text
stringlengths 7
4.92M
|
|---|
Haemoglobin concentration and serum erythropoietin in renal dialysis and transplant patients.
In patients with chronic renal failure the use of the relatively new dialysis technique of continuous ambulatory peritoneal dialysis (CAPD), unlike other forms of dialysis, is consistently associated with an increase in Hb concentration, but the mechanism remains obscure. We measured Hb, haematocrit, S-erythropoietin and Hb-oxygen affinity in 3 groups of patients with chronic renal failure. (1) Untreated patients starting on haemodialysis. (2) Patients on intermittent peritoneal dialysis changing to CAPD. (3) Patients from the above 2 groups receiving renal transplants. In addition, red cell mass, plasma volume and red cell survival were measured in (2), before starting CAPD and at 6 months. There were distinctly different patterns of change in Hb concentration, Hb-oxygen affinity and S-erythropoietin in the 3 groups of patients. The increase in Hb concentration with CAPD is due to both a fall in plasma volume and an increase in red cell mass, with an increase in red cell survival. There was no change in Hb-oxygen affinity or serum erythropoietin concentration. The improvement in red cell mass and survival may be related to increased clearances of substances with mol. wt.s between 500 and 5000 daltons which accumulate in renal failure (uraemic middle molecules).
|
Q:
what is the fastest substring search method in Java
I need to implement a way to search substring (needles) in a list of string (haystack) using Java.
More specifically, my app has a list of user profiles. If I type some letters, for example, "Ja", and then search, then all the users whose name contains "ja" should show up. For instance, the result could be "Jack", "Jackson", "Jason", "Dijafu".
In Java, as I know, there are 3 build-in method to see search substring in a string.
string.contains()
string.indexOf()
regular expression. it is something like string.matches("ja"))
My question is: What are the runtimes of each method above? which one is the fastest or most efficient or most popular way to check if the list of string contains a given substring.
I know there exists some algorithms that do the same thing, such as Boyer–Moore string search algorithm, Knuth–Morris–Pratt algorithm and so on. I do not want to use them because I just have a small list of strings, and I think using them is kind of overkill for me right now. Also I have to type a lot of extra coding for such a non-build-in algorithm.
If you think my thoughts is not correct, please feel free to correct me.
A:
The accepted answer is not correct and not complete.
indexOf() does a naive string search using backtracking on mismatches. This is quite fast on small patterns/texts but shows very poor performance on large texts
contains("ja") should be comparable to indexOf (because it delegates to it)
matches("ja") will not deliver the correct result, because it searches for an exact match (only the string "ja" will match exactly)
Pattern p = Pattern.compile("ja"); Matcher m = p.matcher("jack"); m.find(); would be the correct way to find texts with regular expressions. In practice (using large texts) it will be the most efficient way using only the java api. This is because a constant pattern (like "ja") will not be processed by the regex engine (which is slow) but by an Boyer-Moore-Algorithm (which is fast)
A:
As far as the three you asked about, a regular expression is going to be much slower because it requires putting together a full state machine when you have a much simpler target. For contains vs indexOf...
2114 public boolean contains(CharSequence s) {
2115 return indexOf(s.toString()) > -1;
2116 }
(i.e., contains just calls indexOf, but you might incur an extra String creation on each invocation. This is just one implementation of contains, but since the contract of contains is a simplification of indexOf, this is probably how every implementation will work.)
A:
String[] names = new String[]{"jack", "jackson", "jason", "dijafu"};
long start = 0;
long stop = 0;
//Contains
start = System.nanoTime();
for (int i = 0; i < names.length; i++){
names[i].contains("ja");
}
stop = System.nanoTime();
System.out.println("Contains: " + (stop-start));
//IndexOf
start = System.nanoTime();
for (int i = 0; i < names.length; i++){
names[i].indexOf("ja");
}
stop = System.nanoTime();
System.out.println("IndexOf: " + (stop-start));
//Matches
start = System.nanoTime();
for (int i = 0; i < names.length; i++){
names[i].matches("ja");
}
stop = System.nanoTime();
System.out.println("Matches: " + (stop-start));
Output:
Contains: 16677
IndexOf: 4491
Matches: 864018
|
Predicting the outcomes of using longer-acting prophylactic factor VIII to treat people with severe hemophilia A: a hypothetical decision analysis.
Essentials No randomized trials have compared long-acting factor VIII (FVIII) with currently used products. A comparison was undertaken using a decision model to predict FVIII use and number of bleeds. In the base case, longer acting FVIII reduced factor use by 17% while resulting in similar bleeds. The value of longer acting FVIII will be largely determined by existing regimens and unit price. Click to hear Prof. Makris's presentation on new treatments in hemophilia SUMMARY: Background Recently, factor VIII (FVIII) products with longer half-lives, such as recombinant FVIII Fc fusion protein (rFVIIIFc), have become available. Use of longer-acting FVIII products will largely depend on effectiveness and cost; no direct evaluations have compared these parameters between conventional and longer-acting FVIII therapies. Objectives To present a hypothetical decision analysis, combining evidence from multiple sources to estimate bleeding frequency, resource use and cost of longer-acting prophylactic products, such as rFVIIIFc, vs. conventional recombinant FVIII (rFVIII). Patients/Methods The decision model used published pharmacokinetic parameters, bleeding frequency vs. time information below a 1-IU dL-1 FVIII trough level, and adherence. Prophylactic treatment scenarios were modelled for a hypothetical patient with severe hemophilia A (<1 IU/dL) receiving rFVIIIFc or rFVIII. Results Infusing twice weekly with rFVIIIFc 42.7 IU kg-1 per dose required less clotting factor than infusing every 56 h with rFVIII 33.75 IU kg-1 per dose; annual bleeding rates were similar. Base case analysis suggested that total FVIII costs were equated when rFVIIIFc cost 1.18 times more per IU than rFVIII, assuming similar adherence. Other modelled scenarios produced similar results, although differences in FVIII consumption were particularly sensitive to assumptions regarding frequency and dose of the rFVIII and rFVIIIFc regimens. For example, decreasing rFVIII from 33.75 IU kg-1 to 30 IU kg-1 per dose decreased the price factor to 1.05. Conclusions Longer-acting FVIII products may reduce FVIII consumption and infusion frequency without compromising hemostatic effect; this should be considered along with other factors (e.g. adherence and underlying FVIII regimen) when evaluating a suitable price for these agents.
|
Q:
trying to loop through html drop down
there are a few questions like this on here, but what I am wanting to do is loop through every option element and echo them out, so far it is only echoing the selected item, when Ideally I am going to loop through each item.
<?php
if (isset($_POST['submit'])) {
$st_campaigns = $_POST['campaigns'];
foreach ($st_campaigns as $st) {
echo $st;
}
}
?>
<form action="" method="post">
<select name="campaigns[]" id="campaigns[]" size="15" multiple="multiple" style="width:150">
<option>item</option>
<option>item1</option>
<option>item</option>
<option>item</option>
<option>item</option>
<option>item</option>
<option>item</option>
</select>
<input type="submit" name="submit" />
</form>
A:
Only the selected items are submitted with the form data. If you want all of the possible select items you will need to put them in an array and then you can use that array to populate/generate the select field as well as loop through them for whatever reason after the form is submitted.
|
Taking the same basic features as the 5-Way Hunting Breastplate, this design streamlines the overall look with a one-piece neck strap that goes over the withers and eliminates the need to attach the breastplate to the saddle dees. Elastic was added to allow more freedom in the shoulders for the horse. Crafted from top quality leather. Made in America. and available with Zinc fittings.
Color: HavanaSizes: Cob, Horse, Oversize
Disclaimer ** Being the manufacturer and manufacturing on site allows us
to “make to ordered” certain products that don’t warrant building and holding
stock in house. So we have decided that products that consist of Black and
Brass combination will be “make to order “. Usually we can have the product
made and to you in less than three weeks. Please be aware when ordering this
color and fittings combination.
**
Retail Price: $198.00
Product Code:833
Size
1Qty:
PRODUCT DETAILS
Taking the same basic features as the 5-Way Hunting Breastplate, this design streamlines the overall look with a one-piece neck strap that goes over the withers and eliminates the need to attach the breastplate to the saddle dees. Elastic was added to allow more freedom in the shoulders for the horse. Crafted from top quality leather. Made in America. and available with Zinc fittings.
|
Q:
jQuery Waypoints and Changing Nav Class
I'm using Waypoints.js and have a question about changing the style of a nav item when a certain waypoint is reached. I'm using this code to add a class of black to the menu item menu-item-29 when the waypoint post-26 is reached. It works, however when you scroll away off the waypoint, the black class isn't removed (it stays). How can I remove the black class when the waypoint is scrolled away? Thanks.
$(document).ready(function() {
$(".post-26").waypoint(function () {
$('#menu-item-29').addClass('black');
});
});
A:
The waypoint function is passed a direction parameter. Use that to determine whether you should add or remove.
$('.post-26').waypoint(function(direction) {
if (direction === 'down') {
$('#menu-item-29').addClass('black');
}
else {
$('#menu-item-29').removeClass('black');
}
});
Or, since jQuery's toggleClass takes a second boolean parameter indicating whether to add or remove, you can just write it like this:
$('.post-26').waypoint(function(direction) {
$('#menu-item-29').toggleClass('black', direction === 'down');
});
|
Q:
Regex to check for Capital letters OR small letters if @ is used at the beginning
So I have this regex that checks for string and place them on their proper div class if it matches it. The regex I use for characters are below:
character: /^([A-Z*_]+[0-9A-Z# (,._\-')]*)/
and it checks the string if it's all caps, if yes then place it on <div class="character"></div> tag.
I'd like to place a conditional inside the regex if possible where, if the string is 'McMAHON' or 'McDONALD', it can be placed inside the character tag provided that they use an @ sign at the beginning. e.g. '@McDONALD'
Right now, what I have is this that checks for this structure.
character: /^([@A-Z*_]+[0-9A-Za-z# (,._\-')]*)/,
Which defeats the purpose of regex matching for characters as they can type 'John' even without the '@'.
The string sample expected to be placed on this tag are the following:
'JOHN'
'EXTRA #1'
'M.C. HAMMER'
'@M.C. McDONALD' - I can remove the @ before pushing the string
'ANDROID #D-C_1'
'@McDONALD' - I can remove the @ before pushing the string
A:
It is important that you list your -, in your character classes, at the beginning or end of the list so that you don't create a "range" of characters.
Also you can make your pattern more brief if you use \w to represent [A-Za-z0-9_].
^(@+[\w# (,.\'-]*|[A-Z]+[0-9A-Z# (,._\'-]*)$
Pattern Demo
|
<!DOCTYPE HTML>
<!-- NewPage -->
<html lang="en">
<head>
<!-- Generated by javadoc (13.0.2) on Wed Feb 26 13:47:05 EST 2020 -->
<title>DomainPresenceInfo.ServerStartupInfo (weblogic-kubernetes-operator 2.5.0 API)</title>
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
<meta name="dc.created" content="2020-02-26">
<meta name="description" content="declaration: package: oracle.kubernetes.operator.helpers, class: DomainPresenceInfo, class: ServerStartupInfo">
<meta name="generator" content="javadoc/ClassWriterImpl">
<link rel="stylesheet" type="text/css" href="../../../../stylesheet.css" title="Style">
<link rel="stylesheet" type="text/css" href="../../../../script-dir/jquery-ui.css" title="Style">
<script type="text/javascript" src="../../../../script.js"></script>
<script type="text/javascript" src="../../../../script-dir/jszip/dist/jszip.min.js"></script>
<script type="text/javascript" src="../../../../script-dir/jszip-utils/dist/jszip-utils.min.js"></script>
<!--[if IE]>
<script type="text/javascript" src="../../../../script-dir/jszip-utils/dist/jszip-utils-ie.min.js"></script>
<![endif]-->
<script type="text/javascript" src="../../../../script-dir/jquery-3.4.1.js"></script>
<script type="text/javascript" src="../../../../script-dir/jquery-ui.js"></script>
</head>
<body class="class-declaration">
<script type="text/javascript">var data = {"i0":10,"i1":10,"i2":10,"i3":10,"i4":10,"i5":10,"i6":10,"i7":10};
var tabs = {65535:["t0","All Methods"],2:["t2","Instance Methods"],8:["t4","Concrete Methods"]};
var altColor = "altColor";
var rowColor = "rowColor";
var tableTab = "tableTab";
var activeTableTab = "activeTableTab";
var pathtoroot = "../../../../";
loadScripts(document, 'script');</script>
<noscript>
<div>JavaScript is disabled on your browser.</div>
</noscript>
<header role="banner">
<nav role="navigation">
<div class="fixedNav">
<!-- ========= START OF TOP NAVBAR ======= -->
<div class="topNav"><a id="navbar.top">
<!-- -->
</a>
<div class="skipNav"><a href="#skip.navbar.top" title="Skip navigation links">Skip navigation links</a></div>
<a id="navbar.top.firstrow">
<!-- -->
</a>
<ul class="navList" title="Navigation">
<li><a href="../../../../index.html">Overview</a></li>
<li><a href="package-summary.html">Package</a></li>
<li class="navBarCell1Rev">Class</li>
<li><a href="class-use/DomainPresenceInfo.ServerStartupInfo.html">Use</a></li>
<li><a href="package-tree.html">Tree</a></li>
<li><a href="../../../../deprecated-list.html">Deprecated</a></li>
<li><a href="../../../../index-all.html">Index</a></li>
<li><a href="../../../../help-doc.html">Help</a></li>
</ul>
</div>
<div class="subNav">
<div>
<ul class="subNavList">
<li>Summary: </li>
<li>Nested | </li>
<li><a href="#field.summary">Field</a> | </li>
<li><a href="#constructor.summary">Constr</a> | </li>
<li><a href="#method.summary">Method</a></li>
</ul>
<ul class="subNavList">
<li>Detail: </li>
<li><a href="#field.detail">Field</a> | </li>
<li><a href="#constructor.detail">Constr</a> | </li>
<li><a href="#method.detail">Method</a></li>
</ul>
</div>
<div class="navListSearch"><label for="search">SEARCH:</label>
<input type="text" id="search" value="search" disabled="disabled">
<input type="reset" id="reset" value="reset" disabled="disabled">
</div>
</div>
<a id="skip.navbar.top">
<!-- -->
</a>
<!-- ========= END OF TOP NAVBAR ========= -->
</div>
<div class="navPadding"> </div>
<script type="text/javascript"><!--
$('.navPadding').css('padding-top', $('.fixedNav').css("height"));
//-->
</script>
</nav>
</header>
<!-- ======== START OF CLASS DATA ======== -->
<main role="main">
<div class="header">
<div class="subTitle"><span class="packageLabelInType">Package</span> <a href="package-summary.html">oracle.kubernetes.operator.helpers</a></div>
<h1 title="Class DomainPresenceInfo.ServerStartupInfo" class="title">Class DomainPresenceInfo.ServerStartupInfo</h1>
</div>
<div class="contentContainer">
<div class="inheritance" title="Inheritance Tree">java.lang.Object
<div class="inheritance">oracle.kubernetes.operator.helpers.DomainPresenceInfo.ServerStartupInfo</div>
</div>
<section class="description">
<dl>
<dt>Enclosing class:</dt>
<dd><a href="DomainPresenceInfo.html" title="class in oracle.kubernetes.operator.helpers">DomainPresenceInfo</a></dd>
</dl>
<hr>
<pre>public static class <span class="typeNameLabel">DomainPresenceInfo.ServerStartupInfo</span>
extends java.lang.Object</pre>
<div class="block">Details about a specific managed server that will be started up.</div>
</section>
<section class="summary">
<ul class="blockList">
<!-- =========== FIELD SUMMARY =========== -->
<li class="blockList">
<section class="fieldSummary"><a id="field.summary">
<!-- -->
</a>
<h2>Field Summary</h2>
<div class="memberSummary">
<table>
<caption><span>Fields</span><span class="tabEnd"> </span></caption>
<thead>
<tr>
<th class="colFirst" scope="col">Modifier and Type</th>
<th class="colSecond" scope="col">Field</th>
<th class="colLast" scope="col">Description</th>
</tr>
</thead>
<tbody>
<tr class="altColor">
<td class="colFirst"><code><a href="../wlsconfig/WlsServerConfig.html" title="class in oracle.kubernetes.operator.wlsconfig">WlsServerConfig</a></code></td>
<th class="colSecond" scope="row"><code><span class="memberNameLink"><a href="#serverConfig">serverConfig</a></span></code></th>
<td class="colLast"> </td>
</tr>
</tbody>
</table>
</div>
</section>
</li>
<!-- ======== CONSTRUCTOR SUMMARY ======== -->
<li class="blockList">
<section class="constructorSummary"><a id="constructor.summary">
<!-- -->
</a>
<h2>Constructor Summary</h2>
<div class="memberSummary">
<table>
<caption><span>Constructors</span><span class="tabEnd"> </span></caption>
<thead>
<tr>
<th class="colFirst" scope="col">Constructor</th>
<th class="colLast" scope="col">Description</th>
</tr>
</thead>
<tbody>
<tr class="altColor">
<th class="colConstructorName" scope="row"><code><span class="memberNameLink"><a href="#%3Cinit%3E(oracle.kubernetes.operator.wlsconfig.WlsServerConfig,java.lang.String,oracle.kubernetes.weblogic.domain.model.ServerSpec)">ServerStartupInfo</a></span>​(<a href="../wlsconfig/WlsServerConfig.html" title="class in oracle.kubernetes.operator.wlsconfig">WlsServerConfig</a> serverConfig,
java.lang.String clusterName,
<a href="../../weblogic/domain/model/ServerSpec.html" title="interface in oracle.kubernetes.weblogic.domain.model">ServerSpec</a> serverSpec)</code></th>
<td class="colLast">
<div class="block">Create server startup info.</div>
</td>
</tr>
<tr class="rowColor">
<th class="colConstructorName" scope="row"><code><span class="memberNameLink"><a href="#%3Cinit%3E(oracle.kubernetes.operator.wlsconfig.WlsServerConfig,java.lang.String,oracle.kubernetes.weblogic.domain.model.ServerSpec,boolean)">ServerStartupInfo</a></span>​(<a href="../wlsconfig/WlsServerConfig.html" title="class in oracle.kubernetes.operator.wlsconfig">WlsServerConfig</a> serverConfig,
java.lang.String clusterName,
<a href="../../weblogic/domain/model/ServerSpec.html" title="interface in oracle.kubernetes.weblogic.domain.model">ServerSpec</a> serverSpec,
boolean isServiceOnly)</code></th>
<td class="colLast">
<div class="block">Create server startup info.</div>
</td>
</tr>
</tbody>
</table>
</div>
</section>
</li>
<!-- ========== METHOD SUMMARY =========== -->
<li class="blockList">
<section class="methodSummary"><a id="method.summary">
<!-- -->
</a>
<h2>Method Summary</h2>
<div class="memberSummary">
<div role="tablist" aria-orientation="horizontal"><button role="tab" aria-selected="true" aria-controls="memberSummary_tabpanel" tabindex="0" onkeydown="switchTab(event)" id="t0" class="activeTableTab">All Methods</button><button role="tab" aria-selected="false" aria-controls="memberSummary_tabpanel" tabindex="-1" onkeydown="switchTab(event)" id="t2" class="tableTab" onclick="show(2);">Instance Methods</button><button role="tab" aria-selected="false" aria-controls="memberSummary_tabpanel" tabindex="-1" onkeydown="switchTab(event)" id="t4" class="tableTab" onclick="show(8);">Concrete Methods</button></div>
<div id="memberSummary_tabpanel" role="tabpanel">
<table aria-labelledby="t0">
<thead>
<tr>
<th class="colFirst" scope="col">Modifier and Type</th>
<th class="colSecond" scope="col">Method</th>
<th class="colLast" scope="col">Description</th>
</tr>
</thead>
<tbody>
<tr class="altColor" id="i0">
<td class="colFirst"><code>boolean</code></td>
<th class="colSecond" scope="row"><code><span class="memberNameLink"><a href="#equals(java.lang.Object)">equals</a></span>​(java.lang.Object o)</code></th>
<td class="colLast"> </td>
</tr>
<tr class="rowColor" id="i1">
<td class="colFirst"><code>java.lang.String</code></td>
<th class="colSecond" scope="row"><code><span class="memberNameLink"><a href="#getClusterName()">getClusterName</a></span>()</code></th>
<td class="colLast"> </td>
</tr>
<tr class="altColor" id="i2">
<td class="colFirst"><code>java.lang.String</code></td>
<th class="colSecond" scope="row"><code><span class="memberNameLink"><a href="#getDesiredState()">getDesiredState</a></span>()</code></th>
<td class="colLast">
<div class="block">Returns the desired state for the started server.</div>
</td>
</tr>
<tr class="rowColor" id="i3">
<td class="colFirst"><code>java.util.List<io.kubernetes.client.openapi.models.V1EnvVar></code></td>
<th class="colSecond" scope="row"><code><span class="memberNameLink"><a href="#getEnvironment()">getEnvironment</a></span>()</code></th>
<td class="colLast"> </td>
</tr>
<tr class="altColor" id="i4">
<td class="colFirst"><code>java.lang.String</code></td>
<th class="colSecond" scope="row"><code><span class="memberNameLink"><a href="#getServerName()">getServerName</a></span>()</code></th>
<td class="colLast"> </td>
</tr>
<tr class="rowColor" id="i5">
<td class="colFirst"><code>int</code></td>
<th class="colSecond" scope="row"><code><span class="memberNameLink"><a href="#hashCode()">hashCode</a></span>()</code></th>
<td class="colLast"> </td>
</tr>
<tr class="altColor" id="i6">
<td class="colFirst"><code>boolean</code></td>
<th class="colSecond" scope="row"><code><span class="memberNameLink"><a href="#isServiceOnly()">isServiceOnly</a></span>()</code></th>
<td class="colLast"> </td>
</tr>
<tr class="rowColor" id="i7">
<td class="colFirst"><code>java.lang.String</code></td>
<th class="colSecond" scope="row"><code><span class="memberNameLink"><a href="#toString()">toString</a></span>()</code></th>
<td class="colLast"> </td>
</tr>
</tbody>
</table>
</div>
</div>
<div class="inheritedList">
<h3>Methods inherited from class java.lang.Object</h3>
<a id="methods.inherited.from.class.java.lang.Object">
<!-- -->
</a><code>clone, finalize, getClass, notify, notifyAll, wait, wait, wait</code></div>
</section>
</li>
</ul>
</section>
<section class="details">
<ul class="blockList">
<!-- ============ FIELD DETAIL =========== -->
<li class="blockList">
<section class="fieldDetails"><a id="field.detail">
<!-- -->
</a>
<h2>Field Details</h2>
<ul class="blockList">
<li class="blockList">
<section class="detail">
<h3><a id="serverConfig">serverConfig</a></h3>
<div class="memberSignature"><span class="modifiers">public final</span> <span class="returnType"><a href="../wlsconfig/WlsServerConfig.html" title="class in oracle.kubernetes.operator.wlsconfig">WlsServerConfig</a></span> <span class="memberName">serverConfig</span></div>
</section>
</li>
</ul>
</section>
</li>
<!-- ========= CONSTRUCTOR DETAIL ======== -->
<li class="blockList">
<section class="constructorDetails"><a id="constructor.detail">
<!-- -->
</a>
<h2>Constructor Details</h2>
<ul class="blockList">
<li class="blockList">
<section class="detail">
<h3><a id="<init>(oracle.kubernetes.operator.wlsconfig.WlsServerConfig,java.lang.String,oracle.kubernetes.weblogic.domain.model.ServerSpec)">ServerStartupInfo</a></h3>
<div class="memberSignature"><span class="modifiers">public</span> <span class="memberName">ServerStartupInfo</span>​(<span class="arguments"><a href="../wlsconfig/WlsServerConfig.html" title="class in oracle.kubernetes.operator.wlsconfig">WlsServerConfig</a> serverConfig,
java.lang.String clusterName,
<a href="../../weblogic/domain/model/ServerSpec.html" title="interface in oracle.kubernetes.weblogic.domain.model">ServerSpec</a> serverSpec)</span></div>
<div class="block">Create server startup info.</div>
<dl>
<dt><span class="paramLabel">Parameters:</span></dt>
<dd><code>serverConfig</code> - Server config scan</dd>
<dd><code>clusterName</code> - the name of the cluster</dd>
<dd><code>serverSpec</code> - the server startup configuration</dd>
</dl>
</section>
</li>
<li class="blockList">
<section class="detail">
<h3><a id="<init>(oracle.kubernetes.operator.wlsconfig.WlsServerConfig,java.lang.String,oracle.kubernetes.weblogic.domain.model.ServerSpec,boolean)">ServerStartupInfo</a></h3>
<div class="memberSignature"><span class="modifiers">public</span> <span class="memberName">ServerStartupInfo</span>​(<span class="arguments"><a href="../wlsconfig/WlsServerConfig.html" title="class in oracle.kubernetes.operator.wlsconfig">WlsServerConfig</a> serverConfig,
java.lang.String clusterName,
<a href="../../weblogic/domain/model/ServerSpec.html" title="interface in oracle.kubernetes.weblogic.domain.model">ServerSpec</a> serverSpec,
boolean isServiceOnly)</span></div>
<div class="block">Create server startup info.</div>
<dl>
<dt><span class="paramLabel">Parameters:</span></dt>
<dd><code>serverConfig</code> - Server config scan</dd>
<dd><code>clusterName</code> - the name of the cluster</dd>
<dd><code>serverSpec</code> - the server startup configuration</dd>
<dd><code>isServiceOnly</code> - true, if only the server service should be created</dd>
</dl>
</section>
</li>
</ul>
</section>
</li>
<!-- ============ METHOD DETAIL ========== -->
<li class="blockList">
<section class="methodDetails"><a id="method.detail">
<!-- -->
</a>
<h2>Method Details</h2>
<ul class="blockList">
<li class="blockList">
<section class="detail">
<h3><a id="getServerName()">getServerName</a></h3>
<div class="memberSignature"><span class="modifiers">public</span> <span class="returnType">java.lang.String</span> <span class="memberName">getServerName</span>()</div>
</section>
</li>
<li class="blockList">
<section class="detail">
<h3><a id="getClusterName()">getClusterName</a></h3>
<div class="memberSignature"><span class="modifiers">public</span> <span class="returnType">java.lang.String</span> <span class="memberName">getClusterName</span>()</div>
</section>
</li>
<li class="blockList">
<section class="detail">
<h3><a id="getDesiredState()">getDesiredState</a></h3>
<div class="memberSignature"><span class="modifiers">public</span> <span class="returnType">java.lang.String</span> <span class="memberName">getDesiredState</span>()</div>
<div class="block">Returns the desired state for the started server.</div>
<dl>
<dt><span class="returnLabel">Returns:</span></dt>
<dd>return a string, which may be null.</dd>
</dl>
</section>
</li>
<li class="blockList">
<section class="detail">
<h3><a id="getEnvironment()">getEnvironment</a></h3>
<div class="memberSignature"><span class="modifiers">public</span> <span class="returnType">java.util.List<io.kubernetes.client.openapi.models.V1EnvVar></span> <span class="memberName">getEnvironment</span>()</div>
</section>
</li>
<li class="blockList">
<section class="detail">
<h3><a id="isServiceOnly()">isServiceOnly</a></h3>
<div class="memberSignature"><span class="modifiers">public</span> <span class="returnType">boolean</span> <span class="memberName">isServiceOnly</span>()</div>
</section>
</li>
<li class="blockList">
<section class="detail">
<h3><a id="toString()">toString</a></h3>
<div class="memberSignature"><span class="modifiers">public</span> <span class="returnType">java.lang.String</span> <span class="memberName">toString</span>()</div>
<dl>
<dt><span class="overrideSpecifyLabel">Overrides:</span></dt>
<dd><code>toString</code> in class <code>java.lang.Object</code></dd>
</dl>
</section>
</li>
<li class="blockList">
<section class="detail">
<h3><a id="equals(java.lang.Object)">equals</a></h3>
<div class="memberSignature"><span class="modifiers">public</span> <span class="returnType">boolean</span> <span class="memberName">equals</span>​(<span class="arguments">java.lang.Object o)</span></div>
<dl>
<dt><span class="overrideSpecifyLabel">Overrides:</span></dt>
<dd><code>equals</code> in class <code>java.lang.Object</code></dd>
</dl>
</section>
</li>
<li class="blockList">
<section class="detail">
<h3><a id="hashCode()">hashCode</a></h3>
<div class="memberSignature"><span class="modifiers">public</span> <span class="returnType">int</span> <span class="memberName">hashCode</span>()</div>
<dl>
<dt><span class="overrideSpecifyLabel">Overrides:</span></dt>
<dd><code>hashCode</code> in class <code>java.lang.Object</code></dd>
</dl>
</section>
</li>
</ul>
</section>
</li>
</ul>
</section>
</div>
</main>
<!-- ========= END OF CLASS DATA ========= -->
<footer role="contentinfo">
<nav role="navigation">
<!-- ======= START OF BOTTOM NAVBAR ====== -->
<div class="bottomNav"><a id="navbar.bottom">
<!-- -->
</a>
<div class="skipNav"><a href="#skip.navbar.bottom" title="Skip navigation links">Skip navigation links</a></div>
<a id="navbar.bottom.firstrow">
<!-- -->
</a>
<ul class="navList" title="Navigation">
<li><a href="../../../../index.html">Overview</a></li>
<li><a href="package-summary.html">Package</a></li>
<li class="navBarCell1Rev">Class</li>
<li><a href="class-use/DomainPresenceInfo.ServerStartupInfo.html">Use</a></li>
<li><a href="package-tree.html">Tree</a></li>
<li><a href="../../../../deprecated-list.html">Deprecated</a></li>
<li><a href="../../../../index-all.html">Index</a></li>
<li><a href="../../../../help-doc.html">Help</a></li>
</ul>
</div>
<div class="subNav">
<div>
<ul class="subNavList">
<li>Summary: </li>
<li>Nested | </li>
<li><a href="#field.summary">Field</a> | </li>
<li><a href="#constructor.summary">Constr</a> | </li>
<li><a href="#method.summary">Method</a></li>
</ul>
<ul class="subNavList">
<li>Detail: </li>
<li><a href="#field.detail">Field</a> | </li>
<li><a href="#constructor.detail">Constr</a> | </li>
<li><a href="#method.detail">Method</a></li>
</ul>
</div>
</div>
<a id="skip.navbar.bottom">
<!-- -->
</a>
<!-- ======== END OF BOTTOM NAVBAR ======= -->
</nav>
<p class="legalCopy"><small>Copyright © 2017–2020. All rights reserved.</small></p>
</footer>
</body>
</html>
|
Central Minnesota Federal Credit Union
Central Minnesota Federal Credit Union
This is a listing for Central Minnesota Federal Credit Union (114 Woodman Street, Grey Eagle, MN 56336) from the Personal Finance Directory. You can find more similar services in our Personal Finance Directory.
|
Q:
Java Servlet getParameter for a param that is a URL
I am building a site which submits a url to a servlet for analysis purposes. On the client side, I submit the url as a parameter that is encoded. For example...
Submit: http://www.site.com
Goes to: http://localhost/myservlet/?url=http%3A%2F%2Fwww.site.com
On the server side, I have my servlet request the parameter like so...
String url = request.getParameter("url");
What I receive is a decoded string: http://www.site.com. So far so good -- this works as expected... most of the time.
The problem occurs when a url param contains parameters of its own...
Submit: http://www.site.com?param1=1¶m2=2
Goes to: http://localhost/myservlet/?url=http%3A%2F%2Fwww.site.com%3Fparam1%3D1%26param2%3D2
Everything is fine on the client site, but in my servlet when I get the parameter I receive only part of the url param!
http://www.site.com?param1=1
It dropped the second param from my input url param! I am definitely encoding the url param before submitting it to the server... what is going on?
A:
I can't reproduce your problem on Tomcat 6.0.29. There's more at matter. Maybe a Filter in the chain which is doing something with the request object?
Anyway, here's a SSCCE in flavor of a single JSP:
<!DOCTYPE html>
<html lang="en">
<head>
<title>Test</title>
</head>
<body>
<p><a href="?url=http%3A%2F%2Fwww.site.com%3Fparam1%3D1%26param2%3D2">click here</a>
<p>URL: ${param.url}
</body>
</html>
Copy'n'paste'n'run it and click the link. Right here I see the following result:
click here
URL: http://www.site.com?param1=1¶m2=2
The same is reproducible with a simple servlet like this which is invoked directly by browser address bar:
protected void doGet(HttpServletRequest request, HttpServletResponse response) throws ServletException, IOException {
response.getWriter().write(request.getParameter("url"));
}
Tomcat is by the way configured with URIEncoding="UTF-8" in HTTP connector, but even with ISO-8859-1 (which is the default), the behaviour is -as expected in this particular case- the same.
|
Carlos Romero (Spanish politician)
José Carlos Romero Herrera (born 1941) is a Spanish politician who served as Minister of Agriculture, Fisheries and Food from December 1982 to March 1991.
References
Category:1941 births
Category:Living people
Category:Complutense University of Madrid alumni
Category:Government ministers of Spain
Category:20th-century Spanish politicians
Category:Agriculture ministers of Spain
|
Q:
How can I modify the template for generating setters in CLion?
In CLion, we can generate setters from fields by: Code -> Generate... -> Setter. But how can I modify the template for the code generation to change, for example, the generated setter parameter name?
A:
Unfortunately, I've got it confirmed from JetBrains that this is currently not possible in CLion.
|
Sequence from the assembly nucleation region of TMV RNA.
In an effort to isolate RNA sequences containing the assembly nucleation region, uniformly 32P-labeled tobacco mosaic virus RNA was partially digested with pancreatic ribonuclease, and the mixture of fragments was incubated with limited amounts of tobacco mosaic virus protein disks in conditions favorable for reconstitution. The RNA fragments which became encapsidated were purified and sequenced by conventional techniques. The sequence of the first 139 nucleotides of P1, the principal encapsidated fragment, is AGGUUUGAGAGAGAAGAUUACAAGCGUGAGAGACGGAGGGCCCAUGGAACUUACAGAAGAAGUUGUUGAUGAGUUCAUGGAAGAUGUCCCUAUGUCAAUCAGACUUGCAAAGUUUCGAUCUCGAACCGGAAAAAAGAGU. Residues 1--110 of P1 overlap the assembly origin isolated and characterized in the accompanying papers by Zimmern (1977) and Zimmern and Butler (1977). Our results, taken in conjunction with the two accompanying papers, define the sequence of much of the nucleation region as well as sequences flanking it on both sides. The features of the P1 sequence which may have role in the nucleation reaction are discussed in detail in the text.
|
Rahn, Iran
Rahn (; also known as Dahan and Dehan) is a village in Howmeh Rural District, in the Central District of Gonabad County, Razavi Khorasan Province, Iran. At the 2006 census, its population was 941, in 264 families.
References
Category:Populated places in Gonabad County
|
Alexander Kerfoot will have a hearing with the NHL Department of Player Safety on Monday.
The Toronto Maple Leafs forward is facing discipline for boarding Colorado Avalanche defenseman Erik Johnson on Saturday.
The incident occurred at 17:19 of the second period during Toronto's 5-3 win at Pepsi Center. Kerfoot received a minor penalty for boarding. Johnson remained in the game.
The following grounds are being considered for supplemental discipline: boarding. However, the Department of Player Safety retains the right to make adjustments to the infraction upon review.
|
|
|
|
New Community Day Events Coming To Pokemon Go
Exclusive Pokemon with exclusive moves will land in the first iteration of the new global Pokemon Go event.
It hasn't been very long since the embarassing events of last year's Pokemon Go Festival, and even though many players might have lost interest in new Pokemon Go events since then, developer Niantic seems to have come up with a new strategy that should please fans without running the risk of problems like cell tower overcrowding and other technical failures.
Pokemon Go Community Day Dates, Times, and Activities
The new event is called Community Day, and it's a worldwide in-game event that will unify Pokemon Go players with the chance to score several special Pokemon with powerful exclusive moves. Instead of being limited to just one day or a range of days, Niantic is planning on hosting one Community Day event each month for the forseeable future, with each individual event offering unique bonuses and plenty of opportunities to capture rare creatures.
Starting on January 20, Pokemon Go players will begin to see special Pokemon released into the wild, including a new version of Pikachu featuring the exclusive Surf move. Players will earn double XP during event hours, and players can learn more about which other Pokemon and bonuses will be featured during the event by watching the official Pokemon Go blog and social media channels.
As for what time the inaugural Community Day kicks off, players in the Americas as well as Greenland can expect the event to begin at 11 a.m. Pacific time on Saturday. The event will formally close just three hours later at 2 p.m. Pacific, so players who want to track down a new version of Pikachu with the exclusive Surf move should plan ahead. Beyond that, the development team has encouraged users to post some of their acquisitions and other fun stories on social media using hashtag #PokemonGoCommunityDay.
Kevin Tucker
Contributing Editor
Kevin Tucker is a long-time gamer and writer with an eye for technological news and a drive for extensive research. When he's not off exploring virtual worlds, he spends his time working on motorcycles, reading science fiction, and playing electric bass.
|
New report sets out how digitisation, automation will affect the Scottish labour market
New report sets out how digitisation, automation will affect the Scottish labour market
A new publication sets out how digitisation, automation and other innovations will affect the Scottish labour market.
The joint report (download) from the Scottish Government and the Scottish Trades Union Congress follows from the First Minister’s recent biannual meetings with the STUC, where discussions addressed the growing anxiety among some workers that their jobs may either be lost or changed due to new technologies.
[adbutler zone_id='297765′]
It discusses competing claims about the future of work and assesses the extent that technology is already affecting the labour market, and identifies areas for further consideration.
“This report highlights the continuing positive and constructive relationship the Scottish Government enjoys with trade unions – in stark contrast to the confrontational approach of the UK Government.
“We share a common objective with the STUC – to ensure automation and digitisation have positive outcomes for all of Scotland’s people.
“Scottish workers are already benefitting from quality job opportunities in sectors such as game development and data analytics where we are at the forefront of technological change.
“The report recognises and addresses the genuine fears many workers have over ways in which technology might affect their working lives and future job prospects, and highlights where Scottish Government approaches to skills development and fair work can help meet the challenges of technological change.”
Grahame Smith, STUC General Secretary said:
“Automation represents a major challenge to how work is organised, but it is still unclear how it will affect the quality and type of work in the long term. Predictions swing between utopian visions of emancipation through technology, to dystopian views of severe inequality.
“The STUC and Scottish Government report cuts through this debate to recognise both the positive and negative impacts of automation. It found examples where new technologies lead to job losses, such as the closure of bank branches due to increased internet banking; and examples where it can improve safety and security, like the digitised records in the health service.
“In all cases, workers must be involved in how automation is introduced, shaping or controlling their own workplaces through collective trade union involvement. Otherwise we are likely to see automation pursued as a cost-cutting, profit-driven measure, implemented without proper training or controls, or used to abuse staff with inappropriate targets or high levels of surveillance. These are the sorts of consequences we will be debating at Congress, which the union movement is working to avoid.”
|
Q:
Quickly determining of two bitmaps are the same?
How can I (as fast as possible) determine if two bitmaps are the same, by value, and not by reference? Is there any fast way of doing it?
What if the comparison doesn't need to be very precise?
A:
you can check the dimensions first - and abort the comparison if they differ.
For the comparison itself you can use a variaty of ways:
CRC32
very fast but possibly wrong... can be used as a first check, if it differs they are dfferent... otherwise further checking needed
MD5 / SHA1 / SHA512
not so fast but rather precise
XOR
XOR the image content... abort when the first difference comes up...
|
This weekend, Boots Riley took to Twitter to say that international film distributors are rejecting his new feature film Sorry to Bother You. Riley claims that despite his film’s success, distributors have made the argument that “‘black movies’ don’t do well internationally.”
Sorry to Bother You stars Lakeith Stanfield, Tessa Thompson, Armie Hammer, Terry Crews, and more. The Coup’s soundtrack for the film was just released; it features guest spots from Lakeith Stanfield, Janelle Monáe, Killer Mike, Tune-Yards, and more. Read Pitchfork’s interview with Riley, “Boots Riley Breaks Down the Savvy Radicalism of His Directorial Debut, Sorry to Bother You.”
|
Narrative:The Super Ventura, used for Howard 500 development flying, crashed during a test flight.
Sources:
» The Lockheed Twins / P.J. Marsden
Photos
This information is not presented as the Flight Safety Foundation or the Aviation Safety Network’s opinion as to the cause of the accident. It is preliminary and is based on the facts as they are known at this time.
|
HOSS Glass DownStem - 14mm into 19mm Clear Open Ended 10cm YX23
Hoss is one of very few brands of Glass-On-Glass fitting downstems that measure with the overall length (or more like the distance from TOP of joint to bottom tip of stem) which seems from our measurements to be about 2cm longer than the normal measuring method of bottom-of-joint-to-tip gives. So, for example a 10cm HOSS measurement here represents the equivalent of 8cm in our normal measuring method (bottom of ground-glass joint to bottom tip of downstem).
|
A comparison of the effects of hypoxia to the reports of a brush with the afterlife.
by Brian Dunning
Filed under Health, Paranormal, Religion
Skeptoid Podcast #261
June 7, 2011
Podcast transcript | Subscribe
Also available in French
Listen:
https://skeptoid.com/audio/skeptoid-4261.mp3
Today we're going to float around the operating room, look down at our own body lying there on the table, hear the heart monitor switch to a solid tone, and learn first-hand what some believe goes on during a near death experience. When a small percentage of people are near death or are temporarily dead, either from an accident or during emergency lifesaving treatment, they report eerie experiences that they interpret as having crossed the threshold into an afterlife. Some authors and researchers have catalogued these reports and concluded that the experiences must have been real, while some skeptical researchers have found that the experiences are the natural and expected result of low oxygen to the brain. It seems the perfect place to point our skeptical eye.
A favorite starting point when examining such tales is the application of Occam's Razor. This states that the explanation requiring the introduction of the fewest new assumptions about our world is probably the true one; in other words, the explanation that best fits our understanding of the way the world works. The supernatural explanation for near death experiences (NDEs) requires the existence of an afterlife, heaven or hell or whatever you prefer to call it. To science, which has never found any reason to suspect life might continue after the death of the body, such a place would be a major new assumption about our world. But to many people with certain religious beliefs, such a place is a given and the afterlife is real, and is thus not a new assumption. So to a lot of people, Occam's Razor does nothing to settle this particular question.
Probably everyone will agree to some extent that the brain is capable of generating surprising experiences, such as highly realistic dreams. We've all had faint or dizzy spells, and these can be pretty dramatic episodes even though, to an outsider, nothing notable happened physically. A bit later we'll talk about how all of the major events of an NDE are created in the brain in certain experiments. In summary, even those who believe that NDEs truly represent a brush with the afterlife probably agree that every experience that characterizes one can also be attributed to a natural cause. Why, then, is there a tendency to insist that they had to be an actual life after death experience?
In 1975, Dr. Raymond Moody published Life After Life, which became the seminal work promoting NDEs as evidence of an afterlife. Dr. Moody is a strong personal believer in not only the afterlife, but also reincarnation, claiming that he has personally lived nine previous lives. In his books he's cited 150 cases of people who, after resuscitation, reported extraordinary experiences.
Let's take a look at the reports. First, the basics. Although it's rare for any two stories to be substantially similar, there are common themes. One the most familiar is the life flashing before the eyes, a quick fast-forward replay of either the entire life or important events, even long-forgotten events, commonly called a life review. Perhaps the most popular report is a bright light, warm and inviting. Sometimes this is combined with a feeling of floating through a tunnel. Some NDEs include an out-of-body experience, usually floating in the air and seeing one's own body below, being tended to by medics, sometimes reporting seeing things happen that could not have been observed from the body's position. People with physical limitations, blind, deaf, or paralyzed, usually find that their bodies are whole during these experiences.
Some people report positive meetings with deceased loved ones or religious figures such as Jesus or Muhammad. Just as often, however, people report terrifying encounters with monsters, hated people, or the devil. So while many experiences are euphoric, many are very much the opposite.
So the question is, can we group all of these things together in such a way as to find an undeniable pattern? Is there enough consistency and predictability that we can conclude with good certainty that such a thing as an afterlife must exist, and here is the probable experience you'll have as you cross over? It's unlikely. When Skeptoid looked at The Hum, a worldwide acoustic phenomenon, we found enough variation to conclude that there are probable many different causes that likely have nothing to do with each other. NDEs are similarly complicated by many unrelated causes of characteristic experiences: drug effects, hypoxia, trauma, brain abnormalities, and simple dreaming, just to name a few. We'd expect people coming out of all these conditions to report things very similar to NDEs.
Let's take a look at out-of-body experiences. You can search the Internet and you'll easily find dozens (if not more) stories where someone floated off the operating table and made observations about the room, actions performed by surgical staff, and even things happening outside the room. I'm not even going to list them because there are so many, and I'll grant that many of them sound undeniable, that the only possible explanation is that the person's consciousness and perspective was indeed outside the body. Having read a lot of these, I make three observations:
1. I know a number of anesthesiologists. They are not impressed by these stories. It is common for patients to be aware during general anesthesia. They remember many details of the people, objects, and procedures in the room. We absolutely expect some number of supposedly unconscious patients to report things that happened that a layperson would assume were unknowable. In fact, The Lancet published research in 2001 that showed nearly 20% of patients retained memories of things that happened when they were clinically dead. 2. What's rarely or never written up in books is the fact that most such "recollections" get their details wrong, and were probably just imagined by the patient. When authors compile stories to promote the idea of NDEs, they tend to universally exclude these; in fact the majority were never recorded anywhere to begin with. If out-of-body experiences are truly part of passing over into the afterlife, then they usually represent an afterlife of some alternate universe where everything's wrong. 3. Some of the stories can't be explained by either of the above. They include specific details that the patient could not have known. Sadly, all of these are anecdotal. They're very interesting and I wish we had more of them, and that controls had been in place at the time. Since they weren't, the scientific method requires us to shrug and say "Neat, but not evidence, let's do it better next time."
As an example of the value of anecdotes in suggesting directions for research, Dr. Penny Sartori placed playing cards in obvious places on top of operating room cabinets at a hospital in Wales in 2001, while she was working as a nurse, as part of a supervised experiment. Although she's a believer in the afterlife, and documented fifteen cases of reported out-of-body experiences by patients during her research, not one person ever reported seeing the playing cards or even knowing they were there.
Life review, euphoria, bright lights, and meetings with sacred personages have all been correlated with high levels of carbon dioxide in the brain. Research published in the journal Critical Care in 2010 found that over one-fifth of heart attack patients who went into cardiac arrest and were resuscitated, all of whom would have had high CO 2 , reported these phenomena. But these patients were all also nearly dead; so the NDE correlates equally well with being near death as it does with the physiological condition. To find out which is the best correlation, we'd have to see whether an NDE can happen when one condition is present and the other is not.
It turns out that extensive research has been done to characterize a person's experience with loss of blood to the brain when there is no risk of death, by that patron saint of human experimentation, the US military. For 15 years, Dr. James Whinnery put hundreds of healthy young fighter pilots into centrifuges to understand what a pilot might experience under extreme gravitational loads. He put them in until they blacked out. Once they reached a point where there was inadequate bloodflow to the brain, they lost consciousness; and among the frequently reported experiences were the following: Bright light, floating through a tunnel, out of body experiences, vivid dreams of beautiful places, euphoria, rapid memories of past events, meeting with friends and family, and more. The list is an exact match with the events attributed by believers to a brush with the afterlife.
What about the reverse? Are there reliably documented reports of NDEs from people who were near death, but whose brains had normal oxygen supplies? If there are, I was not able to locate any. This leaves only one group of conditions that can be consistently correlated with what we call a near death experience, and it's not nearness to death. It's a set of brain conditions that includes hypoxia, hypercarbia, and anoxia.
Other researchers have also found ways to produce the symptoms of a NDE without nearness to death being a factor. In 1996, Dr. Karl Jansen published his successful results of inducing a NDE using the drug ketamine. In 2002, Nature published research in which experimenters gave direct electrical stimulation to the part of the brain called the angular gyrus in the parietal lobe. Subjects reported being able to see themselves lying there from a vantage point near the ceiling, and were able to communicate what they observed as it was happening. Some brain surgeries, most notably those for epilepsy, produce very high rates of NDE reports from patients whose lives were not in danger.
But believers in the afterlife are quick to point out that just because the reported experiences have natural explanations, it doesn't prove that the supernatural explanation is not also true in at least some of the cases. That's true, of course. We'd love to have such proof. Most of the symptoms of NDEs, like seeing a bright light and feeling euphoric, are too vague to serve as proof of the afterlife. But one isn't, and that's the out-of-body experience. What science would love to find is a win in a controlled test, consisting of the disembodied consciousness successfully completing a task under controlled conditions. If the claims of the most interesting such stories are true, this should not be a problem. It hasn't happened yet — nobody's yet seen Dr. Sartori's hidden cards, or beaten any other similar tests — but here's to hoping that they do. We all hope that death is not the end. Perhaps someday someone will prove Raymond Moody right, and we can all look forward to a catlike nine lives.
By Brian Dunning
Follow @BrianDunning
|
[Cystic teratoma of the ovary and cancer: structural and histochemical study].
Three cases corresponding to surgical pieces which included cystic ovarian tumors were studied, with the purpose of characterizing their structural and cytochemical components. Techniques of Hematoxylin -eosin, P.A.S., P.A.S.-amylase, Cason's thrichromic and Ag (Senior-Munger) were employed, the last one to determine the presence of cytoplasmic secretory granules. In two the of cases, mature cystic teratomes were found, one of them with malignant development, typical of an adenocarcinoma. The last case corresponded to a monodermic teratoma--highly specialized struma of the ovary-carcinoid tumor. It is to be noted that, in this last case, the patient consulted for hypertensive crises.
|
The image of Richard Nixon waving his arms as he boarded a helicopter leaving the White house for the last time as president on August 9, 1974, remains etched in generational memories. The solemnness of Gerald and Betty Ford waving goodbye to the disgraced 37th president next to David Eisenhower consoling Julie Nixon was in direct contrast to the jubilation of millions celebrating his departure. No more Tricky Dick and the Pink Lady, Helen Gahagan Douglas, no more links to the un-American House Un-American Activities Committee, no more Watergate. Good riddance Milhouse, Pat, Roy Cohn, Bebe Rebozo, H.R. Haldeman and all that. Basta.
There are those moments like Nixon’s waving that define an era. Joseph N. Welch’s challenging Senator Joseph McCarthy during the Army-McCarthy hearings on June 9, 1954, was another such moment. Welch asked: “Have you no sense of decency, sir, at long last? Have you left no sense of decency?” he questioned the Wisconsin senator on national television. Welch pricked the balloon of McCarthy and his anti-Communist hearings. Welch’s simple questions captured all that was wrong with McCarthy and his hysterical witch hunt. Welch, a partner in the Boston white-shoe law firm Hale and Dorr, cut through the anti-Communist frenzy by questioning McCarthy’s “sense of decency.”
What do Nixon’s resignation and Welch’s questions have in common? Both represent unspoken norms. In the Welch case, the American people understood what decency meant. Although there was an exaggerated fear of Communists after World War II – Alger Hiss, Julius and Ethel Rosenberg – somehow Welch was able to capture a decency in the American people that began the closure of McCarthy’s prominence. McCarthy was not being decent, and he and his era started drawing to a close.
And Nixon? This is not as obvious. While those who defend Nixon point to his opening to China and end to the Vietnam War, his detractors will never get over his endless political intrigues. Was there ever a political figure progressives loathed more? One can easily trace the genealogy of dirty tricksters from McCarthy’s Roy Cohn (later a Nixon pal) directly through to Roger Stone, Lee Atwater and Roger Ailes, if not to Steve Bannon and Donald Trump. Nixon was their godfather.
What did Nixon do that he deserves to be fondly remembered? He resigned. In July 1974, the House Judiciary Committee approved three articles of impeachment against him: obstruction of justice, abuse of presidential powers, and hindrance of the impeachment process. On August 5, some transcripts of the Watergate recordings were released, including a segment in which the president was heard instructing Haldeman to order the FBI to halt the Watergate investigation. On August 8, Nixon announced he would resign, which he did the next day.
In an evening nationally televised address, Nixon said: “By taking this action, I hope that I will have hastened the start of the process of healing which is so desperately needed in America.” He threw in the towel before the full House impeached him; he resigned before formal Senate hearings could be held. Richard Nixon was never officially impeached or removed from office.
Rather than face impeachment by the full House of Representatives or trial by the Senate, Nixon left office, the first sitting United States president to do so. Would he have been removed from office by the Senate? Certainly, the Watergate tapes showed his direct orders to cover-up the Watergate break-in as well as evidence that several of his staff members were involved in the break-in.
If Welch was able to establish a sense of decency during the McCarthy era, Nixon must be given credit for resigning. He left office to hasten “the start of the process of healing which is so desperately needed in America.” We can easily say that he knew he would be found guilty and removed from office. But he left office before that could happen. In a sense, he acted decently.
Will Donald Trump leave office if Robert Mueller or the United States Attorney for the Southern District of New York recommend that the House charge him with high crimes or misdemeanors? Would Trump have the decency to step down as Nixon did? Trump said at a campaign stop in Iowa: “You know what else they say about my people? The polls, they say I have the most loyal people. Did you ever see that? Where I could stand in the middle of Fifth Avenue and shoot somebody and I wouldn’t lose any voters, okay? It’s like incredible.”
Incredible? No, indecent.
Will Trump have the decency to step down if there is enough evidence against him or have the norms of decency and healing become ancient history? If Republican senators begin moving away from him instead of merely following, and polls show weakening support for the president approaching the 2020 elections, will enough senators say to Trump that it is time he step down? Can we envision that? Can we envision Trump leaving in a helicopter waving to the crowd as Mike Pence takes over?
Fondly remembering Richard Nixon means we can hope it will happen again.
|
Q:
R: cant get a lme{nlme} to fit when using self-constructed interaction variables
I'm trying to get a lme with self constructed interaction variables to fit. I need those for post-hoc analysis.
library(nlme)
# construct fake dataset
obsr <- 100
dist <- rep(rnorm(36), times=obsr)
meth <- dist+rnorm(length(dist), mean=0, sd=0.5); rm(dist)
meth <- meth/dist(range(meth)); meth <- meth-min(meth)
main <- data.frame(meth = meth,
cpgl = as.factor(rep(1:36, times=obsr)),
pbid = as.factor(rep(1:obsr, each=36)),
agem = rep(rnorm(obsr, mean=30, sd=10), each=36),
trma = as.factor(rep(sample(c(TRUE, FALSE), size=obsr, replace=TRUE), each=36)),
depr = as.factor(rep(sample(c(TRUE, FALSE), size=obsr, replace=TRUE), each=36)))
# check if all factor combinations are present
# TRUE for my real dataset; Naturally TRUE for the fake dataset
with(main, all(table(depr, trma, cpgl) >= 1))
# construct interaction variables
main$depr_trma <- interaction(main$depr, main$trma, sep=":", drop=TRUE)
main$depr_cpgl <- interaction(main$depr, main$cpgl, sep=":", drop=TRUE)
main$trma_cpgl <- interaction(main$trma, main$cpgl, sep=":", drop=TRUE)
main$depr_trma_cpgl <- interaction(main$depr, main$trma, main$cpgl, sep=":", drop=TRUE)
# model WITHOUT preconstructed interaction variables
form1 <- list(fixd = meth ~ agem + depr + trma + depr*trma + cpgl +
depr*cpgl +trma*cpgl + depr*trma*cpgl,
rndm = ~ 1 | pbid,
corr = ~ cpgl | pbid)
modl1 <- nlme::lme(fixed=form1[["fixd"]],
random=form1[["rndm"]],
correlation=corCompSymm(form=form1[["corr"]]),
data=main)
# model WITH preconstructed interaction variables
form2 <- list(fixd = meth ~ agem + depr + trma + depr_trma + cpgl +
depr_cpgl + trma_cpgl + depr_trma_cpgl,
rndm = ~ 1 | pbid,
corr = ~ cpgl | pbid)
modl2 <- nlme::lme(fixed=form2[["fixd"]],
random=form2[["rndm"]],
correlation=corCompSymm(form=form2[["corr"]]),
data=main)
The first model fits without any problems whereas the second model gives me following error:
Error in MEEM(object, conLin, control$niterEM) :
Singularity in backsolve at level 0, block 1
Nothing i found out about this error so far helped me to solve the problem. However the solution is probably pretty easy.
Can someone help me? Thanks in advance!
EDIT 1:
When i run:
modl3 <- lm(form1[["fixd"]], data=main)
modl4 <- lm(form2[["fixd"]], data=main)
The summaries reveal that modl4 (with the self constructed interaction variables) in contrast to modl3 shows many more predictors. All those that are in 4 but not in 3 show NA as coefficients. The problem therefore definitely lies within the way i create the interaction variables...
EDIT 2:
In the meantime I created the interaction variables "by hand" (mainly paste() and grepl()) - It seems to work now. However I would still be interested in how i could have realized it by using the interaction() function.
A:
I should have only constructed the largest of the interaction variables (combining all 3 simple variables).
If i do so the model gets fit. The likelihoods then are very close to each other and the number of coefficients matches exactly.
|
Skin Prick Test Reactivity to Aeroallergens among Egyptian Patients with Isolated Allergic Conjunctival Disease.
Allergic conjunctival disease (ACD) is a type of ocular allergy, which includes seasonal allergic conjunctivitis (SAC), perennial allergic conjunctivitis (PAC), and vernal keratoconjunctivitis (VKC). Little is known about the pattern of sensitization or prevalent aeroallergens among patients with isolated ACD in Egypt We aimed to evaluate the prevalence of skin prick test positivity to common aeroallergens among Egyptian patients with isolated allergic conjunctival disease. The study included 75 patients with isolated ACD recruited from a tertiary Egyptian outpatient clinic. Skin prick test (SPT) was performed for all patients with common aeroallergens. Total serum immunoglobulin E (IgE) was measured by ELISA. A positive SPT reaction was present among 32 patients (42.7%). The most prevalent aeroallergens among all patients were mites and pollens (12% respectively), followed by grass (8%) and hay dust (6.7%). Eight patients (10.7%) had SAC, 19 patients (25.3%) had PAC, and 48 patients (64%) had VKC. Prevalence of SPT positivity to indoor allergens was significantly more common among PAC (52.6%) than among SAC (25%) and VKC (16.7%), P= 0.011. Outdoor allergen sensitization did not differ significantly between the 3 subgroups, P= 0.614. Elevated IgE levels were observed among 62.5%, 73.7% and 66.7% of patients with SAC, PAC and VKC, respectively, with no statistically significant difference between them, P= 0.806. In conclusion aeroallergen sensitization is common among Egyptian patients with isolated ACD. Accordingly, SPT should be included in the diagnostic workup of these patients.
|
CHEM 107. Hair handout. Basic Structure of Hair and
Transcription
1 CHEM 107 Hair handout and Basic Structure of Hair A hair can be defined as a slender, thread-like outgrowth from a follicle in the skin of mammals. Composed mainly of keratin, it has three morphological regions the cuticle, medulla, and cortex. These regions are illustrated in Figure 1 with some of the basic structures found in them. The illustration is a diagram used to emphasize structural features discussed in this guide. Certain structures may be omitted, and others enhanced for illustrative purposes. Figure 1. Hair Diagram A hair grows from the papilla and with the exception of that point of generation is made up of dead, cornified cells. It consists of a shaft that projects above the skin, and a root that is imbedded in the skin. Figure 2 diagrams how the lower end of the root expands to form the root bulb. Its basic components are keratin (a protein), melanin (a pigment), and trace quantities of metallic elements. These elements are deposited in the hair during its growth and/or absorbed by the hair from an external environment. After a period of growth, the hair remains in the follicle in a resting stage to eventually be sloughed from the body.v Figure 2. Diagram of Hair in Skin
2 Cuticle The cuticle is a translucent outer layer of the hair shaft consisting of scales that cover the shaft. Figure 3 illustrates how the cuticular scales always point from the proximal or root end of the hair to the distal or tip end of the hair. Figure 3. Scanning Electron Photomicrograph of Hair
3 There are three basic scale structures that make up the cuticle coronal (crown-like), spinous (petal-like), and imbricate (flattened). Combinations and variations of these types are possible. Figures 4-9 illustrate scale structures. The coronal, or crown-like scale pattern is found in hairs of very fine diameter and resemble a stack of paper cups. Coronal scales are commonly found in the hairs of small rodents and bats but rarely in human hairs. Figure 4 is a diagram depicting a longitudinal view of coronal scales, and Figure 5 is a photomicrograph of a free-tailed bat hair. Figure 4. Diagram of Coronal Scales Figure 5. Photomicrograph of Bat Hair Spinous or petal-like scales are triangular in shape and protrude from the hair shaft. They are found at the proximal region of mink hairs and on the fur hairs of seals, cats, and some other animals. They are never found in human hairs. Figure 6 is a diagram of spinous scales, and Figure 7 is a photomicrograph of the proximal scale pattern in mink hairs. Figure 6. Diagram of Spinous Scales
4 Figure 7. Photomicrograph of Proximal Scale Pattern (Mink) The imbricate or flattened scales type consists of overlapping scales with narrow margins. They are commonly found in human hairs and many animal hairs. Figure 8 is a diagram of imbricate scales, and Figure 9 is a photomicrograph of the scale pattern in human hairs. Figure 8. Diagram of Imbricate Scales Figure 9. Photomicrograph of Scale Pattern (Human)
5 Medulla The medulla is a central core of cells that may be present in the hair. If it is filled with air, it appears as a black or opaque structure under transmitted light, or as a white structure under reflected light. If it is filled with mounting medium or some other clear substance, the structure appears clear or translucent in transmitted light, or nearly invisible in reflected light. In human hairs, the medulla is generally amorphous in appearance, whereas in animal hairs, its structure is frequently very regular and well defined. Figures 10 through 13 are photomicrographs of medullary types found in animal hairs. Figure 10 exhibits a uniserial ladder, and Figure 11 exhibits a multiserial ladder, both found in rabbit hairs. Figure 12 exhibits the cellular or vacuolated type common in many animal hairs. Figure 13 exhibits a lattice found in deer family hairs. Figure 10. Photomicrograph of Uniserial Ladder Medulla Figure 11. Photomicrograph of Multiserial Ladder Medulla
6 Figure 12. Photomicrograph of Animal Hair Figure 13. Photomicrograph of Deer Medulla When the medulla is present in human hairs, its structure can be described as fragmentary or trace, discontinuous or broken, or continuous. Figure 14 is a diagram depicting the three basic medullary types.
7 Figure 14. Diagram of Medullas (Trace, top; Discontinuous, middle; Continuous, bottom) Cortex The cortex is the main body of the hair composed of elongated and fusiform (spindle-shaped) cells. It may contain cortical fusi, pigment granules, and/or large oval-to-round-shaped structures called ovoid bodies. Cortical fusi in Figure 15 are irregular-shaped airspaces of varying sizes. They are commonly found near the root of a mature human hair, although they may be present throughout the length of the hair. Figure 15. Photomicrograph of Cortical Fusi in Human Hair Pigment granules are small, dark, and solid structures that are granular in appearance and considerably smaller than cortical fusi. They vary in color, size, and distribution in a single hair. In humans, pigment granules are commonly distributed toward the cuticle as shown in Figure 16, except in red-haired individuals as in Figure 17. Animal hairs have the pigment granules commonly distributed toward the medulla, as shown in Figure 18.
9 Ovoid bodies are large (larger than pigment granules), solid structures that are spherical to oval in shape, with very regular margins. They are abundant in some cattle (Figure 19) and dog (Figure 20) hairs as well as in other animal hairs. To varying degrees, they are also found in human hairs (Figure 21). Figure 19. Photomicrograph of Ovoid Bodies in Cattle Hair Figure 20. Photomicrograph of Ovoid Bodies in Dog Hair Figure 21. Photomicrograph of Ovoid Bodies in Human Hair
10 Hair Identification Animal Versus Human Hairs Human hairs are distinguishable from hairs of other mammals. Animal hairs are classified into the following three basic types. Guard hairs that form the outer coat of an animal and provide protection Fur or wool hairs that form the inner coat of an animal and provide insulation Tactile hairs (whiskers) that are found on the head of animals provide sensory functions Other types of hairs found on animals include tail hair and mane hair (horse). Human hair is not so differentiated and might be described as a modified combination of the characteristics of guard hairs and fur hairs. Human hairs are generally consistent in color and pigmentation throughout the length of the hair shaft, whereas animal hairs may exhibit radical color changes in a short distance, called banding. The distribution and density of pigment in animal hairs can also be identifiable features. The pigmentation of human hairs is evenly distributed, or slightly more dense toward the cuticle, whereas the pigmentation of animal hairs is more centrally distributed, although more dense toward the medulla. The medulla, when present in human hairs, is amorphous in appearance, and the width is generally less than one-third the overall diameter of the hair shaft. The medulla in animal hairs is normally continuous and structured and generally occupies an area of greater than one-third the overall diameter of the hair shaft. The root of human hairs is commonly club-shaped (figure 22), whereas the roots of animal hairs are highly variable. Figure 22. Photomicrograph of Human Hair Root The scale pattern of the cuticle in human hairs is routinely imbricate. Animal hairs exhibit more variable scale patterns. The shape of the hair shaft is also more variable in animal hairs. Human Hair Classifications Hair evidence examined under a microscope provides investigators with valuable information.
11 Hairs found on a knife or club may support a murder and/or assault weapon claim. A questioned hair specimen can be compared microscopically with hairs from a known individual, when the characteristics are compared side-by-side. Human hairs can be classified by racial origin such as Caucasian (European origin), Negroid (African origin), and Mongoloid (Asian origin). In some instances, the racial characteristics exhibited are not clearly defined, indicating the hair may be of mixed-racial origin. The region of the body where a hair originated can be determined with considerable accuracy by its gross appearance and microscopic characteristics. The length and color can be determined. It can also be determined whether the hair was forcibly removed, damaged by burning or crushing, or artificially treated by dyeing or bleaching. The characteristics and their variations allow an experienced examiner to distinguish between hairs from different individuals. Hair examinations and comparisons, with the aid of a comparison microscope, can be valuable in an investigation of a crime. DNA Examinations Hairs that have been matched or associated through a microscopic examination should also be examined by mtdna sequencing. Although it is uncommon to find hairs from two different individuals exhibiting the same microscopic characteristics, it can occur. For this reason, the hairs or portions of the hairs should be forwarded for mtdna sequencing. The combined procedures add credibility to each. Although nuclear DNA analysis of hairs may provide an identity match, the microscopic examination should not be disregarded. The time and costs associated with DNA analyses warrant a preliminary microscopic examination. Often it is not possible to extract DNA fully, or there is not enough tissue present to conduct an examination. Hairs with large roots and tissue are promising sources of nuclear DNA. However, DNA examinations destroy hairs, eliminating the possibility of further microscopic examination. Document reference:
Chapter 3 The Study of Hair By the end of the chapter you will be able to: identify the various parts of a hair describe variations in the structure of the medulla, cortex, and cuticle distinguish between
37 Hair & Fiber (Unit 5) Morphology of Hair Hair is encountered as physical evidence in a wide variety of crimes. A review of the forensic aspects of hair examination must start with the observation that
Hair Analysis 2005, 2004, 2003, 2001, 1999 by David A. Katz. All rights reserved. Hair can be important physical evidence at a crime scene. Hair normally falls from the body over the course of a day. It
Chemical Principles Exp. #7 Hair and Fiber Identification Fibers are produced naturally by plants and animals and synthetically by man. By gross observation, most fibers have a high length-to-width ratio
Notes on Hair Analysis I have found local veterinarians very uncooperative when trying to get samples of dog and cat fur. I have found neighbors, friends and relatives a much better source of fur. There
Trace Evidence How Fibers and Hair are used to aid in Crime Solving. Locard s Exchange Principal when a criminal comes in contact with a person or object a cross transfer of evidence occurs. Fibers how
Hair Relaxers Science, Design, and Application www.alluredbooks.com Chapter 1 Hair Chemistry We all know that the hair on our head is dead, but underneath the scalp, within the hair follicle, is a surprisingly
Staple here TECHNICAL MANUAL BASIC CONCEPTS OF HAIR PHYSIOLOGY AND COSMETIC HAIR DYES COVER PAGE MACRO-STRUCTURE OF THE HAIR The hair is formed by the shaft and the piliferous bulb. The visible part of
Hair, Fiber and Paint Chapter 8 Introduction Hair is encountered as physical evidence in a wide variety of crimes. Although it is not yet possible to individualize a human hair to any single head or body
Chapter 1 All you need to know about hair almost Before you know about your future see your past before improving your future hair see what has been and is the state of your hair now Ravi Bhanot Typically
PROPERTIES OF THE HAIR AND SCALP 1. The scientific study of hair, its diseases and care is called: a. dermatology c. biology b. trichology d. cosmetology 2. The two parts of a mature hair strand are the
1 PROCEDURES FOR HAIR ANALYSIS Hair examination involves the meticulous visual examination and searching of articles of evidence for the presence of hair, which are mounted on microscope slides in mounting
ENFSI-BPM-THG-03 (vs.01) BPM for the Microscopic Examination and Comparison of Human and Animal Hair Best Practice Manual for the Microscopic Examination and Comparison of Human and Animal Hair ENFSI-BPM-THG-03
Exercise V Bacterial Cultural Characteristics or Morphology When a single bacterial cell is deposited on a solid or in a liquid medium, it begins to divide. One cell produces two, two produce four, four
CLASS 1X BIOLOGY CHAPTER- SKIN- STRUCTURE AND FUNCTIONS The skin in man is the largest of all body organs. There are many structures and glands derived from the skin. Hence the skin along with its derivatives
Inside Hair: A Closer Look at Color and Shape For the past decade women and men alike have had chemical treatments preformed on their hair. Consumers spend millions of dollars on hair care products such
Plant Structure and Function Structure and Function Q: How are cells, tissues, and organs organized into systems that carry out the basic functions of a seed plant? 23.1 How are plant tissues organized?
Objectives INTEGUMENTARY SYSTEM CHAPTER 4 1. List the general function of each membrane type (cutaneous, mucous, serous, synovial) and give its location. 2. Compare the tissue makeup of the major membrane
Versatile in its functions, human skin is a waterproof fabric that serves as a first line of defence against injury or invasion by hostile organisms. This protective ability is due to the presence of a
Cells Cells are the fundamental unit of life. All living things are composed of cells. While there are several characteristics that are common to all cells, such as the presence of a cell membrane, cytoplasm,
Plant Structure, Growth, & Development Ch. 35 Plants have organs composed of different tissues, which in turn are composed of different cell types A tissue is a group of cells consisting of one or more
Forensics applications with Phenom desktop SEM The Phenom desktop SEM combines the best of the optical and electron optical world. The Phenom provides useful images up to 45,000x magnification with high
Chapter 3 The Study f Hair By the end f this chapter yu will be able t: Identify the varius parts f a hair Describe variatins in the structure f the medulla, crtex, and cuticle Distinguish between human
The Cutaneous Membrane Lab Skin Model An overview of human skin anatomy including the types of skin cells in each layer. Complete with an anatomy quiz so you can test your understanding. Skin is actually
Lab 8: Integumentary System Akkaraju, Liachovitzky & McDaniel, 2010-11 Objectives Checklist. After completion of this lab you should be able to: list the general functions of the integumentary system and
Plant and Animal Cells a. Explain that cells take in nutrients in order to grow, divide and to make needed materials. S7L2a b. Relate cell structures (cell membrane, nucleus, cytoplasm, chloroplasts, and
Overview Thick and Thin Evaluating layers of the skin Understanding the layered structure of skin is essential to understanding how it functions. The focus of this lesson is for students to discover and
Forensic Science UNIT I: Introduction to Forensic Science and Human Body The student will demonstrate the ability to explain the history and philosophy of forensic science. a. Define forensic science or
13 Glass & Soil (Unit 3) Glass Fractures Glass bends in response to any force that is exerted on any one of its surfaces. When the limit of its elasticity is reached, the glass will fracture. Frequently,
Cells and Their Organelles The cell is the basic unit of life. The following is a glossary of animal cell terms. All cells are surrounded by a cell membrane. The cell membrane is semi-permeable, allowing
Chicken Wing Lab: Tissues and Muscular System Background Pre-Lab Questions 1. What factors contribute to variation in muscle mass? 2. What proteins are responsible for movement? 3. Describe the four connective
Animal Tissues There are four types of tissues found in animals: epithelial tissue, connective tissue, muscle tissue, and nervous tissue. In this lab you will learn the major characteristics of each tissue
5 The Integumentary System FOCUS: The integumentary system consists of the skin, hair, nails, and a variety of glands. The epidermis of the skin provides protection against abrasion, ultraviolet light,
Name Class Date Biology Ch 10 Cell Growth & Division (10.1-10.2) For Questions 1 4, write True if the statement is true. If the statement is false, change the underlined word or words to make the statement
Period Date LAB. LEAF STRUCTURE Plants are incredible organisms! They can make all their own food from the simple inputs of: sunlight air (carbon dioxide) water minerals This biological wizardry is accomplished
Touch DNA and DNA Recovery 1 2 What is the link between cell biology & forensic science? Cells are the trace substances left behind that can identify an individual. Cells contain DNA. There are two forms
Structure of the Kidney Laboratory Exercise 56 Background The two kidneys are the primary organs of the urinary system. They are located in the upper quadrants of the abdominal cavity, against the posterior
Resource For A&P The following source of information will help you master the the basics of anatomy and physiology 1. Body Smart http://www.getbodysmart.com www.getbodysmart.com/ which has animations to
4THE UNIVERSITY OF THE STATE OF NEW YORK SPRING 2008 GRADE 4 ELEMENTARY-LEVEL SCIENCE TEST WRITTEN TEST Student Name School Name Print your name and the name of your school on the lines above. The test
Mitosis Objectives Having completed the lab on mitosis, you should be able to: 1. Identify each phase of mitosis on the onion root tip and the whitefish blastula. 2. Describe the events during each phase
X-Plain Alopecia Reference Summary Introduction Hair loss is very common in both men and women. You or someone you love may be experiencing hair loss. Hair follicle Learning about normal hair growth is
The Integumentary System Dr. Ali Ebneshahidi The Skin The integument system consists of the skin (cutaneous membrane) and its accessory organs. The skin is composed of three layers of tissue: the outer
CELERY LAB - Structure and Function of a Plant READ ALL INSTRUCTIONS BEFORE BEGINNING! YOU MAY WORK WITH A PARTNER ON THIS ACTIVITY, BUT YOU MUST COMPLETE YOUR OWN LAB SHEET! Look at the back of this paper
CELERY LAB - Structure and Function of a Plant READ ALL INSTRUCTIONS BEFORE BEGINNING! YOU MAY WORK WITH A PARTNER ON THIS ACTIVITY, BUT YOU MUST COMPLETE YOUR OWN LAB SHEET! Plants are incredible organisms!
EFFECT OF CHLORINE ON HUMAN HAIR by Marianne Suwalski Background, Purpose and Hypothesis I have been swimming for many years, without ever wearing a swim cap, and have always had brittle and dull hair.
RAD 223 Radiography physiology Lecture Notes First lecture: Cell and Tissue Physiology: the word physiology derived from a Greek word for study of nature. It is the study of how the body and its part work
The Cell: Organelle Diagrams Fig 7-4. A prokaryotic cell. Lacking a true nucleus and the other membrane-enclosed organelles of the eukaryotic cell, the prokaryotic cell is much simpler in structure. Only
DNA Structure: Gumdrop Modeling Student Advanced Version DNA is one of the most important molecules in our bodies. It s like a recipe book with the instructions for making us who we are. Because each cell
GB2 Change men's colour Learner Name Date session started Date session finished Session 4 of 6 Level 2 Barbering GB2.4.1a Colour and Light When looking at an object or at the colour of hair, what you are
Functions INTEGUMENTARY SYSTEM Anatomy and Physiology Text and Laboratory Workbook, Stephen G. Davenport, Copyright 2006, All Rights Reserved, no part of this publication can be used for any commercial
Human Biology Book Ch. 3.3 Skin performs important functions. Just as an apple's skin protects the fruit inside, your skin protects the rest of your body. Made up of flat sheets of cells, your skin protects
Skin and appendages Lecture objectives briefly list the functions of the integumentary system. describe the two principal layer of the skin. list the layers of the epidermis. describe what are lines of
BTEC s own resources 3.1 Cells and cell function In this section: P1 How you are made Key terms Tissue a group of similar cells acting together to perform a particular function. Epithelial cells one of
Organic Molecules and Water 1. In most animal cells, a complex network of proteins provides which of the following? A. organization B. shape C. movement D. all of these 2. Technology Enhanced Questions
Chapter 6: Wherever he steps, whatever he touches, whatever he leaves even unconsciously, will serve as silent witness against him. Not only his fingerprints or his footprints, but his hair, the fibers
SCAN IN A BOX Guide to the Ideal 3D Scan Part I General Considerations This document is a guide for the person that approaches for the first time to the world of 3D scanning. The advices contained in this
LESSON ASSIGNMENT LESSON 2 Tissues of the Body. TEXT ASSIGNMENT Paragraphs 2-1 through 2-17. LESSON OBJECTIVES After completing this lesson, you should be able to: 2-1. Define tissue. 2-2. Name four major
Lab 2- Bio 160 Name: Prokaryotic and Eukaryotic Cells OBJECTIVES To explore cell structure and morphology in prokaryotes and eukaryotes. To gain more experience using the microscope. To obtain a better
Basic Human Anatomy Lesson 2: Tissues of the Body Welcome to Lesson 2 of the Basic Human Anatomy Course. Today, we ll be studying the Basic Tissues of the Body. I have 5 goals for you in this lesson: 1.
|
Abstract
The paper describes the concept of a compact, lightweight heterodyne NIR spectro-radiometer suitable for atmospheric sounding with solar occultations, and the first measurement of CO2 and CH4 absorption near 1.65 μm with spectral resolution λ/δλ~108. A highly stabilized DFB laser was used as local oscillator, while single model silica fiber Y-coupler served as a diplexer. Radiation mixed in the single mode fiber was detected by a balanced couple of InGaAs p-i-n diodes within the bandpass of ~3 MHz. Wavelength coverage of spectral measurement was provided by sweeping local oscillator frequency in the range of 1.1 cm−1. With the exposure time of 10 min, the absorption spectrum of the atmosphere over Moscow has been recorded with S/N ~120, limited by shot noise. The inversion algorithm applied to this spectrum resulted in methane vertical profile with a maximum mixing ratio of 2148 ± 10 ppbv near the surface and column density 4.59 ± 0.02·1022 cm−2.
E. Choi, K. Choi, S.-M. Yi, “Non-methane hydrocarbons in the atmosphere of a Metropolitan City and a background site in South Korea: Sources and health risk potentials,” Atmos. Environ. 45(40), 7563–7573 (2011).
[CrossRef]
E. Choi, K. Choi, S.-M. Yi, “Non-methane hydrocarbons in the atmosphere of a Metropolitan City and a background site in South Korea: Sources and health risk potentials,” Atmos. Environ. 45(40), 7563–7573 (2011).
[CrossRef]
Choi, E.
E. Choi, K. Choi, S.-M. Yi, “Non-methane hydrocarbons in the atmosphere of a Metropolitan City and a background site in South Korea: Sources and health risk potentials,” Atmos. Environ. 45(40), 7563–7573 (2011).
[CrossRef]
Choi, K.
E. Choi, K. Choi, S.-M. Yi, “Non-methane hydrocarbons in the atmosphere of a Metropolitan City and a background site in South Korea: Sources and health risk potentials,” Atmos. Environ. 45(40), 7563–7573 (2011).
[CrossRef]
|
The Melbourne factory that exploded in a chemical inferno on Friday morning is linked to another factory that went up in flames last August, according to the findings of an Environmental Protection Authority investigation.
Key points: Last week's Melbourne factory fire has been linked to an "alleged criminal operation"
Last week's Melbourne factory fire has been linked to an "alleged criminal operation" Internal EPA documents connect the Campbellfield fire to last year's West Footscray factory fire
Internal EPA documents connect the Campbellfield fire to last year's West Footscray factory fire The Hells Angels have also been linked to the network behind the fire
The environmental regulator is also expecting to find more unlicensed dumps.
The factory blaze in Campbellfield last week choked surrounding suburbs in Melbourne's north with thick smoke and caused nearby schools to close.
The ABC can reveal that the EPA's investigation, launched after last years' West Footscray factory fire, has identified "an alleged criminal operation" involving over a dozen outer-suburban Melbourne sites where vast amounts of hazardous chemicals are being stored, in most instances without a licence.
The ABC can also reveal it is feared that toxic chemicals may have been dumped in sinkholes at a property in western Victoria, and that the company whose factory caught fire last week has transported hazardous waste in rental trucks that are not licensed to carry the dangerous goods.
Code-named Operation Hydrogen, the EPA investigation led the regulator to numerous locations in the Melbourne suburbs of Craigieburn, Epping, Tottenham and Campbellfield — including the Campbellfield site that exploded in flames on Friday morning — where it has now found over 35 million litres of hazardous chemicals.
Got a confidential news tip? Email ABC Investigations at [email protected] For more sensitive information: Text message using the Signal phone app +61 436 369 072 No system is 100 per cent secure, but the Signal app uses end-to-end encryption and can protect your identity. Please read the terms and conditions.
Internal EPA documents obtained by the ABC show the investigation identified a number of associates of the West Footscray factory tenant, Graeme Leslie White, were involved in the operation, including Bradbury Industrial Services, which was based at the Campbellfield factory that burnt down last week.
"White has advised EPA officers that he has a commercial relationship with Bradbury. Anecdotal evidence suggests that White probably also has a personal relationship with one or more employees of Bradbury," the documents say.
Bradbury Industrial Services offers storage and disposal services for hazardous waste. ( ABC News: Dylan Anderson )
The alleged criminal operation "involved the acceptance of chemical waste from various businesses for a fee, which is then stockpiled in warehouses rented by White or Bradbury."
Despite extensive efforts, the ABC has been unable to contact the Bradbury individuals named in the EPA documents. The company's office phone number now rings out and emails bounce back undeliverable.
Hells Angels links to network investigated
Mr White was jailed last week over a large haul of illegal weapons discovered when police and the EPA raided his western Victorian property at Kaniva.
Graham White photographed outside one of the sites inspected by the EPA. ( ABC News )
The EPA documents state there is anecdotal evidence he is "linked to the Hells Angels outlaw motorcycle gang."
The investigation raises the prospect that networks involving convicted criminals, prepared to flout licence laws, may have infiltrated the lucrative waste disposal market, hoarding enormous quantities of dangerous toxic chemicals in suburban Melbourne, unregulated and in some instances beyond the knowledge of the regulator.
Bradbury occupies four warehouses the EPA identified, in addition to the Campbellfield warehouse that burnt down on Friday.
Those four sites were among the unlicensed group. The site of Friday's fire had been licensed, but that licence was suspended after the EPA found in late January it contained three times the volume permitted under its licence.
Toxic waste carried in rental trucks
Space to play or pause, M to mute, left and right arrows to seek, up and down arrows for volume. Watch Duration: 1 minute 22 seconds 1 m 22 s About 100 firefighters responded to the blaze.
A former employee of Bradbury, who did not want to be identified, told the ABC the company hired trucks from rental agencies to use in the transportation of chemicals, despite those vehicles not being licensed for such a purpose.
He said when EPA inspectors visited Bradbury's premises, they did not inspect the trucks.
The former employee also said that many of the containers of chemicals that Bradbury's drivers would collect from customers were unlabelled, and that Bradbury employees had no way of knowing what was in them.
"How waste is disposed of is relying at almost every step on honesty and complete information, whereas it was very rare that you would actually get that from the people we were picking it up from," he said.
"Literally hundreds of times you would be sent somewhere to pick something up, and you wouldn't know what it was, they wouldn't know what it was or it would be something different from what you were told it was."
In a statement to the ABC, the EPA said it took such allegations extremely seriously.
"The safety of the public and the environment are our first concerns. However, the Bradbury fire is the subject of multiple investigations by the coroner and arson squad.
"EPA cannot comment on any matter that could be pertinent to those investigations in case it in some way jeopardises the outcome."
The ABC has been told that only days before last week's fire started, the EPA demanded the company hand over documents and records relating to the chemical stockpile.
The EPA documents show the investigation also identified eight unlicensed sites occupied by Mr White where chemicals were stored.
Chris Baldwin is "believed to have links to the Hells Angels," according to EPA documents. ( Supplied: Channel Nine )
"[T]he financial benefits for White and his associates probably total millions of dollars.
"Based on the volumes of chemicals found and the ongoing discovery of warehouses containing stockpiled chemical waste, it is probable more sites containing stockpiled chemical waste will be identified by the authorities."
The EPA documents state that Shepparton accountant Christopher Baldwin, the owner of the West Footscray site leased by Mr White is also "believed to have links to the Hells Angels."
The ABC has previously reported that Mr Baldwin, who was raided last year by the Tax Office during a phoenixing investigation, is linked to senior Hells Angels through company directorships and shareholdings.
The documents do not link Mr Baldwin to the waste operation, but detail a number of corporate connections between Mr White's companies, Mr Baldwin's former accounting firm, and the West Footscray factory address.
Repeated attempts by the ABC to contact Mr Baldwin in the past have gone answered.
Drums found with 'blue liquid'
The coroner has launched an investigation into the Melbourne factory blaze. ( ABC News: Dylan Anderson )
Last July, EPA inspectors accompanied by officers from Victoria Police and the Australian Federal Police visited a property owned by Mr White near the town of Kaniva in western Victoria and found 26 sites where vegetation had been cleared.
At one of these sites they discovered a number of drums containing a blue liquid.
The EPA inspectors also tested soil near a number of sinkholes on the Kaniva property, finding traces of the toxic and flammable solvents toluene, ethyl benzene and xylenes. It is not known whether any chemicals have been deposited in these sinkholes.
Last month, the EPA issued Bradbury with a "show cause" notice.
"Bradbury responded to the show cause letter with a generic explanation of the services they provide to the waste industry and details of their future plans for extension. No explanation was provided as to how the non-compliance of their licence was to be addressed," the documents state.
The EPA then suspended Bradbury's licence.
Two workers from the Campbellfield warehouse were hospitalised following the fire. One, who was carrying a barrel of chemicals at the time the fire struck, has serious burns, including to his face.
Victorian Coroner Darren Bracken has announced he will investigate this week's fire. The coroner is already investigating the West Footscray fire. A coroner can investigate a fire regardless of whether a person has died.
|
The Rapper Formerly Known as Mos Def Was Arrested in Cape Town With a World Passport. What’s a World Passport?
Yasiin Bey at the 68th Cannes Film Festival in Cannes, France, on May 16, 2015.
Photo by Loic Venance/AFP/Getty Images
The AP reports that Yasiin Bey, the rapper and actor formerly known as Mos Def, was arrested at Cape Town International Airport and has been given 14 days to leave the country after violating immigration laws. After relocating to South Africa in 2013, he overstayed his visitor’s permit and was arrested on Thursday after trying to use an unrecognized “world passport” when trying to leave the country. What’s is that?
As Slate’s Daniel Engber explained in 2006, the Washington-based World Service Authority issues world passports to people who, for whatever reason, prefer not to claim citizenship in any particular country. Only about six countries formally recognize the passport, although, according to the WSA, more than 180 countries, including South Africa, have accepted them on at least one occasion. Actually traveling with one, as Engber wrote, is a bit of a crapshoot and “chances of success will likely depend on the whim (or ignorance) of the schlub working customs at your destination.” (It’s not clear from the initial coverage if Bey was using one of the WSA’s passports or one issued by some other authority. Update: Jan. 15, 2016: Al Jazeera's Atossa Abrahamian confirms that it was from WSA.)
Advertisement
The world passport was the creation of American-born former Broadway actor and world government advocate Garry Davis, who in 1948 renounced his U.S. citizenship at the U.S. embassy in Paris and declared himself a global citizen. Davis managed to travel widely, though he was frequently arrested, and became a minor celebrity for stunts like stealing $47 worth of lingerie from a French department store in order to be arrested and avoid deportation. Davis eventually settled in Vermont, where he died in 2013. In his later years, he had world passports sent to international fugitives Julian Assange and Edward Snowden, though it doesn’t appear to have helped either of them very much in their current predicaments.
As for Bey, his immigration status has been the subject of speculation before. The Brooklyn native told South Africa’s Mail & Guardian in 2014 that he was attracted to Cape Town by the “good vibes” and the thriving art scene as well as dissatisfaction with his home country. “For a guy like me, with five or six generations from the same town in America, to leave America, things gotta be not so good with America," he said. In May 2014, when the politically outspoken rapper canceled a few U.S. tour dates, there were rumors picked up by several news outlets that Bey was being prevented from returning to the United States due to “immigration issues.” The rumors turned out to be false, and he was back in New York for a performance at a Dave Chappelle comedy show that June.
Bey is presumably still a U.S. citizen, unless he has gone through the required procedure, as Davis did, of signing an oath of renunciation at a U.S. diplomatic office in a foreign country. So he should be able to return to the United States if he is expelled from South Africa.
Joshua Keating is a staff writer at Slate focusing on international affairs and author of the forthcoming book, Invisible Countries.
|
#########################################################################
# OpenKore - Packet sending
# This module contains functions for sending packets to the server.
#
# This software is open source, licensed under the GNU General Public
# License, version 2.
# Basically, this means that you're allowed to modify and distribute
# this software. However, if you distribute modified versions, you MUST
# also distribute the source code.
# See http://www.gnu.org/licenses/gpl.html for the full license.
########################################################################
#bysctnightcore
package Network::Send::kRO::RagexeRE_2017_09_20b;
use strict;
use base qw(Network::Send::kRO::RagexeRE_2017_09_13b);
sub new {
my ($class) = @_;
my $self = $class->SUPER::new(@_);
my %packets = (
'089B' => ['actor_action', 'a4 C', [qw(targetID type)]],
'0889' => ['actor_info_request', 'a4', [qw(ID)]],
'0939' => ['actor_look_at', 'v C', [qw(head body)]],
'0921' => ['actor_name_request', 'a4', [qw(ID)]],
'092E' => ['buy_bulk_buyer', 'v a4 a4 a*', [qw(len buyerID buyingStoreID itemInfo)]], #Buying store
'0874' => ['buy_bulk_closeShop'],
'0865' => ['buy_bulk_openShop', 'v V C Z80 a*', [qw(len limitZeny result storeName itemInfo)]], # Buying store
'0961' => ['buy_bulk_request', 'a4', [qw(ID)]], #6
'085A' => ['character_move', 'a3', [qw(coordString)]],
'0861' => ['friend_request', 'a*', [qw(username)]],# len 26
'095D' => ['homunculus_command', 'v C', [qw(commandType, commandID)]],
'086C' => ['item_drop', 'a2 v', [qw(ID amount)]],
'0436' => ['item_list_window_selected', 'v V V a*', [qw(len type act itemInfo)]],
'0369' => ['item_take', 'a4', [qw(ID)]],
'0923' => ['map_login', 'a4 a4 a4 V C', [qw(accountID charID sessionID tick sex)]],
'086A' => ['party_join_request_by_name', 'Z24', [qw(partyName)]],
'0862' => ['skill_use', 'v2 a4', [qw(lv skillID targetID)]],
'0919' => ['skill_use_location', 'v4', [qw(lv skillID x y)]],
'0926' => ['storage_item_add', 'a2 V', [qw(ID amount)]],
'07EC' => ['storage_item_remove', 'a2 V', [qw(ID amount)]],
'0864' => ['storage_password'],
'088E' => ['sync', 'V', [qw(time)]],
'094C' => ['search_store_info', 'v C V2 C2 a*', [qw(len type max_price min_price item_count card_count item_card_list)]],
'096A' => ['search_store_request_next_page'],
'0937' => ['search_store_select', 'a4 a4 v', [qw(accountID storeID nameID)]],
);
$self->{packet_list}{$_} = $packets{$_} for keys %packets;
my %handlers = qw(
actor_action 089B
actor_info_request 0889
actor_look_at 0939
actor_name_request 0921
buy_bulk_buyer 092E
buy_bulk_closeShop 0874
buy_bulk_openShop 0865
buy_bulk_request 0961
character_move 085A
friend_request 0861
homunculus_command 095D
item_drop 086C
item_list_window_selected 0436
item_take 0369
map_login 0923
party_join_request_by_name 086A
skill_use 0862
skill_use_location 0919
storage_item_add 0926
storage_item_remove 07EC
storage_password 0864
sync 088E
search_store_info 094C
search_store_request_next_page 096A
search_store_select 0937
);
$self->{packet_lut}{$_} = $handlers{$_} for keys %handlers;
# #if PACKETVER == 20170920 //
# packetKeys(0x53024DA5,0x04EC212D,0x0BF87CD4);
# use = $key1 $key3 $key2
# $self->cryptKeys(0x53024DA5,0x0BF87CD4,0x04EC212D);
return $self;
}
1;
|
Speaking at SXSW, The Walking Dead creator Robert Kirkman was able to share a few new details about the upcoming online co-op game developed by Overkill, titled Overkill’s The Walking Dead.
Kirkman explained that the game will be heavily inspired by Overkill’s former hit, Payday 2. “It will be Payday-esque. I’m told it will be in a bigger world than Payday currently encompasses. They are going to be learning a lot of stuff from Payday that they will be incorporating into The Walking Dead game,” he said.
“Payday is an online cooperative game correct? Yes. So it will be it will follow a similar approach. That’s good news,” Kirkman concluded.
The comics creator also mentioned that more info was going to be revealed soon. In the meantime, however, all we fans can do is wait in our mountains of speculation for whatever news may be coming.
Source: Polygon.
Some of our posts include links to online retail stores. We get a small cut if you buy something through one of our links. Don't worry, it doesn't cost you anything extra.
|
The specificity requirements of bacteriophage T4 lysozyme. Involvement of N-acetamido groups.
Bacillus cereus peptidoglycan with N-unsubstituted glucosamine residues was insensitive to treatment with bacteriophage T4 lysozyme. After N-acetylation with acetic anhydride, T4 lysozyme cleared solutions of the peptidoglycan and reducing sugars were liberated. The digestion products were mainly of high molecular weight, since the peptidoglycan is peptide cross-linked to a great extent. N-Propylation did not convert the partially N-unsubstituted peptidoglycan to a sensitive form. It is concluded that the acetamido groups are required for binding and/or catalysis by T4 lysozyme.
|
Effects of a single-task versus a dual-task paradigm on cognition and balance in healthy subjects.
Recent evidence has revealed deficiencies in the ability to divide attention after concussion. To examine the effects of a single vs a dual task on cognition and balance in healthy subjects and to examine reliability of 2 dual-task paradigms while examining the overall feasibility of the tasks. Pretest-posttest experimental design. Sports medicine research laboratory. 30 healthy, recreationally active college students. Subjects performed balance and cognitive tasks under the single- and dual-task conditions during 2 test sessions 14 d apart. The procedural reaction-time (PRT) test of the Automated Neuropsychological Assessment Metrics (eyes-closed tasks) and an adapted Procedural Auditory Task (PAT; eyes-open tasks) were used to assess cognition. The NeuroCom Sensory Organization Test (SOT) and the Balance Error Scoring System (BESS) were used to assess balance performance. Five 2-way, within-subject ANOVAs and a paired-samples t test were used to analyze the data. ICCs were used to assess reliability across 2 test sessions. On the SOT, performance significantly improved between test sessions (F1,29 = 35.695, P < .001) and from the single to the dual task (F1,29 = 9.604, P = .004). On the PRT, performance significantly improved between test sessions (F1,29 = 57.252, P < .001) and from the single to the dual task (F1,29 = 7.673, P = .010). No differences were seen on the BESS and the PAT. Reliability across test sessions ranged from moderate to poor for outcome measure. The BESS appears to be a more reliable and functional tool in dual-task conditions as a result of its increased reliability and clinical applicability. In addition, the BESS is more readily available to clinicians than the SOT.
|
Never Underestimate the Power of a Slight
So Fred Thompson's in the race and in New Hampshire, at least, in a heap of trouble too.
A lot of voters there are ticked that he skipped a debate there.
I'm sure he'll try to make amends, but it reminds me of something my Irish mom used to tell me: "Never underestimate the power of a slight" — or the simple reality that you never get a second chance to make a first impression.
Lee Iacocca intrinsically knew that when he had his first big meeting with hundreds of frustrated Chrysler workers. His Vince Lombardi-like pep talk was so inspiring, I'm told, that workers pledged their undying loyalty to lee right there, right on the spot.
Ditto former Johnson & Johnson CEO Jim Burke's crisis baptism by fire with the Tylenol tampering scandal back in the 1980s. Rather than duck the controversy, Burke took the offensive: Recalling capsules, reassuring consumers and ultimately winning over investors.
Not so his counterpart at Union Carbide during the Bhopal gas leak in India in 1984 that claimed thousands of lives. Defensive, prickly and evasive — that CEO… forgettable.
Some wow in the moment. Others lose the moment.
Don't get me wrong: You can still get back a moment.
Who knows that better than Bill Clinton after his disastrously long-winded speech for Michael Dukakis back in 1988?
|
Q:
What are travel times of Andromeda's Slipstream?
I was wondering if anyone knew how long on average it took a ship to travel from place to using the Slipstream. In the show things seem very subjective, I am trying to develop an FTL system for a science-fantasy setting and I intend to base that system on the slipstream, but I have no idea as to the slipstream's travel times.
A:
This is specifically answered in the show's "Director's Bible".
One interesting thing about moving through the Slipstream is that travel time has almost nothing to do with the distance between stars.
If you're lucky and the Stream unfolds just right, you could get from
here to the next galaxy in minutes. But if you're not lucky, and
things get hairy, the same trip could take weeks or even months. About
the only rule is that the more frequently a certain path is traveled,
the easier and more predictable the journey becomes.
It's also worth noting that regularly traveled routes (for example, between major Commonwealth worlds) have drastically fewer 'decision points' and therefore can be traversed to at much higher speeds than locations on the outer rims or adrift in inter-galactic space.
|
[CERN-TH/2003-073]{}\
hep-ph/0303242\
\
$^1$, [**Martti Raidal**]{}$^{1,2}$ and [ **T. Yanagida**]{}$^3$
$^1$ TH Division, CERN, CH-1211 Geneva 23, Switzerland\
$^2$ National Institute of Chemical Physics and Biophysics, Tallinn 10143, Estonia\
$^3$ Department of Physics, University of Tokyo, Tokyo 113-0033, Japan\
\
We reconsider the possibility that inflation was driven by a sneutrino - the scalar supersymmetric partner of a heavy singlet neutrino - in the minimal seesaw model of neutrino masses. We show that this model is consistent with data on the cosmic microwave background (CMB), including those from the WMAP satellite. We derive and implement the CMB constraints on sneutrino properties, calculate reheating and the cosmological baryon asymmetry arising via direct leptogenesis from sneutrino decays following sneutrino inflation, and relate them to light neutrino masses. We show that this scenario is compatible with a low reheating temperature that avoids the gravitino problem, and calculate its predictions for flavour-violating decays of charged leptons. We find that $\mu \to e \gamma$ should occur close to the present experimental upper limits, as might also $\tau \to
\mu \gamma$.
CERN-TH/2003-073\
March 2003
Introduction
============
Inflation [@inf] has become the paradigm for early cosmology, particularly following the recent spectacular CMB data from the WMAP satellite [@wmap], which strengthen the case made for inflation by earlier data, by measuring an almost scale-free spectrum of Gaussian adiabatic density fluctuations exhibiting power and polarization on super-horizon scales, just as predicted by simple field-theoretical models of inflation. As we review below, the scale of the vacuum energy during inflation was apparently $\sim 10^{16}$ GeV, comparable to the expected GUT scale, so CMB measurements offer us a direct window on ultra-high-energy physics.
Ever since inflation was proposed, it has been a puzzle how to integrate it with ideas in particle physics. For example, a naive GUT Higgs field would give excessive density perturbations, and no convincing concrete string-theoretical model has yet emerged. In this conceptual vacuum, models based on simple singlet scalar fields have held sway [@inf]. The simplest of these are chaotic inflation models based on exponential or power-law potentials, of which $\phi^4$ and $\phi^2$ are the only renormalizable examples. The WMAP collaboration has made so bold as to claim that such a $\phi^4$ model is excluded at the 3-$\sigma$ level [^1], a conclusion which would merit further support [@barger; @realbarger]. Nevertheless, it is clear that a $\phi^2$ model would be favoured.
We reconsider in this paper the possibility that the inflaton could in fact be related to the other dramatic recent development in fundamental physics, namely the discovery of neutrino masses [@mnuexp]. The simplest models of neutrino masses invoke heavy singlet neutrinos that give masses to the light neutrinos via the seesaw mechanism [@seesaw]. The heavy singlet neutrinos are usually postulated to weigh $10^{10}$ to $10^{15}$ GeV, embracing the range where the inflaton mass should lie, according to WMAP [*et al*]{}. In supersymmetric models, the heavy singlet neutrinos have scalar partners with similar masses, [*sneutrinos*]{}, whose properties are ideal for playing the inflaton role [@sn1]. In this paper, we discuss the simplest scenario in which the lightest heavy singlet sneutrino drives inflation. This scenario constrains in interesting ways many of the 18 parameters of the minimal seesaw model for generating three non-zero light neutrino masses.
This minimal sneutrino inflationary scenario (i) yields a simple ${1 \over
2} m^2 \phi^2$ potential with no quartic terms, with (ii) masses $m$ lying naturally in the inflationary ballpark. The resulting (iii) spectral index $n_s$, (iv) the running of $n_s$ and (v) the relative tensor strength $r$ are all compatible with the data from WMAP and other experiments [@wmap]. Moreover, fixing $m \sim 2 \times 10^{13}$ GeV as required by the observed density perturbations (vi) is compatible with a low reheating temperature of the Universe that evades the gravitino problem [@gr], (vii) realizes leptogenesis [@fy; @sn2] in a calculable and viable way, (viii) constrains neutrino model parameters, and (ix) makes testable predictions for the flavour-violating decays of charged leptons.
The main features of our scenario are the following. [*First*]{}, reheating of the Universe is now due to the neutrino Yukawa couplings, and therefore can be related to light neutrino masses and mixings. [*Secondly*]{}, the lepton asymmetry is created in direct sneutrino-inflaton decays [@sn2]. There is only one parameter describing the efficiency of leptogenesis in this minimal sneutrino inflationary scenario in all leptogenesis regimes - the reheating temperature of the Universe - to which the other relevant parameters can be related. This should be compared with the general thermal leptogenesis case [@fy; @pluemi; @bbp; @gnrrs] which has two additional independent parameters, namely the lightest heavy neutrino mass and width. [*Thirdly*]{}, imposing the requirement of successful leptogenesis, we calculate branching ratios for $\mu\to e\gamma$ and $\tau\to\mu\gamma$ [@lfv], and the CP-violating observables [@cp] like the electric dipole moments of the electron and muon [@edm]. All these leptonic observables, as well as leptogenesis, are related to the measured neutrino masses via a parametrization with a random orthogonal matrix [@ci]. We show that, in the minimal scenario discussed here, successful leptogenesis implies a prediction for $\mu\to e\gamma$ in a very narrow band within about one order of magnitude of the present experimental bound, whilst $\tau\to \mu\gamma$ might be somewhat further away.
Other sneutrino inflationary scenarios could be considered. For example, the inflaton might be one of the heavier singlet sneutrinos, or two or more sneutrinos might contribute to inflation, or one might play a role as a curvaton [@curv]. These alternatives certainly merit consideration, though they would in general be less predictive. We find it remarkable that the simplest sneutrino inflationary scenario considered here works as well as it does.
Chaotic Sneutrino Inflation
===========================
We start by reviewing chaotic inflation [@inf] with a $V = {1
\over 2} m^2
\phi^2$ potential - the form expected for a heavy singlet sneutrino - in light of WMAP [@wmap]. Defining $M_P \equiv 1/\sqrt{8 \pi G_N}
\simeq 2.4 \times 10^{18}$ GeV, the conventional slow-roll inflationary parameters are M\_P\^2 ( [V\^V]{} )\^2 = [2 M\_P\^2 \_I\^2]{}, M\_P\^2 ( [V\^ V]{} ) = [2 M\_P\^2 \_I\^2]{}, M\_P\^4 ( [V V\^ V\^2]{} ) = 0, \[slowroll\] where $\phi_I$ denotes the [*a priori*]{} unknown inflaton field value during inflation at a typical CMB scale $k$. The overall scale of the inflationary potential is normalized by the WMAP data on density fluctuations: \_R\^2 = [V 24 \^2 M\_P\^2 ]{} = 2.95 10\^[-9]{} A : A = 0.77 0.07, \[normn\] yielding V\^[1 4]{} = M\_P \^4 = 0.027 M\_P \^[1 4]{}, \[WMAP\] corresponding to m\^[1 2]{} \_I = 0.038 M\_P\^[3 2]{} \[onecombn\] in any simple chaotic $\phi^2$ inflationary model, such as the sneutrino model explore here. The number of e-foldings after the generation of the CMB density fluctuations observed by COBE is estimated to be N\_[COBE]{} = 62 - [ln]{} ( [10\^[16]{} [GeV]{} V\_[end]{}\^[1/4]{}]{} ) - [1 3]{} [ln]{} ( [ V\_[end]{}\^[1/4]{} \_[RH]{} ]{} ), \[NCOBE\] where $\rho_{RH}$ is the energy density of the Universe when it is reheated after inflation. The second term in (\[NCOBE\]) is negligible in our model, whereas the third term could be as large as $(-8)$ for a reheating temperature $T_{RH}$ as low as $10^6$ GeV. Conservatively, we take $N \simeq 50$. In a $\phi^2$ inflationary model, this implies N = [1 4]{} [\^2\_I M\_P\^2]{} 50, \[fixN\] corresponding to \^2\_I 200 M\_P\^2. \[fixphi\] Inserting this requirement into the WMAP normalization condition (\[WMAP\]), we find the following required mass for any quadratic inflaton: m 1.8 10\^[13]{} [GeV]{}. \[phimass\] As already mentioned, this is comfortably within the range of heavy singlet (s)neutrino masses usually considered, namely $m_N \sim 10^{10}$ to $10^{15}$ GeV.
Is this simple $\phi^2$ sneutrino model compatible with the WMAP data? The primary CMB observables are the spectral index n\_s = 1 - 6 + 2 = 1 - [8 M\_P\^2 \^2\_I]{} 0.96, \[ns\] the tensor-to scalar ratio r = 16 = [32 M\_P\^2 \^2\_I]{} 0.16, \[r\] and the spectral-index running = [2 3]{} + 2 = [32 M\_P\^4 \^4\_I]{} 8 10\^[-4]{}. \[values\] The value of $n_s$ extracted from WMAP data depends whether, for example, one combines them with other CMB and/or large-scale structure data. However, the $\phi^2$ sneutrino model value $n_s \simeq 0.96$ appears to be compatible with the data at the 1-$\sigma$ level. The $\phi^2$ sneutrino model value $r\simeq 0.16$ for the relative tensor strength is also compatible with the WMAP data. One of the most interesting features of the WMAP analysis is the possibility that ${d n_s / d {\rm ln} k}$ might differ from zero. The $\phi^2$ sneutrino model value ${d n_s / d {\rm ln}
k} \simeq 8 \times 10^{-4}$ derived above is negligible compared with the WMAP preferred value and its uncertainties. However, ${d n_s / d {\rm ln}
k} = 0$ appears to be compatible with the WMAP analysis at the 2-$\sigma$ level or better, so we do not regard this as a death-knell for the $\phi^2$ sneutrino model [^2].
Reheating and Leptogenesis
==========================
Before addressing leptogenesis in this sneutrino model for inflation in all calculational details, we first comment on the reheating temperature $T_{RH}$ following the inflationary epoch. Assuming, as usual, that the sneutrino inflaton decays when the the Hubble expansion rate $H \sim m$, and that the expansion rate of the Universe is then dominated effectively by non-relativistic matter until $H \sim \Gamma_\phi$, where $\Gamma_\phi$ is the inflaton decay width, we estimate T\_[RH]{} = ( )\^[1 4]{} , \[TRH\] where $g_*$ is the number of effective relativistic degrees of freedom in the reheated Universe. In the minimal sneutrino inflation scenario considered here we have $\phi\equiv \tilde N_1,$ $m \equiv M_{N_1}$ and \_\_[N\_1]{} = (Y\_Y\_\^)\_[11]{} M\_[N\_1]{}, where $Y_\nu$ is the neutrino Dirac Yukawa matrix. If the relevant neutrino Yukawa coupling $(Y_\nu Y_\nu^\dagger)_{11} \sim 1$, the previous choice $m=M_{N_1} \simeq
2 \times 10^{13}$ GeV would yield $T_{RH} > 10^{14}$ GeV, considerably greater than $m$ itself [^3]. Such a large value of $T_{RH}$ would be [*very problematic*]{} for the thermal production of gravitinos [@gr]. However, it is certainly possible that $(Y_\nu
Y_\nu^\dagger)_{11}\ll 1$, in which case $T_{RH}$ could be much lower, as we discuss in more detail below. Alternatively, one may consider more complicated scenarios, in which three sneutrino species may share the inflaton and/or curvaton roles between them.
We now present more details of reheating and leptogenesis. In general, inflaton decay and the reheating of the Universe are described by the following set of Boltzmann equations [@gkr] & = & - 3 H \_- \_\_,\
& = & - 4 H \_R +\_\_, \[rehboltz\]\
H & = & =, \[H\] where $\rho_\phi$ is the energy density of the inflaton field, $\rho_R$ describes the energy density of the thermalized decay products and essentially defines the temperature via \_R = g\_\* T\^4, $H$ is the Hubble constant and $G_N$ is the Newton constant. Thus reheating can be described by two parameters, the reheating temperature (\[TRH\]), which is the highest temperature of thermal plasma immediately [*after*]{} reheating is completed, and the initial energy density of the inflaton field \_, which determines the maximal plasma temperature in the beginning of the reheating process. In the following we use the parameter z= to parametrize temperature.
The set of Boltzmann equations describing the inflaton decay and reheating, the creation and decays of thermal heavy neutrinos and sneutrinos, and the generation of a lepton asymmetry, is given by Z & = & - - , \[b1\]\
HZz & = & - Y\_[N\_1]{} - (remaining) \[b2\]\
HZz & = & - Y\_[N\_+]{} - (remaining) \[b3\]\
HZz & = & - Y\_[N\_-]{} - (remaining) \[b4\]\
HZz & = & - Y\_[L\_f]{} + \_1 - (remaining) \[b5\]\
HZz & = & - Y\_[L\_s]{} + \_1 - (remaining) \[b6\]\
H & = & , \[b7\] where Z 1-, $\tilde N_\pm \equiv \tilde N_1 \pm \tilde N_1^\dagger$, and $Y_{N_1},$ $Y_{\tilde N_\pm},$ $Y_{L_f},$ $Y_{L_s},$ denote the number-density-to-entropy ratios, $Y=n/s$, for the heavy neutrinos, sneutrinos and lepton asymmetries in fermions and scalars, respectively. The terms denoted by $remaining$ are the usual ones for thermal leptogenesis, and can be obtained from [@pluemi] by using $H(M_{N_1})=z^2 H$. We do not write out their lengthy expressions in full here. The first terms on the r.h.s. of (\[b2\]-\[b6\]) are the dilution factors of $Y=n/s$ due to entropy production in the inflaton $\phi\equiv \tilde N_1$ decays described by (\[b1\]). The second terms on the r.h.s. of (\[b5\]), (\[b6\]) describe lepton asymmetry generation in the decays of the coherent inflaton field. Identifying and studying the parameter space in which leptogenesis is predominantly direct is one of the aims of this paper.
We are now ready to study (\[b1\]-\[b7\]). First we work out general results on reheating and leptogenesis in the sneutrino inflation scenario, allowing $M_{N_1}$ to vary as a free parameter. In this case, the reheating and leptogenesis efficiency is described by two parameters, namely $M_{N_1}$ and a parameter describing the decays of the sneutrino inflaton. This can be chosen to be either $\tilde m_1= (Y_\nu Y_\nu^\dagger)_{11} v^2 \sin^2\beta/M_{N_1}$ or, more appropriately for this scenario, the reheating temperature of the Universe $T_{RH}$ given by (\[TRH\]). For the CP asymmetry in (s)neutrino decays, we take the maximal value for hierarchical light neutrinos, given by [@di2]: |\_1\^[max]{}(M\_[N\_1]{})|= . This choice allows us to study the minimal values for $M_{N_1}$ and $T_{RH}$ allowed by leptogenesis. Later, we will focus our attention on exact values of $\epsilon_1$ [@vissani].
Solutions to (\[b1\]-\[b7\]) are presented in Figs. \[fig1\] and \[fig2\]. We plot in Fig. \[fig1\] the parameter space in the $(M_{N_1},\,\tilde m_{1})$ plane that leads to successful leptogenesis. This parameter space has three distinctive parts with very different physics.
= 0.5
= 0.5
In the area bounded by the red dashed curve, denoted by A, leptogenesis is entirely thermal. This region has been studied in detail in [@gnrrs]. Whatever lepton asymmetry is generated initially in the decay of the sneutrino inflaton is washed out by thermal effects, and the observed baryon asymmetry is generated by the out-of-equilibrium decays of thermally created singlet neutrinos and sneutrinos. As seen in Fig. \[fig2\], in our scenario this parameter space corresponds to high $M_{N_1}$ and high $T_{RH}$ values.
The area B below the dashed curve and extending down to the minimum value $M_{N_1}=4\times 10^6$ GeV in Fig. \[fig1\] is the region of parameter space where there is a delicate cancellation between direct lepton asymmetry production in sneutrino inflaton decays and thermal washout. This region cannot be studied without solving the Boltzmann equations numerically. However, it roughly corresponds to $T_{RH}\sim M_{N_1}$ as seen in Fig. \[fig2\].
The area denoted by C has $T_{RH}\ll M_{N_1}$. Since the maximal CP asymmetry scales with $M_{N_1},$ the line presented corresponds to a constant reheating temperature. Notice that in Fig. \[fig1\] this line is terminated at $\tilde m_1=10^{-7}$. As seen in Fig. \[fig2\], it continues linearly to high values of $M_{N_1}$. In this area, leptogenesis is entirely given by the decays of cold sneutrino inflatons, a scenario studied previously in [@sn2]. In this case the details of reheating are not important for our analyses. To calculate the lepton asymmetry to entropy density ratio $Y_L=n_L/s$ in inflaton decays we need to know the produced entropy density s= g\_\* T\_[RH]{}\^3, and to take into account that inflaton dominates the Universe. In this case one obtains [@sn2] Y\_L= \_1 , where $\epsilon_1$ is the CP asymmetry in $\phi\equiv \tilde N_1$ decays. The observed baryon asymmetry of the Universe gives a lower bound on the reheating temperature $T_{RH}>10^6$ GeV.
We consider now the most constrained scenario in which the inflaton is the lightest sneutrino, which requires $M_{N_3} > M_{N_2} > M_{N_1} \simeq 2 \times
10^{13}$ GeV. This implies that our problem is completely characterized by only one parameter, either $\tilde m_1$ or $T_{RH}$. As we see in both Figs. \[fig1\] and \[fig2\], the line for $M_{N_1} \simeq 2 \times 10^{13}$ GeV traverses both the regions A, and C, the former corresponding to high $T_{RH}$, as seen in Fig. \[fig2\]. However, $T_{RH}$ may also be low even in the minimal seesaw model, as seen in Fig. \[fig2\].
The cosmological gravitino problem suggests that $T_{RH} \lappeq 10^8$ GeV might be the most interesting, which would correspond to very small $\tilde m_1$, far away from the thermal region A and deep in the region C where leptogenesis arises from the direct decays of cold sneutrinos. We concentrate on this option here. This limit requires very small Yukawa couplings $( Y_\nu
Y_\nu^\dagger )_{11} \lappeq 10^{-12}$, whilst other Yukawa couplings can be ${\cal O} (1)$. This possibility may be made natural, e.g., by postulating a $Z_2$ matter parity under which only $N_1$ is odd. In this case, the relevant Yukawa couplings $(Y_\nu)^1_j$ all vanish, but a Majorana mass for $N_1$ is still allowed. A more sophisticated model postulates a $Z_7$ discrete family symmetry with charges $Y_{FN} = (4, 0,
0)$ for the $N_i$, $(2, 1, 1)$ for the ${\mathbf {\bar 5}}$ representations of SU(5), and $(2, 1, 0)$ for the ${\mathbf 10}$ representations of SU(5). Assuming a gauge-singlet field $\Phi$ with $Y_{FN} = -1$ and $\langle \Phi \rangle \equiv \epsilon$, we find $M_i =
{\cal O}(\epsilon, 1, 1)$ and $(Y_\nu)^1_j = {\cal O}(\epsilon^6,
\epsilon^5, \epsilon^5)$, whilst the other Yukawa couplings are ${\cal
O}(1)$, ${\cal O}(\epsilon)$ or ${\cal O}(\epsilon^2)$. If $\epsilon
\simeq 1/17$, the $(Y_\nu)^1_j$ are sufficiently small for our purposes, whilst the quark and lepton mass matrices are of desirable form. Doubtless, one could construct better models with more effort, but this example serves as an existence proof for a low value of $T_{RH}$ in our scenario.
Leptogenesis Predictions for Lepton Flavour Violation
=====================================================
In this Section, we relate the results of the previous section on direct leptogenesis to light neutrino masses, and make predictions on the lepton-flavour-violating (LFV) decays. Thermal leptogenesis in this context has been extensively studied recently [@lepto; @er; @fgy]. We first calculate neutrino Yukawa couplings using the parametrization in terms of the light and heavy neutrino masses, mixings and the orthogonal parameter matrix given in [@ci]. This allows us to calculate exactly the baryon asymmetry of the Universe, since we know the CP asymmetry $\epsilon_1$ and the reheating temperature of the Universe $T_{RH}.$ For neutrino parameters yielding successful leptogenesis, we calculate the branching ratios of LFV decays.
There are 18 free parameters in the minimal seesaw model with three non-zero light neutrinos, which we treat as follows. In making Fig. \[fig3\], we have taken the values of $\theta_{12}, \theta_{23}$, $\Delta m^2_{12}$ and $\Delta m^2_{23}$ from neutrino oscillation experiments. We randomly generate the lightest neutrino mass in the range $0 < m_1 < 0.01$ eV and values of $\theta_{13}$ in the range $0 <
\theta_{13} < 0.1$ allowed by the Chooz experiment [@chooz], as we discuss later in more detail. Motivated by our previous discussion of chaotic sneutrino inflation, we fix the lightest heavy singlet sneutrino mass to be $M_1 = 2 \times 10^{13}$ GeV, and choose the following values of the heavier singlet sneutrino masses: $M_2 = 10^{14}$ GeV or $M_2 =5 \times 10^{14}$ GeV, and $M_3$ in the range $5 \times 10^{14}$ to $5 \times
10^{15}$ GeV, as we also discuss later in more detail. This accounts for nine of the 18 seesaw parameters.
The remaining 9 parameters are all generated randomly. These include the three light-neutrino phases - the Maki-Nakagawa-Sakata oscillation phase and the two Majorana phases. Specification of the neutrino Yukawa coupling matrix requires three more mixing angles and three more CP-violating phases that are relevant to leptogenesis, in principle. The plots in Fig. \[fig3\] are made by sampling randomly these nine parameters. We apply one constraint, namely that the generated baryon density falls within the $3-\sigma$ range required by cosmological measurements, of which the most precise is now that by WMAP: $7.8\times
10^{-11} < Y_B < 1.0 \times 10^{-10}$ [@wmap].
Making predictions for LFV decays also requires some hypotheses on the parameters of the MSSM. We assume that the soft supersymmetry-breaking mass parameters $m_0$ of the squarks and sleptons are universal, and likewise the gaugino masses $m_{1/2}$, and we set the trilinear soft supersymmetry-breaking parameter $A_0 = 0$ at the GUT scale. Motivated by $g_\mu - 2$, we assume that the higgsino mixing parameter $\mu > 0$, and choose the representative value $\tan \beta = 10$. We take into account laboratory and cosmological constraints on the MSSM, including limits on the relic density of cold dark matter. WMAP provides the most stringent bound on the latter, which we assume to be dominated by the lightest neutralino $\chi$: $0.094 < \Omega_\chi h^2 < 0.129$. For $\tan \beta =
10$, the allowed domain of the $(m_{1/2}, m_0)$ plane is an almost linear strip extending from $(m_{1/2}, m_0) = (300, 70)$ GeV to $(900,
200)$ GeV [@dm]. For illustrative purposes, we choose $(m_{1/2}, m_0) = (800,
170)$ GeV and comment later on the variation with $m_{1/2}$.
= 0.5 = 0.5
Panel (a) of Fig. \[fig3\] presents results on the branching ratio BR for $\mu \to e \gamma$ decay. We see immediately that values of $T_{RH}$ anywhere between $2 \times 10^6$ GeV and $ 10^{12}$ GeV are attainable in principle. The lower bound is due to the lower bound on the CP asymmetry, while the upper bound comes from the gravitino problem. The black points in panel (a) correspond to the choice $\sin \theta_{13} = 0.0$, $M_2 = 10^{14}$ GeV, and $5 \times 10^{14}$ GeV $< M_3 < 5 \times 10^{15}$ GeV. The red points correspond to $\sin \theta_{13} = 0.0$, $M_2 = 5 \times 10^{14}$ GeV, and $M_3 = 5 \times 10^{15}$ GeV, while the green points correspond to $\sin \theta_{13} = 0.1$, $M_2 = 10^{14}$ GeV, and $M_3 = 5 \times 10^{14}$ GeV. We see a very striking narrow, densely populated bands for BR$(\mu \to e \gamma)$, with some outlying points at both larger and smaller values of BR$(\mu \to e \gamma)$. The width of the black band is due to variation of $M_{N_3}$ showing that BR$(\mu \to e \gamma)$ is not very sensitive to it. However, BR$(\mu \to e \gamma)$ strongly depends on $M_{N_2}$ and $\sin \theta_{13}$ as seen by the red and green points, respectively. Since BR$(\mu \to e \gamma)$ scales approximately as $m_{1/2}^{-4}$, the lower strip for $\sin \theta_{13} = 0$ would move up close to the experimental limit if $m_{1/2} \sim 500$ GeV, and the upper strip for $\sin \theta_{13}
= 0.1$ would be excluded by experiment.
Panel (b) of Fig. \[fig3\] presents the corresponding results for BR$(\tau \to \mu \gamma)$ with the same colour code for the parameters. This figure shows that BR$(\tau \to \mu \gamma)$ depends strongly on $M_{N_3}$, while the dependence on $\sin \theta_{13}$ and on $M_{N_2}$ is negligible. The numerical values of BR$(\tau \to \mu \gamma)$ are somewhat below the present experimental upper limit BR$(\tau \to \mu \gamma) \sim 10^{-7}$, but we note that the results would all be increased by an order of magnitude if $m_{1/2} \sim 500$ GeV. In this case, panel (a) of Fig. \[fig3\] tells us that the experimental bound on BR$(\mu \to e \gamma)$ would enforce $\sin \theta_{13} \ll 0.1$, but this would still be compatible with BR$(\tau \to \mu \gamma) >
10^{-8}$.
As a result, Fig. \[fig3\] strongly suggests that fixing the observed baryon asymmetry of the Universe for the direct sneutrino leptogenesis ($T_{RH}<2\times 10^{12}$ GeV $<M_{N_1}$) implies a prediction for the LFV decays provided $M_{N_2}$ and/or $M_{N_3}$ are also fixed. This observation can be understood in the case of hierarchical light and heavy neutrino masses. Consider first $\mu \to e \gamma$ for $\sin
\theta_{13}=0$. It turns out that the $N_2$ couplings dominate in $(Y_\nu
Y_\nu^\dagger)_{21}$ which determines BR$(\mu \to e \gamma)$. Also, the $M_{N_2}$ term dominates in $\epsilon_1$ which implies $Y_B \sim (Y_\nu
Y_\nu^\dagger)_{21}/\sqrt{(Y_\nu Y_\nu^\dagger)_{11}}$, because cancellations among the phases are unnatural. In the parametrization with the orthogonal matrix $R$, this implies $Y_B \sim R_{23}/R_{22}$. If fine tunings are not allowed, the requirement $T_{RH}<M_{N_1}$ fixes $R_{23}/R_{22}$ and therefore relates $Y_B$ to $\mu \to e \gamma$. For more general cases, the behaviour of BR$(\mu \to e \gamma)$ is more complicated and additional contributions occur. However, those new contributions tend to enhance BR$(\mu \to e \gamma)$, as exemplified in Fig. \[fig3\] by the green dots.
The behaviour of BR$(\tau \to \mu \gamma)$ is simpler. To leading order in the largest parameters, $\tau \to \mu \gamma$ depends on the $N_3$ couplings and mass, leading to $(Y_\nu Y_\nu^\dagger)_{32}\sim (Y_\nu)^2_{33} U_{33}U_{23}^\dagger$, independently of leptogenesis results.
We have to stress here that such definite predictions for LFV processes can always be avoided by fine tuning the neutrino parameters, as seen by several scattered points in Fig. \[fig3\]. Points with small BR$(\mu \to
e \gamma)$ can be systematically generated using the parametrization of $Y_\nu$ by a Hermitian matrix [@di], and the predictions for the LFV decays thereby washed away. However, in this case, the $M_{N_i}$ are outputs of the parametrization, and cannot be fixed as required by the present analyses of sneutrino inflation. Therefore the parametrization [@di] is not appropriate for our leptogenesis scenario. Finally, we comment that such fine tunings are impossible in simple models of neutrino masses [@fgy].
Another possibility for avoiding the LFV predictions is to allow the heavy neutrinos to be partially degenerate in mass, which enhances the CP asymmetries [@p]. In supersymmetric models, this possibility was considered in [@ery].
In addition to the quantities shown in Fig. \[fig3\], we have also examined BR$(\tau \to e \gamma)$, which is always far below the present experimental bound BR$(\tau \to e \gamma) \sim 10^{-7}$, and the electron and muon electric dipole moments. We find that $d_e < 10^{-33}$ e cm, in general, putting it beyond the foreseeable experimental reach, and $|
d_\mu / d_e | \sim m_\mu / m_e$, rendering $d_\mu$ also unobservably small.
Alternative Scenarios and Conclusions
=====================================
We have considered in this paper the simplest sneutrino inflation scenario, in which the inflaton $\phi$ is identified with the lightest sneutrino, and its decays are directly responsible for leptogenesis. We find it remarkable that this simple scenario is not already ruled out, and have noted the strong constraints it must satisfy enable it to make strong predictions, both for CMB observables and LFV decays. These might soon be found or invalidated. In the latter case the motivation to study more complicated sneutrino inflation scenarios would be increased.
$\bullet$ One possibility is that inflation might have been driven by a different sneutrino, not the lightest one. In this case, the lightest sneutrino could in principle be considerably lighter than the $2 \times 10^{13}$ GeV required for the inflaton. This would seem to make more plausible a low reheating temperature, as suggested by the gravitino problem. However, this problem is not necessarily a critical issue, as it can already be avoided in the simplest sneutrino inflation scenario, as we have seen. On the other hand, if the lightest sneutrino is not the inflaton, leptogenesis decouples from inflationary reheating, and predictivity is diminished.
$\bullet$ A second possibility is that two or more sneutrinos contribute to inflation. In this case, the model predictions for the CMB observables and the sneutrino mass would in general be changed.
$\bullet$ A related third possibility is that one or more sneutrinos might function as a curvaton, which would also weaken the CMB and sneutrino mass predictions.
For the moment, we do not see the need to adopt any of these more complicated scenarios, but they certainly merit investigation, even ahead of the probable demise of the simplest sneutrino inflation scenario investigated here.
0.5in
[99]{}
For reviews see, D. H. Lyth and A. Riotto, Phys. Rept. [**314**]{} (1999) 1 \[arXiv:hep-ph/9807278\]; W. H. Kinney, arXiv:astro-ph/0301448. C. L. Bennett [*et al.*]{}, arXiv:astro-ph/0302207; D. N. Spergel [*et al.*]{}, arXiv:astro-ph/0302209; H. V. Peiris [*et al.*]{}, arXiv:astro-ph/0302225. S. L. Bridle, A. M. Lewis, J. Weller and G. Efstathiou, arXiv:astro-ph/0302306. V. Barger, H. S. Lee and D. Marfatia, arXiv:hep-ph/0302150. Y. Fukuda [*et al.*]{} \[Super-Kamiokande Collaboration\], Phys. Rev. Lett. [**81**]{} (1998) 1562; Q. R. Ahmad [*et al.*]{} \[SNO Collaboration\], Phys. Rev. Lett. [**89**]{} (2002) 011301 \[arXiv:nucl-ex/0204008\]; K. Eguchi [*et al.*]{} \[KamLAND Collaboration\], Phys. Rev. Lett. [**90**]{} (2003) 021802 \[arXiv:hep-ex/0212021\].
M. Gell-Mann, P. Ramond and R. Slansky, Proceedings of the Supergravity Stony Brook Workshop, New York, 1979, eds. P. Van Nieuwenhuizen and D. Freedman (North-Holland, Amsterdam); T. Yanagida, Proceedings of the Workshop on Unified Theories and Baryon Number in the Universe, Tsukuba, Japan 1979 (eds. A. Sawada and A. Sugamoto, KEK Report No. 79-18, Tsukuba).
H. Murayama, H. Suzuki, T. Yanagida and J. Yokoyama, Phys. Rev. Lett. [**70**]{} (1993) 1912; H. Murayama, H. Suzuki, T. Yanagida and J. Yokoyama, Phys. Rev. D [**50**]{} (1994) 2356 \[arXiv:hep-ph/9311326\]. J. R. Ellis, J. E. Kim and D. V. Nanopoulos, Phys. Lett. B [**145**]{} (1984) 181; J. R. Ellis, D. V. Nanopoulos and S. Sarkar, Nucl. Phys. B [**259**]{} (1985) 175; J. R. Ellis, D. V. Nanopoulos, K. A. Olive and S. J. Rey, Astropart. Phys. [**4**]{} (1996) 371; M. Kawasaki and T. Moroi, Prog. Theor. Phys. [**93**]{} (1995) 879; T. Moroi, Ph.D. thesis, arXiv:hep-ph/9503210; M. Bolz, A. Brandenburg and W. Buchmüller, Nucl. Phys. B [**606**]{} (2001) 518; R. Cyburt, J. R. Ellis, B. D. Fields and K. A. Olive, astro-ph/0211258.
M. Fukugita and T. Yanagida, Phys. Lett. B [**174**]{} (1986) 45.
H. Murayama and T. Yanagida, Phys. Lett. B [**322**]{} (1994) 349 \[arXiv:hep-ph/9310297\]; K. Hamaguchi, H. Murayama and T. Yanagida, Phys. Rev. D [**65**]{} (2002) 043512 \[arXiv:hep-ph/0109030\]; T. Moroi and H. Murayama, Phys. Lett. B [**553**]{} (2003) 126 \[arXiv:hep-ph/0211019\].
M. Plümacher, Nucl. Phys. B [**530**]{} (1998) 207 \[arXiv:hep-ph/9704231\]. W. Buchmüller, P. Di Bari and M. Plümacher, Nucl. Phys. B [**643**]{} (2002) 367 \[arXiv:hep-ph/0205349\]; Phys. Lett. B [**547**]{} (2002) 128 \[arXiv:hep-ph/0209301\]; arXiv:hep-ph/0302092.
G. Giudice, A. Notari, M. Raidal, A. Riotto, and A. Strumia, in preparation.
J. Hisano, T. Moroi, K. Tobe, M. Yamaguchi and T. Yanagida, Phys. Lett. B [**357**]{} (1995) 579; J. Hisano, T. Moroi, K. Tobe and M. Yamaguchi, Phys. Rev. D [**53**]{} (1996) 2442; J. Hisano and D. Nomura, Phys. Rev. D [**59**]{} (1999) 116005.
J. R. Ellis, J. Hisano, S. Lola and M. Raidal, Nucl. Phys. B [**621**]{} (2002) 208 \[arXiv:hep-ph/0109125\]. A. Romanino et al., Nucl. Phys. B [**622**]{} (2002) 73 \[hep-ph/0108275\]; J. R. Ellis, J. Hisano, M. Raidal and Y. Shimizu, Phys. Lett. B [**528**]{} (2002) 86 \[arXiv:hep-ph/0111324\]. J. A. Casas and A. Ibarra, Nucl. Phys. B [**618**]{} (2001) 171.
M. Postma, arXiv:hep-ph/0212005; J. McDonald, arXiv:hep-ph/0302222.
G. F. Giudice, E. W. Kolb and A. Riotto, Phys. Rev. D [**64**]{} (2001) 023508 \[arXiv:hep-ph/0005123\].
S. Davidson and A. Ibarra, Phys. Lett. B [**535**]{} (2002) 25.
L. Covi, E. Roulet and F. Vissani, Phys. Lett. B [**384**]{} (1996) 169.
G. C. Branco, T. Morozumi, B. M. Nobre and M. N. Rebelo, Nucl. Phys. B [**617**]{} (2001) 475; A. S. Joshipura, E. A. Paschos and W. Rodejohann, JHEP [**0108**]{} (2001) 029; D. Falcone, Phys. Rev. D [**66**]{} (2002) 053001 \[hep-ph/0204335\]; G. C. Branco, R. Gonzalez Felipe, F. R. Joaquim and M. N. Rebelo, Nucl. Phys. B [**640**]{} (2002) 202; S. Davidson and A. Ibarra, Nucl. Phys. B [**648**]{} (2003) 345; W. Rodejohann, Phys. Lett. B [**542**]{} (2002) 100; M. N. Rebelo, Phys. Rev. D [**67**]{} (2003) 013008 \[arXiv:hep-ph/0207236\]; Phys. Lett. B [**551**]{} (2003) 127 \[arXiv:hep-ph/0210155\]; G. C. Branco, R. Gonzalez Felipe, F. R. Joaquim, I. Masina, M. N. Rebelo and C. A. Savoy, arXiv:hep-ph/0211001; S. Pascoli, S. T. Petcov and C. E. Yaguna, arXiv:hep-ph/0301095; S. Pascoli, S. T. Petcov and W. Rodejohann, arXiv:hep-ph/0302054; S. Davidson, arXiv:hep-ph/0302075. J. R. Ellis and M. Raidal, Nucl. Phys. B [**643**]{} (2002) 229 \[arXiv:hep-ph/0206174\].
P. H. Frampton, S. L. Glashow and T. Yanagida, Phys. Lett. B [**548**]{} (2002) 119 \[arXiv:hep-ph/0208157\]; M. Raidal and A. Strumia, Phys. Lett. B [**553**]{} (2003) 72 \[arXiv:hep-ph/0210021\]; T. Endoh, S. Kaneko, S. K. Kang, T. Morozumi and M. Tanimoto, Phys. Rev. Lett. [**89**]{} (2002) 231601 \[arXiv:hep-ph/0209020\]; S. F. King, arXiv:hep-ph/0211228; S. Raby, arXiv:hep-ph/0302027; R. Barbieri, T. Hambye and A. Romanino, arXiv:hep-ph/0302118. M. Apollonio [*et al.*]{} \[Chooz Collaboration\], Phys. Lett. B [**466**]{} (1999) 419.
J. Ellis, K. A. Olive, Y. Santoso and V. C. Spanos, arXiv:hep-ph/0303043.
S. Davidson and A. Ibarra, JHEP [**0109**]{} (2001) 013; J. R. Ellis, J. Hisano, M. Raidal and Y. Shimizu, Phys. Rev. D [**66**]{} (2002) 115013 \[arXiv:hep-ph/0206110\].
M. Flanz, E. A. Paschos, U. Sarkar and J. Weiss, Phys. Lett. B [**389**]{} (1996) 693; A. Pilaftsis, Phys. Rev. D [**56**]{} (1997) 5431, Int. J. Mod. Phys. A [**14**]{} (1999) 1811. J. R. Ellis, M. Raidal and T. Yanagida, Phys. Lett. B [**546**]{} (2002) 228 \[arXiv:hep-ph/0206300\].
[^1]: This argument applies [*a fortiori*]{} to models with $\phi^{n > 4}$ potentials.
[^2]: In fact, we note that the favoured individual values for $n_s, r$ and ${d n_s / d {\rm ln}
k}$ reported in an independent analysis [@realbarger] [*all coincide*]{} with the $\phi^2$ sneutrino model values, within the latter’s errors!
[^3]: Even such a large value of $(Y_\nu Y_\nu^\dagger)_{11}$ would not alter significantly the $\phi^2$ sneutrino model prediction for ${d n_s / d {\rm ln} k}$.
|
Filamentation as primitive growth mode?
Osmotic pressure influences cellular shape. In a growing cell, chemical reactions and dilution induce changes in osmolarity, which in turn influence the cellular shape. Using a protocell model relying upon random conservative chemical reaction networks with arbitrary stoichiometry, we find that when the membrane is so flexible that its shape adjusts itself quasi-instantaneously to balance the osmotic pressure, the protocell either grows filamentous or fails to grow. This behavior is consistent with a mathematical proof. This suggests that filamentation may be a primitive growth mode resulting from the simple physical property of balanced osmotic pressure. We also find that growth is favored if some chemical species are only present inside the protocell, but not in the outside growth medium. Such an insulation requires specific chemical schemes. Modern evolved cells such as E. coli meet these requirements through active transport mechanisms such as the phosphotransferase system.
|
Comparison of argyrophilic nucleolar organizer regions by counting and image analysis in canine mammary tumors.
Two techniques for evaluating argyrophilic nucleolar organizer regions (AgNOR) were compared on 74 canine mammary tumors to discriminate between benign and malignant lesions. For each lesion, direct counting of AgNOR on at least 100 cell nuclei was compared with area, perimeter, and integrated optical density AgNOR dot values determined by image analysis. Significant differences between benign and malignant tumors were observed with both methods; however, lesions determined as aggressive or proliferative by histologic evaluation were only singled out by image analysis measurements. Image analysis, in our hands, was a reliable, precise, and convenient technique to characterize malignancy in canine mammary tumors.
|
Districts of Sikkim
The detail analysis of Population Census 2011 published by Govt. of India for Sikkim state reveal that population of Sikkim has increased by 12.89% in this decade compared (2001-2011) to past decade (1991-2001). The density of Sikkim state in the current decade is 223 per sq mile.
Sikkim is an State of India with population of Approximate 6.11 Lakhs.
|
Q:
SOS: Proof of the AM-GM inequality
"A basic strategy in tackling inequalities of few variables is to write things into sum of squares..." is a quote from an answer, intended as commenting the post entitled "Can this inequality proof be demystified?".
I'd like to know what the Sum Of Squares strategy yields for the AM-GM inequality with $\,n$ variables.
In the low-dimensional cases $\,n=2,3,4\,$ one has
\begin{align*}
a^2+b^2-2ab &\;=\;(a-b)^2\;\geqslant\;0\,, \\[2ex]
a^3+b^3+c^3-3abc &\;=\;(a+b+c)\cdot\underbrace{\frac 12\left((a-b)^2+(b-c)^2+(c-a)^2\right)}_{a^2+b^2+c^2-ab-bc-ca}\;\geqslant\;0\,,\\[2ex]
a^4+b^4+c^4+d^4-4abcd &\;=\;\left(a^2-b^2\right)^2
+\left(c^2-d^2\right)^2 + 2(ab-cd)^2\;\geqslant\;0\,,
\end{align*}
and for $\,n=5\,$ cf this math.SE answer.
Now fix some $n\in\mathbb{N}$, let $\,a_1,a_2,\cdots,a_n\geqslant 0$, and consider
$$\sum_{k=1}^n a_k^n\, -\, n\prod_{k=1}^n a_k\tag{AM-GM}$$
which, I'm pretty convinced, can be expressed involving Sums Of Squares and then recognised to be non-negative.
But how does such an expression look like?
Can it be derived in a (a sort of) uniform procedure?
There's the post Proofs of AM-GM inequality (tagged as 'big-list') with 14 answers currently, but none of them would answer this question.
I've considered to add the 'computer-algebra-systems' tag.
Added in edit
Pedro Tamaroff introduced the central keyword Certificate of positivity in his comment which, amongst further insights, led me to rediscover the above $n=4$ expression.
$\exists$ recommended readings:
(1) An algorithm for sums of squares of real polynomials, J. Pure & Appl. Alg. 127 (1998), pp 99–104, is a nice paper by Victoria Powers and Thorsten Wörmann
(2) Computing sum of squares decompositions with rational coefficients
by Helfried Peyrl and Pablo A. Parrilo, Theor. Comp. Sci. 409 (2008), pp 269-281
A:
Yes, we can write $x_1^n+x_2^n+...+x_n^n-nx_1x_2...x_n$ in the SOS form, but I think it's very ugly and it's not useful for big $n$.
We can make the following.
For $n=3$:
$$a^3+b^3+c^3-3abc=\sum_{cyc}\left(a^3-\frac{1}{2}a^2b-\frac{1}{2}a^2c\right)+\sum_{cyc}\left(\frac{1}{2}a^2b+\frac{1}{2}a^2c-abc\right)=$$
$$=\frac{1}{2}\sum_{cyc}(a-b)^2(a+b)+\frac{1}{2}\sum_{cyc}c(a-b)^2=\frac{1}{2}(a+b+c)\sum_{cyc}(a-b)^2.$$
For $n=4$:
$$a^4+b^4+c^4+d^4-4abcd=\sum_{cyc}\left(a^4-\frac{1}{3}(a^3b+a^3c+a^3d)\right)+$$
$$+\frac{1}{6}\sum_{sym}(a^3b-a^2b^2)+\frac{1}{6}\sum_{sym}(a^2b^2-a^2bc)+\frac{1}{3}\sum_{cyc}(a^2bc+a^2cd+a^2bd-3abcd)=$$
$$=\frac{1}{6}\left(\sum_{sym}(a^4-a^3b)+\sum_{sym}(a^3b-a^2b^2)+\sum_{sym}(a^2b^2-a^2bc)+\sum_{sym}(a^2bc-abcd)\right)=$$
$$=\frac{1}{12}\left(\sum_{sym}(a^4-a^3b-ab^3+b^4)+\sum_{sym}(a^3b-2a^2b^2+ab^3)+\sum_{sym}(c^2a^2-2c^2ab+c^2b^2)+\sum_{sym}(a^2cd-2abcd+b^2cd)\right)=$$
$$=\frac{1}{12}\sum_{sym}(a-b)^2(a^2+b^2+c^2+2ab+cd)=$$
$$=\tfrac{(a-b)^2(2(a+b)^2+(c+d)^2)+(a-c)^2(2(a+c)^2+(b+d)^2)+(a-d)^2(2(a+d)^2+(b+c)^2)}{6}+$$
$$+\tfrac{(b-c)^2(2(b+c)^2+(a+d)^2)+(b-d)^2(2(b+d)^2+(a+c)^2)+(c-d)^2(2(c+d)^2+(a+b)^2)}{6}.$$
Here $$\sum\limits_{sym}a=6(a+b+c+d)$$ $$\sum\limits_{sym}a^2b^2=4(a^2b^2+a^2c^2+b^2c^2+a^2d^2+b^2d^2+c^2d^2),...$$
For $n=5$:
$$a^5+b^5+c^5+d^5+e^5-5abcde=\frac{1}{24}\sum_{sym}(a^5-abcde)=$$
$$=\frac{1}{24}\left(\sum_{sym}(a^5-a^4b)+\sum_{sym}(a^4b-a^3b^2)+\sum_{sym}(a^3b^2-a^3bc)\right)+$$
$$+\frac{1}{24}\left(\sum_{cyc}(a^3bc-a^2b^2c)+\sum_{sym}(a^2b^2c-a^2bcd)+\sum_{sym}(a^2bcd-abcde)\right)=$$
$$=\frac{1}{48}\left(\sum_{sym}(a^5-a^4b-ab^4+b^5)+\sum_{sym}(a^4b-a^3b^2-a^2b^3+ab^4)+\sum_{sym}(c^3a^2-2c^3ab+c^3b^2)\right)+$$
$$+\frac{1}{48}\left(\sum_{cyc}(a^3bc-2a^2b^2c+b^3ac)+\sum_{sym}(a^2c^2d-2c^2abd+b^2c^2d)+\sum_{sym}(a^2cde-2abcde+b^2cde)\right)=$$
$$=\frac{1}{48}\sum_{sym}(a-b)^2(a^3+2a^2b+2ab^2+b^3+c^3+abc+c^2d+cde).$$
The rest is the same.
|
1. Field of The Invention
The present invention relates to soldering material, more particularly soldering material which is used for soldering parts which are used under environments where fatigue is likely to occur, and particularly for soldering electronic parts on a printed circuit substrate.
2. Description of Related Arts
Generally, the basic components of soldering material are binary Sn-Pb. It is known that various components are added so as to improve the properties of the binary Sn-Pb alloy.
Japanese Examined Patent Publication No. 40-25885 discloses the fact that copper, silver, nickel or the like have been added to the soldering material in order to prevent the copper of an electric soldering-iron from dissolving into the soldering material, and thus damaging it. It is described therein that damage is prevented through the function of silver or nickel which leads to the uniform dispersion of copper.
Japanese Examined Patent Publication No. 45-2093 discloses the fact that corrosion-resistance of solder with aluminum alloy at the soldered part is improved by addition of Ag or Sb, and, further, fluidity and ease of the soldering operation are improved by addition of Cd.
The following is a prior art which intends to improve specifically the soldering materials used for integrated circuits and printing substrates.
Japanese Examined Patent Publication No. 52-20377 discloses concurrent addition of Cu and Ag, in order to prevent a thin copper-wire which is to be soldered, from being dissolved and eroded by solder, thereby incurring a strength-reduction. According to the description, Cu suppresses the soldering material from encroaching on the material to be soldered. However Cu, when added, raises the melting point of the soldering material, with the result that the melting of the material to be soldered is likely to occur. The liability of melting can be prevented by Ag which has the effect of lowering the melting point.
Japanese Unexamined Patent Publication No. 56-144893 aims to eliminate the drawback that the silver in a silver lead-wire of a ceramic capacitor, diffuses into the soldering material, thereby deteriorating the characteristics of the capacitor or peeling the silver surface. The above mentioned publications also aims to enable high-speed soldering and proposes Sn-Sb-Ag-Pb soldering material.
Japanese Unexamined Patent Publication No. 59-70490 proposes a 1-15% Sb-1-65% Sn(In)-Pb component and a Sb-Ag-Sn(In)-Pb component.
Regarding the properties of soldering material used for soldering electronic parts moved on an integrated circuit or a printed circuit, recently, attention is paid to the failure in current conduction which occurs because cracks are generated in the solder which bonds a lead-wire to a rand of a printed substrate. Presumably, the reason is as follows: stress is generated in a substrate and mounted electronic parts due to periodic change in the temperature in which they are used; the bonding member, i.e., the solder, undergoes this stress and is hence exposed constantly to stress; therefore, fatigue fracture occurs after long time use. In addition, the following facts seem to be reasons for accelerating the fatigue fracture: temperature rises at the soldered parts due to current conduction; heat generation occurs in the electronic parts; and, a printed circuit is subjected to mechanical vibration.
It has been clarified that the binary Sn-Pb soldering material consisting of the basic components involves a problem in fatigue resistance when it is used in an environment where it is exposed to thermal and mechanical stress for long period of time. Although fatigue resistance has heretofore been extensively studied with regard to materials and welded sections of aluminum and steel, methods for improving fatigue resistance of soldering material having not yet been clarified.
|
Q:
Getting recurrence last occurence end date of meeting Series in graph
I'm writing an application to help users scheduling recurring events leveraging the dotnet sdk for Microsoft Graph.
With code similar to this, I'm scheduling a recurring event using a NumberOfOccurences to limit the number of meetings that will be created.
var updatingEvent = new Event
{
Subject = "test",
Location = new Location { DisplayName = "Montreal" },
IsAllDay = false,
Start = getTimeZoneFromDateTime(DateTime.Now, tzLabel),
End = getTimeZoneFromDateTime(DateTime.Now.AddHours(1), tzLabel),
OnlineMeetingUrl = "someurl",
Body = new ItemBody { Content = emailBody.HtmlBody, ContentType = BodyType.Html },
ShowAs = FreeBusyStatus.Busy,
Recurrence = new PatternedRecurrence
{
Range = new RecurrenceRange
{
StartDate = new Date(DateTime.Now.Year, DateTime.Now.Month, DateTime.Now.Day),
Type = RecurrenceRangeType.Numbered,
NumberOfOccurrences = 3
},
Pattern = new RecurrencePattern
{
Interval = 1,
Type = RecurrencePatternType.Daily
}
};
};
I'd like to get the EndDate of the last Occurrence (or the recurrence end date) without have to query all the occurrences and/or having to calculate it on my side.
This way I'd be able to query instances without having to iterate and/or set an arbitrary date.
var request = graphClient.Users[Settings.SkypeUserEmail].Calendar
.Events[updatedEvent.id]
.Instances
.Request();
request.QueryOptions.Add(new QueryOption("startDateTime", DateTime.Now.AddDays(-1).ToString("s")));
request.QueryOptions.Add(new QueryOption("endDateTime", DateTime.Now.AddDays(5).ToString("s")));
Thanks for your help!
var instancesPage = await request.GetAsync();
A:
I thought dan-silver would update his answer to indicated it's currently not possible.
If you create a recurring event with a number of occurrences set, the end date will be null. So you either have to throw random query dates at the API or query all occurrences in order to get the overall end date of the series. It would be something nice to add in future versions of the Graph.
|
Proteomics and Genomics Technology: Comparison in Heart Failure and Apoptosis
Neil J Nosworthy, University of Sydney, New South Wales, Australia
Masako Tsubakihara, University of Sydney, New South Wales, Australia
Cristobal G dos Remedios, University of Sydney, New South Wales, Australia
Abstract
Recent developments in microarray technology in determining the protein and gene content of cellular extracts will allow,
on a much larger scale, the characterization of genes and proteins that change due to heart failure.
Scanned images of 96 gene arrays from Clive and Vera Ramaciotti consortium, University of NSW, Australia. The genes are spotted
in duplicate. Green spots (e.g. actin) indicate genes that are upregulated, orange spots (e.g. tubulin) indicate genes that
are downregulated while yellow spots (e.g. myosin) show genes that have equal expression in donor and diseased hearts. Bright
spots indicate a large amount of gene present, while no color means the gene is absent in the sample.
Figure 2.
Pie chart illustrating a quarter (24×25 spots) of a Micromax gene array in which mRNAs from human left ventricles are compared. The diameter of the pie represents the expression level of each spotted gene (the
stronger the gene expression, the larger the diameter) and dark and light shadings indicate the expression in DCM and donor heart respectively. Equal gene expression divides a pie in half.
Figure 3.
Apoptosis signaling pathways. Upon induction of apoptosis through the Fas signaling pathway, there is an alteration in the
permeability of mitochondrial membranes. This change causes the release of cytochrome c from mitochondria (Mito) into the cytoplasm, which in turn activates cascades of caspases. The Bcl‐2 family of proteins regulates cell death by controlling
mitochondrial membrane permeability.
|
Boeing 747-8 first flight
My son and I watched the landing of the Boeing 747-8 this afternoon at Paine Field, Everett, WA. The 747-8 is the latest Boeing product in the long line of 747 airframes. The first flight today was the freighter version.
Notice the new Boeing House Colors – the curved cheat line down the fuselage. It was surprisingly quiet as well.
The 747-8 can be configured for passenger service with 467 seats in a three cabin configuration. The plane has a range of 14,815 km (Intercontinental) and 8,130 km (Freighter). The plane is more efficient than the prior 747-400 and the only plane in the 400-500 seat market that fits existing airport infrastructure – unlike the Airbus A380.
It’s an expensive gamble for Boeing – the 747-8 lists for $277 million – but it is thought the launch customers paid up the 30% less.
It’s nice to watch something we actually designed and created in this country.
Dawn
Just some trivia:
The original 747 design was not done with CAD. The blueprints were drawn the old fashioned way. Software was used to scan and vectorize the drawings so that later versions like this could be developed and tested using modern software. The infrastructure needed to produce a plane like this is truly amazing. Its impossible for anyone person to understand all of the technology developed so these can fly. I had four different contracts with different companies that were related to this plane.
So true Joaquin! Have you ever toured the Boeing assembly plant in Everett? It was more fun before 9/11 – now you are relegated up one end of the building and have to look through open doors way down the building to see the 747s – and it is a massive building!
We have a set of blue prints for the paint scheme for early British Airways 747 – 100/200 series airframe. They are massive – pages and pages of instruction. I’ve read that the paint can add up to 1,000 pounds to the weight of the plane. That’s a whole lot of paint.
This summer I saw several of the monstrously large A380s – no thanks. Trust me when I say you do not want to be stuck in customs when they disgorge. You really appreciate the subtly of the design of the 747 when you see it by comparison. Nothing else looks like a 747.
I was even part of a group that worked on vectorizing the drawings. I worked on part of the system that delivers tools to the production and repair lines, wrote software used for networking computers used in manufacturing and other things.
for sharing your experiences. Do you still work in the field? Been some tough times for Boeing lately. Saw three 787 on the flight line yesterday (one in ANA livery). Frequently see that “Dreamlifter” fly over – that’s been a rough experiment in building airplanes.
747 Paris to Joburg. Full Plane. Pretty wooman sat next to me, was a French & Afrikaans speaking nun, no english. Plae to for ever to get off the ground in Paris. The feuling engineer for SAA was in the other abject seat, and was white knuckled before we rotated.
Pretty good article. Turns out the quieter engines take advantage of a special trailing edge of the cowling that diffuses the roar. Such clever humans!
.Cows get milked, rubes get bilked,
And fat cats dine on fools and cream.
For the truly airplane nerdy (like my family) we were able to track the first flight in FlightAware software. The plane flew out over the Strait of Juan de Fuca, then down the spine of the Olympic Mountains, turned east around Olympia and eventually returned to Paine Field from the east.
Yes, I was standing outside when it took off from the other side of the factory and over our building. I can’t believe how quiet it was. Something that huge, that close, you would expect to roar for 10 minutes until it’s out of sight, like the big military cargo planes do, but it was just a whoosh. Amazing.
I also saw the 787 takeoff in person — right in front of me, as I stood outside the fence on the grass immediately next to the runway.
It’s really cool to watch the big jets go into the sky with the little tag-a-long airplane wingtip-to-wingtip with it. They fly so close together it’s amazing they don’t touch.
It will be a good thing for us if we can start delivering both planes soon.
Within the last year or so they added a new runway at O’Hare. The new runway’s inbound flight path is very near our house. Even though we are 10 miles or so from the airport I now really notice the incoming planes. In reading the article I took especial notice about the noise reduction effort for the plane. From the above link:
Noise reduction design on the GEnx engines
The GEnx engines have a noise-reduction design.
One of the first things people on the ground noticed about the plane — besides the massive size — is how quiet it is at takeoff. The four engines let out more of a whoosh than a roar, and even as the plane climbed into the sky it didn’t interrupt conversations held just a few hundred feet away. General Electric designed the engines, similar to those found on the 787, to dramatically reduce the noise at airports, adopting such tricks as giving the engine cowling a unique serrated pattern.
The noise reduction is one reason Cargolux signed up for 13 747-8s. Spokesman Patrick Jeanne said the company runs a fleet of 747-400s out of Luxembourg and the new model has a “noise footprint†one-third smaller than the planes they’re using now. That’s a big deal.
“It’s very important to make as little noise as possible.â€
Jeanne says the reduced noise is helpful in maintaining community relations,…
immediately after 9/11 and the plane was almost empty. All of us passengers folded up the seat arms and took down all the blankets and pillows and each made a nest to sleep on. I slept well the whole flight. Then I transfered to a flight from Heathrow to Joburg (12 hours) and it was asshole to elbow the whole flight. Awful.
The only good thing about that trip was that I bought some excellent Eastern European absinthe on the way back in the Heathrow airport.
I remember taking my two girls sometimes, when they were young, to spend an afternoon at the airport in Ottawa. At the end of a large hall were some comfortable couches in front of a wide, ceiling to floor window with a view of the runway. Not only was it exciting to watch planes take off and land, this entertainment also didn’t cost a penny.
As well, their dad took the girls often to the Aviation Museum as it was close to where he lived. There my oldest daughter fell in love with the Lancaster, a heavily armed bomber that took part in many raids on Germany in World War two. She had some pictures of the Lancaster on her bedroom wall and wrote a cute story about this plane. Her fascination with the Lancaster (just the plane, not with the many deaths it caused) lasted many years but was finally replaced with a love of horses when I started taking her for horseback riding lessons.
Tolerating prostitution is tolerating abuse and torture of women and children.
It’s great that you got to see it. I saw the Concord a few times at Dulles but it didn’t have the same form follows function look. Maybe this can be the model for other products. There’s no reason why we can’t retool rapidly (other than inertia and narrow vision).
Both are pretty ungainly just because they’re so damned big. I finally saw an A380 for reals at LAX last year, a Qantas beast that was just stunningly huge. But the A380 loses the beauty contest out of sheer bulk.
Nice to see Boeing carrying on with this relatively ancient plane, though I’m sure the 747-800 bears little resemblance to the ca. 1969 747-100 aside from a silhouette.
Oh and I hope they’re building it from more US-made sources than the 787.
I just wanted to illustrate that for girls, if I may quote Ian Welsh, the horizon is as far as they can imagine. Fuck the marketers that peddle sexualized little girls. Rise up, I say, rise up. We don’t have to take this anymore.
Tolerating prostitution is tolerating abuse and torture of women and children.
One is a former student in the Master’s program I worked in. The other is a second cousin I saw last night at her father’s memorial service. Both are single moms; the first raised four boys by herself.
Girls can be engineers, and successful ones. These two amazing women are proof.
to help sell planes to the airlines based in those countries. It’s my opinion they got seriously carried away with this with the 787, and that multi-country coordination is what has delayed this plane. It’s certain key pieces that should never have left the US, like giving the avionics to the Italians, and the wing manufacturing to the Japanese. Those were both core competencies for Boeing and the US.
|
Q:
for c# to javascript
I have a ViewBag.List > where i have competition, and every competition has a list of teams.
Example : List of {Premier League : [ Arsenal, Chelsea etc]
Bundesliga : [ Bayern Munchen, Wolfsburg etc]
I have 2 selects. When the user selects the first select ( competition ), i want that the second select will have the teams from the competition. If he selects Premier League, the second select will have Arsenal,Chelsea etc.
I tried to have a select for every competition, and if he selects one, that one will be visible and the other ones hidden or none, but all the selects are linked with asp-for string CurrentTeam and i can't put the team in the database.
Another option was with a javascript function.
Whenever the user selects a competition - > onclick = "myfunction (this)"
and in that function i have something like this:
function myFunction(select) {
var sel = document.getElementById("teams");
if (select.value == 'Premier League') {
sel.innerHTML = "";
@foreach(var team in ViewBag.List[0]) // Premier League
{
@: var x = document.createElement("OPTION");
@: x.setAttribute("value", @team);
@:var t = document.createTextNode(@team);
@: x.appendChild(t)
@: sel.appendChild(x);
}
}
else // the other competitions
But i can't use ViewBag in javascript function.
I just want a select that reacts to another select and to put those 2 things in the database.
Any suggestions ?
Thanks!
A:
In your View, you can build a JavaScript object which holds all leagues and teams, and then read from that object in your JavaScript code:
Controller:
[HttpGet]
public ActionResult Index()
{
ViewBag.List = new Dictionary<string, string[]>
{
{ "Premier League", new[] { "Arsenal", "Chelsea" } },
{ "Bundesliga", new[] { "Bayern Munchen", "Wolfsburg" } },
};
return View();
}
View:
...
<script type="text/javascript">
//Complete list of leagues and their teams:
var leagues = {
@foreach(var l in ViewBag.List)
{
@: '@l.Key': [
foreach(var team in ViewBag.List[l.Key])
{
@: '@team',
}
@: ],
}
};
...
Example:
https://dotnetfiddle.net/d0FrGr
|
Nitric oxide (NO) is the first gaseous molecule that acts as a biological messenger and participates in a myriad of biological processes including control of blood pressure, neurotransmission and inhibition of tumor growth. The desire to deliver NO at biological targets under specific physiological conditions has inspired research in the area of designed molecules that release NO on demand. Although a few organic exogenous NO donors (like nitrates and nitrosothiols) and sodium nitroprusside (NSP) have been utilized for such purpose, the possibility of non-porphyrin metal nitrosyls as NO donors has not been explored in any systematic way.
The discovery of the roles of nitric oxide (NO) in blood pressure control, neurotransmission, and immune response has stimulated extensive research activity in the chemistry, biology, and pharmacology of NO.1-5 Cellular NO is almost exclusively generated via oxidation of L-arginine (reaction 1) by the enzyme nitric oxide synthase (NOS).6 NO synthases are a class of heme-proteins which are both constitutive (e.g., neuronal and endothelial NOS) and inducible (e.g., cytokine-inducible NOS III). The principal targets of NO in bioregulatory processes are also iron proteins. For example, binding of NO to the Fe(II) center of the ferroheme enzyme soluble guanylyl cyclase (sGC) activates the enzyme leading to formation of the secondary messenger cyclic-guanylyl monophosphate (from guanylyl triphosphate), which in turn causes relaxation of smooth muscle tissue of blood vessels. Although NO concentrations of less than 1 mM are involved in endothelium cells for blood pressure control, NO concentrations produced during immune response to pathogen invasion are much higher. Sudden increases in local NO concentration have been exploited in NO-mediated photoinduced death of human malignant cells.7
The desire to deliver NO at biological targets under physiological conditions has inspired research in the area of designed molecules that release NO on demand. Several reviews published in the past few years attest the extent of attention and interest in controlled NO release under specific conditions and development of NO-donor compounds.8 Currently, the major classes of exogenous NO donors include organic nitrates (e.g., glyceryl trinitrate, GTN), nitrites (e.g., isoamyl nitrite, IAMN), nitrosamines, oximes, hydroxylamines, nitrosothiols (e.g., SNAP and GSNO), heterocycles (e.g., SIN-1) and NONOates (e.g., DEA-NO).8 These compounds (FIG. 1) release NO upon exposure to heat, light, oxidants or thiols, and in some cases via enzymatic reactions. Several of these organic compounds have found use as pharmaceuticals. In addition, metal-NO complexes (nitrosyls) like sodium nitroprusside (SNP) and Roussin's salts have also been exploited as NO donors (FIG. 2).2,8
There are however, fundamental problems associated with conventional NO-donors such as GTN, SNAP, IAMN, DEA-NO, as well as the metal-NO complex SNP, when used in biomedical applications. In particular, NO-release is poorly controlled upon administration of these NO-donors to a subject, since NO is released via various enzymatic and non-enzymatic pathways. For example, organic nitrates like GTN have been used to relieve angina pectoris and acute myocardial infraction, while organic nitrites such as isobutyl and isoamyl nitrite have been used clinically as vasodilators. The requirement for specific thiols and/or enzymatic bioactivation for triggering NO release from these drugs renders them less ideal compounds for the generation of predictable rates of NO release. Patients also develop nitrate tolerance in many cases. Nitrosothiols NO-donors such as SNAP and related derivatives are often unstable and production of NO is induced by heat, UV light, certain metal ions, superoxide and selected enzymes. In addition, NO-donors such as like hydroxyureas, hydroxylamines, and SIN-1 (sydnonimines) all require activation by specific enzymes and are difficult to target to a given site.
Production of secondary toxic product(s) is another problem encountered with certain conventional NO-donors. For example, among the inorganic NO-donors, sodium nitroprusside (SNP, marketed as NIPRIDE or NITROPRESS) has been in therapeutic use for quite some time. SNP is widely used in hospitals to lower blood pressure during hypertensive episodes (e.g., heart attacks and congestive heart failures). It is also used to combat vasoconstriction during open-heart surgery. However, cyanide poisoning poses some risk in SNP therapy, and in fact SNP infusion is often discontinued after 10-15 min to minimize cyanide toxicity. Moreover, deaths of several patients that have received SNP therapy have been reported (e.g., Butler and Megson, Chem Rev, 102:115-1165, 2002). The cyanide ions, released during photolysis or in vivo enzymatic reduction of SNP are metabolized in the liver and kidneys by the enzyme rhodanase, which converts CN− to SCN−. Patients with severe hepatic compromise therefore require strict monitoring of the thiocyanate levels and are often not good candidates for SNP therapy. Synthetic iron-sulfur cluster nitrosyls like Roussin's black salt (RBS, [Fe4S3(NO)7]−), Roussin's red salt (RRS, [Fe2S2(NO)4]2−) and [FeNOS]4 (FIG. 2) have also been employed therapeutically. Although photodecomposition of RRS and RBS generates NO, formation of ferric precipitates often limits their use. In addition, RRS exhibits carcinogenic properties.
Thus, what is needed in the art are compositions and methods comprising NO-donors that can be safely administered to subjects (e.g., patients with heart disease or cancer), and whose release of NO can be satisfactorily regulated. The present invention meets this need by providing compositions and methods comprising NO-complexes that release NO upon illumination with low-power light.
|
[The effect of a mite allergen on Na/H metabolic activity in peritoneal mast cells].
Mite allergen interacting with mast cells treated with sera from bronchial patient sensitized to home dust Dermatophagoides farinae causes changes in intracellular pH. Regulation of pHi peritoneal mast cells is participated by Na/H metabolism probably activated by protein kinase C.
|
Marvel Teams with Archie Comics to Release 'Marvel Comics Digest'
Marvel Entertainment is teaming with Archie Comics to produce the Marvel Comics Digest, a new series of small format book collections, that will feature Marvel’s iconic characters and will be designed, packaged and distributed to retailers by Archie Comics.
The Archie Comics Digests have been a popular bestselling format for Archie Comics for decades. Archie Comics will publish the new Marvel Comics Digest six times a year beginning in June 2017. The small format books will be distributed to Big Box retailers, comics shops and newsstands by Archie Comics.
Marvel senior v-p, sales and marketing David Gabriel said teaming with Archie to create and distribute the digests will advance the “reach and exposure” of the Marvel brand. Gabriel said the digests offer “our retailer partners, local comic shops and large chain retailers, a new, fun, and easily digestible way to dive into the Marvel Comics Universe and produce life-long fans.”
The first of the Marvel Comics Digest collections will feature the Amazing Spider-Man and the Avengers and will be released in June. Look for Marvel Comics Digest featuring Iron Man, the X-Men, Black Widow, Wolverine, Thor and the Hulk in subsequent Digests.
Archie Comics publisher and CEO Jon Goldwater said the Archie Comics Digests have been popular format with consumers and retailers for many years.
“For years, Archie has made the digest format our bread and butter,” Goldwater said. “We are supremely excited to spotlight iconic characters like Spider-Man and the Avengers through this major partnership with Marvel. These books will serve as a great introduction to the Marvel Universe for new readers and a very special, curated selection of stories for existing fans.”
Click Here to download the complete press release
|
[music]
00:07 Trevor Burrus: Welcome to Free Thoughts. I’m Trevor Burrus.
00:09 Aaron Powell: And I’m Aaron Powell.
00:11 Trevor Burrus: Joining us today is Joe Quirk, President of the Seasteading Institute. He is the co‐author, along with Patri Friedman, of Seasteading: How Floating Nations Will Restore the Environment, Enrich the Poor, Cure the Sick, and Liberate Humanity from Politicians. Welcome to Free Thoughts, Joe.
00:24 Joe Quirk: Thanks for inviting me you guys. It’s great to be with you.
00:27 Trevor Burrus: Now it may be obvious from the term, but what is Seasteading, just to get off with point one here.
00:36 Joe Quirk: Seasteading is homesteading the high sea, and the technology for building floating cities and floating communities on the ocean is at hand and seasteaders wanna make it happen sooner than otherwise, because almost half the earth’s surface is unclaimed by any existing nation state, and seasteaders wanna empower people to have basically startup nano‐nations on the ocean.
01:03 Trevor Burrus: That seems like a pretty bold, bold move. That sounds pretty science fiction, which I’m sure as you say in the book consistently, the biggest question you usually get is, “Are you crazy?” And so, maybe that’s the next question, is like, “Are you crazy? Isn’t the sea dangerous and volatile and barren?”
01:22 Joe Quirk: That’d be a good description of space, and yet people are taking going to Mars very seriously. And the thing about living on the ocean is that science fiction is science fact. We already have oil rigs which are on the high seas and very high waves for decades at a time. We have cruise ships that are essentially self‐governing floating cities, and seasteading is a way of combining these two technologies for permanent living on the sea combining with the governance technology of a cruise ship. Buckminster Fuller designed a floating city and unveiled it way back in 1968. It was featured in Lyndon Johnson’s White House and people were taking very seriously the concept of floating cities. But the whole thing got derailed by the Cold War as people got distracted by the race to space, to compete with the Russians. And guys like Elon Musk were young kids growing up reading science fiction about going to Mars and imagining that by the time they were grown up, we were all gonna go to Mars and then they grew up and realized it hadn’t happened and they’re mad and now they’re trying to make it happen.
02:38 Joe Quirk: But we’re completely skipping the sea, and I like to tell people that we live on Planet Ocean. Two‐thirds of the earth’s surface is water. If you wanna go deep down below the ocean, you’re basically… That’s 98% of the living space. If you’re interested in alien intelligence, we have cephalopods like cuttlefish, they’re highly alien intelligences. But most interesting to seasteaders is the chance to completely start over and to empower as many people as possible to start over. So we have a 193 nation states governing 7.6 billion people. I live near Silicon Valley, seasteading is sort of a Silicon Valley approach to the problem of governments sucking, which is basically, if you think that solutions come from startups and you think if you can create platforms whereby people can choose among different governance structures and you could actually create a peaceful market of governance at sea and people could choose among them, you’d basically have a research and development department on the ocean for people to try different sort of governance ideas, and as long as people can choose among them voluntarily, we will unleash voluntary tiny societies on the ocean that can attach to each other, get bigger, break off from each other, go elsewhere. We’d essentially have variation by governments and selection by citizens which seasteaders believe will unleash evolution in governance itself. And you can imagine the libertarians are very attracted to this idea.
04:32 Aaron Powell: So if the advantage of this though is that you can build these things outside of the territory of governments, won’t we just run into the same problem that Silicon Valley startups are starting to notice now with government calls for regulation of Facebook? That it’s one thing when you’re small and no one’s really… You’re just ignored by the governments, but if seasteading actually became competitive or was done in substantial numbers, wouldn’t governments just decide maybe we do own those parts of the seas and not allow it?
05:06 Joe Quirk: I think the greatest threat to seasteading is what you just described. It’s certainly not technological or business or anything like that. And the great thing about old governments is that they’re dinosaurs, they move very slowly, they’re very dumb, so Facebook can scale up and get a billion users before the government wakes up and starts getting upset that people like Facebook better than them. And when people worry about, governments worrying about seasteads and doing something about it, I just cite historical precedence. China doesn’t invade Hong Kong because it’s a blatant slap in the face of everything that communist China represented as this little defenseless flea that created all these free markets and created so much prosperity and basically persuaded China to change it’s views. The Cayman Islands off the coast of the US has no standing army, takes a very spiteful stance with regard to welcoming medical mavericks and financial innovators and the US doesn’t invade it. They just ignore it because it provides a service. So I always think of, if nation states are like sharks, if you’re a seastead, you wanna think like a cleaner fish. You wanna provide a service that the nation state appreciates.
06:36 Joe Quirk: I think it’ll take so long before seasteads are actually some sort of threat to existing governments, that seasteads have the power to scale up considerably. There’s a really great precedent to show how little governments care about new floating societies that are very rebellious. So there was an abandoned sea fort known as Fort Roughs off the coast of England and it was outside the territorial jurisdiction of England at that time. And there were some pirate radio stations out there playing pirate radio that was basically not legal because the BBC only wanted to play rock and roll sometimes, but this was fulfilling people’s desire to play music all the time. And this guy named Paddy Roy Bates basically sailed out there, kicked off the rivals, and declared himself a sovereign nation. And when the Royal Navy ship strayed into what they claimed as their territorial waters, his son, Michael, basically fired a warning shot. And it’s like, “WTF, what the… These guys are crazy.” And so what happens? Did Britain try to invade? Did they swoop in and shoot these three crazy guys? No, they just ignored it and they brought weapons charges against the Bates family. And a British judge ruled that, “Well, they’re outside the territorial waters of Britain so we don’t have jurisdiction.” And it kept getting crazier.
08:22 Joe Quirk: Another pirate radio rival tried to invade and take the little 120‐meter nation away from [chuckle] Bates, and they captured them and imprisoned them. And then so a German diplomat went and negotiated with Bates as if he was a sovereign country. And then Bates said this, “Release the prisoner.” But then said, “Aha. You’ve negotiated with me. That means you recognize me as an independent state.” So you couldn’t get more provocative than these guys. They’ve established a three‐generation dynasty on this silly little ugly sea fort. The territorial waters of England has since expanded to include Sealand, what’s called the Principality of Sealand, but they remain a self‐declared micro‐nation. Britain has not done anything about it. They’re just letting them do their crazy thing.
09:25 Joe Quirk: And last I checked, they were claiming $600,000, US dollars, GDP just from selling stamps and sponsoring a soccer team and offering dukedoms [chuckle] to people. I hope… I’m involved with the first seasteading company now and we’re not gonna be as provocative as that. We’re not gonna fire canons at navy ships. We’re not gonna capture people and imprison them, but if that crazy guy can establish his own little nation and governments basically don’t care, and he can actually make a profit, and it’s basically the ugliest, smallest nation in the world, I think that’s a great precedent for what seasteads are capable of and a great example of how little the old big governments don’t care because attacking a floating algae farm is basically gonna be a PR nightmare.
10:26 Aaron Powell: There are about 195 nations.
10:30 Trevor Burrus: 93. 193.
10:30 Aaron Powell: 193 nations right now and they are competing with each other and you can move… Some of them are more restrictive than others, but you can move typically from one to another. And yet, none of them, few, if any of them are what libertarians would consider market utopias or the kind of place that we imagine the seasteads might be. And so, if among those nearly 200 nations, we haven’t seen any of them embrace the kind of values that we would like to see, what makes us think that the seasteads would be any better?
11:12 Joe Quirk: Well, the stampede of people like us racing to seastead [chuckle] to volunteer and get involved and make it happen. I think a really cool way to look at this is through the lens of special economic zones. So we tend to think of nation states as being these great big things that control everybody inside them, but they’re disintegrating from the bottom up. And so, I mentioned Hong Kong earlier, the first interesting little special economic zone that just a random experiment that happened accidentally through historical caprice, created so much wealth it ended up converting China into being a much more open market and a half billion people escaped extreme poverty.
12:00 Joe Quirk: That was such an interesting experiment, that China allowed 14 more little special economic zones within its nation. And those all created so much wealth, right now probably more than half of all Chinese people have migrated to these special economic zones. So, in a sense, people have already left the old, poor, communist, rural China, and moved to these much more prosperous free market places. This set a precedent where different countries around the world, especially in the southern hemisphere started experimenting with little free ports, little, I think of them as legal islands, allowing special exemptions from taxes and regulations to create prosperity. And overall, some special economic zones have failed, some have succeeded, some have been corrupted, some have been spectacularly successful, such as Shenzhen in China. That basically, more than 4000 have proliferated across the world in the last 50 years. It’s completely peaceful, it’s a bottom‐up, inside‐out revolution in governance as Tom W Bell calls it.
13:12 Trevor Burrus: Who has been on Free Thoughts before.
13:16 Joe Quirk: Yeah, yeah. He’s the author of Your Next Government?: From Nation States to Stateless Nations. So it’s already happening. But these things are only so free. So there’s this revolution and freedom, to me this is the most momentous political revolution. It’s sweeping the world. You mentioned 193 nation states. Well, over 4000 special economic zones have them completely outnumbered. So, Tom W Bell is the kind of the John Adams, kind of the father of the sea zone where he takes the best practices of all these special economic zones and he wants to instantiate them on the first floating legal structure, which would be the sea zone. Which we hope to establish in an island nation soon, and continue this evolution of better, freer governance.
14:10 Trevor Burrus: That’s interesting, as your book is extremely optimistic, and kind of surprising to the point that it… I felt like I was being pitched, and I came to believe it more and more, almost like I was being pitched time shares in Mexico, a can’t miss real estate opportunity, and all that stuff. But the really interesting thing about it was all these people, not necessarily libertarians doing different technological things were kind of converging on the same idea in terms of, how to get food, how to get energy, how to get different things from the ocean, and how to build floating structures that can sustain. It’s not just libertarians, it’s coming from a bunch of different angles.
14:48 Joe Quirk: Yeah, it’s interesting. It actually works best if you don’t say the L word, because that sets up people’s psychological immune systems. But as soon as you tell the world, “Hey, we’re gonna set up a platform, you can completely start over with a new governance system.” Innovators come stampeding to you, they don’t need to self‐identify as libertarian. No more than an American vacationer who steps on a cruise ship, is changing ideologies because now they’re getting free market healthcare, and free market security on a self‐governing ship, with a dictator known as a captain. [chuckle] They’re not changing what their beliefs are, but it’s about the proliferation of choices, and providing different places where people can experiment with different social structures.
15:38 Joe Quirk: And crucially, people bring their own business ideas to seasteading like crazy. And environmentalists are interested in algae farms and seaweed cultivation, and conservatives are interested in a new frontier, people, socialists, want to create their own sea stead, everybody with a different idea, who wants to prove their point to the world, can get their own seastead, build their own business model, and then succeed or fail in the eyes of the public on their own terms. That’s the great thing about the seasteads is the people who try them absorb the cost of failure. And hopefully, prosperity will be shared and the world can watch and see which systems work. And we don’t have rely on politicians to impose systems from previous centuries from the top‐down on us.
16:32 Aaron Powell: So practically, what does life on a seastead look like? Because I mean, to be perfectly honest, the idea of living on an oil rig doesn’t strike me as super appealing.
16:44 Joe Quirk: Me neither. And that always depends on whether we’re talking about seasteading in 2025 or 2055. So I hope that a company that I helped co‐found, called Blue Frontiers, will build the first very modest seastead in French Polynesia, which is right in the middle of the blue frontier, which is the Pacific Ocean. And if that works, that’ll be for around 300 people. If people want to check it out go to blue-frontiers.com. We have lots of visuals there, we’ve already designed how it’s gonna look, we’ve already got the engineers. And it’s basically gonna look like a floating Hobbiton. Basically green roofs, it’s gonna look like any other island from a distance. It’s gonna be inside a protected lagoon, so there’s no waves. So we’re gonna be using existing technology. It’s basically, the same engineers who built the floating pavilion in Rotterdam, are gonna build something about seven and a half times as big, which will be the first seastead, if all goes according to plan with Blue Frontiers.
17:52 Joe Quirk: But what about seasteading in 2055? Hopefully by then… Oil rigs already are way too expensive. Only oil and gas exploration companies could afford them. If you think of seasteads as the intersection, the confluence of material science, of 3D printing, of people… I have colleagues working on geopolymer concrete and all this sort of stuff. The way it would work is basically the way Buckminster Fuller designed it 50 years ago, which is much of the seastead will be deep below the water, the physical structure of the seastead, where it’ll have tremendous ballast. So, if you put a lot of weight far down below the sea, you can create incredible stability, and then have pilings, which are basically pillars that go up high above the waves, and then your city floats on top of it. So, you have these very high waves, your city well above it. And there’s something called the Flip Ship, if this seems like futuristic to you. I’d encourage your listeners to look up the Flip Ship, F-L-I-P.
19:15 Joe Quirk: It’s been in operation on the ocean since 1962, and it’s basically like a baseball bat thing. Think of it as a wine bottle that’s much bigger. Where four‐fifths of it is below the ocean, basically uses ballast tanks to float in the oceans. And it’s described as being a stable, as a fence post, in 60 foot waves. And that’s just one little floating giant wine bottle, you can think of it. And Robert Ballard, discoverer of the Titanic and famous oceanographer, he’s a seasteading fan. He’s featured in the book and he wants to take Flips, put platforms on top of them high above the waves and create stable structures on the sea. So in many ways, large enough and deep enough structures on the ocean can be more stable and safe than coastal communities. Safer in tsunamis, which don’t become destructive until they reach land. Tsunamis are harmless on the deep sea. So it’s basically the principle of ballast below the oceans.
20:26 Trevor Burrus: Yeah, when I read the part about the Flip, I immediately went to look it up and I do suggest listeners look it up. It stands for Floating Instrument Platform, and there’s a video on YouTube of it turning. It’s like a big barge and then you fill it up and then it floats with part of it sticking out but four‐fifths of it underwater. It’s pretty incredible. You get into, in the book, you also get into the… Well, you seem to think that seasteading is almost imperative, first of all, rather than something that would be fun to do or good to do to get out of government, but imperative in terms of food production and fuel production. Food in particular is pretty interesting. How we could farm the sea.
21:12 Joe Quirk: Yes, in the book, I feature Ricardo Radulovich, who was one of many seaweed farmers who wanna mass farm the oceans. And the amazing thing about seaweed is that there are thousands of different species of algae that are edible. It’s more healthy than corn, wheat, or soy on which we base much of the food we eat now, which is basically not healthy. And the incredible thing about ocean‐based crops is that they can be environmentally restorative. So this is way beyond sustainable, and this is… You can think of this as the Libertarian answer to environmentalist critiques, which is that there’s a type of seaweed called macrocynthis, I think it’s called? It’s been called the Redwood of the ocean. And in order to build its biomass, these different kinds of seaweed need to draw tremendous nutrients and carbonic acid from the oceans, basically. And our coasts are just polluted with dead zones, which are caused by agriculture and all the agricultural runoff that runs into the oceans and dumps all this nutrient wealth that can be used by seaweed farms, which would basically restore those areas.
22:40 Joe Quirk: I’m very intimately aware of this. I wrote a whole book before I discovered seasteading about the problems of agricultural runoff and its effect on coastal oceans and it’s effect on marine mammals. It’s really brutal. You can imagine these dead zones, as they’re called, restored to their pristine conditions by eating. Imagine if you had a company called Restorative Foods, I was trying to found a company like that with a Libertarian friend of mine in big agriculture to try to make this go and we spoke to maybe a half dozen seaweed farmers in California. None of whom have a particular ideology, but all find the regulations in California and in the US so onerous they can’t scale up their vision. And they wanna get outside the existing jurisdictions and scale up their seaweed farms. And Neil Sims, who I also features in the book, he’s a fish farmer. He says, “First come the farms and then come the cities.” You gotta establish the business model out there. It’s just like the Western Frontier. And that seasteads can be thought of as the covered wagons. You get out there, you get your seaweed farm, you get some workers on there, you start hiring people, then the towns will come on their own.
24:05 Aaron Powell: What’s the economy of these things look like? Like I guess I’ll start with just how much would it cost to live on one of these early, or in development seasteads?
24:18 Joe Quirk: So, the first seastead in the early 2020s that will be established by Blue Frontiers will have to be competitive with beach front property. So if you take, it’s gonna be about 7500 square meters. If you divide that up among 300 people, it comes out to about $200,000 per person. Which is steep, but some of the islands are designed for small apartments and things like that. So it has to be… The only way the close to shore seasteads will compete economically, is that they have to offer something that’s less expensive than the land that’s right on shore, especially the beach front property. And the great thing about seasteads is that even though it may be more expensive to build a floating neighborhood than a neighborhood on land, the land is more expensive in the water, the seastead doesn’t have to pay for the land. So if you establish a sea zone in a lagoon off the coast of some beautiful bungalows in Tahiti, we could conceivably make the seasteads cheaper than what people are already paying for with bungalows and hotels and apartments on the beaches of Tahiti.
25:43 Trevor Burrus: So do you expect people like, in the first wave to be telecommuters from Silicon Valley kind of people ’cause there’s no jobs there. You don’t have someone who’s gonna work at McDonald’s able to go live on a seastead. Not only because they can’t afford it, but there’s no McDonald’s there or other services. So, is initially, do you expect kind of people who are telecommuting to live there?
26:07 Joe Quirk: The first one is going to feature various businesses. It’s very important to me that the first seastead set a stellar example. So, we plan to have scientific researchers in the Blue Economy, wave energy generation technologies on there. We plan to have homes for students to come and learn. I want it to be beautiful and to integrate economic classes. Some of it will be villas for families, others will be small apartments and all those people will require services. And so, we hired an economic modeling firm known as Emsi, which gave a third‐party estimate that by the time the… We’re gonna do these seasteads in three phases. If the first one succeeds, it’s gonna triple in size over about 10 years. And they made an independent assessment of the economic activity that would be created by this. When you consider eco‐tourism and potential underwater apartments where you can see through the aquarium walls at how floating seasteads can be environmentally restorative and the commuting back and forth, it’ll be a short ferry ride from shore, so people will probably work there and go back and forth.
27:33 Joe Quirk: Emsi estimated that by the end of phase three, when there’ll probably be less than 1000 people on there, the seastead will produce at least 760 direct jobs, and a lot more indirect jobs when you consider entrepreneurship on shore to service the various people that will be coming out to visit this amazing floating island that looks like a real island. And that’s not Blue Frontiers’ estimates, that’s an independent third party. So once you’re on the water, there’s all sorts of things you can do better. Like solar, for instance, floating solar’s about 20% more efficient than solar on land ’cause you use the water to cool the solar panels and the first seastead, the engineers who work with us plan to use that warmed water for the showers, for the dishwasher, for all that sort of stuff. So, even just the sheer incubation hub and the center for excellence that will be concentrated on the seastead alone, I think will give work to all sorts of network effects so that as people expand anyone that wants a new jurisdiction where they could do something interesting, they will come to you. And probably the industry most beating on our doors is medical research and health care professionals who wanna get outside existing systems and start regulatory startups.
29:11 Aaron Powell: What does the governance system look like? Do the people who live there have an input into the laws and regulations on the seastead? Are there taxes or fees? Does it look like being on a cruise ship, like that dictatorship that you mentioned earlier? Does it look more like a Democratic nation state?
29:32 Joe Quirk: Well, when it starts very small, it’ll be under the jurisdiction of French Polynesia which will also be under the jurisdiction of France, but we will negotiate considerable regulatory and administrative autonomy through the sea zone. And if French Polynesia signs into law our sea zone, it’ll basically be no personal tax, no corporate tax, it’ll be largely self‐regulating. And we’re committed to the decentralization of governance. The currency we’re committed… The token of exchange we’re committed to using is called Varyon, V-A-R-Y-O-N, which is sort of like a crypto‐currency that people are buying already. We’re in pre‐sale now to raise money for the seastead, so it’ll be radically decentralized and people who own Varyon will have a say in some governance decisions. So the whole philosophy of seasteading and our approach to currency is the decentralization of power.
30:39 Joe Quirk: So we wanna take Special Economic Zones to the next step in evolution, which is governance will be developed from the bottom up. I can get into more details on that, but the basic idea is that as long as people can create different societies voluntarily, go bankrupt if they don’t work, and then other people can choose them voluntarily, and the crucial mechanism is that people can leave voluntarily. You could detach your miniature island, float away and go somewhere else. So if you can decentralize the very ground beneath your feet, we’ll develop governance from the bottom up. So the best way of governing ourselves, no one knows how to do it, but it waits to be discovered on the oceans in my opinion. Now, you guys have lots of intelligent listeners, so I’m sure they want the actual details and if I was in the mainstream, I wouldn’t get into this but… So what are the first floating islands by Blue Frontiers? How are they gonna be governed?
31:46 Joe Quirk: They’re gonna be maximally inclined towards economic and personal freedom. And so, basically, with French Polynesia, if they pass the sea zone, Blue Frontiers and French Polynesia will choose a peer group of countries among the most peaceful and prosperous and well‐run countries on earth, and then those countries will choose the regulations in the sea zone. And the way it works is, if all those, say there’s a dozen of the best countries, if all of those have a law or a rule, they can all agree that that law or rule should be on the sea zone. If a single country descents, say, Switzerland says our country runs just fine without that rule, even though the other 11 countries say they require it, then that rule or regulation won’t be instantiated on the sea zone. So it’s… When I first joined the seasteading institute, I learned the term strategic incrementalism. So it’s gonna be the next step, it’s gonna be the most socially free, and the most economically free, but because it’s not yet on the high seas, it won’t be completely free. Criminal Law, France will be in charge of that. So it’ll sort of be like taking slow engineering steps out onto the high seas while also taking steady legal steps steadily towards complete freedom on the high seas, which is the ultimate goal of seasteading.
33:24 Trevor Burrus: As you say in the book, many times that… And, I’ve said it in different contexts, too, is that one of the goals of freedom is you don’t exactly know what it looks like because freedom is a discovery process, and so, at this stage in seasteading, I think the analogy you use is asking whoever created the transistor what the computer look… What kind of things people will do on the computer in the future, whereas the architecture is the transistor, but who knows the App Store and what apps are gonna be created. That’s all unpredictable in its own way.
33:53 Joe Quirk: Yeah, apps, I love the analogy of apps because people say, “Well what kind of government are you gonna create Joe Quirk on your seastead?” Not to compare myself to Steve Jobs, but I’ll do it anyway. It’s like Steve Jobs wasn’t creating an iPhone so he could have an iPhone with one app on it. He was trying to create the platforms where other people can bring their apps, in my case, governance apps. And as long as people can choose among them, the best apps will emerge and the crappy ones will go away, and then we’ll have this huge proliferation of things we couldn’t imagine serving us in the area of governance that certainly we couldn’t imagine before we had the platform. And I always use the analogy of Ben Franklin. The difference between centralized control of innovation, monopolies and decentralized experimentation. So Ben Franklin, genius, innovated in the control of electricity, and innovated in governance. One of the most advanced guys of his day. So his experimentations with and control of electricity led to inventions that he couldn’t possibly have imagined that ever permeated every area of our life. It’s the only reason we’re able to talk about it. Ben Franklin wouldn’t even recognize a light bulb. From the Franklin stove to this iPhone I’m talking to you on. No one could have come to him and said, “Well what good would this electricity do? How will people be lit in the future?” He couldn’t have really answered.
35:37 Joe Quirk: But he also helped write the rules, the parameters for the United States government with a quill pen, when information traveled at the speed of a horse. And we haven’t had any updates since then. We’ve added more rules. We have the same methods by which we choose our rulers. It’s changed over time, but there haven’t been startups. There haven’t been revolutionary new ideas that the Ben Franklins of today can try out. North America at that time was basically a giant seastead where the smartest people in the world went and tried something new, and it worked so much better it ended up converting the whole world. I think of… Another story I like to tell is Steve Wozniak. I think of Steve Wozniak as a modern Ben Franklin. He worked at Hewlett‐Packard. Hewlett‐Packard was a big monstrous company. Steve Wozniak was loyal to Hewlett‐Packard, he loved working at Hewlett‐Packard, and he designed the personal computer and he pitched it to his superiors at Hewlett‐Packard five separate times. They said no five separate times. And with great reluctance, he quit, and he went off, and founded a company with Steve Jobs that Steve Jobs named Apple, and that design became the initial design for the personal computer.
37:01 Joe Quirk: So, if Steve was Wozniak couldn’t leave and try something else outside at his own risk, we wouldn’t have had Apple. It wouldn’t have happened. So, to me, seasteading is a platform for the Wozniaks of governance. The internet and books are full of people with all sorts of ideas for how governance could work better, and there’s no place where they can be tried out. My co‐author on this book is Patri Friedman. He’s the grandson of Milton Friedman. He’s the son of David Friedman. I’m very persuaded by their ideas. I would like to have a place where those ideas can be tried and to see what emerges, unpredictably. It’ll certainly be better than whatever I can imagine. And whatever emerges among floating societies in 2035 will not resemble the ideologies we have now. It will completely defy our limited little minds because we’ll engage the global brain on behalf of innovating in governance the same way the global brain is innovated on behalf of technologies based on electricity.
38:13 Trevor Burrus: Now, if I’ve learned anything from movies like The Perfect Storm or the crab fishing show, Deadliest Catch, that the sea is pretty dangerous, and it has some pretty bad storms that come up. And you mentioned tsunamis, but even in this place in Tahiti, if it is modular to the point that you can actually detach one of them, if a typhoon comes won’t that almost just destroy the entire thing?
38:42 Joe Quirk: The oceans are very dangerous, just as tornadoes on land are dangerous. And we should keep in mind that planes still fly and boats still sail the seas. So you wanna start your seastead not in high wave conditions, preferably close to the equator where waters are warm and very low. The French Polynesia, especially the areas around where we’re gonna start seasteading, if French Polynesia approves, are some of the warmest and lowest, calmest waters on the ocean. And we’ll start inside a protected lagoon, which is sort of a protected atoll actually, which is like a natural wave breaker. It’s like as the volcanoes slowly sink below the oceans over millions of years, they form these nice little rings, where inside it’s like turquoise and lovely and calm and you can put your seastead right inside one of those. And French Polynesia has many, many, many atolls stretching over an area the size of Western Europe, which is what French Polynesia controls.
39:50 Trevor Burrus: But still, a hurricane would disrupt that atoll to some extent, wouldn’t it?
39:54 Joe Quirk: Sure, but they don’t get cyclones of that magnitude. We have to account… Our engineers are Dutch and they build things to account for the one or the 10,000-year storm, they’re very proud of that. The big hurricanes that you see in other parts of the ocean don’t really occur in this area. They do get the occasional cyclone, but the people who live on those islands, and the boats that are there, and the cruise ships that sail there, all weather those things, and our first seastead will too. And it’s about being sort of tethered to the seafloor inside an atoll, creating a kind of stability.
40:43 Aaron Powell: Realistically, how big can this get? Seasteading as a whole. Will it always remain small nations that a handful of people live on or could we see significant numbers of people eventually living on the open ocean.
41:02 Joe Quirk: I think we could get a floating Hong Kong because as these different little things compete, some of them will work very well, and then there’ll be a runaway process where the economy will start to grow so fast that others will come. There’s also an incentive to provide superior governance because the bigger your seastead, the more stable it is in waves and the longer it can stay out there and I can imagine a floating Venice with little moats for roads, where people can move their seastead in and out, but the more of these things you can lock up, the more dangerous conditions you can remain in. Imagine oil platforms where there’s 100 or 1000 of them all locked up together. And to get an idea of how fast a prospering economy can grow, I always point to Shenzhen, which is a fishing village that was right across the street from Hong Kong and was the first imitation of Hong Kong that China allowed.
42:04 Joe Quirk: And at one point, there was just a little fishing village, they didn’t even have a street light and they just had tremendous growth, tremendous property values ascending by 18,000% over a couple of decades and now they make 90% of our computer keyboards. That was just a little bit of freedom, a little bit new economy and people raced there and created something new. So once you have a society that works, I think it will start out distributed. I think you will have lots of small little seasteads living in the doldrums near the equator. But the ones that succeed, I think, will attract more and more people. So I actually do think we could conceivably have cities with floating airports on the ocean and our children will be flying to floating islands the same way they fly to the Cayman Islands and not think it’s weird.
[laughter]
43:05 Trevor Burrus: You point out in the book that a lot of it is about business, it’s not as much about governance and stuff, the latter part is, but about all these businesses that can be put onto the ocean, getting energy from the ocean and things like that. And that seems to be a really important component that you can say, “Hey, do you wanna live in on the ocean?” and maybe some people you’ll find at a libertarian party convention will say yes, but the question of whether or not a business would go out there and build the kind of infrastructure and make money out of the ocean in order to build more and more and scale the problem up. What kind of businesses are interested in this now? And you, have you seen a growth in the amount of businesses that are looking at the sea for various, whether it’s energy or getting out of the regulatory environment and stuff like that?
43:52 Joe Quirk: Yes, as you very smartly point out, seasteading is not an ideology, it’s a technology that requires a business model to pay for people to build it and float out there and actually move out there. So the people most interested in us, and yes, there is a constant acceleration of people coming to us with their ideas about the type of business they’d like to float, the type of technology they could develop. So to run through them quickly, it’s certainly algae farmers and seaweed farmers. It’s absolutely medical researchers, including mainstream ones who are like… Even if I can move our experiments out onto a seastead for six months and then bring them back and go through the whole regulatory process of the FDA, that could save a major pharmaceutical company $100 million. People in the industry have actually told me this. So, we build factories worth a billion dollars just to produce one drug, we’ll pay for a seastead too. And certainly, people working in material science. One of the biggest business models is simply ecotourism and people wanting to be in an incubation hub where other people are working to be pioneers. There’s people with that wanna sell flagging rights. If you just think about, if you had a cruise ship that never docked and floated out there permanently that could be its own nation.
45:36 Joe Quirk: There’s all sorts of ways to rethink how your business would work in a different sort of regulatory environment. And one of the big ones is definitely floating hospitals. Devi Shetty who I feature in the book, who’s Mother Teresa’s former heart surgeon. He’s been called The Henry Ford of heart surgery. Just a huge humanitarian, has just saved many, many lives with his low‐cost heart surgery in India. He actually said in The Economic Times that the best place to have a hospital is floating off shore an existing American city. And given that he doesn’t have that, he’s already built a health city in the Cayman Islands. So businesses are already flying their employees down there to get their knee transplant while on vacation in the Cayman Islands because it’s cheaper to do it that way with a butler and a concierge service than it is to have them get their knee replacement surgery in the US. So there’s innovators trying to get outside the old regulatory structures in pretty much every business and industry you can name that you would need to build society from the ground up and we can even do it from the water up. So you name it, somebody in that industry is reaching out to us and they tend to be the most innovative and entrepreneurial sports.
47:07 Trevor Burrus: Now, as I’ve mentioned, you are very optimistic throughout the whole book and we often ask our guests if they’re optimistic, because we have guests who have apocalyptic predictions about various things, but you seem optimistic. So is that accurate? Do you think that… Would you be surprised if by 2050 there wasn’t some substantial seasteading presence in the world?
47:32 Joe Quirk: Well, I like to think that I’m not an optimist, I like to think that I look at the evidence and do my best to determine what’s most likely. And I’m very influenced by Matt Ridley who wrote The Rational Optimist. Incidentally, he blurbed the seasteading book. I’m very proud of that. And his book is very much about just look at the evidence. Does it say that the apocalypse is coming? Or does it say that things are trucking along okay? Or does the evidence suggest that things are spectacularly getting better, in pretty much every measure of well‐being we can measure globally? And surprise, surprise, it defies human intuitions, everything is getting much, much better in most areas. I’m interested in seasteading, and the startup’s governance, Startup Societies movement, ’cause I think governance is the most important service and it’s the thing that’s getting worse, and worse, and worse. And I don’t think humanity can survive unless we solve that problem.
48:36 Joe Quirk: But I’m also influenced by Nassim Taleb, which is, you can look at all the trends and say, it’s all getting spectacularly better, but the thing that could set us back is a black swan. It’s something you and I are not gonna talk about. Just like the solutions are beyond our imaginings, the thing that could completely screw us up is something we’re not talking about. Who knows? Some cloud of methane gas below the Earth’s crust that could be an earthquake and it could be released and we’d all be wiped out, and none of us were worried about it. So all the trends suggest that we have a lot to be positive about. The trends in governance and fiat currencies, I think, are very negative. But I think blockchain tech and seasteading and Startup Societies could be solving that problem. I think it’s looking up. I think our children and grandchildren will be much wealthier than the wealthiest people today. But there could be some black swan that comes out of nowhere and screws up everything. So I hope I’m an optimist, because the evidence suggests I should be an optimist.
[music]
50:00 Trevor Burrus: Thanks for listening. Free Thoughts is produced by Tess Terrible. If you enjoy Free Thoughts, please rate and review us on iTunes. To learn more, visit us on the web at www.libertarianism.org.
|
Q:
wp_nav_menu() : custom walker
I am starting at WP theming, and it's been more than one day that I am looking to do the similar menu with the wp_nav_menu function :
<div class="ui simple dropdown item">
CATEGORY NAME WITH SUB-CATEGORIES
<i class="dropdown icon"></i>
<div class="menu">
<a href="link_to_sub_category"><div class="item" >Sub Category 1</div></a>
<a href="link_to_sub_category"><div class="item" >Sub Category 2</div></a>
</div>
</div>
Also, if there's no sub categories, the HTML output would be like this :
<div class="ui simple dropdown item">
CATEGORY NAME WITHOUT SUB-CATEGORY
</div>
What do I have to put in my functions.php ?
Any hint or any help would be very much appreciated !
Thanks.
A:
Add next code to functions.php:
class SH_Nav_Menu_Walker extends Walker {
var $tree_type = array( 'post_type', 'taxonomy', 'custom' );
var $db_fields = array( 'parent' => 'menu_item_parent', 'id' => 'db_id' );
function start_lvl(&$output, $depth) {
$indent = str_repeat("\t", $depth);
$output .= "\n$indent";
$output .= "<i class=\"dropdown icon\"></i>\n";
$output .= "<div class=\"menu\">\n";
}
function end_lvl(&$output, $depth) {
$indent = str_repeat("\t", $depth);
$output .= "$indent</div>\n";
}
function start_el(&$output, $item, $depth, $args) {
$value = '';
$classes = empty( $item->classes ) ? array() : (array) $item->classes;
$classes = in_array( 'current-menu-item', $classes ) ? array( 'current-menu-item' ) : array();
$class_names = join( ' ', apply_filters( 'nav_menu_css_class', array_filter( $classes ), $item, $args ) );
$class_names = strlen( trim( $class_names ) ) > 0 ? ' class="' . esc_attr( $class_names ) . '"' : '';
$id = apply_filters( 'nav_menu_item_id', '', $item, $args );
$id = strlen( $id ) ? ' id="' . esc_attr( $id ) . '"' : '';
$attributes = ! empty( $item->attr_title ) ? ' title="' . esc_attr( $item->attr_title ) .'"' : '';
$attributes .= ! empty( $item->target ) ? ' target="' . esc_attr( $item->target ) .'"' : '';
$attributes .= ! empty( $item->xfn ) ? ' rel="' . esc_attr( $item->xfn ) .'"' : '';
$attributes .= ! empty( $item->url ) ? ' href="' . esc_attr( $item->url ) .'"' : '';
$item_output = $args->before;
$item_output .= '<a'. $attributes . $id . $value . $class_names . '>';
$item_output .= '<div class="item">';
$item_output .= $args->link_before . apply_filters( 'the_title', $item->title, $item->ID ) . $args->link_after;
$item_output .= '</div>';
$item_output .= "</a>\n";
$item_output .= $args->after;
$output .= apply_filters( 'walker_nav_menu_start_el', $item_output, $item, $depth, $args );
}
}
and call wp_nav_menu in the "right" place with next parameters:
wp_nav_menu(array('items_wrap' => '<div id="%1$s" class="%2$s ui simple dropdown item">%3$s</div>', 'theme_location' => 'sidebar_right_menu', 'walker' => new SH_Nav_Menu_Walker))
|
The Show (Doug E. Fresh song)
"The Show" is a single by Doug E. Fresh and the Get Fresh Crew. Described as "a reality show of a Hip Hop performance" the track focuses on a conversation between Doug E. Fresh and MC Ricky D (later known as Slick Rick) as they prepare for a show. The song incorporates portions of the melody from the theme song of the animated series Inspector Gadget. The original issue of the song featured a line where Slick Rick mockingly sings a verse from The Beatles' "Michelle" (1965), but all subsequent reissues have removed this line since the rights to the song were never secured.
Originally released as a single, the track was later remixed and included on the 1986 Oh, My God! album.
Reception
"The Show" was named Spin magazine's top rap single of the year, and in Europe (where it received air time on pop music stations such as BBC Radio 1) it broke the record for the best selling rap single of all time. The song peaked at #7 on the UK Singles Chart in December 1985 and was #8 on Jet'''s top 20 for the same month.
The record was produced by Dennis Bell & Ollie Cotton for City Slicker Productions.
While one 1985 critic for Spin included the song in a list of "stupid music"—making fun of Doug E. Fresh's lyrics about his shoes, and calling Slick Rick's sendup of "Michelle" "pathetic"—he still concluded that the single is "the shit". Billboard refused to take it seriously, declaring it the "funniest comedy album of the year". Even when it became only the fourth rap single ever to reach gold record status, the same reviewer stated that it only proved that "talk isn't always cheap".
Legacy
The song is featured in New Jack City and CB4, but is not included in the soundtrack album of either film. Chris Rock, who starred in both these films, would later have Slick Rick perform the song live to introduce his HBO special Bigger & Blacker.
In response to the song's popularity, Hurby Azor and his female hip hop group Super Nature recorded a diss track entitled "The Showstopper". While not a hit in its own right, it did become the breakout track for the group that would later be known as Salt-n-Pepa.
Another diss track entitled "No Show" by The Symbolic Three was released in 1985.
The song is briefly sampled in the song "Oodles of O's" by De La Soul, from their 1991 album De La Soul Is Dead.
Some of the lyrics in this song were interpolated by Snoop Doggy Dogg for the chorus of his 1996 song "Sixx Minutes".
In 1997, The Roots covered the song for the compilation album In tha Beginning...There Was Rap.
In 2013, an interpolation of this song was featured on Eminem's The Marshall Mathers LP 2'', on the track titled "Rap God".
Certifications
References
Category:1985 singles
Category:American hip hop songs
Category:1985 songs
Category:Fantasy Records singles
|
Full documentation loan
In the United States, Full Documentation Loan refers to a loan where all income and assets are documented. It is typically referred to as a "full doc" loan in the mortgage industry and is a common type of loan used for financing a home purchase. A list of the various types of loans can be found at Mortgage Loan Documentation.
Required documentation
Below is a list of some of the documents that are commonly required when applying for a full documentation loan.
Income verification
Proof of Earnings:
W-2 form
Recent pay stub
Tax returns for the past two years
Proof of Earnings (if self-employed):
Profit and loss statements
Tax returns for current year and previous two years
Any additional income; for example:
Social Security
Overtime bonus
Commission
Passive income (interest income)
Veteran's Benefits
Asset verification
Address of one's Bank Branch
Bank account numbers
Checking and savings account statements for the previous 2–3 months
Savings bonds, stocks or investments and their approximate market values
Copies of titles to any motor vehicles that are paid in full
Debt information
Credit card bills for the past few billing periods
Other consumer debt; for example:
Car Loans
Furniture Loans
Student Loans
Other personal and cosigned installment loans with creditor addresses and phone numbers
Evidence of mortgage and/or rental payments
Copies of alimony or child support
Information regarding desired purchase
Copy of the Ratified Purchase Contract
Proof one is committed to the purchase
Cancelled deposit check
Category:Mortgage industry of the United States
Category:Loans
|
6937 a prime number?
False
Is 6917021 a composite number?
False
Is 1144231379 composite?
False
Is 786945739 a composite number?
False
Is 604067 a prime number?
False
Is 30139693 a composite number?
True
Is 346387 prime?
False
Is 198173 composite?
False
Is 6371237 a prime number?
True
Is 151636027 composite?
True
Is 87391211 a prime number?
False
Is 23828969 a composite number?
True
Is 124444063 a prime number?
False
Is 30787787 composite?
False
Is 5818381 composite?
False
Is 634010089 composite?
False
Is 955829 a prime number?
False
Is 11613037 a prime number?
False
Is 43309423 a composite number?
False
Is 179162111 a composite number?
True
Is 97441507 a composite number?
True
Is 21029443 prime?
True
Is 316065121 a composite number?
False
Is 46995815 a prime number?
False
Is 70441337 composite?
False
Is 275521 a prime number?
True
Is 54464677 composite?
False
Is 5790867 a composite number?
True
Is 66204029 prime?
True
Is 3419803 prime?
True
Is 847453 composite?
False
Is 54663937 composite?
True
Is 12534001 a composite number?
False
Is 66716707 a prime number?
True
Is 293411011 composite?
True
Is 70354351 a composite number?
False
Is 70641167 a prime number?
False
Is 8116418 prime?
False
Is 123811079 a prime number?
False
Is 38443367 prime?
True
Is 3510377 composite?
True
Is 16382437 a composite number?
False
Is 1311797 composite?
False
Is 74534471 prime?
False
Is 61881613 composite?
True
Is 5433887 a composite number?
False
Is 7998607 composite?
True
Is 5222753 a composite number?
False
Is 24397679 prime?
False
Is 8063855 composite?
True
Is 5024653 a prime number?
False
Is 419669 a prime number?
False
Is 220966861 prime?
True
Is 1331377 composite?
False
Is 10811573 a prime number?
False
Is 15541057 a composite number?
True
Is 97196063 composite?
True
Is 5632579 a composite number?
False
Is 777463 a prime number?
True
Is 14748161 a prime number?
False
Is 90984031 a prime number?
True
Is 12078373 composite?
False
Is 12924391 prime?
True
Is 13659787 prime?
False
Is 14356501 a prime number?
False
Is 24739501 a prime number?
False
Is 5750177 prime?
False
Is 3911935 a prime number?
False
Is 25794007 a prime number?
True
Is 19639115 a prime number?
False
Is 13170377 a prime number?
False
Is 25801491 composite?
True
Is 7899887 a prime number?
True
Is 1445921 prime?
True
Is 541873 a composite number?
True
Is 8461231 a composite number?
False
Is 8927189 a prime number?
False
Is 35932681 prime?
True
Is 4685981 a prime number?
False
Is 2296661 prime?
True
Is 701219 composite?
False
Is 9308657 a composite number?
True
Is 38188849 a composite number?
True
Is 30753689 a prime number?
True
Is 6654433 prime?
False
Is 326509 composite?
True
Is 3323249 composite?
False
Is 27010721 composite?
False
Is 141632765 prime?
False
Is 19852111 a prime number?
False
Is 9915799 composite?
True
Is 369828721 a prime number?
True
Is 39575753 a prime number?
False
Is 565769 prime?
True
Is 22966699 prime?
False
Is 3557339 a prime number?
True
Is 1505821 a prime number?
False
Is 4131437 a composite number?
True
Is 11272669 a prime number?
True
Is 84882209 a prime number?
True
Is 390151 prime?
True
Is 59184419 a composite number?
True
Is 8434589 composite?
True
Is 46253591 composite?
False
Is 73825357 a prime number?
False
Is 6442259 prime?
True
Is 411401839 a composite number?
True
Is 729451 a prime number?
True
Is 102851597 a prime number?
True
Is 58639999 composite?
True
Is 6509177 a composite number?
False
Is 7585819 composite?
True
Is 107393387 prime?
False
Is 22268419 a prime number?
False
Is 474962659 composite?
True
Is 345901 prime?
False
Is 592903 a composite number?
False
Is 2722001 prime?
True
Is 10273397 composite?
True
Is 5082089 composite?
False
Is 294303479 composite?
False
Is 37087951 composite?
False
Is 25536719 composite?
True
Is 61281607 a prime number?
False
Is 95564759 prime?
True
Is 90105689 a composite number?
False
Is 5357831 prime?
True
Is 29490107 composite?
True
Is 4933111 a composite number?
True
Is 57966799 composite?
True
Is 5288249 a composite number?
False
Is 3565613 composite?
False
Is 159990891 a prime number?
False
Is 4178191 prime?
True
Is 445649 a prime number?
True
Is 45861119 a composite number?
False
Is 218549 a composite number?
False
Is 2094259 prime?
False
Is 5792639 composite?
False
Is 28466941 a prime number?
False
Is 66717029 a prime number?
True
Is 32485529 composite?
True
Is 306638051 composite?
True
Is 1614815 prime?
False
Is 2346427 composite?
True
Is 137400187 a prime number?
True
Is 8334289 a composite number?
True
Is 63095267 a composite number?
False
Is 80641963 composite?
False
Is 20743 prime?
True
Is 27429769 prime?
True
Is 56445503 a prime number?
True
Is 368059207 a prime number?
False
Is 50021 composite?
False
Is 321002843 a composite number?
True
Is 131032609 prime?
True
Is 2669767 a composite number?
False
Is 34913449 a composite number?
False
Is 3877423 a composite number?
True
Is 167533813 a composite number?
False
Is 15507209 a prime number?
False
Is 19029487 a composite number?
True
Is 2172323 prime?
True
Is 165779 a composite number?
False
Is 14000999 a composite number?
True
Is 67043 a composite number?
False
Is 1880497 prime?
True
Is 11400377 a composite number?
False
Is 3458321 prime?
False
Is 104777867 a prime number?
False
Is 13610837 prime?
True
Is 2165549 a prime number?
False
Is 2084837 prime?
False
Is 8095817 prime?
False
Is 20858179 a composite number?
False
Is 19447958 a composite number?
True
Is 4592426 prime?
False
Is 1503119 a prime number?
False
Is 1968245 prime?
False
Is 1745533 a composite number?
True
Is 25117163 prime?
False
Is 13171177 a prime number?
False
Is 85324591 a prime number?
False
Is 153665717 composite?
True
Is 5775017 prime?
True
Is 69791727 a prime number?
False
Is 4526401 prime?
False
Is 3444841 a composite number?
True
Is 30594659 a prime number?
True
Is 111788363 a composite number?
False
Is 1710482 a prime number?
False
Is 38152281 a prime number?
False
Is 79166387 a composite number?
False
Is 145390363 a composite number?
False
Is 19001 composite?
False
Is 4175227 a prime number?
False
Is 7453309 a prime number?
True
Is 627229 prime?
False
Is 26642887 composite?
True
Is 52432999 a composite number?
False
Is 2479649 composite?
True
Is 2546949 a prime number?
False
Is 10617989 a composite number?
False
Is 7478909 prime?
False
Is 4831193 a composite number?
False
Is 17450371 a prime number?
False
Is 101173357 a prime number?
True
Is 196694031 composite?
True
Is 32957069 a prime number?
True
Is 57059 a prime number?
True
Is 212101013 composite?
False
Is 35158177 a prime number?
False
Is 8071963 prime?
False
Is 962324767 a composite number?
False
Is 325597 composite?
False
Is 9592651 prime?
True
Is 4856417 prime?
True
Is 3459137 a composite number?
True
Is 188139466 prime?
False
Is 5766701 prime?
True
Is 15140173 prime?
False
Is 231701 prime?
True
Is 3886637 a composite number?
False
Is 9048109 prime?
False
Is 193445377 a composite number?
True
Is 9743309 composite?
False
Is 357665005 a composite number?
True
Is 12686543 composite?
True
Is 76169083 prime?
True
Is 31089939 prime?
False
Is 13150897 composite?
True
Is 4049671 prime?
False
Is 6868759 prime?
True
Is 506899583 composite?
False
Is 331998193 prime?
False
Is 189198511 a composite number?
False
Is 52337539 a prime number?
True
Is 36069367 a prime number?
True
Is 333937 composite?
True
Is 1383153 prime?
False
Is 40146451 a composite number?
False
Is 16261073 a composite number?
False
Is 71179711 prime?
False
Is 1172179 prime?
True
Is 46187777 composite?
False
Is 13139723 prime?
True
Is 2965251 composite?
True
Is 32347 prime?
False
Is 119284933 a prime number?
True
Is 63893363 composite?
False
Is 1971379 a composite number?
True
Is 10556797 composite?
False
Is 7892873 a prime number?
True
Is 176861689 a prime number?
False
Is 27066113 a prime number?
False
Is 22721801 prime?
True
Is 3592319 composite?
False
Is 6358393 composite?
True
Is 10492049 composite?
False
Is 4865603 prime?
True
Is 220257523 a prime number?
False
Is 153946829 a prime number?
True
Is 5371423 a composite number?
False
Is 5750561 a composite number?
False
Is 11463013 composite?
False
Is 185702933 prime?
False
Is 3155637 composite?
True
Is 6336199 a prim
|
Stonebearing gallbladders: CT anatomy as the key to safe percutaneous lithotripsy. Work in progress.
Percutaneous cholecystolithotripsy can be performed with a transhepatic or transperitoneal approach. Because the anatomy of the gallbladder varies from person to person, the authors began a study to evaluate the position of the gallbladder with computed tomographic scans of 100 patients known to have stones in their gallbladders. Four variations in the relationship of the gallbladder to the liver and anterior abdominal wall were noted: completely intrahepatic gallbladders (39%) (type I), gallbladders bulging anterior to the anterior rim at least in part (35%) (type II), gallbladders completely anterior to the liver (17%) (type III), and gallbladders in a lateral position (9%) (type IV). In 51%, the colon was in direct contact with the gallbladder, and in 13% it was positioned between the abdominal wall and gallbladder. A safe percutaneous puncture was not possible in 34% of the patients (nine type IV gallbladders, 23 type I organs, and two type III gallbladders with anterior interposition of the colon).
|
Photographer Honors Fallen Tecumseh Officer With Portrait Shoots
Sunday, April 2nd 2017, 3:32 pm
By: Tess Maune
The death of Tecumseh Officer Justin Terney, who was killed in a shootout last week, has touched hearts nationwide. A photographer who knew Terney has found a way to honor him, while giving something special to other officers in the state.
It's picture day at the Wewoka Police Department and every officer, even Dante the K9, posed for their portrait dressed in full police uniform.
“My guys truly appreciate it,” Wewoka Police Chief Mike Windle said.
It's been decades since the Wewoka PD has had a professional photographer stop in. It’s just not in the budget.
“We don't have money for that,” Windle said. “Our priorities are more geared to getting our guys trained up and the equipment they need.”
And that's not a problem because this photo session isn't costing the department a dime.
“I knew that I had to step up in a small town and do what was right,” Country Creations Photography owner Tabitha Cozad said.
Cozad is offering free portraits to law enforcement, firefighters and emergency responders within a 50 miles of McAlester. She's already booked about a dozen agencies, some of which are outside the 50 miles because she just couldn’t say no.
3/31/2017 Related Story: Thousands Honor Fallen Tecumseh Police Officer
It's something she decided to do the day after Tecumseh Officer Justin Terney was killed in the line of duty.
“I went to school with him my whole, entire life,” Cozad said. “He made an impact on a small town.”
She says when he died the only pictures of Terney, dressed in his full police uniform, were selfies and snap shots from cell phones.
“His mom can't look back and have that portrait of him to hang on her wall,” Cozad said tearfully..
To make sure other officers and their families always have a professional picture to cherish, Tabitha plans to honor Terney by offering her photography talents to police for free, year around.
“We don't see people like this very often. It's amazing,” said Caroline Glass, whose husband is a Wewoka officer. “It's gonna be a great deal for sure for my family. I know his mom's looking forward to it. I'm just ready to blow it up and put it on the wall.”
And just like the portraits, these moments in time are priceless and without the pictures, Chief Windle says there would some lost history.
“We're very, very appreciative of Tabitha. It strikes to the heart,” Windle said.
Wewoka’s new police portraits will be hung on the from wall inside the police department.
Country Creations Facebook Page
There are other photographers in the Oklahoma area offering to take officer portraits for free. You can visit their Facebook pages here.
Aiden Taylor Photography
Whatever, etc. Photography
|
/***************************************************************************//**
* \file cy_capsense_gesture_lib.h
* \version 2.0
*
* \brief
* Provides the gesture interface.
*
********************************************************************************
* \copyright
* Copyright 2018-2019, Cypress Semiconductor Corporation. All rights reserved.
* You may use this file only in accordance with the license, terms, conditions,
* disclaimers, and limitations in the end user license agreement accompanying
* the software package with which this file was provided.
*******************************************************************************/
#ifndef CY_CAPSENSE_GESTURE_LIB_H
#define CY_CAPSENSE_GESTURE_LIB_H
#include <stdint.h>
#if defined(CY_IP_MXCSDV2)
#if defined(__cplusplus)
extern "C" {
#endif
/******************************************************************************/
/** \addtogroup group_capsense_gesture_structures *//** \{ */
/******************************************************************************/
/** Gesture configuration structure */
typedef struct
{
/* Common parameters */
uint16_t resolutionX; /**< Widget maximum position X-axis */
uint16_t resolutionY; /**< Widget maximum position Y-axis */
/* Enabled gesture */
uint16_t gestureEnableMask; /**< Enabled gesture mask */
/* Timeout */
uint16_t flickTimeoutMax; /**< Flick maximum timeout */
uint16_t edgeTimeoutMax; /**< Edge Swipe maximum timeout */
uint16_t clickTimeoutMax; /**< Click maximum timeout */
uint16_t clickTimeoutMin; /**< Click minimum timeout */
uint16_t secondClickIntervalMax; /**< Second Click maximum interval */
uint16_t secondClickIntervalMin; /**< Second Click minimum interval */
/* Distance */
uint16_t zoomDistanceMin; /**< Zoom minimum distance */
uint16_t flickDistanceMin; /**< Flick minimum distance */
uint16_t scrollDistanceMin; /**< Scroll minimum distance */
uint16_t rotateDistanceMin; /**< Rotate minimum distance */
uint16_t edgeDistanceMin; /**< Edge Swipe minimum distance */
uint8_t secondClickDistanceMax; /**< Second Click maximum distance */
uint8_t clickDistanceMax; /**< Click maximum distance */
/* Debounce */
uint8_t zoomDebounce; /**< Zoom debounce */
uint8_t scrollDebounce; /**< Scroll debounce */
uint8_t rotateDebounce; /**< Rotate debounce */
/* Edge Swipe Specific */
uint8_t edgeAngleMax; /**< Edge Swipe maximum angle */
uint8_t edgeEdgeSize; /**< Edge Swipe border size */
} cy_stc_capsense_gesture_config_t;
/** Gesture position structure */
typedef struct
{
uint16_t x; /**< X axis position */
uint16_t y; /**< Y axis position */
} cy_stc_capsense_gesture_position_t;
/** Gesture One Finger Single Click context structure */
typedef struct
{
uint32_t touchStartTime1; /**< Touchdown time */
cy_stc_capsense_gesture_position_t touchStartPosition1; /**< Touchdown position */
uint8_t state; /**< Gesture state */
} cy_stc_capsense_ofsc_context_t;
/** Gesture One Finger Double Click context structure */
typedef struct
{
uint32_t touchStartTime1; /**< Touchdown time */
cy_stc_capsense_gesture_position_t touchStartPosition1; /**< Touchdown position */
uint8_t state; /**< Gesture state */
} cy_stc_capsense_ofdc_context_t;
/** Gesture One Finger Click and Drag context structure */
typedef struct
{
uint32_t touchStartTime1; /**< Touchdown time */
cy_stc_capsense_gesture_position_t touchStartPosition1; /**< Touchdown position */
uint8_t state; /**< Gesture state */
} cy_stc_capsense_ofcd_context_t;
/** Gesture Two Finger Single Click context structure */
typedef struct
{
uint32_t touchStartTime1; /**< Touchdown time of the first touch */
uint32_t touchStartTime2; /**< Touchdown time of the second touch */
cy_stc_capsense_gesture_position_t touchStartPosition1; /**< Touchdown position of the first touch */
cy_stc_capsense_gesture_position_t touchStartPosition2; /**< Touchdown position of the second touch */
uint8_t state; /**< Gesture state */
} cy_stc_capsense_tfsc_context_t;
/** Gesture One Finger Scroll context structure */
typedef struct
{
cy_stc_capsense_gesture_position_t touchStartPosition1; /**< Touchdown position */
uint8_t state; /**< Gesture state */
uint8_t debounce; /**< Gesture debounce counter */
uint8_t direction; /**< Last reported direction */
} cy_stc_capsense_ofsl_context_t;
/** Gesture Two Finger Scroll context structure */
typedef struct
{
cy_stc_capsense_gesture_position_t touchStartPosition1; /**< Touchdown position of the first touch */
cy_stc_capsense_gesture_position_t touchStartPosition2; /**< Touchdown position of the second touch */
uint8_t state; /**< Gesture state */
uint8_t debounce; /**< Gesture debounce counter */
uint8_t direction; /**< Last reported direction */
} cy_stc_capsense_tfsl_context_t;
/** Gesture One Finger Flick context structure */
typedef struct
{
uint32_t touchStartTime1; /**< Touchdown time */
cy_stc_capsense_gesture_position_t touchStartPosition1; /**< Touchdown position */
uint8_t state; /**< Gesture state */
} cy_stc_capsense_offl_context_t;
/** Gesture One Finger Edge Swipe context structure */
typedef struct
{
uint32_t touchStartTime1; /**< Touchdown time */
cy_stc_capsense_gesture_position_t touchStartPosition1; /**< Touchdown position */
uint8_t state; /**< Gesture state */
uint8_t edge; /**< Detected edge */
} cy_stc_capsense_ofes_context_t;
/** Gesture Two Finger Zoom context structure */
typedef struct
{
cy_stc_capsense_gesture_position_t touchStartPosition1; /**< Touchdown position of the first touch */
cy_stc_capsense_gesture_position_t touchStartPosition2; /**< Touchdown position of the second touch */
uint16_t distanceX; /**< History of X-axis displacement */
uint16_t distanceY; /**< History of Y-axis displacement */
uint8_t state; /**< Gesture state */
uint8_t debounce; /**< Gesture debounce counter */
} cy_stc_capsense_tfzm_context_t;
/** Gesture One Finger Rotate context structure */
typedef struct
{
cy_stc_capsense_gesture_position_t touchStartPosition1; /**< Touchdown position */
uint8_t state; /**< Gesture state */
uint8_t history; /**< History of detected movements */
uint8_t debounce; /**< Gesture debounce counter */
} cy_stc_capsense_ofrt_context_t;
/** Gesture global context structure */
typedef struct
{
cy_stc_capsense_gesture_position_t position1; /**< Current position of the first touch */
cy_stc_capsense_gesture_position_t positionLast1; /**< Previous position of the first touch */
cy_stc_capsense_gesture_position_t position2; /**< Current position of the second touch */
cy_stc_capsense_gesture_position_t positionLast2; /**< Previous position of the second touch */
uint32_t timestamp; /**< Current timestamp */
uint16_t detected; /**< Detected gesture mask */
uint16_t direction; /**< Mask of direction of detected gesture */
cy_stc_capsense_ofrt_context_t ofrtContext; /**< One-finger rotate gesture context */
cy_stc_capsense_ofsl_context_t ofslContext; /**< One-finger scroll gesture context */
cy_stc_capsense_tfzm_context_t tfzmContext; /**< Two-finger zoom gesture context */
cy_stc_capsense_tfsc_context_t tfscContext; /**< Two-finger single click gesture context */
cy_stc_capsense_ofes_context_t ofesContext; /**< One-finger edge swipe gesture context */
cy_stc_capsense_offl_context_t offlContext; /**< One-finger flick gesture context */
cy_stc_capsense_ofsc_context_t ofscContext; /**< One-finger single click gesture context */
cy_stc_capsense_ofdc_context_t ofdcContext; /**< One-finger double click gesture context */
cy_stc_capsense_ofcd_context_t ofcdContext; /**< One-finger click and drag gesture context */
cy_stc_capsense_tfsl_context_t tfslContext; /**< Two-finger scroll gesture context */
uint8_t numPosition; /**< Current number of touches */
uint8_t numPositionLast; /**< Previous number of touches */
} cy_stc_capsense_gesture_context_t;
/** \} */
/*******************************************************************************
* Function Prototypes
*******************************************************************************/
/******************************************************************************/
/** \cond SECTION_CAPSENSE_INTERNAL */
/** \addtogroup group_capsense_internal *//** \{ */
/******************************************************************************/
/*******************************************************************************
* Function Name: Cy_CapSense_Gesture_ResetState
****************************************************************************//**
*
* Initializes internal variables and states.
*
* \param context
* The pointer to the gesture context structure
* \ref cy_stc_capsense_gesture_context_t.
*
*******************************************************************************/
void Cy_CapSense_Gesture_ResetState(
cy_stc_capsense_gesture_context_t * context);
/*******************************************************************************
* Function Name: Cy_CapSense_Gesture_Decode
****************************************************************************//**
*
* Decodes all enabled gestures. This function is called each scanning cycle.
*
* \param timestamp
* Current timestamp.
*
* \param touchNumber
* The number of touches. Also this parameter defines the size of position array.
*
* \param position
* The pointer to the array of positions \ref cy_stc_capsense_gesture_position_t.
*
* \param config
* The pointer to the gesture configuration structure
* \ref cy_stc_capsense_gesture_config_t.
*
* \param context
* The pointer to the gesture context structure
* \ref cy_stc_capsense_gesture_context_t.
*
*******************************************************************************/
void Cy_CapSense_Gesture_Decode(
uint32_t timestamp,
uint32_t touchNumber,
const cy_stc_capsense_gesture_position_t * position,
const cy_stc_capsense_gesture_config_t * config,
cy_stc_capsense_gesture_context_t * context);
/** \} \endcond */
/*******************************************************************************
* Macros
*******************************************************************************/
/******************************************************************************/
/** \addtogroup group_capsense_macros_gesture *//** \{ */
/******************************************************************************/
/* Enable and Detection */
/** No gesture detected */
#define CY_CAPSENSE_GESTURE_NO_GESTURE (0x00u)
/** All gestures enable / detection mask */
#define CY_CAPSENSE_GESTURE_ALL_GESTURES_MASK (0x03FFu)
/** Gesture enable filtering mask */
#define CY_CAPSENSE_GESTURE_FILTERING_MASK (0x8000u)
/** Detection mask of Touchdown */
#define CY_CAPSENSE_GESTURE_TOUCHDOWN_MASK (0x2000u)
/** Detection mask of Lift Off */
#define CY_CAPSENSE_GESTURE_LIFTOFF_MASK (0x4000u)
/** Enable / detection mask of one-finger single click gesture */
#define CY_CAPSENSE_GESTURE_ONE_FNGR_SINGLE_CLICK_MASK (0x0001u)
/** Enable / detection mask of one-finger double click gesture */
#define CY_CAPSENSE_GESTURE_ONE_FNGR_DOUBLE_CLICK_MASK (0x0002u)
/** Enable / detection mask of one-finger click and drag gesture */
#define CY_CAPSENSE_GESTURE_ONE_FNGR_CLICK_DRAG_MASK (0x0004u)
/** Enable / detection mask of two-finger single click gesture */
#define CY_CAPSENSE_GESTURE_TWO_FNGR_SINGLE_CLICK_MASK (0x0008u)
/** Enable / detection mask of one-finger scroll gesture */
#define CY_CAPSENSE_GESTURE_ONE_FNGR_SCROLL_MASK (0x0010u)
/** Enable / detection mask of two-finger scroll gesture */
#define CY_CAPSENSE_GESTURE_TWO_FNGR_SCROLL_MASK (0x0020u)
/** Enable / detection mask of one-finger edge swipe gesture */
#define CY_CAPSENSE_GESTURE_ONE_FNGR_EDGE_SWIPE_MASK (0x0040u)
/** Enable / detection mask of one-finger flick gesture */
#define CY_CAPSENSE_GESTURE_ONE_FNGR_FLICK_MASK (0x0080u)
/** Enable / detection mask of one-finger rotate gesture */
#define CY_CAPSENSE_GESTURE_ONE_FNGR_ROTATE_MASK (0x0100u)
/** Enable / detection mask of two-finger zoom gesture */
#define CY_CAPSENSE_GESTURE_TWO_FNGR_ZOOM_MASK (0x0200u)
/* Direction Offsets */
/** Offset of direction of one-finger scroll gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_OFFSET_ONE_SCROLL (0x00u)
/** Offset of direction of two-finger scroll gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_OFFSET_TWO_SCROLL (0x02u)
/** Offset of direction of one-finger edge swipe gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_OFFSET_ONE_EDGE (0x04u)
/** Offset of direction of one-finger rotate gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_OFFSET_ONE_ROTATE (0x06u)
/** Offset of direction of two-finger zoom gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_OFFSET_TWO_ZOOM (0x07u)
/** Offset of direction of one-finger flick gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_OFFSET_ONE_FLICK (0x08u)
/* Direction Masks */
/** Mask of direction of one-finger scroll gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_MASK_ONE_SCROLL (0x0003u)
/** Mask of direction of two-finger scroll gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_MASK_TWO_SCROLL (0x000Cu)
/** Mask of direction of one-finger edge swipe gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_MASK_ONE_EDGE (0x0030u)
/** Mask of direction of one-finger rotate gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_MASK_ONE_ROTATE (0x0040u)
/** Mask of direction of two-finger zoom gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_MASK_TWO_ZOOM (0x0080u)
/** Mask of direction of one-finger flick gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_MASK_ONE_FLICK (0x0700u)
/** An extra direction offset returned by Cy_CapSense_DecodeWidgetGestures() */
#define CY_CAPSENSE_GESTURE_DIRECTION_OFFSET (16u)
/* Direction */
/** CLOCKWISE direction of Rotate gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_CW (0x00u)
/** COUNTER CLOCKWISE direction of Rotate gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_CCW (0x01u)
/** ZOOM-IN direction of Zoom gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_IN (0x00u)
/** ZOOM-OUT direction of Zoom gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_OUT (0x01u)
/** UP direction of Scroll, Flick and Edge Swipe gestures */
#define CY_CAPSENSE_GESTURE_DIRECTION_UP (0x00u)
/** DOWN direction of Scroll, Flick and Edge Swipe gestures */
#define CY_CAPSENSE_GESTURE_DIRECTION_DOWN (0x01u)
/** RIGHT direction of Scroll, Flick and Edge Swipe gestures */
#define CY_CAPSENSE_GESTURE_DIRECTION_RIGHT (0x02u)
/** LEFT direction of Scroll, Flick and Edge Swipe gestures */
#define CY_CAPSENSE_GESTURE_DIRECTION_LEFT (0x03u)
/** UP-RIGHT direction of Flick gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_UP_RIGHT (0x04u)
/** DOWN-LEFT direction of Flick gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_DOWN_LEFT (0x05u)
/** DOWN-RIGHT direction of Flick gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_DOWN_RIGHT (0x06u)
/** UP-LEFT direction of Flick gesture */
#define CY_CAPSENSE_GESTURE_DIRECTION_UP_LEFT (0x07u)
/** \} */
#if defined(__cplusplus)
}
#endif
#endif /* CY_IP_MXCSDV2 */
#endif /* CY_CAPSENSE_GESTURE_LIB_H */
/* [] END OF FILE */
|
HIPPOLYTA FREEMAN: What's that
book you been reading about?
♪ (INTENSE MUSIC PLAYS) ♪
ATTICUS FREEMAN:
It's about heroes
who get to go on adventures,
defeat the monsters,
and save the day.
Lil' boy from the South Side
of Chicago,
and it's only tourists
who get to do that.
♪ I'm gone
From my little obsession ♪
This story is about my father,
and the secret birthright
that's been kept from us.
You going after it.
We're gonna need a car.
♪ Wave hello to my shadow ♪
You just gon' stand there, Tic?
GEORGE FREEMAN:
This is family business.
And family stay together.
♪ Bad for my health
Scared for myself ♪
MAN: Just because
they don't want you here,
doesn't mean
you're not supposed to be.
♪ I gotta get away ♪
This is an invitation
to unmitigated power.
♪ Hope I'm all right
Hope I'm okay ♪
Where the hell did I go wrong
with you, boy?
I told you to stay away from
that damn place.
LETITIA "LETI" LEWIS:
There's something here.
It's trying to get out.
SAMUEL BRAITHWHITE: Everything
is where and as it should be.
From God to man...
to creature.
(GROWLING)
(SCREAMS)
ATTICUS:
We're surrounded by monsters.
I'm doing this to protect us!
You can't win this game
they settin' up for you to play.
♪ Wave hello to my shadow ♪
This legacy belongs
to our family.
LETI:
We gotta face this new world.
♪ (MUSIC INTENSIFIES) ♪
And stake our claim in it.
(SHRIEKING)
♪ (MUSIC CONTINUES) ♪
(ROARING)
This is our family story.
♪ Say hello to my shadow ♪
♪ (MUSIC CONCLUDES) ♪
|
"I'm sorry your fellow prisoners and your saviors fled." "I was looking forward to 18 against one." "Your lust for needless battle eludes me." "Let us end this." "Mongul is neutralized." "Forget Mongul." "Only the Key matters." "The Crystal Key..." "Is gone." "Our priority must now shift to guarding the Key Chamber, so that whomever stole the Key cannot use it to reactivate the Warworld." "Agreed." "But the Justice League already holds the Chamber for that exact purpose." "And unfortunately, our Ambassador has no appetite for direct confrontation." "Our only choice is to patrol the Chamber's perimeter like mere security guards." " It is galling." " But, as with all Reach warriors..." "We live to serve." "Look!" "I know this missing Key is important, but we need to focus on..." "Blue Beetle, the so-called Reach hero has dominated this news cycle with U.N. Secretary General Tseng announcing his plan to present Beetle with the International Medal of Valor for saving the Earth from the Warworld." "That's a load of good press for a traitor." "Hey!" "Don't blame Blue." "He's just much a captive of the Reach as we were." "We have to set him free." "You know, before he conquers the Earth and enslaves all mankind." "Season 2:" "Invasion Episode 18: "Intervention"" "The Toyman's toys don't come cheap." "In fact..." "They break the bank!" "No, no!" "Hero, what..." "He nearly got us killed!" "And the Reach stinks!" "No fair!" "I get the hero who took down the Warworld single-handed?" "!" "This is Metropolis." "Where's Superman?" "Here you go, officers." "Time to put the toy man back on the shelf." "No fair, no fair, no fair!" "Yeah, OK, yeah, that was pretty cool." "And the Reach is, though." "Blue Beetle, Blue Beetle, a moment?" "For the famed Cat Grant?" "I'm at your service." "Heck, I'm at everyone's service." "That's just how I roll." "So, you've begun handling situations that, once upon a time, were a job for Superman." "Hey, if the Justice League's too busy, I'm happy to pick up the slack." "Why am I still waving?" "I look like an idiot!" "Scarab, get us out of here!" "The Reach desires the crowd's adulation, and we serve the Reach." "Quite correct, scarab." "Fighting human crime is without benefit." "Making sure the crowd appreciates it?" "Priceless." "Given the recent negative publicity over our hidden invasion fleet, it is fortunate your puppet is appreciated at all." "Please." "The meat loves their heroes." "You worry too much, scientist." "I am so honored by your kind attentions..." "And so honored to be your hero." "That's not the way I talk!" "And stop waving!" "Look like the Queen of England." "Great, now I'm Peter Pan." "Uh, as your profile expands, do you worry about increased scrutiny?" "Nah." "I welcome it." "Let 'em watch." "Hi, La'gaan." "I'm glad your leg's all healed." " Angel fish!" "You're here." " I..." "Came to pick you up," " Bring you back to the surface world." " That's so sweet." "I was just going to zeta back tomorrow." "I thought we could use the trip as an opportunity to... talk." "To talk?" "That's..." "Great." "We will soon arrive at your home, Jaime Reyes." "Ugh, could we not?" "Nothing's worse than watching you and the Ambassador pretend to be me to my family." "Any alternative tactic would only endanger them." "Congratulations, scarab." "You took the words right out of my mouth." "Breech of defensive perimeter." "Batgirl?" "!" "What are you doing?" "You know this won't hold us." " It'll hold for a couple seconds." " Batgirl, please!" "They're going to make me hurt you!" "The Batgirl cannot hear your true voice, Jaime Reyes." " And a couple seconds..." " Is more than I need." "Sweet dreams, Blue." "Scarab, what are you waiting for?" "!" "I am establishing the Impulse's pattern of movement, anticipating where he will be." "Target point." "OK, you're down." "You won." "Let's go." "I think not." "As this street is currently deserted, we must seize the opportunity." "Scarab." "Kill them both." "Scarab!" "You don't have to do this!" "But he does." "And so do you." "In fact, it will be a good lesson for you to helplessly observe your own body murder your former friends." "The first kills are always the hardest, my boy." "Might as well get them over with." "Scarab, please!" "We've fought side by side with these guys." "Do something!" "I must do as designed parameters dictate." "Scarab!" "Your attack is ineffective." " Analyze this containment field." " Analysis already complete." "Field displays energy signature consistent with the alien cooperative." "Cooperative technology draws power from kinetic energy." "The scarab's physical attack is strengthening the force bubble." "It should know this!" "Scarab!" "Do you have the means to effectively circumvent this tech?" " I do." "A side attack would..." " Don't explain!" "Do it." "[backwards spell]" "I've reinforced Rocket's force bubble with my magics." "Blue's not going anywhere." "[speaking backwards]" "Ha!" "Don't you get it, extraterrestre?" "Impulse and Batgirl were decoys." "A distraction from Rocket and Zatanna's real attack!" "I guess some first kills are harder than others." "Scarab!" "Proceed with countermeasures." "There are no known countermeasures against this specific combination of magic and cooperative technology." "This goes well." "This isn't going well." "I'm sorry." "You're sorry?" "I'm the one getting dumped." "La'gaan, try to understand." "All those weeks in captivity gave me time to think;" "To... to gain clarity." "I know now, I haven't been fair to you." "Shouldn't I get to decide that?" "You don't see it yet." "But the hard truth is, we only got together because you made me feel better about myself." "And that's not a relationship." "It's selfishness." "That's just how it started, Angel fish." "What matters is what it might become." "Except we'll never be anymore to each other than what we are right now." "Neptune's beard!" " This is about Connor, isn't it?" " No." "It isn't about him." "Or you." "This is about me." "I can't give you what you want..." "To be something other than my rebound guy." "And you deserve more than that." "You're right, M'gann." "I do." "Enjoy your advantage while you can." "The Reach track my every move." "And when we're through with you, there won't be enough left for a DNA identification." "Nice death threat!" "Could it get any more technical and dull?" "Why are they not en route to one of their headquarters?" "We need to find out where they're taking him!" "Tell me our destination." "And I'll make your deaths painless." "Oh, yeah, that scared 'em." "What do they hope to find here?" "Insufficient data." "We've got company!" "And I'm otherwise occupied maintaining this bubble around Blue." "Chillax, Rock'." "We're prepped for Queen Bee's tin soldiers." "[speaking backwards]" " Hey!" "I was going to do that." " You can still knock 'em out." "Oh, yeah!" "Crash!" "Hey, hey, hey, let go!" "Let go!" "Rocket!" "The force bubble!" "Holding!" "But I'm a sitting duck here!" "You were fools to bring us here." "Queen Bee is our ally, and her minions will destroy you." "If only these bubbles were soundproof." "We don't have time for this." "[speaking backwards]" "Girlfriend, someday you have to tell me how you figure out those backwards words so fast." "Maybe backwards is my native tongue." " Seriously?" " Come on, let's get to work." "Here." "You, uh, sure you've got the power for this?" "Me?" "No." "But I'll summon it from those who do." "[speaking backwards]" "Man!" "I wish I could ask what's going on." "They doubtless plan to destroy Blue Beetle." "Ending you and this scarab in the process." "Hermano, if that's your only takeaway from our time together, you haven't learned a thing!" "I do not like the implications of that scarab imagery." "We still know nothing of what put this scarab off-mode for 4,000 years." "You worry too much." "They all die now!" "Guys, this is all on you!" "I still got my own Beetle to hold." "And Z's smacked in the middle of her mystic trance." "Oh, great." "Not like our tushes haven't been kicked by one Beetle already." "But this Beetle comes with his own personal kryptonite." "Go!" "Gone!" "Ha!" "Crash." "Those Martians really can't take the heat." "No, but stay alert." "He has other skills to compensate." "You can thank us later." "Green Beetle is outnumbered." "You must summon Black Beetle immediately." "Black Beetle cannot leave his post guarding the Warworld's Key Chamber." "Nor do I require his help." "Uh, Z, we're on the clock, here." "[speaking backwards]" "Wicked!" "[speaking backwards]" "Fools!" "You will all die!" "[speaking backwards]" "No!" "Beetles Blue and Green are off-mode." "We've lost both!" "Why didn't you listen?" "I warned you!" "Say one..." "More..." "Word." " Ahh." " Zatanna, you OK?" "Did it work?" "Or are we back to square one?" " Who controls the Beetles?" " Well, let's find out." "[speaking backwards]" "It worked." "Jaime and B'arzz O'oomm are back in control of their own bodies." "It's true." "I can feel it!" "I'm free of the Reach." "For real this time." "You're 100% sure?" "Because we've been through this before." "I am certain of it." "Reading no external signals since Zatanna worked her mojo." "Neither Beetle is in contact with the Reach." "Hey, hey, hey, hermano!" "Congrats!" "Thank you." " Congratulations, Jaime Reyes." " Oh, right." "Like you're happy about this." "I am!" "I swear!" "If this mistrust is your only takeaway from our time together, you haven't learned a thing." "This scarab far prefers our partnership to being slaves to the Reach." " You know, I believe you." " Of course you do." "Up high." "It has been so long..." "I had all but forgotten the sensation of controlling my own body." "My gratitude knows no bounds." "Uh, that's great, but Queen Bee's goons are waking up!" "Which means it's time to go." "So spill." "How did you know how to cure us?" "That temple wasn't even in the Reach's database." "Bumblebee and I first came across it months ago, on another mission." "I couldn't help noticing the Blue Scarab imagery, and recorded a holographic file of the symbols in hieroglyphics." "Dr. Fate was able to translate the glyphs, which revealed a mystic ceremony the ancients had used to cleanse the scarab of Reach control." "That's why my scarab was off-mode when I found it." "I had been cleansed upon landing on Earth 4,000 years ago." "Because the ritual used magic of human origin," "Fate, a lord of order, could not perform it." "So he prepped me instead." "Meanwhile, Batgirl and I got with the hacking." "Starting with the computer files of the previous Blue Beetle, the late Ted Kord." "Ted's files revealed that an archaeologist named Dan Garrett first discovered both the temple and the scarab in 1939." "It fused with him the way it fused with you, but Dan assumed it was some kind of mystic artifact, and he used it to become the first Blue Beetle of modern times." "When Dan passed away, he left the scarab to his protege, Ted Kord." "But Kord quickly realized the scarab was alien technology." "Since he wasn't about to let an alien device fuse to his spine, he locked the scarab away." "But Garrett still inspired Ted to become the second Blue Beetle, even with no superpowers." "Ah, I hear those are optional." "Anyway, Ted suspected the Light wanted the scarab back in play." "He tried to stop them from stealing it, and paid the ultimate price." "That's where you came in." "Guess I wasn't exactly what the Light or Reach had in mind." "But why keep all this from me?" "Because it took months for me to learn the ritual." "And not to mention, configure the ancient Bialyian incantations to work in concert with my magic." "And you couldn't risk letting the Reach know the temple existed until you were ready." "You managed to keep your mouth shut?" "You?" "Hey, making sure you stayed a hero was the main reason I came back to the past." "So I was motivated to take my mouth off-mode." "Don't you get used to it, now." "Great news, Team." "Nightwing, out." "What's great news?" "The Team freed Blue Beetle and Green Beetle from Reach control." "Terrific." "You need me, I'm watching TV." "Um, is Connor around?" "He said something about going out with Wendy Harris." "Oh." "Right..." "I realize my order to throw the fight against the children was disappointing, and you have my sympathies." "But it was a necessary evil." "Now the Light's plans for the Reach, the League and the Team may proceed on schedule."
|
1. Field of the Invention
The present invention generally relates to a display device or a panel, and in particular, to a flat panel display (FPD) or a flat panel with touch-sensing function (touch panel).
2. Description of Related Art
To meet the requirements of a modem product on high speed, high efficiency and compact design, all kinds of electronic components attempt to be developed towards miniaturization. Various portable electronic devices, such as notebooks, mobile phones, electronic dictionaries, personal digital assistants (PDAs), web pads, and tablet PCs have become the mainstream. In an image displays of portable electronic devices, flat panel displays have been widely used due to advantages of high space utilization, high display quality, low power consumption and no radiation, specifically, liquid crystal displays (LCDs) are preferred and widely used.
In general, an LCD comprises an LCD panel and a plurality of driver IC (integrated circuit) chips and other electrical components. The driver IC chips or electrical component are disposed on a glass substrate or a circuit board in many ways. The circuit board with the driver IC chips or the electrical components are disposed at the bottom of the LCD panel and electrically connected to the LCD panel through a flexible printed circuit (FPC). In addition, the driver IC chips or electrical components can be also disposed on a control circuit board in a portable electronic device, wherein the driver IC chips or the electrical components are also electrically connected to the LCD panel through an FPC. The driver IC chips usually mean IC chips used to drive thin film transistors of the LCD panel. In contrast, the electrical components are IC chips, some of which are used to drive a touch panel.
Along with the progress of display technology, an LCD panel in some applications is required to be synchronized with the operations to turn on and turn off a light source for providing a better display effect. To meet the demand of a user, other elements in an LCD are also required to be synchronized for operations with the displaying of the LCD panel, and therefore, the signals of the other elements in the LCD are conducted or processed by another FPC. The above-mentioned other elements includes, for example, a circuit to turn on and turn off the light source in the backlight module or a processing circuit in a touch panel to judge a touching position. Consequently, how to integrate a plurality of FPCs in a flat panel display to meet the requirements of consumers is an important project.
FIG. 1 is a diagram of a conventional LCD. Referring to FIG. 1, an LCD 100 includes an LCD panel 110, a first flexible printed circuit 120 and a second flexible printed circuit 130. The second flexible printed circuit 130 is usually used for controlling the display signals of the LCD panel 110, and the first flexible printed circuit 120 is usually used for controlling the operation signals of other elements, for example, control signal of a backlight module or touching-sensing signal of a touch panel. As shown in FIG. 1, the second flexible printed circuit 130 has a plurality of pads 122 arranged side by side, and the first flexible printed circuit 120 also has a plurality of pins 132 arranged side by side. Each of the pins 132 on the first flexible printed circuit 120 is respectively connected to a corresponding pad 122 on the second flexible printed circuit 130 so as to form a plurality of electrical connections 140 arranged side by side, as shown in FIG. 1.
In order to meet the requirements of consumers on the high resolution, the high response speed, the high contrast ratio of LCDs, and the function of the touch panel, the number of the electrical connections 140 between the second flexible printed circuit 130 and the first flexible printed circuit 120 is increased, so that the bonding area between the pins 132 and the pads 122 is not enough. In other words, if the bonding area keeps unchanged, the gap between every two adjacent electrical connections 140 must be decreased to meet the requirements of the high resolution, the high response speed, the high contrast, and the function of the touch panel, which likely makes two adjacent electrical connections 140 to be mutually bridged and short-circuited during soldering the pins 132 and the pads 122. As a result, the production yield of the LCD 100 is reduced.
|
Regulation of prostaglandin synthesis in the human amnion.
An increase in prostaglandin synthesis by intrauterine tissues may be responsible for labour initiation and/or maintenance in humans. In all studies to date, the amnion is the intrauterine tissue whose prostaglandin output consistently increases with the onset of labour. This may be due, in part, to acute activation of the phospholipases A2 and C and to an increase in the specific activity of prostaglandin H synthase (PGHS). A number of factors exist in amniotic fluid, the fetal membranes, the decidua and the placenta that can increase PGHS specific activity. Some of these factors may increase PGHS enzyme activity by gene expression and protein synthesis. Preliminary evidence is presented that suggests the hypothesis that PGHS specific activity increases before the onset of labour rather than as a consequence of labour initiation, and that idiopathic preterm labour may frequently be associated with increased PGHS activity. Hence, activation of PGHS gene expression and/or protein synthesis may be causal for term and preterm labour.
|
Kichcha Sudeepa is all set to rule Pan-Indian screens with ‘Pailwaan’
There are artistes who aren’t willing to settle down accomplishing the regular paradigm of success. They prove themselves distinctly by achieving their star status breaking the linguistic barriers and regional boundaries getting their fame etched across the far-flung zones too. Then, there are artistes, who merely don’t strive for such statures alone, but elevate the industry by turning the spotlights upon them. Kichcha Sudeepa has been the most loved actor of such privileges across the years. From stealing the show as Southern delight being “KICHCHA” and sooner becoming the Bollywood’s most looked upon actor for his consistent associations with maverick filmmaker Ram Gopal Varma. More than all, he conquered the mass crowds with his versatile spell as antagonist in ‘Naan Ee’. Apparently, the actor is all set to send forth his stupendous waves of sensation through ‘PAILWAAN’, a Pan-Indian film to release in 5 different languages – Tamil, Hindi, Telugu, Malayalam and Kannada.
Produced in grandeur by Mrs Swapna Krishna for RRR Motion Pictures and helmed by filmmaker Mr. Krishna, the film is a sports-action-drama packaged with commercial ingredients amalgamating the essence of emotions and amusements together. Kichcha Sudeepa will be seen playing the role of a wrestler, who embarks on a journey of conquering his dreams and the hassling challenges he encounters during the process. While Ms. Akanksha will be seen playing the female lead, the country’s most proficient and celebrated Mr. Sunil Shetty would be appearing in a key role.
Filmmaker Krishna says, “The journey from crafting “Pailwaan” to translating it into celluloid version has been a great learning experience. More than titling it as a film with grandeur, I would say, it was so much bliss to work with the celebrated technicians from Hollywood, Bollywood, Tamil and Telugu film industry. Apart from having the ace actors in lead roles, working with Mr. Sushant Singh, Kabeer Dhuhan Singh, Sharath Lohitashwa, Avinash and others was really enjoyable.”
While the film’s teaser released in January 2019 had stunned everyone for the shirtless avatar of Kichcha Sudeepa, S Krishna says, “Yes, while designing the project, I personally felt that Sudeepa fans should have a surprisal delight and it all happened with this shirtless avatar. Of course, he is a fitness geek and his dedication was completely supportive in exceeding our expectations with his mind-boggling physique.”
The boxing poster of Kichcha Sudeepa in 5 languages will be released by the reigning icons of the respective industries – Mr. Sunil Shetty in Hindi, Megastar Mr Chiranjeevi in Telugu, Mr. Vijay Sethupathi in Tamil and Mr. Mohanlal in Malayalam.
The film has musical score by Arjun Janya and cinematography handled by Karunakar A. Ganesh Acharya, Raju Sundaram & A Harsha have choreographed the songs. While the Indian industry’s most celebrated Ram-Laxman have choreographed the stunts along with Dr. K Ravi Verma, Larnell Stovall has directed the ‘Boxing’ blocks and A. Vijay for Kusthi. Krishna, Madhoo & Kannan (Screenplay), Nithin Lukose (Audiography), Yogi-Chetan-Ganesh (Costumes) are the others in the technical team.
|
1. Technical Field
The present invention relates to survey markers.
2. Description of the Prior Art
Conventional survey indicators consist of plates, spikes, posts, or rods driven in, placed, or attached to natural geographic structures such as rocks or trees. Most permanent markers are formed of concrete posts or the like utilizing a plate or disk having the requisite markings and indicators affixed to or molded therein.
The surveyor usually surveys the tract of property to obtain the boundaries and uses temporary markers, such as pins or pegs having indicia or markings thereon. At a later time the surveyor or some other person must return to the numerous survey reference point cites and affix a more permanent marker at the site.
Permanent markers now used in the industry such as concrete post are heavy and difficult to carry and require a vehicle to transport them to the marker sites. Sometimes the vehicles cannot be driven close to the marker site and the difficult and time consuming task falls upon the surveying team to move the marker to the site. Moreover, these concrete markers are dangerous to walk around or over, or to mow over once vegetation such as grass crops or weeds hide them over time.
None of the above known types of survey markers, taken either singly or in combination, is seen to describe the instant invention as claimed in the instant application.
|
Q:
Efficiency of Select query
Consider two queries,
Select * from table where size = 'L';
Select * from table where id IN (691,12,123,5123,....); # id is primary key for the table. and covers all the cases for which size ='L'.
Now consider a table which has 2 million records and i'll be firing both the queries.
Which of the two queries will run faster and why?
Consider this situation in terms of a system which filters out data on select of the option.
A:
In Short: Ths answer depends on how many rows have size='L'. If there are many rows the the second will be more efficient because an index on size ist slow (cardinality).
|
Updated: Monday March 26, 2018, 9:25 p.m.
UPDATE: ROCKFORD, Ill. (WIFR) -- After months of discussion and nearly 100 recommendations made by the city's financial task force, Rockford City Council has passed a balanced 2018 budget, but some aldermen were reluctant to pass it.
The city council has waited to pass a budget until after the vote on home rule. Since the referendum was voted down the council had to look at plan B that includes a utility tax.
"It should have a line item on everyone's bill that says the realtors association, non-home rule tax,” said 9th Ward Alderman Bill Rose.
The utility tax will add around $6-8 a month to family’s gas and electric bills. The city hopes to generate around $4 million from this tax. Several aldermen did not want to vote to pass the tax saying it's regressive and a result from the failed home rule vote however, the council voted to pass the budget with the tax to keep their word on what would happen if home rule was voted down.
"I don't want to support a utility tax on gas and electric, my constituents, not all of them but a significant amount, you add five to ten dollars yeah it's going to make a difference to them,” said 13th Ward Alderwoman Linda McNeely.
"We told the voters what we were going to do and for us to start getting shifty and 'yeah I don't really want to do a utility tax' when all along we said it was A or B. So I think we're compelled to vote for B, because the last thing we want to do is come off as being a double-minded, wishy-washy council,” said 1st Ward Alderman Tim Durkee.
City staff will now review the budget and all the financial task force recommendations. City leaders say we could see the utility tax on our bills within the next couple of months.
------
ROCKFORD, Ill. (WIFR) -- The Rockford City Council passed a 2018 budget plan at Monday night's meeting.
The budget includes:
- A $400,000 reduction in the property tax levy
- A $1 million refund of general fund overpayments into the unemployment fund
- A $1.7 million refund of general fund overpayments into the workers compensation fund
- Adding $280,000 in net costs after a federal grant to add five new officers to the Rockford Police Department was added, bringing the department to more than 300 sworn officers for the first time in 10 years
- An additional $100,000 for neighborhood blight reduction and abandoned home demolitions
- Nearly $450,000 in police department scheduling cost reductions
- Savings and revenue enhancement projects of more than $3.5 million based recommendations from the Finance Task Force that would be implemented in 2018
- A utility tax on gas and electric services that will generate approximately $4 million in 2018
|
It’s official: 2014 has taken the title of hottest year on record. That ranking comes courtesy of data released Monday by the Japan Meteorological Agency (JMA), the first of four major global temperature recordkeepers to release their data for last year.
The upward march of the world’s average temperature since 1891 is a trademark of human-influenced global warming with 2014 being the latest stop on the climb. All 10 of the hottest years have come since 1998.
The average temperature was 1.1°F above the 20th century average according to JMA’s data. That edges 1998, the previous warmest year, by about 0.1°F.
One big difference between 2014 and 1998 is that the latter was on the tail end of a super El Niño, which has the tendency to spike temperatures. In comparison, 2014 was the year of the almost El Niño.
Instead, record warmth in other parts of the Pacific as well as the hottest year on record in Europe were some of the main drivers in fueling the heat. Joe Romm of Climate Progress also notes that heat in Australia early in the year and California’s hottest year further contributed to the heat.
Seasonal temperatures also paint a picture of a planet that didn’t get a break. Spring, summer and fall were all record-setting hot. Last winter was the only season not to set a record, and even that was still the sixth-warmest winter.
JMA is one of the four major groups that use both ground measurements and satellites to compute the planet’s average temperature. The other three include NASA and the National Oceanic and Atmospheric Administration in the U.S. and the Hadley Center in the U.K. There are subtle differences in how they analyze temperature data, but there’s generally broad agreement, particularly the upward trend in temperatures over the past century.
The other groups are expected to release their data in the coming weeks and confirm that 2014 was indeed the hottest year on record. And some scientists think it could get even hotter sooner. Strong trade winds in the Pacific have likely had a dampening effect on the global average temperature by essentially allowing the ocean to store more heat, but those winds are expected to weaken in the near future as part of a natural fluctuation.
This article is reproduced with permission from Climate Central. The article was first published on January 5, 2015.
|
High Energy People: Solena Group Management and Advisory Team
The creation of any renewable energy facility is a combination of vision and science. Of financial expertise and hard-hatted construction muscle. Of sophisticated project management and marketing finesse. Of the pragmatic needs of industrial society and the ideals of enlightened environmentalism.
Solena's management team have more than 25 years experience in plasma heating systems, the political and social context for green energy, international marketing and finance, and the large-scale conversion of waste, biomass, and coal products into the one thing everybody wants more of: energy.
Dr. Robert T. Do., M.S., M.D.President and CEO
Dr. Do is the author and inventor of our proprietary technology. While running his own general physician practice in the early 1990s, Dr. Do researched the journey medical waste took once leaving his office. He learned that the high-temperature gasification industry had to date been focused on destroying waste while relying on tipping fees for its income. Dr. Do sold his practice and set out to develop a high-temperature gasification system designed for efficient energy extraction/recovery while also destroying the waste. Solena was effectively born, patents were awarded and several industry trends have converged resulting in Solena Fuels Corporation having a market leading position in the drop-in, sustainable fuels markets. Dr. Do is responsible for the overall strategy and technology offering of the Company and has graduate degrees in Physics and Medicine from Georgetown University. Dr. Do has extensive experience as an entrepreneur, environmental scientist and in executive management positions. Dr. Do has been advocating the uses of bioenergy for the reduction of greenhouse gases to combat climate changes and has been lecturing extensively in the US, Europe, and worldwide on the importance of alternative renewable energy. Dr. Do is a Co-Chair for the Transportation Initiative of the American Council on Renewable Energy, a member of the AMA, a Diplomate of the American College of Forensic Examiner, a member of the National Sciences Council for Science and the Environment and a member of the Nationals Who’s Who of Registered Executives and Professionals. He is also founder of the Green Cup, a non-profit charity polo event held annually in DC for the benefit of the environment.
Hung Bui Quang, M.Eng, MBACFO & Director
Mr. Bui Quang joined Solena as a member of the Board of Directors in 2006. Mr. Bui-Quang has extensive experience in project development and project financing, corporate equity fund raising, and is advising Solena regarding its capital strategy for BioEnergy Plant funding. Mr. Bui-Quang has more than 30 years of experience in the energy sector with Hydro Quebec, Gaz Metro Limited Partnership and International Consulting Engineering firms. Mr. Bui Quang is the former Vice-President of International Business Development of Hydro-Quebec; a major integrated electric utility in Canada with an installed Capacity of 35,315 MW, and annual revenue of more than $11 billion. Mr. Bui-Quang currently serves as the Regional Vice-President of RSWI, an engineering consulting firm active in 43 countries and as the Chairman of the Board of Directors of the Vietnam-Canada Engineering Company (VCE) with its head office in Hanoi, Vietnam. Mr. Bui-Quang holds a Bachelor of Science and a M.Sc. in Chemical Engineering from Ecole Polytechnique (University of Montreal, Canada) and an MBA from McGill University (Montreal, Canada). In 1992, Mr. Bui-Quang was awarded the prestigious title "Nouveau Performant 1992" (The New Management Elite 1992) by the Business Community of the Province of Quebec.
Dr. Sylvain Motycka, M.S., Ph.D.- Vice President, Process & Technology
Dr. Motycka leads the engineering teams responsible for Solena's Gasification Island as well as the Waste-to-Liquids plants and the related fuels sustainability compliance. Prior to joining Solena in 2006, Dr. Motycka was a scientific researcher at the Institute of plasma physics; Academy of sciences of the Czech Republic, researching hybrid gas‐water stabilized DC thermal plasma torches. Previously, he designed plasma torch systems for Surfx Technologies applied to the semiconductors, medical devices and aerospace industries. Sylvain Motycka holds a Ph.D. in Systems Engineering from The George Washington University and he received a Master of Science in Plasma Physics from the Université d’Orléans, France and a Master of Science in Electronics and Optics from the Ecole Polytechnique de l’Université d’Orléans, France. Dr. Motycka is co-author of several US patents and pending patents.
Yves G. Bannel Executive Vice President Europe
Mr. Bannel joined Solena in 2001 and has 30 years of experience in market strategy and project development throughout the world. This includes 10 years of senior management experience in the development, promotion and financing of turnkey projects in Europe, Africa, South America and the Middle East. From 1989 to 1994, Mr. Bannel was General Manager of Sateco, a French group dedicated to designing, manufacturing and selling high technology equipment for construction all over the world. During his tenure as General Manager, Sateco became a member of the top 50 companies in France in terms of sales growth, ROI and profitability allowing for the subsequent sale of the company. From 1975 and 1989 Mr. Bannel was successively the General Manager of C2EI, S&T and Gielmetti. Mr. Bannel holds a Masters Degree in Business and a Law Degree from Hautes Etudes Commerciales (HEC) de Paris, and a diploma from Ecole Nationale de Aéronautique Civile (ENAC) de Paris. He has served three years as a Professor of Marketing at the Bordeaux School of Business and published three books on marketing industrial products. Mr. Bannel had been Regional President of the CNPF/French Association of Businessmen for five years.
Grischa KahlenVice President Business Development for Europe
Mr. Kahlen joined Solena in 2001 in the Prague office where he is responsible for the preparation of Solena projects in Central and Eastern Europe. Mr. Kahlen has 15 years experiences in energy cogeneration and renewable energy production from landfill gas. In the early nineties he founded the company PDI. PDI is in charge of using landfill gas from the two biggest landfills in Prague producing electricity and heat for the district and heating more than 5000 homes in the city of Prague. His company implemented similar projects not only in the Czech Republic, but also in neighboring countries. Before the fall of the socialist system in 1990 Mr. Kahlen wasn't allowed to study in the Country's University due to political reasons. In those years he worked as a freelance interpreter. In the time of the so called "velvet revolution" in 1989 he was in the team of Mr. Vaclav Havel, the first president of the free Czech Republic, Mr. Kahlen was responsible for establishing contacts with Germany and was accompanying Mr. Vaclav to German speaking countries, as his interpreter.
Trenton Allen, Advisor
Mr. Allen is Managing Director and CEO of Sustainable Capital Advisors. Mr. Allen founded SCA in 2012, to build upon his successful 15 year career in the financial services industry as an investment banker and financial advisor. Throughout his career, Mr. Allen has participated in over $17 Billion of financings, including public debt offerings and private placements (debt and equity). Prior to SCA, Mr. Allen was a Director at Citi where he led efforts to finance large infrastructure projects including water, wastewater, conventional and renewable energy and energy efficiency for utility, commercial and governmental clients. In 2011, Mr. Allen led the groundbreaking $67 million Energy Efficiency Revenue Bond financing for the Delaware Sustainable Energy Utility (“SEU”) which provided a scaled capital markets solution for financing energy efficiency. Prior to Citi, Mr. Allen served as the Head of the Quantitative Strategies Group afor Public Financial Management, the nation’s leading municipal financial advisory firm.
Mr. Allen serves as an Adjunct Instructor for the Center for Energy and Environmental Policy at the University of Delaware teaching a graduate level course titled “Sustainable Energy Finance”. Mr. Allen is a frequent speaker at major energy conferences and is widely regarded as a thought leader in the financing of clean energy projects. Mr. Allen has served on numerous advisory boards including an appointment to the Green Jobs/Green NY Advisory Board and the Finance Solution Working Group for the US DOE’s State and Local Energy Efficiency Action Network. Mr. Allen is a graduate of Harvard College where he majored in chemistry.
|
903 N.E.2d 565 (2009)
STAKER
v.
STATE.
No. 02A04-0810-PC-601.
Court of Appeals of Indiana.
March 6, 2009.
RILEY, J.
Disposition of case by unpublished memorandum decision. Affirmed.
DARDEN, J. Concurs.
VAIDIK, J. Concurs.
|
Chromosome localization and gene synteny of the major histocompatibility complex in the owl monkey, Aotus.
Rodent cells were hybridized with owl monkey (Aotus) cells of karyotypes II, III, V, and VI. Aotus-rodent somatic hybrid lines preferentially segregating Aotus chromosomes were selected to determine the chromosomal location of the major histocompatibility complex and other genes with which it is synthetic in man. Based on correlation between concordant segregation of the chromosome as visualized by G-banding and expression of the Aotus antigens or enzymes in independent Aotus-rodent hybrid clones, we have assigned Aotus gene loci for the MHC, GLO, ME1, SOD2, and PGM3 to Aotus chromosome 9 of karyotype VI (2n = 49/50), chromosome 10 of karyotype V (2n = 46), and chromosome 7 of karyotype II and III (2n = 54 and 53). On the basis of banding patterns we previously postulated that these chromosomes of the different karyotypes were homologous. The gene assignments reported here provide independent evidence for that hypothesis. Aotus chromosomes 9 (K-VI), 10 (K-V), and 7 (K-II, III) are homologous to human chromosome 6 in that they all code for the MHC, GLO, ME1, SOD2, and PGM3. The structural differences between these homologous chromosomes probably resulted from a pericentric inversion.
|
Q:
Incorrectly picked post for audit on low quality queue?
Just failed an audit on the "Low Quality Post" queue for an answer that looks ok and it is in no way "abusive nonsense, noise, spam, blatantly off-topic or otherwise irredeemable" as the audit message says. More, there's another SO question on a similar topic with an almost identical answer - spaces in project path lead to problems.
The failed audit message for this queue is a little bit harsh IMO for this particular post, as the post itself can at most be categorised as incorrect.
This post was (IMO again) incorrectly pick for audit.
Am I wrong with the above two statements?
Edit: This is what I currently see for the audit:
I can no longer see the answer to understand why I was wrong.
A:
That link is completely unrelated to the answer.
It is the very definition of spam.
Just look at the url the link leads to: the homepage of some company.
If the link were to lead to some kind of blog about Android studio, it might've had merit, but I can't think of a (on-topic) question for SO where some company's homepage can be the answer.
Now, since this answer was spam, it can be categorized as "abusive, nonsense, noise, spam, blatantly off-topic or otherwise irredeemable".
As long as at least one of these descriptions applies to the post, the post should be removed from SO.
Sure, the message might be blunt, but it gets the message across without leaving too much room for interpretation.
|
Deaths in Sadiq Khan’s London in 2018 have topped 100 with the discovery of a 73-year-old woman’s body on Wednesday.
Carole Harrison was found dead in her house in Teddington, in the capital’s south-west, following a house fire, but police say she appears to have suffered injuries “consistent with an assault” prior to the blaze.
The investigation into the pensioner’s death is the sixth murder inquiry launched in London in a week, according to MailOnline, with the capital on course to break its 2017 homicide total of 116.
It is likely that this number would have been even higher had it not been for medical advances over the last few years, with a recently published academic study suggesting there could have been up to 1,650 more homicides UK-wide without the establishment of major trauma networks in 2012.
Murder Surges 44 Per Cent in Khan’s London Amidst ‘Troubling’ Rise in Serious Crime https://t.co/lM2ewca1Z5 — Breitbart London (@BreitbartLondon) May 20, 2018
London has recorded massive rises not just in murder but also in acid attacks, shootings, and knife crime — including a huge surge in attacks with implements such as machetes, more commonly associated with the Third World than England — in recent years, with a 2,138 percent rise in moped-enabled crime being particularly striking.
Boris Johnson, the former Foreign and Commonwealth Secretary and two-time Mayor of London, has laid much of the blame for the crime wave at the feet of his successor, Labour politician and strident Donald Trump critic Sadiq Khan.
“He blames everyone but himself, when it is his paramount duty to keep Londoners safe. It is a pathetic performance,” complained the Tory Brexiteer, claiming Khan preferred “politically correct virtue-signalling” to fighting crime.
Boris Johnson: Khan Prefers ‘Politically Correct Virtue-signalling’ to Fighting Crime https://t.co/jiRdWF1Z6v — Breitbart London (@BreitbartLondon) July 23, 2018
Khan has also come under fire from President Donald Trump himself, in an interview where he discussed the negative impact of mass migration on many European cities.
“I look at cities in Europe, and I can be specific if you’d like. You have a mayor who has done a terrible job in London. He has done a terrible job,” the American leader said ahead of his recent working visit to Britain.
“Take a look at the terrorism that is taking place. Look at what is going on in London. I think he has done a very bad job on terrorism,” he added.
Follow Jack Montgomery on Twitter: @JackBMontgomery
|
One feature I’ve always liked about GW2…
I like how the character tries to line up their feet with the floor, and this works in different stances too.
It’s a really small touch, but I like it all the same. Surprisingly few games do this.
|
OpenStreetMap at Craft Beer Co
A social OpenStreetMap London pub meet-up from 7pm. Join us for some friendly social beers and chit chat on the subject of OpenStreetMap (contributing/using experienced/beginners, whatever interests you in and around OpenStreetMap!)
Whether you’re a mapper, map user, or just curious, come join us! If you think you may have trouble recognising anyone, turn up half an hour later (when the group will be more assembled), and look out for maps or OpenStreetMap hi-viz vests or polo shirts.
Sign up here on attending.io if you fancy it. Not everyone bothers signing up. We normally expect about 5/10 people at the pub.
|
Did the Jeffrey Epstein saga get fishier and fishier with the hanging death of a banker? No, that's not true: Thomas Bowers, who worked at two large banks over recent decades, committed suicide by hanging at his Malibu, California, home on November 19, 2019, according to the Los Angeles County coroner's office. His suicide has not "caused speculation" about his "real cause of death," except for stories arising from questionable websites known to promote unsourced conspiracy rumors. The only named source in the original report is the publisher one of the stories, and his claim to have personal knowledge of Epstein's banking relationships is in question.
While Bowers' work as the head of Deutsche Bank's American wealth management division has been part of a federal investigation, it was concerning his approval of loans for President Donald Trump, not relating to deceased sex offender Jeffrey Epstein. The bank acknowledged it was conducting an internal investigation of its dealings with Epstein, but Bowers, who left Deutsche Bank in 2013, was not himself under investigation.
The claim originated in a TruePundit.com article and was soon repeated in several stories, including an article published by Big League Politics on December 3, 2019 titled "Jeffrey Epstein's Long-Time Banker Found Dead From Hanging, Immediately Ruled a 'Suicide'" (archived here) which opened:
The Epstein saga continues to get fishier and fishier.
Corporate banker Thomas Bowers, who ran the U.S. division of private wealth management for Deutsche Bank AG, reportedly committed suicide last month at the age of 55 by hanging himself with a rope in his California residence.
However, his extensive ties to deceased sex trafficker Jeffrey Epstein - who also died from a mysterious suicide - has caused speculation about what the real cause of Bowers' death may be.
Users on social media only saw this title, description and thumbnail:
Jeffrey Epstein's Long-Time Banker Found Dead From Hanging, Immediately Ruled a 'Suicide' - Big League Politics The Epstein saga continues to get fishier and fishier.
The jail cell suicide of Jeffrey Epstein on August 10, 2019, triggered several conspiracy rumors based on the suspicion that powerful people were using murder to stop revelations about the Epstein's alleged sex trafficking operation. A new rumor was launched a week after banker Thomas Bowers was found dead in his home. Two websites -- TruePundit.com and BigLeaguePolitics.com -- published stories claiming that Bowers had a close relationship with Epstein while he worked at Deutsche Bank and Citigroup.
The Big League Politics story, which parroted the True Pundit article, noted that Epstein opened several accounts with Deutsche Bank after another bank distanced itself from him in 2013:
Epstein moved millions of his personal wealth through Deutsche Bank before his death. He switched to Deutsche Bank in 2013 after his conviction for child sex crimes when even JP Morgan would no longer do business with him. Following investigations into civil cases exposing the extent of Epstein's criminal network by the Miami Herald, Deutsche Bank finally began to close his accounts. "Deutsche Bank is closely examining any business relationship with Jeffrey Epstein, and we are absolutely committed to cooperating with all relevant authorities," a spokesperson for the bank said.
The bank spokesperson quote was lifted from a Bloomberg.com story from July 23, 2019. Bloomberg made no mention of Bowers or an FBI probe of his purported dealings with Epstein. The stories, however, attempted to create a false narative that Bowers had information about Epstein's sex trafficking and that he died "before the FBI questioned him."
Did Bowers have "extensive ties" to Epstein as claimed? Lead Stories has been unable to find a detailed resume' for the banker, but we did find references to Bowers leaving Deutsche Bank in 2013 and also 2015. If Epstein moved his money to Deutsche Bank accounts in 2013, then Bowers would not have been there through much of Epstein's relationship with the bank. Epstein had lost most of his high-powered friends well before 2013. Former President Bill Clinton and future President Donald Trump cut ties with Epstein before the Florida sex investigation began in 2005. Britain's Prince Andrew stopped socializing with Epstein in 2010.
Both the Big League Politics and True Pundit articles, however, claim that Bowers and Epstein became banking buddies years before when Bowers work for Citigroup and approved big loans for Epstein. Big League reported:
Former bank executive Mike Moore, who led a Citigroup division's anti-money laundering unit during a time when Citi was in bed with Epstein, commented on the nature of Epstein's loans with the corporate lender.
"The loans to Epstein were personal and commercial," Moore said. "The Citi loans I can confirm were for more than $25 million. Some were secured, some were not."
According to sources that spoke with True Pundit, Epstein received similar loans from both Citigroup and Deutsche Bank, and it is not a coincidence that Bowers worked in the same role for both banks when Epstein was doing business with them. Bowers was chief of The Citi Private Bank, and led Citigroup's Global Markets and Wealth Management businesses before he made his way to Deutsche Bank.
Turns out "former bank executive Mike Moore" is the founder of TruePundit.com, where he uses the alias "Thomas Paine." In other words, Moore was the source for Paine's story, but they are the same human. Moore/Paine's approach to journalism has been closely examined by Buzzfeed reporter Craig Silverman for an August 27, 2018 story titled "Revealed: Notorious Pro-Trump Misinformation Site True Pundit Is Run By An Ex-Journalist With A Grudge Against The FBI":
Paine combines the use of a pseudonym with almost exclusive use of anonymous sources to establish the persona of a deeply connected reporter with a vast network of FBI, law enforcement, and government sources. As with the Page story, he adds false or conspiracy-filled claims to real events or documents in order to create the impression of being rooted in fact.
Silverman's report also revealed that Moore/Paine has a recent criminal record:
He was arrested by federal agents in November 2011 for running two websites that sold pirated hockey DVDs and downloads. Months earlier, FBI agents executed a search warrant on his home and carted off the equipment he used to pirate hockey games and other content.
Moore pleaded guilty to one count of copyright infringement in June 2013. He was sentenced to time served of one day in prison, a year of house arrest, and three years of supervised release. During his release he had to provide monthly income statements and facilitate the "investigation of his financial dealings," according to a sentencing document filed on June 17, 2013.
Silverman confirmed that Moore/Paine worked in the past as a journalist, but he could find no evidence he was "a former banker" with CitiGroup. He challenged Moore/Paine in a tweet to explain why Citigroup said he never worked for them:
Hey Mike, you claim to have worked for Citi "running its anti-money laundering Ops in three states." A spokesperson told me they have no record of employing anyone with your name in anti-money laundering operations, or otherwise. Can you explain?
Hey Mike, you claim to have worked for Citi "running its anti-money laundering Ops in three states." A spokesperson told me they have no record of employing anyone with your name in anti-money laundering operations, or otherwise. Can you explain? https://t.co/mveU1GloPT -- Craig Silverman (@CraigSilverman) September 4, 2018
Another look at who is Moore/Paine can be read at https://whoistruepundit.com/.
Aside from Moore/Paine's validity as a source for what kind of business Epstein did with Citigroup, there are credible reports that the banking relationship was short and sour. The Wall Street Journal, in an August 28, 2019 article titled "Jeffrey Epstein's Road Through Wall Street Was a Bumpy One", that Epstein used JP Morgan for most of his money matters prior to moving to Deutsche Bank:
From the 1990s through about 2013, Mr. Epstein had a relationship with JPMorgan, one that proved lucrative for the bank. The Wall Street Journal previously reported that JPMorgan gained a stream of private-banking clients and referrals from Mr. Epstein. The bank ended the relationship in the midst of concern about its reputation, the Journal reported, years after a 2007 nonprosecution agreement with the government related to a Florida sexual-misconduct investigation into Mr. Epstein.
The WSJ reported that Epstein did take out two $10 million loans from Citigroup in 1999, which he defaulted on, leading to lawsuits:
By 2002, the investments were in trouble. Mr. Epstein defaulted on both loans, even after Citigroup extended their repayment deadlines, the bank later claimed. Mr. Epstein filed a lawsuit in District Court of the Virgin Islands claiming Citigroup had defrauded him and misrepresented information related to the investments, which he said had been made on the recommendation of Ms. Davison, who "aggressively solicited my participation." Through a spokeswoman, Ms. Davison declined to comment.
Citigroup filed its own suit in the Southern District of New York for repayment of the loans. Both parties dropped their suits in 2005. Mr. Epstein's relationship with Citigroup was severed in 2006, according to people close to the matter, around the time Mr. Wexner stopped working with Citigroup, the people say. A spokesman for Mr. Wexner declined to comment.
"Mr. Epstein was a client for a short period of time, before his abhorrent behavior came to light," a Citigroup spokeswoman said.
There is no indication that Bowers was close to Epstein during that "short period of time" or that their friendship survived the lawsuits. True Pundit claims an unnamed "banking executive" said Bowers visited Epstein's private island but his name did not appear on any of the flight logs carrying passengers there. It also said Bowers had "an active night life and enjoyed the party circuit," but that does not serve as evidence he did so with Epstein.
The Big League story ends with this claim:
Anything that Bowers may have been able to divulge about Epstein's network died with him. Loose ends are being tied up, and the powerful individuals who Epstein provided with illicit child sex services have to be breathing a sigh of relief as a result.
There is another high-profile banking relationship involving Bowers that the FBI and Congress are probing: President Donald Trump. For more on that, read the London's Metro newspaper report titled "Banker who signed off Trump loans found dead after killing himself".
NewsGuard, a company that uses trained journalist to rank the reliability of websites, describes bigleaguepolitics.com as:
A conservative political site owned by a political consultant that has published false and misleading headlines and stories and that does not correct errors.
According to NewsGuard the site does not maintain basic standards of accuracy and accountability. Read their full assessment here.
We wrote about bigleaguepolitics.com before, here are our most recent articles that mention the site:
|
Abdul Majid Muhammed
Abdul Majid Muhammed () is a citizen of Iran who was held in extrajudicial detention in the United States Guantanamo Bay detention camps, in Cuba.
His Guantanamo Internment Serial Number was 555.
Joint Task Force Guantanamo counter-terrorism analysts estimate he was born in 1978, in Zahedan, Iran.
Abdul Majid Muhammed was captured in Afghanistan and was transferred to Iran on October 11, 2006.
Press reports
The Guardian reported on March 15, 2006 that Muhammad was accused of serving as a night watchman for the Taliban.
Combatant Status Review Tribunal
Initially the Bush Administration asserted that they could withhold all the protections of the Geneva Conventions to captives from the war on terror. This policy was challenged before the Judicial branch. Critics argued that the United States could not evade its obligation to conduct a competent tribunals to determine whether captives are, or are not, entitled to the protections of prisoner of war status.
Subsequently, the Department of Defense instituted the Combatant Status Review Tribunals. The Tribunals, however, were not authorized to determine whether the captives were lawful combatants—rather they were merely empowered to make a recommendation as to whether the captive had previously been correctly determined to match the Bush administration's definition of an enemy combatant.
Summary of Evidence memo
A Summary of Evidence memo was prepared for Abdul Majid Muhammed's Combatant Status Review Tribunal, on 3 December 2004.
Transcript
Muhammed chose to participate in his Combatant Status Review Tribunal.
His Tribunal was convened on December 10, 2004.
Tribunal documents
Lieutenant Commander Peter C. Bradford, one of the officers from the Judge Advocate General's Corps tasked to serve as a legal advisor to the CSR Tribunals, wrote a Legal Sufficiency Review, dated February 5, 2005.
His status was considered by the 12th panel of officers sitting on Combatant Status Review Tribunal.
The president of his tribunal was a colonel in the United States Marine Corps Reserve.
The JAG officer was a lieutenant colonel in the United States Army.
The third member was a lieutenant colonel in the United States Air Force.
Conclusions
Abdul Majid Mujahid' CSR Tribunal concluded that he had been properly determined to have been an enemy combatant:
Abdul Majid Muhammed v. George W. Bush
A writ of habeas corpus was submitted on Abdul Majid Muhammed's behalf.
The Department of Defense released a 32-page dossier of unclassified documents from his CSR Tribunal. A declaration from Commander Teresa M. Palmer, one of the officers from the Judge Advocate General's Corps tasked to serve as a legal advisor to the CSR Tribunals, was dated August 15, 2005.
Administrative Review Board hearing
Detainees who were determined to have been properly classified as "enemy combatants" were scheduled to have their dossier reviewed at annual Administrative Review Board hearings.
The Administrative Review Boards were not authorized to review whether a detainee qualified for POW status, and they were not authorized to review whether a detainee should have been classified as an "enemy combatant".
They were authorized to consider whether a detainee should continue to be detained by the United States, because they continued to pose a threat—or whether they could safely be repatriated to the custody of their home country, or whether they could be set free.
Summary of Evidence memo
A Summary of Evidence memo was prepared for Abdul Majid Muhammed's
Administrative Review Board,
on 12 August 2005.
The memo listed factors for and against his continued detention.
The following factors favor continued detention
The following factors favor release of transfer
Transcript
Muhammed chose to participate in his Administrative Review Board
hearing.
In the Spring of 2006, in response to a court order from Jed Rakoff the Department of Defense published an eight-page summarized transcript from his Administrative Review Board.
References
External links
Meltdown at the Guantánamo Trials Andy Worthington
Category:1978 births
Category:Year of birth uncertain
Category:Living people
Category:Guantanamo detainees known to have been released
Category:Iranian military personnel
Category:People with borderline personality disorder
|
Q:
convert json string send with text/html headers to valid object
I have this php script
if (!$chunks || $chunk == $chunks - 1) {
// Strip the temp .part suffix off
rename("{$filePath}.part", $filePath);
if( $content = $this->html_file_uploaded( $filePath ) ){
die('{"Done" : "yee", "content" : "woe" , "id" : "id"}');
}
and in JavaScript I want to do
FileUploaded: function(up, file, info) {
// Called when a file has finished uploading
$('body').prepend('FileUploaded fired<br>'+info.Done);
but it returns undefined if I write it to the page
$('body').prepend('FileUploaded fired<br>'+info.Done);
var info = $.parseJSON(info); did not work for me.
how can I make it work?
EDIT
The JavaScript and php are from the plupload api
I don't want to use json_encode, unless I am told sending a string like this can never work, or is not reliable. I am interested how to convert the string to a valid object.
I use online json string checker and it says it is not valid, - Unable to format the JSON input. A JSONObject text must begin with '{' at character 1 near ''{'"Done" :'
A:
Inside your callback function (referenced as FileUploaded) do
var obj = $.parseJSON(info.response);
now you can reference the response like obj.Done
|
Spatial analysis for regional behavior of patients with mental disorders in Japan.
The aim of our study was to clarify the geographical movement of patients treated in psychiatric facilities, which can provide important information on the resources and health-care system of psychiatric services. We conducted an analysis of nationwide data on psychiatric patients, collected as an additional survey to the conventional '630 survey' in 2014. For the 151 848 initially admitted inpatients during 6 months and the 144 401 outpatients on a specific day, we identified whether a patient was admitted to a psychiatric facility located in the same medical area as his/her residence. We estimated percentages of being from (i) within the medical area, (ii) within the prefecture, and (iii) outside the prefecture, using a Bayesian statistical approach for each secondary medical area. The inpatients moved across wider areas than did the outpatients. Almost all inpatients and outpatients received their medical treatment at hospitals/clinics within their prefecture of residence. The current mental health medical system in Japan has been operating according to prefecture unit; thus, it may be appropriate to plan a medical system at a prefectural level.
|
Arun Shenoy
Arun Shenoy (born April 30, 1978) is a Singaporean musician and songwriter. He is best known for his Grammy Award nomination at the 55th Annual Grammy Awards for his debut full-length studio album Rumbadoodle released in 2012. “Bliss”, the first song from his Indian Fusion project released as a single in 2013 was featured on a worldwide Exclusive First Look on Grammy.com. His second album A Stagey Bank Affair, released in 2016 was chosen as the Critics's Pick for Best Album of the Year by Jazziz Magazine. He was conferred the Outstanding Computing Alumni Award by the School of Computing at NUS in 2018 and is also a Distinguished Alumni of MIT, Manipal. He is the founder of record label, Narked Records. Looking back at Shenoy's music over the years, music critic Jonathan Widran has noted that Shenoy's discography may sound a bit scattered, but it's reflective of a brilliant, multi-faceted creative mind, pushed relentlessly by a restless spirit. He has stated that (band) name shifts aside, it’s some of the most compelling, heartfelt and life affirming music he has heard. Shenoy who describes himself as the prodigal son of Rock & Roll., has been featured by Zen Magazine in the best dressed couples list at the 56th Annual Grammy Awards red carpet arrivals in 2014; and again by Le Guide Noir at the 57th Annual Grammy Awards red carpet arrivals in 2015.
Early life
Shenoy was born in 1978 at Manipal in coastal Karnataka. He did his schooling at The Frank Anthony Public School, Bangalore from 1982-1993 followed by his pre-university education at St Joseph's Arts and Science College, Bangalore, from 1993-1995. Shenoy returned to Manipal for his engineering degree at the Manipal Institute of Technology (MIT, Manipal) and graduated in 1999. Shenoy moved to Singapore in 2003 pursue his master's degree by research in Computation Audio from the National University of Singapore (NUS). He became a Singapore citizen in 2008.
Music career
Shenoy has been involved in the local music scene through his university days. His professional music debut as a record producer came when he worked on the production for an EP by the American hard rock artist Tanadra released on April 29, 2010. Later in the same year, Shenoy also released a solo EP on October 31, 2010, which was titled Sol. While attempting to start a career in music, Shenoy said that he worked up to 80 hours a week for 2 years, while producing his debut EP Sol and working with the American artist Tanadra on her solo debut.
Shenoy’s full-length debut studio album Rumbadoodle was recorded across the world over two years and was released on August 30, 2012. The album has a flamenco feel with fusion influences drawn from contemporary pop, rock and jazz. Though he hails from a rock music background, Shenoy has said he always loved the Spanish Flamenco for its energy and passion characterized by its flourishes, rhythms and staccato style. Shenoy has cited Yanni as a major inspiration for the album. The album consists of 11 songs, which are individually named by a wide range of styles that are integrated into every song. Shenoy contributes all the proceeds from the album to an education fund for underprivileged people in India. The Art Directors of the album included Roshni Mohapatra, who was also Shenoy’s wife. On Dec 5, 2012, Shenoy was announced as a nominee for a Grammy Award at the 55th Annual Grammy Awards in the category of Best Pop Instrumental Album for the album. He has been noted as a first time nominee alongside other first time nominees in the Pop Field Fun., Carly Rae Jepsen, Gotye and Kimbra, and also among the more than 80 nominees who hail from outside U.S. borders.
"Bliss", Shenoyʼs follow up single from his Indian World Fusion project was launched by the Recording Academy via a Worldwide Exclusive First Look at Grammy.com in 2013. The project explores the rich lexicon of Indian classical instrumentation conceptually steeped in ancient Hindu scriptures and mythology in what Shenoy describes as a "long journey back to his own cultural roots." The song also features Grammy nominated arranger Don Hart and Indian flautist Ravichandra Kulur. The animated video for the music was scripted by art directors Roshni Mohapatra and Robert Capria and created by Actuality Films in New York.
Shenoy has also collaborated with American producer Matthew Shell on a jazz instrumental single titled "Genesis" in 2013.
In 2014, Shenoy announced a collaboration with Berlin-based producer Sridhar. Branded as Sridhar & Arun Shenoy, the first single by the duo titled “Make Up Your Mind Or Leave It Behind” was released on May 7, 2014 and featured Lonnie Park on guest lead vocals. The follow up single titled “Illusion” was released on August 5, 2014.
Later in the year, Shenoy announced the formation of a new band Soul’d, a trio of Shenoy on guitar, Ravichandra Kulur on flute and Duke Purisima on bass The band released their first single as a self-titled debut
on September 5, 2014. The style of music has been referred to as ‘Bansuri Funk’. It has been noted that Kulur's performance on the flute is fast and melodic with influences of jazz, yet rooted in the Indian traditional style.
On July 1, 2016, Shenoy released A Stagey Bank Affair, his second album and his first as a collaboration with The Groove Project, a group that consists of 13 other artists. The album is a concept album in the musical style of 'Bansuri Funk' that in addition to featuring 14 primary musicians in the group, also features a four person horn section and nine person string section. The most prominent performer on the album is Indian flutist Ravichandra Kulur who provides the emotional core of the songs. There is also a guest appearance by keyboard player, Uziel on the opening track. The performances by Kulur on the flute and Purisima on the bass were two key elements that have served as an inspiration for the music on the album. Most of the songs on the album starting off as jams between Kulur and Shenoy.
The title of the album makes a reference to Stagey Bank Fair, an agricultural based affair held in the early 20th century at Stagshaw Bank in Northern England. As Shenoy explains, legend has it that, over the years, the farming aspect dwindled and the fair became notoriously associated with gambling and drinking. After it was discontinued in the 1920s, the phrase 'Stagey Bank Fair' became a common euphemism for 'mess'. The title is a metaphor for a place that was once a joyous fair, but is now a disheveled, chaotic experience, kind of like adulthood can be.
The mix of contemporary jazz, funky soul and manic world music is complemented by the CD's old-school carnival themed artwork, which serves to reinforce the record's loss of innocence theme. The music and visuals combine to represent the childlike wonder that remains in some adults, despite life's inherent sadness and chaotic nature.
The visual aesthetic used for the fairground concept, presented in the format of vintage poster illustrations, was conceived by art directors Roshni Mohapatra and Robert Capria The album physical package includes a 20 page booklet with 10 retro-styled carnival art panels, a second 24 page booklet with additional artwork and anecdotes, as well as 6 more images on the album package and 2 animated music videos.
Another facet of the album theme is that of the sad clown, where Shenoy counters the lighthearted tunes with the darker track of the same name "Sad Clown" that taps deepest into the loss of innocence theme. Images of the sad clown passed around drunk amid the revelry around him appear several times in the artwork. Shenoy has said that laughter and misery becomes the balance-beam on which our existence is constantly weighed. The album is a journey of the sad clown, who goes through the randomness of being in a colorful fairground, which is life.
2 singles from the album have been released to date. "Sugar Free (feat. Uziel)" on June 3, 2016 and "Mary Go Around" on March 1, 2017 The album was chosen as the Critics's Pick for Best Album of the Year by Jazziz Magazine.
Shenoy collaborated with singer-songwriter, Elizabeth Butler on an American roots song titled "If I Knew" that was released on July 1, 2017.
On August 30, 2018, Shenoy released a 5 track singer-songwriter acoustic EP titled The Unplugged Songwriter Sessions, as a musical collaboration with the core team from The Groove Project, most notably, the rhythm section of bassist Duke Purisima and drummer Jerry Chua, and the addition of a few former and a few new musical collaborators. In the group named Arun Shenoy & The Maverick Express, Shenoy takes on the duties of vocalist along with Lonnie Park. Shenoy has explained in the liner notes the music was written during an extended phase dealing with difficult personal issues. It has been noted that these tunes showcase a more fragile, vulnerable, softer side of the singer’s personality, in great contrast to the muscular intensity of his earlier work; and that the album features the guitarist’s lushly melodic melodies, simple yet thoughtful lyrics and surprisingly graceful vocals. With an intimate approach to the music, Shenoy has been credited with being a deft storyteller, incorporating a great amount of detail into the singular whole and that by far the true heart and soul of the collection comes from Arun Shenoy’s emotive vocals that nicely ties everything together. Stylistically the group goes for a soothing chamber pop approach, with classical, jazz, and worldly influences woven into a colorful tapestry of sound.
Looking back at Shenoy's music over the years, music critic Jonathan Widran has noted that Shenoy's discography may sound a bit scattered, but it's reflective of a brilliant, multi-faceted creative mind, pushed relentlessly by a restless spirit. He has stated that (band) name shifts aside, it’s some of the most compelling, heartfelt and life affirming music he has heard.
In 2019, Shenoy changed the lineup of The Groove Project into a high energy, groove intensive eight-man lineup recording music produced, co-written and co-arranged by Shenoy with Matthew Shell, and prominently featuring pianist Lonnie Park and saxophonist Marcus Mitchell. The group members are from all around the world - Matthew Shell from Washington DC, USA, Shenoy from Singapore. Saxophonist Marcus Mitchell from Maryland, USA, pianist, vocalist & mixer Lonnie Park from New York, USA, keyboard player David Joubert from New Jersey, USA, guitarist Samituru from Finland, bass player Hector Ruano from Venezuela and drummer Glenn Welman from South Africa. The group is working on a funk driven smooth jazz-oriented project dedicated to mankind’s fascination with flying. The group has taken the path of releasing a new single each month as they progressed toward the completion of their album. Each new piece has an aeronautical theme. In an interview, Shenoy has stated that idea of this concept album is, in part, a posthumous tribute to Roshni Mohapatra (7 Jan 1980 – 13 Dec 2018), his ex-wife of 16 years who passed away in 2018. She had envisioned Shenoy’s previous project as a multi-sensory experience of music, art, animation and physical packaging. She had cited David Bowie and Pink Floyd as some of her early influences for art direction of musical projects.
The inspiration for the debut single “Pilot” released on July 31, 2019 came from a popular quote by author and speaker Michael Althusser: “The bad news is time flies. The good news is you’re the pilot.” The second single, "First Flight" released on August 30, 2019 was inspired by the quote from Leonardo Da Vinci: “Once you have tasted flight, you will forever walk the earth with your eyes turned skyward, for there you have been, and there you will always long to return.” The third single "To Be a Bird" released on Oct 10, 2019, draws inspiration from the quote by Neil Armstrong: “Gliders, sailplanes, they are wonderful flying machines. It’s the closest you can come to being a bird.”
The fourth single, the island vibe jazz track titled "Ocean of Air" released on Nov 10, 2019 was inspired from the quote by Welch Pogue – “Unlike the boundaries of the sea by the shorelines, the ocean of air laps at the border of every state, city, town and home throughout the world.” The cover art is of the Cliffs of Dover, Shenoy’s tribute to Eric Johnson for his song by the same name, that won the Grammy Award for Best Rock Instrumental Performance in 1992, and a big part of Shenoy’s musical journey. Like the earlier songs, “Ocean Of Air” is built on a solid foundation of funk. However, this track also picks up the tempo. As a result, the new track finds the band stepping out of the Smooth Jazz arena and a little further into the world of Jazz Fusion. The tune has been compared to a theater play than a music track, with elements of tension, a plot, a rise, and an almost mysterious calming part. The musicians have been referred to as a musical mastermind conglomerate and the tune as the soundtrack of life.
The sixth single, titled "Shadows" released on Jan 01, 2020 was inspired from the quote by Amelia Earhart – “You haven’t seen a tree until you’ve seen its shadow from the sky.” The track adds a classic Soul/ R&B vibe to The Groove Project’s guitar and saxophone led, Smooth Jazz groove, reminiscent of George Benson.
“Home in the Sky” is the seventh single in the project released on Jan 20, 2020. The song was inspired by the Jerry Crawford quote, “To most people, the sky is the limit. To those who love aviation, the sky is home.” It has been noted that the new piece leans a little more into the Pop music realm than previous singles. The composition and arrangement follow a funky downbeat groove than takes the band slightly left of center from their previous Smooth Jazz releases. However, the group’s signature virtuoso saxophone and guitar leads ultimately land this excellent track firmly in The Groove Project’s Jazzy home. Some of the guitar work has been compared to that of Mike Oldfield, and that the passion involved and soulful performances highlights to the band's love for the music, a piece of their life they are delivering to the listener through the headphones.
“Leap of Faith” is the eighth single from the project released on Feb 15, 2020. The song was inspired by the Lauren Oliver quote, “He who leaps for the sky may fall, it’s true. But he may also fly.” The song has been reviewed as an upbeat and funky number. The first two minutes of the piece follow in the footsteps of the group’s previous releases, with Mitchell’s brilliant saxophone playing sitting front and center. At the halfway point, Lonnie Park shines with a cool, rhythmic and percussive piano solo. The final act features Samituru’s crystal clean guitar tone and soulful Jazz licks, backed by the group’s airtight rhythm section.
Accolades
His album Rumbadoodle was nominated for the Best Pop Instrumental Album at the 55th Annual Grammy Awards held on February 10, 2013 in Los Angeles. He was nominated along with Larry Carlton, Dave Koz, Gerald Albright and Norman Brown, and the eventual winner Chris Botti. He was the first ever Singapore citizen to be nominated for a Grammy. His follow up album, A Stagey Bank Affair, was chosen as the Critics's Pick for Best Album of the Year by Jazziz Magazine. He was conferred the Outstanding Computing Alumni Award by the School of Computing at NUS in 2018 and is also a Distinguished Alumni of MIT, Manipal.
Discography
See Arun Shenoy Discography
References
Category:1978 births
Category:Singaporean musicians
Category:Singaporean music
Category:Singaporean composers
Category:Singaporean singer-songwriters
Category:Living people
Category:National University of Singapore alumni
|
IBM says a study it did of some 1,700 Chief Executive Officers worldwide found that many are embracing what Big Blue calls openness -characterized by a greater use of social media as a key enabler of collaboration and innovation.
According to the IBM CEO study, the companies that outperform their peers are 30% more likely to identify this openness as a key influence on their organization. The idea is to a certain extent to "tap into the collective intelligence of an organization to devise new ideas and solutions for increased profitability and growth."
To forge closer connections with customers, partners and a new generation of employees in the future, CEOs will shift their focus from using e-mail and the phone as primary communication vehicles to using social networks as a new path for direct engagement. Today, only 16 % of CEOs are using social business platforms to connect with customers, but that number is poised to spike to 57 % within the next three to five years. While social media is the least utilized of all customer interaction methods today, it stands to become the number two organizational engagement method within the next five years.
More than half of CEOs (53 %) are planning to use technology to facilitate greater partnering and collaboration with outside organizations, while 52 % are shifting their attention to promoting internal collaboration.
Greater openness is not without risks. Openness increases vulnerability. The Internet - especially through social networks - can provide a worldwide stage to any employee interaction, positive or negative. For organizations to operate effectively in this environment, employees must internalize and embody the organizations values and mission. Championing collaborative innovation is not something CEOs are delegating to their HR leaders. According to the study findings, the business executives are interested in leading by example.
The trend toward greater collaboration extends beyond the corporation to external partnering relationships. Partnering is now at an all-time high. In 2008, slightly more than half of the CEOs IBM interviewed planned to partner extensively. Now, more than two-thirds intend to do so, IBM said.
A majority (71 %) of global CEOs regard technology as the number one factor to impact an organization's future over the next three years - considered to be a bigger change agent than shifting economic and market conditions.
CEOs recognize the need for more sophisticated business analytics to mine the data being tracked online, on mobile phones and social media sites. The traditional approach to understanding customers better has been to consolidate and analyze transactions and activities from across the entire organization. However, to remain relevant, CEOs must piece together a more holistic view of the customer based on how he or she engages the rest of the world, not just their organization. The ability to drive value from data is strongly correlated with performance. Outperforming organizations are twice as good as underperformers at accessing and drawing insights from data.
"Rather than repeating the familiar lament about de-personalizing human relationships, this view leans heavily in favor of deepening them, and using dynamic social networks to harness collective intelligence to unlock new models of collaboration," said Bridget van Kralingen, senior vice president, IBM Global Business Services.
|
Q:
Are comments on application folders accessible to students?
If a student applies to a university in the United States, can they legally access all comments written on their application (e.g. as a consequence of the FERPA)?
A:
If a student is admitted to the university and ultimately enrolls then yes, under FERPA they have the right to access any educational records about them that have been retained by the university. However, this doesn't include confidential recommendations in cases where the student explicitly waived the right to review the document. It also doesn't include the records of students who were denied admission or who were admitted and didn't enroll (FERPA rights begin when a student enrolls at the university.)
In the last few years it has become common for students to request this information. There have been articles about this in the campus newspapers at many prominent universities. In response to this trend some universities have changed their policies on retention of data from the admissions process (e.g. you can destroy any notes at the point when a student is admitted and then there won't be any record for the student to access.)
Keep in mind that the vast majority of students in the US attend institutions where admission is either completely open or is based purely on high school grades, standardized test scores, etc. In these cases there typically aren't any "comments" on the student's application.
See these articles:
http://www.browndailyherald.com/2015/04/22/ferpa-requests-yield-limited-access-files/
http://www.stanforddaily.com/2015/03/09/first-students-gain-access-to-their-admissions-files-through-ferpa-provision/
|
(NATALIA KOLESNIKOVA/AFP/Getty Images)
A transgender man has been arrested while collecting his parcel of testosterone from the post office.
Vladislav had been ordering the hormones from Belarus for 18 months without any issue.
He told Zona Media: “I bought on foreign websites – that is, Belarus.
“For a while – these 18 months – everything was fine.
“I did not even know in principle that it was forbidden,” he added.
Getting testosterone from a pharmacy in Russia can be extremely expensive.
Vladislav described ordering his hormones online as the “simplest and most profitable option” for him.
But when he went to collect his hormones in November last year, he was stopped by two customs agents at the post office.
“They introduced themselves and said that they had received a tip about me that I was getting something illegal at the post office.”
He told the two officers: “I’m transgender, and I need it.”
After confiscating his parcel and taking him to their car, they interrogated him.
They suspected that he could be an athlete taking drugs to enhance his performance or someone who wanted to smuggle drugs into Russia to sell on the black market.
Vladislav was arrested under Article 226.1 of the Criminal Code for smuggling of potent substances.
Since 2007, the testosterone he ordered has been classed as one of these substances.
If convicted, he could face imprisonment for a term of three to seven years with a fine of up to one million roubles.
Transgender activist group, Trans Coalition told GSN: “The criminal prosecution of a trans person who needs medical care is inhumane and inadequate to international legal norms.”
The officers misgendered Vladislav, calling him “your daughter” when speaking to his mother.
Getting legal gender recognition in Russia can be a long and stressful process, and because of this 50 percent of the trans population are still rejected from job positions.
|
Hydra-class ironclad
The Hydra class of ironclads composed three ships, , , and . The ships were ordered from France in 1885 during the premiership of Charilaos Trikoupis, as part of a wider reorganization and modernization of the Greek armed forces, which had proved themselves inadequate during the Cretan uprising of 1866. Launched in 1889 and 1890, the ships were ready for service with the Greek Navy by 1892. They were armed with a main battery of three guns and five guns, and had a top speed of .
The ships frequently served together throughout their careers. Their participation in the Greco–Turkish War in 1897 was limited due to intervention by the Great Powers. Modernizations in the 1890s and 1900s upgraded the ships' armament, but by the First Balkan War, they were too slow to keep up with newer vessels in the Greek fleet, particularly the armored cruiser . They saw action at the Battle of Elli but were left behind due to their slow speed at the Battle of Lemnos. Thoroughly obsolete, the ships were reduced to secondary duties after the war and did not see active duty during World War I. The ships were intended to be sold in 1919, but were retained out of active service until 1929.
Design
The Balkan crisis that started with the Serbo-Bulgarian War, coupled with Ottoman naval expansion in the 1860s and 1870s, prompted the Greek Navy to begin a rearmament program. In addition, the Greek fleet had proved to be too weak to effectively challenge Ottoman naval power during the 1866 Cretan Revolt. In 1885, Greece ordered three new ironclads of the Hydra class. The ships were ordered from the Graville and St. Nazaire shipyards in France during the premiership of Charilaos Trikoupis.
Characteristics
The ships were long between perpendiculars and had a beam of and a mean draft of . They displaced as built. By 1910, their displacement had increased slightly, to . Approximately 400 officers and men crewed each ship. The ships were powered by a pair of triple expansion steam engines with four double-ended cylindrical boilers; they were rated at and provided a top speed of . Coal storage amounted to The boilers were trunked into two funnels. The hull was divided into 118 watertight compartments.
The Hydra class was armed with a main battery of three Canet guns. Two guns were mounted forward in barbettes on either side of the forward superstructure; these were L/34 guns. The third gun, a L/28 gun, was placed in a turret aft. The secondary battery consisted of four L/36 guns in casemates were mounted below the forward main battery, and a fifth 5.9-inch gun was placed on the centerline on the same deck as the main battery. A number of smaller guns were carried for defense against torpedo boats. These included four L/22 guns, four 3-pounder guns, four 1-pounder guns, and six 1-pounder Hotchkiss revolver cannons. The ships were also armed with three torpedo tubes. Two tubes were placed on the broadside and one was mounted in the bow.
The ships were armored with a mix of Creusot and compound steel. The main belt was thick amidships and reduced to on either end of the hull. At a normal displacement, the main belt extended for above the waterline. Under a full load, however, the belt was completely submerged below the waterline, rendering it largely ineffective. Above the belt, a strake of 3 in of armor covered the side of the vessels amidships. The main battery was protected by of armor with 12-inch thick barbettes. Hydra had an armored deck thick; the decks of Spetsai and Psara were increased to .
Service history
Hydra was built by the Ateliers et Chantiers de la Loire dockyard in St. Nazaire, while Spetsai and Psara were built at the Société Nouvelle des Forges et Chantiers de la Méditerranée shipyard in Graville. Hydra was launched on 15 May 1889. Spetsai was launched on 26 October 1889 and Psara followed on 20 February 1890. All three ships were transferred to Piraeus and in service by 1892.
Throughout their careers, the three Hydra-class ships generally operated together. The ships saw limited action in the Greco–Turkish War in 1897, as the Royal Hellenic Navy was unable to make use of its superiority over the Ottoman Navy. The Ottoman Navy had remained in port during the conflict, but a major naval intervention of the Great Powers prevented the Greeks from capitalizing on their superiority. In the immediate aftermath of the war, the three ships were partially rearmed, with work lasting until 1900. Their small-caliber guns were replaced with one gun forward, eight guns, four 3-pounders, and ten 1-pounder revolver cannon. One of the 14-inch torpedo tubes was replaced with a weapon.
In 1908–1910, the ships' armament was again revised. The old 5.9 in guns were replaced with new, longer L/45 models. The three ships saw action during the First Balkan War in 1912 at the Battle of Elli, alongside the powerful armored cruiser . At the subsequent Battle of Lemnos, the ships were left behind due to their slow speed and did not engage the Ottoman flotilla.
By 1914, Hydra and Psara had been reduced to secondary duties: Hydra became a gunnery training ship while Psara was used to train engine-room personnel. During World War I, Greece belatedly entered the war on the side of the Triple Entente and the Hydra-class ships served as coastal defense. They were already obsolete and were decommissioned immediately after the war, although their hulks survived as naval training facilities and accommodation space for a decade. All three ships were broken up for scrap in 1929.
Notes
Footnotes
Citations
References
Category:Ironclad classes
|
I have news about my EVE playing, a good one and a bad one. The good one is that I joined a medium-sized corporation, after being invited by one of my readers. The bad news is that me playing EVE caused an unexpected amount of angry rage among some bloggers. Basically I'm being accused to play EVE only to be more convincingly able to badmouth it. Yeah, sure, as if I hadn't anything better to do than to explicitely try not to have fun in a game, just to spite the people who like that game.
Fact is that I do have fun, which is why I still keep playing. Learning how a game works is often fun, and there is a lot to learn in EVE Online. But that doesn't turn me into a mindless drone fanboi. Every game has good sides and bad sides, and sometimes things are neither good nor bad, but just different. I observe, I analyze, and I write about my experiences. If I make some statement about EVE like "mining is boring", you need to read that as "I tried mining and found it to be boring for me personally". Now I tend to have rather middle-of-the-road tastes in gaming, so you could also read it as "some new players trying mining in EVE find it boring". What you should definitely not read it as is "MMORPG guru Tobold made a final judgement about EVE and declared it is a bad game". I'm simply not as authorative as that, and never wanted to be. Even subscriptions numbers, flawed as they are as a measure of how good a game is, are a better indicator of whether a game is good or bad than any single blogger's opinion, reviews, and other posts, mine included.
I sometimes wonder whether video games are the new religion of our secular age. Some people really behave just like religious nutters about their favorite game, treating any open discussion about it as "blasphemy".
I do believe that by playing very different games and writing about them, I can give a larger view of the MMORPG genre and all its possible features in general. Not just a narrow question of whether game X is good or bad. But for example the discussion of whether a real time based advancement system is a good idea or a bad idea for any MMORPG, the disconnect some people feel when their advancement is independant of their actions vs. the freedom that not having to do anything specific to advance grants you. Or the question why for some people buying in-game currency with game time cards is acceptable, while buying a sparkly pony is evil. There has been some excellent discussion about questions like these on this blog this week, for which I want to thank all participants.
Nevertheless, as some rabid EVE players are out there, I had to decide not to make my character name nor the name of the corporation I joined public. The last thing I want is thanking the friendly people that invited me by getting them war dec'd by somebody who didn't like me writing anything else but glowing praise about EVE Online. It is worrying how much hate some people can produce over a completely unimportant issue like some feature in some video game.
- posted by Tobold Stoutfoot @ 1:16 PM Permanent Link
Links to this post
Comments:
I have admitted to being an EVE fanboy in the past and I am delighted that you are trying the game and writing about it.
I have seen ads for EVE but never really looked into it. I had played such space sims as Dracova's Hellfighter, Freespace, and now X3, and I was surprised to find its quite similar to the X universe games, except its multi-player.
I have enjoyed hearing about it, and I might try it out if finances permit.
That being said, everyone is entitled to their opinions. Your page would have postings that reflect that. I see no reason for people to get so upset. I mean, if its that big of a deal, they would write it up on their blog, so people searching for information would see both sides of the coin.
Wardecs come and wardecs go. You really can't let them affect how you interact with the rest of the internets. Besides they give us extra things to talk about (your blog hits a boring stretch? get wardeced and report on it - instant un-boring of blog)
I personally love EvE, but when you folks mention its downsides I admit they are clear to me as well. Its not impossible to be a fan of both WoW and EvE is it?
However, there is no doubt in my mind that each game does certain things much better.
Anyways, one thing I wanted to mention. Ive heard a few people groaning about how even though its supposed to be sandbox, whenever someone asks what they should do its "run missions, join a corp". This is for very simple and logical reasons.
If someone is at the point still (as a new player) where they don't have any idea what they want to do, or even what they can do; then the best thing they can do is run missions. This has the twofold effect of teaching them while segwaying nicely from other MMOs, and giving them a taste of different aspects of gameplay.
Likewise, joining a corp is the biggest step you take in EvE as it is the key to accomplishing greater things. Ever heard the phrase greater than the sum of its parts? Thats an EvE corp. Simply put, a corp allows you to experience gameplay you never could alone. In a dangerous world like EvE, you need strength in numbers.
You will find that the most boring activities (mining for example) can become much more profitable and fun with a corp. Running a 10 person mining session not only multiplies your haul (pooling resources like ships, skills, and cargo space is essential) but is usually pretty entertaining.
I remember times we'd lay claim to an asteroid belt and start our op. Then punk kids started infecting the system. We had our big ships either leave the system or go stealth, and left the small miners alone, so when the griefer showed up he had his shiny new ship blasted away. Its times like this, where a completely unexpected and unscripted moment makes you feel like you are really in this world, that I love EvE.
Maybe fanboism in general is the new secular religion of our age. It can get pretty nasty on engadget.com articles with the apple vs windows comments. Definitely not just an MMO thing.
Constructive criticism is an idea that just eludes so many people on the interwebs. Your pretty much not accountable for anything you say so its a free for all.
I like EVE so I might not agree with some peoples assessment of it. Maybe I feel they've oversimplified things or are comparing apples & cantaloupe but nobody is going to take someone seriously if they can't coherently express that. In the end EVE like many MMO's fits a certain personality and play style and I'm fine with that.
People find it easy to have very broad and sweeping, adamant opinions about subjects that are actually nuanced, complex, and have room for significant intelligent debate and discussion. I try to avoid having serious discussions with these people because they are often unproductive and frustrating.
I mentioned on your first post, and in light of this post it bears mentioning again; I'm really curious about your EVE experiences. I'm a WoW player(becoming more and more bored with it), and EVE has always interested me. You doing this is a cheap way for my to "try" the game out.
What Mike said. I played EVE for about two plus years, it was a gorgeous game and complicated. Very much liked the idea of economic warfare (oh yes, it exists) as well as physical warfare, but going into low-sec space or (shudder) 0.0 space without a corp or on your own was so darned scary.
My biggest complaint (other than never quite getting into the PvP aspects) was that there wasn't enough N. Americans in the game. Time zone issues really matter, when you have a bunch of Europeans and Australians in the corp, kinda hard to synch up with them.
Oh, and taking hours to form up a gang, move into enemy territory just to find them holed up in a NPC station, waiting for action, and then going home. Not fun. So now I'm a WARHAMMER man.
Your drawing an incorrect conclusion from what I wrote. The demographic of an Eve player is going to differ from the demographic of a CS player. Eve is not constant in your face action... it's just not. If you go into it looking for that, you're going to be disappointed.
That doesn't mean if you were to construct a Venn, that there isn't some overlap in players - I'm certain there is. But for instance, I have a 10yo son that really enjoys WoW and Allods and has managed to reach max level in both. He likes the way Eve looks but it's a bit over his head and he simply doesn't have the attention space for it.
As for the 'speak of the devil' comment, I'm not sure I understand your implication.
I also have wondered about EVE Online and enjoy reading this series. I agree with Drac that fanboyism may be the new religion of our time. Specifically, the worship of technology which seems to do so much. People have always worshiped the powerful and unknown, and tech fills the space nicely. What is strange to me is how some people know technology intimately but still worship it. My only explanation is that having invested so much time into something, they have wrapped up their identity and ego into it and are obligated to defend it to the death.
If you stay in a game or a community long enough, it's highly likely that you're still there because you're compatible with its conventions. That is, you're willing to take those conventions as given, and criticism of its fundamental premises comes off as alien.
If you're new to a game, and especially if you're exploring it from a journalistic or critical standpoint, the value of your comments is in shedding light on premises that an established community takes for granted.
In one sense they could tell you: it gets better, and don't pass judgment until you've seen more of the thing... but if that's all that new players (and playtesters) do, the design flaws in the early game (or pervasive through the entire game) go unchecked.
Admittedly, that's overintellectualizing it a bit... the reality is that people grow up in a self-reinforcing culture of brand loyalty, be it to their nation, their local sports team, their church/denomination, their video game console, or their preferred brand of shampoo. If you notice how local sports journalists transition into becoming national sports journalists, the hardest thing to crack is their partiality towards their home team - the same kind of support that may have been, for a very long time, the reason they got into the game.
(By the way, Tobold, if you're responding to criticisms you're getting from other bloggers, I think it's only fair that you link the posts you're clearly responding to: this one, for example, or this one. I disagree with them and I believe that you're playing EVE in good faith and out of genuine curiosity, but shoving your critics behind the curtain as "some bloggers" is really unfortunate.)
Games aren't the new religion, they're the new sports. Not that anyone in their right mind wants to sit and watch you play a game, but that people become emotionally invested and tie their self-esteem to the success or popularity of a particular team/game.
Maybe sports were the new religion, come to think of it. I am guessing it's some deep biological/social impulse that fills us with endorphins when we hear that some stranger has become a player of a game we like, a fan of a sports team we favor, or an adherent of our religion (which is, I would say, still around, but becoming outmoded.)
Wish there was a cure for it though, it makes for miserably stupid social interactions. :(
Actually, I wouldn't say only video games are the new zealot religion. It's more like everything these days has the potential to be that. Probably has something to do with overall trends towards increasing secularity and such.
People have a hard time admitting to themselves that they're wrong, or even could be wrong (after all, if I thought my opinion was wrong, it wouldn't be my opinion any more, something else would be). And most perceive the existence of a different point of view as meaning they could be wrong. Couple that with a black and white view of things, and you've got just about the right recipe.
Tobold, I think most people reading your blog understand how to interpret your take on games. I, for one, know that you are not an all-knowing video game god. I do respect your opinion and the fact that you always let readers know where you are coming from. It makes your blog very interesting.
Heh, so at least you now have more material for you "MMO communities and their crazy zealots" theories :) .
I guess an MMO needs these fanatics to spread the word, but i often wonder if it's not a bit like joining a Sanitarium when you join a community with alot of these in....no objectivity, a bit of abandoning reason with a rabid tantrum streak if things don't go their way...
Tobold, you should feel free to add me to your EVE address book and drop me line in game.My two main characters are Jmarr Hyrgund and Rokkit Kween.
I won't ask you to reveal your in game name publically, that's just asking for greifers and trolls to bug you in game which can ruin the experience for many new players. I will also not reveal such information to anyone.
I've been playing on and off for a good wee while and am always open to helping out newcomers to the game.
I too can see both the good and the bad in EVE but still admit to being a fanboi, though not as rabid as some.
re "as if I hadn't anything better to do than to explicitely try not to have fun in a game, just to spite the people who like that game."
As silly as that sounds outside of EVE, it is quite common in EVE for people to take a security hit and lose a ship just to cause pain and suffering to another player. Someone with the EVE mindset but unfamiliar with you might ask themselves the question.
Anonymous, unaccountable internet actions do not bring out the best in people, as you saw with your comment experiments. The downside of EVE's dark and complicated sandbox is that it brings out the worst of the worst. It is certainly one of the reasons EVE will be a niche not mainstream game.
I think Tobold shouldn't care about who reads his blog. Either you're interested how and about what he writes or you don't.
If readers start to complain they can read someplace else. The lesson here is that if they complain they do care, so they like the blog but somehow disagree. fine with me, but that shouldn't force Tobold in a defensive state. This isn't blog wars, this is a site where we all read the interesting thoughts from Tobold to reflect what we think about the given topic.
I like Eve, I know all its downsides, and I had 3 tries over the years until I fell for Eve Online, so now I am running 2 accounts.
I got bored with mining, switched to trading and after making billions (which pay both of my accountsn now) I even got bored with missions.
So I reskill now to low sec PvP and support&logistics, which can be challenging as well. Finding the right corp to accept me is another challenge as I can't play every day.
So if you need a T3/Command Ship pilot and a logistics/trader jump freighter pilot let me know ;)
I play Eve. I've been playing for years. Still learning about it. Am I a fanboi? No, do I still try other games, other mmo's? Yes. (Got bored of STO in about 4 weeks...made admiral and realized there was nothing new to keep me. Still play Modern Warfare 2 occasionally, and there's Starcraft and EQ2 with my son.)
|
Q:
$\text{Evaluate:} \lim_{b \to 1^+} \int_1^b \frac{dx}{\sqrt{x(x-1)(b-x)}}$
I'm trying to solve the following problem
$$\text{Evaluate:} \lim_{b \to 1^+} \int_1^b \frac{dx}{\sqrt{x(x-1)(b-x)}}$$
I'm tempted to think it's 0 because the bounds would be about equal, but that's not the correct answer. But I don't know what integration techniques to use, so any hints are greatly appreciated.
I don't know how to solve for the indefinite integral itself.
A:
We can solve this using complex analysis: The function $x(x-1)(b-x)$ has a holomorphic square root $f$ on $\mathbb{C}\setminus\left((-\infty,0]\cup[1,b]\right)$ because every loop in this domain circles two zeroes of $x(x-1)(b-x)$ - more concretely, for $(r,\phi)\in (0,\infty)\times (-\pi,\pi)$, set $g(re^{i\phi}) = \sqrt{r}e^\frac{i\phi}{2}$. Then $g$ is the holomorphic extension of $\sqrt\cdot$ to $\mathbb{C}\setminus(-\infty,0]$, and $f(z)$ is the unique holomorphic extension of $ig(z)g(z-1)g(z-b)$ to the domain given above. Indeed, we can check directly that for $x\in (0,1)$, we have $\lim_{\epsilon\to 0} f(x\pm i\epsilon) = i\sqrt{x(1-x)(b-x)}$, so that we can extend $f$ to this interval. On the other hand, for $x\in [1,b]$, we have $\lim_{\epsilon\to 0} f(x\pm i\epsilon) = \mp\sqrt{x(x-1)(b-x)}$. Thus, we have $\int_1^b \frac{\mathrm dx}{\sqrt{x(x-1)(b-x)}} = \frac{1}{2}\lim_{\epsilon\to 0}\int_{1-\epsilon}^{b-\epsilon} f(z)\mathrm dz + \int_{b+\epsilon}^{1+\epsilon} f(z)\mathrm dz$, and in the limit we can close this path by vertical edges to get $\int_1^b \frac{\mathrm dx}{\sqrt{x(x-1)(b-x)}} = \frac{1}{2} \oint_\gamma f(z)\mathrm d z$ where $\gamma$ is any path which circles the "slit" $[1,b]$ once in counterclockwise direction. For $b$ small, we can for example take the circle of radius $\frac{1}{2}$ around $1$. Then the path of integration no longer depends on $b$, and by dominated convergence we can exchange the limit with integration to see that $
\lim_{b\to 0}\int_1^b \frac{\mathrm dx}{\sqrt{x(x-1)(b-x)}} = \frac{1}{2}\oint_\gamma \frac{\mathrm d z}{g(z)i(z-1)}$ and by the Cauchy integral formula this is $\frac{2\pi i}{2ig(1)} = \pi$.
A:
First you can notice that the $\frac{1}{\sqrt{x}}$ term is between $1$ and $\frac{1}{\sqrt{b}}$, so there is no need to bother about it. Indeed this approximation will yield a relative mistake of at most $\sqrt{b}$.
Indeed,
$$ \frac{1}{\sqrt{b}}I = \frac{1}{\sqrt{b}} \int_1^b \frac{dx}{\sqrt{(x-1)(b-x)}} \leq \int_1^b \frac{dx}{\sqrt{x(x-1)(b-x)}} \leq \int_1^b \frac{dx}{\sqrt{(x-1)(b-x)}} = I . $$
Then you can see by an affine change of variable that the remaining integral $I$ doesn't depend on $b$.
All you need to do then is a simple change of variable to show that the answer is $\pi$. Can you try or do you want me to spell it out?
|
Small cell carcinoma of the ampulla of vater.
Primary small cell carcinoma of the periampullary region is rare. Only four patients have been reported previously. The authors examined a patient with ampullary small cell carcinoma using a range of immunocytochemical stains. This tumor shows morphologic and neuroendocrine features similar to its pulmonary and extrapulmonary counterparts.
|
Scientists have found one of human's earliest ancestors 12,000 feet deep under the ocean - a weird pink worm named after a doughnut.
The four-inch (10 cm) long Xenoturbella churro - named for its resemblance to the popular fried-dough pastry - is one of four species discovered 1,700 metre deep in the Gulf of California.
Previously Xenoturbeklla was only known from a single species found in the North Atlantic, puzzling biologists for almost six decades.
Now expeditions half a world away by scientists from Scripps Institution of Oceanography at California University in San Diego, the Western Australia Museum and the Monterey Bay Aquarium Research Institute (MBARI) have helped properly identify the mysterious creatures.
Scripps marine biologist Dr Greg Rouse said: "The findings have implications for how we understand animal evolution. By placing Xenoturbella properly in the tree of life we can better understand early animal evolution."
The animal's shifting evolution began when the first species, named Xenoturbella bocki, was found off the coast of Sweden in 1950.
It was classified as a flatworm in the 1990s and thought of as a simplified mollusc. In recent years, though, Xenoturbella has been regarded as either close to vertebrates and echinoderms - starfish - or as a more distant relative of its own.
Expets said that knowing where Xenoturbella come from is important to understand the evolution of organs such as guts, brains and kidneys in animals.
MBARI scientist Dr Robert Vrijenhoek, who led the deep-sea expeditions using remotely operated vehicles, said: "When Greg first spotted the worms gliding through a clam field in Monterey Bay, we jokingly called them purple socks."
The hunt for more of the worms continued for the next 12 years. By 2015, they had found four new species and collected analysis.
Scientists examined nearly 1,200 of the animal's genes to identify them conclusively as evolved members of bilaterally symmetrical animals - such as certain crustaceans and even butterflies - which are distinguished by having matching halves through a line down the centre.
The Xenoturbella also have only one body opening, the mouth. They have no brain, gills, eyes, kidneys or anus and now appear to be evolutionarily simple rather than having lost these features over time.
As in, they have evolved to a point that they can function without them.
This discovery also increases the diversity of this known species from one to five. The largest of the new species, Xenoturbella monstrosa, was found in Monterey Bay off the coast of California and the Gulf of California and measured 8 ins (20 cm) long.
The smallest, Xenoturbella hollandorum, also found in Monterey Bay, was only one inch (2.5 cm) long.
And the Xenoturbella profunda was discovered in a 12,139 foot (3,700 metre) deep hydrothermal vent in the Gulf of California.
Dr Rouse said: "I have a feeling this is the beginning of a lot more discoveries of these animals around the world."
The oldest human ancestor is a 500 million-year-old worm-like creature no longer than a thumb.
Pikaia gracilens is the most primitive known vertebrate and therefore the ancestor of all descendant vertebrates - including humans.
|
Epimactis spasmodes
Epimactis spasmodes is a moth in the family Lecithoceridae. It was described by Meyrick in 1914. It is found in southern India.
The wingspan is about 21 mm. The forewings are whitish fuscous with the costal edge whitish-ochreous and with a suffused dark fuscous wedge-shaped spot along the base of the dorsum. The stigmata are dark-fuscous, the plical beyond the first discal. There is a fuscous shade from four-fifths of the costa to the dorsum before the tornus, angulated inwards to touch the second discal. A strongly outwards-curved series of cloudy dark-fuscous dots is found from beneath the costa at two-thirds to the dorsum before the tornus and there is also a series of cloudy dark-fuscous dots around the posterior part of the costa and termen. The hindwings are pale whitish grey-ochreous.
References
Category:Moths described in 1914
Category:Epimactis
|
[^1]: Dr. Siakotos\' present address is Physiology Division, Directorate of Medical Research, Chemical Warfare Laboratories, Army Chemical Center, Maryland
|
Student life - The Code and you.
To remain on the Nursing and Midwifery Council register as a qualified nurse you will have to revalidate every three years. This involves demonstrating that you are incorporating the NMC Code into your day-today practice and continuing professional development.
|
Police identify suspect in shooting that killed three as Fraiser Glenn Cross Jr., alias of former Ku Klux Klan white supremacist leader.
Kansas police have published the identity of the 73-year-old suspect in Sunday's shootings at two local Jewish institutions that left three dead. The suspect, Fraiser Glenn Cross Jr., is the former Grand Dragon of the Carolina Knights of the Ku Klux Klan.
The name Cross is an alias for Fraiser Glenn Miller, former leader of the white supremacist group, according to a Southern Poverty Law Center (SPLC) statement released Sunday, reports ABC.
SPLC reports having identified the suspect as Miller after a conversation with Miller's wife, Marge, during which she acknowledged police had informed her of her husband's arrest in context of the shootings.
Further, the address listed by local police for Cross is the same one used by Miller when he ran for Congress in Missouri in 2006, and later sued the secretary of state for refusing his candidacy.
Cross had posted at least 12,000 messages on a neo-Nazi internet forum called the Vanguard News Network. Members of the forum celebrated the shooting with a discussion thread that reached nearly 100 posts by early Monday. "3 ain't bad. Hail Hitler brother!!" read one comment.
The shootings took place a day before Passover outside the Overland Park Jewish Community Center (JCC) and at a nearby assisted living residence, Village Shalom. Cross was reportedly arrested in an elementary school parking lot nearby.
Local reports say Cross shouted "heil Hitler" during his arrest, and indeed local KMBC News filmed the arrest and released footage of him apparently yelling the words out from inside a police car.
Two of the victims have been identified
The shooting at the Overland Park JCC took place just outside a theater where local media said 75 people, mostly children, were inside, reports AFP. They had been auditioning for "KC Superstar," a local singing competition based on "American Idol."
While police have yet to release the identities of the victims, a 14-year-old and his grandfather were identified by their family as being among the dead.
The two, Dr. William Lewis Corporon and Reat Griffin Underwood, were killed at the Jewish Community Center, according to a statement signed "Will Corporon, Son and Uncle."
Reat "loved spending time camping and hunting with his Grandfather, Father, and brother," noted the statement. Corporon retired from family medicine in 2003, and moved with his wife to Kansas from Oklahoma to be closer to their grandchildren.
Rev. Adam Hamilton of the United Methodist Church of the Resurrection in Leawood reportedly identified the two as members of his church.
A third victim, shot at Village Shalom, is a woman in her 70s who has yet to be identified.
Overland Park Police Chief John Douglass said "we have no indication that he knew the victims. We're investigating it as a hate crime, we're investigating it as a criminal act, we haven't ruled out anything."
"There was a shotgun that was involved," Douglass added, noting two others were reportedly shot at but unharmed. "We are exploring the possibility that a handgun was involved in the shooting at the two persons that he missed, and we are looking at the possibility of an assault rifle."
|
The One Simple Method to Block Mobile Ads Tracking
These days, whatever you do on the Internet easily ends up building a profile of your likes, behaviour, and demographic. If you are not careful, these digital footprints of whatever you do online winds up being traced back to you and served to you in the form of targeted advertising.
Online ads seem to follow you everywhere. And that’s because these targeted ads are built to understand your online buying preferences. As most of us spend much time of our casual surfing or social networking through our phones, why not learn how to make it harder for these mobile ads to track you?
MOBILE ADVERTISING IDs
Traditional marketing methods to track you on the Internet relies heavily on cookies, the tiny tracking tools on the web used to recognise you every time you return online.
However, on mobile apps there are no cookies. So in its place, to target and fingerprint app consumers, there are Mobile Advertising IDs (MAIDs) which uses user-resettable identifiers provided by the mobile device’s operating system. On Android these advertising IDs are known as AdID and for Apple they are IDFA.
These MAIDs help developers identify who is using their app and is linked to whatever data marketers collect from you. Nonetheless, the upside of having an ad ID designated to you is that iOS and Android allow you to reset it or zero it out.
This means that at any time you can clear out the ad profiles the marketers have collected about you and prevent them from growing more.
HOW TO BLOCK MOBILE ADS TRACKING
This can be done by turning on the feature on your device that essentially sends out a dummy ID that’s all zeros. By doing this, you will stop the tracking that apps were coordinating through your mobile advertising ID.
Android
Go to Settings
Enter Privacy
Tap on Advanced
In Ads, toggle on Opt Out of Ads Personalization.
iOS
Navigate to Settings
Tap into Privacy
Scroll down to Advertising
Toggle on Limit Ad Tracking
If you do not want to stop your mobile ads tracking altogether but would prefer to have a clear slate very once so often, you can navigate to those same screens and tap Reset Advertising ID on Android or Reset Advertising Identifier on iOS to cycle your ad ID and essentially force advertisers to start a new profile on you.
|
The 2015 Federal Budget was tabled in the House of Commons last Tuesday, April 21, 2015. It shows that Canada has achieved the highest GDP growth among G-7 countries since the financial crisis.
Yet, productivity growth remains a major concern for the country. In addition, Canadian competitiveness has deteriorated. In 2000, Canada ranked 7th in the World Economic Forum’s Global Competitive Index, but dropped to 14th in 2014. Canada needs a budget that prioritizes long-term competitiveness and productivity enhancements to provide all Canadians with a good standard of living.
The Federal Budget proposals encourage businesses to stay small
Although small and medium-sized enterprises (SMEs) are responsible for the largest share of job creation, large companies are on average more efficient and productive. Over the past few years, the federal and provincial governments have adopted various corporate tax incentives for small businesses, aimed at helping them grow. While the intention is good, the results have shown the opposite effect on business growth.
In the most recent Annual Report, the Institute revealed that Canada is the second best country to start a business among 189 countries. Despite this advantage, Canada performed poorly in indicators evaluating the environment for business growth, such as trading across borders, dealing with construction permits, and getting electricity. Furthermore, Canada’s global companies trailed international peers in market value, indicating the poorer performance of Canada’s global corporations.
Academics often criticize the business tax system in Canada, mostly the “taxation wall” created for small business with $500,000 of taxable income. There is evidence showing that the corporate tax structure in Canada distorts business behavior and impedes small business growth. Companies tend to break up into smaller and less efficient units in order to take advantage of the small businesses tax deduction. Additionally, this deduction encourages individuals who fall into higher personal income tax brackets to create small corporations in order to reduce their personal income tax liabilities. Unfortunately, the 2015 Budget highlighted a plan to further cut the federal small business tax rate from 11 percent to 9 percent by 2019. Meanwhile, the federal government will decrease the Employment Insurance (EI) premiums for qualified small businesses. By further widening the disparity between large and small business federal corporate tax rates and contribution requirements, the incentives for small businesses to grow will be further stifled.
Universal Child Care Benefit spending could be better leveraged towards productivity-enhancing programs
The Budget proposes a Universal Child Care Benefit (UCCB) totaling $7.8 billion in 2015-16, and ongoing spending of over $4.5 billion each year thereafter. While the UCCB was designed to enhance the Canada Child Tax Benefit (CCTB), it will be offered on a per child basis instead of an income level basis as it was. Thus, this could make the child care benefit program that aims to combat child poverty and income inequality less effective. According to Martin Prosperity Institute, low-income families in Canada (the bottom 25th percentiles in the income distribution) are much more likely to spend the money from the program than high-income families. Additionally, low-income families spend the child-tax benefit very wisely, on more education, including tuition and computer equipment. They also found evidence from the U.S. showing that maternal “risky” behavior like smoking declines when mothers get more benefit income.
On the other hand, a shortage of government-regulated space for child care is reported as the most pressing child-care problem. According to a study by Child Care Canada, public spending for early childhood education and care (ECEC) remains low compared to the soaring demand. Desperate parents stuck on day care waiting lists have to either reduce their working hours (negatively affecting output by reducing work intensity) or be forced to put their children into unlicensed daycare. Either way, the Institute sees an increasing need for building more high quality child care centers rather than funding a universal taxable benefit. These programs will not only create more jobs, but also save time and money for families with children, especially working mothers, thus generating long-term benefits for the country.
Transportation infrastructure spending continues to lag in Canada
Low investments in public transit and roads are hampering Canada’s competitiveness by affecting the country’s business attractiveness and productivity. According to McKinsey Global Institute, the latest estimated investment needed for Canada’s urban roads and bridges to satisfy the demand, amount to about $66 billion over next 10 years. The 2015 Budget proposes investments of $53 billion under the New Building Canada Plan (NBCP), devoted to the entire public infrastructure stock. Yet, this amount will not even meet the estimated need to close only one aspect of Canada’s infrastructure deficit. Among the $37 billion dedicated federal funding, Ontario received merely 29 percent of the Plan’s monies. Nonetheless, Ontario makes up nearly 39 percent of the country’s population and 37 percent of Canadian GDP. Receiving an inadequate share of the Federal Funds will limit the province’s capacity to invest in productivity enhancing infrastructure, especially regarding transportation, which will adversely impact the overall growth of Ontario’s economy.
The Institute reviewed the Budget and advocates for greater allocation of federal resources to productivity enhancements and long-term competitiveness. The 2015 Budget focuses greatly on balancing the federal public accounts. But balancing the budget without fully tackling the most pressing challenges that Canada is facing might be costly for the country from a global competitiveness perspective.
Photo Credit: sorbetto, Getty Images
|
Bryelmis siskiyou
Bryelmis siskiyou is a species of riffle beetle in the family Elmidae. It is found in North America.
References
Further reading
Category:Elmidae
Category:Articles created by Qbugbot
Category:Beetles described in 2011
|
A new species of the hermit crab genus Areopaguristes Rahayu & McLaughlin (Crustacea, Decapoda, Anomura, Paguroidea, Diogenidae) from the Mexican Pacific.
A new species of hermit crab, Areopaguristes espetacioni, family Diogenidae, is described and illustrated in detail, including the color pattern in live/fresh specimens. This is the fifth species of Areopaguristes reported from the eastern Pacific. Given the morphological similarity between Areopaguristes espetacioni n. sp. and A. tudgei Lemaitre & Felder, 2012, these can be considered sister species. The presence of a long rostrum, the antennal flagella with short setae, chelipeds and ambulatories legs with dense plumose setae, and telson with calcareous teeth on the posterior margin allow to separate Areopaguristes espetacioni n. sp. from all other species in the genus previously described for the region. A key for Areopaguristes species from the eastern tropical Pacific is provided.
|
<?xml version="1.0" encoding="UTF-8" ?>
<!DOCTYPE ldml SYSTEM "../../common/dtd/ldml.dtd">
<!-- Copyright © 1991-2017 Unicode, Inc.
For terms of use, see http://www.unicode.org/copyright.html
Unicode and the Unicode Logo are registered trademarks of Unicode, Inc. in the U.S. and other countries.
CLDR data files are interpreted according to the LDML specification (http://unicode.org/reports/tr35/)
-->
<ldml>
<identity>
<version number="$Revision: 13133 $"/>
<language type="ff"/>
<territory type="GN"/>
</identity>
<numbers>
<currencies>
<currency type="GNF">
<symbol>FG</symbol>
</currency>
</currencies>
</numbers>
</ldml>
|
Swedish research in sports traumatology.
With long-established traditions in both sports medicine and trauma in Sweden, investigations are in progress on prevention, diagnosis, treatment, and rehabilitation, with special emphasis on soft-tissue injuries. The following subjects are of current interest: injuries to the ankle ligaments, compartment syndromes, knee ligament and meniscus injuries, thigh and groin muscle injuries, shoulder dislocation, lateral epicondylitis, and rupture of the ulnar collateral ligament of the thumb. Skiing injuries and the prevention of trauma in soccer players represent important unsolved problems.
|
415 So.2d 999 (1982)
Louis BRADLEY
v.
Michael TRIPKOVICH et al.
No. 12894.
Court of Appeal of Louisiana, Fourth Circuit.
June 8, 1982.
*1000 John H. Brooks, Gretna, for plaintiff-appellee.
Drury & Grossel-Rossi, James H. Drury, New Orleans, for defendants-appellants.
Before REDMANN, AUGUSTINE and LOBRANO, JJ.
REDMANN, Judge.
Defendant appeals from a judgment for $57,166.40 for damages from a collision between a tractor-trailer and a pick-up truck at the intersection of state highway 23 and St. Peter street in Oakville. At issue are liability and quantum. We affirm.
The tractor-trailer was being operated on highway 23 for defendant Sam Broussard Trucking Co., Inc. and was insured by defendant Empire Fire and Marine Insurance Company. The pick-up was being operated by plaintiff on St. Peter street. Plaintiff's evidence is that the lights of defendants' tractor-trailer were not turned on as it moved at highway speeds in the darkness of night. Defendants' driver testified that the lights were on.
Defendant's argument on liability is both factual and legal.
*1001 Factually, defendant argues the improbability of anyone's driving a tractor-trailer at highway speeds without lights, especially along the curving road from Venice to Oakville, some 50 miles. We agree that that is improbable, as, to a lesser extent, it is also improbable that one would drive even a few miles without lights. On the other hand, there is independent eye-witness testimony that this truck was indeed being driven without lights, and there is testimony from two others that some truck was driven past them without lights shortly before the accident. We note that while it is indeed improbable that a truck would be driven without lights, it is even more improbable that two or three different trucks would have been driven without lights at about the same time and the same place. The trial judge's obvious factual conclusion was that the truck was unlighted, and the record does support that conclusion. We simply cannot say the trial judge was "clearly wrong," Arceneaux v. Domingue, 365 So.2d 1330 (La.1978), in the credibility evaluation that is his province, Canter v. Koehring Co., 283 So.2d 716 (La. 1973).
Legally, defendant argues that plaintiff was at least contributorily negligent in trying to cross a four-lane, median-divided highway from a small street without looking sufficiently to see the truck (even if unlighted) that the other witnesses could see. We agree that one driving on a favored highway has only the duty of "slightest care" towards drivers entering from side streets, while one entering a highway from a side street has an obvious obligation to enter only when it is safe to do so. The concretization of the latter obligation depends, however, on such factors as speeds and distances andcritical to this case visibility. The obligation upon the highway driver to have lights on is imposed not only in order to enable him to see others in his or her path, but also in order to enable others to see his or her vehicle. On a duty-risk analysis, we first conclude that the duty to have lights on at night includes, within the risks it intends to avoid, the risk that someone entering from a side street might fail to detect the approach of an unlit vehicle and therefore enter the path of the unlit vehicle. We therefore conclude that the fact that one does enter that path under those circumstances cannot be counted contributory negligence: that possibility cannot be both a purpose of the other driver's duty and an excuse for its breach. This principle is established by the factually differing but legally similar cases of Pence v. Ketchum, 326 So.2d 831 (La.1976); Guilbeau v. Liberty Mut. Ins. Co., 338 So.2d 600 (La.1976); Baumgartner v. State Farm Ins. Co., 356 So.2d 400 (La.1978); Boyer v. Johnson, 360 So.2d 1164 (La.1978); and Rue v. State Dept. Hwys., 372 So.2d 1197 (La.1979). It has also been applied in Outlaw v. Bituminous Ins. Co., 357 So.2d 1350 (La.App. 4 Cir. 1978), writ refused 359 So.2d 1293 (La.); and Oliver v. Capitano, 405 So.2d 1102 (La. App. 4 Cir. 1981), writs refused 407 So.2d 731 and 734 (La.). Thus the possibility that plaintiff exercised something less than perfect night vision, or less than perfect attention, can not bar his recovery.
We therefore affirm the trial judge's determination of liability.
Defendant's argument on quantum is limited to the $27,500 award for general damages; medical expenses, property damage and lost wages are not challenged.
Plaintiff's worst injury was the traumatic tearing apart of the clavicle and scapular joint of the shoulder (the acromioclavicular joint), requiring surgical repair and later pin removal. Other injuries included fractured ribs. The orthopedic surgeon testified, almost two years after the accident, that plaintiff would have problems "indefinitely" in the future. Although defendants cite cases such as Dabov v. Allstate, 302 So.2d 697 (La.App. 3 Cir. 1974), writ refused 305 So.2d 539 (La.), which awarded $10,000 general damages, plaintiff cites LeJeune v. Flash Truck, 353 So.2d 296 (La.App. 1 Cir. 1977), which awarded $50,000 total damages (the special damage elements of which are not disclosed in the opinion). We simply cannot articulate any basis for concluding that $27,500 general damages award transgresses *1002 the upper limit of the trial judge's "much discretion," C.C. 1934(3); Reck v. Stevens, 373 So.2d 498 (La.1979)
Affirmed.
|
Behind the scenes with fight monster Cris Cyborg
It’s kinda unfortunate that the best female fighter in the world is currently stuck competing in front of 1000 people in Kansas City, rather than the 15,000+ in Vegas and millions through PPV who’d see her if she were in the UFC. But until the UFC women’s division is developed enough and demand for Ronda Rousey vs Cris Cyborg hits a fever pitch, that’s how things are gonna be. For now, eat a cookie and watch this great video from the All Elbows crew that takes you behind the scenes for Cris’s fight against Marloes Coenen. If you didn’t have time to watch the full 20 minute fight, this compresses the beating down into an easily digestible form.
|
Q:
extracting Persian data from a String
i want to extract this pattern from variable String in java (android studio) that always include this pattern but another texts are Variable and don't have same number:
" this internet will expires on 1397/7/16 22:30"
i just want extract YYYY/MM/DD pattern every time
for example give me this: "1397/7/16"
how i can do this?
A:
If you just want a simple pattern the gets the numbers resembling a date and time, you could go with something using regular expressions with Pattern and Matcher like this:
import java.util.regex.Matcher;
import java.util.regex.Pattern;
public class TestPattern {
public static void main(String[] args) {
Pattern datePatt = Pattern.compile(".*(\\d{4}/\\d{1,2}/\\d{1,2})\\s+(\\d{1,2}:\\d{1,3}).*");
Matcher matcher = datePatt.matcher("this internet will expires on 1397/7/16 22:300");
if (matcher.matches()) {
System.out.println(matcher.group(1));
System.out.println(matcher.group(2));
}
}
}
It will print the expected:
1397/7/16
2:300
If you don't know how to use regular expressions, start here:
https://www.regular-expressions.info/
And you could test them here:
https://www.regexpal.com
If you ever need something more elaborate check this question:
Regex to validate date format dd/mm/yyyy
cheers!
|
Weaning in the Norway rat: relation between suckling and milk, and suckling and independent ingestion.
We examined in rat pups the relation between the decline of suckling and the emergence of independent ingestion, and the role of milk delivery conditional on nipple attachment in the maintenance of suckling. Fifteen-day-old litters were reared for either 5 or 10 days, and 20-day-old litters for 5 days by either a thelectomized (no nipples), ligated (nipples but no milk), or intact (nipples and milk) dam. Pups' food and water intakes were monitored daily, and their suckling, feeding, and drinking behaviors were videorecorded for 24 hr in the presence of their foster dam (Day 19 or 24) and for 24 hr in the presence of an intact, lactating dam (Day 20 or 25). There were no differences between treatment conditions with respect to either the onset or rate of increase of independent feeding or drinking. Pups reared by a thelectomized dam for 10 days displayed a pronounced, lasting depression of suckling. Twenty-five-day-old pups reared by a ligated dam displayed suckling levels comparable to those of control pups; in the presence of the ligated dam, however, their tendency to attach to a nipple was notably reduced. The implications of the findings for our understanding of the weaning process are discussed.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.