) plates (see Recipes)
Large LB + Carb (100 μg/ml) plates (see Recipes)
Killing assay plates (see Recipes)
Nematode growth media (NGM) plates (see Recipes)
RNAi plates (see Recipes)
Equipment
Dissection stereo microscope (e.g. Zeiss, model: Stemi 2000 )
15 °C and 25 °C C. elegans incubators (e.g. Thermo Fisher Scientific, model: 3940 )
37 °C bacterial incubator and shaker
Platinum wire worm pick* and ethanol lamp (Cole-Parmer, catalog number: EW-48585-84 ) for sterile transfer of worms at dissection scope.
*Worm picks can either be purchased (e.g. Genesse Scientific, catalog number: 59-AWP ) or made in the lab. To make a pick, insert a 5 cm segment of 90% platinum/10% iridium wire (Tritech Research, catalog number: PT-9010 ) into the narrow end of a glass Pasteur pipet, melt glass over Bunsen burner flame to fasten wire inside, and flatten the tip of the protruding wire (~5 mm) into a flat “spatula”-like structure using a pair of needle-nose pliers. The handle end of the glass pipet can be inserted into foam tubing (Maddak, catalog number: F766900183 ) for more comfortable manipulation (see Figure 1).
Figure 1. Example of a worm pick made in the lab. The pick consists of platinum wire inserted into a Pasteur pipet, held in foam tubing for easy handling. See text for details.
Software
Microsoft Excel or any other spreadsheet software
GraphPad Prism
Procedure
Before starting
At least one month before “Day 1” (and ideally 2-3 months before):
Prepare killing assay plates (4 ml TSA per 35 x 10 mm plate, final Nal concentration 10 μg/ml) Store plates in a covered box at 4 °C (Nal is light-sensitive).
Note: “Aging” of the killing assay plates – i.e. storage of poured agar plates at 4 °C for at least 1 month prior to the spreading of bacteria – is done in order to slow the rate of S. aureus-induced death, so that differences in killing kinetics can be more readily observed. Spreading S. aureus on freshly-made (non-aged) agar plates and using them immediately for a killing assay will result in very rapid C. elegans death.
Between 1 and 7 days before “Day 2/step 3”:
Streak E. coli HT115 directly from 15% glycerol stock onto an LB + Carb (100 μg/ml) plate.
Grow plate at 37 °C overnight; can use the next day (step 6 below) or keep at 4 °C for at most one week.
Between 1 and 7 days before “Day 5/step 10”:
Streak S. aureus bacteria directly from 15% glycerol stock onto a TSA + Nal (10 μg/ml) plate.
Grow plate at 37 °C overnight; can use the next day (step 13 below) or keep at 4 °C for at most one week.
After starting
Day 1
For each condition to be tested, pick 3-5 young adults onto three different NGM plates that have been seeded with OP50 (see Recipes).
Incubate at 15 °C until Day 5. This ensures approximately 100 L4 animals for each condition at step 15 on Day 5 (i.e. the 3-5 adults will produce 30-40 L4’s per plate, x3 NGM-OP50 plates = approximately 100 L4 animals).
Day 2
Pick one colony from the HT115 cdc-25.1 plate into 5 ml of LB + Carb (100 μg/ml final concentration).
Grow overnight at 37 °C with agitation.
Day 3
For each condition to be tested, spread 200 μl of the HT115 cdc-25.1 overnight culture to 3x RNAi plates (60 mm x 10 mm).
Dry plates (open side up, lids aside) for 30 minutes in the flow hood.
Incubate plates at 25 °C for 48 hours (until Day 5).
Note: Steps 3-7 can also be performed on Days 1/2 or Days 3/4, since HT115 cdc-25.1 needs to be grown on RNAi plates for 24 to 72 hours prior to the addition of C. elegans.
Day 5
For each condition to be tested, pick 35-50 L4 animals from the NGM + OP50 plates to each of the 3 RNAi plates prepared on Day 3 (step 5), for a total of 100-150 L4 animals per condition.
Incubate 24 to 48 hours at 15 °C.
Note: cdc-25.1 is required for germ line mitotic proliferation, and thus targeting cdc-25.1 by RNAi renders the animals infertile (Ashcroft et al., 1999). This step serves to remove potential differences in death rate that are actually due to differences in fertility or egg-laying behavior among different C. elegans genotypes. Make sure the animals are late L4. If picked younger, the RNAi treatment will inhibit gonad development and skew results.
Pick one colony from the S. aureus plate into 5 ml of TSB + NAL (10 μg/ml final concentration).
Grow overnight at 37 °C with agitation.
Day 6
For each condition to be tested, spread 10 μl of the S. aureus overnight culture to 3 (aged) killing assay plates.
Note: S. aureus kills C. elegans best during exponential growth (i.e. the time interval when the bacterial lawn is progressively thickening), so strains with rapid growth should be diluted at this step to make sure they do not create a thick lawn too soon and cause an inhibition of virulence. For example, in our lab we plate 10 μl of undiluted NCTC8325, but we dilute the faster-growing SH1000 (1:1 in TSB media) before plating. It is also important in this step to spread S. aureus fully over the entire plate surface, so that animals cannot avoid the pathogen by crawling off the lawn.
Incubate plates at 37 °C for 4-8 hours.
Dry plates for 30 minutes in the flow hood.
For each condition to be tested, pick 35-50 animals from the HT115 cdc-25.1 plates to each of the 3 killing assay plates prepared in steps 12-14 above.
Notes:
Make sure to transfer as little E. coli as possible, as contaminating E. coli tends to inhibit killing. An alternative approach, that of rinsing animals from the HT115 plates and washing in M9 buffer before pipetting animals to killing assay plates, might eliminate even more E. coli; we do not use this approach because the experience of being placed in liquid, centrifuged, and vortexed triggers a stress response that could potentially confound the pathogen response.
It is critically important that only animals that have gonads are used. Gonadless animals (generated by stronger RNAi) exhibit resistance to killing by pathogens, due to up-regulation of the stress transcription factor DAF-16 (Miyata et al., 2008).
Incubate at 25 °C, ~65-70% humidity.
Note: It is important that plates be neither too dry nor too wet. Low humidity, leading to dry plates, causes cracks in the agar, which distort results and make scoring death more challenging, and may cause the animals to desicate over the course of the experiment. High humidity, leading to condensation on the internal sides of the petri dish, allows animals to travel off the agar and eventually desiccate on the side of the plate (as the condensation fluctuates). In both cases, desiccated animals must be censored, and therefore do not give complete lifespan information (see below).
Following days
Score dead animals twice a day. Data points are ideally collected every 10-12 hours during initial experiments, to determine the timeframe during which survival drops from 100% to 0%; in subsequent experiments, time points should be chosen to focus on this particular time window. Animals should be scored as dead or alive by gently prodding them with the worm pick under a dissecting microscope. Animals that died because of an extruded vulva or crawled off the agar should be counted in a separate category as “censored.” Remove both censored and dead animals from the plate when they are scored, to facilitate the next scoring period, by burning them off the pick.
Enter data into GraphPad Prism or a similar software package to create survival graphs (based on the Kaplan-Meier method). Briefly, use one column for each condition, enter a “0” for a censored animal and a “1” for a dead animal, and enter a corresponding time point in the far-left column for each such event (note that a single time point will thus be entered for many different rows). An example of what the data entry will look like is shown in Figure 2.
Note: Survival data are reported using the full graph (survival over time), rather than using a comparison of survival at a single time point.
Condition 1
Condition 2
Condition 3
Time:
# Censored
# Dead
# Censored
# Dead
# Censored
# Dead
10 h
2
(0)
(0)
(0)
(0)
1
20 h
1
4
(0)
1
2
5
35 h
0
13
1
(0)
1
3
Figure 2. Demonstration of conversion of raw data into Prism survival data. In this example, data are entered for three time points (10, 20, 35 hours) and three conditions, according to the above raw results.
Conduct statistical analyses (i.e. the log-rank test) to determine the significance of any differences in killing kinetics observed between test conditions and the wild type control.
Report the following data along with the survival curve: (i) median survival (MS), as defined by Kaplan-Meier analysis, or Time to 50% Death (LT50), as defined by nonlinear regression, if MS values were skewed by having a small number of time points; (ii) N (total number of animals/censored), and (iii) p value.
Notes: If no C. elegans mutant strain is available, expression of the nematode gene of interest can be down-regulated using an RNAi approach. Use the above protocol with the following modifications:
Step 1: Instead of picking animals to NGM + OP50 plates, transfer them to RNAi plates spread with E. coli strain HT115 expressing dsRNA for the gene of interest (g.o.i). Follow the same steps to prepare the g.o.i. RNAi plates as those described above for cdc-25.1 plates. Note that this will mean carrying out steps 3-7 earlier, to have RNAi plates ready at step 1.
Step 8: Instead of transferring L4 animals to cdc-25.1 RNAi plates for sterilization, transfer them to a new set of g.o.i. RNAi plates containing FUDR (for chemical sterilization). FUDR-containing RNAi plates are made the same way as the other RNAi plates, with the simple addition of 200 μl of 5 mg/ml (50x) FUDR to the top of the lawn 1 hour before animals are transferred to it. Note that the RNAi plates for FUDR should be prepared according to the time frame described in the original protocol for cdc-25.1 plates, so that they are 24 to 72 hours old at step 7 instead of at step 1.
Recipes
Nalidixic Acid (Nal) 1,000x stock solution (10 mg/ml)
200 mg of Nalidixic Acid Sodium Salt
20 ml of ddH2O
5 μl of 10 N NaOH
Vortex, filter, aliquot and store at -20 °C
Carbenicillin 1,000x stock solution (100 mg/ml)
2 g of carbenicillin
20 ml of ddH2O
Vortex, filter, aliquot and store at -20 °C
TSB
30 g of Bacto Tryptic Soy Broth
1 L of ddH2O
Autoclave 15 min at 121 °C
Store at room temperature
LB
25 capsules of Luria Broth (or manufacturer’s instructions)
1 L of ddH2O
Autoclave 15 min at 121 °C
Store at room temperature
Large TSA + Nal (10 μg/ml) plates
40 g of Bacto Tryptic Soy Agar
1 L of ddH2O
Autoclave 15 min at 121 °C
Cool down in a 55 °C water bath
Add 1 ml of NAL 1,000x stock solution
Pour 25 ml of TSA + Nal per 100 x 10 mm plate
Store at 4 °C
Large LB + Carb (100 μg/ml) plates
40 capsules of Luria Broth Agar (or manufacturer’s instructions)
1 L of ddH2O
Autoclave 15 min at 121 °C
Cool down in a 55 °C water bath
Add 1 ml of Carb 1,000x stock solution
Pour 25 ml of LB Agar + Carb per 100 x 10 mm plate
Store at 4 °C
Killing assay plates
40 g of Bacto Tryptic Soy Agar
1 L of ddH2O
Autoclave 45 min at 121 °C
Cool down in a 55 °C water bath
Add 1 ml of Nal 1,000x stock solution
Pour 4 ml of TSA + Nal per 35 x 10 mm tissue culture dish
Store at 4 °C, protected from light
Let the plate age for at least 1 month before use
Nematode growth media (NGM) plates, seeded with OP50
Follow Recipes in Common Worm Media & Buffers (He, Bio-protocol, 2011) to make 60 mm x 10 mm NGM plates
Grow OP50 overnight culture in LB + Strep (190 μg/ml) at 37 °C without agitation
Spot desired amount of O.N. culture to center of plate (~200 μl is standard)
Notes:
a.A wide range of Streptomycin concentrations, i.e. 60-300 μg/ml, may be used.
b.If fungal contamination is a problem, add 1 ml of 1% Nystatin per 1 L of media.
RNAi plates
Follow protocol for RNA Interference (RNAi) by Bacterial Feeding (He, Bio-protocol, 2011), with the following three modifications:
Use more IPTG (5 mM instead of 1 mM).
Use less antibiotic (25-50 μg/ml Carbenicillin instead of 100 μg/ml Ampicillin).
Instead of “spotting” 50 μl of 20x concentrated culture to center of 35 mm plate, evenly spread 200 μl of overnight culture across 60 mm plate.
Acknowledgments
This laboratory protocol is a free adaption of various published and unpublished protocols and has evolved over time (Irazoqui et al., 2010).
References
Ashcroft, N. R., Srayko, M., Kosinski, M. E., Mains, P. E. and Golden, A. (1999). RNA-Mediated interference of a cdc25 homolog in Caenorhabditis elegans results in defects in the embryonic cortical membrane, meiosis, and mitosis. Dev Biol 206(1): 15-32.
Horsburgh, M. J., Aish, J. L., White, I. J., Shaw, L., Lithgow, J. K., and Foster, S. J. (2002). σB modulates virulence determinant expression and stress resistance: characterization of a functional rsbU strain derived from Staphylococcus aureus 8325-4. J Bacteriol 184(19): 5457-5467.
Irazoqui, J. E., Ng, A., Xavier, R. J. and Ausubel, F. M. (2008). Role for beta-catenin and HOX transcription factors in Caenorhabditis elegans and mammalian host epithelial-pathogen interactions. Proc Natl Acad Sci U S A 105(45): 17469-17474.
Irazoqui, J. E., Troemel, E. R., Feinbaum, R. L., Luhachack, L. G., Cezairliyan, B. O. and Ausubel, F. M. (2010). Distinct pathogenesis and host responses during infection of C. elegans by P. aeruginosa and S. aureus. PLoS Pathog 6: e1000982.
Kamath, R. S., Martinez-Campos, M., Zipperlen, P., Fraser, A. G. and Ahringer, J. (2001). Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biol 2(1): RESEARCH0002.
Miyata, S., Begun, J., Troemel, E.R., and Ausubel, F.M. (2008). DAF-16-dependent suppression of immunity during reproduction in Caenorhabditis elegans. Genetics 178 (2): 903-918.
Sifri, C. D., Begun, J., Ausubel, F. M. and Calderwood, S. B. (2003). Caenorhabditis elegans as a model host for Staphylococcus aureus pathogenesis. Infect Immun 71(4): 2208-2217.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbe-host interactions > In vivo model
Immunology > Host defense > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Amplex Red Assay for Measuring Hydrogen Peroxide Production from Caenorhabditis elegans
Ozgur Karakuzu [...] Danielle A. Garsin
Nov 5, 2019 10714 Views
Phytophthora infestans (Late blight) Infection Assay in a Detached Leaf of Potato
Hari S. Karki and Dennis A. Halterman
Feb 20, 2021 5665 Views
Brain-localized and Intravenous Microinjections in the Larval Zebrafish to Assess Innate Immune Response
Alison M. Rojas and Celia E. Shiau
Apr 5, 2021 4807 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
917 | https://bio-protocol.org/en/bpdetail?id=917&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Hydroxyproline Assay Using NaBr/NaOCl
Derek T. A. Lamport
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.917 Views: 9941
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in New Phytologist Jan 2013
Abstract
Hydroxyproline (Hyp) is a major constituent of a relatively few proteins that are major structural components of the extracellular matrix and primary cell wall of animals and plants respectively. Significant amounts of the cyclic amino acids proline and hydroxyproline decrease polypeptide flexibility; thus proline/hydroxyproline-rich proteins are ideal scaffold components. Collagens typify animal tissues but extensins, arabinogalactan proteins (AGPs) and their close relatives, collectively referred to as hydroxyproline-rich glycoproteins (HRGPs), typify plants (Lamport et al., 2011). While collagens are minimally glycosylated generally via a galactosyl hydroxylysine linkage, plant HRGP glycosylation involves short neutral oligosaccharides (in extensins) or much larger acidic polysaccharide substituents (in AGPs) O-linked via the hydroxyproline hydroxyl group. Hydroxyproline assay is thus an integral part of their characterization and dominates the biochemical properties of these glycoproteins. The colourimetric assay described here quantifies free hydroxyproline (e.g. released by acid hydrolysis) based on Kivirikko and Liesmma (1959) with hypobromite as an oxidant but modified by avoiding the use of hazardous liquid bromine. A number of oxidants have been used over the years, Vogel (1961, page 395) explains the preference for hypobromite as follows: “Hypochlorites tend to react slowly with reducing agents. Hypobromites although rather unstable when prepared directly from bromine and alkali, often react more rapidly; it is therefore advantageous to produce hypobromite in situ by adding an excess of bromide to the sample of hypochlorite:” OCl- + Br- → OBr- + Cl- “By this means the relative stability of hypochlorite is combined with the more effective oxidizing properties of hypobromite.”
Materials and Reagents
NaOCl (Lab bleach)
NaOH
NaBr
6 N HCl
Dilute hypobromite
p.dimethylaminobenzaldehyde (Sigma-Aldrich, catalog number: 156477 )
n.propanol (Sigma-Aldrich, catalog number: 402893 )
Equipment
2 ml screw-cap microtube (SARSTEDT AG)
Microplate reader or spectrophotometer
Procedure
Prepare dilute sodium hypobromite (NaOBr) from NaOCl, mix equal volumes (a) + (b) (e.g. 5 ml each) (prepare fresh weekly-store at 4 °C).
Add 775 μl lab bleach to 10 ml 4% NaOH (fresh weekly).
Prepare 100 mM NaBr (1.03 g in 100 ml 4% NaOH) (stable).
Add 250 μl aqueous sample to 2 ml screw-cap microtubes (e.g. SARSTEDT AG).
Add 500 μl dilute hypobromite to:
Analysis samples each in 250 μl distilled water.
Hyp standards of 2.5, 5.0, 7.5 and 10 μg, each in 250 μl distilled water.
A reagent blank contains reagents plus an additional 250 μl distilled water.
Mix and leave for 5 min to oxidize at room temperature.
Add 250 μl 6 N HCl.
Add 500 μl 5% p.dimethylaminobenzaldehyde in n.propanol (total volume = 1.5 ml).
Mix and heat at 70 °C for 15 min, then cool in ice-water.
Measure absorbancy of samples and standards at 560 nm against the reagent blank. e.g. 10 μg Hyp → ~680 mAUs
Construct the standard curve and calculate sample values by interpolation.
Recipes
This assay determines free hydroxyproline, best prepared by hydrolysis peptide bonds in the sample to be analysed (6 N HCl at 110 °C for 18 h) followed by removal of HCl in vacuo and redissolving the hydrolysate in distilled water. Interestingly free O-glycosylated Hyp can be assayed directly.
Use aqueous Hyp standards over a 2.5 to 10 μg range. It is convenient to prepare a Hyp standard of 100 μg/ml in distilled water stored frozen; mix well after thawing! The reagent blank contains all the reagents with distilled water as a substitute for the sample.
5% w/w p.dimethylaminobenzaldehyde in n-propanol.
Acknowledgments
This protocol is adapted from Kivirikko and Liesmaa (1959) and Lamport et al. (2012).
References
Kivirikko, K. I. and Liesmaa, M. A. (1959). A colorimetric method for determination of hydroxyproline in tissue hydrolysates. Scandinavian J Clin Lab 11(2): 128-133.
Lamport, D. T., Kieliszewski, M. J., Chen, Y. and Cannon, M. C. (2011). Role of the extensin superfamily in primary cell wall architecture. Plant Physiol 156(1): 11-19.
Vogel, A. I. (1961). A text-book of quantitative inorganic analysis. 1-1216, Third Edition. Publisher: Longmans.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Lamport, D. T. A. (2013). Hydroxyproline Assay Using NaBr/NaOCl. Bio-protocol 3(19): e917. DOI: 10.21769/BioProtoc.917.
Download Citation in RIS Format
Category
Biochemistry > Protein > Modification
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Modeling Perturbations in Protein Filaments at the Micro and Meso Scale Using NAMD and PTools/Heligeom
Benjamin Boyer [...] Chantal Prévost
Jul 20, 2021 2436 Views
Protocol for Spontaneous and Chaperonin-assisted in vitro Refolding of a Slow-folding Mutant of GFP, sGFP
Anwar Sadat [...] Koyeli Mapa
Jul 20, 2021 2390 Views
Optimizing Transmembrane Protein Assemblies in Nanodiscs for Structural Studies: A Comprehensive Manual
Fernando Vilela [...] Dorit Hanein
Nov 5, 2024 558 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
918 | https://bio-protocol.org/en/bpdetail?id=918&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Arabinogalactan Glycoproteins from Plant Tissue
Derek T. A. Lamport
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.918 Views: 11291
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in New Phytologist Jan 2013
Abstract
This supplements an earlier protocol (Popper, 2011) for the extraction and assay of cell surface arabinogalactan proteins (AGPs). These highly glycosylated glycoproteins (~95% carbohydrate) contain numerous glycomodules with paired glucuronic acid residues that bind Ca2+ in a pH dependent manner (Lamport and Varnai, 2013). Classical AGPs comprise the bulk of cell surface glycoproteins and are thus integral components of a Ca2+ oscillator involved in a signalling pathway where calcium is a “universal signalling currency” analogous to ATP as the universal energy currency. The central role of these peripheral glycoproteins is thus reason enough for their further study. However, problems arise due to the extensive glycosylation and its apparent microheterogeneity generally assumed to preclude a simple reductionist approach.
Here I describe a simple partial purification of classical AGPs based on their specific interaction with the β-D-glucosyl or galactosyl Yariv reagent, a synthetic diazo dye that precipitates AGPs as an insoluble complex in salt solutions at neutral pH. (The solubility of this complex in dilute alkali provides a rapid sensitive quantitative assay for AGPs.) Reduction of the Yariv diazo linkage releases soluble AGPs for further analysis. For example deglycosylation of AGPs in anhydrous hydrogen fluoride followed by column chromatography yields just a few major AGP polypeptides purified to homogeneity (Zhao et al., 2002). However, purification of individual AGP glycoproteins to homogeneity is rarely achieved (Darjania et al., 2002); not only do the closely related AGP glycosylation profiles vastly outweigh any contribution from the amino acid composition but the glycan polydispersity made isolation of a single molecular entity well-nigh impossible until AGPs genetically engineered with a hydrophobic green fluorescent protein tag allowed chromatographic purification (Zhao et al., 2002). New approaches to AGP fractionation into discrete classes is now also a distinct possibility based on their calcium content hitherto ignored!
[Principle] Disrupted plant tissues release soluble AGPs that can be precipitated as their Yariv complex. This procedure yields mainly classical AGPs; these comprise the bulk of cell surface AGPs. Extraction with CaCl2 rather than the more usual NaCl has two advantages:
It results in Ca2+ tightly bound by the glucuronic acid residues (Lamport and Varnai, 2013) at > pH 4.5 thus enhancing AGP solubility after its release from the insoluble Yariv complex.
It removes pectin as insoluble calcium pectate crosslinked by intermolecular Ca2+ bridges while AGPs with intramolecular Ca2+ remain soluble.
Materials and Reagents
Tobacco BY-2 cells or other plant tissue
Liquid nitrogen
CaCl2 (2% w/v)
Distilled water
Na metabisulphite (Sigma-Aldrich, catalog number: S-1256 )
Dialysis tubing 12 kDa MW cutoff (3.2 cm flat width) (Sigma-Aldrich, catalog number: D-0530 )
Superose-6, 10/300 GL (GE Healthcare, catalog number: 17-5172-01 )
Hydroxyproline
Glucuronic acid
Gum arabic (Sigma-Aldrich, catalog number: G-9752 )
NaCl
NaOH
Yariv reagent (Biosupplies Australia Pty, catalog number: 100-2 ) (see Recipes)
Equipment
Blender/coffee mill
Minifuge centrifuge
2 ml Sarstedt tube (with screw cap)
Spectrophotometer or microplate reader
Mass spectroscope
Microfuge
Fine-tip pipette
Fine tip sonic probe
Block heater
Procedure
Freeze ~10 to 100 g plant tissue in liquid nitrogen.
Pulverise frozen fresh tissue to a fine powder in a cold blender/coffee mill.
Stir tissue in 2% w/v CaCl2 for 2-3 h at RT (2 ml for each gram of tissue).
Centrifuge 30 minutes at ~10,000 x g (e.g. minifuge at RT)。
Assay 10, 50 and 100 μl aliquots to estimate total AGP in extract (see Notes).
Add a slight excess (see Notes) of Yariv reagent to the remaining extract.
Allow to precipitate at least 1 h or overnight at RT.
Collect precipitate by low speed centrifugation (10 min at 2,000 x g).
Resuspend precipitate in 1.5 ml distilled water.
Transfer to 2 ml Sarstedt tube (with screw cap).
Add ~25 mg Na metabisulphite (final conc. 70 mM) to reduce the diazo linkage (top up with H2O to exlude oxygen which otherwise results in the formation of elemental sulfur).
Cap tube tightly and heat at ~50 °C until decolourised (5-20 min).
Transfer to small (~5 ml) dialysis bag; stir overnight at RT in 500 ml distilled H2O and change H2O three times.
Freeze dialysate in liquid nitrogen, lyophilise, then and weigh the product. (AGP yields vary from 30-300 μg AGP/g fresh weight depending on tissue source) (see Notes).
Validate classical AGPs by size and composition:
Gel filtration on Superose-6 (Lamport, et al., 2006).
Hydroxyproline content (Kivirikko and Liesmaa, 1959).
Uronic acid content (Blumenkrantz and Asboe-Hansen, 1973).
Bound calcium via colourimetry (Gindler and King, 1972) or ICPMS (inductively coupled plasma mass spectroscopy) (Lamport and Varnai, 2013).
Amino acid and sugar analyses.
Notes
Arabinogalactan protein assay via Yariv reagent.
All steps at RT.
Add test samples to Eppendorf microfuge tubes.
Make up to ~500 μl in 1% CaCl2.
Use 10 and 20 μg gum arabic as AGP "standards" as follows:
Add 10 μl gum arabic (1 mg/ml) to 500 μl 1% CaCl2
Add 20 μl gum arabic (1 mg/ml) to 500 μl 1% CaCl2
Use 500 μl 1% CaCl2 as a reagent blank.
Then to each tube:
Add 200 μl β-D-Galactosyl-Yariv reagent (1 mg/ml in 2% CaCl2)
Or use β-D-Glucosyl-Yariv reagent – choice depends on availability.
Mix well and leave for at least 30 min at room temperature.
Spin 10 min at ~15,000 x g in microfuge.
With CARE use fine-tip pipette to remove & discard supernate.
Wash pellet twice with 1 ml 2% CaCl2.
Add 1 ml 20 mM NaOH.
Shake vigorously to dissolve pellet or sonicate 10-20 sec with fine tip probe or in a sonic bath. If solution is turbid, spin at ~15,000 x g to clarify.
Read A457 nm against reagent blank within an hour or so. A457 avoids phenolic interference when eluting Yariv from intact BY-2 cells; for general assays read at 440 nm.
Plot "standard curve" and calculate unknowns as μg AGP/tube.
Note: Gum arabic quantification is only an approximation as each AGP binds different amounts of Yariv.
As a general guide, however, a given weight of Yariv reagent will precipitate the same weight of AGP. So for AGP isolation a 10% excess of Yariv reagent generally suffices to precipitate all the AGP.
AGP cellular distribution (background information):
Classical AGPs are essential glycoproteins distributed in three cell surface compartments: bound to the outer surface of the plasma membrane by a GPI anchor; soluble in the periplasm; and "bound" or trapped in the wall matrix.
Thus AGP cellular distribution T = M + S + W (Lamport et al., 2006)
M = AGPs bound to plasma membrane
S = Soluble AGPs released by cell disruption
W = AGPs bound to cell wall
Table 1. Total of AGPs in tobacco BY-2 cells. In tobacco BY-2 cells, T = 600 μg AGPs g fresh weight.
BY-2 cells
(data in 6)
T Total
M Membrane bound
S Soluble periplasmic
W Wall bound
Salt-adapted*
600
60
354
186
Control
600
210
282
108
* AGPs upregulated by high salt appear in the growth medium.
Recipes
Preparation of Yariv reagent (1,3,5-tri-(p-β-D-galactosyloxyphenylazo)-2,4,6-trihydroxybenzene) or the β-D-glucosyl derivative
Dissolve 100 mg β-D-galactosyl Yariv in 100 ml 2% w/v CaCl2
Acknowledgments
This protocol is adapted from Popper (2011), Lamport and Varnai (2013) and Lamport et al. (2006).
References
Blumenkrantz, N. and Asboe-Hansen, G. (1973). New method for quantitative determination of uronic acids. Anal Biochem 54(2): 484-489.
Darjania, L., Ichise, N., Ichikawa, S., Okamoto, T., Okuyama, H. and Thompson Jr, G. A. (2002). Dynamic turnover of arabinogalactan proteins in cultured Arabidopsis cells. Plant Physiol Biochem 40(1): 69-79.
Gindler, E. and King, J. (1972). Rapid colorimetric determination of calcium in biologic fluids with methylthymol blue. Am J Clin Pathol 58(4):376-82.
Kivirikko, K. I. and Liesmaa, M. A. (1959). A Colorimetric method for determination of hydroxyproline in tissue hydrolysates. Scandinavian J Clin Lab 11(2):128-133.
Lamport, D. T. and Varnai, P. (2013). Periplasmic arabinogalactan glycoproteins act as a calcium capacitor that regulates plant growth and development. New Phytol 197(1): 58-64.
Lamport, D. T., Kieliszewski, M. J. and Showalter, A. M. (2006). Salt stress upregulates periplasmic arabinogalactan proteins: using salt stress to analyse AGP function. New Phytol 169(3): 479-492.
Popper, Z. A. (2011). Extraction and Detection of Arabinogalactan Proteins in The Plant Cell Wall - Methods and Protocols, edited by John M. Walker. Humana Press, New York, pp.245-254.
Qi, W., Fong, C. and Lamport, D. T. (1991). Gum arabic glycoprotein is a twisted hairy rope: a new model based on o-galactosylhydroxyproline as the polysaccharide attachment site. Plant Physiol 96(3): 848-855.
Zhao, Z. D., Tan, L., Showalter, A. M., Lamport, D. T. and Kieliszewski, M. J. (2002). Tomato LeAGP-1 arabinogalactan-protein purified from transgenic tobacco corroborates the Hyp contiguity hypothesis. Plant J 31(4): 431-444.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Lamport, D. T. A. (2013). Preparation of Arabinogalactan Glycoproteins from Plant Tissue. Bio-protocol 3(19): e918. DOI: 10.21769/BioProtoc.918.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Protein > Isolation and purification
Biochemistry > Carbohydrate > Glycoprotein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Analysis of Pectin-derived Monosaccharides from Arabidopsis Using GC–MS
Patricia Scholz [...] Athanas Guzha
Aug 20, 2023 508 Views
A Simple Sonication Method to Isolate the Chloroplast Lumen in Arabidopsis thaliana
Jingfang Hao and Alizée Malnoë
Aug 5, 2023 597 Views
A Simple, Rapid, and Cost-Effective Method for Assessing Carbohydrate Partitioning in Microalgae and Arabidopsis thaliana
Araceli N. Bader [...] Leonardo Curatti
Dec 5, 2024 271 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
919 | https://bio-protocol.org/en/bpdetail?id=919&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
LDH-A Enzyme Assay
DZ Di Zhao
YX Yue Xiong
QL Qun-Ying Lei
KG Kun-Liang Guan
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.919 Views: 14537
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Cell Apr 2013
Abstract
LDH (Lactate dehydrogenase) enzyme catalyzes the reversible conversion of pyruvate to lactate using NAD+ as a cofactor. Although the physiological significance of lactate accumulation in tumor cells, a dead-end product in cellular metabolism, is currently a topic of debate, it has long been known that many tumor cells express a high level of LDH-A (Koukourakis et al., 2003; Koukourakis et al., 2006; Koukourakis et al., 2009). So detection of its enzyme activity in vitro is important for researching on LDH-A. Recently, it has been reported that Lys-5 acetylation could decrease LDH-A enzyme activity (Zhao et al., 2013).
Keywords: LDH Enzyme activity Lactate NAD+
Materials and Reagents
293T cells
DMEM + 10% NCS
Aprotinin (BBI Solutions, catalog number: AD0153-50mg )
Leupeptin (AMRESCO, catalog number: J580-25MG )
Pepstatin (AMRESCO, catalog number: J583 )
PMSF (Sangon Biotech, catalog number: P0754-5g )
Tris-HCl (pH 7.3) (Sangon Biotech)
250 μg/ml Flag peptide (in PBS buffer) (GL Biochem, sequence: DYKDDDDK)
Pyruvate (Sigma-Aldrich, catalog number: 80443 )
NADH (Sigma-Aldrich, catalog number: N8129 )
Flag-beads (Sigma-Aldrich, catalog number: M8823 )
Lipofectamine 2000 (Invitrogen)
Reaction buffer (see Recipes)
0.3% NP-40 buffer (Lysis buffer) (see Recipes)
Equipment
F-4600 Fluorescence Spectrophotometer
37 °C, 5% CO2 incubator
90 mm cell culture plate
Procedure
Prepare LDH-A protein. You could ectopically overexpress and purify it from E. coli, or ectopically express Flag-LDH-A plasmid in 293T cells, followed by immunoprecipitation by Flag-beads and eluted using Flag peptide.
293T cells were cultured in DMEM + 10% NCS, in 5% CO2 incubator at 37 °C. Cell transfection was performed using Lipofectamine 2000 or calcium phosphate methods. 2 μg plasmids was transfected into 90 mm plate of 293T cells. And cells were cultured for 30 hours after transfection.
Cells ectopically expressed Flag-LDH-A were lysated by 0.3% NP-40 buffer (lysis buffer) with protein degradation inhibitors by shaking gentally at 4 °C for half an hour.
Cell lysate was centrifuged 4 °C for 15 min (16,000 x g) and the supernatant was incubated with 10 μl (per 90 mm plate of 293T cells) Flag-beads for 3 hours at 4 °C by rotation slowly.
And then flag-beads were washed and centrifuged at 4 °C for 1 min (400 x g) by 1 ml 0.3% NP-40 buffer for 3 times, and incubated with 250 μg/ml of flag peptide (200 μl per 90 mm plate of 293T cells) shaking for one hour, followed by centrifuge at 16,000 x g for 5 min. The supernatant was used for enzyme activity detection.
Prepare the reaction buffer containing 0.2 M Tris-HCl (pH 7.3), 30 mM pyruvate and 6.6 mM NADH.
For every reaction, 10 μl LDH-A enzyme solution and 290 μl reaction buffer are added into the measuring cup of F-4600 Fluorescence Spectrophotometer, and detect the fluorescence change in absorbance (340 nm) resulting from NADH oxidation at room temperature.
Note: The reaction system could be adjusted according to your LDH-A solution concentration. And the reaction is very quick, please detect the change as soon as possible.
After a reaction, the software will show the slope of fluorescence change, and this value is the speed of this reaction.
Recipes
Reaction buffer
0.2 M Tris-HCl (pH 7.3)
30 mM pyruvate
6.6 mM NADH
0.3% NP-40 buffer (Lysis buffer)
50 mM Tris-HCl (pH 7.5)
150 mM NaCl
0.3% Nonidet P-40
1 μg/ml aprotinin
1 μg/ml leupeptin
1 μg/ml pepstatin
1 mM PMSF
Acknowledgments
This protocol has been adapted from the previously published paper Zhao et al. (2013) and is described in further detail. We thank the members of the Fudan MCB laboratory for discussions throughout this study. We also thank Dr. Liming Wei for the IEF assay. This work was supported by the Chinese Ministry of Sciences and Technology 973 (Grant No. 2009CB918401, 2011CB910600), (Grant No. NCET-09-0315), NSFC (Grant No.31271454, 81225016) and NSFC-NIH (Grant No. 81110313). This work was also supported by Chinese Ministry of Education 985 Program, 100 Talents Program of Shanghai Health and Scholar of “Dawn” Program of Shanghai Education Commission and Shanghai Key basic research program(12JC1401100) to Q.Y.L. and NIH grants (Y.X. and K.L.G.); and the Fudan University Medical School Graduate Student Ming Dao Project Funds (D.Z.). This work is dedicated to the memory of Zhen Yu, who prepared the K5 acetylation antibody.
References
Koukourakis, M. I., Giatromanolaki, A., Sivridis, E., Bougioukas, G., Didilis, V., Gatter, K. C., Harris, A. L., Tumour and Angiogenesis Research, G. (2003). Lactate dehydrogenase-5 (LDH-5) overexpression in non-small-cell lung cancer tissues is linked to tumour hypoxia, angiogenic factor production and poor prognosis. Br J Cancer 89(5): 877-885.
Koukourakis, M. I., Giatromanolaki, A., Sivridis, E., Gatter, K. C., Harris, A. L. and Tumour Angiogenesis Research, G. (2006). Lactate dehydrogenase 5 expression in operable colorectal cancer: strong association with survival and activated vascular endothelial growth factor pathway--a report of the Tumour Angiogenesis Research Group. J Clin Oncol 24(26): 4301-4308.
Koukourakis, M. I., Kontomanolis, E., Giatromanolaki, A., Sivridis, E. and Liberis, V. (2009). Serum and tissue LDH levels in patients with breast/gynaecological cancer and benign diseases. Gynecol Obstet Invest 67(3): 162-168.
Zhao, D., Zou, S. W., Liu, Y., Zhou, X., Mo, Y., Wang, P., Xu, Y. H., Dong, B., Xiong, Y., Lei, Q. Y. and Guan, K. L. (2013). Lysine-5 acetylation negatively regulates lactate dehydrogenase A and is decreased in pancreatic cancer. Cancer Cell 23(4): 464-476.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cancer Biology > Cellular energetics > Biochemical assays
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
An Automated pre-Dilution Setup for Von Willebrand Factor Activity Assays
Tobias Schachinger [...] Peter L. Turecek
Sep 5, 2024 338 Views
Measurement of the Activity of Wildtype and Disease-Causing ALPK1 Mutants in Transfected Cells With a 96-Well Format NF-κB/AP-1 Reporter Assay
Tom Snelling
Nov 20, 2024 270 Views
Quantitative Measurement of the Kinase Activity of Wildtype ALPK1 and Disease-Causing ALPK1 Mutants Using Cell-Free Radiometric Phosphorylation Assays
Tom Snelling
Nov 20, 2024 254 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
92 | https://bio-protocol.org/en/bpdetail?id=92&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Yeast Transcription Factor Chromatin Immunoprecipitation
Wei Zheng
In Press
Published: Jul 5, 2011
DOI: 10.21769/BioProtoc.92 Views: 13339
Ask a question
Favorite
Cited by
Abstract
This ChIP protocol was developed and improved over the years by various researchers in the Snyder lab, Stanford University, especially Anthony Borneman and Christopher Yellman. I have used this method to successfully map the genome-wide binding of transcription factors Ste12. The ChIPed DNA is suitable for downstream analysis using PCR, microarray or sequencing.
Materials and Reagents
500 ml of log-phase yeast cell culture per ChIP (at -0.9 x 107 cells/ml, ~4.5 x 109 cells per sample)
37% formaldehyde
2.5 M glycine in H2O (heat sterilized)
Liquid nitrogen, dry ice/ethanol bath or -70 °C freezer
0.5 mm Zirconia/Silica Beads (Bio Spec Products, catalog number: 11079105z )
Commercial protease inhibitor cocktails, for example:
Roche Complete protease inhibitor cocktail tablets (F. Hoffmann-La Roche, catalog number: 11697498001 )
Roche Complete Mini protease inhibitor cocktail tablets (F. Hoffmann-La Roche, catalog number: 11836153001 )
EZview anti-Myc affinity gel (red colored beads) (Sigma-Aldrich, catalog number: E6654 )
Minelute kit for final DNA purification (QIAGEN, catalog number: 28004 )
LiCl
NaOAc
Ethanol
Triton X-100
TE
NaCl
EDTA
Isopropanol
NP-40
Na-deoxycholate
SDS
Tris-buffered saline (TBS) (10x stock) (see Recipes)
Lysis/IP buffer (see Recipes)
Lysis buffer/500 mM NaCl (see Recipes)
IP wash solution (see Recipes)
TE/1% SDS (100 ml) (see Recipes)
TE/0.67% SDS (100 ml) (see Recipes)
TE (100 ml) (PH 8.0) (see Recipes)
1 mM PMSF (Fluka, catalog number: 93482 ) (see Recipes)
Equipment
Millipore stericup sterile vacuum filter units, 500 ml funnel, 0.22 μm or 0.45 μm pore size (EMD Millipore, catalog number: SCGVU05RE , SCHVU11RE )
Syringe needle (BD Biosciences, catalog number: 305155 or 305156 )
5 ml snap-cap tubes, polypropylene (preferred) or polystyrene (BD Biosciences, Falcon®)
15 and 50 ml conical polypropylene screw-top tubes (BD Biosciences, Falcon®)
Branson Sonifier 250 with microtip or Digital Sonifier S-450D (BD Biosciences)
Refrigerated tabletop centrifuges, e.g. Beckman GS-6R, GS-15R (Beckman Coulter), or Eppendorf refrigerated multipurpose centrifuges (EppendorfTM, model: 5810R and 5804R ) (or simply put an ordinary tabletop centrifuge in the cold room)
Fume hood
FastPrep machine (FastPrep, catalog number: 6004500 )
Hemacytometer
Spectrophotometer
Procedure
Day 0
Set up the experiment.
Each IP is from 500 ml of cells in mid-log phase at OD600 of ~0.6, a density of ~0.9 x 107 cells/ml. The total number of cells per IP is ~4.5 x 109, and the total cell weight per sample should be 0.2-0.25 g.
Note: Other ChIP protocols specify 100 ml of cells at 107 cells/ml, or 109 total cells. If in doubt about cell number (for example when dealing with clumpy yeast strains), use a hemacytometer to count cells instead of using the spectrophotometer.
Grow cells under the desired conditions
Growth conditions for inducing pheromone response transcription are described in Zheng et al. (2010).
Treat the cells with formaldehyde to crosslink proteins and DNA
In a fume hood, add 37% formaldehyde to the cells to a final concentration of 1% (use 14 ml formaldehyde). Maintain the cells at room temperature (RT) for 15 min, swirling occasionally to mix. Effective fixation conditions vary according to the protein that will be immunoprecipitated. The simplest way to optimize this variable is to change (in most cases increase) the fixation time.
Quench the crosslinking reaction with glycine
Add 2.5 M glycine to a final concentration of 125 mM (a 20x dilution, so add 27 ml). Incubate the samples for 5 min at RT with occasional mixing.
Collect and wash the cells
Collect the cells by filtration using a 0.45 or 0.22 μm filter. Wash the cells twice on the filter with 100 ml of water at RT. Rinse the cells from the filter using 20 ml of water and transfer them to a 50 ml polypropylene tube. Repeat the rinse to collect residual cells.
Spin at 4,000 rpm for 5-25 min to pellet the cells and discard the supernatant. Resuspend the cells in 1 ml of water and transfer them to a 2 ml screw cap tube (for later lysis). Spin the cells down in a microcentrifuge (3 min at max rpm) and thoroughly remove the supernatant. Weigh the samples at this point. Each 500 ml culture should yield 0.2-0.25 g of cells. Add 1 ml of zirconium beads to each sample to prepare it for the lysis step. Keep the samples on ice or freeze them for storage. Process the experimental replicates separately from here forward.
Notes:
It is a good idea to check the total weight of cells recovered. Cell weight can be strain dependent and differs significantly between haploids and diploids.
The cells can be kept on ice for several hours at this point or frozen for storage. Putting the samples directly into a -70 °C freezer works well.
Day 1
Prepare lysis/IP buffer with protease inhibitors
Prepare 6 ml of lysis/IP buffer for each sample of cells and some extra for equilibrating the antibody beads (50 ml for 6 ChIPs works). Use Roche complete protease inhibitor pellets, which will treat 50 ml of buffer. When using the tablets, it is still necessary to add PMSF. Add 0.75 ml of lysis/IP buffer with protease inhibitors to each sample tube.
Note: It is best to add PMSF last, just before using the buffer, since it is unstable in aqueous solutions, with a half-life of ~35 min at pH 8.
Lyse the cells with cubic zirconium beads
Perform all manipulations in an ice/water bath. Disrupt the cells with the FastPrep machine, using a total of five 1 min bursts at speed 6.0 (additional rounds only if needed). After each burst, immerse the samples in ice water for a minute or so to keep them cold.
Note: Examine the cells under the microscope to check for effective lysis. The number of lysed cells should approach 100%.
Recover the crude lysate
Prepare a Falcon Sml snap-cap tube for each sample. Place the 2 ml lysis tube top-down on the benchtop. Heat a syringe needle to red hot in a flame and use it to pierce the bottom of each sample tube. Put the 2 ml tube about 1 cm into a 5 ml Falcon tube, where it should rest snugly. Centrifuge in a tabletop (preferably chilled) for 1 min at 1,500 rpm, bringing the lysate down into the Falcon tube. Add 0.75 ml of cold lysis buffer to each tube to wash the beads and spin again. Transfer the lysate to a 15 ml conical tube (good for sonication), and add 2.4 ml of lysis buffer. Total lysate volume should be ~4 ml.
Sonicate the lysate to shear chromatin
Shear the chromatin by sonicating the suspension with a Branson 2S0 Sonifier fitted with a microtip. Use the sonifier at amplitude 6 and 100% duty cycle. Sonicate each sample 5 times for 30 sec each time. Hold the tube in a small beaker of ice/water while sonicating. Between sonications chill the samples in ice/water for at least 2 min. Also chill the sonifier tip in ice water periodically (after 18x sonications) to keep it from getting too hot. If using the Digital Sonifier S-450, use 15 times for 10 sec each to avoid overheating. Set total run time as 2 min 30 sec, amplitude 50%, pulse on 10 sec, pulse off 1 min. Hold the tube in a small beaker of ice/water. Preferably the whole procedure is done in a cold room. The average length of DNA post-sonication should be 500 bp, with a range of 100-1,000 bp.
Notes:
Sonication should be monitored and adjusted to yield the desired average DNA length as described in Notes section.
Clean the sonicator tip after use.
A suggested routine is to dip the probe in 0.1 % SDS, then water, spray it with ethanol and dry it with a kimwipe tissue.
Remove cell debris from the lysate by centrifugation
Centrifuge the lysates at 3,000 rpm in a refrigerated tabletop centrifuge for 5 min at 4 °C, remove the supernatant and divide it into two 2 ml microcentrifuge tubes. Spin in a cooled microcentrifuge at 14,000 rpm for 10 min, remove the supernatants, and pool the two lysates into a fresh 15 ml conical tube. The lysates are now ready to use for IP, and one can save aliquots at this point for analysis of total chromatin and protein. This is often used as input control.
Note: Avoid carrying over any aggregated debris by staying away from the pellet, sacrificing ~50 μl of lysate. Improper performance of this step is a likely source of contamination.
Immunoprecipitate the protein of choice
Wash the antibody-coupled beads carefully to eliminate any free antibody (see note). Add 400 μl of Myc-coupled beads (20% suspension, so ~80 μl bead volume) to each IP sample using a 1 ml pipette tip that has been cut off to increase the bore. Bring the total volume of each IP up to 5 ml with buffer. Incubate overnight (12-20 h) on a rocker at 4 °C.
Note: When using any antibody-coupled bead, follow the supplier's recommended bead prewash procedure to avoid bringing along free antibody. To wash an entire bottle of 50% Sigma anti-Myc bead suspension, remove the beads from the supplier's bottle with a 1 ml pipette and follow with 2 washes of 2 ml of lysis buffer to transfer all of the beads into a 15 ml conical tube. Vortex the suspension briefly (or just mix vigorously by hand) and centrifuge for 2 min at 2,000 rpm in a tabletop centrifuge to bring the beads down. Wash the beads 3 times with 4-5 ml fresh lysis buffer each time. Finally, add lysis/IP buffer to the beads to reach a total volume of 5 ml. This amount of beads is sufficient for 12 IP's using ~400 μl of 20% suspension for each IP.
Day 2
Remove the IP supernatant
Pellet the beads in a tabletop centrifuge (3,000 rpm for S min) and remove the supernatant. Add 600 μl of lysis buffer and transfer the beads to a fresh 1.5 ml microcentrifuge tube using a 1 ml pipette tip. Repeat with 600 μl of lysis buffer to collect any residual beads.
Wash the IP beads
Between washes, spin the beads down for 1 min at 1,000 x g (3,000 rpm in an Eppendorf S417 microcentrifuge) and remove the supernatant with a small pipette tip attached to an aspirator, taking care to avoid the pellet. Perform the washes on a rocker (at RT or in the cold room) with 1 ml of the indicated solution for 5 min. Twice with lysis buffer (the first wash was done with the transfer of beads). Once with lysis buffer/500 mM NaCI. Twice with IP wash solution. Once with TE. When aspirating away the last wash, thoroughly remove the small amount of remaining TE from the beads.
Notes: It may be useful to save the IP supernatant fraction to analyze protein content and IP efficiency.
Elute the immunoprecipitate with TES (TE/1% SDS)
Elute the immunoprecipitate from the beads with 100 μl of TE/1% SDS (PH 8.0), incubating at 65 °C for 15 min. Mix the samples briefly after 10 min. Pellet the beads for a few seconds at full speed (14,000 rpm) and transfer the eluate to a 1.5 ml tube. Add 150 μl of TE/0.67% SDS to the beads, heat for a few minutes and pellet again. Remove the supernatant and add it to the first eluate fraction. Spin the pooled eluate once more to pellet residual beads, and transfer it to a screw-cap tube, avoiding the ~10 μl left with the beads at the bottom of the tube.
Reverse crosslinking
Incubate the eluates at 65 °C over night to reverse the crosslinking.
Notes: Screw-cap microcentrifuge tubes eliminate evaporation during the heating.
Day 3
Cool the samples down at RT. Briefly spin down to collect condensation. Purify the samples using a spin column designed for small DNA fragments. Qiagen MinElute kit or PCR purification kit can be used for this step. Follow the manufacturer's instructions for using the kit.
Note: One can vary the volume of EB as needed, keeping in mind that the DNA sequencing library construction protocol is set up for a 34 μl sample.
Notes
DNA quantification
The precipitated DNA can be quantified with NanoDrop and assayed for emichment of transcription factor bound sequences by PCR or microarray (see below). If too little DNA is purified or the DNA is not emiched for a subset of sequences, some parameters of the chromatin IP procedure can be altered, as described below.
Quantitative PCR
If you know of some sites where the protein of interest will be bound, you can use them as positive controls to assay the ChIP. This is the best way to quantitatively determine the success or failure of an experiment. See the protocol for qPCR of ChIP DNA samples.
Optimizing crosslinking
Extent of crosslinking can be adjusted by changing the time of incubation with the cross linking agent, the concentration of formaldehyde, or the temperature of crosslinking. The extent of crosslinking is critical and can depend on the individual protein. Too much crosslinking may mask epitopes, while too little will cause failure to co-IP chromatin.
Assaying sonication
Sonication should be monitored since chromatin fragments that are too large will pellet with the lysate debris. The settings described in the protocol were empirically tested by experimenters in Snyder lab. Since different sonifiers and tips may perform differently, it is strongly recommended that users adjust sonication parameters to different levels and monitor the resulting chromatin fragment size. To check DNA fragment size, take a 250 μl aliquot of the total chromatin (lysate just before the IP step) and add 250 μl of TE/1% SDS. Incubate for 6-8 h at 65 °C to reverse crosslinking, then add 20 μl of 20 mg/ml protease K and incubate for 2 h at 37 °C. Add 50 μl of 5 M LiCI, extract (3x with Phenol-Chloroform-Isopropanol, 1x with chloroform) and ethanol-precipitate the DNA (add 1 ml of ethanol, chill at -20 °C for 1 h). Resuspend the DNA in 50 μl of TE and add 2 μl of DNase-free RNase A. Incubate for 30 min at 37 °C. To resolve the DNA fragments, add DNA loading buffer to the sample. Use a loading buffer with only xylene cyanol as a marker, since it runs just above 3 kb. Pour a 1.5% agarose gel and run the gel until the marker is very well separated. The range of fragment sizes should be 100-1,000 bp, averaging 400-500.
Input control DNA can be purified using the same procedure.
Optimizing antibody amount
The amount of antibody used for IP is another critical parameter. Preliminary IP experiments should be performed to determine the appropriate amount of antibody to be used for purification of the specific protein of interest. The amount used in this protocol is specifically tested for the myc-tagged Ste12 protein. To ensure that the crosslinking is not rendering the protein refractory to immunoprecipitation, the IP supernatant from step 11 can be analyzed by SDS-PAGE and immunoblotting. The material should be boiled in sample buffer for 20 min before running a protein gel.
Cell lysis
If necessary, it is possible to increase the efficiency of cell lysis by either increasing the number of cycles in the FastPrep machine or using rnore beads. The new FastPrep machine should give >95% lysis if used as described in the protocol.
Two-step IP
This is an alternative to use when no bead-coupled antibody is available.
primary IP: Add the appropriate amount of free primary antibody against the protein of interest (or epitope tag) to the lysate (see Notes for determination of antibody amount to use). Incubate overnight on a rocker at 4 °C.
secondary IP: Add 50 μl (of ~50% suspension) of protein A or G sepharose beads. Incubate on a rocker at 4 °C for 1-2 h.
Note: This is a high-affinity binding step, and extending time is not likely to improve the IP.
Recipes
TBS (1 L 10x stock)
200 ml 1 M Tris/HCI (pH 7.6)
300 ml 5 M NaCI
H2O to reach 1 L
Note: Dilute to working concentration and store in the cold room, as it is to be used cold.
Lysis/IP buffer (1 L)
50 ml 1 M Hepes/KOH (pH 7.5)
28 ml 5 M NaCI
2 ml 500 mM EDTA
100 ml 10% Triton X-100
1 g Na-deoxycholate
Lysis buffer/500 mM NaCl (250 ml)
Add NaCI to Lysis/IP buffer to bring the NaCl concentration up to 500 mM. For 250 ml final volume of Lysis buffer/500 mM NaCl, this requires 18 ml of 5 M NaCl.
IP wash solution (250 ml)
2.5 ml 1 M Tris/HCl (pH 8.0)
12.5 ml 5 M LiCl
6.25 ml 20% NP-40
1.25 g Na-deoxycholate
0.5 ml 500 mM EDTA
TE/1% SDS (100 ml)
5 ml 1 M Tris/HCl (pH 8.0)
2 ml 500 mM EDTA
5 ml 20% SDS
TE/0.67% SDS (100 ml)
5 ml 1 M Tris/HCl (pH 8.0)
2 ml 500 mM EDTA
3.35 ml 20% SDS
TE (PH 8.0) (100 ml)
5 ml 1 M Tris/HCl (pH 8.0)
2 ml 500 mM EDTA
1 mM PMSF
Prepare 100 mM PMSF stock solution (17.4 mg/ml) in isopropanol, and store small aliquots (0.5-1 ml) at -20 °C. Alternatively, use 100 mM PMSF.
References
Aparicio, O., Geisberg, J. V. and Struhl, K. (2004). Chromatin immunoprecipitation for determining the association of proteins with specific genomic sequences in vivo. Curr Protoc Cell Biol Chapter 17: Unit 17 17.
Zheng, W., Zhao, H., Mancera, E., Steinmetz, L. M. and Snyder, M. (2010). Genetic analysis of variation in transcription factor binding in yeast. Nature 464(7292): 1187-1191.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Molecular Biology > DNA > DNA-protein interaction
Microbiology > Microbial genetics > DNA
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
920 | https://bio-protocol.org/en/bpdetail?id=920&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Endogenous H2O2 and NO and Cell Viability by Confocal Laser Scanning Microscopy
MW Mi-Mi Wu
XM Xian-Ge Ma
Jun-Min He
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.920 Views: 13322
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Mar 2013
Abstract
Recently, there is compelling evidence that hydrogen peroxide (H2O2) and nitric oxide (NO) function as signaling molecules in plants, mediating a range of responses including stomatal movement. Thus, the choice of sensitive methods for detection of endogenous H2O2 and NO in guard cells are very important for understanding the role of H2O2 and NO in guard cell signaling. In addition, besides stomatal closure caused by interfering guard cell signaling, it can also be caused by widespread, nonspecific damage to guard cells. To determine whether stomatal movement is caused by damage to guard cells, sensitive methods for detection of guard cell viability are often required.
The oxidatively sensitive fluorophore 2′,7′-dichlorofluorecin (H2DCF) is commonly employed to measure changes in intracellular H2O2 level directly. The non-polar diacetate ester (H2DCFDA) of H2DCF enters the cell and is hydrolysed into the more polar, non-fluorescent compound H2DCF, which, therefore, is trapped. Subsequent oxidation of H2DCF by H2O2, catalysed by peroxidases, yields the highly fluorescent DCF. Similarly, the cell-permeable, NO-sensitive fluorescent probe 4,5-diaminofluorescein diacetate (DAF-2DA) is widely used for the direct detection of NO presence in both animal and plant cells. The non-polar DAF-2DA enters the cell and is hydrolyzed by cytosolic esterase into the more polar, non-fluorescent compound DAF-2, which in the presence of NO is converted to the highly fluorescent triazole derivative DAF-2T. The fluorescent indicator dyes fluorescein diacetate (FAD) and propidium iodide (PI) are widely used for detection of cell viability. FAD passes through cell membranes and is hydrolyzed by intracellular esterase to produce a polar compound that passes slowly through a living cell membrane but fast through a damaged or dead cell membrane, and thus accumulates inside the viable cells and exhibits green fluorescence when excited by blue light. In contrast, PI passes through damaged or dead cell membranes and intercalates with DNA and RNA to form a bright red fluorescent complex seen in the nuclei of dying or dead cells but not living cells. Based on the above analysis, the fluorescent indicator dyes H2DCFDA, DAF-2DA, FAD and PI load readily into guard cells, and their optical properties make them amenable to analysis by confocal laser scanning microscopy.
This protocol describes how to combine confocal laser scanning microscopy with fluorescent indicator dyes H2DCFDA, DAF-2DA, FAD and PI respectively for measurement of H2O2 and NO and viability of guard cell in leaves of Arabidopsis (Arabidopsis thaliana).
Materials and Reagents
Leaves of Arabidopsis (Arabidopsis thaliana)
Ethanesulfonic acid (MES)
2′,7′-dichlorofluorescin diacetate (H2DCFDA) (Sigma-Aldrich, catalog number: D6883 )
4, 5-diaminofluorescein diacetate (DAF-2DA) (Sigma-Aldrich, catalog number: D2813 )
Propidium iodide (PI) (Sigma-Aldrich, catalog number: P4170 )
Fluorescein diacetate (FDA) (Sigma-Aldrich, catalog number: F7378 )
DMSO (Sigma-Aldrich, catalog number: D8418 )
10 mM MES/KCl buffer pH 6.15 (see Recipes)
Tris/KCl buffer pH 7.2 (see Recipes)
10 mM H2DCFDA (see Recipes)
10 mM DAF-2DA (stock solution) (see Recipes)
1 mg/ml PI (stock solution) (see Recipes)
5 mg/ml FDA (stock solution) (see Recipes)
Equipment
TCS-SP2 Confocal Laser Scanning Microscopy (Leica Lasertechnik Gmbh3, Heidelberg)
25 °C incubator
Glass slide and cover glass
Eyelbrow brush (Yellow wolf hair, length of hair: 0.8 cm, width of hair: 0.8 cm)
Tweezers
6-cm diameter Petri plate
Software
Leica confocal software (Leica Lasertechnik Gmbh3, Heidelberg)
Photoshop software
Procedure
Sampling.
Arabidopsis seedlings were gown in plant growth chambers under a 16-h light/8-h dark cycle, a photon flux density of 0.1 mmol/m2/s, and a day/night temperature cycle of 18 °C/22 °C for 4-6 weeks. The youngest, fully expanded and flat leaves were harvested for immediate use.
Opening the stomata.
For stomatal closing experiments, to ensure stomata at fully opened stage before starting of treatments, the freshly harvested flat leaves were first floated with their abaxial surfaces facing up on MES/KCl buffer (15 ml) in 6-cm diameter Petri plates for 2-3 h at 22 °C under light condition (0.1 mmol/m2/s) to open the stomata, and then for subsequent treatments.
Treating samples.
Once the stomata were fully open (checked by microscope), the leaves were then floated on MES/KCl buffer alone or containing various compounds or inhibitors for required time at 22 °C under the same white light condition mentioned above or the desired conditions. Control treatments involved addition of buffer or appropriate solvents used with inhibitors.
Note: As the epidermal strips is easier peeled from the abaxial surface than the paraxial surface of Arabidopsis leaves, we only peeled epidermal strips from abaxial surface of leaves for subsequent measurement. Thus, for treatments of UV-B radiation as well as other lights, to ensure the abaxial surface of leaves receiving same dose of UV-B radiation as well as other lights, the leaves were floated with their abaxial surfaces facing up and perpendicular to the light on MES/KCl buffer in all treatments including opening stomata.
Peeling epidermal strips.
After the above treatments, the leaf was taken out from MES/KCl buffer and a piece of filter paper was used to absorb the MES/KCl buffer on the surface of leaf. The leaf were flatly placed on a glass slide with its abaxial surfaces facing up, a tweezers was used to clamp a part of abaxial epidermis and mesophyll cells near the tip of leaf and the epidermal strips were quickly peeled along with the direction of the main leaf veins. Then, the peeled epidermal strips were immediately immersed in the corresponding treated buffer and pushed on the bottom of Petri plates by a forceps, the remained mesophyll cells were gently removed from epidermal strips by an eyebrow brush (Figure 1), and the tip of epidermal strip clamped by tweezers with more mesophyll cells was cut away, then epidermal strips were quickly used for loading of the fluorescent indicator dyes.
Loading fluorescent indicator dyes.
The peeled epidermal strips were immediately placed into Petri plates containing Tris-KCl buffer in the presence of H2DCFDA at a final concentration of 50 μM for 10 min, DAF-2DA at a final concentration of 10 mM for 30 min, FAD at a final concentration of 10 μg/ml for 10 min, or PI at a final concentration of 5 μg/ml for 10 min respectively, in the dark at 25 °C to exclude the possibility of that the fluorescent probes were oxidized or hydrolyzed by UV-B or PAR radiation. Then, the epidermal strips were washed with fresh Tris–KCl buffer without the fluorescent indicator dyes at least three times in dark to remove the excess dyes.
Examination of H2O2, NO and viability of guard cells by confocal laser scanning microscopy.
After loading of the fluorescent indicator dyes, the slides were made and an examination of the peels was immediately performed by TCS-SP2 confocal laser scanning microscopy with the following settings: excitation 488 nm and emission 530 nm for H2DCFDA, DAF-2DA and FAD or excitation 536 nm and emission 617 nm for PI; normal scanning speed, frame 512 x 512. For example, by using these fluorescent indicator dyes and the confocal laser scanning microscope, Figure 1 clearly showed that guard cells of wild-type Arabidopsis under light alone had low levels of H2O2 (Figure 1A) and NO (Figure 1D), and high viability of guard cells (Figure 1G). However, 3 h of 0.5 W/m2 UV-B radiation significantly induced production of H2O2 (Figure 1B) and NO (Figure 1E), and did not affect cell viability (Figure 1H) in wild-type guard cells, but did not induce H2O2 production in guard cells of AtrbohD/F double mutant (Figure 1C) or NO production in guard cells of Nia1-2/Nia2-5 double mutant (Figure 1F). Furthermore, when wild-type leaves were exposed to 0.8 W/m2 UV-B for 3 h, the guard cells were significantly damaged and clearly marked by the fluorescent dye PI (Figure 1I).
Analysis
Images acquired from the confocal microscope were analyzed with Leica confocal software to measure the average fluorescent pixel intensities in the guard cells following various treatments (such as in Figure 1J; the detailed procedure of analysis seen the following note) and processed with Photoshop software. In each experiment, three epidermal strips were at least measured, each of which originated from a different plant. Each experiment was repeated three times. The selected confocal image represented the same results from approximately nine time measurements. Data of fluorescence pixel intensities are statistically analyzed by one-way ANOVA and displayed as means ± SE (n = 60).
Note: Procedure for analysis of fluorescent intensity: On the “LAS AF” screen of Leica confocal software, click the “quality” button, select “Histogram” analysis method and circle guard cell to be analyzed, then “Statistics” shows the average fluorescent intensity of the circled guard cell, select “Export as” to save the “Statistics” displayed data in a text format.
Figure 1. Effects of UV-B radiation on the production of H2O2 and NO and viability of Arabidopsis guard cells. A-C. Images of guard cells loaded with the fluorescent indicator dye H2DCFDA. D-F. Images of guard cells loaded with the fluorescent indicator dye DAF-2DA. G and H. Images of guard cells loaded with the fluorescent indicator dye FAD. A, D and G. Wild-type guard cells exposed to light alone for 3 h. B, E and H. Wild-type guard cells exposed to light with 0.5 W m-2 for 3 h. C and F. Double mutants AtrbohD/F and Nia1-2/Nia2-5 guard cells respectively exposed to light with 0.5 W m-2 for 3 h. I. Image of wild-type guard cells exposed to 0.8 W m-2 UV-B for 3 h and loaded with the fluorescent indicator dye PI. J. The figure shows the average fluorescent intensities (means ± SE) of guard cells in images from A to H. The guard cells shown in images a-i are representative of guard cells shown in images A-I, respectively. Scale bars in image I (75 μm) and i (25 μm) are for images A-I and a-i, respectively.
Recipes
10 mM MES/KCl buffer (10 mM MES, 50 mM KCl, 0.1 mM CaCl2, pH 6.15, 500 ml)
1.066 g MES
5.549 mg CaCl2
1.86375 g KCl
Mix these chemicals with 400 ml dH2O
Adjust pH to 6.15 with KOH
Add dH2O to 500 ml
Stored at room temperature
Tris/KCl buffer (10 mM Tris and 50 mM KCl, pH 7.2, 500 ml)
0.6055 g Tris
1.86 g KCl
Mix these chemicals with 400 ml dH2O
Adjust pH to 7.2 with HCl
Add dH2O to 500 ml
Stored at room temperature
10 mM H2DCFDA (1 ml, stock solution).
Mix 4.8729 mg of H2DCFDA with 1 ml DMSO
Stored at -20 °C
This stock solution is diluted by Tris/KCl pH 7.2 buffer to get a working concentration of 50 μM
10 mM DAF-2DA (stock solution).
Mix 1 mg of DAF-2DA with 224 μl DMSO to form 10 mM stock solution
Stored at -20 °C
This stock solution is diluted by Tris/KCl pH 7.2 buffer to get a working concentration of 10 μM
1 mg/ml PI (stock solution)
Mix 1 mg of PI with 1 ml dH2O to make a stock solution
Stored at 4 °C in a dark bottle
This stock solution is diluted by Tris/KCl pH 7.2 buffer to get a working concentration of 5 μg/ml
5 mg/ml FDA (stock solution)
Mix 5 mg of FDA with 1 ml acetone to make a stock solution
Stored at 4 °C in a dark bottle
This stock solution is diluted by Tris/KCl pH 7.2 buffer to get a working concentration of 10 μg/ml
Acknowledgments
This work was supported by the National Science Foundation of China (grant no. 31170370) and the Fundamental Research Funds for the Central Universities (grant no. GK200901013). This protocol was adapted from previously published paper He et al. (2013).
References
He, J. M., Ma, X. G., Zhang, Y., Sun, T. F., Xu, F. F., Chen, Y. P., Liu, X. and Yue, M. (2013). Role and interrelationship of Galpha protein, hydrogen peroxide, and nitric oxide in ultraviolet B-induced stomatal closure in Arabidopsis leaves. Plant Physiol 161(3): 1570-1583.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant biochemistry > Other compound
Cell Biology > Cell imaging > Confocal microscopy
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Quick Method to Quantify Iron in Arabidopsis Seedlings
Chandan Kumar Gautam [...] Wolfgang Schmidt
Mar 5, 2022 2601 Views
Quantitative Live Confocal Imaging in Aquilegia Floral Meristems
Ya Min [...] Elena M. Kramer
Jun 20, 2022 2128 Views
Isolation of Intact Vacuoles from Arabidopsis Root Protoplasts and Elemental Analysis
Chuanfeng Ju [...] Zhenqian Zhang
Mar 5, 2023 717 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
921 | https://bio-protocol.org/en/bpdetail?id=921&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Stomatal Bioassay in Arabidopsis Leaves
XL Xuan Li
XM Xian-Ge Ma
Jun-Min He
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.921 Views: 15568
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Mar 2013
Abstract
Stomata embedded in the epidermis of terrestrial plants are important for CO2 absorption and water transpiration, and are possible points of entry for pathogens. Thus, the regulation of stomatal apertures is extremely important for the survival of plants. Furthermore, stomata can respond via accurate change of stomatal apertures to a series of extracellular stimuli such as phytohormones, pathogens, ozone, drought, humidity, darkness, CO2, visible light and UV-B radiation, so stomatal bioassay is widely used to dissect signal transduction mechanisms of plant cells in responses to multiple stimuli. This protocol describes how to measure stomatal apertures in leaves of model plant Arabidopsis thaliana under multiple treatments.
Materials and Reagents
Leaves of Arabidopsis (Arabidopsis thaliana)
Ethanesulfonic acid (Mes)-KOH
MES/KCl buffer, pH 6.15 (see Recipes)
Equipment
Light microscope
Eyepiece micrometer and stage micrometer
Glass slide and cover glass
6-cm diameter Petri plates
Eyelbrow brush (Yellow wolf hair, length of hair: 0.8 cm, width of hair: 0.8 cm)
Tweezers
Procedure
Sampling
Arabidopsis seedlings were gown in plant growth chambers under a 16-h light/8-h dark cycle, a photon flux density of 0.1 mmol/m2/s, and a day/night temperature cycle of 18 °C/22 °C for 4-6 weeks. The youngest, fully expanded and flat leaves were harvested for immediate use.
Notes:
To avoid any potential rhythmic effects on stomatal aperture, sampling was always started at the same time of day and avoided at midday.
For all treatments, the leaves at same developmental stage were always sampled.
For each treatment, at least three leaves originated from different plants and at same developmental stage were harvested.
Opening the stomata
For stomatal closing experiments, to ensure stomata at fully opened stage before starting of treatments, the fresh sampled flat leaves were first floated with their abaxial surfaces facing up on MES/KCl buffer (15 ml) in 6-cm diameter Petri plates for 2-3 h at 22 °C under light condition (0.1 mmol/m2/s) to open the stomata, and then for subsequent treatments.
Treating samples
Once the stomata were fully open (checked by microscope as the following 5 procedure), the leaves were then floated on MES/KCl buffer alone or containing various compounds or inhibitors for required time at 22 °C under the same white light condition mentioned above or under the desired conditions. Control treatments involved addition of buffer or appropriate solvents used with inhibitors.
Notes:
For each treatment, at least three leaves originated from different plants were treated.
As the epidermal strips is easier peeled from the abaxial surface than the paraxial surface of Arabidopsis leaves, we only peeled epidermal strips from abaxial surface of leaves for subsequent measurement of stomatal aperture. Thus, for treatments of UV-B radiation as well as other lights, to ensure the abaxial surface of leaves receiving same dose of UV-B radiation as well as other lights, the leaves were floated with their abaxial surfaces facing up and perpendicular to the light on MES/KCl buffer in all treatments including opening stomata.
Peeling epidermal strips and making slides
After the above treatments, the leaf was taken out from MES/KCl buffer and a piece of filter paper was used to absorb the MES/KCl buffer on the surface of leaf. The leaf were flatly placed on a glass slide with its abaxial surfaces facing up, a tweezers was used to clamp a part of abaxial epidermis and mesophyll cells near the tip of leaf and the epidermal strips were quickly peeled along with the direction of the main leaf veins. Then, the peeled epidermal strips were immediately immersed in the corresponding treated buffer and pushed on the bottom of Petri plates by a forceps, the remained mesophyll cells were gently removed from epidermal strips by an eyebrow brush (Figure 1), and the tip of epidermal strip clamped by tweezers with more mesophyll cells was cut off, then slides were made with the corresponding treating buffer.
Figure 1. Eyebrow brush
Measurement of stomatal apertures with a light microscope
Install eyepiece micrometer and stage micrometer in your used light microscope, calibrate micrometer scale, and fifty to ninety randomly selected stomatal apertures were scored under the calibrated microscope in each replicate and treatments were repeated at least three times. The data are presented as means ± SE derived from one-way ANOVA.
Figure 2. Eyepiece micrometer and stage micrometer
Recipes
MES/KCl buffer, pH 6.15 (500 ml)
1.86375 g 50 mM KCl
5.549 mg 0.1 mM CaCl2
1.066 g 10 mM Mes-KOH (pH 6.15)
Stored at room temperature and used for one week
Acknowledgments
This work was supported by the National Science Foundation of China (grant no. 31170370) and the Fundamental Research Funds for the Central Universities (grant no. GK200901013). This protocol was adapted from previously published paper He et al. (2013).
References
He, J. M., Ma, X. G., Zhang, Y., Sun, T. F., Xu, F. F., Chen, Y. P., Liu, X. and Yue, M. (2013). Role and interrelationship of Galpha protein, hydrogen peroxide, and nitric oxide in ultraviolet B-induced stomatal closure in Arabidopsis leaves. Plant Physiol 161(3): 1570-1583.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant physiology > Tissue analysis
Plant Science > Plant cell biology > Cell structure
Cell Biology > Cell structure > Cell surface
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Analysis of Monosaccharides from Arabidopsis Seed Mucilage and Whole Seeds Using HPAEC-PAD
Gillian H. Dean [...] George W. Haughn
Dec 20, 2019 4485 Views
Visualization of Actin Organization and Quantification in Fixed Arabidopsis Pollen Grains and Tubes
Xiaolu Qu [...] Shanjin Huang
Jan 5, 2020 4114 Views
Targeting Ultrastructural Events at the Graft Interface of Arabidopsis thaliana by A Correlative Light Electron Microscopy Approach
Clément Chambaud [...] Lysiane Brocard
Jan 20, 2023 1114 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
922 | https://bio-protocol.org/en/bpdetail?id=922&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Fractionation of Pseudomonas aeruginosa
Esteban Paredes-Osses
Kim R. Hardie
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.922 Views: 12600
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Aug 2012
Abstract
Pseudomonas aeruginosa is a Gram negative bacterium. Separating the cell envelope compartments enables proteins to be localized to confirm where in the cell they function. Cell fractionation can also provide a first step in a protein purification strategy (Williams et al., 1998). This protocol has been designed to obtain the different fractions of P. aeruginosa, namely the inner membrane, outer membrane, cytoplasmic and periplasmic compartments. Specific detection of the arginine specific autotransporter (AaaA) (Luckett et al., 2012) in the outer membrane of P. aeruginosa has been performed using this protocol.
Materials and Reagents
P. aeruginosa strain (In this experiment, AaaA deficient mutant strains are used). The strain was bearing the pME6032 shuttle expression vector (Heeb et al., 2002). This vector is IPTG-inducible and has very good stability in Pseudomonas.
Polyclonal antibody anti-AaaA (rabbit) (not commercial available) (Luckett et al., 2012)
Anti-Rabbit IgG (whole molecule)–Peroxidase antibody produced in goat (Sigma-Aldrich, catalog number: A6154 )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Sigma-Aldrich, catalog number: I5502 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: EDS )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
Luria Bertani (LB) (Difco, catalog number: 244620 )
Autoclaved sterilized Phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: P4417 )
Sucrose (Sigma-Aldrich, catalog number: S7903 )
Sodium Lauryl Sarcoscine (SLS) (Sigma-Aldrich, catalog number: L5125 )
Magnesium Sulphate (Sigma-Aldrich, catalog number: 63139 )
MgCl2 (Sigma-Aldrich, catalog number: M2393 )
DNAase I (Sigma-Aldrich, catalog number: D4527 )
RNAase A (Sigma-Aldrich, catalog number: R5503 )
100% Trichloroacetic acid (TCA) (Sigma-Aldrich, catalog number: T6399 )
Acetone (Sigma-Aldrich, catalog number: 179124 )
NaOH (Sigma-Aldrich, catalog number: 221465 )
Tris(hydroxymethyl) aminomethane (Sigma-Aldrich, catalog number: 252859 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D9779 )
Sodium Dodecyl Sulphate (SDS) (Sigma-Aldrich, catalog number: L4509 )
Bromophenol Blue (Sigma-Aldrich, catalog number: B0126 )
Glycerol (Sigma-Aldrich, catalog number: G8773 )
4x Loading buffer (see Recipes)
Equipment
French Pressure cell (Manufactured by Amicon and supplied by Thermo Fisher Scientific)
50 ml Falcon tube (BD Biosciences, Falcon®, catalog number: 352070 ) (Supplied by Scientific Laboratory Supplies)
Eppendorf® Safe-Lock micro test tubes (Eppendorf, catalog number: 0030121023 ) (Supplied by Scientific Laboratory Supplies)
Microfuge, larger volume centrifuge and high speed centrifuge (Beckman Coulter, model: Allegra X-22R Centrifuge )
1 ml pipettman
W380 sonicator (Ultrasonics)
Procedure
Set up overnight cultures for P. aeruginosa strains of interest from a single colony. Conditions: 10 ml LB broth in 50 ml Falcon tube at 37 °C shaking at 200 rpm.
Next day, set up fresh cultures from the overnight cultures in new LB broth using a 1:100 ratio dilution, and grow at 37 °C shaking at 200 rpm until the exponential growth phase (0.4 - 0.5 OD600 nm).
When the exponential phase is reached, add IPTG (1 mM final concentration) for 1 h to induce the production of the protein of interest if required.
After the hour of induction, centrifuge the culture at 3,000 x g for 5 min at 4 °C. Discard the supernatant and gently resuspend the pellet in 10 ml of room temperature PBS using a 1 ml pipettman.
Repeat step 4 twice so that the cells are washed three times in total.
Resuspend the final pellet in 10 ml PBS solution.
Check OD600 nm and dilute to an OD600 nm of 1.0 with PBS solution. This will be referred to as the ‘main solution’.
Take 1 ml of the main solution to prepare the whole cell fraction. Centrifuge at 3,700 x g for 5 min in an Eppendorf tube and resuspend in 200 μl of 1x loading buffer, then sonicate for 10 seconds in W380 sonicator using the following settings: duty cycle, 40%; output control, 41/2 position and cycle time, continuous and boil at 100 °C for 10 minutes. The supernatant from the centrifugation can be kept on ice as a sample from the supernatant if secreted proteins are also to be analyzed.
Take another 1 ml of the main solution to prepare the periplasmic and cytoplasmic fractions. Centrifuge at 3,700 x g for 2 min at room temperature in an Eppendorf tube.
Wash with 300 μl of 25 mM Tris pH 7.4 three times by centrifuging at 3,700 x g for 5 min (room temperature) and gently resuspending the pellet with a pipettman.
After the last centrifugation, the pellet needs to be resuspended in 50 μl of 25 mM Tris pH 7.4, 1 μl of 0.1 M EDTA and 50 μl of 40% w/w sucrose in 25 mM Tris pH 7.4.
Mix the sample gently at room temperature for 10 min.
Centrifuge at 3,700 x g for 5 min (room temperature), discard supernatant and resuspend pellet in 100 μl of ice cold 0.5 mM Magnesium Sulphate.
Incubate on ice for 10 min, gently inverting occasionally to mix.
Centrifuge for 5 min at 10,300 x g in microfuge (4 °C).
The supernatant of the sample has the periplasmic fraction, and should be stored on ice.
The pellet needs to be resuspended in 600 μl of 10 mM Tris pH 7.4 containing 20 μg/ml PMSF.
The sample from step 17 should be frozen and thawed three times on dry ice.
Add 19.9 μl MgCl2 (1 M) and 1.2 μl DNase I (1 mg/ml) to the sample from step 18. Mix by inversion.
Incubate at 37 °C for 15 min.
Centrifuge for 15 min at 10,300 x g, and the supernatant contains the cytoplasmic fraction, which should be stored on ice.
The rest of main solution (approximately 5 ml) is used to get the membrane fractions.
Centrifuge at 3,000 x g for 10 min at 4 °C, discard supernatant and resuspend pellet in 3 ml 20 mM Tris pH 7.4 containing 0.1 mg/ml DNase and 0.1 mg/ml RNase.
Pass through the French Press three times at 16,000 lb/in, on ice.
Centrifuge 3,000 x g for 20 min at 4 °C to remove unlysed cells.
The resultant supernatant is transferred to a fresh tube, and centrifuged at 30,000 x g for 40 minutes at 4 °C.
Discard the supernatant and resuspend the pellet in 200 μl 20 mM Tris pH 7.4 containing 0.7% (w/v) SLS.
Incubate at 4 °C for 25 minutes and centrifuge at 30,000 x g for 40 minutes at 4 °C.
The supernatant contains the inner membrane fraction, and should be stored in a fresh tube on ice.
The pellet needs to be resuspended in 200 μl 20 mM Tris pH 7.4 and contains the outer membrane.
Note: The samples (periplasmic, inner membrane, cytoplasmic outer membrane fractions and culture supernatant) need to be subjected to TCA precipitation (Cooksley et al., 2003) to concentrate the proteins and remove residual detergents and salts. To TCA precipitate the proteins add TCA (from a 100% stock solution kept at 4 °C in the dark) to a final concentration of 10% v/v. Incubate the samples on ice for 30 minutes and centrifuge for 15 minutes at top speed in a microfuge at room temperature or 4 °C. Discard the supernatant carefully without disturbing the small and fragile pellet. Add 500 μl of ice cold acetone to the pellet, and centrifuge for 5 minutes in the microfuge. The supernatant is discarded again and the pellet air dried for 15 min. Finally, the pellet is resuspended in 20 μl of 50 mM NaOH plus 180 μl loading buffer 1x, sonicated for 10 sec, and boiled for 10 min.
The proteins can then be visualized by SDS-PAGE or Immunoblotting (Cooksley et al., 2003) as seen in Figure 1. It is good practice to have available control antibodies against proteins known to be localized to each of the cell fractions analyzed to verify that there is no cross contamination.
Figure 1. AaaA is found in the outer membrane fraction of P. aeruginosa. Cell fractionation was performed as described, followed by immunoblotting with specific anti-AaaA sera as described previously (Luckett et al., 2012). Whole cell (W), cytoplasmic (C), Inner Membrane (IM), Perplasmic (P) and outer membrane (OM) fractions are shown, and the expected position of AaaA is indicated by the arrow. The P. aeruginosa strains analyzed were the AaaA deficient mutant containing the plasmid pME6032 [PA01 delta aaaA (pME6032)], or a derivative of pME6032 with an insert encoding wild type AaaA [PA01 delta aaaA (pME6032::aaaA)] or a site directed mutant of AaaA replacing alanine with the residue at either position G89 [PA01 delta aaaA (pME6032:: aaaA G89A)] or E149 [PA01 delta aaaA (pME6032::aaaA E149A)]. To verify that the fractionation has occurred correctly, it is important to strip the blots and reprobe with antibodies specific for proteins that are only found in the fractions of interest as was shown in Luckett et al. (2012).
Recipes
4x Loading buffer
200 mM Tris(hydroxymethyl) aminomethane (pH 6.8)
800 mM Dithiothreitol (DTT)
8% Sodium Dodecyl Sulphate (SDS)
0.4% w/v Bromophenol Blue
40% v/v Glycerol
Acknowledgments
We acknowledge the use of this protocol in Luckett et al. (2012). We would like to thank the Chilean Government for financially supporting Esteban Paredes. We also thank Prof Miguel Camara for critical analysis of our work and everyone else in the Bacteriology Laboratories of the Centre of Biomolecular Sciences, University of Nottingham for helpful discussion about our work.
References
Cooksley, C., Jenks, P. J., Green, A., Cockayne, A., Logan, R. P. and Hardie, K. R. (2003). NapA protects Helicobacter pylori from oxidative stress damage, and its production is influenced by the ferric uptake regulator. J Med Microbiol 52(Pt 6): 461-469.
Heeb, S., Blumer, C. and Hass, D. (2002). Regulatory RNA as mediator in GacA/RsmA-dependent global control of exoproduct formation in Pseudomonas fluorescent CHA0. J Bacteriol 184(4):1046-56.
Methods in Microbiology: Bacterial Pathogenesis, Academic Press. (1998). Eds: Paul Williams, Peter Williams, George Salmond, Julian Ketley Chapter 6.1: p185-191.
Luckett, J. C., Darch, O., Watters, C., Abuoun, M., Wright, V., Paredes-Osses, E., Ward, J., Goto, H., Heeb, S., Pommier, S., Rumbaugh, K. P., Camara, M. and Hardie, K. R. (2012). A novel virulence strategy for Pseudomonas aeruginosa mediated by an autotransporter with arginine-specific aminopeptidase activity. PLoS Pathog 8(8): e1002854.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Paredes-Osses, E. and Hardie, K. R. (2013). Cell Fractionation of Pseudomonas aeruginosa. Bio-protocol 3(19): e922. DOI: 10.21769/BioProtoc.922.
Luckett, J. C., Darch, O., Watters, C., Abuoun, M., Wright, V., Paredes-Osses, E., Ward, J., Goto, H., Heeb, S., Pommier, S., Rumbaugh, K. P., Camara, M. and Hardie, K. R. (2012). A novel virulence strategy for Pseudomonas aeruginosa mediated by an autotransporter with arginine-specific aminopeptidase activity. PLoS Pathog 8(8): e1002854.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Organelle isolation
Cell Biology > Organelle isolation > Fractionation
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
923 | https://bio-protocol.org/en/bpdetail?id=923&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Virus Overlay Assay (Far-Western blotting)
KJ Kun-Tong Jia
CG Chang-Jun Guo
XY Xiao-Bo Yang
JH Jian-Guo He
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.923 Views: 15342
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Virology Mar 2013
Abstract
Virus overlay assay is a method to detect protein-protein interaction in vitro. We performed the virus overlay assay to identify the receptor proteins interacting with the infectious spleen and kidney necrosis virus (ISKNV).
Keywords: Far-Western blotting Protein Virus
Materials and Reagents
Purified ISKNV (was purified in our laboratory)
12% SDS-PAGE gel
PVDF membrane (Whatman, catalog number: 10485290 )
Coomassie brilliant blue G-250 (Beyotime Institute of Biotechnology, catalog number: P0017B )
Tris-HCl (pH 7.4)
EDTA
Tween 20
Guanidine hydrochloride (Sigma-Aldrich, catalog number: G4505 )
Nonfat milk powder
Maltose-binding protein (MBP) or MBP-mCav-1 protein (these proteins were made in our laboratory)
Anti-MBP antibodies (Sigma-Aldrich, catalog number: M1321 )
Horse radish peroxidase (HRP)-conjugated goat anti-mouse secondary antibodies (Invitrogen, catalog number: 626520 )
HRP substrate solution (Beyotime Institute of Biotechnology, catalog number: P0209 )
BCA protein assay kit (Thermo Fisher Scientific, catalog number: 23225 )
Renaturing buffer (see Recipes)
Tris Buffered Saline and Tween 20 (TBST) (see Recipes)
Equipment
Electrophoresis equipment
Bio-Rad blotting equipment (Bio-Rad Laboratories, model: A101441 )
Procedure
The protein concentrations of the purified virus are determined using the BCA protein assay kit. 100 micrograms of the sample are boiled in 2x SDS-PAGE sample loading buffer for 5 min.
30 μl (100 micrograms) denatured product is resolved in two parallel 12% SDS-PAGE gels.
After electrophoresis, the viral structural proteins in one gel are transferred to a PVDF membrane by electroblotting using the Bio-Rad wet transfer Blotter (50 V for 2 h), whereas the other gel is stained with Coomassie brilliant blue G-250 for a parallel experiment.
The membrane is washed twice in TBST at room temperature (RT) under constant rotation for 5 min each.
The blots are then blocked overnight in renaturing buffer at 4 °C, and then incubated with 10 μg/ml MBP or MBP-mCav-1 protein for 2 h at RT.
The membrane is incubated with anti-MBP antibodies (1:2,000 dilution) in TBST for 2 h at RT after washing three times in TBST under constant rotation for 10 min each.
The membrane is washed as described in step 4, and the antigen-antibody complexes are then detected using HRP-conjugated goat anti-mouse secondary antibodies (1:5,000 dilution) in TBST for 1 h under constant rotation.
The membrane is washed as described in step 4, the immobilized conjugates on the membrane are subsequently visualized using an HRP substrate solution. When the member reaches desired intensity, pour off the HRP substrate solution and rinse in several changes of distilled water. Incubate in ddH2O for ~20 min, see an example of the results in Figure 1.
Figure 1. A. Far-Western blot analysis; B. Purified ISKNV particles (100 μg) were isolated using SDS-PAGE, and then stained with Coomassie brilliant blue R-250.
Recipes
Renaturing buffer
20 mM Tris-HCl
1 mM EDTA
0.5 mol/L NaCl
0.05% Tween 20
1 M guanidine hydrochloride
5% nonfat milk powder
TBST (1 L)
NaCl 8 g
KCl 0.2 g
Tris base 3 g
Mix in ~ 800 ml dH2O, adjust pH to 7.4 with HCl, then adjust volume to 1 L
Autoclave
After cooling, add 1 ml Tween 20
Acknowledgments
This protocol is adapted from Kikkert et al. (1998).
References
Kikkert, M., Meurs, C., van de Wetering, F., Dorfmuller, S., Peters, D., Kormelink, R. and Goldbach, R. (1998). Binding of tomato spotted wilt virus to a 94-kDa thrips protein. Phytopathology 88(1): 63-69.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Jia, K., Guo, C., Yang, X. and He, J. (2013). Virus Overlay Assay (Far-Western blotting). Bio-protocol 3(19): e923. DOI: 10.21769/BioProtoc.923.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein > Immunodetection
Biochemistry > Protein > Immunodetection > Western blot
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
HIV-1 Virus-like Particle Budding Assay
Nathan H Vande Burgt [...] Paul Bates
Jul 20, 2013 10330 Views
Detection of HBV C Protein Phosphorylation in the Cell
Jaesung Jung and Kyongmin Kim
Aug 5, 2015 7730 Views
Coupling of HIV-1 gp120-derived Core Protein to Paramagnetic Beads and Adsorption Assays
Jidnyasa Ingale and Richard T Wyatt
Oct 5, 2015 6755 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
924 | https://bio-protocol.org/en/bpdetail?id=924&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
IEF-2DE Analysis and Protein Identification
XW Xia Wu
SC Steven J. Clough
SH Steven C. Huber
Man-Ho Oh
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.924 Views: 15357
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Dec 2012
Abstract
Isoelectric focusing followed by SDS-PAGE (IEF-2DE) separates proteins in a two-dimensional matrix of protein pI (Protein Isoelectric Point) and molecular weight (MW). The technique is particularly useful to distinguish protein isoforms (Radwan et al., 2012) and proteins that contain post-translational modifications such as phosphorylation (Oh et al., 2012) and lysine acetylation (Wu et al., 2011). Proteins that are separated by IEF-2DE can be identified by immunoblot analysis using sequence-specific antibodies or by mass spectrometry.
Materials and Reagents
Protein extracts
Phenol (TE-saturated pH 7.9) (Sigma-Aldrich, catalog number: P4557 )
0.1 M ammonium acetate (dissolved in methanol)
Tris-base (General Electric Company, catalog number: 17-1321-01 )
Glycine
Urea (Life Technologies, Invitrogen™, catalog number: ZU10001 )
Thiourea (Life Technologies, Invitrogen™, catalog number: ZT10002 )
CHAPS (Life Technologies, Invitrogen™, catalog number: ZC10003 )
DTT (General Electric Company, catalog number: 17-1318-01 )
Bromophenol blue (General Electric Company, catalog number: 17-1329-01 )
Glycerol (General Electric Company, catalog number: 17-1325-01 )
SDS (General Electric Company, catalog number: 17-1313-01 )
Iodoacetamide (General Electric Company)
100% Ethanol (HPLC grade)
Water (HPLC grade)
IPG buffer (General Electric Company, catalog number: 17-6000-87 )
IPG strips (General Electric Company, catalog number: 17-6000-14 )
Immobiline DryStrip Cover Fluid (General Electric Company, catalog number: 17-1335-01 )
Bradford assay dye reagent (Bio-Rad Laboratories, catalog number: 500-0006 )
SimplyBlueTM SafeStain protein stain (Life Technologies, Invitrogen™, catalog number: LC-6065 )
Precision PlusTM All Blue Protein Standards (Bio-Rad Laboratories, catalog number: 161-0373 )
IEF sample buffer (see Recipes)
SDS equilibration buffer (see Recipes)
10x Tank buffer (see Recipes)
Agarose overlay solution (General Electric Company, catalog number: 17-0554-01 ) (see Recipes)
Equipment
1.5 ml microfuge tubes
15 ml tubes
EttanTM IPGphoreTM Isoelectric Focusing System (General Electric Company, Model: 80-6414-02 )
Large Format 1-D Electrophoresis Systems (Bio-Rad Laboratories)
Semi-dry transfer system (Bio-Rad Laboratories)
Mass spectrometers (such as MALDI-TOF or tandem mass spectrometer)
Procedure
Sample preparation
To maximize the separation of proteins by IEF, the protein extracts should contain minimal contaminants of salts and detergents. Here is the method we used to prepare protein extracts (protein extraction buffer: 100 mM Tris-HCl, pH 8.0) for IEF analysis.
Mix crude protein extract and ice-cold phenol (TE-saturated, pH 7.9) in a 1:1 (v:v) ratio. Vortex for 1 min.
Centrifuge the mixture at 24,000 x g for 15 min at 4 °C.
Carefully remove upper aqueous phase and discard (do not disturb interphase).
Add equal volume of ice-cold 50 mM Tris-HCl (pH 8.0) to the protein mixture. Vortex for 1 min.
Centrifuge at 24,000 x g for 15 min at 4 °C.
Remove upper aqueous phase and discard (do not disturb interphase).
Repeat steps 4 to 6 once more.
Transfer the lower phenol phase (including interphase) to a new ice-cold 15 ml tube and add 5 volumes of ice-cold 0.1 M ammonium acetate (in methanol). Vortex for 1 min.
Precipitate proteins overnight at -20 °C.
Gently and briefly vortex to resuspend the protein precipitate. Split the samples between 1.5 ml microfuge tubes as necessary.
Centrifuge at 24,000 x g for 20 min at 4 °C and carefully remove the supernatant.
Add 1 ml ice-cold 0.1 M ammonium acetate (in methanol) to each microfuge tube.
Let pellet “soak” in the buffer for 10 min at -20 °C.
Centrifuge at 24,000 x g for 20 min at 4 °C.
Pipette out the supernatant and take care to not disturb the pellet.
Repeat steps 12 to 15 twice.
Wash each pellet further with 1 ml ice-cold 100% ethanol.
Centrifuge at 24,000 x g for 20 min at 4 °C.
Pipette out the supernatant (as much as possible).
Resuspend each protein pellet with the volume of about 50-100 μl IEF sample buffer. The total resuspension volume per sample is about 500 μl.
Vortex the pellet and let it dissolve in IEF sample buffer at room temperature for 1 h. Do not heat the pellet in IEF sample buffer.
Centrifuge at 24,000 x g for 20 min at room temperature. The resulting supernatant is suitable for IEF analysis.
Quantify the protein concentration with the Bradford assay. Store protein extract at -80 °C until use.
IEF Protein separation
Thaw the protein extract at room temperature.
Centrifuge the protein extract at 24,000 x g for 20 min at room temperature to remove any precipitate.
Take an aliquot containing 200 μg of total protein and adjust the volume to 250 μl with IEF sample buffer.
Note: A good range of sample loading for a 13 cm IPG strip is about 100 – 250 μg total proteins. Generally, we used 13 cm IPG strip (pH 3-10), but we can choose the strip depend on proteins analyzing.
Load 250 μl of each sample uniformly into the ceramic strip holder (13 cm size).
Take out a 13 cm IPG strip and remove the thin plastic seal from the gel side of the strip.
Notes:
The pH range of the strip should match the pH range of the IPG buffer in the IEF sample buffer.
Use a tweezer to handle IPG strip. Avoid touching the gel area of the strip.
Carefully place the IPG strip onto the surface of the IEF sample in the ceramic strip holder, with gel-side down and the acidic end of the strip (marked with a “+”) towards the pointed (+) end of strip holder (Figure 1A).
Figure 1. Illustration of IEF-2DE protein separation by protein pI and MW. A. In the first dimension, proteins are separated by protein pI in IEF strip. B. IEF setup to show the positive side the IEF gel should match the arrow direction of ceramic strip holder and the IPGphor positive electrode plate. C. In the second dimension, proteins are further separated by protein MW in SDS-PAGE.
Carefully raise and lower the strip to assure the gel side of IPG strip is in good contact with the IEF sample solution.
Overlay strip with about 1.5 ml Immobiline DryStrip Cover Fluid.
Cover the strip holder with the plastic lid.
Place the strip unit onto the IPGphor Manifold with pointed (+) end on the large “+” electrode plate.
Begin IEF protocol #1 (Voltage-assisted rehydration sample loading) 20 °C, 50 μA per strip, 0 h rehydration (under non-voltage).
Note: Ensure that the correct number of IPG strips to be run is entered.
Step 1 = 30 V for 360 voltage-hour (Vh)
Step 2 = 500 V for 500 Vh
Step 3 = 1,000 V for 1,000 Vh
Step 4 = 8,000 V for 32,000 Vh
Step 5, 10 h hold at 8,000 V
Total running time = about 20 h (This range of voltage-hour recommended for all pH ranges of IPG strip)
The IEF separation is completed. A good range to stop is at the 32,000 Vh to 42,000 Vh.
Proceed directly to IPG strip equilibration (described below) or store the strip in a closed container before processing further at -80 °C.
SDS-PAGE Protein separation
Pour a 1 mm x 20 cm sized 10% acrylamide gel (pH 8.8 or 9.2) using a flat comb with only a single protein marker well.
Allow to polymerize for 45 to 60 min at room temperature.
Rinse upper surface of running gel with de-ionized water.
Prepare 2 L of 1x solution of Tank Buffer.
Prepare fresh SDS equilibration buffer (± DTT or Iodoacetamide). 20 ml of buffer is needed for each IPG strip.
Directly after IEF, remove the IPG strip and place it into equilibration tube with plastic backing against the tube wall.
Note: Handle each strip individually. Don’t mix up the strips.
Add 10 ml of SDS equilibration buffer (+ DTT) to each tube and gently shake on the rocker platform for 10 min at room temperature.
Decant liquid from tube and add 10 ml SDS equilibration buffer (+ DTT) and gently shake on the rocker platform for an additional 15 min at room temperature.
Decant liquid from tube and replace with 10 ml SDS equilibration buffer (+ Iodoacetamide) and gently shake on the rocker platform for 10 min at room temperature.
Decant liquid from tube and add 10 ml SDS equilibration buffer (+ Iodoacetamide) and gently shake on the rocker platform for additional 15 min at room temperature.
Use a tweezer to place IPG strip in-between the glass plates of the gel with gel-side up and acidic end strip (+) nearest the reference well.
Use a 0.75 mm spacer to gently push the IPG strip onto the top surface of the second dimension gel. Avoid bubbles between strip and gel, and ensure good contact.
Seal strip in place with about 500 μl of “cooled” Agarose overlay solution. Let solidify for about 3 min.
Assemble gels into Bio-Rad Protean II.
Fill upper buffer tank with 1x Tank buffer until full. Place remainder in bottom buffer tank with stir bar.
Load 20 μl Bio-Rad protein standards into the reference well.
Electrophorese at 10 mA per gel (constant current) (~ 40-125 V) for about 15 h, or at 20 mA per gel (constant current) (~ 80-250 V) for about 7.5 h. (This is the approximate time required for bromophenol blue dye to migrate within 1 cm of the end of a 10% gel.)
Protein identification from IEF-2DE
Following IEF-2DE protein separation, proteins can be transferred onto PVDF membrane for immunoblot analysis. We used the Bio-Rad semi-dry transfer system and found efficient transfer.
Alternatively, the 2-DE gel can be stained with Coomassie blue to visualize protein spots. Protein spots of interests can be excised from the gel for mass spectrometry analysis following removal of the dye. (Figure 2)
Figure 2. Total soluble proteins (250 μg) of Arabidopsis thaliana are separated by 2-D gel electrophoresis and identified specific proteins with methionine synthase and lysine-acetylated Abs
Recipes
IEF sample loading buffer Final concentration
Add 0.42 g Urea 7 M
0.15 g Thiourea 2 M
400 μl of 10% CHAPS 4%
20 μl of IPG buffer (appropriate pH range for IPG strip) 2%
0.01 g DTT 1%
20 μl of 0.1% bromophenol blue 0.002%
Check that final volume is 1 ml
SDS equilibration buffer (± DTT or Iodoacetamide), make freshly Final concentration
Add 1.333 ml of 1.5 M Tris Base (pH 8.8) into a 50 ml tube 50 mM
12 ml of 100% glycerol 30%
8 ml of 10% SDS 2%
800 μl of 0.1% bromophenol blue 0.002%
14.41 g Urea 6 M
Add water to 40 ml total volume
After the solution is completely dissolved. Divide the solution in half
Add 0.2 g DTT to 20 ml SDS equilibration buffer(and no iodoacetamide) 2%
Add 0.5 g iodoacetamide to 20 ml SDS equilibration buffer (and no DTT) 5%
10x Tank buffer Final concentration
Dissolve 60.4 g Tris Base 25 mM
288 g glycine 192 mM
20 g SDS 0.1%
In 2 L of water
Do not adjust pH, 10x pH ~ 8.6, 1x pH ~ 8.1
Agarose overlay solution Final Concentration
980 μl of 1x Tank buffer 1x
20 μl of 0.1% bromophenol blue 0.002%
0.005 g Agarose powder 0.5%
Total volume is 1 ml ( ~ 250 μl needed per strip)
Heat at 95 °C for ~10 min to melt
Let cool to touch (~70 °C) before use
Acknowledgments
None.
References
Oh, M. H., Clouse, S. D. and Huber, S. C. (2012). Tyrosine phosphorylation of the BRI1 receptor kinase occurs via a post-translational modification and is activated by the juxtamembrane domain. Front Plant Sci 3: 175
Radwan, O., Wu, X., Govindarajulu, M., Libault, M., Neece, D. J., Oh, M. H., Berg, R. H., Stacey, G., Taylor, C. G., Huber, S. C. and Clough, S. J. (2012). 14-3-3 proteins SGF14c and SGF14l play critical roles during soybean nodulation. Plant Physiol 160(4): 2125-2136.
Wu, X., Oh, M. H., Schwarz, E. M., Larue, C. T., Sivaguru, M., Imai, B. S., Yau, P. M., Ort, D. R. and Huber, S. C. (2011). Lysine acetylation is a widespread protein modification for diverse proteins in Arabidopsis. Plant Physiol 155(4): 1769-1778.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Wu, X., Clough, S. J., Huber, S. C. and Oh, M. (2013). IEF-2DE Analysis and Protein Identification. Bio-protocol 3(19): e924. DOI: 10.21769/BioProtoc.924.
Radwan, O., Wu, X., Govindarajulu, M., Libault, M., Neece, D. J., Oh, M. H., Berg, R. H., Stacey, G., Taylor, C. G., Huber, S. C. and Clough, S. J. (2012). 14-3-3 proteins SGF14c and SGF14l play critical roles during soybean nodulation. Plant Physiol 160(4): 2125-2136.
Download Citation in RIS Format
Category
Biochemistry > Protein > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
HOW TO CALCULATE TIME FROM VOLT-HOUR.
0 Answer
3 Views
Aug 23, 2023
Related protocols
Separation of Plant 6-Phosphogluconate Dehydrogenase (6PGDH) Isoforms by Non-denaturing Gel Electrophoresis
Francisco J Corpas [...] José M. Palma
Jul 20, 2017 8483 Views
Detection of Protein S-nitrosothiols (SNOs) in Plant Samples on Diaminofluorescein (DAF) Gels
Marta Rodríguez-Ruiz [...] Francisco J. Corpas
Sep 20, 2017 7223 Views
Solubilization Method for Isolation of Photosynthetic Mega- and Super-complexes from Conifer Thylakoids
Pushan Bag [...] Domenica Farci
Sep 5, 2021 2316 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
925 | https://bio-protocol.org/en/bpdetail?id=925&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Spindle Angle Measurements
JC Julien Cau
NM Nathalie Morin
GB Guillaume Bompard
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.925 Views: 11828
Reviewed by: Lin FangFanglian HeHui Zhu
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Oncogene Feb 2013
Abstract
Spindle angles measures derive from the measures of spindle poles positions that were taken from fixed and immunostained adherent cells. To determine spindle angles (α), z-stack images of metaphasic cells immunostained with anti γ-tubulin (spindle poles) and anti β-tubulin antibodies (mitotic spindle) were acquired. A very simple ImageJ software macro was developed to measure the spindle angle using spindle pole coordinates (see Figure 1).
Keywords: Spindle Angle Mitosisi
Figure 1. Spindle angle measurement principle. Spindle poles coordinates are measured, then the spindle angle alpha is calculated.
Materials and Reagents
Fixed cells
Antibodies
For example, for mitotic spindle poles, an antibody against γ-tubulin antibody (clone AK-15) (e.g. Sigma-Aldrich, catalog number: T3320 )
For mitotic spindle using an antibody directed against α-or β-tubulin (clone TUB 2.1) (e.g. Sigma-Aldrich, catalog number: T4026 )
Anti-rabbit coupled to Alexa Fluor® 555 (Life Technologies, Invitrogen™, catalog number: A21429 )
Anti-mouse coupled to Alexa Fluor® 488 (Life Technologies, Invitrogen™, catalog number: A11029 )
Note: Primary (AK-15 and TUB 2.1) and secondary (Anti-rabbit coupled to Alexa Fluor® 555 and anti-mouse coupled to Alexa Fluor® 488) antibodies were used after a 1,000 time dilution in 1x PBS/1% BSA.
10x PBS (Life Technologies, Invitrogen™, catalog number: AM9625 )
4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (Sigma-Aldrich, catalog number: D9542 )
BSA (Sigma-Aldrich, catalog number: A4503 )
1x PBS (see Recipes)
1x PBS/1% BSA (see Recipes)
Equipment
We use a Zeiss Axioimager Z1 with 63x Plan-Apochromat 1.4 oil lens and using an Axiocam Mrm camera with a Grid Projection Illumination (apotome). The system is driven by Axiovision software. Images can also be obtained from any confocal microscopes/widefield microscope + deconvolution.
12 mm round coverslips (#1.5)
Glass slides
Vectashield® Mounting Media (Vector Laboratories, catalog number: H-1000 ) or ProLong® Gold (Life Technologies, Invitrogen™, catalog number: P36934 )
Software
Axiovision software
Open source software ImageJ 1.47q (http://rsbweb.nih.gov/ij/index.html)
Macro for spindle angle measurements
Procedure
Stain cells for spindle poles and mitotic spindle using the above-mentioned antibodies and according to the following protocol
Cells grown on 12 mm round coverslips (#1.5) are fixed for 5 minutes at -20 °C in MeOH.
Rehydrated in 1x PBS for 5 minutes and saturated in 1x PBS/1% BSA for at least 30 minutes at room temperature.
Incubated for 2 hours at room temperature with primary antibodies in 1x PBS/1% BSA.
After 3 washes of few seconds in 1x PBS/1% BSA, cells are incubated for 1 hour at room temperature with secondary antibodies coupled to fluorophores and DAPI (to stain DNA, DAPI was used at 0.5 μg/ml) in 1x PBS/1% BSA.
After 3 washes in 1x PBS/1% BSA, coverslips are mounted onto glass slides using either Vectashield® or ProLong® Gold.
Imaging analysis
Acquire Z stacks with a 63x/100x PLAN APO lens. Use Nyquist/Shannon criterion for Z step calculation (0.24 μm for this lens). Image quality must be good enough so that poles are clearly identified.
Make sure the acquisition software calibrates the image (i.e. voxel size is included in the image Metadata). If not, the macro will request to calibrate the Image. XY pixel size can be derived from (physical camera pixel size*camera binning)/(Objective Magnification*tube lens magnification).
Save the Macro text into a 3Dangle.txt file in the Macro subfolder in the ImageJ directory. Install the macro using Plugins>Macros>Install. Select the point selection tool (if multipoint selection tool is selected, right click to switch). Double click on the point tool icon to select the automeasure option. Alternatively, run the macro once (Plugins>Macros>3Dangle).
Using the point selection tool set as indicated in step B3, click on the two spindle poles. Then run the macro (Plugins>Macros>3Dangle). The macro uses the first two lines of the result table to compute the angle. The calculated angle is indicated in the log window. Then, the result table is cleared.
Macro
run("Point Tool...", "mark=0 auto-measure label selection=yellow");
run("Set Measurements...", " redirect=None decimal=3");
IsCalibratedImage();
x1=getResult("X", 0);
y1=getResult("Y", 0);
z1=getResult("Slice", 0);
x2=getResult("X", 1);
y2=getResult("Y", 1);
z2=getResult("Slice", 1);
xmag1=x1;
ymag1=y1;
zmag1=0;
xmag2=(x1-x2);
ymag2=(y1-y2);
zmag2=(z1-z2);
// scalar product
product = (xmag1*xmag2) + (ymag1*ymag2) + (zmag1*zmag2);
// magnitude horizontal vector 1 (points 1- to (0,0,z1)
length1 = sqrt(xmag1 * xmag1 + ymag1*ymag1 + zmag1*zmag1);
// magnitude vector 2 (points 1-2)
length2 = sqrt(xmag2 * xmag2 + ymag2*ymag2 + zmag2*zmag2);
degrees = acos(product/length1/length2);
print("3d angle is " + degrees + " degrees");
run("Select None");
run("Clear Results");
exit();
}
function IsCalibratedImage()
{
um="um";
getVoxelSize(width, height, depth, unit);
if(unit=="pixels" || unit=="microns" || unit=="micron")
{
if (width==0 || width==1)
{
Dialog.create("Image Calibration:");
Dialog.addMessage("Image has to be calibrated \nPlease enter the following parameters");
Dialog.addNumber("x , y pixel size: ", 0, 3, 5, um);
Dialog.addNumber("Z step: ", 0, 3, 5, um);
Dialog.show();
XYscale=Dialog.getNumber();
Zscale=Dialog.getNumber();
n=nSlices;
run("Properties...", "channels=1 slices=n frames=1 unit=um pixel_width="+XYscale+"
pixel_height="+XYscale+" voxel_depth="+Zscale+" frame=[0 sec] origin=0,0");
return;
}
}
}
Recipes
1x PBS
Made by diluting 10x PBS in MilliQ water
1x PBS/1% BSA
Made by addition of 1% (weight/volume) into 1x PBS
Acknowledgments
This protocol is adapted from: Bompard et al. (2013). GB was supported by a grant from ‘Fondation pour la Recherche Médicale’ (Université Montpellier 2). This work was supported by a grant MEGAPAK to NM from the ANR (Agence Nationale pour la Recherche) GENOPAT.
References
Bompard, G., Rabeharivelo, G., Cau, J., Abrieu, A., Delsert, C. and Morin, N. (2013). P21-activated kinase 4 (PAK4) is required for metaphase spindle positioning and anchoring. Oncogene 32(7): 910-919.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cell Biology > Cell staining > Protein
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Correlative Light and Electron Cryo-Microscopy Workflow Combining Micropatterning, Ice Shield, and an In-Chamber Fluorescence Light Microscope
Sabrina Berkamp [...] Carsten Sachse
Dec 20, 2023 2280 Views
Immunofluorescent Staining Assay of 3D Cell Culture of Colonoids Isolated from Mice Colon
Trisha Mehrotra [...] Didier Merlin
Mar 5, 2024 936 Views
An NMR Approach for Investigating Membrane Protein–Lipid Interactions Using Native Reverse Micelles
Sara H. Walters and Brian Fuglestad
Jul 20, 2024 599 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
926 | https://bio-protocol.org/en/bpdetail?id=926&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Batch Culture Fermentation of Endophytic Fungi and Extraction of Their Metabolites
Susheel Kumar
Nutan Kaushik
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.926 Views: 14854
Reviewed by: Ru Zhang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS ONE Feb 2013
Abstract
Antibiosis is one of the possible modes of action shown by endophytic fungi having antifungal activity. To test if antifungal activity in endophytic fungi is due to antibiosis, assay of the metabolites of endophytic fungi was needed. To obtain metabolites for bioassay batch culture fermentation and extraction of metabolites was done. Fungus was multiplied on wickerham media at incubation temperature of 25 ± 2 °C for 4 weeks and then extracted with solvents of different polarity. All the solvent extracts were dried under vacuum rotary evaporator to get dried crude fungal extract, which was subjected to further fractionation and bioassay.
Keywords: Fermentation Endophytic fungi Batch culture Metabolites of endophytic fungi Solvent extraction
Materials and Reagents
Ethyl acetate (Rankem)
Butanol (Qualigens)
Methanol (Qualigens)
Hexane (Qualigens)
Fungus culture
Measuring cylinder
Whatman filter paper
Detergent
Glass jars of 5 L capacity
Malt extract (HiMedia Laboratories)
Yeast extract (HiMedia Laboratories)
Peptone (HiMedia Laboratories)
Glucose (Qualigens)
Needle
Spirit lamp
Commercial disinfectant (70% ethanol)
Vacuum pump
Malt extract
Yeast extract
Wickerham medium (see Recipes)
Equipment
Inoculation flasks
Conical flasks of 1 L capacity
Vacuum rotary evaporator (Heidolph Instruments GmbH)
pH meter (Eutech Instruments pH tutor)
Autoclave (Nat steel)
BOD incubator (Toshiba)
Laminar air flow hood (Toshiba)
Filteration assembly
Hand blender (inalsaappliances.com)
Fume hood
Microbalances (Sartorious, model: RC210P )
Procedure
5 discs of 5 mm diameter of endophytic fungus from petridish were inoculated in Wickerham medium.
Flasks with inoculated media were incubated at 24 °C for 24 days under static culture condition without light.
One flask of medium without any inoculam served as a control.
After 24 days of incubation, 250 ml of ethyl acetate was added to each flask, mixed, and left overnight.
Ethyl acetate immersed fungus culture was blended with a hand blender for 15 min and filtered by whatman filter paper under vacuum (Wicklow et al., 1998).
The filtrate was collected and residual aqueous phase was partitioned thrice times with equal volumes of ethyl acetate in a separator funnel (Figure 1).
Figure 1. Partitioning by separator funnel
Aqueous phase obtained after ethyl acetate extraction was further partitioned three times with equal volumes of saturated butanol.
Aqueous phase obtained after butanol extraction was discarded after immersing in detergent.
The ethyl acetate and butanol extracts were dried with vacuum rotary evaporator.
Dried ethyl acetate extract resuspended in 90% methanol and extracted with n-hexane.
After drying the hexane, butanol, and methanol extracts with vacuum rotary evaporator they were subjected to further experimentation. Schematic diagram for the extraction of the metabolite has been given in Figure 2.
Figure 2. Schematic diagram of extraction procedure for obtaining crude fungal extracts
Recipes
Wickerham medium
Malt extract 3 g/L
Yeast extract 3 g/L
Peptone 5 g/L
Glucose 10 g/L
All the media chemicals were weighed and dissolved in distilled water and pH was measured. After adjusting the pH in range of 7.2-7.4, media was distributed in conical flasks (300 ml in 1 L conical flask). These flasks were subjected to autoclaving at 121 °C temperature and 15 psi pressure for 20 min.
Acknowledgments
This protocol was adopted from Kumar and Kaushik (2013). Authors are grateful to their host institution, The Energy and Resources Institute (TERI), New Delhi, India for funding the research. Susheel Kumar is grateful to University Grant Commission, New Delhi for a research fellowship.
References
Kumar, S. and Kaushik, N. (2013). Endophytic fungi isolated from oil-seed crop Jatropha curcas produces oil and exhibit antifungal activity. PLoS One 8(2): e56202.
Wicklow, D. T., Joshi, B. K., Gamble, W. R., Gloer, J. B. and Dowd, P. F. (1998). Antifungal metabolites (monorden, monocillin IV, and cerebrosides) from Humicola fuscoatra traaen NRRL 22980, a mycoparasite of Aspergillus flavus sclerotia. Appl Environ Microbiol 64(11): 4482-4484.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Kumar, S. and Kaushik, N. (2013). Batch Culture Fermentation of Endophytic Fungi and Extraction of Their Metabolites. Bio-protocol 3(19): e926. DOI: 10.21769/BioProtoc.926.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Biochemistry > Other compound > Antimicrobial
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Yeast Single-cell RNA-seq, Cell by Cell and Step by Step
Mariona Nadal-Ribelles [...] Lars M. Steinmetz
Sep 5, 2019 6028 Views
Yeast Lipid Extraction and Analysis by HPTLC
Dan Li [...] Zhiping Xie
Jul 5, 2021 3507 Views
A Microfluidic Platform for Tracking Individual Cell Dynamics during an Unperturbed Nutrients Exhaustion
Théo Aspert [...] Gilles Charvin
Jul 20, 2022 1565 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
927 | https://bio-protocol.org/en/bpdetail?id=927&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bioassay of Extracts of the Endophytic Fungi
Susheel Kumar
Nutan Kaushik
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.927 Views: 9649
Reviewed by: Ru Zhang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS ONE Feb 2013
Abstract
Many of the microbes including fungi produce metabolites possessing antifungal activity and in some cases fungal metabolites are main cause of antifungal activity resulted by fungus. To infer that antifungal activity is due to fungal metabolites, there is a need to develop a repeatable procedure to assay these metabolites. Here we are presenting the poisoned food technique for bioassay of extract from endophytic fungi, where culture media is supplemented with extract to testpathogen viability as proxy for antifungal activity.
Keywords: Bioassay Antifungal Endophytic fungi Fungal extract
Materials and Reagents
Culture of plant pathogenic fungi (Sclerotinia sclerotiorum)
Methanol (Qualigens)
Potato dextrose agar (PDA) media (HiMedia Laboratories)
Commercial disinfectant (70% ethanol)
Distilled water
PDA media (see Recipes)
Equipment
Measuring cylinder
Inoculating needle
Spirit lamp
Cork borer
Conical flask
Measuring scale
10 cm Petri dishes
pH meter (Eutech Instruments pH tutor)
Autoclave (Nat steel)
BOD incubator (Toshiba)
Laminar air flow hood (Toshiba)
Micropipette (Eppendorf)
Microbalances (Sartorious, model: RC210P )
Procedure
Solvent extracts from endophytic fungi were tested against Sclerotinia sclerotiorum a well known plant pathogenic fungus.
30 mg of dried extract was dissolved in 800 μl of methanol.
200 and 400 μl of the dissolved extract were added to 30 ml of molten PDA media, mixed and then poured equally into three 10 cm Petri plates to obtain 250 and 500 μg/ml extract concentrations, respectively.
To obtain 1,000 μg/ml concentration, 30 mg of dried extracts were dissolved in 400 μl of methanol and 400 μl were added to 30 ml of molten PDA.
Control growth plates contained 400 μl of methanol.
S.sclerotiorum was inoculated at the centre of the plate and radial growth was measured at 48 h intervals till the control plate attained the full growth.
Per cent growth inhibitions (%GI) of the extracts were calculated relative to the growth on the control plate.
%GI = {(A-B)/A} x 100
Where A = Growth of plant pathogenic fungus in control plate
B = Growth of plant pathogenic fungus plates supplemented with extract from endophytic fungus
Recipes
PDA media
39.1 g of PDA media was dissolved in 1,000 ml of distilled water and pH was adjusted to 7.0
Acknowledgments
This protocol was adopted from Kumar and Kaushik (2013). Authors are grateful to their host institution, The Energy and Resources Institute (TERI), New Delhi, India for funding the research. Susheel Kumar is grateful to University Grant Commission, New Delhi for a research fellowship.
References
Kumar, S. and Kaushik, N. (2013). Endophytic fungi isolated from oil-seed crop Jatropha curcas produces oil and exhibit antifungal activity. PLoS One 8(2): e56202.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Kumar, S. and Kaushik, N. (2013). Bioassay of Extracts of the Endophytic Fungi. Bio-protocol 3(19): e927. DOI: 10.21769/BioProtoc.927.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Biochemistry > Other compound > Antimicrobial
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Yeast Single-cell RNA-seq, Cell by Cell and Step by Step
Mariona Nadal-Ribelles [...] Lars M. Steinmetz
Sep 5, 2019 6028 Views
Yeast Lipid Extraction and Analysis by HPTLC
Dan Li [...] Zhiping Xie
Jul 5, 2021 3507 Views
A Microfluidic Platform for Tracking Individual Cell Dynamics during an Unperturbed Nutrients Exhaustion
Théo Aspert [...] Gilles Charvin
Jul 20, 2022 1565 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
928 | https://bio-protocol.org/en/bpdetail?id=928&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Protein Ubiquitination Assays
QZ Qingzhen Zhao
Qi Xie
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.928 Views: 47639
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Plant Journal May 2013
Abstract
Ubiquitin can be added to substrate protein as a protein tag by the concerted actions of ubiquitin activating enzyme (E1), ubiquitin conjugating enzyme (E2) and ubiquitin protein ligase (E3). At the present of E1 and ubiquitin, E2 activity can be determined by the thio-ester formation. The E3 activity of a putative protein as well as the E2/E3 or E3/substrate specificities also can be explored by in vitro ubiquitination assay. The result can be detected by western blot with certain antibody. Purified proteins expressed from bacterial system are always used in this assay.
Keywords: Ubiquitination In vitro Ubiquitin ligase Ubiquitin conjugating enzyme
Materials and Reagents
Cell crude extract
Purified protein or crude extract of ubiquitin activating enzyme (E1)
Purified recombinant ubiquitin conjugating enzyme (E2) fused with a protein tag (such as 6x His tag)
Purified recombinant ubiquitin ligase (E3)
Purified ubiquitin or recombinant ubiquitin protein fused with a tag ( (Kraft et al., 2005; Liu et al., 2010 )
ATP (Sigma-Aldrich, catalog number: A7699 )
MgCl2 (Sigma-Aldrich, catalog number: V900020 )
Anti-ubiquitin antibody or antibody of a certain protein tag
For example:
Anti-Ub, raised in our laboratory
Anti-His (Santa Cruz, catalog number: sc-0836 )
Nickel-HRP (KPL, Kirkegaard & Perry Laboratories, catalog number: 24-01-01 )
Anti-GST (Beijing Protein Innovation, catalog number: AbM59001-2H5-PU )
Anti-MBP (New England Biolabs, catalog number: E8030S )
Amylose resin (New England Biolabs, catalog number: E8021 )
DTT
SDS-PAGE gel
Tris
PMSF
Skimmed milk powder or BSA
Chemiluminescent HRP substrate kit (EMD Millipore, catalog number: WBKLS0100 )
Glycerol
Bromophenol blue
MBP (maltose binding protein) Column buffer (see Recipes)
20x reaction buffer (see Recipes)
4x SDS sample buffer with or without DTT (or β- mercaptoethanol) (see Recipes)
1x PBS (see Recipes)
Equipment
Centrifuge
Thermo-mixturer (Eppendorf Thermomixer comfort)
Protein electrophoresis apparatus
Western blot apparatus
Procedure
DTT sensitive thio-ester assay of E2 protein
The reaction is performed in total 30 μl, including 1.5 μl of 20x buffer, 50 ng of E1, 200-500 ng E2, and 2 μg ubiquitin.
Incubate the reactions at 37 °C for 5 min.
Split the reactions by adding 10 μl 4x SDS sample buffer with or without DTT (or β- mercaptoethanol).
Boil the samples at 100 °C for 5 min.
The reaction products are separated with 12% SDS-PAGE gel and detected by Western blotting with anti-ub antibody or antibody for certain tag fused with the E2 protein to detect the formation of DTT-sensitive thio-ester bonds.
The sample proteins separated by 12% SDS-PAGE gel are electroblotted to nitrocellulose membrane at 100 V for 75 min.
The membrane is blocked with 1x PBS containing 5% skimmed milk powder for 1 h at room temperature.
The membrane was then incubated first with primary antibody (suggested dilution ratio: 1:5,000 for anti-Ub, 1:500 for anti-His, 1:500 for anti-MBP antiserum) then with secondary antibody diluted in 1x PBS containing 3% skimmed milk for 1 h at room temperature. Wash the membrane with 1x PBS for two times (15 min each) after it was incubated with the primary and secondary antibody. If detect His tagged protein with Nickel-HRP，just incubate the membrane with 1:15,000 dilution of Nickel-HRP in 1x PBS containing 1% BSA for 1 h, wash the membrane two times and then bands can be detected.
Bands were detected with the Millipore chemiluminescent HRP substrate kit. (Figure 1)
Figure 1. DTT sensitive thio-ester assay of His-UBC3 ((Kraft et al., 2005)). The reaction samples were detected with anti-His antibody. The arrows indicate the DTT-sensitive thioester linkage. The open triangles indicate bands of E2 protein itself that was not attached to Ub. Asterisks indicate His-tagged Ub.
Autoubiquitination assay of E3 protein
The E3 proteins can be purified in a 1.5-ml Eppendorf tube from cell crude extract just before use (recombinant MBP (Maltose binding protein)-E3 protein is used as an example below).
Vortex and thoroughly suspend the amylose beads.
Aliquot 100 μl of bead suspension to a sterile microcentrifuge tube.
Add 1 ml of MBP column buffer and resuspend the beads.
Centrifuge at 400 x g for 2 min and decant supernatant. Repeat wash.
Add 0.5-1 ml of crude extract (the total amount of the E3 protein should be 0.5-1 μg) to the tube containing the prewashed beads.
Rotate at room temperature for 1 h (or 4 °C for 2 h).
Wash the beads with 1 ml of 50 mM Tris–HCl (pH 7.5) for three times (like steps B3-4) and remove all the liquid of the final wash using very thin tips.
Prepare the reactions in total 30 μl, including 1.5 μl of 20x reaction buffer, 50 ng of E1, 200–500 ng of E2, and 5 μg of ubiquitin. Add the reaction system to the tubes containing the amylose resin beads binding with MBP-E3 proteins.
The reactions minus E1 and minus E2 respectively should be performed at the same time as control.
Incubate the reactions at 30 °C for 1.5 h with agitation (900 rpm) in a thermomixer.
Split the reactions by adding 10 μl 4x SDS sample buffer (with DTT or β- mercaptoethanol) and boil the samples at 100 °C for 5 min.
The reaction products are separated with 8–12% SDS-PAGE gel and detected with anti-ubiquitin antibody or antibody for certain tag fused with ubiquitin or anti-MBP antibody by Western blotting. (see steps A5a-d) (Figure 2)
Figure 2. E3 ligase autoubiquitination activity of MBP-SDIR1 (Zhang et al., 2007).
MBP-SDIR1 was assayed for E3 activity in the presence of E1 (from wheat), E2 (UBCH5b) and 6x His tagged ubiquitin. Samples were resolved by 8% SDS-PAGE. The nickel–horseradish peroxidase (Nickel-HRP) was used to detect His tag ubiquitin.
Note: E2/E3 specificities could be explored using different E2 proteins combined with the same E3 in this assay.
E3/substrate ubiquitination assay
The E3 and substrate protein should be fused with different tag (and the tag also should be different with the tag fused with E1, E2 and ubiquitin) and the recombinant proteins should be expressed and purified before use. The proteins also can be prepared via in vivo expression such as agroinfiltration in Nictotiana benthamiana.
Prepare the reactions in total 30 μl, including 1.5 μl of 20x reaction buffer, 50 ng of E1, 200 ng of E2, 200-500 ng E3, 500 ng substrate proteins and 5 μg of ubiquitin. The reactions minus E1, minus E2 (and minus E3) respectively should be performed at the same time as control.
Incubate the reactions at 30 °C for 1.5 h.
Split the reactions by adding 10 μl 4x SDS sample buffer (with DTT or β- mercaptoethanol) and boil the samples at 100 °C for 5 min.
The reaction products are separated with 8–12% SDS-PAGE gel and detected with anti-ubiquitin antibody or antibody for certain tag fused with substrate protein by Western blotting. (see steps A5a-d) (Figure 3)
Figure 3. HY5-GFP (substrate protein) was ubiquitinated by Myc-COP1 (E3 ligase) (Zhao et al., 2013). HY5-GFP and Myc-COP1 were all expressed via agroinfiltration. Then, the cell lysates were mixed and immunoprecipitated with anti-Myc antibody. The immunoprecipitated product was applied for a further in vitro ubiquitination assay. E1 (from wheat), E2 (UBCH5b) and 6x His tagged Ubiquitin (Ub) were added to the reaction. ★represents the mixture of poly-ubiquitinated HY5-GFP and Myc-COP1. ▲means mono-ubiquitinated E2.
(a) The in vitro ubiquitination samples were detected by immunoblot with anti-GFP antibody.
(b) The in vitro ubiquitination samples were detected by immunoblot with Nickel-HRP (or anti-His antibody) to detect His-Ubiquitin.
Note: The E3 proteins can be purified in a 1.5-ml Eppendorf tube from cell crude extract just before use as steps B1-5. And then the following E3-substrate ubiquitination reactions should be performed with agitation (900 rpm) in a thermomixer.
Recipes
MBP column buffer
20 mM Tris-HCl (pH 7.4)
0.2 M NaCl
1 mM EDTA
Add 1 mM DTT and 1 mM PMSF before use
20x reaction buffer
1 M Tris pH 7.5
40 mM ATP
100 mM MgCl2
40 mM DTT
Note: Aliquoted and stored at -20 °C. Take out an aliquot from -20 °C just before use and each aliquot can be used only once.
4x SDS sample buffer
0.2 M Tris pH 6.8
8% SDS
40% glycerol
0.004% bromophenol blue
0.4 M DTT (or 20% β-mercaptoethanol)
The buffer without DTT or β-mercaptoethanol can be prepared according to this recipe
1x PBS
137 mM NaCl
2.7 mM KCl
10 mM Na2HPO4
2 mM KH2PO4
Adjust to pH 7.4
Acknowledgments
This protocol was developed from the following published paper: Zhao et al. (2013). This work was supported by grants from the National Basic Research Program of China (973 Program) (2011CB915402) and the National Science Foundation of China (CNSF 31030047/90717006). Zhao QZ is supported by National Science Foundation of China grant CNSF 31200907.
References
Kraft, E., Stone, S. L., Ma, L., Su, N., Gao, Y., Lau, O. S., Deng, X. W. and Callis, J. (2005). Genome analysis and functional characterization of the E2 and RING-type E3 ligase ubiquitination enzymes of Arabidopsis. Plant Physiol 139(4): 1597-1611.
Liu, L., Zhang, Y., Tang, S., Zhao, Q.,Zhang, Z., Zhang, H., Li, D., Guo, H. and Xie, Q. (2010). An efficient system to detect protein ubiquitination by agroinfiltration in Nictotiana benthamiana. Plant J 61(1): 893-533.
Zhang, Y., Yang, C., Li, Y., Zheng, N., Chen, H., Zhao, Q., Gao, T., Guo, H. and Xie, Q. (2007). SDIR1 is a RING finger E3 ligase that positively regulates stress-responsive abscisic acid signaling in Arabidopsis. Plant Cell 19(6): 1912-1929.
Zhao, Q., Tian, M., Li, Q., Cui, F., Liu, L., Yin, B. and Xie, Q. (2013). A plant-specific in vitro ubiquitination analysis system. Plant J 74(3): 524-533.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Zhao, Q. and Xie, Q. (2013). In vitro Protein Ubiquitination Assays. Bio-protocol 3(19): e928. DOI: 10.21769/BioProtoc.928.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein > Modification
Biochemistry > Protein > Activity
Biochemistry > Protein > Interaction > Protein-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Simple Method to Determine Protein Redox State in Arabidopsis thaliana
Keisuke Yoshida and Toru Hisabori
Jun 5, 2019 6129 Views
Split-luciferase Complementation Imaging Assay to Study Protein-protein Interactions in Nicotiana benthamiana
Liping Wang [...] Rosa Lozano-Durán
Dec 5, 2021 7868 Views
In vitro Auto- and Substrate-Ubiquitination Assays
Hye Lin Park [...] Gyeong Mee Yoon
Apr 5, 2022 2122 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
929 | https://bio-protocol.org/en/bpdetail?id=929&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
MAPK Phosphorylation Assay with Leaf Disks of Arabidopsis
PF Pascale Flury
DK Dominik Klauser
TB Thomas Boller
Sebastian Bartels
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.929 Views: 12508
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Apr 2013
Abstract
Activation of mitogen activated protein kinases (MAPKs) is involved in many abiotic and biotic stress responses including plant defense. MAPK acitvation is based on the dual phosphorylation of threonine (T) and tyrosin (Y) residues (T-x-Y motif) in the activation loop of the MAPK protein. By determination of the phosphorylation status of a specific MAPK one can detect if the MAPK has been activated or not.
This protocol describes how to analyze the phosphorylation status of Arabidopsis MAPKs MPK3 and MPK6 by using leaf disks, western blotting and a specific antibody (Figure 1). It can also be used for the analysis of MAPKs in other plant systems although some alterations regarding protein extraction might be necessary.
Keywords: Arabidopsis Kinase PTI Innate Immunity Microbe
Figure 1. Detection of the phosphorylation of Arabidopsis thaliana MAPKs MPK6 and MPK3 upon treatment of seedlings for 15 min with the active epitope (flg22, 1 μM) of the bacterial elicitor flagellin (+). No phosphorylated MAPKs were detected in the control treated sample (-).
Materials and Reagents
Arabidopsis thaliana adult plants
Liquid nitrogen
Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) Rabbit mAb #4370 (Cell Signaling Technology) (http://www.cellsignal.com/products/4370.html)
Anti-Rabbit secondary antibody
Tris-HCl
Glycerol
SDS
Dithiothreitol (DTT)
Bromphenol blue
Reagents for SDS-PAGE and Western Blotting
6x Protein extraction/loading buffer (see Recipes)
Equipment
1.5 ml Microcentrifuge tubes
Small petri dishes (~ 5 cm diameter) or 6-well plates
Cork borer (~ 10 mm diameter)
Glass beads (~ 1-2 mm diameter)
Silamat S6 (http://www.ivoclarvivadent.com/en/products/equipment/mixer/silamat-s6)
Alternatively for 4. and 5. Mortar (~ 5 cm diameter) and pestle
Vortexer
Heating block
Centrifuge
Equipment for SDS-PAGE, Western Blotting and detection
Procedure
Leaf disks are cut from adult Arabidopsis (Arabidopsis thaliana) leaves using the cork borer. Try to take leaves of similar age and fitness but from different plants.
Weigh one exemplary leaf disk and note the weight (usually ~ 20 mg).
Float disks on distilled water in small petri dishes or 6-well plates (at least 3 per dish or well in approximately 5 ml of water).
Wait overnight (usually 16 h, dishes closed) and keep the dishes in an undisturbed and controlled place (e.g. growth chamber of origin). This will lead to dephosphorylation of MAPKs which have been phosphorylated upon harvesting.
Next morning perform the treatment, for example add an elicitor peptide of which you would like to know if it triggers MAPK phosphorylation. We add it to a final concentration of 1 μM, mix carefully to not mechanically stress the leaf tissue and in most cases wait for 15 min. As a proper control use a mock treatment (e.g. solvent only) and also incubate for 15 min. This is critical, since MAPK phosphorylation is triggered very easily by many different stresses. Thus you need to show that your control treatment does not lead to phosphorylation of MAPKs. Other treatments could be addition of chemicals, wounding stress, UV-treatment etc.
Note: Phosphorylation and activation of MAPKs happens very quickly and is transient. It starts roughly 2-5 min after treatment and lasts at least for 1 h or longer.
Harvest all disks from one well after the desired incubation time quickly with a forceps and dry them briefly on a paper towel (residual water will dilute your sample and interfere with the grinding procedure). Place them into a microcentrifuge tube (preferably safe lock) that contains 5 glass beads and shock-freeze them in liquid nitrogen. Repeat this procedure for each well.
Note: Here you have to be quick! Harvesting the disks (mechanical stress) will induce MAPK phosphorylation, thus you should not take longer than 1 min for each sample to avoid false positive phosphorylation results!
Grind tissue to fine powder (the tissue should not thaw before the next step!). You can do this by using a mortar and pestle (cooled in liquid nitrogen) but we do not recommend this. Especially if you have many samples grind the tissue by using a Silamat S6 (or similar machine) that grinds the tissue in the tube due to rapid movement and the previously added glass beads.
Add extraction/loading buffer. For example for 60 mg of tissue, use 60 μl and use the same ratio depending on sample weight.
Vortex vigorously until the sample has completely thawed and potential buffer precipitates have been dissolved again. Keep at room temperature and continue with further samples.
Spin all samples 15 sec at 11,000 x g to get down the sample from the lid.
Boil (95 °C) for 5-10 min.
Let cool for 3 min.
Centrifuge at 11,000 x g for 5 min to precipitate glass beads and debris.
Take supernatant from the top (do not disturb the pellet) and load 15 μl on an SDS-PAGE gel (10% or 12%, 1 mm thickness).
Perform your standard Western Blotting method (for us wet and semi-dry worked, and similarly both Alkaline Phosphatase and Horseradish peroxidase worked). We use the primary antibody at 1:2,000 dilutions.
Notes
The “extraction buffer” used in this protocol is a 6x loading buffer. Usually a buffer called “Lacus” (which is very complex) is used for the extraction of phosphorylated MAPKs but we observed, that it works well with just adding the undiluted 6x loading buffer. Since it contains high amounts of SDS do not keep the samples on ice after adding the buffer. Since the samples are very cold SDS might precipitate anyway (white precipitate). In that vortex the samples at room temperature until the SDS dissolved again.
This MAPK antibody detects in principle all phosphorylated MAPKs so it might produce more bands than just the two of MPK3 and MPK6 (especially when using other plant material). If possible include mpk3 and mpk6 mutants in your analysis to clarify the origin of the bands you see.
According to the manufacturer the used MAPK antibody detects single as well as dual phosphorylated MAPKs. To our knowledge you cannot discriminate between the two states. Keep that in mind when interpreting the data.
Recipes
6x Protein extraction/loading buffer
0.35 M Tris-HCl pH 6.8
30% (v/v) glycerol
10% (v/v) SDS
0.6 M DTT
0.012% (w/v) bromphenol blue
Acknowledgments
This work was supported by the Swiss National Science Foundation (grant 31003A_127563; to TB) and by stipends to SB from the European Molecular Biology Organisation (EMBO: ALTF 61-2010) and the Leopoldina Fellowship Programme of the National Academy of Science Leopoldina (LPDS 2009-35).
References
Flury, P., Klauser, D., Schulze, B., Boller, T. and Bartels, S. (2013). The anticipation of danger: microbe-associated molecular pattern perception enhances AtPep-triggered oxidative burst. Plant Physiol 161(4): 2023-2035.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Flury, P., Klauser, D., Boller, T. and Bartels, S. (2013). MAPK Phosphorylation Assay with Leaf Disks of Arabidopsis. Bio-protocol 3(19): e929. DOI: 10.21769/BioProtoc.929.
Flury, P., Klauser, D., Schulze, B., Boller, T. and Bartels, S. (2013). The anticipation of danger: microbe-associated molecular pattern perception enhances AtPep-triggered oxidative burst. Plant Physiol 161(4): 2023-2035.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Perception and signaling
Cell Biology > Cell signaling > Phosphorylation
Biochemistry > Protein > Immunodetection > Western blot
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Western Blot Analysis of Chloroplast HSP70B in Chlorella Species
Stephka Chankova [...] Nadezhda Yurina
Aug 5, 2013 10154 Views
Capillary Nano-immunoassay for Quantification of Proteins from CD138-purified Myeloma Cells
Irena Misiewicz-Krzeminska [...] Norma C. Gutiérrez
Jun 20, 2019 5714 Views
Far-western Blotting Detection of the Binding of Insulin Receptor Substrate to the Insulin Receptor
Jinghua Peng [...] Ling He
Feb 20, 2023 1081 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
93 | https://bio-protocol.org/en/bpdetail?id=93&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Histostaining for Tissue Expression Pattern of Promoter-driven GUS Activity in Arabidopsis
Xiyan Li
In Press
Published: Jul 5, 2011
DOI: 10.21769/BioProtoc.93 Views: 31324
Ask a question
Favorite
Cited by
Abstract
Promoter-driven GUS (beta-glucuronidase) activity is the most commonly used technique for tissue-specific expression patterns in Arabidopsis. In this procedure, GUS enzyme converts 5-bromo-4-chloro-3-indolyl glucuronide (X-Gluc) to a blue product. The staining is very sensitive. Processed samples can be examined under dissecting microscope or Differential Interference Contrast (Nomaski) microscope for bright blue color over cleared transparent background. Note this assay does not provide accurate information to subcellular levels.
Keywords: Gene expression GUS activity Histostaining Arabidopsis Promoter activity
Materials and Reagents
Transgenic plants that contain genomic integration of a promoter: GUS expression cassette
Potassium Ferrocyanide
Potassium Ferricyanide
Triton X-100
50 mM NaHPO4 buffer (pH 7.2)
Dimethylformamide (DMF)
Acetone
NaHPO4 buffer
5-bromo-4-chloro-3-indolyl beta-D-glucuronide cyclohexamine salt (X-Gluc)
200 proof ethanol (once opened, 200 proof becomes essentially 190 proof)
Staining buffer (see Recipes)
Stock solutions (see Recipes)
Equipment
Eppendorf tubes
Vacuum
Dissecting or light microscope
Differential Interference Contrast (Nomaski) microscope
Procedure
Harvest tissue and place in cold 90% Acetone on ice. This should stay on ice until all samples are harvested. For sample containers, Eppendorf tubes and glass scintillation vials work well.
When all samples are harvested, place at room temperature (RT) for 20 min.
Remove acetone from the samples, and add staining buffer on ice.
Add X- Gluc to the staining buffer to a final concentration of 2 mM from a 100 mM stock solution of X-Gluc in DMF- this must be kept in the dark at -20 °C.
Remove staining buffer from samples and add staining buffer with X-Gluc on ice.
Note: Do not infiltrate when make LR embedding, instead infiltrate in the fixatives or 10% ethanol.
Infiltrate the samples under vacuum, on ice, for 15 to 20 min. Release the vacuum slowly and verify that all the samples sink. If they don't, infiltrate again until they all sink to the bottom when the vacuum is released.
Incubate at 37 °C (I usually do it for 2 h for strong promotors and up to overnight for weak promotors. It is not advisable from my experience to go too long (over two days) as the tissue seems to begin deteriorating during long incubations.
Remove samples from incubator and remove staining buffer.
Go through ethanol series from 10%, 30%, 50%, 70% (you may heat the sample to 60 °C to get rid of chloroplasts), to 95% (avoid light); 30 min each step and then finally 100%. You may store at 4 °C for up to a month, seal well.
Go to embedding procedure, or observe directly under dissecting or light microscope. To mount, simply apply a few drops of water to the samples.
Recipes
Staining buffer (final conc.) (fresh)
0.2% Triton X-100 (may be reduced to 0.05%)
50 mM NaHPO4 buffer (pH 7.2)
2 mM potassium Ferrocyanide
2 mM potassium Ferricyanide
Water to volume
Note: Higher Ferricyanide and ferrocyanide concentrations give lower overall staining level, but more specificity. 2 mM works well for most applications, but the concentrations may need to be adjusted for certain needs.
Stock solutions (4 °C)
10% Triton X-100
0.5 M NaHPO4 buffer (pH 7.2)
100 mM potassium Ferrocyanide (store in the dark at 4 °C)
100 mM potassium Ferricyanide (store in the dark at 4 °C)
100 mM X-Gluc in DMF
References
Li, X., Chanroj, S., Wu, Z., Romanowsky, S. M., Harper, J. F. and Sze, H. (2008). A distinct endosomal Ca2+/Mn2+ pump affects root growth through the secretory process. Plant Physiol 147(4): 1675-1689.
Padmanaban, S., Chanroj, S., Kwak, J. M., Li, X., Ward, J. M. and Sze, H. (2007). Participation of endomembrane cation/H+ exchanger AtCHX20 in osmoregulation of guard cells. Plant Physiol 144(1): 82-93.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cell Biology > Tissue analysis > Tissue staining
Plant Science > Plant cell biology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
930 | https://bio-protocol.org/en/bpdetail?id=930&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pancreatic Acinar Cell 3-Dimensional Culture
Chunjing Qu
SK Stephen F. Konieczny
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.930 Views: 13868
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Oncogene Apr 2013
Abstract
Normal pancreatic acinar cells are difficult to maintain on traditional plastic culture surfaces due to their physical properties of housing large quantities of digestive enzymes and the formation of intercellular tight junctions and gap junctions (Apte and Wilson 2005; Rukstalis et al., 2003). However, placing primary acinar cells within a 3-dimensional matrix (3D-culture) maintains the cells for sufficient time so that they can be monitored for physiological changes to different stimuli. We have used a modified collagen 3D-culture system that has been adapted from Means et al. (2005) to model the very early events associated with pancreatic cancer development. In this model, KrasG12D-expressing pancreatic acinar cells, or wildtype acinar cells treated with EGFR-dependent growth factors (i.e., TGFα), convert to ductal cysts that mimic the acinar-to-ductal metaplasia (ADM) stage that precedes formation of Pancreatic Intraepithelial Neoplasia (PanIN) and Pancreatic Ductal Adenocarcinoma (PDAC) (Means et al., 2005; Shi et al., 2013).
Keywords: Tissue culture Differentiation Pancreas
Materials and Reagents
Rat Tail Collagen I (Life Technologies, Invitrogen™, catalog number: A10483 )
Fetal Bovine Serum (FBS)
Pen-Strep
Hanks Balanced Salt Solution (HBSS) (Life Technologies, Gibco®, catalog number: 14065 )
E.Z.N.Z Total RNA Kit I (Omega Bio-Tek, catalog number: R6834-01 )
BME-phenol blue
Xylene
10x RPMI 1640 medium (Life Technologies, Gibco®, catalog number: 31800-022 ) (see Recipes)
4.2% NaHCO3 (see Recipes)
Collagenase P (Roche, catalog number: 11213857001 ) (see Recipes)
100x Soybean Trypsin Inhibitor (STI) (Sigma-Aldrich, catalog number: T6522 ) (see Recipes)
2,000x Dexamethasone (Dex) (Sigma-Aldrich, catalog number: D4902 ) (see Recipes)
3D-culture medium (see Recipes)
Equipment
Centrifuge (Beckman Coulter, model: GS-15R or equivalent, rotor S4180)
Standard 5% CO2 tissue culture incubator
24-well tissue culture plates
37 °C shaker
6 cm culture dish
Dissection scissors
15 ml plastic screw cap tube
Laminar flow hood
Rocking platform
Tissue processor
Polypropylene Mesh (105 μm & 500 μm sizes) (Spectra/Mesh) (Fisher Scientific, catalog number: 146436 and 146418 )
Note: Cut meshes into 10 x 10 cm squares and sterilize by autoclaving.
Homogenizer spin column (Omega Bio-Tek, catalog number: HCR003 )
Tissue-Teck Biopsy Uni-cassette (Sakura, catalog number: 4087)
Falcon tube (15 ml and 50 ml)
Nanodrop spectrophotometer
Procedure
The following procedures for one mouse pancreas
Notes:
All procedures are performed in a laminar flow hood under sterile conditions.
For each pancreas prepare 30 ml Cold HBSS + 5% FBS and 20 ml HBSS + 30% FBS.
Prepare 24-well tissue culture plates (you will need 250 μl collagen mix per well)
On ice, mix rat tail collagen in a ratio of 0.9 ml collagen: 0.1 ml 10x RPMI 1640 medium. Add 80-100 μl 4.2% NaHCO3 per 1 ml mixture (usually a light pink/yellowish color will be achieved).
Note: The volume of NaHCO3 should be tested and adjusted for each batch of collagen.
Place each 24-well plate on ice and pipette 250 μl of collagen gel mixture into each well, assuring that the gel covers the bottom of each well. Repeat so as to have a separate plate for each day of harvest. Cover and place in a 37 °C, 5% CO2 incubator for at least 1 h to solidify.
Isolate cells
Sacrifice each mouse following institutional IACUC protocols.
Put the mouse on a dissection plate in a supine position, spray with 70% EtOH and open the abdominal cavity to expose the pancreas.
Resect the pancreas and place into ~20 ml of HBSS in a 6 cm culture dish on ice. Swirl to wash, and decant liquid.
Add 5 ml cold HBSS and mince the pancreas quickly with dissection scissors.
Transfer the pancreas material into a 15 ml plastic screw cap tube. Add 100 μl 10 mg/ml collagenase P to the tissue suspension and mix gently.
Wrap Parafilm around the cap and shake at 225 rpm in a 37 °C shaker for 15-20 min, until most of the tissue clumps are gone and the suspension look cloudy (examine by eye every 5 min to prevent over- or under-digestion).
Add 5 ml cold HBSS + 5% FBS and centrifuge 2,000 rpm, 2 min at 4 °C. Aspirate supernatant.
Resupsend the pellet 3 times in 5 ml cold HBSS + 5% FBS, spinning at 1,500 rpm, 2 min between rinses.
After the final wash, resuspend the pellet in 5 ml HBSS + 5% FBS.
With sterilized scissors, cut the tip of the1,000 μl pipette tip to make the opening wider and then gently pipet the cell suspension through a sterile 500 μm mesh.
Pipet an additional 5 ml HBSS + 5% FBS to wash all remaining cells through the mesh.
Repeat by pipetting the cell suspension through a 105 μm mesh.
Slowly pipet the cell suspension on top of a 50 ml tube containing 20 ml HBSS + 30% FBS.
Centrifuge 1,000 rpm, 2 min, 4 °C to pellet individual acini clusters.
Aspirate supernatant.
Plating cells
Resuspend the cell pellet in 8-10 ml (volume adjusted according to the size of pancreas) in 3D-culture medium.
Mix the collagen as above step A1.
Mix equal parts of the cell suspension and collagen mix.
Immediately plate the cell suspension in the collagen-coated wells, 0.5 ml/well (see Figure 1).
Figure 1. 3D-culture setup
Allow the collagen-cell mixture to solidify ~1 h at 37 °C, 5% CO2, and then add 1 ml warm 3D-culture medium (with or without growth factors inhibitors).
Change the medium on days 1 and 3. For KrasG12D-expressing acinar cells, over 90% of ductal cysts should form by day 5 (see Figure 2). Similarly, wild-type acinar cells provided 50 ng/ml TGFα following plating will form ductal cysts by day 5, with a conversion rate of about 70%-80% (see Figure 2) (Shi et al., 2013).
Figure 2. Pancreatic acinar cells in 3D-culture
RNA/protein prep from acinar cell 3D-culture
Dilute collagenase P (10 mg/ml) 1:50 in 1x HBSS (room temperature). Prepare 4 ml solution in a 15 ml falcon tube for each sample.
Wash cells/collagen disc in culture well once with 1x HBSS. Transfer collagen disc to a 15 ml falcon tube with a spatula. Pool 3 or 4 wells together to obtain enough cells.
Digest collagen for ~ 30 min in a 37 °C shaker, 250 rpm. Check every 10 or 15 min.
After all of the collagen is digested, pellet the cells at 2,000 rpm for 2 min at 4 °C.
Remove the supernatant, resuspend cells with 1 ml cold HBSS and transfer to a 1.5 ml centrifuge tube.
Centrifuge at 5,000 rpm for 2 min at 4 °C. Carefully remove the supernatant. Loosen the pellet by flicking the bottom of the tube with your finger tips.
OPTION 1: RNA Prep. Follow the E.Z.N.A. Total RNA Mini Kit protocol. Homogenize using a homogenizer column. Resuspend the final RNA in 40 μl ddH2O. Measure the RNA concentration using a nanodrop spectrophotometer. Store at -20 °C.
OPTION 2: Protein Prep. Prepare 100 μl 4x Sample Buffer (BME-phenol blue) + 1:50 protease inhibitor cocktail + 1:100 phosphatase inhibitor cocktail 1 + 1:100 phosphatase inhibitor cocktail 2 + 1:200 Na3VO4 for each sample. Lyse the cells by pipetting and sonicate 15 seconds. Store at -20 °C.
Collagen disc fixation
Fix the collagen discs in the wells with 10% neutral buffered formalin for 30 min at room temperature, and then separate the discs from the plate wall using a yellow 200 μl pipette tip and transfer the discs into scintillation vials containing 10% neutral buffered formalin. Fix on rocker at RT overnight.
Transfer the fixed collagen discs from the scintillation vials into standard biopsy cassettes.
Gradually dehydrate the collagen discs by incubating in 70%, 90%, and 100% EtOH and then in Xylenes in a glass container at room temperature, 2 times of 1 h incubation for each solution on a rocking platform.
After Xylene clearing, transfer the cassettes into the paraffin tank of the tissue processor. Let the collagen discs go through the last two steps of paraffin incubation (1 h each at 65 °C) and then keep them in paraffin tank until it is time for making paraffin blocks.
IMPORTANT: Keep cassettes horizontal or the gels will "flow" into the corners and will be difficult to embed.
Collagen discs can be processed through an automatic tissue processor. However, the freshness (cleanliness) of the solutions inside the processor greatly affects the outcome (the collagen discs will be hard and shrunken when solutions in the processor become old). Manual processing with small volumes of fresh solutions will keep the collagen discs in their original shape after processing.
Recipes
10x RPMI 1640 medium
Dissolve 1 package of RPMI 1640 powder in 100 ml ddH2O
Add 2 g NaHCO3, pH to 7.2
Filter sterilize
Store at 4 °C
Make fresh solution every 2 months
4.2% NaHCO3
Dissolve 4.2 g NaHCO3 in 100 ml ddH2O
Filter sterilize
Store at 4 °C
Collagenase P
Dissolve in 10 ml ddH2O to make a 10 mg/ml stock
Filter sterilize, aliquot and store at -80 °C
Thaw a new vial for each acinar prep
100x Soybean Trypsin Inhibitor (STI)
Dissolve in ddH2O to make a 10 mg/ml stock
Filter sterilize, aliquot and store at -20 °C
2,000x Dexamethasone (Dex)
Dissolve 25 mg in 12.5 ml of 100% EtOH to generate a 2 mg/ml stock
Aliquot and store at -20 °C
3D-culture medium
RPMI 1640
1% FBS
1% Pen-Strep
0.1 mg/ml STI
1 μg/ml Dex
Acknowledgments
This protocol was adapted from Shi et al. (2013).
References
Apte, M. and Wilson, J. (2005). The importance of keeping in touch: regulation of cell-cell contact in the exocrine pancreas. Gut 54(10): 1358-1359.
Means, A. L., Meszoely, I. M., Suzuki, K., Miyamoto, Y., Rustgi, A. K., Coffey, R. J., Wright, C. V., Stoffers, D. A. and Leach, S. D. (2005). Pancreatic epithelial plasticity mediated by acinar cell transdifferentiation and generation of nestin-positive intermediates. Development 132(16): 3767-3776.
Rukstalis, J. M., Kowalik, A., Zhu, L., Lidington, D., Pin, C. L. and Konieczny, S. F. (2003). Exocrine specific expression of Connexin32 is dependent on the basic helix-loop-helix transcription factor Mist1. J Cell Sci 116(16): 3315-3325.
Shi, G., DiRenzo, D., Qu, C., Barney, D., Miley, D. and Konieczny, S. (2013). Maintenance of acinar cell organization is critical to preventing Kras-induced acinar-ductal metaplasia. Oncogene 32(15): 1950-1958.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Qu, C. and Konieczny, S. F. (2013). Pancreatic Acinar Cell 3-Dimensional Culture. Bio-protocol 3(19): e930. DOI: 10.21769/BioProtoc.930.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays > Cell isolation and culture
Cell Biology > Cell isolation and culture > 3D cell culture
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Isolation of Murine Alveolar Type II Epithelial Cells
Fan Sun [...] Zhaoxia Qu
May 20, 2017 11317 Views
Soft Agar Colony Formation Assay as a Hallmark of Carcinogenesis
Feng Du [...] Daiming Fan
Jun 20, 2017 28825 Views
A Fast and Reliable Method to Generate Pure, Single Cell-derived Clones of Mammalian Cells
Zhe Han [...] Varun Kumar
Aug 20, 2022 2586 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
931 | https://bio-protocol.org/en/bpdetail?id=931&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Blood AST, ALT and UREA/BUN Level Analysis
Yuh-Pyng Sher
MH Mien-Chie Hung
Published: Vol 3, Iss 19, Oct 5, 2013
DOI: 10.21769/BioProtoc.931 Views: 38807
Reviewed by: Lin Fang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Oncogene Feb 2013
Abstract
AST (aspartate aminotransferase; GOT, glutamate oxalacetate transaminase) and ALT (alanine aminotransferase; GPT, glutamate pyruvate transaminase) are sensitive indicators to monitor the liver function under drugs treatment or with acute viral hepatitis. The elevated AST and ALT values in the blood sample indicate liver damage or injury. The determination of urea is the most widely used for the evaluation of kidney function. This protocol is for the quantitative determination of AST, ALT and UREA/BUN in serum and plasma on Roche automated clinical chemistry analyzers. The principle is shown below:
For AST:
α-ketoglutarate + L-aspartate L-glutamate + oxaloacetate (AST catalyzes this equilibrium reaction)
oxaloacetate + NADH + H+ L-malate + NAD+ (malate dehydrogenase catalyzes this equilibrium reaction)
The rate of the photometrically determined NADH decrease is directly proportional to the rate of formation of oxaloacetate and thus the AST activity. The above reactions were carried out at 37 °C and measured at a wavelength of 340 nm.
For ALT:
α-ketoglutarate + L-alanine L-glutamate + pyruvate (ALT catalyzes this equilibrium reaction)
Pyruvate + NADH + H+ L-lactate + NAD+ (lactate dehydrogenase catalyzes this equilibrium reaction)
The rate of the photometrically determined NADH decrease is directly proportional to the rate of formation of pyruvate and thus the ALT activity. The above reactions were carried out at 37 °C and measured at a wavelength of 340 nm.
For UREA/BUN:
Urea + H2O → 2 NH4+ + CO2 (urea is hydrolyzed by urease)
α-ketoglutarate + NH4+ + NADH → L-glutamate + NAD+ + H2O (the presence of GLDH yields glutamate and NAD+)
The decrease in absorbance due to consumption of NADH is measured kinetically. The above reactions were carried out at 37 °C and measured at a wavelength of 340 nm.
Keywords: Liver Function AST ALT Urea/BUN
Materials and Reagents
Blood
AST (GOT) detection kit (Roche, catalog number: 11876848216 )
ALT (GPT) detection kit (Roche, catalog number: 11876805216 )
UREA/BUN detection kit (Roche, catalog number: 11729691216 )
Cuvette (Roche, catalog number: TA28 ) and sample cups (Roche, catalog number: 1105 )
Calibrator for automated system (Roche, catalog number: 10759350 )
Normal saline (0.9% w/v of NaCl) (see Recipes)
Equipment
Microhematocrit blood tube (heparinized) (Assistant®, catalog number: 563 )
Dropper (3 ml)
Centrifuge (Eppendorf)
Polypropylene test tube (Corning Incorporated, Axygen®, catalog number: MCT-150-C )
Chemistry Analyzer (Roche, Cobas Mira Plus)
Procedure
Collect blood from the orbital sinus with a microhematocrit blood tube (heparinized). Use dropper to push out the blood in the heparinized blood tube and collect about 300 μl blood in the 1.5 ml polypropylene test tube.
Centrifuge at 1500 x g, 4 °C for 15 min. Carefully take the cell-free supernatant plasma (about half volume of blood) and place it in a properly labeled polypropylene test tube and transfer about 150 μl plasma into the sample cups.
Use fresh plasma for blood AST, ALT and UREA/BUN level analysis.
For analysis, it needs 100-150 μl sample volume in the sample cups. Put the sample cups containing plasma in the sample place and empty cuvettes in the detection place of Chemistry Analyzer. If the sample volume is not enough, it can be diluted with normal saline.
Prepare the detection reagent according to the manufacturer’s instruction and transfer the prepared detection reagent into the reagent container for Chemistry Analyzer. It is easy to prepare the detection reagent by mixing R1 and R2 solution provided in the kit. Briefly, in AST and ALT reagent preparation, connect one bottle 1 to one bottle 1a to prepare R1 solution and then combine the volume of R1 and R2 in R1:R2 = 5:1 to get the detection reagent. For UREA/BUN detection reagent preparation, combine the volume of R1 and R2 in R1:R2 = 5:3. These mixed detection reagents are stable for 7 days at 4 °C.
It needs to correct the Chemistry Analyzer with commercial calibrator before sample detection. The calibrator is as positive control and normal saline as negative control.
After correction, it is ready to analyze AST, ALT and BUN levels of sample in Chemistry Analyzer.
The automatic analysis steps for AST and ALT are:
Aspirate 10 μl of plasma sample from sample cups into cuvette.
Dilute sample with 40 μl of normal saline.
Add 300 μl of detection reagent into cuvette.
Begin to detect the values at 340 nm wavelength at different time points.
Report the measured results.
For UREA/BUN analysis, the steps are:
Aspirate 4 μl of plasma sample from sample cups into cuvette.
Dilute sample with 20 μl of normal saline.
Add 400 μl of detection reagent into cuvette.
Begin to detect the values at 340 nm wavelength at different time points.
Report the measured results.
Notes
The sensitivity of AST, ALT and UREA/BUN is 4 U/L, 4 U/L and 0.83 mmol/L, respectively. The measurement range of AST, ALT and UREA/BUN is 4-800 U/L, 4-600 U/L and 0.83-40.00 mmol/L, respectively.
It is not necessary to repeatedly detect the values from the same sample because the program can monitor the values at different time points. If the variation of measured values in the sample is over 5%, the machine will automatically detect the sample again.
In normal mice, the level of ALT, AST and UREA/BUN in plasma is ALT: 25-60 U/L; AST: 50-100 U/L; UREA/BUN: 16-30 mmol/L. The elevated values of ALT and AST indicate liver injury and high level of UREA/BUN indicates loss of kidney function.
Recipes
Normal Saline (0.9% w/v of NaCl)
Make sure all apparatus are clean, dry, and sterile.
Weight 0.9 grams of sodium chloride. Dissolve the powder in about 80 ml distilled water by mixing gently with a stirring bar until all the powder has been dissolved. Add distilled water to a final volume of 100 ml.
Transfer the prepared 0.9% sodium chloride solution (normal saline) in a storage bottle and label properly. Autoclave the solution.
Acknowledgments
This protocol was adapted from the previously published paper, Sher et al. (2009). This work was supported by Grants from NRPGM in DOH97-TD-G-111-041 (to M-C Hung) and DOH97-TD-111-TM003 (to L-Y. Li). YP Sher was also supported by a postdoctoral fellowship award from the National Health Research Institutes, Taiwan (PD9602).
References
Sher, Y. P., Tzeng, T. F., Kan, S. F., Hsu, J., Xie, X., Han, Z., Lin, W. C., Li, L. Y. and Hung, M. C. (2009). Cancer targeted gene therapy of BikDD inhibits orthotopic lung cancer growth and improves long-term survival. Oncogene 28(37): 3286-3295.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Protein > Activity
Biochemistry > Protein > Quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Measurement of the Activity of Wildtype and Disease-Causing ALPK1 Mutants in Transfected Cells With a 96-Well Format NF-κB/AP-1 Reporter Assay
Tom Snelling
Nov 20, 2024 270 Views
Compartment-Resolved Proteomics with Deep Extracellular Matrix Coverage
Maxwell C. McCabe [...] Kirk C. Hansen
Dec 5, 2024 333 Views
Quantitative Measurement of the Kinase Activity of Wildtype ALPK1 and Disease-Causing ALPK1 Mutants Using Cell-Free Radiometric Phosphorylation Assays
Tom Snelling
Nov 20, 2024 254 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
932 | https://bio-protocol.org/en/bpdetail?id=932&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Colon Tissue Immunoelectron Microscopy
MI Megumi Iwano
Akio Tsuru
KK Kenji Kohno
Published: Vol 3, Iss 20, Oct 20, 2013
DOI: 10.21769/BioProtoc.932 Views: 7254
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Proceedings of the National Academy of Sciences of the United States of America Feb 2013
Abstract
The method described here is intended to study intracellular localization of proteins in colon cells. This protocol was used to localize IRE1β in the endoplasmic reticulum membrane. We used anti-IRE1β antibody raised in guinea pig for this purpose. We also studied the location of BiP (also known as GRP78), with the antibody raised in rabbit. Both antibodies used with appropriate gold particle-conjugated secondary antibodies gave good results. Primary mouse antibodies are not recommended because secondary anti-mouse antibodies also react with the internal mouse epitopes.
Keywords: Immunoelectron microscopy Goblet cells ER stress IRE1 BiP
Materials and Reagents
Mice
Paraformaldehyde (TAAB, catalog number: P001/1 )
Sucrose
Glutaraldehyde (Polysciences, catalog number: 111-30-8 )
Ethanol
Propylene oxide
LR White (London resin, medium)
Hydrogen peroxide
ImmunoSaver (Nisshin EM, catalog number: 333 )
Gelatin
Tween 20
Uranyl acetate
Distilled water or Milli-Q water
Primary antibodies
10-nm gold-conjugated secondary antibodies (we purchased from EY laboratories in Tsuru et al., 2013)
Phosphate buffered saline (PBS) (see Recipes)
0.1 M phosphate buffer (pH 7.2) (see Recipes)
Antigen-retrieval solution (see Recipes)
Equipment
Peristaltic pump
Refrigerator
Freezer
UV irradiator (Nisshin EM, model: TUV-100 ) with 15 W UV light
Gold grid (Maxtaform HR25)
Ultra microtome (Leica Microsystems, model: Ultracut UCT )
Diamond knife (Diatome AG, catalog number: ultra 45 )
Incubator
Microwave (Nisshin EM, catalog number: MWF-2 )
Electron microscope (Hitachi, model: H-7100 )
Procedure
Sample preparation
Fix whole mice by perfusion.
Set up perfusion system consisted of needle, tubing, peristaltic pump and beakers with PBS (ice-cold) or 4% paraformaldehyde in PBS (ice-cold).
Anesthetize mice and expose hearts by surgery.
Insert the needle into the left ventricle and make a hole in the right atrium.
Remove blood from mice by perfusion (8 ml/min) with PBS (ice-cold).
Fix mice by perfusion (8 ml/min) with 4% paraformaldehyde in PBS (ice-cold).
Isolate colons and cut them up into small pieces (~1.5 mm thick).
Fix again with 0.1% glutaraldehyde and 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.2) for 2 h at 4 °C.
Wash samples by 0.1 M phosphate buffer (pH 7.2) containing 8% sucrose.
Dehydrate samples with a series of ethanol as follows.
25% ethanol, 10 min at 4 °C
60% ethanol, 30 minu at -30 °C
80% ethanol, 30 min at -30 °C
99% ethanol, 30 min at -30 °C
99% ethanol, 10 min at RT
100% ethanol, two changes, 10 min each at RT
To promote the infiltration of resin, remove ethanol with propylene oxide as follows.
Ethanol-propylene oxide (2:1), 10 min at RT
Ethanol-propylene oxide (1:1), 10 min at RT
Ethanol-propylene oxide (1:2), 10 min at RT
Propylene oxide, 20 minutes at RT
Make resin infiltrate into samples by immersion as follows.
Propylene oxide-LR White containing accelerator (3:1), 2 h at RT
Propylene oxide-LR White containing accelerator (1:1), 2 h at RT
Propylene oxide-LR White containing accelerator (1:3), 2 h at RT
LR White containing accelerator, 12 h at RT
Polymerize resin under UV irradiation for two days at RT.
Cut the embedded samples (90 nm thick) with ultra microtome and mount on uncoated gold grids (300 mesh).
Immunostaining
Treat sections with 3% (vol/vol) hydrogen peroxide for 30 min at RT to unmask epitope.
Wash sections with distilled water.
Treat sections with antigen-retrieval solution for 15 min under microwave at 95 °C by interval of 2 sec.
Block sections with 0.1% gelatin in PBST (PBS containing 0.05% Tween 20) for 30 min at 37 °C.
Reacted sections with primary antibodies diluted with PBST overnight at RT.
Wash sections three times with PBST for 10 min each at RT.
React sections with 10-nm gold-conjugated secondary antibodies diluted with PBST for 2 h at RT.
Wash sections twice with PBST for 10 min each at RT.
Wash sections twice with distilled water for 5 min each at RT.
Stain sections with 4% uranyl acetate for 10 min at RT.
Wash sections with distilled water.
Observe sections with an electron microscope.
Recipes
Phosphate buffered saline (PBS)
Dissolve 2.89 g of Na2HPO4·12H2O, 0.2 g of KH2PO4, 8.0 g of NaCl, and 0.2 g of KCl in distilled water
Adjust the final volume to 1,000 ml
Sterilize by autoclaving
0.1 M phosphate buffer (pH 7.2)
Solution A: Dissolve 13.61 g KH2PO4 in 1,000 ml distilled water
Solution B: Dissolve 17.8 g Na2HPO4·2H2O in 1,000 ml distilled water
Mix appropriate volumes of solution A and solution B to adjust pH to 7.2
Antigen-retrieval solution
Dilute ImmunoSaver 200-fold with distilled water
Acknowledgments
This work was supported by the Japan Society for the Promotion of Science (JSPS) KAKENHI Grants 24228002, 24248019 (to K.K.), and 14580699 (to A.T.), Ministry of Education, Culture, Sports, Science and Technology in Japan (MEXT) KAKENHI Grant 19058010 (to K.K.), The Uehara Memorial Foundation (K.K.), Takeda Science Foundation (K.K.), Mitsubishi Foundation (K.K.).
References
Tsuru, A., Fujimoto, N., Takahashi, S., Saito, M., Nakamura, D., Iwano, M., Iwawaki, T., Kadokura, H., Ron, D. and Kohno, K. (2013). Negative feedback by IRE1β optimizes mucin production in goblet cells. Proc Natl Acad Sci U S A 110(8): 2864-2869.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Iwano, M., Tsuru, A. and Kohno, K. (2013). Colon Tissue Immunoelectron Microscopy. Bio-protocol 3(20): e932. DOI: 10.21769/BioProtoc.932.
Download Citation in RIS Format
Category
Cell Biology > Cell staining > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Immunohistochemistry of Immune Cells and Cells Bound to in vivo Administered Antibodies in Liver, Lung, Pancreas, and Colon of B6/lpr Mice
Kieran Adam and Adam Mor
Jul 20, 2022 2200 Views
High-throughput Assessment of Mitochondrial Protein Synthesis in Mammalian Cells Using Mito-FUNCAT FACS
Hironori Saito [...] Shintaro Iwasaki
Feb 5, 2023 671 Views
Immunofluorescent Staining Assay of 3D Cell Culture of Colonoids Isolated from Mice Colon
Trisha Mehrotra [...] Didier Merlin
Mar 5, 2024 936 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
933 | https://bio-protocol.org/en/bpdetail?id=933&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro T Cell–DC and T Cell–T Cell Clustering Assays
AG Audrey Gérard
Published: Vol 3, Iss 20, Oct 20, 2013
DOI: 10.21769/BioProtoc.933 Views: 14593
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Nature Immunology Apr 2013
Abstract
To get activated, T cells need to find their cognate antigen at the surface of an antigen-presenting cell (APC). Recognition of cognate antigen in the context of the MHC (Major histocompatibility complex) by the TCR (T-Cell Receptor) results in long lasting interactions between T cells and APCs. Subsequently, T cells form homotypic interactions with each other, which is seen as a hallmark of T cell activation. This protocol describes a method to analyze T-APC and T-T conjugation.
Materials and Reagents
RPMI-1640 medium (Life Technologies, Gibco®, catalog number: 11875-093 )
FBS (Hyclone, catalog number: SH30396-03 )
Penicillin-Streptomycin-Glutamine Solution (Life Technologies, Gibco®, catalog number: 10378-016 )
2-mercaptoethanol (Life Technologies, Invitrogen™, catalog number: 21985-023 )
Phorbol 12-myristate-13-acetate (PMA) (Sigma-Aldrich, catalog number: 79346 )
Ionomycin (Sigma-Aldrich, catalog number: 19657 )
5-(and-6)-Carboxyfluorescein Diacetate, Succinimidyl Ester (5(6)-CFDA, SE) (CFSE) (Life Technologies, Molecular Probes®, catalog number: C1157 )
7-hydroxy-9H-(1,3-dichloro-9,9-dimethylacridin-2-one (DDAO) (Life Technologies, Invitrogen™, catalog number: C34553 )
5-(and-6)-(((4-Chloromethyl)Benzoyl)Amino) Tetramethylrhodamine (CMTMR) (Life Technologies, Invitrogen™, catalog number: C2927 )
16% Paraformaldehyde Solution (PFA) (16% Formaldehyde, EM Grade) (Electron Microscopy Sciences, catalog number: 15710 )
Vectashield Hardset with Dapi (VWR International, catalog number: 101098-050 )
Poly-L-Lysine Solution 0.1% (w/v) in H2O (Sigma-Aldrich, catalog number: P8920 )
SL8 (Ovalbumin (257-264)) (AnaSpec, catalog number: 60193 )
PBS (Life Technologies, catalog number: 14190-44 )
Media (see Recipes)
2% PFA (see Recipes)
Poly-L-Lysine-coated chamber (see Recipes)
Equipment
Centrifuge
Flow Cytometer
Epifluorescent microscope
37 °C, 5% CO2 Cell culture incubator
24 well plate (Corning, Costar®, catalog number: 3524 )
40 μm Cell strainer (BD Biosciences, Falcon®, catalog number: 352340 )
FACS tube, polystyrene (BD Biosciences, Falcon®, catalog number: 352054 )
8-well chamber slide (Thermo Fisher Scientific, Lab-TekTM, catalog number: 177445 )
Procedure
T-APC conjugation assay
Notes:
This protocol uses purified OT-I CD8+ T-cells from naive mice, which are transgenic for a TCR recognizing the chicken egg OVA–derived SIINFEKL peptide (SL8) in the context of the MHC class I molecule H2-kb. The same protocol can be used with T cells specific for other antigens. BMDCs (Bone-Marrow derived Dendritic Cells) are used as APCs, but DCs from other origin, or many cell lines, can be used as APCs.
Once cells are labeled, they should stay protected from light as much as possible.
Cell labelling: resuspend BMDCs and purified naive OT-I cells in PBS at a concentration of 10 x 106 cells/ml (usually 20 x 106 cells in 2 ml). Add DDAO at a final concentration of 4 μM on BMDCs, and CFSE at a final concentration of 1 μM on OT-I cells. Incubate for 30 min at 37 °C 5% CO2.
Note: CFSE and DDAO can be substituted for other dyes. The advantage using those 2 dyes is that little to no compensation on the flow cytometer is needed.
Wash cells three times with 5 volumes of media (10 ml if you start with 20 x 106 cells) by centrifuging at 300 x g for 5 min at room temperature.
Pulse APCs: resuspend BMDCs in media at a concentration of 10 x 106 cells/ml. Add SL8 at a final concentration ranging from 0-1,000 ng/ml (usually 5 different concentrations are used) and incubate for 60 min at 37 °C 5% CO2.
While APCs are antigen pulsing, resuspend OT-I cells at 4 x 106 cells/ml in media (usually 20 x 106 cells in 5 ml). Add 50 μl of OT-I cells per FACS tube. Leave cells at 37 °C 5% CO2 until APCs are ready.
Wash BMDCs three times with 5 volumes of media by centrifuging at 300 x g for 5 min at room temperature.
Resuspend BMDCs at 4 x 106 cells/ml in media.
Add 50 μl of BMDCs to each FACS tube containing OT-I cells. Immediately spin at 228 x g (1,000 rpm) for 1 min at 20 °C. Immediately place at 37 °C.
Note: In this protocol, the ratio T cell-APC is 1, but you can make it vary. Time of incubation is usually between 0-60 min (0-10-20-30-60 min).
Fix the cells: Once the desired amount of time is completed, add 100 μl per sample of warm (20 °C) 2% PFA. Mix very gently, either by pipetting up and down or quickly vortexing on low. Incubate at room temperature (around 20 °C) for 10 min.
Run on flow cytometer. Assess the percentage of coupling based on double CFSE/DDAO positives (Figure 1).
Figure 1. T-APC coupling assay-Example. CFSE-labeled OT-I cells are incubated for 30 min at 37 °C with DDAO-labeled BMDCs that were pulsed with 0 (left plot) or 100 ng/ml (right plot) SL8 peptide. Cells debris were first excluded using a SSC/FSC gate (upper panel). Coupled cells are DDAO+ and CFSE+.
T-T clustering assay
Notes:
In this protocol, T cells are activated with PMA and Ionomycin, which by-pass the need for an APC and every T cell could be activated this way. However, the same protocol can be used with T cells activated with an APC, anti-CD3 and anti-CD28, etc...
This protocol compares, as an example, the capacity of OT-I cells deficient for the integrin ICAM-1 to form homotypic interactions compared to control OT-I cells. But the same protocol can be used to investigate the kinetic of T cell clustering, blocking antibodies, etc…
Cell labelling: resuspend purified OT-I cells in PBS at a concentration of 10 x 106 cells/ml (usually 20 x 106 cells in 2 ml). Add CFSE at a final concentration of 1 μM on Control cells, and CMTMR at a final concentration of 4 μM on ICAM-1-/- cells. Incubate for 30 min at 37 °C 5% CO2.
Wash cells three times with 5 volumes of media by centrifuging at 300 x g for 5 min at room temperature.
T cell activation: Resuspend OT-I cells in media at a concentration of 2 x 106 cells/ml. WT and ICAM-1-/- cells are mixed at a ratio 1 and then activate cells by adding 5 ng/ml PMA and 50 ng/ml ionomycin directly in the media. Plate 2 ml cell suspension per well of a 24 well plate.
16 to 24 h after activation, percentage of cells in clustered is analyzed by flow cytometry (step B5) or microscopy (step B6).
Analysis by flow cytometry: Cells are fixed by adding the same volume of 2% PFA for 10 min at 20 °C. Fixed cells are run through a 40 μm strainer into a FACS tube. Cells that went through represent the “non-clustered” fraction. Cells retained on the strainer are washed with 1 ml of PBS 2 mM EDTA (to disrupt cell clusters) and represent the “clustered” fraction. Both fractions are run on flow cytometer (Figure 2).
Figure 2. T-T clustering assay–Analysis by flow cytometry. CFSE-labeled WT OT-I cells and CMTMR-labeled ICAM-1-/- OT-I cells were ad-mixed and stimulated with PMA and Ionomycin. 24 h after activation, clustered cells were separated from non-clustered cells through a 40 μm strainer and both fractions were analyzed by flow cytometry. Cell debris was first excluded using a SSC/FSC gate (upper panel). Clustered cells – left panel; non-clustered cells – right panel.
Note that ICAM-1 deficient cells are mainly found in the non-clustered cell fraction compared to WT cells.
Note: Cut the tip of your pipet tip to ensure that cell clusters are not disrupted by pipetting when applying the cell suspension on the strainer.
In vitro activated T cells usually form clusters that are bigger than 40 μm diameter and therefore should be retained on the strainer. However, cells that are going through the strainer can potentially be part of smaller clusters. It is therefore useful to compare the flow cytometry data with microscopy quantification.
Analysis by microscopy: Cells (usually 300 μl of cell suspension) are transferred onto a poly-L-Lysine-coated chamber and incubated for 10 min at 37 °C 5% CO2. Media is then carefully removed and replaced by 200 μl of 2% PFA. After 10 min, PFA is carefully removed, and replaced by 200 μl of PBS. Remove the PBS and let dry for 2 min. Remove the chamber gasket and mount with a drop of Vectashield on a coverslip. Analyze with epifluorescent microscope.
Note: Cut the tip of your pipet tip to ensure that cell clusters are not disrupted by pipetting when applying the cell suspension on the chamber.
Recipes
Media (555 ml)
500 ml RPMI Medium 1640
50 ml heat inactivated (30 min at 56 °C) FCS
500 μl of 50 mM β-mercaptoethanol
5 ml of Penicillin-Streptomycin-Glutamine Solution
Keep at 4 °C
2% PFA
Dilute 1 ml of 16% PFA solution in 7 ml PBS
Keep in dark at 4 °C
Poly-L-Lysine coated chambers
Dilute poly-L-Lysine stock solution 1/100 in dH2O
Put 500 μl on each chamber
Incubate 5-10 min at RT
Wash thoroughly with dH2O and let the chambers dry at least 2 h
Chambers can be stocked for several weeks at RT
Acknowledgments
This protocol was adapted from the previously published paper Gerard et al. (2013). This protocol was adapted in the laboratory of Matthew F. Krummel, and was supported by grants from the Juvenile Diabetes Foundation (MFK), and NIH R01AI52116 (MFK).
References
Gérard, A., Khan, O., Beemiller, P., Oswald, E., Hu, J., Matloubian, M. and Krummel, M. F. (2013). Secondary T cell-T cell synaptic interactions drive the differentiation of protective CD8+ T cells. Nat Immunol 14(4): 356-363.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
T Cell Clonal Analysis Using Single-cell RNA Sequencing and Reference Maps
Massimo Andreatta [...] Santiago J. Carmona
Aug 20, 2023 2603 Views
Functional Phenotyping of Lung Mouse CD4+ T Cells Using Multiparametric Flow Cytometry Analysis
Céline M. Maquet [...] Bénédicte D. Machiels
Sep 20, 2023 1343 Views
T-Cell-Based Platform for Functional Screening of T-Cell Receptors Identified in Single-Cell RNA Sequencing Data Sets of Tumor-Infiltrating T-Cells
Aaron Rodriguez Ehrenfried [...] Rienk Offringa
Apr 20, 2024 3775 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits