id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
63 | https://bio-protocol.org/en/bpdetail?id=63&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Rabbit IgG Conjugation to Dynabeads
Xiyan Li
In Press
Published: May 5, 2011
DOI: 10.21769/BioProtoc.63 Views: 16964
Ask a question
Favorite
Cited by
Abstract
This method couples rabbit IgG (or any other proteins serve as affinity reagent) to the surface of magnetic beads (Brand name: Dynabeads). The amine and thiol groups of amino acid residues on the protein are covalently linked with the epoxy group on Dynabeads. The coupled IgG beads can be stored at 4°C for 6-12 month with no obvious loss in reactivity.
Keywords: Dynabeads Immunoglobulin G Conjugation Immunoprecipitation Affinity purification
Materials and Reagents
Invitrogen Conjulation kit (143.11D), contains C1, C2, HB, LB, SB solutions
IgG (Sigma-Aldrich, catalog number: I5006-10 mg )
Dynabeads M-270 Epoxy 300 mg (Life Technologies, Invitrogen™)
Phosphate buffered saline (PBS) tablet
30% NaN3 (fresh)
20% Tween 20
Equipment
Hula mixer (Life Technologies, Invitrogen™) or other rocker capable of 360° rotation
Magnet for 15 ml tubes
Spectrometer
Procedure
Day 1
Dissolve rabbit IgG in cold 1x PBS to a final concentration of 10 mg/ml.
Centrifuge the rabbit IgG at 14,000 rpm for 10 min at 4 °C, and save the supernatant.
Determine the IgG concentration using the Bradford method on a spectrometer.
Add 5 ml C1 of the Conjulation Kit to the 300 mg dynabeads and mix by pipetting in the original glass vial. Then transfer to a 15 ml tube. Add C1 to 12 ml, split to another three 15 ml tubes, each tube with 3 ml beads.
Remove the supernatant from the tube on a magnet.
Add 300 μl rabbit IgG from step 1, 2.7 ml C1 to the beads, mix by pipetting.
Add 3 ml C2 and mix by pipetting again.
Wrap in aluminum foil and incubate at 37 °C for 16-24 h on Hula mixer set at 15-20 rpm.
Day 2
Centrifuge 1,000 x g, 5 min. Remove the supernatant (save supernatant for calculation of protein conjulation efficiency).
Wash each tube with 1,000 μl HB in each tube (add HB, then transfer to a 2 ml tube). Combine supernatant.
Wash each tube with 1,000 μl LB. Combine supernatant.
Wash each tube with 1,000 μl SB. Combine supernatant.
Wash each tube with 1,000 μl SB and incubate at room temperature (RT) for 15 min. Combine supernatant.
Wash each tube with 1,000 μl PBS+0.05% Tween at RT for 10 min x 3 times.
Resuspend beads in each tube with 2 ml SB, add NaN3 to final concentration of 0.02%. Then split each tube of beads (400 μl) to 5 tubes containing 600 μl SB each with 0.02% NaN3.
References
Li, X., Gianoulis, T. A., Yip, K. Y., Gerstein, M. and Snyder, M. (2010). Extensive in vivo metabolite-protein interactions revealed by large-scale systematic analyses. Cell 143(4): 639-650.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Systems Biology > Proteomics > Whole organism
Biochemistry > Protein > Interaction
Molecular Biology > Protein > Protein-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
64 | https://bio-protocol.org/en/bpdetail?id=64&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Yeast Genomic DNA Miniprep Using A FastPrep Cell Lyser
Xiyan Li
In Press
Published: May 5, 2011
DOI: 10.21769/BioProtoc.64 Views: 11914
Ask a question
Favorite
Cited by
Abstract
This method is a convenient way to purify high-quality genomic DNA from yeast cells. It is suitable for PCR and other assays that require genomic DNA of higher quality.
Keywords: Genomic DNA Yeast Small scale FastPrep Cell Lyser PCR
Materials and Reagents
5 M Ammonium acetate (pH 7.0)
Chloroform
Isopropanol
70% Ethanol
Lysis buffer (see Recipes)
Equipment
Adapted for Fastprep machine
Screw-tube
Glass beads
Microfuge
Procedure
Grow 5 ml yeast cells overnight at 30 °C.
Spin,wash once with 1 ml H2O.
Resuspend in 500 μl lysis buffer.
Transfer to a screw-tube with acid washed glass beads.
Fastprep at 6.0 speed for 2 min.
Recover liquid phase with blue tip into another tube.
Add 385 μl 5 M ammonium acetate pH 7.0.
Incubate 5 min at 65 °C, then 5 min on ice.
Add 500 μl chloroform, vortex, spin 2 min in microfuge.
Take supernatant and precipitate with 1 ml isopropanol.
Incubate 5 min at room temprature, then spin 5 min.
Wash pellet with 70% ethanol, dry and dissolve in 50 μl H2O.
Note: For Southern, digest 5 μl DNA; For PCR, use 0.5-1 μl DNA. For E coli transformation, use 1-5 μl DNA.
Recipes
Lysis buffer
100 mM Tris (pH 8.0)
50 mM EDTA
1% SDS
For 50 ml: 5 ml 1 M Tris, 5 ml 0.5 M EDTA, 5 ml 10% SDS
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Molecular Biology > DNA > DNA extraction
Microbiology > Microbial genetics > DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
644 | https://bio-protocol.org/en/bpdetail?id=644&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Allergen Sensitization and Challenge to Ovalbumin
FD François Daubeuf
LR Laurent Reber
NF Nelly Frossard
Published: Vol 3, Iss 7, Apr 5, 2013
DOI: 10.21769/BioProtoc.644 Views: 16827
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Immunology Apr 2012
Abstract
This protocol describes the sensitization and challenge of mice with ovalbumin for use as an acute murine model of asthma. This protocol induces reproducible airway inflammation and remodelling, and bronchial hyperresponsiveness to methacholine as measured by barometric plethysmography, as well as by the Flexivent® technique in Balb/c mice.
Keywords: Asthma Allergen sensitization Ovalbumin Intranasal challenge Mouse
Materials and Reagents
Sterile saline (0.9% NaCl) (B. Braun)
Chicken egg albumin (ovalbumin, grade V) (Sigma-Aldrich, catalog number: A-5503 )
Aluminium hydroxide (Sigma-Aldrich, catalog number: 23918-6 )
Ketamine (Imalgene®, Mérial)
Xylazine (2%) (Rompun®, Bayer)
Ovalbumin (see Recipes)
Anaesthetics (see Recipes)
Equipment
"1 ml" sterile syringes (Terumo, catalog number: SS+01T1 )
"25 G" 0.5 mm sterile needles (Terumo, catalog number: NN-2516R )
Sterile tips (Starlab, catalog number: S1111-0800 )
Precision pipette (20 μl)
End-over-end rotator (SB2, Stuart)
15-ml Falcon tube
Procedure
Summary:
• Nine week-old male Balb/c mice are sensitized on days 0 and 7 by intraperitoneal (i.p.) injections of 50 μg ovalbumin adsorbed with 2 mg aluminium hydroxide (alum) in saline.
• Mice are challenged on days 18, 19, 20 and 21 by intranasal (i.n.) instillations of 10 μg ovalbumin in saline; control animals receive i.n. instillations of saline alone; i.n. administrations must be carried out under anesthesia (ketamine and xylazine diluted in sterile saline, see Recipes).
• Assessments are performed 18-24 h after the last i.n. challenge.
Allergen sensitization
Freshly prepare a suspension containing 0.5 mg/ml of ovalbumin (see Recipes) and 20 mg/ml of alum in sterile saline (0.9% NaCl): Weigh 80 mg alum in a 5 ml tube, add 1 ml from a 2 mg/ml ovalbumin aliquot, and 3 ml of sterile saline (0.9% NaCl).
Gently homogenize the suspension in a rotator for 4 h at 4 °C so that ovalbumin may adsorb on alum. The mixture appears as a white suspension, susceptible to rapidly settle down to the bottom of the tube. It should be homogenized by rapid reversals (3-4) of the tube/syringe just before use.
Before use, bring suspension to room temperature (18-25 °C) on the rotator.
Hold the mouse in your hand by the dorsal skin so that its head is up and its rear legs are down. Maintain its tail with fingers.
Use "1 ml" syringes and "25 G" needles to inject i.p. 100 μl suspension per mouse.
Note: Gently homogenize the suspension by 3-4 repeated reversals of the tube/syringe between each use so that the suspension does not drop at the bottom of the tube/syringe).
Allergen challenge
Before use, bring solutions (anaesthetics, 0.4 mg/ml ovalbumin aliquot (1 aliquot per 24 mice), and saline) to room temperature (18-25 °C). Vortex for 4 sec at the highest speed to mix.
Hold the mouse in your hand by the dorsal skin so that its head is up and its rear legs are down. Maintain its tail with fingers.
Use "1 ml" syringes and "25 G" needles to inject i.p. 100 μl per mouse (25 g) of the anesthetic solution (at room temperature).
Wait until the mouse is anesthetized; check that vibrissae do not move any more.
Hold the mouse in your hand so that its head is up and its rear legs are down. Administer 12.5 μl of the 0.4 mg/ml ovalbumin solution in each nostril for sensitized mice, and saline alone for control mice, by use of sterile tips (note: Solution must be administered drop by drop, slowly and very carefully).
Keep the mouse in your hand in a vertical position at least for 1 min, and check that the mouse breathes normally.
Note: If the mouse does not breathe normally, perform a thorax massage by pressing the rib cage several times, quickly but carefully.
Place the mouse in decubitus on a heated blanket until complete recovery.
Recipes
Ovalbumin
Prepare a sterile 2 mg/ml solution of ovalbumin as follows: Weigh 80 mg ovalbumin and dissolve it in 40 ml cold sterile saline in a 50-ml Falcon tube. Vortex for 5 min at 2,000 rpm to mix and distribute 30 ml of the solution as 1.1 ml aliquots into 1.5 ml microtubes; this will result in ovalbumin aliquots for 24 mice. Immediately store frozen at -20 °C for up to 2 months.
Take the remaining 10 ml of the 2 mg/ml ovalbumin solution, dilute it 1/5 in sterile saline resulting in a 0.4 mg/ml solution, and distribute as 1 ml aliquots into microtubes (1 aliquot per 24 mice). Immediately store aliquots frozen at -20 °C for up to 2 months.
Anaesthetics
Iin a 15 ml Falcon tube, add 1.5 ml of a 100 g/L commercial solution of ketamine (Imalgene® 1000), 0.5 ml of a 20 g/L commercial solution of xylasine (Rompun® 2%) and 10 ml of sterile saline (0.9% NaCl). The prepared solution contains 12.5 mg/ml ketamine base and 0.83 mg/ml xylasine base from hydrochloride. Inject 100 μl of the anaesthetic solution per mouse (25 g), i.e. a 4 ml/kg.
The administrated dose is 50 mg/kg ketamine and 3.3 mg/kg xylazine. This preparation may be stored at 4 °C for 10 days.
Notes
Other protocols based on this one may be implemented by modification of either the mouse strain, the dose or sequence of administration of ovalbumin, or the allergen (house dust mite or cockroach extracts for instance), with a sensitization step followed by challenges to the allergen. However, using standardized procedures for allergen sensitization and challenge would allow better reproducibility and comparison between results in the literature when studying airway inflammation and remodelling, and generation of bronchial hyper responsiveness.
Acknowledgments
This protocol was adapted from a previously published paper: Reber et al. (2012). FD was supported by the “fond de dotation recherche en santé respiratoire”, call for tenders 2010.
References
Reber, L. L., F. Daubeuf, M. Plantinga, L. De Cauwer, S. Gerlo, W. Waelput, S. Van Calenbergh, J. Tavernier, G. Haegeman, B. N. Lambrecht, N. Frossard and K. De Bosscher (2012). A dissociated glucocorticoid receptor modulator reduces airway hyperresponsiveness and inflammation in a mouse model of asthma. J Immunol 188(7): 3478-3487.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Daubeuf, F., Reber, L. and Frossard, N. (2013). Allergen Sensitization and Challenge to Ovalbumin. Bio-protocol 3(7): e644. DOI: 10.21769/BioProtoc.644.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Monitoring Group 2 Innate Lymphoid Cell Biology in Models of Lung Inflammation
Jana H. Badrani [...] Taylor A. Doherty
Jul 20, 2023 737 Views
HDR-based CRISPR/Cas9-mediated Knockout of PD-L1 in C57BL/6 Mice
Laura V. Heeb [...] Johannes vom Berg
Jul 20, 2023 924 Views
Epicutaneous Application of Mannan Induces Psoriasis-like Inflammation in an Inbred Mouse Strain
Huimei Wu and Kutty Selva Nandakumar
Oct 20, 2023 561 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
645 | https://bio-protocol.org/en/bpdetail?id=645&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Airway Responsiveness in the Anesthetized Mouse
FD François Daubeuf
LR Laurent Reber
NF Nelly Frossard
Published: Vol 3, Iss 7, Apr 5, 2013
DOI: 10.21769/BioProtoc.645 Views: 12204
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Immunology Apr 2012
Abstract
Airway hyperresponsiveness to methacholine is an important characteristic of asthma. Many devices can be used to measure airway responsiveness in the mouse but it is well established that the invasiveness of a measurement technique is correlated with its precision and reproducibility. This protocol describes how to measure airway responses to aerosolized methacholine in anesthetized, tracheotomized, and mechanically ventilated mice using the forced oscillation technique with FlexiVent® (SCIREQ). This is a computer-controlled precision piston pump that can intersperse mechanical ventilation with volume and pressure controlled manoeuvres to obtain accurate, reproducible measurement of respiratory mechanics.
Keywords: Airway responsiveness Forced oscillation technique Flexivent® Methacholine Mouse
Materials and Reagents
Sterile saline (0.9% NaCl) (B. Braun)
Acetyl-β-methylcholine chloride, powder (Sigma-Aldrich, catalog number: A-2251 )
Drierite (Sigma-Aldrich, catalog number: 238988 )
Sodium Pentobarbital (5.47%) (CEVA)
Xylazine (2%) (Rompun®, Bayer)
Cotton wire n50 (DMC, catalog number: 334A/50 )
Equipment
FlexiVent® system (SCIREQ Technologies) composed of the following modules: FV-M1 (1.8 ml), FV-PP-M1 , FV-XC , FV-EC , FV-BU and Aeroneb® Lab nebuliser system associated with Aeroneb® Pro (AG-AL-1000)
"1 ml" sterile syringes (Terumo, catalog number: SS+01T1 )
"25-gauge 0.5 mm" sterile needles (Terumo, catalog number: NN-2516R )
18-gauge metal needle (SCIREQ Technologies, catalog number: 73-0019 )
Procedure
Summary of the protocol to measure airway responsiveness to methacholine:
Mice are weighed and anesthetised i.p. with xylasine and pentobarbital.
Mice are tracheotomised and a 18-gauge metal needle is inserted into the trachea and connected to the FlexiVent® computer-controlled small animal ventilator.
Baseline values are measured.
Saline and then methacholine are aerosolized in the ventilator circuit.
Airway measurements are performed with the FlexiVent® protocol.
Mice are disconnected at the end to ensure that they breathe normally again without the aid of the ventilator.
Anaesthesia
Bring xylasine and pentobarbital solutions to room temperature (18-25 °C), and place methacholine and saline solutions on ice.
Weigh the mouse.
Hold the mouse in your hand by the dorsal skin so that its head is up and its rear legs are down. Maintain its tail with fingers.
Use "1 ml" syringes and "25-gauge" needles to inject solution and administrate 6 ml/kg of the xylasine solution intraperitoneally (i.p.).
Isolate the mouse in another cage. Wait for 10 min.
Hold the mouse in your hand by the dorsal skin so that its head is up and its rear legs are down. Maintain its tail with fingers.
Use another "1 ml" syringe and a "25-gauge" needle to inject 6 ml/kg of pentobarbital i.p.
Replace the mouse in the cage. Wait for 10 min.
Tracheotomy
Check that the mouse is profoundly anesthetised.
Dissect and expose the trachea, place a cotton wire under the trachea, insert the 18-gauge metal needle into the trachea and tie a knot around the trachea with the cotton wire in order to hold the needle in place.
Connect the needle (i.e. connect the mouse) to the computer-controlled small animal ventilator (FlexiVent®).
Follow the "Mouse_AN_v5.2.ext" standard protocol supplied with the FlexiVent®. This protocol consists of 12 cycles of 2 perturbations (snapshot and Prime-8) after 10 sec of nebulization, and allows to measure the resistance, elastance and compliance data.
Measurement processes and methacholine nebulization
Start ventilation when the mouse is connected.
Start the protocol.
Add saline in the nebuliser for the first nebulization step (10 sec) and proceed to the 12 perturbations cycles.
Rinse the nebuliser 3 times with deionized water (eliminate solution with a syringe and replace it with water, repeat 3 times).
Add methacholine in the nebuliser for the second nebulisation step (10 sec) and proceed to the 12 perturbations cycles.
Stop the experiment and stop the ventilation.
Disconnect immediately the 18-gauge metal needle from the apparatus. The mouse should breathe again normally, indicating it was alive during the measures. Then, euthanize the mouse. If the mouse is dead, data should be eliminated.
Rinse the nebulizer 3 times with deionized water.
Begin a new analysis session with the following mouse.
Data analysis
Export data from the Scireq FlexiVent® V5.2 program to an Excel file
For each saline or methacholine nebulization, the peak response is calculated as the mean of the three maximal values (in red on the figure here below), and used for calculation of airway resistance and compliance. Airway resistance is expressed as cm H2O.s.ml-1 and airway compliance as ml.cm H2O-1.
Figure 1.
Recipes
Prepare a solution of methacholine containing 50 mg/ml methacholine (0.26 M) diluted in sterile saline. Methacholine must be prepared extemporaneously.
Freshly prepare a solution of xylasine containing 0.25% xylasine diluted in sterile saline and a solution of pentobarbital containing 0.9% pentobarbital.
Acknowledgments
This protocol was adapted from a previously published paper: Reber et al. (2012). FD was supported by the “fond de dotation recherche en santé respiratoire”, call for tenders 2010.
References
Reber, L. L., F. Daubeuf, M. Plantinga, L. De Cauwer, S. Gerlo, W. Waelput, S. Van Calenbergh, J. Tavernier, G. Haegeman, B. N. Lambrecht, N. Frossard and K. De Bosscher (2012). A dissociated glucocorticoid receptor modulator reduces airway hyperresponsiveness and inflammation in a mouse model of asthma. J Immunol 188(7): 3478-3487.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Daubeuf, F., Reber, L. and Frossard, N. (2013). Measurement of Airway Responsiveness in the Anesthetized Mouse. Bio-protocol 3(7): e645. DOI: 10.21769/BioProtoc.645.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Monitoring Group 2 Innate Lymphoid Cell Biology in Models of Lung Inflammation
Jana H. Badrani [...] Taylor A. Doherty
Jul 20, 2023 737 Views
HDR-based CRISPR/Cas9-mediated Knockout of PD-L1 in C57BL/6 Mice
Laura V. Heeb [...] Johannes vom Berg
Jul 20, 2023 924 Views
Epicutaneous Application of Mannan Induces Psoriasis-like Inflammation in an Inbred Mouse Strain
Huimei Wu and Kutty Selva Nandakumar
Oct 20, 2023 561 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
65 | https://bio-protocol.org/en/bpdetail?id=65&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Immunofluorescent Staining of Murine Tissue
Zheng Liu
In Press
Published: May 5, 2011
DOI: 10.21769/BioProtoc.65 Views: 17252
Ask a question
Favorite
Cited by
Abstract
Renal immune complex deposition and leukocyte infiltration are characteristic of lupus nephritis in human patients and lupus-prone mice. This protocol describes how to stain frozen sections of murine kidney to study these features using fluorescent microscopy. This protocol was developed or modified in Dr. Anne Davidson’s lab at Feinstein Institute for Medical Research.
Keywords: Lupus Nephrtitis Mouse Immunofluorescent Frozen
Materials and Reagents
Antibodies
Rat anti-mouse IgG2a FITC (Southern Biotech, catalog number: 1155-02 )
Rat anti-mouse IgG3 FITC (Southern Biotech, catalog number: 1190-02 )
Rat anti-mouse IgD PE (Southern Biotech, catalog number: 1120-09 )
Rat anti-mouse F480 PE (Life Technologies, Invitrogen™, catalog number: MF48004 )
Rat anti-mouse B220 PE (BD Biosciences, Pharmingen™, catalog number: BD553090 )
Hamster anti-mouse CD11c PE (BD Biosciences, Pharmingen™, catalog number: BD553802 )
Rat anti-mouse CD4 PE (BD Biosciences, Pharmingen™, catalog number: BD553049 )
Note: The above antibodies have been tested by the author and may be substituted with the antibodies desired by users.
Other materials
Murine kidney tissues
Acetone (Sigma- Aldrich, catalog number: 650501-4L )
Tek O.C.T. Compound (Sakura Finetek, catalog number: 4587 )
3% Fetal bovine serum (FBS) (Sigma- Aldrich, catalog number: F2442-500ML ) in PBS.
0.5% Mouse BD Fc Block (BD Biosciences, Pharmingen™, catalog number: 553141 )
DAPI nucleic acid stain (Life Technologies, Invitrogen™, catalog number: D1306 )
Glycergel mounting medium (Dako, catalog number: C0563 )
Block solution
Equipment
Glass staining jars (Cole-Parmer, catalog number: EW-48585-00 )
ImmEdge Pen (Vector Laboratories, Inc, catalog number: #H-4000 )
Procedure
Murine tissues need to be snap frozen in Tek O.C.T. compound and cut into 5 μM sections.
Remove slides from -80 °C and keep in the dark at room temperature (RT) until thawed.
In the fume hood, immerse slides in acetone for 5 min and acetone needs to be pre-chilled in -20 °C.
Immerse slides in PBS for 5 min.
Repeat step 4.
Dry slides at RT and circle tissues with an ImmEdge pen.
Apply ~100 μl blocking solution per tissue and make sure that the solution is within the circles and the entire tissue is covered.
Incubate at RT for 30 min.
Dry the slides.
Note: Do not dry the slides excessively.
Dilute the desired antibody 1/50 in 3% FBS/PBS.
Apply 100 μl antibody dilution per tissue to the slides.
Incubate the slides for 1 h at RT. Keep in dark.
Wash slides in PBS three times (5 min each wash). Keep in dark.
Apply 100 μl DAPI solution (300 nM) per tissue to the slides.
Incubate the slides at RT for 1-5 min. Keep in dark.
Wash the slides in PBS three times (5 min each). Keep in dark.
Heat glycergel mounting medium to 65 °C in a water-bath until melted.
Drain out the PBS from the slides.
Apply the mounting solution to the top of the slides and cover tissue with cover glass, making sure no air bubbles are formed.
Slides are now ready for immediate use for fluorescent microscopy or can be stored at 4 °C in dark for future use.
Notes
This protocol has been successfully used for staining murine renal immune complexes, renal leukocyte infiltrates (CD4 T cells, B220 B cells, F480 macrophages, and CD11c dendritic cells), and murine splenic structures such as B cell follicles (IgD+) germinal centers (Peanut Agglutinin+).
Recipes
Block solution
0.5% Mouse BD Fc Block in 3% FBS
Acknowledgments
This protocol was developed or modified in Dr. Anne Davidson’s lab at Feinstein Institute for Medical Research, NY, USA. This work was supported by grants from the NY SLE Foundation (RB), Rheuminations, NIH AI082037 and AR 049938-01, NIH (PO1 AI51392 and the Flow Cytometry and Protein Expression and Tetramer Cores of PO1 AI51392).
References
Liu, Z., Bethunaickan, R., Huang, W., Lodhi, U., Solano, I., Madaio, M. P. and Davidson, A. (2011). Interferon-alpha accelerates murine systemic lupus erythematosus in a T cell-dependent manner. Arthritis Rheum 63(1): 219-229.
Ramanujam, M., Wang, X., Huang, W., Liu, Z., Schiffer, L., Tao, H., Frank, D., Rice, J., Diamond, B., Yu, K. O., Porcelli, S. and Davidson, A. (2006). Similarities and differences between selective and nonselective BAFF blockade in murine SLE. J Clin Invest 116(3): 724-734.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Immunology > Immune cell staining > Immunodetection
Immunology > Immune cell function > General
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
67 | https://bio-protocol.org/en/bpdetail?id=67&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
RNA Isolation from Arabidopsis Pollen Grains
Yongxian Lu
In Press
Published: May 5, 2011
DOI: 10.21769/BioProtoc.67 Views: 18652
Ask a question
Favorite
Cited by
Abstract
This purpose of this experiment is to isolate high quality RNAs from pollen grains, which lays the foundation for further studies, like gene expression analysis and cDNA cloning.
Materials and Reagents
Mannitol (Thermo Fisher Scientific/ VWR International)
TRIzol reagent (Life Technologies, InvitrogenTM)
Chloroform (Thermo Fisher Scientific)
75% ethanol
Liquid nitrogen
RNase-free water
Isopropyl alcohol
Equipment
Ceramic mortar and pestles
Nanodrop (Thermo Fisher Scientific)
Centrifuges (Eppendorf)
Vortexer (VWR International)
Fume hood
500 ml flask
50 ml falcon tubes
100 μm nylon mesh
Procedure
Pollen collection:
To collect mature pollen grains, stage 13 flowers (Sanders et al., 1999) should be used.
Collect flowers and put into a 500 ml flask.
Add 300 ml ice-cold 0.3 M mannitol.
Hand-shake the flask vigorously for 2 min.
Filter the pollen suspension through 100 μm nylon mesh.
Collect pollen by centrifugation using 50 ml falcon tubes. (450 x g, 5 min, 4 °C). Repeat this step until all the pollen suspension is finished.
Transfer pollen pellet into a 1.5 ml centrifuge tube. You can stop here by storing pollen at -80 °C , or proceed to the RNA isolation steps.
Homogenization:
Put into liquid N2.
Homogenize pollen with mortar and pestles. Try to be as quick as possible at this step.
Add TRIzol reagent (1 ml reagent/ 50-100 mg tissue, the sample volume should not exceed 10% of the volume of TRIzol used for homogenization, as suggested by the TRIzol protocol provided by the manufacturer).
Phase separation:
Incubate the homogenized samples for 5 min at RT to permit the complete dissociation of nucleoprotein complexes.
Add 0.2 ml of chloroform per 1 ml of TRIzol reagent under fume hood. Cap sample tubes securely.
Shake tubes vigorously by hand for 15 sec and incubate them at RT for 2 to 3 min.
Centrifuge the samples at no more than 12,000 x g for 15 min at 4 °C.
Transfer the upper aqueous phase to a fresh tube.
RNA precipitation:
Precipitate the RNA from the aqueous phase by mixing with isopropyl alcohol (Use 0.5 ml of isopropyl alcohol per 1 ml of TRIzol reagent used for the initial homogenization).
Incubate samples at RT for 10 min.
Centrifuge at no more than 12,000 x g for 10 min at 4 °C.
Discard the supernatant.
RNA wash:
Wash the RNA pellet with 75% ethanol (use at least 1 ml of 75% ethanol per 1 ml of TRIzol reagent used for the initial homogenization).
Mix the sample by vortexing.
Centrifuge at no more than 7,500 x g for 5 min at 4 °C.
Discard the supernatant. Now you get the RNA pellet at the tube bottom.
Dissolving RNA:
Briefly dry the RNA pellet on bench at RT (10-20 min).
Dissolve RNA in RNase-free water by passing the solution in a few times through a pipette tip.
Incubate at 55 to 60 °C for 10 min. Tap the tube several times during the incubation.
Use Nanodrop to test the quantity and quality of the RNA.
Store the RNA sample in -80 °C for future use.
References
Honys, D. and Twell, D. (2003). Comparative analysis of the Arabidopsis pollen transcriptome. Plant Physiol 132(2): 640-652.
Lu, Y., Chanroj, S., Zulkifli, L., Johnson, M. A., Uozumi, N., Cheung, A. and Sze, H. (2011). Pollen tubes lacking a pair of K+ transporters fail to target ovules in Arabidopsis. Plant Cell 23(1): 81-93.
Sanders, P. M., Bui, A. Q., Weterings, K., McIntire, K. N., Hsu, Y. C., Lee, P. Y., Truong, M. T., Beals, T. P., Goldberg, R. B. (1999). Anther developmental defects in Arabidopsis thaliana male-sterile mutants. Sexual Plant Reproduction 11(6): 297-322.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
(1) For pollen collection, normally how many flowers are enough for RNA extraction? (2) Are the collected pollen also suitable for protein extraction?
0 Answer
6 Views
Mar 15, 2023
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
68 | https://bio-protocol.org/en/bpdetail?id=68&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Spinning
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
682 | https://bio-protocol.org/en/bpdetail?id=682&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Culture of Rat Olfactory Ensheathing Cells Using EasySep® Magnetic Nanoparticle Separation
Susan Louise Lindsay
Susan Carol Barnett
Published: Vol 3, Iss 8, Apr 20, 2013
DOI: 10.21769/BioProtoc.682 Views: 9008
Reviewed by: Xuecai Ge Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Neuroscience Nov 2012
Abstract
Olfactory ensheathing cells (OECs) can be isolated and purified from a range of postnatal day 7-day to 10-day rat olfactory bulbs. Rat OECs express the CD271/p75NTR receptor and using the “Do-It-Yourself” magnetic nanoparticle EasySep kit from STEMCELL technologies this protocol allows the selective purification of these cells in less than 50 min. Similar procedure can be used for mouse cultures.
Keywords: Olfactory Glia Purification P75NTR Magnetic beads
Materials and Reagents
EasySep® "Do-It-Yourself" Selection Kit (STEMCELL Technologies, catalog number: 18098 )
Mouse IgG1 P75NTR antibody (Abcam, catalog number: ab8877 )
2% Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F4135 ) in PBS (2 ml in 98 ml of PBS,10 mM)
Phosphate buffered saline (PBS) (Life Technologies, catalog number: 00-3002 )
Dissolve tablets in 100 ml of distilled H2O , The buffer contains 10 mM phosphate, 150 mM sodium chloride (pH 7.3-7.5 )
10x Trypsin solution (Life Technologies, InvitrogenTM , catalog number: 15090046 )
Low-glucose DMEM (Life Technologies, InvitrogenTM , catalog number: 21885025 )
5% v/v FBS (Sigma-Aldrich, catalog number: F4135)
2 mM L-glutamine (Life Technologies , InvitrogenTM, catalog number: 25030024 )
Bovine serum albumin Pathocyte (MP Biomedicals, catalog number: 810111 )
Bovine pancreatic insulin (Sigma-Aldrich, catalog number: I-5500 )
Human transferrin (Sigma-Aldrich, catalog number: T-2252 )
Progesterone (Sigma-Aldrich, catalog number: P-0130 )
Putrescine (Sigma-Aldrich, catalog number: P7505 )
l-thyroxine (Sigma-Aldrich, catalog number: T-2501 )
Selenium (Sigma-Aldrich, catalog number: S-1382 )
3,3’,5-triiodo-l-thyronine (Sigma-Aldrich, catalog number: T-2752 )
FGF2 (25 ng/ml ) (Peprotech , catalog number: 100-18B )
Heregulin β-1 (50 ng/ml ) (R&D Systems, catalog number: 396-HB-050 )
Forskolin (5 x 10-7 M) (Sigma-Aldrich , catalog number: F6886 )
Gentamicin solution (50 mg/ml use at 1 ml/l) (Sigma-Aldrich , catalog number: G1397 )
L15 media (Leibovitz medium) (Sigma-Aldrich, catalog number: L1518 )
1.33% collagenase (MP Biomedicals UK, catalog number: 195109 Type I )
Plastic bijou bottle (Sterilin ) (Thermo Fisher Scientific , catalog number: 129A )
Bovine pancreas DNAse (Sigma-Aldrich , catalog number: D4263 )
Bovine serum albumin fraction v (Sigma-Aldrich , catalog number: A2153 )
Astrocyte-conditioned media (ACM; use at 1:5) ACM is fresh serum-free media (DMEM-BS) collected from a confluent astrocyte monolayer for 48 h (noble and Murray, 1984; Alexander et al., 2002 )
Poly-L-Lysine (Sigma-Aldrich, catalog number: P1274 )
70% ethanol
10% v/v serum free DMEM-Bottenstein and Sato (DMEM-BS) (Bottenstein et al., 1979) (see Recipes)
Equipment
EasySep® Magnet Catalog (STEMCELL technologies, catalog number: 18000 )
FACS tubes 5 ml Polystyrene Round-Bottom Tubes (BD Biosciences, catalog number: 352058 )
50 ml centrifuge tubes (BD Biosciences, catalog number: 352070 )
40 μm cell strainers (BD Biosciences, catalog number: 352340 )
1.5 ml polypropylene microcentrifuge tube (Griener Bio-One GmbH, catalog number: 616201 )
Poly-l-lysine coated (13.3 μg/ml, MW-100,000) (Sigma-Aldrich, catalog number: P1274), T25 cm2 tissue culture flasks (Greiner Bio-One GmbH, catalog number: 690175 )
Nunc sterile centrifuge tube (Thermo Fisher Scientific, catalog number: 339651 )
25 cm2 flask (Greiner Bio-One GmbH, catalog number: 690160 )
40 μm cell strainer (BD Biosciences, Falcon®, catalog number: 352340)
37 °C incubator
Plastic bijou bottle (Thermo Fisher Scientific, Sterilin®, catalog number: 129A)
21 gauge needle (BD Biosciences , catalog number: 305167 )
23 G needle (BD Biosciences , catalog number: 305143 )
Procedure
Coating tissue culture flask with poly-L-Lysine (PLL, MW ~100,000)
Make up 4 mg/ml of pLL in ddH2O (e.g. dilute 25 mg in 6.25 ml), filter sterilise using 0.22 μm filter and store at -20 °C. For use dilute 1:300 in dH2O (final concentration 13.3 μg/ml).
Follow the protocol provided with the EasySep® "Do-It-Yourself" Selection Kit to make up the positive selection antibody cocktail. Briefly, add 15 μg (15 μl) of mouse IgG1 P75NTR to a 1.5 ml microcentrifuge tube. Add 100 μl of component A (supplied in the kit) to the vial and mix well. Add 100 μl of component B (supplied in the kit) to the vial and mix well. Tightly cap the vial and place it into a humidified 37 °C incubator in 7% CO2 overnight. The following day bring the vial to a final volume of 1.0 ml by adding 985 ml PBS. The positive selection antibody cocktail is now ready for use.
Dissect out the olfactory bulbs from postnatal rat pups by first decapitating the pups under Home Office License. Pin the head dorsal-side up onto a dissecting board and spray with 70% ethanol. Using sterile instruments remove the skin from the head using curved scissors and make a large circular cut to remove the skull to reveal the brain and the two olfactory bulbs at the nose tip. Using curved forceps gently remove the olfactory bulbs. Enzymatically digest the bulbs in 1.33% collagenase (MP Biomedicals UK, 195109 Type I) in 500 μl of L15 media containing 50 μg/ml gentamicin in a 7 ml plastic bijou bottle. The tissue mix is placed in a humidified 37 °C incubator in 7% CO2 for 15 min to aid dissociation. After dissociation DNase (500 μl) of stock containing 0.04 mg/ml bovine pancreas DNAse and 3.0 mg/ml bovine serum albumin fraction v diluted in L15 is added to prevent cell clumping and the tissue is dissociated by passing gently and slowly through syringes carrying a 21 gauge needle first followed by a 23 G needle. The cell suspension is transferred to a 15 ml Nunc sterile centrifuge tube and spin at 1,200 rpm (~480 x g) for 5 min and plate cells in OEC media in a 25 cm2 flask, and replace half the medium twice a week. After 1 week in culture remove cells off the flask using trypsin. First wash the monolayer with 2.0 ml of PBS, remove and then add 1 ml of PBS containing 100 μl of trypsin (10x) and allow the cells to detach for 1-2 min in the incubator. Add 1 ml of 2% FBS to neutralise the trypsin, spin down cells to generate an unpurified mixed of olfactory bulb cells (Higginson and Barnett, 2011).
Using 5 ml 2% FBS, wash detached cells through a 40 μm cell strainer and centrifuge at 1,200 rpm for 5 min.
Resuspend cell pellet in 100 μl 2% FBS and transfer them to a 5 ml FACS tube.
Add 10 μl of the positive selection cocktail that has been assembled in step 1 to the cell suspension. Mix well and incubate at room temperature for 15 min.
Mix EasySep® Magnetic Nanoparticles to ensure that they are in a uniform suspension by pipetting up and down at least 5 times. Vortexing is not recommended. Add 5 μl of the magnetic nanoparticles and mix well. Incubate at room temperature for 10 min.
Bring cell suspension to a total volume of 2.5 ml by adding 2% FBS. Mix the cells in the tube by gently pipetting up and down 2-3 times. Place the tube (without cap) into the EasySep® magnet. Set aside for 5 min.
Pick up the magnet and in one continuous motion, invert the magnet and tube, pouring off the supernatant fraction. The magnetically labelled cells will remain inside the tube, held by the magnetic field. Leave the magnet and tube inverted for 2-3 sec then return to upright position. Do not shake or blot off any drops that may remain hanging from the mouth of the tube.
Remove the tube from the magnet and add 2.5 ml of 2% FBS. Mix the cell suspension by gently pipetting up and down 2-3 times. Place the tube back in the magnet and set aside for a further 5 min.
Repeat steps 7 to 9 once more, for a total of four 5 min separations in the magnet.
Remove tube from magnet and resuspend cells in 3 ml OEC medium.
Centrifuge the FACS tube containing the cells for 1,200 rpm (~480 x g) for 5 min to pellet the now purified OECs.
Resuspend pellet in 50 μl of fresh OEC media and plate in a strip in a PLL coated T25 cm2 tissue culture flask. Allow cells to attach for 15 min at 37 °C. Cells are plated in a small strip to allow cells to attach to the flask in a high density which promotes viability.
Flood flask with 3 ml OEC media and incubate at 37 °C, 7% CO2. We use 7% CO2 as this was a general protocol for all glial cells when the original purification of OECs was carried out in Prof Mark Noble’s lab (Barnett et al., 1993).
After 7 days the strip of cells will be confluent and OECs can be harvested by standard trypsination and bulked up for further use.
Using this system OECs will be at least 98-99% pure of any contaminating fibroblasts or other cells (see below image, Figure 1).
Figure 1. Image of P75NTR (green) positive OECs (blue DAPI to visualise nuclei).
Recipes
10% v/v serum free DMEM-Bottenstein and Sato (DMEM-BS) (Bottenstein et al., 1979)
Made by combining DMEM-45 g/L glucose, and supplemented with:
25 μg/ml gentamicin
0.0286% bovine serum albumin Pathocyte
0.5 μg/ml bovine pancreatic insulin
100 μg/ml human transferrin
0.2 μM progesterone
0.10 μM putrescine
0.45 μM l-thyroxine
0.224 μM selenium
0.49 μM 3,3’,5' -triiodo-l-thyronine
Acknowledgments
The protocol was adapted from Franceschini and Barnett, (1996) and Higginson and Barnett, (2011). The work was funded by the MRC.
References
Alexander, C. L., Fitzgerald, U. F. and Barnett, S. C. (2002). Identification of growth factors that promote long-term proliferation of olfactory ensheathing cells and modulate their antigenic phenotype. Glia 37(4): 349-364.
Barnett, S. C., Hutchins, A. M. and Noble, M. (1993). Purification of olfactory nerve ensheathing cells from the olfactory bulb. Dev Biol 155(2): 337-350.
Bottenstein, J. E. and Sato, G. H. (1979). Growth of a rat neuroblastoma cell line in serum-free supplemented medium. Proc Natl Acad Sci U S A 76(1): 514-517.
Franceschini, I. A. and Barnett, S. C. (1996). Low-affinity NGF-receptor and E-N-CAM expression define two types of olfactory nerve ensheathing cells that share a common lineage. Dev Biol 173(1): 327-343.
Higginson, J. R. and Barnett, S. C. (2011). The culture of olfactory ensheathing cells (OECs)--a distinct glial cell type. Exp Neurol 229(1): 2-9.
Noble, M. and Murray, K. (1984). Purified astrocytes promote the in vitro division of a bipotential glial progenitor cell. EMBO J 3(10): 2243-2247.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Lindsay, S. L. and Barnett, S. C. (2013). Culture of Rat Olfactory Ensheathing Cells Using EasySep® Magnetic Nanoparticle Separation. Bio-protocol 3(8): e682. DOI: 10.21769/BioProtoc.682.
Higginson, J. R., Thompson, S. M., Santos-Silva, A., Guimond, S. E., Turnbull, J. E. and Barnett, S. C. (2012). Differential sulfation remodelling of heparan sulfate by extracellular 6-O-sulfatases regulates fibroblast growth factor-induced boundary formation by glial cells: implications for glial cell transplantation. J Neurosci 32(45): 15902-15912.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Developmental Biology > Cell signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
683 | https://bio-protocol.org/en/bpdetail?id=683&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
p65 Chromatin Immunoprecipitation Protocol
CD Crissy Dudgeon
Published: Vol 3, Iss 8, Apr 20, 2013
DOI: 10.21769/BioProtoc.683 Views: 11485
Reviewed by: Lin Fang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Oncogene Nov 2012
Abstract
Chromatin Immunoprecipitation (ChIP) is an important procedure that allows you to verify if a certain protein is physically located at a regulatory region. This information, taken together with other procedures such as luciferase assays and EMSAs, will give definitive proof that the query protein is involved in the transcription of a protein. This procedure for p65 ChIP can be adapted to investigate other proteins; just a change of the antibody will suffice.
The transcription factor known as NF-κB is a homo- or hetero-dimer consisting of members of the Rel/NFKB family. The most abundant NF-κB complexes are made of two different proteins, p65 (Rel-A) and p50 (NFKB1). The NF-κB complex is initially inhibited by IκB by direct binding, thus trapping NF-κB in the cytoplasm. After a stimulatory signal, IκB kinase (IKK) phosphorylates IκB, allowing IκB to undergo proteasome-mediated degradation. The degradation of IκB and phosphorylation of p65 by multiple kinases activates NF-κB, allowing it to transport to the nucleus and cause the transcriptional activation of many of its target genes containing κB sites (consensus sequence: gggRNNYYcc, R = purine Y = pyrimidine), such as PUMA, IL-6, and TNF.
Keywords: P65 NFkB ChIP Promoter
Materials and Reagents
HCT116 cell line
Trypsin (0.05%) (Life Technologies, catalog number: 25300-054 )
DMSO
PBS
Formaldehyde (J.T. Baker, catalog number: 2106-01 )
1 M Glycine
Liquid nitrogen or a dry ice/100% ethanol
NP-40
Protease inhibitor cocktail tablet (F. Hoffmann-La Roche, catalog number: 04-693159-001 )
p65 antibody (Santa Cruz, catalog number: sc-109 )
Chromatin Immunoprecipitation Assay Kit (EMD Millipore, catalog number: 17-295) online at: http://www.millipore.com/coa.nsf/a73664f9f981af8c852569b9005b4eee/20c0dc520d2b30f0852573be007ffdae/$FILE/17-295-DAM1411265.pdf
Protein A/G PLUS-agarose (has been preblocked with BSA) (Santa Cruz, catalog number: sc-2003 )
Phenol
Chloroform
Glycogen
70% ethanol
SDS
Triton X-100
EDTA
Tris-HCl
NaCl
NaHCO3
EBC buffer (see Recipes)
ChIP dilution buffer (see Recipes)
10x protease inhibitor solution (see Recipes)
Low salt immune complex wash buffer (see Recipes)
High salt immune complex wash buffer (see Recipes)
LiCl immune complex wash buffer (see Recipes)
TE buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
Sonicator (Branson Digital Sonifier 450) (Branson Ultrasonics Corp)
Centrifuge
15 ml conical tubes
T75 flasks
Cell scrapers
Procedure
Outline
Three days before starting this procedure, usually on a Friday, split your cells 1:4 so that they will be confluent on Monday.
Day 1 (Monday)-split your cells.
Day 2 (Tuesday)-treat your cells with whatever compound you have found that causes transcriptional activation of your gene of interest. Fix cells when you believe p65 will be at the regulatory region of your gene of interest. Count cells and aliquot 4 million cells per 15 ml conical tube.
Day 3 (Wednesday)-Sonicate samples, pre-clear samples, and IP with p65 antibody overnight.
Day 4 (Thursday)-Wash samples, elute, and reverse crosslink.
Day 5 (Friday)-Do phenol/chloroform extraction and ethanol precipitation. Proceed to do PCR of your region of interest if you have time that day.
Note: First determine the sonication conditions for your particular cell type to yield DNA fragments between 300-1,000 bp. This is usually around 12% output, 5 cycles of 10 sec each with a 30 sec cooling period in between sonications. A 1.2% agarose Ethidium bromide gel of the DNA will show a brighter smear in this region, as shown in the second lane of Figure 1.
Figure 1. Determining sonication conditions for HCT116 for ChIP. The lane denoted with a star shows the proper sonication conditions.
Day 1
Split your cells. Cells should be in log phase of growth. Usually I use a T75 flask to grow the cells. The cells should be about 60-70% confluent for the next day. If you split a confluent T75 flask of your cells with 3 ml trypsin + 9 ml media, you will need 4 ml cells (~5 x 106 cells) for each T75 (you can do 3 total, so untreated, treated, and a counting dish per T75 flask). These conditions are for HCT116, so adjust accordingly for your cell line.
Day 2
Treat your cells the next day with DMSO or PBS for control (depending on your compound’s solubility) and the compound of interest. To detect p65 on the PUMA promoter after sorafenib treatment, I did an 8 h time point. This may change depending on the transcription rate of your protein. I would use the time that you first started seeing your protein expression increase.
While you wait for your time point, count the cells in your extra flask. This will tell you how many cells/ml you have in your other flasks. If you can’t do this due to limited sample amounts, after the time point for your compound, and before you fix the cells, count them.
Add formaldehyde to a final concentration of 1% in your flask. Let sit at room temperature (RT) with gentle rocking for 15 min.
Add 1 M glycine to a final concentration of 125 mM to stop the reaction. Mix gently.
Using a cell scraper, scrape off the cells and spin down cells at 400 x g for 5 min at 4 °C. Aspirate supernatant.
Resuspend cells in cold PBS. Make aliquots of 4 million cells per 15 ml conical tube. Label tubes correctly. Spin down again and aspirate supernatant. Snap freeze in liquid nitrogen or a dry ice/100% ethanol bath, and store at -80 °C.
Day 3
Remove 2 untreated and 2 treated tubes from the -80 °C freezer. Place on ice to thaw.
Note: All tubes on ice from now on.
Resuspend cell pellet in 200 μl cold EBC buffer with protease inhibitors (complete mini EDTA-free tablet, Roche. I make up 10 ml of EBC buffer with 1 tablet of the complete mini EDTA-free protease inhibitor cocktail). One set of untreated and treated will be used for IP for p65 and the other will be a minus antibody (-Ab) control. So you will have 4 tubes total and will need 800 μl cold EBC buffer+protease inhibitors.
Sonicate samples at 12% output, 10 sec x 5 cycles, with 30 sec on ice between sonications.
Spin cells down at 9,000 x g for 10 min.
Remove supernatant into a fresh tube.
Follow the protocol for the Chromatin Immunoprecipitation Assay Kit.
Make a master mix of protease inhibitor cocktail solution with ChIP dilution buffer (included in the kit). Since there are 4 total samples, you will need 6.4 ml ChIP dilution buffer and 800 μl of the 10x protease inhibitor cocktail solution. Add 1,800 μl to each sample. Remove 20 μl from the untreated and treated –Ab tubes as input controls and save at 4 °C for later use.
Preclear the lysates with 75 μl Protein A/G PLUS-agarose for 1 h rotating at 4 °C.
Pellet at 14,000 x g for ~15 sec. Save the supernatant to a fresh tube, being careful to not disturb the pellet. I usually leave about 50 μl of supernatant behind so as not contaminate the supernatant with the agarose. Keep the tubes with the supernatant, toss the pellets in the trash.
For the –Ab tubes, rotate at 4 °C overnight. For the p65 IPs, use 2 μg of p65 antibody per tube. Rotate overnight at 4 °C.
Day 4
Add 60 μl of Protein A/G PLUS-agarose to all 4 tubes (–Ab tubes. Rotate for 1 h at 4 °C to pull down immuno complexes.
Briefly centrifuge pellets at 14,000 x g, 15 sec. Remove supernatant and discard.
Wash pellet with the following list of buffers that are included in the kit. If you do not have the kit, the recipe is included. Centrifuge after washing, remove supernatant completely and resuspend in the next buffer on this list. The wash buffers increase in salt concentration to remove non-specific binding to the antibody/agarose complex. Use 500 μl of the buffer, rotating for 5 min at 4 °C for each wash.
1x low salt immune complex wash buffer.
1x high salt immune complex wash buffer.
1x LiCl immune complex wash buffer.
2x TE buffer.
Freshly prepare elution buffer. Elute protein by adding 250 μl of elution buffer, vortexing, and incubating at RT for 15 min with rotation. Briefly spin, remove eluate to a new tube, and repeat elution with another 250 μl elution buffer. Combine eluents for a final volume of 500 μl per IP reaction (at this point you should have 4 tubes, 2 for p65 IP, 2 for -Ab, with control and treated for each).
Add 20 μl 5 M NaCl to the eluents. Also, add 5 μl 5 M NaCl to the input controls and heat all samples at 65 °C for 4 h to reverse the crosslinking. At this step the samples can be stored at –20 °C, or proceed to DNA extraction if you have time.
Day 5
Recover DNA by phenol/chloroform extraction.
Measure the volume of the reversed-cross linked samples. Add an equal volume of phenol to each sample, vortex, and spin for 3 min at 14,000 x g. Transfer supernatant to a fresh tube (avoid the bottom and interphase layer).
Add an equal volume of chloroform, vortex, and spin for 3 min at 14,000 x g. Transfer supernatant to a fresh tube (avoid the bottom and interphase layer).
Precipitate DNA by ethanol precipitation.
Measure the volume of the extracted samples. Add 0.1 volume 3 M sodium acetate, 2 volumes of 100% ethanol, and 4 μl of 5 mg/ml glycogen (as a DNA carrier) to each tube.
Vortex and place at -20 °C for 30 min.
Spin for 20 min at 14,000 x g at 4 °C.
Very carefully pour off the supernatant, watching the DNA pellet very carefully so that it does not dislodge.
Wash pellets with 500 μl 70% ethanol. Vortex and spin for 5 min at 14,000 x g at 4 °C.
Very carefully pour off the supernatant, watching the DNA pellet so that it does not dislodge. It will be very “slippery” at this point. I use an unfiltered tip to wick away the remaining ethanol from the pellet and to push the pellet back to the bottom of the tube if it has moved.
Flip the tube upside-down and air dry for 7 min.
Resuspend in 30 μl water.
Proceed with PCR using primers surrounding the potential binding site of interest in the gene promoter. Product size of DNA should be around 100-200 bp. Run PCR reaction on a 2% TBE or TAE gel and document.
Recipes
EBC buffer
50 mM Tris (pH 7.5)
100 mM NaCl
0.5% NP-40
ChIP dilution buffer
0.01% SDS
1.1% Triton X-100
1.2 mM EDTA
16.7 mM Tris-HCl (pH 8.1)
167 mM NaCl
10x protease inhibitor solution
Dissolve one complete mini EDTA-free tablet in 1 ml water.
Low salt immune complex wash buffer
0.1% SDS
1% Triton X-100
2 mM EDTA
20 mM Tris-HCl (pH 8.1)
150 mM NaCl
High salt immune complex wash buffer
0.1% SDS
1% Triton X-100
2 mM EDTA
20 mM Tris-HCl (pH 8.1)
500 mM NaCl
LiCl immune complex wash buffer
0.25 M LiCl
1% IGEPAL-CA630
1% deoxycholic acid (sodium salt)
1 mM EDTA
10 mM Tris (pH 8.1)
TE buffer
10 mM Tris-HCl
1 mM EDTA (pH 8.0)
Elution buffer
1% SDS
0.1 M NaHCO3
Acknowledgments
This protocol was adapted from Dudgeon et al. (2012). This work was supported by NIH grants CA106348 and CA121105 and American Cancer Society grant RSG-07-156-01-CNE (LZ); Flight Attendant Medical Research Institute, NIH grant CA129829 and American Cancer Society grant RGS-10-124-01-CCE (JY); NIH National Research Service Award postdoctoral fellowship grant F32CA139882 (CD); and China Scholarship Council (RP). LZ is a scholar of the V Foundation for Cancer Research.
References
Dudgeon, C., Peng, R., Wang, P., Sebastiani, A., Yu, J. and Zhang, L. (2012). Inhibiting oncogenic signaling by sorafenib activates PUMA via GSK3β and NF-κB to suppress tumor cell growth. Oncogene 31(46): 4848-4858.
Wang, P., Yu, J. and Zhang, L. (2007). The nuclear function of p53 is required for PUMA-mediated apoptosis induced by DNA damage. Proc Natl Acad Sci U S A 104(10): 4054-4059.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Molecular Biology > DNA > DNA-protein interaction
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
684 | https://bio-protocol.org/en/bpdetail?id=684&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Packaging of Retroviral RNA into Viral Particles Analyzed by Quantitative Reverse Transcriptase-PCR
Bianca Hoffmann
Bastian Grewe
Published: Vol 3, Iss 8, Apr 20, 2013
DOI: 10.21769/BioProtoc.684 Views: 16317
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Virology Mar 2012
Abstract
Formation of viral particles and packaging of genomic retroviral RNA into these particles are important steps in the late phase of the viral replication cycle. The efficiency of the incorporation of viral or cellular RNAs into viral particles can be studied using a quantitative Reverse Transcriptase-PCR (RT-qPCR)-based approach. After isolation of cytoplasmic RNA from either infected or transfected cells and extraction of virus particle-associated RNA, specific RNA levels present in both fractions are determined. The ratio of virion-associated and cytoplasmic RNA defines the encapsidation efficiency (Brandt et al., 2007; Blissenbach et al., 2010; Grewe et al., 2012).
Keywords: HIV Encapsidation Packaging RT-PCR Viral Particles
Materials and Reagents
I. Cell harvesting and ultracentrifugation
Dulbecco’s Modified Eagle Medium (DMEM) (Life Technologies, Gibco®, catalog number: 41965-039 )
Fetal calf serum (FBS) (Life Technologies, Gibco®, catalog number: 10108-165 )
Phosphate buffered saline (PBS) (Life Technologies, Gibco®, catalog number: 14200-067 )
Trypsin (Biochrom)
Penicillin/Streptomycin (Life Technologies, Gibco®)
0.45 μm filter (Sarstedt)
Sucrose (Biomol)
Ultracentrifugation tubes (17 ml) (Herolab)
II. Cell fractionation and RNA isolation
Dithiothreitol (DTT) solution (1 M) (AppliChem GmbH, catalog number: A3668,0050 )
RiboLock RNase Inhibitor (40 U/μl) (Thermo Fisher Scientific, catalog number: E00384 )
Ethanol >99.8% (Sigma-Aldrich)
QIAshredder Spin Columns (QIAGEN, catalog number: 79654 )
RNeasy Kit (QIAGEN, catalog number: 74106 )
QIAmp Viral RNA Kit (QIAGEN, catalog number: 52906 )
TURBO DNA-free Kit (Life Technologies, Ambion®, catalog number: AM1907 )
Nuclease-free water (B Braun)
Quant-iT RNA Assay Kit (Life Technologies, InvitrogenTM, catalog number: Q-33140 )
III. RT-qPCR
QuantiTect Probe RT-PCR Kit (includes Reverse Transcriptase) (QIAGEN, catalog number: 204443 )
SYBR Green (Life Technologies, InvitrogenTM)
Primers sense and antisense (Biomers)
Isolated RNA
TOPO TA Cloning Kit (Life Technologies, InvitrogenTM, catalog number: 45-0640 )
AmpliScribe-T7/Sp6 High Yield Transcription Kit (Epicentre, catalog number: AS2607 )
RNA standards
IV. Other materials
HIV-1 DIY p24 sandwich ELISA Kit 2 (Aalto Bio Reagents)
Equipment
Heraeus Multifuge X3R Centrifuge (Thermo Fisher Scientific)
Centrifuge 5417R (Eppendorf)
Sorvall WX Ultra 100 Ultracentrifuge (Thermo Fisher Scientific)
Qubit Fluorometer (Life Technologies, InvitrogenTM, catalog number: Q32857 )
Rotor-Gene Q (QIAGEN, catalog number: 9001620 )
Strip tubes 0.1 ml (QIAGEN)
15 ml tubes (Sarstedt)
1.5 ml tubes (Sarstedt)
Procedure
Note: The procedure was established for cell numbers obtained from small 25 cm2 cell culture flasks. Initially, 1.5 million adherent cells were seeded. After transfection/infection and subsequent cultivation the cells reached 80-100% confluence at day of cell harvest (three days later).
Concentration of viral particles
Centrifuge supernatants of adherent, transfected or infected cells at 300 x g and 4 °C for 5 min to pellet all remaining cellular material. When suspension cells are used, pellet the cells by this centrifugation step. For 25 cm2 flasks 5 ml medium is used during transfection and cultivation. In general, a larger volume of medium can be used as long as the capacity of the ultracentrifugation tubes (see I-8 in materials and step 1-d of the procedure) including the sucrose solution is not exceeded.
Add fresh medium to the transfected or infected cells and place them in the incubator until cytoplasmic RNA isolation.
Filter cell-free supernatants through a 0.45 μm filter.
Ultracentrifuge pre-cleared supernatants through a 30% sucrose cushion. Add 2.5 ml sucrose solution to the tube and carefully overlay with the 5 ml supernatant without disrupting the sucrose pellet. The tubes have to be filled up with serum-free DMEM until 0.5-1 cm below the edge of the tube. This is important to stabilize the tubes during ultracentrifugation. The final volume is determined by precise balancing the tubes in buckets which are inserted opposite each other in the same rotor. Centrifuge at 150,000 x g for 2 h at 4 °C.
Harvest cells
Adherent cells: Discard the freshly added cellular supernatant, wash cells once with PBS (1x; RT) and detach cells with trypsin. Stop trypsin treatment by resuspending cells in serum-containing medium. Pellet cells at 300 x g and 4 °C for 10 min and resuspend them in cold PBS (4 °C).
Suspension cells: Centrifuge cells at 300 x g and 4 °C for 10 min, discard freshly added cellular supernatant and resuspend cells in cold PBS (4 °C).
Pellet cells at 300 x g and 4 °C for 5 min and discard the supernatant. Remove all remaining PBS and loosen the cells by flipping the tube a few times.
During centrifugation steps: Prepare working solutions of RLN and RLT buffers. Prepare 600 μl aliquots of RLT buffer in 1.5 ml tubes. Store both buffers on ice.
Cell fractionation
Resuspend cells carefully in 175 μl ice cold RLN buffer by shortly pipetting them up and down with a wide bored 1,000 μl pipette. Extensive pipetting may result in total cell lysis and should be prevented.
Incubate exactly 5 min on ice to lyse the plasma membrane.
Pellet nuclei by centrifugation at 300 x g for 2 min at 4 °C in a pre-cooled centrifuge.
Transfer the supernatant representing the cytoplasmic fraction to new 1.5 ml tubes with a 200 μl pipette. Be sure not to contaminate the supernatant with the nuclear pellet.
Centrifuge the cytoplasmic fraction at 13,000 x g at 4 °C for 3 min in a pre-cooled centrifuge to pellet all remaining nuclear contaminants.
Transfer supernatant to already prepared 600 μl RLT aliquots (step 2-c) and store on ice.
Optional: Extraction of the nuclear fraction
Resuspend nuclei pellet in 900 μl cold PBS (4 °C) and centrifuge for 5 min at 300 x g and 4 °C in a pre-cooled centrifuge.
Discard PBS, add 600 μl icecold RLT buffer and mix by vortexing. Cell debris will not resolve completely in the RLT buffer.
Load the solution containing the debris onto QIAshredder Spin Columns and centrifuge 2 min at 13,000 x g. Collect the flow through as nuclear fraction.
Cytoplasmic/Nuclear RNA isolation
Vortex nuclear or cytoplasmic fractions in RLT and spin for 5 sec at 13,000 x g and RT.
Add 430 μl ethanol (> 99.8%) and mix by pipetting up and down.
Isolate RNA with RNeasy Mini Kit according to manufacturer’s instructions.
Elute RNA with 47 μl RNase-free H2O (this will result in an elution volume of 45 μl).
Perform DNase digestion with the TURBO DNase-free Kit as follows: Add 5 μl 10x TURBO-DNase buffer and 1 μl or 2 μl TURBO DNase to cytoplasmic or nuclear eluates, respectively. Mix gently and incubate 2-4 h at 37 °C.
Inactivate DNase by adding 5 μl inactivation reagent (included in TURBO DNA-free Kit) per 1 μl DNase used, incubate for 5 min at RT while keeping the reagent resuspended.
Centrifuge 1 min at 11,000 rpm and RT and transfer the supernatant into a fresh tube.
Measure RNA concentration using an RNA-specific dye (e.g. Quant-iT RNA Assay Kit), adjust RNA concentrations with nuclease-free water to e.g. 0.05-0.5 μg/μl and store samples at -80 °C.
Isolation of particle-associated RNA
Carefully remove the supernatant from ultracentrifuged samples from step 1-d and dry the tube walls with a clean wipe.
Resuspend (invisible) pellet in 150 μl PBS by pipetting up and down (Optional: Shake tubes 1 h on ice in advance. This step allows a 1 h interruption of the procedure without any loss of assay performance).
Take 10 μl of concentrated, resuspended particles and store at -20 °C for p24-specific ELISA (HIV-1 DIY p24 sandwich ELISA Kit Protocol 2).
Note: For analyzing the encapsidation efficiency virion-associated RNA copy numbers need to be normalized to the amount of particles in the supernatant. (Reduced/increased levels of particle-associated RNA can sometimes be attributed to reduced/increased particle levels.) Therefore, determination of p24 levels in the supernatant is important.
Add 560 μl AVL buffer containing carrier RNA (both included in QIAmp Viral RNA Kit) to the samples, vortex and incubate 10 min at RT (crystals appear in the AVL buffer containing carrier RNA when stored at 4 °C. Resolve those precipitations by vigorous shaking for max. 2 min at 50 °C and let the buffer cool down to RT before usage).
Add 560 μl ethanol (> 99.8%) to the samples and vortex vigorously for 15 sec.
Isolate RNA using QIAmp Viral RNA Kit according to the manufacturer’s instructions.
Elute virus-associated RNA with 47 μl RNase-free H2O.
Perform DNase digestion as described in steps 4-e~4-g. An amount of 1 μl DNase is sufficient for particle-RNA samples.
Store samples at -80 °C until further use. Measurement of RNA concentration is not necessary in this case, because the total RNA amount is low and the samples contain unspecific carrier RNA (present in the AVL buffer).
RT-qPCR
Set up RT-qPCR reaction using QuantiTect Probe RT-PCR Kit as follows:
PCR mix (2x, contains Taq, dNTPs)
10 μl
Reverse Transcriptase (RT) enzyme
0.2 μl
Primer sense (2.5 μM)
1 μl
Primer antisense (2.5 μM)
1 μl
SYBR Green (0.1x)
1 μl
Isolated RNA0.5 μg cytoplasmic or 0.05 μg nuclear RNA; 5 μl particle-associated RNA; 5 μl RNA standards ranging from 2 x 101-1 x 109 RNA copies/μl
Add nuclease-free water to 20 μl.
Prepare additional samples omitting the RT enzyme in order to detect amplification of (genomic or transfected) DNA sequences.
Primers used for HIV-1 specific RT-qPCR are used according to the Amplicor HIV-1 Monitor Test (Michael et al., 1999).
Sense: SK145s (5’-AGT GGG GGG ACA TCA AGC AGC CAT GCA AAT-3’)
Antisense: SKCC1Bas (5’-TAC TAG TAG TTC CTG CTA TGT CAC TTC C-3’)
RNA standards identical in sequence to the detected HIV RNA segment for absolute quantification of cytoplasmic and particle-associated RNA copy numbers were produced with the AmpliScribe-T7/Sp6 High Yield Transcription Kit (Epicentre). The amplicon obtained with primer pair SK145s/SKCC1Bas after RT-(q)PCR was subcloned into the pCRII-TOPO plasmid with the TOPO TA Cloning Kit. An amplicon containing either the T7 or the SP6 promoter was used as template for the in vitro transcription reaction according to the manufacturer’s instructions. Template DNA was removed by digestion with the MBU DNase from the in vitro transcription kit and in addition by two treatments with the TURBO DNA-free kit. RNA concentrations were measured and adjusted to 2 x 101 to 1 x 109 RNA copies per μl.
Using QuantiTect Probe RT-PCR Kit allows the RT reaction and PCR amplification to happen in one tube without interruption.
RT-qPCR is performed in a Rotor-Gene Q system with the following settings:
RT step
50 °C
20 min
Initial denaturation
95 °C
15 min
Denaturation
95 °C
10 sec
Annealing
65 °C
60 sec
Elongation and fluorescence
72 °C
30 sec
Detection 1
Fluorescence detection 2
78 °C
15 sec
Steps( iii-vi) should be repeated in a total of 45 cycles.
After the last PCR cycle the following melting curve measurement is performed:
Ranging from 50 °C to 99 °C with 1 °C/step, 90 sec equilibration for the first step after that 4 s/step. Since amplification is monitored by SYBRGreen in this RT-qPCR, melting curve analyses are important to verify amplification of specific DNA fragments. Furthermore, regular agarose gel electrophoresis analyses should be included to verify amplification of DNA fragments of the expected size.
Analyze RNA copy numbers with Rotor-Gene Q software using values for fluorescence measurement 2 only. In contrast to measurement 1 fluorescence signals from primer dimers should be strongly reduced at 78 °C. Please note that the exact temperature for the second fluorescence measurement may vary between different Rotor-Gene devices and therefore needs to be optimized.
Note: The primers and settings described here are designed for the detection of HIV-1 unspliced, genomic RNA. To analyze RNA from other retroviruses the RT-qPCR protocol has to be modified.
Figure 1. Schematic diagram of encapsidation assay workflow. Particle-containing supernatants from infected or transfected cells were ultracentrifuged through a 30% sucrose cushion. RNA isolated from concentrated particles and cytoplasm of the infected/transfected cells was analyzed by RT-qPCR. Encapsidation efficiency was determined as the ratio between HIV-1 copy numbers/ml supernatant and HIV-1 copy numbers/μg cytoplasmic RNA. Depending on the experimental design quantification of p24 levels in the concentrated-particle samples is important to normalize particle-associated RNA levels to the amount of p24/Gag particles in the supernatants.
Recipes
Cell culture medium
DMEM
10% (v/v) FCS
1% (v/v) Penicillin/Streptomycin
RLN buffer
50 mM Tris-Cl (pH 8.0)
140 mM NaCl
1.5 mM MgCl2
0.5% (v/v) Nonidet P-40
Filter through a 0.2 μm filter.
Before use add 1,000 U/ml RNase inhibitor and 1 mM DTT.
RLT buffer (included in the RNeasy Mini Kit)
Before use add 1% (v/v) beta-Mercaptoethanol
AVL buffer (included in the QIAamp Viral RNA Kit)
Add 1 ml of AVL buffer to one tube of lyophilized carrier RNA (included in the QIAamp Viral RNA Kit), mix thoroughly and transfer the solution to the AVL buffer bottle. After mixing prepare aliquots and store them at 4 °C
Acknowledgments
This protocol was adapted from our papers: Brandt et al. (2007); Blissenbach et al. (2010); and Grewe et al. (2012). This work was funded by a grant from the German Research Foundation (DFG) to Klaus Überla (Ue45/11-1). Bianca Hoffmann is and Bastian Grewe was supported by a fellowship from the DFG graduate school (GRK 1045). Beside Bianca Hoffmann and Bastian Grewe, Inga Ohs, Maik Blissenbach, Sabine Brandt, Bettina Tippler, Thomas Grunwald, Klaus Überla, Rebecca Konietzny, and Klaus Sure were part of the team which established the methods described.
References
Brandt, S., Blissenbach, M., Grewe, B., Konietzny, R., Grunwald, T. and Uberla, K. (2007). Rev proteins of human and simian immunodeficiency virus enhance RNA encapsidation. PLoS Pathog 3(4): e54.
Blissenbach, M., Grewe, B., Hoffmann, B., Brandt, S. and Uberla, K. (2010). Nuclear RNA export and packaging functions of HIV-1 Rev revisited. J Virol 84(13): 6598-6604.
Grewe, B., Hoffmann, B., Ohs, I., Blissenbach, M., Brandt, S., Tippler, B., Grunwald, T. and Uberla, K. (2012). Cytoplasmic utilization of human immunodeficiency virus type 1 genomic RNA is not dependent on a nuclear interaction with gag. J Virol 86(6): 2990-3002.
Michael, N. L., Herman, S. A., Kwok, S., Dreyer, K., Wang, J., Christopherson, C., Spadoro, J. P., Young, K. K., Polonis, V., McCutchan, F. E., Carr, J., Mascola, J. R., Jagodzinski, L. L. and Robb, M. L. (1999). Development of calibrated viral load standards for group M subtypes of human immunodeficiency virus type 1 and performance of an improved AMPLICOR HIV-1 MONITOR test with isolates of diverse subtypes. J Clin Microbiol 37(8): 2557-2563.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial genetics > RNA
Molecular Biology > RNA > qRT-PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
689 | https://bio-protocol.org/en/bpdetail?id=689&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Isolation of Spleen Mononuclear Cells
BW Benno Weigmann
Published: Vol 3, Iss 9, May 5, 2013
DOI: 10.21769/BioProtoc.689 Views: 32261
Reviewed by: Lin Fang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Sep 2012
Abstract
This method allows you to isolate different subclass mononuclear cells, like B-cells, T cells, CD4+ and CD8+ T, from mouse spleen. By conjugating cells with specific antibodies and subsequently magnetic beads isolation, using the technique from Miltenyi, this allows a high purity.
Keywords: T cell Purification Lymphocyte Isolation
Materials and Reagents
Antibody
FITC-conjugated anti-CD3 antibody (BD Biosciences, catalog number: 553058 , clone 145-2C11)
PE-conjugated anti-CD19 antibody (BD Biosciences, catalog number: 557399 , clone 1D3)
FITC-conjugated anti-CD4 antibody (BD Biosciences, catalog number: 557667 , clone RM4-5)
PE-conjugated anti-CD8 antibody (BD Biosciences, catalog number: 561095 , clone 53-6.7)
Microbeads
Anti-CD43 microbeads (Miltenyi Biotec, catalog number: 130-049-801 )
Anti-CD90 microbeads (Miltenyi Biotec, catalog number: 130-091-376 )
Anti-CD4 microbeads (Miltenyi Biotec, catalog number: 130-049-201 )
Anti-CD8 microbeads (Miltenyi Biotec, catalog number: 130-091-112 )
Others
1x phosphate-buffered saline (PBS) (pH 7.2) (Life Technologies, Gibco®, catalog number: 10010-031 )
Bovine serum albumin (BSA) (Life Technologies, InvitrogenTM, catalog number: 15561-020 )
EDTA (Sigma-Aldrich, catalog number: EDS-100G )
Ice-cold separation buffer (see Recipes)
Equipment
Scissors and forceps
MiniMACS separation unit (Miltenyi Biotec, MiniMACS Separator, catalog number: 130-090-312 )
Separation column (Miltenyi Biotec, separation column, Type MS, catalog number: 130-042-201 )
Cell strainer (BD Biosciences, catalog number: 352360 )
Flow cytometer (BD Biosciences, Coulter)
Shaker
Procedure
B-cells, total T cells and/or single positive CD4+ and CD8+ T cells, were purified from spleen cells by magnetic separation with the Mini-MACS system [Miltenyi, 1990] (http://www.miltenyibiotec.com). The scheme illustrates how to manage the procedure.
Figure 1. Schematic view of the experimental strategy using magnetic MACS beads to isolate CD4+ cells. Cells were incubated with CD4-,CD8-,CD90- and CD43-antibody conjugated magnetic beads. The cell suspensions were subjected to column selection and placed in the magnetic separator. Flow-through was discarded. Then the column was washed with separation puffer to increase purity and removed afterwards from the magnetic separator. With a plunger the magnetically labelled cells were flushed out of the column.
Sacrifice mouse and isolate the complete spleen.
Pass spleen through a 100-μm cell strainer to get single cells suspension by crushing with forceps and collecting the cell suspension in 5 ml PBS.
Wash with 1x PBS & centrifuge the cells (100 x g for 5 min), then resuspend spleen cells in 80 μl ice-cold separation buffer per 107 cells. From a normal spleen you will get approximately 8 x 107 cells. The overall operation temperature is room temperature. The buffers should be ice cold.
Add a 20 μl aliquot of antibody-conjugated microbeads per 107 cells incubate for 30 min at 4-8 °C at a shaker. No prewash is needed. The number of cells is depending from the animal.
The following microbeads were used: anti-CD43 microbeads for negative isolation of resting B cells, anti-CD90 microbeads for positive isolation of total T cells, anti-CD4 and anti-CD8 microbeads for positive isolation of the respective T-cell subset.
Wash the column by putting 5 ml 1x PBS on the top. The liquid passes the column by gravity. Then pipette the labelled cell suspension on top of a separation column, which had been washed three times with separation buffer and placed in the MiniMACS separation unit. Pass the suspension through the column.
In case of negative selection of CD43- B cells the effluent was collected as a B-cell fraction and washed respectively centrifuged three times with 5 ml PBS.
In case of positive selection of CD90+, CD4+ or CD8+ T-cells the effluent was discarded and the columns were washed twice with 500 μl separation buffer. Subsequently, remove columns from the separator and wash magnetically labelled cells out with 1 ml separation buffer using a plunger.
Wash the respective T-cell fraction three times with medium same as B-cells
Assess the purity of the various cell fractions by Flow cytometry analysis using a Flow cytometer. Stain cells with fluorescein isothiocyanate (FITC)-conjugated anti-CD3 (clone 145-2C11 to detect total T-cells), phycoerythrin (PE)-conjugated anti-CD19 (clone 1D3 to detect B-cells), FITC-conjugated anti-CD4 (clone RM4-5 to detect CD4+ T-cells) and PE-conjugated anti-CD8 (clone 53-6.7 to detect CD8+ T-cells) and analyse for positive cells according to standard procedures.
Recipes
Separation buffer
1x PBS with 5 mM EDTA and 0.5% BSA
Acknowledgments
The authors thank the German Research Foundation (DFG) and the University Erlangen-Nuremberg for funding. We thank A. von Berg and L. Sologub for excellent technical assistance.
References
Miltenyi, S., Muller, W., Weichel, W. and Radbruch, A. (1990). High gradient magnetic cell separation with MACS. Cytometry 11(2): 231-238.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Immunology > Immune cell isolation > Lymphocyte
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
69 | https://bio-protocol.org/en/bpdetail?id=69&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Whole Blood Staining of Human Monocyte Subsets for Flow Cytometry
Zheng Liu
In Press
Published: May 20, 2011
DOI: 10.21769/BioProtoc.69 Views: 41542
Ask a question
Favorite
Cited by
Abstract
This is a general protocol to stain whole human blood for flow analysis with minimal spontaneous activation of monocytes. This protocol was developed or modified in Dr. Anne Davidson’s lab at Feinstein Institute for Medical Research.
Keywords: Human Flow cytometry Monocytes Whole blood
Materials and Reagents
Antibodies
Mouse anti-human CD56 FITC (BD Biosciences, catalog number: 340410 )
Mouse anti-human CD2 FITC (BD Biosciences, catalog number: 555326 )
Mouse anti-human CD19 FITC (BD Biosciences, catalog number: 555412 )
Mouse anti-human CD14 PerCP (Life Technologies, Invitrogen™, catalog number: MHCD1431 )
Mouse anti-human CD16 Pac Blue (BD Biosciences, catalog number: 558122 )
Mouse anti-human HLA-DR APC-Cy7 (BioLegend, catalog number: 307617 )
Other materials
Human blood
10x BD FACS Lysing Solution (BD Biosciences, catalog number: 349202 )
20% formaldehyde (Tousimis, catalog number: 1008A )
Phosphate buffered saline (PBS) (Life Technologies, Gibco®, catalog number: 20012-027 )
Equipment
Standard Bench-top Centrifuge
5 ml polypropylene tubes (BD Biosciences, Falcon®, catalog number: 352063 )
BD LSR II flow cytometer
Glass Whole Blood Tube with K3EDTA (BD Vacutainer®, catalog number: 366450 )
Software
FlowJo (Tree Star)
Procedure
Harvest human blood into a 13 ml Glass Whole Blood Tube with K3EDTA and mix the blood by gently inverting the tube several times.
Transfer 100 μl whole blood into 5 ml polypropylene tubes and label the samples accordingly.
Add 5 μl of each antibody into the blood sample and mix by gently tapping the tubes.
Incubate the samples for 15 min in dark at room temperature.
Add 2 ml 1x BD FACS Lysing Solution (10x solution diluted in ddH2O) in each sample.
Vortex sample briefly three times, check for clarity and take to centrifuged within 2-3 min.
Centrifuge 1,200 rpm for 7 min at room temperature.
Remove supernatant and resuspend pellet in 200 μl 2% formaldehyde.
Acquire the samples on BD LSR II flow cytometer.
Analyze data using FlowJo.
Gating strategy
Gate on monocytes
Gate on HLA-DR+ cells
Exclude CD2+, CD19+, and CD56+ cells
Gate CD16hi, CD14hi, and CD14hiCD16hi monocytes
Acknowledgments
This protocol was developed or modified in Dr. Anne Davidson’s lab at Feinstein Institute for Medical Research, NY, USA. This work was supported by grants from the NY SLE Foundation (RB), Rheuminations, NIH AI082037 and AR 049938-01, NIH (PO1 AI51392 and the Flow Cytometry and Protein Expression and Tetramer Cores of PO1 AI51392).
References
Liu, Z., Bethunaickan, R., Huang, W., Lodhi, U., Solano, I., Madaio, M. P. and Davidson, A. (2011). Interferon-alpha accelerates murine systemic lupus erythematosus in a T cell-dependent manner. Arthritis Rheum 63(1): 219-229.
Ramanujam, M., Wang, X., Huang, W., Liu, Z., Schiffer, L., Tao, H., Frank, D., Rice, J., Diamond, B., Yu, K. O., Porcelli, S. and Davidson, A. (2006). Similarities and differences between selective and nonselective BAFF blockade in murine SLE. J Clin Invest 116(3): 724-734.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Immunology > Immune cell staining > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
690 | https://bio-protocol.org/en/bpdetail?id=690&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Modified Single-Cell Transient Gene Expression Assay in Barley Epidermal Cells
SB Shiwei Bai
CC Cheng Chang
XH Xinyun Han
QS Qian-Hua Shen
Published: Vol 3, Iss 9, May 5, 2013
DOI: 10.21769/BioProtoc.690 Views: 9643
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Jun 2012
Abstract
Transient gene expression via biolistic particle delivery is a widely used technique for gene functional analysis in plants. In this protocol we describe a modified single-cell transient expression assay through transformation with a particle inflow gun of the model PDS-1000/He system (Bio-Rad). This assay was originally optimized for analyzing cell death activity and disease resistance function of the barley MLA (mildew locus A) disease resistance proteins against the powdery mildew fungus, which can be further adopted for other purposes for other types of plant proteins and in some other plant species, including Arabidopsis thaliana.
Keywords: Transient gene expression Single epidermal cell Particle bombardment DNA coating Barley, wheat
Materials and Reagents
Barley (Hordeum vulgare L.) plants, 1 week old seedlings
Powdery mildew strain(s), fresh conidiospores as inoculum
Benzimidazol (Genview, catalog number: 51-17-2 )
Agar (Japan, plant cell culture tested)
CaCl2 (Sigma-Aldrich, catalog number: C7902 )
X-gluc (Inalco, catalog number: 1758-0600 )
Coomassie Brilliant Blue R-250 (Amresco, catalog number: 0472 )
Ethanol (Beijing Chemical Works)
Glycerol (Beijing Chemical Works)
Methanol (Beijing Chemical Works)
Lactic acid (Beijing Chemical Works)
Plasmid
Reporter DNA
K3Fe [CN6] (Sinopharm Chemical Reagent, catalog number: 10016718 )
Triton X-100 (AMRESCO, catalog number: 0694 )
Spermidine (Sigma-Aldrich, catalog number: S-4139 ) (see Recipes)
GUS staining solution (see Recipes)
Destaining solution (see Recipes)
Benzimidazol plates (see Recipes)
Coomassie blue solution (see Recipes)
Equipment
PDS-1000/He delivery system (Bio-Rad Laboratones)
Macrocarrier (Bio-Rad Laboratones, catalog number: 1652335 )
Rupture disc (900 psi) (Bio-Rad Laboratones, catalog number: 1652328 )
Centrifuges (Eppendorf, catalog number: 5424 )
Fluorescence microscope (Carl Zeiss, Axio Scope. A1 )
pH meter (Mettler Toledo, FE20K)
Gold microcarrier: 1.0 μm in diameter (Bio-Rad Laboratones,catalog number: 165-2263 )
Procedure
Preparations
Inoculate plants with powdery mildew spores to prepare inoculum and sow barley seeds to grow plants for bombardment one week in advance. The plants were grown in a growth chamber under a 16 h/8 h, 20 °C/18 °C day/night cycle with 70% relative humidity.
Prepare Benzimidazol plates one day in advance.
Bombardment
Cut primary leaves and put them on Benzimidazol plates with adaxial side up (Figure 1), 3-5 leaves per petridish (90 mm) per shot, incubate at least 4 h before shooting.
Figure 1. Picture showing preparation of Benzimidazol agar plate with barley leaves for bombardment. 5-6 barley primary leaves were detached from 1 week old barley seedlings and put side by side with adaxial side up on prepared Benzimidazol agar plate.
Prepare gold particles (20 shots):
Weigh 9 mg gold particles in a 1.5 ml tube.
Add 1 ml 70% ethanol, vortex 5 min, sediment particles for 15 min on bench.
Spin 2 sec. (about 2,000 rpm), discard supernatant.
Repeat 3 times: add 1 ml sterile H2O, vortex 2 min, sediment 1 min, spin 2 sec. (about 2,000 rpm), discard supernatant.
Add 1 ml of 50% glycerol (in water), vortex (gold particles can be stored at -20 °C for 2-3 weeks).
Coat the gold particles (use 50 μl gold particle solution for one shot):
Vortex gold particle for at least 5 min.
Mix equal molar plasmid and reporter DNA (e.g. GUS or GFP reporter), do not use more than 2 μg DNA in total, add ddH2O when volume is less than 5 μl.
Aliquot 50 μl gold particles into each empty tube, then add DNA solution.
While vortexing, add: 50 μl 2.5 M CaCl2 drop-by-drop, then 20 μl 0.1 M spermidine, vortex for 3 min in total.
Sediment particles for 1 min, spin 2 sec. (2,000 rpm), discard supernatant.
Add 140 μl 70% ethanol, vortex, spin 2 sec. (2,000 rpm), discard supernatant.
Add140 μl 100% ethanol, vortex, spin 2 sec. (2,000 rpm), discard supernatant.
Add 15 μl 100% ethanol, vortex, store on ice until used.
Bombard, for each shot repeat the following steps:
Fix the macrocarriers in macrocarier holder, suspend particles by pipetting, and apply the particles onto the macrocarrier. Dry on the bench.
Dip rupture disc (900 psi) in 100% (v/v) 2-propanol and subsequentlyplace it into rupture disk retaining cap, add few more drops of 2-propanol.
Insert macrocarrier holder with stop-screen in stop screen holder at position 1 (from top) (Figure 2).
Figure 2. Picture showing the PDS-1000/He delivery system. Indicated are position 1 and 3 that reserved for macrocarrier holder and patridish holder, respectively.
Insert petridish with leaves at position 3 (Figure 2).
Apply vacuum up to 27 inches of mercury, trigger the shot.
Arrange leaves on the petridish, put in incubator.
Note: We put the leaves on the dish side by side with adaxial side up (Figure 1).
(Omit this step if fungal inoculation is not necessary)
Inoculate with powdery mildew condiospores at least 4 h after bombardment.
For GFP index scoring
36-48 h after bombardment count GFP expressing cell numbers using fluorescence microscope.
Note: The total number of cells here is the sum of compatible (haustorium, seccondary hyphae) and incompatible (only appressorium) on GUS expressing cells. We score all of the five leaves and at least 60 cells were scored.
For Fungal Haustorium index scoring
48 h after fungal spores inoculation
Stain leaves for GUS expression: put leaves into 15 ml falcon tube containing about 8 ml X-gluc staining solution, vacuum infiltrate 5 min for 3 times, and incubate overnight to 24 h at 37 °C.
1 day after GUS staining
Remove GUS staining solution, add about 10 ml destaining solution, store at RT at least 2 days.
When time available:
Stain for the fungus:
Transfer leaves to large volume of ddH2O for 1 h.
Stain in coomassie solution for few seconds.
Wash twice in water.
Mount on microscope slide in 50% glycerol. Once on the slide the samples should be scored within few days.
Score compatible (visible intracellular haustorium, and sometimes secondary hyphae on leaf surface) and incompatible (only fungal appressorium) interaction cell/site for GUS expressing cells.
Recipes
Benzimidazol plates
1% agar in water with 85 μM Benzimidazol (from 8.5 mM stock solution in water, 100 x)
Note: The pH value for these plates is about 6.5. It is not necessary to adjust the pH value.
Spermidine
0.1 M solution, 1 g solution mix with 67.8 ddH2O, filter sterilized.
Aliquot and stored at -20 °C (note: it's very hygroscopic and air sensitive, close and put back to freezer immediately when done.)
2.5 M CaCl2 in water, sterile filtrate store in room temperature
GUS staining solution
0.1 M Na2HPO4/NaH2PO4 (pH 7.0)
10 mM Na-EDTA
5 mM K4Fe[CN6]
5 mM K3Fe[CN6]
0.1% Triton X-100 (v/v)
20% methanol (v/v)
1 g/L X-gluc
adjust to pH 7.0
Destaining solution: stock solution
50% glycerol
25% lactic acid
25% H2O
Dissolve 1 volume stock solution in 2 volumes ethanol.
Coomassie blue solution
0.6% coomassie blue (w/v) in 100% (v/v) methanol/or ethanol
Acknowledgments
This protocol is adapted from Shirasu et al. (1999); Shen et al. (2012) and Bai et al. (2012).
References
Bai, S., Liu, J., Chang, C., Zhang, L., Maekawa, T., Wang, Q., Xiao, W., Liu, Y., Chai, J., Takken, F. L., Schulze-Lefert, P. and Shen, Q. H. (2012). Structure-function analysis of barley NLR immune receptor MLA10 reveals its cell compartment specific activity in cell death and disease resistance. PLoS Pathog 8(6): e1002752.
Shen, Q. H., Zhou, F., Bieri, S., Haizel, T., Shirasu, K. and Schulze-Lefert, P. (2003). Recognition specificity and RAR1/SGT1 dependence in barley Mla disease resistance genes to the powdery mildew fungus. Plant Cell 15(3): 732-744.
Shirasu, K., Nielsen, K., Piffanelli, P., Oliver, R., and Schulze-Lefert, P. (1999). Cell-autonomous complementation of mlo resistance using a biolistic transient expression system. Plant J 17: 293-299.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant molecular biology > DNA
Cell Biology > Single cell analysis > Cell carrier
Molecular Biology > DNA > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
691 | https://bio-protocol.org/en/bpdetail?id=691&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Lipid Transfer Assay
YZ Yan Zhang
XW Xiaochen Wang
Published: Vol 3, Iss 9, May 5, 2013
DOI: 10.21769/BioProtoc.691 Views: 12293
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Current Biology Jul 2012
Abstract
This is a protocol to detect lipid transfer activity of NRF-5, a member of the LPS binding/lipid transfer protein family. The lipid transfer activity is examined by using isotope-labeled cholesterol and liposomes, and tested in two directions (Figure 1): from proteins to liposomes and from liposomes to proteins.
Materials and Reagents
PC (Avanti-Polar Lipids)
PE (Avanti-Polar Lipids)
Cholesterol (Avanti-Polar Lipids, catalog number: 700000 )
1,2-Dioleoyl-sn-Glycero-3-Phosphoethanolamine (DOPE) (Avanti, catalog number: 850725 )
1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) (Avanti, catalog number: 770375 )
1 mCi (37 MBq) (PerkinElmer, catalog number: NET139001MC )
Protein of interest tagged with Flag
Tris-HCl (pH 7.4)
NaCl
Anti-Flag M2 agarose beads (Sigma-Aldrich, catalog number: A2220 )
Flag peptide (Sigma-Aldrich, catalog number: F3290 )
Chloroform
Wash buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
Avanti Mini-Extruder (Avanti, catalog number: 610023 )
Vortexer
Centrifuges
Rotator
Branson tip-sonicator (Cole-parmer Cp750)
Scintillation counter (Wallac MicroBeta TriLux, catalog number: 1450-023 )
Procedure
Preparation of liposomes (room temperature)
Liposome in the absence of cholesterol is made by Avanti Mini-Extruder at room temperature. The dried 1.25 mg mix of PC (75%) and PE (25%) is hydrated in 1 ml buffer (50 mM Tris-Cl, 150 mM NaCl). 100 nm unilamellar vesicles are obtained by extrusion as described:
(http://www.avantilipids.com/index.php?option=com_content&view=article&id=185&Itemid=193)
Liposomes containing [3H]cholesterol are generated by using a standard sonication procedure.
Dissolve dried 2.5 mg mix of PC (75%) and PE (25%) in 200 μl chloroform by vortex.
Take 8 μl of above chloroform dissolved lipid mix and add 0.001 mg [3H]cholesterol (~2% molar mass).
The chloroform is evaporated and dried under a stream of nitrogen. Longer drying time (4-12 h) can be used to remove any trace of organic solvent.
The dry lipid film is hydrated by adding 0.5 ml of buffer (50 mM Tris-Cl, 150 mM NaCl). After vortex at room temperature for 20 min, the large multilamellar vesicle suspension is disrupted with a Branson tip-sonicator until the suspension clear. For sonication, the samples are placed on ice and sonicated for 10 min with cycles including 9 seconds sonication, 9 seconds interval and 35% input.
Metal particles from the sonicator tip and undisrupted lipid aggregates are removed by centrifugation at 100,000 x g for 30 min at 4 °C. The resulting hazy supernatant, composed primarily of small unilamellar vesicles, is stored at 4 °C. The liposomes can be stored at this condition for one week.
Examine [3H]Cholesterol transfer from liposomes to proteins (Figure 1)
Reactions are performed on ice.
In the [3H]cholesterol/liposome to protein transfer assay, each reaction contains, in a final volume of 200 μl buffer (50 mM Tris-Cl, 150 mM NaCl, pH 7.4), 4 μg of PC:PE:[3H]cholesterol liposomes, and different amounts of the acceptor protein EGFP-FLAG and EGFP::NRF-5-FLAG(15 and 30 μg) purified from 293T cells (Zhang et al., 2012). EGFP-FLAG is used as the negative control.
After incubation for 30 min at 4 °C, each mixture is diluted with 600 μl 50 mM Tris-Cl, 150 mM NaCl, followed by adding 70 μl 50% Flag beads.
After incubation for about 1 h at 4 °C on shaker, the Flag beads are washed 4-5 times in 1,000 μl wash buffer on shaker, and bounded [3H]cholesterol is quantified by scintillation counting.
Figure 1. Schematic diagrams of the lipid transfer assay in two directions
Examine [3H]Cholesterol transfer from proteins to liposomes (Figure 1)
Protein-[3H]cholesterol complex is obtained by incubating EGFP-FLAG or EGFP::NRF-5-FLAG (400 pmol) with [3H]cholesterol (100 pmol) in a final volume of 300 μl buffer (50 mM Tris-Cl, 150 mM NaCl, pH 7.4) for 3 h at 4 °C. The protein-[3H]cholesterol complex is pulled down by incubating with 100 μl 50% Flag beads for 2 h at 4 °C, washing 6 times as above and eluted with 100 μl Flag peptide (100 mg ml-1) for two times.
In the protein-to-liposome transfer assay, each reaction contains, in a final volume of 200 μl buffer (50 mM Tris-Cl, 150 mM NaCl, pH 7.4), [3H]cholesterol complexed to either EGFP or EGFP-NRF-5 (40 μl), and different amounts of acceptor PC liposomes (50 and 100 ng).
After incubation for 30 min at 4 °C, each mixture is diluted with 600 μl of buffer (50 mM Tris-Cl, 150 mM NaCl, pH 7.4).
Liposomes are separated by centrifuging at 10,000 x g (hard to detect weight at this stage) for 30 min at 4 °C. The lipososomes can be seen as a small white patch at the bottom of the tube.
Wash the liposomes 4-5 times in the buffer (50 mM Tris-HCl, 150 mM NaCl), with 500 μl buffer used in each tube at each time. The liposomes are collected by centrifuge (10,000 x g) after each wash. The amount of [3H]cholesterol transferred to liposomes is determined by scintillation counting.
Recipes
Wash buffer
50 mM Tris-Cl, 150 mM NaCl (pH 7.4)
Elution buffer
50 mM Tris-Cl, 150 mM NaCl (pH 7.4), Flag peptide
Acknowledgments
This protocol is adapted from Zhang et al. (2012) and Infante et al. (2008).
References
Infante, R. E., Wang, M. L., Radhakrishnan, A., Kwon, H. J., Brown, M. S. and Goldstein, J. L. (2008). NPC2 facilitates bidirectional transfer of cholesterol between NPC1 and lipid bilayers, a step in cholesterol egress from lysosomes. Proc Natl Acad Sci U S A 105(40): 15287-15292.
Zhang, Y., Wang, H., Kage-Nakadai, E., Mitani, S. and Wang, X. (2012). C. elegans secreted lipid-binding protein NRF-5 mediates PS appearance on phagocytes for cell corpse engulfment. Curr Biol 22(14): 1276-1284.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Protein > Activity
Biochemistry > Lipid > Lipid transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
692 | https://bio-protocol.org/en/bpdetail?id=692&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Single-cell Gene Expression Profiling of Mouse Stem Cells With Fluidigm BiomarkTM Dynamic Array
Ana Sevilla
Published: Vol 3, Iss 9, May 5, 2013
DOI: 10.21769/BioProtoc.692 Views: 18319
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Nature Cell Biology Nov 2012
Abstract
This protocol describes how to use Fluidigm BiomarkTM 96.96 dynamic arrays for high-throughput expression profiling from single mouse stem cells, assaying up to 96 independent samples with up to 96 quantitative PCR (qPCR) probes (equivalent to 9,216 reactions) in a single experiment. This Dynamic Array contains a network of microfluidic channels, chambers and valves that automatically assemble all these individual PCR reactions. Single-cell profiling can provide definitive evidence of stem cell heterogeneity. Modifications are most likely needed if users intend to use BiomarkTM 48.48 Dynamic array or experimenter-designed primers in conjunction with DNA-binding dyes such as EvaGreen (Biotium 31000).
Figure 1. Workflow for Single-Cell Gene Expression Profiling in Mouse Stem Cells using Fluidigm BiomarkTM Dynamic Array. The main basic steps of this protocol are: Single cell sorting on 96 well plates, specific target amplifycation, chip loading, single cell gene expression RT-PCR and data collection. This Fluidigm Dynamic Array integrated fluidic circuit chip (IFCs) contains a network of microfluidic channels, chambers and valves that automatically assemble individual PCR reactions. More specific information about this particular chip can be obtained from http://www.fluidigm.com/single-cell-gene-expression.html.
Materials and Reagents
Mouse ES cells (E14 Cell Line) (ATCC®, catalog number: SCRC-1040TM )
Low-EDTA (0.1 mM EDTA) TE buffer (Teknova, catalog number: T0227 )
CellsDirectTM One-Step qRT-PCR kit (Life Technologies, InvitrogenTM, catalog number: 11753-100 )
Taqman Gene Expression Assays of the genes of interest for your study (Applied Biosystems)
Note: TaqMan® Assays are probe and primer sets based on 5’ nuclease chemistry using TaqMan® MGB (minor groove binder) probes.Search your Taqman gene expression assays here: https://bioinfo.appliedbiosystems.com/genome-database/gene-expression.html
Select the type of experiment you are conducting. Click In gene expression
Select the type of assay you want. click in all gene expression assays
Select what specie you want to target. Click on mouse since our samples are Mouse ES cells.
Enter the target information. Add the gene symbol or entrez gene symbol or entrez gene ID of the gene you want to analyze its expression.
96.96 Dynamic Array Chip for Gene Expression (Fluidigm, catalog number: BMK-M-96.96 )
Gene expression 96.96 Dynamic Array sample & loading reagent kit (Fluidigm, catalog number: 85000802 ), which contains:
Two tubes of 2x assay loading reagent (Fluidigm, catalog number: 85000736 )
Two tubes of 20x GE sample loading reagent (Fluidigm, catalog number: 85000746 )
20 syringes of Control Line Fluid (150 μl)
TaqMan® universal PCR master mix (Applied Biosystems, catalog number: 4304437 )
Dulbecco's Phosphate-Buffered Saline (DPBS) (Life Technologies, catalog number: 14190-136 )
TryPLE express solution (Life Technologies, catalog number: 12605-010 )
4',6-diamidino-2-phenylindole (DAPI) (Life Technologies, catalog number: D1306 )
Propidium iodide (PI) (Life Technologies, catalog number: P-3566 )
2x Assay Loading Reagent (Fluidigm, catalog number: 85000736)
2x TaqMan®Universal PCR Master Mix (Applied Biosystems, catalog number: 4304437)
20x GE Sample Loading Reagent (Fluidigm, catalog number: 85000746 )
Equipment
96-well semi-skirted plate, 0.2 ml wells, straight raised sides (USA scientific, catalog number: 1402-9200 )
Optical adhesive film (Applied Biosystems, catalog number: 4311971 )
PCR-8-Tube Strips & Strip Camps, natural (USA Scientific, catalog number: 1402-2500 )
TipOne 0.1–10 μl extended-length filter tips (USA Scientific, catalog number: 1120-3810 )
TipOne 101–1,000 μl extended-length filter tips (USA Scientific, catalog number: 1122-1830 )
TipOne 1–200 μl graduated filter tips (USA Scientific, catalog number: 1120-8810 )
Fluorescence-activated cell sorter (FACS Aria II; BD Biosciences, catalog number: 643756 )
Multichannel pipettes (10-100 μl Eppendorf Research®, catalog number: 38-3122000043 ; 0.5-10 μl catalog number: 38-3122000019 )
Thermal cycler (VeritiTM 96-well Applied Biosystems, catalog number: PN 4375786 )
The Integrated Fluidic Circuit IFC-Controllers
The MX model primes and loads 48.48 chips
The HX model primes and loads the 96.96 chips.
Centrifuge (Eppendorf, catalog number: 5810 )
Procedure
Reverse transcription-specific target amplification (RT-STA) master mix preparation.
Thaw the CellsDirect 2x Reaction Mix from the CellsDirectTM One-Step qRT-PCR kit. All steps should be performed on ice, and reagents should be chilled and/or thawed immediately prior to use.
Transfer 65 μl of the 2x Reaction Mix to each tube of the PCR-8-Tube Strip.
Add 5 μl of 2x Reaction Mix from the PCR-8-Tube Strip to each well of the 96 well-plate with the multichannel pipette.
Since the amount of RNA from a single cell is few pictograms, we don’t perform a traditional RNA isolation protocol. Instead, the sorted cells are directly introduced into the 2x Reaction Mix. To ensure optimal sample preservation, this master mix contains CellDirect 2x reaction Mix (CellsDirect One-Step qRT-PCR kit) and SUPERase-In. This enzyme protects the RNA extracted from a lysed cell from any RNAases that could be present in the RT-STA master mix.
Cell sorting
Detach the mouse ES cells with TryPLE Express solution. Gently aspirate away cell media culture and wash the cells with 5-6 ml of fresh 1x DPBS to remove serum that could inhibit TryPLE Express solution activity.
Aspirate away the 1x DPBS.
Add 1 ml of pre-warmed TryPLE Express solution directly to the cell culture plate, and incubate the plate at 37 °C, 5% CO2 for 3-5 min.
Take the cell culture plate out, gently tap or shake it, and then add 10 ml of fresh cell culture medium with 10% (v/v) FBS to stop trypsin activity. Mix cells with a pipette and transfer 1 x 106 cells into a 15 ml conical tube. Centrifuge at 300 x g, 4 °C for 5 min.
Aspirate the cell supernatant and resuspend 1 x 106 cells in 1 ml of 1x DPBS supplemented with 5% (v/v) FBS.
Keep 1 x 106 cells on ice before sorting or label the cells with the suitable surface markers according to the cell population you are interested to study.
Add 10 μl of DAPI (> 200 ng/ml) or 10 μl of PI (5 μg/ml) per 1 x 106 cells to the single-cell suspension that contains 1 x 106 cells suspended in 1 ml of 1x DPBS supplemented with 5% (v/v) FBS just before cell sorting to distinguish the live cell population.
Perform cell sorting in FACS Aria II and data analysis with FACS Diva software.
When sorting cells gate for singlet’s in your sorting parameters.
Sort single cells directly into the wells of a 96 well-plate containing a 5 μl mixture of CellsDirect 2x reaction mix (component CellsDirect One-Step qRT PCR Kits, Invitrogen). We estimate that the final volume of the reaction after cells are sorted into the wells will be 6 μl.
Note: Sort the cells into the same plate that is used for the RT-STA PCR. Always keep the well-plate on ice.
Centrifuge at 300 x g, 4 °C for 5 min the 96 well-plate to let the cells go into the CellsDirect 2x reaction mix.
Seal the plate with the optical adhesive film.
Store the plate at -80 °C. This overnight freezing step allows a better lysis efficiency.
Preparation of the Specific Target Amplification (RT- STA) master mix.
Make an excel file template for the 96 well-plate and label each cell with the specific 20x Taqman assay probe.
Thaw the 20x Taqman assays and deposit them in the 96 well-plate according to the location establish in the excel file template for each 20x Taqman assay probe.
Thaw the plate with the sorted cells in the CellsDirect 2x reaction mix on ice.
Prepare the assay mix in a 1.5 ml eppendorf tube. Pool all Taqman real-time assays that will be analyzed in the single-cell real-time PCR that you previously deposited on a 96 well-plate in step b. Final concentrations of the Taqman assays used in the mix will be 0.2x. Use TE buffer to dilute the Taqman assays. This is the 0.2x assay mix.
Component
Volume to add per reaction (μl)
Final concentration
20x Taqman gene expression assay1
1.5
0.2x
20x Taqman gene expression assay2
1.5
0.2x
…
…
…
TE buffer
Up to 150 μl
TOTAL
150 μl
Prepare the sample RT-STA Master Mix by combining the following reagents:
Component
Volume (μl)
0.2x Assay Mix
2.5
SuperScriptTM RT/Platinum® Taq Mix
0.2
TE Buffer
1.3
TOTAL
4
Note: It is important to create a bulk solution for all the samples being tested to overcome pipetting limitations.
Add 4 μl of the RT-STA master mix to each well that already contain the sorted cell immersed into the CellsDirect 2x reaction mix.
Seal the plate with the optical adhesive film. Leave the plate on ice for 5 min meantime you program the thermal cycler.
Before you run the Reverse transcription and specific target amplification verify that each well from the 96 well plate has the components and the volumes according to the table below. Your final volume has to be 9 μl.
Component Volume (μl)
CellsDirect 2x Reaction Mix (This reagent is already in the plate with the sorted cell)
5.0
0.2x Assay Mix
2.5
SuperScriptTM RT/Platinum® Taq Mix
0.2
TE Buffer
1.3
TOTAL
9
Reverse transcription and specific target amplification.
Place the 96 well plate with the RT-STA master mix in a thermal cycler.
50 °C for 15 min (Step to reverse transcribe the RNA to cDNA)
95 °C for 2 min (Step to inactivate the RT enzyme and activate the Taq)
22 Cycles of 95 °C for 15 sec and 60 °C for 4 min (STA Specific Target Amplification)
Hold at 4 °C
Run the sample PCR according to these parameters:
Note: We screened different number of cycles and we found that for single cell analysis 22 cycles gave us better results in the Chip resolution.
Dilute the resulting cDNA product 1:5 with TE buffer.
Any dilution between 1:2 and 1:5 is possible.
Preparing 10x Assays
In a DNA-free hood, prepare a 96 well-plate with 5μl aliquots of 10x assays using the volumes in the table below (scale up appropriately for multiple runs). Add the 20x TaqMan assays, one per well, to the 96 well-plate in the same position as in the excel file template.
Component
Volume per Inlet (μl)
20x Taqman® gene expression assay (Applied Biosystems)
2.5
2x Assay Loading Reagent
2.5
Total volume
5.0
Final concentration (at 10x)
Primers: 9 μM: Probe: 2 μM
Seal the plate with the optical adhesive film.
Important: For unused sample inlets, add 3.3 μl of sample mix and 2.7 μl of DNA-free water per inlet, for unused assay inlets, add 3.0 μl assay loading reagent and 3.0 μl of water.
Preparing sample mixture
Combine the components in the table below to make the Sample Mixture (scale up appropriately for multiple runs).
Component
Volume per Inlet (μl)
TaqMan® Universal PCR Master Mix (2x)
2.5
20x GE sample loading reagent
0.25
cDNA (already diluted 1/5)
2.25
Total volume
5.0
Seal the plate with the optical adhesive film.
Priming the 96.96 Dynamic ArrayTM in the Integrated Fluidic Circuit (IFC).
Take a BioMark 96 x 96 Dynamic Array from its bag. Avoid touching the center of the chip.
Control line fluid on the chip or in the inlets makes the chip unusable. This chip needs to be use within 24 h after opening the package.
Take the 96.96 syringes with 150 μl of control line fluid and inject the 150 μl of control line fluid into each accumulator on the chip by introducing the syringe through the accumulators and pushing down the black O-ring. Use one syringe per accumulator. Avoid bending the pipette tip from the syringe.
Place the chip into the Integrated Fluidic Circuit (IFC) controller HX, then select the Prime (136x) script program to prime the control line fluid into the chip. This program takes (~20 min).
Chip Loading
Load the chip within 60 minutes of priming to reduce the loss of pressure within the chip.
Vortex thoroughly and at 300 x g, 4 °C for 5 min all assay and sample solutions from the 96 well-plates before pipetting into the chip inlets.
Important: It is crucial to avoid forming any bubbles inside the chip inlets when loading the 10x assay mixes (prepared in step 5) on the chip inlets located on the left side and the 10x sample mixes (prepared on step 6) on the chip inlets located on the right side of the chip. To avoid bubbles, press the pipette only until the first stop. If bubbles appeared, pop them with a fresh sterile tip. Take care of cross-contamination or loss of reaction volume.
Place the chip back into the IFC Controller HX, select the Load mix (163x) program to load the samples and assays into the chip. Selecting OK starts the loading. This program takes (~1 h and 30 min).
While the Load Mix (136x) program is running select the “BioMark data collection Fluidigm” program from the computer.
Select “double-click to warm up the lamp” from the program. The lamp will be ready in 20 min and the lamp indicator on the software should be in green.
When the Load Mix (136x) program has finished, remove loaded chip from the IFC Controller HX.
Using the data collection software.
Double-click the data collection software icon on the desktop to launch the software.
Click start a New Run to open the machine door.
Check the status bar to verify that the camera temperature and the lamp are ready in green.
Remove the blue plastic film just before placing the chip on the tray. Place the chip with the barcode facing the outside of the machine. Follow the “A” orientation.
Click Load.
Verify that the reader identifies properly the chip barcode and recognizes the chip type.
Click Next.
Click run file.
Select new.
Browse for a file location where you want your data to be stored.
Click Next.
Amplification, Reference, Probes:
Select application type: gene expression.
Select passive reference: (ROX).
Select assay: Single probe.
Select probe types: FAM-MGB.
Click Next.
Click Browse to find thermal protocol file: GE 96 x 96 Standard v1.pcl
PCR profile included:
95 °C for 10 min
40 cycles 95 °C for 15 sec and 60 °C for 60 sec
Confirm auto expose is selected.
Click Next.
Verify the chip run information.
Click Start Run. This program takes (~2 h).
Result analysis Single-cell gene expression profiling represented as CT values.
When the run has been completed, open the program “Fluidigm Real-time PCR analysis”.
Open the chipRun file. bml to be analyzed.
Select “Analysis view”.
With the view of the results, set the following parameters for your analysis: the quality threshold, the baseline correction and CT threshold method.
Click “Analyze”.
The results are shown as CT values. The CT values can be seen in the software as a heat- map view, image view or as a table. Export all files with the “.cvs” extension.
The data can be visualized and fully analyzed using Fluidigm real-time PCR analysis or any program for gene expression arrays.
Acknowledgments
We thank all the authors of this paper MacArthur et al. (2012) that participated in the single cell generation profiling as well as the data analysis. We gratefully acknowledge funding support by NIH (GM078465) and NYSTEM (C024410) to IRL. This work was also supported by an EPSRC Doctoral Training Centre grant (EP/G03690X/1) and an EPSRC 2011/12 Institutional Sponsorship Award (EP/J501530/1).
References
MacArthur, B. D., Sevilla, A., Lenz, M., Muller, F. J., Schuldt, B. M., Schuppert, A. A., Ridden, S. J., Stumpf, P. S., Fidalgo, M., Ma'ayan, A., Wang, J. and Lemischka, I. R. (2012). Nanog-dependent feedback loops regulate murine embryonic stem cell heterogeneity. Nat Cell Biol 14(11): 1139-1147.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Sevilla, A. (2013). Single-cell Gene Expression Profiling of Mouse Stem Cells With Fluidigm BiomarkTM Dynamic Array. Bio-protocol 3(9): e692. DOI: 10.21769/BioProtoc.692.
Download Citation in RIS Format
Category
Stem Cell > Embryonic stem cell > Cell-based analysis
Cell Biology > Single cell analysis > Microfluidics
Molecular Biology > RNA > Transcription
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
693 | https://bio-protocol.org/en/bpdetail?id=693&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Cell Corpses, Cell Death Occurrence, Cell Corpse Duration
YZ Yan Zhang
HW Haibin Wang
XW Xiaochen Wang
Published: Vol 3, Iss 9, May 5, 2013
DOI: 10.21769/BioProtoc.693 Views: 11087
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Current Biology Jul 2012
Abstract
During the development of the C. elegans hermaphrodite, 131 of the 1090 somatic cells generated undergo programmed cell death, among which 113 die during embryogenesis starting from 200-cell stage. The apoptotic cells (also called “cell corpses”) appear as highly refractile button-like objects and are easily identified using differential interference contrast (DIC) optics (Robertson et al., 1982).
Materials and Reagents
Agar pad (made by melting and coating 4% agar on glass slides)
C. elegans strains [Wild type (N2), Engulfment-defective mutants: commonly used mutants including ced-1, ced-5, ced-7, ced-6, ced-2, ced-12, ced-10, which all contain persistent cell corpses that are easily detected under DIC optics]
KH2PO4
Na2HPO4
NaCl
MgSO4
Peptone
Cholesterol
Vaseline
NGM agar (see Recipes)
M9 (used to mount embryos on agar pads) (see Recipes)
Equipment
Zeiss Axioimager M1 microscope (Carl Zeiss)
AxioCam monochrome digital camera (Carl Zeiss)
AxiovisionRel 4.7 software (Carl Zeiss)
Slides
Coverslips
Procedure
Quantification of cell corpses
C. elegans is grown on NGM agar plates carrying a lawn of bacterial and kept at 20 °C. Embryos are randomly picked from NGM agar plates containing mix-staged worms and mounted on slides with agar pads in M9 and covered with coverslips. Cell corpses are observed using a Zeiss Axioimager M1 microscope equipped with DIC at 20 °C. Cell corpses are identified by the “raised button” morphology and quantified in the head region of living embryos either at the six different embryonic stages (comma, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 4-fold) for a time course analysis (Figure 2) or at the 4-fold embryonic stage. 15 embryos are counted at each embryonic stage for each strain.
Figure 1.Seven Apoptotic cells (arrows) which appear as “raised button” objects in a C. elegans embryo are shown. Some apoptotic cells are not visible at this focus plane.
Figure 2.Time-course analysis of cell corpses during embryonic development was performed in wild-type (N2, open bar), nrf-5(qx16) (black bar), or nrf-5(sa513) (gray bar). At least 15 embryos were scored at each stage. Data are shown as mean+SEM. Data derived from N2 and nrf-5(qx16) or N2 and nrf-5(sa513) were compared by unpaired t test. **P < 0.0001; all other points had P > 0.05.
Monitor the occurrence of embryonic cell death and cell corpse duration
C. elegans embryos at the two-cell stage are mounted on slides with agar pads in M9 and coverslips are sealed with Vaseline. Images in a 20 micron z series (0.5 micron per section) were captured every 1 min for 8 h using a Zeiss Axioimager M1 microscope equipped with an AxioCam monochrome digital camera (Carl Zeiss). Images are processed and viewed using AxiovisionRel 4.7 software (Carl Zeiss). Embryonic cell deaths are followed during 200-370 min after the first embryonic cleavage by the appearance of the “raised button” morphology of cell corpses. The duration of cell corpses is determined by following the appearance and disappearance (no button-like morphology can be seen) of apoptotic cells. At least three embryos from each strain are followed and quantified. The standard error of the mean (SEM) is used as y error bars for bar charts plotted from the mean value of the data. Data derived from different genetic backgrounds were compared by Student’s two way unpaired t-test. Data were considered statistically different at P < 0.05.
Recipes
M9
0.022 M KH2PO4
0.042 M Na2HPO4
0.086 M NaCl
0.001 M MgSO4
NGM agar
NaCl 3 g
Agar 17 g
Peptone 2.5 g
Cholesterol (5 mg/ml in EtOH) 1 ml
H2O 975 ml
Acknowledgments
This protocol is adapted from Robertson et al. (1982) and Stanfield and Horvitz (2000).
References
Robertson, A. M. G. and Thomson, J. N. (1982). Morphology of programmed cell death in the ventral nerve cord of Caenorhabditis elegans larvae. J Embryol Exper Morphol 67(1): 89-100.
Stanfield, G. M. and Horvitz, H. R. (2000). The ced-8 gene controls the timing of programmed cell deaths in C. elegans. Mol Cell 5(3): 423-433.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Zhang, Y., Wang, H. and Wang, X. (2013). Quantification of Cell Corpses, Cell Death Occurrence, Cell Corpse Duration. Bio-protocol 3(9): e693. DOI: 10.21769/BioProtoc.693.
Download Citation in RIS Format
Category
Developmental Biology > Cell signaling > Apoptosis
Cell Biology > Cell viability > Cell death
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
694 | https://bio-protocol.org/en/bpdetail?id=694&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Lipid Binding Assay
YZ Yan Zhang
XW Xiaochen Wang
Published: Vol 3, Iss 9, May 5, 2013
DOI: 10.21769/BioProtoc.694 Views: 14782
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Current Biology Jul 2012
Abstract
This is a protocol to examine in vitro protein-lipid binding using membrane strips coated with various lipids. It has been successfully used to study in vitro interaction between lipids and C. elegans proteins.
Materials and Reagents
Membrane Lipid strip (Echelon Bioscience, catalog number: P-6001 )
Proteins of interest (EGFP-NRF-5-Flag, EGFP-Flag as control)
Anti-Flag M2 antibody (Sigma-Aldrich, catalog number: A2220 )
Primary antibodies (Anti-Flag M2 from Mouse, sigma, catalog number: F1804 )
HRP-conjugated secondary antibodies (e.g. Goat anti-Mouse LgG (H+L) HRP, The Jackson Laboratory, catalog number: 115-035-003 )
SuperSignal West Pico reagent (Thermo Fisher Scientific, catalog number: 34080 )
293T cells
Tris-Cl
NaCl
Tween-20
Ca2+ chloride
Zn2+ sulfate
Non-fat milk
Blocking buffer (see Recipes)
Incubation buffer (see Recipes)
Wash buffer (see Recipes)
Equipment
Vortexer
Rotator
Procedure
Membrane strips coated with various lipids are incubated in 10 ml of blocking buffer for 1 h at room temperature in dark (the commercially available membrane strip has been coated with lipids).
20-60 μg of proteins are added to 6 ml incubation buffer with membrane strips and incubated overnight at 4 °C. In our study, we used Flag-tagged protein purified from 293T cells (Zhang et al., 2012). However, proteins purified from other sources can all be used. Negative controls should be included according to specific proteins used in this assay.
Membrane strips are washed extensively with wash buffer for 3 times at RT, 10 min each wash on rotator.
Membrane strips with bounded proteins are incubated with primary antibodies (Anti-Flag M2 from mouse, 1:1,000) in incubation buffer for 3 h at RT.
Wash 3 times at RT with wash buffer, 10 min each wash on rotator.
Incubate membrane strips with HRP-conjugated secondary antibodies (Goat anti-Mouse LgG (H+L) HRP, 1:10,000) in incubation buffer for 1 h at RT.
Membranes are washed as above and protein-antibody interaction is detected using SuperSignal West Pico reagent.
Recipes
Blocking buffer
25 mM Tris-Cl
150 mM NaCl
0.1% Tween-20
1% non-fat milk
Incubation buffer
25 mM Tris-Cl
150 mM NaCl
0.1% Tween-20
1% non-fat milk
2 mM Ca2+ chloride
1 mM Zn2+ sulfate
Wash buffer
25 mM Tris-Cl
150 mM NaCl
0.1% Tween-20
2 mM Ca2+ chloride
1 mM Zn2+ sulfate
Acknowledgments
This protocol is adapted from Zhang et al. (2012) and Wang et al. (2010).
References
Wang, X., Li, W., Zhao, D., Liu, B., Shi, Y., Chen, B., Yang, H., Guo, P., Geng, X., Shang, Z., Peden, E., Kage-Nakadai, E., Mitani, S. and Xue, D. (2010). Caenorhabditis elegans transthyretin-like protein TTR-52 mediates recognition of apoptotic cells by the CED-1 phagocyte receptor. Nat Cell Biol 12(7): 655-664.
Zhang, Y., Wang, H., Kage-Nakadai, E., Mitani, S. and Wang, X. (2012). C. elegans secreted lipid-binding protein NRF-5 mediates PS appearance on phagocytes for cell corpse engulfment. Curr Biol 22(14): 1276-1284.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Zhang, Y. and Wang, X. (2013). In vitro Lipid Binding Assay. Bio-protocol 3(9): e694. DOI: 10.21769/BioProtoc.694.
Download Citation in RIS Format
Category
Biochemistry > Protein > Interaction > Protein-ligand interaction
Biochemistry > Lipid > Lipid binding
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
7 | https://bio-protocol.org/en/bpdetail?id=7&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Spinning
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
70 | https://bio-protocol.org/en/bpdetail?id=70&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
A Transient Expression Assay Using Arabidopsis Mesophyll Protoplasts
Xiyan Li
In Press
Published: May 20, 2011
DOI: 10.21769/BioProtoc.70 Views: 21165
Ask a question
Favorite
Cited by
Abstract
This method can be used to free and separate the mesophyll cells from Arabidopsis leaves. The protoplasts that are generated in this way can be used for transient expression for protein activity and subcellular localization assays.
Keywords: Protoplast Transient expression Arabidopsis Transfection
Materials and Reagents
Arabidopsis (Ecotype: Columbia)
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F6178 )
PEG4000 (Fluka, catalog number: 81240 )
Mannitol
NaCl
KCl
CaCl2
MgCl2
0.5 M MES (pH 5.7)
β-mercaptoethanol
Cellulase R10 purchased from http://www.yakult.co.jp/ypi/english/frame03.html
Macerozyme R10 purchased from http://www.yakult.co.jp/ypi/english/frame03.html
Bright-Line/Dark-Line Counting Chambers (catalog numbers: 3100 , 3110 , 3200 , 3500 , 1490 , 1492 , 1475 and 1483 )
Enzyme solution (see Recipes)
PEG solution (see Recipes)
W5 solution (see Recipes)
MMg solution (see Recipes)
Washing and incubation solution (see Recipes)
Equipment
IEC clinical centrifuge
Chamber Counter (instruction attached)
Petri plate
Vacuum desiccator
Zeiss LSM510
Aluminum foil
Nylon filters (35-75 µm) (Carolina Biological Supplies, catalog number: 65-2222N )
Procedure
Protoplast Isolation
Arabidopsis Columbia plants are planted on soil, cold treated for 3 d, and then transferred to the growth chamber (10 h Light/14 h Dark, 22 °C day/ 20 °C night, 80-100 μE). Well expanded leaves from 3.5-4.5 weeks old plants (6-8 leaves with elongated petiole) are used to prepare protoplasts.
Protoplast isolation procedure:
Make 10 ml enzyme solution. This is enough for more than 10 standard transfections. Pour solution into 15 cm petri plate.
Cut 0.5-1 mm leaf strips with fresh razor blades without wounding. Use 2-4 young leaves per plant. Put strips in enzyme solution immediately after cut. 10 ml enzyme solution can hold 40-60 such leaves.
Put the plate into to a vacuum desiccator and apply vacuum for 30 min. Continue the digestion for about 3 h without shaking in the dark (wrapped in Al foil) at room temperature (RT) 22-25 °C.
Use a round-bottom tube (like the one used for E. coli culture), filter the enzyme solution containing protoplasts with a 35-75 µm nylon mesh by slowly releasing the cell-containing solution from a 10 ml transfer pipette. Rinse the plate once with 4 ml W5 solution. Combine the filter-through and spin at 100 x g to pellet the protoplasts 1.5 min (speed 3 with an IEC clinical centrifuge).
Resuspend protoplasts once in 10 ml W5 solution. Spin at speed 3 for 1.5 min, and resuspend in 2 ml W5 solution. Count the cells using a chamber counter. Add more W5 to a cell density of 2.5 x 105/ml.
Keep the protoplasts on ice (30 min) in W5 solution.
Spin down protoplasts (speed 3 for 1 min) and resuspend in MMg solution (2.5 x 105 /ml) before PEG transfection.
PEG Transfection
All steps are carried out at RT (e.g. 23 ˚C)
Coat the 15 ml conical bottom tube with 5% FBS for 1 sec. Spin for 1 min and remove the leftover.
Add 60 μl DNA (60-120 μg of plasmid DNA of 5 kb in size. For co-transfection, use each with equal moles, the total remains the same).
Add 400 μl protoplasts to a microfuge tube (1 x 105 protoplasts), mix well gently with a 2 ml plastic transfer pipet.
Add 460 μl of PEG/Ca solution, mix well (handle 6-10 samples each time) gently with a 2 ml plastic transfer pipet. Incubate at 23 °C for 5-30 min.
Dilute with 3 ml W5 solution and mix well gently with a 2 ml plastic transfer pipet.
Spin at speed 3 in a clinical centrifuge for 1 min, remove supernatant. Resuspend protoplasts gently in 200 μl WI solution by a 2 ml plastic transfer pipet.
Wrap the tubes with Al foil and keep at ~23 °C until microscopic observation.
Check the cells for fluorescence under microscope. Most cells should be round with flashy red chloroplasts (auto fluorescence) dispersed evenly throughout the cell.
Common filter settings (on Zeiss LSM510):
Excitation (nm)
Emission (nm)
GFP
488
BP505-530
RFP
543
BP560-615
Chlorophyll
488
LP650
Recipes
Enzyme solution (10 ml)
stock
volume
final conc.
1 M mannitol
4 ml
0.4 M
1 M KCl
0.2 ml
20 mM
0.5 M MES (pH 5.7)
0.4 ml
20 mM
cellulase R10
100-150 mg
1-1.5%
macerozyme R10
20-40 mg
0.2-0.4%
Heat the enzyme solution at 55 °C for 10 min (to inactivate proteases and enhance enzyme solubility) and cool it to RT before adding.
1 M CaCl2
0.1 ml
10 mM
β-mercaptoethanol
4 μl
5 mM
10% FBS
0.1 ml
0.1%
PEG solution (40%, w/v) 10 ml
PEG4000
4 g
40% w/v
**Very Important!!
1 M mannitol
2 ml
200 mM
1 M CaCl2
1 ml
100 mM
H2O
3.5 ml
W5 solution (50 ml)
1 M NaCl
7.7 ml
154 mM
1 M CaCl2
6.25 ml
125 mM
1 M KCl
0.25 ml
5 mM
0.5 M MES-K (pH 5.7)
0.2 ml
2 mM
MMg solution (5 ml)
1 M mannitol
2 ml
0.4 M
0.3 M MgCl2
0.25 ml
15 mM
0.5 M MES-K (pH 5.7)
40 μl
4 mM
Washing and incubation solution (WI) 10 ml
final conc.
stock
volume
1 M mannitol
5 ml
0.5 M
0.5 M MES (pH 5.7)
80 μl
4 mM
1 M KCl
0.2 ml
20 mM
Directions for Chamber Counter
http://www.hausserscientific.com/
Bright-Line / Dark-Line Counting Chambers
Catalog Numbers: 3100, 3110, 3200, 3500, 1490, 1492, 1475 and 1483
Usage: Cell Counts
Cell Depth: 0.100mm +/- 2% (1/10 mm)
Volume: 0.1 Microliter
Ruling Pattern: Improved Neubauer, 1/400 Square mm
Rulings cover 9 square millimeters. Boundary lines of the Neubauer ruling are the center lines of the groups of three (these are indicated in the illustration below). The central square millimeter is ruled into 25 groups of 16 small squares, each group separated by triple lines, the middle one of which is the boundary. The ruled surface is 0.10 mm below the cover glass, so that the volume over each of the 16 small squares is.00025 cubic mm.
The number of cells per milliliter = Number of cells counted per square millimeter X dilution (if used) X 10,000
Neubauer Ruling
Acknowledgments
This protocol is consolidated from Jen Sheen’s protocol and Inhwan Hwang’s protocol. For references please go to the following websites for their publication lists:
http://genetics.mgh.harvard.edu/sheenweb/
http://www.postech.ac.kr/center/cpit/professor.html
References
Li, X., Chanroj, S., Wu, Z., Romanowsky, S. M., Harper, J. F. and Sze, H. (2008). A distinct endosomal Ca2+/Mn2+ pump affects root growth through the secretory process. Plant Physiol 147(4): 1675-1689.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Molecular Biology > Protein > Expression
Plant Science > Plant molecular biology > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
72 | https://bio-protocol.org/en/bpdetail?id=72&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Spinning
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
73 | https://bio-protocol.org/en/bpdetail?id=73&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Arabidopsis Pollen Tube Germination
Xiyan Li
In Press
Published: May 20, 2011
DOI: 10.21769/BioProtoc.73 Views: 19578
Ask a question
Favorite
Cited by
Abstract
This method uses a PEG-supplemented liquid solution to germinate separated Aradidopsis pollen. It thus eliminated the need for humidity control.
Keywords: Pollen tube Arabidopsis in vitro PEG3350 in vitro germination
Materials and Reagents
Plant growth
Stratify surface-sterilized seeds on 1x Johnson’s medium at 4 ˚C for at least 3 days to synchronize the flowering time. Transfer the plates to growth chamber with sufficient illumination (e.g. 12-16 h light/day, growth chamber on the 2nd or 3rd floor is OK).
1 week seedlings are transferred to soil pots. I usually grow up to 8 seedlings per standard pot. Mutant and wildtype should be put side by side to avoid position effect in the growth chamber.
Water the plants twice a week (Tuesday and Friday, for example), and apply 0.5x Johnson’s medium once every other week. The plants may begin to flower 3-4 weeks after transferring. The fresh flowers on the first inflorescence will be good for pollen germination experiments (note: The time to pick flowers is very critical).
Preparation of germination plates
Prepare germination medium plates as following (Fan et al., 2001)
Stock
Final Conc.
V stock/40 ml
MES-Tris (pH 5.8 adjusted with Tris base)
200 mM
5 mM
1 ml
KCl
1 M
1 mM
40 μl
MgSO4
0.5 M
0.8 mM
64 μl
Boric acid
100 mM
1.5 mM
600 μl
CaCl2
0.5 M
10 mM
800 μl
Sucrose
5% w/v
2 g
PEG4000
15% w/v
6 g
Notes:
Mix well when add MgSO4 and CaCl2 to avoid precipitation.
5 mM Ca might be better than 10 mM sometimes.
You can make pollen germination medium (PGM) without Ca, use it to prepare the pollen resuspension. The unwanted germination before time 0 can be avoided this way.
Equipment
Incubator with humidity control or saturated humidity
Nikon microscope
Scion Image (free download from NCBI website)
8-well chamber (Lab-Tek International, catalog number: 155411 or VWR International, catalog number: 43300-774)
Procedure
Collect 20-50 freshly opened flowers (stage 13-15, in which the long filaments are just level with stigma and petals) in 1.5 ml tube, let dry on RT for 0.5 h (tube cap opened).
Note: You can remove all open flowers from the plant 16-24 h before the pollen experiment. By this way just simply pick all flowers without spending time on identifying right stage (warning: wounding response may happen). Flowers picked in the morning are better than in afternoon.
Add 1 ml germination medium to submerge the flowers. Vortex at maximal speed for 1 min.
Concentrate the pollens by 500 x g for 5 min, at RT centrifuge (3,000 rpm on mini-centrifuge). Carefully remove the supernatant and floating flower residues, resuspend the pollen pellet in 1 ml germination medium (with Ca if you used –Ca PGM previously) by vortex.
Use 10 μl suspension for pollen amount estimation and purity check under light microscope (typical yield of 10 μl from 20 flowers is somewhere 2,000-5,000 grains).
Germinate the pollen grains at 25-28 °C for 6 h or over night in the chambers of a chambered coverlip (200 μl pollen suspension/ 8-well chamber); no agitation.
Take photos of the germinated tubes using 10x lens on Nikon microscope (inverted is better). Since the tube is transparent, phase contrast will give good pictures.
Analyze the tube germination (rate and length) using Scion Image. A normal distribution is expected for each population of pollen tube length, the P value should be less than 0.05 for student’s test.
References
Fan, L. M., Wang, Y. F., Wang, H. and Wu, W. H. (2001). In vitro Arabidopsis pollen germination and characterization of the inward potassium currents in Arabidopsis pollen grain protoplasts. J Exp Bot 52(361): 1603-1614.
Lalanne, E., Honys, D., Johnson, A., Borner, G. H., Lilley, K. S., Dupree, P., Grossniklaus, U. and Twell, D. (2004). SETH1 and SETH2, two components of the glycosylphosphatidylinositol anchor biosynthetic pathway, are required for pollen germination and tube growth in Arabidopsis. Plant Cell 16(1): 229-240.
Mouline, K., Very, A. A., Gaymard, F., Boucherez, J., Pilot, G., Devic, M., Bouchez, D., Thibaud, J. B. and Sentenac, H. (2002). Pollen tube development and competitive ability are impaired by disruption of a Shaker K(+) channel in Arabidopsis. Genes Dev 16(3): 339-350.
Thorsness, M. K., Kandasamy, M. K., Nasrallah, M. E. and Nasrallah, J. B. (1993). Genetic ablation of floral cells in Arabidopsis. Plant Cell 5(3): 253-261.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant physiology > Tissue analysis
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
74 | https://bio-protocol.org/en/bpdetail?id=74&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Arabidopsis Stomatal Opening and Closing Experiment
ZZ Zhixin Zhao
In Press
Published: May 20, 2011
DOI: 10.21769/BioProtoc.74 Views: 19048
Ask a question
Favorite
Cited by
Abstract
Stomata pores are mainly localized in the lower epidermis of plant leaves and transpirational water loss occurs through these pores. ABA inhibits light-promoted stomatal opening and promotes stomatal closure. This protocol describes how to measure stomatal apertures following ABA treatment.
Materials and Reagents
ABA
KCl
CaCl2
Iminodiacetic acid
Mes-KOH
Solution for stomatal opening (see Recipes)
Solution for stomatal closure (see Recipes)
Equipment
Light microscope
Aluminium foil
Culture dish
Procedure
Stomata opening
Sampling
Sample three leaves for each treatment before turning the light on in the morning and put them under a small container enveloped with aluminium foil.
Put them into a culture dish and place a cover glass on them to make them immersed in the opening medium, envelop with aluminium foil, and then put the culture plate under dark for at least 2.5 h to ensure that most of the stomata are fully closed.
ABA treatment
Transfer the culture plate to the light, in the mean time add 50 μM ABA (20 °C, 450 μmol/ m2/s), treat for at least 2 h to ensure that most of the stomata of the control are fully open.
Peel experiment:
Peel abaxial epidermis, make slides, and then observe and measure under microscope. (*40 objective, unit/4.5 in the field). One scale in the sight field corresponding to one circle of the screw attached to eyepiece.
Stomata closing
Sampling
Sample two leaves for each treatment, put them into culture dish and place a cover glass on them to immerse them in the opening medium, and then put the culture plate under the light for 2.5 h to ensure that most of the stomata are fully open.
ABA treatment
Add 50 μM ABA and treat under the light for at least 3 h.
Peel experiment
Peel abaxial epidermis, make slides, and then observe and measure under microscope.
Recipes
Solution for stomatal opening (200 ml)
Reagent
Stock or FW
Weight or volume
10 mM KCl
3 M
0.67 ml
7.5 mM Iminodiacetic acid
133.1
0.2 g
10 mM Mes-KOH (pH 6.15)
0.3904 g
Solution for stomatal closure (200 ml)
Reagent
Stock or FW
Weight or volume
20 mM KCl
75.5
0.2982 g
1 mM CaCl2
0.5 M
0.4 ml
5 mM Mes-KOH (pH 6.15)
0.1952 g
References
Allen, G. J., Kuchitsu, K., Chu, S. P., Murata, Y. and Schroeder, J. I. (1999). Arabidopsis abi1-1 and abi2-1 phosphatase mutations reduce abscisic acid-induced cytoplasmic calcium rises in guard cells. Plant Cell 11(9): 1785-1798.
Leymarie, J., Lasceve, G., Vavasseur, A. (1998). Interaction of stomatal responses to ABA and CO2 in Arabidopsis thaliana. Aust J Plant Physiol 25: 785-791.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant physiology > Tissue analysis
Plant Science > Plant developmental biology > General
Plant Science > Plant biochemistry > Plant hormone
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
75 | https://bio-protocol.org/en/bpdetail?id=75&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Pollen Fertility/viability Assay Using FDA Staining
Xiyan Li
In Press
Published: May 20, 2011
DOI: 10.21769/BioProtoc.75 Views: 30270
Ask a question
Favorite
Cited by
Abstract
Pollen grains can be fertile or sterile by nature. This method stains pollen grains for an enzyme as the vital indicator of membrane integrity. Only fertile grains fluoresce under microscopic examination.
Keywords: Pollen Fertility Vital staining Fluorescein diacetate Pollen grain
Materials and Reagents
Fluorescein diacetate (FDA)
Excision: At the time of anthesis
Stain: Stock solution of FDA 2 mg FDA/ml of acetone (stored at -20 °C in an Eppendorf tube)
BK buffer S15 MOPS (see Recipes)
BK buffer S15 (see Recipes)
Equipment
Fluorescence microscope
Eppendorf tube
Procedure
Take 1 μl of the stock solution of FDA and add to 1 ml of the BK buffer S15 MOPS (pH 7.5).
Note: The stock solution of FDA is very volatile-the FDA-buffer mixture will not keep for more than 2 h.
Mounting: Place a drop of the FDA-buffer mixture on a slide cleaned with alcohol and put a few pollen grains on the drop. Place a coverslip on top.
Observation: Observe under optical microscope in blue light (wavelength = 495 nm). The viable pollen grains show fluorescence (FCR+).
Remarks: The fluorescein diacetate, an apolar and non-fluorescent molecule, penetrates the pollen grain. Its hydrolysis by pollen esterases liberates fluorescein, a polar and fluorescent molecule. When the properties of membrane permeability are intact, the fluorescein accumulates inside the pollen grain, which appears fluorescent in blue light. The FCR test brings to light the esterase activity and the membrane integrity of the pollen grains.
Recipes
BK buffer S15 MOPS (pH 7.5)
Ca(NO3)2·4H2O (MW 236)
30 mg/L (0.127 mM)
MgSO4·7H2O (MW 246.5)
20 mg/L (0.081 mM)
KNO3 (MW 101)
10 mg/L (0.1 mM)
Sucrose
15%
MOPS (MW209)
10 mM (pH 7.5)
Stored at -20 °C in an Eppendorf tube.
BK buffer
100 mM MOPS (pH 7.5)
5 ml
Sucrose
7.5 g
Ca(NO3)2 (1 M)
6.35 μl
MgSO4 (1 M)
4.05 μl
KNO3 (1 M)
5 μl
References
Heslop-Harrison, J. and Heslop-Harrison, Y. (1970). Evaluation of pollen viability by enzymatically induced fluorescence; intracellular hydrolysis of fluorescein diacetate. Stain Technol 45(3): 115-120.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cell Biology > Tissue analysis > Tissue staining
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
752 | https://bio-protocol.org/en/bpdetail?id=752&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
GTP Binding Assays in Arabidopsis thaliana
AF Ana Romina Fox
Maria Agustina Mazzella
Published: Vol 3, Iss 9, May 5, 2013
DOI: 10.21769/BioProtoc.752 Views: 9562
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Molecular Biology Oct 2012
Abstract
Signaling through G proteins constitutes an ancient mechanism that functions in the transduction of extracellular signals into intracellular responses. Activation of a proper receptor by a stimuli leads to an exchange of GDP for GTP, the activation of G proteins and the dissociation of Gα-GTP from the Gβγ dimer for the heterotrimeric G proteins. The G protein subunits remain active until the intrinsic GTPase activity or/and a GTPase activating protein result in the hydrolysis of GTP to GDP and the inactivation of the protein. Here we describe a protocol for measuring GTP binding activity from Arabidopsis plant protein extracts using GTP γ35S. GTP γ35S assay measures the level of G protein activation following a stimuli, by determining the binding activity of the non-hydrolysable analog GTP γ35S. To determine specific G protein activities specific mutants and/or overexpressors extracts should be included and measured as controls.
Keywords: GTP binding Arabidopsis GPA1
Materials and Reagents
GTP γ35S 1,200 Ci/mmol (PerkinElmer, catalogue number: NEG030H250UC )
0.45 μm nitrocellulose filters (Bio-Rad, catalogue number: 162-0115 )
Scintillation solution (Optiphase Hisafe 3, Perkin Elmer Inc, catalogue number: 1200-437 )
Bradford reagent
Triton X-100
Tris HCl (pH 8)
NaCl
EDTA
DTT (USB Corporation, Cleaveland OH USA, cataslogue number: 15397 )
Roche complete protease inhibitor (Roche, Molecular Biochemicals)
Extraction buffer (see Recipes)
Reaction buffer (see Recipes)
Initiation buffer (see Recipes)
Stop buffer (see Recipes)
Equipment
Liquid Scintillation Counter Wallac 1214 RackBeta (Pharmacia, Turku, Finland)
Procedure
I. Protein extraction protocol (Keep all steps at 4 °C)
Harvest approximately 300 mg of Arabidopsis tissue in liquid nitrogen.
Homogenize with mortar and pestle to a fine powder.
Resuspend the powder in 500 μl of extraction buffer (you can use manual homogeneizer).
Centrifuge 15 min at 10,000 rpm at 4 °C and discard the pellet.
Measure protein concentration in the supernatant as described (Bradford, 1976).
II. GTP binding assay (reaction: final volume 200 μl)
Mix 100 μg of proteins in 100 μl extraction buffer with 80 μl of reaction buffer.
Add 20 μl of Initiation Buffer.
Expose to the corresponding stimuli (Light, agonist etc).
(You should adjust the specific stimuli, time of exposition, concentration, intensity etc where you can detect optimum binding).
Incubate the reaction 10 min at room temperature.
Add 2 ml of ice-cold stop buffer to finish the reaction.
Filter the reaction through 0.45 μm nitrocellulose filters using vacuum. We use 3 cm diameter disks.
Wash the disk filters 5 times with 2 ml of cold Stop Buffer using vacuum. This step is important to wash away unbound GTP γ35S.
Dry disk filters containing the membranes for 15 min at 75 °C.
Put the disks in plastic vials containing 2 ml of scintillation solution.
Record the cpm in the 35S energy range with a liquid scintillation counter.
Important: Unspecific binding must be estimated using blank reactions. We recommend three replicates of two possible blanks: reactions without proteins (reaction buffer plus initiation buffer) or 100 μg of protein samples preheated to 95 °C for 10 min. We did not find differences in GTP binding between both blanks.
Subtract the average cpm obtained with the blank samples from the cpm obtained for each measured sample to obtain the correct value.
Recipes
Extraction Buffer
50 mM Tris HCl pH 8
100 mM NaCl
1 mM EDTA
1 mM DTT
0.1% Triton X-100
1x Roche complete protease inhibitor
Reaction buffer (use 80 μl from the stock per reaction)
Stock
Final concentration in 200 μl reaction
50 mM Tris HCl (pH 8)
20 mM Tris HCl (pH 8)
250 mM NaCl
100 mM NaCl
2.5 mM EDTA
1 mM EDTA
2.5 mM DTT
1 mM DTT
0.25% Triton X-100
0.1% Triton X-100
Initiation buffer (use 20 μl from the Stock per reaction) (pH 8)
Stock
Final concentration in 200 μl reaction
100 mM MgCl2
10 mM MgCl2
1% Triton X-100
0.1% Triton X-100
Add GTP γ35S, 300,000 cpm/reaction.
Stop buffer (use 2 ml per reaction)
20 mM Tris-HCl (pH 8)
100 mM NaCl
25 mM MgCl2
1 mM phosphate buffer
Acknowledgments
This protocol was adapted from Fox et al. (2012). This work was financially supported by FonCyT PICT 2010 num 1821 to A.M.
References
Fox, A. R., Soto, G. C., Jones, A. M., Casal, J. J., Muschietti, J. P. and Mazzella, M. A. (2012). cry1 and GPA1 signaling genetically interact in hook opening and anthocyanin synthesis in Arabidopsis. Plant Mol Biol 80(3): 315-324.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
In vitro Auto- and Substrate-Ubiquitination Assays
Hye Lin Park [...] Gyeong Mee Yoon
Apr 5, 2022 2122 Views
Measuring in vitro ATPase Activity with High Sensitivity Using Radiolabeled ATP
Sarina Veit and Thomas Günther Pomorski
May 20, 2023 877 Views
A Semi-throughput Procedure for Assaying Plant NADP-malate Dehydrogenase Activity Using a Plate Reader
Kevin Baudry and Emmanuelle Issakidis-Bourguet
Aug 20, 2023 320 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
753 | https://bio-protocol.org/en/bpdetail?id=753&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Stomatal Density in Rice
Kensuke Kusumi
Published: Vol 3, Iss 9, May 5, 2013
DOI: 10.21769/BioProtoc.753 Views: 19476
Reviewed by: Ru Zhang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Experimental Botany Sep 2012
Abstract
The number of stomata on leaves is known to be affected by various environmental factors and intrinsic developmental program. Stomatal density and stomatal index are generally used as indicators of the leaf development and the plant growth. This protocol describes an easy, non-destructive method for preparing imprints of the rice leaf surface that is suitable for observation and counting of stomata. Researchers can process many leaf samples at once in the field or in the green house distance from the laboratory.
Keywords: Rice Stomatal density CO2 Stomata Respiration
Materials and Reagents
Microscope cover glasses (Matsunami Glass, 24 x 40 mm No.1)
Note: Though tougher glass slides (1-1.2 mm thickness) are safer, you should use cover glasses if the objective lens of the microscope is designed for standard 0.17 mm glass thickness. Only special objective lenses that have long working distances (ELWD, LWD) will allow observation through a thick glass slide. Alternatively objectives designed for use without a cover glass (NCG, NC) will enable direct observation of imprints placed on the slide glasses. I use large (24 x 40 mm) glasses for making imprints covering large leaf area. Larger glass is also useful when you set it on the microscope stage.
Instant glue (Aron Alpha Super Set) (Toagosei Co., catalog number: EA936A-5 )
Note: Aron Alpha Super Set includes liquid glue and accelerator. Aron Alpha is sold as Krazy Glue in North America and Cyanolit in Europe.
Accelerator for instant glue
Note: While I use the genuine accelerator made by Toagosei, third-party accelerators developed for Aron Alpha (Krazy Glue) will work fine. You can observe stomata without the accelerator, but the imprints may be less clear.
Equipment
Light microscope with equipment for photomicrography
Eyepiece micrometer and stage micrometer
Note: These are indispensable for measurement of field of view unless your microscope can automatically calculate scale bars.
Procedure
Select the leaves for observation. Make sure that they are not wet with rain or dew (Figure 1). Imprints can be taken from both upper (adaxial) and lower (abaxial) surfaces. Unless there are particular reasons, widest (middle) region of mature leaf blade should be selected as a target area. Avoid thick major vain for making smooth imprints.
Figure 1. Typical healthy leaf of rice.
Apply several drops of the accelerator to the cover glass (Figure 2) and wait until they are thoroughly dry (2-3 min, at room temperature) (Figure 3).
Figure 2. Place a drop of accelerator on a cover glass.
Figure 3. Dried accelerator on the cover glass.
Immediately after applying a drop of instant glue to the surface of the leaf, press the accelerator side of the cover glass on the leaf for about 30 seconds (Figures 4 and 5).
Figure4. Instant glue dropping on the leaf surface.
Figure 5. Drying glue mixture.
Remove the cover glass from the leaf gently. Make sure that the imprint is on the cover glass (Figure 6). If glue mixture is completely dried, obtained imprint will be sturdy and durable. When a healthy leaf is used, only a remnant will be left on the leaf surface.
Figure 6. Removed imprints on the cover glasses (left).
Figure 7. A cover glass placed on the microscope stage. In this case, imprint is placed on the upper surface of the cover glass for imaging on inverted microscope.
Observe imprints under the light microscope (Figure 7). Stomata in rice are formed in rows or files that are parallel to the sides of the leaf (Figure 8) (Hoshikawa, 1989). Therefore, finding stomata is relatively easy. Take photographs of the magnified image, calculate captured leaf area by using the micrometer or by the build-in imaging software, and then count all stomata within the printed image. I routinely counted stomata within a 0.42 mm2 of leaf area.
Figure 8. Typical imprint image of medial leaf reagion. Red circles indicate positions of stomata.
Note: Since imaging through a microscope gives a very shallow depth of field, only a very narrow region of the picture may be in focus at a time. To solve the focus problem, you can use autofocusing microscope or photo-processing software. I routinely use Keyence BZ-9000 microscope with optical software (Keyence, Osaka, Japan). ImageJ software (http://rsb.info.nih.gov/ij/) with appropriate plug-ins (e.g. Stack Focuser, Extended Depth of Field) also generates reasonable in-focus composite images Figure 9).
Figure 9. Focus stacking. Left are the three source images at different focal depths. Right is a composite image generated by ImageJ and the Stack Focuser plug-in (http://rsb.info.nih.gov/ij/plugins/stack-focuser.html).
Imprints can be stored without any sealing treatment for long time at room temperature. I could get clear images even after 2 years.
Acknowledgments
I am grateful to Ryoko Kaji for her technical assistance. This work was supported by the Kyushu University Interdisciplinary Programs in Education and Projects in Research Development (P&P), a Grant-in-Aid for Scientific Research on Innovative Areas (No. 21114002) and the Ministry of Education, Science and Culture of Japan (No. 22570045).
References
Hoshikawa, K. (1989). The growing rice plant: an anatomical monograph. Tokyo: Nobunkyo xvi, 310p.-illus.. ISBN 245913836.
Kusumi, K., Hirotsuka, S., Kumamaru, T. and Iba, K. (2012). Increased leaf photosynthesis caused by elevated stomatal conductance in a rice mutant deficient in SLAC1, a guard cell anion channel protein. J Exp Bot 63(15): 5635-5644.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Kusumi, K. (2013). Measuring Stomatal Density in Rice. Bio-protocol 3(9): e753. DOI: 10.21769/BioProtoc.753.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Tissue analysis
Plant Science > Plant cell biology > Cell structure
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Analysis of Monosaccharides from Arabidopsis Seed Mucilage and Whole Seeds Using HPAEC-PAD
Gillian H. Dean [...] George W. Haughn
Dec 20, 2019 4485 Views
Visualization of Actin Organization and Quantification in Fixed Arabidopsis Pollen Grains and Tubes
Xiaolu Qu [...] Shanjin Huang
Jan 5, 2020 4114 Views
Targeting Ultrastructural Events at the Graft Interface of Arabidopsis thaliana by A Correlative Light Electron Microscopy Approach
Clément Chambaud [...] Lysiane Brocard
Jan 20, 2023 1114 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
754 | https://bio-protocol.org/en/bpdetail?id=754&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Subcellular Fractionation of Cultured Human Cell Lines
ZY Zhuoyou Yu
ZH Zhiguang Huang
Maria Li Lung
Published: Vol 3, Iss 9, May 5, 2013
DOI: 10.21769/BioProtoc.754 Views: 48747
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Oncogene Aug 2012
Abstract
Subcellular localization is crucial for the proper functioning of a protein. Deregulation of subcellular localization may lead to pathological consequences and result in diseases like cancer. Immuno-fluorescent staining and subcellular fractionation can be used to determine localization of a protein. Here we discuss a protocol to separate the nuclear, cytosolic, and membrane fractions of cultured human cell lines using a centrifuge and ultracentrifuge. The membrane fraction contains plasma membranes and ER-golgi membranes, but no mitochondria or nuclear structures. The fractions can be further analyzed using Western blotting. This protocol is based on that from Dr. Richard Patten at Abcam, and was modified and utilized in a publication by Huang et al. (2012).
Keywords: Nuclear Cytosolic Membrane Centrifugation Fractionation
Materials and Reagents
Sucrose
HEPES
Potassium chloride (KCl)
Magnesium chloride (MgCl2)
Ethylene diamine tetraacetic acid (EDTA)
Ethylene glycol tetraacetic acid (EGTA)
Dithiothreitol (DTT)
Tris (Affymetrix-USB, catalog number: 75825 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 13565 )
Nonidet P40 substitute (NP40)
Sodium deoxycholate
Glycerol
Sodium dodecyl sulfate (SDS)
Protease inhibitor (PI) cocktails (F. Hoffmann-La Roche, catalog number: 11836145001 )
Methanol
Acetic acid
Brilliant Blue R (Affymetrix, catalog number: 32826 )
Phosphate buffered saline (PBS)
Histone H3 antibody (Cell Signaling Technology, catalog number: 9715 )
Alpha-tubulin antibody (GeneTex, catalog number: GTX108784 )
Cell scraper (BD Biosciences, Falcon®, catalog number: 353086 )
Subcellular fractionation buffer (SF buffer) (see Recipes)
Nuclear Lysis buffer (NL buffer) (see Recipes)
Brilliant Blue R staining solution and destaining solution (see Recipes)
Equipment
4 °C Microcentrifuge (Eppendorf, catalog number: 5415R );
Ultracentrifuge (Beckman Coulter, model number: Optima TLX )
Optional: Sonicator (Sonics, model number: VC505 )
Whatman filter paper
37 °C incubator
1.5 ml Eppendorf microtubes
Tube roller (Maplelab-scientific, model number: MTR-1D )
Procedure
Note: Keep the sample at 4°C on ice at ALL times! All buffers must be ice-cold when used. All centrifugations are done in the Eppendorf Microcentrifuge unless stated otherwise.
Culture cells on 100 mm culture plate until 75% confluent in a 37 °C incubator supplied with 5% CO2. For beginners, the well-studied HEK293 and its derivatives are recommended for easy maintenance and ectopic protein expression.
Note: This is for adherent cell. Suspension cells may need centrifugation before lysis.
Wash twice with ice-cold PBS and immediately add 500 μl per 100 mm plate of SF buffer and put on ice, use cell scraper to collect lysate and transfer to a 1.5 ml Eppendorf tube. If multiple samples are collected, process one specimen at a time.
Agitate the lysates at 4 °C for 30 min at around 30-50 rpm on the tube roller.
Centrifuge at 720 x g at 4 °C for 5 min. Carefully transfer the supernatant to a new 1.5 ml tube for future use. Keep the pellet for next step.
Wash the pellet with 500 μl of SF buffer and disperse the pellet with a pipette.
Centrifuge the pellet at 720 x g at 4 °C for 10 min.
Remove the supernatant and resuspend the pellet in NL buffer. Agitate and incubate at 4 °C for 15 min.
Optional: Sonicate the pellet on ice (2 x 3 sec sonication, separated by 3 sec resting, under 30% full amplitude power. On ice!). This is the nuclear fraction including nuclear membranes.
Centrifuge the supernatant from step 4 at 10,000 x g at 4 °C for 10 min.
Carefully transfer the supernatant to a new 1.5 ml tube. This is the cytosolic and membrane fraction.
Centrifuge the cytosolic and membrane fraction from step 9 in an ultracentrifuge. Ultracentrifuge at 100,000 x g at 4 °C for 1 h. Carefully transfer the supernatant to a new 1.5 ml tube. This is the cytosolic fraction.
Wash the pellet with 500 μl of SF buffer and re-suspend by pipetting.
Ultracentrifuge the pellet at 100,000 x g at 4 °C for 1 h.
Remove the supernatant and re-suspend the pellet in NL buffer.
Optional: Sonicate the pellet on ice (same setting as for nuclear fraction in step 7). This is the membrane fraction.
Internal loading control for Western blotting could be used to make sure each fraction does not cross-contaminate others; but relative amount can also be determined between samples to ensure equal loading. For example, alpha-tubulin is used for the cytosolic fraction; histone H3 is used for the nuclear fraction; Brilliant Blue R is used for staining for the membrane fraction. Use an extra gel for the loading controls. Alpha-tubulin and histone H3 are probed after protein is transferred onto a PVDF membrane. Brilliant Blue R staining can be applied directly to the SDS-PAGE gel (Figure 1).
Note: Brilliant Blue R is used here for monitoring relative amount of protein loading across different samples, but is unable to show cross contamination. Membrane proteins such as EGF receptor and integrins may be used to confirm cross-contamination between the membrane and other fractions. However the recycling of these membrane proteins can be an issue, which may appear to be false-positive cross-contamination.
Figure 1. Western blotting of nuclear, cytoplasmic, and membrane fractions with internal controls. Alpha-tubulin and histone H3 are used for the cytoplasmic and nuclear fractions, respectively; Brilliant Blue R staining is applied for the membrane fraction.
Recipes
Subcellular fractionation buffer (SF buffer)
Stocks
50 ml 1x solution
250 mM Sucrose
-
4.28 g
20 mM HEPES (pH 7.4)
1 M
1 ml
10 mM KCl
-
0.0373 g
1.5 mM MgCl2
1 M
75 μl
1 mM EDTA
0.5 M
100 μl
1 mM EGTA
0.5 M
100 μl
At time of use, add the following into 10 ml of SF buffer
Stocks
10 ml 1x solution
1 mM DTT
1 M
10 μl
PI cocktail
40x (dissolve 1 tablet in 2 ml dd H2O)
250 μl
Nuclear Lysis buffer (NL buffer)
Stocks
50 ml 1x solution
50 mM Tris HCl (pH 8)
1 M
2.5 ml
150 mM NaCl
1 M
7.5 ml
1% NP-40
20%
2.5 ml
0.5% sodium deoxycholate
10%
2.5 ml
0.1% SDS
10%
0.5 ml
At time of use, add the following into 10 ml of NL buffer
Stocks
10 ml 1x solution
PI cocktail
40x
250 μl
10% glycerol
-
1 ml
Note: DTT can be added if further delicate experiments such as IP and ChIP are needed; current recipe without DTT is fine for Western blotting.
Brilliant Blue R staining solution and destaining solution
For staining solution, dissolve 1 g of Brilliant Blue powder in 1 L of 50% Methanol/10% AceticAcid/40% H2O (all [v/v]) solution. Stir until dissolved and (optional) filter through Whatman filter paper.
For destaining, make a 10% AceticAcid/15% Methanol/75% H2O solution.
Procedures: Place the gel containing the proteins of interest in a plastic container and cover with fresh staining solution. Shake it for 1 h at room temperature (or overnight). Remove the staining solution and add destaining solution. Put three sheets of fine-grade tissue paper in the container. Shake it until gel is fully destained. Constantly replace the solution and tissue paper.
Acknowledgments
This protocol is based on that from Dr. Richard Patten at Abcam (see Reference 1), and was modified and utilized in a publication by Huang et al. (2012).
References
Patten R. Procedure for separating nuclear, membrane, and cytoplasmic cell fractions using centrifugation methods.
Huang, Z., Cheng, Y., Chiu, P. M., Cheung, F. M., Nicholls, J. M., Kwong, D. L., Lee, A. W., Zabarovsky, E. R., Stanbridge, E. J., Lung, H. L. and Lung, M. L. (2012). Tumor suppressor Alpha B-crystallin (CRYAB) associates with the cadherin/catenin adherens junction and impairs NPC progression-associated properties. Oncogene 31(32): 3709-3720.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Yu, Z., Huang, Z. and Lung, M. L. (2013). Subcellular Fractionation of Cultured Human Cell Lines. Bio-protocol 3(9): e754. DOI: 10.21769/BioProtoc.754.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays > Protein analysis
Biochemistry > Protein > Isolation and purification
Cell Biology > Organelle isolation > Fractionation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
In which fraction do I find the mitochondrial proteins and mitochondrial membrane proteins?
0 Answer
9 Views
Jan 3, 2024
Related protocols
Measuring Protein Synthesis during Cell Cycle by Azidohomoalanine (AHA) Labeling and Flow Cytometric Analysis
Koshi Imami and Tomoharu Yasuda
Apr 20, 2019 8233 Views
Analysis of the Ubiquitination and Phosphorylation of Vangl Proteins
Di Feng [...] Bo Gao
Oct 20, 2022 1976 Views
Isoform-specific, Semi-quantitative Determination of Highly Homologous Protein Levels via CRISPR-Cas9-mediated HiBiT Tagging
Kristina Seiler [...] Mario P. Tschan
Jul 20, 2023 894 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
76 | https://bio-protocol.org/en/bpdetail?id=76&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
RbCl Super Competent Cells
Xiyan Li
In Press
Published: Jun 5, 2011
DOI: 10.21769/BioProtoc.76 Views: 23997
Ask a question
Favorite
Cited by
Abstract
This method is used to inexpensively prepare home-made competent cells of E. coli. The transformation efficiency is at the high end of chemical-efficient competent cells, and close to library-efficient competent cells.
Keywords: Competent cells E. coli Chemical competent cells Rubidium chloride
Materials and Reagents
3 mM hexamine cobalt chloride
Tryptone
Yeast extract
NaCl
DMSO
KCl
MgCl2
MgSO4
KOH
CaCl2·2H2O
RbCl
SOB or 2x YT (see Recipes)
MES (see Recipes)
TFB (50 ml) enough for 80 tubes/400 transformations. DMSO (see Recipes)
Equipment
Microcentrifuge
Procedure
Inoculate overnight culture at room temperature (RT) in 5 ml SOB or 2x YT.
Add overnight to 500 ml of SOB or 2x YT in 4 L flask to maximize aeration.
Add 36 ml of 5 M NaCl. Shake well at 30 °C.
Grow to OD600 of 0.5. About 3 h.
Spin cells. Drain pellet very well. Suck out extra liquid.
Gently resuspend in 50 ml of cold TFB. Incubate for 15 min on ice.
Prepare a dry ice/ethanol bath (should be thick in consistency) or liquid nitrogen.
While swirling cells add 1.75 ml DMSO (no need to sterilize DMSO).
Incubate cells for 10 min on ice and chill eppendorfs on ice.
Add 0.5 ml cells to each Eppendorf and quickly drop tubes into dry ice bath. Store cells at -70 °C for up to 12 months.
Use 100 μl for transformation. Heat shock at 42 °C for 1.5 to 2 min.
Recipes
SOB or 2x YT (1 L)
Tryptone 20 g
Yeast extract 5 g
5 M NaCl 2 ml
pH to 7.0 and bring up to 1 L
Autoclave and add 2.5 ml 1 M KCl, 10 ml of 1 M MgCl2, 10 ml 1 M MgSO4
MES
1 M MES solution made to pH 6.2 with KOH
Filter sterilized and stored frozen
TFB (50 ml) enough for 80 tubes/400 transformations
0.5 ml of 1 M MES
0.6 g of RbCl (makes 100 mM final conc.)
0.45 g MnCl2 (45 mM)
0.077 g CaCl2.2H2O (10 mM)
0.04 g hexamine cobalt chloride (3 mM)
Store at 4 °C
Keeps for several months
Use it cold
References
http://sinclairfs.med.harvard.edu/methods/supercompetentecoli.php
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
77 | https://bio-protocol.org/en/bpdetail?id=77&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
DAPI Nuclear Staining of Live Worm
Fanglian He
In Press
Published: Jun 5, 2011
DOI: 10.21769/BioProtoc.77 Views: 19041
Ask a question
Favorite
Cited by
Abstract
Adapted from the Villenueve Lab at Stanford University. This is a very simple method using ethanol fixation, but works very well.
Materials and Reagents
Vectashield Mounting Media (Vector Labs)
M9 solution
95% ethanol
DAPI solution
Equipment
Fluorescence microscope (Leica)
Whatman paper
Coverslip
Nail polish
Procedure
Pick worms in M9 solution (see common worm media and buffers) onto your slide.
Wick away extra liquid by Whatman paper.
Add 95% ethanol and let dry (usually 10~20 μl); repeat 3x.
Add DAPI solution with vectashield (or other mounting media).
Cover with coverslip and seal with nail polish; let sit in the dark ~10 min.
The slides can then be visualized.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cell Biology > Cell staining > Nucleic acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
775 | https://bio-protocol.org/en/bpdetail?id=775&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Infiltrating Leukocytes from the Spinal Cord of Mice
Julia M. Martinez Gomez
Stephan Gasser
Herbert Schwarz
Published: Vol 3, Iss 10, May 20, 2013
DOI: 10.21769/BioProtoc.775 Views: 12172
Reviewed by: Xuecai Ge Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Neuroscience Dec 2012
Abstract
The infiltration of leukocytes into the central nervous system (CNS) is a common feature of many neuroinflammatory diseases such as multiple sclerosis, and also occurs during certain microbial infections such as by West Nile Virus. Here, we describe a method to isolate leukocytes from the spinal cords of mice. This method can be used for the characterization of leukocyte populations that infiltrate the spinal cord, and to perform functional studies with the isolated cells. The CNS of naive mice is infiltrated by very low numbers of leukocytes, however, upon inflammation increased numbers of mononuclear cells traffic to the CNS. The number of leukocytes that can be isolated roughly correlates with the degree of inflammation.
Keywords: Experimental Autoimmune Encepahlomyelitis CD137 4-1BB Infiltration Spinal cord
Materials and Reagents
1x PBS and 10x PBS
Surgical instruments: scissors, forceps, scalpel
Percoll (Sigma-Aldrich, catalog number: P4937 )
Note: prepare isotonic Percoll solution stock (one part 10x PBS and 9 parts Percoll).
Equipment
Centrifuge with swing-out bucket rotor (e.g. Eppendorf, model: 5810 R )
75 mm petri dish
18 G and 27 G needle (BD Biosciences)
10 ml syringe (BD Biosciences)
15 and 50 ml conical centrifuge tubes
Plastic Pasteur pipette
70 μm cell strainer (BD Biosciences, catalog number: 352350 )
Procedure
Preparation of the animal
Euthanize the mouse using CO2 gas (cervical dislocation might damage the spinal cord therefore it should be avoided).
Spray the mouse with 70% ethanol to maintain aseptic conditions and cut open the chest wall to expose the heart.
Perfusion of the animal
Attach a 27G needle to a 10 ml syringe pre-filled with ice-cold PBS.
Cut the right atrium of the heart with scissors (Figure 1).
Perfuse the animal with the entire 10 ml of PBS through the left ventricle (Figure 1), repeat this procedure for 3-5 times (final volume of ~50 ml). Alternatively, a perfusion pump can be used in this step. By the end of the perfusion, the effluent from the atrium should be clear and the liver should have lost its red color. If this does not occur, continue to perfuse.
Figure 1. Photograph of the heart with the incision site (right atrium) and injection site (left ventricle) indicted.
Isolation of the spinal cord
Spray the back of the mouse with ethanol. Remove the head using scissors by doing a clean cut at the base of the head (start of the spinal column). Then expose the spinal column by cutting open the skin on the back from the base of the head to the tail of the animal. Identify where the base of the spinal column attaches to the pelvis.
Using a pair of scissors, make a perpendicular cut through the spinal column at this location.
Attach an 18G needle to a 10 ml syringe pre-filled with PBS. Hold the spinal column with forceps and identify the spinal canal at the caudal end of the spinal column. Carefully insert the 18G needle up to 10 mm at this point. Resistance will be encountered as the needle enters the spinal canal.
Slowly push past the resistance in the canal until the point where the resistance is suddenly lost. Hold the spinal column over the 75 mm petri dish and flush the spinal cord out of the column.
Dissociation of the spinal cord tissue
Transfer the spinal cords to a 50 ml conical centrifuge tube containing 1x PBS and keep on ice (pool a maximum of 5 spinal cords per tube). In a petri dish and using scalpel or scissors and a pair of forceps, cut the spinal cords into very small pieces of about 10 mm.
Transfer the spinal cord pieces into a 70 µm cell strainer placed on top of a 50 ml conical centrifuge tube and homogenize the tissue using the plunger of a 5 ml syringe. Add cold PBS to wash the cell strainer and top up to 50 ml.
Centrifuge at 400 x g for 10 min, discard the supernatant and resuspend the cells in 5 ml of 30% isotonic Percoll (prepared using Percoll stock solution and 1x PBS). Add the 30% isotonic Percoll gently on top of 4 ml 70% isotonic Percoll (prepared using Percoll stock solution and 1x PBS) contained in a 15 ml conical centrifuge tube. Avoid mixing of the interface between the 70% and 30% solutions. Percoll should be used at room temperature, since cold cells tend to clump.
Centrifuge for 20 min at 500 x g, at room temperature, without break or accelerator. The myelin will form a compact layer at the top, while the leukocytes will form an opaque ring between the two layers of Percoll, the so called interface.
Remove the myelin and part of the supernatant above the interface by aspiration.
Collect the cells in the interface into a clean 15 ml conical tube. Wash the cells 1-2x with 1x PBS by centrifuging at 400 x g for 5 min. Proceed with any further analysis of experimentation. If culturing of the cells is required, processing of the spinal cords (step IV) should be performed under sterile conditions, e.g. in a biological biosafety cabinet.
Acknowledgments
This protocol is was adapted from and utilized in a publication by Martinez Gomez et al. (2012).
References
Martinez Gomez, J. M., Croxford, J. L., Yeo, K. P., Angeli, V., Schwarz, H. and Gasser, S. (2012). Development of experimental autoimmune encephalomyelitis critically depends on CD137 ligand signaling. J Neurosci 32(50): 18246-18252.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Martinez Gomez, J. M., Gasser, S. and Schwarz, H. (2013). Isolation of Infiltrating Leukocytes from the Spinal Cord of Mice. Bio-protocol 3(10): e775. DOI: 10.21769/BioProtoc.775.
Martinez Gomez, J. M., Croxford, J. L., Yeo, K. P., Angeli, V., Schwarz, H. and Gasser, S. (2012). Development of experimental autoimmune encephalomyelitis critically depends on CD137 ligand signaling. J Neurosci 32(50): 18246-18252.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation
Neuroscience > Nervous system disorders
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
776 | https://bio-protocol.org/en/bpdetail?id=776&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Insulin Tolerance Test and Hyperinsulinemic-euglycemic Clamp
GP Georgios K. Paschos
GF Garret A. FitzGerald
Published: Vol 3, Iss 10, May 20, 2013
DOI: 10.21769/BioProtoc.776 Views: 10646
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Nature Medicine Dec 2012
Abstract
The two tests are used to evaluate in vivo sensitivity to insulin in mouse. The hypoerinsulinemic-euglycemic clamp provides information about the sensitivity to insulin in liver and other metabolically relevant tissues.
Keywords: Insulin Diabetes Mouse Glucose
Materials and Reagents
Human insulin (Eli Lilly, Indianapolis, IN)
[3-3H] glucose (Perkin Elmer, catalog number: NET331A250UC )
2-deoxy-D-[1-14C] glucose (2-[14C]DG) (PerkinElmer, catalog number: NET328250UC )
Equipment
Contour blood glucometer (Bayer)
Procedure
C57BL/6J mice were fasted for 6 h and then injected intraperitoneally with insulin (1 U per kg of body weight), and blood glucose concentrations were monitored over time using a Contour blood glucometer on a drop of blood from the tip of the tail.
Mice were cannulated in the lateral cerebral ventricle and catheterized in the right internal jugular vein for the hyperinsulinemic-euglycemic clamp (Figure 1) (Thrivikraman et al., 2002). Intravenous infusion of [3-3H] glucose (5 μCi bolus, 0.05 μCi/min) was used.
Human insulin (16 mU/kg) was injected intravenously as a bolus, followed by continuous infusion at 2.5 mU/kg/min.
Tail blood glucose was measured by glucometer at 10 min intervals, and 20% glucose was infused to maintain blood glucose at euglycemic levels (120 to 140 mg/dl of plasma glucose levels).
After steady state had been maintained for 1 h, the glucose uptake in various tissues was determined by injecting 2-deoxy-D-[1-14C] glucose (2-[14C]DG) (10 mCi) 45 min before the end of clamps (the catheter was used for the injection). During the final 50 min of basal and clamp infusions, 20 μl blood samples were collected at 10 min intervals for measurement of [3H] glucose, [3H] H2O and 2-[14C]DG from the tail vein. Samples were stored in -20 °C.
Figure 1. Right internal jugular vein catheterization. A catheter is placed in the right jugular vein for the infusion of glucose and insulin.
Acknowledgments
This protocol has been adapted from our previously published paper: Paschos et al. (2012). The work during the development of the protocol was supported by the US National Institutes of Health (NIH) grant RO1 HL097800.
References
Paschos, G. K., Ibrahim, S., Song, W. L., Kunieda, T., Grant, G., Reyes, T. M., Bradfield, C. A., Vaughan, C. H., Eiden, M., Masoodi, M., Griffin, J. L., Wang, F., Lawson, J. A. and Fitzgerald, G. A. (2012). Obesity in mice with adipocyte-specific deletion of clock component Arntl. Nat Med 18(12): 1768-1777.
Thrivikraman, K. V., Huot, R. L. and Plotsky, P. M. (2002). Jugular vein catheterization for repeated blood sampling in the unrestrained conscious rat. Brain Res Brain Res Protoc 10(2): 84-94.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
An Automated pre-Dilution Setup for Von Willebrand Factor Activity Assays
Tobias Schachinger [...] Peter L. Turecek
Sep 5, 2024 338 Views
Measurement of the Activity of Wildtype and Disease-Causing ALPK1 Mutants in Transfected Cells With a 96-Well Format NF-κB/AP-1 Reporter Assay
Tom Snelling
Nov 20, 2024 270 Views
Quantitative Measurement of the Kinase Activity of Wildtype ALPK1 and Disease-Causing ALPK1 Mutants Using Cell-Free Radiometric Phosphorylation Assays
Tom Snelling
Nov 20, 2024 254 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
777 | https://bio-protocol.org/en/bpdetail?id=777&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
DNA Methylation Profiling Using Infinium Methylation Assay
CZ Constanze Zeller
NM Nahal Masrour
NP Naina Patel
WD Wei Dai
CW Charlotte Wilhelm-Benartzi
RB Robert Brown
Published: Vol 3, Iss 10, May 20, 2013
DOI: 10.21769/BioProtoc.777 Views: 14694
Reviewed by: Lin Fang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Oncogene Oct 2012
Abstract
The Infinium Human Methylation 450 BeadChip technology allows the rapid quantitative DNA methylation analysis of more than 485,000 CpG dinucleotides located across the genome. The method utilizes sodium bisulfite treatment of genomic DNA to convert unmethylated cytosine residues into uracils whereas methylated cytosines remain unchanged. Modified DNA is then whole genome amplified, fragmented and hybridized to locus-specific oligomer probes linked to individual beads on a BeadChip. Hybridization is followed by single-base extension of the oligomer with a labeled nucleotide. The BeadChip is subsequently fluorescently stained and scanned to measure the intensities of the beads corresponding to the unmethylated and methylated CpG sites.
Keywords: Epigenetics DNA methylation Infinium Methylation Assay Bisulfite conversion Cancer Biology
Materials and Reagents
EZ-96 DNA Methylation Kit (Zymo Research, catalog number: D5003 )
Ethanol (VWR International, catalog number: 20821.330 )
Genomic DNA
PCR Grade water (Life Technologies, InvitrogenTM, catalog number: AM9937 )
PCR reagents: PCR buffer, dNTPs, Taq (Roche Applied Science, catalog number: 04738420001 )
Primers for methylation specific PCR [see Step 20-(1)]
96-well 0.2 ml microplates (Starlab, catalog number: I1402-9800-C )
96-well 0.8 ml microplates (Thermo Fisher Scientific, catalog number: AB-0765 )
Seal sheets (Thermo Fisher Scientific, catalog number: AB-0558 )
Infinium Human Methylation450 BeadChip Kit (Illumina, catalog number: WG-314-1003 )
PyroMark Q96 CpG LINE-1 Kit (QIAGEN, catalog number: 973043 ) and associated reagents (Optional)
Equipment
96-well Thermal Cycler
Centrifuge with microplate adapters
Vortex mixer
HiScan SQ or iScan systems (Illumina, catalog number: SY-103-2001 or SY-101-1001 respectively)
GenomeStudio Methylation Module software (Illumina, catalog number: SW-300-1001 )
NanoDrop ND-1000 UV-Vis spectrophotometer (Thermo Fisher Scientific) or equivalent
Speed Vacuum (Optional)
PyroMark Q96 MD (QIAGEN, catalog number: 9001526 ) or equivalent (Optional)
Procedure
Quantitate genomic DNA concentration using NanoDrop and determine A260/280 ratio which should be > 1.80 for samples to be analyzed.
Dilute each DNA sample in water to 100 ng μl-1 concentration.
Note: It is also possible to use samples at lower concentrations and adjust the volumes in step 6 accordingly to meet the minimum quantity of DNA required. However, volumes of DNA samples with lower concentrations used in step 6 should not exceed a maximum volume of 45 μl.
Note: Once DNA is bisulfite treated it should be used for Infinium Methylation analyses as soon as possible, preferably within one month.
Prepare Conversion Reagent from EZ96 DNA Methylation Kit by adding 7.5 ml water and 2.1 ml of M-Dilution buffer to a bottle of CT Conversion Reagent. Mix at room temperature with frequent vortexing for 10 min and keep reagent in dark.
Note: It is normal to see trace amounts of undissolved CT Conversion Reagent. Also, for best results the reagent should be immediately used after preparation.
Prepare M-Wash Buffer from EZ96 DNA Methylation Kit by adding 144 ml 100% ethanol to the 36 ml M-Wash Buffer concentrate.
Pipet 10 μl of each DNA sample (100 ng μl-1) into a 96-well 0.2 ml microplate for bisulfite treatment (500 ng is the minimum quantity of DNA used).
Add 5 μl of M-Dilution buffer to each sample and adjust the total volume to 50 μl with water and mix by pipetting up and down. Seal with seal sheet.
Incubate samples at 37 °C for 15 min using thermal cycler.
Add 100 μl of the prepared CT Conversion Reagent to each sample and mix by pipetting up and down several times. Seal plate with a seal sheet.
Note: CT-Conversion Reagent contains 97% Sodium Metabisulfite (bisulfite ions) which mediates bisulfite-mediated deamination of unmethylated Cytosine.
Incubate samples on thermal cycler using the following program
95 °C for 30 sec.
50 °C for 1 h and repeat steps a and b for 15 more cycles.
4 °C for 10 min.
From EZ96 DNA Methylation Kit, place Silicon-A Binding Plate on top of Collection Plate and pipette 400 μl of M-Binding Buffer to each well. This buffer contains guanidine hydrochloride salt which provides pH that enables DNA to bind to the silica particles and allows washing and bisulfite treatment of the DNA.
Load the DNA samples from step 10 into the wells of the Silicon-A Binding Plate and mix by pipetting up and down.
Centrifuge at room temperature at ≥ 3,000 x g for 5 min and discard the flow-through. Use this condition for all centrifugation steps in this protocol.
Add 500 μl of M-Wash buffer to each well and centrifuge at ≥ 3,000 x g for 5 min. Discard the flow-through. M-Wash buffer is to wash and clean any reagent from silica-bound DNA from previous step.
Add 200 μl of M-Desulphonation buffer to each well and let it stand at room temperature for 15-20 min. After incubation centrifuge at ≥ 3,000 x g for 5 min. Discard the flow-through. M-Desulphonation buffer contains sodium hydroxide which converts deaminated cytosines to Uracil.
Add 500 μl of M-Wash buffer to each well and centrifuge at ≥ 3,000 x g for 5 min. Discard the flow-through.
Add another 500 μl of M-Wash buffer to each well and centrifuge at ≥ 3,000 x g for 10 min. Ensure there is no liquid left in the wells of Silicon-A binding Plate, otherwise centrifuge for further 2 min.
Place Silicon A Binding Plate onto an elution plate.
Add 30 μl of M-Elution buffer directly to the binding matrix in each well of Silicon A Binding Plate. Incubate for 1-2 min at room temperature and centrifuge for 3 min at ≥ 3,000 x g to elute the DNA. M-Elution buffer contains 1% Tris (hydroxymethyl) aminomethane/Hydrochloric Acid and 1% Ethylenediaminetetraacetic Acid, pH 8.0 which enables dissociation of DNA from silica column.
Keep aside 4 μl of each (bisulfite converted) DNA sample for quality control and store remaining amount in the elution plate at -20 °C.
Note: It is recommended to use bisulfite converted samples on the Infinium HumanMethylation450 BeadChip within 1 month of conversion and to avoid repeated freeze-thaw cycles of samples.
Assess the quality of bisulfite converted DNA by using for instance methylation-specific PCR (Ku et al., 2011) for gene of interest (see Note below for an example of our Methylation-specific PCR for Calponin gene) or using pyrosequencing of LINE1 with PyroMark Q96 CpG LINE-1 kit. Proceed with DNA samples which have passed quality control, i.e. samples which either show a PCR product with methylation specific PCR or have passed the bisulfite modification control contained within the LINE1 pyrosequencing assay.
Notes:
Methylation-specific PCR for Calponin gene for assessing quality of bisulfite treated DNA:
Mix 15.8 μl water with
2.5 μl 10x PCR buffer
3 μl MgCl2 (25 mM)
0.5 μl dNTPs (2.5 mM)
1 μl Forward Primer (5′-GGAAGGTAGTTGAGGTTGTG-3′, 20 μM)
1 μl Reverse Primer (5′-CCCAAACTCAAAACTCTAACCTAAC-3′, 20 μM)
1 μl Bisulfite converted DNA
0.2 μl Taq (5 U)
PCR conditions:
95 °C for 6 min
95 °C for 30 sec
63 °C for 30 sec
72 °C for 30 sec
Repeat steps b to d for 35 cycles
72 °C for 5 min.
Run PCR products on a 2% agarose gel to confirm presence of amplicons (333 bp) which verify that the bisulfite conversion has been successful in respective samples. (Teodoridis et al., 2005)
Determine concentration of bisulfite treated DNA using NanoDrop.
Note: As the bisulfite treatment can degrade DNA samples, we have additional DNA quantitation step here after the bisulfite treatment in our protocol, to ensure that there is sufficient sample present before proceeding to Infinium Methylation analyses.
Thaw DNA samples stored at -20 °C and briefly centrifuge. Adjust DNA concentration of each sample to 50 ng μl-1 with M-Elution buffer or water.
Note: DNA samples below 50 ng μl -1 may be concentrated using speed vacuum.
Transfer 6 μl of each 50 ng μl-1 sample to a new 0.8 ml 96-well microplate which is labeled as BCD plate in the Infinium HD Assay Methylation Protocol.
Process 4 μl (or equivalent of 200 ng) samples according to Infinium HD Assay Methylation Protocol Guide (see Reference 3), starting from step 3, page 43 (under steps to make MSA4 plate). Briefly, bisulfite converted DNA is whole genome amplified, fragmented and hybridized to the BeadChip. Following hybridization, unhybridized DNA is washed off and probes on the BeadChip are extended using a labeled nucleotide and captured DNA as a template. The BeadChip is fluorescently stained, scanned and the intensities of beads are measured.
Following processing, extract DNA methylation signals from scanned arrays.
Background correct raw signals and compute into β value using the GenomeStudio software.
Before proceeding to data analysis, perform quality control using the GenomeStudio Software. Data quality can be assessed by checking the detection p-value of probes as well as the sample-dependent and sample-independent control probes which are present on the BeadChips. The following criteria are applied for removal of poorly performing probes or samples: a) probes with a detection p-value above a certain cut-off (e.g. p < 0.05) should be excluded from the analysis, b) samples which fail in any of the array control probes i.e. the raw signal intensities of the control probes of the sample are out of normal range (median+3SD or median-3SD depending on the control probe type) of the signal intensities across all the samples and c) if a certain probe has failed quality control via the detection p-value in greater than 10-25% of samples, then that probe should be removed from further downstream analyses.
An appropriate method of within and between array normalization should be performed. For instance the Genome studio software provides an internal control normalization procedure.
The Infinium 450 K BeadChips use two different types of assay chemistries (Infinium I and Infinium II probes). The β value represents either the ratio of the intensity of the methylated bead type to the combined locus intensity (Infinium type 1 probes) or the ratio of the intensity of the signal from the green channel (corresponding to the methylated CpG state) to the combined intensity obtained from red and green channels (Infinium type II probes) and reflects the methylation status of the specific CpG site. Due to the divergent chemistries of Infinium I and II probes which result in different β value distributions it is recommended to perform peak base correction or the scaling of probes to more accurately reflect the divergent distributions of type I and II probes. Different peak base correction methods are publicly available; see for instance in (Teschendorff et al., 2013).
Acknowledgments
This work was supported by grant awards from Cancer Research UK (C536/A6689), Imperial Experimental Cancer Medicine Centre and Imperial Cancer Research UK Centre.
References
Dedeurwaerder, S., Defrance, M., Calonne, E., Denis, H., Sotiriou, C. and Fuks, F. (2011). Evaluation of the Infinium Methylation 450K technology. Epigenomics 3(6): 771-784.
EZ-96 DNA Methylation Kit D5003 Instruction Manual Version 1.2.6, Zymo Research.
GenomeStudio Methylation Module v1.8 User Guide, Catalog number # 11319130 Rev. B November 2010, Illumina.
Infinium HD Assay Methylation Protocol Guide, catalog number: WG-914-1001Pat # 15019519 Rev. A December 2010, Illumina.
Ku, J. L., Jeon, Y. K., Park, J. G. (2011). Methylation-specific PCR. Methods Mol Biol 791:23-32.
PyroMark Q96 CpG LINE-1 Handbook 12/2010, Qiagen.
Sriraksa, R., Chaopatchayakul, P., Jearanaikoon, P., Leelayuwat, C. and Limpaiboon, T. (2010). Verification of complete bisulfite modification using Calponin-specific primer sets. Clin Biochem 43(4-5): 528-530.
Teschendorff, A. E., Marabita, F., Lechner, M., Bartlett, T., Tegner, J., Gomez-Cabrero, D., Beck, S. (2013). A Beta-Mixture Quantile Normalisation method for correcting probe design bias in Illumina infinium 450k DNA methylation data. Bioinformatics 29 (2): 189-196.
Teodoridis, J. M., Hall, J., Marsh, S., Kannall, H. D., Smyth, C., Curto, J., Siddiqui, N., Gabra, H., McLeod, H. L., Strathdee, G. and Brown, R. (2005). CpG island methylation of DNA damage response genes in advanced ovarian cancer. Cancer Res 65(19): 8961-8967.
Touleimat, N. and Tost, J. (2012). Complete pipeline for Infinium((R)) Human Methylation 450K BeadChip data processing using subset quantile normalization for accurate DNA methylation estimation. Epigenomics 4(3): 325-341.
Zeller, C., Dai, W., Steele, N. L., Siddiq, A., Walley, A. J., Wilhelm-Benartzi, C. S., Rizzo, S., van der Zee, A., Plumb, J. A. and Brown, R. (2012). Candidate DNA methylation drivers of acquired cisplatin resistance in ovarian cancer identified by methylome and expression profiling. Oncogene 31(42): 4567-4576.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Zeller, C., Masrour, N., Patel, N., Dai, W., Wilhelm-Benartzi, C. and Brown, R. (2013). DNA Methylation Profiling Using Infinium Methylation Assay. Bio-protocol 3(10): e777. DOI: 10.21769/BioProtoc.777.
Download Citation in RIS Format
Category
Systems Biology > Epigenomics > DNA methylation
Molecular Biology > DNA > DNA modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
In situ Quantification of Cytosine Modification Levels in Heterochromatic Domains of Cultured Mammalian Cells
María Arroyo [...] Florian D. Hastert
Jul 20, 2023 566 Views
Efficient Large DNA Fragment Knock-in by Long dsDNA with 3′-Overhangs Mediated CRISPR Knock-in (LOCK) in Mammalian Cells
Wenjie Han [...] Jianqiang Bao
Oct 20, 2023 1160 Views
CRISPR/dCas9-Tet1-Mediated DNA Methylation Editing
Junming Qian and Shawn X. Liu
Apr 20, 2024 1080 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
778 | https://bio-protocol.org/en/bpdetail?id=778&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Labeling of Precursor Granule Cells in the Cerebellum by ex vivo Electroporation
AI Aya Ito-Ishida
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.778 Views: 14824
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Neuron Nov 2012
Abstract
This protocol will be useful to introduce the genes of interest into the cerebellar granule cells at early stages of development. Since the granule cell precursors are localized in the external granule layer before migration, DNA plasmids can be specifically incorporated into the granule cells by injecting DNA solution into the cerebellar fissures followed by application of electric pulses. This technique can be performed prior to the preparation of either dissociated or organotypic culture, which can be used to study the molecular mechanisms of cell migration, axon elongation and synapstogenesis during development.
Keywords: Electroporation Cerebellum Granule cell Neuron
Materials and Reagents
Plasmid Maxi Kit (QIAGEN)
10x HEPES buffered saline (HBS)
Fast green FCF (Sigma-Aldrich, catalog number: F7252 )
1x Phosphate buffered saline (PBS)
10x HBS (see Recipes)
Equipment
Capillary glass (Harvard Apparatus, catalog number: 30-0066 )
Micropipette puller P-97/ IVF (Sutter Instrument)
Aspirator Tube Assembly (Drummond, catalog number: 2-000-000 )
Square pulse electroporator and a foot switch (Nepagene, catalog number: CUY21 )
Platinum plate tweezers-type electrode (Protech International, catalog number: CUY650-P5 )
Dissecting microscope
Dissecting tools: Forceps and some fine scissors
10 cm-petri dish
Procedure
A. Preparation of micropipettes for DNA injection
Pull the capillary glass using the puller with a single pull. Adjust the puller setting to make the capillary taper approximately 10-20 mm. When using P-97, start with the following setting: Heat equal of the Ramp value, Pull 0, Vel 40 and Time 200.
Cut out 1/3 – 1/2 of the tips of the pulled pipettes using the forceps.
B. DNA preparation
Prepare plasmids using the Plasmid Maxi Kit and elute DNA with distilled water. The concentration of the DNA should be 4-5 μg/μl for storage.
For injection, the final concentration of DNA should be 2 μg/μl. Add 1/10 volume of 10x HBS, 1/10 volume 1% fast green (final 0.1%) and water to the DNA solution to adjust the concentration.
C. Electroporation
Attach a micropipette to an aspirator tube assembly and draw 10 μl of DNA -solution into the pipette (Figure 1).
Figure 1. An aspirator tube and a glass capillary
Remove a whole-brain from a mouse (postnatal days 7-9) and put it into an ice-cold PBS in a 10-cm petri dish.
Remove the forebrain and the brain stem using the forceps. If the cerebellum is planned to be used for organotypic culture, the meninges should not be removed in order to keep the cellular layers intact. If the cerebellum is to be further processed for dissociated culture, the meninges should be removed to avoid glial cell overgrowth.
Observe the cerebellum under a dissecting microscope. Inject the DNA solution (2 -3 μl/fissure) into the cerebellar fissures by mouth pipetting (Figure 2). Inject into at least 2 or 3 fissures, starting from those in the vermis. If high transfection efficiency is required, inject into as many fissures as possible.
Figure 2. Injection of plasmid DNA solution into cerebellar fissures
Place the forceps-type electrodes so that cerebellum is in between the two electrode planes. The two planes should be positioned parallel to the fissures of the cerebellar vermis. They should be held about 3-5 mm apart from the cerebellum surface (Figure 3).
Figure 3. Placement of electrodes
Apply electric pulses; 99.9 V, ON 50 msec, OFF 450 msec, 5 pulses. Adjust the voltage value depending on the outcome. When the transfection efficiency is too low, the voltage should be increased up 120 V. When the transfection efficacy is too high or when the number of dying cells is too high, the voltage setting should be decreased.
The cerebellum can be further processed for either organotypic slice or dissociated cultures (please see reference 1 for the images showing the labeled granule cells).
Recipes
10x HBS
10x conc. (mM)
g/100 ml H2O
NaCl
1,400
8.2
Na2HPO4.2H2O
15
0.3
HEPES
500
11.9
Acknowledgments
This protocol is adapted from Yang et al. (2004) and Ito-Ishida et al. (2012).
References
Ito-Ishida, A., Miyazaki, T., Miura, E., Matsuda, K., Watanabe, M., Yuzaki, M. and Okabe, S. (2012). Presynaptically released Cbln1 induces dynamic axonal structural changes by interacting with GluD2 during cerebellar synapse formation. Neuron 76(3): 549-564.
Yang, Z. J., Appleby, V. J., Coyle, B., Chan, W. I., Tahmaseb, M., Wigmore, P. M. and Scotting, P. J. (2004). Novel strategy to study gene expression and function in developing cerebellar granule cells. J Neurosci Methods 132(2): 149-160.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Ito-Ishida, A. (2013). Labeling of Precursor Granule Cells in the Cerebellum by ex vivo Electroporation. Bio-protocol 3(12): e778. DOI: 10.21769/BioProtoc.778.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Neuron
Neuroscience > Development > Neuron
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Parkinson’s Disease-relevant Mitochondrial and Neuronal Morphology High-throughput Screening Assay in LUHMES Cells
Tom Leah [...] Heather Mortiboys
Jan 5, 2021 4282 Views
Spatial Centrosome Proteomic Profiling of Human iPSC-derived Neural Cells
Fatma Uzbas and Adam C. O’Neill
Sep 5, 2023 786 Views
Primary Neuronal Culture and Transient Transfection
Shun-Cheng Tseng [...] Eric Hwang
Jan 20, 2025 337 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
779 | https://bio-protocol.org/en/bpdetail?id=779&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Polyclonal Specific Antibodies
MW Maureen Wirschell
MP Mary E. Porter
Published: Vol 3, Iss 11, Jun 5, 2013
DOI: 10.21769/BioProtoc.779 Views: 11447
Reviewed by: Ru Zhang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Nature Genetics Mar 2013
Abstract
Generation of antibodies specific for a protein of interest is a common method in many disciplines. This protocol details the steps in production of a polyclonal antibody in rabbits using a bacterially expressed fusion protein as an antigen. The protocol is generated based on data presented in Wirschell et al.(2013).
Keywords: Antibody Dynein Cilia Flagella Protein purification
Materials and Reagents
Topo TA cloning kit with One Shot competent cells (Life Technologies, Invitrogen™, catalog number: K457501 )
pCR2.1 TOPO
pET28a
pMal-C (New England Biolabs)
BL21 (DE3) pLysS competent cells (Stratagene, catalog number: 200132 )
Bacto agar (BD Biosciences, catalog number: 214530 )
Bacto Peptone Peptone (BD Biosciences, catalog number: 211677 )
Bacto yeast extract (BD Biosciences, catalog number: 212750 )
NaCl (Thermo Fisher Scientific, catalog number: 7647-14-5 )
IPTG (Promega Corporation, catalog number: PR-V3953 )
Novagen BugBuster Lysis buffer (Thermo Fisher Scientific, catalog number: 50-230-9216 )
Urea (Thermo Fisher Scientific, catalog number: U15-500 )
Novagen His-Bind Purification kit (Thermo Fisher Scientific, catalog number: 50-230-8606 )
Novagen rLysozyme (EMD Millipore, catalog number: 71110-4 )
Novagen Benzonase (EMD Millipore, catalog number: 70664-3 )
PMSF (Sigma-Aldrich, catalog number: 78830-5G )
Aprotinin (Sigma-Aldrich, catalog number: A1153-5MG )
Roche Complete Protease inhibitor cocktail (F. Hoffmann-La Roche, catalog number: 04-693-124-001 )
Takara Chaperone plasmid set (Takara Bio Company, catalog number: 3340 )
Amylose resin (New England Biolabs, catalog number: E8021S )
Nitrocellulose membrane (Bio-Rad Laboratories, catalog number: 162-0115 )
PVDF (EMD Millipore, catalog number: IPVH00010 )
I-BLOCK (Life Technologies, Invitrogen™, catalog number: T2015 )
Tween-20 (Sigma-Aldrich, catalog number: P9416 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Sodium azide (Sigma-Aldrich, catalog number: S2002 )
Glycine (Sigma-Aldrich, catalog number: G8898 )
Tris (Sigma-Aldrich, catalog number: T1503 )
Sodium bicarbonate (Sigma-Aldrich, catalog number: S5761 )
AminoLink Immobilization kit (Pierce Antibodies, catalog number: 44894 )
Hydrochloric acid (HCl) (Thermo Fisher Scientific, catalog number: A144-212 )
Sodium acetate (Sigma-Aldrich, catalog number: S2889 )
Ethanol by Acros(Thermo Fisher Scientific, catalog number: 61509-0020 )
Methanol (Thermo Fisher Scientific, catalog number: BP1105-4 )
Na2HPO4
KH2PO4
KCl
NaCl
CNBr-activated sepharose (Sigma-Aldrich, catalog number: C9142 )
3x PBST (see Recipes)
Glycine elution buffer (see Recipes)
Low pH wash buffer (see Recipes)
High pH wash buffer (see Recipes)
Coupling buffer (see Recipes)
Equipment
Nickel-chromatography column (Thermo Fisher Scientific, catalog number: 50-230-8606 )
Procedure
Preparation of expression construct:
cDNA sequences encoding amino acids 155-243 of Chlamydomonas DRC1 were amplified by PCR and cloned into the pCR2.1 TOPO cloning vector to generate plasmid pMW199.1.
The insert from pMW199.1 was excised with EcoR1 and subcloned into the EcoR1 site of pET28a to generate plasmid pMW219.15, which was sequenced to confirm orientation. The expressed protein sequence is shown in Figure 1.
Figure 1. The DRC-His fusion protein. The predicted size of the expressed fusion protein is ~20 kDa. In bold is the sequence encoded by the pET28A vector including the 6-His tag (underlined) followed by the sequences encoded by the EcoR1 insert from pMW199.1 containing 6 amino acids from the pCR2.1 cloning vector and DRC1 sequences (italics).
Production of the His-tagged DRC1 fusion protein: 1 ng of pMW219.15 was transformed into 50 μl of BL21 (DE3) pLysS cells from Stratagene by electroporation according to manufacturer’s recommendations.
Single colonies were selected and tested for expression.
Cells were grown overnight in 3 ml LB cultures at 37 °C.
The next day, cultures were diluted to A600 = 0.1 and grown until A600 = 0.3 - 0.4.
Expression of the His-DRC1 fusion was induced with 100 mM IPTG for 2-3 h at 37 °C.
Cells were lysed and both soluble and insoluble fractions were analyzed by 15% SDS-PAGE for induction of the fusion protein.
The His-DRC1 fusion protein was completely insoluble and found in inclusion bodies.
Scaled-up expression:
Cells were grown in 50 ml overnight LB cultures at 37 °C.
The next day, cells were diluted into 1.5 L LB to an A600 = 0.1 and grown to A600 = 0.3.
Expression of the His-DRC1 fusion protein was induced with 100 mM IPTG for 2 h.
Lysis of bacterial cells and purification of inclusion bodies:
Cells were pelleted and resuspended in 30 ml (5 ml/gram of cell pellet) BugBuster supplemented with 10 U/ml rLysozyme, 10 U/ml Benzonase, 1 mM PMSF, 2.5 U/ml Aprotinin (Alternatively, use Roche complete protease inhibitor cocktail per manufacturers instructions). Incubate for 30 min at room temperature on a platform or rotisserie shaker.
Add Triton-x-100 to 0.1% and incubate 10 min.
Centrifuge at 5,000 x g for 15 min at 4 °C.
Save supernatant (S1) for gel analyses. Resuspend the pellet in 0.5 volumes (15 ml) of Bugbuster diluted 1:10 with water (0.1x Bugbuster). Vortex to resuspend the pellet. Centrifuge 16,000 x g for 15 min at 4 °C.
Save supernatant (S2) for gel analyses. Resuspend the pellet in 15 ml of 0.1x Bugbuster. Vortex to resuspend the pellet. Centrifuge at 16,000 x g for 15 min at 4 °C.
Save supernatant (S3) for gel analyses. Resuspend the pellet in 1x binding buffer + 6 M urea. Save an aliquot for gel analyses (IB).
Purification of His-DRC1 using Novagen His-Bind purification kit:
Add 2.0 ml of resin to a column (20 mg/2.5 ml binding capacity) and let drain.
Wash resin with 3 volumes distilled water.
Wash resin with 5 volumes of 1x charge buffer (50 mM NiSO4).
Wash with 3 volumes of 1x binding buffer + 6 M urea.
Connect column to a peristaltic pump with a flow rate set at ~5 ml/h (0.08 ml/min). Load the solubilized inclusion bodies containing the His-DRC1 fusion protein onto the column and let run through the column. Save flow through (FT) for gel analyses.
Wash column with 10 column volumes of 1x binding buffer + 6 M urea.
Wash column with 6 column volumes of 1x wash buffer + 6 M urea + 20 mM Imidizole.
Flush out tubing briefly and reconnect to column and peristaltic pump.
Elute fusion protein in 6 column volumes of 1x elution buffer + 6 M urea and collect in 10x 300 μl fractions.
Fix 50 μl of each fraction for gel analyses.
Run all samples (saved supernatants, purified inclusion bodies, flowthrough, washes and column fractions) on 12% acrylamide SDS-PAGE gel (Figure 2).
Figure 2. Coomassie stained gel of DRC1-His purification. S1, S2 and S3 are the supernatants from the three washes of the insoluble cell pellet. IB is the inclusion body pellet. FT is the flow through from the Nickel column. IB is the inclusion body pellet. 1-10 are the fractions collected from the column.
Immunization of rabbits for polyclonal antibody production: The antibody against DRC1 was generated using the standard protocol offered by Spring Valley Laboratory (Woodbine, MD).
First, we requested pre-immune sera from 10 rabbits. These were tested on western blots for endogenous reactivity to axonemal proteins. 2 rabbits were selected that showed minimal to no reactive bands on western blots.
4.2 mg of column purified His-DRC1 fusion protein was sent to Spring Valley Laboratories to be used as antigen for immunizations. The fusion protein was in the elution buffer used to elute the fusion protein from the Nickel-chromatography column.
The following protocol was followed for immunization and bleeding:
Day 0: Pre-immunization test bleed
Day 0: Primary immunization
Day 21: Immunogen boost
Day 42: Immunogen boost
Day 52: Bleed
Day 63: Immunogen boost
Day 73: Bleed or exsanguination
Optional: monthly protocol extension
Day 1: Immune boost
Day 12: bleed
Day 27: bleed
For our DRC1 antibody production, we opted to exsanguinate after the day 73 production bleed. Approximately 1 mg of total protein is used per rabbit for the immunizations.
Purification of DRC1-specific antibodies: Whole serum was tested by western blot on isolated axonemes from wild-type cells and the drc1-mutant to verify specificity of the antibody produced in rabbits. The sera was used at a 1:10,000 dilution for western blots or was further affinity purified as follows:
MBP-DRC1 fusion protein:
An MBP-DRC1 construct was prepared by inserting the EcoR1 insert from pMW199.1 into the EcoR1-digested pMal-C vector. Isolated clones were sequence verified.
The MBP-DRC1 fusion protein was expressed in the presence of chaperone proteins to increase the solubility of the fusion protein (Takara Chaperone plasmid set).
Soluble MBP-DRC1 fusion protein was purified on an amylose resin according to manufacturers instructions, run on 10% SDS-PAGE at 200 V for 1 h and transferred to nitrocellulose or PVDF membrane. The region of the membrane containing the fusion protein was cut out and used to purify DRC1-specific antibodies.
Blot affinity purification:
The MBP-DRC1 fusion protein was run on SDS-PAGE and transferred to two sheets of PVDF membrane. The region of the membranes containing the fusion protein were cut out and used to purify DRC1-specific antibodies.
The MBP-DRC1 membrane was washed in 1x PBS, and then blocked with 5 ml of 0.2% I-BLOCK, 0.1% Tween-20 in PBS for 30 minutes.
The strip was incubated overnight at room temperature with a 1:1,000 dilution of DRC1 sera in the blocking solution plus 0.05% azide to specifically bind DRC1 antibodies to the membrane.
The membrane was washed 3x in PBS-Tween, and the bound DRC1 antibodies were eluted in 2 ml of glycine elution buffer for 3 min on ice.
The glycine eluate was collected and neutralized with 1/10th volume of 1 M Tris pH 8.1.
The elution step was repeated two more times and the three elutes were combined, normal goat serum was added to 10%, and then the eluted antibody was dialyzed overnight against 1x PBS at 4 °C.
The eluted, dialyzed antibody was supplemented with 0.1% azide and stored at 4 °C.
Column affinity purification:
The MBP-DRC1 fusion protein was purified as indicated above and peak fractions (~10 mg) dialyzed overnight at 4 °C into coupling buffer.
Next day: Prepare the CNBr-activated sepharose. The binding capacity is 13-20 mg/ml. Weigh out 0.3 grams for ~10 mg of MBP-DRC1 fusion protein and rehydrate / wash it with 1 mM HCl.
Wash the column with water, then coupling buffer.
Bind the MBP-DRC1 fusion to the CNBr-activated sepharose column for 2.5 h at room temperature using a rabbit pump to recirculate the protein back onto the column.
Wash the column with alternating low pH wash buffer and high pH wash buffer. The column was stored in 20% ethanol until ready to use for affinity purification.
Wash the MBP-DRC1 column with PBS.
Cap the bottom of the column and add 2 ml of DRC1 sera and 500 μl of PBS.
Mix and let the resin re-settle in the column. Incubate for 1 h.
Collect the flow through.
Wash the column with PBS.
Elute antibody with 6 ml of 0.1 M Glycine pH 2.87.
Collect 900 μl fractions into Eppendorf tubes with 100 μl of 1 M Tris pH 8.0.
Pool the peak fractions and dialyze overnight into PBS.
Collect the dialyzed antibodies and add sodium azide as a preservative.
Pre-absorption to methanol-fixed drc1-mutant cells:
The pf3 mutant cells were grown in standard Chlamydomonas media (Harris, 2009)
Cells were harvested, washed and resuspended in ~50 ml of 100% methanol repeatedly until the supernatant was clear and the pellet was white. The final pellet of extracted cells was split into 5 aliquots.
50-100 microliters of antisera was diluted 1:10 into PBS plus 0.1% azide and then incubated overnight at 4 °C with the first aliquot of extracted cells.
The supernatant was removed, a sample saved, and then the supernatant was incubated overnight with the 2nd aliquot of extracted cells. The process was repeated three more times.
The original 1:10 dilution of antisera was diluted 1:1,000, and the supernatants from each absorption step were diluted 1:100 and 1:1,000. All samples were tested on western blots of wild-type and pf3 mutant axonemes. Aliquots with minimal background, but strong signals, were combined and used at the appropriate dilution (Wirschell et al., 2013).
Recipes
Note: All buffers can be generated using the concentrated stock solutions provided with the referenced kits and by standard molarity calculations.
3x PBST
9.6 mM Na2HPO4
1.5 mM KH2PO4
3.9 mM KCl
405 mM NaCl
0.15% Tween-20
Glycine elution buffer
0.1 M glycine-HCl
0.5 M NaCl
0.05% Tween (pH 2.5)
Low pH wash buffer
0.1 M sodium acetate (pH 3.85)
0.5 M NaCl
High pH wash buffer
0.1 M Tris (pH 9)
0.5 M NaCl
Coupling buffer
0.1 M NaHCO3 (pH 8.0)
0.5 M NaCl
References
Harris, E. (2009). Chlamydomonas in the Laboratory. The Chlamydomonas Sourcebook. E. Harris. Kidlington, Oxford, Academic Press. 1: 241-301.
Wirschell, M., Olbrich, H., Werner, C., Tritschler, D., Bower, R., Sale, W. S., Loges, N. T., Pennekamp, P., Lindberg, S., Stenram, U., Carlen, B., Horak, E., Kohler, G., Nurnberg, P., Nurnberg, G., Porter, M. E. and Omran, H. (2013). The nexin-dynein regulatory complex subunit DRC1 is essential for motile cilia function in algae and humans. Nat Genet 45(3): 262-268.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Immunology > Antibody analysis > Antibody-antigen interaction
Biochemistry > Protein > Isolation and purification
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Protein Immunoprecipitation Using Nicotiana benthamiana Transient Expression System
Fang Xu [...] Xin Li
Jul 5, 2015 21839 Views
Separation and Visualization of Low Abundant Ubiquitylated Forms
Ramona Schuster [...] Mafalda Escobar-Henriques
Nov 20, 2018 4606 Views
Assessing Self-interaction of Mammalian Nuclear Proteins by Co-immunoprecipitation
Claudia Cattoglio [...] Anders S. Hansen
Feb 20, 2020 7245 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
78 | https://bio-protocol.org/en/bpdetail?id=78&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Coomassie Blue Staining
Fanglian He
In Press
Published: Jun 5, 2011
DOI: 10.21769/BioProtoc.78 Views: 81890
Ask a question
Favorite
Cited by
Abstract
Coomassie staining is able to detect protein bands containing about 0.2 μg or more protein. For low abundant protein, silver staining (www/silver staining) is a better choice since it is about 100-fold more sensitive than Coomassie staining.
Keywords: Coomassie staining Coomassie blue Staining solution Destaining solution Protein
Materials and Reagents
Coomassie Brilliant Blue R250 (EM Science)
Glacial acetic acid
MetOH
Staining solution
Dye solution
Destaining solution
Equipment
Shaker
Procedure
Incubate the gel in staining solution with shaking for 30 min or longer (can leave it overnight).
Remove the dye solution (it can be reused for many times) and rinse the gel with water 1-2 times to remove the dye.
Add destaining solution to the gel and incubate for 30-60 min.
Transfer the gel to water (can keep it in water for several days).
Recipes
100 ml staining solution
Coomassie Brilliant Blue R250 0.25 g
Glacial acetic acid 10 ml
MetOH: H2O (1: 1 v/v) 90 ml
Destaining solution
Destaining solution is the same as staining solution, but not containing the Coomassie R250 dye powder.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Protein > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
780 | https://bio-protocol.org/en/bpdetail?id=780&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Retro- and Lentiviral Reverse Transcriptase Activity by Real-time PCR
Jolien Vermeire
Bruno Verhasselt
Published: Vol 3, Iss 11, Jun 5, 2013
DOI: 10.21769/BioProtoc.780 Views: 13216
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS ONE Dec 2012
Abstract
Quantification of retroviral reverse transcriptase activity in retrovirus containing supernatant by quantitative reverse transcription PCR as a method for titration of HIV, lenti- and retroviral vectors is described here.. The procedure was optimized for use with LightCycler 480 (Roche, Vilvoorde, Belgium) and ABI 7300 real-time PCR system (reagents and procedures that are system specific will be marked accordingly in the protocol).
Materials and Reagents
MS2 RNA, aliquoted per 30 μl, storage -20 °C (F. Hoffmann-La Roche, catalog number: 10165948001 )
Ribolock RNase inhibitor 40 U/μl, aliquoted per 10 μl, storage -20 °C (Fermentas, catalog number: EO0381 )
HIV Reverse Transcriptase (Life Technologies, Ambion®, catalog number: AM2045 )
Primers (directed against MS2 cDNA), storage -20 °C, (Eurogentec, Seraing, Belgium):
FWD: 5'TCCTGCTCAACTTCCTGTCGAG3'
REV: 5'CACAGGTCAAACCTCCTAGGAATG3'
Nuclease-free water, further referred to as H2O (Life Technologies, catalog number: AM9939 )
[Light Cycler 480]: LightCycler 480 SybrGreen I Master: Protect against light with aluminium foil (F. Hoffmann-La Roche, catalog number: 04707516001)
OR [ABI 7300]: Eurogentec qPCR core kit for SYBR Green I (Eurogentec, catalog number: RT-QP73-05 )
Tris (Sigma-Aldrich, catalog number: 154563-500G )
Ultrapure water (MilliQ water filtered with Milli-Q Gradient System) (Merck Millipore, Overijse, Belgium)
KCl (UCB, catalog number: 1592 )
Glycerol (Merck Millipore, catalog number: 1.04094.1000 )
Triton-X100 (MP Biomedicals, catalog number: 807423 )
2x Lysis buffer (Homemade), storage -20 °C (see Recipes)
Eurogentec qPCR core kit for SYBR Green I (see Recipes)
Equipment
Tissue Culture Plate 96W U-bottom (BD Biosciences, Falcon®, catalog number: 353077 or similar)
[Light Cycler 480]: LightCycler 480 Sealing foil (F. Hoffmann-La Roche, catalog number: 04729757001 ) OR [ABI 7300]: Optical adhesive film (Applied Biosystems, catalog number: 4311971 )
[Light Cycler 480]: LightCycler 480 Multiwell plate 384 (F. Hoffmann-La Roche, catalog number: 04729749001 ) OR [ABI 7300]: MicroAmp Optical 96-well reaction plate with barcode (Applied Biosystems, catalog number: 4306737 )
MicroAmp adhesive film applicator (Applied Biosystems, catalog number: 4333183 )
Aluminium foil
Table top centrifuge
Procedure
Overview of the procedure:
Preparations (see A): Make the lysis buffer / RNase inhibitor mix and qRT-PCR reaction mix.
Lysis of the viral samples (see B): Addition of lysis buffer to the viral supernatant to release reverse transcriptase.
qRT-PCR (see C): Addition of qRT-PCR reaction mix to the lysed samples, followed by the reverse transcription and quantitative PCR reaction.
Analysis (see D): Calculation of the reverse trancritpase activity of the samples based on the obtained standard curve.
Preparations:
Calculate the amount of samples that will be included in the RT assay (x samples).
Always include:
Standard curve (SC) (containing 7 dilutions of viral supernatant or 7 dilutions of recombinant HIV reverse transcriptase + 1 medium control = 8 samples).
3 control viral supernatant (C ) (= 3 samples)
your samples (S)
Make a mixture of 2x lysis buffer and RNase inhibitor (40 U/μl) (see Table 1):
Table 1. Required Lysis buffer/RNase inhibitor
Reagent per reaction
(1 sample)
Reagent for all reactions
((x *1.25) samples)
2x lysis buffer
5 μl
5*(x*1.25) μl
RNase inhibitor (40 U/μl)
0.1 μl
0.1* (x*1.25) μl
Notes:
1) lysis buffer is very viscious. Therefore always make 25% extra and do not vortex to avoid formation of bubbles.
2) keep RNase inhibitor on ice.
Calculate the amount of samples that you will measure by qRT-PCR (n samples)
Always include:
Each sample in duplicate (= x*2 samples)
H2O twice (= 2 samples) (negative control of the qPCR)
Make the qRT-PCR reaction mix (see Table 2a [Light Cycler 480] or Table 2b [ABI 7300].):
Notes:
1) Make 10% extra.
2) Keep LC 480 Sybr Green I mix, MS2 RNA and RNase inhibitor on ice.
3) Do not vortex LC480 Sybr Green I mix.
4) RNase inhibitor has to be diluted 10x in H2O (final concentration: 4 U/μl).
Table 2a. qRT-PCR reaction mix for use on LightCycler 480 (384 well plates)
Reagent per reaction (1 sample)
Reagent for all reactions ((n *1.1) samples)
LC 480 Sybr Green I (2x)
10 μl
10*(n*1.1) μl
Fwd primer (100 μM)
0.1 μl
0.1* (n*1.1) μl
Reverse primer (100 μM)
0.1 μl
0.1* (n*1.1) μl
MS2 RNA
0.1 μl
0.1* (n*1.1) μl
RNase inhibitor (10x diluted in H2O, final concentration: 4 U/μl)
0.1 μl
0.1* (n*1.1) μl
Table 2b. qRT-PCR reaction mix for use on ABI 7300 real-time PCR system (96 well plates)
1 sample
(n *1.1) samples
Eurogentec qPCR core kit for SYBR Green I
10.6 μl
10*(n*1.1) μl
Fwd primer (100 μM)
0.1 μl
0.1* (n*1.1) μl
Reverse primer (100 μM)
0.1 μl
0.1* (n*1.1) μl
MS2 RNA
0.1 μl
0.1* (n*1.1) μl
RNase inhibitor (10x diluted in H2O, final concentration: 4 U/μl)
0.1 μl
0.1* (n*1.1) μl
Lysis of the viral samples
Add 5 μl of the viral supernatant or standard curve per well of a 96W U bottom plate.
Add 5 μl of Lysis buffer/RNase mix to each well and mix.
Incubate 10 min at room temperature (RT).
Add 90 μl nuclease-free water to each well and mix.
Spin plate for 3 min at 1,600 x g at RT in table top centrifuge.
Keep the plate on ice until transfer to the 384W [LightCycler 480] OR 96W [ABI 7300] qPCR plate.
qRT-PCR
Take a cooling element out of the -20 °C and cover the cooling element with aluminium foil. Put the 384W [LightCycler 480] OR 96W [ABI 7300] plate on the aluminium foil during the filling of the plate to prevent evaporation.
Put 10.4 μl [LightCycler 480] OR 11 μl [ABI 7300] of qRT-PCR reaction mix in each well of 384W [LightCycler 480] OR 96W [ABI 7300] plate.
Resuspend all the viral samples in the lysate plate.
Add 9.6 μl [LightCycler 480] OR 9 μl [ABI 7300] of sample to each well and resuspend.
Seal the plate using Sealing foil [LightCycler 480] OR Optical Adhesive film [ABI 7300], by removing the protective layer and press it to the plate using the applicator.
Spin the plate at 1,600 x g for 3 min at RT in table top centrifuge.
Run reaction:
Light Cycler 480:
Detection format: Sybr Green/HRM dye
Reaction volume: 20 μl
Program:
Step 1: Reverse transcription (rt): 42 °C for 20 min.
Step 2: Pre-incubation: 95 °C for 5 min.
Step 3: Amplification: 40 cycles of
95 °C for 5 sec
60 °C for 5 sec + detection
72 °C for 15 sec
Step 4: Melting curve
Step 5: Cooling
Run on the ABI Prism 7300:
Reaction volume: 20 μl
Program:
Step 1: Reverse transcription (rt): 42 °C for 20 min.
Step 2: Pre-incubation: 95 °C for 2 min.
Step 3: Amplification: 40 cycles of
95 °C for 5 sec
60 °C for 30 sec + detection
72 °C for 15 sec
Step 4: Melting curve
Analysis
Export the obtained Cq (Cycle of quantification) values from the LC480 or ABI Prism 7300.
Calculate for each sample the average Cq value of the duplicate measurements.
Make the standard curve: plot the average Cq value of SC1-SC7 versus the logarithm of the RT activity (expressed as mU RT/ml), determine the trendline and the formula expressing the correlation between the Cq values and the logarithm of the RT activity.
Use the obtained formula to calculate the absolute RT value of the samples.
Notes
Control samples:
Standard curve:
For absolute quantification of retroviral RT activity one can measure a serial dilution with known concentration of recombinant reverse transcriptase in parallel with the samples of interest (see a). Alternatively, a standard curve can be made by using serial dilution of a retro- or lentiviral supernatant of choice. In the latter case, it necessary to determine the RT activity of this supernatant in a first experiment by running a recombinant reverse transcriptase standard curve in parallel. For later experiment the serial dilution of the retroviral supernatant can be used as a standard curve (see b).
Use recombinant HIV Reverse transcriptase as standard curve
SC1 = solution of 200 mU/μl HIV Reverse Transcriptase. This is 1/50 dilution of the stock solution (10 U/μl)
SC2-SC7 are made by serial 1/10 dilution of SC1 in cell culture medium (preferably the same medium in which retro- and lentiviruses were produced)
Sample SC8 = cell culture medium (negative control)
Use high titer retroviral supernatant as a standard curve
SC1 = high titer retro- or lentiviral supernatant of your choice.
This sample can be any viral supernatant that is more concentrated than the samples being analysed. As mentioned above, the RT activity of this sample should be determined in an initial experiment by running a recombinant reverse transcriptase standard curve (see a) in parallel.
SC2-SC7 are made by serial 1/10 dilution of SC1 in cell culture medium (preferably the same medium in which retro- and lentiviruses are produced)
Sample SC8 = cell culture medium
All samples are aliquoted per 8.5 μl in PCR strips. For each assay a new strip will be used.
Control samples C1, C2, C3:
3 retroviral supernatants of your choice that will be measured in each RT assay for quality control: The obtained RT activity of the control samples should be similar over different RT assays and offers a control for interrun variation.
Recipes
1 M Tris-HCl solution
12.1 g Tris in 50 ml ultrapure water-adjust pH to 7.4 with HCl
Adjust total volume to 100 ml with MilliQ water
2x Lysis buffer (storage -20 °C)
0.25% Triton X-100, 50 mM KCl, 100 mM TrisHCl, pH 7.4, 40% glycerol
Add 50 ml of 1 M TRIS-HCl solution to a 500 ml bottle
Add 1.86 g KCl to the 500 ml bottle
Add 200 ml glycerol
Add 1.25 ml of Triton-X100
Mix the solution very well until everything is dissolved
Add MilliQ water up to a final volume of 500 ml
Aliquot 40 ml in 1.5 ml screw cap microtube
Aliquot the remainder in 50 ml tubes
Eurogentec qPCR core kit for SYBR Green I (store aliquots at -20 °C)
Composition of 10.6 μl:
2 μl 10x reaction buffer
1.4 μl of 50 mM MgCl2
0.8 μl of 5 mM dNTP mix
0.1 μl of HotGoldS Tar Taq polymerase
0.6 μl SYBR Green I
5.7 μl of nuclease-free water
Acknowledgments
The presented assay is an adapted version of the SG-PERT assay described before in Pizzato et al. (2009). This work was supported by SBO CellCoVir grant from the agency for Innovation by Science and Technology (IWT) Flanders, Belgium; HIV-STOP Interuniversity Attraction Poles program of Belgian Science Policy, European Union FP7 Health-2007-2.3.2-1 Collaborative Project iNEF, Ghent University grant BOF11/GOA/013 and grants from the Research Foundation – Flanders (FWO).
References
Pizzato, M., Erlwein, O., Bonsall, D., Kaye, S., Muir, D. and McClure, M. O. (2009). A one-step SYBR Green I-based product-enhanced reverse transcriptase assay for the quantitation of retroviruses in cell culture supernatants. J Virol Methods 156(1-2): 1-7.
Vermeire, J., Naessens, E., Vanderstraeten, H., Landi, A., Iannucci, V., Van Nuffel, A., Taghon, T., Pizzato, M. and Verhasselt, B. (2012). Quantification of reverse transcriptase activity by real-time PCR as a fast and accurate method for titration of HIV, lenti- and retroviral vectors. PLoS One 7(12): e50859.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial genetics > RNA
Molecular Biology > RNA > qRT-PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A SYBR Green-based Real Time RT-PCR Assay for Detection of the Emerging H7N9 Virus
Zheng Zhu and Lunbiao Cui
Jun 20, 2014 9274 Views
Infectious Virus Yield Assay for Hepatitis E Virus
Yannick Debing [...] Johan Neyts
Aug 5, 2014 10067 Views
Quantification of HIV RNA and Human Herpesvirus DNA in Seminal Plasma
Milenka V. Vargas-Meneses [...] Sara Gianella
May 5, 2015 9623 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
781 | https://bio-protocol.org/en/bpdetail?id=781&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
2D Diagonal Redox SDS-PAGE of Proteins
CS Christian Schwarz
JN Joerg Nickelsen
Published: Vol 3, Iss 11, Jun 5, 2013
DOI: 10.21769/BioProtoc.781 Views: 15703
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Plant Journal Nov 2012
Abstract
2D diagonal redox SDS-PAGE of proteins is used to detect intramolecular or intermolecular disulfide bridges using Chlamydomonas in this example (Stroeher and Dietz, 2008; Schwarz et al., 2012). Both dimensions consist of a conventional SDS-PAGE, except that the sample buffer for the first dimension lacks a reducing agent. Intermolecular disulfide bridges increase the apparent molecular weight of a protein in the first dimension, whereas intramolecular bridges decrease the apparent weight of the protein.
Keywords: 2d Diagonal SDS PAGE Redox Disulfide bridge
Materials and Reagents
All material for a conventional Laemmli SDS-PAGE
Non-reducing Laemmli sample buffer
KCl (Applichem, catalog number: A1039 )
Triton X-100 (Applichem, catalog number: A1388 )
DTT (Applichem, catalog number: A1101 )
SDS (SERVA Electrophoresis GmbH, catalog number: 20765 )
Acrylamide 40% 37.5:1 (SERVA Electrophoresis GmbH, catalog number: 10681 )
Ammoniumperoxodisulfate (Carl Roth, catalog number: 9592 )
TEMED (Carl Roth, catalog number: 2367 )
Beta-mercaptoethanol (Carl Roth, catalog number: 4227 )
Iodoacetamide (Applichem, catalog number: A1666 )
Tris (Applichem, catalog number: A1379 )
Na2EDTA (Carl Roth, catalog number: 8043 )
Tricine (Carl Roth, catalog number: 6977 )
Glycine (SERVA Electrophoresis GmbH, catalog number: 23390 )
Agarose (SERVA Electrophoresis GmbH, catalog number: 11380 )
Bromophenol blue (Carl Roth, catalog number: T116 )
Filter paper (Munktell, catalog number: 2.519.580600N )
Page Ruler unstained protein ladder (Thermo Fisher Scientific, catalog number: 26614 )
2x Cell lysis buffer (see Recipes)
5x non-reducing Laemmli sample buffer (see Recipes)
5x reducing Laemmli sample buffer (see Recipes)
Laemmli electrophoresis buffer (see Recipes)
Equipment
All equipment for a conventional Laemmli SDS-PAGE
Procedure
Cell lysis (perform all lysis steps at 4 °C)
Break your cells with 2x cell lysis buffer (use 1 ml of lysis buffer per pellet of a 1 L culture) by repeated pipetting for up to 5 min.
Solubilize proteins with a final concentration of 1% SDS (30 min, 4 °C, no agitation required).
Prevent thiol-reshuffling of your sample by alkylation with a final concentration of 0.1 M iodoacetamide (30 min, 4 °C, in the dark as iodoacetamide is not stable in light, no agitation required).
First dimension (keep in mind that each lane of the first dimension requires a separate gel for the second dimension when calculating the number of samples that you want to process)
Add appropriate amount of non-reducing Laemmli sample buffer to each sample while staying within the size limits of your gel comb, use enough material to enable the analysis of your protein by your detection method.
Denature sample according to the best conditions for your protein (e.g. many soluble proteins can be denatured at 95 °C for 6 min).
Perform Laemmli SDS-PAGE with your sample (Figure 1).
Second dimension
Excise lanes from gel as gel stripes (Figure 1).
Reduce disulfide bridges by agitating your gel stripes in an amount of Laemmli electrophoresis buffer that covers your gel stripe completely (+ 0.1 M DTT [final concentration], 15 min, room temperature).
Prevent thiol-reshuffling through alkylation by agitating your gel stripes in Laemmli electrophoresis buffer (containing 0.1 M idoacetamide [final concentration], 15 min, room temperature, in the dark).
Prepare a separate gel for the 2nd dimension SDS-PAGE of each gel stripe with a shorter stacking gel (approximately 50% shorter than your stacking gel in the first dimension and no wells) to accommodate the gel stripe of the first dimension into your gel apparatus.
Place gel stripe from first dimension in horizontal orientation (higher molecular weight on the left side, lower molecular weight on the right side) above stacking gel of the 2nd dimension (Figure 1).
Boil 0.5% agarose (in Laemmli electrophoresis buffer with bromophenol blue [0.75 g L-1]) and fill your gel of the second dimension with the agarose solution (Figure 1).
Press gel stripe against stacking gel of the second dimension (do not change orientation of gel stripe, avoid or remove air bubbles between gel stripe and stacking gel) before agarose solidifies (Figure 1).
Pipet protein size marker on a small stripe of filter paper and stick that piece of paper beside your gel stripe into the agarose solution before agarose solidifies.
Run Laemmli SDS-PAGE as the second dimension (bromophenol blue from the solidified agarose serves as running dye, a 17 cm gel of 1.5 mm thickness requires ~16 h at 14 mA) (Figure 1).
Analyze your protein of interest (e.g. western blotting, MS).
Proteins with intermolecular disulfide bridges appear on the left side of the diagonal, as their apparent weight shrank from the first to the second dimension.
Proteins without disulfide bridges appear directly on the diagonal of your 2D PAGE, as there is no difference in their electrophoresis pattern between the two dimensions.
Proteins with intramolecular disulfide bridges appear on the right side of the diagonal, as their apparent weight increased from the first to the second dimension.
Figure 1. A scheme of the steps 2c - 3i with the results for the proteins described in 3k - 3m.
Recipes
2x cell lysis buffer
~200 ml dH2O
2.24 g KCl
97 mg EDTA
0.89 g Tricine
2.5 ml Triton X-100
Adjust pH to 7.8
Fill up with dH2O to 250 ml
5x non-reducing Laemmli sample buffer
~40 ml dH2O
1.51 g Tris
3.75 g SDS
0.125 g Bromophenol blue
Adjust pH to 6.8
Fill up with dH2O to 50 ml
5x reducing Laemmli sample buffer
Add 0.44 ml beta-mercaptoethanol to 50 ml of 5x non-reducing Laemmli sample buffer
Laemmli electrophoresis buffer
~800 ml dH2O
3.03 g Tris
14.41 g glycine
1.5 g SDS
Fill up with dH2O to 1,000 ml
References
Schwarz, C., Bohne, A. V., Wang, F., Cejudo, F. J. and Nickelsen, J. (2012). An intermolecular disulfide-based light switch for chloroplast psbD gene expression in Chlamydomonas reinhardtii. Plant J 72(3): 378-389.
Stroher, E. and Dietz, K. J. (2008). The dynamic thiol-disulphide redox proteome of the Arabidopsis thaliana chloroplast as revealed by differential electrophoretic mobility. Physiol Plant 133(3): 566-583.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Schwarz, C. and Nickelsen, J. (2013). 2D Diagonal Redox SDS-PAGE of Proteins. Bio-protocol 3(11): e781. DOI: 10.21769/BioProtoc.781.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein > Structure
Biochemistry > Protein > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
782 | https://bio-protocol.org/en/bpdetail?id=782&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Wax Analysis of Stem and Rosette Leaves in Arabidopsis thaliana
Tegan M Haslam
Ljerka Kunst
Published: Vol 3, Iss 11, Jun 5, 2013
DOI: 10.21769/BioProtoc.782 Views: 14243
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Nov 2012
Abstract
The primary aerial surfaces of all land plants are coated by a lipidic cuticle, which restricts non-stomatal water loss and protects the plant from pathogens, herbivores, and ultraviolet radiation. The cuticle is made up of two components: cutin, a polymer of hydroxy- and epoxy- long-chain fatty acid derivatives and glycerol, and cuticular waxes, which are derivatives of very-long-chain fatty acids. While chemical analysis of cutin can be a lengthy and technically challenging task, analysis of cuticular waxes is relatively simple, and can be routinely used to characterize different plant species, adaptations of a given species to environmental conditions, or mutant phenotypes. Here, we present a protocol tailored for the analysis of cuticular waxes on the surface of the model organism Arabidopsis thaliana. Because cuticular waxes are found on the outermost surface of the plant, the wax extraction process is very simple, and sample processing can be completed in less than one day. Chemical analysis involves quantitation of wax monomers by gas chromatography coupled with flame ionization detection (GC/FID), and identification of wax monomers by either mass spectrometry or comparison of retention times of individual wax components to those of known standards.
Keywords: Arabidopsis Cuticle Wax Lipid Gas chromatography
Materials and Reagents
Chloroform, ACS grade (Sigma-Aldrich, catalog number: 319988-4L )
N,O-bis(trimethylsilyl)trifluoroacetamide with trimethylchlorosilane (99:1 BSTFA+TMCS) (Sigma-Aldrich, catalog number: 33148 )
Pyridine, ACS grade (Thermo Fisher Scientific, catalog number: P368-500 )
Tetracosane (solid, for use as an internal standard) (Sigma-Aldrich, catalog number: 87089-1G )
Equipment
Ruler or sticker of known dimensions
Overhead transparent sheets (only needed for leaf wax analysis)
Camera, ideally with a small tripod
Scissors
Forceps
11 ml glass tubes (Wheaton, catalog number: 358606 )
1.5 ml GC vials (Agilent, catalog number: 5182-0715 )
250 μl GC vial inserts (Agilent, catalog number: 5183-2085 )
GC vial rack
100 μl glass syringe (Hamilton, catalog number: 80630 )
500 μl glass syringe (Hamilton, catalog number: 80865 )
Oven
Reacti-Vap evaporator (Thermo Fisher Scientific, catalog number: TS-18825 ) with Reacti-Therm heating module (Thermo Fisher Scientific, catalog number: TS-18822 )
Nitrogen gas (Praxair NI M-T)
Adobe Photoshop
Microsoft Excel
Gas chromatography system
Agilent 7890A GC system with FID
HP1 methyl siloxane column (Agilent, 19091Z-313 )
hydrogen (GC carrier gas and FID fuel) and compressed air (for FID)
Procedure
Note: A few steps of the protocol vary between leaves and stems. Chloroform, pyridine, and BSTFA should all be handled in a fume hood.
Prepare a 1 μg μl-1 internal standard by dissolving 500 μg tetracosane in 500 μl chloroform. If you expect to be analyzing waxes routinely, scale this up to make a large stock, and aliquot known amounts of the stock in 1.5 ml GC vials. Allow the chloroform to evaporate off, seal the vials, and store at 4 °C. Resuspend the aliquots in chloroform to their initial volume as required for immediate use.
Prepare one 11 ml glass tube for each sample you will collect. We recommend using 3-6 technical replicates for each genotype you are investigating. Rinse all glass tubes with chloroform three times before you begin. Then, fill the tubes with approximately 10 ml chloroform, and add 10 μl internal standard to each sample. It is critical to remember to include a set of wild-type samples as a positive control every time you do a wax analysis experiment. Wax load and composition can vary greatly depending on the conditions your plants are grown in, so this control is necessary to distinguish between changes caused by different genotypes vs. changes in the environmental conditions or developmental stage of the plants at the time of harvest. If you wish to check the GC trace of the solvent and standard alone, you can prepare an extra tube at this step, which will not have a tissue sample dipped in it.
STEMS: Stem wax extraction and image capture for surface area calculation. Take care to minimize sample handling, as handling will remove wax from your sample. Use forceps, not your hands, whenever possible.
Cut stems approximately 10cm from the apical meristem, remove leaves and branches, and lie flat on a light, even background with a ruler or item of known dimensions for size comparison. Label each sample by writing on the background. Only one stem for each replicate is needed.
Photograph the samples so that you have all stems, their labels, as well as the ruler or size marker in view (Figure 1). Photographs will be used later to calculate stem surface area.
Dip stems in solvent tubes for 30 s to extract wax. Stems can be thrown out after dipping.
Figure 1. How to collect stem area data. Stems are trimmed and photographed for measurement before dipping in chloroform. The round green sticker was used as a reference for size.
ROSETTE LEAVES: Rosette leaf wax extraction and image capture for area calculation. As with stems, take care to minimize sample handling, and use forceps, not your hands, whenever possible.
Arabidopsis rosette leaves carry approximately 10% of the wax load found on inflorescence stems. Therefore, you will need to collect more leaf tissue to complete your analysis. Aim to collect at least 6 leaves for each replicate. Also, you will likely find more variability in leaf wax composition and load than you will for stem, so using more technical replicates for each genotype (5-8) is advisable.
As rosette leaves of Arabidopsis are often curved and warped, it is difficult to calculate their area based on a 2D image. Our solution is to first dip leaves in chloroform for 30 s, then, after the wax has been extracted and the leaf is limp and coated with solvent, spread the leaf flat on a plastic transparency sheet. The transparency sheet will melt very slightly with the chloroform, helping to hold the leaf flat. Label each sample by writing on the transparency sheet (Figure 2).
Repeat for all leaves for each replicate, and all replicates for each genotype. Photograph the samples after wax extraction, with the labels and ruler or size marker in view. Photographs will be used later to calculate stem surface area.
Try to work quickly, as the leaves will eventually dry out after wax extraction, and your area calculation will be inaccurate if you do not photograph the samples quickly enough.
Figure 2. How to collect leaf area data. Leaves are laid flat (which is sometimes easier if small notches are cut in the leaf blade) and photographed for measurement after dipping in chloroform.
Evaporate off all of the solvent by passing a gentle stream of nitrogen gas from an evaporator manifold over each sample. Clean the steel needles of the manifold in chloroform before and after each use.
Note: A greater flow of nitrogen will not necessarily reduce the time required to evaporate your sample. Use a low flow and position the needles so that there is a shallow dimple in the top of your sample from the outflow of gas. If your sample is splashing or bubbling, you are wasting nitrogen, and risk losing your sample.
After the solvent has dried off, you should be able to see a white film of wax at the bottom of each tube. Resuspend this wax residue in 100-200 μl fresh chloroform using a glass syringe, and transfer to a GC vial insert in a GC vial. Evaporate solvent off as above. Be very careful with the outflow of nitrogen this time; because the vial inserts are narrow, it is very easy to apply too much nitrogen and lose your concentrated sample.
After the solvent has dried off completely, add 10 μl pyridine and 10 μl BSTFA+TMCS to each sample using a glass syringe. Seal the GC vials tightly, and incubate for 1 h in an oven set to 80 °C.
Remove the vials from the oven and allow them to cool to room temperature for 1-2 min. Evaporate off the solvent again as above.
Note: Pyridine, BSTFA, and TMCS will evaporate much more slowly than chloroform.
Resuspend the final derivatized residues in 40 μl chloroform, and seal the GC vials tightly.
Inject samples on the GC column. We use a 2.7:1 split for stem wax analysis, and run leaf waxes in splitless mode. For both, we inject 1 μl sample. The program we use is as follows:
50 °C for 2 min
ramp 40 °C/min to 200 °C
hold 1 min
ramp 3 °C/min to 320 °C
hold 15 min
Calculate the area of your samples. Upload your photos to Adobe Photoshop, and use the magic wand tool to select and record the area of each of your samples and the size marker in pixels. As the size of the marker is known, you can use a simple ratio to determine the 2D areas of your samples in centimeters or inches. For leaves, 2D area is used as is. For stems, the 2D area represents the stem diameter multiplied by length. Therefore, you will need to multiply the 2D area by pi to obtain the surface area for the entire stem.
After the GC has finished running your samples, download your data. Typically, a wild-type sample will be run through GC/MS using the same program as for GC/FID so that you can determine the chemical identities of each of the peaks in your trace from GC/FID. Alternatively, you can compare the peaks in the GC/FID chromatogram from your wild-type sample to a chromatogram where the peaks have been identified, and determine the exact retention times that you expect for each monomer on your system. Identify the peaks for the wax monomers you are interested in, and the internal standard, and copy their retention times and peak areas into a Microsoft Excel spreadsheet. Repeat this for all of your replicates and different genotypes.
10 μg tetracosane standard was added to each sample. Therefore, you can use a ratio with the tetracosane standard mass and peak area and the peak area of each of your wax monomers to determine the mass of each monomer for every sample. Finally, the amount of each monomer is divided by the sample area, so that you express wax monomer amount in μg/cm2 for stems, or μg/dm2 for leaves. If you include all wax monomers in your analysis, you can tally these values to determine the total wax load for each sample.
References
Haslam, T. M., Manas-Fernandez, A., Zhao, L. and Kunst, L. (2012). Arabidopsis ECERIFERUM2 is a component of the fatty acid elongation machinery required for fatty acid extension to exceptional lengths. Plant Physiol 160(3): 1164-1174.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant biochemistry > Lipid
Biochemistry > Lipid > Extracellular lipids
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Qualitative Analysis of Lipid Peroxidation in Plants under Multiple Stress Through Schiff’s Reagent: A Histochemical Approach
Jay Prakash Awasthi [...] Sanjib Kumar Panda
Apr 20, 2018 13198 Views
GC-MS-Based Analysis of Methanol: Chloroform-extracted Fatty Acids from Plant Tissues
Manish Kumar Patel [...] Jitendra Kumar Thakur
Sep 20, 2018 13734 Views
Sorghum bicolor Extracellular Vesicle Isolation, Labeling, and Correlative Light and Electron Microscopy
Deji Adekanye [...] Jeffrey L. Caplan
Oct 5, 2024 267 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
783 | https://bio-protocol.org/en/bpdetail?id=783&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
35S pulse Labelling of Chlamydomonas Chloroplast Proteins
AB Alexandra-Viola Bohne
CS Christian Schwarz
JN Joerg Nickelsen
Published: Vol 3, Iss 11, Jun 5, 2013
DOI: 10.21769/BioProtoc.783 Views: 9652
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Plant Journal Nov 2012
Abstract
35S pulse labelling of proteins is used to attach a radioactive label to newly synthesized proteins, as sulfur is an element that is mainly present in proteins (Fleischmann and Rochaix 1999). Depending on your organism’s uptake mechanisms you need cysteine, methionine or sulfuric acid as a source of radioactive sulfur. This example uses Chlamydomonas cells and H235SO4 (Schwarz et al., 2012).
Keywords: 35S pulse Labelling Chlamydomonas Protein Synthesis Chloroplast Proteins
Materials and Reagents
Strain of interest
Control strains lacking the gene for the proteins of interest (as a negative control)
Tris (Applichem, catalog number: A1379 )
Ammonium chloride (Carl Roth, catalog number: 5470 )
Magnesium chloride (Carl Roth, catalog number: KK36 )
Calcium chloride (Merck, catalog number: 1023780500 )
K2HPO4 (Applichem, catalog number: A1363 )
KH2PO4 (Applichem, catalog number: A1364 )
Na2EDTA (Carl Roth, catalog number: 8043 )
ZnSO4·7H2O (Carl Roth, catalog number: T884 )
H3BO3 (Carl Roth, catalog number: P010 )
MnCl2·4H2O (Carl Roth, catalog number: 0 276 )
FeSO4·7H2O (Carl Roth, catalog number: P015 )
CoCl2·6H2O (Carl Roth, catalog number: T889 )
CuSO4·5H2O (Carl Roth, catalog number: 8175 )
(NH4)6Mo7O24·4H2O (Carl Roth, catalog number: 3666 )
HEPES (Carl Roth, catalog number: HN78 )
Tricine (Carl Roth, catalog number: 6977 )
Methanol (Applichem, catalog number: A3493 )
Cycloheximide (Carl Roth, catalog number: 8682 )
35S sulfuric acid (Hartmann Analytic, catalog number: S-RA-1 )
Liquid nitrogen (Linde, inquire)
Protease inhibitor cocktail (F. Hoffmann-La Roche, catalog number: 04693159001 )
TAP-B (see Recipes)
TAP-B/T(see Recipes)
Hutner trace elements (see Recipes)
Buffer A (see Recipes)
Buffer B (see Recipes)
Equipment
Sterile Erlenmeyer flasks (Brand KG)
Photometer (GE Healthcare)
Hemocytometer (Brand KG)
Microscope (≥ 400x magnification, Leica)
Reaction tubes (Sarstedt)
Screw cap microreaction tubes (Sarstedt)
Microreaction tube centrifuge with cooling capacity (Eppendorf)
Gel dryer (Bio-Rad Laboratories)
Whatman filter paper (GE Healthcare)
Procedure
I. Sulfur deprivation
Grow your strain of interest and the control strains at 23 °C to the early log phase (cell density < 2 x 106 cells/ml).
Spin down your cells (5 min, 1,000 x g, RT) in sterile 50 ml reaction tube and resuspend carefully in 10 ml TAP-B, centrifuge again (5 min, 1,000 x g, RT) and resuspend the cells in 10 ml TAP-B.
Transfer cells to a sterile 25 ml Erlenmeyer flask (it is best to set up the medium in this flasks and put the resuspended cells back in the same flask), shake for 16 h at 23 °C in medium light (30 – 50 μmol x m-2 x s-1).
Spin down your cells (5 min, 1,000 x g, RT) and resuspend carefully in 10 ml TAP-B/T.
Centrifuge again (5 min, 1,000 x g, RT) and resuspend the cells in exactly 10 ml TAP-B/T, transfer cells back to 25 ml Erlenmeyer flask.
Agitate cells for 2 h in the dark (wrap flasks with aluminium foil or cover with cardboard box).
II. Adjustment of cells to the same amount of chlorophyll/cells
Transfer 0.5 ml of the cultures to a microreaction tube (keep the remaining culture shaking in the dark).
Centrifuge tube (2 min, 20,000 x g, 4 °C) and discard supernatant, resuspend pellet thoroughly in 1 ml methanol.
Centrifuge again (1 min, 20,000 x g, 4 °C) and use supernatant for chlorophyll measurement at 652 nm, dilute with methanol (prechilling not necessary) if optical density is higher than 1 (do not forget to adjust your calculation for that dilution factor).
Calculate chlorophyll content:
Adjust Adjust chlorophyll content with TAP-B/T to 80 μg ml-1:
Centrifuge cells (5 min, 1,000 x g, RT) and resuspend carefully in calculated volume of TAP-B/T to get 80 μg Chl/ml.
If your cells are lacking chlorophyll better adjust the cell number than the chlorophyll amount, prepare a 1: 10 dilution of cultures and count the cells (hemocytometer, microscope), spin down cells and adjust cell number to 7.25 x 107 cells/ml (that corresponds to ~ 80 μg Chlorophyll/ml if using a green culture).
III. Pulse
Add 25 μl of cycloheximide stock solution (100 μg/ml, final: 10 μg/ml) per culture to a screw cap tube (cycloheximide is for inhibition of cytosolic protein synthesis).
Take your cultures and prepared tubes and go to fume hood in the radioactive lab (don’t inhale 35S! Release of radioactive gaseous SO2).
Add 225 μl of each culture to the cycloheximide.
Incubate for 10’ in rotary shaker in the dark (covered with cardboard box).
Add 12.5 μl of 35S (H235SO4, 10 mCi/ml).
Light pulse: incubate for 5-20 min in front of a appropriate light source and agitate cells occasionally.
Spin down cells, discard supernatant (radioactive waste) and freeze the tube with the pellet in liquid nitrogen for at least 5 min to stop cellular activity.
IV. Cell lysis
Thaw your cells on ice and keep them on ice from now on.
Add 200 μl of buffer A and break the cells by pipetting up and down for ~ 1 min or sonication (three times 5 pulses at 50% output with 30’’ pauses in between).
Remove soluble material: spin down membranes at 20,000 x g for 25 min at 4 °C, discard supernatant into radioactive waste.
Resuspend membrane pellet with 100 μl of buffer B.
V. Protein electrophoresis
Use a protocol for Laemmli-SDS-PAGE and adjust conditions for your protein depending on its molecular weight, e.g. a 6 M urea-16% polyacrylamide-SDS-PAGE gel for separation of the photosystem II reaction center proteins D1 (encoded by the psbA gene) and D2 (encoded by the psbD gene).
VI. Coomassie staining and drying of gel
Use a protocol for Coomassie Blue staining (to visualize size marker and lanes).
Put gel (upside down) on plastic tray, put Whatman paper (moistened with water) on top, flip over (Figure 1).
Place Whatman paper and gel on top of two more layers of Whatman paper, cover with plastic foil and dry in gel dryer.
VII.Autoradiography
Place phosphor imaging screen on top of your gel and expose for 1-3 days (or use X-ray film for longer time).
Scan screen / develop X-ray film.
Compare bands in your strains of interest with negative controls to identify affected protein, e.g. the band for the photosystem II reaction center protein D1 (encoded by the psbA gene) is missing in the investigated mutants as in the psbA mutant FuD7 in Figure 5 of (Morais et al., 1998).
Figure 1. Scheme of step (VI-2).
Recipes
TAP-B
20 mM Tris
7.5 mM ammonium chloride
0.805 mM magnesium chloride
0.34 mM calcium chloride
0.537 mM K2HPO4
0.463 mM KH2PO4
0.1% Hutner trace elements
Adjust to pH 7 with acetic acid
TAP-B/T
20 mM tris
7.5 mM ammonium chloride
0.805 mM magnesium chloride
0.34 mM calcium chloride
0.537 mM K2HPO4
0.463 mM KH2PO4
Adjust to pH 7 with acetic acid
Hutner trace elements (Hill and Kafer, 2001)
50 g Na2EDTA·2H2O
22 g ZnSO4·7H2O
11.4 g H3BO3
5 g MnCl2·4H2O
5 g FeSO4·7H2O
1.6 g CoCl2·6H2O
1.6 g CuSO4·5H2O
1.1 g (NH4)6Mo7O24·4H2O
Fill up with dH2O to 1,000 ml
Buffer A
10 mM EDTA
10 mM HEPES (pH 7.8)
Protease inhibitor cocktail (according to the manufacturer’s instructions)
Buffer B
10 mM EDTA
10 mM tricine (pH 7.8)
Protease inhibitor cocktail (according to the manufacturer’s instructions)
Acknowledgments
This protocol was adapted from the protocol published by Fleischmann and Rochaix (1999). The work was supported by a grant from the Deutsche Forschungsgemeinschaft to J.N. (grant number Ni390/4-2).
References
Fleischmann, M. M. and Rochaix, J. D. (1999). Characterization of mutants with alterations of the phosphorylation site in the D2 photosystem II polypeptide of Chlamydomonas reinhardtii. Plant Physiol 119(4): 1557-1566.
Hill T. W., Kafer E. (2001). Improved protocols for Aspergillus minimal medium: trace element and minimal medium salt stock solutions. Fungal Gen News 48: 20 -21
Morais, F., Barber, J. and Nixon, P. J. (1998). The chloroplast-encoded alpha subunit of cytochrome b-559 is required for assembly of the photosystem two complex in both the light and the dark in Chlamydomonas reinhardtii. J Biol Chem 273(45): 29315-29320.
Schwarz, C., Bohne, A. V., Wang, F., Cejudo, F. J. and Nickelsen, J. (2012). An intermolecular disulfide-based light switch for chloroplast psbD gene expression in Chlamydomonas reinhardtii. Plant J 72(3): 378-389.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Bohne, A., Schwarz, C. and Nickelsen, J. (2013). 35S pulse Labelling of Chlamydomonas Chloroplast Proteins. Bio-protocol 3(11): e783. DOI: 10.21769/BioProtoc.783.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein > Labeling
Biochemistry > Protein > Labeling
Biochemistry > Other compound > Chlorophyll
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Phosphopeptide Purification Protocol for the Moss Physcomitrella paten
Xiaoqin Wang and Yikun He
Jul 20, 2015 8891 Views
Indirect Immunofluorescence Assay in Chlamydomonas reinhardtii
Takashi Yamano and Hideya Fukuzawa
Jul 5, 2016 12069 Views
Tandem Purification of His6-3x FLAG Tagged Proteins for Mass Spectrometry from Arabidopsis
He Huang and Dmitri Anton Nusinow
Dec 5, 2016 12214 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
784 | https://bio-protocol.org/en/bpdetail?id=784&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of DNA Methylation Changes Surrounding Transposable Elements
Beery Yaakov
KK Khalil Kashkush
Published: Vol 3, Iss 11, Jun 5, 2013
DOI: 10.21769/BioProtoc.784 Views: 10734
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Transposable elements (TEs) are a major component of all genomes, thus the epigenetic mechanisms controlling their activity is an important field of study. Cytosine methylation is one of the factors regulating the transcription and transposition of TEs, alongside Histone modifications and small RNAs. Adapter PCR-based methods [such as Amplified Fragment Length Polymorphism (AFLP)] have been successfully used as high-throughput methods to genotype un-sequenced genomes. Here we use methylation-sensitive restriction enzymes, in combination with PCR on adaptor-ligated restriction fragments, to evaluate epigenetic changes in TEs between genomic DNA samples.
Keywords: DNA methylation Transposable elements TMD Transposon methylation display Cytosine methylation
Materials and Reagents
Two oligonucleotides which form the double-stranded adapter, with an overhang complementary to the overhang of the restriction enzyme used. In the case of HpaII or MspI, the overhang is a 5' CG, and the adapter sequences are 5'-GATCATGAGTCCTGCT-3' and 5'-CGAGCAGGACTCATGA-3'. The two nucleotides at the 5' end of the latter oligonucleotide will constitute the 5' CG overhang, after hybridization of the two sequences (black rectangles in Figure 1, Shaked et al., 2001). These oligonucleotides should be designed such that they do not resemble know sequences in the examined species.
Pre-selective primers, one complementary to the adapter with the addition of a G nucleotide at the 3' end (5'-ATCATGAGTCCTGCTCGG-3'; primer P2 in Figure 1), and the other complementary to the TE of interest (primer P1 in Figure 1). The TE-specific primer should be designed as a reverse-complement of the 5' end of the TE with a Tm=60 °C, between 30-50 bp into the TE (to allow for sequence validation in downstream assays). Restriction enzyme recognition sites (CCGG) between the primer and the 5' end of the TE should be avoided.
Selective primers, one identical to the above TE-specific primer with the addition of a fluorescent tag (e.g. 6-FAM) or radioactive tag (end label with 32P), and one similar to the pre-selective primer complementary to the adapter with the addition of random nucleotides at the 3' end (e.g. 5'-CATGAGTCCTGCTCGGTCAG-3', includes an extra TCAG at the 3' end).
NaCl
T4 DNA ligase and buffer (New England Biolabs, catalog number: M0202 )
Restriction enzymes HpaII and MspI (New England Biolabs, catalog number: R0171 and R0106 )
Taq DNA polymerase and Taq DNA polymerase buffer (EURx, catalog number: E2500 )
MgCl2
dNTP mix
Polynucleotide Kinase (PNK) enzyme and PNK buffer (New England Biolabs, catalog number: M0201 )
Gamma-phosphate (32P)-labeled ATP (or fluorescently-labeled primers)
GS-500 ROX-labeled size standard (for fluorescently-labeled products only) (Applied Biosystems)
Hi-Di Formamide (for fluorescently-labeled products only) (Applied Biosystems, catalog number: 4311320 )
Figure 1. An overview of the TMD method, adapted from (Yaakov and Kashkush, 2011). The method steps include: (a) Restriction of genomic DNA with HpaII (H) or MspI (M); (b) The first round of PCR amplification, using a primer from within the TE (P1) and a primer from the adapter (P2); (c) The second round of PCR amplification, using primer P1 from within the TE, labeled with a radioactive or fluorescent tag, and primer P2 with the addition of random nucleotides at the 3' end; and (d) Electrophoresis of the resulting PCR amplicons on a polyacrylamide gel (in the case of a radioactive tag) or in a capillary fluorescence detection machine (in the case of a fluorescent tag).
Equipment
Thermal cycler
Agarose gel electrophoresis machine
43 cm PAGE machine (Thermo Scientific Owl Aluminum-Backed Sequencer S3S, for radiolabeled products only)
Capillary electrophoresis machine (such as the Applied Biosystems 3730xl DNA analyzer; for fluorescently-labeled products only)
Procedure
Adapter pair preparation
Mix the two adapter oligonucleotides to a final concentration of 250 ng/μl.
Incubate them at 95 °C for 5 min and then at room temperature for 10 min.
Restriction/Ligation
Add to a 0.2 ml tube: 1 μl of 10x ligase buffer, 1 μl of 0.5 M NaCl, 1 μl of the adapter pair 120 units of T4 ligase, 2 units of HpaII or MspI, 300-500 ng of genomic DNA and ddH2O to a final volume of 10 μl.
Mix well and incubate at 37 °C for 2-3 h.
Dilute reaction 1: 10 by adding 90 μl of ddH2O.
This reaction can be stored at -20 °C.
Pre-selective amplification
Add to a 0.2 ml tube: 2 μl of 10x Taq DNA polymerase buffer, 2 μl of 25 mM MgCl2, 0.8 μl of dNTP mix, 1 unit of Taq DNA polymerase, 1 μl of 50 ng μl-1 adapter-specific pre-selective primer, 1 μl of 50 ng/μl transposon-specific primer, 4 μl of Restriction/Ligation reaction products (cut with HpaII or MspI) and ddH2O to a final volume of 20 μl.
Use the thermal cycler to PCR with the following program:
94 °C for 3 min
94 °C for 30 s
60 °C for 30 s
72 °C for 1 min
Return to step b 29 times
Run 10 μl of the resulting products on a 1.5% agarose gel to validate amplification.
Dilute the remaining 10 μl with 190 μl of ddH2O.
This reaction can be stored at -20 °C.
Radiolabeling
For 20 reactions, add to a 0.2 ml tube: 6 μl of ddH2O, 6 μl of transposon-specific primer, 2 μl of 10x PNK buffer, 1 μl of PNK and 5 μl of radiolabeled ATP.
Mix well and incubate at 37 °C for 1 h and then at 70 °C for 10 min.
Selective amplification
Add to a 0.2 ml tube: 2 μl of 10x Taq DNA polymerase buffer, 2 μl of 25 mM MgCl2, 0.8 μl of dNTP mix, 1 unit of Taq DNA polymerase, 1 μl of 50 ng μl-1 adapter-specific selective primer, 1 μl of radiolabeled (or fluorescently labeled) transposon-specific primer, 3 μl of pre-selective amplification PCR products and ddH2O to a final volume of 20 μl.
Use the thermal cycler to PCR with the following program:
94 °C for 2 min.
63 °C for 30 sec (decrease temperature by 1 °C every cycle until 56 °C).
72 °C for 1 min.
Return to step b 32 times.
Run the resulting products on a denaturing 5% polyacrylamide gel (for radio-labeled products, see Figure 2 for an example); or add 0.5 μl of GS-500 ROX-labeled size standard, 1-2.5 μl of PCR product (add less PCR product if fluorescence intensity is too high) and complete to 13 μl with formamide (for fluorescently-labeled products only).
Figure 2. An example (Yaakov and Kashkush, 2011) of an autoradiogram showing TMD products for 6 DNA samples representing two parental plants (P1 and P2) and their allopolyploid offspring (S1-S4). The TE analyzed is a Stowaway-like miniature inverted repeat transposable element (MITE), called Thalos. Arrow (a) shows a change in methylation between S1 and S2, as only the MspI band is present in P1 and S1-S2, but both HpaII and MspI bands are present in S3-S4. The disappearence (b) or appearance (c) of bands can also be seen, which may arise as a result of complete methylation of the restriction site, or a mutation in the restriction or primer binding sites. The total percent methylation of all sites for a given sample analyzed can be calculated by dividing the number of polymorphic sites (those resenting bands for only one restriction enzyme) by the total number of sites (presenting bands for one and both restriction enzymes).
Acknowledgments
The transposon methylation display method (TMD) was adapted from the amplified fragment length polymorphism (AFLP) (Vos et al. 1995), and used first by Shaked et al. (2001). This work was supported by a grant from the Israel Science Foundation (grant # 142/08) to Khalil Kashkush.
References
Kashkush, K. and Khasdan, V. (2007). Large-scale survey of cytosine methylation of retrotransposons and the impact of readout transcription from long terminal repeats on expression of adjacent rice genes. Genetics 177(4): 1975-1985.
Shaked, H., Kashkush, K., Ozkan, H., Feldman, M. and Levy, A. A. (2001). Sequence elimination and cytosine methylation are rapid and reproducible responses of the genome to wide hybridization and allopolyploidy in wheat. Plant Cell 13(8): 1749-1759.
Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M. and et al. (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 23(21): 4407-4414.
Yaakov, B. and Kashkush, K. (2011) Massive alterations of the methylation patterns around DNA transposons in the first four generations of a newly formed wheat allohexaploid. Genome 54: 42-49.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Yaakov, B. and Kashkush, K. (2013). Detection of DNA Methylation Changes Surrounding Transposable Elements. Bio-protocol 3(11): e784. DOI: 10.21769/BioProtoc.784.
Download Citation in RIS Format
Category
Systems Biology > Epigenomics > DNA methylation
Plant Science > Plant molecular biology > DNA > DNA modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Efficient Transient Gene Knock-down in Tobacco Plants Using Carbon Nanocarriers
Gozde S. Demirer and Markita P. Landry
Jan 5, 2021 4800 Views
Faster Bacterial Gene Cloning Using the Brick into the Gateway (BiG) Protocol
Flaviani G. Pierdoná [...] Fabio T. S. Nogueira
Dec 20, 2022 1125 Views
Autolysin Production from Chlamydomonas reinhardtii
Justin Findinier
Jul 5, 2023 528 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
785 | https://bio-protocol.org/en/bpdetail?id=785&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Membrane Potential in Mycobacterium tuberculosis
MC Manbeena Chawla
AS Amit Singh
Published: Vol 3, Iss 11, Jun 5, 2013
DOI: 10.21769/BioProtoc.785 Views: 14650
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Molecular Microbiology Sep 2012
Abstract
DiOC2 (Novo et al., 2000) exhibits green fluorescence in all bacterial cells, but the fluorescence shifts towards red emission as the dye molecules self associate at the higher cytosolic concentrations caused by larger membrane potentials. Proton ionophores such as CCCP destroy membrane potential by eliminating the proton gradient. The magnitude of membrane potentials varies with different bacterial species. For many gram-positive species, including Staphylococcus aureus and Micrococcus luteus, the red:green ratio tends to vary with the intensity of the proton gradient while in many gram-negative bacteria such as Escherichia coli and Salmonella choleraesuis, the response of the dye does not appear to be proportional to proton gradient intensity. Mycobacterium tuberculosis itself is a difficult organism to work with because of its rigid cell wall.
Materials and Reagents
Mycobacterial cells (Mycobacterium tuberculosis)
7H9 broth (Difco, catalog number: 271310 )
Glycerol (Amresco, catalog number: 0854 )
TWEEN®80 (Amresco, catalog number: 0442 )
Middlebrook ADC (albumin-dextrose-catalase) enrichment (BD Biosciences, catalog number: 211886 )
The BacLightTM Bacterial Membrane Potential Kit (Invitrogen, catalog number: B34950 )
Provides the following solution:
DiOC2 (Component A), 1.2 ml of a 3 mM solution in DMSO
CCCP (Component B), 300 μl of a 500 μM solution in DMSO
Phosphate-buffered saline (PBS, Component C), 10 mM sodium phosphate and 145 mM sodium chloride, pH 7.4
Supplenmented 7H9 broth (see Recipes)
Equipment
Incubation shaker
Laminar flow hood
Laboratory centrifuge
Flow cytometer (BD FACSVerseTM System)
Procedure
Culture the mycobacterial cells aerobically in 7H9 broth at 37 °C with shaking (200 rpm) till mid- log phase (OD600 of 0.3).
Filter the required volume of PBS (Component C) through a 0.22 μm pore size membrane, preparing enough for culture dilution and 500 μl per test.
Allow the 3 mM DiOC2 (Novo et al., 2000) and 500 μM CCCP solutions (Components A and B) to come to room temperature before use.
Wash the cells with 1 ml filtered PBS twice. Spin down at a speed of 4,000 rpm for 5 min for each wash.
Dilute the mycobacterial culture to approximately 1 x 106 cells per ml in filtered PBS.
Aliquot 500 μl of the bacterial suspension into a flow cytometry tube for each staining experiment to be performed. Prepare two additional tubes for a depolarized control and an unstained control.
Add 25 μl of 500 μM CCCP (Component B) to the depolarized control sample and mix.
Add 3 μl of 3 mM DiOC2 Component A) to each flow cytometry tube and mix (do not add stain to the unstained control sample). Incubate samples at room temperature for 30 min. Stained samples can be analyzed after 5 min, but signal intensity continues to increase until about 30 min.
Stained bacteria can be assayed in a flow cytometer equipped with a laser emitting at 488 nm. Fluorescence is collected in the green and red channels; filters used for detecting fluorescein and the Texas Red dye, respectively, are generally suitable. The forward scatter, side scatter, and fluorescence should be collected with logarithmic signal amplification.
Instrument adjustments are especially critical for detecting relatively small particles such as bacteria. Use the unstained control sample to locate bacterial populations in the forward and side scatter channels. Use the side scatter as the parameter for setting the acquisition trigger.
After adjusting the flow cytometer as described above, apply the depolarized control sample. Gate on bacteria using forward versus side scatter and adjust fluorescence photomultiplier tube voltages such that the green and red MFI values are approximately equal. Do not set compensation.
While the relative amount of red and green fluorescence intensity will vary with cell size and aggregation, the ratio of red to green fluorescence intensity can be used as a size-independent indicator of membrane potential. The data can also be processed by gating on bacteria using forward versus side scatter, and analyze gated populations with a dot plot of red versus green fluorescence reporting MFI values as linear values, not as channels.
On a ratiometric histogram, set markers around the peaks of interest and record the mean ratio values (Figure 1). For a dot plot of red versus green fluorescence, set regions around the populations of interest and record red and green MFI values for each. To evaluate the data, divide the red population MFI by the green population MFI.
In the flow cytometer, bacteria are identified solely on the basis of their size and stain ability.
Figure 1. Detection of membrane potential in mycobacteria. Red/green ratios were calculated using population mean fluorescence intensities for mycobacteria, incubated with 3 μM DiOC2 for 30 min in either the presence or absence of 25 μM CCCP.
Notes
Carbocyanine dyes, including DiOC2 and CCCP, are inhibitors of respiration. While these dyes do not alter assay results over the recommended staining periods, both DiOC2 and CCCP are toxic to bacterial cells and the cells will not be culturable after even brief exposure.
The cells should be washed properly and any kind of aggregation should be avoided as it might interfere with the assay. In case any aggregates are still observed, allow the tubes to stand for a while so that the clumps can settle down. The sample can be transferred to a fresh tube.
Solutions of the carbocyanine dye DiOC2 (3,3′-diethyloxacarbocyanine iodide) and CCCP (carbonyl cyanide 3-chlorophenylhydrazone) should be protected from light.
Recipes
7H9 broth supplemented with 0.1% glycerol, 0.1% TWEEN®80 and Middlebrook ADC (albumin-dextrose-catalase) enrichment
Acknowledgments
Dr. Amit Singh is a Wellcome- DBT India Alliance Intermediate Fellow. The work was supported by the Wellcome- DBT India Alliance grant, WTA01/10/355.
References
Chawla, M., Parikh, P., Saxena, A., Munshi, M., Mehta, M., Mai, D., Srivastava, A. K., Narasimhulu, K. V., Redding, K. E., Vashi, N., Kumar, D., Steyn, A. J. and Singh, A. (2012). Mycobacterium tuberculosis WhiB4 regulates oxidative stress response to modulate survival and dissemination in vivo. Mol Microbiol 85(6): 1148-1165.
Novo, D. J., Perlmutter, N. G., Hunt, R. H. and Shapiro, H. M. (2000). Multiparameter flow cytometric analysis of antibiotic effects on membrane potential, membrane permeability, and bacterial counts of Staphylococcus aureus and Micrococcus luteus. Antimicrob Agents Chemother 44(4): 827-834.
Novo, D., Perlmutter, N. G., Hunt, R. H. and Shapiro, H. M. (1999). Accurate flow cytometric membrane potential measurement in bacteria using diethyloxacarbocyanine and a ratiometric technique. Cytometry 35(1): 55-63.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Chawla, M. and Singh, A. (2013). Detection of Membrane Potential in Mycobacterium tuberculosis . Bio-protocol 3(11): e785. DOI: 10.21769/BioProtoc.785.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell-based analysis > Ion analysis
Cell Biology > Cell-based analysis > Flow cytometry
Cell Biology > Cell staining > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Measurement of Extracellular Ca2+ Influx and Intracellular H+ Efflux in Response to Glycerol and PEG6000 Treatments
Tao Li and Baodong Chen
Sep 20, 2013 9428 Views
Bacterial Intracellular Sodium Ion Measurement using CoroNa Green
Yusuke V. Morimoto [...] Tohru Minamino
Jan 5, 2017 9376 Views
Live Cell Measurement of the Intracellular pH of Yeast by Flow Cytometry Using a Genetically-Encoded Fluorescent Reporter
Catherine G. Triandafillou and D. Allan Drummond
Jun 20, 2020 3506 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
786 | https://bio-protocol.org/en/bpdetail?id=786&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phalloidin Staining and Immunohistochemistry of Zebrafish Embryos
Michelle F. Goody
Clarissa A. Henry
Published: Vol 3, Iss 11, Jun 5, 2013
DOI: 10.21769/BioProtoc.786 Views: 27642
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Biology Oct 2012
Abstract
Fluorescent conjugated Phalloidin is a stain that allows for visualization of F-actin. In immunohistochemistry, primary antibodies and fluorescent conjugated secondary antibodies can be used to visualize subcellular localization and relative amounts of proteins of interest. Here is a protocol for Phalloidin and antibody staining of zebrafish embryos 5 days old and younger.
Keywords: Muscle Myotendinous junction Antibody
Materials and Reagents
Alexa Fluor 488 or 546 Phalloidin (Life Technologies)
Desired primary antibodies (see Table 1 for information for antibodies commonly used in the Henry Lab)
Alexa Fluor 488, 546, or 633 secondary antibodies (e.g. goat anti-mouse or goat anti-rabbit secondary antibodies, Life Technologies)
Vacuum grease (e.g. Dow Corning High vacuum grease)
10x PBS (see Recipes)
PBS 0.1% Tween-20® (see Recipes)
PBS 2% Tween-20® (see Recipes)
8% PFA (see Recipes)
4% PFA (see Recipes)
Block (see Recipes)
80:20 glycerol:PBS solution (see Recipes)
Equipment
Two fine forceps (e.g. Dumont #5 tweezers)
Two deyolking tools (e.g. insect pin super glued in the end of a glass capillary tube, Figure 1)
Bench rocker
1.5-2 ml Microcentrifuge tubes
Glass Pasteur pipettes
Pipette pump
Micropipettes
Micropipette tips
Microscope slides
Microscope slides
Dissecting microscope
Microscope for image acquisition (e.g. Zeiss Axio Imager running AxioVision software)
Figure 1. Deyolking tools. Deyolking tools can be used to surgically remove the yolk sac from fixed zebrafish embryos. Deyolking tools consist of insect pins (Fine Science Tools, catalog number: 26002-20) super glued into the ends of glass capillary tubes (Sutter Instruments, catalog number: BF100-50-10). The glass capillary tubes are then wrapped in lab tape.
Procedure
Fixation and Phalloidin staining:
Dechorionate embryos with two pairs of fine forceps. Under a dissecting microscope, pinch an embryo’s chorion using a pair of forceps held in one of your hands. With the forceps in your other hand, pinch the chorion near to the original pinch and gently tear the chorion by separating your hands. Repeat pinching and tearing chorions with forceps until the embryos are dechorionated.
Using a pipette pump and glass pipettes, transfer dechorionated embryos into microcentrifuge tubes. Put a maximum of 10 embryos in a single tube. Label the tubes accordingly.
Note: A pipette pump and glass pipette tips can be used for all solution additions and removals in this protocol excluding the addition of primary and secondary antibodies. Gently pipetting the embryos up and down in the glass pipette tip with each solution change improves washing and keeps the embryos from sticking together.
Remove as much liquid as possible from the microcentrifuge tubes.
Wear gloves when working with PFA. Add ~0.5 ml of 4% PFA to each microcentrifuge tube.
Place the microcentrifuge tubes containing fixative on their sides at room temperature on a bench rocker (gently rocking) for 4 h or at 4 °C overnight. Orient the tubes perpendicular to the rocking motion such that the embryos rock from side to side in the tube rather than from cap to bottom.
Remove the fixative and dispose of it in the appropriate waste container.
Rinse the embryos 3 times for 5 min each in ~0.5 ml PBS 0.1% Tween-20®. With each rinse in this protocol, gently resuspend the embryos in the solution to improve rinsing and keep them from sticking together.
Remove the last PBS 0.1% Tween-20® rinse and add ~0.5 ml PBS 2% TritonX-100® to each tube to permeabilize the embryos for Phalloidin staining.
Lay the tubes containing PBS 2% Trition on their sides and gently rock for 1.5 h at room temperature.
Remove the PBS 2% TritonX-100® and use a P20 micropipette to add 19 μl of PBS 2% TritonX-100® to each tube. Use a P20 micropipette to add 1 μl of Alexa Fluor 488 or 546 Phalloidin to each tube (wear gloves when working with Phalloidin).
Lay the tubes on their sides and gently rock (if possible) overnight at 4 °C. From this point on, keep tubes in the dark whenever possible (e.g. under a box lid or wrapped in foil).
Antibody staining with mono/polyclonal antibodies:
Remove Phalloidin from the tubes and add ~0.5 ml of block to each tube.
Rock tubes containing block on their sides in the dark for at least 1 h at room temperature.
Use micropipettes to add block and primary antibody solutions into each tube to obtain the appropriate primary antibody dilution optimized for zebrafish embryo staining. A 1:100 dilution of primary antibody in block is a good place to start. Primary antibody dilutions can range from 1:10 to 1:5,000. Some antibodies may require additional permeabilization steps (e.g. incubation in methanol or acetone at -20 °C, proteinase treatment) prior to the addition of the primary antibody. Some primary antibodies may not be compatible with Phalloidin staining.
Incubate embryos in primary antibody at 4 °C overnight in the dark with tubes on their sides and gently rocking, if possible.
Remove the primary antibody dilution and add in ~0.5 ml block.
Block embryos with tubes on their sides in the dark and gently rocking for ~8 h at room temperature. Additional rinses with block can be added if necessary to reduce non-specific background staining.
Remove block and use micropipettes to add 199 μl of antibody block and 1 μl of the appropriate fluorescent conjugated secondary antibody into each tube. Be mindful of the wavelength of the fluorophore that you used for Phalloidin staining when determining the appropriate secondary antibody to use. Ensure that the secondary antibody used corresponds to whether the primary antibody is monoclonal or polyclonal.
Incubate embryos in this secondary antibody dilution overnight at 4 °C in the dark with tubes on their sides and gently rocking, if possible.
Remove secondary antibody dilution and store embryos in ~0.5 ml PBS 0.1% Tween-20® in the dark. Additional rinses in PBS 0.1% Tween-20® can be added if necessary to reduce non-specific background staining.
Deyolking, Mounting, and Imaging:
Manually deyolk embryos in 1x PBS with two deyolking tools. Use a deyolking tool to orient an embryo on its side. Hold the embryo down by inserting the tip of the deyolking tool held in one hand at a location in between the yolk sac and the embryo’s body. Use the deyolking tool in the other hand to ‘cut’ the yolk sac away from the embryo’s body while keeping the other hand stationary. Once the majority of yolk has been removed, use the pins as desired to clean up and remove any additional yolk sac remnants. Suck up and discard the pieces of yolk sac. Repeat deyolking process until all embryos are deyolked.
Transfer embryos to 80:20 glycerol:PBS. If embryos become dehydrated upon transfer to 80:20 glycerol:PBS, slow washes in increasing concentrations of glycerol may have to be implemented. For example, 1 h long washes in each of 30:70 glycerol:PBS and 60:40 glycerol:PBS may be necessary before transfer to 80:20 glycerol:PBS. Use one deyolked embryo as a test sample and move it from 1x PBS to 80:20 glycerol:PBS. If the shape of the embryo changes, proceed with the incubations listed above for the rest of the embryos.
Dot a glass microscope slide with 4 small dots of vacuum grease such that the dots will hold up the four corners of a square cover slip.
Transfer one embryo and two drops of 80:20 glycerol:PBS onto the microscope slide in the middle of the 4 dots of grease.
Orient the embryo with a deyolking tool so that it is side mounted and flat.
Place the cover slip over the specimen and gently press down on the corners of the cover slip until it is touching the embryo, but not squishing it.
Repeat steps C3-6 until all embryos are mounted. Keep your prepared slides in a slide book in the dark at 4 °C until they are imaged. Image your stained zebrafish embryos within ~2 weeks, the sooner the better. Representative images are shown in Figure 2.
Figure 2. Phalloidin staining representative results. (A) Brightfield image of a deyolked, side mounted zebrafish embryo, anterior left, dorsal top. (B) Fluorescence micrograph of the same embryo showing phalloidin 546 staining. (C) Image of the same embryo taken with the 20x objective on a Zeiss Axio Imager running AxioVision software. Phalloidin 546 staining enables visualization of the actin cytoskeleton of skeletal muscle fibers. For representative images of antibody staining, please refer to (Goody et al., 2010).
Table 1. Antibody staining information for antibodies commonly used in the Henry Lab.
Name Company
Product #
Dilution
Mono/polyclonal
Works withphalloidin®
Extra
permeabiliza-tion®
Beta-Dystroglycan
Novocastra
NCLbDG
1:50
Monoclonal
Yes
No
F59
Developmental StudiesHybridoma Bank (DSHB)
1:10
Monoclonal
Yes
No
Fibronectin
Sigma
F3648
1:50
Polyclonal
Yes
No
Laminin-111
Thermo Scientific
RB-082-A0
1:50
Polyclonal
Yes
No
Paxillin
BD TransductionLaboratories
610051
1:50
Monoclonal
Yes
No
FAK pY397 or pY861
Invitrogen
1:50
Polyclonal
Yes
No
Dystrophin
Sigma
D8043
1:50
Monoclonal
Yes
No
MF20
DSHB
1:10
Monoclonal
Not well
No
F310
DSHB
1:10
Monoclonal
Not well
No
Vinculin
Sigma
V4505
1:10
Monoclonal
Unknown
PBS 2% TritonX-100® for 2.5 hours at room temp
4D9/engrailed
DSHB
1:2
Monoclonal
Yes
10 minutes in acetoneat -20 °C
Beta-catenin
Abcam
Ab6302
1:500
Monoclonal
Unknown
Requires specialfixative (4% PFA, 4% sucrose, 3 mM CaCl2, 1x PBS)
GFP
Molecular Probes
A21311
1:200
Polyclonal
Unknown
2 h fix in 4% PFAat room temp
Recipes
Phosphate Buffered Saline (PBS)
10x PBS
Add to a 1 L bottle
74 g NaCl
19.4 g Na2HPO4.7H2O
4.37 g NaH2PO4.H2O
~800 ml dH2O
Stir until dissolved. Bring volume up to 1 L with dH2O. Autoclave. Dilute 10x PBS to 2x PBS or 1x PBS with dH2O. Store at room temperature.
PBS 0.1% Tween-20®
To 1 L of 1x PBS, add
1 ml of Tween-20®
Mix solution. Store at room temperature.
PBS 2% TritonX-100®
To 1 L of 1x PBS, add
20 ml TritonX-100®
Mix solution. Store at room temperature.
Paraformaldehyde (PFA)
8% PFA
Add to a 50 ml conical tube
4 g PFA
30 ml dH2O
20 drops 1 N NaOH
Gently heat and stir until dissolved. Bring volume up to 50 ml with dH2O. Filter solution through #1 Whatman paper. Add 20 drops 1 N HCl and mix. Store at 4 °C. Use within 1 week.
4% PFA
Add to a 50 ml conical tube
25 ml 8% PFA
25 ml 2x PBS
Mix, then store at 4 °C. Use within 1 week.
Block
Add to a 50 ml conical tube-
2.5 g Bovine Serum Albumin (BSA)
40 ml 1x PBS
Gently heat and stir until BSA is dissolved. Then add
0.5 ml DMSO
0.5 ml TritonX-100®
0.1 g Saponin
Bring up to 50 ml with 1x PBS. Store at 4 °C. Use within 1 week.
80:20 glycerol:PBS
Add to a 50 ml conical tube-
40 ml glycerol
10 ml 1x PBS
Mix solution. Store at room temperature
Acknowledgments
This protocol was adapted from the previous publications: Goody et al. (2010) and Goody et al. (2012). Development of this protocol was supported by NIH grant RO1 HD052934-01A1 to CAH. MFG would like to thank the University of Maine Graduate School of Biomedical Sciences and Engineering for funding.
References
Goody, M. F., Kelly, M. W., Lessard, K. N., Khalil, A. and Henry, C. A. (2010). Nrk2b-mediated NAD+ production regulates cell adhesion and is required for muscle morphogenesis in vivo: Nrk2b and NAD+ in muscle morphogenesis. Dev Biol 344(2): 809-826.
Goody, M. F., Kelly, M. W., Reynolds, C. J., Khalil, A., Crawford, B. D. and Henry, C. A. (2012). NAD+ biosynthesis ameliorates a zebrafish model of muscular dystrophy. PLoS Biol 10(10): e1001409.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Goody, M. F. and Henry, C. A. (2013). Phalloidin Staining and Immunohistochemistry of Zebrafish Embryos. Bio-protocol 3(11): e786. DOI: 10.21769/BioProtoc.786.
Download Citation in RIS Format
Category
Developmental Biology > Morphogenesis
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Fluorescence Microscopy for Cilia in Cultured Cells and Zebrafish Embryos
Jingli Cao [...] Xiumin Yan
Jul 20, 2014 14306 Views
Colocalization Analysis for Cryosectioned and Immunostained Tissue Samples with or without Label Retention Expansion Microscopy (LR-ExM) by JACoP
Xiang Zhao [...] Su Guo
Mar 5, 2022 3398 Views
Long-term in toto Imaging of Cellular Behavior during Nerve Injury and Regeneration
Weili Tian [...] Hernán López-Schier
May 5, 2023 627 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
787 | https://bio-protocol.org/en/bpdetail?id=787&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Motility Assay for Zebrafish Embryos
Michelle F. Goody
Clarissa A. Henry
Published: Vol 3, Iss 11, Jun 5, 2013
DOI: 10.21769/BioProtoc.787 Views: 12006
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Biology Oct 2012
Abstract
Analyzing the swimming ability of 2 days post fertilization zebrafish embryos can be a useful technique to study neuromuscular function. Here is a protocol for determining the time it takes for zebrafish embryos to swim a predetermined distance.
Keywords: Muscle Neuromuscular junction Swimming Escape response
Materials and Reagents
Pipette pump
Glass Pasteur pipette
Overhead transparency sheet
Zebrafish embryo media of choice (Goody et al., 2012)
Embryo ‘poker’ tool (e.g. segment of fishing line super glued in the end of a glass capillary tube, fire polished glass rod)
Figure 1. Embryo poker tool. This is a useful tool for the positioning and touch stimulus of zebrafish embryos. Fishing line (10 lb, 0.012 inch diameter) is super glued into the end of a glass capillary tube (Sutter Instruments, catalog number: BF100-50-10) with approximately 1 cm of overhang. The glass capillary tube is then wrapped in lab tape.
Equipment
Microscope with high-speed, digital video camera attachment (e.g. Zeiss SteREO Discovery.V12 with Zeiss Axiocam HSm)
Video processing software (e.g. Zeiss Axiovision)
60 mm Petri dish
Procedure
A. Preparation:
Print the motility wheel (Figure 2) on an overhead transparency sheet.
Figure 2. Motility wheel. The diameters of these concentric circles provide predetermined distances for zebrafish embryos to swim. The diameters of the circles are, in ascending order: 5 mm, 10 mm, 15 mm, 20 mm.
Place the overhead transparency sheet on the stage of the microscope that will be used to record the videos and adjust the magnification of the microscope such that the edges of the desired concentric circle (e.g. the circle with a 10 mm diameter) are just within the field of view. Do not readjust the magnification setting within a motility assay experiment and use this magnification setting for any subsequent replicates that will be pooled together or compared.
Center a 60 mm Petri dish containing zebrafish embryo media over the concentric circles on the overhead transparency sheet on the microscope stage.
Using a pipette pump and glass Pasteur pipette, transfer one embryo into the Petri dish and use a poker to gently move the embryo into the middle of the concentric circles.
Figure 3. Microscope set up. A 60 mm Petri dish containing embryo media is placed on top of the motility wheel on top of the microscope stage. An embryo poker tool is used to position a zebrafish embryo in the middle of the motility wheel. Photo credit: University of Maine, Mike Mardosa.
B. Video acquisition:
Begin recording a video when the embryo is stationary and in the center of the concentric circles.
Looking through the eyepieces of the microscope, gently poke the tail of the embryo with a poker. Ensure that you are holding the poker such that your hand does not appear in the video.
When the embryo completely exits the predetermined concentric circle, stop the video recording. A normal 2 day old embryo will exit the circle with a 10 mm diameter in approximately 200 milliseconds on the first poke (Goody et al., 2012).
If the embryo does not completely exit the designated circle, use the poker to reposition the embryo in the center of the circles and repeat steps B1-3. After multiple unsuccessful attempts (~10 attempts), it may be determined that the embryo is incapable of exiting the circle and video recording can be stopped.
Repeat these video acquisition steps until videos of all the desired embryos have been recorded.
C. Video analysis:
‘Cut’ the videos to only contain the necessary frames, if desired. Save the videos.
For each video, scroll through the frames and determine the first frame in which the entire body of the embryo has exited the predetermined circle. Record that frame number in a spreadsheet. Scroll back to the beginning frames of that same video and determine the last frame in which the embryo is stationary prior to the touch stimulus. Record that frame number in the spreadsheet.
Repeat step C2 for all the videos.
Determine the time lag that occurs between each of the frames (e.g. 9 ms).
Calculate the time it takes an embryo to swim a predetermined distance in milliseconds by subtracting the beginning frame number from the end frame number and multiplying by the time lag value. Record this value in the spreadsheet.
Repeat step C5 for all the motility videos.
After all the biological replicates for a motility experiment have been completed and analyzed, assign the greatest (i.e. slowest) value recorded within a treatment group to all the embryos in that same treatment group that never successfully exited the designated circle.
Calculate the mean and standard deviation or standard error of the mean for each treatment group and statistically compare the values using an unpaired student’s t-test with unequal variance. For an example experimental result using this motility assay, please refer to (Goody et al., 2012).
Acknowledgments
This protocol was adapted from the previous publication: Goody et al. (2012). Development of this protocol was supported by NIH grant RO1 HD052934-01A1 to CAH. MFG would like to thank the University of Maine Graduate School of Biomedical Sciences and Engineering for funding.
References
Goody, M. F., Kelly, M. W., Reynolds, C. J., Khalil, A., Crawford, B. D. and Henry, C. A. (2012). NAD+ biosynthesis ameliorates a zebrafish model of muscular dystrophy. PLoS Biol 10(10): e1001409.
Westerfield, M. (1993) The Zebrafish Book: A Guide for the Laboratory Use of the Zebrafish (Brachydanio rerio) University of Oregon Press, Eugene.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Developmental Biology > Morphogenesis > Motility
Neuroscience > Sensory and motor systems
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Reproducible Protocol to Measure the Critical Swimming Speed of Adult Zebrafish
Yuma Wakamatsu [...] Hiromi Hirata
Aug 20, 2020 4570 Views
Automated Analysis of Cerebrospinal Fluid Flow and Motile Cilia Properties in The Central Canal of Zebrafish Embryos
Olivier Thouvenin [...] Claire Wyart
Mar 5, 2021 5152 Views
Live Imaging Transverse Sections of Zebrafish Embryo Explants
Eric Paulissen and Benjamin L. Martin
Feb 5, 2024 587 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
788 | https://bio-protocol.org/en/bpdetail?id=788&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
High Resolution Detection of Genetic Changes Associated with Transposons
Beery Yaakov
KK Khalil Kashkush
Published: Vol 3, Iss 11, Jun 5, 2013
DOI: 10.21769/BioProtoc.788 Views: 9704
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Molecular Biology Nov 2012
Abstract
Transposable elements (TEs) are repetitive sequences, capable of inducing genetic mutations through their transpositional activity, or by non-homologous or illegitimate recombination. Because of their similarity and often high copy numbers, examining the effects of mutations caused by TEs in different samples (tissues, individuals, species, etc.) can be difficult. Thus, high throughput methods have been developed for genotyping TEs in un-sequenced genomes. A common method is termed Transposon Display (or transposon SSAP), which utilizes restriction enzymes and PCR amplification to produce chimeric DNA molecules that include genomic and TE DNA. The advent of second generation sequencing technologies, such as 454-pyrosequencing, have dramatically improved the resolution of this assay, allowing the simultaneous sequencing of all PCR products, representing all amplified TE sites in a specific genome.
Keywords: Transposon PCR Sequencing Restriction AFLP
Materials and Reagents
Two oligonucleotides which form the double-stranded adapter, with an overhang complementary to the overhand of the restriction enzyme used. In the case of Mse I, the overhang is a 5' TA, and the adapter sequences are 5'- TACTCAGGACTCAT-3' and 5'- GACGATGAGTCCTGAG-3'. The two nucleotides at the 5' end of the former oligonucleotide will constitute the 5' TA overhang, after hybridization of the two sequences (green rectangles in Figure 1). These oligonucleotides should be designed such that they do not resemble know sequences in the examined species.
Pre-selective primers, one complementary to the adapter with the addition of a C nucleotide at the 3' end (5'-GATGAGTCCTGAGTAAC-3'; primer P2 in Figure 1), and the other complementary to the TE of interest (primer P1 in Figure 1). The TE-specific primer should be designed as a reverse-complement of the 5' end of the TE with a Tm=60 °C, between 30-50 bp into the TE (to allow for sequence validation in downstream assays). Restriction enzyme recognition sites (TTAA) between the primer and the 5' end of the TE should be avoided. Both the adapter- and TE-specific primers should be designed with the linker A and B sequences (for 454-pyrosequencing) at their 5' ends.
NaCl
T4 DNA ligase and buffer (New England Biolabs, catalog number: M0202 )
Restriction enzyme MseI (New England Biolabs, catalog number: R0525 )
Taq DNA polymerase and Taq DNA polymerase buffer (EURx, catalog number: E2500 )
MgCl2
dNTP mix
Figure 1. An overview of the TD-454 pyrosequencing method. (a) The genomic samples are fragmented with a restriction enzyme and ligated to adapters (green rectangles); (b) The fragments undergo PCR with a primer specific to the adapter (containing a 454 linker sequence) and a primer specific to the analyzed TE (containing a 454 linker sequence); (c) The resulting PCR amplicons are sequenced with a 454 pyrosequencer.
Equipment
Thermal cycler
Procedure
Adapter pair preparation
Mix the two adapter oligonucleotides to a final concentration of 250 ng/μl.
Incubate them at 95 °C for 5 min and then at room temperature for 10 min.
Restriction/Ligation
Add to a 0.2 ml tube: 1 μl of 10x ligase buffer, 1 μl of 0.5 M NaCl, 1 μl of the adapter pair, 120 units of T4 ligase, 2 units of Mse I, 300-500 ng of genomic DNA and ddH2O to a final volume of 10 μl.
Mix well and incubate at 37 °C for 2-3 h.
Dilute reaction 1:10 by adding 90 μl of ddH2O.
This reaction can be stored at -20 °C.
Pre-selective amplification
Add to a 0.2 ml tube: 2 μl of 10x Taq DNA polymerase buffer, 2 μl of 25 mM MgCl2, 0.8 μl of dNTP mix, 1 unit of Taq DNA polymerase, 1 μl of 50 ng/μl adapter-specific pre-selective primer,1 μl of 50 ng/ul transposon-specific primer, 4 μl of Restriction/Ligation reaction products (cut with Mse I) and ddH2O to a final volume of 20 μl.
Use the thermal cycler to PCR with the following program:
94 °C for 3 min
94 °C for 30 sec
60 °C for 30 sec
72 °C for 1 min
Return to stage b for 29 times.
Run the relevantly-sized PCR products (usually a narrow band between 150-550 bp, such as 300-500 bp, depending on the expected number of amplicons) in a 454-pyrosequencing machine (Figure 2).
Figure 2. An example of PCR products from pre-selective amplification, using a primer from the adapter and a prom from a Stowaway-like MITE, called Eos, on a 1.5% agarose gel. The lanes include a 100 bp marker (left), pre-selective amplification of goatgrass Aegilops longissima (accession TL05; middle lane) and pre-selective amplification of diploid wheat Triticum urartu (accession TMU06; right lane).
Acknowledgments
The transposon (TD) display method was adapted from the amplified fragment length polymorphism (AFLP) (Vos et al., 1995 Nucl Acid Res 23:4407-4414). This work was supported by a grant from the Israel Science Foundation (grant # 142/08) to Khalil Kashkush.
References
Yaakov, B. and Kashkush, K. (2012). Mobilization of Stowaway-like MITEs in newly formed allohexaploid wheat species. Plant Mol Biol 80(4-5): 419-427.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Yaakov, B. and Kashkush, K. (2013). High Resolution Detection of Genetic Changes Associated with Transposons. Bio-protocol 3(11): e788. DOI: 10.21769/BioProtoc.788.
Download Citation in RIS Format
Category
Systems Biology > Genomics > Transposons
Plant Science > Plant molecular biology > DNA > Genotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
EST-SSR Analysis and Cross-species Transferability Study in Lavandula
Ayelign M. Adal [...] Soheil S. Mahmoud
Aug 5, 2016 9347 Views
Experimental Pipeline for SNP and SSR Discovery and Genotyping Analysis of Mango (Mangifera indica L.)
Michal Sharabi-Schwager [...] Ron Ophir
Aug 20, 2016 10138 Views
Investigation of Transposon DNA Methylation and Copy Number Variation in Plants Using Southern Hybridisation
Vivek Hari Sundar G. and P. V. Shivaprasad
Jun 5, 2022 1393 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
789 | https://bio-protocol.org/en/bpdetail?id=789&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Electroolfactogram (EOG) Recording in the Mouse Main Olfactory Epithelium
Xuanmao Chen
ZX Zhengui Xia
Daniel R. Storm
Published: Vol 3, Iss 11, Jun 5, 2013
DOI: 10.21769/BioProtoc.789 Views: 9014
Reviewed by: Xuecai Ge Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Neuroscience Nov 2012
Abstract
Olfactory sensory neurons in the main olfactory epithelium (MOE) are responsible for detecting odorants and EOG recording is a reliable approach to analyze the peripheral olfactory function. However, recently we revealed that rodent MOE can also detect the air pressure caused by airflow. The sensation of airflow pressure and odorants may function in synergy to facilitate odorant perception during sniffing. We have reported that the pressure-sensitive response in the MOE can also be assayed by EOG recording. Here we describe procedures for pressure-sensitive as well as odorant-stimulated EOG measurement in the mouse MOE. The major difference between the pressure-sensitive EOG response and the odorant-stimulated response was whether to use pure air puff or use an odorized air puff.
Keywords: Olfaction Epithelium EOG Mouse Odorants
Materials and Reagents
3-heptanone (Sigma-Aldrich)
Forskolin (Sigma-Aldrich)
IBMX (3-isobutyl-1-methylxanthine) (Sigma-Aldrich)
SCH202676 (Sigma-Aldrich)
Compressed pure nitrogen air (Praxair Inc)
Thin-wall glass capillary (OD 1.0 mm ID 0.78 mm) (Harvard Apparatus)
C57Bl/6 mice (Charles River or Jackson Lab)
Note: Mice used were 2.5-5 months age-matched males or females. Mice were maintained on a 12 h light/dark cycle at 22 °C, and had access to food and water ad libitum. All animal procedures were approved by the Institutional Animal Care and Use Committee at the University of Washington and performed in accordance with their guidelines.
Ringer’s solution (see Recipes)
Equipment
Dissecting microscope
Faraday cage
Air table
Specimen stage
Nitrogen air tank
Air puff valve (ASCO scientific, catalog number: 330224S303 )
Glass cylinder
Air delivery tube
Oscilloscope
CyberAmp 320 (an electric amplifier) (Axon Instruments)
Recording electrode and reference electrode
Digidata 1332A (Axon Instrument)
MiniDigi 1A processor (Axon Instruments)
S48 Stimulator (Glass Technologies)
Hum Bug (a line frequency noise eliminator) (Quest scientific)
Flow meter (Praxair Inc, Seattle, WA, catalot number: PRS FM43504 )
Horizontal electrode puller, Model p-97 (Sutter Instruments)
Computer
Software
Clampex 10, Clampfit 10, Axoscope 10 (All from Axon Instruments Foster City)
Procedure
A. Preparation of electrodes
Glass capillary electrodes were pulled using a micropipette puller, then filled with Ringer’s solution and connected to the head stage of amplifier.
Silver wire of reference grounding electrode, which was an agar- and Ringer’s solution-filled, was connected to the head stage.
B. MOE dissection
Mice were sacrificed by decapitation. Skin overlying skull and lower jaw were removed with a small scissor.
The rostral part of head was separated from the caudal part with a scissor and was bisected sagittally among midline with a sharp razor blade.
Under a stereomicroscope, the septal cartilage and septum was carefully removed to expose the MOE, one of which was then put on the recording specimen stage. The other side was kept under moist condition for subsequent use.
C. Configuration of EOG recording
A filter paper immersed in Ringer’s solution was used to hold the sample on a plastic specimen stage during recording.
The filter paper was connected to Ringer’s bath solution and also served to connect the recording circuit as the reference electrode was immersed in Ringer’s bath solution.
Humidified nitrogen puff (nitrogen passing over dsH2O in a horizontal glass cylinder) was used because olfactory tissue remained viable for a longer period of time with humidified air. The air-puff was driven by a pressure tank containing compressed ultra-pure nitrogen gas.
Air-puffs were applied to the exposed MOE using an automated four-way slider valve that was controlled by a computer via a S48 stimulator. The duration of air puff was usually 100-200 ms. The tip of the puff application tube was directly pointed to the recording site on the MOE. The distance from tip of the air-puff application tube to surface of the recording turbinate was 1.5-2.0 centimeter.
A flow meter was installed in line to regulate and measure the flow rate of air-puffs.
An oscilloscope was required to calibrate the scale of EOG amplitude. EOG recordings could be performed using various application flow rates (0.03-2.4 L/min), but low flow rate (0.03-0.5 L/min) was physiological relevant in mouse EOG recording.
If studying odorant-stimulated EOG response in the MOE, odorized air was generated by blowing nitrogen air through a horizontal glass cylinder that was half-filled with an odorant, i.e. 3-heptanone at variable concentrations.
D. EOG measurement
The EOG field potential was detected with a Ringer’s solution-filled glass microelectrode in contact with the apical surface of the olfactory epithelia in an open circuit configuration.
Electrophysiological EOG signals were amplified (normally 100x) with a CyberAmp 320 and digitized at 10 kHz or 1 kHz by means of a Digidata 1332A processor or simultaneously through a MiniDigi 1A processor; the signals were acquired online with software pClamp 10.3 and simultaneously with Axoscope 10.
E. Exclusion of artifacts from EOG recording of pressure-sensitive response
Occasionally, artifacts were seen in the EOG recordings due to damaged tissue preparations or other unpredicted reasons. Artifacts could be excluded from pressure-sensitive EOG recording on the basis of following criteria.
Artifacts usually had symmetric rising and decay phases while pressure-sensitive signals had a fast rising phase (about 100 msec) with a relative slow decay phase. The decay phase of pressure-stimulated EOG signals were readily fitted with a mono-exponential function, giving a deactivation time constant of 1,400 msec. Artifacts usually lacked the mono-exponential deactivation phase.
The half-width of maximum response of symmetric artifacts was about 200 msec, which is much shorter than the airflow-sensitive signal (about 600 msec).
Artifacts did not demonstrate amplitude adaptation upon repetitive stimulation, while the air pressure-sensitive response showed adaptation upon rapid repetitive stimulations.
The amplitude of pressure-sensitive responses was much larger than that of artifacts. Pressure-sensitive responses were sensitive to odorants, forskolin/IBMX (that elevate cellular cAMP level), or SCH202676 (a general inhibitor of GPCRs) while artifacts were insensitive to these chemical treatments. Artifacts were more easily to be excluded from odorant-sensitive EOG recording because odorant-sensitive EOG recording was about several folds larger than pressure-sensitive EOG measurement.
F. Data analysis
Data were analyzed with Clampfit 10, and GraphPad Prism 5. The latency and rise time of EOG response could be analyzed with Clampfit 10. The desensitization and deactivation phases of the EOG field potential were fitted with a mono-exponential function f(t)= A0 x exp(-t/τ) + a, where τ is the time constant; A0 is the maximal response, a is residual response. Depending on stimulation protocols (i.e. inter-stimulation interval), olfaction adaption or recovery could be assayed using EOG amplitudes of repetitive odorant/air-pressure stimulation.
The kinetic and amplitude of EOG recording can provide some useful information about how olfactory signals are processed in olfactory sensory neurons.
G.Comparison of pressure-sensitive EOG response with odorant-stimulated EOG response
EOG measurement can be used to study both odorant- and air pressure-stimulated responses in the MOE.
Procedurally the major difference between pressure-sensitive EOG response and odorant-stimulated response was whether to use pure air puff or to use odorized air puff.
Two measurements also have several functional distinctions:
Most of odorant-stimulated EOG measurement more or less contained some portion of pressure-sensitive response because air-phase odorants need an air puff (which exert an air pressure) to be blown onto the surface of MOE.
Odorant-stimulated EOG response is generally higher than pressure-sensitive response although it may depend on dosage of stimulation (i.e. odorant concentration vs. flow rate of air puff).
Pressure-sensitive EOG response was positively correlated with odorant-stimulated EOG response. Most of EOG field potential amplitude varies from 0.5-50 mV depending the odorant concentration, application flow rate and tissue quality.
At high odorant dosage, decay phase of odorant-stimulated EOG response is much slower than that of the pressure-sensitive response.
Pressure-sensitive response and odor-evoked response in the MOE share a common signal pathway, both of which may function synergistically to promote olfaction.
Recipes
Ringer’s solution
125 mM NaCl
2.5 mM KCl
1 mM MgCl2
2.5 mM CaCl2
1.25 mM NaH2PO4
20 mM HEPES
15 mM D-Glucose
pH 7.3
Osmolarity 305
Filter sterilized
Acknowledgments
The EOG recording method described in this protocol was published in Chen et al. (2013). This research was supported by a National Institutes of Health Grant DC0415 (To Dr Daniel R. Storm).
References
Chen, X., Xia, Z. and Storm, D. R. (2012). Stimulation of electro-olfactogram responses in the main olfactory epithelia by airflow depends on the type 3 adenylyl cyclase. J Neurosci 32(45): 15769-15778.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Chen, X., Xia, Z. and Storm, D. R. (2013). Electroolfactogram (EOG) Recording in the Mouse Main Olfactory Epithelium. Bio-protocol 3(11): e789. DOI: 10.21769/BioProtoc.789.
Chen, X., Xia, Z. and Storm, D. R. (2012). Stimulation of electro-olfactogram responses in the main olfactory epithelia by airflow depends on the type 3 adenylyl cyclase. J Neurosci 32(45): 15769-15778.
Download Citation in RIS Format
Category
Neuroscience > Sensory and motor systems
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
79 | https://bio-protocol.org/en/bpdetail?id=79&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunofluorescence (Especially for Cells Growing on a Coverglass)
Hui Zhu
Published: Vol 2, Iss 4, Feb 20, 2012
DOI: 10.21769/BioProtoc.79 Views: 24601
Download PDF
Ask a question
Favorite
Cited by
Abstract
If an antibody for your protein of interest is available, immunofluorscence is a useful method to detect the localization and relative abundance of the protein by using a fluorescence microscope. Immunofluoresence can be used in combination with other, non-antibody methods of fluorescence staining, for example, the use of DAPI to label DNA. This protocol describes setting up an immunofluorescence experiment using cells grown on a coverglass.
Keywords: Protein localization Protein abundance Fluorescence microscope
Materials and Reagents
Primary antibodies: self-produce or commercially order
Note: For self-produce primary antibodies, optimalize antibody concentration at 1-50 µg/ml); Try 5 µg/ml as a starting point. For commercial primary antibodies, usually 1:1,000 dilution as a starting point, and then adjust the working concentration according to the preliminary data.
Secondary antibodies (below are the most common secondary antibodies):
Goat anti-rabbit IgG (Life Technologies, Molecular Probes®/Alexa Fluor® 488, catalog number: A-11008 )
Goat anti-rabbit IgG (Life Technologies, Molecular Probes®/Alexa Fluor® 594, catalog number: A-11012 )
Goat anti-mosue IgG (Life Technologies, Molecular Probes®/Alexa Fluor® 488, catalog number: A-11001 )
Goat anti-mosue IgG (Life Technologies, Molecular Probes®/Alexa Fluor® 594, catalog number: A-11005 )
Goat anti-human IgG (Life Technologies, Molecular Probes®/Alexa Fluor® 488, catalog number: A-11013 )
Goat anti-human IgG (Life Technologies, Molecular Probes®/ Alexa Fluor® 594, catalog number: A-11014 )
Note: We usually dilute commercial secondary antibodies at 1: 200 as a starting point. Make sure to spin down the stock solution of secondary antibody before dilution to prevent precipitated fluorophores from causing high background. We usually aliquot secondary antibody and stored at -20 °C.
4’, 6-diamidine-2-phenylindole dihydrochloride (DAPI) (Boeringer Manheim, 236 276) (make 1 mg/ml stock, 1,000x)
Paraformaldehyde (16% solution) (Electron Microscopy Sciences, catalog number: 15170 )
Methanol (Thermo Fisher Scientific, catalog number: BP 1105-4 )
Coverglasses (12 mm) (Thermo Fisher Scientific, catalog number: 12-545-82 )
Poly-L-lysine (MW 150,000-300,000) (Sigma-Aldrich, catalog number: P1399 )
Fluormount-GTM (mounting solution) (SouthernBiotech, catalog number: 0100-01 )
Nitric acid
Hydrochloric acid
Liquid nitrogen
PBS-BT solution (see Recipes)
Normal goat serum (The Jackson Laboratory, catalog number: 005-000-001 ) (see Recipes)
Equipment
Glass beaker
Petri dishes
UV-irradiate
24-well plate
6-well plate
60 mm dish
Parafilm
Procedure
Preparing coverglasses
Make up 100 ml acid solution in a large glass beaker in the hood.
Note: The acid solution is made of 2 parts of nitric acid and 1 part of HCl, and the color is orange-red.
Put the 12 mm coverglasses into the acid solution one by one so that the coverglasses are evenly washed in the acid.
Let the coverglasses sit in the acid for 2 h or overnight swirling occasionally.
Decant acid solution into another large glass beaker; neutralize acid with NaOH pellets.
Note: With NaOH, the solution will ‘boil’ vigorously, so be careful.
Wash coverglasses with ddH2O until pH goes up to 7.0.
Add sufficient 500 µg/ml poly-L-lysine solution to cover all coverglasses, and sit for 2 h with occasionally swirling.
Decant poly-L-lysine solution (solution can be used repeatedly).
Wash coverglasses 3 times with ddH2O.
Dry each coverglass individually in Petri dishes, avoiding coverglasses stuck to the surface.
Note: If coverglasses are stuck to the surface of a Petri dish, they can be easily removed by adding a small amount of liquid nitrogen.
After dry, put all the coverglasses into a Petri dish and UV-irradiate overnight before first use.
Note: For coverglasses that are stored for a long time, re-irradiate for the sake of sterility.
Growing cells on coverglasses
Split cells onto tissue culture dishes containing coverglasses or chambered slides.
Notes:
We usually put one coverglass in one well of the 24-well plate; or no more than 2 coverglasses in one well of the 6-well plate, or no more than 5 coverglasses in a 60 mm dish.
Pipette up and down or shake the dish to make sure cells are not concentrating in the center of the dish well. Make sure there are no air bubbles between the coverglasses and the tissue culture dish.
Grow cells to 70-100% confluency.
Fixation and permeablization of the cells
Transfer the coverglasses or chambered slides into another tissue plate containing sufficient methanol (-20 °C stock), fix for 10 min or a couple of weeks.
Alternately, transfer cells to another plate including PBS. Discard PBS, adding 200 µl PBS plus 20 µl 16% paraformaldehyde. Shaking the plate for 15 min at room temperature (RT).
Notes:
Transfer to methanol directly, no need to do the PBS wash.
16% paraformaldehyde needs to be stored at -20 °C, the final working concentration is 1.6% here.
Formaldehyde preserves antigens by crosslinking the proteins, it has the advantage of preserving most subcellular antigens in their proper localization and GFP. Methanol precipitates antigens by dehydrating cells, it is useful for observing cytoskeletal elements such as microtubles, actin, and other associated structures, but it destroys GFP.
Carefully transfer the coverglasses or chambered slides from the plates and place cell side up onto secured Parafilm. Wash the coverglasses or chambered slides with 100 µl PBS immediately after transfer, never dry the cells.
Add 100 µl PBS-BT solution to the coverglasses or chambered slides, let sit for 30 min at RT to permeablize and block cells.
Note: For stringent block, 4-6% normal goat serum (NGS) can be used.
Staining and mounting cells
Incubate cells in 40 µl primary antibody (1 µg/ml final primary antibody concentration, dilute in PBS-BT) for 30 min at RT.
Rinse with PBS-BT twice, and then wash with 100 µl PBS-BT twice, 5 min each.
Cells were incubated in 40 µl secondary antibody (1 µg/ml final secondary antibody concentration, dilute in PBS-BT) for 30 min at RT.
Rinse with PBS-BT twice, wash with PBS-BT once, 5 min, and then wash with PBS, 5 min.
Incubate cells in 40 µl DAPI (1 µg/ml final concentration, 1:1,000 dilute in PBS) for 2 min, and then wash with PBS once.
Add 5-10 µl mounting solution to a clean microscope slide for each coverglass, place stained coverglass cell side down onto mounting solution from one edge; allow mounting solution to cover the entire surface of the coverglass, avoiding air bubbles.
Let the mounting solution dry and self-seal for 30 min at RT.
Recipes
PBS-BT solution
10 ml 10x PBS
3 g BSA (to 3%)
1 ml 10% Triton X-100 (to 0.1%)
1 ml 5% NaN3
ddH2O to 100 ml
Stored at 4 °C
Normal goat serum
Make 4-6% solution in PBS
Acknowledgments
This protocol was modified from an immunoprecipitation protocol developed in the laboratory of Dr. Guowei Fang (Department of Biology, Stanford University, Stanford, CA, USA). The protocol was originally developed Dr. Jim Wong. This work was supported by a Burroughs-Wellcome Career Award in Biomedical Research (G.F.) and by grants from National Institutes of Health (GM062852 to G.F.).
References
Wong, J. and Fang, G. (2006). HURP controls spindle dynamics to promote proper interkinetochore tension and efficient kinetochore capture. J Cell Biol 173(6): 879-891.
Zhu, H., Coppinger, J. A., Jang, C. Y., Yates, J. R., 3rd and Fang, G. (2008). FAM29A promotes microtubule amplification via recruitment of the NEDD1-gamma-tubulin complex to the mitotic spindle. J Cell Biol 183(5): 835-848.
Zhu, H., Fang, K. and Fang, G. (2009). FAM29A, a target of Plk1 regulation, controls the partitioning of NEDD1 between the mitotic spindle and the centrosomes. J Cell Sci 122(Pt 15): 2750-2759.
Article Information
Copyright
© 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Protein > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Monitoring Changes in the Oxidizing Milieu in the Endoplasmic Reticulum of Mammalian Cells Using HyPerER
Julia Birk [...] Alex Odermatt
Jul 5, 2021 2722 Views
Co-immunofluorescence of MRPL12 and Nrf2 in HK2 Cells
Yao Lu [...] Yi Liu
Oct 20, 2021 2799 Views
Preparation of Protein Lysates Using Biorthogonal Chemical Reporters for Click Reaction and in-Gel Fluorescence Analysis
Yaxin Xu and Tao Peng
Nov 20, 2024 361 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
790 | https://bio-protocol.org/en/bpdetail?id=790&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Calcium Mobilization Assay to Measure the Activity of Gq-coupled Receptors
HU Hamiyet Unal
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.790 Views: 24912
Reviewed by: Cheng Zhang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Biological Chemistry Jan 2013
Abstract
Calcium mobilization assay is a cell-based second messenger assay to measure the calcium flux associated with Gq-protein coupled receptor activation or inhibition. The method utilizes a calcium sensitive fluorescent dye that is taken up into the cytoplasm of most cells. In some cell lines in which organic-anion transporters are particularly active (e.g. CHO, HeLa), addition of probenecid, an inhibitor of anion transport, is required for retention of this dye in the cells. The dye binds the calcium released from intracellular store and its fluorescence intensity increases. The change in the fluorescence intensity is directly correlated to the amount of intracellular calcium that is released into cytoplasm in response to ligand activation of the receptor of interest. This protocol can be applied to most mammalian cell lines expressing both endogenous and transiently/stably transfected receptors. The method is sensitive enough to be used for low-expressing systems or high throughput screening of target of interest.
Note: The method does not differentiate the Ca2+ mobilization induced by Gqα from the Ca2+ mobilization induced by Gβγ.
Keywords: GPCR Calcium Gq protein FLIPR AT1R
Materials and Reagents
Cells of choice: HEK293 cells stably expressing Angiotensin II Type 1 Receptor (AT1R)
Ligands of choice: Sar1-Angiotensin II (Bachem, catalog number: H1740 )
Poly-L-lysine (Sigma-Aldrich, catalog number: P4707 )
1x phosphate-buffered saline (PBS)
FLIPR Calcium 5 assay kit (Molecular Devices, catalog number: R8185 )
96-well, FlexStation pipet tips, black (Molecular Devices, catalog number: 9000-0911 )
Probenecid (Life Technologies, Invitrogen™, catalog number: P36400 )
Cell growth media (see Recipes)
Equipment
Incubator (5% CO2, 37 °C)
FlexStation® 3 Multi-Mode Microplate Reader (Molecular Devices)
Assay plate: 96-well microplate, tissue culture treated, black/clear, with lid (Greiner bio one, catalog number: 655090 )
Ligand plate: Clear 96-well microtest plate, tissue culture treated, U-bottom (BD Biosciences, Falcon®, catalog number: 353077 )
Software
SoftMax® Pro Microplate Data Acquisition & Analysis Software (supplied with the FlexStation® 3 Multi-Mode Microplate Reader)
Procedure
Preparing the assay plate:
Pre-coat the assay plate with 0.01% poly-L-lysine (50 μl/well) for 30 min at 37 °C (or 2 h at room temperature).
Remove and wash excess poly-L-lysine with PBS.
Prepare uniform suspension of cells of choice expressing the receptor and seed 50,000 cells per well in 50 μl medium.
Notes:
a. The cell number needs to be optimized for a particular cell line so that a 90% to 100% confluent cell monolayer is formed on the day of the assay.
b. If the cell line is transiently transfected with the receptor of interest, it is useful to measure the expression level of the receptor on the plasma membrane.
Incubate the cells overnight at 37 °C, 5% CO2.
Aspirate the medium and add 100 μl serum-free medium into each well. Incubate the cells for 2 h at 37 °C in the CO2 incubator.
Prepare the FLIPR loading dye by mixing 10 ml of component A with component B (see manufacturer's instructions for more details) and mix well.
Note: If your cells require probenecid, add probenecid into the loading dye at a final working concentration of 2.5 mM. Probenecid by Invitrogen is water-soluble and dissolves quickly in assay buffer. Probenecid should be added freshly on the day of the experiment.
Remove the assay plate from the CO2 incubator. Do not aspirate serum free medium. Add an equal volume (100 μl) of FLIPR loading dye into each well and incubate for 30 min at 37 °C, 5% CO2 followed by a 30 min incubation at room temperature if the assay will be performed at room temperature. The plate can be incubated at 37 °C, 5% CO2 for an hour if the assay will be performed at 37 °C.
Note: The incubation time and temperature needs to be optimized for a particular cell line.
After incubation transfer the assay plate to the FlexStation® 3 Multi-Mode Microplate Reader.
Note: The temperature should be set to optimum assay condition.
Preparing the ligand plate:
Prepare ligands (activator/inhibitor) at 5x concentration in 1x PBS in a final volume of 200 μl in ligand plate.
Notes:
You can test either one or several different concentrations of ligand of interest.
You need to have at least duplicates of each ligand concentration to do a statistical analysis of the data.
Plan your experiment carefully so that the ligand plate should be loaded by the time the cells are ready to be assayed.
Setting up the instrument (FlexStation® 3 Multi-Mode Microplate Reader):
Place the assay plate, the ligand plate and the pipette tips as directed by the manufacturer's instructions.
Open the SoftMax® Pro Microplate Data Acquisition & Analysis Software.
Click on settings and select the FLEX mode. Recommended experimental setup parameters are given below:
Read mode: Fluorescence
Wavelengths: Ex: 485; Em: 525; Cut off: Auto (515)
Sensitivity: High (Choose medium or low sensitivity if you expect very strong signals, especially with cell lines stably overexpressing the receptor.)
Timing: 120 s reading with an interval of 2 sec (or choose accordingly)
Assay plate type: 96 well Greiner blk/clr btm
Wells to read: entire plate (or choose accordingly)
Compound transfer:
Initial volume: 200 μl
Transfers: 1 (or choose accordingly for multiple transfers)
Pipette height: 220 μl (adjusted slightly more than initial volume)
Pipette volume: 50 μl (to make the final volume of the ligand in the assay plate as 1x)
Rate: 1
Time point: 18 sec (or choose accordingly)
Compound source: Costar 96 well Ubtm clr. 3 ml
Autocalibrate: on
Autoread: off
Read
Representative data
Figure 1. HEK293-AT1R cells stimulated with (well H1) and without (well A1) 1 μM Sar1-Angiotensin II at 18th second. The decrease in the signal with time is most likely resulted from receptor internalization.
Recipes
Cell growth media (for HEK293 cells stably expressing Angiotensin II Type 1 Receptor (AT1R)) Dulbecco's modified eagle medium (DMEM) supplied with 10% fetal bovine serum (FBS).
Acknowledgments
This work was supported by the National Institutes of Health grants HL47570 and HL115964 (Sadashiva Karnik, Ph. D.) and National Research Service Award HL007914 (Hamiyet Unal, Ph. D.).
References
Unal, H., Jagannathan, R., Bhatnagar, A., Tirupula, K., Desnoyer, R. and Karnik, S. S. (2013). Long range effect of mutations on specific conformational changes in the extracellular loop 2 of angiotensin II type 1 receptor. J Biol Chem 288(1): 540-551.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Unal, H. (2013). Calcium Mobilization Assay to Measure the Activity of Gq-coupled Receptors. Bio-protocol 3(12): e790. DOI: 10.21769/BioProtoc.790.
Unal, H., Jagannathan, R., Bhatnagar, A., Tirupula, K., Desnoyer, R. and Karnik, S. S. (2013). Long range effect of mutations on specific conformational changes in the extracellular loop 2 of angiotensin II type 1 receptor. J Biol Chem 288(1): 540-551.
Download Citation in RIS Format
Category
Cell Biology > Cell-based analysis > Ion analysis > Calcium
Cell Biology > Cell staining > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Measurement of Extracellular Ca2+ Influx and Intracellular H+ Efflux in Response to Glycerol and PEG6000 Treatments
Tao Li and Baodong Chen
Sep 20, 2013 9428 Views
Analyzing the Quenchable Iron Pool in Murine Macrophages by Flow Cytometry
Michael Riedelberger and Karl Kuchler
Mar 20, 2020 4850 Views
Double Labeling of PDGFR-β and α-SMA in Swine Models of Acute Kidney Injury to Detect Pericyte-to-Myofibroblast Transdifferentation as Early Marker of Fibrosis
Alessandra Stasi [...] Giuseppe Castellano
Oct 5, 2020 2829 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
791 | https://bio-protocol.org/en/bpdetail?id=791&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA-Seq Library Generation from Rare Human Cells Isolated by FACS
SG Sofia Gkountela
AC Amander T. Clark
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.791 Views: 12335
Reviewed by: Lin Fang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Nature Cell Biology Jan 2003
Abstract
High throughput RNA Sequencing has revolutionized transcriptome analyses. However, most available protocols require micrograms of RNA rendering this technique not feasible for analyzing small numbers of cells, including precious rare cell types isolated from human tissues or organs. Here, we used an RNA Amplification System and describe a method for preparing RNA sense-strand cDNA libraries compatible with an Illumina sequencing platform starting from limited numbers of human fetal germ cells as well as human embryonic stem cells (hESCs) isolated using Fluorescence Activated Cell Sorting (FACS). With this protocol we generated seven RNA-Seq libraries starting from 4,000 germ cells sorted from fetal ovaries (n = 2) and fetal testes (n = 2) at 16-16.5 weeks of development and 4,000 sorted hESCs (n = 3). We predict that multiplexed libraries can also be generated by replacing the single-plex 3’ adapter used here with a multiplexing compatible 3’ adapter and indexed PCR primers.
Keywords: PGC Human Germ-cell RNA-Seq
Materials and Reagents
RNeasy Micro Kit (QIAGEN, catalog number: 74004 )
WT-Ovation Pico RNA Amplification System (Nugen, catalog number: 3300 )
WT-Ovation Exon Module (Nugen, catalog number: 2000 )
Qubit dsDNA HS Assay Kit (Life Technologies, Invitrogen™, catalog number: Q32851 )
Tris-EDTA pH 8.0, molecular biology grade (Life Technologies, Ambion®, catalog number: AM9849 )
TruSeq DNA Sample Preparation Kit (Illumina, catalog number: FC-121-2001 )
MinElute PCR Purification Kit (QIAGEN, catalog number: 28004 )
QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704 )
Certified Low Range Ultra Agarose (Bio-Rad Laboratories, catalog number: 161-3107 )
Equipment
BD FACSAria Fluorescence activated cell sorter
NanoDrop 1000
PCR Thermal Cycler
Sonic Dismembrator 550 (Thermo Fisher Scientificc)
Microtip (Misonix Inc, catalog number: 419 )
Fluorometer
Agarose gel running apparatus and UV-light transilluminator
Illumina HiSeq 2000
Figure 1. Overview of the protocol and main reagents used
Procedure
Sort 4,000 cells directly in 75 μl of RLT buffer (Qiagen RNeasy Micro Kit) using BD FACSAria cell sorter.
Isolate total RNA from sorted cells using the RNeasy Micro Kit according to manufacturer’s protocol without the addition of β-mercaptoethanol to RLT buffer. Perform on column DNA digestion for 15 min according the manufacturer’s instructions using the DNase that is provided with the RNeasy Micro Kit and elute in 14 μl of RNase/DNase free water. Yield of total RNA using a NanoDrop 1000 ranges between 30-80 ng.
Amplify RNA and generate cDNA with complementary sequences to the original mRNA using the WT-Ovation Pico RNA Amplification System according to manufacturer’s instruction. Expected yield of amplified cDNA measured on a NanoDrop 1000 is between 5-10 μg. A quality control step can be included at this point by performing Real-Time PCR for known transcripts that are expected to be present in the amplified cDNA pool.
Generate sense-strand cDNA targets from 3 μg of complementary sequence cDNA using the WT-Ovation Exon Module kit according to manufacturer’s instructions.
Sonicate 3 μg of sense-strand cDNA that is diluted to a final volume of 400 μl Tris-EDTA pH 8.0 buffer to generate cDNA fragments in the 200-500 bp range. Sonication with Sonic Dismembrator 550 and a 419 Microtip is performed on ice with six pulses of 20 sec each (magnitude setting of 3) and a 60 sec rest interval.
Quantify sense-strand sonicated cDNA on a fluorometer using the Qubit HS dsRNA assay kit according to manufacturers’ instructions and aliquot 30 ng for generating the Sequencing library.
Perform End Repair (Reagents are part of the TruSeq DNA Sample Preparation Kit)
Sense-strand cDNA (30 ng)
30 μl
Water
10 μl
T4 DNA Ligase Buffer with 10 mM ATP
5 μl
10 mM dNTP mix
2 μl
T4 DNA Polymerase (3 U μl-1)
1 μl
Klenow DNA Polymerase (1 U μl-1 diluted with water)
1 μl
T4 PNK (10 U μl-1)
1 μl
20 °C 30 min on a thermal cycler
Purify using the MinElute PCR Purification Kit according to manufacturer’s instructions and elute in 34 μl of RNase/DNase free water. Use all eluted cDNA in following step.
Adenylate 3’ ends (Reagents are part of the TruSeq DNA Sample Preparation Kit)
cDNA
34 μl
10x Klenow buffer
5 μl
1 mM dATP
10 μl
Exo-Klenow (5 U μl-1)
1 μl
37 °C 30 min on a thermal cycler
Purify using the MinElute PCR Purification Kit according to manufacturer’s instructions. Elute with 10 μl of RNase/DNase free water.
Ligate paired-end adapters (reagents are part of the TruSeq DNA Sample Preparation Kit)
cDNA
10 μl
2x Ligase buffer
15 μl
Adapter oligo mix (1/10 dilution in water)
1 μl
DNA ligase
4 μl
Room temperature 15 min
Purify the ligation reaction using the MinElute PCR Purification Kit according to manufacturer’s instructions.
Size select the cDNA library by running the purified PCR product through a 1.5% Agarose Gel, cutting a smear in the range of 150-300 bp, purifying using the QIAquick Gel Extraction Kit according to manufacturer’s instructions and eluting with 36 μl of RNase/DNase free water. Note that DNA concentration is very low therefore there is no visible DNA band on the gel.
PCR amplification of the adapter modified DNA fragments (Reagents are part of the TruSeq DNA Sample Preparation Kit)
DNA
36 μl
5x Phusion buffer
10 μl
10 mM dNTPs
1.5 μl
PCR primer 1.1
1 μl
PCR primer 1.2
1 μl
Phusion DNA Polymerase (2 U μl-1)
0.5 μl
Use the following protocol on a thermal cycler
98 °C 30 sec
18 cycles of
98 °C 10 sec
65 °C 30 sec
72 °C 30 sec
72 °C 5 min
4 °C hold
Validate library by running the amplified DNA through a 1.5% Agarose Gel. The majority of the amplified cDNA should appear between the 150-300 bp range. Primer dimers and adapters appear at the 30-60 bp range.
Purify library by gel extracting the DNA that appears in the 150-300 bp range using the QIAquick Gel Extraction Kit according to manufacturer’s instructions and eluting with 15 μl RNase/DNase free water (Figure 2). Quantify library final yield on a fluorometer using the Qubit HS dsDNA assay according to manufacturer’s instructions. The libraries generated using this protocol yielded between 200-700 ng.
Figure 2. Example of gel extracted band alongside 100 bp ladder. Adapters visible around 30-60 bp.
A quality control step can be included at this point by performing Real-Time PCR for known transcripts that are expected to be present in the generated library. If a quality control step was performed at step 3, before generating the library, the results should be similar.
Run the cDNA library on an Illunina HiSeq 2000. Alignment statistics for all samples analyzed as well as correlation scores on the 3 replicates of hESC RNA-Seq libraries are shown in Tables 1 and 2.
Table 1. Alignment statistics
Sample
Total reads
Uniquely aligned reads (% total)
Testis 16 wk
116,399,186
35,497,900
30.5
Testis 16.5 wk
153,982,474
37,907,565
24.6
Ovary 16 wk
102,837,931
44,784,216
43.5
Ovary 16.5 wk
211,659,065
93,766,963
44.3
hESCs 1
161,037,803
39,339,764
24.4
hESCs 2
133,355,463
38,571,046
28.9
hESCs 3
104,997,235
37,164,448
35.4
Table 2. Correlation scores for hESC RNA-Seq libraries
hESCs 1
hESCs 2
hESCs 3
hESCs 1
1
0.96
0.96
hESCs 2
0.97
1
0.97
hESCs 3
0.96
0.97
1
Acknowledgments
A.T.C. is supported by funds from the NIH/NICHD 2 R01 HD058047.
References
Gkountela, S., Li, Z., Vincent, J. J., Zhang, K. X., Chen, A., Pellegrini, M. and Clark, A. T. (2013). The ontogeny of cKIT+ human primordial germ cells proves to be a resource for human germ line reprogramming, imprint erasure and in vitro differentiation. Nat Cell Biol 15(1): 113-122.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Gkountela, S. and Clark, A. T. (2013). RNA-Seq Library Generation from Rare Human Cells Isolated by FACS. Bio-protocol 3(12): e791. DOI: 10.21769/BioProtoc.791.
Download Citation in RIS Format
Category
Systems Biology > Transcriptomics > RNA-seq
Molecular Biology > RNA > RNA sequencing
Stem Cell > Embryonic stem cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Updated Pseudo-seq Protocol for Transcriptome-Wide Detection of Pseudouridines
Yi Pan [...] Paul L. Boutz
May 5, 2024 331 Views
Linearly Amplified Single-Stranded RNA-Derived Transcriptome Sequencing (LAST-seq)
Jun Lyu and Chongyi Chen
Jun 5, 2024 445 Views
Single Cell Isolation from Human Diabetic Fibrovascular Membranes for Single-Cell RNA Sequencing
Katia Corano Scheri [...] Amani A. Fawzi
Oct 20, 2024 306 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
792 | https://bio-protocol.org/en/bpdetail?id=792&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
LC3B Labeling on Terrestrial Isopod Adipocytes
CB Christine Braquart-Varnier
MR Maryline Raimond
MS Mathieu Sicard
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.792 Views: 9998
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Aug 2012
Abstract
The LC3B protein plays a critical role in autophagy. Normally, this protein resides in the cytosol, but following cleavage and lipidation with phosphatidylethanolamine, LC3B associates with the phagophore. This localization can be used as a general marker for autophagic membranes. To visualize the LC3B, we used the LC3B Antibody Kit for Autophagy (Invitrogen). As this kit was designed to work with cell coming from cell culture it was not possible to perform it on compact tissues such as nerve cord or ovaries. We thus adapted LC3B labeling initial protocol to be able to label autophagic membranes of adipocytes from terrestrial isopods which form a loose tissue that can be more easily penetrated by antibodies. The following protocol permits a visualization of the autophagic vesicles directly in terrestrial isopod cells freshly sampled in animals.
Materials and Reagents
LC3B Antibody kit for autophagy (Life Technologies, Invitrogen™, catalog number: L10382 )
Alexa fluor 555 goat anti-rabbit IgG (H + L) (2 mg/ml) (Life Technologies, Invitrogen™, catalog number: A21428 )
Formaldehyde
BSA
DAPI (2.5 μg/ml) (Sigma-Aldrich)
AF1 antifading-25 ml (Citifluor, England)
Pincers for dissection
Pap Pen Liquid Blocker Super Pap Pen (Daido Sangyo Co. Ltd, Japan)
Glass slide
Blocking buffer (see Recipes)
Terrestrial isopod Phosphate buffered saline (PBS) (see Recipes)
Fixative (see Recipes)
Permeabilization reagent (see Recipes)
Equipment
Black box
Epifluorescent microscope (Axio Observer-A1, Zeiss) with Apotome (structured illumination) equipped with a 63x/1.25 objective (oil immersion) and with the AxioVision 4.8.1 software (Zeiss)
Procedure
Dilute the LC3B rabbit polyclonal antibody in blocking buffer to prepare 0.5 μg/ml working solution (1 μl stock solution in 1,999 μl of blocking buffer).
Draw a well (of a diameter of around 1 cm) with a liquid repellent pen on glass slide.
Dissect the terrestrial isopod and collect fat tissue especially those surrounding the nerve cord (a length of around 6 mm) (Figure 1).
Figure 1. Location of the nerve cord in Porcellio dilatatus (A) and the nerve cord surrounded by adipocytes (Ad) once collected (B).
Deposit the nerve cord surrounded by adipocytes (fat tissue) on the middle of the drawn well.
Add 150 μl of the 3.7% formaldehyde fixative in terrestrial isopod PBS onto the tissue.
Incubate 15 min in a black box containing a humid paper at room temperature (RT).
Remove the fixative and wash the tissue three times with terrestrial isopod PBS (5 min with 150 μl of PBS by washing).
Remove the PBS after the last wash.
Prepare 0.2% Triton X-100 in terrestrial isopod PBS and apply 150 onto the fat tissue.
Be careful of not dissolving the liquid repellent pen for the tissue to be always immerged in the solution.
Incubate in a black box with humid paper at 15 min RT.
Draw a well (~1 cm diameter) with a liquid repellent pen on a fresh glass slide.
Collect the fat tissue with forceps and transfer it onto the fresh slide.
Add 150 μl of the diluted primary antibody prepared in step 1 onto the fat tissue.
Incubate 60 min in a black box containing a humid paper at RT.
Remove the primary antibody solution and wash the tissue three times with terrestrial isopod PBS (5 min with 150 μl of PBS by washing).
Remove the PBS after the last washing.
Dilute the goat anti-rabbit secondary antibody in blocking buffer to prepare 5 μg/ml working solution (1 μl stock solution in 399 μl of blocking buffer).
Add 150 μl of goat anti-rabbit secondary antibody onto the fat tissue.
Incubate 60 min in a black box with humid paper at RT.
Remove the anti-goat secondary antibody solution and wash the cells three times with terrestrial isopod PBS (5 min with 150 μl of PBS by washing).
Mount the preparation in a mixture of DAPI (2.5 mg/ml) to label the nuclei and Citifluor (AF1 antifading).
Detection was performed with epifluorescent microscope with apotome equipped with a 63x/1.25 objective (oil immersion) and with the AxioVision 4.8.1 software (Figure 2).
Figure 2. Observation of LC3B labeling in adipocytes collected from Porcellio dilatatus infected with the Wolbachia strain wVulC (Le Clec’h et al., 2012).
Recipes
Terrestrial isopod PBS
137 mM NaCl
1.5 mM Na2HPO4
8 mM KH2PO4
3 mM KCl
pH 7.4
Blocking buffer
BSA 1% diluted in terrestrial isopod PBS
Fixative
3.7% formadehyde in terrestrial isopod PBS
Permeabilization reagent
0.2% Triton X-100 in terrestrial isopod PBS
Acknowledgments
We thank all the technical staff of the UMR EBI CNRS 7267. We also thank Winka Le Clec’h for her valuable comments on the protocol. This work was supported by the Agence Nationale de la Recherche (ADaWOL ANR-09-JCJC-0109-01 coordinated by Mathieu Sicard).
References
Chevalier, F., Herbiniere-Gaboreau, J., Bertaux, J., Raimond, M., Morel, F., Bouchon, D., Greve, P. and Braquart-Varnier, C. (2011). The immune cellular effectors of terrestrial isopod Armadillidium vulgare: meeting with their invaders, Wolbachia. PLoS One 6(4): e18531.
Le Clec'h, W., Braquart-Varnier, C., Raimond, M., Ferdy, J. B., Bouchon, D. and Sicard, M. (2012). High virulence of Wolbachia after host switching: when autophagy hurts. PLoS Pathog 8(8): e1002844.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Braquart-Varnier, C., Raimond, M. and Sicard, M. (2013). LC3B Labeling on Terrestrial Isopod Adipocytes. Bio-protocol 3(12): e792. DOI: 10.21769/BioProtoc.792.
Le Clec'h, W., Braquart-Varnier, C., Raimond, M., Ferdy, J. B., Bouchon, D. and Sicard, M. (2012). High virulence of Wolbachia after host switching: when autophagy hurts. PLoS Pathog 8(8): e1002844.
Download Citation in RIS Format
Category
Cell Biology > Cell staining > Protein
Biochemistry > Protein > Labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Cell Type-specific Metabolic Labeling of Proteins with Azidonorleucine in Drosophila
Ines Erdmann [...] Daniela C. Dieterich
Jul 20, 2017 7532 Views
Click Chemistry (CuAAC) and Detection of Tagged de novo Synthesized Proteins in Drosophila
Kathrin Marter [...] Daniela C. Dieterich
Jan 20, 2019 9895 Views
Molecular and Phenotypic Characterization Following RNAi Mediated Knockdown in Drosophila
Saurabh Jayesh Kumar Mehta [...] Ram Kumar Mishra
Feb 20, 2021 4089 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
793 | https://bio-protocol.org/en/bpdetail?id=793&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Amino Acid Transport Assays in Resting Cells of Lactococcus lactis
HT Hein Trip
JL Juke S. Lolkema
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.793 Views: 8494
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Bacteriology Jan 2013
Abstract
Many bacteria are auxotrophic for at least a number of amino acids for which they lack the biosynthetic pathways. The organisms are still able to grow in media containing free amino acids as the sole source of amino acid when transport systems for the free amino acids are present in the cytoplasmic membrane. A range of transport systems for essential as well as non-essential amino acids has been described that use the proton motive force (by proton symport) or ATP hydrolysis as driving force to allow for the accumulation of the amino acid in the cells. The most widely used assay for uptake of amino acids (or any other substrate) is the rapid filtration assay using radiolabelled substrates. Here we describe the assay for uptake in resting cells of Lactococcus lactis (L. lactis) that are energized by glucose.
Keywords: Lactococcus lactis Amino acid Transport Resting cells Radiolabelled
Materials and Reagents
L. lactis cells
Whatman, Protran® BA85 Nitrocellulose Membranes (2.5 cm diameter, 0.45-μm-pore-size nitrocellulose filter ) (Sigma-Aldrich, catalog number: Z670634 )
LiCl
K2HPO4
KH2PO4
14C-labelled amino acids (PerkinElmer)
Note: stock solutions typically contain 50-100 mCi/ml corresponding to 100 to 500 μM concentrations.
Scintillation fluid (e.g. Emulsifier Scintillator Plus, Packard Bioscience)
100 mM potassium phosphate (KPi) pH 5.8 buffer at 4 °C (see Recipes)
KPi containing 0.2% glucose at 4 °C (see Recipes)
Equipment
Filtration setup (e.g. Ten-place filtration manifold, catalog number: FH225V )
Vacuum pump
Thermostat water bath with magnetic stirrer
Liquid scintillation analyser (e.g. Tri-Carb 2000CA, Packard Instruments)
Glass tubes (10 x 75 mm)
Tweezers
Magnetic stirring bars
Timer
Vortex
Procedure
L. lactis cells harvested in the late exponential growth phase between OD660 of 0.6 and 1.0, washed and resuspended to OD660 of 2 in potassium phosphate (KPi) buffer, kept on ice.
Homogenize cell suspension by briefly vortexing.
Distribute alliquotes of 100 μl of the cell suspension over 5 glass tubes. Keep on ice.
Incubate one of the tubes for 5 min at 30 °C under continuous stirring.
Mount filter in setup and apply vacuum.
At t = 0, add 1 μl of the 14C-labelled amino acid stock solution to the cells in each of the five tubes giving 1-5 μM concentrations.
At each of the time points t = 0.5, 1, 2, 4 min, add 2 ml of ice cold 0.1 M LiCl and filtrate cells over the nitrocellulose filter. For most amino acids these four time points cover a complete uptake curve. Occasionally, other time points may have to be selected.
Immediately rinse tube with another 2 ml of 0.1 M LiCl and filtrate over the same filter.
Remove vacuum, and transfer filter with tweezer to a 2 ml Eppendorf tube and put a new filter back to the filtration setup for the next sample.
For the zero time point (final tube), skip the incubation at 30 °C (step 3); add the radioactivity to the cell suspension on ice , immediately followed by 2 ml LiCl and filtration plus rinsing (steps 6 and 7). Keeping the sample on ice prevents uptake during processing of the sample.
Add 1 μl of the 14C-labelled amino acid stock solution to a 2 ml Eppendorf tube to determine the total amount of radioactivity used per time point.
Add 1.8 ml of scintillation fluid to the Eppendorf tubes.
Measure radioactivity retained on the filters by scintillation counting. Best results are obtained after allowing the filter plus bacteria to dissolve in the scintillation fluid.
Uptake (rate) can be calculated from retained activity and total added activity and expressed in nmol amino acid/(mg protein x minute). The amount of amino acid is calculated from the data provided by the manufacturer and the amount of protein determined by standard assays for cell protein.
Recipes
0.1 M KPi pH 5.8 buffer (1,000 ml)
Mix 1 M K2HPO4 and 1 M KH2PO4 to a final pH of 5.8 and dilute 10x with dH2O.
Mix 10 ml KPi pH 5.8 and 0.1 ml of a 20% glucose solution. Store at 4 °C.
Acknowledgments
This protocol was adapted from and recently used in Trip et al. (2013).
References
Trip, H., Mulder, N. L. and Lolkema, J. S. (2013). Cloning, expression, and functional characterization of secondary amino acid transporters of Lactococcus lactis. J Bacteriol 195(2): 340-350.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial metabolism > Nutrient transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Measurement of Proton-driven Antiport in Escherichia coli
Scarlett R. Holdsworth and Christopher J. Law
Nov 5, 2014 8708 Views
Determination of Mn Concentrations in Synechocystis sp. PCC6803 Using ICP-MS
Fabian Brandenburg [...] Marion Eisenhut
Dec 5, 2017 7490 Views
Quantification of Hydrogen Sulfide and Cysteine Excreted by Bacterial Cells
Sergey Korshunov and James A. Imlay
May 20, 2018 6056 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
794 | https://bio-protocol.org/en/bpdetail?id=794&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Structural Based Strategy for Predicting Transcription Factor Binding Sites
BX Beisi Xu
YW Yongmei Wang
HL Haojun Liang
GL Guohui Li
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.794 Views: 8596
Reviewed by: Fanglian HeLin Fang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS ONE Jan 2013
Abstract
Scanning through genomes for potential transcription factor binding sites (TFBSs) is becoming increasingly important in this post-genomic era. The position weight matrix (PWM) is the standard representation of TFBSs utilized when scanning through sequences for potential binding sites. Many transcription factor (TF) motifs are short and highly degenerate, and methods utilizing PWMs to scan for sites are plagued by false positives. Furthermore, many important TFs do not have well-characterized PWMs, making identification of potential binding sites even more difficult. One approach to the identification of sites for these TFs has been to use the 3D structure of the TF to predict the DNA structure around the TF and then to generate a PWM from the predicted 3D complex structure. However, this approach is dependent on the similarity of the predicted structure to the native structure. We introduce here a novel approach to identify TFBSs utilizing structure information that can be applied to TFs without characterized PWMs, as long as a 3D complex structure (TF/DNA) exists. Our approach utilizes an energy function that is uniquely trained on each structure thus leads to increased prediction accuracy and robustness compared with those using a more general energy function. The software is freely available upon request. Please see reference supplementary material for details.
Keywords: ChIP-Seq Transcription Factor PDB Motif ATAC-seq
Data and Software
TF/DNA structure
tFIRE takes standard PDB format for TF/DNA structures.
A good place to look for such data is PDB (Rose et al., 2011) (http://www.pdb.org).
If the TF/DNA complex structure does not exist but the TF structure exists, you can generate the TF/DNA structure by docking DNA to the TF structure. Software that can be utilized for this includes HADDOCK (De Vries et al., 2007) (http://www.nmr.chem.uu.nl/haddock), FTDOCK (Jackson R.M. et al., 1998) (http://www.sbg.bio.ic.ac.uk/docking/ftdock.html), YASARA DOCK (http://www.yasara.org/dnadock.htm), ParaDock (Banitt and Wolfson, 2011) (http://www.paradocks.org). Our method indicates that such docking will not affect a result significantly but we have not tested any of these docking predictions ourselves for validation. Hence we urge their use with caution, and revalidate the results once the structures are available.
If the TF structure does not exist in 3D structure databases, you can predict TF structure using homology modeling like SWISS-MODEL (Guex and Peitsch, 1997) (http://swissmodel.expasy.org), Rosetta (Bradley et al., 2003) (https://www.rosettacommons.org), Sybyl (Visegrády et al., 2001) (http://www.tripos.com/index.php?family=modules,SimplePage,,,&page=SYBYL-X). Please use with caution that each prediction step would reduce the accuracy.
Predict TFBSs
tFIRE predicted motif(PWM) can be used to predict TFBSs.
Motif scanning programs can be used to scan the whole genome for motif matches. Such methods included MAST (Bailey et al., 2006) (http://meme.nbcr.net/meme/cgi-bin/mast.cgi) from MEME suite and STORM (Schones et al., 2007) (http://rulai.cshl.edu/storm) from Cold Spring Harbor Laboratory.
TFBSs vary for different cells. Recently, a newly developed method, CENTIPEDE (Pique-Regi et al., 2010) (http://centipede.uchicago.edu) shows that with the result from a single DNase-seq experiment, one can accurately predict TFBSs for all TFs. Therefore, downloading DNase-seq data from ENCODE project can be very helpful.
Recently developed FAIRE-seq technology allow similar predictions for detection of chromatin accessibility regions (Song et al., 2011). Such data can be substituted for DNase-seq, but needs be tested and validated before use.
Epigenetic information can also be employed instead of DNase-seq (Cuellar-Partida et al., 2012). We propose to update our data and methods available for such predictions on a regular basis.
Software
C++ software environment, better with Linux system
tFIRE, Feel Free to ask the author for a linux version
WebLogo (Crooks et al., 2004) can be used for visualization the PWM we predicted (http://weblogo.berkeley.edu)
Procedure
If you are confident of your TF/DNA complex 3D structure, then you can use tFIRE default function pre-trained by all available TF/DNA structures in the PDB database. You can also construct your own energy function with tFIRE by several non-homology structures. You can use the PISCES server (Wang and Dunbrack, 2003) (http://dunbrack.fccc.edu/PISCES.php) that this server will give you a subset of your input structure list (PDB id) that each protein in the subset has little homology to another.
If you are not confident of your TF/DNA structure, you can train tFIRE with a single structure and subsequently predict PWMs using tFIRE.
Acknowledgments
This protocol have been adapted from: Xu et al. (2013). We thank the funding supported by the National Sciences Foundation of China (no. 31070641) and National 973 Program of China (no. 2012CB721000) and start-up funding from SKLMRD and DICP, CAS (Chinese Academy of Sciences). The funders offered most of the costs of study design, data collection and analysis, decision to publish, or preparation of the manuscript. We would like to thank Dr. Yan Cui, Dr. Yaoqi Zhou, Dr. Yuedong Yang, Dr. Chi Zhang, Dr. Song Liu, Dr. Jason Donald, Dr. Eugene Shakhnovich, Dr. Timothy Robertson, Dr. Gabriele Varani, Dr. Marc Jung, Dr. Amy Leung and Dr. Rongze Lu, Juan Du for their databases, programs and helpful discussions.
References
Bailey, T. L., Williams, N., Misleh, C. and Li, W. W. (2006). MEME: discovering and analyzing DNA and protein sequence motifs. Nucleic Acids Res 34(Web Server issue): W369-373.
Banitt, I. and Wolfson, H. J. (2011). ParaDock: a flexible non-specific DNA--rigid protein docking algorithm. Nucleic Acids Res 39(20): e135.
Bradley, P., Chivian, D., Meiler, J., Misura, K. M., Rohl, C. A., Schief, W. R., Wedemeyer, W. J., Schueler-Furman, O., Murphy, P., Schonbrun, J., Strauss, C. E. and Baker, D. (2003). Rosetta predictions in CASP5: successes, failures, and prospects for complete automation. Proteins 53 Suppl 6: 457-468.
Crooks, G. E., Hon, G., Chandonia, J. M. and Brenner, S. E. (2004). WebLogo: a sequence logo generator. Genome Res 14(6): 1188-1190.
Cuellar-Partida, G., Buske, F. A., McLeay, R. C., Whitington, T., Noble, W. S. and Bailey, T. L. (2012). Epigenetic priors for identifying active transcription factor binding sites. Bioinformatics 28(1): 56-62.
de Vries, S. J., van Dijk, A. D., Krzeminski, M., van Dijk, M., Thureau, A., Hsu, V., Wassenaar, T. and Bonvin, A. M. (2007). HADDOCK versus HADDOCK: new features and performance of HADDOCK2.0 on the CAPRI targets. Proteins 69(4): 726-733.
Guex, N. and Peitsch, M. C. (1997). SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18(15): 2714-2723.
Jackson, R. M., Gabb, H. A. and Sternberg, M. J. (1998). Rapid refinement of protein interfaces incorporating solvation: application to the docking problem. J Mol Biol 276(1): 265-285.
Pique-Regi, R., Degner, J. F., Pai, A. A., Gaffney, D. J., Gilad, Y. and Pritchard, J. K. (2011). Accurate inference of transcription factor binding from DNA sequence and chromatin accessibility data. Genome Res 21(3): 447-455.
Rose, P. W., Beran, B., Bi, C., Bluhm, W. F., Dimitropoulos, D., Goodsell, D. S., Prlic, A., Quesada, M., Quinn, G. B., Westbrook, J. D., Young, J., Yukich, B., Zardecki, C., Berman, H. M. and Bourne, P. E. (2011). The RCSB Protein Data Bank: redesigned web site and web services. Nucleic Acids Res 39(Database issue): D392-401.
Schones, D. E., Smith, A. D. and Zhang, M. Q. (2007). Statistical significance of cis-regulatory modules. BMC Bioinformatics 8: 19.
Song, L., Zhang, Z., Grasfeder, L. L., Boyle, A. P., Giresi, P. G., Lee, B. K., Sheffield, N. C., Graf, S., Huss, M., Keefe, D., Liu, Z., London, D., McDaniell, R. M., Shibata, Y., Showers, K. A., Simon, J. M., Vales, T., Wang, T., Winter, D., Clarke, N. D., Birney, E., Iyer, V. R., Crawford, G. E., Lieb, J. D. and Furey, T. S. (2011). Open chromatin defined by DNaseI and FAIRE identifies regulatory elements that shape cell-type identity. Genome Res 21(10): 1757-1767.
Visegrady, B., Than, N. G., Kilar, F., Sumegi, B., Than, G. N. and Bohn, H. (2001). Homology modelling and molecular dynamics studies of human placental tissue protein 13 (galectin-13). Protein Eng 14(11): 875-880.
Wang, G. and Dunbrack, R. L., Jr. (2003). PISCES: a protein sequence culling server. Bioinformatics 19(12): 1589-1591.
Xu, B., Yang, Y., Liang, H. and Zhou, Y. (2009). An all-atom knowledge-based energy function for protein-DNA threading, docking decoy discrimination, and prediction of transcription-factor binding profiles. Proteins 76(3): 718-730.
Xu, B., Schones, D. E., Wang, Y., Liang, H. and Li, G. (2013). A structural-based strategy for recognition of transcription factor binding sites. PLoS One 8(1): e52460.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Molecular Biology > DNA > DNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Microtitre Plate Based Cell-SELEX Method
Munish Shorie and Harmanjit Kaur
Oct 20, 2018 6791 Views
Characterize the Interaction of the DNA Helicase PriA with the Stalled DNA Replication Fork Using Atomic Force Microscopy
Yaqing Wang [...] Yuri L. Lyubchenko
Mar 5, 2021 3629 Views
A Gel-Based Assay for Probing Protein Translocation on dsDNA
Christiane Brugger and Alexandra M. Deaconescu
Jul 20, 2021 2857 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
795 | https://bio-protocol.org/en/bpdetail?id=795&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Hairy Root Transformation in Lotus japonicus
SO Satoru Okamoto
EY Emiko Yoro
TS Takuya Suzaki
MK Masayoshi Kawaguchi
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.795 Views: 19354
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Development Nov 2012
Abstract
In L. japonicus, hairy root transformation is the very useful technique to generate transformed root systems in a short term. This protocol was previously described (Kumagai and Kouchi, 2003) with some modifications. After the infection of Agrobacterium rhizogenes, L. japonicus develops not only transformed but also untransformed roots. Thus, transgenic roots need to be identified by certain indications. In this protocol, we use the GFP florescent signals as such indication.
Materials and Reagents
Germination plate (1% agar in sterilized water)
B5 salt
Agar
Sucrose
Gamborg’s vitamin solution (Sigma-Aldrich, catalog number: G1019 )
Meropen (Dainippon Sumitomo Pharma)
LB medium
Sterilized water
Co-cultivation medium (see Recipes)
Hairy root elongation medium (see Recipes)
Equipment
Clean bench
L. japonicus growth facility
Surgical knife
Sterilized dish (9 cm in diameter)
Sterilized filter paper (7-8 cm in diameter)
Sterilized square dish (10 x 14 cm)
Procedure
A. Plant growth
Sandpaper the surface of L. japonicus Gifu or MG-20 seeds, and then incubate them in 2% sodium hypochlorite solution for 5 min. Wash the seeds several times with sterilized water and incubate the seeds overnight in the sterilized water.
Surface-sterilized seeds are germinated and grown in the germination plate.
Place the plate vertically in a growth cabinet (For Gifu, 23 °C 24 h dark for first 3 days and 23 °C 16 h light/8 h dark for next 2 days; For MG-20, 23 °C 24 h dark for first 2 days and 23 °C 16 h light/8 h dark for next 2 days).
B. Culture of Agrobacterium
Streak A. rhizogenes harboring the desired construct on LB plate with appropriate antibodies for 2 days at 28 °C, then spread bacteria all around sterilized dish (9 cm in diameter) and incubate for 1 day.
C. Infection of A. rhizogenes with L. japonicus
Collect the bacteria with bacteria spreader from LB plate and suspend 6 ml sterilized water.
Set a sterilized filter paper in a new dish, and saturate it with bacterial suspension by pipetting.
Place the juvenile plants on the saturated filter paper, and cut at the middle of the hypocotyl with surgical knife (Figure 1).
Transfer the seedlings of shoot side onto co-cultivation media (cut end is need to be about 1 mm in depth from agar surface), and place the plate horizontally in a growth cabinet (23 °C 24 h dark) for 1 day.
Place the plate vertically and incubate at 23 °C (16 h light/8 h dark) for 5 days.
D.Induction of hairy roots
Transfer the plants onto hairy root elongation media and incubate vertically in a growth cabinet (23 °C 16 h light/8 h dark).
After 10-14 days, the hairy roots should be approximately 2-5 cm in length. Pick up plants with transgenic roots expressing florescent proteins for further analysis (Figure 1).
Figure 1. Hairy root transformation in L. japonicus
Recipes
Co-cultivation medium
1/2x B5 salt
1/2x Gamborg’s vitamin solution
1% agar
Maintain pH with KOH at pH 5.5, pour into a square dish
Mix all components except for Gamborg’s vitamin solution, and autoclave the mixture, and then add Gamborg’s vitamin solution.
Hairy root elongation medium
1/2x B5 salt
1/2x Gamborg’s vitamin solution
12.5 μg/ml meropen
1% sucrose
1% agar
Maintain pH with KOH at pH 5.5, pour into a square dish
Mix all components except for Gamborg’s vitamin solution and meropen, and autoclave the mixture, and then add Gamborg’s vitamin solution and meropen.
Acknowledgments
This work was supported by MEXT/JSPS KAKENHI, Japan (22870035, 23012038, 25114519 to Takuya Suzaki).
References
Kumagai, H. and Kouchi, H. (2003). Gene silencing by expression of hairpin RNA in Lotus japonicus roots and root nodules. Mol Plant Microbe Interact 16(8): 663-668.
Okamoto, S., Ohnishi, E., Sato, S., Takahashi, H., Nakazono, M., Tabata, S. and Kawaguchi, M. (2009). Nod factor/nitrate-induced CLE genes that drive HAR1-mediated systemic regulation of nodulation. Plant Cell Physiol 50(1): 67-77.
Suzaki, T., Yano, K., Ito, M., Umehara, Y., Suganuma, N. and Kawaguchi, M. (2012). Positive and negative regulation of cortical cell division during root nodule development in Lotus japonicus is accompanied by auxin response. Development 139(21): 3997-4006.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Okamoto, S., Yoro, E., Suzaki, T. and Kawaguchi, M. (2013). Hairy Root Transformation in Lotus japonicus. Bio-protocol 3(12): e795. DOI: 10.21769/BioProtoc.795.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Agrobacterium
Molecular Biology > DNA > Transformation
Cell Biology > Tissue analysis > Tissue staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Fast and Easy Method to Study Ralstonia solanacearum Virulence upon Transient Gene Expression or Gene Silencing in Nicotiana benthamiana Leaves
Wenjia Yu and Alberto P. Macho
Aug 5, 2021 3192 Views
Agrobacterium-mediated Transformation of Japonica Rice Using Mature Embryos and Regenerated Transgenic Plants
Ammar Elakhdar [...] Takahiko Kubo
Sep 20, 2021 4106 Views
Agrobacterium-mediated Genetic Transformation of Cotton and Regeneration via Somatic Embryogenesis
Alka Srivastava [...] Praveen C. Verma
May 20, 2023 1856 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
796 | https://bio-protocol.org/en/bpdetail?id=796&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Stable Transformation in Lotus japonicus
TS Takema Sasaki
TS Takuya Suzaki
MK Masayoshi Kawaguchi
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.796 Views: 15527
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Development Nov 2012
Abstract
This is a protocol to produce stable transgenic plants in Lotus japonicus, which is established based on methods previously reported (Handberg and Stougaard, 1992; Stiller et al., 1997; Thkjaer et al., 1998) with some modifications. In this protocol, hygromycin is used to select transgenic plants.
Materials and Reagents
Germination plate (1% agar in sterilized water)
B5 salt (Wako Pure Chemical Industries, catalog number: 399-00621 )
Gamborg’s vitamin solution
BAP (Wako Pure Chemical Industries, catalog number: 020-07621 )
1-Naphthaleneacetic acid (NAA)
Acetosyringone
MES
(NH4)2SO4
Phytagel (Sigma-Aldrich, catalog number: P8169 )
Meropen (Dainippon Sumitomo Pharma)
Hygromycin B
LB medium (nacalai tesque, catalog number: 20066-95 )
Co-cultivation medium (see Recipes)
YMB medium (see Recipes)
Callus medium (see Recipes)
Shoot elongation medium (see Recipes)
Root induction medium (see Recipes)
Root elongation medium (see Recipes)
Equipment
Clean bench
L. japonicus growth facility (we use several types of Biotrons such as LH-410S purchased from NIPPON MEDICAL & CHEMICAL INSTRUMENTS CO., LTD.)
Surgical knife
Sterilized dish ( 9 cm in diameter x 2 cm)
Sterilized magenta box
Sterilized filter paper (7 cm in diameter)
Sterilized filter paper (6 x 6 cm)
Vermiculite (Hakugen)
Procedure
A. Plant growth
Sandpaper the surface of L. japonicus Gifu or MG-20 seeds, and then incubate them in 2% sodium hypochlorite solution for 5 min. Wash the seeds several times with sterilized water and incubate the seeds overnight in the sterilized water.
Surface-sterilized L. japonicus Gifu or MG-20 seeds are germinated and grown in the germination plate.
Place the plate vertically in a growth cabinet (Gifu; 23 °C 24 h dark for first 3 days, 23 °C 16 h light/8 h dark for next 2 days, MG-20; 23 °C 24 h dark for first 2 days, 23 °C 16 h light/8 h dark for next 2 days). Incubation time in the darkness is depends on ecotypes (hypocotyl growth speed of Gifu is slower than MG-20).
B. Culture of Agrobacterium
Streak A. tumefaciens harboring the desired construct on LB plate with appropriate antibodies for 2 days at 28 °C, then spread bacteria all around sterilized dish (9 cm in diameter) and incubate for 1 day. We use AGL1 as agrobacteria strain.
C. Infection of A. rhizogenes with L. japonicus
Put about 5 mm piles of sterilized filter papers (6 x 6 cm) in a new dish and pour 20-25 ml co-cultivation medium (Figure 1A). Pouring the medium to the bottom of a dish and then it gradually permeates to the top of pilled filter papers. It enables us to recognize the saturation of filter papers with the medium.
Collect the bacteria with bacteria spreader from LB plate and suspend 5 ml YMB medium.
Put a sterilized filter paper (7-8 cm in diameter) in a new dish and saturate it with bacterial suspension by pipetting.
Place the juvenile plants on the filter paper and cut their hypocotyls into about 3 mm length with surgical knife.
Transfer the hypocotyl pieces onto the top of pilled filter papers saturated with co-cultivation medium and place the plate in a growth cabinet (23 °C 24 h dark) for 6 days (Figure 1B).
Figure 1. Infection of A. tumefaciens with L. japonicas
D. Callus induction
Transfer the hypocotyl pieces from co-cultivation medium onto callus medium (about 1 cm thick) and place the plate in a growth cabinet (23 °C 16 h light/8 h dark) for 2-5 weeks (Figure 2A). Transfer the hypocotyl pieces onto new medium every 5 days.
In 2-3 weeks, calluses should start to develop from the tips of hypocotyls. When they become more than 1 mm in size, cut off them from the hypocotyls and transfer them onto new medium (Figure 2B). You can trash white hypocotyls as it is unlikely that calluses develop from them.
Figure 2. Callus induction
E. Shoot induction
Transfer the calluses onto callus medium without hygromycin B (about 1 cm thick) and place the plate in a growth cabinet (23 °C 16 h light/8 h dark) for no longer than 7 weeks. Transfer the calluses onto new medium every 5 days (Figure 3). Shoots start to appear in about 3 weeks.
Figure 3. Shoot induction
F.Shoot elongation
When shoots start to appear, transfer the calluses onto shoot elongation medium (about 1 cm thick) and place the plate in a growth cabinet (23 °C 16 h light/8 h dark) for no longer than 6 weeks. Transfer the calluses onto new medium every 5 days (Figure 4).
Figure 4. Shoot elongation
G.Root induction
1.When shoots become about 1 cm in length, cut off the shoots from the calluses and stick them shallowly into root induction medium (about 1 cm thick).
2.Place the plate in a growth cabinet (23 °C 16 h light/8 h dark) for 10 days (Figure 5).
Figure 5. Root induction
H.Root elongation
Transfer and stick the shoots into root elongation medium (about 3 cm thick) and place the magenta box in a growth cabinet (23 °C 16 h light/8 h dark) until their root length become about 2-3 cm (Figure 6).
Figure 6. Root elongation
I.Naturalization
Transplant the plants into 100% vermiculite and grow them with high humidity at least first 1 week (23 °C 16 h light/8 h dark), and keep growing them for further analysis. To keep high humidity, we cover the pots of plants with Saran wrap.
Recipes
Co-cultivation medium (pH 5.5)
1/10x B5 salt
1/10x Gamborg’s vitamin solution
0.5 μg/ml BAP (Gifu)
0.2 μg/ml BAP (MG-20)
0.05 μg/ml NAA
5 mM MES (pH 5.2)
20 μg/ml acetosyringone
Prepare 1/10x B5 salt solution and adjust pH, and autoclave it. Add remaining components after autoclave.
YMB medium (100 ml)
0.2 g mannitol
0.04 g yeast extract
0.02 g MgSO4.7H2O
0.01 g NaCl
Mix all components and autoclave the mixture.
Add 1 ml 0.3 M potassium phosphate buffer (pH 6.8) before use.
Callus medium (pH 5.5)
1x B5 salt
1x Gamborg’s vitamin solution
2% sucrose
0.5 μg/ml BAP (Gifu)
0.2 μg/ml BAP (MG-20)
0.05 μg/ml NAA
10 mM (NH4)2SO4
0.3% phytagel
12.5 μg/ml meropen
15-40 μg/ml HygromycinB (you need to find the optimal concentration of HygromycinB because its purity is different among materials)
Mix 1x B5 salt and 2% sucrose and adjust pH, and add 0.3% phytagel. Autoclave the mixture. Add remaining components after autoclave.
Shoot elongation medium (pH 5.5)
1x B5 salt
1x Gamborg’s vitamin solution
2% sucrose
0.2 μg/ml BAP
0.3% phytagel
12.5 μg/ml meropen
Mix 1x B5 salt and 2% sucrose and adjust pH, and add 0.3% phytagel. Autoclave the mixture. Add remaining components after autoclave.
Root induction medium (pH 5.5)
1/2x B5 salt
1/2x Gamborg’s vitamin solution
1% sucrose
0.5 μg/ml NAA
0.4% phytagel
12.5 μg/ml meropen
Mix 1/2x B5 salt and 1% sucrose and adjust pH, and add 0.4% phytagel. Autoclave the mixture. Add remaining components after autoclave.
Root elongation medium (pH 5.5)
1/2x B5 salt
1/2x Gamborg’s vitamin solution
1% sucrose
0.4% phytagel
12.5 μg/ml meropen
Mix 1/2x B5 salt and 1% sucrose and adjust pH, and add 0.4% phytagel. Autoclave the mixture. Add remaining components after autoclave. Magenta boxes are used for this root elongation medium.
Acknowledgments
This work was supported by MEXT/JSPS KAKENHI, Japan (22870035, 23012038, 25114519 to Takuya Suzaki).
References
Handberg, K. and Stougaard, J. (1992). Lotus japonicus, an autogamous, diploid legume species for classical and molecular genetics. The Plant Journal 2(4): 487-496.
Stiller, J., Martirani, L., Tuppale, S., Chian, R.-J., Chiurazzi, M. and Gresshoff, P. M. (1997). High frequency transformation and regeneration of transgenic plants in the model legume Lotus japonicus. J Exp Bot 48(7): 1357-1365.
Suzaki, T., Yano, K., Ito, M., Umehara, Y., Suganuma, N. and Kawaguchi, M. (2012). Positive and negative regulation of cortical cell division during root nodule development in Lotus japonicus is accompanied by auxin response. Development 139(21): 3997-4006.
Thykjaer T., Schauser L., Danielsen D., Finneman J., Stougaard J. (1998). Transgenic plants: Agrobacterium-mediated transformation of the diploid legume Lotus japonicus. In Cell Biology: A laboratory handbook. Second edition vol 3. Academic Press.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Sasaki, T., Suzaki, T. and Kawaguchi, M. (2013). Stable Transformation in Lotus japonicus. Bio-protocol 3(12): e796. DOI: 10.21769/BioProtoc.796.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Agrobacterium
Molecular Biology > DNA > Transformation
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Quantification of Ethylene Production in Leaf and Bud Tissue of the Subtropical Tree Crop Litchi (Litchi chinensis Sonn.) Using Gas Chromatography and Flame Ionization Detection
Regina B. Cronje and Arnoldus J. Jonker
Mar 20, 2023 571 Views
Agrobacterium-mediated Genetic Transformation of Cotton and Regeneration via Somatic Embryogenesis
Alka Srivastava [...] Praveen C. Verma
May 20, 2023 1856 Views
Bi-directional Dual-flow-RootChip for Physiological Analysis of Plant Primary Roots Under Asymmetric Perfusion of Stress Treatments
Claudia Allan [...] Claudia-Nicole Meisrimler
Aug 5, 2023 509 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
797 | https://bio-protocol.org/en/bpdetail?id=797&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Paper Chromatography as Exemplified by Separation of Urocanic Acid and Deaminohistidine
Alexander V. Bogachev
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.797 Views: 10914
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Molecular Microbiology Dec 2012
Abstract
Paper chromatography is an ancient technique to separate low molecular mass compounds based on their distribution between mobile phase (solvent) and stationary phase (cellulose and cellulose-bound water). Paper chromatography has been largely replaced by thin layer chromatography and high performance liquid chromatography as the latter methods have higher resolution capability. Nevertheless due to low cost and availability of great number of protocols for separation of various compounds, paper chromatography is still a powerful analytical tool. In the current protocol this technique is exemplified by separation of urocanic acid and deaminohistidine.
Keywords: Paper chromatography Urocanate Dihydrourocanate
Materials and Reagents
Chromatography paper (Whatman No. 1)
Urocanic acid (MP Biomedicals)
Deaminohistidine (Chem-Impex International)
Isobutanol
Acetone
Formic acid
Sulfanilic acid
NaNO2
HCl
Na2CO3
Pauly diazo reagent (see Recipes)
Equipment
Chromatography chamber
Capillary tubes (Kimble Chase Kimble, catalog number: 71900 10 )
Spraying nozzle
Procedure
Preconditioning of chromatography chamber
Prepare chromatography solvent by mixing isobutanol, acetone, formic acid, and water in 160:160:1:39 proportion (vol. by vol.).
Pour the solvent into a chromatography chamber, the liquid level should be around 5 mm from the bottom. Seal the solvent-containing chamber for at least 1 h to saturate the chamber with solvent vapors.
Preparation of chromatography paper
Scissor out a strip of chromatography paper with the appropriate dimensions. The width of the strip depends on number of samples to be analyzed (the distance between sample spots and between spots and paper edges should be at least 20 mm). The height depends on difference in Rf values of separated compounds and usually is 100-400 mm.
Draw a line from 20 mm from the bottom of the strip by a graphite pencil (starting line). Mark dots on this line for future sample spots.
Load spots of the test samples and standards on the starting line using a capillary tube. Micro liter quantities are used to prepare spots. The diameter of the spots should be only up to a few mm. In order to get a concentrated spot, the spotting can be repeated several times. If it is necessary, wait till the spot is dried and then repeat the spotting. In the case of urocanic acid and deaminohistidine, each spot should contain about 10 nmol of one of these compounds.
Chromatography
To develop the chromatogram, place the prepared strip into the saturated chromatography chamber and seal the chamber.
Remove the strip from the chamber when solvent front has traveled up to about 20 mm from the top of the paper. Mark position of the solvent front on the strip.
Detection
Air dry the strip. Using a spraying nozzle spray the dried strip first with the Pauly diazo reagent until the paper become humid, followed by spraying the humid strip with a 10% Na2CO3 solution until spots of imidazolyl derivatives become colored (urocanic acid – orange, deaminohistidine – red). The color is stable within several weeks. The schematic representation of the typical chromatogram can be seen in Figure 1.
Calculate Rf values [(distance traveled by a component)/(distance traveled by the solvent)].
Figure 1. Schematic representation of the separation of urocanate and deaminohistidine by paper chromatography.
Recipes
Pauly diazo reagent
Reagent A: Dissolve 0.9 g sulfanilic acid in H2O and add 9 ml concentrated HCl (37%), and then make up to a total volume of 100 ml in H2O
Reagent B: Dissolve 5 g NaNO2 in 100 ml H2O
Pauly diazo reagent: Mix 6 ml of ice cold reagent A with 6 ml of ice cold reagent B and incubate 5 min on ice. Add to the mixture additional 24 ml of reagent B and 64 ml of ice cold water. The Pauly diazo reagent can be stored for a few hours on ice.
Acknowledgments
This protocol was adapted from Sen et al. (1962). This work was supported by the Russian Foundation for Basic Research (project number 10-04-00352).
References
Bogachev, A. V., Bertsova, Y. V., Bloch, D. A. and Verkhovsky, M. I. (2012). Urocanate reductase: identification of a novel anaerobic respiratory pathway in Shewanella oneidensis MR-1. Mol Microbiol 86(6): 1452-1463.
Consden, R., Gordon, A. H. and Martin, A. J. (1944). Qualitative analysis of proteins: a partition chromatographic method using paper. Biochem J 38(3): 224-232.
Sen, N. P., Mc, G. P. and Paul, R. M. (1962). Imidazolepropionic acid as a urinary metabolite of L-histidine. Biochem Biophys Res Commun 9: 257-261.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Bogachev, A. V. (2013). Paper Chromatography as Exemplified by Separation of Urocanic Acid and Deaminohistidine. Bio-protocol 3(12): e797. DOI: 10.21769/BioProtoc.797.
Download Citation in RIS Format
Category
Biochemistry > Other compound > Alkaloid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Isolation and Characterization Procedure for Indole Alkaloids from the Marquesan Plant Rauvolfia Nukuhivensis
Nicolas J. Martin [...] Phila Raharivelomanana
Oct 20, 2015 11210 Views
Chromatographic Separation of the Codonocarpine Type Alkaloids from the Root Bark of Capparis decidua
Yvonne Forster [...] Stefan Bienz
Feb 20, 2017 7491 Views
Radioactive Tracer Feeding Experiments and Product Analysis to Determine the Biosynthetic Capability of Comfrey (Symphytum officinale) Leaves for Pyrrolizidine Alkaloids
Thomas Stegemann [...] Dietrich Ober
Feb 5, 2018 6077 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
798 | https://bio-protocol.org/en/bpdetail?id=798&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Macromolecular Biosynthesis Assay for Evaluation of Influence of an Antimicrobial on the Synthesis of Macromolecules
JN Justyna Nowakowska
NK Nina Khanna
RL Regine Landmann
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.798 Views: 11138
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Antimicrobial Agents and Chemotherapy Jan 2012
Abstract
One of the most compelling approaches in the discovery of novel antimicrobials is screening of natural sources. In our publication we report on the activity of a compound 8-hydroxyserrulat-14-en-19-oic acid (EN4), a diterpene isolated from the Australian plant Eremophila neglecta. We evaluate its applicability for treatment of implant-associated infections. A comprehensive analysis of the mechanism of action of EN4 against staphylococci revealed its membranolytic properties and a general inhibition of macromolecular biosynthesis, which was confirmed in a macromolecular biosynthesis assay and suggested a multitarget activity. The method used to investigate an influence of EN4 on the synthesis of peptidoglycan, RNA, DNA and proteins is based on precipitation of macromolecules with trichloroacetic acid. These macromolecules are synthesised from respective [3H]-labelled precursors. The incorporated radioactivity with and without an antimicrobial is measured and it reflects the mode of action of the tested compound. Antibiotics with known mechanisms of action are used as controls.
Keywords: Macromolecular synthesis Mechanism of action Antibiotic Antimicrobial Bacterial biosynthesis
Materials and Reagents
[3H] N-acetylglucosamine (Hartmann Analytic, catalog number: ART 0101 )
[3H] Uridine (Hartmann Analytic, catalog number: MT-602 )
[3H] Thymidine (PerkinElmer, catalog number: NET35500 )
[3H] Leucine (Hartmann Analytic, catalog number: MT-672 )
Triptic soy broth (TSB) (Becton Dickinson, catalog number: 211825 )
Control antimicrobials for the influence on synthesis of:
Peptidoglycan: vancomycin (Vancocin 500 mg) (Teva Pharma)
RNA: actinomycin D (Sigma-Aldrich, catalog number: A1410 )
DNA: ciprofloxacin (Ciproxin Infusion 0.2 g) (Bayer)
Proteins: chloramphenicol (Applichem, catalog number: A1806 )
All macromolecules (antiseptic activity): chlorhexidine dihydrochloride (Sigma-Aldrich, catalog number: C8527 )
Note: All substances prepared according to the manufacturer’s instructions; minimal inhibitory concentration (MIC) of each antimicrobial can be determined according to Clinical and Laboratory Standards Institute guidelines (see Reference 1) (The following MICs were determined for S. aureus WSPPA: MICvancomycin = 2 μg/ml, MICactinomycin D = 6.25 μg/ml, MICciprofloxacin = 2 μg/ml, MICchloramphenicol = 8 μg/ml, MICchlorhexidine = 0.78 μg/ml)
Scintillation cocktail (Ultima Gold, catalog number: 6013321 ).
Phosphate-buffered saline (PBS) (Reagens, catalog number: 9007695 ).
Na2HPO4 (Sigma-Aldrich, catalog number: S3264 )
KH2PO4 (Sigma-Aldrich, catalog number: P8416 )
MgSO4.7H2O (Fluka, catalog number: 63138 )
NH4Cl (Sigma-Aldrich, catalog number: A9434 )
NaCl (Sigma-Aldrich, catalog number: S3014 )
Sodium citrate tribasic dihydrate (Sigma-Aldrich, catalog number: S4641 )
Glucose (B. Braun Medical, catalog number: 395176 )
Various amino acids (i.e., L-alanine (Sigma-Aldrich, catalog number: A7469 )
L-Valine (Sigma-Aldrich, catalog number: V0513 )
L-Isoleucine (Sigma-Aldrich, catalog number: I7403 )
L-Aspartic acid (Sigma-Aldrich, catalog number: A7219 )
L-Glutamic acid (Sigma-Aldrich, catalog number: G8415 )
L-Serine (Sigma-Aldrich, catalog number: S4311 )
L-Threonine (Sigma-Aldrich, catalog number: T8441 )
L-Cysteine hydrochloride (Sigma-Aldrich, catalog number: C6852 )
L-Arginine (Sigma-Aldrich, catalog number: A8094 )
L-Leucine (Sigma-Aldrich, catalog number: L8912 )
L-Lysine (Sigma-Aldrich, catalog number: L9037 )
L-Proline (Sigma-Aldrich, catalog number: P5607 )
L-Phenylalanine (Sigma-Aldrich, catalog number: P5482 )
L-Tryptophan (Sigma-Aldrich, catalog number: T8941 )
L-Histidine monohydrochloride (Sigma-Aldrich, catalog number: H5659
Glycine (Sigma-Aldrich, catalog number: G7126 )
Cyanocobalamine (Sigma-Aldrich, catalog number: V2876 )
p-Aminobenzoate (Fluka, catalog number: 06940 )
Biotin (Sigma-Aldrich, catalog number: B3399 )
Nicotinic acid (Sigma-Aldrich, catalog number: N0761 )
D-pantothenic acid hemicalcium salt (Sigma-Aldrich, catalog number: P5155 )
Pyridoxine hydrochloride (Sigma-Aldrich, catalog number: P6280 )
Thiamine hydrochloride (Sigma-Aldrich, catalog number: T1270 )
Riboflavin (Sigma-Aldrich, catalog number: R9504 )
ZnCl2 (Sigma-Aldrich, catalog number: 208086
MnCl2.4H2O (Sigma-Aldrich, catalog number: M5005 )
BH3O3 (Fluka, catalog number: 15665 )
CoCl2.6H2O (Sigma-Aldrich, catalog number: C8661 )
CuCl2.2H2O (Sigma-Aldrich, catalog number: C3279 )
NiCl2.6H2O (Sigma-Aldrich, catalog number: 223387 )
Na2MoO4.2H2O (Sigma-Aldrich, catalog number: M1003 )
FeCl2.4H2O (Fluka, catalog number: 44939 )
NaOH (Sigma-Aldrich, catalog number: S5881 )
Uracil (Sigma-Aldrich, catalog number: U0750 )
Cytosine (Sigma-Aldrich, catalog number: C3506 )
Adenine (Sigma-Aldrich, catalog number: A2786 )
Guanine (Sigma-Aldrich, catalog number: G11950 )
Sodium dodecyl sulphate (SDS) (Sigma-Aldrich, catalog number: L4390 )
Trichloroacetic acid (TCA) (Sigma-Aldrich, catalog number: T9159 )
15 ml TPP centrifuge tubes (TPP 91015 )
10% TCA, 5% TCA, 5% TCA/1.5 M NaCl (see Recipes)
Completely defined medium (CDM) (see Recipes)
Note: This medium has been optimised for Staphylococcus (S.) aureus and may require further optimisation if other bacteria are investigated.
Equipment
37 °C bacterial culture incubator
Sterile capped glass tubes (to reduce bacterial adherence) (GlasKeller, catalog number: 2613111 )
Ultracentrifuge tubes (2 ml) (Eppendorf, catalog number: 0030120.094 )
Scintillation tubes (PerkinElmer, catalog number: 6000288 )
Benchtop centrifuge
Vacuum pump
Liquid scintillation analyser (Tri-CARB, catalog number: 1900TR )
Procedure
Note: The glass tubes for incubation must be pre-warmed and the reagents and tubes for precipitation must be pre-cooled; to assess the interference with biosynthesis of one macromolecule prepare 14 pre-warmed glass tube (untreated control, investigated antimicrobial and five control antimicrobials, in duplicates).
Overnight bacterial culture (for S. aureus WSPPA approximately 1.5 x 108 CFU/ml) prepared in TSB is diluted 1:100 in 10 ml CDM and, for [3H] Leucine incorporation, in 10 ml CDM-Leu.
Note: For S. aureus WSPPA the overnight and logarithmic-phase cultures are prepared in 15 ml TPP centrifuge tubes, without shaking.
Incubation: 5 h, 37 °C.
Note: The incubation time must be adjusted respectively to the strain in order to reach the logarithmic growth phase.
The log-phase culture (0.9 ml for S. aureus WSPPA, which corresponds to approximately 2 x 107 CFU) is transferred in duplicates to pre-warmed glass tubes and all antimicrobials at concentration of 4x MIC are added; untreated controls are incubated with an adequate volume of a solvent used to prepare solution of investigated antimicrobial.
Note: Untreated control must be prepared in exactly the same solvent as used for the antimicrobial of interest to control for the effect of solvent on bacterial biosynthesis. It is therefore recommended to dilute all antimicrobials to the concentrations of 4x MIC in the same solvent, which additionally does not interfere with bacterial viability (e.g. PBS). If due to its chemical properties any substance needs to be diluted in a harsh solvent then a concentrated stock solution is prepared in the harsh solvent followed by diluting in a mild solvent to the 4x MIC to reduce the concentration of the first solvent below a level affecting bacteria. The untreated controls are prepared in exactly the same way for incorporation of each of the precursors.
The samples are mixed thoroughly and [3H]-labelled precursors are immediately transferred to separate tubes:
[3H] N-acetylglucosamine up to a concentration of 0.1 μCi per ml (for peptidoglycan synthesis)
[3H] Uridine up to 1 μCi per ml (for RNA synthesis)
[3H] Thymidine up to 1 μCi per ml (for DNA synthesis)
[3H] Leucine up to 3 μCi per ml (for protein synthesis)
Incubation: 37 °C.
At time points of interest 0.5 ml aliquots are transferred into 2 ml ultracentrifuge tubes containing 1 ml of ice-cold 10% TCA, mixed thoroughly and placed on ice for at least 1.5 h to facilitate the precipitation.
Note: Time points of interest can be determined in the time-killing study according to Clinical and Laboratory Standards Institute guidelines (see Reference 1). For S. aureus WSPPA time point of 1 h was chosen.
The precipitates are washed one time with 0.5 ml of 5% TCA/1.5 M NaCl followed by one-time washing with 0.5 ml of 5% TCA (16,100 x g, 10 min, 20 °C), supernatants are removed using vacuum pump.
After the second wash samples are solubilised with 0.5 ml of 0.1% SDS/0.1 M NaOH by vortexing at room temperature.
The solubilised precipitates are transferred into scintillation tubes and thoroughly mixed with 2 ml of scintillation cocktail.
The incorporated radioactivity is measured in counts per minute using liquid scintillation analyser and the results are expressed as percentage of untreated control (Figure 1A - 1D).
Figure 1. Inhibition of biosynthesis of macromolecules by EN4. Incorporation of [3H] N-acetylglucosamine (A), [3H] Uridine (B), [3H] Thymidine (C) and [3H] Leucine (D) by WSPPA treated for 1 h with EN4, vancomycin (VAN), actinomycin D (ActD), ciprofloxacin (CIP), chloramphenicol (CHL) or chlorhexidine (CHX) at 4x MIC, was expressed as percentage of untreated control (for peptidoglycan = 3444 ± 1212 cpm, RNA = 115538 ± 19533 cpm, DNA = 13862 ± 762 cpm, protein = 7065 ± 323 cpm); values shown are the means of at least two independent experiments prepared in duplicates ± SDs; dotted lines represent 100% incorporation. Significant reduction of biosynthesis as compared to results for the untreated control is indicated; *, P < 0.05; **, P < 0.01; ***, P < 0.001 by one-way ANOVA (Kruskal-Wallis test) with a Dunns post test. (Nowakowska et al., 2013)
Recipes
CDM (1,000 ml)
Mix 1.77 g of Na2HPO4, 1.36 g of KH2PO4, 0.2 g of MgSO4.7H2O, 0.5 g of NH4Cl, 0.5 g of NaCl, 294.1 g of sodium citrate tribasic dihydrate, 3.75 ml of 40% glucose, 160 mg each of various amino acids, L-Valine, L-Isoleucine, L-Aspartic acid, L-Glutamic acid, L-Serine, L-Threonine, L-Cysteine hydrochloride, L-Arginine, L-Leucine, L-Lysine, L-Proline, L-Phenylalanine, L-Tryptophan, L-Histidine, monohydrochloride, and 1.6 g of glycine, 0.05 mg of cyanocobalamine, 0.04 mg of p-aminobenzoate, 0.01 mg of biotin, 0.1 mg of nicotinic acid, 0.1 mg of D-pantothenic acid hemicalcium salt, 0.15 mg of pyridoxine hydrochloride, 0.1 mg of thiamine hydrochloride, 0.1 mg of riboflavin, 69.5 μg of ZnCl2, 0.1 μg of MnCl2.4H2O, 6 μg of BH3O3, 0.347 mg of CoCl2.6H2O, 2.6 μg of CuCl2.2H2O, 24 μg of NiCl2.6H2O, 36 μg of Na2MoO4.2H2O, 0.15 mg of FeCl2.4H2O, 120 mg of NaOH, 5 mg of uracil, 5 mg of cytosine, 5 mg of adenine, and 5 mg of guanine with 1,000 ml sterile dH2O;
The concentration of L-Leucine in CDM-Leu was 22.5 mg/L instead of 160 mg/L;
Filter-sterilise (0.22 μm)
Store at 4 °C.
5% (10%) TCA (1,000 ml)
Mix 50 g (100 g) of TCA with 1,000 ml dH2O
Store at 4 °C.
5% TCA/1.5 M NaCl (100 ml)
Mix 8.8 g NaCl with 100 ml of 5% TCA
Store at 4 °C.
0.1% SDS/0.1M NaOH (100 ml)
Gently mix by rotating 0.1 g sodium dodecyl sulphate (SDS) (w/v) and 0.6 g NaOH (w/v) with 100 ml dH2O
Store at room temperature.
Acknowledgments
This protocol has been adapted from Nowakowska et al. (2013). The study was supported by the CCMX Competence Centre for Materials Science and Technology, Lausanne, Switzerland.
References
Clinical and Laboratory Standards Institute. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard, 7th ed. CLSI document M7-A7 (ISBN 1-56238-587-9). Clinical and Laboratory Standards Institute. Wayne, PA, 2006.
Nowakowska, J., Griesser. H. J., Textor, M., Landmann, R., Khanna, N. (2013) Antimicrobial Properties of 8-Hydroxyserrulat-14-en-19-oic Acid for Treatment of Implant-Associated Infections. Antimicrob Agents Chemother 57(1): 333-42.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Nowakowska, J., Khanna, N. and Landmann, R. (2013). Macromolecular Biosynthesis Assay for Evaluation of Influence of an Antimicrobial on the Synthesis of Macromolecules. Bio-protocol 3(12): e798. DOI: 10.21769/BioProtoc.798.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Microbiology > Antimicrobial assay > Antibacterial assay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Determination of Poly(3-hydroxybutyrate) Content in Cyanobacterium Synechocystis sp. PCC 6803 Using Acid Hydrolysis Followed by High-performance Liquid Chromatography
Janine Kaewbai-ngam [...] Tanakarn Monshupanee
Aug 20, 2023 575 Views
Functional Assay for Measuring Bacterial Degradation of Gemcitabine Chemotherapy
Serkan Sayin and Amir Mitchell
Sep 5, 2023 508 Views
An HPLC-based Assay to Study the Activity of Cyclic Diadenosine Monophosphate (C-di-AMP) Synthase DisA from Mycobacterium smegmatis
Avisek Mahapa [...] Dipankar Chatterji
Dec 20, 2024 272 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
799 | https://bio-protocol.org/en/bpdetail?id=799&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
EdU labeling of Trypanosome Cells and Their Kinetoplast DNA (kDNA)
JW Jianyang Wang
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.799 Views: 10169
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Molecular Microbiology Feb 2012
Abstract
Trypanosome mitochondrial genome, known as Kinetoplast DNA (kDNA), is a massive network of interlocked DNA rings. The studies of kDNA replication and architecture are of major significance since kDNA is a valid drug target. However, DNA in procyclic trypanosomes can not be labeled with tracer concentrations of 3[H]-thymidine, possibly because they lack a high-affinity transporter for thymidine. Therefore, BrdU, a thymidine analog, has been used at high concentrations to study kDNA replication. However, the detection of BrdU with anti-BrdU antibody requires harsh conditions such as the acid or heat treatment to seperate double DNA strand, which affects the ability for other antibodies to bind as well as the morphology and ability for dyes that require dsDNA to bind efficiently. Instead, EdU (5-Ethynyl-2′-deoxyuridine), a novel thymidine analog, can be used to study kDNA replication and cell proliferation with a simplified protocol. Detection of EdU is based on a click reaction, which is a copper (I) catalyzed reaction between an azide and an alkyne. This click reaction does not require DNA denaturation and it is multiplex compatible, such as other antibodies and dyes for cell cycle analyses. To visualize trypanosome replicating nuclear DNA and kDNA, EdU is added into the medium of cell culture and incubated for 0.5 h to 3 h and then detected by the following procedures.
Keywords: Trypanosome Kinetoplast DNA EdU labeling KDNA Trypanosoma brucei
Materials and Reagents
Click-iT® Cell Reaction Buffer Kit (Life Technologies, InvitrogenTM, catalog number: C10269 )
EdU (Life Technologies, InvitrogenTM, catalog number: A10044 )
Alexa Fluor® 488 azide (Life Technologies, InvitrogenTM, catalog number: A10266 )
OR Alexa Fluor® 594 azide (Life Technologies, InvitrogenTM, catalog number: C10270 )
4% Paraformaldehyde (PFA) in PBS
Deionized water (ddH2O)
Poly-L-Lysine (Sigma-Aldrich, catalog number: P8920 )
TEFLON printed slides 8-well, 6 mm diameter (Electron Microscopy Sciences)
Vectashield® mounting medium with DAPI (Vector Laboratories, catalog number: H-1200 )
Nail polish
EdU solution (molecular weight of EdU: 252.22 g/mol) (see Recipes)
0.1 M Glycine in 1x PBS (see Recipes)
Equipment
A humid chamber (a box with moistened paper tower; can protect from light and at least 8 x 10 cm2)
Microscope Coverslips, 22 x 50 cm2 (Fisherbrand®)
Centrifuge
28 °C 5% CO2 Cell culture incubator
Fluorescent microscope
Procedure
I. EdU labeling of trypanosome cells
Notes:
1)This protocol has not been used for the bloodstream form of trypanosomes yet. However, it is supposed to work well for the bloodstream form of trypanosomes too.
2)From step 3 to the end of the protocol, operate at room temperature (RT).
3)From step 9, please protect from light by covering the box with lid or the eppendorf tubes with foil paper. In steps 7, 8, and 10, use a 100 or 200 μl pipette to remove solution from each well.
Culture procyclic trypanosomes in 10 ml SDM-79 medium supplemented with 10% FBS at 28 °C, 5% CO2 incubator.
Add EdU solution to cell culture at final concentration of 50 μM to 100 μM and continue to incubate at the same condition as step 1 for 30 min to 3 h as planned.
Trypanosome cells are then pelleted at 700 x g for 5 min.
Wash the cells with 1 ml 1x PBS once and resuspend cells in 1x PBS at around 2 x 107 cells/ml.
Coat the 8-well glass slide with poly-L-lysine (0.1% w/v in H2O).
Add 25 μl cell suspension onto each well in a humid chamber (see Equipment 1) and seat for 5 min.
Remove cell suspension and add 40 μl 4% paraformaldehyde to fix cells for 5 min.
Remove fixatives and wash cells twice with 50 μl 0.1 M Glycine for 5 min.
Prepare Click-iT reaction cocktail (make cocktail fresh and keep dark).
For 200 μl (1 slide or 8 wells, 25 μl/well):
Component A: 1x TBS 176 μl
Component B: 100 mM CuSO4 4 μl
Component C: Buffer additive 20 μl
1 mM Alexa-488-azide 1 μl
(OR 1 mM Alexa-594-azide 1 μl)
Remove the wash buffer from each well at step 8 and add 25 μl reaction cocktail per well and incubated for 1 h at RT. Protect from light.
After 1 h incubation, remove the reaction cocktail, wash twice with 50 μl 1x PBS. Protect from light.
Mount slides with Vectashield Mounting Medium with DAPI (1.5 μg/ml), seal with nail polish and seat for 15~30 min. Protect from light.
Examine by Fluorescent Microscopy (using 63x or 100x objective lens) (Figure 1).
Figure 1. EdU labeling of procyclic form of trypanosome cells. DNA synthesis was measured by adding 100 μM EdU to the culture medium for 1 h before harvest. Cells were then adhered to a poly-L-lysine coated 8-well slide and EdU was detected with Alexa-488-azide followed by the counterstaining of DNA and nucleus with 1.5 μg/ml DAPI. The inset in the EdU panel is the enlarged EdU labeling image of the cell on the right in the Phase panel. N, nucleus; k, kDNA. Red, DAPI; Green, EdU. Bar, 5 μm.
II. EdU labeling of kDNA networks isolated from trypanosomes
Notes:
1)From step 3 to the end of the protocol, operate at RT (room temperature).
2)From step 7, please protect from light by covering the box with lid or the eppendorf tubes with foil paper.
3) In steps 8 and 9, please use a 100 or 200 μl pipette to remove solution from each well.
Culture the procyclic trypanosomes in SDM-79 medium supplemented with 10% FBS at 28 °C, 5% CO2 incubator. For kDNA isolation, prepare more than 1 x 108 cells in total.
Add EdU solution to cell culture at 50 μM to 100 μM and continue to incubate for 30 min to 3 h as planned.
Isolate kDNA networks from ≥ 5 x 107 trypanosome cells.
Coat the 8-well glass slide with 1:50 diluted poly-L-lysine in ddH2O.
Mix 1 μl isolated kDNA networks with 19 μl 1x PBS (add 1x PBS in each well first and then mix kDNA with 1x PBS on the well).
Note: Before doing EdU labeling of isolated kDNA networks, it is suggested to examine kDNA networks abundance by DAPI staining only by following steps 5, 6, 10 and 11 (at least 15 kDNA networks in each field to continue).
Allow kDNA networks seat on the slide (poly-L-lysine coated) for 30 min at room temperature in humid chamber (see Equipment 1).
Prepare Click-iT reaction cocktail (make cocktail fresh and keep dark).
For 200 μl (1 slide or 8 wells, 25 μl/well):
Component A: 1x TBS 176 μl
Component B: 100 mM CuSO4 4 μl
Component C: Buffer additive 20 μl
1 mM Alexa-488-azide 1 μl
(OR 1 mM Alexa-594-azide 1 μl)
Remove kDNA and 1x PBS mixture from each well and add 25 μl reaction cocktail per well and incubated for 1 h at RT. Protect from light.
After 1 h incubation, remove the reaction cocktail, wash twice with 50 μl 1x PBS. Protect from light.
Mount slides with Vectashield Mounting Medium with DAPI (1.5 μg/ml), and seal with nail polish, and seat for 15~30 min. Protect from light.
Examine by Fluorescent Microscopy (using 100x objective lens) (Figure 2).
Figure 2. EdU labeling of isolated kDNA network from trypanosome cells. Networks were isolated from EdU-labeled cells and adhered to an 8-well glass slide and incorporated EdU was then detected with Alexa-488-azide (in green) and networks were stained with 1.5 μg/ml DAPI (in red). Arrows, a unit-sized pre-replication kDNA; Arrowhead, a double-sized post-replication kDNA.
Recipes
EdU solution (molecular weight of EdU: 252.22 g/mol)
Dissolve 12.16 mg EdU in 1 ml ddH2O for 50 mM EdU solution
Dissolve 12.16 mg EdU in 1 ml ddH2O for 50 mM EdU solution
1x PBS
Dissolve the following in 800 ml distilled H2O
8 g of NaCl
0.2 g of KCl
1.44 g of Na2HPO4
0.24 g of KH2PO4
Adjust pH to 7.4; then adjust volume to 1 L with additional distilled H2O. Sterilize by autoclaving.
Acknowledgments
I thank all lab members of Paul Englund and Robert Jensen for helpful discussions. This work was supported by NIH grant AI058613.
References
Wang, J., Englund, P. T. and Jensen, R. E. (2012). TbPIF8, a Trypanosoma brucei protein related to the yeast Pif1 helicase, is essential for cell viability and mitochondrial genome maintenance. Mol Microbiol 83(3): 471-485.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Wang, J. (2013). EdU labeling of Trypanosome Cells and Their Kinetoplast DNA (kDNA). Bio-protocol 3(12): e799. DOI: 10.21769/BioProtoc.799.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA > DNA labeling
Molecular Biology > DNA > DNA synthesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Molecular Surveillance of Malaria Using the PF AmpliSeq Custom Assay for Plasmodium falciparum Parasites from Dried Blood Spot DNA Isolates from Peru
Johanna Helena Kattenberg [...] Anna Rosanas-Urgell
Mar 5, 2023 696 Views
A Quick DNA Extraction Method for High Throughput Screening in Gram-positive Bacteria
Nuo Chen and Xiaoming Yuan
Apr 20, 2023 1224 Views
Protocol to Retrieve Unknown Flanking DNA Using Fork PCR for Genome Walking
Hongjing Wu [...] Haixing Li
Jan 20, 2025 1074 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
8 | https://bio-protocol.org/en/bpdetail?id=8&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Purification of 6x His-tagged Protein (from E. coli)
Bio-protocol Editor
In Press
Published: Jan 5, 2011
DOI: 10.21769/BioProtoc.8 Views: 27652
Ask a question
Favorite
Cited by
Abstract
A polyhistidine-tag is an amino acid motif that contains at least six histidine (His) residues, usually at the N- or C-terminus of the protein. This tag can also be referred to as a hexa histidine-tag or a 6x His-tag. The protocol described here has been developed to purify His-tagged proteins from E. coli under denaturing conditions using Ni-NTA agarose beads.
Materials and Reagents
Ni-NTA superflow (QIAGEN)
Tris base
Urea
IPTG
NaH2PO4·H2O
NaOH
HCl
LB/Amp media
Buffer B (see Recipes)
Buffer C (see Recipes)
Buffer D (see Recipes)
Buffer E (see Recipes)
Equipment
Centrifuge and rotor JLA8.1000 and JA-20 (Beckman Coulter)
Sonicator
Procedure
Induction of recombinant proteins
Grow 5 ~ 10 ml culture to saturated stage. The next day, inoculate this starter culture in 2 to 4 L of LB/Amp media using 1:50 or 1:100 dilution of saturated culture.
Grow the culture till it reaches OD= 0.4 to 0.6. Add IPTG to its final concentration of 0.6 M and induce 6x His-tagged protein production for 4 h.
Note: The amount of culture required depends on the level at which the protein is expressed, which must be determined empirically for each expression experiment. In a small scale induction experiment, if the expression level is 1.6%, concentration of 6x His-tagged protein ~ 2 mg/L and culture volume is 2 L, then the amount of 6x His-tagged protein is ~ 4 mg.
Note: 1 mg for antigen production. 1 mg for antibodies affinity purification.
Harvest cells using rotor JLA8.1000 at 5,000 rpm for 20 min. Store cell pellets at -80 °C.
Preparation of cleared E. coli lysates under denaturing conditions
Thaw the cell pellet at room temperature (RT) and resuspend in buffer B at 2 ml per gram wet weight.
The amount of cells required depends on the expression level of the 6x His-tagged protein and the expression system used. The binding capacity of Ni-NTA resins is protein dependent and normally lies between 5-10 mg/ml.
Sonicate cells in cold room.
Setting: Amplitude 30%, 3 min, 15 sec on, 15 sec off. Try 3 min cycle at least twice. Sonication shears genomic DNA, which makes the lysate less sticky.
Centrifuge lysate at 10,000 x g (11,294 rpm for rotor JA-20) at 8-12 °C to pellet cellular debris.
Save supernatant. Save 20 μl as input.
Proceed to protocols for purification under denaturing conditions.
Batch purification of 6x His-tagged proteins from E. coli under denaturing conditions
Add 1 ml of the pre-washed 50% Ni-NTA slurry to 4 ml lysate and mix gently by rotating for 60 min at RT.
The amount of lysate required depends on the expression level of the 6x His-tagged protein and the expression system used. The binding capacity of Ni-NTA resins is protein-dependent and normally lies between 5 -10 mg/ml. I use 1 ml resin for 10 ml lysate.
Load lysate-resin mixture carefully into an empty column with the bottom cap still attached.
Remove the bottom cap and collect the flow through.
Collect flow through (20 μl) for SDS-PAGE analysis.
Wash twice with 4 ml buffer C.
Keep wash fractions (20 μl) for SDS-PAGE analysis.
Elute the recombinant protein 4 times with 0.5 ml buffer D, followed by 4 times with 0.5 ml buffer E. Collect fractions and analyze by SDS-PAGE.
Monomers generally elute in buffer D, while multimers, aggregates, and proteins with two 6x His tags will generally elute in buffer E.
Notes
The amount of culture required for an experiment like this will depend on the level at which the protein is expressed, which must be determined empirically for each expression experiment.
Recipes
Buffer B (1 L)
100 mM NaH2PO4 [13.8 g NaH2PO4·H2O (MW 137.99 g/mol)]
10 mM Tris·HCl [1.2 g Tris base (MW 121.1 g/mol)]
8 M urea 480.5 g (MW 60.06 g/mol)
Adjust pH to 8.0 using NaOH
Buffer C (1 L)
100 mM NaH2PO4 [13.8 g NaH2PO4·H2O (MW 137.99 g/mol)]
10 mM Tris·HCl [1.2 g Tris base (MW 121.1 g/mol)]
8 M urea 480.5 g (MW 60.06 g/mol)
Adjust pH to 6.3 using HCl.
Buffer D (1 L)
100 mM NaH2PO4 [13.8 g NaH2PO4·H2O (MW 137.99 g/mol)]
10 mM Tris·HCl [1.2 g Tris base (MW 121.1 g/mol)]
8 M urea 480.5 g (MW 60.06 g/mol)
Adjust pH to 5.9 using HCl.
Buffer E (1L)
100 mM NaH2PO4 [13.8 g NaH2PO4·H2O (MW 137.99 g/mol)]
10 mM Tris·HCl [1.2 g Tris base (MW 121.1 g/mol)]
8 M urea 480.5 g (MW 60.06 g/mol)
Adjust pH to 4.5 using HCl.
Note: Due to the dissociation of urea, the pH of Buffers B, C, D, and E should be adjusted immediately prior to use. Do not autoclave.
Acknowledgments
This protocol has been modified and adapted in the Espenshade Lab, Johns Hopkins School of Medicine. Funding to support different projects that have used this protocol has come from NIH – National Heart, Lung, and Blood Institute, National Institute of Allergy and Infectious Diseases, the Pancreatic Cancer Action Network, and the American Heart Association.
References
QIAgenes E. coli Handbook. (2009). QIAgenes expression kit E. coli for high-level expression of His-tagged proteins in E. coli systems.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Protein > Isolation and purification
Microbiology > Microbial biochemistry > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Free Bio-protocol alerts
Sign up to receive alerts for:
. Monthly Electronic Table of Contents (eToC)
. Protocol Collections
. Bio-protocol Webinars
. Events
By clicking Subscribe, you agree to register as a Bio-protocol user and to our Terms of Service and Privacy Policy.
Subscribe
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
80 | https://bio-protocol.org/en/bpdetail?id=80&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Laemmli-SDS-PAGE
Fanglian He
In Press
Published: Jun 5, 2011
DOI: 10.21769/BioProtoc.80 Views: 161042
Ask a question
Favorite
Cited by
Abstract
Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) is used to separate proteins with relative molecular mass no smaller than 10 KD. Very small proteins (<10 KD) are difficult to resolve due to low ability of binding to SDS, which can be solved by gradient gels or using different eletrophoresis conditions, like Tricine-SDS-page. The basic Laemmli SDS PAGE procedure is described here.
Keywords: SDS-PAGE Protein Electrophoresis
Materials and Reagents
Pre-stain Protein MW marker (Bio-Rad Laboratories)
TEMED (Life Technologies, Gibco®)
Ammonium persulfate (Sigma-Aldrich)
SDS (Research Organics INC)
30% Acrylamide stock (37.5: 1 acrylamide: bisacrylamide) (Bio-Rad Laboratories)
Bromophenol Blue (Thermo Fisher Scientific)
Tris Base (Calbiochem-Behring)
Glycine (EM Science)
EDTA (Amresco)
Glycerol (EM Science)
Isopropanol
Tris-HCl (pH 6.8)
β-mercaptoethanol (Sigma-Aldrich)
10x running buffer (see Recipes)
2x SDS protein sample buffer (see Recipes)
Equipment
Protein mini gel cassettes (Bio-Rad)
Heating block module
Table-top centrifuge
Power supply
Gloves
Filter paper
Procedure
Making SDS-PAGE gel
Clean and completely dry glass plates, combs, and spacers are required.
Assemble gel cassette by following manufacturer instructions.
Prepare 10% lower gel (separating gel) by adding the following solutions (wear gloves when prepare gel solution) (total volume= 5 ml)
2 ml ddH2O
1.67 ml 30% acrylamide/Bis
1.25 ml 1.5 M Tris (pH 8.8)
25 μl 20% SDS
25 μl 10% ammonium persulfate (make it fresh and store at 4 °C up to a month)
2.5 μl TEMED (add it right before pour the gel)
Note: Change ration of ddH2O to 30% acrylamide/Bis to get different percentage of separating gel.
To avoid polymerization, after adding TEMED, mix well and quickly transfer the gel solution by using 1 ml pipette to the casting chamber between the glass plates and fill up to about 0.7 cm below the bottom of comb when the comb is in place.
Add a small layer of isopropanol to the top of the gel prior to polymerization to straighten the level of the gel.
Once the gel has polymerized, start to prepare stacking gel (5%) by adding the following solutions (total volume= 3 ml)
2.088 ml dH2O
0.506 ml 30% acrylamide/Bis
0.375 ml 1 M Tris (pH 6.8)
15 μl 20% (w/v) SDS
15 μl 10% ammonium persulfate
1.5 μl TEMED (add it right before the gel is poured)
Remove the isopropanol layer by using filter paper. Rinse the top layer of the gel with ddH2O and dry off as much of the water as possible by using filter paper.
Add TEMED and mix the stacking gel solution well. Quickly transfer the gel solution by using a 1 ml pipette till the space is full, and then insert the appropriate comb.
Allow the top portion to solidify and then carefully remove the comb.
Note: The gels can be stored with the combs in place tightly wrapped in plastic wrap and put in a second container with wet tissue towel (keep the gels moist) at 4 °C for 1 to 2 weeks.
Sample preparation
Prepare same amount of protein samples according to BCA assay result, see BCA (bicinchoninic acid) protein assay.
Add the same volume of 2x protein sample buffer to each protein sample, mix and boil the samples at 95 °C heating block module for 10 min.
Spin the samples at the maximal speed for 1 min (samples from some tissue/cell sources may need longer spin) in tabletop centrifuge and leave the samples at room temperature until you are ready to load onto the gel.
Note: Can store extracted protein samples (containing sample buffer) at -20 °C and reheat at 95 °C for 5 min when used the following time.
Electrophoresis
Remove the gel cassette from the casting stand and place it in the electrode assembly with the short plate on the inside. Press down on the electrode assembly while clamping the frame to secure the electrode assembly and put the clamping frame into the electrophoresis tank.
Pour some 1x electrophoresis running buffer into the opening of the casting frame between the gel cassettes. Add enough buffer to fill the wells of the gel. Fill the region outside of the frame with 1x running buffer.
Slowly load the same amount of protein samples into each well as well as load 10 μl of protein MW marker.
Connect the electrophoresis tank to the power supply.
Protein detection
If protein of interest is about 0.2 μg or more in the sample, typically use Coomassie blue staining (see Coomassie blue staining). Otherwise, use silver staining (sliver staining), which is more sensitive and can detect as little as 5 ng protein.
Recipes
10x running buffer
30.3 g Tris-base
144.0 g glycine
10.0 g SDS
Completely dissolve in about 800 ml ddH2O and then more ddH2O up to 1 liter.
2x SDS protein sample buffer
1.25 ml 1 M Tris-HCl (pH 6.8)
4.0 ml 10% (w/v) SDS
2.0 ml glycerol
0.5 ml 0.5 M EDTA
4 mg bromophenol blue
0.2 ml b-mercaptoethanol (14.3 M)
Bring the volume to 10 ml with ddH2O.
References
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227(5259): 680-685.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Protein > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
800 | https://bio-protocol.org/en/bpdetail?id=800&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Growth Assay and Detection of TRP and Indole Derivatives in Piriformospora indica Culture Supernatant by LC-MS/MS
MH Magdalena Hilbert
LV Lars M. Voll
JH Jörg Hofmann
AZ Alga Zuccaro
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.800 Views: 12332
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in New Phytologist Oct 2012
Abstract
The mutualistic root endophyte Piriformospora indica colonizes a wide range of plants and the colonization of root cells by this fungus is very often associated with beneficial effects to its host, such as growth promotion and increased biotic and abiotic stress tolerance. These traits may be based on general mechanisms and signaling pathways common to many different plant species. One such mechanism could be the recruitment of phytohormone pathways by P. indica. It is known, that many mutualistic microorganisms are able to synthesize and secrete phytohormones during the interaction with their host plants. This protocol has been successfully utilized to analyze tryptophan (TRP)-dependent biosynthesis of indole-3-acetic acid (IAA) and its indole derivatives by P. indica as well as their influence on the growth of this fungus (Hilbert et al., 2012).
Materials and Reagents
Indole derivative:
TRP (Sigma-Aldrich, catalog number: T0254-500g )
IAD (indole-3-acetaldehyde) (Sigma-Aldrich, catalog number: I1000-100mg )
IAA (Sigma-Aldrich, catalog number: I5148-2g )
Neubauer improved counting chamber (Marienfeld-Superior)
Sterile scalpel
Sterile drigalski spatula
Miracloth filter 15 cm x 15 cm (Merck KGaA, catalog number: 475855 )
Ruler
0.3 ml polypropylene snap ring microvials
0.9% NaCl
0.002% (v/v) Tween water 20
90% methanol (HPLC grade)
Acetonitrile (HPLC grade)
Acetic acid (HPLC grade)
Chlamydospores solution
Microelements (MnCl2.4H2O, H3BO3, ZnSO4.7H2O, KI, Na2MO4.2H2O, CuSO4.5H2O)
Glucose
Peptone
Yeast extract
Casamine acids
Agar
Complete medium (CM medium) (see Recipes)
Buffer A (see Recipes)
Buffer B (see Recipes)
Equipment
1.5 ml Eppendorf tubes
50 ml Falcon tube
Petri dishes (12 mm diameter)
Incubator (e.g. B. Braun Biotech International, Certomat BS-1)
Biofuge Primo R (Heraeus, Germany) (Rotor, catalog number: 7590 )
Phenomenex Luna 250 x 4.6 mm C18 RP-HPLC column (Phenomenex)
Phenomenex Luna 10 x 4.6 mm C18 RP-HPLC guard column (Phenomenex)
ICS3000 HPLC system (Dionex)
QTrap 3200 triple quadrupole mass spectrometer (Applied Biosystems SCIEX)
Polypropylene snap ring microvial
Procedure
Growth Assay
Collect spores from 3 to 4 weeks old Piriformospora indica plate cultures (see Figure 1).
Figure 1. Four-week-old P. Indica agar plate
Pour approximately 5 ml sterile 0.002% Tween water 20 on 3-4 weeks old P. indica plate under sterile condition at room temperature (RT).
Scratch plate with sterile Drigalski spatula and/or scalpel and mix.
Pour spore solution through miracloth filter and collect flow through in 50 ml Falcon tube.
Centrifuge for 7 min at 3,500 rpm discard supernatant.
Wash pellet with 5-10 ml 0.002% Tween water 20.
Centrifuge for 7 min at 3,500 rpm, discard supernatant.
Wash pellet with 5-10 ml 0.002% Tween water 20.
Centrifuge for 7 min at 3,500 rpm, discard supernatant.
Resuspend spore pellet in 10 ml 0.002% Tween water 20, count spores with counting chamber (e.g. Neubauer improved) and dilute to requested spore concentration (e.g. 500,000 spores/ml)
Inoculate 50 ml CM medium (Pham et al., 2004) supplemented with appropriate indole derivative (e.g. 2.5 mM TRP; 250 μM IAD or 1, 10, 100 μM IAA) with 400 μl chlamydospores solution (500,000 spores/ml) and cultivate for 7 days at 28 °C in the dark (alternatively wrap flasks with aluminium foil). Use mock inoculated flask as a negative control.
Separate supernatant from mycelium using miracloth filter (check the mass of each filter before).
Wash mycelium with 0.9% NaCl and let the whole miracloth filter with fungal biomass dry overnight in oven (85 °C).
Measure the dry fungal biomass (= mass of miracloth filter with dried fungal biomass – mass of empty miracloth filter).
Place 5 mm agar plugs from the 3 to 4 weeks old Piriformospora indica plate culture in the middle of a CM agar plate supplemented with the appropriate indole derivative (2.5 mM TRP, 250 μM IAD or 1, 10, 100 μM IAA). Use CM agar plate as control.
Use ruler to measure colony diameter after 14 days of cultivation at 28 °C in the dark.
Detection of tryptophan and indole derivatives in culture supernatant by LC-MS/MS
Use a 15 μl aliquot of P. indica culture supernatant obtained from section I point 2 of the procedure.
Add 1 ml of 90% methanol.
Vortex briefly and dilute an aliquot 1:10 in 90% methanol into a 0.3 ml polypropylene snap ring microvial.
Analyze 10 μl of the 1:10 dilution by LC-MS/MS.
IAA and ILA are separated on an ICS3000 HPLC system equipped with a Phenomenex Luna 250 x 4.6 mm C18 RP-HPLC column with the following gradient
0 to 5 min hold at 80% buffer A, 20% buffer B
5 to 26 min hold at 54% buffer A, 46% buffer B
26 to 27 min ramp to 10% buffer A, 90% buffer B
32 to 34 min ramp to 80% buffer A, 20% buffer B
32 to 34 min ramp to 80% buffer A, 20% buffer B
34 to 45 min equilibrate with 80% buffer A, 20% buffer B
Subject the HPLC eluate to coupled electrospray ionization in the negative ionization mode and to subsequent tandem MS analysis on the QTrap 3200 mass spectrometer with the following settings:
dwell time 75 ms
declustering potential (DP) -22 V (IAA), -30 V (ILA)
entrance potential (EP) -7 V (IAA), -55 V (ILA)
collision energy (CE) -15 V (IAA), -18 V (ILA)
collision energy (CE) -15 V (IAA), -18 V (ILA)
collision cell exit potential (CXP) 0 V (IAA), -4 V (ILA)
Quantitate IAA using the m/z transitions 174/130 and 174/128.
Quantitate ILA using the m/z transitions 204/128 and 204/158.
Employ commercially available authentic substances as references.
Recipes
Complete medium (CM medium; Pham et al., 2004)
CM medium (1 L)
50 ml 20x salt solution
20 g glucose
2 g peptone
1 g yeast extract
1 g casamine acids
1 ml microelements
15 g agar
20x salt solution
120 g NaNO3
10.4 g KCl
10.4 g MgSO4.7H2O
30.4 g KH2PO4
Microelements
6 g MnCl2.4H2O
1.5 g H3BO3
2.65 g ZnSO4.7H2O
750 mg KI
2.4 mg Na2MO4.2H2O
130 mg CuSO4.5H2O
Buffer A
0.75% acetic acid, pH 2.55 (adjust with acetic acid, if necessary)
Buffer B
acetonitrile/0.75% acetic acid, pH 2.55 (adjust with acetic acid, if necessary)
Acknowledgments
This protocol is adapted from Hilbert et al. (2012).
References
Hilbert, M., Voll, L. M., Ding, Y., Hofmann, J., Sharma, M. and Zuccaro, A. (2012). Hilbert, M., Voll, L. M., Ding, Y., Hofmann, J., Sharma, M. and Zuccaro, A. (2012). Indole derivative production by the root endophyte Piriformospora indica is not required for growth promotion but for biotrophic colonization of barley roots. New Phytol 196(2): 520-534.
Pham,G. H., Singh, A., Malla, R., Kumari, R., Prasad, R., Sachdev, M., Luis, P., Kaldorf, M., Peskan, T., Herrmann, S. (2004). Interaction of P. indica with other microorganisms and plants. In: Varma A, Abbott L, Werner D, Hampp R, eds. Plant Surface Microbiol Heidelberg, Germany: Springer, 237-265.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Hilbert, M., Voll, L. M., Hofmann, J. and Zuccaro, A. (2013). Growth Assay and Detection of TRP and Indole Derivatives in Piriformospora indica Culture Supernatant by LC-MS/MS. Bio-protocol 3(12): e800. DOI: 10.21769/BioProtoc.800.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Endosymbiosis
Microbiology > Microbe-host interactions > Fungus
Biochemistry > Other compound > Plant hormone > Indole
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Quantification of Salicylic Acid (SA) and SA-glucosides in Arabidopsis thaliana
Valérie Allasia [...] Harald Keller
May 20, 2018 11857 Views
Gene Replacement by a Selectable Marker in the Filamentous Fungus Magnaporthe oryzae
Nalleli Garcia [...] Jessie Fernandez
Sep 5, 2023 614 Views
In Vitro Hyphal Branching Assay Using Rhizophagus irregularis
Takaya Tominaga and Hironori Kaminaka
Aug 20, 2024 634 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
801 | https://bio-protocol.org/en/bpdetail?id=801&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Indole Derivative Feeding Test and Detection of TRP and Indole derivatives by Thin Layer Chromatography
MH Magdalena Hilbert
LV Lars M. Voll
JH Jörg Hofmann
AZ Alga Zuccaro
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.801 Views: 10522
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in New Phytologist Oct 2012
Abstract
The mutualistic root endophyte Piriformospora indica colonizes a wide range of plants and the colonization of root cells by this fungus is very often associated with beneficial effects to its host, such as growth promotion and increased biotic and abiotic stress tolerance. These traits could be based on general mechanisms and signaling pathways common to many different plant species. One such mechanism could be the recruitment of phytohormone pathways by P. indica. It is known, that many mutualistic microorganisms are able to synthesize and secrete phytohormones during the interaction with their host plants. This protocol has been successfully utilized to analyze tryptophan (TRP)-dependent biosynthesis of indole-3-acetic acid (IAA) and its indole derivatives by P. indica (Hilbert et al., 2012).
Materials and Reagents
Indole derivative:
TRP (Sigma-Aldrich, catalog number: T0254-500g )
IAD (indole-3-acetaldehyde) (Sigma-Aldrich, catalog number: I1000-100mg )
IAA (Sigma-Aldrich, catalog number: I5148-2g )
Standard microscope coverslips
Standard microscope slides
0.002% (v/v) Tween water 20
0.9% NaCl
FeCl3
HClO4
NaNO3
MgSO4.7H2O
KH2PO4
Orthophosphoric acid
Glucose
Peptone
Yeast extract
Casamine acids
Microelements
Agar
Tryptophan (Sigma-Aldrich, catalog number: T0254-500g)
Ethyl acetate
Aluminum foil
p-dimethylaminobenzaldehyde (Sigma-Aldrich)
Van Urk reagent (see Recipes)
Salkowski test reagents (see Recipes)
10 mM orthophosphoric acid (see Recipes)
Complete medium (see Recipes)
20x salt solution (see Recipes)
Microelements (see Recipes)
Equipment
Erlenmeyer flasks (100 ml)
Neubauer improved counting chamber (Marienfeld-Superior, Lauda, Königshofen, Germany)
Scalpel (sterile)
Whatman paper
Miracloth filter 15 cm x 15 cm (Merck KGaA, catalog number: 475855 )
Drigalski spatula (sterile)
Disposable cuvettes
Preval sprayer
Thin layer chromatography (TLC) chamber
Petri dishes (12 mm in diameter)
15 ml sterile Falcon tubes
2 ml Eppendorf tubes
Glass test tubes
Incubator e.g. Certomat BS-1 (B. Braun Biotech International)
Speedvac sc110 (Savant, Thermo Fisher Scientific)
Biofuge Primo R (Heraeus) (Rotor, catalog number: 7590 )
Heraeus Pico 17 centrifuge (Heraeus)
Spectrophotometer e.g. Ultrospec 3,000 proUV/Visible (GE Healthcare)
Clean bench Hera Safe (Heraeus)
Hybridization oven (Hybaid Shake n’ Stack, Thermo Fisher Scientific)
Procedure
Collect spores from 3 to 4 weeks old Piriformospora indica CM agar plate cultures grown at 28 °C (see Figure 1).
Figure 1. Four-week-old P. indica agar plate
Pour approximately 5 ml sterile 0.002% Tween water 20 on 3-4 weeks old P. indica plate under sterile condition at room temperature (RT).
Scratch plate with Drigalski spatula and/or scalpel and mix.
Pour spore solution through miracloth filter and collect flow through in 50 ml falcon tube.
Centrifuge for 7 min at 3,500 rpm, discard supernatant.
Wash pellet with 5-10 ml 0.002% Tween water 20.
Centrifuge for 7 min at 3,500 rpm, discard supernatant.
Wash pellet with 5-10 ml 0.002% Tween water 20.
Centrifuge for 7 min at 3,500 rpm, discard supernatant.
Resuspend spore pellet in 10 ml 0.002% Tween water 20, count spores with counting chamber (e.g. Neubauer improved) and dilute to requested spore concentration (e.g. 500,000 spores ml-1).
Inoculate 50 ml “complete medium” CM liquid medium (Pham et al., 2004) with 400 μl of 500,000 spores/ml spore solution in 100 ml Erlenmeyer flask.
Let spores germinate for 1 week at 28 °C and 130 rpm.
Inoculate with 2.5 mM TRP (prepare the stock 1 day before, dissolve slowly; work in darkness auxin is light sensitive).
Incubate cultures in darkness (alternatively wrap flasks with aluminium foil) for 3 days.
Collect 11 ml supernatant through miracloth filter (check the mass of each filter) into 15 ml falcon tube:
Wash mycelium with 0.9% NaCl and let the whole miracloth filter with fungal biomass dry overnight in oven (85 °C).
15 μl aliquot of the culture supernatant can be used for the determination of TRP and indole derivatives by LC-MS/MS (see Hilbert et al., 2013") From the falcon tube take 1 ml into glass test tube for Salkowski test.
Salkowski test: Mix 1 ml supernatant with 2 ml Salkowski reagent and 50 μl of 10 mM orthophosphoric acid, incubate for 25 min at RT, measure OD530.
Add 5 ml ethyl acetate to the remaining 10 ml of supernatant and incubate for 3 to 4 h at 200 rpm in darkness (supernatant can be frozen at -20 °C overnight).
For good phase separation centrifuge 5 min at 4 °C at 3,500 rpm (if needed leave falcons overnight at 4 °C in darkness).
Transfer 2 ml of organic phase (upper phase) into a 2 ml eppendorf tube and evaporate in SpeedVac concentrator for 30 min with medium heating.
Add 2 ml of the remaining organic phase to the pellet and repeat the SpeedVac process.
Resuspend pellet in 60 μl ethyl acetate (Storage in -20 °C).
Calculate the dry biomass.
Fill the TLC chamber with Whatman paper.
Saturate TLC chamber for approximately 1 h with approximately 200 ml of running buffer chloroform: ethanol: water (84:14:1).
Load extracted samples onto the TLC plate in a volume, that each spot represents the amount of indole derivatives obtained from the samples of equal biomass (use not more than 6 μl for loading on TLC plate).
Use commercially available indole derivatives as marker control (e.g. TRP, IAD and IAA).
Let TLC run for 1 to 1.5 h in darkness.
Dry TLC plate for 5 min at RT for approximately 2 to 5 min.
Develop TLC plate by spraying on it a mixture of van Urk and Salkowski reagents in the proportion of 1:3 (Ehmann, 1977) and incubate in an incubator at 90 °C up to 10 min.
Calculate retention factor (Rf) for each spot (the distance travelled by the compound divided by the distance travelled by the solvent) and compare it with Rf calculated for each indole derivative control.
Recipes
Van Urk reagent
1 g p-dimethylaminobenzaldehyde dissolved in 50 ml concentrated HCl and 50 ml ethanol. This reagent is stable for several months at room temperature when stored in a brown/light protected glass bottle.
Salkowski test reagents
Prepare stock solution of 0.5 M FeCl3 (1.35 g in 10 ml water)
Use 1 ml of this stock to mix with 49 ml of 35 % HClO4
10 mM orthophosphoric acid
115 μl (of 85 %) in 100 ml water
Complete medium (CM) 1 L
50 ml 20x salt solution
20 g glucose
2 g peptone
1 g yeast extract
1 g casamine acids
1 ml microelements
15 g agar
20x salt solution 1 L
120 g NaNO3
10.4 g KCl
10.4 g MgSO4.7H2O
30.4 g KH2PO4
Microelements 1 L
6 g MnCl2.4H2O
1.5 g H3BO3
2.65 g ZnSO4.7H2O
750 mg KI
2.4 mg Na2MO4.2H2O
130 mg CuSO4.5H2O
Acknowledgments
This protocol is adapted from Hilbert et al. (2012).
References
Hilbert, M., Voll, L. M., Ding, Y., Hofmann, J., Sharma, M. and Zuccaro, A. (2012). Indole derivative production by the root endophyte Piriformospora indica is not required for growth promotion but for biotrophic colonization of barley roots. New Phytol 196(2): 520-534.
Hilbert, M., Voll, L., Hofmann, J. and Zuccaro, A. (2013). Growth Assay and Detection of TRP and Indole Derivatives in Piriformospora indica Culture Supernatant by LC-MS/MS. Bio-protocol 3(12): e800.
Ehmann, A. (1977). The van urk-Salkowski reagent--a sensitive and specific chromogenic reagent for silica gel thin-layer chromatographic detection and identification of indole derivatives. J Chromatogr 132(2): 267-276.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Hilbert, M., Voll, L. M., Hofmann, J. and Zuccaro, A. (2013). Indole Derivative Feeding Test and Detection of TRP and Indole derivatives by Thin Layer Chromatography. Bio-protocol 3(12): e801. DOI: 10.21769/BioProtoc.801.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Endosymbiosis
Microbiology > Microbe-host interactions > Fungus
Biochemistry > Other compound > Plant hormone > Indole
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Quantification of Salicylic Acid (SA) and SA-glucosides in Arabidopsis thaliana
Valérie Allasia [...] Harald Keller
May 20, 2018 11857 Views
Gene Replacement by a Selectable Marker in the Filamentous Fungus Magnaporthe oryzae
Nalleli Garcia [...] Jessie Fernandez
Sep 5, 2023 614 Views
In Vitro Hyphal Branching Assay Using Rhizophagus irregularis
Takaya Tominaga and Hironori Kaminaka
Aug 20, 2024 634 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
802 | https://bio-protocol.org/en/bpdetail?id=802&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
IFN-α Inhibition Assay in vitro
Kathrin Gibbert
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.802 Views: 10026
Reviewed by: Fanglian HeLin Fang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Aug 2012
Abstract
During viral infections Interferon-α (IFN-α) is expressed by infected host cells. IFN-α binds to its receptor (IFNAR1/2), which leads to the activation of downstream signaling via JAK-STAT. This signaling cascade results in the expression of several hundred different genes, so called interferon-stimulated gene, which lead to an antiviral state of the infected and the neighboring cells.
Keywords: Type I IFNs IFN-alpha subtypes Friend Murine leukemia virus Antiviral effect
Materials and Reagents
Mus dunni fibroblast cells
Friend murine leukemia virus (F-MuLV) (titer was measured as previously described (Robertson et al., 1991))
3-Amino-9-ethylcarbazole (AEC) (Sigma-Aldrich, catalog number: A6926-100TAB )
Antibody 720 (mouse antibody against FV envelope protein), hybridoma supernatant (Robertson et al., 1991)
Bovine serum albumin (BSA) (PAA Laboratories GmbH, catalog number: K41-001 )
Ethanol 96% (Roth North America, catalog number: 5054.5 )
Superior FBS (fetal bovine serum, not heat-inactivated) (Biochrom, catalog number: S0615 )
Goat anti-mouse HRP (Dako, catalog number: P0477 )
Hydrogen peroxide 30% (Applichem, catalog number: A1134,0250)
N,N-dimethylformamide (Merck Millipore, catalog number: 1.03053.1000 )
PBS (GIBCO, catalog number: 14190-136 )
Penicillin/streptomycin (PAA Laboratories GmbH, catalog number: P11-010 )
Polybrene/Hexadimethrine bromide (Sigma-Aldrich, catalog number: H9268 )
RPMI 1640 (PAA Laboratories GmbH, catalog number: E15-840 )
Sodium Acetate (Merck Millipore, catalog number: 1062811000 )
Murine IFN-α (PBL, catalog number: 12100-1 )
Medium (see Recipes)
Washing Buffer (see Recipes)
3-Amino-9-ethylcarbazole (AEC) substrate solution (see Recipes)
Equipment
Incubator (37 °C; 5% CO2)
24 well cell culture plate (Greiner Bio-one, catalog number: 662160 )
Procedure
Day 1:
Seed 7.5 x 103 Mus dunni fibroblast cells in 500 μl media per well in 24-well plates.
Add IFN-α in increasing concentrations to the cells (use concentrations between 50 pg/ml to 10,000 pg/ml).
Controls: Without IFN-α; without virus.
Incubate the cells for 24 h at 37 °C (5% CO2).
Day 2:
Decant media.
Add 1 ml fresh media supplemented with polybrene (8 μg/ml) to increase the infection efficiency.
Add 50 FFU (focus-forming units) F-MuLV to the wells.
Incubate for 3 days.
Day 5:
Decant media.
Fix cells with 500 μl 96% ethanol for 5 min at room temperature (RT).
Wash wells twice with 500 μl washing buffer (PBS + 0.1% BSA).
Add 250 μl supernatant of antibody 720 (mAB against FVenv) per well for 2 h.
Wash twice with 500 μl washing buffer.
Add 250 μl 2nd antibody (goat anti-mouse HRP) to wells (diluted 1 to 500 in PBS).
Incubate for 1 h at RT.
Wash twice with 500 μl washing buffer.
Freshly prepare AEC substrate solution as indicated in Recipes section.
Add 250 μl substrate solution per well.
Incubate for 10-15 min at RT in the dark.
Decant supernatant in special waste container for toxic solvents.
Wash with 500 μl water.
Dry plates overnight.
Day 6:
Count foci
Treatment with IFN-α should significantly decrease the numbers of foci compared to unstimulated cells (Figure 1).
Figure 1. Representative example of Interferon-α Inhibition assay with Interferon-α (left picture without foci) and without Interferon-α (right picture with foci)
Recipes
Medium
RPMI 1640
10% FCS
1% penicillin/streptomycin
Washing buffer
PBS + 0.1% BSA
AEC substrate solution
Dissolve 1 tablet AEC in 2.5 ml of N, N-dimethylformamide. Add 2.5 ml of the substrate solution to 47.5 ml of 50 mM sodium acetate buffer, pH 5.0. Add 25 μl of fresh 30% hydrogen peroxide immediately prior to use.
Acknowledgments
This work was supported by the Deutsche Forschungsgemeinschaft (GRK 1045).
References
Dittmer, U., Brooks, D. M. and Hasenkrug, K. J. (1998). Characterization of a live-attenuated retroviral vaccine demonstrates protection via immune mechanisms. J Virol 72(8): 6554-6558.
Gibbert, K., Joedicke, J. J., Meryk, A., Trilling, M., Francois, S., Duppach, J., Kraft, A., Lang, K. S. and Dittmer, U. (2012). Interferon-alpha subtype 11 activates NK cells and enables control of retroviral infection. PLoS Pathog 8(8): e1002868.
Gerlach, N., Gibbert, K., Alter, C., Nair, S., Zelinskyy, G., James, C. M. and Dittmer, U. (2009). Anti-retroviral effects of type I IFN subtypes in vivo. Eur J Immunol 39(1): 136-146.
Robertson, M. N., Miyazawa, M., Mori, S., Caughey, B., Evans, L. H., Hayes, S. F. and Chesebro, B. (1991). Production of monoclonal antibodies reactive with a denatured form of the Friend murine leukemia virus gp70 envelope protein: use in a focal infectivity assay, immunohistochemical studies, electron microscopy and western blotting. J Virol Methods 34(3): 255-271.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Gibbert, K. (2013). IFN-α Inhibition Assay in vitro. Bio-protocol 3(12): e802. DOI: 10.21769/BioProtoc.802.
Gibbert, K., Joedicke, J. J., Meryk, A., Trilling, M., Francois, S., Duppach, J., Kraft, A., Lang, K. S. and Dittmer, U. (2012). Interferon-alpha subtype 11 activates NK cells and enables control of retroviral infection. PLoS Pathog 8(8): e1002868.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Immunology > Host defense > Murine
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Production of Recombinant Hepatitis B virus (HBV) and Detection of HBV in Infected Human Liver Organoids
Tanvir Hossain [...] Tokameh Mahmoudi
Apr 20, 2022 2203 Views
Protein Pull-down Assay Using HiBiT-tag-dependent Luciferase Activity Measurement
Masashi Arakawa and Eiji Morita
Mar 20, 2023 1092 Views
Mass Spectrometry-based Lipidomics, Lipid Bioenergetics, and Web Tool for Lipid Profiling and Quantification in Human Cells
Liang Cui [...] Kuan Rong Chan
Aug 20, 2023 1333 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
803 | https://bio-protocol.org/en/bpdetail?id=803&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of IFN-α Subtype Concentrations (Virus-free, Cell-based Bioassay)
Kathrin Gibbert
Published: Vol 3, Iss 12, Jun 20, 2013
DOI: 10.21769/BioProtoc.803 Views: 8510
Reviewed by: Fanglian HeLin Fang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Aug 2012
Abstract
The induction of type I IFN is the immediate host response against viral infections. Type I IFNs belong to a multigene family including up to 14 different IFN-α subtypes and one IFN-β. They are highly conserved and bind the same receptor (IFNAR1/2) with varying affinities, although they differ in their biological activities.
Keywords: Type I IFNs IFN-alpha subtypes Mx expression
Materials and Reagents
7AAD (7-amino-actinomycin D) (BD Pharmingen, catalog number: 51-68981E )
Bovine serum albumin (BSA) (PAA Laboratories GmbH, catalog number: K41-001 )
DMEM (Life Technologies, Gibco®, catalog number: 41966-029 )
Superior FBS (fetal bovine serum, not heat-inactivated) (Biochrom, catalog number: S0615 )
Mx/RAGE7 cells (virus-transformed adherent cell line with a temperature-inducible promotor; must be cultured at 32 °C; cells express the Mx transgene and a promotorless eGFP gene which is expressed due to type I IFN stimulation ) (Bollati-Fogolin and Muller, 2005)
PBS (Life Technologies, Gibco®, catalog number: 14190-136 )
Penicillin/streptomycin (PAA Laboratories GmbH, catalog number: P11-010 )
Propidium iodide (eBioscience, catalog number: 00-6990-50 )
Murine IFN-α (PBL, catalog number: 12100-1 )
Sodium azide (Applichem, catalog number: A1430.0010 )
Sodium pyruvate (Life Technologies, Gibco®, catalog number: 11360-039 )
Trypsin EDTA (PAA Laboratories GmbH, catalog number: L11-004 )
β-mercaptoethanol (Life Technologies, Gibco®, catalog number: 31350-010 )
Media for Mx/RAGE7 cells (see Recipes)
FACS buffer (see Recipes)
Equipment
96-well flat bottom plate (Falcon BD Labware, catalog number: 3072 )
1.5 ml microfuge tubes
FACS tubes (BD Biosciences, Falcon®, catalog number: 352054 )
Flow cytometer (e.g. BD LSR II)
Incubator (37 °C; 5% CO2)
Incubator (32 °C; 5% CO2)
Procedure
Different murine IFN-α subtypes (IFN-α1, -α2, -α4, -α5, -α6, -α9, -α11) were produced as already described (Gerlach et al., 2009).
Day 1:
Seed Mx/RAGE7 cells in a 96 well cell culture plate (2 x 104 cells per well in 200 μl medium).
Grow the cells for 24 h at 32 °C.
Day 2:
Perform serial dilutions (log10) of produced IFN-α subtypes in medium in 1.5 ml tubes.
Perform serial dilutions (log2) of recombinant IFN-α subtypes (PBL) with known concentrations from 1,000 U/ml to 31.25 U/ml (= standards) in 1.5 ml tubes.
Decant medium of Mx/RAGE7 cells.
Add 200 μl of the IFN-α solutions with known (standards) and unknown concentrations to the cells.
As negative control add 200 μl of medium without IFN-α.
Incubate the samples for 24 h at 37 °C.
Day 3:
Decant the medium.
Add 200 μl fresh medium to the cells.
Incubate the samples for 48 h at 37 °C.
Day 5:
Decant the medium.
Wash cells with 200 μl PBS.
Add 50 μl of trypsin EDTA (1x) 0.05% to the cells at room temperature until they suspend.
Harvest suspended cells in FACS tubes containing 1 ml of PBS.
Centrifuge cells (300 x g; 5 min).
Resuspend cells with 250 μl FACS buffer.
Add 2.5 μl 7AAD or 0.5 μl propidium iodide per sample to exclude dead cells.
Immediately analyze cells with flow cytometer.
IFN-α treated Mx/RAGE7 cells express eGFP (Figure 1).
Perform standard curve with samples treated with known IFN-α concentrations (graph the data for the standard curve (Figure 2), the IFN-α titer can be determined by comparison).
Calculate concentrations of unknown samples.
Figure 1. Representative dot plots of Mx/RAGE7 cells without IFN-α (upper panel) and with IFN-α (lower panel)
Figure 2. Standard curve of IFN-α
Recipes
Media for Mx/RAGE7 cells
DMEM
10% FBS
1 mM sodium pyruvate
1% penicillin/streptomycin
50 μM β-mercaptoethanol
FACS buffer
PBS
0.1% BSA
0.02% sodium azide
Acknowledgments
This work was supported by the Deutsche Forschungsgemeinschaft (GRK 1045).
References
Bollati-Fogolin, M. and Muller, W. (2005). Virus free, cell-based assay for the quantification of murine type I interferons. J Immunol Methods 306(1-2): 169-175.
Gerlach, N., Gibbert, K., Alter, C., Nair, S., Zelinskyy, G., James, C. M. and Dittmer, U. (2009). Anti-retroviral effects of type I IFN subtypes in vivo. Eur J Immunol 39(1): 136-146.
Gibbert, K., Joedicke, J. J., Meryk, A., Trilling, M., Francois, S., Duppach, J., Kraft, A., Lang, K. S. and Dittmer, U. (2012). Interferon-alpha subtype 11 activates NK cells and enables control of retroviral infection. PLoS Pathog 8(8): e1002868.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Gibbert, K. (2013). Measurement of IFN-α Subtype Concentrations (Virus-free, Cell-based Bioassay). Bio-protocol 3(12): e803. DOI: 10.21769/BioProtoc.803.
Gibbert, K., Joedicke, J. J., Meryk, A., Trilling, M., Francois, S., Duppach, J., Kraft, A., Lang, K. S. and Dittmer, U. (2012). Interferon-alpha subtype 11 activates NK cells and enables control of retroviral infection. PLoS Pathog 8(8): e1002868.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Immunology > Immune cell function > Cytokine
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Protein Pull-down Assay Using HiBiT-tag-dependent Luciferase Activity Measurement
Masashi Arakawa and Eiji Morita
Mar 20, 2023 1092 Views
Mass Spectrometry-based Lipidomics, Lipid Bioenergetics, and Web Tool for Lipid Profiling and Quantification in Human Cells
Liang Cui [...] Kuan Rong Chan
Aug 20, 2023 1333 Views
Unlocking Bio-Instructive Polymers: A Novel Multi-Well Screening Platform Based on Secretome Sampling
Shirin Fateh [...] Morgan R. Alexander
Feb 20, 2024 1300 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
804 | https://bio-protocol.org/en/bpdetail?id=804&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bacterial Conjugation in Rhodobacter capsulatus
ML Molly M. Leung
John Thomas Beatty
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.804 Views: 12491
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Molecular Microbiology Feb 2012
Abstract
Bacterial conjugation of plasmids is the common method of introducing foreign DNA into Rhodobacter capsulatus because transformational systems have not been shown as efficient methods of introducing DNA to R. capsulatus. For R. capsulatus bacterial conjugation using an Escherichia coli donor can be used to introduce replicating vectors, and non-replicating vectors for targeted chromosomal modifications.
Materials and Reagents
R. capsulatus recipient strain
Escherichia coli donor strain (containing plasmid to be conjugated) capable of conjugation (e.g. S17-1) or E. coli donor strain containing plasmid to be conjugated and a helper strain containing the tra genes [e.g. HB101 (pRK2013)]. For a review on conjugation and tra genes see Willetts et al. (1984)
Plasmid to be conjugated into R. capsulatus (e.g. pXCA601; Tetracycline resistance)
Appropriate antibiotic (resistance specified by plasmids and bacterial strains)
Thiamine hydrochloride
H3BO3
MnSO4·H2O
Na2MoO4·2H2O
ZnSO4·7H2O
Cu(NO3)·3H2O
D, L-malic acid
Na2EDTA
MgSO4·7H2O
CaCl2·2H2O
FeSO4·7H2O
10 mM potassium phosphate buffer
0.3% Difco yeast extract
0.3% Difco bactopeptone
Bacto-tryptone
Yeast extract
Trace element solution (see Recipes)
RCV broth (see Recipes)
RCV agar (see Recipes)
LB broth (see Recipes)
LB agar (see Recipes)
YPS agar (see Recipes)
Equipment
30 °C and 37 °C shakers
30 °C and 37 °C incubator
Test tubes
Petri plates
Sterile 1.7 ml microcentrifuge tubes
Inoculation loop
Pipetmen (10 μl to 1 ml range) and appropriate tips
Graduated pipette (5 ml range) and aspiration bulb
Bench-top microcentrifuge with rotor for 1.7 ml microcentrifuge tubes
Procedure
Streak recipient R. capsulatus strain on RCV agar plate (with appropriate antibiotics) and incubate at 30 °C for 2-3 days.
Streak donor E. coli strain (and helper E. coli) on LB agar plate with appropriate antibiotics and incubate at 37 °C overnight.
Inoculate 4 ml of RCV broth (with appropriate antibiotics) with a single colony of the recipient R. capsulatus strain and incubate at 30 °C in a 200-250 rpm shaker for 2 days.
One day later inoculate 4 ml of LB broth (with appropriate antibiotics) with donor E. coli strain, and 4 ml of LB broth with helper E. coli strain if applicable (see Materials and Reagents for examples), and incubate at 37 °C in a 200-250 rpm shaker overnight.
In separate sterile microcentrifuge tubes transfer 100 μl of donor E. coli strain, 100 μl of helper E. coli strain (if applicable), and 200 μl of recipient R. capsulatus strain. Each strain should be in mid- to late- log phase.
Spin microcentrifuge tubes containing cultures at 3,500 x g for 1 min. in bench-top centrifuge.
Decant all supernatant from microcentrifuge tubes.
Resuspend cell pellets in 500 μl RCV broth per microcentrifuge tube to wash away residual antibiotics and LB broth.
Spin microcentrifuge tubes containing resuspended cultures at 4,000 x g for 1 min in bench-top centrifuge.
Decant all supernatant from microcentrifuge tubes.
Resuspend donor E. coli strain cell pellet in 50 μl RCV broth.
Transfer all of the resuspended donor E. coli strain to helper E. coli strain cell pellet and resuspend (if applicable).
Transfer all of the resuspended donor E. coli strain (and helper E. coli strain) to the recipient R. capsulatus strain and resuspend.
Aliquot 10 μl drops of donor-helper-recipient mix onto a dry RCV agar plate (no antibiotics) and allow for the drops to dry.
Incubate plate upside down at 30 °C for 1-2 days. R. capsulatus but not E. coli will grow on the RCV agar plate and the cells are ready when the conjugation spots have a red ring around it. The middle of the spot will likely be pale pink.
Streak the conjugation spots onto RCV agar plates containing appropriate antibiotic to select for the cell containing the plasmid (see Materials and Reagents for plasmid example). Do this by scraping the red ring around the conjugation spot up with an inoculation loop.
Incubate streaked plate at 30 °C for 3-4 days or until you see colonies.
Optional (this will also be done in step 20): Test the R. capsulatus colonies for plasmid using your choice method, such as colony PCR.
Restreak colony on YPS agar plate containing appropriate antibiotics and incubate at 30 °C for 2-3 days to ensure that it is “clean” of E. coli cells. Although E. coli does not grow on RCV, it can survive. E. coli will grow on YPS agar plates. This YPS agar plate will isolate R. capsulatus cells containing the conjugated plasmid from the E. coli survivors as individual colonies. You can visually identify single R. capsulatus colonies on this YPS agar plate. It will be pink/maroon in colour compared to the cream colored E. coli colonies.
Test the “non-contaminated” R. capsulatus colonies for the conjugated plasmid by colony PCR.
Recipes
Trace element solution (in 250 ml dH2O)
0.7 g H3BO3
398 mg MnSO4·H2O
188 mg Na2MoO4·2H2O
60 mg ZnSO4·7H2O
10 mg Cu(NO3)·3H2O
RCV broth/agar (Beatty et al., 1981) (in 1 L; autoclaved)
4 g D, L-malic acid
1 g (NH4)2SO4
10 mM potassium phosphate buffer
200 mg MgSO4·7H2O
75 mg CaCl2·2H2O
12 mg FeSO4·7H2O
20 mg Na2EDTA
1 ml trace element solution
1 mg thiamine hydrochloride
Adjust pH to 6.8 with NaOH before autoclaving
(for agar add 1.5% Agar)
YPS broth/agar (Wall et al., 1975) (autoclaved)
0.3% Difco yeast extract
0.3% Difco bactopeptone
2 mM CaCl2
2 mM MgSO4
(for agar add 1.5% agar)
LB Broth (Sambrook et al., 1989) (in 1 L; autoclaved)
10 g Bacto-tryptone
5 g Yeast extract
10 g NaCl
Adjust pH to 7.5 with NaOH before to autoclaving
(for agar add 1.5% Agar)
Acknowledgments
The development of this protocol was funded by a grant to J.T.B. from the Canadian Institutes of Health Research.
References
Beatty J. T. and Gest H. (1981). Generation of succinyl-coenzyme A in photosynthetic bacteria. Arch Microbiol 129(5): 335-340.
Leung M.M., Brimacombe C.A., Spiegelman G.B., and Beatty, J.T. (2012). The GtaR protein negatively regulates transcription of the gtaRI operon and modulates gene transfer agent (RcGTA) expression in Rhodobacter capsulatus. Mol Microbiol 83(4):759-74.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning: a laboratory manual (2nd edn). Plainview: New York: Cold Spring Harbor Laboratory Press.
Wall J.D., Weaver P.F., et al. (1975). Gene transfer agents, bacteriophages, and bacteriocins of Rhodopseudomonas capsulata. Arch Microbiol 105(3): 217-224.
Willetts,N., and Wilkins, B. (1984). Processing of plasmid DNA during bacterial conjugation. Microbiol Rev 48: 24-41.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial genetics > Transformation
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
About buffer preparation
0 Answer
4 Views
Nov 7, 2023
Related protocols
A Fast and Easy Method to Study Ralstonia solanacearum Virulence upon Transient Gene Expression or Gene Silencing in Nicotiana benthamiana Leaves
Wenjia Yu and Alberto P. Macho
Aug 5, 2021 3192 Views
A New Tool for the Flexible Genetic Manipulation of Geobacillus kaustophilus
Ryotaro Amatsu [...] Ken-ichi Yoshida
Sep 5, 2022 868 Views
Efficient Genetic Transformation and Suicide Plasmid-mediated Genome Editing System for Non-model Microorganism Erwinia persicina
Tingfeng Cheng [...] Lei Zhao
Mar 20, 2024 580 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
805 | https://bio-protocol.org/en/bpdetail?id=805&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
cAMP Accumulation Assays Using the AlphaScreen® Kit (PerkinElmer)
CK Cassandra Koole
DW Denise Wootten
PS Patrick Sexton
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.805 Views: 12513
Reviewed by: Cheng Zhang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Proceedings of the National Academy of Sciences of the United States of America Nov 2012
Abstract
Cyclic adenosine monophosphate (cAMP) is an intracellular signaling messenger derived from the catalytic conversion of ATP, and is a major product of activated Gs protein-coupled receptors. Conversely, formation of cAMP is inhibited by Gi protein-coupled receptors. This protocol has been optimized for the detection of ligand-mediated cAMP accumulation in adherent immortal cell lines expressing Gs-coupled receptors.
Materials and Reagents
Sterile 96-well clear flat bottom plates (BD Biosciences, Falcon®, catalog number: 353072 )
Phenol Red Free Dulbecco’s Modified Eagle Medium (DMEM) (Life Technologies, Gibco®, catalog number: 21063-029 )
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
3-isobutyl-1-methylxanthine (IBMX) (Sigma-Aldrich, catalog number: I5879 )
Tween-20 (Sigma-Aldrich, catalog number: P2287 )
HEPES (Life Technologies, Gibco®, catalog number: 11344-041 )
100% Ethanol
Milli-Q H2O
Alphascreen® cAMP Assay Kit (PerkinElmer, catalog number: 6760625 )
White OptiPlate-384 well microplate (PerkinElmer, catalog number: 6007290 )
TopSeal (PerkinElmer, catalog number: 6005250 )
Stimulation buffer (see Recipes)
Lysis buffer (see Recipes)
Acceptor buffer (see Recipes)
Donor buffer (see Recipes)
Equipment
Fusion-α plate reader or Envision plate reader with appropriate alphascreen modules (PerkinElmer)
Humidified Incubator
Multichannel Pipettes
Micropipettes
Benchtop centrifuge
Oven
Orbital shake
Procedure
Notes:
1) Cells can either be stably or transiently expressing receptor of interest.
2) All incubations are in a humidified environment at 37 °C, 5% CO2 unless otherwise indicated.
I. Cell preparation
Seed cells in suitable nutrient media (e.g. DMEM, 10% FBS, no antibiotics) into a sterile 96-well plate and incubate in a humidified environment at 37 °C, 5% CO2 to be ~90% confluent the following day (~24 h).
Note: Optimization for cell number depending on the cell line used will be necessary (we suggest a starting range of 10,000-50,000 cells/well). Recommended density for CHO FlpIN cells is 30,000 cells/ well.
II. Stimulation
The day following seeding, aspirate nutrient media and replace with 90 μl prewarmed Stimulation buffer.
Incubate in a humidified environment at 37 °C, 5% CO2 for 30 min.
Note: Do not leave in cells in Stimulation buffer for longer than 2 h prior to stimulation.
Prepare serial dilutions of ligands at 10x final concentration in Stimulation buffer, enough for 10 μl/well, to be performed in duplicate (minimum).
Note: Concentration range to use will depend on ligand affinity for receptor. For initial tests, select a top concentration 100x Kd of ligand, a buffer only control, and several concentrations between these. The range can then be refined in subsequent experiments.
Prepare 10x appropriate concentration of forskolin in Stimulation buffer.
Note: This is the internal control for the experiment – forskolin is an activator of adenylate cyclase, enhancing the formation of cAMP. Recommended final concentration of forskolin in a CHO FlpIN cell line is 100 μM.
Following 30 min incubation in stimulation buffer, add 10 μl of 10x prepared ligands to cells, for a total volume of 100 μl, 1x final concentration.
Incubate cells with ligand in a humidified environment at 37 °C, 5% CO2 for 30 min.
Note: Optimization for assay time will be necessary. Recommended initial stimulation is 30 min.
After 30 min, rapidly remove ligand containing media from cells.
Note: Depending on the cell type, this may involve flicking or gentle aspiration.
Add 50 μl ice cold 100% ethanol to cells.
Allow ethanol to evaporate at room temperature (RT) or in a 37 °C oven.
Note: Ensure the ethanol is completely evaporated before proceeding to the next step.
Add 75 μl Lysis buffer.
Note: Optimization for lysis volume will be necessary, and depends on the cell type, expression level of the receptor and efficiency of coupling to the cAMP pathway. Recommended starting lysis volume in a CHO FlpIN cell line is 75 μl.
Incubate lysates at RT for 5-10 min on an orbital shaker.
III. Detection
In reduced lighting conditions, prepare detection reagents (Acceptor and Donor buffers).
Transfer 10 μl of cell lysate to a 384-well OptiPlate.
Prepare cAMP standard curve in Lysis buffer, enough for 10 μl/well to be performed in duplicate (minimum).
Transfer 10 μl cAMP standard curve to a 384-well OptiPlate.
Briefly centrifuge to draw contents to the bottom of the wells.
In reduced lighting conditions, add 5 μl Acceptor buffer to every well (samples and standard curve).
In reduced lighting conditions, add 15 μl Donor buffer to every well (samples and standard curve) (following preincubation for 30 min).
Seal the plate with TopSeal and wrap in foil.
Note: Small volumes are subject to evaporation, TopSeal is essential.
Briefly centrifuge to draw contents to the bottom of the wells.
Incubate overnight at RT (8-12 h) in reduced lighting conditions.
Briefly centrifuge to draw contents to the bottom of the wells.
Analyse luminescence on a Fusion-α or Envision plate reader using standard α-screen settings.
IV. Data analysis
Extrapolate data from the cAMP standard curve. Ideally, data should lie on the linear section of the cAMP standard curve.
If data falls off the bottom end of the curve (i.e., high concentration of cAMP), dilute lysates further with Lysis buffer and repeat detection component of protocol.
If data falls off the top end of the curve (i.e., low concentration of cAMP), assay should be performed again and cells lysed with a lower volume of Lysis buffer.
Normalize data to forskolin control.
Recipes
Stimulation buffer (pH 7.4, incubate at 37 °C prior to use)
Phenol free DMEM
0.1% w/v BSA*
1 mM 3-isobutyl-1-methylxanthine (IBMX)**
* BSA is not essential, but is recommended for ‘sticky’ ligands, i.e. peptides.
** IBMX is a potent phosphodiesterase inhibitor. IBMX powder should be made up as
a 500 mM stock in 100% DMSO. It may precipitate out of solution if DMEM is too cold, so gently heat and stir DMEM when adding IBMX.
Lysis buffer (pH 7.4)
Milli-Q H2O
0.3% Tween 20
5 mM HEPES
0.1% w/v BSA
Acceptor buffer (prepare in Stimulation buffer)
1% Acceptor beads (10 U/μl) (mix gently by pipetting before use)
Donor buffer (prepare in Stimulation buffer)***
0.3% Donor Beads (10 U/μl) (mix gently by pipetting before use)
0.025% biotinylated cAMP (133 U/μl)
*** Donor buffer MUST be preincubated at RT for 30 min prior to use.
cAMP standard curve
Prepare cAMP standard dilution series in Lysis buffer at 3x concentration to take into account dilution in detection plate (10 μl cAMP standard, 5 μl Acceptor buffer and 15 μl Donor buffer, final volume 30 μl). Recommended concentration range for cAMP standard (final) is 10 μM - 1 pM in half log units.
Note: Lysates may be stored at -20 °C and cAMP accumulation can be detected at a later time, but no longer than 2 weeks following stimulation.
References
Koole, C., Wootten, D., Simms, J., Valant, C., Sridhar, R., Woodman, O. L., Miller, L. J., Summers, R. J., Christopoulos, A. and Sexton, P. M. (2010). Allosteric ligands of the glucagon-like peptide 1 receptor (GLP-1R) differentially modulate endogenous and exogenous peptide responses in a pathway-selective manner: implications for drug screening. Mol Pharmacol 78(3): 456-465.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Koole, C., Wootten, D. and Sexton, P. M. (2013). cAMP Accumulation Assays Using the AlphaScreen® Kit (PerkinElmer) . Bio-protocol 3(13): e805. DOI: 10.21769/BioProtoc.805.
Download Citation in RIS Format
Category
Cell Biology > Cell signaling > Second messenger
Biochemistry > Protein > Interaction > Protein-ligand interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Quantitative Assay to Measure Stress Granule Association of Proteins and Peptides in Semi-permeabilized Human Cells
Saskia Hutten and Dorothee Dormann
Dec 20, 2020 3748 Views
Enrichment of Membrane Proteins for Downstream Analysis Using Styrene Maleic Acid Lipid Particles (SMALPs) Extraction
Benedict Dirnberger [...] Kathryn S. Lilley
Aug 5, 2023 940 Views
Establishment of Human PD-1/PD-L1 Blockade Assay Based on Surface Plasmon Resonance (SPR) Biosensor
Tess Puopolo [...] Chang Liu
Aug 5, 2023 1080 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
806 | https://bio-protocol.org/en/bpdetail?id=806&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
pERK Detection Assays Using the Surefire AlphaScreen® Kit (TGR Biosciences and PerkinElmer)
CK Cassandra Koole
DW Denise Wootten
PS Patrick Sexton
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.806 Views: 10052
Reviewed by: Cheng Zhang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Proceedings of the National Academy of Sciences of the United States of America Nov 2012
Abstract
Extracellular signal-regulated kinase 1 and 2 (ERK1/2) are serine/threonine protein kinases that are phosphorylated on Thr202/Tyr204 (ERK1) and Thr185/Tyr187 (ERK2). Phosphorylation of ERK1/2 (pERK1/2) arises from multiple stimuli, resulting in physiological responses that include cell growth, proliferation and differentiation. This protocol has been optimized for the detection of ligand-mediated pERK1/2 in adherent immortal cell lines expressing G protein-coupled receptors (GPCRs).
Materials and Reagents
Dulbecco’s modified eagle medium (DMEM) (Life Technologies, Gibco®, catalog number: 11995-065 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
SureFire® Reagents (Includes Lysis, Activation and Reaction buffers) (TGR BioSciences, catalog number: TGRES500 )
AlphaScreen® General IgG (Protein A) detection kit (PerkinElmer, catalog number: 6760617 )
White ProxiPlate 384-well microplate (PerkinElmer, catalog number: 6008280 )
TopSeal (PerkinElmer, catalog number: 6005250 )
NaCl
KCl
Na2HPO4
KH2PO4
Phosphate buffered saline (PBS) (see Recipes)
Detection buffer (see Recipes)
Equipment
Fusion-α plate reader or Envision plate reader with appropriate Alphascreen detection modules (PerkinElmer)
Sterile 96-well clear flat bottom plates (BD Biosciences, Falcon®, catalog number: 353072 )
Humidified incubator
Multichannel pipettes
Micropipettes
Orbital shaker
Procedure
Notes:
1) Cells can either be stably or transiently expressing receptor of interest.
2) It is recommended to first perform a timecourse analysis to determine the time at which ligand-mediated pERK1/2 is maximal. For this, follow the same protocolusing a single concentration of ligand (recommended concentration 100x Kd).
Recommended initial timecourse (min): 90, 60, 45, 30, 15, 10, 8, 6, 4, 2, 1, 0.
3) Subsequent timecourses can then be refined to determine the precise time at which maximum ligand-induced pERK1/2 occurs.
I. Cell preparation
Seed cells in suitable nutrient media (e.g. DMEM, 10% FBS, no antibiotics) into a sterile 96-well plate and incubate in a humidified environment at 37 °C, 5% CO2 to be ~90% confluent the following day (~24 h).
Note: Optimization for cell number depending on the cell line used will be necessary (we suggest a starting range of 10,000-50,000 cells per well). Recommended density for CHO FlpIN cells is 30,000 cells/ well.
II. Stimulation
The day following seeding, aspirate nutrient media, rinse once with 100 μl PBS, and replace with 90 μl prewarmed DMEM (no FBS).
Incubate in a humidified environment at 37 °C, 5% CO2 for a minimum of 4 h (recommended 6 h, up to overnight (O/N)).
Prepare serial dilutions of ligands at 10x final concentration in DMEM, enough for 10 μl/well, to be performed in duplicate (minimum), and enough for the number of timepoints if doing a timecourse.
Note: Concentration range to use will depend on ligand affinity for receptor. For initial timecourse test, select a concentration 100x Kd of ligand and a DMEM control. The concentrations can then be refined in subsequent experiments. If using a peptide or ‘sticky’ ligand, prepare serial dilutions in DMEM with 0.1% BSA.
Prepare a suitable concentration of FBS in DMEM, enough for 10 μl/well, to be performed in duplicate (minimum), and enough for the number of timepoints if doing a timecourse.
Note: This is the internal control for the experiment – FBS promotes pERK1/2. Recommended final concentration of FBS in a CHO FlpIN cell line is 3-10%.
Following preincubation in DMEM, add 10 μl of 10x prepared ligands or FBS to cells for a total volume of 100 μl, 1x final concentration.
Note: For initial timecourse, begin at 90 min, and add ligand or FBS to cells at each timepoint until time 0 (no addition). For concentration response, add ligand or FBS at time of maximal induced pERK1/2 as determined through timecourse.
After completion of stimulation, rapidly remove ligand-containing media from cells.
Note: Depending on the cell type, this may involve flicking or gentle aspiration.
Add 50 μl 1x Surefire® Lysis buffer.
Note: Optimization for lysis volume will be necessary, and depends on the cell type, expression level of the receptor and efficiency of coupling to pERK1/2 pathways. Recommended starting lysis volume in a CHO FlpIN cell line is 30-100 μl.
Incubate lysates at room temperature (RT) for 5-10 min on an orbital shaker.
III. Detection
In reduced lighting conditions, prepare detection buffer.
Transfer 5 μl of cell lysate from each well to a 384-well ProxiPlate.
In reduced lighting conditions, add 8.5 μl Detection buffer to each sample.
Seal the plate with TopSeal and wrap in foil.
Note: Small volumes are subject to evaporation, TopSeal is essential.
Incubate at RT for 2 h or 37 °C for 1 h in reduced lighting conditions.
Note: If incubating at 37 °C, ensure the plate has returned to RT before measuring luminescence (~15 min at RT following 37 °C incubation should suffice). Detection beads are temperature sensitive.
Analyse luminescence on a Fusion-α or Envision plate reader using standard α-screen settings.
IV. Data analysis
Data should be normalized to the response elicited by the FBS control.
Recipes
Phosphate Buffered Saline (PBS)
137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4.
Detection buffer
85.0% SureFire® reaction buffer
14.2% SureFire® activation buffer*
0.4% Acceptor beads
0.4% Donor beads
* Activation buffer should be stored at 4 °C, however, precipitation will occur at this temperature. Before use, heat to 37 °C to ensure all is dissolved.
Prepare Detection buffer immediately before use. Discard unused detection buffer. Mix detection buffer gently. Do not vortex.
Additional note: Lysates may be stored at -20 °C and pERK1/2 detected at a later time, but no longer than 2 weeks following stimulation.
References
Koole, C., Wootten, D., Simms, J., Valant, C., Sridhar, R., Woodman, O. L., Miller, L. J., Summers, R. J., Christopoulos, A. and Sexton, P. M. (2010). Allosteric ligands of the glucagon-like peptide 1 receptor (GLP-1R) differentially modulate endogenous and exogenous peptide responses in a pathway-selective manner: implications for drug screening. Mol Pharmacol 78(3): 456-465.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Koole, C., Wootten, D. and Sexton, P. M. (2013). pERK Detection Assays Using the Surefire AlphaScreen® Kit (TGR Biosciences and PerkinElmer). Bio-protocol 3(13): e806. DOI: 10.21769/BioProtoc.806.
Download Citation in RIS Format
Category
Cell Biology > Cell signaling > Phosphorylation
Biochemistry > Protein > Modification
Biochemistry > Protein > Interaction > Protein-ligand interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Quantitative Assay to Measure Stress Granule Association of Proteins and Peptides in Semi-permeabilized Human Cells
Saskia Hutten and Dorothee Dormann
Dec 20, 2020 3748 Views
Enrichment of Membrane Proteins for Downstream Analysis Using Styrene Maleic Acid Lipid Particles (SMALPs) Extraction
Benedict Dirnberger [...] Kathryn S. Lilley
Aug 5, 2023 940 Views
Establishment of Human PD-1/PD-L1 Blockade Assay Based on Surface Plasmon Resonance (SPR) Biosensor
Tess Puopolo [...] Chang Liu
Aug 5, 2023 1080 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
807 | https://bio-protocol.org/en/bpdetail?id=807&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Pneumococcal Proteins for Western Blot Analysis
Maria João Frias
JM José Melo-Cristino
Mário Ramirez
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.807 Views: 9398
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Molecular Microbiology Jan 2013
Abstract
This protocol was developed in a study aimed to determine the cellular localization of the lysin of pneumococcal phage SV1 (Frias et al., 2013). We obtained proteins from the surface of Streptococcus pneumoniae by elution with choline or those secreted to the medium. The analysis by Western blot of these fractions allowed us to demonstrate that the phage lysin localizes to the cell wall, associating with choline residues in the teichoic acids. Hence, protein extracts can be used to determine the localization of uncharacterized proteins and can also be useful for other biochemical analyses such as protein identification. This protocol can be easily adapted to different pneumococcal strains and growth conditions and it is well suited to isolate other proteins of interest.
Materials and Reagents
Pneumococcal cells
Mitomycin C (MitC) (0.1 μg/ml) (Sigma-Aldrich, catalog number: M0503 )
1x PBS (10x PBS pH 7.2) (Life Technologies, Gibco®/Invitrogen®, catalog number: 70013-016 )
50 mM Tris pH 7.5
2% (w/v) Choline chloride in 1x PBS (Sigma-Aldrich, catalog number: C7527 )
NaCl (AppliChem, catalog number: A46615000 )
Tris-HCl (Bio-Rad Laboratories, catalog number: 161-0799 )
Glycerol (AppliChem, catalog number: A2364, 5000 )
SDS (Bio-Rad Laboratories, catalog number: 161-0416 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Bromophenol blue (Bio-Rad Laboratories, catalog number: 161-0404 )
Casamino acids
L-Tryptophan
L-Cysteine.HCl
Glutamine
Adenosine
Uridine
Nicotinic acid
Pyridoxine
Ca-pantothenate
Thiamine-HCl
Riboflavin
Biotin
Asparagine
Casein-based semisynthetic medium C+Y (Lacks and Hotchkiss, 1960) (see Recipes)
Loading buffer 5x (see Recipes)
C+Y with 2% choline chloride (see Recipes)
Equipment
Water bath at 37 °C to grow bacterial cultures
Cell density meter (Biochrom WPA CO8000 Cell Density Meter) (Biochrom, catalog number: 80-3000-45 )
Centrifuge
0.2 μm low-binding-protein membrane (DISMIC-03CP) (Advantec, catalog number: 03CP020AS )
0.22 μm membrane filter (Frilabo, catalog number: 1520012 )
Amicon Ultra-15 centrifugal filter unit, cut-off 10 kDa (Merck Millipore, catalog number: UFC901024 )
Western blot equipment
Procedure
I. Extraction of choline-binding proteins by choline wash
Grow lysogenic cells without holin activity, hence incapable of lysis, in C+Y at 37 °C until OD600 nm of approximately 0.9 is reached (overnight culture). We used a lysogenic strain since this protocol was developed to determine the localization of the phage lysin. Moreover, since holin function activates phage-mediated lysis, we eliminated holin activity in this strain to avoid possible phage lysin escape (Frias et al., 2013).
Dilute 1:100 in 7 ml of fresh C+Y and continue incubation at 37 °C to an OD600 nm of 0.2-0.25, which takes approximately 2 h. Then, induce the phage by treating with Mitomycin C (MitC) at a final concentration of 0.1 μg/ml or left untreated as control.
Take samples (7 ml) at different time points, for instance in 20 min-intervals, after MitC treatment. In the case of untreated cultures, collect the samples at the same time points after the culture reached OD600 nm 0.2-0.25.
Harvest the cells by centrifugation (3,200 x g for 10 min at 4 °C).
Wash the cells once with 0.5 culture volumes (3.5 ml) of cold 1x PBS.
To obtain the total cell pellet fraction, suspended the cells in 200 μl of 50 mM Tris pH 7.5 and store at -20 °C.
For choline wash, gently suspend the PBS washed cells (in step 5) in 200 μl of 2% choline chloride (w/v) prepared in 1x PBS and incubate 30 min at 4 °C without agitation to elute the choline binding proteins (avoiding cell lysis).
As control for the specificity of the choline wash in removing only choline binding proteins, incubate cells in the same conditions with 1x PBS or 2% (w/v) NaCl prepared in 1x PBS.
Collect bacteria by centrifugation (3,200 x g for 15 min at 4 °C). To obtain the cell pellet fraction after choline extraction, wash the pellet once with 0.5 volumes of cold 1x PBS, suspended in 200 μl of 50 mM Tris pH 7.5 and store at -20 °C.
Filter the supernatant, which corresponds to the choline wash fraction, through a 0.2 μm low-binding-protein membrane to ensure the removal of all bacteria. Store at -20 °C.
Separate proteins on SDS-PAGE: Boil 5-15 μl of the pellet fractions and 45 μl of the supernatant fractions for 5 min with 1x loading buffer and load onto the gel. You will need the antibody for your protein to visualize the protein on Western blot and it is important to control for possible cell lysis using an antibody for a known cytoplasmic protein (Figure 1). When comparing the amount of the protein of interest between samples, do not forget to normalize by a loading protein control. As an alternative to loading equal sample volumes followed by normalization, determine the protein concentration of each sample and load the same amount of total protein in each lane.
Figure 1. Choline extracts increasing amounts of phage lysin (a choline-binding protein) from the cell surface. Equal aliquots were taken at the indicated times from MitC-treated lysogenic cultures (without holin activity). Cells were harvested by centrifugation and directly suspended in Tris buffer (cell pellet fraction, P) or choline washed (choline wash fraction, Scholine). As control, cells collected at 60 and 80 min were washed with PBS (SPBS). All fractions were tested by Western blotting for the phage lysin Svl (37 kDa) presence with the appropriate antibody. P and S fractions were also tested for the cytoplasmic elongation factor Ts (43 kDa) to control for cell lysis (Frias et al., 2013).
II. Preparation of culture medium fractions in the presence of 2% choline
Grow lysogenic cells without holin activity in C+Y at 37 °C until OD600 nm of approximately 0.9 is reached (overnight culture).
Dilute 1:100 in 7 ml of fresh C+Y and continue incubation at 37 °C to an OD600 nm of 0.2-0.25.
Collect cells by centrifugation (3,200 x g for 10 min at 4 °C) and discard the supernatant.
Suspend lysogens in 7 ml of C+Y with 2% choline chloride, treat the cells with MitC (0.1 μg/ml) to induce the phage and continue the incubation (alternatively, bacteria can be grown in the absence of choline).
Take samples (7 ml) at different time points after MitC treatment.
Harvest the cells by centrifugation (3,200 x g for 10 min at 4 °C). To obtain the cell pellet fraction, wash the cells once with 0.5 volumes of cold 1x PBS, suspend in 200 μl of 50 mM Tris pH 7.5 and store at -20 °C.
Collect the supernatant, which corresponds to the culture medium fraction, and filter through a 0.22 μm membrane filter. Besides the secreted proteins, this fraction also includes the choline binding proteins which are eluted from the pneumococcal surface in the presence of 2% choline chloride in the growth medium. Note that the choline binding proteins can be extracted using procedure described in Section I.
Concentrate the supernatant 35-fold (final volume of 200 μl) by centrifugation (3,200 x g at 4 °C for approximately 15 min) on an Amicon Ultra-15 centrifugal filter unit (cut-off 10 kDa). It is recommended that the molecular weight cut off of the membrane is at least 3 times smaller than the molecular weight of the protein being retained. Since we wanted to study the 37 kDa phage lysin, we selected a 10 kDa cut off.
Note that this experiment also allows to test for the membrane permeabilizing effect of a specific compound since in this case one expects the release of cytoplasmic proteins into the culture medium. If this is the goal of the experiment, after challenging the (MitC-treated) cultures with the compound of interest in step 4, the samples are processed as described in the following steps.
Separate proteins on SDS-PAGE: Boil 5-15 μl of the pellet fractions and 45 μl of the supernatant fractions for 5 min with 1x loading buffer and load onto the gels. You will need the antibody for your protein to visualize the protein on Western blot and it is important to control for eventual cell lysis using an antibody for a known cytoplasmic protein.
Recipes
C+Y (pH 8), 463 ml
400 ml of PreC (A)
13 ml of Supplement (B)
10 ml of 1 mg/ml (w/v) glutamine in water
10 ml of Adams III (C)
5 ml of 2% (w/v) pyruvate in water
15 ml of 1 M potassium phosphate (KPO4) buffer pH 8
10 ml of 5% (w/v) yeast extract in water.
(A) PreC, 2,000 ml
2.42 g of sodium acetate anhydrous
10 g of casamino acids
0.01 g of L-Tryptophan
0.1 g of L-Cysteine.HCl
Add dH2O to 2,000 ml
Adjust to pH 7.4-7.6
Autoclave
Store at room temperature.
(B) Supplement, 213 ml
30 ml of 3 in 1 Salts (D)
60 ml of 20% (w/v) glucose in water
3 ml of 50% (w/v) sucrose in water
60 ml of 2 mg/ml (w/v) adenosine in water
60 ml of 2 mg/ml (w/v) uridine in water
Filter sterilize (0.22 μm)
Store at 4 °C
(C) Adams III, 400 ml
0.8 g of asparagine
0.08 g of choline
0.64 ml of 1% (w/v) CaCl2 in water
64 ml of Adams I (E)
16 ml of Adams II (F)
Add dH2O to 400 ml
Filter sterilize (0.22 μm)
Store in the dark at 4 °C
(D) 3 in 1 salts, 100 ml
10 g of MgCl2.6H2O
0.05 g of CaCl2 anhydrous
0.02 ml of 0.1 M MnSO4.4H2O
Add dH2O to 100 ml
Autoclave
Store at room temperature
(E) Adams I, 200 ml
0.03 g of nicotinic acid
0.035 g of pyridoxine
0.12 g of Ca-pantothenate
0.032 g of thiamine-HCl
0.014 g of riboflavin
0.06 ml of 0.5 mg/ml (w/v) biotin in water
Add dH2O to 200 ml
Filter sterilize (0.22 μm)
Store in the dark at 4 °C
(F) Adams II, 100 ml
0.05 g of FeSO4.7H2O
0.05 g of CuSO4.5H2O
0.05 g of ZnSO4.7H2O
0.02 g of MnCl2.4H2O
1 ml of HCl concentrated
Add dH2O to 100 ml
Autoclave
Store at room temperature
5x loading buffer (62.5 mM Tris-HCl, pH 6.8, 20% glycerol, 2% SDS, 10% β-mercaptoethanol), 8 ml
1 ml of 0.5 M Tris-HCl (pH 6.8)
1.6 ml of Glycerol
1.6 ml of 10% SDS
0.8 ml of β-mercaptoethanol
0.4 ml of 0.5% (w/v) bromophenol blue in water
Add dH2O to 8 ml
Store at -20 °C
C+Y with 2% choline chloride, 100 ml
2 g of choline chloride
Add C+Y to 100 ml
Filter sterilize (0.22 μm)
Store at 4 °C
References
Frias, M. J., Melo-Cristino, J. and Ramirez, M. (2013). Export of the pneumococcal phage SV1 lysin requires choline-containing teichoic acids and is holin-independent. Mol Microbiol 87(2): 430-445.
Lacks, S. and Hotchkiss, R. D. (1960). A study of the genetic material determining an enzyme in Pneumococcus. Biochim Biophys Acta 39: 508-518.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Immunodetection
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Lectin Binding Analysis of Streptococcus mutans Glycoproteins
Alejandro Avilés-Reyes [...] Jacqueline Abranches
Apr 5, 2015 8717 Views
Analysis of Direct Interaction between Viral DNA-binding Proteins by Protein Pull-down Co-immunoprecipitation Assay
Ana Lechuga [...] Modesto Redrejo-Rodríguez
Jan 5, 2018 10327 Views
Construction of a Highly Diverse mRNA Library for in vitro Selection of Monobodies
Taishi Kondo [...] Hiroshi Murakami
Aug 20, 2021 2504 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
808 | https://bio-protocol.org/en/bpdetail?id=808&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA-Affinity Chromatography
L Lucia Morales
PM Pedro A. Mateos-Gomez
LE Luis Enjuanes
IS Isabel Sola
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.808 Views: 14634
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Virology Jan 2013
Abstract
RNA-affinity chromatography assays are used to identify proteins binding specific RNA sequences. These proteins represent potential factors contributing to the function of RNA molecules. In our lab, we have used this protocol to identify proteins binding sequence motifs involved in replication and transcription of positive strand RNA viruses. The assay described in this protocol consists on the immobilization of 5’-biotinylated RNA oligonucleotides (30-40 nt) on a streptavidin-conjugated, paramagnetic solid matrix. Then, cytoplasmic protein extracts pre-cleared on the solid matrix to decrease nonspecific binding, were incubated with the immobilized RNA molecules in the presence of a nonspecific competitor. RNA-protein complexes immobilized on the paramagnetic solid matrix were isolated using a magnet and the bound proteins were separated by polyacrylamide gel electrophoresis for proteomic analysis.
Keywords: RNA-protein interactions Biotinylated-RNA Biotin-streptavidin interaction Paramagnetic solid matrix
Materials and Reagents
5’-biotinylated RNAs (Sigma-Aldrich)
Streptavidin conjugated solid matrix (Dynabeads M-280 Streptavidin) (Life Technologies, InvitrogenTM, catalog number: 11205D )
Protease inhibitor (Complete Protease Inhibitor Cocktail Tablets) (Roche, catalog number: 1697498 )
10% glycerol
Non-specific competitor tRNA (Baker yeast) (Sigma-Aldrich, catalog number: R8759 )
NuPAGE LDS sample buffer (Life Technologies, InvitrogenTM)
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D9779 )
Bis-Tris-Gel (Life Technologies, InvitrogenTM)
NuPAGE MOPS SDS Running Buffer (Life Technologies, InvitrogenTM)
Coomassie Simply Blue Safe Stain (Life Technologies, InvitrogenTM, catalog number: LC6060 )
Diethylpyrocarbonate (DEPC) treated water
RNase inhibitor (RNasin) (Promega, catalog number: N2611 )
IGEPAL CA-630 (NP-40 substitute) (Sigma-Aldrich, catalog number: I3021 )
KCl
Glycerol
NP-40
EDTA
Extraction buffer (see Recipes)
H-BW solution (see Recipes)
BW solution (see Recipes)
Equipment
150 mm plates
Protein gel cassettes
Orbital Shaker (J.P. SELECTA, catalog number: Orbit 3000445 )
Magnetic particle concentrator for microcentrifuge tubes (DYNAL BIOTECH, Dynal MPC-S 120.20)
Software
Image Lab V3.0 (Bio-Rad)
Procedure
The capture of proteins binding specific RNA was performed using 5’-biotinylated RNAs linked to a streptavidin conjugated solid matrix.
Proteins were extracted from transmissible gastroenteritis virus (TGEV) infected human Huh7 cells using an extraction buffer containing 10% Igepal (NP-40) detergent. The cell lysate was then centrifuged to pellet the nuclei and save the cytoplamic extract. Briefly, Huh7 cells grown on 150 mm plates were infected with TGEV virus. At 48 h post infection, cells from two plates were harvested and resuspended with 500 μl extraction buffer without Igepal (NP-40) on ice. Cellular extracts were incubated for 15 min on ice and then, Igepal (NP-40) detergent was added to the cell suspension to a final concentration of 10%. Extracts were mixed by vortexing, incubated for 10 additional minutes on ice and centrifuged for 2 min at maximum speed to recover the supernatant. Protein extracts may be storaged at -80 °C with 10% glycerol.
60 μl of streptavidin-conjugated solid matrix (10 μg μl-1) were used per RNA binding assay. Before binding to RNA, the solid matrix was washed twice with 360 μl of solution H-BW. All washes were performed by inverting the tube. No incubation time was required. After washing, the solid matrix was separated from the supernatant using a magnet. Leave the tubes in the magnet for 1-2 min.
Pre-clearing protein extracts on solid matrix not bound to RNA. Protein extracts diluted in H-BW solution (500 μg of total protein per RNA binding assay), were precleared three times by incubating with 60 μl of solid matrix in an orbital shaker at 12 rpm, for at least 5 h each time at 4 °C. Separate the solid matrix using a magnet. Leave the tubes in the magnet for 1-2 min. The solid matrix was discarded after each pre-clearing incubation and the supernantant was transferred to a new tube containing 60 μl of new solid matrix. After the third preclearing, the supernatant was preserved for RNA-binding (step 7).
RNA-immobilization on the streptavidin solid matrix. For each RNA binding assay, 60 μl of solid matrix were used. Previously, the solid matrix was washed twice with 60 μl of BW solution as a minimum volume. Then, the streptavidin matrix was incubated with the biotinylated RNA (8 μg) in 60 μl of BW solution for 30 min at RT.
Immobilized RNAs on the solid matrix were washed twice with 60 μl of H-BW solution as a minimum volume. Remove the wash solution after placing the tubes in a magnet.
RNA-protein binding. Add to the immobilized RNAs, 500 μg of precleared protein extract (from step 4) resuspended in H-BW solution and different amounts of non-specific competitor tRNA (0.5 or 1.25 μg tRNAs μg-1 protein). Incubate the mixture overnight in an orbital shaker at 4 °C and a speed of 12 rpm. The total volume of the sample was 180 μl (three times the solid matrix volume) consisting of 120 μl of precleared protein extract, 25 μl of tRNAs and 35 μl of H-BW. All the solutions were prepared in DEPC-water in the presence of 0.4 U/μl of RNAse inhibitor to minimize RNA degradation.
Place the tubes in a magnet and remove the supernatant containing non-bound proteins. Wash three times with 120 μl H-BW solution.
Elute the proteins bound to immobilized RNAs with NuPAGE LDS sample buffer supplemented with DTT 100 mM for 10 min at RT.
Proteins bound to RNAs were resolved in NuPAGE 4-12% Bis-Tris-Gel by electrophoresis with NuPAGE MOPS SDS running buffer. Finally gels were stained with Coomassie Simply Blue Safe Stain. Images were taken with Image Lab V3.0.
Recipes
Extraction buffer
2.5 mM Hepes pH 7.9
2.5 mM KCl
25 μM EDTA
0.25 mM DTT
Protease inhibitor: One tablet diluted in 25 ml extraction buffer.
Igepal is added (if needed) to a final concentration of 10%.
H-BW solution
50 mM HEPES pH 7.9
150 mM KCl
5% glycerol
0.01% NP-40
BW solution
5 mM Tris HCl (pH 7.5)
1 mM EDTA
1 M NaCl
Acknowledgments
This work was supported by grants from the Ministry of Science and Innovation of Spain (BIO2010-167075) and the European Community’s Seventh Framework Programme (FP7/2007-2013), under the project PoRRSCon (EC grant agreement 245141). L.M. and P.A.M.-G. received a predoctoral fellowship from the Ministry of Science and Innovation of Spain (BES-2011-043489 and BES-2008-001932, respectively). We gratefully acknowledge C. M. Sanchez, and M. Gonzalez for technical assistance.
References
Mateos-Gomez, P. A., Morales, L., Zuniga, S., Enjuanes, L. and Sola, I. (2013). Long-distance RNA-RNA interactions in the coronavirus genome form high-order structures promoting discontinuous RNA synthesis during transcription. J Virol 87(1): 177-186.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial biochemistry > RNA
Biochemistry > RNA > RNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Mapping RNA Sequences that Contact Viral Capsid Proteins in Virions
C. Cheng Kao [...] Doug B. Rusch
Jul 20, 2017 7693 Views
Real-time Fluorescence Measurement of Enterovirus Uncoating
Visa Ruokolainen [...] Varpu Marjomäki
Apr 5, 2020 3485 Views
Viral Double-Stranded RNA Detection by DNase I and Nuclease S1 digestions in Leishmania parasites
Nathalie Isorce and Nicolas Fasel
May 5, 2020 3752 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
809 | https://bio-protocol.org/en/bpdetail?id=809&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Construction of Human Monocyte Derived Macrophages Armed with Oncolytic Viruses
Munitta Muthana
JR Jay Richardson
SR Samuel Rodrigues
CL Claire Lewis
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.809 Views: 9116
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Jan 2013
Abstract
Macrophages are involved in many key physiological processes and complex responses such as inflammatory, immunological, infectious and neoplastic diseases. The appearance and activation of macrophages are thought to be rapid events in the development of many pathological lesions, including malignant tumours, atherosclerotic plaques, and arthritic joints. This has prompted recent attempts to use macrophages as novel cellular vehicles for gene therapy, in which macrophages are genetically modified ex vivo and then reintroduced into the body with the hope that a proportion will then home to the diseased site. Here, we describe a protocol for preparing monocyte-derived macrophages (MDM) and arming these with oncolytic viruses (OV) as a novel way for delivering anti-cancer therapies. In this approach, proliferation of macrophages co-transduced with a hypoxia-regulated E1A/B construct and an E1A-dependent oncolytic adenovirus, is restricted to prostate tumour cells using prostate-specific promoter elements from the TARP, PSA, and PMSA genes (Muthana et al., 2013; Muthana et al., 2011). When such co-transduced cells reach an area of extreme hypoxia (like that found in tumours), the E1A/B proteins are expressed, thereby activating replication of the adenovirus. The virus is subsequently released by the host macrophage and infects neighboring tumour cells. The virus then infects neighboring cells but only proliferates and is cytotoxic in prostate tumour cells. OV kill cancer cells by a number of mechanisms, including direct lysis, apoptosis, autophagy and shutdown of protein synthesis, as well as the induction of anti-tumoural immunity. Using macrophages to deliver OV ensures that they are protected from the many hazards they face in circulation including neutralizing antibodies, complement activation and non-specific uptake by other tissues such as the liver and spleen.
Materials and Reagents
Blood (Sheffield Blood Transfusion Service)
50 ml falcon tubes (BD Biosciences, Falcon®, catalog number: 734-0451 )
Hank's Balanced Salt Solution (HBSS) (without Calcium, Ca2+ and Magnesium, Mg2+) (Lonza BioWhittaker Ltd., catalog number: 10-543Q )
Ficoll-Hypaque (GE Healthcare, catalog number: 17-1440-02 )
IMDM medium (Lonza BioWhittaker Ltd., catalog number: 12-722 )
Human AB serum (Lonza BioWhittaker Ltd., Wokingham, UK)
L-Glutamine (Lonza BioWhittaker Ltd., catalog number: 17-605 )
RPMI medium (Lonza BioWhittaker Ltd., catalog number: 12-115 )
Fetal bovine serum (FBS) (Biosera, catalog number: FB-1000 )
Phosphate buffered saline (PBS) (Lonza BioWhittaker Ltd., catalog number: 17-516F )
Trypsin/EDTA (Promocell Ltd., catalog number: C-41000 )
Adenoviruses (Adenoviruses used in our experiment include AdCMV-GFP, and oncolytic Ad[1/PPTE1A]) (kind gift from professor Magnus Essand, Uppsala, Sweden)
Hypoxia driven plasmid (HRE-E1A/B)
Macrophage Amaxa Nucleofector® kit (Lonza BioWhittaker Ltd.)
Equipment
T75 tissue culture flask (BD Biosciences, Falcon®)
12-well plate (BD Biosciences, Falcon®, catalog number: 734-2324 )
Centrifuge (MSE Mistral 2000R)
Haemocytometer (Camlab Limited, catalog number: 1127884 )
Nucleofector® machine (Lonza BioWhittaker Ltd.)
Procedure
Monocyte Isolation
Venous blood collected by Sheffield Teaching Hospitals (STH) blood bank was collected from healthy donors and consolidated into one bag of waste buffy coat.
25 ml of this blood was poured into 50 ml Falcon tubes and then filled up to the 40 ml line with 15 ml of HBSS (without Calcium, Ca2+ and Magnesium, Mg2+).
The tubes were then spun at 1,200 x g for 20 min (4 °C and Brake Rate of 0).
After spinning, the cloudy white blood cell layer (below the plasma) was removed by pipette and collecting the transferred into two new 50 ml Falcon tubes where it was made up to 30 ml with HBSS (w/o Ca2+/Mg2+).
The 30 ml of white cells were then carefully layered on top of 20 ml of Ficoll-Hypaque (in 50 ml Falcon tubes).
These tubes were then placed in the centrifuge and once again spun at 1,200 x g (4 °C and Brake Rate of 0) for 20 min.
Once again, the cloudy white cell layer was removed and made up to 40 ml with HBSS (w/o Ca2+/Mg2+) in a new 50 ml Falcon tube.
This tube was then spun at 400 x g for 5 min (4 °C and Brake Rate of 3) to wash and pellet the cells.
This process was repeated three times.
The cells were then counted using a haemocytometer and diluted with IMDM (supplemented with 2% Human AB serum and 4 mM L-Glutamine) so that there were 5-7 x 106 cells /ml.
To plate the cells down 1 ml of this cell suspension was added to each T75 (BD falcon-these flasks are superior when it comes to infecting with virus) flask and topped up to 10 ml with supplemented IMDM. The cells were then incubated for two hours (37 °C, 5% CO2). After two hours the flasks were washed with HBSS to remove the non-adherent cells and then refilled with 10 ml of supplemented IMDM.
Subculture of monocytes and differentiation into monocyte derived macrophages (MDM)
Monocytes isolated as above and cultured in 10 ml of IMDM, supplemented with L-glutamine (4 mM) and Human AB serum (2%), for the first 24 h. After this point the medium was replaced with 5 ml of RPMI, supplemented with L-glutamine (4 mM) and 10% FBS. Medium was replaced every three days depending on which other procedures were performed and monocyte derived MDM. Macrophages are visible after 24 hours these have a different morphology to monocytes, which are non-adherent and spherical. Macrophages on the other hand are larger and have irregular features. The can possess dendrites and appear spindle shaped.
Co-transduction of MDM
MDM were co-transduced with a therapeutic oncolytic adenovirus and a hypoxia-regulated plasmid carrying the replication component of the virus E1A. A description of the virus and plasmid can be found in (Muthana et al., 2013; Muthana et al., 2011).
Note: The adenoviruses used in this study include AdCMV-GFP, and oncolytic Ad[1/PPTE1A].
MDM infection with human adenovirus
The plated monocytes were washed the following day with HBSS and re-suspended in 5 ml of RPMI (supplemented with 10% FBS and L-Glutamine). This prevents the virus binding to the Human AB serum in the IMDM and neutralising the viral particles.
The viral particles were added at a multiplicity of infection (MOI) 100 and placed in the incubator over-night.
After an overnight incubation the cells were washed in PBS and fresh supplemented RPMI medium was added. Virus infection was assessed by flow cytometry and fluorescent microscopy for expression of green fluorescent protein (GFP) reporter gene.
Transfection of MDM using Amaxa Nucleofection
24 h later infected macrophages were harvested using trysin/EDTA and then transfected with a hypoxia driven plasmid (HRE-E1A/B) using the macrophage Amaxa Nucleofector® kit. This was carried out according to the manufacturer’s protocol. In brief, RPMI (1.5 ml) supplemented with 10% FCS and L-glutamine was added to the wells of a 12-well plate and pre-incubated at 37 °C.
Three-day-old MDM were trypsinised, centrifuged at 400 x g for 5 min (at room temperature) and resuspended at 8 x 105 cells/ ml. The supernatant was completely discarded and 100 μl of Amaxa Nucleofector® solution added as well as 3 μg plasmid (HRE-E1A/B). The cell suspension was then inserted into the Nucleofector® machine and the Y-10 program selected. Once the machine displayed “OK”, the sample was removed, 500 μl of pre-warmed RPMI supplemented with 10% FCS and L-glutamine was added and the entire cell suspension was transferred to the appropriately labelled well. The 12-well plate was then incubated for 24 h. Plasmid transfection was optimised using the pmaxGFP plasmid supplied with the kit according to the manufacturer’s protocol. In brief, GFP expression was assessed 24-48 h after transfection by fluorescent microscopy and flow cytometry.
Co-transduced macrophages can be delivered to tumour cells in vitro (e.g. 3D tumour spheroids) or intravenously to tumour bearing mice. Tumour cell death as a result of the OV killing can be determined.
Acknowledgments
This protocol is adapted from Muthana et al. (2011) and Muthana et al. (2013).
References
Muthana, M., Rodrigues, S., Chen, Y. Y., Welford, A., Hughes, R., Tazzyman, S., Essand, M., Morrow, F. and Lewis, C. E. (2013). Macrophage delivery of an oncolytic virus abolishes tumor regrowth and metastasis after chemotherapy or irradiation. Cancer Res 73(2): 490-495.
Muthana, M., Giannoudis, A., Scott, S. D., Fang, H. Y., Coffelt, S. B., Morrow, F. J., Murdoch, C., Burton, J., Cross, N., Burke, B., Mistry, R., Hamdy, F., Brown, N. J., Georgopoulos, L., Hoskin, P., Essand, M., Lewis, C. E. and Maitland, N. J. (2011). Use of macrophages to target therapeutic adenovirus to human prostate tumors. Cancer Res 71(5): 1805-1815.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Muthana, M., Richardson, J., Rodrigues, S. and Lewis, C. (2013). Construction of Human Monocyte Derived Macrophages Armed with Oncolytic Viruses. Bio-protocol 3(13): e809. DOI: 10.21769/BioProtoc.809.
Download Citation in RIS Format
Category
Cancer Biology > Tumor immunology > Cancer therapy > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Immunology > Immune cell function > Macrophage
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
81 | https://bio-protocol.org/en/bpdetail?id=81&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
In vivo BrdU Incorporation and Detection in Mouse
Zheng Liu
In Press
Published: Jun 5, 2011
DOI: 10.21769/BioProtoc.81 Views: 37086
Ask a question
Favorite
Cited by
Abstract
BrdU (Bromodeoxyuridine or 5-bromo-2’-deoxyuridine) is a synthetic nucleoside that is incorporated into DNA by proliferating cells. This protocol is to be used to incorporate and detect BrdU in murine plasma cells. The plasma cells described in this protocol are formed spontaneously in autoimmune mice (NZB/W mice). Modifications are most likely needed if users intend to label plasma cells in immunized mice.
Keywords: Autoimmune Mouse Plasma cells
Materials and Reagents
Antibodies
BD mouse Fc Block (BD Biosciences, Pharmingen™, catalog number: 553142 )
Rat anti-mouse B220 APC (Southern Biotech, catalog number: 1665-11 )
Rat anti-mouse CD138 PE (BD Biosciences, Pharmingen™, catalog number: 561070 )
Note: The above antibodies have been tested by the author and may be substituted with the antibodies desired by users.
Other materials
Mice
FITC BrdU Flow Kit (BD Biosciences, Pharmingen™, catalog number: 559619 )
Note: *Provided in the kit.
BrdU (Sigma-Aldrich, catalog number: B5002 )
1x Dulbecco’s modified eagle medium (DMEM) (Life Technologies, Invitrogen™, catalog number: 10313-039 )
Fetal bovine serum (FBS) (Life Technologies, Invitrogen™, catalog number: 11091-148)
Ammonium chloride 10x lysing solution (see Recipes)
FACS buffer (see Recipes)
Equipment
BD LSR II flow cytometer
Procedure
Give the mice one i.p. injection of 1 mg BrdU in 200 μl of sterile PBS.
Feed the mice water containing 0.8 mg/ml BrdU for 14 days. The water needs to be changed daily and be wrapped in aluminum foil to avoid light.
Note: 14 days are needed to label all the newly synthesized plasma cells with BrdU in autoimmune mice (NZB/W mice) and would not result in noticeable toxic effects in the mice.
Sacrifice the mice and harvest the spleen.
Create single cell suspension by gently smashing spleen pieces with the frosted surface of a pair of microscope slides in 5 ml of DMEM.
Transfer cells into 50 ml conical tubes and spin down cells at 300 x g for 5 min at 4 °C.
Discard the supernatant with aspiration without disturbing pellet.
Resuspend cells with 5 ml of 1x ammonium chloride lysing solution (see Recipes) and incubate on ice for 5 min.
Add 15 ml DMEM to cells and spin at 300 x g for 5 min at 4 °C.
Discard supernatant and resuspend cells with 20 ml of DMEM and count cells.
Resuspend 2 millions spleen cells in 50 μl of 1:200 BD Fc block in FACS buffer (see Recipes) and incubate for 30 min on ice.
Wash cells with 200 μl of PBS and spin down the cells at 300 x g for 5 min at 4 °C.
Discard supernatant and resuspend cells in 100 μl FACS buffer containing 1:200 anti-mouse B220 APC and anti-mouse CD138 PE.
Incubate cells at room temperature for 15 min.
Wash cells as in step 11.
Discard supernatant and resuspend cells with 100 μl of BD cytofix/Cytoperm buffer*.
Incubate for 30 min on ice for fix cells.
Wash cells with 1 ml of BD perm/Wash Buffer* and spin at 300 x g for 5 min at 4 °C.
Discard supernatant and resuspend cells with 100 μl of BD Cytoperm Plus Buffer*.
Incubate cells for 10 min on ice.
Wash cells as in step 17.
Resuspend cells with 100 μl of BD Cytofix/Cytoperm Buffer*.
Incubate for 5 min on ice to re-fix cells.
Wash cells as in step 17.
Discard supernatant and resuspend cells with 100 μl of diluted DNase* (300 μg/ml in PBS).
Incubate cells for 1 h at 37 °C to expose incorporated BrdU.
Wash cells as in step 17.
Discard supernatant and resuspend cells with 50 μl of BD Perm/Wash Buffer* containing anti-BrdU FITC* (1:50 in buffer).
Incubate cells for 20 min at room temperature.
Wash cells as in step 17.
Resuspend cells in 1 ml of PBS and analyzed stained cells with a flow cytometer (run at a rate no greated than 400 events/second).
Note: Cells can be resuspended in 2% formaldehyde and stored overnight at 4 °C in dark, prior to analysis by flow cytometry.
Flow cytometric analysis
Gate on plasma cells (B220 int CD138hi)
Gate on BrdU positive and negative cells
Recipes
Ammonium chloride 10x lysing solution (1 L)
96 g NH4Cl
10 g KHCO3
3.7 g Na4EDTA
Add ddH2O to final volume
Adjust pH to 7.2-7.4 and autoclave
Add ddH2O 9:1 to make 1x lysing solution
FACS buffer
300 μl FBS
10 ml PBS
Acknowledgments
This protocol was developed or modified in Dr. Anne Davidson’s lab at Feinstein Institute for Medical Research, NY, USA. This work was supported by grants from the NY SLE Foundation (RB), Rheuminations, NIH AI082037 and AR 049938-01, NIH (PO1 AI51392 and the Flow Cytometry and Protein Expression and Tetramer Cores of PO1 AI51392).
References
Hoyer, B. F., Moser, K., Hauser, A. E., Peddinghaus, A., Voigt, C., Eilat, D., Radbruch, A., Hiepe, F. and Manz, R. A. (2004). Short-lived plasmablasts and long-lived plasma cells contribute to chronic humoral autoimmunity in NZB/W mice. J Exp Med 199(11): 1577-1584.
Liu, Z., Bethunaickan, R., Huang, W., Lodhi, U., Solano, I., Madaio, M. P. and Davidson, A. (2011). Interferon-alpha accelerates murine systemic lupus erythematosus in a T cell-dependent manner. Arthritis Rheum 63(1): 219-229.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Immunology > Immune cell function > General
Developmental Biology > Cell growth and fate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
810 | https://bio-protocol.org/en/bpdetail?id=810&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorescent Dye Based Measurement of Vacuolar pH and K+
Elias Bassil
MK Melanie Krebs
SH Stephen Halperin*
KS Karin Schumacher
EB Eduardo Blumwald
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.810 Views: 12721
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Plant Cell Sep 2011
Abstract
Availability of ion specific fluorescent dyes has enabled the possibility to perform in vivo ion specific measurements using live cell imaging in many cellular compartments (Krebs et al., 2010; Bassil et al., 2011; Halperin and Lynch, 2003; Swanson et al., 2011; O'Connor and Silver, 2007). The importance of ion and pH homeostasis of intracellular compartments, including the vacuole, to cell growth is critical and well established (Krebs et al., 2010; Bassil et al., 2011).
* Dedicated to Stephen Halperin who tragically and unexpectedly passed away.
Keywords: Plant nutrition PH Ion transport Homeostasis Live cell imaging
Materials and Reagents
Fluorescent dyes:
2',7'-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein acetoxymethyl (BCECF, AM) (Invitrogen, catalog number: B-1170 ; TEFLabs, catalog number: 0062 )
Potassium-binding benzofuran isophthalate acetoxymethyl ester (PBFI, AM) (Life Technologies, InvitrogenTM, catalog number: P-1267MP ; TefLabs, catalog number: 0021 )
Other materials:
Pluronic F127 (Life Technologies, InvitrogenTM, catalog number: P-3000MP ; Teflabs, catalog number: 2510 )
Gramicidin (Sigma-Aldrich, catalog number: G5002 )
1/2 MS plates containing 0.8% sucrose, 0.8% agar pH 5.7 for seedling germination and growth
1/10 strength MS medium (without sucrose) for dye loading
Sterile Arabidopsis seeds of choice
Note: This method is optimized for Arabidopsis.
Small culture dishes (35 mm x 10 mm), small glass beaker (vol. 10 ml or smaller) or other small vessel for seedling incubation. An Eppendorf tube will work but caution should be taken when adding or removing seedlings from these tubes causes damage. We prefer a vessel with a larger opening for easier access to seedlings.
Note: For PBFI loading, a sterile culture vessel is recommended because of the long incubation time.
Micropore tape (3 M, catalog number: 1530-1 )
Dye loading medium (see Recipes)
In situ calibration buffer for BCECF (see Recipes)
In situ calibration buffer for PBFI (see Recipes)
Equipment
Confocal or epifluorescence microscope with appropriate filters (see below for spectral characteristics of the dyes)
Software
Open source software ImageJ (http://rsbweb.nih.gov/ij/index.html)
Procedure
Seedling growth
Vernalize sterile seeds in sterile water for 3 days at 4 °C. Seeds were sterilized according to the following protocol. In several Eppendorf tubes, aliquot 100 seeds approximately and place, without closing the lid, into a dessication jar. In the same desiccation jar, add 30 ml bleach to a small beaker and very carefully add 1 ml concentrated HCl to the bleach, while working in fume hood. Use the dessicator lid to shield from possible splashes. Close the lid immediately and make sure it is airtight. Leave for 3 h. Open in a clean bench and be cautious of inhaling any fumes as these are dangerous. Leave the room for 15 min. Close the tubes while in the clean bench. Seeds are now sterilized and can be vernalized by adding sterile water.
In a clean bench sow sterile seeds. Sterile pipette tips with a cut end large enough to allow imbibed seeds to pass are useful.
Note: Using Micropore tape instead of parafilm to seal plates helps to reduce condensation in plates.
Place plates with seeds, vertically in a growth chamber 22 °C 16 h light. Growing seedling in vertically plates is intended to minimize damage to seedlings when moving them off the plated and into the dye-loading vessel.
Grow seedlings until cotyledons are fully expanded but before true leaves have emerged (approximately 4 days) and the seedlings are about 1 cm in length.
Seedlings are now ready for dye loading.
Dye loading
Prepare 10 μM BCECF or 20 μM PBFI in Dye loading medium and add 0.02% Pluronic F-127. Mix gently but thoroughly. Typically 0.5 ml Dye Loading medium is sufficient to incubate approximately 10 seedlings, depending on the culture vessel used. Small 10 ml beakers or a 12 well culture plate work well for this.
Note: Given the sensitivity of acetoxylmethyl ester (AM) dyes to hydrolysis, it is critical to use a fresh dye stock. We store our dye stock in aliquots at -20 °C in dark, sealed containers with silica dessicant beads.
Using forceps gently pick up seedlings under the cotyledons and place in dye loading medium. Sterile conditions are not necessary at this point. Care should be taken not to damage seedlings especially for loading with PBFI dye. We observed that poor handling leads to the bursting of many root hairs which coats the root surface with cytoplasmic matter that is strongly stained by PBFI. Staining outside roots reduces dye loading and creates a strong extracellular signal that interferes with the imaging of dye loaded into root cortical cells.
Incubate seedlings in dye loading medium in the dark at room temperature on a shaker at very low speed (enough to move the solution but not the seedlings).
Incubate seedlings loading with BCECF for 30 min to 1 h and 18 h to 20 h for PBFI.
Note: Sterile conditions are necessary given the long incubation time and the presence of sucrose in the loading medium.
Carefully wash seedling with Dye loading medium to remove excess dye (5 min x 2). Care should be taken to prevent seedling damage and the bursting of root hairs (again it is critical in the in the case of PBFI loading).
Seedlings are now ready to image.
Note: For PBFI, we found it difficult to measure root cortical cells near the root tip because root hairs nearest the tip are more prone to bursting, leading to the problem of strong fluorescence staining outside the roots described above in B-2. Reliable measurements using PBFI were made in mature zone root cortical cells and cells of the hypocotyl. For BCECF, imaging of all cell types was possible because this dye loads readily.
Imaging and image analysis
BCECF
BCECF is a dual-ratiometric dye that has been widely used to measure intracellular pH in various biological systems (Swanson et al., 2011; O'Connor and Silver, 2007). Ratiometric measurements have several advantages over single emission or excitation dyes in that they are less affected by differences in amounts of dye loading or the volume of compartments where the dye is accumulating. In Arabidopsis root cells, BCECF specifically accumulates in the large central vacuole, making it an ideal tool for vacuolar pH measurements.
Seedlings can be imaged using a confocal or epifluorescent microscope. BCECF is sequentially excited using 458 and 488 nm. Fluorescence emission is detected for each of the two excitation wavelengths between 530 and 550 nm. Carefully adjust the imaging settings to account for that fact that the fluorescence intensity of BCECF will increase with rising pH and that it is best to detect fluorescence within a similar dynamic range. Avoid oversaturation since this will, underestimate fluorescent intensities and create artifacts in your pH measurements. Take into account that some light sources used for fluorescence microscopy such as argon gas lasers or mercury arc lamps require to be on for some time before they emit a stable non-fluctuating excitation light. A 20x objective is sufficient to collect images of many cortical cells. Root and hypocotyl cells stain more readily and are easier to image than shoot tissue.
Note: Different cell types and tissues can have different vacuolar pH values (Bassil et al., 2011).
Image analysis can be done with the open source software ImageJ.
A background correction for each image is necessary before proceeding with the calculation of fluorescence intensity values. Images are corrected for background fluorescence using the subtract background function of ImageJ (found in the ‘Process” pull down menu). Instructions for this type of background correction can be found here:
(http://imagejdocu.tudor.lu/doku.php?id=gui:process:subtract_background&s[]=rolling&s[]=ball)
It may be necessary to try different radius settings to obtain reasonable values which must be assessed empirically from the quality of the calibration curve (see below). A general rule is to obtain a calibration curve with a ratio range (i.e. the slope of the calibration curve) that would be large enough to allow small changes in pH to be determined (a 3 fold increase in the ratio over the pH range of 5.2-7.6 recommended here should be sufficient). The utility of the calibration curve depends greatly on the quality of the images collected and must therefore be worked out empirically. Background correction can greatly influence the ratio values which must be kept in mind when using different background correction modification parameters.
From each background corrected image, an integrated pixel density value is obtained from the ‘Measure’ function of ImageJ (under the Analyze menu). Depending on the settings it may be necessary to first set measurements values to include ‘integrated density’ which can be done with the ‘Set Measurements’ command, also in the ‘Analyze’ menu. For each image (i.e. 488 nm and 458 nm) a single ‘Integrated Density’ measurement will be obtained. The measurements can be copied from the ImageJ output and pasted into Excel for further calculation. For the calculation, the Integrated Density value for the 488 nm excitation image is divided by the Integrated Density of the Ex458 nm image. This is repeated for the different pairs of images to obtain an average ratio and standard deviation to determine statistical significance between treatment samples.
Typically a ratio value that is the average of 10-20 images is collected from approximately 20 seedlings and would include 6-10 cortical cells for each image.
PBFI
PBFI is also a ratiometric dye with dual excitation (360 nm & 380 nm) and emission above 500 nm. In general a similar approach is taken to collect and correct images of PBFI loaded root cells, except that imaging settings are Excitation 360 nm and collection of emission above 500 nm, and excitation 380 nm and collection of emission also above 500 nm.
Image processing is performed identically as that described for BCECF above Ⅲ-1 c- f.
In situ calibration
BCECF
To obtain the calibration curve, dye loaded seedlings are incubated in each of the pH calibration buffers (see Recipe 2) for no longer than 15-20 min. Seedlings are carefully placed onto microscope slide with approximately 100 μl of dye and imaged immediately as described above.
The ratios for each pH incubation can now be plotted against pH to obtain the calibration curve. A sigmoidal regression (Boltzmann function) can be fitted to describe the calibration curve and to calculate subsequent pH values from the equation describing the curve.
PBFI
In situ calibration of PBFI loaded seedlings is performed by incubating dye loaded seedlings in PBFI in situ calibration buffers containing different K+ concentrations.
Recipes
Dye loading medium
1/10 strength MS
5 mM MES pH 5.7
0.5% sucrose
Note: pH can be adjusted with KOH for BCECF loading but this will interfere with PBFI dye loading. For the later pH can be adjusted with BTP.
In situ calibration buffer for BCECF
50 mM ammonium acetate
50 mM Mes-BTP (pH 5.2-6.4) or 50 mM-HEPES-BTP (pH 6.8-7.6)
Typically 6 or 7 buffers are adequate to cover the range pH 5.2 to 7.6
In situ calibration buffer for PBFI
Dye loading medium
2 μM Gramicidin
Different solutions containing a range of KCl 0-100 mM should be prepared and typically 7 solutions (0, 10, 20, 40, 60, 80 and 100 mM KCl), are sufficient. It is important to note that in situ calibration of K+ cannot be done at ‘0 mM K+’ because the tissue already contains some K+. In this case measurements will fall below the lower limit of the calibration curve and it will be necessary to perform an in vitro calibration curve as well.
Acknowledgments
This protocol was modified in part from Krebs et al. (2010) and Halperin et al. (2003). This work was supported by grants from the National Science Foundation (MCB-0343279; IOS-0820112) and the Will W. Lester Endowment, University of California. It is dedicated to Stephen Halperin who tragically and unexpectedly passed away.
References
Bassil, E., Tajima, H., Liang, Y. C., Ohto, M. A., Ushijima, K., Nakano, R., Esumi, T., Coku, A., Belmonte, M. and Blumwald, E. (2011). The Arabidopsis Na+/H+ antiporters NHX1 and NHX2 control vacuolar pH and K+ homeostasis to regulate growth, flower development, and reproduction. Plant Cell 23(9): 3482-3497.
Halperin, S. J. and Lynch, J. P. (2003). Effects of salinity on cytosolic Na+ and K+ in root hairs of Arabidopsis thaliana: in vivo measurements using the fluorescent dyes SBFI and PBFI. J Exp Bot 54(390): 2035-2043.
Krebs, M., Beyhl, D., Gorlich, E., Al-Rasheid, K. A., Marten, I., Stierhof, Y. D., Hedrich, R. and Schumacher, K. (2010). Arabidopsis V-ATPase activity at the tonoplast is required for efficient nutrient storage but not for sodium accumulation. Proc Natl Acad Sci U S A 107(7): 3251-3256.
O'Connor, N. and Silver, R. B. (2007). Ratio imaging: practical considerations for measuring intracellular Ca2+ and pH in living cells. Methods Cell Biol 81: 415-433.
Swanson, S. J., Choi, W. G., Chanoca, A. and Gilroy, S. (2011). In vivo imaging of Ca2+, pH, and reactive oxygen species using fluorescent probes in plants. Annu Rev Plant Biol 62: 273-297.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Bassil, E., Krebs, M., Halperin*, S., Schumacher, K. and Blumwald, E. (2013). Fluorescent Dye Based Measurement of Vacuolar pH and K+. Bio-protocol 3(13): e810. DOI: 10.21769/BioProtoc.810.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Ion analysis
Cell Biology > Cell-based analysis > Ion analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Measurement of ATP Hydrolytic Activity of Plasma Membrane H+-ATPase from Arabidopsis thaliana Leaves
Masaki Okumura and Toshinori Kinoshita
Dec 5, 2016 9064 Views
Evaluation of Root pH Change Through Gel Containing pH-sensitive Indicator Bromocresol Purple
Aparecida L. Silva [...] Daniel S. Moura
Apr 5, 2018 8633 Views
MAMP-triggered Medium Alkalinization of Plant Cell Cultures
Gabriel L. Fiorin [...] Paulo J.P.L. Teixeira
Apr 20, 2020 3496 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
811 | https://bio-protocol.org/en/bpdetail?id=811&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cellular Extract Preparation for Superoxide Dismutase (SOD) Activity Assay
WK Wen-Yu Kuo
CH Chien-Hsun Huang
CS Chun Shih
Tsung-Luo Jinn
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.811 Views: 24189
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in New Phytologist Jan 2013
Abstract
Superoxide dismutase (SOD) acts as a primary defence against reactive oxygen species (ROS) by converting O2- to O2 and H2O2. Members of this enzyme family include CuZnSOD, MnSOD and FeSOD. Most eukaryotes harbor CuZnSOD and MnSOD, and FeSOD is found in plants and prokaryotes. This protocol is to demonstrate how to prepare the cellular extract for the identification and characterization of SODs in planta.
Keywords: SOD Activity Assay N
Materials and Reagents
Nitroblue tetrazolium (NBT) (Sigma-Aldrich, catalog number: N6876 )
Riboflavin (Sigma-Aldrich, catalog number: R4500 )
N,N,N’,N’-Tetramethylethylenediamine (TEMED) (Sigma-Aldrich, catalog number: T9281 )
KCN (Sigma-Aldrich, catalog number: 60178 )
H2O2 (Sigma-Aldrich, catalog number: 349887 )
NBT solution (see Recipes)
Grinding buffer (see Recipes)
Riboflavin solution (see Recipes)
KCN solution (see Recipes)
H2O2 solution (see Recipes)
Equipment
A light box (white light)
Centrifuge (Heraecus, Biofuge fresco)
Protein gel cassette
Procedure
Arabidopsis cellular extract preparation
Arabidopsis seedlings were grown at 23 °C with 16 h of light at 60–100 μmol m-2 s-1. Nine-day-old seedlings were collected and weighted.
Seedlings were homogenized with ice-cold Grinding buffer (tissue weight/buffer volume = 1 mg/3 μl).
Note that the tissue and extract should be kept at 4 °C during all extraction processes.
Centrifuge at 16,000 x g at 4 °C for 10 min.
The supernatant is the resulting cellular extract, and the amount of protein was quantified by Bradford method (1976).
SOD activity staining
Proteins or cellular extract (15 to 25 μg) was subjected to 10% native-PAGE at 4 °C.
Wash the gel with distilled water for 3 times.
Incubate with NBT solution in dark with shaking for 15 min at room temperature (RT).
Pour off the NBT solution, wash the gel with distilled water for 3 times.
Incubate with Riboflavin solution in dark with shaking for 15 min at RT.
Pour off the Riboflavin solution, wash the gel with distilled water for 3 times.
Gel was illuminated with a white-light box for 10-15 min at RT. During illumination, immerse gel in a thin layer of distilled water to avoid drying the gel.
Under light exposure, the riboflavin is reduced then leading the production of O2-. NBT is reduced by O2- to form formazan, a dark blue color precipitate. The enriched SOD activity scavenges the O2- to prevent the formation of formazan, thus, the white SOD activity bands appear in the blue background.
Identification of different SOD species (Figure 1)
KCN treatment: KCN inhibits the CuZnSOD activity only.
All procedures are the same as SOD activity staining processes except the addition of KCN to final 8 mM in Riboflavin solution.
H2O2 treatment: H2O2 inhibits both CuZnSOD and FeSOD activities.
After native-PAGE and prior to NBT staining of SOD activity staining processes, soak the gel with 8 mM H2O2 solution for 30 min with shaking at room temperature. Wash the gel with distilled water for 3 times, and follow the remaining processes of SOD activity staining.
Figure 1. SOD activity verification in Arabidopsis thaliana. KCN is an inhibitor of CuZnSOD activity, whereas H2O2 inhibits both CuZnSOD and FeSOD activities. MnSOD activity is not inhibited by either treatment.
Recipes
Grinding buffer
150 mM Tris (pH 7.2)
NBT solution
0.1% NBT dissolved in distilled water.
Store in 4 °C in dark
Riboflavin solution (freshly prepare before use)
28 μM riboflavin and 28 mM TEMED in 0.1 M potassium phosphate buffer (pH 7.0).
2 N KCN solution
KCN in distilled water. Store in 4 °C.
8 mM H2O2 solution (freshly prepare before use)
Add 27 μl H2O2 (35%) into 30 ml 0.1 M potassium phosphate buffer (pH 7.0).
References
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254.
Kuo, W. Y., Huang, C. H., Liu, A. C., Cheng, C. P., Li, S. H., Chang, W. C., Weiss, C., Azem, A. and Jinn, T. L. (2013). CHAPERONIN 20 mediates iron superoxide dismutase (FeSOD) activity independent of its co-chaperonin role in Arabidopsis chloroplasts. New Phytol 197(1): 99-110.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Kuo, W., Huang, C., Shih, C. and Jinn, T. (2013). Cellular Extract Preparation for Superoxide Dismutase (SOD) Activity Assay. Bio-protocol 3(13): e811. DOI: 10.21769/BioProtoc.811.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein > Isolation and purification
Biochemistry > Protein > Activity
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Autolysin Production from Chlamydomonas reinhardtii
Justin Findinier
Jul 5, 2023 528 Views
A Simple Sonication Method to Isolate the Chloroplast Lumen in Arabidopsis thaliana
Jingfang Hao and Alizée Malnoë
Aug 5, 2023 597 Views
Streamlining Protein Fractional Synthesis Rates Using SP3 Beads and Stable Isotope Mass Spectrometry: A Case Study on the Plant Ribosome
Dione Gentry-Torfer [...] Federico Martinez-Seidel
May 5, 2024 698 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
812 | https://bio-protocol.org/en/bpdetail?id=812&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of the Incorporation of Carbon Atoms from Radioactive Lactate into Proteins
T Tania Fiaschi
PC Paola Chiarugi
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.812 Views: 6983
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Oct 2012
Abstract
This method allows to analyze if the carbon atoms of lactate are embedded into proteins. Indeed, mammalian cells express the transporter of monocarboxylic acids (called MCT1) that allows the entry of lactate into the cell. To this end, cells are incubated for 24 h with the culture medium containing lactate uniformly labeled with carbon 14 and then, lactate inside the cell is evaluated by counting the radioactivity by a scintillator.
Materials and Reagents
[U-14C] lactate (U: uniformly labelled) (PerkinElmer, catalog number: NEC599250UC )
Phosphate buffered saline (pH 7) (Sigma-Aldrich, catalog number: D8537 )
Trichloroacetic acid (Sigma-Aldrich, catalog number: T6399 )
Liquid scintillation (PerkinElmer, catalog number: 6NE9529 )
Vials for scintillator (PerkinElmer)
Dulbecco’s Modified Eagle Medium (DMEM)
Eppendorf tube
Water
Cell scrapers (Euroclone)
Equipment
Incubator for cell culture
Petri dish for cell culture (six inches diameter)
Scintillator
Burker chamber
Procedure
Count cells using Burker chamber.
Plate 30,000 cells in each plate (six inches diameter).
Add to culture medium [U-14C] lactate (2 μCi/ml, final concentration).
Place the cells in incubator at 37 °C, 5% CO2 for 24 h.
Wash cells with 2 ml of PBS.
Add to cells 1 ml of 20% trichloroacetic acid.
Rupture the cells with the scrapers.
Recover the cells and put them in an Eppendorf tube.
Leave in ice for 30 min.
Centrifuge at 12,000 x g for 15 min at room temperature.
Remove the supernatant and resuspend the pellet with 200 μl of water.
Put 2 ml of scintillation liquid in a vial for scintillation.
Transfer an equal volume of resuspended pellet in the vial containing the scintillation liquid.
The resuspended pellet was assayed for [14C] labelled proteins by liquid scintillation counting.
Acknowledgments
This protocol is adapted from Fiaschi et al. (2012).
References
Fiaschi, T., Marini, A., Giannoni, E., Taddei, M. L., Gandellini, P., De Donatis, A., Lanciotti, M., Serni, S., Cirri, P. and Chiarugi, P. (2012). Reciprocal metabolic reprogramming through lactate shuttle coordinately influences tumor-stroma interplay. Cancer Res 72(19): 5130-5140.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Fiaschi, T. and Chiarugi, P. (2013). Analysis of the Incorporation of Carbon Atoms from Radioactive Lactate into Proteins . Bio-protocol 3(13): e812. DOI: 10.21769/BioProtoc.812.
Download Citation in RIS Format
Category
Biochemistry > Carbohydrate > Lactate
Cell Biology > Cell metabolism > Carbohydrate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Determination of the Glycolysis and Lipogenesis in Culture of Hepatocytes
Pierre-Damien Denechaud and Luis Fajas
Nov 5, 2016 11645 Views
Isolation of Tumor Cells Based on Their Distance from Blood Vessels
Saran Kumar [...] Eli Keshet
May 20, 2020 4422 Views
Intestinal Co-culture System to Study TGR5 Agonism and Gut Restriction
Snehal N. Chaudhari and A. Sloan Devlin
Mar 20, 2021 4894 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
813 | https://bio-protocol.org/en/bpdetail?id=813&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Released CO2 by Radioactive Lactate
T Tania Fiaschi
PC Paola Chiarugi
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.813 Views: 8447
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Oct 2012
Abstract
This method allows to evaluate the degradation of lactate during cellular respiration. During this metabolic process, carbon atoms of lactate can be transformed in carbon dioxide. For this purpose, the radioactive lactate is added to the cells and the amount of radioactive carbon dioxide liberated is monitored. The radioactive carbon dioxide generated during cellular respiration is released into the culture medium and it is further converted into gas through the addition of sulfuric acid to culture media. A piece of Whatman paper wet with phenyl-ethylamine-methanol is placed inside the petri dish to trap radioactive carbon dioxide whose production is then evaluated by scintillator counting.
Materials and Reagents
Petri dish for cell culture (six inches diameter plate)
[U-14C] lactate (U: uniformly labelled) (PerkinElmer, catalog number: NEC599250UC )
2-Phenethylamine (Sigma-Aldrich, catalog number: P2641 )
Methanol
4 M H2SO4
Liquid scintillation (PerkinElmer, catalog number: 6NE9529 )
Vials for scintillator (PerkinElmer)
Dulbecco’s Modified Eagle Medium (DMEM)
Phenyl-ethylamine-methanol (1:1:1)
Equipment
Incubator for cell culture
Scintillator
Burker chamber
3 mm Whatman paper
Procedure
Count cells using Burker chamber.
Plate the same number of cells in each plate (30,000 cells).
Wet a disk of Whatman paper with 100 μl of phenyl-ethylamine-methanol (1:1:1).
Put the wetted piece of Whatman paper under the lid of Petri dish.
Add to 1 ml of culture medium 0.2 μCi/ml D-[U-14C] lactate.
Place the cells in incubator at 37 °C, 5% CO2 for 15 min.
Add 200 μl of 4 M H2SO4 to culture medium.
Place 2 ml of scintillation liquid in a vial for scintillation.
Remove the Whatman paper and put it in the scintillation liquid.
Radioactive CO2 released was counted by scintillator.
Acknowledgments
This protocol is adapted from Fiaschi et al. (2012).
References
Fiaschi, T., Marini, A., Giannoni, E., Taddei, M. L., Gandellini, P., De Donatis, A., Lanciotti, M., Serni, S., Cirri, P. and Chiarugi, P. (2012). Reciprocal metabolic reprogramming through lactate shuttle coordinately influences tumor-stroma interplay. Cancer Res 72(19): 5130-5140.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cell Biology > Cell metabolism > Carbohydrate
Biochemistry > Carbohydrate > Lactate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Determination of the Glycolysis and Lipogenesis in Culture of Hepatocytes
Pierre-Damien Denechaud and Luis Fajas
Nov 5, 2016 11645 Views
Isolation of Tumor Cells Based on Their Distance from Blood Vessels
Saran Kumar [...] Eli Keshet
May 20, 2020 4422 Views
Intestinal Co-culture System to Study TGR5 Agonism and Gut Restriction
Snehal N. Chaudhari and A. Sloan Devlin
Mar 20, 2021 4894 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
814 | https://bio-protocol.org/en/bpdetail?id=814&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Genomic Signature of Homologous Recombination Deficiency in Breast and Ovarian Cancers
TP Tatiana Popova
EM Elodie Manié
M Marc-Henri Stern
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.814 Views: 14459
Reviewed by: Lin Fang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Nov 2012
Abstract
Homologous recombination deficiency, mainly resulted from BRCA1 or BRCA2 inactivation (so called BRCAness), is found in breast and ovarian cancers. Detection of actual inactivation of BRCA1/2 in a tumor is important for patients’ treatment and follow-up as it may help predicting response to DNA damaging agents and give indication Homologous recombination deficiency, mainly resulted from BRCA1 or BRCA2 inactivation (so called BRCAness), is found in breast and ovarian cancers. Detection of actual inactivation of BRCA1/2 in a tumor is important for pat for genetic testing. This protocol describes how to detect impairment of homologous recombination based on the tumor genomic profile measured by SNP-array. The proposed signature of BRCAness is related to the number of large-scale chromosomal breaks in a tumor genome calculated after filtering and smoothing small-scale alterations. The procedure strongly relies on good quality SNP-arrays preprocessed to absolute copy number and allelic content (allele-specific copy number) profiles. This genomic signature of homologous recombination deficiency was shown to be highly reliable in predicting BRCA1/2 inactivation in triple-negative breast carcinoma (97% accuracy; for more details, see Popova et al., 2012) and predictive of survival in ovarian carcinoma (unpublished data). Authors are grateful to Dominique Stoppa-Lyonnet, Anne Vincent-Salomon, Thierry Dubois, and Xavier Sastre-Garau for their contributions. (Patent was deposited: Reference number EP12305648.3, June 7, 2012)
Data and Software
Data:
Whole genome SNP-array profile of a tumor. Affymetrix and Illumina are the major platforms providing high quality SNP-array chips and software for primary normalization. Specific protocols are available in manufacturers' websites www.affymetrix.com or www.illumina.com. SNP array profiles have to be further processed to absolute copy number and allelic content profiles by some software for mining SNP array profiles. Good examples of properly processed SNP-array profiles are in Cancer Cell line collection of Sanger Institute.
http://www.sanger.ac.uk/cgi-bin/genetics/CGP/cghviewer/CghHome.cgi
SNP-array like profiles obtained from Next Generation Sequencing (NGS) also could be used in this protocol if they are processed to absolute copy number and allelic content profiles; however, we do not consider it here in details.
Software:
Software for primary normalization of SNP-arrays: Genotyping Console, ChAS (both www.affymetrix.com), Genome Studio (www.illumina.com), Aroma package (www.aroma-project.org), tQN for quantile normalization of Illumina arrays (Staaf et al., 2008).
Software for mining SNP array profiles to obtain absolute copy numbers and allelic contents (allele-specific copy numbers), such as GAP (Popova et al., 2009), PICNIC (Greenman et al., 2010), ASCAT (Van Loo et al., 2010), GPHMM (Li et al., 2011), TAPS (Rasmussen et al., 2011), Absolut (Carter et al., 2012), etc.
The GAP method and further data processing were realized in R environment (www.r-project.org). However, any other language could be used to perform this analysis, including MatLab, Java, C++, etc.
Equipment
Computers (2 GHz, 2 G RAM, Intel Core 2, 40 G HD)
Procedure
Preprocessing of SNP array data
Normalize .CEL files by the appropriate software depending on the array platform.
Export the normalized data: chromosome, position, Log_R_Ratio (Illumina) or Log_2_Ratio (Affymetrix), B allele frequency (BAF, Illumina) or Allelic Difference (AD, Affymetrix) into a text file.
Process SNP-arrays by (for example) GAP method (Popova et al., 2009) to obtain (Birkbak et al., 2011) estimation of normal contamination and (Carter et al., 2012) absolute copy number and allelic content profiles (Table 1).
Table 1. Segmented tumor genomic profile (a fragment from Affymetrix OncoScan 300K)
Position Start
Position End
Chromosome*
Length SNPs
Copy Number
Major Allele
59369
115065314
1
13869
2
1
115067829
121049277
1
639
3
2
143701096
144299541
1.5
47
3
2
144337336
144989346
1.5
19
0
0
145008423
148551158
1.5
252
3
2
148565769
152700090
1.5
554
6
5
* 1 stands for p arm and 1.5 stands for q arm of chromosome 1; pericentric region is indicated in red.
Quality control
Quality control of measured SNP-array profile: software for primary data normalization usually provides quality index for each chip; chips indicated to have marginal quality have to be excluded from further analysis; indication of quality cut-offs could be found in corresponding User Guides.
Contamination of tumor sample by normal stromal cells: sample with more than 65% of predicted normal cells admixture have to be excluded from further analysis (Note: Measured tumor sample usually represents a mixture of tumor and normal cells in different proportions, which results in different contrast in the measured SNP-array profile; 60-70% of normal contamination is at the limit of current recognition techniques).
Quality control of copy number and allelic content recognition: pattern of copy number alterations (CNAs) in a tumor genome have to be "interpretable", meaning, copy number variation and allelic imbalance profiles have to be consistent. Unfortunately, there is no reliable measure of such consistency developed; we used manual control of recognition based on the GAP plots (Figure 1). GAP plot of a tumor genome is a two dimensional representation of segmented SNP array profiles, where each circle represents a segment (Popova et al., 2009). Clear and regular structure of the GAP plot indicates consistency (Figure 1A), while chaotic structure indicates inconsistency (Figure 1B). Samples with inconsistent profiles have to be excluded from further analysis.
Figure 1. GAP plots for two tumor samples measured by Affymetrix OncoScan 300K representing (A) high quality and (B) low quality profiles. GAP plot of a tumor genome is a two dimensional representation of segmented SNP array profiles, where each circle represents a segment (Popova et al., 2009). Tumor samples are from GEO database (GSE28330, Birkbak et al., 2012).
Quality control of adequate detection of chromosomal breaks: Highly contaminated tumor samples together with unspecific variation in SNP array profiles often result in false positive chromosomal breaks detected by segmentation algorithms; the sample need to be discarded in the case of large number of false positive breaks. Adequate formal procedure for this type of quality control is not yet developed. We performed rough visual estimation of consistency of detected breaks in copy number variation and in recognized copy number profiles.
Note: Poor quality sample comprises around 10-15% of hybridized samples, including low tumor content, poor hybridization, low recognition quality, etc.
Calculating the number of large-scale chromosomal breaks from segmented profile (Table 1, Figure 2):
Note: Here we describe how to estimate the number of chromosomal breaks related to homologous recombination deficiency; filtering of variation is performed only for the purpose of estimation of breakpoints number and has no relation to particular alterations whatever important they are.
Filtering out micro-variation: The size of micro-variation S_micro is the lower limit of the detectable somatic alteration size, which is dependent on the SNP density in the array; for example, we used 50 SNPs for Affymetrix SNP 6.0; 30 SNPs for Illumina 600K; etc.
Note: Main reason for this filtering is that micro-variations are often linked to germline copy number variations.
Exclude from the segmented genomic profile all segments less than S_micro SNPs and link adjacent segments if they have identical Copy Numbers and Major Alleles.
Filtering out and smoothing small-scale variation: The size of small-scale variation, S_small < 3 Mb, was defined in (Popova et al., 2012).
Note: Main reason for this definition is that starting from 3 Mb chromosomal breaks follow a Poisson distribution, i.e. are independent from each other; while the small-scale segments tend to cluster in discrete chromosomal regions.
Order small-scale segments according to the size.
Exclude from the segmented genomic profile the smallest segment and link adjacent segments if they have identical Copy Numbers and Major Alleles.
Repeat filtering and smoothing until the last small segment.
Note: The way of filtering and smoothing small-scale variations has a minor effect on the resulting profile.
Calculating number of Large-scale State Transitions (LSTs) of the size S Mb: LST_SMb is defined as a chromosomal break (change in copy number or allelic content) between two adjacent (< 3 Mb in between) segments >= S Mb each; number of LSTs is calculated directly from the segmented genomic profile after filtering and smoothing of small-scale variation (Figure 2).
Annotate chromosomal breaks as follows: If two segments from the same chromosome arm differ in Copy Number or in Major Allele, and are >= SMb in size, and the distance between the segments is < 3 Mb, the break is annotated as LST_SMb;
Calculate number of LST_SMb (S = 3, 4,…, 11 Mb) in a tumor genome.
Note: Centromeric breaks are not taken into account.
Figure 2. Example of genomic profile of one chromosome with detected copy numbers and LSTs. LRR: log R ratio profile; BAF: B allele frequency profile; GT: segmental genotypes recognized by GAP; LST_10 Mb: black arrows point to LST_10 Mb detected. The black under-line shows large-scale segments obtained after filtering and smoothing small-scale variations seen in the GT profile. Chromosome 3 of a tumor sample from GEO database is shown (GSE28330, Birkbak et al., 2012).
Estimation of tumor ploidy:
Estimate DNA index for a tumor genome as an average copy number in a genome divided by 2.
Estimate chromosome counts in a tumor genome as a sum of copy numbers at pericentric regions of each chromosome arm (Table 1), following the rules:
If the size of a segment in pericentric region is >= 1.5 Mb (or 500 SNPs for Affymetrix SNP6.0), the number of copies of corresponding chromosome arm is set to that of the segment;
If the size of a segment in pericentric region is < 1.5 Mb, chromosome arm count is replaced by its average copy number.
Note: Chromosome number is estimated after filtering micro-variation.
Estimate tumor ploidy following the rule: tumor ploidy is estimated to be 2 (near-diploid genome) if DNA index < 1.3 and chromosome counts < 60; tumor ploidy is estimated to be 4 (near-tetraploid genome) if DNA index >= 1.3 and chromosome counts >= 60.
Note: This attribution is obtained for breast and ovarian cancer genomes based on the analysis of a large number of tumor genomes, (Popova et al., 2012). Genomes with ambiguous attribution of ploidy represented less than 5% of all cases considered. Other cancers might have different genomic evolution and the thresholds for ploidy attribution might need to be adjusted.
Signature of homologous recombination deficiency in a tumor genome
Based on the analysis of a large series of breast cancers with known status of BRCA1/2 genes the number of LST_6,7,8,9,10 Mb were found to represent effective discriminating features with naturally defined ploidy-specific cutoffs, which allowed prediction of BRCA1/2 inactivation with high accuracy and precision (Table 2). Testing the signature on ovarian cancer showed LST_6,7 Mb to be the most efficient prediction features with similar to breast cancer cohort cut-offs.
Tumor genome is annotated as homologous recombination deficient if number of LSTs in a tumor genome is higher than corresponding ploidy-specific cut-off (Table 2).
Note: Tumors with borderline LST number could be false positives due to false positive breaks detected in the genome. Inconsistency among LST_6, 7, 8, 9, 10 Mb predictions are rare.
Table 2. Cut-offs for LST number predicting BRCAness in breast cancer
LST_S Mb, S
Ploidy 2: (p=68, N=182)
Ploidy 4: (P=53, N=123)
Cut-Off*
FPR
TPR
Cut-Off
FPR
TPR
6
19 (17)
0.04
0.99
32 (32)
0.10
1
7
17 (15) 0.05
0.99
29 (27)
0.07
0.98
8
14 (14)
0.06
1
26 (26)
0.08
1
9
14 (11)
0.04
0.99
25 (19)
0.07
0.98
10
11 (11)
0.07
1
22 (18)
0.06
0.98
*Cut-offs correspond to max (TPR-FPR); cut-offs in parenthesis correspond to 100 sensitivity.
P: Numbers of BRCA1/2 mutated tumors; N: Number of BRCA1/2 wild type or not tested tumors;
TPR: True positive rate; FPR: False positive rate.
References
Birkbak, N. J., Wang, Z. C., Kim, J. Y., Eklund, A. C., Li, Q., Tian, R., Bowman-Colin, C., Li, Y., Greene-Colozzi, A., Iglehart, J. D., Tung, N., Ryan, P. D., Garber, J. E., Silver, D. P., Szallasi, Z. and Richardson, A. L. (2012). Telomeric allelic imbalance indicates defective DNA repair and sensitivity to DNA-damaging agents. Cancer Discov 2(4): 366-375.
Carter, S. L., Cibulskis, K., Helman, E., McKenna, A., Shen, H., Zack, T., Laird, P. W., Onofrio, R. C., Winckler, W., Weir, B. A., Beroukhim, R., Pellman, D., Levine, D. A., Lander, E. S., Meyerson, M. and Getz, G. (2012). Absolute quantification of somatic DNA alterations in human cancer. Nat Biotechnol 30(5): 413-421.
Greenman, C. D., Bignell, G., Butler, A., Edkins, S., Hinton, J., Beare, D., Swamy, S., Santarius, T., Chen, L., Widaa, S., Futreal, P. A. and Stratton, M. R. (2010). PICNIC: an algorithm to predict absolute allelic copy number variation with microarray cancer data. Biostatistics 11(1): 164-175.
Li, A., Liu, Z., Lezon-Geyda, K., Sarkar, S., Lannin, D., Schulz, V., Krop, I., Winer, E., Harris, L. and Tuck, D. (2011). GPHMM: an integrated hidden Markov model for identification of copy number alteration and loss of heterozygosity in complex tumor samples using whole genome SNP arrays. Nucleic Acids Res 39(12): 4928-4941.
Popova, T., Manie, E., Rieunier, G., Caux-Moncoutier, V., Tirapo, C., Dubois, T., Delattre, O., Sigal-Zafrani, B., Bollet, M., Longy, M., Houdayer, C., Sastre-Garau, X., Vincent-Salomon, A., Stoppa-Lyonnet, D. and Stern, M. H. (2012). Ploidy and large-scale genomic instability consistently identify basal-like breast carcinomas with BRCA1/2 inactivation. Cancer Res 72(21): 5454-5462.
Popova, T., Manie, E., Stoppa-Lyonnet, D., Rigaill, G., Barillot, E. and Stern, M. H. (2009). Genome Alteration Print (GAP): a tool to visualize and mine complex cancer genomic profiles obtained by SNP arrays. Genome Biol 10(11): R128.
Rasmussen, M., Sundstrom, M., Goransson Kultima, H., Botling, J., Micke, P., Birgisson, H., Glimelius, B. and Isaksson, A. (2011). Allele-specific copy number analysis of tumor samples with aneuploidy and tumor heterogeneity. Genome Biol 12(10): R108.
Staaf, J., Vallon-Christersson, J., Lindgren, D., Juliusson, G., Rosenquist, R., Hoglund, M., Borg, A. and Ringner, M. (2008). Normalization of Illumina Infinium whole-genome SNP data improves copy number estimates and allelic intensity ratios. BMC Bioinformatics 9: 409.
Van Loo, P., Nordgard, S. H., Lingjaerde, O. C., Russnes, H. G., Rye, I. H., Sun, W., Weigman, V. J., Marynen, P., Zetterberg, A., Naume, B., Perou, C. M., Borresen-Dale, A. L. and Kristensen, V. N. (2010). Allele-specific copy number analysis of tumors. Proc Natl Acad Sci U S A 107(39): 16910-16915.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cancer Biology > General technique > Genetics
Cancer Biology > Genome instability & mutation > Biochemical assays
Molecular Biology > DNA > DNA recombination
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Approaching RNA-seq for Cell Line Identification
Tabrez A. Mohammad and Yidong Chen
Feb 5, 2020 3690 Views
SMART (Single Molecule Analysis of Resection Tracks) Technique for Assessing DNA end-Resection in Response to DNA Damage
Angela Altieri [...] Alfano Luigi
Aug 5, 2020 4425 Views
ATAC-Seq-based Identification of Extrachromosomal Circular DNA in Mammalian Cells and Its Validation Using Inverse PCR and FISH
Zhangli Su [...] Anindya Dutta
May 5, 2021 7016 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
815 | https://bio-protocol.org/en/bpdetail?id=815&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
MACS Isolation and Culture of Mouse Liver Mesothelial Cells
YL Yuchang Li
IL Ingrid Lua
Kinji Asahina
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.815 Views: 10862
Reviewed by: Lin Fang Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Proceedings of the National Academy of Sciences of the United States of America Feb 2013
Abstract
Mesothelial cells (MCs) form a single squamous epithelial cell layer and cover the surfaces of the internal organs, as well as the walls of cavities. The isolation of MCs is of great importance to study their function and characteristics for the understanding of physiology and pathophysiology of the liver. Glycoprotein M6a (GPM6A) was originally identified as a cell surface protein expressed in neurons and recently its expression was reported in epicardium and liver MCs (Wu et al., 2001; Bochmann et al., 2010; Li et al., 2012). Here we describe a method to isolate MCs from the adult mouse liver with anti-GPM6A antibodies. Under the low glucose and serum concentration, primary MCs grow and form epithelial colonies (Figure 1).
Figure 1. Liver MCs 2 days in culture (20x objective)
Keywords: Antibody Epithelial-mesenchymal transition Fibrosis Gpm6a Pronase
Materials and Reagents
Dulbecco’s Modified Eagle’s Medium (DMEM) Low glucose with stable L-glutamine (Thermo Fisher Scientific, catalog number: SH30021.01 )
DMEM/F-12 (Thermo Fisher Scientific, catalog number: SH30023.FS )
Fetal Bovine Serum (FBS) (Sigma-Aldrich, catalog number: F9665 )
PBS, pH 7.4 (Sigma-Aldrich, catalog number: P3813-10PAK )
Bovine Collagen Solution, Type I (Advanced BioMatrix, catalog number: 5005-B )
Pronase (Roche, catalog number: 11459643001 )
Antibiotic-Antimycotic (100x) (Life Technologies, catalog number: 15240-062 )
BD Falcon polypropylene conical tube 50 ml (BD Biosciences, catalog number: 352070 )
BD Falcon cell strainer with 70 μm nylon mesh (BD Biosciences, catalog number: 352350 )
Rat anti-mouse glycoprotein M6a (GPM6A) antibodies (MBL International, catalog number: D0553 )
Goat anti-rat IgG microbeads (Miltenyl Biotec, catalog number: 130-048-501 )
Hydrocortisone solution (Sigma-Aldrich, catalog number: H6909-10ML )
Insulin-Transferrin-Selenium-X (Life Technologies, catalog number: 41400-045 )
Ketamine (Clipper Distributing Company, catalog number: NDC57319-542-02 )
5% low glucose DMEM medium (see Recipes)
MC medium (see Recipes)
Ketamine solution (see Recipes)
Equipment
37 °C shaker
Surgery Tools: Forceps, scissors and glass petri dish
37 °C incubator
Centrifuge
24-well plate (VWR, catalog number: 29442-044 )
G24 Environmental Incubator Shaker (New Brunswick Scientific)
Miltenyi AutoMacs machine
Procedure
I. Before procedure
Autoclave all surgery tools.
Collagen-coated dishes are used for better attachment of MCs. Mix 50 μl of the collagen solution with 950 μl sterile water and coat the 24-well plate (200 μl per well).
Put the coated dish in 37 °C incubator for at least 30 min, remove the collagen solution, and then wash with PBS 3 times. Make sure each well is completely dry before plating the cell.
Prepare 1 mg/ml Pronase in DMEM/F-12 medium and incubate in 37 °C incubator with gentle stirring for 20 min; Filter the solution with 0.22 μm filter into 50 ml tube before using.
Prepare 5% low glucose DMEM medium.
Prepare MC medium.
Prepare Ketamine solution.
Use 3-5 C57BL/6 male or female mice (20-30 g/each) for MC isolation. Age preference at least 8 weeks old.
II. Isolation and culture of liver mesothelial cells
Inject Ketamine solution intraperitoneally to mice with 1 ml syringe 23-25 gauge 5/8 inch needle for anesthesia, 0.1 ml per 10 mg of mouse body weight.
Shave the hair and clean up with 70% ethanol, cut the skin, muscle and expose the abdomen cavity.
Remove the gallbladder, cut off the ligaments connected to the liver lobes and diaphragm carefully, take out the liver lobes gently without disturbing the liver surface, and put the liver in 10 cm petri dish washing with sterile PBS.
Transfer the livers in 50 ml tube, add 30 ml DMEM/F-12 and shake at 130 rpm in 37 °C shaker for 5-10 min washing.
Transfer the livers to the tube with 30 ml Pronase/DMEM/F-12 medium and shake at 130 rpm in 37 °C shaker for 20 min. No need to cut the liver into small pieces.
Filter the supernatant containing MCs by BD Falcon cell strainer.
Collect the flow through and add 30 ml 5% low glucose DMEM.
Spin down at 1,700 x g for 5 min at RT.
Discard the supernatant, add 30 ml 5% low glucose DMEM, and spin down at 1,700 x g for 5 min at RT.
Repeat step 9.
Resuspend the pellet with 1.5 ml 5% low glucose DMEM and add 1 μl rat anti-mouse GPM6A antibodies at 1:1,500 dilutions.
Incubate on ice for 15-30 min.
Add 5% low glucose DMEM to 30 ml, spin down at 1,700 x g for 5 min at RT and discard supernatant.
Add 1 ml 5% low glucose DMEM to gently suspend the pellet.
Add 10 μl goat anti-rat IgG microbeads (1 μl/5 x 105 cells) and incubate on ice for 20 min.
Add 5% low glucose DMEM to 30 ml, spin down at 1,700 x g for 5 min at RT and discard supernatant.
Suspend pellet in 1 ml 5% low glucose DMEM and filter with BD Falcon cell strainer.
Use Miltenyi AutoMACS machine to separate the MCs according to their instruction (https://www.miltenyibiotec.com). In brief, the machine will load the cell suspension to the magnetic column and the magnetically labeled GPM6A+ cells will be retained in the column under the magnetic field. After washing, GPM6A+ MCs will be eluted to a new tube.
Note: Or use Miltenyi magnetic separator to separate MC.
Add 30 ml low glucose DMEM medium and spin down at 1,700 x g for 5 min at RT, discard supernatant.
Add 1 ml MC medium to gently suspend the pellet, count the cell number (yield: about 3 x 104 MCs from 1 mouse) and plate the cells to the wells of the plate (2 x 104 cells per well).
Culture MCs in 5% CO2 at 37 °C incubator, change with MC medium every 3 days. Primary MCs form epithelial colonies and become confluent within 1 week. From 1 week after plating, some MCs start to lose epithelial cell polarity and become fibroblastic cells. Following two passages, neither epithelial nor fibroblastic MCs attach to the dish and survive.
Recipes
5% low glucose DMEM medium
Low glucose DMEM
5% FBS
1% Antibiotic-Antimycotic
MC medium
Low glucose DMEM
5% FBS
1% Antibiotic-Antimycotic
Hydrocortisone solution (1:1,000 dilution)
Insulin-Transferrin-Selenium-X (1:100 dilution)
Ketamine solution
4.5 ml Ketamine (conc. 100 mg/ml)
0.75 ml Xylazine (conc. 20 mg/ml)
19.5 normal saline 0.9%
References
Wu, D. F., Koch, T., Liang, Y. J., Stumm, R., Schulz, S., Schroder, H. and Hollt, V. (2007). Membrane glycoprotein M6a interacts with the micro-opioid receptor and facilitates receptor endocytosis and recycling. J Biol Chem 282(30): 22239-22247.
Bochmann, L., Sarathchandra, P., Mori, F., Lara-Pezzi, E., Lazzaro, D. and Rosenthal, N. (2010). Revealing new mouse epicardial cell markers through transcriptomics. PLoS One 5(6): e11429.
Li, Y., Wang, J. and Asahina, K. (2013). Mesothelial cells give rise to hepatic stellate cells and myofibroblasts via mesothelial-mesenchymal transition in liver injury. Proc Natl Acad Sci U S A 110(6): 2324-2329.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Li, Y., Lua, I. and Asahina, K. (2013). MACS Isolation and Culture of Mouse Liver Mesothelial Cells. Bio-protocol 3(13): e815. DOI: 10.21769/BioProtoc.815.
Download Citation in RIS Format
Category
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Streamlined Methods for Processing and Cryopreservation of Cell Therapy Products Using Automated Systems
Ye Li [...] Annie C. Bowles-Welch
Dec 20, 2023 1824 Views
Dissociation and Culture of Adult Mouse Satellite Glial Cells
Raquel Tonello [...] Temugin Berta
Dec 20, 2023 858 Views
Isolation of Human Bone Marrow Non-hematopoietic Cells for Single-cell RNA Sequencing
Hongzhe Li [...] Stefan Scheding
Jun 20, 2024 642 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
816 | https://bio-protocol.org/en/bpdetail?id=816&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transmission Electron Microscopy (TEM) Protocol: Observation Details within Cells
WP Wei-Haw Peng
KL Kuo-Shyan Lu
SL Shu-Mei Lai
HS Horng-Tzer Shy
HK Hsiu-Ni Kung
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.816 Views: 18802
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Sep 2012
Abstract
Transmission electron microscopy is a technique for observing the fine details of organelles in cells or tissues. This protocol is to be used to exam the membrane structure in cells with or without virus infection. Modifications should be made if users want to get images from tissues.
Keywords: Transmission Electron Microscopy TEM Cell Organelle
Materials and Reagents
Trypsin: working solution is 0.5% trypsin-0.2% EDTA (Life Technologies, Gibco®, catalog number: 15400-054 )
NaH2PO4 (Kanto, catalog number: 37239-01 )
Na2HPO4 (Chemical, catalog number: 37240-01)
Alcohol
Poly/Bed 812 (Electron microscopy sciences, catalog number: 14900 )
Araldite 502 (Electron microscopy sciences, catalog number: 10900 )
Dodecenylsuccinic anhydride (DDSA) (TAAB, catalog number: D025 )
DMP-30 (Electron microscopy sciences, catalog number: 13600 )
Propylene oxide (Merk, catalog number: S4912527-745 )
Note: Toxic, need to handle with care and collect after use.
Syringe
Dropper
Grid (200 mesh) (TAAB)
0.1 M Phosphate buffer (PB) (see Recipes)
Paraformaldehyde (4% in PB) (Bionovas, catalog number: AP0130-0500 ) (see Recipes)
Osimium tetraoxide (1% in PB) (Electron microscopy sciences, catalog number: 51007 ) (see Recipes)
Note: Toxic, need to handle with care and collect after use.
Epon (see Recipes)
Toluidune Blue (Sigma-Aldrich, catalog number: NO202-146-2) (see Recipes)
Uranyl acetate (Art, catalog number: 8473) (see Recipes)
Lead citrate (TAAB, catalog number: L003 ) (see Recipes)
Equipment
Eppendorf tubes
Centrifuge
Vacuum drying oven
Diamond knife (Diatome)
Ultracut (Leica)
TEM (HITACHI, model: H-7100 )
Procedure
Note: Put all droppers and syringes into the 60 °C oven the day before this procedure to remove all the water inside all stuffs.
After treatment, collecting cells (1 x 106) with 0.5% trypsin-EDTA and washing cell with 0.5 ml 0.1 M phosphate buffer (PB) in an eppendorf tube by centrifuge (300 x g, 5 min).
Add 0.5 ml paraformaldehyde (4% in PB) to fix cells in room temperature (RT) for at least 30 min (or store cells at 4 °C for long term storage).
Wash cells 3 times with 0.5 ml 0.1 M PB by centrifuge (300 x g, 5 min).
Add 0.5 ml Osimium tetraoxide (1% in PB) into the tube and incubate cells for 1 h at RT.
Wash cells 3 times with 0.5 ml 0.1 M PB by centrifuge (300 x g, 5 min).
Dehydrate cells with adding 0.5 ml 70% alcohol for 5 min twice→ centrifuge (300 x g, 5 min)→ remove alcohol.
Dehydrate cells with adding 0.5 ml 85% alcohol for 5 min twice→ centrifuge (300 x g, 5 min)→ remove alcohol.
Dehydrate cells with adding 0.5 ml 95% alcohol for 5 min for three times→centrifuge (300 x g, 5 min)→ remove alcohol.
Dehydrate cells with adding 0.5 ml 100% alcohol for 10 min for five times→ centrifuge (300 x g, 5 min)→ remove alcohol.
Note: From step 10, all materials used should be from 60 °C oven.
Add 0.5 ml propylene oxide into tubes and incubate for 3 min twice at RT.→ centrifuge (300 x g, 5 min)→remove propylene oxide.
Add 1 ml (propylene oxide:Epon = 1:1) into tubes and incubate for 1 h at RT.→ centrifuge (300 x g, 5 min)→ remove Propylene oxide: Epon.
Add 1 ml pure Epon into tubes and put the samples into the vacuum drying oven to vacuum for 1 h at RT.→ remove Epon.
Add 1 ml pure Epon into tubes and vacuum for 1 h at RT.→ remove Epon.
Add 1 ml pure Epon into tubes and vacuum overnight at RT.
Put tubes into 60 °C oven for at least 48 h.
Trimming-remove the edge of the block.
Get thick section (1 μm) with Ultracut using diamond knife→put the thick section on a slide and stain with 0.5% toluidune blue for around 40 s to 1 min (until the edge is dried)→ wash 1 min with water → observe under microscopy to find the cells.
Once we found the cells on the thick section, change the thickness of Ultracut to get thin sections (65-70 nm).
Put the thin sections on the grids (3-4 sections on one grid).
Stain sections with uranyl acetate and lead citrate for 3 min sequentially.
Wash the grids with water for 1 min and let them dry completely.
Get images from digital camera on TEM with identical magnificence.
Recipes
0.1 M Phosphate buffer (PB)
19 ml 0.2 M NaH2PO4
81 ml 0.2 M Na2HPO4
4% paraformaldehyde
4% paraformaldehyde in PB
Osimium tetraoxide
1% osimium tetraoxide in PB
Epon
Use syringe to mix all reagents below to make Epon.
Poly/Bed 812 10 ml
Araldite 502 6 ml
DDSA 18 ml
DMP-30 0.7 ml
Epon could be stored in 4 °C or -20 °C for 1-2 weeks.
Toluidine Blue
0.5% Toluidine Blue
1% Sodium borate/in H2O
Filter with 0.22 μM filter
Uranyl acetate
Saturated uranyl acetate in 50% Alcohol
Lead citrate
1% lead citrate in H2O
Add 3 drops of 10 M NaOH (around 0.5 ml)
Acknowledgments
This protocol is adapted from Chau and Lu (1996) and Lee et al. (2012).
References
Chau, Y. P. and Lu, K. S. (1996). Differential permeability of blood microvasculatures in various sympathetic ganglia of rodents. Anat Embryol (Berl) 194(3): 259-269.
Lee, C. P., Liu, P. T., Kung, H. N., Su, M. T., Chua, H. H., Chang, Y. H., Chang, C. W., Tsai, C. H., Liu, F. T. and Chen, M. R. (2012). The ESCRT machinery is recruited by the viral BFRF1 protein to the nucleus-associated membrane for the maturation of Epstein-Barr Virus. PLoS Pathog 8(9): e1002904.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Peng, W., Lu, K., Lai, S., Shy, H. and Kung, H. (2013). Transmission Electron Microscopy (TEM) Protocol: Observation Details within Cells. Bio-protocol 3(13): e816. DOI: 10.21769/BioProtoc.816.
Lee, C. P., Liu, P. T., Kung, H. N., Su, M. T., Chua, H. H., Chang, Y. H., Chang, C. W., Tsai, C. H., Liu, F. T. and Chen, M. R. (2012). The ESCRT machinery is recruited by the viral BFRF1 protein to the nucleus-associated membrane for the maturation of Epstein-Barr Virus. PLoS Pathog 8(9): e1002904.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Electron microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Preparation and Manipulation of Olfactory Epithelium Explant Cultures for Measurement of the Mechanical Tension of Individual Axons Using the Biomembrane Force Probe
Coralie Fouquet and Alain Trembleau
Apr 20, 2019 4400 Views
Electron Microscopy Sample Preparation Protocol Enabling Nano-to-mesoscopic Mapping of Cellular Connectomes and Their Habitats in Human Tissues and Organs
Lucy Ngo [...] Melissa L. Knothe Tate
Jul 20, 2019 6385 Views
Serial-section Electron Tomography and Quantitative Analysis of Microtubule Organization in 3D-reconstructed Mitotic Spindles
Robert Kiewisz [...] Gunar Fabig
Oct 20, 2023 931 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
817 | https://bio-protocol.org/en/bpdetail?id=817&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Malondialdehyde, Chlorophyll Proline, Soluble Sugar, and Glutathione Content in Arabidopsis seedling
Zhijin Zhang
Rongfeng Huang
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.817 Views: 32977
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Plant Journal Jul 2012
Abstract
The protocol has four sub-protocols, which are about the measurement of malondialdehyde, chlorophyll proline, soluble sugar, and glutathione content, respectively, in Arabidopsis seedling by using spectrophotometer. These methods are simple, effective and reproducible, which will help the researchers who are not familiar with these approaches, quickly get reliable results.
Keywords: Malondialdehyde Proline Sugar Glutathione Arabidopsis
I. Measurement of Malondialdehyde
Materials and Reagents
Thiobarbituric acid (TBA) (Sigma-Aldrich, catalog number: T5500 )
Trichloroacetic acid (TCA) (Sigma-Aldrich, catalog number: T9159 )
Malondialdehyde (MDA) (BOC Sciences, catalog number: 542-78-9 )
Equipment
Centrifuge
Spectrophotometer
Procedure
Note: The experiment is done at room temperature (RT) except of specific indication.
0.1 g leaf tissue (with similar age, and young expanded leaf may be better) is ground into powder with liquid nitrogen, and then put the powder into a tube containing 1 ml 0.1% (w/v) TCA and mix by inverting the tube to homogenize the leaf tissue.
Centrifuge homogenized samples at 10,000 x g for 10 min, and then transfer supernatant to a new tube.
4 ml of 20% TCA containing 0.5% TBA was added to the supernatant and mixed well.
The mixture is boiled at 95 °C for 15 min and quickly cooled on ice (TBA can interact with MDA and results into red compound in acidic buffer, so the content of MDA can be calculated by measuring the density of the resulting red compound with spectrophotometer at 532 nm. The high temperature can accelerate the reaction and low temperature can inhibit it).
Centrifuge the mixture at 10,000 x g for 5 min, and then transfer supernatant to a new tube.
To generate a standard curve, a serial concentration of MDA is made: 1 μM, 2 μM, 5 μM, 10 μM, 20 μM and 50 μM (the volume of each dilution depends on the size of the cuvette of spectrophotometer).
Measure the optical density of standard samples from step 6 at 532 nm by spectrophotometer and make the standard curve to get the extinction coefficient (Figure 1).
Figure 1. The standard curve of MDA
Measure the optical density of plant samples from step 5 at 532 nm and calculate the content of MDA according to the standard curve (Madhava Rao and Sresty, 2000; Baryla et al., 2000).
II. Measurement of chlorophyll
Materials and Reagents
Dimethyl formamide (DMF) (Sigma-Aldrich, catalog number: D4551 )
Equipment
Centrifuge
Spectrophotometer
Procedure
Note: The experiment is done at room temperature.
0.1 g leaf tissue is ground into powder with liquid nitrogen, and then homogenized with 1 ml 100% DMF.
Centrifuge homogenized samples at 10,000 x g for 10 min, and then gather the supernatant.
Measure the optical density of the supernatant at 664 nm and 647 nm, respectively.
Calculate the content of chlorophyll a and chlorophyll b by the following formulas (Sibley et al.,1996; Inskeep and Bloom, 1985; Aono et al., 1993):
[chlorophyll a] = 12.7 x A664 - 2.79 x A647
[chlorophyll b] = 20.7 x A647 - 4.62 x A664
[chlorophyll a + chlorophyll b] = 17.90 x A647 + 8.08 x A664
III. Measurement of Proline
Materials and Reagents
Sulphosalicylic acid (DingGuo, catalog number: DS094 )
Proline (Sigma-Aldrich, catalog number: 858919 )
Ninhydrin (Sigma-Aldrich, catalog number: 151173 )
Acetic acid (DingGuo, catalog number: DS002 )
Orthophosphate (Sigma-Aldrich, catalog number: P2023 )
Toluene (Sigma-Aldrich, catalog number: 650579 )
Ninhydrin reagent (see Recipes)
Equipment
Centrifuge
Spectrophotometer
Procedure
Note: The experiment is done at room temperature (RT) except of specific indication.
To generate a standard curve, a serial concentration of Proline is made in 3% sulphosalicylic acid: 1 μM, 10 μM, 50 μM, 100 μM, 150 μM, 200 μM, 300 μM, 1 ml for each dilution.
Each 500 μl standard solution is added with 500 μl acetic acid and 500 μl ninhydrin reagent in 5 ml tube and boil for 45 min, and then cooled in ice for 30 min.
Add equal volume toluene to each sample and vibrate for 1 min, and then centrifuge at 1,000 x g for 5 min.
Measure the optical density of toluene solution at 520 nm by spectrophotometer and make the standard curve (Figure 2).
Figure 2. The standard curve of proline
0.5 g plant sample is ground into powder with liquid nitrogen, and then homogenized with 2 ml of 3% sulphosalicylic acid in tube.
Centrifuge homogenized samples at 5,000 x g for 5 min, and then collect the supernatant
The supernatant is treated as steps 2 and 3, and measure the optical density of samples as step 4, and then calculate the content of praline using the standard curve from step 3 (Bates et al., 1973; Lattanzioa et al., 2009).
Recipes
Ninhydrin reagent
2.5 g ninhydrin is successively added to 60 ml Glacial Acetic acid and 40 ml 6 M orthophosphate, and then dissolved at 70 °C. After cool down, the reagent can be stored in brown bottle at 4 °C for less than 24 h.
IV. Measurement of Soluble Sugar
Materials and Reagents
Ethanol (DingGuo, catalog number: DS023 )
Glucose (DingGuo, catalog number: DS063 )
Anthrone (SCRC, catalog number: 30015014 )
H2SO4 (Sigma-Aldrich, catalog number: 339741 )
Thiourea (Amresco, catalog number: M222 )
Chloroform (Sigma-Aldrich, catalog number: C2432 )
Anthrone reagent (see Recipes)
Equipment
Centrifuge
Spectrophotometer
Shaker
Procedure
Note: The experiment is done at room temperature (RT) except of specific indication.
To generate a standard curve, a serial concentration of glucose is made: 1 μM, 10 μM, 50 μM, 100 μM, 150 μM, 200 μM, 300 μM, 5 ml for each concentration of glucose solution.
50 μl of each diluted glucose solution is mixed with 4.95 ml anthrone reagent and then boiled for 15 min.
Measure the optical density of glucose standards at 620 nm by spectrophotometer to generate a standard curve.
0.1 g dried sample is ground into powder with liquid nitrogen, and then homogenized with 2 ml 80% ethanol in shaker at 200 rpm in 50 ml tube for 1 h.
Centrifuge at 6,000 x g for 10 min, and then transfer as much supernatant as possible into a new 5 ml tube.
Add equal volume of chloroform, completely mix, and then centrifuge at 12,000 x g for 10 min.
The aqueous part is transferred to a new tube and repeat steps 2 and 3 to measure the optical density of the sample. The content of soluble sugar is calculated according the standard curve made at step 3 (Mandre et al., 2002; Jin et al., 2007).
Recipes
Anthrone reagent
72% H2SO4
500 mg/L anthrone
10 g/L thiourea
V. Measurement of Glutathione
Materials and Reagents
Trichloroacetic acid (TCA) (Sigma-Aldrich, catalog number: T9159 )
Polyvinylpolypyrrolidone (PVPP) (Sigma-Aldrich, catalog number: P6755 )
2-amino-2-(hydroxymethyl)-1,3-propanediol (TRIS) (DingGuo, catalog number: DH350 )
5,50-dithio-bis (2-nitrobenzoic acid) (DTNB) (DingGuo, catalog number: DH499 )
Glutathione reductase (GR) (Merck KGaA, catalog number: 359960 )
Glutathiol (GSSG) (Solarbio, catalog number: G8690 )
Reaction solution (see Recipes)
Equipment
Centrifuge
Spectrophotometer
Procedure
Note: The experiment is done at room temperature (RT) except of specific indication.
To generate a standard curve, a serial concentration of GSSG is made: 0.5, 1, 2, 5, 10, 20 μM, 2 ml for each dilution of GSSG.
100 μl of each GSSG standard made at step 1 is added to 3 ml of Reaction solution and incubated for 15 min. Then add 100 mM DTNB to a final concentration of 10 mM and incubate at 25 °C for 15 min.
Measure the optical density of each sample at 412 nm by spectrophotometer, and make standard curve with a function of the concentration of GSSG standard and the optical density of each GSSG standard.
0.5 g of Arabidopsis leaves is ground in liquid nitrogen.
The samples are homogenized with 1 ml extract solution and mixed completely by inverting the tube.
The mixture is centrifuged at 10,000 x g at 4 °C for 10 min, and then the supernatant is transferred to a new tube.
100 μl supernatant is treated as described at step 2, and the optical density of the supernatant is measured at 412 nm as described at step 3, and calculate the GSSG content of the sample according the standard curve.
100 μl supernatant is mixed with 3 ml 500 mM TRIS–HCl (pH 8.0) buffer containing 10 mM DTNB and incubated at 25 °C for 15 min. The optical density is then measured at 412 nm. The Glutathione (GSH) content is determined by the same standard curve as described at step 3 with the following formula: [GSH] = 2 x [standard curve].
The total glutathione content = [GSH] + [GSSG] (Huang et al., 2005; Chen et al., 2011)
Recipes
Reaction solution
500 mM TRIS–HCl (pH 8.0) buffer
GR (1 U for each 3 ml reaction solution)
1 mM EDTA
3 mM MgCl2
150 μM NADPH
Extract solution
0.1% TCA (pH 2.8)
1 mM EDTA
1% (w/v) PVPP
Acknowledgments
This protocol is adapted from Huang et al. (2005) as well as other works mentioned in the reference list.
Competing interests
The authors declare no conflict of interest or competing interest.
References
Aono, M., Kubo, A., Saji, H., Tanaka, K. and Kondo, N. (1993). Enhanced tolerance to photooxidative stress of transgenic Nicotiana tabacum with high chloroplastic glutathione reductase activity. Plant Cell Physiol 34(1): 129-135.
Baryla, A., Laborde, C., Montillet, J. L., Triantaphylides, C. and Chagvardieff, P. (2000). Evaluation of lipid peroxidation as a toxicity bioassay for plants exposed to copper. Environ Pollut 109(1): 131-135.
Bates, L., Waldren, R. and Teare, I. (1973). Rapid determination of free proline for water-stress studies. Plant Soil 39(1): 205-207.
Chen, L., Han, Y., Jiang, H., Korpelainen, H. and Li, C. (2011). Nitrogen nutrient status induces sexual differences in responses to cadmium in Populus yunnanensis. J Exp Bot 62(14): 5037-5050.
Huang, C., He, W., Guo, J., Chang, X., Su, P. and Zhang, L. (2005). Increased sensitivity to salt stress in an ascorbate-deficient Arabidopsis mutant. J Exp Bot 56(422): 3041-3049.
Inskeep, W. P. and Bloom, P. R. (1985). Extinction coefficients of chlorophyll a and B in n,n-dimethylformamide and 80% acetone. Plant Physiol 77(2): 483-485.
Jin, Z. M., Wang, C. H., Liu, Z. P. and Gong, W. J. (2007). Physiological and ecological characters studies on Aloe vera under soil salinity and seawater irrigation. Process Biochem 42(4): 710-714.
Lattanzio, V., Cardinali, A., Ruta, C., Fortunato, I. M., Lattanzio, V. M., Linsalata, V. and Cicco, N. (2009). Relationship of secondary metabolism to growth in oregano (Origanum vulgare L.) shoot cultures under nutritional stress. Environ Exp Bot 65(1): 54-62.
Madhava Rao, K. V. and Sresty, T. V. (2000). Antioxidative parameters in the seedlings of pigeonpea (Cajanus cajan (L.) Millspaugh) in response to Zn and Ni stresses. Plant Sci 157(1): 113-128.
Mandre, M., Tullus, H. and Kloseiko, J. (2002). Partitioning of carbohydrates and biomass of needles in Scots pine canopy. Z Naturforsch C 57(3-4): 296-302.
Sibley, J. L., Eakes, D. J., Gilliam, C. H., Keever, G. J., Dozier, W. A. and Himelrick, D.G. (1996). Foliar SPAD-502 meter values, nitrogen levels, and extractable chlorophyll for red maple selections. Hort Sci 31(3): 468-470.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Zhang, Z. and Huang, R. (2013). Analysis of Malondialdehyde, Chlorophyll Proline, Soluble Sugar, and Glutathione Content in Arabidopsis seedling. Bio-protocol 3(14): e817. DOI: 10.21769/BioProtoc.817.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Biochemistry > Carbohydrate > Glucose
Biochemistry > Other compound > Chlorophyll
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
MAMP-triggered Medium Alkalinization of Plant Cell Cultures
Gabriel L. Fiorin [...] Paulo J.P.L. Teixeira
Apr 20, 2020 3496 Views
A Quick Method to Quantify Iron in Arabidopsis Seedlings
Chandan Kumar Gautam [...] Wolfgang Schmidt
Mar 5, 2022 2601 Views
Isolation of Intact Vacuoles from Arabidopsis Root Protoplasts and Elemental Analysis
Chuanfeng Ju [...] Zhenqian Zhang
Mar 5, 2023 717 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
818 | https://bio-protocol.org/en/bpdetail?id=818&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation, Culture and Differentiation of Primary Acinar Epithelial Explants from Adult Murine Pancreas
Clara Lubeseder-Martellato
Published: Vol 3, Iss 13, Jul 5, 2013
DOI: 10.21769/BioProtoc.818 Views: 11680
Reviewed by: Lin Fang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Cell Sep 2012
Abstract
The adult pancreas possesses an intrinsic developmental plasticity whereby acinar cells can convert into ductal structures under some pathological conditions. Acinar tissue can be isolated from murine pancreas and kept in three-dimensional collagen culture. Acinar to ductal metaplasia can be induced in primary acinar epithelial explants by treatment with growth factors. This method can be utilized in ex vivo studies involving pancreatic epithelial differentiation.
Keywords: Pancreatic acini Acinar-ductal-metaplasia 3-dimensional culture
Materials and Reagents
Mice (4-7 weeks old). As a positive control you can always use wild type mice and induce differentiation of acinar explants by treatment with EGF as described. Depending on your application you may use transgenic mice.
McCoy′s 5A medium (Sigma-Aldrich, catalog number: M8403 )
Waymouth′medium MB 752/1 medium (Genaxxon, catalog number: C4119 )
BSA (Sigma-Aldrich, catalog number: A4503 )
Soybean trypsin inhibitor (SBTI) (Sigma-Aldrich, catalog number: T6522 )
Collagenase Type VIII (Sigma-Aldrich, catalog number: C2139 )
80% EtOH
Penicillin-streptomycin (P/S) (Life Technologies, Gibco®, catalog number: 15140-122 )
Amphotericin B (not critical, for example from Biochrom, catalog number: A2610 )
FCS (Life Technologies, Gibco®, catalog number: 10270 )
Bovine pituary extract (BPE) (Life Technologies, Gibco®, catalog number: 13028-014 )
Insulin, Transferrin, Selenium, Ethanolamine solution (ITS-X) (Life Technologies, Gibco®, catalog number: 51500 )
Rat Tail Collagen Type I (BD Biosciences, catalog number: 354236 )
Sterile 10x PBS (BIOCHROM, catalog number: 182-50 )
Sterile dH2O
Sterile 1 N NaOH
rhTGFa (R&D systems, catalog number: 239-A )
mEGF (BD Biosciences, catalog number: 354010 )
SBTI stock solution (see Recipes)
Collagenase VIII stock solution (see Recipes)
Wash solution (see Recipes)
0.1% Culture medium (Waymouth′s medium) (Genaxxon, catalog number: C4119) (see Recipes)
30% Culture medium (Waymouth′s medium) (Genaxxon, catalog number: C4119) (see Recipes)
Equipment
Stericups filter units (EMD Millipore)
50 ml Falcon tubes
Tissue culture dishes (10 mm)
6-well plates
24- or 48-well plates
Dissecting forceps and scissors
Disposable scalpels
100 μM cell strainer (BD Biosciences, Falcon®, catalog number: 352360 )
Syringe plungers
Procedure
I. On the bench:
Mice should be between 4 and 7 weeks of age. Isolation of acinar issue does not work with older mice. Because time is a critical step for the viability of acinar cells, we usually do not process more than 2 mice at the same time.
From one mouse it is possible to obtain about 1,000 acinar-explants. Acinar tissue can be seeded for example in 15 wells of a 48-well plate, thus the obtimal denisty for differetiation of acinar tissue is obtained when you see about 30 acinar explants in a well through a 10x objetive. If density is too high differentiation will take longer, if too low acinar cells will die.
Put forceps and scissors into 80% EtOH.
Anesthetize the mouse with isofluorane, sacrifice the mouse by cervical dislocation and resect the pancreas as fast and possible (time is a critical step).
Place the resected pancreas into a tissue culture dish containing ice cold sterile PBS.
II. Up to now all protocol steps should be performed under sterile conditions.
Centrifugation steps at 720 x g (18 °C) are a critical step!
In the hood, transfer the pancreas into a culture dish containing 10 ml of PBS.
Immediately put the pancreas in culture dish with 5 ml collagenase VIII solution (see Recipe 4) and cut the organ in very small pieces (less then 1 mm of diameter) with a scalpel within 2 min. Pipette the tissue up and down.
Incubate the dish at 37 °C for 10 min. Shake from time to time.
Transfer the sample into a 50 ml falcon. Pipette the solution 3x up and down.
Wash the dish with 10 ml wash solution and transfer to the 50 ml falcon.
Centrifuge, 720 x g, 5 min, 18 °C.
Carefully remove the supernatant.
Resuspend the pellet in 5 ml collagenase VIII solution. Put in a culture dish. Pipette the tissue up and down.
Incubate at 37 °C for 10 min. Shake from time to time.
Aspirate the sample and filter through a 100 μm nylon cell strainer positioned on a 50 ml falcon.
Macerate the tissue pieces through the cell strainer with a syringe plunger.
Note: This step is difficult to describe, try to press the tissue through the strainer with the syringe plunger without applying a shear stress. It is possible you have to optimize this step in your hands.
Wash the mesh with 10 ml wash solution to carefully collect any remaining cell.
Centrifuge, 720 x g, 5 min, 18 °C.
Carefully remove the supernatant.
Aspirate the pellet in 20 ml wash solution, and transfer the solution in a fresh tube. Do not aspirate up and down!
Centrifuge, 720 x g, 5 min, 18 °C.
Resuspend the pellet in 2 ml culture medium 30% and transfer it on a well of a 6-well culture dish.
Check the quality of isolated acinar tissue under the microscope. Isolation is good if you see clusters of acinar cells (epithelial explants, the morphology is the same as in the Ctr. of the figure below) and only rare isolated acinar cells swimming around. Sometimes damaged acinar cells agglomerate together, remove such sticky agglomerates with a forceps.
Let the isolated acini recover for 60 min in the incubator (37 °C with 5% CO2).
Meanwhile precoat a cell culture plate of the desired size with collagen (see below). Calculate the required volume of collagen - medium mixture required for step 25. The volume depends from your application. Calculated 100 μl volume/well for a 48-well plate or 80 μl volume/well for an 8 well chamber slide. Typically you will seed the acinar explants obtained from one wild type mice in 15 wells of a 48 well plate. In this case you need 100 μl x 15/2 = 750 μl collagen and 100 μl x 15/2 = 750 μl medium 0.1%.
Collect the acinar suspension from the plate and transfer it to a fresh 15 ml tube.
Centrifuge acinar suspension, 720 x g, 5 min, 18 °C.
Carefully aspirate the supernatant.
Resuspend the pellet in a mixture of collagen and culture medium 0.1% (1:1 vol. /vol.)
Pipet the acini/collagen-medium suspension mixture into each coated well in the plate (at least in triplicate). For the typical 48-well example you pipet 100 μl of the mixture in 15 wells.
Wait until solidification of the collagen (about 30 min)
Add some more collagen (100 μl/well for the 48 well plate). You may skip this step when you will perform immunofluorescence as a downstream application. Wait until solidification (about 30 min)
Add culture medium 0.1% with/without the desired supplements to each well. Typically 400 μl/well for a 48 well plate.
To induce transdifferentiation of acinar explants, add TGFa (10 ng ml-1) or EGF (25 ng ml-1) into the culture medium 0.1% at day 1-3-5 where day 1 is the day of isolation.
Note:
1) We usually quantify transdifferentiation of wild type acinar explants after EGF treatment at day 5 (Figure 1).
2) Culture can be kept until day 8. For longer periods of culture you have to reseed the acinar explants into fresh collagen because cultures become acidic and collagen breaks down.
III. Gelation Procedure for Rat Tail Collagen I, 2.5 mg ml-1
Place on ice: Collagen, sterile 10x PBS, sterile water, sterile 1 N NaOH, falcon tubes. Keep all reagents on ice.
Calculate the total amount of collagen (final concentration of 2.5 mg ml-1) needed with the formula: (final Vol. x 2.5)/ (collagen concentration in the bottle). You need a 100/120 μl collagen layer/well for a 48-well plate or 80 μl collagen layer/well for a 8 well chamber slide.
Prepare a tube on ice with the following volume of 10x PBS: (final Vol.)/10.
Add the following volume of 1 N NaOH to the tube containing 10x PBS: (Vol. collagen to be added) x 0.023 ml.
Add to the 10x PBS/1 N NaOH the following volume of sterile ice-cold water: (final Vol.) - (Vol. collagen) - (Vol. 10x PBS) - (Vol. 1 N NaOH).
Mix the contents of tube and hold in ice.
Add the calculated volume of collagen and mix. Leave on ice (stable for 2-3 h) until ready for use.
Coat tissue culture dishes with collagen (use 24/48 wells for quantification of transdifferentiation, protein or RNA extraction, or use 8 well chamber slides for later staining applications).
Allow collagen to solidify at 37 °C (about 30 min)
Note: Downstream applications include immunofluorescence, protein extraction, RNA extraction and cytotoxicity assay.
Figure 1. Example of acinar explants at day 5. Acinar explants from a wild type mouse were isolated and cultivated for 5 days in collagen as described. Ctr (medium only): a typical acinar explant is composed by a sphere of several acinar cells. EGF: in presence of 25 ng/ml of EGF cell clusters get a more flattened morphology and differentiate to a duct-like structure characterized by a lumen (arrow) lined by several cells.
Recipes
SBTI stock solution
10 mg/ml in McCoy medium, store at -20 °C.
(optional) Collagenase VIII stock solution
9.6 mg/ml in McCoy medium (not fully dissolved), store at -20 °C.
Wash solution (40 ml/mouse)
McCoy′s medium
0.1% BSA (sterile filtered)
0.2 mg/ml SBTI (Stock 1:50)
Collagenase VIII solution (10 ml/mouse)
McCoy′s medium
0.1% BSA (sterile filtered)
0.2 mg/ml SBTI (Stock 1:50)
1.2 mg/ml Collagenase VIII (critical step, add collagenase just before use, dilute the collagenase VIII stock solution 1:8)
0.1% culture medium
Waymouth′s medium
0.1% BSA (sterile filtered)
0.2 mg/ml SBTI (Stock 1:50)
P/S 1:200 (optional, not necessary for short term culture)
0.25 μg/ml Amphotericin B (antifungal, optional)
ITS-X 1:100
BPE: 50 μg/ml (dilute according the batch concentration) (Aliquots, -20 °C)
0.1% FCS
30% culture medium
0.1% culture medium
30% FCS
Acknowledgments
This protocol for acinar epithelial explants from adult murine pancreas was established by modification previously published protocols ((Lisle and Logsdon, 1990; Githens et al., 1994; Means et al., 2005). The work was supported by grants from the Wilhelm Sander Stiftung (2010.021.1).
References
Ardito, C. M., Grüner, B. M., Takeuchi, K. K., Lubeseder-Martellato, C., Teichmann, N., Mazur, P. K., DelGiorno, K. E., Carpenter, E. S., Halbrook, C. J. and Hall, J. C. (2012). EGF receptor is required for KRAS-induced pancreatic tumorigenesis. Cancer Cell 22(3): 304-317.
Githens, S., Schexnayder, J. A., Moses, R. L., Denning, G. M., Smith, J. J. and Frazier, M. L. (1994). Mouse pancreatic acinar/ductular tissue gives rise to epithelial cultures that are morphologically, biochemically, and functionally indistinguishable from interlobular duct cell cultures. In Vitro Cell Dev Biol Anim 30A(9): 622-635.
Heid, I., Lubeseder–Martellato, C., Sipos, B., Mazur, P. K., Lesina, M., Schmid, R. M. and Siveke, J. T. (2011). Early requirement of Rac1 in a mouse model of pancreatic cancer. Gastroenterology 141(2): 719-730. e717.
Lisle, D., Ratcliffe, J. F., Faoagali, J. and Cherian, S. (1990). Bacterial contamination of contrast media stored after opening. Br J Radiol 63(751): 532-534.
Means, A. L., Meszoely, I. M., Suzuki, K., Miyamoto, Y., Rustgi, A. K., Coffey, R. J., Wright, C. V., Stoffers, D. A. and Leach, S. D. (2005). Pancreatic epithelial plasticity mediated by acinar cell transdifferentiation and generation of nestin-positive intermediates. Development 132(16): 3767-3776.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cell Biology > Tissue analysis > Tissue isolation
Cell Biology > Cell isolation and culture > Cell differentiation
Cell Biology > Cell isolation and culture > 3D cell culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Simple Staining Method Using Pyronin Y for Laser Scanning Confocal Microscopy to Evaluate Gelatin Cryogels
Brianna Reece [...] Katsuhiro Kita
Nov 20, 2024 446 Views
Culture and Characterization of Differentiated Airway Organoids from Fetal Mouse Lung Proximal Progenitors
Zhonghui Zhang [...] Qiuling Li
Dec 5, 2024 244 Views
Cochlear Organ Dissection, Immunostaining, and Confocal Imaging in Mice
Chenyu Chen [...] Dongdong Ren
Jan 20, 2025 1598 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
819 | https://bio-protocol.org/en/bpdetail?id=819&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Endosomal pH Measurement in Bone Marrow Derived Dendritic Cells
Sophia Maschalidi
Bénédicte Manoury
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.819 Views: 9331
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Aug 2012
Abstract
Endosomes embraces different set of compartments such as early endosomes, intermediate endosomes and late endosomes or lysosomes. They become acidic as they mature. This acidification is generated by the vacuolar membrane proton pump V-ATPase that is recruited in late endosomes. This protocol described the measurement of endosomal pH using dextran molecules labelled with pH sensitive and insensitive dyes.
Materials and Reagents
CO2 independent medium (Invitrogen, catalog number: 18045054 )
Iscove’s Modified Dulbecco’s Medium (IMDM) (Sigma-Aldrich, catalog number: I3390 )
10% fetal bovine serum (FBS) (Hyclone/PAA, catalog number: sv143-03 )
Penicillin-streptomycin (100 Units/ml, 100 μg/ml) (Sigma-Aldrich, catalog number: P11-010 )
Glutamine (Sigma-Aldrich, catalog number: G75013 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Granulocyte-macrophage colony stimulating factor (GM-CSF) (Peprotech, catalog number: 315-03 )
40,000 MW Dextran fluorescein (10 mg/ml) (Molecular Probes)
40,000 MW Dextran Alexa 647 (10 mg/ml) (Molecular Probes)
5 mM EDTA (Invitrogen, catalog number: 15575-038 )
1% Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Triton X-100 (Sigma-Aldrich, X-100) kept at room temperature
1x PBS (see Recipes)
Conditioned complete medium (see Recipes)
Equipment
Water bath (37 °C)
Incubator (37 °C)
The FACSCalibur flow cytometer (Becton Dickinson)
Hemocytometer
Centrifuge
Procedure
Detach bone marrow-derived dendritic cells (BMDCs) with 1x PBS-5 mM EDTA (10 min at 37 °C).
Wash the cells with 1x PBS twice by centrifugation at 367 x g for 10 min.
Count cells. A total of 3 x 106 cells are required for pH measurement at different time points (kinetics of 10 min, 20 min, 30 min and 60 min for example). Additionally, 6 x 106 cells are needed to acquire the pH standard curve.
For measurement of pH at different time points, resuspend the cells in 100 μl total volume of prewarmed conditioned complete medium containing 1 mg/ml of fluorescein- and 0.5 mg/ml Alexa-647-labeled 40,000 MW dextrans. Pulse cells in a water bath set at 37 °C for 10 min.
Stop the reaction by adding a large volume (1 ml) of cold 1x PBS-1% BSA and wash cells extensively (6 times) with the same buffer to get rid of the non-internalised dextrans.
After washing, resuspend the cells in prewarmed conditioned complete medium (1 ml) and incubate at 37 °C for different time points (chase). The pulse (10 min) corresponds to early endosomes (EE), the chase of 40 min corresponds to intermediate endosomes (IE) and the 110 min of chase corresponds to the lysosomes.
Stop the reaction each time by immediately adding cold PBS and placing the tubes on ice.
Rapidly, analyse the cells by FACS, via a FL1/FL4 gate selective for cells that have endocytosed both fluorescent probes and determine the ratio of the mean fluorescence intensity (MFI) emission between the two probes.
For the pH standard curve, resuspend the cells in 200 μl total volume of prewarmed conditioned complete medium containing 1 mg/ml of fluorescein- and 0.5 mg/ml Alexa-647-labeled 40,000 MW dextrans and pulse the cells in a water bath set at 37 °C for 20 min. Repeat step 5 and split cells into nine 1.5 ml Eppendorf tubes for a pH measurement ranging from 4 to 8.
Prepare several buffers that differ in pH by 0.5 units using prewarmed CO2 independent medium. Adjust the pH with citric acid or NaOH.
Resuspend each cell pellet in a different pH solution supplemented with 0.001% of Triton X-100 to slightly permeabilise the cells and to give access to the external prefixed pH solution into the cell.
Analyse immediately by FACS and determine the ratio of the mean fluorescence intensity (MFI) emission between the two fluorescent probes at each pH. Make the standard curve by plotting the different MFI ratio values that correspond to each pH and apply this formula to the MFI ratio values obtained before (steps 1-8, Figure 1).
Figure 1. Kinetic of endo-lysosomal pH in BMDCs pulsed with a mixed of fluorescein- and Alexa-647-labeled 40,000 MW dextrans for 10 min and then chased for different times
Recipes
1x PBS
137 mM NaCl
2.7 mM KCl
8 mM Na2HPO4
1.46 mM KH2PO4
Keep 1x PBS cold
Conditioned complete medium
IMDM supplemented with
10% FBS
100 Units/ml,100 μg/ml penicillin-streptomycin
2 mM glutamine
50 μM 2-mercaptoethanol
10 ng/ml GM-CSF
Acknowledgments
This protocol is adapted from Savina et al. (2010); Maschalidi et al. (2012) and Sepulveda et al. (2009).
References
Maschalidi, S., Hassler, S., Blanc, F., Sepulveda, F. E., Tohme, M., Chignard, M., van Endert, P., Si-Tahar, M., Descamps, D. and Manoury, B. (2012). Asparagine endopeptidase controls anti-influenza virus immune responses through TLR7 activation. PLoS Pathog 8(8): e1002841.
Savina, A., Vargas, P., Guermonprez, P., Lennon, A. M. and Amigorena, S. (2010). Measuring pH, ROS production, maturation, and degradation in dendritic cell phagosomes using cytofluorometry-based assays. Methods Mol Biol 595: 383-402.
Sepulveda, F. E., Maschalidi, S., Colisson, R., Heslop, L., Ghirelli, C., Sakka, E., Lennon-Dumenil, A. M., Amigorena, S., Cabanie, L. and Manoury, B. (2009). Critical role for asparagine endopeptidase in endocytic Toll-like receptor signaling in dendritic cells. Immunity 31(5): 737-748.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Immunology > Immune cell function > Dendritic cell
Biochemistry > Other compound > Ion
Cell Biology > Cell-based analysis > Ion analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Quantitative Determination of Ca2+-binding to Ca2+-sensor Proteins by Isothermal Titration Calorimetry
Seher Abbas and Karl-Wilhelm Koch
Apr 5, 2020 4870 Views
Quantification of Salivary Charged Metabolites Using Capillary Electrophoresis Time-of-flight-mass Spectrometry
Masahiro Sugimoto [...] Tomoyoshi Soga
Oct 20, 2020 2911 Views
Detection and Quantification of Calcium Ions in the Endoplasmic Reticulum and Cytoplasm of Cultured Cells Using Fluorescent Reporter Proteins and ImageJ Software
Shunsuke Saito and Kazutoshi Mori
Aug 20, 2023 1337 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
82 | https://bio-protocol.org/en/bpdetail?id=82&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Labeling Protein with Thiol-reactive Probes
QY Qingrong Yan
In Press
Published: Jun 5, 2011
DOI: 10.21769/BioProtoc.82 Views: 12520
Ask a question
Favorite
Cited by
Abstract
This protocol is used to label protein or peptide with a maleinmide or iodoacetamide conjugated fluorescent probe through the free cysteine.
Materials and Reagents
Thiol-reactive Maleimide probes (Life Technologies, Invitrogen™)
Note: A large collection of probes are available from Invitrogen.
Tris-(2-carboxyethyl)phosphine (TCEP) (Life Technologies, Invitrogen™, catalog number: T2556 )
Dithiothreitol (DTT) (Life Technologies, Molecular Probes®, catalog number: D1532 )
DMSO
Dissolving buffer (see Recipes)
Equipment
Aluminum foil
Sephadex G-25 column
Procedure
Dissolve protein at 50-100 μM in dissolving buffer containing 1 mM TCEP at room temperature to keep reactive cysteine reduced.
Note: It is not necessary to remove excess TCEP during conjugation with iodoacetamides or maleimides. TCEP can be substituted with DTT. If DTT is used, then dialysis is required to remove the excess DTT prior to introducing the reactive dye.
A 1-10 mM stock solution of thiol-reactive probe is prepared in DMSO immediately prior to use. Protect stock solution from light by wrapping containers in aluminum foil.
Mix thiol-reactive probe and protein as approximately 10:1 molar ratio and allow the reaction to proceed preferably in dark for 2 h at room temperature or overnight at 4 °C.
Note: Add the probe into protein solution dropwise and it is stirring.
Upon completion of the reaction, the conjugate is separated from excess dye on a gel filtration column (e.g. a Sephadex G-25 column) or by extensive dialysis at 4 °C in an appropriate buffer.
Recipes
Dissolving buffer (pH 7.0-7.5)
10-100 mM phosphate
Tris
HEPES
References
Hermanson, G., (1996). Bioconjugate Techniques, Academic Press.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Protein > Labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
820 | https://bio-protocol.org/en/bpdetail?id=820&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Phagosomes from Dendritic Cells by Using Magnetic Beads
Bénédicte Manoury
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.820 Views: 10221
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Aug 2012
Abstract
Phagosomes are intracellular organelles in dendritic cells in which pathogens such as viruses, bacteria and parasites are internalised to be proteolysed and killed. Phagosomes are formed by fusion with the plasma membrane, some area of the endoplasmic reticulum as well as the lysosome. This protocol described the purification of phagosomal compartments at different stage of their maturation using magnetic beads.
Materials and Reagents
CO2 independent medium (Life Technologies, InvitrogenTM, catalog number: 18045054 )
Iscove’s Modified Dulbecco’s Medium (IMDM) (Sigma-Aldrich, catalog number: I3390 )
Fetal calf serum (Hyclone/PAA, catalog number: sv-143-03 )
Penicillin streptomycin (Sigma-Aldrich, catalog number: P11-010 )
Glutamine (Sigma-Aldrich, catalog number: G7513 )
GM-CSF (10 ng/ml) (Peprotech, catalog number: 315-03 )
EDTA (Life Technologies, InvitrogenTM, catalog number: 15575-038 )
BSA (Sigma-Aldrich, catalog number: A2153 )
DTT (Sigma-Aldrich, catalog number: 43813 )
ULTRA tablets protease inhibitor cocktail solution (Roche, catalog number: 0 5892791001 )
NaCl (Sigma-Aldrich, catalog number: S-7653 )
Tris pH 7 (Sigma-Aldrich, catalog number: T-1503 )
NP40 (Sigma-Aldrich, catalog number: I8896 )
MgCl2 (Sigma-Aldrich, catalog number: M8266 )
EGTA (Sigma-Aldrich, catalog number: E3889 )
Imidazole (Sigma-Aldrich, catalog number: I-5513 )
Sucrose (Sigma-Aldrich, catalog number: S79-03 )
RIPA (Pierce Antibodies, catalog number: 89900 )
Antibodies:
EEA1 (Abcam, catalog number: ab2900 )
TfR rabbit serum (Home made)
LAMP1 (Abcam, catalog number: ab62562 )
Rab7 (Abcam, catalog number: ab126712 )
1x PBS (see Recipes)
RIPA buffer (see Recipes) supplemented with 2 mM DTT and 1x complete ULTRA Protease inhibitor cocktail tablets
Bone marrow derived dendritic cells medium (BMDCs) (see Recipes)
Homogenisation buffer (HB) (see Recipes)
Lysis buffer (see Recipes)
Equipment
Water bath
Magnetic beads (Dynal, Dynabeads M-280 streptavidine)
Magnetic stand for eppendorf (Dynal, catalog number: R670001 )
22 g Needle (Terumo, catalog number: NN-2238R )
1 ml Syringe (Terumo, catalog number: S*025E1 )
Centrifuge
Procedure
Detach bone marrow-derived dendritic cells (BMDCs) with 1x PBS-5 mM EDTA (10 min at 37 °C).
Wash the cells with PBS twice by centrifugation at 367 x g for 10 min.
Resuspend the cells in 15 ml falcon tube (7.5 x 107 cells/750 μl) in CO2 independent medium.
Add the magnetic beads (ratio: 6.5 x 105 beads/μl) to the cells.
Incubate 20 min in the water bath at 30 °C.
Raise the temperature of the water bath to 37 °C and leave the cells for 20 min (pulse).
Stop the reaction by adding 10 ml cold-ice 1x PBS-0.1% BSA and centrifuge for 10 min at 340 x g at 4 °C.
Repeat step 7 3 times.
Resuspend the cells in 3 ml of BMDCs medium and split the cells in 3 falcon tubes of 15 ml (1 ml of cells each).
Add 10 ml cold PBS-0.1% BSA fort = 0 (pulse) and leave on ice, put the other tubes at 37 °C for different times (chase, 40 min and 100 min).
T = 0 corresponds to early phagosomes (20 min of pulse); t = 60 min correspond to intermediate phagosomes (20 min of pulse + 40 min of chase), t = 120 min correspond to phagolysosomes (20 min of pulse + 100 min of chase).
At the end of the chase, centrifuge the cells at 463 x g for 10 min.
Now, perform the following steps on ice.
Wash the cells in ice-cold HB buffer.
Resuspend the cells in 1 ml of HB buffer.
Break the cells using a 1 ml syringe and a 22 g needle. You need about 30 flushes to break the cells. Check the broken the cells under a microscope (about 70% of the cells should be dead).
Transfer the broken cells into cold eppendorf tubes and place the eppendorf tubes on the magnetic stand on ice.
Leave 5 min; aspirate the supernatant with a thin tip. Keep the supernatant aside (on ice).
Wash the beads carefully with 1 ml PBS-0.1% BSA and repeat 8x step 16.
Resuspend the beads in lysis buffer or RIPA buffer (50 μl) and leave on ice for 15 min.
Centrifuge at 13,400 x g for 15 min and freeze the supernatant.
Phagosomes are ready to use and can be checked for their purity using a panel of antibodies (EEA1 or TfR for early markers, LAMP1 or Rab7 for late markers, see Figure 1).
Figure 1. Phagosomes from BMDCs are purified with magnetic beads after 20, 60 and 120 min. 5 μg of proteins are resolved by SDS-PAGE. Late marker (LAMP1) is visualized by immunoblot.
Recipes
1x PBS
137 mM NaCl
2.7 mM KCl
8 mM Na2HPO4
1.46 mM KH2PO4
RIPA buffer
50 mM Tris pH 7.5
150 mM NaCl
1% NP40
0.5% desoxycholate de sodium
20 mM EGTA
Bone marrow derived dendritic cells medium (BMDCs)
IMDM supplemented with
10% fetal calf serum
1% penicillin streptomycin
1% glutamine
10 ng/ml GM-CSF
Homogenisation buffer (HB)
8% sucrose
3 mM Imidazole
2 mM DTT
A complete 1x ULTRA tablets protease inhibitor cocktail solution (dissolve 1 tablet in 2 ml of H2O, 25x)
Lysis buffer
150 mM NaCl
50 mM Tris pH 7
a complete 1x ULTRA tablets protease inhibitor cocktail solution (1 tablet for 10 ml)
0.5% NP40
2 mM MgCl2
Acknowledgments
This protocol is adapted from Cebrian et al. (2011); Maschalidi et al. (2012); and Mantegazza et al. (2012).
References
Cebrian, I., Visentin, G., Blanchard, N., Jouve, M., Bobard, A., Moita, C., Enninga, J., Moita, L. F., Amigorena, S. and Savina, A. (2011). Sec22b regulates phagosomal maturation and antigen crosspresentation by dendritic cells. Cell 147(6): 1355-1368.
Maschalidi, S., Hassler, S., Blanc, F., Sepulveda, F. E., Tohme, M., Chignard, M., van Endert, P., Si-Tahar, M., Descamps, D. and Manoury, B. (2012). Asparagine endopeptidase controls anti-influenza virus immune responses through TLR7 activation. PLoS Pathog 8(8): e1002841.
Mantegazza, A. R., Guttentag, S. H., El-Benna, J., Sasai, M., Iwasaki, A., Shen, H., Laufer, T. M. and Marks, M. S. (2012). Adaptor protein-3 in dendritic cells facilitates phagosomal toll-like receptor signaling and antigen presentation to CD4(+) T cells. Immunity 36(5): 782-794.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Immunology > Immune cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
821 | https://bio-protocol.org/en/bpdetail?id=821&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Endogenous MALT1 Activity
DN Daniel Nagel
Daniel Krappmann
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.821 Views: 11817
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Cell Dec 2012
Abstract
MALT1(Mucosa associated lymphoid tissue protein 1) is an important adapter protein for the NF-kB driven lymphocyte activation and the development and survival of distinct B-cell lymphoma entities. In addition MALT1 is a cysteine protease that structurally resembles caspases while having a different substrate preference and mechanism of activation. This paracaspase activity of MALT1 has been shown to be critical for an optimal NF-kB activation and survival of the aggressive ABC-DLBCL (Activated B cell-type of diffuse large B cell lymphoma), which highlights the protease as an attractive therapeutic target for the treatment of distinct B-cell lymphomas and immune diseases like rheumatoid arthritis or multiple sclerosis. In this protocol we describe a fluorogenic cleavage assay, which can be used to measure endogenous and also ectopic MALT1 activity. To this end, cellular MALT1 needs to be precipitated from the lysed cells via antibody immunoprecipitation and subsequently incubated with a fluorogenic substrate peptide. The MALT1 cleavage assay has been developed to directly determine the activity profile of MALT1 in the course of the adaptive immune response as well as in pathological signaling in lymphoid malignancies. In addition, the MALT1 activity assay has been successfully used to monitor cellular MALT1 inhibition with small molecule inhibitors.
Keywords: Protease Paracaspase Immune signaling T cell activation Lymphoma
Materials and Reagents
Primary human and murine cells
T-cell-lines (Jurkat)
B-cell-lines: ABC-(TMD8, HBL1, OCI-Ly3, U2932, OCI-Ly10, RIVA) and GCB-DLBCL (Su-DHL-6, Su-DHL-4, BJAB)
RPMI 1640 (Life Technologies, catalog number: 21875 )
IMDM (Life Technologies, catalog number: 21056 )
Fetal Bovine Serum (FBS) (Life Technologies, catalog number: 10270 )
PMA (Phorbol 12-Myristat 13-Acetat) (Calbiochem, catalog number: 16561-29-8 )
Lonomycin (Calbiochem, catalog number: 407950 )
Anti-CD3/CD28 (Hit3a/CD28.2) (BD Heidelberg)
IgG1 (R19-15) (BD Pharmingen, catalog number: 553440 )
IgG2a (A85-1) (BD Pharmingen, catalog number: 553387 )
MALT1 antibody (Santa Cruz, catalog number: H300 )
Protein-G Sepharose (GE Healthcare, catalog number: 17-0618-01 )
PBS (Life Technologies, catalog number: 14190 )
Ac-LRSR-AMC (Peptides International, catalog number: MCA-3952-PI )
Z-VRPR-FMK (ENZO Life Sciences, catalog number: ALX-260-166 )
Complete protease inhibitor cocktail tablets (Roche, catalog number: 11836145001 )
Mepazine (Hit2lead, catalog number: 5216177 )
384-well non-binding plates, black (Greiner Bio-one, catalog number: 781900 )
Saccharose
CHAPS
HEPES
Triton X-100
Cellular lysis buffer (see Recipes)
MALT1 cleavage buffer (see Recipes)
Equipment
37 °C 5% CO2 cell culture incubator
26 G syringe (Roth, catalog number: C718.1 )
Centrifuge (Eppendorf, model: 5417R )
Synergy II multiwell plate reader (Biotek)
Rotary Mixer
Procedure
To activate MALT1 plate 2.5 x 106 cells (Jurkat T-cells, primary T cells or PBMCs) and either stimulate with PMA/Ionomycin (200 ng/ml and 300 ng/ml final concentrations) in 10 ml of complete RPMI media in 25 cm2 cell culture flasks or with anti-CD3 and anti-CD28 antibodies (1 μg/ml final concentration each) in the presence of anti-IgG1/IgG2a coupling antibodies (0.5 μg/ml each) in 1 ml of complete RPMI media in 12-well for 30 min or treat with solvent (H2O) in the control. Cells with constitutive MALT1 activity (e.g. ABC-DLBCL) can be left untreated.
As a negative control treat the above cells with MALT1 inhibitors, e.g. the tetrapeptide Z-VRPR-FMK (50 μM) or small molecule inhibitors like mepazine (10 μM) 3 - 6 h prior to stimulation and lysis.
All 2.5 x 106 cells per reaction are then pelleted at 300 x g for 5 min.
Removal of supernatant and lysis of the cells with cellular lysis buffer (500 μl) by rotating for 20 min on 4 °C in a 1.5 ml reagent tube.
Centrifugation of the lysates for 10 min at 21,000 x g to remove cell debris.
Incubation of all of the lysate with 700 ng MALT1 antibody over night at 4 °C on a rotary mixer.
Incubation with 15 μl Protein-G sepharose beads (beads were washed and diluted 1:2 in PBS and equilibrated before usage) for 60 min at 4 °C on a rotary mixer.
Beads are pelleted and washed 3 times with PBS at 300 x g for 2 min at 4 °C.
In the last washing step all PBS is discarded via a syringe and 45 μl cleavage buffer is added to the beads.
The beads are pelleted at 300 x g for 1 min afterwards re-suspended carefully and 49 μl of the suspension (beads and cleavage buffer) are subsequently transferred to one well of a 384-well assay plate.
1 μl of the fluorogenic substrate Ac-LRSR-AMC is then added to the wells in a final concentration of 20 μM and the plates are placed into the plate reader where they are shaked for 10 sec to mix the reagents.
After an incubation of 30 min at 30 °C the release of AMC fluorescence due to MALT1 cleavage is measured at 360 nm excitation and 460 nm emission over a time course of 90 min.
Specificity of MALT1 cleavage activity in vitro can be assessed by adding 5 nM of Z-VRPR-FMK to a separate control reaction (negative control).
Figure 1. Fluorogenic MALT1 cleavage assay. Jurkat T-cells (2.5 x 106) were pre-incubated with Mepazine or DMSO for 4 h and subsequently stimulated with PMA/Ionomycin (P/I) or antiCD3/CD28 for 30 min or left untreated. After lysis of the cells MALT1 was precipitated and the catalytic activity was measured after addition of Ac-LRSR-AMC in a Synergy II plate reader over 60 min at 2 min intervals.
Recipes
Cellular lysis buffer
50 mM HEPES (pH 7.5)
10% (v/v) Glycerin
0.1% (v/v)Triton X-100
1 mM Dithiothreitol (DTT)
150 mM NaCl
2 mM MgCl2
1 complete protease inhibitor tablet per 50 ml
MALT1 cleavage buffer
50 mM MES (pH 7.0)
150 mM NaCl
10% (w/v) Saccharose
0.1% (w/v) CHAPS
1 M Sodium citrate
10 mM DTT
Acknowledgments
This protocol was adapted from two previous publications (Kloo et al., 2011; Nagel et al., 2012). The work was supported by a grant of the ‘Deutsche Krebshilfe e.V.’ to DK.
References
Kloo, B., Nagel, D., Pfeifer, M., Grau, M., Duwel, M., Vincendeau, M., Dorken, B., Lenz, P., Lenz, G. and Krappmann, D. (2011). Critical role of PI3K signaling for NF-kappaB-dependent survival in a subset of activated B-cell-like diffuse large B-cell lymphoma cells. Proc Natl Acad Sci U S A 108(1): 272-277.
Nagel, D., Spranger, S., Vincendeau, M., Grau, M., Raffegerst, S., Kloo, B., Hlahla, D., Neuenschwander, M., Peter von Kries, J., Hadian, K., Dorken, B., Lenz, P., Lenz, G., Schendel, D. J. and Krappmann, D. (2012). Pharmacologic inhibition of MALT1 protease by phenothiazines as a therapeutic approach for the treatment of aggressive ABC-DLBCL. Cancer Cell 22(6): 825-837.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Nagel, D. and Krappmann, D. (2013). Measurement of Endogenous MALT1 Activity. Bio-protocol 3(14): e821. DOI: 10.21769/BioProtoc.821.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays > Protein analysis
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Measuring Protein Synthesis during Cell Cycle by Azidohomoalanine (AHA) Labeling and Flow Cytometric Analysis
Koshi Imami and Tomoharu Yasuda
Apr 20, 2019 8233 Views
Analysis of the Ubiquitination and Phosphorylation of Vangl Proteins
Di Feng [...] Bo Gao
Oct 20, 2022 1976 Views
Isoform-specific, Semi-quantitative Determination of Highly Homologous Protein Levels via CRISPR-Cas9-mediated HiBiT Tagging
Kristina Seiler [...] Mario P. Tschan
Jul 20, 2023 894 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
822 | https://bio-protocol.org/en/bpdetail?id=822&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Candida albicans Biofilms for Transmission Electron Microscopy
HT Heather T. Taff
David R. Andes
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.822 Views: 10455
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Aug 2012
Abstract
Transmission Electron Microscopy is a form of microscopy that allows for imaging of distinct portions of an individual cell. For Candida albicans biofilms, it is often used to visualize the cell walls of fixed samples of yeast and hyphae. This protocol describes how to grow, harvest, and fix Candida albicans biofilms in preparation for Transmission Electron Microscopy.
Materials and Reagents
Plate containing grown Candida albicans colonies
500 ml 0.22 μm filter (Corning, catalog number: 431118 )
Aluminum foil
Bacto-peptone (BD Biosciences, catalog number: 211677 )
Bacto-yeast extract (BD Biosciences, catalog number: 212750 )
Cell scraper (BD Biosciences, Falcon®, catalog number: 353085 )
Difco Dextrose (BD Biosciences, catalog number: 215530 )
Glutaraldehyde (Sigma-Aldrich, catalog number: G5882 )
Lead nitrate (PbNO3) (Electron Microscopy Sciences, catalog number: 17900 )
MOPS (Thermo Fisher Scientific, catalog number: BP308 )
4% Osmium tetroxide (Electron Microscopy Sciences, catalog number: 19140 )
Parafilm
Paraformaldehyde (Electron Microscopy Sciences, catalog number: 15710 )
Propylene oxide (Electron Microscopy Sciences, catalog number: 20410 )
RPMI 1640 (Sigma-Aldrich, catalog number: R6504 )
Sodium cacodylate trihydrate (Sigma-Aldrich, catalog number: C0250 )
Sodium chloride (Thermo Fisher Scientific, catalog number: S671-3 )
Sodium citrate (Electron Microscopy Sciences, catalog number: 21140 , 500 gm)
Sodium hydroxide (Sigma-Aldrich, catalog number: 59223C )
Sodium phosphate dibasic anhydrous (Thermo Fisher Scientific, catalog number: BP332-500 )
Sodium phosphate monobasic monohydrate (Thermo Fisher Scientific, catalog number: S369-500 )
Spurr’s Resin Kit (Polyscience, catalog number: 01916-1 )
Uridine (Sigma-Aldrich, catalog number: U3750 )
Uranyl acetate (Electron Microscopy Sciences, catalog number: 22400 )
YPD + uridine (see Recipes)
RPMI + MOPS (see Recipes)
1x PBS (see Recipes)
Fixative (see Recipes)
Reynold’s Lead Citrate Strain (see Recipes)
Equipment
15 ml conical tube (Corning, catalog number: CLS430055 )
6 well polystyrene plate (Grenier Bio-one, catalog number: 657160 )
Hemocytometer
Shaking incubator with adjustable temperatures and speeds
Transmission Electron Microscope facility with trained microscopist
Procedure
5 ml of YPD + uridine culture in a 15 ml conical tube is inoculated with a single colony of Candida albicans growing on a plate that is between 2 and 10 days old (age of colony may vary based on growth rate of particular strain). Most Candida strains and species should grow well in this medium, but if another medium is commonly used for a specific strain, that can be used instead.
Inoculum is incubated overnight at 30 °C and 200 rpm.
Cell concentration of overnight culture is determined by cell counting on a hemocytometer.
Inoculum diluted to 1 x 106 cells/ml in RPMI + MOPS.
1 ml of diluted incolulum added to each well of a 6 well plate.
Note: Inoculum spread to cover the entire bottom of the well.
6 well plate incubated at 30 °C for 60 min without shaking.
Inoculum is then removed from each well gently, so as not to scratch away the newly forming biofilm.
1 ml of fresh RPMI + MOPS media is added gently to each well.
6 well plates are wrapped in parafilm and aluminum foil and incubated for 24 h at 37 °C and 50 rpm.
Note: It is very important that the biofilms not be shaken above 50 rpm, as this will dislodge the growing biofilm from the plate bottom.
After 24 h, media is gently removed so as not to disturb the biofilm and replaced with 1 ml of fresh RPMI + MOPS.
Note: Tilting the 6 well plates and gently placing your pipet tip in the corner of the well helps to prevent too much disruption of the fragile biofilm.
6 well plates are re-wrapped as before and incubated another 24 h at 37 °C and 50 rpm.
After the second 24 h incubation, the media is removed from the wells and the biofilms are gently washed 1x in 1 ml of 1x PBS. It is important to slowly pipet in the PBS so as not to disturb the delicate biofilms. The PBS wash can be removed immediately after adding it to the biofilm.
Harvest each biofilm in 2 ml of 1x PBS and store in a 15 ml conical tube.
Note: Harvesting is best done by adding 1 ml of PBS into the well and scraping away the biofilm with a plastic spatula, and adding the biofilm to the conical tube. Then repeat this process with the second 1 ml of PBS to collect any remnants.
Conical tubes are gently centrifuged at 720 x g for 5 min at room temperature.
Supernatant is discarded and the pellet is resuspended in 2 ml of Fixative.
Tubes can be stored at 4 °C until ready for imaging by a trained transmission electron microscopist. It is recommended that the tubes not be stored more than a few days.
The following steps are a summary of those performed by a trained transmission electron microscopist.
Cells are postfixed in 1% osmium tetroxide.
Samples are then dehydrated by soaking for 10 min each in increasing concentrations of ethanol (30%, 50%, 70%, 85%, 90%, 95%, and 100%).
Next, samples are rinsed 3 x 10 min in 100% propylene oxide then embedded in Spurr’s resin.
70 nm sections are cut and placed on copper grids and poststained for 5 min with 8% uranyl acetate in 50% ethanol and for 5 min in Reynold’s lead citrate stain.
Samples can now be analyzed by TEM. A sample picture of a reference strain Candida albicans biofilm is shown below (Figure 1). Most pictures will only show one or two cells at a time, and usually cross-sectioned so that you can see inside the cells. Scale bar represents 1 μm.
Figure 1. Transmission Electron Microscopy image of a Candida albicans biofilm cell
Recipes
YPD + uridine
Bacto-yeast extract (1%)
10 g
Bacto-peptone (2%)
20 g
Dextrose (2%)
20 g
Uridine
0.08 g
Distilled water
1,000 ml
Combine all ingredients and aliquot into 100 ml bottles. Autoclave bottles on liquid cycle to sterilize.
RPMI + MOPS
RPMI 1640
10.4 g
MOPS
34.5 g
Distilled water
700 ml
Combine all ingredients in a 2 L flask. Use a 10 ml pipette to adjust pH to 7.0 using Sodium hydroxide (5 N). Bring volume up to 1 L with distilled water. Filter sterilize RPMI + MOPS into 500 ml bottles. Use at 37 °C, but can store for up to 6 months at 4 °C to prevent contaminant growth.
1x PBS
Sodium phosphate monobasic monohydrate (mw = 137.99; 0.038 M)
2.62 g
Sodium phosphate dibasic anhydrous
11.5 g
Sodium chloride
43.84 g
Distilled water
500 ml
Add above ingredients to 450 ml distilled water. Adjust pH to 7.4 by adding 1 M NaOH if necessary. Bring final volume to 500 ml distilled water. This makes 10x PBS stock. Dilute in distilled water 1:10 for final concentration of PBS.
Fixative
2.5% glutaraldehyde
2.0% paraformaldehyde
Add above ingredients to 0.1 M sodium cacodylate trihydrate. Use caution with this reagent, as it is very toxic.
Reynold’s lead citrate stain
Lead nitrate
1.33 g
Sodium citrate
1.76 g
Distilled water
30 ml
1 N Sodium hydroxide
8 ml
Place all ingredients in a 50 ml flask and shake forcefully for 1 min, then intermittently for 30 min until fully dissolved. Then add 8 ml of NaOH and bring volume up to 50 ml with distilled water. Filter sterilize before using.
References
Bowling Green State University (2012). Reynold’s Lead Citrate Stain. Retrieved from www.bgsu.edu/departments/biology/facilities/MnM/TEM/ReynoldsLeadStain.pdf.
Nett, J. E., Sanchez, H., Cain, M. T., Ross, K. M. and Andes, D. R. (2011). Interface of Candida albicans biofilm matrix-associated drug resistance and cell wall integrity regulation. Eukaryot Cell 10(12): 1660-1669.
Nett, J., Lincoln, L., Marchillo, K., Massey, R., Holoyda, K., Hoff, B., VanHandel, M. and Andes, D. (2007). Putative role of beta-1,3 glucans in Candida albicans biofilm resistance. Antimicrob Agents Chemother 51(2): 510-520.
Taff, H. T., Nett, J. E., Zarnowski, R., Ross, K. M., Sanchez, H., Cain, M. T., Hamaker, J., Mitchell, A. P. and Andes, D. R. (2012). A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance. PLoS Pathog 8(8): e1002848.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial biofilm > Biofilm culture
Microbiology > Microbial cell biology > Cell imaging
Cell Biology > Cell imaging > Electron microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Imaging Cryptococcus spp. Capsule by Differential Interference Contrast Microscopy Using Percoll®
Hugo Costa Paes [...] André Moraes Nicola
Nov 20, 2019 3279 Views
Intracellular cAMP Measurements in Candida albicans Biofilms
Liuliu Jiang [...] Xin Wei
Dec 5, 2019 3376 Views
A Novel and Robust Method for Investigating Fungal Biofilm
Biswambhar Biswas [...] Anil Thakur
Jan 5, 2025 472 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
823 | https://bio-protocol.org/en/bpdetail?id=823&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Candida albicans Biofilms Using an in vivo Rat Central Venous Catheter Model
HT Heather T. Taff
KM Karen Marchillo
David R. Andes
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.823 Views: 8633
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Aug 2012
Abstract
In vivo biofilms grown on medical devices are necessary to understand the interactions of the fungal biofilm and the host environment in which it is most commonly found. This protocol describes a way to grow Candida albicans biofilms on the interior lumen of central venous catheters surgically implanted into rats, which mimics quite well the clinical cases of biofilms found on human central venous catheters. These infected catheters can then be studied via a multitude of different experiments, including cell counting by plating, imaging the catheters under light or electron microscopy, or comparing the relative content of in vivo biofilms to in vitro biofilms and planktonic cultures. These biofilms also provide enough high quality RNA for transcriptional profiling.
Keywords: Candida Biofilm In vivo model Catheter infection
Materials and Reagents
350 g Specific-pathogen-free male Sprague-Dawley rats (Harlan)
Plate containing grown Candida albicans colonies
Ethylene oxide
4 way Large Bore (lipid resistant) Stopcock (Baxter, catalog number: 2C62047 )
Xylazine (Sigma-Aldrich, catalog number: X1126 )
Ketamine (Sigma-Aldrich, catalog number: K2753 )
Bacitracin (Sigma-Aldrich, catalog number: B0125 )
Bacto-peptone (BD Biosciences, catalog number: 211677 )
Bacto-yeast extract (BD Biosciences, catalog number: 212750 )
Betadine (SWIFT, catalog number: 159935 )
Difco agar (BD Biosciences, catalog number: 214530 )
Difco dextrose (BD Biosciences, catalog number: 215530 )
Heparin 1,000 U/ml (Sigma-Aldrich, catalog number: H3393 )
Intramedic PE 160 polyethylene tubing (BD Biosciences, catalog number: 427430 )
Needle holder (World Precision Instruments, catalog number: 14109 )
Silk braided sutures (size 2-0) (Thermo Fisher Scientific, catalog number: 14-516-130 )
Size med rat jacket (Braintress Scientific, catalog number: RJ-M )
Sodium chloride (Thermo Fisher Scientific, catalog number: S671-3 )
Sterile surgical draping materials (autoclaved hospital towels)
Surgical button attached to wire rat tether (Instech Solomon, catalog number: LW95S )
Uridine (Sigma-Aldrich, catalog number: U3750 )
Xylazine/ketamine anesthetic (see Recipes)
YPD + uridine media (see Recipes)
Heparinized saline (see Recipes)
0.85% saline solution (see Recipes)
YPD + uridine plates (see Recipes)
Equipment
Iris scissors (Braintree Scientific, catalog number: SC128 )
Metzenbaum scissors (Braintree Scientific, catalog number: SC126 )
Micro scissors (Braintree Scientific, catalog number: SC152 )
Hartman Mosquito-Hemostatic forceps (World Precision Instruments, catalog number: 15920 )
Adson forceps (Braintree Scientific, catalog number: FC028 )
Micro-Tissue forceps (Braintree Scientific, catalog number: FC145 , FC146 , FC147 )
Scalpels (Bladex, catalog number: 22-080-087 )
35 mm Surgical staples and associated stapler (Ethicon Endo-Surgery, catalog number: TR35B )
Animal Care Facilities
Gas sterilization chamber
Hemocytometer
Shaking incubator with adjustable temperatures and speeds
Vein scissors
Procedure
Cut polyethylene tubing into 54 cm segments and gas sterilize using ethylene oxide.
Anesthetize rats with roughly 0.5 ml intraperitoneal (i.p.) injection with 1 mg/kg of xylazine/ketamine mixture.
Note: Exact volume will depend on the size of the rat.
Shave the neck, midscapular space, and anterior chest of the rats to be catheterized and scrub with betadine.
Prep a sterile surgical space containing the rat in a supine position.
Fill the catheter piece with 540 μl of heparin (100 U/ml) via a 2 way stopcock. Once filled, place stopcock in the locked position to ensure sterility.
Create a vertical incision just right of the midline of the anterior neck and horizontal cut in the midscapular region. Tunnel the catheter subcutaneously from the midscapular region to the vertical incision (secure subcutaneous button end with staple at midscapular area leaving rat wire tether exposed).
Use blunt surgical dissection to find and expose jugular vein and tie off cranial end.
Make a small longitudinal incision in the wall of the internal jugular vein with vein scissors.
Place catheter in incision and advance along the vein until approximately 2 cm above the right atrium. Check for proper placement by opening stopcock and checking for flash of blood flowing inside catheter.
Secure catheter to the vein with 2-0 silk ties. Close stopcock.
Close incision site with surgical staples.
Treat surgical sites with bacitracin and place rat jacket on.
Rats are allowed to rest for 24 h to recover from the catheter placement and their recovery from surgery assessed according to standard animal care protocols.
Note: Throughout rest of study, check on health of rats every 8hr and flush catheters with heparinized saline once a day.
During 24 h rest period for the rat, 5 ml of YPD + uridine culture in a 15 ml conical tube is inoculated with a single colony of Candida albicans growing on a plate. Ideally, colony should have grown large enough to be picked easily (usually takes ~ 2 days) but not so old that it starts to lose its circular shape (usually after about 10 days of growth). Most Candida strains will grow well on YPD + uridine agar plates, but any medium that allows the strain to be studied to grow well can be used.
Inoculum is incubated overnight at 30 °C and 200 rpm.
Cell concentration of overnight culture is determined by cell counting on a hemocytometer.
Inoculum diluted to 1 x 106 cells/ml in 0.85% saline.
Viable cell counts are confirmed by plating unused inoculum on YPD + uridine plates.
540 μl of diluted inoculum is added to the intraluminal portion of the catheter (via stopcock) and allowed to adhere for 6 h.
Inoculum is then removed through stopcock in the open position and the catheter volume is filled with 100 U/ml heparinized saline. The stopcock is then closed.
Microbes within the catheters are then allowed to grow for 48 h.
Note: If desired, drugs can be administered into the catheter lumen (via stopcock) after 24 h of growth to test in vivo drug susceptibility of biofilms.
At the end of the growth period, rats are sacrificed according to animal safety protocols. Catheters are removed from the rats in a sterile surgical environment with all sterile tools and supplies, and cut into roughly 1-2 cm long segments.
At this point, protocols diverge based on the nature of the in vivo experiment being conducted.
Recipes
Xylazine/ketamine anesthetic
Combine 20 mg/ml xylazine and 50 mg/ml ketamine in a 1:3 vol/vol ratio
YPD + uridine media
Bacto-yeast extract (1%)
10 g
Bacto-peptone (2%)
20 g
Dextrose (2%)
20 g
Uridine
0.08 g
Distilled water
1,000 ml
Combine all ingredients and aliquot into 100 ml bottles. Autoclave bottles on liquid cycle to sterilize.
Heparinized saline
Dilute heparin to 100 U/ml in 0.85% saline solution
0.85% saline solution
Sodium Chloride
4.25 g
Distilled water
500 ml
Autoclave on liquids cycle.
YPD + uridine plates
Bacto-yeast extract (1%)
10 g
Bacto-peptone (2%)
20 g
Dextrose (2%)
20 g
Bacto-agar (2%)
20 g
Uridine
0.08 g
Distilled water
1,000 ml
Combine all ingredients in 2 L flask and autoclave on liquids cycle to sterilize before pouring plates.
References
Andes, D., Nett, J., Oschel, P., Albrecht, R., Marchillo, K. and Pitula, A. (2004). Development and characterization of an in vivo central venous catheter Candida albicans biofilm model. Infect Immun 72(10): 6023-6031.
Taff, H. T., Nett, J. E., Zarnowski, R., Ross, K. M., Sanchez, H., Cain, M. T., Hamaker, J., Mitchell, A. P. and Andes, D. R. (2012). A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance. PLoS Pathog 8(8): e1002848.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Taff, H. T., Marchillo, K. and Andes, D. R. (2013). Preparation of Candida albicans Biofilms Using an in vivo Rat Central Venous Catheter Model . Bio-protocol 3(14): e823. DOI: 10.21769/BioProtoc.823.
Taff, H. T., Nett, J. E., Zarnowski, R., Ross, K. M., Sanchez, H., Cain, M. T., Hamaker, J., Mitchell, A. P. and Andes, D. R. (2012). A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance. PLoS Pathog 8(8): e1002848.
Download Citation in RIS Format
Category
Microbiology > Microbial biofilm > Biofilm culture
Microbiology > Microbe-host interactions > In vivo model > Mammal
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Visualizing Hypoxia in a Murine Model of Candida albicans Infection Using in vivo Biofluorencence
José Pedro Lopes and Constantin F. Urban
Aug 5, 2019 4001 Views
RNA Extraction from Ears and Draining Lymph Nodes of Mice Infected with Leishmania amazonensis
Emilie Giraud and Evie Melanitou
Jun 5, 2020 4166 Views
TetR Regulated in vivo Repression Technology to Identify Conditional Gene Silencing in Genetically Engineerable Bacteria Using Vibrio cholerae Murine Infections as Model System
Franz G. Zingl [...] Stefan Schild
Oct 5, 2020 2223 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
824 | https://bio-protocol.org/en/bpdetail?id=824&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
DNase I Footprinting to Identify Protein Binding Sites
IG Isabelle Gaugué
DB Dominique Bréchemier-Baey
JP Jacqueline Plumbridge
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.824 Views: 22350
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Molecular Microbiology Sep 2012
Abstract
DNase I footprinting is used to precisely localise the position that a DNA binding protein, e.g. a transcription factor, binds to a DNA fragment. A DNA fragment of a few hundred bp is labelled at one end and then incubated with the proteins suspected to bind. After a limited digestion with DNase I, the reaction is quenched, DNA is precipitated and analysed on a denaturing polyacrylamide gel. This protocol uses 32P-radioactively labeled DNA.
Materials and Reagents
Oligonucleotides (usually 20-30 mer) to amplify a suitable fragment (100-400 bp) encompassing the region to be tested for protein binding ability
Plasmid DNA carrying the cloned required region to use as template for the PCR amplification
[γ-32P] ATP (3,000 Ci/mmole, 30 μCi = 3 μl/labeling ) (e.g. NEN, catalog number: BLU502A)
Polynucleotide kinase (PNK) (e.g. Biolabs, catalog number: M0201 )
Agarose
Purified protein (or enriched crude bacterial extracts see below)
DNase I (e.g. Sigma-Aldrich, catalog number: D5025 )
Phenol
Chloroform
Herring sperm DNA (e.g. Sigma-Aldrich, catalog number: D6898 ; Roche, catalog number: 223 646 )
BSA (e.g. Biolabs, catalog number: B9001 )
Acrylamide
Urea
DTTP (e.g. Biolabs, catalog number: N0447 )
Taq polymerase (5 units/μl) (e.g. Biolabs, catalog number: M0267 )
DNA Marker (e.g. 100 bp ladder, Biolabs, catalog number: N3231 )
Antarctic alkaline phosphatase (Biolabs, catalog number: M0296 )
MspI (Biolabs, catalog number: N3032 )
40% Acrylamide stock (19:1 acrylamide: bis acrylamide) (e.g. Euromedex, catalog number: EU0076-C)
TBE buffer
Binding buffer (see Recipes)
DNase I dilution buffer (see Recipes)
DNase I stop buffer (see Recipes)
DNase I stock (see Recipes)
Loading formamide dyes (see Recipes)
Denaturing Sequencing gel (6% acrylamide) (see Recipes)
Hepes-Glutamate (see Recipes)
Equipment
Suitable space for working with 32P radioactivity
Image quantification apparatus (e.g. Typhoon GE Healthcare Life Sciences; X-ray film and developing materials)
PCR machine
Small horizontal agarose gel apparatus
Transilluminator (preferably 365 nM)
Apparatus for running a 30 cm sequencing gel (e.g. Model S2 Vertical sequencing apparatus, now sold by Biometra)
Power supply capable of producing 2,000 volts and 60 watts)
Geiger counter to monitor for radioactivity and any contamination.
Heating block at 90 °C
Gel drying apparatus
Procedure
Preparation of the labeled DNA fragment
Label the 5' end of one of the oligonucleotides to be used to make the fragment to footprint. Choose the oligo so that the suspected binding site is not too far from the labeled end. Normally the footprint should be performed on both strands of the DNA, i.e. using two DNA fragments labeled at either end. Use a 0.5 ml tube suitable for PCR.
3 μl Oligo 1, 10 pmoles/μl
2 μl 10x PNK buffer (supplied by manufacturer of PNK)
3 μl [γ- 32P] ATP (3,000 Ci/mmole)
11 μl H2O
1 μl (10 units) PNK
Incubate 30 min 37 °C
N.B. Take suitable precautions for use of radioactivity. Perform in approved location.
Precipitate the labeled oligo. Add
80 μl 0.1 M Sodium acetate (natural pH about 9.0)
1 μl 10 mM Sodium phosphate buffer, pH 7.4
250 μl ethanol (96%)
Incubate in dry ice for 30 min (or at -80 °C for > 1 h).
Centrifuge 15 min 4 °C 12,000 x g.
Carefully remove the supernatant.
N.B. Very radioactive, Discard accordingly.
Rinse the (tiny) pellet with 100 μl 96% ethanol (or 70% ethanol at -20 °C). Centrifuge 5 min 4 °C 12,000 x g.
Carefully remove the supernatant. Dry in vacuo 5 min.
Resuspend the labeled Oligo 1 in 35 μl H2O. Vortex well and give a quick centrifugation to place all labeled oligo in bottom of tube.
Add 5 μl Thermopol buffer (Biolabs or other suitable Taq polymerase buffer).
5 μl deoxyNTP mix containing 2.5 mM each dATP, dCTP, dGTP, DTTP.
4 μl Oligo 2 10 pmoles/μl (Oligo 2 corresponds to the other end of fragment to be amplified).
1 μl template DNA (e.g. plasmid DNA carrying the cloned region to be amplified, about 50 ng depending on size of plasmid. We usually use 1 μl 1/10 dilution of standard mini plasmid DNA preparation).
Mix well, quick centrifugation and add 0.5 μl (2.5 units) Taq polymerase (5 units/μl) and immediately start PCR.
PCR cycling
Denature 94 °C for 2 min
94 °C for 30 sec
55 °C* for 30 sec
72 °C for 30 sec*
Repeat b-d 25 times
Final extension 5 min 72 °C
* The temperature of annealing depends upon the oligonucleotides used and the extension time at 72 °C on the length of the fragment amplified. Footprints on fragments greater than 500 bp are not recommended and so 30 sec is usually good for most fragments.
Test 1-2 μl on small agarose gel (containing ethidium bromide or other suitable DNA detection reagent) for amplification of a fragment of the correct size and check you have a fragment of the correct size in good yield (i.e. most or all of the oligos have been used up) 30 pmoles of oligos can give maximally 2 μg of a fragment of 100 bp and 10 μg of a fragment 500 bp. Proceed to purification. In theory you can use the PCR as it is or after passage through a spin column. However any minor, shorter length contaminants will produce artifactual bands in the footprint and the presence of unincorporated radioactivity will not allow you to estimate the amount of radioactive DNA in the footprinting reactions. So we always proceed to purify the labeled DNA from an agarose gel. In exceptional cases e.g. to eliminate a close running contaminant band from a short (100-200 bp) fragment, the fragments can be purified on a native acrylamide gel (see step I-14 below).
Run the PCR mixture, mixed with 10 μl of loading dyes, on a small 1% agarose gel in 50 mM TBE buffer. Usually the whole 50 μl PCR can be loaded in 3 wells.
Visualize the gel on a long wavelength (365 nm) transilluminator (to minimize damage to the DNA by short wavelength) and cut out the agarose containing the radioactive fragment. Discard rest of gel as radioactive waste.
Extract the DNA from agarose using a gel purification kit (e.g. Machery-Nagel Nucleo-spin Gel and PCR clean-up). Elute in 50 μl elution buffer.
To purify the DNA from an acrylamide gel: Run the PCR mix on a native acrylamide gel (5-8% depending upon size in 50 mM TBE at room temperature i.e. do not allow the gel to heat up. Depending upon the size of the apparatus used 100-200 volts should be adequate). Locate the radioactive DNA by short exposure of the wet gel wrapped in Saran wrap to a phosphorimager screen (or X-ray film). The piece of acrylamide containing the radioactive band is cut out and the radioactive DNA eluted by shaking overnight at 37 °C in 1 ml of 0.5 M ammonium acetate, 0.1% SDS, 1 mM EDTA. Separate the aqueous phase from the acrylamide gel piece by centrifugation and transfer to another tube. Extract with 0.5 ml phenol/CHCl3 and precipitate the DNA with 2.5 volumes ethanol in dry ice for at least 30 min. Centrifuge 10 min 4 °C, remove all the supernatant, dry in vacuo 2-3 min) Resuspend in 50 μl elution buffer (as for DNA eluted from agarose.).
Run 1 μl on a new small agarose gel and estimate the quantity by comparison to the staining intensity of marker DNAs (e.g. 100 bp ladder).
Count 1 μl by Kerenkov radiation in a scintillation counter or estimate using a Geiger counter. Expect to have 50,000-150,000 cpm/μl with about 5-50 ng DNA/μl (yield in range 10-50% of the moles of starting oligonucleotide). You can calculate the molar concentration of the DNA fragment from the length of the fragment in bp and using 1 bp corresponds to a molecular mass of 660.
The footprinting reaction
All protein and DNA dilutions are made in 1x binding buffer. Protein dilutions are made at 4 °C to minimize any instability of the protein in dilute solutions. Binding reactions can be made at RT or at 30 °C or 37 °C depending upon the experiment. E.g. Most prokaryotic transcription factors bind DNA at RT. E.coli RNA polymerase will only form open complexes at 37 °C.
The binding buffer we usually use is Hepes-Glutamate. The concentration of K glutamate can be increased or decreased according to the experiment; generally higher salt favors specificity but decreases affinity. Mg++ salts (1-10 mM) can be added according to the experiment, e.g. Mg++ is required for RNA polymerase binding. The BSA is added to stabilize dilute proteins and prevent non-specific absorption to the microfuge tube. The reaction mix in general consists of 20 μl DNA solution to which we add 20 μl of the diluted protein (if several components need to be tested at the same time the volume for each component can be reduced accordingly to give a final volume of 40 μl).
To test a range of protein concentrations for binding to the labeled DNA. Make a suitable volume of binding buffer and keep on ice. Prepare a series of dilution tubes for the protein to test over a range of concentrations. This range depends entirely on the protein under study as binding constants can vary from nM to nearly mM. E.g. for 10 serial dilution of 1/2 concentration each step, Prepare 10 tubes with 25 μl binding buffer on ice.
Prepare a suitable volume of labeled DNA e.g. For 12 reactions prepare 240 μl binding buffer and add labeled DNA fragment to have about 20,000 -100,000 cpm/reaction. Mix well. Ideally this should give a final concentration of the DNA of about 1 nM in the 40 μl footprinting reaction, if binding constants of protein to DNA are in the nM range.
Dispense 20 μl of the DNA mix into 12 1.5 ml microtubes at RT.
Make the protein dilutions on ice and immediately mix the diluted protein with the DNA at RT. E.g. Dilute the protein to 1 μM in 50 μl binding buffer.
Add 20 μl to one tube of DNA (to give final concentration of 500 nM). Mix by pipetting. Leave at RT until finished all mixes.
Take 25 μl of the 1 μM dilution and mix with 25 μl binding buffer in next dilution tube.
Add 20 μl of this dilution to the next DNA tube (final concentration 250 nM).
Take 25 μl of the 0.5 μM dilution and mix with 25 μl binding buffer in next dilution tube.
Continue for the whole series of 10 dilutions.
Add 20 μl 1x binding buffer to two DNA samples for the (essential) controls without protein.
Incubate for 10 min at RT (or at chosen temperature for chosen time).
Meanwhile prepare a suitable dilution of DNase I in DNase I dilution buffer. It is crucial to find the correct DNase I concentration to get limited DNase attack so that not all the DNA is degraded. As there should in theory be no more than 1 break/DNA strand, the majority (80-90%) of the DNA should be full length.
It is usually necessary to make a pilot experiment with each new stock of DNase I to test a series of dilutions of DNase I with a DNA fragment (in the absence of binding proteins) to find the concentration which gives an adequate ladder but leaves full length DNA at the top of the gel. The amount of DNase I used should be lower for longer DNA fragments. The amount given below is a guideline only.
DNase I stock of 5 mg/ml in DNase I storage buffer (store in aliquots at -20 °C).
Dilute about 10,000 fold (e.g. 2 μl to 200 μl, in DNase I dilution buffer, then take 2 μl of the first dilution to 200 μl DNase I dilution buffer) to give 0.5 μg/ml.
To make the footprint reactions:
T= 0 add 4 μl dilute DNase I to the footprint mix 1. Mix gently by pipetting.
T= 15 sec Add 4 μl dilute DNase I to the footprint mix 2. Mix gently by pipetting.
T= 30 sec Add 4 μl dilute DNase I to the footprint mix 3. Mix gently by pipetting.
T= 45 sec Add 4 μl dilute DNase I to the footprint mix 4. Mix gently by pipetting.
T= 60 sec Add 100 μl phenol pH 8.0 to the footprint mix 1. Vortex to stop reaction
T= 75 sec Add 100 μl phenol pH 8.0 to the footprint mix 2. Vortex to stop reaction.
T= 90 sec Add 100 μl phenol pH 8.0 to the footprint mix 3. Vortex to stop reaction.
T= 105 sec Add 100 μl phenol pH 8.0 to the footprint mix 4. Vortex to stop reaction.
Repeat until all the tubes have been treated.
Precise timings are crucial to get precise and comparable DNase I digestions in each lane (some researchers prefer to use longer times and more dilute DNase I).
Add 200 μl DNase I STOP solution to each reaction. Vortex well.
Centrifuge 10 min RT.
Transfer the aqueous upper phase (careful not to take any phenol) to a clean 1.5 ml microfuge tube.
Add 600 μl 96% ethanol. Mix well and incubate in dry ice for 1 h (or overnight at -80 °C).
Centrifuge 15 min, 4 °C, 12,000 x g.
Remove the supernatant carefully with a pipette and 1 ml pipette tip. Depending upon the number of cpm used per reaction and the sensitivity of the available Geiger counter, verify that some radioactivity is in the (invisible) pellet with a Geiger counter. If the herring sperm DNA, used in the DNase I STOP to aid precipitation, has not been sufficiently sonicated or too much has been used, the DNA pellet might not adhere to the microfuge tube and can be lost with the ethanol.
Centrifuge again, 5 min 4 °C. Remove the rest of the liquid with a 20 μl pipette tip. Verify that the radioactivity is still in the tube.
Dry in vacuo 5 min.
Resuspend in 5 μl H2O and add 6 μl gel loading formamide dyes (deionized formamide with Bromophenol blue and Xylene cyanol). Vortex well. Quick centrifuge to put all liquid in bottom of tube.
Heat to 90 °C for 2 min. Quench in ice and immediately load (5 μl) onto a denaturing (7 M urea) acrylamide sequencing gel, acrylamide (19:1 acrylamide: bis-acrylamide), which has been prerun for 30 min to 1 h to get hot. Voltage and wattage depends upon the apparatus used. We use 60 watts for the Model S2. Use with 5-10% final concentration acrylamide depending on the size of the fragment under investigation.
To locate the site of protein binding it is necessary to calibrate gels with molecular weight markers. E.g. DNA marker pBR322 digested with MspI, treated with alkaline phosphatase (e.g. Antarctic alkaline phosphatase) and labeled with [γ-32P] ATP and PNK or a sequencing ladder prepared using the same Oligo 1, which was used for the radioactive labeling of the fragment.
Electrophorese at 60 watts for a 30 x 30 plates and 1 mM thick gels using the Model S2 apparatus. Adjust volts and power for other sized gels. Time of migration depends upon the size of the fragment and expected position of protein binding sites (generally 80 min to 3 h).
After migration, allow to cool slightly, open plates, transfer the gel to Whatman 3 mm paper. Cover with Saran wrap and dry on a gel drying apparatus.
Put the dried gel, still covered with Saran to expose in a Phosphorimager cassette overnight (alternatively expose to X-ray film with an intensifying screen).
The pattern of DNase I cleavages with and without protein indicates the site of protein binding (Figure 1). Deformations such as bent or looped DNA are indicated by hypersensitive cleavages compared to the control (free DNA), since bending of the DNA has facilitated attack by DNase I in the wider minor groove formed on the outside of the loop or bend (Figure 2).
Figure 1. Principle of DNase I footprinting
Figure 2. Example of DNase I footprinting
Using the Image Quant program, it is possible to quantify the amount of radioactivity in specific bands or regions, corresponding to protein protected sites and non-protected regions, and hence to derive binding constants for the proteins.
Recipes
Binding buffer
25 mM Hepes (pH 8.0)
100 mM K glutamate (pH 8.0)
0.5 mg/ml BSA
DNase I dilution buffer
10 mM Tris (pH 8.0)
10 mM MgCl2
10 mM CaCl2
125 mM KCl
0.1 mM DTT
DNase I stop buffer
0.5 M Na acetate pH 5.0
10 μg/ml DNA (e.g. sonicated herring sperm DNA. Suspend DNA in 10 mg ml-1 H2O and allow to hydrate overnight at 4 °C. Sonicate until the solution loses all viscosity.)
2.5 mM EDTA
DNase I stock e.g. 5 mg/ml in
50% glycerol
100 mM NaCl
10 mM Tris (pH 8.0)
10 mM MgCl2
Loading formamide dyes
1 ml deionized formamide
10 μl 5% solution xylene cyanol and bromophenol blue.
Denaturing Sequencing gel (6% acrylamide)
6% acrylamide (19:1 acrylamide: bis acrylamide) (dilute from 40% stock)
7 M urea
1x TBE
For 80 ml of acrylamide/urea/TBE mixture add 0.4 ml 10% ammonium persulphate and 40 μl TEMED to polymerise the acrylamide, mix gently and carefully pour between the gel plates (0.4 mM thick spacers) avoiding bubbles. Insert a comb to make the wells and leave to polymerise horizontally.
Hepes-Glutamate
25 mM Hepes (pH 8.0)
100 mM K glutamatew
0.5 mg/ml BSA
Acknowledgments
The use of DNAse I to identify protein bindinging sites on DNA was first described by Galas and Schmitz (1978). Since then it has been exploited and adapted in very many laboratories. Our protocol is based on that in use in the laboratory of Annie Kolb (Colland et al., 2000; Marschall et al., 1998), who introduced the use of potassium glutamate in the binding buffer, which mimics in vivo conditions and increases the affinity of most proteins for their DNA targets. We are extremely grateful to Annie Kolb for her continuous advice and interest. Work in our lab has been funded by the Centre National de Recherche Scientifique (CNRS) to UPR9073 (now renamed FRE3630), by Université Paris 7, Denis Diderot; Agence National de Recherche [(ANR-09-Blanc 0399 (GRONAG)] and by the "Initiative d'Excellence" program from the French state [ANR-11-LBX-0011-01 (DYNAMO)].
References
Brenowitz, M., Senear, D. F., Shea, M. A. and Ackers, G. K. (1986). Quantitative DNase footprint titration: a method for studying protein-DNA interactions. Methods Enzymol 130: 132-181.
Brechemier-Baey, D., Dominguez-Ramirez, L. and Plumbridge, J. (2012). The linker sequence, joining the DNA-binding domain of the homologous transcription factors, Mlc and NagC, to the rest of the protein, determines the specificity of their DNA target recognition in Escherichia coli. Mol Microbiol 85(5): 1007-1019.
Colland, F., Barth, M., Hengge-Aronis, R. and Kolb, A. (2000). Sigma factor selectivity of Escherichia coli RNA polymerase: role for CRP, IHF and lrp transcription factors. EMBO J 19(12): 3028-3037.
El Qaidi, S. and Plumbridge, J. (2008). Switching control of expression of ptsG from the Mlc regulon to the NagC regulon. J Bacteriol 190(13): 4677-4686.
Galas, D. J. and Schmitz, A. (1978). DNase footprinting: a simple method for the detection of protein-DNA binding specificity. Nucleic Acids Res 5(9): 3157-3170.
Marschall, C., Labrousse, V., Kreimer, M., Weichart, D., Kolb, A. and Hengge-Aronis, R. (1998). Molecular analysis of the regulation of csiD, a carbon starvation-inducible gene in Escherichia coli that is exclusively dependent on sigma s and requires activation by cAMP-CRP. J Mol Biol 276(2): 339-353.
Plumbridge, J. and Kolb, A. (1991). CAP and Nag repressor binding to the regulatory regions of the nagE-B and manX genes of Escherichia coli. J Mol Biol 217(4): 661-679.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Gaugué, I., Bréchemier-Baey, D. and Plumbridge, J. (2013). DNase I Footprinting to Identify Protein Binding Sites. Bio-protocol 3(14): e824. DOI: 10.21769/BioProtoc.824.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA-protein interaction
Molecular Biology > DNA > DNA labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Attachment of a 32P-phosphate to the 3′ Terminus of a DNA Oligonucleotide
Joshua C. Cofsky and Jennifer A. Doudna
Oct 20, 2020 3734 Views
Characterize the Interaction of the DNA Helicase PriA with the Stalled DNA Replication Fork Using Atomic Force Microscopy
Yaqing Wang [...] Yuri L. Lyubchenko
Mar 5, 2021 3629 Views
A Gel-Based Assay for Probing Protein Translocation on dsDNA
Christiane Brugger and Alexandra M. Deaconescu
Jul 20, 2021 2857 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
825 | https://bio-protocol.org/en/bpdetail?id=825&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Enzyme Kinetic Parameters of UDP-glycosyltransferases
Jörg M. Augustin
SB Søren Bak
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.825 Views: 12233
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Dec 2012
Abstract
The determination of enzyme kinetic parameters, such as the Km and kcat values, is an essential part of the characterization of newly discovered enzymes. This protocol describes the determination of enzyme kinetic parameters of the Barbarea vulgaris UDP-glycosyltransferases (UGTs) UGT73C11 and UGT73C13 toward the sapogenins oleanolic acid and hederagenin as sugar acceptor substrates. UGTs catalyze the transfer of glycosyl residues. They generally use uridine sugar nucleotides as their sugar donor substrates, whereas sugar acceptor substrates arise from structurally diverse sets of metabolite classes. This protocol is based on the quantification of 14C-labeled glycosides following thin layer chromatography (TLC)-based separation. The dependence of the measured signal on a universal radioactively-labeled sugar donor substrate allows the potential application of the protocol in combination with a wide range of different sugar acceptor substrates. However, since the here described TLC separation procedure has been optimized for the separation of sapogenins and their glycosides, some modifications may become necessary when investigating other compound classes.
Figure 1. Glucosylation reaction catalyzed by UGT73C10-UGT73C13 from Barbarea vulgaris (Augustin et al., 2012). All four enzymes utilize uridine diphosphate glucose (UDP-glc) as glucosyl-moiety donor substrate and different sapogenins such as the oleanane sapogenins oleanolic acid and hederagenin as glucosyl-moiety acceptor substrates.
Materials and Reagents
Uridine-5'-diphosphoglucose (UDP-Glc) (e.g. Sigma-Aldrich, catalog number: S451649 )
Uridine-5'-diphosphate-[14C]glucose (UDP-[14C]Glc) (e.g. PerkinElmer, catalog number: NEC403050UC )
N-Tris(hydroxymethyl)methyl-3-aminopropanesulfonic acid (TAPS) (e.g. Sigma-Aldrich, catalog number: T5130 )
Bovine serum albumin (BSA) (e.g. Sigma-Aldrich, catalog number: A7906 )
Dithiothreitol (DTT) (e.g. Sigma-Aldrich, catalog number: D0632 )
Silica gel 60 F254 plates (e.g. EMD Millipore, catalog number: 1055540001 )
Appropriate E. coli protein expression strain (e.g. strain XJb(DE)) (Zymo Research, catalog number: T5051 )
FRETWorks S-tag assay kit (EMD Millipore, catalog number: 70724 )
TAPS buffer
1.6 mM oleanolic acid stock solution (see Recipes)
1.6 mM hederagenin stock solution (see Recipes)
Pre-master mix for 36 UGT73C11 enzyme assay reactions (see Recipes)
Pre-master mix for 37 UGT73C13 enzyme assay reactions (see Recipes)
Equipment
Vacuum centrifuge (e.g. Labogene, catalog number: 7.008.100.777 )
TLC Developing Chamber (e.g. VWR international, catalog number: 21432-739 )
Storage phosphor screens (e.g. GE healthcare, catalog number: 28-9564-74 )
Phosphorimager (e.g. Molecular Dynamics, model: STORM 840 )
Software
ImageQuant 5.0 (Molecular Dynamics) or similar
SigmaPlot 11.0 (Systat Software, Inc.) or similar
Procedure
Preparation of radiolabeled sapogenin-glucoside standards and TLC plates with reference dilution series
100 μl (6.623 nmol [74 kBq]) UDP-[14C]Glc were evaporated to dryness in a 1.5 ml microcentrifugation tube using a vacuum centrifuge. The same microcentrifugation tube was used to prepare 200 μl of a glucosylation reaction master mix that was used to generate the reference glucosides.
Final reaction conditions of the glucosylation reaction were adjusted to 25 mM TAPS pH 8.6, 1 mM DTT, 33.12 μM UDP-[14C]Glc (by dissolving the dried 6.623 nmol) and 467 μM non-radioactive UDP-Glc (additionally added).
Frozen (-80 °C) E. coli cells resuspended in 10 mM TAPS buffer pH 8.0 were lysed by thawing (see Notes) and insoluble cell debris were removed by centrifugation for 20 min at 20,000 x g, 4 °C.
The concentration of the recombinant UGTs in the E. coli lysate was determined by applying the FRETWorks S-tag assay kit according to manufacturer's instructions.
E. coli lysate containing recombinant UGT73C11 was added to the master mix to a final concentration of 200 ng/μl UGT73C11. 60 μl of this master mix were transferred to 0.5 ml microcentrifugation tubes.
Enzymatic reactions were started by adding 4 μl of a 1.6 mM aglycone stock solution. In our case the applied aglycones were the sapogenins oleanolic acid and hederagenin that had been solubilized in 100% DMSO (thus, final concentrations of the aglycone and DMSO in the enzymatic reaction were 100 μM and 6.25%, respectively).
Complete conversion of the supplied aglycones to their corresponding glucosides was achieved by incubating the reactions overnight (18 h) at 37 °C (shaking is not necessary for this step).
Conversion efficiency was evaluated by TLC analysis. For this purpose both sapogenin-glucosides and possibly remaining sapogenins were 4 times extracted with 50 μl ethyl acetate from a 20 μl aliquot of the complete reaction.
The merged ethyl acetate fractions were evaporated to dryness in a vacuum centrifuge.
The dried extracts were dissolved in 20 μl 96% ethanol and this solution stepwise (3.5 μl per step) spotted to a silica gel TLC plate. The TLC plate was pre-run for 1-2 min using methanol as mobile phase until the solvent front was approximately 1 cm above the loading line.
The methanol was left to evaporate in a fume hood and the dry plate subsequently developed using dichloromethane: methanol: water (80:19:1) as mobile phase. After evaporation of the mobile phase the developed plate was sprayed with 10% sulfuric acid in methanol and heated to 100 °C until sapogenin and sapogenin-glucosides became visible as reddish bands on the TLC plate.
The stained TLC plate was evaluated under visible as well as under long wave UV (366 nm) light.
To generate standard curves of the 14C-labled sapogenin-glucosides, sequential dilutions of the glucosidation reactions were made.
The highest chosen sapogenin-glucoside concentration for the standard curve was a 1:5 dilution of the overnight reaction with 62.5% ethanol, corresponding to a 20 μM sapogenin-glucoside concentration.
This dilution was 11 times sequentially diluted with 50% ethanol, thereby generating dilutions with sapogenin-glucoside concentrations of 10 μM, 5 μM, 2.5 μM, 1.25 μM, 0.625 μM, 0.313 μM, 0.156 μM, 0.078 μM, 0.039 μM, 0.020 μM and 0.010 μM.
20 μl of each dilution were in 5 μl steps loaded to a silica gel TLC plate, which corresponds to sapogenin-glucoside amounts per spot of 400 nmol, 200 nmol, 100 nmol, 50 nmol, 25 nmol, 12.5 nmol, 6.25 nmol, 3.13 nmol, 1.56 nmol, 0.78 nmol, 0.39 nmol and 0.20 nmol, respectively.
After evaporation of all solvents the TLC plates were pre-run for 1-2 min using methanol as mobile phase until the solvent front was approximately 1 cm above the loading line.
The methanol was left to evaporate in a fume hood, and the TLC plates were afterwards developed with dichloromethane: methanol: water (80:19:1) as mobile phase.
All solvents were left to evaporate and 1.5 μl, 1.0 μl and 0.5 μl of the original master mix of the glucosylation reaction (before addition of the sapogenins) were spotted on an unused side lane of the TLC plate. These spots would allow at a later point normalization of variation in the radioactivity between different reaction master mixes.
Notes:
Local regulations may require you to work with radioactive compounds in specialized areas. Please inform yourself about regulations and guidelines of working with radioactive compounds that apply at your workplace.
UDP-[14C]Glc was dried out prior to usage, since Perkin Elmer provides this reagent solubilized in 70% ethanol, which serves as a sugar acceptor substrate for the investigated UGTs itself.
Recombinant UGTs were in this case expressed in the BL21(DE) derivative XJb(DE). This strain expresses a viral endolysin protein and thus allows to be lysed by simply thawing after being frozen.
Quantification with the FRETWorks S-tag assay kit is based on regeneration of RNaseS activity due the interaction of the S protein (included in the kit) and the S-tag N-terminally fused to the recombinant expressed UGTs. See kit manual for additional information.
As references for the unmodified sapogenins were 2 nmol oleanolic acid and hederagenin loaded to the TLC plate that was used to determine the conversion efficiency.
Sapogenin/saponin-glucoside evaluation on sulfuric acid stained TLC plates under long wave UV light is approximately 10 times more sensitive than under visible light.
Figure 2. TLC plate with aliquots of the reactions to generate radiolabled (1) 3-O-[14C]glc-oleanolic acid (oa-glc) or (3) 3-O-[14C]glc-hederagenin (he-glc) standards. The TLC plate was evaluated under (A) visible (colored) as well as under (B) long wave UV light (366 nm, black/white). For comparison purpose were authentic (oa) oleanolic acid and (he) hederagenin (2 nmol each) loaded to lane (2).
Preparation of enzyme assays for the determination of enzyme kinetic parameters
In preparation of the UGT73C11 enzyme assays were 228 μl UDP-[14C]Glc (15.10 nmol [168.72 kBq]) evaporated to dryness in a 1.5 ml microcentrifugation tube using a vacuum centrifuge.
2.39 μl and 2.18 μl of a 1 mM UDP-Glc (non-radioactive) solution were evaporated to dryness in two additional 1.5 ml microcentrifugation tubes. Simultaneously, were for the UGT73C13 assays 86.4 μl UDP-[14C]Glc (5.72 nmol [63.94 kBq]), 1.99 μl 0.5 mM UDP-Glc (non-radioactive) and 1.59 μl 0.25 mM UDP-Glc (non-radioactive) dried out in 1.5 ml microcentrifugation tubes.
Of the acceptor substrates, oleanolic acid and hederagenin, were for the UGT73C11 assays stock solutions with concentrations of 128 μM, 96 μM, 64 μM, 32 μM, 16 μM, 8 μM, 4 μM and 2 μM in 100% DMSO prepared.
For the UGT73C13 assays were acceptor substrate stock solutions of 1,600 μM, 1,200 μM, 800 μM, 400 μM, 200 μM, 100 μM, 50 μM and 25 μM prepared.
Frozen (-80 °C) aliquots of E. coli cells resuspended in 10 mM TAPS buffer pH 8.0 were lysed by thawing (see Notes) and insoluble cell debris removed by centrifugation for 20 min at 20,000 x g, 4 °C.
The concentration of the recombinant UGTs in the E. coli lysate was determined by applying the FRETWorks S-tag assay kit according to manufacturer's instructions.
The E. coli lysates were diluted to either 5 ng/μl (UGT73C11) or 50 ng/μl (UGT73C13) recombinant protein with 10 mg/ml BSA in 10 mM TAPS buffer pH 8.0.
Enzyme assays for UGT73C11
Preparation of pre-master mix for 36 enzyme assay reactions as described in the recipe section.
427.4 μl of this pre-master mix were added to the microcentrifuge tube that contained the dried UDP-[14C]Glc to prepare a reaction master mix that would result with concentrations of the sugar donor substrate of 33.12 μM UDP-[14C]Glc (0.37 kBq/μl) and 467 μM non-radioactive UDP-Glc in the final enzyme assay.
96 μl of this master mix were transferred to the tube in which 2.39 μl 1 mM UDP-Glc had been dried out and mixed with 144 μl of the original pre-master mix. Enzyme assays set up with this master mix would have a sugar donor substrate concentration of 13.25 μM UDP-[14C]Glc (0.15 kBq/μl) and 487 μM non-radioactive UDP-Glc.
82 μl of the latter master mix were transferred to the tube in which 2.18 μl 1 mM UDP-Glc had been dried out, and mixed with 82 μl of the original pre-master mix. This last master mix is for preparing enzyme assays with a concentration of 6.62 μM UDP-[14C]Glc (0.08 kBq/μl) and 493 μM non-radioactive UDP-Glc.
18.75 μl aliquots of the master mixes were transferred to 1.5 ml microcentrifuge tubes on ice.
For performing the actual assays, tubes with master mix aliquots were pre-incubated for 3 min at 30 °C and the enzymatic reaction started by addition of 1.25 μl acceptor substrate stock solutions prepared in step B-3.
The master mix with the highest concentration of UDP-[14C]Glc (33.12 μM) was used to assay UGT73C11 with final sugar acceptor substrate concentrations of 1 μM, 0.5 μM, 0.25 μM and 0.125 μM, by adding 1.25 μl of the 16 μM, 8 μM, 4 μM and 2 μM oleanolic acid or hederagenin stock solutions.
Similarly was the 13.25 μM UDP-[14C]Glc master mix used for final concentrations of 4 and 2 μM oleanolic acid and hederagenin, and the 6.62 μM UDP-[14C]Glc master mix for final concentrations of 8 and 6 μM of the two acceptor substrates. The corresponding stock solutions in these cases were 64 μM, 32 μM, 128 μM and 96 μM.
After addition of the acceptor substrate, enzymatic reactions were allowed to take place by incubation for 3 min at 30 °C, and subsequently stopped by addition of 50 μl ethyl acetate and vigorous mixing for 10 sec.
Enzyme assays for UGT73C13 (in general similar to procedure C, however, enzyme and substrate concentrations differ, as UGT73C13 is less efficient in catalyzing the investigated reaction)
Preparation of pre-master mix for 37 enzyme assay reactions as described in the recipe section.
405 μl of the pre-master mix were transferred to the tube with the dried UDP-[14C]Glc to prepare a reaction master mix for enzyme assays with a final concentration of 13.25 μM UDP-[14C]Glc (0.15 kBq/μl) and 487 μM non-radioactive UDP-Glc.
150 μl of this master mix were mixed with 150 μl of the pre-master mix in the microcentrifugation tube in which 1.99 μl 0.5 mM UDP-Glc had been dried out. This master mix was applied for reactions with a final sugar donor substrate concentrations of 6.62 μM UDP-[14C]Glc (0.08 kBq/μl) and 493 μM non-radioactive UDP-Glc.
For a master mix for enzyme assays with a final UDP-[14C]Glc concentration of 3.31 μM (0.04 kBq/μl) and 497 μM non-radioactive UDP-Glc 120 μl of the previous master mix were diluted with 120 μl of the pre-master mix in the tube that contained the dried out 1.59 μl 0.25 mM UDP-Glc. The 13.25 μM UDP-[14C]Glc master mix was applied for assays with final oleanolic acid and hederagenin concentrations of 1.56 μM, 3.12 μM and 6.25 μM.
1.25 μl of the 25 μM, 50 μM and 100 μM sugar acceptor substrate stock solutions were added to 18.75 μl master mix to adjust these sugar acceptor substrate concentrations. Similarly, was the 6.62 μM UDP-[14C]Glc master mix used to assay final sugar acceptor substrate concentration of 12.5 μM and 25 μM (200 μM and 400 μM stock solutions), and the 3.31 μM UDP-[14C]Glc master mix for sugar acceptor substrate concentrations of 50 μM, 75 μM and 100 μM (800 μM, 1,200 μM and 1,600 μM stock solutions).
Analysis of the enzyme assays
Stopped assays were 4 times extracted with 50 μl ethyl acetate and the merged ethyl acetate extracts evaporated to dryness in a vacuum centrifuge.
The dried extracts were dissolved in 20 μl 96% ethanol and in 5 μl steps loaded to silica gel TLC plates.
Potential remainders of the radioactive sapogenin-glucosides were washed out with another 20 μl 96% ethanol and loaded to the same spots on the TLC plates.
The TLC plates were pre-run for 1-2 min using methanol as mobile phase until the solvent front was approximately 1 cm above the loading line.
The methanol was left for evaporation in a fume hood and the dried TLC plates were afterwards developed using dichloromethane: methanol: water (80:19:1) as mobile phase.
After evaporation of the mobile phase, 0.5 μl, 1.0 μl and 1.5 μl of the master mix with the highest UDP-[14C]Glc were spotted on an unused lane of the TLC plate. Additionally, were also 1 μl of the two remaining master mixes with the lower UDP-[14C]Glc spotted to each TLC plate.
The dried TLC plates were together with one of the prepared reference dilution series TLC plates of the same sapogenin-glucoside exposed for several days to a storage phosphor screen.
The exposed phosphor screens were scanned with a STORM 840 Phosphorimager and signal intensities in the digital scans quantified using ImageQuant 5.0.
To compensate for the 10-fold lower concentration of the radioactive sugar donor substrate as compared to the master mix used for generating the reference glucosides, were all sapogenin-glucoside intensities resulting from assays with a 3.31 μM UDP-[14C]Glc master mix prior to their further evaluation multiplied by factor 10. Similarly, were sapogenin-glucoside intensities resulting from 13.25 μM and 6.62 μM UDP-[14C]Glc master mixes multiplied by 2.5 and 5, respectively.
To further address unintended variation in the amounts of UDP-[14C]Glc in the master mixes used for generating the reference glucosides and the actual enzyme assays, all glucoside intensities of the assays were multiplied with the ratio between the intensities of the corresponding master mix spots on each TLC plate.
Km and Vmax values were calculated using SigmaPlot 11.0 to perform non-linear regression according to the Michaelis-Menten equation or the velocity equation for substrate inhibition (please refer to the SigmaPlot manual for an instruction how to perform regressions).
Notes:
Recombinant UGTs were in this case expressed in the BL21(DE) derivative XJb(DE). This strain expresses a viral endolysin protein and thus allows to be lysed by simply thawing after being frozen.
Upon lysis of the E. coli cells all lysates, lysate dilutions and master mixes were constantly kept on ice.
Quantification with the FRETWorks S-tag assay kit is based on regeneration of RNaseS activity due the interaction of the S protein (included in the kit) and the S-tag N-terminally fused to the recombinant expressed UGTs. See kit manual for additional information.
The E. coli lysates were diluted with a BSA solution instead of pure buffer, since the specific activity of the recombinant UGTs was seen to decrease upon reduction of total protein concentration.
The final amount of the investigated enzyme should be chosen based on its activity. If too much of the acceptor substrate is used up within the applied incubation time, the determined reaction velocity will not be in the initial linear range anymore.
The intention behind using master mixes with different ratios of radiolabeled to non-labeled UDP-Glc was to use as low amounts of the radiolabeled UDP-[14C]Glc as possible, while still ensuring sufficient signal strength for assays with the lowest acceptor substrate concentrations. The final total concentration of 500 μM UDP-Glc was kept throughout the experiment to provide saturating conditions of the sugar donor substrate.
The different pH in assays of UGT73C11 and UGT73C13 were chosen due to different pH optima of the two enzymes.
Which concentrations of the acceptor substrate are tested, depends on the investigated enzyme. For deciding optimal concentrations, it is helpful to estimate the Km value in pre-experiments and choose concentrations below and above the estimated Km value for the final experiment.
The optimal reaction time is dependent on the enzyme activity and the enzyme amount. Time course experiments have to be performed to determine if the reaction velocity is still in the initial linear range after the chosen incubation time. If too much of the acceptor substrate is converted at the lowest applied concentrations, resulting v/S-characteristics are typically sigmoid instead of hyperbolic.
Figure 3. Autoradiogram of TLC plates to determine kinetic parameters of UGT73C11 towards hederagenin. The TLC plates with the ethyl acetate extracts from the actual enzyme assays are on the top as well as on the bottom, whereas the co-exposed TLC plate with the [14C]Glc-hederagenin standard curve is located in the middle. The band representing 3-O-[14C]Glc-hederagenin is for each plate marked with an arrow and the label he-glc. The concentrations below the he-glc bands of the UGT73C11 enzyme assay extracts represent the hederagenin concentration in the corresponding enzyme assay, while I and II mark duplicates. Substance amounts below each standard curve lane represent the amount of [14C]Glc-hederagenin present in the corresponding lane. Master mix aliquots to account for variation in the amount of UDP-[14C]Glc in the master mix preparation (MM1, MM2, MM3) were spotted either right or left of lanes with the actual assays or standards.
Recipes
1.6 mM oleanolic acid stock solution
Dissolve 7.30 mg oleanolic acid in 10 ml DMSO
1.6 mM hederagenin stock solution
Dissolve 7.56 mg hederagenin in 10 ml DMSO
Pre-master mix for 36 UGT73C11 enzyme assay reactions
36 μl 500 mM TAPS buffer pH 8.6
3.6 μl 200 mM DTT
36 μl 9.34 mM UDP-Glc
72 μl 10 mg/ml BSA
72 μl 5 ng/μl UGT73C11 (diluted E. coli lysate)
455.4 μl water
Pre-master mix for 37 UGT73C13 enzyme assay reactions
37 μl 500 mM TAPS buffer pH 7.9
37 μl 200 mM DTT
37 μl 9.34 mM UDP-Glc
74 μl 10 mg/ml BSA
74 μl 50 ng/μl UGT73C13 (diluted E. coli lysate)
465.05 μl water
Acknowledgments
This protocol was adapted and modified from various, previous 14C-UDP-glucose-based UGT enzyme assay protocols commonly applied in the Section for Plant Biochemistry – Department for Plant Biochemistry Biotechnology – Faculty of Life Sciences – University of Copenhagen and preceding organizations. This work was supported by the Danish Council for Independent Research, Technology, and Production Sciences (grant nos. 09–065899/FTP and 274–06–0370), by the Villum Kann Rasmussen Foundation to Pro-Active Plants, and by a PhD stipend from the Faculty of Life Sciences, University of Copenhagen (to J.M.A.).
References
Augustin, J. M., Drok, S., Shinoda, T., Sanmiya, K., Nielsen, J. K., Khakimov, B., Olsen, C. E., Hansen, E. H., Kuzina, V., Ekstrom, C. T., Hauser, T. and Bak, S. (2012). UDP-glycosyltransferases from the UGT73C subfamily in Barbarea vulgaris catalyze sapogenin 3-O-glucosylation in saponin-mediated insect resistance. Plant Physiol 160(4): 1881-1895.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Augustin, J. M. and Bak, S. (2013). Determination of Enzyme Kinetic Parameters of UDP-glycosyltransferases. Bio-protocol 3(14): e825. DOI: 10.21769/BioProtoc.825.
Augustin, J. M., Drok, S., Shinoda, T., Sanmiya, K., Nielsen, J. K., Khakimov, B., Olsen, C. E., Hansen, E. H., Kuzina, V., Ekstrom, C. T., Hauser, T. and Bak, S. (2012). UDP-glycosyltransferases from the UGT73C subfamily in Barbarea vulgaris catalyze sapogenin 3-O-glucosylation in saponin-mediated insect resistance. Plant Physiol 160(4): 1881-1895.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein > Activity
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
A Semi-throughput Procedure for Assaying Plant NADP-malate Dehydrogenase Activity Using a Plate Reader
Kevin Baudry and Emmanuelle Issakidis-Bourguet
Aug 20, 2023 320 Views
An in vitro Assay to Probe the Formation of Biomolecular Condensates
Yu Zhang and Shen Lisha
Sep 5, 2023 1441 Views
Immunofluorescence for Detection of TOR Kinase Activity In Situ in Photosynthetic Organisms
Ana P. Lando [...] Giselle M. A. Martínez-Noël
Dec 20, 2024 312 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
826 | https://bio-protocol.org/en/bpdetail?id=826&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Reglucosylation of Barbarea vulgaris Sapogenins
Jörg M. Augustin
CO Carl Erik Olsen
SB Søren Bak
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.826 Views: 9827
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Dec 2012
Abstract
Plants produce a vast array of natural compounds. Many of them are not commercially available, and are thus lacking to be tested as substrates for enzymes. This protocol describes the extraction and acidic hydrolysis of metabolites from Barbarea vulgaris with special focus on saponins and their agylcones (sapogenins). It was developed to determine if some B. vulgaris UDP-glucosyltransferases (UGTs) that were shown to glucosylate commercially available sapogenins, would also accept additional sapogenins from this plant as substrate, which are yet chemically uncharacterized and/or commercially unavailable (Figure 1).
Figure 1. Glucosylation reaction catalyzed by UGT73C10-UGT73C13 from Barbarea vulgaris (Augustin et al., 2012). All four enzymes utilize uridine diphosphate glucose (UDP-glc) as glucosyl-moiety donor and different sapogenins such as the oleanane sapogenins oleanolic acid and hederagenin as glucosyl-moiety acceptor. Oleanolic acid and hederagenin both naturally occur in G-type B. vulgaris, where they are predominantly found in their 3-O-cellobiosylated form. Additional saponins from G-type B. vulgaris have been identified by Nielsen et al., 2010. However, the majority of saponins and sapogenins that occur in B. vulgaris remain unidentified.
Materials and Reagents
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
Polyvinylpolypyrrolidone (PVPP) (Sigma-Aldrich, catalog number: 77627 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: H1758 )
Tris(hydroxymethyl)aminomethane (Tris base) (Sigma-Aldrich, catalog number: T1503 )
Ethyl acetate (Sigmal-Aldrich, catalog number: 34972 )
N-Tris(hydroxymethyl)methyl-3-aminopropanesulfonic acid (TAPS) (Sigma-Aldrich, catalog number: T5130 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
Uridine-5’-diphosphoglucose (UDP-Glc) (Sigma-Aldrich, catalog number: S451649 )
Silica gel 60 F254 TLC plates (EMD Millipore, catalog number: 1055540001 )
Polyvinylidene difluoride (PVDF) filter plate (0.45 μm pore diameter) (EMD Millipore, catalog number: MAHVN4510 )
FRETWorks S-tag assay kit (EMD Millipore, catalog number: 70724 )
Equipment
Water bath
Centrifuge for 50 ml and 15 ml conical centrifugation tubes (VWR international, catalog number: 89004-368 )
Thermomixer (VWR international, catalog number: 21516-168 )
pH indicator paper (Whatman, catalog number: 2600-100A )
Vacuum centrifuge (Labogene, catalog number: 7.008.100.777 )
Thin layer chromatography (TLC) developing chamber (VWR international, catalog number: 21432-739 )
Aldrich flask-type sprayer (Sigma-Aldrich, catalog number: Z190373 )
Heat block (VWR international, catalog number: 12621-120 )
LC-MS analysis was carried out on an Agilent 1100 Series LC (Agilent Technologies), equipped with a Gemini NX column (Phenomenex), and coupled to a Bruker HCT-Ultra ion trap mass spectrometer (Bruker Daltonics)
Software
DataAnalysis 4.0 (Bruker Daltonics)
Procedure
Preparation of the crude metabolite extract
Freshly harvested Barbarea vulgaris leaves were weighed and transferred to 15 ml centrifugation tubes.
Following addition of 5 ml 55% ethanol per g fresh leaf material the leaves were boiled in a water bath for 10 min.
To increase the extraction efficiency, the tubes were occasionally shaken while boiling.
After heating the extracts were chilled on ice before they were centrifuged for 5 min (3,000 x g, room temperature) to precipitate insoluble leaf debris.
The supernatant was transferred to fresh centrifugation tubes and stored at -20 °C until further usage. A minimum incubation time of 4 h at -20 °C is recommended to cause further unwanted compounds to precipitate from the solution.
Newly emerged precipitates were removed by centrifugation (3,000 x g, 5 min, 4 °C).
Notes:
Usage of the protocol has been limited so far to rosette leaves of 1-3 month old Barbarea vulgaris plants with a typical weight of 1.5-2 g fresh weight.
Saponins can be extracted with this protocol from both fresh and ground plant material.
55% ethanol has been determined in pre-experiments to be hydrophobic enough to still extract B. vulgaris saponins, while being hydrophilic enough to lower the amount of some hydrophobic compounds that were previously seen to interfere with TLC analysis. However, it should be noted that these extracts still contains many more compounds than just saponins.
Acidic hydrolysis and purification:
2 x 1.25 ml of the crude saponin extract were transferred into 2 ml microcentrifuge tubes and mixed with 250 μl 6 M HCl to adjust the final HCl concentration to 1 M.
The acidified extracts were incubated for 24 h in a thermomixer adjusted to a temperature of 99 °C and shaking at 1,400 rpm.
After heating the extracts were chilled for approximately 1 h at -20 °C before they were combined in 50 ml centrifugation tubes.
Remaining precipitates in both microcentrifuge tubes were recovered by washing each tube three times with 250 μl 96% ethanol. The resulting ethanol solutions of these three wash steps were added to the hydrolysate in the 50 ml centrifugation tubes.
1 M Tris base solution was added to the hydrolysate until the pH shifted from acidic to basic conditions (here: 4.5 ml).
Subsequently, 13.55 ml water was added to lower the ethanol concentration to 14%. 1.125 g PVPP and 225 mg BSA were added to the solution to adjust their final concentrations to 5% (w/v) and 10 mg ml-1, respectively.
The mixture was six times extracted ethyl acetate using 5 ml ethyl acetate per extraction step.
Phase separation was achieved by centrifugation for 20 min at 5,200 x g. The ethyl acetate fraction will be the upper phase.
The combined ethyl acetate fractions were evaporated to dryness in a vacuum centrifuge.
Dried extracts were dissolved in 500 μl 96% ethanol and transferred to 15 ml centrifugation tubes. For a second round of purification 3,720 μl water, 480 μl 500 mM TAPS pH 9.1, 240 mg PVPP and 48 mg BSA were added in the given order and 5-fold ethyl acetate extraction performed with 2 ml ethyl acetate per extraction step.
After evaporation of the solvent of the combined ethyl acetate fractions in a vacuum centrifuge, the dried extracts were dissolved in 1 ml 96% ethanol.
Notes:
Brief spinning in a tabletop microcentrifuge was found sufficient during the washing steps to recover precipitates from the hydrolysate.
Due to a lack of investigations if sapogenins will remain solubilized in the chosen hydrolysation conditions or are among the observed precipitates both fractions combined were subjected to subsequent purification steps.
The pH of the hydrolysate was shifted to basic conditions by addition of Tris base prior extraction, since ethyl acetate extraction carries over low amounts of water/ions, which caused the initial hydrolysate extracts to be of slightly acidic pH. The UGTs investigated by us had a slightly basic pH optimum and a weakly basically buffered sapogenin extract was considered to have a lower effect on the pH of the final enzyme assay.
pH changes were monitored by spotting 1 μl of the hydrolysate to pH indicator paper.
The ethanol concentration of the hydrolysate had to be lowered prior ethyl acetate, extraction to enable formation of an organic phase upon addition of ethyl acetate.
Early ethyl acetate extracts of hydrolysated crude Barbarea vulgaris leaf extracts generated without the PVPP/BSA purification step were seen to completely inhibit the activity of the investigated UGTs. PVPP was used to adsorb phenolic compounds. BSA was added in the purification step, since in enzyme assays using the early hydrolysation extracts proteins were seen to become brownish by binding to compounds from the extract. The addition of BSA was intended to remove such protein binding compounds.
While drying down the ethyl acetate fractions in the vacuum centrifuge, new aqueous phases emerged, which were removed in the process.
Re-glucosylation assay:
In preparation of the re-glucosylation assays 500 μl of the hydrolysated and purified B. vulgaris leaf metabolite extracts were dried out in a vacuum centrifuge and subsequently dissolved in 78.13 μl dimethyl sulfoxide (DMSO).
Additionally, the recombinant expressed UGTs were directly quantified within E. coli lysates applying the FRETWorks S-tag assay kit.
Following quantification, UGT concentrations were adjusted to 50 ng μl-1 by diluting the E. coli lysates with 10 mg ml-1 BSA in 10 mM TAPS pH 8.0.
Enzymatic activity assays were performed in 1.5 ml microcentrifugation tubes in a final volume of 50 μl.
Reaction conditions were adjusted to 25 mM TAPS pH 8.6 (UGT73C9-C11), pH 7.9 (UGT73C12/C13) or pH 8.2 (combination of UGT73C9, UGT73C10 or UGT73C11 with UGT73C12 or UGT73C13), 1 mM DTT and 1 mM UDP-Glc. The final UGT amount per reaction was 750 ng.
Reactions were preincubated for 3 min at 30 °C and started by addition of 3.13 μl hydrolysated and purified B. vulgaris leaf metabolite extract in DMSO.
The assays were incubated for 30 (LC-MS only) or 120 (TLC and LC-MS) min at 30 °C, and stopped by addition of 325 μl ice cold methanol (LC-MS) or 50 μl ice cold ethyl acetate (TLC).
Notes:
The solvent of the hydrolysated extracts was exchanged from ethanol to DMSO prior to the re-glucosylation assays, as ethanol was found to act as substrate for the applied UGTs itself.
Quantification with the FRETWorks S-tag assay kit is based on regeneration of RNase S activity due the interaction of the S protein (included in the kit) and the S-tag N-terminally fused to the recombinant expressed UGTs.
The E. coli lysates were diluted with a BSA solution instead of pure buffer, since the recombinant UGTs were seen to lose specific activity upon reduction of the total protein concentration.
Whenever combinations of different UGTs were tested, the individual enzymes were applied in equimolar amounts.
Analysis by thin layer chromatography (TLC)
Stopped enzymatic reactions were three times extracted with ethyl acetate (50 μl, 185 μl and 50 μl):
Ethyl acetate was added to the enzymatic reaction and the sample thoroughly mixed for approximately 10-20 sec with a vortex shaker. (The ethyl acetate added to stop the reaction is at the same time also used for the first extraction step.)
The samples were centrifuged for 5 min (16,100 x g, room temperature) to achieve phase separation. The ethyl acetate fraction will be the upper phase.
The combined ethyl acetate fractions were evaporated to dryness in a vacuum centrifuge and the dried extracts dissolved in 20 μl 96% ethanol.
The re-dissolved extracts were stepwise, completely (3.5 μl per step) loaded to a silica gel TLC plate.
TLC plates were pre-run in 100% methanol until the solvent front was approximately 1 cm above the loading line.
The methanol was left to evaporate in a fume hood, and the TLC plates were subsequently developed using dichloromethane: methanol: water (80: 19: 1) as mobile phase.
Sapogenins and sapogenin-glucosides were visualized by spraying TLC plates with 10% sulfuric acid in methanol using a flask-type sprayer (or similar) and subsequent heating to 100 °C on a heat block (Figure 2).
Notes: The amount of developing solution needed depends on the size of the used TLC plate. The plate should be consistently and homogeneously wetted. However, spraying of too much developing solution may cause the bands to diffuse.
Figure 2. TLC plate with the (1) G-type B. vulgaris crude metabolite extract, the (2) corresponding acidic hydrolyzed metabolite extract and the (3)-(7) hydrolyzed metabolite extract treaded with different B. vulgaris UGTs. The TLC plate was evaluated under (A) visible (colored) as well as under (B) long wave UV (366 nm, black/white). The applied UGTs for the reglucosylation assays were (3) UGT73C9, (4) UGT73C10, (5) UGT73C11, (6) UGT73C12, (7) UGT73C13. For comparison purpose were authentic (oa) oleanolic acid, (he) hederagenin, (oa-glc) 3-O-glc oleanolic acid, (he-glc) 3-O-glc-hederagenin loaded to the (ref) reference lane (2 nmol each). Additionally are (oa-cell) oleanolic acid cellobioside and (he-cell) hederagenin cellobioside, the naturally in G-type B. vulgaris occurring di-glucosidic forms of these two sapogenins, marked in the crude metabolite extract. The accordingly estimated migration rate of (agly) aglycones, (m-glc) mono-glucosides and (di-glc) di-glucosides are shown on the right of Figure 2B.
Analysis by liquid chromatography-mass spectrometry (LC-MS)
Stopped enzymatic reactions were centrifuged for 5 min (16,100 x g, room temperature) to precipitate proteins.
Supernatants were transferred to fresh 1.5 ml microcentrifugation tubes and evaporated to dryness in a vacuum centrifuge.
Dried extracts were dissolved in 30 μl methanol and the solvent subsequently diluted to a final concentration of 50% methanol by addition of 30 μl water.
The methanol extracts were filtered (PVDF, 0.45 μm pore diameter) and transferred to 1.5 ml glass sample vials for LC-MS analysis.
LC-MS analysis was carried out on an Agilent 1100 Series LC, equipped with a Gemini NX column (35 °C) (2.0 x 150 mm, 3.5 μm), and coupled to a Bruker HCT-Ultra ion trap mass spectrometer.
Mobile phases in the LC were water with 0.1% (v/v) formic acid (eluent A) and acetonitrile with 0.1% (v/v) formic acid (eluent B). The gradient program was as follows: 0 to 1 min, isocratic 12% B; 1 to 33 min, linear gradient 12 to 80% B; 33 to 35 min, linear gradient 80 to 99% B; 35 to 38 min isocratic 99% B; 38 to 45 min isocratic 12% B at a constant flow rate of 0.2 ml min-1.
The MS detector was operated in negative electrospray mode, and MS2 ( = MS/MS) and MS3 (=MS/MS of MS2 fragments) fragmentations were performed to obtain additional structural information of the detected ions.
Run files were analyzed with DataAnalysis 4.0, a software to display the LC chromatograms and the corresponding MS spectrums. Please refer to Augustin et al., 2012 (and Online Supplemental Data) to see the LC chromatograms of crude metabolite extracts from G- and P-type B. vulgaris, the acidic hydrolyzed metabolite extracts from both plants as well as chromatograms of the corresponding reglucosylation assays with different B. vulgaris UGTs.
References
Augustin, J. M., Drok, S., Shinoda, T., Sanmiya, K., Nielsen, J. K., Khakimov, B., Olsen, C. E., Hansen, E. H., Kuzina, V., Ekstrom, C. T., Hauser, T. and Bak, S. (2012). UDP-glycosyltransferases from the UGT73C subfamily in Barbarea vulgaris catalyze sapogenin 3-O-glucosylation in saponin-mediated insect resistance. Plant Physiol 160(4): 1881-1895.
Nielsen, N. J., Nielsen, J. and Staerk, D. (2010). New resistance-correlated saponins from the insect-resistant crucifer Barbarea vulgaris. J Agric Food Chem 58(9): 5509-5514.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Plant Science > Plant biochemistry > Other compound
Biochemistry > Other compound > Saponin
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
MAMP-triggered Medium Alkalinization of Plant Cell Cultures
Gabriel L. Fiorin [...] Paulo J.P.L. Teixeira
Apr 20, 2020 3496 Views
A Quick Method to Quantify Iron in Arabidopsis Seedlings
Chandan Kumar Gautam [...] Wolfgang Schmidt
Mar 5, 2022 2601 Views
Isolation of Intact Vacuoles from Arabidopsis Root Protoplasts and Elemental Analysis
Chuanfeng Ju [...] Zhenqian Zhang
Mar 5, 2023 717 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
827 | https://bio-protocol.org/en/bpdetail?id=827&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
High-throughput β-galactosidase and β-glucuronidase Assays Using Fluorogenic Substrates
Joshua P. Ramsay
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.827 Views: 14866
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Molecular Microbiology Jan 2013
Abstract
β-galactosidase and β-glucuronidase enzymes are commonly used as reporters for gene expression from gene promoter-lacZ or uidA fusions (respectively). The protocol described here is a high-throughput alternative to the commonly used Miller assay (Miller, 1972) that utilises a fluorogenic substrate (Fiksdal et al., 1994) and 96-well plate format. The fluorogenic substrates 4-Methylumbelliferyl β-D-galactoside (for β-galactosidase assays) (Ramsay et al., 2013) or 4-Methylumbelliferyl β-D-glucuronide (for β-glucuronidase assays) (Ramsay et al., 2011) are cleaved to produce the fluorescent product 4-methylumbelliferone. Cells are permeabilized by freeze-thawing and lysozyme, and the production of 4-methylumbelliferone is monitored continuously by a fluorescence microplate reader as a kinetic assay. The rate of increase in fluorescence is then calculated, from which relative gene-expression levels are extrapolated. Due to the high sensitivity fluorescence-based detection of 4-methylumbelliferone and the high density of time points collected, this assay may offer increased accuracy in the quantification of low-level gene expression. The assay requires small sample volumes and minimal preparation time. The permeabilisation conditions outlined in this protocol have been optimised for Gram-negative bacteria (specifically Escherichia coli and Serratia), but is likely suitable for other organisms with minimal optimisation.
Keywords: LacZ UidA Galactosidase Glucuronidase Miller assay
Materials and Reagents
Bacteria cell culture
4-Methylumbelliferyl β-D-galactoside (Life Technologies, catalog number: M-1489MP ) (for β-galactosidase assays)
4-Methylumbelliferyl β-D-glucuronide (Life Technologies, catalog number: M-1490 ) (for β-glucuronidase assays)
Phosphate-Buffered Saline Tablets (Life Technologies, InvitrogenTM, catalog number: 00-3002 )
Lysozyme from chicken egg white (Sigma-Aldrich, catalog number: L7651 )
200x stock solution for 4-Methylumbelliferyl β-D-galactoside or 4-Methylumbelliferyl β-D-glucuronide (see Recipes)
Final working reagent of 4-Methylumbelliferyl β-D-galactoside or 4-Methylumbelliferyl β-D-glucuronide (see Recipes)
Equipment
Fluorescence microplate reader, for example: Gemini XPS Fluorescence Microplate Reader (Molecular Devices) or Infinite 200 PRO (Tecan Group Ltd.)
96-Well microplates (Thermo Fisher Scientific, catalog number: 269787 )
Flat-bottomed clear 96-well microplates (low autofluorescence and/or absorbance at 365 and 445 nm is preferable)
Multi-channel pipette(s) (12 or 8 channel) capable of dispensing 10 μl and 100 μl
Ultra-low temperature freezer (-70 °C)
Procedure
Record the OD600 of the samples to be assayed. It is recommended that the OD600 of the samples to be analysed are in the 0.1-1 OD600 range. Dilute the samples in growth media to give an OD600 in the 0.1-1 range. Depending on the range of gene expression levels observed, the dilution factor may need to be optimised by analysing multiple dilutions.
Collect 100 μl of the diluted samples (0.1-1 OD600 range) to be assayed and freeze at -70 °C in a 96-well microplate (the "master plate"). Once all samples are collected, return plate to the -70 °C and leave to freeze overnight.
For example: For a time-course experiment in E. coli, 100 μl samples could be collected every hour for 12 h in a single microplate, returning the microplate to the -70 °C after collecting each sample. This microplate now acts as the "master plate", from which replicate assays can be carried out at a later date if desired. Negative media-only controls can also be added to the master plate in free wells.
After all samples are collected (make sure all samples have been fully frozen at -70 °C), defrost the master plate in the 37 °C incubator with the lid off (to avoid cross-contamination via condensation).
When the master plate has fully defrosted, aliquot 10 μl from each well into a new microplate (the "assay plate") using a multichannel pipette and place the assay plate in the -70 °C for at least 15 min.
Pre-warm the microplate reader to 37 °C prior to carrying out the assay and initialise the microplate reader software so it is ready to go (see Notes about microplate reader settings for example settings).
Prepare the final working reagent.
Note: Prepare immediately prior to use and avoid prolonged exposure to light (i.e. Use the same day). Make enough for 100 μl per reaction.
Defrost the assay plate in the 37 °C incubator with the lid off (to avoid cross-contamination via condensation) for at least 10 min and/or until any visible ice crystals have dissolved in all wells.
Place yourself within close distance of the microplate reader. Dispense 100 μl of working reagent into each well of the 96-well microplate (or just wells containing samples) using a multichannel pipette. Try to minimize the time between dispensing reagent to each well. Immediately place the microplate in the plate reader with the lid off and start the program. Samples containing large amounts of β-galactosidase and β-glucuronidase can saturate the assay within the first 10 min, therefore it is important to capture reads quickly after the addition of substrate.
Note: For highly expressing samples that saturate the detector early, data is still recoverable. However as there are likely to be fewer timepoints with a linear increase in fluorescence the rate estimation may be less accurate. Sample dilution will improve accurate measurement of these samples.
Extract the rate of increase in fluorescence from the reads using the microplate software or export to excel (see Figure 1):
Plot the relative fluorescence intensity (the machine carries out internal fluorescence normalisation, hence it is "relative" fluorescence intensity) over time (per second is usually convenient). Choose a linear portion of the graph with the steepest slope (Vmax) from which to extrapolate the rate (in excel, the equation = SLOPE() can be used). This will provide relative fluorescence units per second (RFU/sec). Some platereader software will calculate Vmax automatically and in real time during the assay. If the graph is curved or very noisy, you may have problems with cell permeabilization or the fluorescence detector gain settings, respectively (see Troubleshooting below).
Optional: Subtract the average RFU/sec of negative control wells (media-only with final working reagent) from all samples (in practice this value is usually zero or very small and so this step is usually not necessary).
Normalise to optical cell density (OD600) recorded in step 1. This will give you units of RFU/sec/OD600.
Values can be normalized to account for sample volume used (i.e. Divided by 0.01 ml to give values as RFU/sec/ml/OD600), however this normalization is somewhat arbitrary if the same volumes (10 μl) are always used. Alternatively, standard curves with known concentrations of purified β-galactosidase or β-glucuronidase can be used to estimate actual units of enzyme concentration.
Figure 1. Plot of raw relative fluorescence units over time. Biological triplicate samples were analysed by the β-galactosidase assay over a 30-min period, as described above. Mean slope and standard deviation for the three replicates are indicated next to each group. The highly-expressed samples saturate the detector after 600 sec. Statistically significant low-level expression is also detected from the lowly-expressed sample compared to the negative media-only (with final reagent mix) control. Final values for publication/presentation are normalised to OD600.
Notes about microplate reader settings
Universal settings:
Temperature
37 °C
Excitation wavelength
360-365 nm
Emmission wavelength
445-460 nm
Total assay time
10-30 min depending on expression level
Additional settings may be optional on some machines, however shaking between each read is recommended if avaliable.
Specific machine settings:
Gemini XPS Fluorescence Microplate Reader
Temperature:
37 °C
Autoshake:
on
Read type:
kinetic read of 30 min, read intervals 1 min
Excitation:
360 nm
Emission:
450 nm
cut-off:
435 nm
Reads:
8 reads/well
PMT:
High
Calibrate:
On
Infinite 200 PRO
Select full plate read
Nuclon flat-bottom transparent
lid mode
off
Temperature
37 °C
Number of cycles
30
Kinetic time interval
1 min
Shaking duration
5 sec
Shaking amplitude
1 mm
Shaking mode
Linear
Excitation
360 nm
Emission
460 nm
Plate read mode
Top
Gain
Manual Gain mode
Gain
85
Lagtime
0
Integration time
20
Multiple reads per well
No
Troubleshooting
Excitation/emission
4-methylumbelliferone has an excitation peak at 365 nm and emission peak at 448 nm. However the peak absorption and emission spectra observed on your particular machine and the settings available to you may vary slightly. Additionally, autofluorescence and/or absorbance from the media and/or microplate may require you to select wavelengths outside the peaks. It is best to optimize for your setup by carrying out an emission/excitation wavelength scan with a positive control, such as a sample with known β-galactosidase or β-glucuronidase activity. In our experience, LB, TY and minimal medium and Nunc MicroWell Flat-bottomed 96-Well Microplates do not generate any problems with autofluorescence. It is possible that a particular organism may generate products that fluoresce in this assay. Excitation/emission wavelength scans of samples containing appropriate negative control strains (lacking lacZ or uidA) may reveal if this is the case.
Cell permeabilization
In our hands this assay is very sensitive to the degree of cell permeabilization. In this protocol, optimized for Gram-negative bacteria, efficient cell permeabilization is achieved by freeze-thawing the samples twice between -70 and 37 °C and through the addition of high concentrations of lysozyme in the assay buffer. If cells are not completely permeabilized or become increasingly permeabilized throughout the assay, the RFU/sec plot will appear curved rather than linear. You may need to optimise the protocol to allow efficient permeabilization of your samples.
Microplate reader gain
Some microplate readers automatically adjust the detector gain over the entire plate or for each individual well. This can increase the dynamic range of the reader, as ideally both very lowly and very highly fluorescent samples can be analysed in the same plate. However for some microplate readers, the gain may need to be set manually. If fluorescence is not detected at all then the gain is likely too low. If the gain is too high, samples will saturate the detector almost immediately after the assay begins. To determine the optimal gain for your assay and machine, take samples from your most highly expressed samples and your most lowly expressed samples and carry out trial assays, adjusting the gain with each iteration. Choose a level at which lowly expressed samples have a detectible increase and the highest expressed sample doesn't saturate the detector before 10 min.
Recipes
200x stock solution for 4-Methylumbelliferyl β-D-galactoside or
4-Methylumbelliferyl β-D-glucuronide Dissolve 4-Methylumbelliferyl β-D-galactoside or 4-Methylumbelliferyl β-D-glucuronide in DMSO at 50 mg ml-1.
Store in small aliquots away from light at -70 °C. Avoid repeated freeze-thawing.
Final working reagent of 4-Methylumbelliferyl β-D-galactoside or 4-Methylumbelliferyl β-D-glucuronide
Dilute 200x stock to 1x in PBS buffer containing 2 mg ml-1 lysozyme
References
Fiksdal, L., Pommepuy, M., Caprais, M.-P. and Midttun, I. (1994). Monitoring of fecal pollution in coastal waters by use of rapid enzymatic techniques. Appl Environ Microbiol 60(5): 1581-1584.
Miller, J. H. (1972). Experiments in molecular genetics, Cold Spring Harbor Laboratory Cold Spring Harbor, New York. p. 352-355.
Ramsay, J. P., Major, A. S., Komarovsky, V. M., Sullivan, J. T., Dy, R. L., Hynes, M. F., Salmond, G. P. and Ronson, C. W. (2013). A widely conserved molecular switch controls quorum sensing and symbiosis island transfer in Mesorhizobium loti through expression of a novel antiactivator. Mol Microbiol 87(1): 1-13.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial cell biology > Cell-based analysis
Molecular Biology > DNA > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
In vivo Analysis of Cyclic di-GMP Cyclase and Phosphodiesterase Activity in Escherichia coli Using a Vc2 Riboswitch-based Assay
Ying Liu [...] Ute Römling
Mar 5, 2018 6685 Views
Real-Time Analysis of Mitochondrial Electron Transport Chain Function in Toxoplasma gondii Parasites Using a Seahorse XFe96 Extracellular Flux Analyzer
Jenni A. Hayward [...] Giel G. van Dooren
Jan 5, 2022 2178 Views
Analysis of Plasmodium falciparum Mitochondrial Electron Transport Chain Activity Using Seahorse XFe96 Extracellular Flux Assays
SaiShyam Ramesh [...] Alexander G. Maier
Nov 5, 2023 501 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
828 | https://bio-protocol.org/en/bpdetail?id=828&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Quantification of Cyclic Di-GMP from Pseudomonas aeruginosa
Ankita Basu Roy
Olga E. Petrova
Karin Sauer
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.828 Views: 14203
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Bacteriology Jun 2012
Abstract
Cyclic di-GMP (c-di-GMP) has emerged as an important intracellular signaling molecule, controlling the transitions between planktonic (free-living) and sessile lifestyles, biofilm formation, and virulence in a wide variety of microorganisms. The following protocol describes the extraction and quantification of c-di-GMP from Pseudomonas aeruginosa samples. We have made every effort to keep the protocol as general as possible to enable the procedure to be applicable for the analysis of c-di-GMP levels in various bacterial species. However, some modifications may be required for the analysis of c-di-GMP levels in other bacterial species.
Keywords: HPLC Biofilm Standard curve Calibration
Materials and Reagents
Bacterial culture
Ethanol (95-100%)
Tris base
EDTA
NaCl
KCl
Na2HPO4.7H2O
KH2PO4 (pH 7.2)
0.5 M Ethylenediaminetetraacetic acid (EDTA) disodium salt solution (pH 8.0)
Bis-(3'-5')-cyclic diguanylic monophosphate (c-di-GMP) (Biolog)
Ammonium acetate (MS grade)
Methanol (HPLC grade)
Nanopure water (18 Ohm)
Protein determination reagents
Phosphate-buffered saline (PBS) (see Recipes)
HPLC Solvent A (see Recipes)
HPLC Solvent B (see Recipes)
TE buffer (see Recipes)
Equipment
Syringes (1 ml)
Syringe filters (2 μm) (Upchurch Scientific, catalog number: B-100 )
Microfuge tubes (unpolished, to reduce static)
Spectrophotometer
Refrigerated microcentrifuge
Vacuum concentrator/Centrifugal evaporator (e.g. SpeedVac)
Reverse-phase C18 Targa column (2.1 x 40 mm, 5 μm) (The Nest Group, catalog number: TR-0421-C185 )
Heat block or water bath
High performance liquid chromatography (HPLC) system and software for HPLC peak analysis (e.g. Agilent 1100 HPLC)
Sonicator
Homogenizer
Software
ChemStation for LC (Agilent Technologies)
Procedure
Extraction of c-di-GMP
Grow bacterial cells to desired growth stage under required experimental conditions. Proceed directly with the extraction, with no waiting periods or incubation of cells on ice, as this may drastically alter the c-di-GMP levels.
Note: Extraction at mid-exponential phase is recommended, as using early exponential phase cells will yield c-di-GMP levels too low for accurate detection. To extract c-di-GMP from planktonic cells, allow P. aeruginosa to grow in either Lennox broth or Vogel-Bonner minimal medium (VBMM) for 6 h to mid-exponential phase in flasks at 37 °C and 220 rpm. Inoculate using a 5% inoculum size of an overnight culture. Biofilm c-di-GMP levels can be determined from biofilms grown for 3-5 days under flowing conditions; see References 2-4 for more detail.
Determine the optical density of the bacterial culture at 600 nm (OD600).
Note: If working with biofilm samples, include a step to homogenize (10 sec on high) the cultures to disrupt cell aggregates prior to OD600 determination.
Obtain a bacterial culture volume equivalent to 1 ml of OD600 = 1.8 (e.g. If the OD600 = 0.9, spin down 2 ml of culture).
Note: This biomass has been optimized for the analysis of c-di-GMP in P. aeruginosa strains PAO1 and PA14 planktonic and biofilm samples. Analysis of c-di-GMP levels in other strains or species may require the initial biomass harvested for extraction to be adjusted.
Centrifuge (16,000 x g, 2 min, 4 °C) the respective culture volume. Discard the supernatant.
Wash the cell pellet with 1 ml ice-cold PBS (16,000 x g, 2 min, 4 °C). Discard the supernatant.
Repeat step A-5.
Resuspend the cell pellet in 100 μl ice-cold PBS and incubate at 100 °C for 5 min.
Add ice-cold ethanol (stored at -20 °C until use) to a final concentration of 65% (186 μl of 100% ethanol or 217 μl of 95% ethanol) and vortex for 15 sec.
Centrifuge sample (16,000 x g, 2 min, 4 °C), and remove and retain the supernatant containing extracted c-di-GMP in a new microfuge tube. Store the supernatant on ice or at -80 °C until step A-10. Retain the cell pellet.
Using the cell pellet, repeat twice the extraction procedure in steps A-7~A-9. Pool the supernatants obtained from the three extractions into one microfuge tube. Retain the cell pellet after the final extraction step. The cell pellet can be stored at -20 °C until step B-3-a.
Dry the combined supernatants using a vacuum concentrator/centrifugal evaporator. Following evaporation, a white pellet should be visible. This sample, containing the extracted c-di-GMP, can be stored at -80 °C until step B-2-a.
Quantification of c-di-GMP
This procedure has been optimized for the detection of c-di-GMP using an Agilent 1100 HPLC equipped with an autosampler, degasser, pressure regulator, prefilter, and UV/Vis detector set to 253 nm. Separation was carried out using a reverse-phase C18 Targa column (2.1 x 40 mm; 5 μm) and a flow rate of 0.2 ml/min. Solvents containing methanol and ammonium acetate (see Recipes for solvents A and B) were used. The following gradient was used to elute c-di-GMP: 0 to 9 min, 1% B ( = 1% solvent B and 99% solvent A); 9 to 14 min, 15% B; 14 to 19 min, 25% B; 19 to 26 min, 90% B; 26 to 40 min, 1% B. This gradient resulted in the elution of c-di-GMP at approximately 14-15 min.
Note: Analysis of c-di-GMP levels using a different reverse-phase column, flow rate, or HPLC system may require the optimization of HPLC separation gradients.
Generation of a standard curve
Using commercially available c-di-GMP, prepare the following standards in nanopure water: 1, 2, 5, 10 and 20 pmo/μl.
To generate the standard curve, inject 20 μl per standard per HPLC run. Use 20 μl of nanopure water as a negative control (0 pmol μl-1 c-di-GMP). For an example of c-di-GMP detection (Figure 1).
Figure 1. Example of c-di-GMP standard elution profile. 20 μl of a 10 pmo/μl c-di-GMP standard (200 pmol total) were separated using a reverse-phase C18 Targa column (2.1 x 40 mm; 5 μm) at a flow rate of 0.2 ml/min with the following gradient: 0 to 9 min, 1% B; 9 to 14 min, 15% B; 14 to 19 min, 25% B; 19 to 26 min, 90% B; 26 to 40 min, 1% B. Peak at 15 min corresponds to the elution of c-di-GMP. The c-di-GMP peak was found to have an area of 935.7.
Prepare a standard curve by plotting the c-di-GMP amount in pmol (e.g. 200 pmol for the 20 μl of the 10 pmol/μl standard) vs the peak areas. An example of a standard curve is given in Figure 2. Peak areas can be determined using various programs, including ChemStation for LC, which was used here.
Figure 2. Example of a c-di-GMP HPLC standard curve. The standard curve was generated by plotting the peak areas obtained following the separation of 20 μl aliquots of c-di-GMP standards (here: 0, 1, 2, 5, and 10 pmo/μl) versus the total c-di-GMP amounts in pmol. Peak areas were obtained using the ChemStation for LC software.
Analysis of samples
Resuspend the dried extracts from step A-11 in 200 μl nanopure water and vortex for 1 min.
Centrifuge the solution at max speed (≥ 16,000 x g) to remove insoluble material.
Using a 2 μm HPLC syringe filter attached to a 1 ml syringe, filter the sample supernatants into a new microfuge tube.
Note: Small sample volume loss may occur, but will not interfere with downstream application, as only a limited sample volume (20 μl) is subjected to HPLC analysis.
Analyze 20 μl per sample using the HPLC program used for the standards above. Repeat using biological replicates.
Note: This procedure has been optimized for P. aeruginosa PAO1 and PA14. Analysis of c-di-GMP levels in other strains or species may require the adjustment of sample volumes.
Determine the peak area for each sample and determine the c-di-GMP amounts using the standard curve established with the commercially available c-di-GMP in step B-1-c.
Calculations
To normalize the c-di-GMP levels, total cellular protein levels from the extraction procedure must be determined.
Resuspend the cell pellet from step A-10 in 500 μl TE buffer.
Sonicate the suspension for a total of 1 min using 10 sec bursts at 5 W followed by 15 sec off. Sonication should be carried out on ice.
Determine the protein concentrations using a protein determination assay.
Normalize the c-di-GMP levels to total cellular protein levels (i.e. pmol/mg) using the following calculations:
Total c-di-GMP in pmol
= (pmol c-di-GMP) x 10
A factor of 10 is used here, as only 1/10th of the c-di-GMP extract (20 μl out of 200 μl) was used for HPLC analysis
Total protein in mg
= (mg/ml protein) * 0.5 ml
→Normalized c-di-GMP (pmol/mg)
= Total c-di-GMP/Total protein
Recipes
PBS
137 mM NaCl
2.7 mM KCl
4.3 mM Na2HPO4·7H2O
1.4 mM KH2PO4 (pH 7.2)
HPLC Solvent A
10 mM ammonium acetate in water
Do not adjust pH
HPLC Solvent B
10 mM ammonium acetate in methanol
Dissolve ammonium acetate salt in methanol
Do not adjust pH
TE buffer
10 mM Tris-HCl (pH 8.0)
1 mM EDTA
Acknowledgments
The c-di-GMP extraction procedure using heat and ethanol is based on previously published protocols (Amikam et al., 1995; Simm et al., 2004). The HPLC-based method for the detection and quantitation of c-di-GMP is a modification of protocols published by Thormann and Spormann (Thormann et al., 2006) and Ueda and Wood (2009). This work was supported by a grant from NIH (1RO1 A107525701A2).
References
Amikam, D., Steinberger, O., Shkolnik, T. and Ben-Ishai, Z. (1995). The novel cyclic dinucleotide 3'-5' cyclic diguanylic acid binds to p21ras and enhances DNA synthesis but not cell replication in the Molt 4 cell line. Biochem J 311 ( Pt 3): 921-927
Morgan, R., Kohn, S., Hwang, S. H., Hassett, D. J. and Sauer, K. (2006). BdlA, a chemotaxis regulator essential for biofilm dispersion in Pseudomonas aeruginosa. J Bacteriol 188(21): 7335-7343
Petrova, O. E., Schurr, J. R., Schurr, M. J. and Sauer, K. (2012). Microcolony formation by the opportunistic pathogen Pseudomonas aeruginosa requires pyruvate and pyruvate fermentation. Mol Microbiol 86(4): 819-835.
Simm, R., Morr, M., Kader, A., Nimtz, M. and Romling, U. (2004). GGDEF and EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility. Mol Microbiol 53(4): 1123-1134.
Thormann, K. M., Duttler, S., Saville, R. M., Hyodo, M., Shukla, S., Hayakawa, Y. and Spormann, A. M. (2006). Control of formation and cellular detachment from Shewanella oneidensis MR-1 biofilms by cyclic di-GMP. J Bacteriol 188(7): 2681-2691.
Ueda, A. and Wood, T. K. (2009). Connecting quorum sensing, c-di-GMP, pel polysaccharide, and biofilm formation in Pseudomonas aeruginosa through tyrosine phosphatase TpbA (PA3885). PLoS Pathog 5(6): e1000483.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Microbiology > Microbial biochemistry > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
β-lactamase (Bla) Reporter-based System to Study Flagellar Type 3 Secretion in Salmonella
Fabienne F. V. Chevance and Kelly T. Hughes
Jun 20, 2023 496 Views
Determination of Poly(3-hydroxybutyrate) Content in Cyanobacterium Synechocystis sp. PCC 6803 Using Acid Hydrolysis Followed by High-performance Liquid Chromatography
Janine Kaewbai-ngam [...] Tanakarn Monshupanee
Aug 20, 2023 575 Views
An HPLC-based Assay to Study the Activity of Cyclic Diadenosine Monophosphate (C-di-AMP) Synthase DisA from Mycobacterium smegmatis
Avisek Mahapa [...] Dipankar Chatterji
Dec 20, 2024 272 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
829 | https://bio-protocol.org/en/bpdetail?id=829&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analyzing Inhibitory Effects of Reagents on Mycoplasma Gliding and Adhesion
Taishi Kasai
Makoto Miyata
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.829 Views: 11379
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Journal of Bacteriology Feb 2013
Abstract
Dozens of Mycoplasma species bind to solid surfaces and glide in the direction of the membrane protrusion at a pole. In gliding, Mycoplasma legs catch, pull and release sialylated oligosaccharides fixed on a solid surface. The analyses of inhibitory effects of sialylated compounds on gliding of Mycoplasma can determine the target structure of Mycoplasma for gliding and adhesion.
Keywords: Sialylated oligosaccharide Adhesion Mycoplasma Optical microscopy Gliding
Materials and Reagents
M. mobile 163K strain
M. pneumoniae M129 strain
Horse serum (Life Technologies, catalog number: 16050-122 )
Interested reagents (for example, 0.05-1 mM 3’-sialyllactose, Dextra Laboratories, catalog number: SL302 )
Heart infusion broth (Becton, Dickinson and Company, catalog number: 238400 )
Yeast extract (Becton, Dickinson and Company, catalog number: 212750 )
Amphotericin B (Sigma-Aldrich, catalog number: A2942 )
Ampicillin (Nacalai Tesque, catalog number: 02739-32 )
NaCl
Sodium phosphate (pH 7.3)
Glucose
Aluotto medium (see Recipes)
PBS-G buffer (see Recipes)
Equipment
Test tubes
Tissue culture flask
Scraper (Greiner Bio-One GmbH, catalog number: 541070 )
0.45-μm-pore size filter (Millipore, catalog number: SLHVX13NK ) (PolyVinylidene DiFluoride, or equivalent)
25 °C incubator (Yamato, model: IL62 )
37 °C incubator (Yamato, model: IS62 )
Centrifuges (Sigma Zentrifugen, model: SIGMA 1-14 )
Optical microscope (OLYMPUS, model: BX51 )
Stage heater (for M. pneumoniae) (Minitube, model: HT200 )
Lens heater (for M. pneumoniae) (Tokai Hit, model: MATS-LH )
Software
ImageJ
Procedure
M. mobile
Cultivate M. mobile cells in a growth medium (Aluotto medium) at 25 °C incubator to mid log phase.
Collect the cells in mid log phase at 0.03-0.08 of OD600, by centrifugation at 13,000 x g for 4 min at RT and suspend them in the Aluotto medium to be OD600 = 1.0.
Wash the cells three times by centrifugation followed by suspension, and resuspend the cells with PBS-G buffer by the same volume with the Aluotto medium used in A-2.
Prepare a tunnel chamber (5 mm interior width, 18 mm length, 60 μm wall thickness) composed of a coverslip, a glass slide, and double-sided tapes (see Figure 1).
Figure 1. Tunnel chamber
Figure 2. Appearance of Mycoplasma cells (Bar 10 mm)
Insert 10-50 μl of the cell suspension into the tunnel chamber to fill the tunnel.
Observe the cells bound to the coverslip with microscope with a 100x phase-contrast objective lens with video recording (see Figure 2 left).
Replace the PBS-G buffer with the buffer containing the interested reagents (i.e. sialylated compounds, monoclonal antibody, etc.). Put the buffer on one side of tunnel and suck the buffer from the other side using a filter paper.
Count the number of bound cells by a command “analyze > analyze particles” of ImageJ, an image analyzing software. Unbound cells are in Brownian motion and cannot be counted by this Image J command, owing to the insufficient image density.
M. pneumoniae
Cultivate M. pneumoniae cells in Aluotto medium at 37 °C incubator to mid log phase. The density of cells is not detectable because the cells are not floating in the medium. However, the density in mid log phase should be 0.02-0.05 at OD600, if the cells are suspended into the medium.
Replace the medium by 2-5 times smaller volume of PBS containing 10% horse serum.
Scrape the bottom of culture flask to release Mycoplasma cells into the solution, because the cells adhere to the flask bottom tightly.
Recover the cell suspension.
Filter the suspension through a membrane filter unit with a 0.45 μm-pore size.
Prepare a tunnel chamber.
Insert 10-50 μl of the cell suspension into the tunnel chamber to fill the inside.
Incubate the tunnel chamber for 60 min, with facing of coverslip-side to the stage heater. The water evaporates only slightly in Japanese climate, but the tunnel chamber should be cover by a lid of Petri dish.
Observe the cells bound to the coverslip by the microscope with a 100x phase-contrast objective lens heated by the lens heater, with video recording (see Figure 2 right).
Replace the buffer with the buffer containing the interested reagents. Put the buffer on one side of tunnel and suck the buffer from the other side using a filter paper.
Count the number of bound cell by a command “analyze > analyze particles” of ImageJ, an image analyzing software.
Recipes
Aluotto medium
2.1% heart infusion broth
0.56% yeast extract
10% horse serum
0.025% amphotericin B
0.005% ampicillin
PBS-G buffer
68 mM NaCl
75 mM sodium phosphate (pH 7.3)
10 mM glucose
Acknowledgments
This protocol is adapted from Kasai et al. (2013).
References
Kasai, T., Nakane, D., Ishida, H., Ando, H., Kiso, M. and Miyata, M. (2013). Role of binding in Mycoplasma mobile and Mycoplasma pneumoniae gliding analyzed through inhibition by synthesized sialylated compounds. J Bacteriol 195(3): 429-435.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Kasai, T. and Miyata, M. (2013). Analyzing Inhibitory Effects of Reagents on Mycoplasma Gliding and Adhesion. Bio-protocol 3(14): e829. DOI: 10.21769/BioProtoc.829.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Cell Biology > Cell structure > Cell adhesion
Cell Biology > Cell movement > Cell motility
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Engineering Agrobacterium tumefaciens with a Type III Secretion System to Express Type III Effectors
Vidhyavathi Raman and Kirankumar S. Mysore
Aug 5, 2023 443 Views
Bacterial Pathogen-mediated Suppression of Host Trafficking to Lysosomes: Fluorescence Microscopy-based DQ-Red BSA Analysis
Mădălina Mocăniță [...] Vanessa M. D'Costa
Mar 5, 2024 392 Views
Purification of Native Dentilisin Complex from Treponema denticola by Preparative Continuous Polyacrylamide Gel Electrophoresis and Functional Analysis by Gelatin Zymography
Pachiyappan Kamarajan [...] Yvonne L. Kapila
Apr 5, 2024 377 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
83 | https://bio-protocol.org/en/bpdetail?id=83&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is an In Press version of the protocol that has not yet been assigned to an issue.
Peer-reviewed
Rapid Coomassie Protein SDS-gel Staining
QY Qingrong Yan
In Press
Published: Jun 20, 2011
DOI: 10.21769/BioProtoc.83 Views: 19042
Ask a question
Favorite
Cited by
Abstract
This is a fast gel-staining protocol (within 10 min) compared to the conventional coomassie staining with the same detecting sensitivity.
Materials and Reagents
Ethanol
Acetic acid
Coomassie brilliant blue R250
Solution I (see Recipes)
Solution II (see Recipes)
Coomassie stock solution (see Recipes)
Equipment
Aluminum foil
Rocker
Procedure
Transfer gel to 50 ml of Solution I.
Heat in microwave oven for ~25 sec.
Cool in rocker for 5 to 10 min.
Add 200 μl of Coomassie stock solution to 50 ml of Solution II.
Transfer gel to Solution II + Coomassie.
Heat in microwave oven for ~35 sec.
Cool in rocker for 5 to 10 min.
Observe bands on the gel.
Note: Staining is not complete after these 5 to 10 min and faint bands may take longer to become visible.
Recipes
Solution I
50% ethanol
10% acetic acid
Solution II
5% ethanol
7.5% acetic acid
Coomassie stock solution
0.25% Coomassie brilliant blue R250 in 95% ethanol
References
Studier, F. W. (2005). Protein production by auto-induction in high density shaking cultures. Protein Expr Purif 41(1): 207-234.
Article Information
Copyright
© 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Biochemistry > Protein > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
830 | https://bio-protocol.org/en/bpdetail?id=830&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
HIV-1 Virus-like Particle Budding Assay
NB Nathan H Vande Burgt
L Luis J Cocka
PB Paul Bates
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.830 Views: 10330
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Sep 2012
Abstract
Viral replication culminates with the egress of the mature virion from the host cell. This step of the viral life cycle has recently garnered increased attention with the discovery of the cellular restriction factor, Tetherin, which tethers budded virions to the surface of infected cells and inhibits viral spread. The importance of this block in viral infections has been suggested by the discovery of viral antagonists, such as HIV-1 Vpu, which counteract Tetherin. This protocol describes a system to study HIV-1 budding under BSL-2 safety conditions. It takes advantage of the ability of many viral matrix/capsid proteins to generate non-infectious virus-like particles (VLPs) with the expression of a single viral protein (i.e. HIV-1 p24 Gag). This protocol was recently used to characterize the effect of Tetherin isoforms on VLP release in the presence of HIV-1 Vpu (Cocka and Bates, 2012). Simultaneous expression of Tetherin and other viral antagonists can be used to study Tetherin-mediated restriction on viral budding.
Keywords: HIV-1 Virus-like Budding Virus release
Materials and Reagents
HEK 293T cell line (ATCC, catalog number: CRL-11268 )
Antibody, HIV-1 p24 Gag (NIH AIDS Reagent Program, catalog number: 24-3 )
Antibody, HIV-1 Vpu (optional) (NIH AIDS Reagent Program, catalog number: 969 )
Antibody, human Tetherin (optional) (NIH AIDS Reagent Program, catalog number: 11721 )
Bromophenol Blue (Sigma-Aldrich, catalog number: B-5525 )
Complete Mini protease inhibitor cocktail (F. Hoffmann-La Roche, catalog number: 04693132001 )
Criterion Precast Gels, 4-15% Tris-HCl (Bio-Rad Laboratories, catalog number: 345-0027 )
Dithiothreitol (DTT) (Thermo Fisher Scientific, catalog number: BP172-5 )
Dulbecco’s Modified Eagle Media (DMEM) (Life Technologies, InvitrogenTM, catalog number: 11965-084 )
Dulbecco’s Phosphate-buffered saline (DPBS) (Life Technologies, InvitrogenTM, catalog number: 14190-136 )
0.5 M EDTA solution (Life Technologies, InvitrogenTM, catalog number: 15575-038 )
Fetal Bovine Serum (FBS) (Sigma-Aldrich, catalog number: F2442-500ML )
Glycerol (Thermo Fisher Scientific, catalog number: BP229-1 )
Hydrochloric acid (HCl) (Thermo Fisher Scientific, catalog number: A144-212 )
Instant Nonfat Dry Milk (Nestle, catalog number: 050000033188 )
Lipofectamine 2000 (Life Technologies, InvitrogenTM, catalog number: 11668-019 )
NaCl (Thermo Fisher Scientific, catalog number: BP 358-212 )
Opti-MEM (Life Technologies, InvitrogenTM, catalog number: 31985-070 )
Plasmid, human Tetherin cDNA (optional) (OpenBiosystems, catalog number: 5217945 )
Plasmid, psPAX2 HIV Gag (Addgene, catalog number: 12260 )
Plasmid, Tetherin antagonist (HIV-1 Vpu) (optional)
Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: BP166-500 )
D-Sucrose (Thermo Fisher Scientific, catalog number: BP220-1 )
Tris Base (Thermo Fisher Scientific, catalog number: BP152-500 )
Triton X-100 (Thermo Fisher Scientific, catalog number: BP151-500 )
Tween 20 Thermo Fisher Scientific, catalog number: BP337-500 )
Cell culture media (see Recipes)
20% sucrose solution (see Recipes)
Triton X-100 lysis buffer (see Recipes)
Blocking solution (see Recipes)
6x protein gel loading buffer (see Recipes)
Equipment
24 well plate, cell culture treated (Corning, catalog number: 3524 )
1.7 ml Microcentrifuge tubes (GeneMate, catalog number: C-3260-1X )
8 x 34 mm Ultracentrifuge tubes (Beckman Coulter, catalog number: 343776 )
Tabletop Centrifuge, refrigerated (Eppendorf Centrifuge, model: 5417R )
TLA 120.1 rotor (Beckman Coulter, model: 357655 )
Ultracentrifuge, refrigerated (Beckman Coulter Optima, model: TLX-IM-3 )
Procedure
Plate 293T cells in 500 μl of Cell Culture Media at a concentration of 2.5 x 105 cells/well in a 24 well plate. Cells should grow to 70-80% confluence 18-24 h post-seeding.
For the following transfection, the amounts of plasmid DNA have been optimized for this protocol. Transfect seeded cells with 50 ng of psPAX2, an HIV gag expression vector, using Lipofectamine 2000. Follow the manufacturer’s protocol using a ratio of Lipofectamine (μl):DNA (μg) of 2.5:1 diluted in OPTI-MEM. Aspirate the transfection reagent from the transfected cells 5 hours post transfection and add 500 μl fresh Cell Culture Media. Incubate at 37 °C and 5% CO2 for 36-48 h.
Alternatively cells can be transfected with any other vector expressing a viral matrix/capsid protein, such as Ebola VP40 (Kaletsky, 2009) that can produce virus-like particles (VLPs).
The effect of the cellular restriction factor Tetherin can be assessed by co-transfecting increasing amounts (10-200 ng) of the pCMV-SPORT6 Tetherin expression vector with a VLP producing plasmid.
Viral antagonists of Tetherin can be studied by co-transfection of increasing amounts (25-100 ng) of a Tetherin antagonist such as pCAGGS HIV-1 Vpu along with a Tetherin and VLP expression plasmid.
Harvest cellular proteins and purify VLPs.
VLP analysis. 36-48 h post-trasnfection, pipet all of the media from each transfected well into individual 1.7 ml microcentrifuge tubes. Centrifuge at 1,700 x g for 2 min at 4 °C to clear media and pellet cell debris. Transfer 450 μl of cleared media by pipetting into individual 8 x 34 mm ultracentrifuge tubes and underlay with 100 μl of the 20% Sucrose Solution. Place ultracentrifuge tubes in a pre-chilled TLA 120.1 rotor and centrifuge at 40,000 rpm for 30 min at 4 °C in a refrigerated ultracentrifuge. Carefully remove and discard all of the media and sucrose underlay by pipetting. Be very careful, as the protein pellet is not clearly visible. Add 50 μl PBS to the protein pellet on ice and incubate for 1-24 h (1 h minimum).
Cellular Lysate Analysis. After removing the VLP containing media, add 80 μl Triton X-100 Lysis Buffer to each transfected well in the 24-well plate and incubate for 5 min at room temperature. Transfer all of the lysate to a 1.7 ml microcentrifuge tube. Centrifuge at 17,900 x g for 3 min at 4 °C to pellet insoluble cell debris. Transfer 50 μl of the cleared lysate to new microcentrifuge tube for immunoblot analysis.
Immunoblot Analysis. For each sample, either sucrose pelleted VLPs or cellular lysates, transfer 25 μl into a new 1.7 ml microcentrifuge tube. Add 5 μl of 6x protein gel loading buffer to each sample. Heat the samples to 95 °C for 10 min. Analyze the VLPs and cellular lysates on separate Criterion Precast 4-15% SDS-PAGE gels. Transfer gel to Western blot membrane and continue to immunoblot using the Blocking Solution. Immunoblot with an anti-p24 Gag antibody (1:10,000 dilution in Blocking Solution) to detect the VLPs and cellular p24 gag. Membranes can also be stripped and immunoblotted for other transfected proteins (Tetherin, Vpu) or housekeeping genes as loading controls (GAPDH). For example, Tetherin can be used to restrict VLP release as shown in Figure 1. Samples containing VLPs co-transfected with Tetherin have less detectable p24 Gag expression compared to VLPs co-transfected without Tetherin. In contrast, the cellular lysates exhibit detectable p24 Gag across all samples, irrespective of Tetherin expression. Rescue of VLP release can be observed in samples expressing increasing amounts of a Tetherin antagonist.
Figure 1. An immunoblot showing the effects of Tetherin on p24 Gag VLP production and release. In the top image, release of VLPs into the culture media is significantly decreased in the presence of Tetherin. However, production of p24 Gag in the cellular lysates is unaffected by increased Tetherin expression.
Recipes
Cell Culture Media (1 L solution)
1 L DMEM
10% FBS
20% sucrose solution (100 ml solution)
20 g sucrose
100 ml DPBS
Triton X-100 lysis buffer
50 mM Tris-HCl
150 mM NaCl
Buffer the solution to pH 7.5 with HCl
5 mM EDTA
1% Triton X-100
Immediately prior to use, add complete Mini protease inhibitor to Triton X-100 Buffer at concentration suggested by manufacturer.
Blocking Solution (1 L solution)
50 mM Tris-HCl
150 mM NaCl
Buffer the solution to pH 7.5 with HCl
50 g Instant Nonfat Dry Milk
1 ml Tween-20
6x protein gel loading buffer
350 mM Tris-HCl buffered to pH 6.8
0.6 M DTT
10% SDS
30% glycerol
0.012% Bromophenol Blue
Acknowledgments
This protocol was adapted from and recently used in Cocka and Bates (2012).
References
Cocka, L. J. and Bates, P. (2012). Identification of alternatively translated Tetherin isoforms with differing antiviral and signaling activities. PLoS Pathog 8(9): e1002931.
Kaletsky, R. L., Francica, J. R., Agrawal-Gamse, C. and Bates, P. (2009). Tetherin-mediated restriction of filovirus budding is antagonized by the Ebola glycoprotein. Proc Natl Acad Sci U S A 106(8): 2886-2891.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Vande Burgt, N. H., Cocka, L. J. and Bates, P. (2013). HIV-1 Virus-like Particle Budding Assay. Bio-protocol 3(14): e830. DOI: 10.21769/BioProtoc.830.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Virus Overlay Assay (Far-Western blotting)
Kun-Tong Jia [...] Jian-Guo He
Oct 5, 2013 15342 Views
Coupling of HIV-1 gp120-derived Core Protein to Paramagnetic Beads and Adsorption Assays
Jidnyasa Ingale and Richard T Wyatt
Oct 5, 2015 6755 Views
Construction of a Highly Diverse mRNA Library for in vitro Selection of Monobodies
Taishi Kondo [...] Hiroshi Murakami
Aug 20, 2021 2504 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
831 | https://bio-protocol.org/en/bpdetail?id=831&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Estradiol Receptor (ER) Chromatin Immunoprecipitation in MCF-7 Cells
Pia Giovannelli
Gabriella Castoria
Antimo Migliaccio
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.831 Views: 10307
Reviewed by: Lin Fang Anonymous reviewer(s)
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Oncogene Nov 2012
Abstract
Steroid hormone receptors, for example estradiol receptor, act like transcription factors. In the cell, steroids bind to a specific receptor. Upon ligand binding, many steroid receptors dimerize and enter nuclei where they bind specific DNA sequences called Hormone Responsive Elements (HRE) and regulate gene transcription. ER is able to bind DNA sites that are not Estrogen Responsive Elements (ERE) so regulating also the transcription of genes that are not classically controlled by estrogens.
Keywords: Estradiol Receptor Breast cancer ChIP MCF-7 cells Transcription factor
Materials and Reagents
Fetal Bovine Serum (FBS) (Life Technologies, Gibco®, catalog number: 10270 )
200 mM L-Glutamine (100x) (Life Technologies, Gibco®, catalog number: 25030 )
Penicillin-Streptomycin (100x) (Life Technologies, Gibco®, catalog number: 15140-122 )
Hydrocortisone (Sigma-Aldrich, catalog number: H-0888 )
Insulin (Human, recombinant) (F. Hoffmann-La Roche, catalog number: 11376497001 )
Estradiol (Beta-estradiol) (Sigma-Aldrich, catalog number: E8875 )
Protease inhibitors cocktail tablets (LAP tablets) (F. Hoffmann-La Roche, catalog number: 11836153001 )
Protein A-agarose fast flow (Sigma-Aldrich, catalog number: P3476 )
Formaldeyde (Sigma-Aldrich)
Salmon sperm DNA
DPBS (Sigma-Aldrich, catalog number: D5652 )
Proteinase K (F. Hoffmann-La Roche, catalog number: 03115879001 )
Qiagen PCR purification kit
Immunoprecipitating antibody (ER-alpha) (Sigma-Aldrich, catalog number: E1396 )
Primers CCDN1 locus (-1039 to 770 bp): Fw(-1039) (AACAAAACCAATTAGGAACCTT), Rv(-770) (ATTTCCTTCATCTTGTCCTTCT)
Primers CCDN1 promoter (-235 to -53 bp): Fw(-235) (TATGAAAACCGGACTACAGG), and Rv(-53) (CTGTTGTTAAGCAAAGATCAAAG)
Charcoal dextran stripped serum (CSS) (see Recipes)
Phenol Red-free Dulbecco’s Modified Medium (DMEM with PR) (Life Technologies, Gibco®, catalog number: 31885 ) (for MCF-7 cells) (see Recipes)
Phenol Red-free Dulbecco’s Modified Medium (DMEM w/o PR) (Life Technologies, Gibco®, catalog number: 11880 ) supplemented with Charcoal (for MCF-7 cells) (see Recipes)
50x LAP (Protease inhibitor cocktail) (see Recipes)
DTT solution (see Recipes)
Buffer I (see Recipes)
Buffer II (see Recipes)
Buffer III or cell lysis buffer (see Recipes)
Buffer IV (see Recipes)
TSE I buffer (see Recipes)
TSE II buffer (see Recipes)
TSE III buffer (see Recipes)
TE buffer (see Recipes)
Elution buffer (see Recipes)
PCR buffer (see Recipes)
Equipment
Sonicator (equipped with a 3 mm diameter tip) (Sonics & Materials Inc., model: Vibracell VC 130PB )
100 mm dishes
Centrifuge (Eppendorf centrifuge, model: 5417R )
Shaker
PCR thermal cycler
Procedure
The MCF-7 cells are plated in 100 mm dishes approximately at 40-50% cell confluence in Phenol red Dulbecco’s modified medium. After12-18 h, the Red phenol medium is substituted with Phenol red-free Dulbecco’s modified medium supplemented with CSS. Cells are maintained in this medium for 3 or 4 days (80% confluence in 100 mm dishes).
Stimulate the cells with 10 nM estradiol for various times from 15 to 75 min. (the maximal ER binding to chromatin is usually observed after 30-40 min of hormone treatment). Use un-stimulated cells as negative control.
After hormone stimulation, wash the cells twice with cold PBS (5-10 ml).
Cross-link the cells with 10 ml 1% formaldehyde solution in PBS at room temperature for 10 min. Add the formaldehyde to PBS immediately prior to use.
Rinse cells twice with cold PBS (5-10 ml).
Add 1 ml DTT solution and collect the cells in a 1.5 ml tube using a cell scraper.
After collecting, incubate the cells for 15 min at 30 °C and centrifuge for 4 or 5 min at 3,000 RCF.
Wash the pellet three times with 1 ml PBS and after every wash centrifuge at 3,000 RCF for 3 min.
Wash sequentially the pellet with 1 ml Buffer I with 50x LAP, 1 ml Buffer II with LAP.
Suspend the cellular pellet in 300 μl Buffer III with 50x LAP and incubate 10 min on ice.
Sonicate three times at 30-40% amplitude and 0.4 W intensity for 35 sec each to obtain 200 bp DNA fragments. During the sonication, keep the samples on ice.
To define amplitude, intensity and duration of sonication, you can use a sample of MCF-7 cells, sonicate at different intensity, amplitude and duration and after check the DNA fragment size running the sonicated DNA on an agarose gel. The right conditions will be those that will allow you to obtain a DNA smear with the center on around 200 bp.
Centrifuge the cellular lysates at 20,000 RCF for 10 min at 4 °C, collect the supernatants and dilute ten fold using the Buffer IV with 50x LAP. Store in a rack and keep at 4 °C for 3 or 4 h or overnight (O.N.).
For preparing the protein A-agarose (40 μl of 50% for each sample), wash twice the required amount of resin with TE solution (ten fold the protein A-agarose volume). Collect the protein A-agarose by brief centrifugation. After the last wash, discard the TE solution and add fresh TE solution and salmon sperm DNA (20 μl TE solution and 2 μg salmon sperm DNA for each sample). Keep on a rotating platform at 4 °C for 3 or 4 h or O.N.
Clear the samples at 20,000 RCF for 10 sec. Store at -80 °C or use immediately for immunoprecipitation and lysates. Save back 20% of the total supernatant as total input control and process with eluted IPs beginning with the cross-link reversal step.
Add the immunoprecipitating antibody (2 μl ER-alpha) to the 0.7 ml samples fraction in a new tube and precipitate for 6 h or overnight. For a negative control, incubate 0.7 ml samples fraction with 1 μl (2 μg) of rabbit IgG. Keep all the samples on a rotating platform at 4 °C.
Add 40 μl of blocked protein A-agarose beads at 4 °C with rotation O.N. if you have incubated the samples with the antibody for 6 h or for 2-3 h if you have incubated the samples with the antibody O.N.
Pellet beads by centrifugation (3,000 x g) at 4 °C and wash for 10 min sequentially with 1 ml of TSE I, 1 ml of TSE II and 500 μl of TSE III. Wash three times with 1 ml TE Buffer.
Elute with 300 μl of freshly prepared elution buffer. Prepare buffer fresh each time. Vortex briefly to mix and shake gently on the vortex shaker for 10 min.
Centrifuge at 20,000 rpm for 10 min, transfer supernatants to clean tube and add 200 μl elution buffer in 100 μl of the frozen input control.
Reverse formaldehyde cross-linking by heating at 65 °C O.N.
Add 18 μl 1 M Tris-HCl pH 6.5 0.5 M EDTA and 5 μg Proteinase K to each sample and heat at 48 °C for 90 min.
Isolate DNA by using either the Qiagen PCR purification kit.
Another method for isolating DNA is the 1x phenol/chloroform extraction, 1x chloroform extraction, O.N. precipitation using 2.5 volumes absolute ethanol with 30 μl potassium acetate 3 M pH 5.7 and 5 μg glycogen. Wash pellets twice with 500 μl 70% ethanol and air dried.
Resuspend pellets in 35 μl TE with 0.1 mg/ml RNase A.
Perform the conventional PCR using 2 μl DNA per reaction. For example, for CCDN1 locus (-1039 to -770 bp) or for CCDN1 promoter (-235 to -53 bp) PCR, use 20 μl H2O solution with 1.5 mM MgCl2, 0.2 mM dNTP, 0.25 μM PRIMER F, 0.25 μM PRIMER R, 0.5 U/μl TAQ Pol, 2 μl DNA and 2 μl PCR buffer. Use 33-35 cycles of amplification (denaturation 96 °C for 20 sec, annealing 50 °C for 90 sec, elongation 69 °C for 60 sec). Run in a 2% agarose gel in TBE 0.5%.
Recipes
Charcoal dextran stripped serum
Dextran coated charcoal is used to strip steroid hormones from serum. Charcoal/dextran stripped serum is commercially available, but we prepare the serum as described in Migliaccio et al. (2011).
Phenol red-free Dulbecco’s modified medium for MCF-7 cells (DMEM with PR)
5% FBS
2 mM L-glutamine
100 U/ml penicillin-streptomycin
3.75 ng/ml Hydrocortisone
6 ng/ml Insulin
Phenol red-free Dulbecco’s modified medium supplemented with Charcoal for MCF-7 cells
(DMEM w/o PR)
5% CSS
2 mM L-glutamine
100 U/ml penicillin-streptomycin
3.75 ng/ml Hydrocortisone
6 ng/ml Insulin
50x LAP (Protease inhibitor cocktail)
Dissolve a tablet in 1 ml distilled H2O and use 50x
DTT solution
10 mM DTT
100 mM Tris-HCl
pH 9.5
Buffer I
0.25% Triton X-100
10 mM EDTA
0.5 mM EGTA
10 mM Hepes
pH 6.5
Buffer II
200 mM NaCl
1 mM EDTA
0.5 mM EGTA
10 mM Hepes
pH 6.5
Buffer III or cell lysis buffer
1% SDS
10 mM EDTA
50 mM Tris-HCl (pH 8.1)
50x protease inhibitor cocktail
Buffer IV
1% Triton X-100
2 mM EDTA
150 mM NaCl
20 mM Tris-HCl (pH 8.1)
TSE I buffer
0.1% SDS
1% Triton X-100
2 mM EDTA
20 mM Tris-HCl (pH 8.1)
150 mM NaCl
TSE II buffer
0.1% SDS
1% Triton X-100
2 mM EDTA
20 mM Tris-HCl (pH 8.1)
500 mM NaCl
TSE III buffer
0.25 M LiCl
1% NP40
1% Sodium Deoxycholate
1 mM EDTA
10 mM Tris-HCl (pH 8.1)
TE buffer
20 mM Tris-HCl (pH 8.1)
1 mM EDTA (pH 8.0)
Elution buffer
1% SDS
0.1 M NaHCO3
PCR buffer
300 mM Tris-Base
100 mM Hepes
250 mM Potassium Chloride
200 mM Potassium Glutamate
20 mM DTT
50% Glycerol
Sterilize by filtration
Acknowledgments
This work was funded by the Italian Association for Cancer Research (A.I.R.C.; Grant No. IG 5389). Pia Giovannelli is supported by a fellowship from A.I.R.C. This protocol was adapted from Castoria et al. (2012).
References
Castoria, G., Giovannelli, P., Lombardi, M., De Rosa, C., Giraldi, T., de Falco, A., Barone, M. V., Abbondanza, C., Migliaccio, A. and Auricchio, F. (2012). Tyrosine phosphorylation of estradiol receptor by Src regulates its hormone-dependent nuclear export and cell cycle progression in breast cancer cells. Oncogene 31(46): 4868-4877.
Lombardi, M., Castoria, G., Migliaccio, A., Barone, M. V., Di Stasio, R., Ciociola, A., Bottero, D., Yamaguchi, H., Appella, E. and Auricchio, F. (2008). Hormone-dependent nuclear export of estradiol receptor and DNA synthesis in breast cancer cells. J Cell Biol 182(2): 327-340.
Migliaccio, A., Castoria, G., Auricchio, F. (2011). Analysis of androgen receptor rapid actions in cellular signaling pathways: receptor/Src association. Methods Mol Biol 776: 361-370.
Yahata, T., Shao, W., Endoh, H., Hur, J., Coser, K. R., Sun, H., Ueda, Y., Kato, S., Isselbacher, K. J., Brown, M. and Shioda, T. (2001). Selective coactivation of estrogen-dependent transcription by CITED1 CBP/p300-binding protein. Genes Dev 15(19): 2598-2612.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cancer Biology > General technique > Biochemical assays
Biochemistry > Protein > Immunodetection
Molecular Biology > DNA > DNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Measuring Protein Synthesis during Cell Cycle by Azidohomoalanine (AHA) Labeling and Flow Cytometric Analysis
Koshi Imami and Tomoharu Yasuda
Apr 20, 2019 8233 Views
Analysis of the Ubiquitination and Phosphorylation of Vangl Proteins
Di Feng [...] Bo Gao
Oct 20, 2022 1976 Views
Isoform-specific, Semi-quantitative Determination of Highly Homologous Protein Levels via CRISPR-Cas9-mediated HiBiT Tagging
Kristina Seiler [...] Mario P. Tschan
Jul 20, 2023 894 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
832 | https://bio-protocol.org/en/bpdetail?id=832&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Maize Endosperm Protein Extraction and Analysis
XC Xinze Chen
DY Dongsheng Yao
RS Rentao Song
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.832 Views: 12993
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Plant Cell Aug 2012
Abstract
Alcohol-solubility is the most characteristic feature of the zein proteins, the major storage protein in maize. Using sodium borate buffer system with added reducing agent, total proteins are isolated, and zein proteins are separated from non-zein proteins. The extraction effect is intuitive on a SDS-PAGE isolation system. In addition, a simple and rapid approach to extract zeins is introduced, taking full advantage of alcohol-solubility of zeins directly.
Keywords: Maize Seed Zein Extraction
Materials and Reagents
Mature corn kernels
Petroleum ether
Ethanol
β-mercaptoethanol
Sodium dodecyl sulfonate (SDS)
Urea
Glycerol
HCl
Tris(Hydroxymethyl)aminomethane (Tris)
Phenylmethanesulfonyl fluoride (PMSF)
Methylene diacrylamide
Bromophenol blue
CHAPS (Sigma-Aldrich, catalog number: V900480-5G )
Dithiothreitol (DTT)
Liquid nitrogen
ddH2O
SDS-PAGE gel (15% separation)
Coomassie brilliant blue (R250) staining buffer
30% acrylamide (see Recipes)
Sodium borate buffer (see Recipes)
5x protein loading buffer (see Recipes)
IPG solution (see Recipes)
Equipment
A mortar and pestle
Centrifuge (Eppendorf, model: 5415D )
Shaker (Zhicheng, model: ZHWY-111C )
Concentrator plus (Eppendorf, catalog number: 5305000.193 )
Gel DocTM XR + System (Bio-Rad, catalog number: 170-8195 )
Procedure
Using sodium borate buffer system to extract zeins
Soak 3-5 mature corn kernels in ddH2O for 10 min, then remove the pericarp and embryo and dry the kernels for 10 min at 37 °C.
Grind kernels into powder using a mortar and pestle within liquid nitrogen.
Transfer the powder into a 2 ml eppendorf tube. Dry it in Concentrator plus for 1 h till achieve constant weight.
Add 1 ml petroleum ether. Vortex and place in the shaker at 250 rpm for 1 h.
Centrifuge for 15 min at 12,000 rpm at room temperature (RT), and discard the supernatant.
Dry it in Concentrator Plus for 1.5 h until no smell of organic liquid is detectable.
Fill a new 2 ml Eppendorf tube with 50 mg dried powder from the step 6.
Add 1 ml sodium borate buffer and 20 μl β-mercaptoethanol as well as 1% PMSF. Mix and incubate with shaking at 250 rpm for at least 2 h at 37 °C.
Centrifuge for 15 min at 12,000 rpm at RT.
Transfer 300 μl supernatant into a new 2 ml eppendorf tube as total protein extraction (Fraction A).
Transfer another 300 μl supernatant from the step 9 into a new 2 ml Eppendorf tube, and add 700 μl ethanol as well as 1% PMSF. Mix with shaking at 250 rpm for 2 h at RT.
Centrifuge product from step 11 for 15 min at 12,000 rpm at RT.
Transfer 400-500 μl supernatant into a new 2 ml Eppendorf tube and dry it in Concentrator plus for 2-3 h. Resuspend it in 200 μl IPG as zein proteins extraction (Fraction B).
Wash the precipitate in step 12 with 70% ethanol twice.
Centrifuge for 15 min at 12,000 rpm at RT.
Discard the supernatant and air-dry the precipitate until the edges become transparent. Resuspend it in 200 μl IPG as non-zein proteins extraction (Fraction C).
Add 10 μl protein extraction from fraction A, or B, or C (see the attached corresponding pictures), 1.5 μl DTT and 3 μl 5x Protein loading buffer in a new 0.2 ml eppendorf tube. Heat 10 min at 99 °C for denaturation.
Load 2-5 μl denatured protein sample and perform the SDS-PAGE on a 15% separation gel.
Afterwards, the gel is stained with Coomassie brilliant blue R250 (Figure 1, Figure 2, and Figure 3).
Figure 1. SDS-PAGE (Fraction A). M represents protein standards with molecular weight ranging from 14,400 to 97,400 Da (similarly hereinafter). This figure shows total proteins extraction. 1, 2, 3, 4 represent four different maize cultivars.
Figure 2. SDS-PAGE (Fraction B). This figure shows zein protein extraction. 1, 2 represent two different maize cultivars (two replicates for each maize cultivar).
Figure 3. SDS-PAGE (Fraction C). This figure shows non-zein protein extraction. 1, 2, 3, 4 represent four different maize cultivars.
Simple and rapid extraction approach
Soak 3-5 mature corn kernels in ddH2O for 10 min, then remove the pericarp and embryo and dry the kernels for 10 min at 37 °C.
Grind kernels into powder using a mortar and pestle within liquid nitrogen.
Transfer the powder into a 2 ml eppendorf tube. Dry it in Concentrator plus for 1 h till achieve constant weight.
Fill a new 2 ml eppendorf tube with 50 mg dry powder from step 3.
Add 400 μl 70% ethanol and 8 μl β-mercaptoethanol as well as 1% PMSF.
Mix and incubate for at least 2 h at RT. Invert the cube 2-3 times during incubation.
Centrifuge for 10 min at 1,300 rpm at RT.
Transfer 100 μl supernatant into a new 2 ml eppendorf tube.
Add 10 μl 10% SDS, and mix by pipetting.
Dry it in Concentrator plus for 1 h.
Add 200 μl ddH2O for elution.
SDS-PAGE is performed in 15% polyacrylamide gels, and the gels are stained with Coomassie brilliant blue R250 (Figure 4).
Figure 4. SDS-PAGE (zein proteins). This figure shows zein proteins through simple and rapid extraction approach. 1, 2 represent two replicates of same maize cultivar.
Recipes
30% acrylamide (500 ml aqueous solution)
145 g acrylamide
5 g methylene diacrylamide
Sodium borate buffer
12.5 mmol/L sodium borate
1% SDS
pH 10.0
5x Protein Loading Buffer
60 mmol/L Tris-HCl (pH 6.8)
25% glycerol
2% SDS
0.1% bromophenol blue
IPG solution
8 mol/L urea
2% CHAPS
References
Bradford, M. M. (1976). A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein–dye binding. Anal Biochem 72: 248-254.
Gibbon, B. Protein extraction from flour [updated April 2003]. Available from http://ag.arizona.edu/research/larkinslab/protocols.htm
Wallace, J. C., Lopes, M. A., Paiva, E. and Larkins, B. A. (1990). New Methods for Extraction and Quantitation of Zeins Reveal a High Content of gamma-Zein in Modified opaque-2 Maize. Plant Physiol 92(1): 191-196.
Wang, G., Sun, X., Wang, G., Wang, F., Gao, Q., Sun, X., Tang, Y., Chang, C., Lai, J., Zhu, L., Xu, Z. and Song, R. (2011). Opaque7 encodes an acyl-activating enzyme-like protein that affects storage protein synthesis in maize endosperm. Genetics 189(4): 1281-1295.
Wu, Y., Goettel, W. and Messing, J. (2009). Non-Mendelian regulation and allelic variation of methionine-rich delta-zein genes in maize. Theor Appl Genet 119(4): 721-731.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Chen, X., Yao, D. and Song, R. (2013). Maize Endosperm Protein Extraction and Analysis. Bio-protocol 3(14): e832. DOI: 10.21769/BioProtoc.832.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein > Isolation and purification
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Autolysin Production from Chlamydomonas reinhardtii
Justin Findinier
Jul 5, 2023 528 Views
A Simple Sonication Method to Isolate the Chloroplast Lumen in Arabidopsis thaliana
Jingfang Hao and Alizée Malnoë
Aug 5, 2023 597 Views
Streamlining Protein Fractional Synthesis Rates Using SP3 Beads and Stable Isotope Mass Spectrometry: A Case Study on the Plant Ribosome
Dione Gentry-Torfer [...] Federico Martinez-Seidel
May 5, 2024 698 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
833 | https://bio-protocol.org/en/bpdetail?id=833&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Polysome Profiling Analysis
Masahiro Morita
TA Tommy Alain
IT Ivan Topisirovic
NS Nahum Sonenberg
Published: Vol 3, Iss 14, Jul 20, 2013
DOI: 10.21769/BioProtoc.833 Views: 51967
Reviewed by: Lin FangFanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Dec 2012
Abstract
Polysome profiling is a method that allows monitoring of translation activity of mRNAs in cells and tissues. Once each polysome fractions are collected, the translation activity of each mRNA is analyzed using various molecular biology techniques such as Northern blotting, RT-PCR, microarray or deep-sequencing.
Keywords: Translation Polysome MRNA Ribosome Genome-wide analysis
Materials and Reagents
Sucrose
1 M HEPES-KOH (pH 7.6)
2 M KCl
1 M MgCl2
PBS
1 M Tris-HCl (pH 7.5)
10 mg/ml cycloheximide (Sigma-Aldrich, catalog number: C7698 ) in MilliQ water
Note: Cycloheximide inhibits protein synthesis by blocking translation elongation. This molecule interferes with the translocation of tRNAs with the mRNA and the ribosome, resulting in fixed ribosomes on mRNAs.
Protease inhibitor cocktail (EDTA-free) (F. Hoffmann-La Roche, catalog number: 04 693 159 001 )
RNase inhibitor (RNasin 40 units/μl) (Promega Corporation, catalog number: N2511 )
10% Triton X-100
10% Sodium deoxycholate (Sigma-Aldrich, catalog number: D6750 )
RNaseZap (Life Technologies, Ambion®, catalog number: AM9780 )
Trizol (Life Technologies, InvitrogenTM)
Oligo dT primer and Super Script III (Life Technologies, InvitrogenTM, catalog number: 18418012 and 18080093 )
10x sucrose gradient buffer (see Recipes)
10-50% sucrose solutions (see Recipes)
Hypotonic buffer (see Recipes)
Equipment
Ultra centrifuge and rotor (Beckman, model: Optima L-80 ; SW40Ti rotor )
UV detector and fraction collector (Teledyne ISCO)
NanoDrop (Thermo Fisher Scientific)
0.22 µm filter
Software
TracerDAQ software (MicroDAQ)
Procedure
I. Preparation of sucrose gradients
Prepare 50 ml of 60% (w/v) sucrose solution in MilliQ water and 10 ml of 10x sucrose gradient buffer. Filter solutions with 0.22 μm filter.
Prepare 10-50% sucrose solutions using 60% sucrose. Prepare gradients at least one day before cell lysis to allow gradient to diffuse overnight at 4 °C.
Carefully add 1.2 ml of each sucrose solution (starting with the 50% sucrose solution) to Beckman tubes (12 ml total volume).To improve efficacy at this step, the gradients can be flash frozen in liquid nitrogen following each addition of sucrose solution. This helps in generating equally poured gradients and prevents too much diffusion.
Cover tube with parafilm and incubate at 4 °C overnight. Alternatively, sucrose gradients can be stored at -80 °C indefinitely.
II. Isolation of polysomes
Prepare cells at least one day before lysing. Confluency is very important. About 80-90% confluency gets the maximum polysomes. 1-5 15-cm dishes are needed to see polysome profile.
Prior to lysing the cells, treat cells with 100 μg/ml cycloheximide at a final concentration for 5 min.
Wash cells twice with 10 ml of ice-cold 1x PBS containing 100 μg/ml cycloheximide.
Scrape cells with 5 ml of ice-cold 1x PBS containing 100 μg/ml cycloheximide, collect them in 15 ml tube and rinse with 5 ml of ice-cold 1x PBS containing 100 μg/ml cycloheximide.
Centrifuge cells at 1,200 rpm (300 x g) for 5 min at 4 °C.
Aspirate supernatant, resuspend cells in 425 μl of hypotonic buffer and transfer all to a new pre-chilled 1.5 ml tube.
Then add:
5 μl of 10 mg/ml cycloheximide
1 μl of 1 M DTT
100 units of RNasin
Vortex for 5 sec.
Then add:
25 μl of 10% Triton X-100
25 μl of 10% Sodium Deoxycholate
Vortex for 5 sec.
Centrifuge at 15,000 rpm (21,000 x g, a maximal speed on a bench top centrifuge in 1.5 ml eppendorf tube) for 5 min at 4 °C.
Transfer supernatant (about 500 μl) to a new pre-chilled 1.5 ml tube. Measure OD260nm for each sample using NanoDrop.
Figure 1. Polysome profiling from MEFs treated with DMSO or Ink1341 (250 nM) for 8 h from Dowling et al. (2010). 40 S, 60 S and 80 S denote the corresponding ribosomal subunits and monosome, respectively.
Load the same OD amount of lysate onto each gradient (10-30 OD260nm is loaded). Keep 10% of lysates as an input.
Weight and balance each gradient.
Centrifuge at 35,000 rpm for 2 h at 4 °C using SW40Ti rotor in a Beckman Coulter (Optima L-80 ultra centrifuge). No brake of brake at 1 (maximum) for deceleration. Acceleration does not matter much.
While the samples are centrifuging, clean fraction collector with warm MilliQ water containing a bit of RNase ZAP (a few sprays).
Carefully remove tubes from the rotor and place them at 4 °C until they are ready for running.
Switch on computer, pump, UV detector and fraction collector. Set pump at 1.5 ml/min and the fraction collector by time. Place 2 ml tubes on fraction collector.
Open TracerDAQ program.
Run chasing solution (60% (w/v) sucrose with bromophenol blue) through the system until it reaches the needle. Make sure to see at least one drop coming out of the needle such that no bubbles are introduced into the gradient.
Screw each tube onto the ISCO UV detector and then pierce the tube with the needle.
Begin running the chasing solution through the gradient. Run solution with the pump at 1.5 ml/min. Click on acquire data button and press run on the fraction collector.
Place fractions on dry ice or liquid nitrogen.
Add 750 μl of Trizol for RNA isolation.
III. RNA isolation and RT-qPCRMQ
Add 150 μl of chloroform to each fraction.
Isolate RNA according to manufacturer’s Trizol protocol.
Measure the RNA concentration of each fraction or input.
Prepare the following solutions in 500 μl tubes or PCR tubes.
0.5 μg of RNA x μl
Oligo (dT) primer 1 μl
dNTP (10 mM each) 1 μl
Water x μl/total 13 μl
65 °C for 5 min.
On ice for at least 1 min.
Add the following solutions (7 μl premix) on ice. Make premix before adding.
5x buffer 4 μl
1 M DTT 1 μl
RNasin 40 units/μl 1 μl
RTase 1 μl
Mix gently and spindown on ice.
50 °C for 60 min.
70 °C for 15 min.
Keep at 4 °C until next step.
Add 180 μl of MQ.
qPCR according to manufacturer’s protocol.
2x SYBR 10 μl
5’ Primer (10 μM) 0.4 μl
3’ Primer (10 μM) 0.4 μl
RT sample 5 μl
MQ 4.2 μl/Total 20 μl
Recipes
10x sucrose gradient buffer (50 ml)
200 mM HEPES (pH 7.6)
1 M KCl
50 mM MgCl2
100 μg/ml cycloheximide
1x protease inhibitor cocktail (EDTA-free)
100 units/ml RNase inhibitor
10-50% sucrose solutions
Final (%)
60% stock (ml)
water (ml)
10x sucrose gradient buffer (ml)
50
8.3
0.7
1
45
7.5 1.5
1
40
6.7
2.3
1
35
5.8
3.2
1
30
5.0
4.0
1
25
4.2
4.8
1
20
3.3
5.7
1
15
2.5
6.5
1
10
1.7
7.3
1
Hypotonic buffer
5 mM Tris-HCl (pH 7.5)
2.5 mM MgCl2
1.5 mM KCl
1x protease inhibitor cocktail (EDTA-free)
References
Alain, T., Morita, M., Fonseca, B. D., Yanagiya, A., Siddiqui, N., Bhat, M., Zammit, D., Marcus, V., Metrakos, P., Voyer, L. A., Gandin, V., Liu, Y., Topisirovic, I. and Sonenberg, N. (2012). eIF4E/4E-BP ratio predicts the efficacy of mTOR targeted therapies. Cancer Res 72(24): 6468-6476.
Dowling, R. J., Topisirovic, I., Alain, T., Bidinosti, M., Fonseca, B. D., Petroulakis, E., Wang, X., Larsson, O., Selvaraj, A., Liu, Y., Kozma, S. C., Thomas, G. and Sonenberg, N. (2010). mTORC1-mediated cell proliferation, but not cell growth, controlled by the 4E-BPs. Science 328(5982): 1172-1176.
Larsson, O., Morita, M., Topisirovic, I., Alain, T., Blouin, M. J., Pollak, M. and Sonenberg, N. (2012). Distinct perturbation of the translatome by the antidiabetic drug metformin. Proc Natl Acad Sci U S A 109(23): 8977-8982.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Morita, M., Alain, T., Topisirovic, I. and Sonenberg, N. (2013). Polysome Profiling Analysis. Bio-protocol 3(14): e833. DOI: 10.21769/BioProtoc.833.
Download Citation in RIS Format
Category
Molecular Biology > RNA > mRNA translation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
In Vitro Analysis of Stalled Ribosomes using Puromycin Incorporation
MaKenzie R. Scarpitti and Michael G. Kearse
Aug 20, 2023 1314 Views
Immunoprecipitation of Reporter Nascent Chains from Active Ribosomes to Study Translation Efficiency
Roberta Cacioppo and Catherine Lindon
Sep 20, 2023 685 Views
Metabolic RNA Labeling and Translating Ribosome Affinity Purification for Measurement of Nascent RNA Translation
Hirotatsu Imai and Akio Yamashita
Oct 20, 2024 472 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
834 | https://bio-protocol.org/en/bpdetail?id=834&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Whole Spleen Flow Cytometry Assay
CY Cathy S. Yam
AH Adeline M. Hajjar
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.834 Views: 34836
Reviewed by: Fanglian He Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in PLOS Pathogens Oct 2012
Abstract
In the Whole Spleen Flow Cytometry Assay, we used splenocytes directly ex vivo for stimulation with a variety of TLR ligands. The splenocytes were stimulated for a total of 4 hours, then stained for intracellular cytokines. We then examined cytokine production via flow cytometry. This allowed us to compare the responses of minimally manipulated primary macrophages/monocytes and conventional dendritic cells.
Materials and Reagents
PerCP/Cy5.5 anti-mouse CD11b (Biolegend, catalog number: 101228 )
PE/Cy7 anti-mouse CD11c (BD Bioscience, catalog number: 558079 )
APC/Cy7 anti-mouse CD19 (BD Bioscience, catalog number: 557655 )
APC anti-mouse CD3e (Biolegend, catalog number: 100312 )
FITC anti-mouse TNFa (Caltag, catalog number: RM9011 )
PE anti-mouse IL-12 (BD Bioscience, catalog number: 554479 )
aCD16/32 FcBlock (BD Bioscience, catalog number: 553142 )
FITC anti-mouse CD8 (BD Bioscience, catalog number: 553031 )
PE anti-mouse CD8 (BD Bioscience, catalog number: 553033 )
PerCP/Cy5.5 anti-mouse CD4 (Biolegend, catalog number: 100539 )
PE/Cy7 anti-mouse CD8 (Biolegend, catalog number: 100722 )
APC anti-mouse CD8 (BD Bioscience, catalog number: 553035 )
Ultrapure O111:B4 EC LPS (Life Technologies, InvitrogenTM, catalog number: tlrl-pelps )
Synthetic Lipid IVa (Peptides International, catalog number: CLP-24006-S )
ODN1826 (Coley Pharmaceuticals)
Frosted glass slides, nonsterile (Fisherbrand, catalog number: 12-550-343 )
Cytofix/Cytoperm Solution (BD Biosciences, catalog number: 554722 )
10x Perm Wash Buffer (BD Biosciences, catalog number: 554723 )
10% Paraformaldehyde (Electron Microscopy Sciences, catalog number: 15712-S )
RPMI 1640 Medium (with glutamax, HEPES, Phenol red) (Life Technologies, catalog number: 72400-120 )
Fetal bovine serum (FBS) (Heat Inactivated) (Hyclone, catalog number: SH30070.03HI )
Pen/Strep (Life Technologies, catalog number: 15140-122 )
Beta-ME (Sigma-Aldrich, catalog number: M-7522 )
NaCl
KCl
KH2PO4
Na2HPO4
NaOH
NH4Cl
NaHCO3
10x Phosphate buffered saline (PBS) (see Recipes)
1x PBSA/azide (PBSA/az) (see Recipes)
RBC Lysis Buffer (see Recipes)
Culture Medium (see Recipes)
Brefeldin A (Sigma-Aldrich, catalog number: B6542 ) (see Recipes)
Equipment
15 ml conical tubes (BD Biosciences, Falcon®, catalog number: 352196 )
50 ml conical tubes (BD Biosciences, Falcon®, catalog number: 352070 )
FACS titertube microtubes (Bio-Rad Laboratories, catalog number: 223-9391 )
70 μM filters (BD Biosciences, Falcon®, catalog number: 352350 )
Tissue culture (TC) dish (100 x 20 mm) (Corning Incorporated, catalog number: 430167 )
96-well round bottom plates (Corning Incorporated, catalog number: 3799 )
BD FACS Canto I (6 color analyzer) flow cytometer: Equipped with 2 lasers; blue laser 488 nm four color detection and red laser 633 nm 2 color detection. Uses FACSDiva software
Centrifuge (Beckman Coulter, model: Allegra X-15R )
Software
FACSDiva software
BD FACS Canto I software
Procedure
Splenocyte Isolation
Extract whole spleen from mouse and place in a 15 ml polypropylene tube on ice (no liquid).
Put 5 ml RBC lysis buffer into 15 ml tube with spleen.
Pour out spleen with RBC lysis buffer into a 10 cm tissue culture dish.
Smash spleen thoroughly between frosted glass slides by placing the spleen on the rough side of the frosted part of the slide (wetted with RBC lysis buffer) and grind it between the two slides until spleen is dissociated (Video 1).
Video 1. Homogenization of spleen between two glass slides
Pipette up the RBC lysis containing splenocytes back into the 15 ml tube.
Add 10 ml of culture medium to the tube, invert 2-3 times.
Spin at 1,300 rpm at 4 °C for 5 min.
Discard the supernatant and resuspend the pellet in 3 ml medium.
Filter through a 70 μM filter over a 50 ml conical tube.
Count 1:100 dilution of cells.
Dilute single-cell suspensions to 1 x 107 cells/ml in RPMI medium (for Flow Assays, counting and calculating of cells is not necessary).
Place splenocytes on ice until ready to plate into 96-well plate.
Stimulation of splenocytes
Prepare a stock of RPMI medium with Brefeldin A added to it at 10 μg/ml.
Vortex and spin down all LPS stocks, then sonicate each for 10 min. After sonication, vortex and spin down again.
Each stimulus (EC LPS, PA, YP, Lipid IVa) is prepared to twice (2x) its desired final concentration using the Brefeldin A containing medium.
Plate 100 μl of each stimulus into the appropriate wells of the 96-well plate, include unstimulated wells as a control.
Plate 100 μl of the splenocytes into the appropriate wells (plate an extra set of splenocytes to be used as single stain controls).
Incubate the plate for 4 h at 37 °C.
Immunocytochemistry (ICC) staining
After 4 h, treat wells with 20 μl of 20 mM EDTA.
Mix and incubate at 37 °C for 10 min.
Mix again after incubation and then spin at 1,300 rpm for 5 min.
Aspirate or flick medium off.
Block with 100 μl of diluted FcBlock (1:100 FcBlock in PBSA/az) to all wells.
Incubate on ice for 15 min.
Add 100 μl of PBSA/az, then spin at 1,300 rpm for 5 min.
Aspirate or flick medium off.
Resuspend/stain with 100 μl of Antibody mix: CD11b PerCP-Cy5.5, CD11c PE-Cy7, CD19 APC-Cy7, and CD3 APC (1:100 Ab in PBSA/az) to the stimulated splenocyte samples.
Add 100 μl of PBSA/az to the single stain controls, then add 1 μl of each of these single stain Ab: CD8 FITC, CD8 PE, CD4 PerCP-Cy5.5, CD8 PE-Cy7, CD19 APC-Cy7, and CD8 APC.
Incubate on ice in dark (or wrap in foil) for 20 min.
Add 100 μl PBSA/az, then spin at 1,300 rpm for 5 min.
Aspirate or flick medium off.
Resuspend with 100 μl of BD cytofix/cytoperm solution to all wells.
Incubate on ice in dark for 20 min.
Add 100 μl of 1x BD Perm wash (dilute 10x Perm wash in dH2O) to all wells.
Spin at 1,300 rpm for 5 min, then aspirate or flick medium off.
Resuspend/wash once with 200 μl of 1x BD Perm wash by pipetting up and down a few times to all wells.
Spin at 1,300 rpm for 5 min, then aspirate or flick medium off.
Resuspend/stain with 50 μl of Antibody mix: TNF FITC and IL-12/IL-23p40 PE (1:100 Ab in 1x perm wash) to the stimulated splenocyte samples (add 50 μl of 1x perm wash to the single stain controls).
Incubate on ice in dark for 30 min.
Add 150 μl 1x perm wash to all wells, then spin at 1,300 rpm for 5 min.
Aspirate or flick medium off.
Resuspend/wash once with 200 μl 1x perm wash by pipetting up and down a few times to all wells.
Spin at 1,300 rpm for 5 min, then aspirate or flick medium off.
Resuspend in final volume of 200 μl of 1% Paraformaldehyde solution (dilute 10% Paraformaldehyde in 1x PBS).
Store at 4 °C in dark (or wrapped in foil) until ready for Flow Cytometry (recommended to store no longer than 24 h) – transfer samples from 96-well plate into titer tubes immediately prior to FACS.
Flow Cytometry
On the BD FACS Canto I software, select for a 'New Experiment' to set up.
Select for Area, Height, Width for FSC and SSC; select for Log and Area for the colors FITC, PE, PerCP/Cy5.5, PE/Cy7, APC/Cy7, and APC (under Inspector box).
Create compensation controls and adjust the gating for unstained splenocytes (adjust FSC and SSC voltages as necessary).
Adjust each color of single stains in the voltage panel so that the positive peak is at the 104 mark.
For single stains, use anti-CD4 for PerCP/Cy5.5, anti-CD19 for APC/Cy7, and anti-CD8 for FITC, PE, PE/Cy7, and APC, see Figure 1 for example.
Figure 1. Example of single stain controls. Splenocytes were stained with the single antibodies listed under IV-5 and voltages adjusted to give depicted histograms.
Record the desired voltages after any adjustments for each of the single stains and unstain, then calculate compensation controls.
Events are now ready to be recorded – set up to collect 500,000 – 1,000,000 events.
Recipes
10x Phosphate buffered saline (PBS) (for 1 L)
75 g NaCl
2 g KCl
2 g KH2PO4
11.5 g Na2HPO4
1 ml 10 N NaOH
pH to 7.4 and autoclave
1x PBSA/azide (for 1 L)
Dilute 10x PBS to 1x PBS using ddH2O
10 g BSA
18 ml of 5% NaN3 (final concentration = 0.09% sodium azide)
Filter sterilize
RBC Lysis buffer
0.15 M NH4Cl
1 mM NaHCO3
0.1 mM EDTA dissolved in sterile irrigation water
pH to 7.2-7.4 with 1 M HCl
Filter sterilize
Culture medium
RPMI 1640 Medium (with glutamax, HEPES, Phenol red)
10% FBS
5 ml Pen/Strep
5 ml 5 mM beta-ME
Brefeldin A
Received as 25 mg of dry powder
Dissolve in ethanol to 2 mg/ml and aliquot into dark eppendorf tubes (light sensitive)
Store at -20 °C
References
Hajjar, A. M., Ernst, R. K., Fortuno, E. S., 3rd, Brasfield, A. S., Yam, C. S., Newlon, L. A., Kollmann, T. R., Miller, S. I. and Wilson, C. B. (2012). Humanized TLR4/MD-2 mice reveal LPS recognition differentially impacts susceptibility to Yersinia pestis and Salmonella enterica. PLoS Pathog 8(10): e1002963.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Yam, C. S. and Hajjar, A. M. (2013). Whole Spleen Flow Cytometry Assay. Bio-protocol 3(15): e834. DOI: 10.21769/BioProtoc.834.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Cytokine
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Flow Cytometry Analysis of Microglial Phenotypes in the Murine Brain During Aging and Disease
Jillian E. J. Cox [...] Sarah R. Ocañas
Jun 20, 2024 1048 Views
Quantification of Proliferating and Mitotically Active Retinal Cells in Mice by Flow Cytometry
Hope K. Vanzo-Sparks [...] Cindy L. Linn
Jul 5, 2024 504 Views
Flow-based In Vivo Method to Enumerate Translating Ribosomes and Translation Elongation Rate
Mina O. Seedhom [...] Jonathan W. Yewdell
Jan 20, 2025 1021 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
835 | https://bio-protocol.org/en/bpdetail?id=835&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Maize Kernels – Fixation in FAA, Embedding, Sectioning and Feulgen Staining
Aleš Kladnik
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.835 Views: 17067
Reviewed by: Tie Liu Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in Plant Physiology Nov 2013
Abstract
The protocol describes preparation of young developing maize kernels for microscopical analysis of nuclei in tissue sections. The fixative FAA (formaldehyde, acetic acid and ethanol) is suitable for preservation of nuclear morphology and allows for quantitative staining of DNA with Schiff reagent in Feulgen staining. The fixation and embedding protocol may be used also for various other histology staining procedures, but care must be taken as the cytoplasm usually shrinks a bit using this procedure. The protocol was used for analysis of seed development of various maize lines, mutants and maize relatives (Vilhar et al., 2002; Kladnik et al., 2006; Dermastia et al., 2009; Bernardi et al., 2012).
Keywords: Plant biology Histology Fixation DNA staining Seed
Materials and Reagents
Maize Kernels
At different developmental stages; kernels up to 20 days after pollination (DAP) usually fix and section well, at later stages the endosperm becomes progressively dry and hard, causing the sections to crumble and tear while sectioning on the microtome
Paraplast Plus (Pelco, catalog number: 18393 ; Sherwood Medical, catalog number: 8889-502005; or Sigma-Aldrich, catalog number: P3683 )
Glacial acetic acid (Sigma-Aldrich, catalog number: A6283 )
Formaldehyde solution (histological grade, 37 wt.% in H2O) (Sigma-Aldrich, catalog number: 533998 )
Ethanol (96% and absolute)
Tert-butanol (TBA) (Sigma-Aldrich, catalog number: B85927 )
Pararosaniline hydrochloride (Sigma-Aldrich, catalog number: P3750 )
Potassium metabisulfite (K2S2O5) (Sigma-Aldrich, catalog number: 31268 )
Xylene (Xylenes, histological grade) (Sigma-Aldrich, catalog number: 534056 )
5 M HCl (Merck-Millipore, catalog number: 1099110001 )
Decolorizing charcoal (BDH, GB) (Sigma-Aldrich, catalog number: 161551 )
DPX mounting medium (Sigma-Aldrich, catalog number: 0 6522 )
Formaldehyde – acetic acid – ethanol (FAA) (see Recipes)
Dehydrating solutions (see Recipes)
Schiff reagent (see Recipes)
Equipment
Glass vials (volume ~20 ml)
Glass fiber filters (Microfibre filters, Whatman GF/C)
Scalpels, razor blades
Metal forceps (use dedicated forceps for wax work, they are difficult to clean)
Disposable plastic Pasteur pipettes
Vacuum desiccator (Bel-Art, model: 420100000 )
Staining dishes (for melting Paraplast Plus) (Electron Microscopy Sciences, catalog number: 70312-21 )
Hot plate (set on low – around 68 °C), with aluminum foil tent to keep the heat inside
Alcohol burner
Plastic or metal molds
Disposable Base Mold (Pelco, catalog number: 27147 )
Tissue-Tek Base Mold (Sakura, catalog number: 4123 )
Tissue embedding cassette bases (Pelco, catalog number: 27168-1 ) or embedding rings (Pelco, catalog number: 27169-1 ) or Tissue-Tek Embedding Rings (Sakura, catalog number: 4151 )
Small beaker with molten Paraplast Plus (dedicated for wax work)
Tray with a thin layer of cold water (cool it by adding ice)
Ice bucket filled with ice
Flat ice packet (frozen cooling pack) or brass plate (optional)
Rotary microtome
Disposable microtome blades
Small brush
Forceps with sharp ends
Single-edged razorblade
Dark cardboard plate
Stereomicroscope
Coplin jars (Electron Microscopy Sciences, catalog number: 70316-02 )
Procedure
Fixation in FAA
Aliquot FAA fixative in glass vials (~20 ml vials, 10 ml fixative). Keep vials on ice, fixative should be cold when you put tissue in. Cut tissue with a scalpel or razor blade into pieces, that have at least one dimension smaller than 2 or 3 mm, and immediately immerse in cold fixative.
Note: When cutting the tissue take into consideration the type of sections you wish to obtain.
Place open vials with fixed material in the vacuum desiccator and expose them to moderate vacuum for 15 min to pull the air out of the tissue. If the tissue doesn't sink when you release vacuum, apply and release the vacuum one more time. After vacuuming, replace fixative in vials with fresh fixative.
Fix overnight at 4 °C (refrigerator).
Dehydration in a series of TBA
Keep pure TBA (1 L) in a warm place before use (e.g. on the top of an incubation oven), it freezes below 25 °C. Prepare dehydration solutions and store solutions a – e on room temperature (RT) and f – h on the incubating oven.
Dehydrate tissue in each step for an hour to one day, depending on tissue size (6 DAP maize kernels for half a day, 12 DAP maize kernels for one day each step). Steps with dehydration solution a – e should be on RT, steps f – h in the incubation oven at 56-60 °C.
Use a plastic Pasteur pipette to pull the old solution from the vial, then replace with equal amount of next solution (you need a relatively much larger volume of dehydrating solution compared to your sample). Mark dehydration progress on the label on vial. Alternatively, you can pour the old solution out of the vial and replace with a new one (you don't need to completely drain the vial). Work in a fume hood. In the last change of TBA, fill the vial only to the half of the vial volume, so that you will leave enough room for the adding of the Paraplast Plus in the next step.
Embedding in paraffin (Paraplast Plus)
Keep molten Paraplast Plus and plastic pipettes in the incubation oven at 56-60 °C. You need a large stock of molten paraffin, because it takes a long time to melt (e.g. two rectangular histology staining dishes holding ~300 ml).
Add pellets of Paraplast Plus wax in vials half filled with TBA. Alternatively, you can add equal volume of molten wax to the TBA in the vials. Paraplast Plus has a fine structure and additives (DMSO), which help in better penetration into the tissue, which is very important for trouble-free sectioning. Keep in 56-60 °C oven, with the vial cap attached and mix a few times, when the wax is completely melted. Leave in the oven overnight.
The next day, pour or pipette away the TBA/wax mixture in a waste container in a fume hood (you can make a small waste container out of aluminum foil). Add fresh molten wax, and leave in oven overnight with vials open, so that all the TBA evaporates. The next day change the wax with fresh one several times (use a warm transfer pipette or pour away), for example twice a day for two days.
Casting wax blocks
Set air condition in the lab on warmer (if it is too cold, the wax will solidify too quickly).
Equipment:
Hot plate (set on low – around 68 °C), with aluminum foil tent to keep the heat inside
Metal forceps (use dedicated forceps for wax work, they are difficult to clean)
Alcohol burner
Plastic or metal molds
Embedding rings or embedding cassete bases
A small beaker with molten Paraplast Plus (also has to be dedicated for wax work)
A tray with a thin layer of cold water (cool it by adding ice)
An ice buckets filled with ice
Flat ice packet (frozen cooling pack) or brass plate (optional)
Keep a small amount of molten wax in a beaker in the aluminium foil tent in the hot plate. We also protect the hot plate with a layer of aluminium foil to keep it clean from wax. If the plate is not precisely thermo-regulated check the plate temperature all the time – if it gets too hot to touch, you have to turn it off and then turn it on when the wax starts to solidify. Prolonged temperatures over 62 °C will damage Paraplast Plus. Also, if using metal molds, keep them on a hot plate before using them.
Take one vial with samples out of the oven at a time, and place it on the hot plate. Label the same number of embedding rings as the number of samples with a pencil or waterproof marker. Pour some wax in the mold, take one sample out of the vial with forceps warmed in a flame of alcohol burner.
Note: Be careful, just pass forceps through the flame for a short time, if smoke is coming off the forceps, they are too hot.
Orient the sample in the mold on the hotplate considering the type of sections you wish to obtain later. Carefully transfer the mold on the brass-plate/ice-packet or just on the table, so that the bottom layer of wax solidifies and fixes the sample in place. If the sample is difficult to position on the hot plate, you can position it now, when the bottom layer of wax is solid. Fill the mold with molten wax to the edge, and cover with the labeled embedding ring. Then transfer the mold into the tray with cold water and ice and leave it there for about 10 min so that wax solidifies completely. Then put the mold on the ice, wait for a few minutes and then remove the wax block from the mold (the cooling with ice helps the block getting loose from the mold). Put the mold back on a hotplate to re-use it. We usually process 5 to 10 blocks at a time. Store the blocks in the refrigerator at 4 °C (see Figure 1).
Figure 1. Schematic drawing of workplace organization for embedding tissue samples in paraffin.
Sectioning
Equipment:
Rotary microtome
Disposable microtome blades
A small brush
A forceps with sharp ends
A single-edged razorblade
Dark cardboard plate (for putting the sections on and observing them)
A stereomicroscope (optional but recommended)
Hot plate set on 40 °C
A small jar with distilled water
A plastic pipette
Cleaned objective microscope slides, frosted on one edge
A pencil
Trim the wax block around the sample with a single-edged razor blade so that the upper and lower edges are parallel, and the left and right edges are at an angle, so that the lower edge of the block is longer than the upper. Also the sides of the block should not be vertical but inclined – always cut the block with the razor blade away from the sample in clean cuts from the top to the bottom of the block (see Figure 2).
Figure 2. Sectioning paraffin-embedded tissue samples. Top: Directions of trimming the paraffin around the sample. Bottom: sectioning on the microtome and arranging the sections on a slide.
Fix the embedding ring with the sample in the sample holder on the microtome. Set the thickness of sections (usually 10 to 20 μm) and the cutting angle (around 7 degrees). Start sectioning; the first few sections won't be good, so remove them with a small brush, always away from the blade, not towards it! When the surface of the sample evens, the ribbon will start forming. Cut enough sections to fit them on a dark cardboard, and cut the ribbon with a razor blade. Cut several ribbons, until you are sure that you have cut the region of interest, and then look at the sections with a stereomicroscope, to locate the interesting sections (e.g. median longitudinal sections of the kernel).
Label the objective slides with a pencil, put them on a hot plate (at 40 °C) and apply some water on them (to almost cover them). Cut the ribbon in smaller regions with two or three sections, and apply two sets of sections on each slide (one will be used for the experiment and the other will serve as a control). The water area should be larger than the size of the ribbon, so the sections have room to spread and even out. Optionally you can drain excess water from the slides using filter paper. Leave the sections on the hot plate overnight to dry and attach to the slides. Store them in slide boxes on room temperature or in the refrigerator at 4 °C.
Feulgen staining
The Feulgen reaction (Feulgen and Rossenbeck, 1924) quantitatively stains DNA. The nuclei become purple, while the rest of the cell is clear. The staining is done in Coplin jars (the volume of staining solution is 40 ml). Sections on objective slides are dewaxed in xylene, rehydrated through an ethanol series to water, hydrolyzed in 5 M HCl for 75 min at 20 °C, stained with Feulgen reagent for 120 min at 20 °C, washed for 45 min in six changes of SO2-water, dehydrated in an ethanol series, then mounted in DPX mounting medium.
Feulgen staining protocol (adapted from Greilhuber and Ebert, 1994)
Rehydration
100% xylene
RT
Date of solution preparation:
100% xylene
5 min/step
Feulgen:
absolute ethanol
HCl:
96% ethanol
SO2 water:
70% ethanol
Xylene:
30% ethanol
Ethanols:
distilled water
Hydrolysis
5 M HCl
20 °C
75 min for FAA fixed
(in a water bath)
____ min
Paraplast embedded
samples
distilled water
4 °C
(cold water stops hydrolysis)
5 min
Feulgen
Feulgen
20 °C
Staining
(water bath)
120 min
Washing
SO2 water
RT
250 ml SO2 water
(work in fume hood!)
3 x 2 min
247.5 ml dH2O
2 x 10 min
2.5 ml 5 M HCl
20 min
1.25 g K2S2O2
Dehydration
distilled water
RT
30% ethanol
5 min/step
70% ethanol
96% ethanol
absolute ethanol
100% xylene
100% xylene
Mounting
DPX + cover slip
Recipes
FAA (200 ml)
100 ml 95% ethanol
70 ml dH2O
20 ml 37% formaldehyde solution
10 ml glacial acetic acid
Store at 4 °C
Dehydrating solutions (for 100 ml each)
10 ml TBA, 40 ml 95% ethanol, 50 ml dH2O
20 ml TBA, 50 ml 95% ethanol, 30 ml dH2O
35 ml TBA, 50 ml 95% ethanol, 15 ml dH2O
55 ml TBA, 45 ml 95% ethanol
75 ml TBA, 25 ml 95% ethanol
100 ml TBA
100 ml TBA
100 ml TBA
Schiff reagent (Feulgen stain)
Boil 800 ml of dH2O. Add 4 g of pararosaniline hydrochloride and dissolve while mixing. Cool to 50 °C. Filter the solution through 2 glass fiber filters using vacuum. Add 120 ml 1 M HCl and 12 g K2S2O5. Leave the solution overnight in the dark at room temperature. Add 2 to 4 g decolorizing charcoal in the solution and mix. Filter the solution through 2 glass fiber filters using vacuum into a dry bottle (the stain must be clear and colorless). Store Schiff reagent in the refrigerator at 4 °C for up to 1 year (use until precipitate starts forming in the reagent)
Acknowledgments
The author acknowledges the Slovenian Research Agency for funding support.
References
Bernardi, J., Lanubile, A., Li, Q. B., Kumar, D., Kladnik, A., Cook, S. D., Ross, J. J., Marocco, A. and Chourey, P. S. (2012). Impaired auxin biosynthesis in the defective endosperm18 mutant is due to mutational loss of expression in the ZmYuc1 gene encoding endosperm-specific YUCCA1 protein in maize. Plant Physiol 160(3): 1318-1328.
Dermastia, M., Kladnik, A., Dolenc Koce, J. and Chourey, P. S. (2009). A cellular study of teosinte Zea mays subsp. parviglumis (Poaceae) caryopsis development showing several processes conserved in maize. Am J Bot 96(10): 1798-1807.
Feulgren, R. and Rossenbeck, H. (1924). Mikroskopisch-chemischer Nachweis einer Nucleinsaure vom Typus der Thymonucleinsaure und die-darauf beruhende elektive Farbung von Zellkernen in mikroskopischen Praparaten. Hoppe-Seyler′s Zeitschrift für physiologische Chemie 135(5-6): 203-248.
Greilhuber, J. and Ebert, I. (1994). Genome size variation in Pisum sativum. Genome 37(4): 646-655.
Kladnik, A., Chourey, P. S., Pring, D. R. and Dermastia, M. (2006). Development of the endosperm of Sorghum bicolor during the endoreduplication-associated growth phase. J Cereal Sci 43(2): 209-215.
Vilhar, B., Kladnik, A., Blejec, A., Chourey, P. S. and Dermastia, M. (2002). Cytometrical evidence that the loss of seed weight in the miniature1 seed mutant of maize is associated with reduced mitotic activity in the developing endosperm. Plant Physiol 129(1): 23-30.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Kladnik, A. (2013). Maize Kernels – Fixation in FAA, Embedding, Sectioning and Feulgen Staining. Bio-protocol 3(15): e835. DOI: 10.21769/BioProtoc.835.
Bernardi, J., Lanubile, A., Li, Q. B., Kumar, D., Kladnik, A., Cook, S. D., Ross, J. J., Marocco, A. and Chourey, P. S. (2012). Impaired auxin biosynthesis in the defective endosperm18 mutant is due to mutational loss of expression in the ZmYuc1 gene encoding endosperm-specific YUCCA1 protein in maize. Plant Physiol 160(3): 1318-1328.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > Morphogenesis
Cell Biology > Cell staining > Nucleic acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Quantitative Live Confocal Imaging in Aquilegia Floral Meristems
Ya Min [...] Elena M. Kramer
Jun 20, 2022 2128 Views
Modified Pseudo-Schiff Propidium Iodide for Staining the Shoot Apical Meristem in Arabidopsis
Ruiqi Li [...] Ligeng Ma
May 5, 2023 980 Views
A Novel Imaging Protocol for Investigating Arabidopsis thaliana Siliques and Seeds Using X-rays
Brylie A. Ritchie [...] Ansul Lokdarshi
Oct 5, 2023 884 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
836 | https://bio-protocol.org/en/bpdetail?id=836&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transfection of Human Naive CD4+ T Cells with PHA Activation and Neon Electroporation
Amy Palin
DL David B. Lewis
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.836 Views: 17055
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Immunology Mar 2013
Abstract
Transfection of primary T cells can be challenging. This protocol describes a method to transfect primary human naive CD4+ T cells with an AP-1 luciferase reporter using low-level activation by phytohemagglutinin (PHA) and electroporation, as published (Palin et al., 2013). This technique is a modification of one previously described by our group (Cron et al., 2013). Anyone wishing to transfect murine T cells should consult the publication by Cron et al., 2013. This technique may be adapted for other primary T cell types by optimizing the Neon electroporation conditions, as described in the text. Other luciferase or GFP reporters may be used, and will require optimization of the stimulation conditions for that particular reporter.
Keywords: Human CD4+ T cells Transfection Electroporation Luciferase reporter GFP reporter
Materials and Reagents
Human blood or peripheral blood mononuclear cells (PBMCs), collected using heparin (1 ml per 60 ml of blood as an anti-coagulant)
Heparin (Sigma-Aldrich, catalog number: H3393 )
Ficoll-Hypaque (GE Life Sciences, catalog number: 17-1440-02 )
Human MACS Naive CD4+ T cell II Kit (Miltenyi Biotec, catalog number: 130-094-131 )
BSA (Thermo Fisher Scientific, catalog number: SH30574 )
PBS (Life Technologies, InvitrogenTM, catalog number: 10010 )
RPMI medium (Life Technologies, InvitrogenTM, catalog number: 11875093 )
Heat-inactivated fetal bovine serum (FBS) (Atlanta Biologicals or other supplier)
Hank's balanced salt solution without calcium or magnesium (HBSS) (Life Technologies, InvitrogenTM, catalog number: 14170161 )
PHA (Sigma-Aldrich, catalog number: 61764 )
Neon Transfection System 100 μl kit (Life Technologies, InvitrogenTM, catalog number: MPK10096 or MPK10025 )
Aqua Amine Live/Dead discriminator (Life Technologies, InvitrogenTM, catalog number: L34957 )
7AAD (BD Biosciences, catalog number: 559925 )
Anti-CD3+ anti-CD28- coated Dynal beads (Life Technologies, InvitrogenTM, catalog number: 11131D )
Ionomycin (Sigma-Aldrich, catalog number: I3909 )
Phorbol myristate acetate (PMA) (Sigma-Aldrich, catalog number: P8139 )
One Glo luciferase reagent (Promega Corporation, catalog numbers: E6110 , E6120 , or E6130 )
AP-1-luciferase reporter (as described in Vaysberg et al., 2008)
Note: This plasmid consists of a pGL3 backbone (Promega Corporation, catalog number: E1751) with 5 copies of the AP-1 binding site from the metallothionein promoter inserted into the human IL2 minimal promoter.
pEGFP-N1 (Clonetech) or equivalent GFP-expressing plasmid
Beta-actin (b-actin)-driven luciferase reporter plasmid, or other highly expressing luciferase reporter
Note: Use of a renilla luciferase-expressing plasmid is not recommended in this assay, as we found it interferes with the firefly luciferase signal.
CD3-Alexa700 (eBiosceince, catalog number: 56-0037-42 )
CD4-PE-Cy7 (BD Biosciences, catalog number: 557852 )
CD4-PE (Life Technologies, InvitrogenTM, catalog number: MHCD0404 )
CD45RA–PacificBlue (Life Technologies, InvitrogenTM, catalog number: MHCD45RA28 )
CD45RO-PerCp-Cy5.5 (BD Biosciences, catalog number: 560607 )
CD4RA-APC (Life Technologies, InvitrogenTM, catalog number: MHCD45RA05 ) or Alexa647 (BD Biosciences, catalog number: 562763 )
CD25-APC (Life Technologies, InvitrogenTM, catalog number: MHCD2505 )
CD40L-FITC (BD Biosciences, catalog number: 555699 )
CD62L-PE (BD Biosciences, catalog number: 555544 )
CD69-PE-Cy5 (Life Technologies, InvitrogenTM, catalog number: MHCD6906 )
MACS buffer (see Recipes)
Equipment
96-well round-bottom sterile tissue culture plates (BD Biosciences, catalog number: 353077 or equivalent)
96-well white-wall, flat-bottom plates (BD Biosciences, catalog number: 353296 or equivalent)
MACS LS columns (Miltenyi Biotec, catalog number: 130-042-401 )
Neon Transfection System (Life Technologies, InvitrogenTM, model: MPK5000 )
Dynal magnet (Life Technologies, InvitrogenTM, model: 12321D )
Luminometer with 96-well plate capability (any manufacturer)
MACS midi magnets (Miltenyi Biotec, model: 130-042-302 )
Flow cytometer (BD LSR II or similar)
Procedure
Note: All centrifugation steps in 15 or 50 ml conical tubes should be performed at 450 x g for 10 minutes in a general-purpose centrifuge. All centrifugation steps in eppendorf tubes should be performed at 800 x g for 5 min in a microfuge.
Subject blood to standard Ficoll-Hypaque density gradient centrifugation; harvest interface layer and wash twice in HBSS, and purify with MACS Hunan Naive CD4+ II Kit and LS columns. Collect the flow-through; this is the naive CD4+ T cell fraction. Do not add EDTA to MACS buffer; use only 0.5% BSA in sterile PBS. Count cells. Resuspend in RPMI and centrifuge 540 x g for 10 minutes in general purpose centrifuge. You will need at least 1 x 106 cells for each plasmid to be transfected. To allow for extra volume, stimulate a minimum 1.2 x 107 cells. See Table 1 for a breakdown of cell number requirements.
Table 1. Plasmids and number of replicates
Plasmid
Number of Replicates
AP-1 luciferase reporter
5
b-actin luciferase reporter
1
pEGFP reporter
1
No plasmid (mock)
3
Dilute PHA to 2.5 μg/ml in RPMI/10% FBS (no PSG). Concentration should be optimized for each PHA source in terms of transfection efficiency and low expression of activation markers. Resuspend cells in PHA/RPMI at 1 x 106 cells/100 μl. Leave 1 x 106 cells unstimulated for FACS analysis of activation markers.
Activate cells for 19.5-20 h at 37 °C in a humidified 5% CO2 containing incubator. Set concurrent timers for 19.5 and 20 h. If you are doing more than 10 transfections, stagger the start of the stimulations by at least half an hour to allow enough time to finish transfections by 20 h. The samples must be transfected between 19.5 and 20 h after PHA stimulation.
Before 19.5 h is up, add DNA plasmids to Eppendorf tubes (2.0 μg/1 x 106 cells), as shown in Table 2. Aliquot 1.0 ml RPMI/10% FBS (no antibiotics) to wells of a 24 well plate (one well for each transfection reaction), and keep at 37 °C until ready to transfect. Add 3.0 ml Neon buffer E (included in Neon kit) to transfection chamber.
Table 2. Volumes for transfections
Transfection
DNA
Final volume
Total number of
reactions
buffer T
cells necessary
1
3.0 μg
150 μl
1.5 x 106
2
5.0 μg
250 μl
2.5 x 106
3
7.0 μg
350 μl
3.5 x 106
n
2 n + 1 μg
100 n + 50 μl
n x 106 + 5 x 105
At 19.5 h, begin washing cells in PBS by centrifuging for 800 x g for 5 min in microfuge. Resuspend cells in Neon buffer T (106 cells/100 μl, see Table 2). Prepare at least 50 μl extra volume for each tube. Not allowing extra volume will introduce air bubbles into the Neon pipette, which will disrupt the transfection.
Make sure to finish transfections by 20 h. Set the Neon for 2,400 V, 2 pulses, 12 ms. For other human T cell subsets, these parameters should be optimized as described in the Neon manual.
Electroporate 100 μl at a time. Check tip to make sure there are no bubbles in the Neon tip, and watch for sparks. If a sample sparks, omit it and do not reuse that tip. Use tips no more than twice. Add each electroporation/transfection reaction (100 μl) to 1 well of 24 well plate. Repeat electroporation until finished. Work quickly to maintain consistency. To assess viability, you may electroporate one sample in the absence of plasmid.
Incubate cells for 24 h in 37 °C/5% CO2 incubator.
After 24 or 48 h of activation, stain cells for activation markers. Stain one unstimulated sample and one PHA-stimulated sample. Include aqua amine live/dead discriminator. To stain, pellet 1 x 106 cells in an eppendorf tube (800 x g, 5 min in microfuge), wash with PBS and follow manufacturer's instructions for aqua amine staining. Wash cells in MACS buffer and resuspend in a total volume of 100 μl MACS buffer with antibodies as listed below. Incubate for 10 minutes at room temperature, wash with 1.0 ml of MACS buffer, and resuspend in 1% paraformaldehyde in MACS buffer. Suggested antibodies and fluorophores are listed in the Table 3. This staining combination may be adapted according to the capability of the available flow cytometer.
Table 3. Suggested staining for activation markers
Epitope
Fluorophore
Volume/106 cells
CD3
Alexa700
2.5 μl
CD4
PE-Cy7
10 μl
CD45RA
PacificBlue
2.5 μl
CD45RO
PerCp-Cy5.5
10 μl
CD25
APC
2.5 μ
CD69
PE-Cy5
2.5 μl
CD40L
FITC
10 μl
CD62L
PE
10 μl
Gate on lymphocytes, aqua amine- cells, singlets. To assess purity, gate on CD3+ CD4+ then CD45RA+ CD45RO- cells. To identify the percentage of cells that are not activated in the PHA-stimulated sample, use the unstimulated sample to set gates using a histogram plot for CD25-, CD69-, CD40L-, and CD62L+. See Figure 1 for gating strategy.
Figure 1. Analysis of sample purity and activation by flow cytometry. Top row: unstimulated sample stained for purity. Bottom row: Overlays of unstimulated (gray) and PHA-stimulated samples (black) stained for activation markers as indicated, and gated on naive CD4+ T cells as indicated.
At 24 h after transfection, activate cells for measurement of AP-1 activity. Wash anti-CD3+anti-CD28-coated Dynal beads with 1 ml RPMI/10% FBS. Leave tube containing beads on magnet for 1 minute before aspirating medium, while leaving tube containing beads on magnet. Remove from magnet, add 1 ml medium, and repeat for a total of 3 washes. Prepare 25 μl beads per 106 cells, plus enough for 1 extra sample. Resuspend in 4x original volume (e.g. 100 μl RPMI/10% FBS per 25 μl beads originally used).
Dilute and combine PMA and ionomycin to working concentrations of 50 ng/ml PMA and 250 nM ionomycin. Make a total volume of 1 ml.
Transfer transfected cells to eppendorf tubes and pellet (800 x g, 5 min in microfuge). Leave one replicate of unstimulated cells. Do not combine replicates. Aspirate supernatants and resuspend in 550 μl RPMI/10% FBS. Aliquot 100 μl per well and transfer to 96 well round-bottom plate. Split transfection replicates across rows for 5 wells each replicate. Pellet cells by centrifuging at 450 x g for 10 min and aspirate supernatants.
Note: To avoid this step, you may resuspend cells in 225 μl RPMI/10% FBS and prepare 2x working stocks of all stimulation reagents described above. In this case, aliquot 50 μl of cells per well according to the diagram below and add 50 μl of medium containing stimulation reagents.
Resuspend each well in 100 μl medium containing appropriate stimulation agents and transfer to a 96 well white-wall plate on ice. See Table 4 for layout and diagram of distribution of replicates.
Use RPMI/10% FBS for unstimulated samples, and for b-actin-luciferase-transfected sample. There is room for additional stimuli, such as anti-CD3 alone. If using soluble antibodies, use a secondary cross-linking antibody.
Table 4. Sample plate layout for stimulation
1
2
3
4
5
6
7
8
9
10
11
12
A
AP-1 (1)
medium
CD3+CD28 Dynal beads
Iono. + PMA
B
AP-1 (2)
medium
CD3+CD28 Dynal beads
Iono. + PMA
C
AP-1 (3)
medium
CD3+CD28 Dynal beads
Iono. + PMA
D
AP-1 (4)
medium
CD3+CD28 Dynal beads
Iono. + PMA
E
AP-1 (5)
medium
CD3+CD28 Dynal beads
Iono. + PMA
F
Untransfected
medium
medium
medium
medium
medium
G
b-actin-luc
medium
medium
medium
medium
medium
H
Once all stimulation reagents have been added, remove plate from ice and incubate for 4 h at 37 °C, 5% CO2.
During stimulation incubation, assess transfection efficiency by staining one untransfected sample and the pEGFP-transfected sample with 2.5 μl of anti-CD4-PE and 2.5 μl of anti-CD4RA-APC or Alexa-647. After staining, add 5 μl 7AAD to each sample to assess viability. This is detected on the PE-Cy5 channel. Do not fix these samples. Transfection efficiency is expected to range between 5 and 40% of live (7AAD-), CD4+ CD45RA+ cells. Set EGFP+ gate at top 1% of untransfected cells. See Figure 2.
Figure 2. Assessment of viability and transfection efficiency by flow cytometry. Top: mock-transfected sample gated on live cells (7AAD-), then lymphocytes, and CD4+ CD45RA+ cells. Bottom: Measurement of transfection efficiency by %EGFP+ in population described in top row. EGFP+ gate is set at top 1% of signal from mock-transfected cells.
Prepare Promega One-Glo reagent according to the manufacturer's instructions, or thaw an aliquot covered in foil. You will need 100 μl per well. At 4 h after stimulation, remove plate from incubator and add 100 μl One-Glo reagent per well using a multi-channel pipette. Cover with foil and incubate for 3 min.
Note: There is no need to remove Dynal beads as these do not affect the luciferase reading (A. Palin, unpublished data). Read on a luminometer with a 1 sec read per well. One Glo reagent does not require the use of injectors. Include an empty well as a control for background from the plate.
To analyze data, subtract absorbance values for unstimulated samples, pairing the transfection replicates (i.e. subtract A1 value from A2 or A3; B1 from B2 or B3, etc.). Divide instead of subtract to calculate fold change. The untransfected control gives background fluorescence from the cells and the b-actin luciferase signal is a control for luciferase activity. This will be significantly higher than the stimulated cells. The anti-CD3+CD28- stimulated cells give a measure of the upregulation of AP-1 in response to TCR engagement and co-stimulation, while the ionomycin + PMA serves as a measure of the capacity of the cell to induce AP-1. To compare between two sample types or two groups, use the average of the 5 stimulated replicates minus the unstimulated replicates and an unpaired student's t-test.
Recipes
MACS buffer
1x PBS
0.5% BSA
Sterilize by vacuum filtration.
Note: Do not include EDTA in this buffer, as it may interfere with T cell receptor signaling.
References
Cron, R. Q., Schubert, L. A., Lewis, D. B. and Hughes, C. C. (1997). Consistent transient transfection of DNA into non-transformed human and murine T-lymphocytes. J Immunol Methods 205(2): 145-150.
Palin, A. C., Ramachandran, V., Acharya, S. and Lewis, D. B. (2013). Human neonatal naive CD4+ T cells have enhanced activation-dependent signaling regulated by the microRNA miR-181a. J Immunol 190(6): 2682-2691.
Vaysberg, M., Hatton, O., Lambert, S. L., Snow, A. L., Wong, B., Krams, S. M. and Martinez, O. M. (2008). Tumor-derived variants of Epstein-Barr virus latent membrane protein 1 induce sustained Erk activation and c-Fos. J Biol Chem 283(52): 36573-36585.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Palin, A. and Lewis, D. B. (2013). Transfection of Human Naive CD4+ T Cells with PHA Activation and Neon Electroporation. Bio-protocol 3(15): e836. DOI: 10.21769/BioProtoc.836.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Lymphocyte
Molecular Biology > DNA > Transfection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Functional Phenotyping of Lung Mouse CD4+ T Cells Using Multiparametric Flow Cytometry Analysis
Céline M. Maquet [...] Bénédicte D. Machiels
Sep 20, 2023 1343 Views
T-Cell-Based Platform for Functional Screening of T-Cell Receptors Identified in Single-Cell RNA Sequencing Data Sets of Tumor-Infiltrating T-Cells
Aaron Rodriguez Ehrenfried [...] Rienk Offringa
Apr 20, 2024 3775 Views
Primary Neuronal Culture and Transient Transfection
Shun-Cheng Tseng [...] Eric Hwang
Jan 20, 2025 337 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
837 | https://bio-protocol.org/en/bpdetail?id=837&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Mouse Lung Epithelial Cells
AK Andrea L. Kasinski
FS Frank J. Slack
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.837 Views: 13350
Reviewed by: Lin FangSalma HasanFanglian He
Download PDF
Ask a question
Favorite
Cited by
Original Research Article:
The authors used this protocol in Cancer Research Nov 2012
Abstract
Although in vivo models are excellent for assessing various facets of whole organism physiology, pathology, and overall response to treatments, evaluating basic cellular functions, and molecular events in mammalian model systems is challenging. It is therefore advantageous to perform these studies in a refined and less costly setting. One approach involves utilizing cells derived from the model under evaluation. The approach to generate such cells varies based on the cell of origin and often the genetics of the cell. Here we describe the steps involved in generating epithelial cells from the lungs of KrasLSL-G12D/+;p53LSL-R172/+ mice (Kasinski and Slack, 2012). These mice develop aggressive lung adenocarcinoma following cre-recombinase dependent removal of a stop cassette in the transgenes and subsequent expression of Kra-G12D and p53R172. While this protocol may be useful for the generation of epithelial lines from other genetic backgrounds, it should be noted that the Kras; p53 cell line generated here is capable of proliferating in culture without any additional genetic manipulation that is often needed for less aggressive backgrounds.
Keywords: Mouse cells Kras P53 Cancer Lung
Materials and Reagents
Collagenase/Dispase (F. Hoffmann-La Roche, catalog number: 10269638001 )
PureCol Collagen I (Bovine-Fisher, catalog number: 50-360-230 )
Fibronectin (Life Technologies, Gibco®, catalog number: PHE-0023 )
Dulbecco's Phosphate-buffered saline (D-PBS)
RPMI-1640 with L-Glutamine (Life Technologies, Gibco®, catalog number: 11875-093 )
Fetal bovine serum (FBS) (from multiple vendors)
0.25% Trypsin-EDTA (1x) (Life Technologies, Gibco®, catalog number: 25200-056 )
Collagen Coating Mix (see Recipes)
Fibronectin Coating Mix (see Recipes)
1 mg/ml Collagenase (see Recipes)
Equipment
10 ml syringes
25 gauge needles
37 °C 5% CO2 cell culture incubator
Refrigerated centrifuge
Inverted microscope
Tissue culture hood equipped with UV light source
Vacuum aspirator
Procedure
Coating tissue culture plates
Plates are coated with collagen and fibronectin to facilitate cell adhesion acting as a cellular matrix. Fibronectin specifically aids in anchoring the cells to the collagen.
Prepare collagen coating mix under sterile conditions.
Add adequate volume of collagen coating mix to cover the bottom of the plate being coated (e.x. 5 ml/10 cm plate).
Leave plates covered overnight in the tissue culture hood under the UV light to prevent contamination.
The following day aspirate the coating mix.
Air-dry the plates in the tissue culture hood.
Rinse the plate 2x with D-PBS (2.5 ml/10 cm plate).
Air-dry plates in the tissue culture hood.
Cover the plates, seal with parafilm, and store at 4 °C until ready to coat with fibronectin (duration of storage has not been tested extensively; however, plates left at 4 °C for one week were successfully used).
Prepare fibronectin coating mix.
Add adequate volume of fibronectin mixture to cover the bottom of the plate being coated (e.x. 5 ml/10 cm plate).
Incubate coated plates at 37 °C overnight in 5% CO2 cell culture incubator.
The following day rinse the plates 2x with D-PBS (leave D-PBS in plates if not using immediately -do not allow plates to dry).
Extracting cells from Tumor tissue
Individual tumors, small areas of lung tissue, or entire lungs can be used to generate epithelial cells.
Sacrifice animals per the university/institute established animal care and use protocol.
Open up the thoracic cavity immediately after sacrifice.
Perfuse the lungs by slowly injecting 7-10 ml of D-PBS into the left ventricle of the heart using a 25 gauge needle and syringe. Successful perfusion will result in the lungs changing color from pink to white, representing displacing the RBCs.
Carefully remove the lungs and place them into D-PBS.
If large tumors are evident dissect them out and proceed; otherwise continue the procedure using the entire lung (see Figure 1 for lung tumors that can easily be harvested from the lung).
Figure 1. A KrasLSL-G12D/+; p53flx/flx mutant mouse was intratracheally infected with adenoviral particles expressing cre-recombinase to induce transgene recombination. Ten weeks following infection the mouse was sacrificed, lungs were perfused and harvested, and imaged. Multiple large tumor nodules are present on the surface.
Wash the tumors/lungs by rinsing the exterior 4x with D-PBS.
Mince the tissue in and equal volume ice-cold D-PBS with a sterile blade in tissue culture hood until the mass represents a slurry and few if any larger solid pieces are evident; however care should be taken to perform this step in a timely fashion to avoid cell death. The mincing step allows for easier retrieval of individual cells for propagating.
Add the minced tissue to an equal volume of RPMI-1640 supplemented with 1 mg/ml collagenase and incubate for 1 h at 37 °C in 5% CO2 cell culture incubator.
Remove cells intermittently from supernatant. Do not centrifuge. Let the larger pieces settle and remove the top-half of the supernatant containing individual cells every 10-15 min. Replenish RPMI/collagenase solution as needed and repeat 4-5 times.
Pool and spin the collected supernatant at 1,000 x g at 4 °C for 5 min.
Remove the supernatant and add 10 ml of RPMI-1640 supplemented with 10% FBS.
Remove the D-PBS from the collagen/fibronectin coated plates.
Immediately transfer the cell suspension to the coated plates being sure to supplement with additional RPMI-1640/10% FBS to cover the surface of the plate if necessary (10 ml/10 cm plate).
Incubate cells at 37 °C in 5% CO2 cell culture incubator.
Continue to passage on coated plates for three passages.
Selecting epithelial cells
Over the course of culturing select epithelial looking colonies. There are a few mechanisms to help in the selection process. Firstly, the fibroblasts are often more sensitive to trypsin and can therefore be removed from the plate while the epithelial cells will adhere for a longer time. This is done by treating the cells with trypsin and removing the first cells begin to slough off the plate as visualized under a microscope. This step helps to increase the epithelial cell population. Secondly, epithelial clones will become visible and are easily discernible from the fibroblast population.
Once epithelial clones are evident, the clones are treated directly with a small amount of trypsin (50 μl dispensed directly on the clone) and visualized under a microscope until they begin to round up. The cells are then abducted using a sterile transfer pipette. The bulb of the pipette is squeezed in and held in that position while the tip of the pipette is placed over the individual clone. Once in place the pressure on the bulb is released slowly to encourage the cells to enter into the pipette. The entire contents are then transferred to individual wells in 12-well standard tissue-culture treated plates to further propagate (to enhance visualization of the clones, allow clones to be followed, and increase the abduction step, once identified, clones can be circled on the bottom of the plate with a sharpie).
To confirm that cells are of epithelial origin stain with standard markers such as keratins. For the cells described here, keratin 14 was used.
Thus far, cells generated by this procedure have been able to propagate beyond 50 passages.
Note: It is inherently difficult to generate cultures of normal cells. All the cells that formed clones and were isolated by this procedure (irrespective of being generated from tumors or the whole lung) were confirmed to be mutant for Kras and p53. This procedure will specifically allow one to "select" for epithelial cells that can propagate outside of the organ.
Recipes
Collagen coating mix (10 ml)
Item
Final
Stock
Volume
Collagen
0.4 mg/ml
3 mg/ml in water
1.33 ml
D-PBS
8.67 ml
Fibronectin coating mix (10 ml)
Item
Final
Stock
Volume
Fibronectin
5 μg/ml
500 μg/ml in water
100 μl
Ice-cold-D-PBS
9.9 ml
1 mg/ml collagenase (2 ml)
Dilute collagenase stock in RPMI-1640
Add 20 μl of stock to 1980 μl of RPMI-1640.
Acknowledgments
The protocol presented herein was adapted from Kasinski and Slack (2012). This work was supported by an NIH grant to FJS and Joanne Weidhaas (NCI R01 CA131301). AK was supported by a US National Institutes of Health (NIH) grant (1F32CA153885-01) and an American Cancer Society Postdoctoral Fellowship (120,766-PF-11-244-01-TBG).
References
Kasinski, A. L. and Slack, F. J. (2012). MiRNA-34 prevents cancer initiation and progression in a therapeutically resistant K-ras and p53-induced mouse model of lung adenocarcinoma. Cancer Res 72(21): 5576-5587.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Category
Cancer Biology > General technique > Cell biology assays
Cell Biology > Cell isolation and culture > Cell isolation
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Isolation of Murine Alveolar Type II Epithelial Cells
Fan Sun [...] Zhaoxia Qu
May 20, 2017 11317 Views
Soft Agar Colony Formation Assay as a Hallmark of Carcinogenesis
Feng Du [...] Daiming Fan
Jun 20, 2017 28825 Views
A Fast and Reliable Method to Generate Pure, Single Cell-derived Clones of Mammalian Cells
Zhe Han [...] Varun Kumar
Aug 20, 2022 2586 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
838 | https://bio-protocol.org/en/bpdetail?id=838&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
EMSA Analysis of DNA Binding By Rgg Proteins
BL Breah LaSarre
MF Michael J. Federle
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.838 Views: 14033
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in mBio Nov 2012
Abstract
In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activitiesthat that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases).
Materials and Reagents
General chemicals
Non-specific DNA
e.g. Poly-dIdC (Sigma-Aldrich, catalog number: P4929 )
Sheared salmon sperm DNA (Amresco, catalog number: E213 )
BSA (10 mg/ml)
Polyacrylamide-bis (40%) for PAGE (e.g. Bio-Rad Laboratories, catalog number: 161-0146 )
Fluorescently-labeled and unlabeled primers for generation of DNA probe (e.g. IDT)
Protein of interest
4x binding buffer (see Recipes)
20x running buffer (see Recipes)
5% Polyacrylamide Gel (see Recipes)
Equipment
Mini-PROTEAN electrophoresis apparatus (Bio-Rad Laboratories)
Fluorescence imaging device (e.g. GE Life Sciences Typhoon PhophorImager )
Mini-PROTEAN casting system (Bio-Rad Laboratories)
Procedure
Procedure for generating fluorescently-tagged DNA probes
Obtain synthetic DNA oligo primers that will be used for PCR amplification of the target DNA of interest (we have had success using primers from IDT). Primers should be designed with the same strategy as general PCR primers (namely a length of 18-30 nt, melting temperatures of both primers in a pair being near 60 °C and within 3 °C of each other, and G + C content between 40%-60%, when possible). At least one of the primers must include a 5'-fluorescent tag (e.g. 6-carboxyfluorescein (6FAM)), but visualization sensitivity can be doubled if both primers are labeled. Generate the fluorescent DNA probe by a standard PCR protocol with any general polymerase enzyme. Probe sizes amenable to EMSA analysis can range from very small (25 bp) to very large (1,000 bp); however, probes between 100-500 bp work well in providing optimal resolution of DNA-protein complexes without requiring extensively long gel running times. If smaller probes are required, the gel percentage may need to be increased or the running time and/or voltage decreased.
Excess oligos and free nucleotides should be separated from the DNA probe using a standard PCR reaction clean-up kit or by gel purifying the product of interest. The DNA probe should be suspended in dH2O or preferred buffer.
The concentration of the probe should be determined using a spectrophotometer. A recommended working concentration is 200 nM (final concentration in EMSA reaction, 10 nM).
Store probes at -20 °C in the dark. Probes can be stored in the manner successfully for several months, although fluorescence intensity may begin to decrease after the first month.
Procedure for purifying Rgg protein of interest
We have been unable to identify a generic purification scheme compatible with various types of Rgg proteins. Solubility of expressed Rgg proteins varies greatly between homologs, necessitating individual optimization of buffer composition and affinity tag utilization. Examples of successful purification schemes can be found in the methods sections of the references provided below. Regardless of the method of purification, it should be mentioned that it is preferable to generate affinity-tagged Rgg's in such a way as to allow for removal the affinity tag from Rgg prior to use in EMSA assays, thereby helping to ensure that the tag is not interfering with the DNA-binding activity of the protein.
Procedure for EMSA
Cast a 5% non-denaturing polyacrylamide gel following the suggested recipe below. We have successfully used the Bio-Rad mini-PROTEAN casting system for these purposes.
Dilute the Rgg protein to the desired concentration(s) in a solution ensuring its solubility (e.g. storage or binding buffer). The optimal concentration range will depend on the Rgg protein, however serial dilutions resulting in final concentrations of 25-200 nM in the binding reactions should provide a good starting point for such optimization.
Prepare the reaction mixture containing the following components (can prepare master mix of as many components as are shared between all reactions). Dye should not be included in the reaction in order to avoid interference with binding. It should be also noted that control reactions (i.e. probe alone and control probe of DNA not expected to be recognized by the protein) will need to be included as additional lanes on the gel:
5 μl 4x Binding Buffer + DTT
X μl non-specific DNA*
3 μl 80% glycerol
2 μl 10x BSA*
1 μl 10 mM CaCl2*
Y μl dH2O
18 μl total volume
Note: The concentrations of the starred components will need to be determined empirically and may be altered or eliminated depending on the activity and DNA-binding specificity of the Rgg protein being used, but the quantities outlined above are good starting points (as is 0.001 U/ml poly-dIdC and 50 μg/ml salmon sperm DNA for non-specific DNA).
To above binding reaction, add 1 μl Rgg protein (or buffer as control).
To each reaction, add 1 μl fluorescently-labeled DNA probe.
Incubate reactions at room temperature (25 °C) for 30 min.
While the reactions are incubating, pre-run gel (no samples) at 100 V, 10 min, 4 °C in 1x running buffer (50 mM potassium phosphate pH 7.5) as the running buffer.
Load 5-10 μl of each reaction on the gel and run at 100 V at 4 °C. The run time should be optimized depending on the size of the DNA probe (for probes between 150-300 bp 60 min is sufficient). Additionally, dye can be run in an empty lane to help visualize migration through the gel (bromophenol blue and xylene cyanol run at approximately 65 nt and 260 nt, respectfully, on a 5% gel).
Transfer the gel to a fluorescence imaging device. We found that sandwiching gels between clear polypropylene sheet protectors was convenient for handling.
Note: The above binding reaction can be amended to include competitor DNA and/or signaling peptide by reducing the amount of dH2O in the reaction such that the total reaction volume remains 20 μl. Competitor DNA is often included at a concentration of 10-100 fold molar excess relative to the labeled probe, but will need to be optimized for each protein. If competitor DNA is added, add the DNA prior to or simultaneously with the probe. If signaling peptide is included, add the peptide (or empty vehicle as a control) 20 min after the incubation is started (10 min before loading the sample on the gel).
Recipes
4x binding buffer
80 mM HEPES (pH 7.9)
80 mM KCl
20 mM MgCl2
0.8 mM EDTA
2 mM dithiothreitol (added immediately before use)
20x running buffer
1 M potassium phosphate (pH 7.5)
Note: The easiest way to make this is to prepare separate 1 M stocks of both K2HPO4 and KH2PO4, then mix them until the desired pH is reached. Separately, it should be noted that we customarily use potassium phosphate buffer in our EMSAs and have successfully visualized DNA-binding by three different Rgg proteins using this system. However, should it be preferred, it is possible that Tris-based buffer systems would also yield successful results (if the running buffer is changed, the gel buffer will also need to be changed accordingly).
5% Polyacrylamide Gel (enough for 2 gels; can adjust the gel percentage as needed)
3.5 ml Acrylamide-bis (40%)
1 ml 1 M potassium phosphate (pH 7.5)
16.3 ml dH2O
200 μl 10% ammonium persulfate (make fresh)
20 μl TEMED catalyst
Note: Extra gels can be wrapped in saran wrap or damp paper towels and stored at 4 °C.
References
Chang, J. C., LaSarre, B., Jimenez, J. C., Aggarwal, C. and Federle, M. J. (2011). Two group A streptococcal peptide pheromones act through opposing Rgg regulators to control biofilm development. PLoS Pathog 7(8): e1002190.
LaSarre, B., Aggarwal, C. and Federle, M. J. (2013). Antagonistic Rgg regulators mediate quorum sensing via competitive DNA binding in Streptococcus pyogenes. MBio 3(6): e00333-12.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
LaSarre, B. and Federle, M. J. (2013). EMSA Analysis of DNA Binding By Rgg Proteins. Bio-protocol 3(15): e838. DOI: 10.21769/BioProtoc.838.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein > Interaction
Molecular Biology > DNA > DNA-protein interaction
Biochemistry > Protein > Interaction > EMSA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Combining Gel Retardation and Footprinting to Determine Protein-DNA Interactions of Specific and/or Less Stable Complexes
Meng-Lun Hsieh [...] Deborah M. Hinton
Dec 5, 2020 2332 Views
Assay for Assessing Mucin Binding to Bacteria and Bacterial Proteins
Lubov S. Grigoryeva [...] Nicholas P. Cianciotto
Mar 5, 2021 3345 Views
Large-scale Purification of Type III Toxin-antitoxin Ribonucleoprotein Complex and its Components from Escherichia coli for Biophysical Studies
Parthasarathy Manikandan [...] Mahavir Singh
Jul 5, 2023 413 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
839 | https://bio-protocol.org/en/bpdetail?id=839&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Subcellular Fractionation of Mouse Brain Homogenates
Ditte Olsen
CG Camilla Gustafsen
Published: Vol 3, Iss 15, Aug 5, 2013
DOI: 10.21769/BioProtoc.839 Views: 13719
Reviewed by: Xuecai Ge Anonymous reviewer(s)
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original Research Article:
The authors used this protocol in The Journal of Neuroscience Jan 2013
Abstract
This subcellular fractionation protocol is used for separation of cellular organelles based on their density. We have designed and optimized the protocol for separation of subcellular compartments of brain homogenates with focus on the localization and trafficking of transmembrane proteins, but we have also successfully used this protocol for fractionation of other types of tissue. The protocol has two major steps 1) preparation of homogenate from dissected tissue and 2) separation of organelles by centrifugation of homogenates using a continuous sucrose gradient.
Materials and Reagents
Mice
PBS
Phosphatase inhibitor (e.g. PhosStop) (F. Hoffmann-La Roche, catalog number: 04906845001 )
HEPES
EDTA
Distilled water
Glucose
Protease inhibitors (e.g. Complete) (F. Hoffmann-La Roche, catalog number: 11697498001 )
Solution A (see Recipes)
2.5 M sucrose stock (see Recipes)
Sucrose solution (0.8 M and 1.6 M) (see Recipes)
Equipment
A pair of scissor
A brain scooper
Falcon tubes (15 ml)
Centrifuge
Ultracentrifuge
Ultracentrifuge rotor (T70.1 Ti and Sw41Ti )
Ultracentrifuge tubes for T70.1 Ti rotor (Polycarbonate, 16 x 76 mm) (Beckman Coulter, catalog number: 355651 )
Ultracentrifuge tubes for SW41 Ti rotor (14 x 89 mm) (Seton Open-Top Polyclear centrifuge tubes, catalog number: 7030 )
Thomas® Teflon Pestle (A.H Thomas Co., model: 3431-E20 )
1 and 10 ml syringes
Needles (18 and 27 G)
Gradient Master 107 ip (BioComp, model: 107 ) with marker block and cannula
Refractometer
Procedure
Mouse is sacrificed by cervical dislocation; Restrain the mouse on a hard, flat surface. Hold a strong stick or metal rod firmly against the base of the skull, and the tail firmly with the other hand. Pull the mouse body away from the head in one single quick motion. Verify the dislocation by feeling for a separation between cervical vertebras.
Cut the head off the mouse, and open the skin of the head with a pair of scissor.
Open the skull of the mouse using a pair of scissor, and gently lift out the exposed brain using a brain scooper and transfer to ice-cold PBS.
Brains are quickly rinsed in ice-cold PBS.
Brains are put in 10 ml solution A containing proteinase inhibitors and continue to point 9 when all brains have been isolated.
Repeat steps 1-7 for the remaining mice.
The brains are homogenized using a Thomas® Teflon Pestle.
Transfer the homogenized brain tissue to a 15 ml Falcon tube.
Centrifuge at 1,000 x g for 10 min at 4 °C.
Transfer the supernatant (there are typically several layers of supernatant – take them all) to a new 15 ml Falcon tube.
Centrifuge at 3,000 x g for 10 min at 4 °C.
Transfer the supernatant to an ultracentrifugation tube.
Centrifuge at 13,000 rpm for 10 min using an ultracentrifuge with a T70.1 Ti rotor.
Transfer the supernatant to a new ultracentrifugation tube and centrifuge at 50,000 rpm for 45 min at 4 °C (using the same rotor (T70.1 Ti rotor) as previous step).
Note: During this centrifugation step, one can prepare the sucrose gradient.
Discard the supernatant.
Dissolve pellet in 600 μl solution A containing proteinase inhibitors. Use a 1 ml syringe with an 18 G needle first, thereafter a 27 G needle to dissolve pellet.
Carefully layer 500 μl of the homogenate (= dissolved pellet) on top of a continuous 0.8 to 1.6 M sucrose gradient and centrifuge at 25,000 rpm for 18 h/overnight, using a SW41 Ti swing bucket rotor.
Notes for preparation of the gradient:
The gradient is made with a Gradient Master 107 ip.
Insert a tube in the marker block and mark a line on the tube at the half-full mark for short, 4 mm cap.
Add 5.5 ml 0.8 M sucrose solution to the tube.
Add 1.6 M sucrose beneath the 0.8 M sucrose solution using a cannula (a cannula is received together with the Gradient Master) and a 10 ml syringe until the bottom of the 0.8 M sucrose solution reaches the recently marked line.
Adjust the level of the Gradient Master before use, to ensure that the plate is in level.
Prepare the 10-57% linear gradient, by choosing “SW41” in the ”gradient menu” list of BioComp Gradient Master. This program will mix the gradient at 50 degrees for 10 min, followed by 1 min at 80 degrees.
Next day the gradient is fractionated into 24 samples (500 μl/sample), using a 1 ml pipette. Alternatively, one can use a Piston Gradient Fractionator to collect the fractions.
Store the fractions at -20 °C until Western blot analysis.
Notes
Perform steps 1-9 as fast as possible.
Do as many steps as possible on ice.
Remember to tare the balance of the weight of the samples before performing ultracentrifugation. Use Solution A to adjust the weight.
Stored fractions should be thawed on ice and vortexed before preparation of samples for Western blot analysis.
Recipes
Solution A (200 ml)
0.25 mM sucrose
1 mM EDTA
20 mM HEPES (pH 7.4)
Mix 17 g sucrose with approximately 100 ml dH2O
Add 400 μl EDTA (500 mM stock, to a final concentration of 1 mM)
Add 8 ml HEPES (500 mM stock, to a final concentration of 20 mM)
Add dH2O to a final volume of 200 ml
pH 7.4
Store at 4 °C
2.5 M sucrose stock (580 ml)
500 g sucrose
Add a little volume of distilled water at the time, while heating, until final volume is approximately 580 ml.
Measure refractive index to ensure a concentration of approximately 2.5 M
Store at 4 °C.
0.8 M sucrose solution (50 ml) in 10 mM HEPES (pH 7.2)
16 ml of 2.5 M sucrose stock
1 ml HEPES (500 mM stock, to a final concentration of 10 mM) (pH 7.2)
Add 33 ml dH2O to a final volume of 50 ml
Mix all ingredients
Store at 4 °C if the solution is made shortly before experiment, otherwise the solution can be stored at -20 °C
1.6 M Sucrose solution (50 ml) in 10 mM HEPES (pH 7.2)
32 ml of 2.5 M sucrose stock
1 ml HEPES (500 mM stock, to a final concentration of 10 mM) (pH 7.2)
Add 17 ml dH2O to a final volume of 50 ml
Mix all ingredients
Store at 4 °C if the solution is made shortly before experiment, otherwise the solution can be stored at -20 °C
References
Gustafsen, C., Glerup, S., Pallesen, L. T., Olsen, D., Andersen, O. M., Nykjaer, A., Madsen, P. and Petersen, C. M. (2013). Sortilin and SorLA display distinct roles in processing and trafficking of amyloid precursor protein. J Neurosci 33(1): 64-71.
Article Information
Copyright
© 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Olsen, D. and Gustafsen, C. (2013). Subcellular Fractionation of Mouse Brain Homogenates. Bio-protocol 3(15): e839. DOI: 10.21769/BioProtoc.839.
Gustafsen, C., Glerup, S., Pallesen, L. T., Olsen, D., Andersen, O. M., Nykjaer, A., Madsen, P. and Petersen, C. M. (2013). Sortilin and SorLA display distinct roles in processing and trafficking of amyloid precursor protein. J Neurosci 33(1): 64-71.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms
Cell Biology > Organelle isolation > Fractionation
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Related protocols
Detection of Cytoplasmic and Nuclear Circular RNA via RT-qPCR
Ke-En Tan [...] Yat-Yuen Lim
Sep 5, 2023 1413 Views
Endoplasmic Reticulum Isolation: An Optimized Approach into Cells and Mouse Liver Fractionation
Marc Leiro [...] María Isabel Hernández-Alvarez
Sep 5, 2023 1256 Views
Cochlear Organ Dissection, Immunostaining, and Confocal Imaging in Mice
Chenyu Chen [...] Dongdong Ren
Jan 20, 2025 1598 Views
News
Become a Reviewer
FAQs
Other Resources
Bio-protocol Exchange
Bio-protocol Preprint Repository
Bio-protocol Webinars
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits