Split (1)

train · 134M rows

text stringlengths 7 4.92M
Compromise bill would permit small webcasters to stay alive without setting dangerous CARP precedent; goes to Senate next BY PAUL MALONEY & KURT HANSON The House of Representatives, in a "suspension" vote that bypasses the usual committee process, has just passed H.R. 5469, the bill which amends the copyright law to include the royalty rate compromise reached last night by small commercial webcasters and the record industry. "The interplay between Berman and Sensenbrenner was really interesting," noted 3WK co-founder Wanda Atkinson, who watched the proceedings on C-SPAN. "Berman acknowledged Sensenbrenner's 'ham-handed- manner of introducing the earlier version of HR 5469, but then indicated he realized that the bill introduction was actually Sensenbrenner's way of forcing webcasters and the RIAA to come to an agreement." This means the bill now goes to the Senate, where, if it passes, and with a signature from the President, it will become law. It is expected to hit the Senate floor within the next week or so. The bill specifies that the rate cannot be claimed to be a "willing buyer/willing seller" by participants in any future CARP arbitration. (This should satisfy the NAB's primary concern last week that had them intending to not support the bill because it might be seen as establishing a new "marketplace" rate.) The full text of the bill is not yet available (as of 3PM CDT) but may soon be posted on the website of the Office of the Clerk of the House of Represenatives here._________________"Injustice, poverty, slavery, ignorance - these may be cured by reform or revolution. But men do not live only by fighting evils. They live by positive goals, individual and collective, a vast variety of them, seldom predictable, at times incompatibl
Eintracht Frankfurt’s Makoto Hasebe has been ranked the second best defender in the Bundesliga this season, according to German football magazine Kicker. Hasebe, having spent the bulk of his career in midfield and at the age of 35, came into his own in a new role this season. Playing as a libero in a three-man defence, he contributed to Frankfurt’s impressive runs in the Bundesliga and Europa League. His individual performances were highly rated in Germany, and he was chosen as the best centreback in the first half of the league by Kicker. He was also shortlisted to be in this season’s best eleven on the league’s official website. In the average rating for outfield players on Kicker, Hasebe was ranked at the top for a period of time. Frankfurt fell to consecutive defeats at the tail end of the season, and he ended the season with a final rating of 2.96 (1 highest, 6 lowest). Overall, he is tied at #11 and #22 for outfield players and all positions respectively. In the position of a defender, he is #2, just behind RB Leizpig’s Willi Orban. For Japanese football news, follow CoolJapan Soccer. Source: Yahoo Images: gettyimages
Steve is ill and will not be in the office today. He will be listening to voicemails and will periodically check his email. Please call me if you need to reach him in an emergency. Thanks, Lillian xt. 37092
Do socio-technical systems cognise? Olle Blomberg 1 Abstract. The view that an agent's cognitive processes sometimes include proper parts found outside the skin and skull of the agent is gaining increasing acceptance in philosophy of mind. One main empirical touchstone for this so-called active externalism is Edwin Hutchins' theory of distributed cognition (DCog). However, the connection between DCog and active externalism is far from clear. While active externalism is one component of DCog, the theory also incorporates other related claims, which active externalists may not want to take on board. DCog implies a shift away from an organismcentred cognitive science to a focus on larger socio-technical-cumcognitive systems. In arguing for this shift, proponents of DCog seem to accept that socio-cultural systems have some form of agency apart from the agencies of the individuals inside them. I will tentatively suggest a way in which such a notion of agency can be cashed out. 1 Introduction In "The Extended Mind" [8], Andy Clark and David Chalmers ask where the mind stops and the rest of the world begins. They argue that bits of our environment sometimes become proper parts of our cognitive processes. In other words, contrary to the received view in cognitive science, cognitive processes sometimes loop out beyond the skin and skull. This is a claim about the location and boundaries of cognition. A closely related issue is what the "unit of analysis" should be in cognitive science. The unit of analysis is the system or set of interactions that needs to be analysed in order to reach a correct understanding of how organisms cognize and behave. Presumably, if cognitive processes extend beyond the skin and skull, so should the unit of analysis. But an extended unit of analysis may be recommended on less radical grounds too, as Robert Rupert has pointed out [27]. It is enough to claim that cognition is deeply embedded in the world - without looping out into it - in order to conclude that "we can properly understand the traditional subject's cognitive processes only by taking into account how the agent exploits the surrounding environment to carry out her cognitive work" [27, p. 395].2 While the boundaries of the unit of analysis and the boundaries of cognition are not necessarily the same then, they are clearly connected. The distributed cognition approach (henceforth DCog) is probably the approach in cognitive science that has widened the unit of 1 University of Edinburgh, United Kingdom, email: [email protected] 2 Rupert also makes use of the concept 'unit of analysis', but perhaps in a slightly different way. He characterises active externalists as claiming that "the unit of analysis should be the organism and certain aspects of its environment treated together, as a single, unified system." [27, p. 395] My concept 'unit of analysis' is intended to be separate from 'cognitive system' so that even an active internalist can claim that "the unit of analysis should be the organism and certain aspects of its environment", although she would reject that they in the end should be treated "together, as a single unified system." analysis the most. In DCog, socio-technical systems (made up of socially organized individuals equipped with tools and technologies) are treated as cognitive systems. 3 For example, the cognitive anthropologist Edwin Hutchins, in what is arguably the canonical account of DCog [17], provides a detailed ethnography of a navigation team steering a large military vessel into port. He analyses the navigation team as a cognitive system in which mental-cum-cultural representations are created, transformed and propagated. While Hutchins' work is one of the main empirical touchstones of the philosophical extended mind movement, the relation between DCog and the philosophy that has drawn on it is unclear. This is partly due to the promiscuous use of the 'distributed cognition' label as more or less synonymous with 'the extended mind', 'active externalism', 'vehicle externalism', 'locational externalism' etc. [8, 15, 31]. In this paper, I will use Clark and Chalmers' label active externalism to refer to these philosophical positions collectively. Clark and Chalmers [8] refer to Hutchins' research as an example of empirical work that "reflects" their active externalism. Other active externalists (such as Susan Hurley and Robert Wilson) as well as "active internalists" (such as Fred Adams, Ken Aizawa and Robert Rupert) also refer to DCog as a sort of empirical counterpart of active externalism [15, 31, 2, 27]. There is a clear focus on "socially distributed cognition" in the DCog literature. This is a phenomenon that is largely absent in discussions about active externalism. Clark and Chalmers' [8] mention the possibility of socially extended cognition, where one thinker's mental state is partly constituted by the state of another thinker, but in such a case, the cognitive system is still firmly centred on the brain of an individual human organism. However, the socio-technical systems that are typically studied using the DCog framework are not centred on an individual organism. DCog thus departs from Clark's "organism-centered" [7, p. 139] active externalism, in the sense that there is often no clear locus of control which can be attributed to any one organism (but not in the sense that there may be no organisms involved at all).4 I will not enter the debate between active externalists and active internalists. My aim is rather to clarify what the relation is between (Hutchins' version of) DCog and active externalism.5 In the next section, I present the DCog approach and tease out four theoreticalphilosophical claims that make up the approach's theoretical backbone. One of these claims is tantamount to a commitment to active externalism. In the following sections, I consider whether some of the arguments that have been used to support active externalism can 3 Such systems are sometimes also referred to as 'socio-cultural systems' or 'distributed cognitive systems' in the DCog literature. 4 However, Christine Halverson, a former student of Hutchins, states that "DCog focuses on the socio-technical system, which usually (but not necessarily) includes individuals." [11] 5 Rupert [27, pp. 391–2, 425n59] also briefly discusses the relation between DCog and active externalism. be used to support a widening of the unit of analysis to cover sociotechnical systems. I argue that this is doubtful and, considered as theory of human cognition, DCog seems to rest on a contentious claim about socio-technical systems having a form of agency. 2 The distributed cognition approach DCog grew out of ethnographic studies of people interacting with each other and with various tools in organisational settings. Such socio-technical systems are conceptualised through the theoretical lens of DCog as both computational and cognitive. In Hutchins' analysis of naval navigation, the activity of the navigation team is described using the symbol-shuffling framework of traditional cognitive science, but applied to a unit of analysis that includes not only several mariners, but also various representational artifacts.6 To give some flavour of research informed by DCog, I here provide a brief summary of Hutchins' analysis of a type of navigation activity. When Hutchins did his fieldwork, a navy ship that was near land and in restricted waters had to have its position plotted on the chart (map) at intervals of a few minutes. In such situations, a team of about five people had to be involved in "the fix cycle". To fix a ship's position, two lines of sight from the ship to known visual landmarks have to be drawn on the chart (the ship should be where the lines intersect on the chart). Simplifying slightly, the fix cycle ran as follows: with the help of special telescopic sighting devices called alidades, two "bearing takers" determined the bearing (direction) of one landmark each; they reported the bearings over a telephone circuit to a "bearing timer-recorder" who jotted them down in the bearing log; the "plotter", standing beside the bearing time-recorder, then plotted the lines of sight on the chart to determine the ship's position. Hutchins glosses this fix cycle in a computational framework drawn from traditional cognitive science: The task of the navigation team [...] is to propagate information about the directional relationships between the ship and known landmarks across a set of technological systems until it is represented on the chart. Between the situation of the ship in the world and the plotted position on the chart lies a bridge of technological devices. Each device (alidade, phone circuit, bearing log etc.) supports a representational state, and each state is a transformation of the previous one. Each transformation is a trivial task for the person who performs it, but, placed in the proper order, these trivial transformations constitute the computation of the ship's position. [16, pp. 206–7] From a DCog perspective, the members of the navigation team together with their tools and social organisation make up a cognitive system that keeps the ship on track. It seems appropriate to think of the navigation activity as instantiating a form of computation, but why think of the distributed computational process as a cognitive process? Are all computational processes cognitive? Or just those that are somehow hooked up in the right way to a biological organism? I do not question that it may be fruitful to conceptualise and 6 Other settings studied under the auspice of DCog include the cockpit of a commercial airliner [18], a telephone hotline group [1], software programming teamwork [9], a neuroscience laboratory [3], work practice in an engineering company [26], and trauma resuscitation teamwork [29] In Hutchins' terminology, these are all cases that exemplify social distribution of cognition. While Hutchins usually presents DCog as a theory about the nature of human cognition [17, 20], it should be noted that DCog is also used as an analytical framework in Human-Computer Interaction (HCI) and in Computer-Supported Cooperative Work (CSCW) [33, 14, 11]. Interestingly, Clark [7, p. 96] actually takes HCI to be a field that house "nascent forms" of a science of the extended mind. study a socio-technical system as computational systems for various reasons. But is it fruitful for cognitive science to adopt the sociotechnical system as a unit of analysis? Will this increase our understanding of the nature and manifestation of human cognition? Why should these systems be studied by cognitive science rather than, say, social science? Later on, I will engage with these questions. But first, I present four distinct theoretical-philosophical claims that are part of DCog and relate them to the current philosophical debate about active externalism. 2.1 Into the wild Empirical research informed by DCog has primarily been descriptive and based on ethnographic observation. According to Hutchins, much research on cognition "in the lab" (arguably a highly atypical setting for human cognition) is based on unexamined assumptions about what a human mind is for. One of the supposed pay-offs of ethnographic studies of cognition "in the wild" is to expose these assumptions and provide "a refinement of a functional specification for the human cognitive system" [17, p. 371]. According to Hutchins, cognitive science needs to get a richer empirically grounded conception of its explananda. Hutchins calls the approach he recommends cognitive ethnography. A cognitive ethnography is a description of a "cognitive task world" of some specific setting. Hutchins claims that we in fact know very little about such everyday cognitive task worlds since "our folk and professional models of cognitive performance do not match what appears when cognition in the wild is examined carefully." [17, p. 371] One systematic such mismatch that cognitive science is suffering from, according to Hutchins, consists in mistaking the cognitive properties of socio-technical systems for cognitive properties of individuals considered in isolation [17, p. 355]. Hutchins argues that recognition of this mistake should lead one to suspect that the performance of cognitive tasks such as navigation "requires internal representation of much less of the environment than traditional cognitive science would have led us to expect." [17, p. 132] In sum, DCog incorporates a methodological commitment that I call the ETHNOGRAPHY claim: ETHNOGRAPHY: Cognitive science is operating with an inadequate functional specification of the mind. Ethnographic descriptions of cognitive activities in the wild can provide a better specification for cognitive science in the lab to work with. Note that this claim in itself does not touch on the issue of where cognitive processes are to be found, it merely points out there is a gap in our knowledge about the range, variety, and constitution of everyday activities in which cognitive processes are somehow involved. 2.2 Computation in socio-technical systems While DCog departs from traditional cognitive science in many ways, its core, the computational model of mind, is retained. Computation is broadly conceived as the "creation, transformation, and propagation of representational states" so that it can be applied both to what happens inside and outside the heads of individuals [17, pp. xvi, 49]. Hutchins actually argues that while the notion of computation as symbol manipulation was metaphorically applied to the individual mind (in the head), it is a literal description of what occurs within (some?) socio-technical systems [17, pp. 363–4]. [T]he computation observed in the activity of the larger system can be described in the way that cognition had been traditionally described that is, as computation realized through the creation, transformation, and propagation of representational states. [17, p. 49] It is a bit unclear whether Hutchins believes DCog to be a theory of socio-technical systems in general or only of a symbol-shuffling subset of them. In [17, p. 363] and [19, p. 67] Hutchins sometimes suggests that it is a framework restricted for describing a subset of systems, but in later writings DCog "refers to a perspective on all of cognition, rather than a particular kind of cognition" [14, p. 3] (see also [20, p. 376]).7 We thus get the COMPUTATION claim: COMPUTATION: (i) A socio-technical system is a computational system, in which "representational states are created, transformed and propagated", and (ii) cognitive science should take it as a unit of analysis. I take COMPUTATION to constitute the core of DCog. Its first part, (i), sets DCog apart from other socio-cultural approaches to cognition, while the second part (ii) sets it apart from traditional internalist cognitive science. Note that the claim in (ii) is not that cognitive science should exclusively take socio-technical systems as its unit of analysis. 2.3 Crossing old boundaries Hutchins typically does not merely construe socio-technical systems as computational systems, but also as cognitive systems.8 In calling socio-technical systems "cognitive", Hutchins seems to accept something like Clark and Chalmers' Parity Principle.9 It is the functionalcomputational contributions of a process that makes it cognitive, not whether it occurs on one side or the other of a skin or skull boundary. In an article co-authored with James Hollan and David Kirsh, he writes: Distributed cognition looks for cognitive processes, wherever they may occur, on the basis of the functional relationships of elements that participate together in the process. A process is not cognitive simply because it happens in a brain, nor is a process noncognitive simply because it happens in the interactions among many brains. [14, p. 175] This in itself need not imply that the boundaries of the cognition of individuals need to be redrawn. One can imagine several brainbound cognitive agents interacting in such a way, with each other 7 As the HCI researchers Victor Kaptelinin and Bonnie Nardi [22, p. 205] have noted, DCog seems to be suited for studying certain highly structured socio-technical systems which some kind of overarching system-level goal can be attributed to. Without such system-level goals it becomes difficult to interpret system activity as a form of problem solving. 8 I write "typically" since occasionally, Hutchins uses the term 'functional system' instead of 'cognitive system'. His broad conception of computation certainly leaves room for important differences between internal and external computational processes. Hutchins can thus argue that even if what happens inside an individual's head is not a component according to the bandwidth criterion, internal and external processes might be different in such a way that only internal processes ought to be called "cognitive". 9 The Parity Principle: "If, as we confront some task, a part of the world functions as a process which, were it done in the head, we would have no hesitation in recognizing as part of the cognitive process, then that part of the world is (so we claim) part of the cognitive process." [8, p. 8] and with their tools, that they collectively make up a larger cognitive system (so that there are several brainbound cognitive systems nested within a larger one). However, Hutchins argues that this is the wrong picture. One important advantage of having a single framework for describing both what goes on inside and outside the heads of individuals, Hutchins argues, is that this highlights that "the normally assumed boundaries of the individual are not the boundaries of the unit described by steep gradients in the density of interaction among media." [17, p. 157, my emphasis] He claims he has "developed a language of description of cognitive events that is unaffected by movement across old boundaries." [19, p. 65] As I interpret Hutchins, the location of these steep gradients determines where the boundaries of cognitive systems. The criterion can be used to analyse the relevant boundaries of socio-technical systems, as well as individuals working with tools. For example, in his analysis of how a bearing taker finds a specific landmark to read and report the bearing, the system is not restricted by the bearing taker's biological boundaries. Instead, it includes, at one point, the degree scale and the tick hairline presented to the bearing taker as he aligns the alidade with the landmark, and it then shifts as activity progresses: "The active functional system thus changes as the task changes. A sequence of tasks will involve a sequence of functional systems, each composed of a set of representational media." [17, p. 157] Hutchins' criterion for determining system boundaries is similar to John Haugeland's proposed bandwidth criterion for deciding whether the mind is a distinct component in a brain-body-world system [12]. Following Herbert Simon [30], Haugeland suggests that systems should be decomposed according the pathways and bandwidth of information flow in the systems. A system is made up of components that interact with each other over interfaces. Interfaces are points of well-defined low-bandwidth interaction between components. Components are made up of parts that interact at much higher bandwidth and in ill-defined ways (relative to the interaction that is mediated by the components interfaces). If a system can be analysed as made up of components and interfaces in this way, then the system's behaviour can be made more intelligible. However, a mind is not a component that can be partitioned off from the world in this way according to Haugeland.10 Hutchins, I take it, clearly embraces some form of active externalism. DCog thus incorporates what I will call the EXTENDED claim: EXTENDED: Cognitive processes are not bound by the skin and skull of an individual but may loop out and include bits of the environment as proper parts. Note that EXTENDED is different from the first part (i) of COMPUTATION. Active internalists can certainly accept that (some) socio-technical systems are computational systems. Adams and Aizawa, for example, argue that DCog is best seen as a theory of "naturally occurring computation" rather than of cognition, on the ground that processes that exhibit the "mark of the cognitive", all occur the brains of people "as a matter of contingent empirical fact". [2, pp. 46, 59]. Rupert takes a similar stance: socio-technical systems may "act as computational systems, of a sort" but there is no explanatory benefits of treating them as cognitive systems [27, p. 392]. One can of course also accept EXTENDED without accepting the sociotechnical systems are computational systems. 10 Note that Haugeland is only using the bandwidth criterion negatively to argue that the mind cannot be partitioned off from the body and the world. He is not using it to partition off some other component (made up of bits of brain, body and world), which could be identified with the mind. 2.4 Socio-technical systems and agency DCog seems to incorporate yet another claim, which takes it even further away from traditional brainbound cognitive science. Hutchins claims that a social-technical system considered as a whole can have cognitive properties of its own. In discussing the navigation team and its tools as a cognitive system, Hutchins [17] attributes several cognitive capacities to this system, such as perception (p. 182), error-detection (p. 182), self-reflection (see p. 182), remembering (p. 196), and confirmation bias (p. 239). Hollan and Hutchins claim that "[f]rom a distributed cognition perspective, goals may be properties of institutions, but need not necessarily be properties of individuals." [21] I will call this claim, which is independent of EXTENDED, the AGENCY claim: AGENCY: A socio-technical system can have a form of agency and be the locus of cognitive capacities such as memory, perception and reasoning. Many will probably take AGENCY to be highly counterintuitive. Given this, should not AGENCY be read metaphorically, as a claim that it might be fruitful to view a socio-technical system as sort of an agent? To treat a socio-technical system as an agent, it could be argued, is no more misleading than to treat a subsystem in the brain as an intentional system (one that, say, "interprets" incoming information from other neural subsystems).11 In this vein, Mark Perry suggests that DCog should be seen as a "representational tool for systems analysis, and not as a true description of activity" and system boundaries should be taken as "artificially defined" [25]. Hutchins is not entirely consistent on this issue, but when takes up the issue of whether mentalistic terms such as 'remembering' are only metaphorically applied to socio-technical systems, he argues that they are not [17, pp. 363–4]. Despite the fact that Hutchins [17] is frequently cited in the extended mind debate, only Rupert [27, 28] and Wilson [32] seem to have picked up on the fact that AGENCY is part of DCog. 3 Outline of the argument COMPUTATION, which is the core of DCog, suggests a radical reorientation in cognitive science. To include the workings of sociotechnical systems among the explananda of cognitive science would amount to a significant widening of the discipline's scope. The second part (ii) of COMPUTATION is therefore in need of some kind of defence. While the boundaries of the unit of analysis need not be restricted to the boundaries of cognition, the relevance of the workings of socio-technical systems for our understanding of cognition needs to be argued for or demonstrated in some way. There seem to be two routes that proponents of DCog can take to defend COMPUTATION, a direct route or an indirect one. The computational processes of a socio-technical system must either themselves be cognitive (the direct route), or else it must be the case that the unit of analysis needed to make sense of the cognitive processes has to be widened to cover the socio-technical system in which the processes are embedded. I will argue that EXTENDED cannot help establish COMPUTATION, at least not when EXTENDED is arrived at by appeal to the bandwidth criterion. While EXTENDED can be used to motivate the 11 Of course, some think that such explanations are very much misleading [4]. study of socially extended cognition, it cannot, or so I will argue, justify treating whole socio-technical systems as cognitive systems. COMPUTATION therefore needs some other (or further) supporting consideration. I will therefore argue that COMPUTATION depends on AGENCY being true. If AGENCY is accepted, then the claim that cognitive science should study socio-technical systems - the second part (ii) of COMPUTATION - follows naturally. Should AGENCY be accepted? I will not give an answer to this question, but I will argue that the principles that may lead one to accept EXTENDED cannot be straightforwardly carried over into an argument in support of AGENCY. Towards the end of the paper, I will suggest one way in which AGENCY at least can be made intelligible. 4 From EXTENDED to COMPUTATION Before considering the direct and the indirect route from EXTENDED to COMPUTATION, I want to briefly consider whether COMPUTATION can be established without the means of EXTENDED or AGENCY. 4.1 Embedded cognition In an attempt to deflate active externalism, or what he calls the hypothesis of extended cognition (HEC), Rupert argues that all the empirical results and observations that active externalists appeal to in order to defend their position can be accounted for equally well (or better) by a hypothesis of embedded cognition (HEMC). HEMC: "[C]ognitive processes depend very heavily, in hitherto unexpected ways, on organismically external props and devices and on the structure of the external environment in which cognition takes place." [27, p. 393] HEMC indirectly takes the study of how organisms interact with tools and their immediate environment into the purview of cognitive science, although, what cognitive science should ultimately explain is the (internal) cognitive processes. An example will be helpful here. In an ethnographic study of cooperative work in the control room of a London Underground line, the sociologists Christian Heath and Paul Luff [13] note how the two personnel in the control room constantly peripherally monitor each other's activities and design their actions not only to achieve the action's primary goal but also to communicate to each other what they are doing.12 Such multi-tasking and mutual coordination is ubiquitous in all kinds of settings. Yet, how people manage to do this is hardly something that cognitive science has advanced our understanding of very far. Such mundane but overlooked patterns of interaction are important phenomena that cognitive science arguably ought to investigate. What cognitive abilities and capacities enable people to smoothly engage in such temporally fine-grained social interaction and monitoring? This example certainly suggests that it may be fruitful for cognitive scientists to pay more attention to what is going on in parts of sociology. However, it seems to me to fall short of making the case that the information flow and "behaviour" of the control room system should be taken as a unit of analysis in cognitive science. 4.2 The direct route Perhaps the bandwidth criterion (which I take Hutchins to be endorsing) can be used to establish COMPUTATION. According to the 12 Heath and Luff's study was not informed by DCog, but by ethnomethodology, a theoretical framework in microsociology. bandwidth criterion, if a socio-technical system is not decomposable into components, which interact through relatively well-defined interfaces, but itself interacts with its environment through such interfaces, then cognitive science ought to, it seems, treat that whole socio-technical system as an explanandum. In the case of Hutchins' navigation team, this would be plausible if the visual input of the landmarks as presented in the alidade and the auditory output of commands to change are low-bandwidth interaction when compared to the interaction happening inside the system. However, this does not seem to be the case. There are clearly some well-defined low-bandwidth interfaces inside the system. For example, the communication of landmark and bearing information over the telephone circuit between bearing takers and the bearing timerecorder and plotter is clearly a low-bandwidth and well-defined one. In addition, the low-bandwidth interaction of the system as a whole with the wider world of the sea is probably a special feature of this particular socio-technical system (Hutchins does not, I think, claim that all socio-technical systems are fruitfully taken as objects of study in cognitive science, but if COMPUTATION turns out to be true only of a very small set of socio-technical systems, then the claim is considerably less interesting). The bandwidth criterion, it should be made clear, is not the only criterion for determining the boundaries of cognition that has been proposed by active externalists. Andy Clark, for example, rejects the bandwidth criterion as a criterion for determining cognitive system boundaries [7, pp. 156–9]. The existence of genuine interfaces between the brain/body and the world does not, he argues, threaten the claim that cases of genuine cognitive extension are fairly common. What is important is instead that people's cognitive performance often results from "rich temporal integration" of internal and external processes and events [7, sect. 2.6, 4.7]. In such cases, the "fine structure [of internal processes and events] has been selected (by learning and practice) so as to assume the easy availability of such and such information" from the external world [7, p. 74]. The emergence of such "subpersonal interweaving" [7, p. 240n11] of internal and external threads is (sometimes?) reflected in personal-level experience, such as when a tool or some other bit of the world become "transparent equipment through which you confront a wider world." [7, p. 74] Clearly, the proponent of DCog cannot rely on personal-level phenomenology to argue for the second part (ii) of COMPUTATION (unless they are willing to claim that socio-technical systems have experiences). What about the subpersonal-level phenomena of rich temporal integration and interweaving? It certainly seems possible in principle that a whole socio-technical system or practice may emergence in such a way that the all the processes that occur in the system are highly dependent on each other and their organisation. Perhaps Hutchins' navigation team and Heath and Luff's control room are actually examples of such systems. The question is if such a subpersonal (or should it be intersubpersonal?) organisation counts for anything in the absence of personal-level phenomena (superpersonallevel phenomena?). 4.3 The indirect route The indirect route from EXTENDED to COMPUTATION is analogous with the way in which HEMC leads to the adoption of a larger unit of cognitive analysis (without extending the boundaries of cognition). Assuming that EXTENDED is true, might it not be the case that the extended cognitive processes are deeply dependent on environment of the extended cognitive system. Adapting HEMC somewhat, the proponent of DCog might appeal to the following hypothesis of embedded extended cognition (HEMEC): HEMEC: Extended cognitive processes depend very heavily, in hitherto unexpected ways, on props and devices external to the extended cognitive system and on the structure of the wider environment in which the extended cognition takes place. If we assume that the dependency that HEC (EXTENDED), HEMC and HEMEC are concerned with is understood in terms of bandwidth (so that two components are heavily dependent on each other just in case they are coupled in high-bandwidth interaction), then it becomes difficult to argue for HEMEC. If one has already accepted EXTENDED on "bandwidth profile grounds", then all the props and devices that are coupled with an agent in high-bandwidth interaction will already be part of that (extended) agent. HEMEC will therefore not help extend the unit of analysis further. Perhaps there is some other (better) way to unpack dependency without relying on bandwidth profiles, which could justify a further widening of the unit of analysis. As I have mentioned, it is possible to argue for active externalism in other ways than by relying on the bandwidth criterion. 5 From AGENCY to COMPUTATION To motivate the inclusion of socio-technical systems among the explananda of cognitive science, some notion of group agency seems to have to be made cogent. If some socio-technical systems are agents, then it seems plausible that the computational processes in these systems should be thought of as their cognitive processes. Admittedly, this looks like putting the cart before the horse, since AGENCY is arguably in as much need of justification as COMPUTATION. However, I think looking at the relation between COMPUTATION and AGENCY may throw some light on what would be needed in order to show that they are true. 5.1 Subsystemic representations Arguments for the existence of group agency, or socio-technical system agency, usually appeal to the explanatory benefits of treating groups or socio-technical systems as agents (see [28]). However, as critics are quick to point out, it seems that the behaviour of groups or socio-technical systems - their "agency" - can be reductively explained by appeal to the behaviour of the people that participate in the system and how they communicate among themselves. For example, one can argue that while a whole navigation team is needed to correctly plot the passage of a ship, the knowledge of the ship's position is found in the head of the plotter, never literally on the navigation chart or diffused in the team and its tools. Similarly, while the organisation of the team must be considered when making sense of the actions of its members, it is redundant to attribute agency to the organisation itself. Rupert [28] argues, correctly in my view, that to make the case of what he calls "group cognitive systems", it must minimally be shown that the representations used in/by such systems are mental representations, not merely cultural/conventional representations that sometimes prompt mental representations in the minds of individual group members. Rupert then argues that according to a number of wellknown theories of mental representations, the cultural/conventional representations that are propagated in group cognitive systems fail to count as mental representations. In cognitive science and the philosophy of mind, one commonly distinguishes between the personal-level of explanation and the subpersonal-level of explanation. Folk psychological accounts of human conduct, often couched in terms of the beliefs and desires, are examples of person-level explanations. Computational and information-processing models in cognitive psychology, on the other hand, are examples of subpersonal-level explanations. I propose that we make a similar distinction when discussing socio-technical systems. Systemic explanations refer to the "behaviour" of the entire system, in terms of its goal for example (e.g. "navigation into port"), while subsystemic explanations refer to the computational processes that occur in the system. Rupert presupposes that all representations in a group cognitive system are personal-level representations. Now, this is a plausible presupposition, and as far as I know, it is shared by most philosophers who have defended some group agency thesis. Moreover, when proponents of DCog are out on the field, they are supposed to trace the trajectories and transformations of personal-level representations. However, these representations are ultimately of interest in virtue of their functional roles in the socio-technical system they are trying to understand, in virtue of them being subsystemic representations. In DCog, public representations thus have a dual role. They are personal-level representations and - when "functionalised" - they are also subsystemic representations.13 Now, I tentatively propose, that one way of cashing out the idea of group (or socio-technical) system agency, is in terms of computations over subsystemic representations that are not personal-level representations for any member in the system. To understand the details of how such a system "behaves", a reductive explanation is unlikely to be adequate. If there exist such subsystemic representations inside a system it seems that there might be some explanatory benefit in treating the whole system as a cognitive system, as a kind of agent. 6 Discussion Much of the previous discussion hangs on the idea that there is a proper domain of explananda for cognitive science. This explananda will consist of the behaviour of various cognitive systems, such as human beings and other animals, and more controversially, the behaviour of robots, software agents, or socio-technical systems. In this paper, when I have referred to explanatory targets or explananda, I have primarily done so by appealing to loose intuitions about what cognition is. I take it to be uncontroversial that cognition is at least primarily an activity of biological organisms, and when we want to extend our notion of cognition to other entities, we have to appeal to similarities to these paradigmatic systems. The intuition, deep-seated in many, that socio-technical systems simply cannot be agents or cognitive systems may have its roots in the fact that socio-technical systems lack many features of biological organisms. Biological organisms are autopoietic systems, "selfproducing" systems, that continuously reproduce their own internal components and boundaries. While there have been attempts to apply such concepts from biology to socio-technical systems, such attempts are I think best seen as metaphorical (see [24] for a brief discussion). The fact that it is so easy to extend notions of mind and cognition from a computational perspective, should perhaps be taken as a sign that the perspective is missing something important. An alternative way of understanding DCog is to read it as a proposal to revise our very concept of cognition. If this is correct, then 13 Clark [6, pp. 292–3] argues, in the context of active externalism, that speech, writing and other "material symbols" play such a dual role in human cognition. the objection that DCog does not fit our intuitions about cognition appears moot. Ronald Giere suggests that such a reading is the most charitable one. He argues against the application of everyday mentalistic notions such as 'believing' and 'remembering' to sociotechnical systems but he does not find the notion of 'distributed cognition' objectionable since 'cognition' is a term used primarily by specialists: "We are thus free to develop it as a technical term of cognitive science". [10, p. 318] For Giere, a socio-technical system qualifies as a cognitive system simply by producing or outputting knowledge. The socio-technical system of the navigation team and its tools studied by Hutchins thus make up a cognitive system since it repeatedly produces a fix of the ship's position. On Giere's view, the knowledge of the position is found in the head of the plotter (and possibly one or two other persons), but not on the chart or somehow diffused in the system. It is possible to read Hutchins [17] as proposing such a revision as well. In a way, he points out that the phenomenon that traditional brainbound cognitive science took as characteristic of cognitive processes, namely the sequential manipulation of symbols, actually manifests itself in various socio-technical systems. So if cognitive science is the science of systems that manipulate symbols or process information, then it should look elsewhere than in the heads of individuals. Such a revision of the concept of 'cognition', Hutchins can argue, allows us step inside the cognitive system and observe symbol manipulation directly [17, pp. 128–9]. I have no objection against such a revision in principle. However, one might argue that it is both arbitrary and redundant [23, 5]. After all, frameworks for studying socio-technical systems and modern organisations are already available within the social sciences. 7 Conclusions Proponents of DCog, whose works sometimes cited as empirical work that reflect active externalism, seem to be pressed to embrace the idea that some socio-technical systems should be considered to be agents. Appeals to a bandwidth criterion for determining the boundaries of cognitive system do not establish that socio-technical systems should be taken as a unit of analysis in cognitive science. However, many active externalists do rely on the bandwidth criterion to determine the bounds of cognition, but rely on other considerations. It is possible that the bandwidth criterion is not the right one, and that a better criterion will in fact show that (many) socio-technical systems are cognitive systems after all. Finally, I want to note that these are conclusions about DCog as a framework for studying human cognition. DCog is also widely used in Human Computer Interaction (HCI) and Computer-Supported Cooperative Work (CSCW) research. If the background motivation for our use of DCog is to understand a specific work setting and the (potential) role for information technology in it, then it seems unproblematic to focus on the propagation of representational states in the system. Many information technology systems (especially those deployed in organisational settings) are used to create, transform and propagate various representational states. ACKNOWLEDGEMENTS I would like to thank Andy Clark, Julian Kiverstein and Matteo Colombo, and two anonymous reviewers for helpful comments. Thanks also to Microsoft Research for financial support. REFERENCES [1] Mark S. Ackerman and Christine Halverson, 'Considering an organization's memory', in Proceedings of ACM 1998 Conference on Computer Supported Cooperative Work, pp. 39–48. ACM Press, (1998). [2] Fred Adams and Ken Aizawa, 'The bounds of cognition', Philosophical psychology, 14(1), 43–64, (2001). [3] Morana Alac and Edwin Hutchins, 'I see what you are saying: Action as cognition in fmri brain mapping practice', Journal of Cognition and Culture, 4(3-4), 629–661, (2004). [4] Max R. Bennett and Peter M. S. Hacker, Philosophical Foundations of Neuroscience, Blackwell Publishing, 2003. [5] Graham Button, 'Review of edwin hutchins' 'cognition in the wild", Computer Supported Cooperative Work, 6, 391–395, (1997). [6] Andy Clark, 'Material symbols', Philosophical Psychology, 19(3), 291–307, (2006). [7] Andy Clark, Supersizing The Mind: Embodiment, Action, and Cognitive Extension, Oxford University Press, 2008. [8] Andy Clark and David// Chalmers, 'The extended mind', Analysis, 58(1), 7–19, (1998). [9] Nick V. Flor and Edwin Hutchins, 'Analyzing distributed cognition in software teams: A case study of team programming during perfective software maintenance', in Empirical Studies of Programmers: Fourth Workshop, eds., Jurgen Koenemann-Belliveau, Thomas G. Moher, and Scott P. Robertson, chapter 5, 36–64, Ablex Publishing Corporation, (1991). [10] Ronald N. Giere, 'Distributed cognition without distributed knowing', Social Epistemology, 21(3), 313–320, (July–September 2007). [11] Christine A. Halverson, 'Activity theory and distributed cognition: or what does cscw need to do with theories?', Computer Supported Cooperative Work, 11(1-2), 243–267, (2002). [12] John Haugeland, 'Mind embodied and embedded', in Having Thought: Essays in The Metaphysics of Mind, chapter 9, 207–237, Harvard University Press, (1998). [13] Christian Heath and Paul Luff, 'Collaborative activity and technological design: Task coordination in london underground control rooms', in Proceedings of Second European Conference on Computer-Supported Cooperative Work, eds., Liam Bannon, Mike Robinson, and Kjeld Schmidt, 65–80, Kluwer, (1991). [14] James Hollan, Edwin Hutchins, and David Kirsh, 'Distributed cognition: Toward a new foundation for human-computer interaction research', ACM Transactions on Computer-Human Interaction, 7, 174– 196, (2000). [15] Susan L. Hurley, Consciousness in Action, Harvard University Press, 1998. [16] Edwin Hutchins, 'The technology of team navigation', in Intellectual Teamwork: Social and Technological Foundations of Cooperative Work, eds., Jolane Galegher, Robert E. Kraut, and Carmen Egido, chapter 8, 191–220, Lawrence Erlbaum Associates, (1990). [17] Edwin Hutchins, Cognition in The Wild, MIT Press, 1995. [18] Edwin Hutchins, 'How a cockpit remembers its speeds', Cognitive Science, 19(3), 265–288, (July 1995). [19] Edwin Hutchins, 'Response to reviewers', Mind, Culture, and Activity, 3(1), 64–68, (1996). [20] Edwin Hutchins, 'The distributed cognition perspective on human interaction', in Roots of Human Sociality: Culture, Cognition and Interaction, eds., Nick J. Enfield and Stephen C. Levinson, chapter 14, 375– 398, Berg Publishers, (2006). [21] Victor Kaptelinin, Bonnie Nardi, Susanne Bodker, John Carroll, Jim Hollan, Edwin Hutchins, and Terry Winograd, 'Post-cognitivist hci: second-wave theories', in CHI '03: CHI '03 extended abstracts on Human factors in computing systems, pp. 692–693, New York, NY, USA, (2003). ACM. [22] Victor Kaptelinin and Bonnie A. Nardi, Acting with Technology: Activity Theory and Interaction Design, MIT Press, 2006. [23] Bruno Latour, 'Cogito ergo sumus! or psychology swept inside out by the fresh air of the upper deck. . . (review of ed hutchins' cognition in the wild)', Mind, Culture, and Activity, 3(1), 54–63, (1996). [24] John Mingers, 'An introduction to autopoiesis–implications and applications', Systems Practice, 2(2), 159–180, (1989). [25] Mark Perry, 'The application of individually and socially distributed cognition in workplace studies: two peas in a pod?', in Proceedings of European Conference on Cognitive Science, pp. 87–92, (1999). [26] Yvonne Rogers and Judi Ellis, 'Distributed cognition: an alternative framework for analyzing and explaining collaborative working', Journal of Information Technology, 9, 119–128, (1994). [27] Robert Rupert, 'Challenges to the hypothesis of extended cognition', Journal of Philosophy, 101(8), 389–428, (2004). [28] Robert Rupert, 'Minding one's cognitive systems: When does a group of minds constitute a single cognitive unit?', Episteme, 1(3), 177–188, (2005). [29] Aleksandra Sarcevic, Ivan Marsic, Michael E. Lesk, and Randall S. Burd, 'Transactive memory in trauma resuscitation', in CSCW '08: Proceedings of the ACM 2008 conference on Computer supported cooperative work, New York, NY, USA, (2008). ACM Press. [30] Herbert A. Simon, The Sciences of the Artificial, 3rd Edition, MIT Press, 1996. [31] Robert A. Wilson, Boundaries of the Mind: The Individual in the Fragile Sciences, Cambridge University Press, 2004. [32] Robert A. Wilson, 'Collective memory, group minds, and the extended mind thesis', Cognitive processing, 6(4), 227–236, (December 2005). [33] Peter Wright, Bob Fields, and Michael Harrison, 'Analysing humancomputer interaction as distributed cognition: The resources model', Human Computer Interaction, 15, 1–42, (2000).
Thanks for checking on that, Rhonda - I'll make a mental note of it. Kate Evelyn Metoyer@ENRON 04/12/2001 01:34 PM To: Kate Symes/PDX/ECT@ECT cc: Subject: Re: deal 580011 According to Rhonda we never use BP Amoco however, she thinks the Calgary office does. Thanks Kate Symes @ ECT 04/12/2001 03:13 PM To: Evelyn Metoyer/Corp/Enron@ENRON cc: Subject: Re: deal 580011 I've changed this to BP Energy - and I was wondering - didn't BP Amoco change over to BP Energy? Do we ever trade with the old counterparty name anymore? Kate Evelyn Metoyer@ENRON 04/12/2001 12:29 PM To: Kate Symes/PDX/ECT@ECT cc: Subject: deal 580011 Cara Semperger deal 580011 CP name should be BP Energy not BP Amoco. Thanks
European Juggling Convention The European Juggling Convention (EJC), is the largest juggling convention in the world, regularly attracting several thousand participants. It is held every year in a different European country. It is organised by changing local organisation committees which are supported by the European Juggling Association (EJA), a non-profit association founded in 1987 in Saintes, France. Like most juggling conventions, it features a mix of workshops for jugglers, a "renegade" performance performed for participants, games, performances and a public show, usually spread out over a period of a week in the European summer. Accommodation is usually in the form of tents provided by participants. History The first EJC was inspired by the IJA Festival and organised by jugglers who didn't want to travel to the USA. The IJA helped by giving the organisers a list (known as the roster) of IJA members living in Europe. It was also known as the "first European IJA mini-convention" and had an attendance of 11 jugglers from 5 countries. EJC has now grown much bigger than its inspiration and has much less focus on competitive juggling, but is more about the sharing of juggling. List of European Juggling Conventions See also British Juggling Convention International Jugglers' Association World Juggling Federation References External links List of European Juggling Conventions European Juggling Association (EJA) EJC Data Pages 1978 - 2006 Category:Juggling conventions Juggling Category:Recurring events established in 1978
Saturday, April 17, 2010 Blog of the Week I'm exercising again! After a week of feeling ucky (yes, ucky), I finally felt well enough to complete week 2 of C25k. I'm stoked to move on to week 3. This week's blog of the week (I know, I was supposed to do this on Thursday. I've been slacking the past couple days on posting.) had a really great line. "Weight loss doesn’t solve everything. It’s just one step in the right direction." This week's blog of the week is A Merry Life. Her blog is seriously awesome. A couple weeks ago, she did a workout pledge like I've done a couple times. I, as well as 21 other bloggers, joined in. 180 comments later, we were each in for 90 minutes of exercise. I split mine between C25k, a bike ride, and elliptical I traveled nearly 10 miles between the three. Go check out Mary's blog. She's a great writer and all around fantastic person!
Introduction {#s1} ============ In 2013, Jordi et al. ([@r1]) reported that [l]{.smallcaps}-arginine, [l]{.smallcaps}-lysine and [l]{.smallcaps}-glutamic acid inhibited food intake via the area postrema or vagal afferents. Carney et al. ([@r2]) found that a sense of fullness was greater after [l]{.smallcaps}-tryptophan than after ingestion of [d]{.smallcaps}-tryptophan, suggesting a delay in gastric emptying. We also observed a significant delay in gastric emptying with treatment with [l]{.smallcaps}-tryptophan using the ^13^C-breath test ([@r3]). In the previous paper, we reported that amino acids having either an alkyl chain with a hydroxyl group, or a branched chain, differently inhibited and/or delayed gastric emptying, by analyzing the change of expired ^13^CO~2~ air and the Cmax, Tmax and AUC^120 min^ values as evaluated by the noninvasive breath test using \[1-^13^C\]acetic acid in conscious rats ([@r4]). However, the effects of these amino acids on gastric adaptive relaxation have not been clarified in relation to the structure of different amino acids. In basic studies using experimental animals, many reports have investigated changes in intra-gastric pressure by surgically inserting a pressure transducer into the stomach of rats or mice ([@r5],[@r6],[@r7],[@r8]). However, such surgical intervention would affect gastric physiological function in an in vivo study. We recently improved the method to evaluate gastric adaptive relaxation in rats without surgery ([@r9]). Therefore, in the present study we evaluated the effects of amino acids having either a straight alkyl chain (glycine and [l]{.smallcaps}-alanine), an extra hydroxylated alkyl chain ([l]{.smallcaps}-serine and [l]{.smallcaps}-threonine) or a branched chain ([l]{.smallcaps}-isoleucine, [l]{.smallcaps}-leucine and [l]{.smallcaps}-valine) on gastric adaptive relaxation using our improved method ([@r9]). Materials and Methods {#s2} ===================== The following animal studies were performed in accordance with the Guiding Principles for the Care and Use of Laboratory Animals approved by Meiji Co., Ltd. Animals ------- Male Sprague-Dawley rats weighing about 200 g were purchased from SLC (Shizuoka, Japan) and housed for 1 week prior to the commencement of the experiments under a constant temperature of 21 ± 2 degree centigrade, with a humidity of 55 ± 15% and exposed to a 12-h light/dark cycle. The rats were fasted in mesh cages for 18 h before each experiment in order to prevent coprophagy, but were allowed free access to drinking water during this period. Barostat study -------------- Gastric adaptive relaxation was evaluated by the method previously reported by us ([@r9]). Rats were anesthetized with urethane (1.2 g/kg, i.p.). In this study we used a modified balloon, by removing the tube within the balloon to improve the fitting of the balloon to the fundus ([Fig. 1A](#fig_001){ref-type="fig"}Fig. 1.Schematic representation of the experimental setting, the changes of the balloon pressure and gastric adaptive relaxation, and time schedule of the experiment. Note the following: A: A slightly improved balloon with the tube within the balloon removed was used in this study so that the balloon fitted more closely within the fundus. The balloon was introduced from the mouth to the stomach in anesthetized rats without surgical operation and set at the fundus. The balloon has two tubes connecting to the barostat. B: The balloon volume increased gradually just after the increment of the balloon pressure, and allowed to plateau for about 1 min. We defined this increased volume as the gastric adaptive relaxation. C: Amino acids were administered orally 30 min before the barostat study. Twenty min after the amino acids administration, rats were anesthetized by intraperitoneal administration of urethane (1.2 g/kg). The balloon was introduced from the mouth to the stomach 5 min after anesthesia and the barostat study performed 5 min later. right). A polyvinyl tube with an adherent polyethylene balloon (maximum volume 7 ml; 3 cm maximum diameter) was introduced from the mouth to the stomach ([Fig. 1A](#fig_001){ref-type="fig"} left). Five ml of air was injected into the balloon via a second balloon tube under the closed first balloon tube used for fitting the balloon to the stomach as shown in [Fig. 1A](#fig_001){ref-type="fig"} right. The second balloon tube was immediately opened to the air. After 5 min recovery time, the tube of the balloon was connected to the barostat (Barostat Distender IIR, G&J Electronics, Toronto Canada). The pressure of the balloon was changed stepwise, from 1, to 2, then 4 and 8 mmHg, at 1 min intervals. The volume of the balloon increased correspondingly. When the pressure was raised the balloon inflated quickly and then the volume gradually increased reaching a plateau within one min. The amplitude of this gradually increased component was used as a measure of the adaptive relaxation (see [Fig. 1B](#fig_001){ref-type="fig"}). Following the evaluation of gastric adaptive relaxation, each rat was dissected and the position of the balloon visually checked to determine correct positioning in the fundus. If the balloon was not in the right position, the data from that animal was excluded from the results. Effects of orally administered amino acids on the gastric adaptive relaxation ----------------------------------------------------------------------------- In the present study we used amino acids having either a straight alkyl chain, such as glycine and [l]{.smallcaps}-alanine, an extra hydroxylated alkyl chain, such as [l]{.smallcaps}-serine and [l]{.smallcaps}-threonine, or a branched chain, such as [l]{.smallcaps}-isoleucine, [l]{.smallcaps}-leucine and [l]{.smallcaps}-valine. After fasting, 1 g/kg of amino acid dissolved or suspended in distilled water for injection was administered orally in a volume of 5 ml/kg. In control rats, distilled water for injection was administered instead of the amino acid solution. Barostat study was performed 30 min after administration of the amino acid solution. The time schedule used in the present experiments is shown in detail in [Fig. 1C](#fig_001){ref-type="fig"}. The dosage of amino acids (1 g/kg) was identical to that in our earlier study ([@r4]) to allow a comparison between the gastric adaptive relaxation and gastric emptying studies. Effects of intravenously administered glycine and [l]{.smallcaps}-serine on gastric adaptive relaxation ------------------------------------------------------------------------------------------------------- In this study, because orally administered glycine and [l]{.smallcaps}-serine showed significant enhancement of gastric adaptive relaxation, we examined the effects of intravenously administered glycine and [l]{.smallcaps}-serine. The pressure of the balloon was changed stepwise, from 1, to 2 and then 4 mmHg, at 1 min intervals. One min after the balloon pressure was changed from 2 to 4 mmHg, an amino acid solution was administered intravenously at a dosage of 100 mg/kg (2 ml/kg) dissolved in saline. In the control rats, saline was administered instead of amino acid solution. The increased volume of the balloon when it reached a plateau was calculated either 3 min after or within 3 min. The increase in volume was used as a measure of adaptive relaxation (ml). Agents ------ Amino acids used in the present study were purchased from Wako Pure Chemical (Tokyo, Japan). Both distilled water for injection and saline were obtained from Otsuka Pharmaceutical Factory, Inc. (Tokushima, Japan). Data analysis ------------- All results are presented as the mean ± standard error (S.E.). Statistical analysis was performed by Dunnett\'s multiple comparison test and P\<0.05 was considered to be significant. Results {#s3} ======= Effects of orally administered amino acids on the gastric adaptive relaxation ----------------------------------------------------------------------------- In the control group, the volume of gastric adaptive relaxation increased with the increment of the balloon pressure as shown in [Fig. 2](#fig_002){ref-type="fig"}Fig. 2.Correlation between the balloon pressure and changes in the adaptive relaxation in control rats. Adaptive relaxation increased with each increment of the balloon pressure. A positive correlation was observed between the pressure and the adaptive relaxation. Values represent the mean ± standard error of the mean (SEM) (n = 5)., and a positive correlation was observed between the balloon pressure and the gastric adaptive relaxation. However, significance could not be calculated because with 4 observations, the degrees of freedom was 2. Adaptive relaxation showed the highest value at 8 mmHg. Therefore, we used a pressure of 8 mmHg to evaluate the effects of amino acids hereafter. The effects of amino acids were expressed as a percentage of the control at 8 mmHg. In the control group, the gastric adaptive relaxation was 0.57 ± 0.11 ml at 8 mmHg. The effects of amino acids used were shown in [Fig. 3](#fig_003){ref-type="fig"}Fig. 3.Effects of orally administered amino acids on gastric adaptive relaxation in rats. Gastric adaptive relaxation was expressed as a percentage of that in control rats. In the control rats, gastric adaptive relaxation was 0.57 ± 0.11 ml at 8 mmHg. Values were expressed as the percentage of the control at 8 mmHg, and represent the mean ± standard error of the mean (SEM) (n = 5 or 6). \: Significant difference observed as compared with control (P\<0.05).. In the straight alkyl chain and extra hydroxylated alkyl chain amino acids, glycine and [l]{.smallcaps}-serine significantly enhanced the gastric adaptive relaxation as compared with the control group (P\<0.05), but [l]{.smallcaps}-alanine and [l]{.smallcaps}-threonine did not. The branched chain amino acids, [l]{.smallcaps}-isoleucine and [l]{.smallcaps}-leucine and [l]{.smallcaps}-valine, also did not significantly influence gastric adaptive relaxation. The chemical structure of the amino acids and their respective values of gastric adaptive relaxation are shown in [Fig. 4](#fig_004){ref-type="fig"}Fig. 4.Chemical structures of the amino acids and their gastric adaptive relaxation as a percentage of the control value. Values represent the mean ± standard error of the mean (SEM) (n = 5 or 6).. The shorter alkyl chain amino acids, glycine and [l]{.smallcaps}-serine, significantly enhanced gastric adaptive relaxation. On the contrary, the longer alkyl chain amino acids, [l]{.smallcaps}-alanine and [l]{.smallcaps}-threonine, as compared with glycine and [l]{.smallcaps}-serine, respectively, did not enhance gastric adaptive relaxation. Similarly, the branched chain amino acids having longer alkyl chains when compared with glycine and [l]{.smallcaps}-serine also did not enhance gastric adaptive relaxation. Effects of intravenously administered glycine and [l]{.smallcaps}-serine on the gastric adaptive relaxation ----------------------------------------------------------------------------------------------------------- The effects of intravenously administered glycine and [l]{.smallcaps}-serine on gastric adaptive relaxation are shown in [Fig. 5](#fig_005){ref-type="fig"}Fig. 5.Effects of intravenously administered glycine and L-serine on gastric adaptive relaxation in rats. In control rats, gastric adaptive relaxation was 0.30 ± 0.03 ml at 8 mmHg. Significant differences were observed following intravenous administration of both glycine and L-serine (P\<0.05 and P\<0.01, respectively). Values represent the mean ± standard error of the mean (SEM) (n = 4).. The balloon volume increased gradually and reached a plateau within 3 min. In the control rats, adaptive relaxation was 0.30 ± 0.03 ml. Glycine and [l]{.smallcaps}-serine significantly enhanced the gastric adaptive relaxation ([Fig. 5](#fig_005){ref-type="fig"}). Discussion {#s4} ========== As compared with the control, glycine and [l]{.smallcaps}-serine significantly enhanced the gastric adaptive relaxation when administered both orally and intravenously. This did not occur with the other amino acids used in the present study. These findings clearly demonstrate that the calorific content of amino acids is not involved at all in the enhancement of gastric adaptive relaxation, because all amino acids were administered orally at the same dosage of 1 g/kg (4 Kcal/kg). In addition, it was found that none of the amino acids tested significantly inhibited gastric adaptive relaxation. Nitric oxide (NO) has been accepted as a mediator of gastric adaptive relaxation. Adaptive relaxation has been known to be mediated by capsaicin sensitive afferent nerves. Lee et al. ([@r10]) reported that acute administration of capsaicin decreased proximal gastric tone and inhibited phasic contractility of the proximal stomach in humans. We have also reported that NO plays an important role in the gastric adaptive relaxation in the rat stomach as reported previously using a barostat ([@r9]). Tonini et al. ([@r11]) also reported a role for NO- and vasoactive intestinal peptide-containing neurones in the relaxation of human gastric fundus strips. Desai et al. ([@r5]) reported that adaptive relaxation in the isolated stomach of guinea pigs is mediated by a nonadrenergic and noncholinergic neurotransmitter substance indistinguishable from NO and derived from [l]{.smallcaps}-arginine by NO synthase. These findings show that NO may be involved in the enhancement of gastric adaptive relaxation by glycine and [l]{.smallcaps}-serine. Pretreatment with the N^ω^-nitro-[l]{.smallcaps}-arginine methyl ester, NO synthase inhibitor, may clarify the mechanism involved in the adaptive relaxation caused by glycine and [l]{.smallcaps}-serine in this study. However, pretreatment with N^ω^-nitro-[l]{.smallcaps}-arginine methyl ester significantly inhibited the gastric adaptive relaxation as reported by us using our experimental system ([@r9]). Thus, further evaluation would be needed to clarify the mechanism involved in producing the effects of glycine and [l]{.smallcaps}-serine using another method, such as in vitro* studies of preparations of the fundus of the stomach. Nagahama et al. ([@r12]) reported that orally administered glycine was highly effective against acid reflux esophagitis in rats. This finding may show that glycine would enhance gastric adaptive relaxation and inhibit reflux esophagitis. Li et al. ([@r13]) found that glycine had a protective effect on cisplatin nephrotoxicity and that this efficacy was inhibited by treatment with N^ω^-nitro-[l]{.smallcaps}-arginine methyl ester, suggesting the involvement of NO. However, Nagahama et al. ([@r12]) found that NO was not involved in the efficacy of glycine against acid reflux esophagitis, because the efficacy was not influenced by the prior subcutaneous administration of N^ω^-nitro-[l]{.smallcaps}-arginine methyl ester. Therefore, glycine may not enhance gastric adaptive relaxation via a NO pathway. Glycine has been known to be converted to serine by serine hydroxymethyltransferase ([@r14]). Therefore, the enhancement of gastric adaptive relaxation by glycine may in fact be caused by [l]{.smallcaps}-serine derived from glycine. In the present study, [l]{.smallcaps}-serine also significantly enhanced gastric adaptive relaxation. Mishra et al. ([@r15]) reported that [l]{.smallcaps}-serine was a potential antihypertensive agent in chronic N^ω^-nitro-[l]{.smallcaps}-arginine methylester-treated and spontaneously hypertensive rats, supporting our relaxant effect of the gastric smooth muscle by [l]{.smallcaps}-serine, even though in experimental tissue from different organs. On the contrary, Mishra et al. ([@r15]) reported that glycine, the precursor of [l]{.smallcaps}-serine, increased blood pressure in chronic N^ω^-nitro-[l]{.smallcaps}-arginine methylester-treated and spontaneously hypertensive rats. In the present study, both [l]{.smallcaps}-serine and glycine significantly enhanced the gastric adaptive relaxation. Therefore, glycine may not cause the enhancement of gastric adaptive relaxation as a result of its conversion to [l]{.smallcaps}-serine. Yim et al. ([@r16]) reported the expression of a functional glycine receptor chloride channel that attenuates contraction induced by both a tachykinin and acetylcholine in airway smooth muscle. Therefore, the mechanism of enhancement of adaptive relaxation by glycine may be explained by the presence of glycine receptor chloride channels. However, further studies are needed to clarify the mechanisms involved in the enhancement of gastric adaptive relaxation by glycine or [l]{.smallcaps}-serine. With regard to the correlation between the chemical structures and gastric adaptive relaxation, it would appear that the shortest alkyl chain amino acids, glycine and [l]{.smallcaps}-serine, enhance gastric adaptive relaxation, as the longer alkyl chain amino acids, [l]{.smallcaps}-alanine, [l]{.smallcaps}-threonine, [l]{.smallcaps}-leucine, [l]{.smallcaps}-isoleucine and [l]{.smallcaps}-valine, did not show significant effects on the gastric adaptive relaxation ([Fig. 4](#fig_004){ref-type="fig"}). Therefore, a short alkyl chain may be effective on the enhancement of gastric adaptive relaxation. However, we reported that [l]{.smallcaps}-tryptophan significantly enhanced gastric adaptive relaxation ([@r3]). [l]{.smallcaps}-tryptophan has an aromatic ring, but not an alkyl chain. To elucidate the speculation that a molecule with a short alkyl chain may be effective in the enhancement of gastric adaptive relaxation, many other compounds having a longer alkyl chain would need to be evaluated for their capacity to produce gastric adaptive relaxation. Sanaka et al. ([@r17]) reported that delayed gastric emptying may cause the gastric adaptive relaxation which occurs with proton pump inhibitor therapy, suggesting that the enhancement of gastric adaptive relaxation induces the delay of gastric emptying. In addition, we also found that [l]{.smallcaps}-tryptophan may inhibit gastric emptying through the enhancement of gastric adaptive relaxation ([@r3]). These reports suggest that inhibition of gastric emptying may relate to the enhancement of gastric adaptive relaxation. However, a correlation between gastric emptying and gastric adaptive relaxation has not been clarified for amino acids other than [l]{.smallcaps}-tryptophan as reported by us ([@r3]). We have previously evaluated the effects of these same amino acids on gastric emptying with the breath test using \[1-^13^C\]acetic acid, and found that [l]{.smallcaps}-serine significantly delayed gastric emptying. The Tmax and Cmax values were significantly delayed and decreased, respectively, as compared with control, but the AUC~120 min~ value was not. In addition, glycine also significantly delayed and inhibited gastric emptying, with a significant decrease in the Cmax and AUC~120 min~ as well as a significant delay in the Tmax as compared with the control ([@r4]). Then, we analyzed the correlation between gastric adaptive relaxation and gastric emptying. By adding the data for the Tmax values and the gastric adaptive relaxation cited from these previous studies to the present results, a significant positive correlation between the gastric adaptive relaxation and Tmax values was found as shown in [Fig. 6](#fig_006){ref-type="fig"}Fig. 6.Correlation in rats between gastric adaptive relaxation and Tmax, one of the parameters for gastric emptying. By adding the data of Tmax value and gastric adaptive relaxation cited from our previous studies to the present results, a significant positive correlation was obtained between Tmax values and gastric adaptive relaxation (P\<0.01). Open circle represents control values. (r = 0.861, P\< 0.01). However, the other pharmacokinetic parameters, Cmax and AUC~120 min~ values did not show a significant correlation with gastric adaptive relaxation (data not shown). These findings may show that enhancement of gastric adaptive relaxation delays gastric emptying, although these amino acids might have a direct effect on the function of the antrum. In conclusion, the present results show that glycine and [l]{.smallcaps}-serine significantly enhanced gastric adaptive relaxation and that the other amino acids used in the present study did not significantly influence it. Therefore, glycine and [l]{.smallcaps}-serine may become useful in the therapy of functional dyspepsia, especially for early satiety, because one of the causes of early satiety is dysfunction of gastric adaptive relaxation. Moreover, it was found that there was a positive correlation between the enhanced gastric adaptive relaxation and the inhibition of gastric emptying as evaluated by the breath test, suggesting that enhanced gastric adaptive relaxation delays gastric emptying. Conflict of interest {#s5} ==================== The authors declare that they have no conflict of interest.
Neonates are most vulnerable as they begin their extrauterine life. During this time, some neonates need ventilatory support. Because of concerns about oxygen toxicity, however, neonates are aggressively weaned from the ventilator. Weaning puts neonates at greater risk of hypoxemia, particularly due to their high fetal hemoglobin level, which is associated with lower oxygen content in the tissues. Thus, ventilator weaning must follow a fine line between oxygen toxicity and oxygen insufficiency. During weaning, neonates are more sensitive to stimuli and frequently develop desaturation episodes, apnea, and bradycardia. During these times, accurate information about oxygen saturation (502) is crucial. Current routine bedside monitoring includes a pulse oximeter to measure peripheral oxygen saturation (SpO2) and a cardiac monitor to indicate heart rate. However, the pulse oximeter may not be accurate, and can affect clinicians' judgment when they wean neonates from the ventilator, which will affect the infant's oxygenation status. During ventilatory support, umbilical arterial and venous catheters are inserted routinely. Fiberoptic catheters can be used to monitor arterial (SvO and venous oxygen saturation (SvO. Monitoring of SvO2 in addition to SaO2 ma)? reflect more accurately the status of oxygen supply and demand in neonates. Concurrent measurement of human vagal tone, using the R-R intervals of the electrocardiogram (ECG) from a cardiac monitor, may also facilitate more accurate interpretation of oxygenation values, because decreased human vagal tone precedes apnea and bradycardia in preterm infants. Its relationship with oxygenation, however, is not documented. Thus, the aims of this clinical trial are to: I. examine the effects of using fiberoptic umbilical catheters to monitor SaO2 and SvO2 on ventilator weaning of neonates and the number of oxygenation however, is not documented. Thus, the aims of this clinical trial are to: a. the effect of fetal hemoglobin on the accuracy of 502 monitoring, using a gold standard co-oximeter; and b.the association between 502 and oxygen tension values in neonates 3. examine the effects of ventilator weaning on 502 readings and vagal tone.
[Efficacy of Phoslock® on the Reduction of Sediment Phosphorus Release in West Lake, Hangzhou, China]. Famous as the world cultural heritage, West Lake in Hangzhou city has plenty of soft sediments with high organic matter content. To search the countermeasures for internal phosphorus release reduction from the sediment, the sediment core incubation was conducted to understand the efficacy of Phoslock® on internal phosphorus release in spring, summer and winter, respectively. The results showed that the internal phosphorus release fluxes in winter and spring were relatively low, with averaged values in the entire lake of 0.13 mg·(m2·d)-1 and 0.29 mg·(m2·d)-1, respectively, while the release flux was 3.29 mg·(m2·d)-1 in summer, more than ten times higher than those in spring and winter. It was estimated that 23.7 kg of phosphorus could be released from sediment in the entire lake every day in summer. Spatially, the phosphorus release flux was related to organic matter contents in sediments, but not the phosphorus or bioavailable phosphorus contents in sediments in West Lake. With Phoslock® added at the rate of 630 g·m-2, sediment phosphorus release was successfully controlled, which reduced the phosphorus concentration in the lake water to less than 0.010 mg·L-1. Especially during summer time, the sediment phosphorus release was reduced by 98% after Phoslock® application. The research suggested that Phoslock® is powerful for phosphorus control even for sediments with high organic matter content, which could be considered in ecological restoration of WEst Lake.
Jolla 2013 appears to be the year of the alternative smartphone OS, with Tizen, Ubuntu Touch, and Firefox OS throwing their hats in the ring. By the end of this year, big name mobile operators like Telefonica and manufacturers including Samsung will have worked together to get devices running those operating systems into the market. But it's not just the big guys who want to upset the Apple-Android duopoly. Finnish startup Jolla is taking aim too. Read more of "Jolla: With just months til launch, here's what's happening with the Sailfish smartphone" at ZDNet.
Background ========== Nurses constitute the largest group of health care providers and their care influences patient outcomes \[[@B1]-[@B3]\]. However, nurses, like other professionals, often fail to incorporate current research findings into their practices \[[@B4]\]. A lack of research use contributes to as many as 30%--40% of patients not receiving care, according to current scientific evidence, and some 20%--25% of patients may receive potentially harmful care \[[@B5]\]. In response, much attention has been directed to developing interventions aimed at changing provider behavior to reflect current research. Several systematic reviews have been published in this area \[[@B6]-[@B10]\], and authors of such reviews primarily include physicians and outcomes relevant to physicians. For example, Grimshaw and colleagues included only medical providers in a systematic review of guideline dissemination strategies \[[@B8]\]. Additionally, in a review of continuing education meetings and workshops, only four of the thirty-two studies included nurses \[[@B9]\]. Poor representation of nursing studies in existing reviews is partially a result of a lack of rigorous nursing research in the area of research utilization. For example, in a review of organizational infrastructures aimed at increasing evidence-based nursing practice, Foxcroft and Cole could locate no studies rigorous enough to be included \[[@B11]\]. Generalizing findings from existing reviews to nursing is problematic. While physicians and nurses experience similar challenges in incorporating evidence, there are differences that influence how each group uses research in practice. One key issue is the social structure of the two professions. Nurses typically work in hierarchical social structures as salaried employees. Conversely, in many countries physicians typically work in more autonomous group practices or in hospitals, not as salaried employees, but as attending physicians with privileges \[[@B12]\]. In these configurations, with the different resulting relationships with the organization, it is likely organizational context will exert different influences on the two groups. A second key difference, related to inpatient care, is the nature and structure of the work of the two professions. Nursing is typically responsible for continuous care over a short period of time. Conversely, episodic contact, often of longer duration, is more the case with medical practice. Moreover, nursing practice does not typically include medical diagnosis or prescribing of diagnostic or therapeutic interventions (although this is changing with the movement to nurse practitioners and other extended practice nursing roles). While these differences are not as common beyond inpatient settings (i.e., community care), the majority of nursing care continues to be provided in hospital settings. Therefore, results from existing reviews cannot be assumed to transfer readily or well to nursing practice in general. Another weakness, we argue, with existing literature is investigators\' reliance upon provider behavior change as a proxy for research use. For example, 88.8% of studies included in a widely cited and influential systematic review of studies aimed at increasing evidence-based practice used behavior practice changes as outcome measures \[[@B13]\]. Using provider behavior as a proxy for research use has some limitations. First, relating to different meanings of research use, scholars generally accept three forms of research utilization: instrumental, conceptual and symbolic \[[@B14]-[@B17]\]. Instrumental research utilization is the concrete application of research in practice \[[@B15],[@B17]\]. Most often, this involves using research to carry out an actionable behavior. Conceptual research utilization is the use of research to change one\'s thinking but not necessarily one\'s action \[[@B15],[@B17]\]. Symbolic research utilization refers to the use of research to influence policies or decisions \[[@B15],[@B17]\]. Investigators have shown the three forms of research utilization can be measured with self-report questionnaires \[[@B14],[@B17]-[@B20]\]. However, authors of existing studies (and reviews) have relied primarily upon behavior change outcomes \[[@B13]\]. Because instrumental research use results in actionable behavior while conceptual and symbolic may not, measuring behavior change may only capture instrumental research use -- a portion of the larger research utilization construct. Second, research in our group has focused on more general measures of research utilization as opposed to specific guidelines or innovation-specific measures. Specific guideline measures have an important role in the understanding of the influences on research uptake, and they permit identification of guideline characteristics that may differentially influence reports of research use. However, we lack direction when attempting to ascertain a level of uptake that can be considered representative of a patient care unitor organization, or when seeking a formula with which to derive a unit or organization\'s level of research uptake. Thus researchers at organizational levels must rely on the very general measures identified above. Our experience with these general measures has been reasonably promising -- we are able to capture variance in responses, the responses are reasonably normally distributed, and factors that one would expect to predict research utilization have generally held true. Third, while research utilization is assumed to have a positive impact on patient outcomes through provider behavior, this is poorly understood and the means by which this occurs is believed to be inconsistent and complex \[[@B21]\]. The process by which research becomes used in practice has, in fact, been treated as something of a \'black box phenomenon\' \[[@B22]\]. We know that providers base their behavior on many mediating factors, one of which may be research findings \[[@B21],[@B23]\]. Factors such as professional training, clinician experience, organizational context, and administrative support are also influential. Drawing conclusions about the effectiveness of research utilization interventions based on changes in provider behavior alone is probably an unreliable approach, because it is not clear how much of a behavior change can be ascribed to research use and how much to other factors. If provider behavior change results in a patient, or other outcome change, investigators are unable to determine if this is a direct effect (of provider behavior on patient outcome) or an indirect effect, that is, an effect mediated by research utilization. If it is the latter, then understanding which factors are mediated viaa research utilization variable is important as the causal forces that are exerted on that variable may themselves be modifiable but would remain undetected if only behavior change were measured. The aim of this systematic review was to assess the evidence on interventions aimed explicitly at increasing research use in nursing practice. We were interested in reports in which the investigators had explicitly measured research use. We were therefore interested explicitly in studies that used some general measure of research use. Methods ======= Search Strategy --------------- In consultation with a Library Information Specialist familiar with the field, we searched Medline, CINAHL, Healthstar, ERIC, Cochrane Central Register of Controlled Trials, and Psychinfo from inception to February 2006 (Table [1](#T1){ref-type="table"}). Ancestry searches were conducted on relevant studies, and systematic reviews indexed in the Cochrane Database of Systematic Reviews and elsewhere \[[@B6]-[@B11]\]. We searched grey literature using the System for Information on Grey Literature database (SIGLE), the New York Academy of Medicine, and the Sarah Cole Hirsch Institute. We retrieved the majority of relevant studies from our database search from the Journal of Nursing Care Quality, MEDSURG Nursing, Journal of Clinical Nursingand Journal of Gerontological Nursing. We manually searched these journals from 1990 (or their inception) to 2006. ###### Search strategy ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ CINAHL (1982-February 2006) 1. exp NURSING CARE/ 2. exp NURSES/ 3. exp Practice Guidelines/ 4. exp AUDIOVISUALS/ 5. exp PAMPHLETS/ 6. exp \"POLICY AND PROCEDURE MANUALS\"/ 7. exp Nursing Protocols/ 8. exp Staff Development/ 9. inservice\$.mp. 10. exp \"Seminars and Workshops\"/ 11. exp Education, Clinical/ 12. exp Clinical Nurse Specialists/ 13. exp Nurse Practitioners/ 14. exp Staff Development Instructors/ 15. exp Nurse Consultants/ 16. (chang\$ adj2 agent\$).mp. 17. (facilitat\$ adj2 change\$).mp. 18. (coordinat\$ adj2 change\$).mp. 19. exp Quality Assurance/ 20. (critical adj1 appraisal).mp. 21. exp Quality Improvement/ 22. exp Reminder Systems/ 23. (champion\$ adj1 change\$).mp. 24. exp \"Diffusion of Innovation\"/ 25. exp Nursing Practice, Research-Based/ 26. evidence based nursing.mp. 27. (utilizat\$ or utilisa\$ or uptake or transfer\$ or implement\$ or disseminat\$ or diffusion\$ or translat\$).mp. 28. journal club.mp. 29. exp Nursing Practice, Evidence-Based/ 30. 1 or 2 31. or/3--23 32. 31 or 28 33. or/24--27 34. 33 or 29 35. 30 and 32 and 34 36. limit 35 to research Medline (1966-February 2006) 1. exp NURSING/ 2. exp NURSES/ 3. exp Practice Guidelines/ 4. exp AUDIOVISUAL AIDS/ 5. exp PAMPHLETS/ 6. exp MANUALS/ 7. exp CLINICAL PROTOCOLS/ 8. exp Inservice Training/ 9. seminar.mp. 10. workshop.mp. 11. clinical education.mp. 12. exp Nurse Clinicians/ 13. clinical nurse specialist\$.mp. 14. exp Nurse Practitioners/ 15. nurse educator\$.mp. 16. staff instructor\$.mp. 17. exp Consultants/ 18. exp Nurse Clinicians/ 19. (chang\$ adj2 agent\$).mp. 20. (facilitator\$ adj2 chang\$).mp. 21. (coordinator\$ adj2 chang\$).mp. 22. (champion\$ adj2 chang\$).mp. 23. journal club.mp. 24. exp Quality Assurance, Health Care/ 25. exp REMINDER SYSTEMS/ 26. exp \"Diffusion of Innovation\"/ 27. exp Evidence-Based Medicine/ 28. exp Nursing Research/ 29. (utilizat\$ or utlisat\$ or uptake or transfer\$ or implement\$ or disseminat\$ or diffusion\$ or translat\$).mp. 30. 1 or 2 31. or/3--25 32. or/26--29 33. 30 and 31 and 32 PsychINFO (1887-February 2006) exp NURSING/ 2. exp NURSES/ 3. exp Treatment Guidelines/ 4. exp EDUCATIONAL AUDIOVISUAL AIDS/ 5. pamphlets.mp. 6. (policy and procedure).mp. \[mp = title, abstract, subject headings, table of contents, key concepts\] 7. protocol.mp. 8. exp Professional Development/ 9. inservice.mp. 10. workshop.mp. 11. seminar.mp. 12. clinical nurse specialist.mp. 13. nurse practitioner.mp. 14. instructor.mp. 15. nurse consultant.mp. 16. (chang\$ adj2 agent\$).mp. 17. (facilitat\$ adj2 chang\$).mp. 18. (coordinat\$ adj2 change).mp. 19. exp \"Quality of Services\"/ 20. (critical adj1 appraisal).mp. 21. reminder\$.mp. 22. (champion\$ adj1 change\$).mp. 23. diffusion of innovation.mp. 24. exp Decision Making/ 25. (research and (utiliz\$ or utilis\$ or uptake or transfer or implement\$ or disseminat\$ or translat\$)).mp. \[mp = title, abstract, subject headings, table of contents, key concepts\] 26. (knowledge and (utiliz\$ or utilis\$ or uptake or transfer or implement\$ or disseminat\$ or translat\$)).mp. \[mp = title, abstract, subject headings, table of contents, key concepts\] 27. (evidence adj1 practice).mp. 28. journal club.mp. 29. 1 or 2 30. or/2--22 31. 30 or 28 32. or/23--27 33. 29 and 31 and 32 HealthSTAR/Non-medlie (1975-February 2006) 1.exp NURSING/ 2. exp NURSES/ 3. exp Practice Guidelines/ 4. exp AUDIOVISUAL AIDS/ 5. exp PAMPHLETS/ 6. exp MANUALS/ 7. exp CLINICAL PROTOCOLS/ 8. exp Inservice Training/ 9. seminar.mp. 10. workshop.mp. 11. clinical education.mp. 12. exp Nurse Clinicians/ 13. clinical nurse specialist\$.mp. 14. exp Nurse Practitioners/ 15. nurse educator\$.mp. 16. staff instructor\$.mp. 17. exp Consultants/ 18. exp Nurse Clinicians/ 19. (chang\$ adj2 agent\$).mp. 20. (facilitator\$ adj2 chang\$).mp. 21. (coordinator\$ adj2 chang\$).mp. 22. (champion\$ adj2 chang\$).mp. 23. journal club.mp. 24. exp Quality Assurance, Health Care/ 25. exp REMINDER SYSTEMS/ 26. exp \"Diffusion of Innovation\"/ 27. exp Evidence-Based Medicine/ 28. exp Nursing Research/ 29. (utilizat\$ or utlisat\$ or uptake or transfer\$ or implement\$ or disseminat\$ or diffusion\$ or translat\$).mp. 30. 1 or 2 31. or/3--25 32. or/26--29 33. 30 and 31 and 32 34. limit 33 to nonmedline ERIC (1966-February 2006) 1. nurs\.tx 2. (practice guidelines).tx 3. audiovisual.tx 4. (policy and procedure).tx 5. protocol\.tx 6. (staff development).tx 7. (in service).tx 8. seminar.tx 9. workshop.tx 10.(journal club).tx 11.(clinical education).tx 12. (clinical nurse specialist).tx 13.(nurse practitioner).tx 14.instructor.tx 15.consultant.tx 16.(change agent).tx 17.champion.tx 18.coordinator.tx 19.facilitator.tx 20.(clinical educator).tx 21.(quality assurance).tx 22.(critical appraisal).tx 23.(quality improvement).tx 24.(reminder).tx 25.or/2--24 26. 1 and 25 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Inclusion Criteria ------------------ A study was eligible for inclusion if: 1) it was a randomized controlled trial (RCT) or controlled before and after (CBA) design, 2) authors evaluated interventions aimed at increasing research use or evidence-based practice, 3) participants were nurses, and 4) outcomes directly and explicitly captured research use. Only studies in English were assessed. For criterion one, we defined RCT and CBA using Cochrane definitions. To meet criterion two, investigators must have explicitly stated that the research purpose was to test an intervention aimed at increasing research or evidence-based practice. For criterion three, we included both registered and student nurses and did not exclude based on type of nurse (i.e., psychiatric nurse, license practical nurse, etc). However, we did not include studies of nurse practitioners because, we argue, their practice has more similarities to medical practice than nursing. To meet criterion four, investigators must have explicitly described how their chosen outcomes represented research use or have used an instrument designed explicitly to measure research use. We excluded studies unless authors were explicitly clear as to how chosen outcomes captured a conceptualization of research use. This was a clear decision when authors used a tool designed to measure research use. However, to be included when a change in provider behavior was the outcome, the investigator had to have clearly described how the behavior reflected research use. For example, in evaluating the implementation of a clinical practice guideline, the investigator needed to measure all recommended behaviors outlined in the guideline, identify the percentage of recommended behaviors that signified research use, or illustrate how outcomes reflected their conceptualization of research use. If this was not done, we could not be certain the investigators were measuring research use and so we excluded the study. Screening Process ----------------- The search resulted in over 8,000 titles. One author reviewed titles, abstracts and selected studies. Two reviewers each screened 20% of the titles and abstracts. Inter-rater reliability between reviewers was greater than 90%. The initial screening process resulted in 117 studies. Manual and ancestry searching produced an additional 21 studies. Further review of the 138 studies narrowed them to 14 and the final result was four studies meeting the inclusion criteria \[[@B24]-[@B27]\]: three RCTs and one CBA (Figure [1](#F1){ref-type="fig"}). ![Search and retrieval process.](1748-5908-2-15-1){#F1} Excluded Studies ---------------- In the final exclusion of studies, ten of the studies were excluded for two reasons: uncertainty that the outcomes were measuring research use \[[@B28]-[@B31]\], and interventions not explicitly aimed at increasing research use or evidence-based practice \[[@B32]-[@B37]\] (Table [2](#T2){ref-type="table"}). ###### Details of excluded studies First Author Description of Study Purpose Reason for Exclusion from Review -------------------- --------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------------------ Davies ^\[28\]^ To determine whether using a specific intervention would lead to more appropriate implementation of guidelines 1\. Investigators do not describe guideline content and recommendations 2\. Investigators do not specify what percentage or number of guideline recommendations must be met to signify effectiveness 3\. Unable to determine the extent guideline recommendations were followed Hodnett ^\[29\]^ To evaluate the effectiveness of an intervention to promote research-based nursing care 1\. Investigators described the content of the intervention but the outcomes do not correspond to the content 2\. Unable to determine how the outcomes represent research use McDonald ^\[30\]^ To test the effectiveness an intervention to increase nurses adherence to pain assessment and management guidelines, and to improve patient outcomes 1\. Investigators do not specify what percentage or number of recommendations must be met to signify effectiveness 2\. Investigators do not measure all recommendations of the intervention 3\. Unable to determine the extent of recommendation adherence Murtaugh ^\[31\]^ To test the effectiveness of two interventions designed to improve the adoption of evidence-based practices 1\. Investigators do not specify what percentage or number of recommendations must be met to signify effectiveness 2\. Investigators do not measure all recommendations of the intervention 3\. Unable to determine the extent of recommendation adherence Feldman ^\[32\]^ To assess the impact and cost-effectiveness of two interventions designed to improve management and outcomes of patients 1\. Not explicitly aimed at increasing research use or evidence-based practice Feldman ^\[33\]^ To examine the effect of an intervention designed to standardize nursing care, strengthen nurses\' support for patient self management, and yield better patient outcomes 1\. Not explicitly aimed at increasing research use or evidence-based practice Gould ^\[34\]^ To develop, implement, and evaluate an intervention designed to promote nurses\' compliance with key procedures 1\. Not explicitly aimed at increasing research use or evidence-based practice 2\. Unable to determine if \'key procedures\' are evidence-based Jones ^\[35\]^ To develop and test an intervention to improve practices, knowledge, attitudes, and policies 1\. Not explicitly aimed at increasing research use or evidence-based practice Moongtui ^\[36\]^ To evaluate the effectiveness of an intervention on nursing practices 1\. Not explicitly aimed at increasing research use or evidence-based practice Krichbaum ^\[37\]^ To test the effectiveness of interventions designed to improve patient outcomes 1\. Not explicitly aimed at increasing research use or evidence-based practice Methodological Quality ---------------------- We evaluated the studies for methodological quality using two tools available from the Cochrane Collaboration Effective Practice and Organization of Care Group (EPOC) \[[@B38]\]. The RCT tool consisted of items related to unit of analysis, power, baseline measure, concealment of allocation, blinded or objective assessment of outcome(s), protection against contamination, reliable outcome(s), and completeness of follow-up. The CBA tool consisted of items related to unit of analysis, power, baseline measure, comparability of groups, blinded or objective assessment of outcome(s), protection against contamination, reliable outcome(s), and completeness of follow-up. In both tools, unit of analysis errors were determined using the unit of allocation and unit of analysis items. That is, if authors allocated by cluster and analyzed by individual without reporting appropriate statistical measures to account for clustering, we reported unit of analysis errors. If in these cases the authors reported power calculations and did not account for intra-cluster correlations, we scored the power calculation item as done but accounted for the error in the overall rating. We report results in Table [3](#T3){ref-type="table"}. ###### Methodological quality of included studies CBA Methodological Quality Assessment Results and Rating ---------------------------------------------------------- -------------------- ------------------ ------------------- ------------------ ---------------------------- ---------------------------- ---------------------------------- --------------------------- -------------------- ------------------- -------- First Author Unit of Allocation Unit of Analysis Power Calculation Baseline Measure Characteristics of Control Blinded Outcome Assessment Protection Against Contamination Reliable Outcomes Measure Provider Follow Patient Follow Up Rating Tsa i ^\[27\]^ Provider Provide r NC √ √ X NC X √ n/a Low RCT Methodological Quality Assessment Results and Rating First Author Unit of Allocation Unit of Analysis Power Calculation Baseline Measure Allocation Concealment Blinded Outcome Assessment Protection Against Contamination Reliable Outcomes Measure Provider Follow Up Patient Follow Up Rating Dufault ^\[24\]^ Ward Provider \* NC X NC X √ X NC n/a Low Hong ^\[25\]^ Ward Provider \* NC √ √ X √ X & NC NC n/a Low Tranme r ^\[26\]^ Ward Provider \* NC X NC X √ X NC n/a Low √:Done X: Not Done NC: Not Clear \* Unit of analysis error 4/8 or less -- low quality 5/8--6/8 -- medium quality 7/8 or higher -- high quality Two reviewers assessed each study and discrepancies were resolved through discussion. Each item was scored as: done, not done, and not clear. A quality rating was assigned to each study as low, medium, or high depending whether it scored done on zero to four, five to six, or seven to eight items respectively. Unit of analysis errors and incorrect power calculations were noted. We did not use quality assessment ratings to exclude studies because we sought to explore the general state of the science in this field. Data Extraction --------------- We extracted data from four studies representing five experimental cohorts where an intervention was compared to a control. One reviewer independently extracted data from all four studies while two reviewers each extracted data from two of the studies. We used extraction tools and dictionaries available from EPOC \[[@B38]\]. Data on design, subjects, setting, interventions and outcomes were extracted. To facilitate comparison and discussion, we classified interventions using an EPOC classification system \[[@B38]\]. Interventions were classified as: educational meetings, multidisciplinary committees and local opinion leaders. The EPOC classification is used throughout the text (Table [4](#T4){ref-type="table"}). ###### Outcome measure and classification of research utilization intervention Author/Year/Country Study Design Setting and Specialty Description of Intervention(s) Classification Using EPOC Method Outcome Measure -------------------------------------- -------------- ----------------------------- --------------------------------------------------------------------------------------------------------------- ---------------------------------- ------------------------------------------------------------------- Dufault, 1995 United States ^\[24\]^ RCT Hospital/Oncology 1\. Organization of practitioners and researchers aimed at solving a clinical problem using research findings 1\. Multi-disciplinary team Kim\'s Research Utilization Competency Scale ^\[39\]^ Hong 1990 China ^\[25\]^ RCT Hospital/Inpatient 1\. In-service education and demonstration tutorial by opinion leader 1\. Educational meetings Compliance with all clinical practice guideline recommendation s 2\. Local opinion leaders Tranme r2002 Canada ^\[26\]^ RCT Hospital/Medical & Surgical 1\. Workshops about conducting a research study and using the findings 1\. Educational meetings Champion and Leach Research Utilization Questionnaire ^\[40-41\]^ 1\. Workshops about research findings 1\. Educational meetings Champion and Leach Research Utilization Questionnaire ^\[40-41\]^ Tsai, 2003 Taiwan ^\[27\]^ CBA Hospital/Inpatients 1\. Workshops about research utilization 1\. Educational meetings Tsai Research Utilization Questionnaire Several studies in this review reported additional outcomes, for example, on predictors of research use, changes in knowledge or attitudes, or patient outcomes. These were not extracted or reported on as we did not consider them as measures of research use per se. Results ======= Methodological Quality of Included Studies ------------------------------------------ Overall, the quality of the studies was low (Table [3](#T3){ref-type="table"}). Two had unit of analysis errors where the investigators allocated by group but did not account for clustering in the analysis \[[@B24],[@B25]\]. Of the two studies without unit of analysis errors, the investigators of one study allocated by unit and accounted for clustering \[[@B26]\], while the other allocated and analyzed at the provider level \[[@B27]\]. No authors presented power calculations. Two studies had substantial differences in outcomes prior to the intervention \[[@B24],[@B26]\]. Allocation concealment was not reported in two RCTs \[[@B24],[@B26]\]. None of the investigators used blinded or reliable outcome assessments. The CBA investigators did not protect against contamination of the intervention across study groups \[[@B27]\]. However, the RCT investigators all randomized by ward and attempted to protect against contamination \[[@B24]-[@B26]\]. The CBA investigator reported adequate provider follow up \[[@B27]\]. However, the RCT investigators either used separate samples \[[@B25],[@B26]\], or did not report on follow up \[[@B24]\]. Included Studies ---------------- Four studies representing five intervention cohorts in Canada, USA, Taiwan, and Hong Kong met our inclusion criteria (Table [4](#T4){ref-type="table"}). Three were RCTs (four intervention cohorts) \[[@B24]-[@B26]\], and one was a CBA (one intervention cohort) \[[@B27]\]. All studies included nurses from inpatient clinical settings; oncology, medicine, surgery and multiple specialties. Investigators assessed educational meetings delivered to nurses in three studies \[[@B25]-[@B27]\]. In one study, the investigators compared two investigator-provided educational interventions to a control \[[@B26]\]. Because these interventions varied in content and duration, we identified this study as having two cohorts. Another study used a combination of local experts and educators to deliver the intervention \[[@B27]\]. The third study that assessed educational meetings used local opinion leaders identified by the study participants to conduct a demonstration tutorial which was supplemented with education delivered by a local expert \[[@B25]\]. One study investigated the formation of a multidisciplinary team of practitioners and researchers \[[@B24]\]. Within this intervention there were components of education and marketing. However, the investigators based their conclusions on the entire intervention (the multidisciplinary team) rather than the components, therefore, we did not separate the components of this intervention. The investigators of three studies used nurse-administered instruments to measure research use. Dufault \[[@B24]\] used Kim\'s \[[@B39]\] 13-item Likert-type scale that asked participants to rate their research utilization competency on a one to seven scale. Tranmer \[[@B26]\] used the Research Utilization Questionnaire (RUQ) developed by Champion and Leach \[[@B40],[@B41]\]. This 42-item Likert-type questionnaire measured attitudes towards research, access to research, support of the use of research and research use. The questionnaire was divided into corresponding subscales. Because Tranmer \[[@B26]\] reported and analyzed the results of each subscale, we extracted only the data that pertained to the use of research subscale. Finally, using an instrument based on her previous work, Tsai \[[@B27]\] assessed whether research utilization was implemented in nursing practice and to what degree. Tsai\'s instrument consisted of 11 items including single-choice, multiple-choice and open-ended questions. In the final study by Hong, investigators used self-reporting and participant observation to assess practice compliance with all the recommendations from a clinical practice guideline \[[@B25]\]. This study differed from many of the excluded studies that assessed provider behavior change. Specifically, the investigators linked all eight outcomes to the eight practices recommended by the clinical guideline, which was referenced to research, thus providing support that the outcomes did reflect research use. Findings -------- Methodological weaknesses, varied interventions and outcomes across health contexts, incomplete reporting, and the small samples prevented meta-analysis. Instead, we present narrative results. The characteristics and findings of the four studies included in this review are summarized in Tables [5](#T5){ref-type="table"} and [6](#T6){ref-type="table"}. All findings must be interpreted with significant caution given the low quality of studies. ###### Effect of interventions on research use First Author Intervention(s) Outcome(s) of Interest Effect of Intervention(s) on Outcome(s) of Interest ------------------- -------------------------------------------------- ---------------------------------------------------------------------------------- ----------------------------------------------------- Dufault ^\[24\]^ Multidisciplinary team 1\. Kim\'s research utilization competency scale ^\[39\]^ Significant change Hong ^\[25\]^ Educational meetings led by local opinion leader 1\. Proportion of reported catheter practices meeting guidelines recommendations Significant change 1\. Proportion of observed catheter practices meeting guideline recommendations Significant change Tranmer ^\[26\]^, Educational meetings \#1 1\. Champion and Leach Research ^\[40-41\]^Use Questionnaire No significant change Tranmer ^\[26\]^ Educational meetings \#2 1\. Champion and Leach Research ^\[40-41\]^Use Questionnaire No significant change Tsai ^\[26\]^ Educational meetings 1\. Tsai Research Utilization Questionnaire. No significant change ###### Characteristics of included studies and detailed description of intervention First Author Study Subjects Deliverer/Recipient of Intervention Length of Intervention (Dose) Detailed Description of Intervention ------------------- --------------------------------------------------------------------------------------- ------------------------------------------------------------------------------ ------------------------------------------------------------------------- ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Dufault ^\[24\]^ 27 nurses from 4 oncology units Both nurses and researcher s/nurses 28 weeks consisting of 6 sequential phases Nurses and investigators participated in activities related to optimal pain management. The phases included: 1\. Problem identification and assessment of research bases for utilization 2\. Evaluation of research relevancy to problem selection, nursing department values, standards and policies, and potential cost and benefit 3\. Innovation design to meet the needs of the problem within the scope of the research base. 4\. Actual or construct replication and evaluation of the innovation. 5\. Decision to adopt, alter or reject the innovation. 6\. Development of means to extend the innovation within and outside of the setting. Hong ^\[25\]^ 220 nurses surveyed/255 episodes of care observed from 3 medical and 3 surgical units Local opinion leaders and infection control nurses/Nurses and student nurses 30 minute lecture and unspecified length demonstratio n tutorial Infection control nurses provided lectures on research based practices surrounding catheter care. Local opinion leaders provided demonstration tutorials to group of 6--10 nurses following the lectures. Tranme r ^\[26\]^ 235 nurses from 6 medical/surgical units Researchers/nurses 20 hours for \'high\' intervention and 8 hours for \'low\' intervention High intervention: Nurses learned how to review and critique research literature, completed a literature review on a clinical practice, participated in the design of a research study to address the identified clinical problem, and participated in the implementation of the study. Low intervention: Nurses learned about the literature related to a clinical problem and discussed now best to implement the research study. Tsai ^\[27\]^ 89 nurses from multiple clinical units Clinical experts/nurses 65 hour workshops delivered over 8 weeks Research utilization education designed and based on steps of research utilization: 1\. Preparation stage 2\. Confirmation stage 3\. Comparison and assessment stage 4\. Decision stage 5\. Implementation stage 6\. Evaluation stage Educational meetings -------------------- Two studies representing three cohorts tested the effect of interactive educational meetings on research utilization \[[@B26],[@B27]\]. Tranmer measured research use both in nurses who participated and nurses from the same unit as those who participated \[[@B26]\]. There were no significant changes in research utilization scores in either group. This suggests that, based on this study, educational meetings are ineffective whether a nurse participates directly (attending education meetings) or indirectly (working with nurses who attended educational meetings but not attending themselves). However, no definite conclusions can be drawn due to design limitations. Educational meetings of varying content, frequency and duration (Table [6](#T6){ref-type="table"}) were also found to be ineffective. Tranmer, who did not describe frequency of their intervention, reported non-significant changes in research utilization scores regardless of whether the intervention was twenty hours and focused on literature critiquing, research design, and protocol implementation, or eight hours and focused solely research design and implementation \[[@B26]\]. These results are supported by Tsai\'s study, in which she tested a series of educational strategies focused on research use totaling 65 hours and delivered over eight weeks \[[@B27]\]. Interactive educational meetings did not have a delayed effect on research utilization. Tsai measured research use at two points: immediately and six months following the intervention. In both cases, there were no significant changes in research utilization \[[@B27]\]. Similar findings were reported by Tranmer who measured research utilization only once, one year following the start of the intervention and also reported non-significant results \[[@B26]\]. In summary, based on this review, educational meetings of varying content, duration, and frequency cannot be said to be effective research utilization interventions in nursing. The studies were few in number and were of poor quality. Clearly, there is inconclusive evidence and educational meetings require more rigorous investigations to determine their effect in nursing. Educational meetings and local opinion leaders ---------------------------------------------- One study tested the effect of interactive educational meetings combined with a local opinion leader, and found that nurses who attended both the lecture and the tutorial (led by a local opinion leader) reported increased research utilization related to urinary catheter practices \[[@B25]\]. It was not possible to determine whether the positive effect was due to the local opinion leader, the educational meeting, or a combination of both. The intervention consisted of a 30 minute lecture by an educator, followed one week later by a demonstration tutorial conducted by a local opinion leader (Table [6](#T6){ref-type="table"}). The length of the demonstration tutorial was not reported. No data were collected during the lapse between interventions. Outcomes were assessed twice: two weeks and two months following the intervention. The authors used a practice survey at two weeks, and direct observation at two months. Longitudinally, education and local opinion leaders appeared to sustain an increase in research utilization, but this study was also of low quality and represents inconclusive evidence for educational interventions combined with a local opinion leader. Multidisciplinary committees ---------------------------- One study was found in which formation of multidisciplinary committees was reported to be effective at increasing nurses\' research use related to oncology pain \[[@B24]\]. The intervention lasted 28 weeks and was divided into six stages (Table [6](#T6){ref-type="table"}). Each stage was sequential and lasted between two and nine weeks. Stages were constructed around collaboration of members of the multidisciplinary team working to operationalize an existing research utilization process (the Conduct and Utilization of Research in Nursing Project) \[[@B42]\]. Unlike other interventions, education was not the primary component. Outcomes were assessed at one point using a research utilization scale. The investigators did not report the duration between the intervention and outcome measurement. Multidisciplinary committees require further investigation. Summary of Findings ------------------- In summary, the four studies reviewed were of poor quality \[[@B24]-[@B27]\]. The findings of this review represent a lack of evidence to support or refute the benefit of educational meetings for increasing research utilization in nursing, and further study is required. Discussion ========== Study design and implementation must improve before one can comment on the effectiveness of interventions aimed at increasing research use in nursing practice. The current state of the science provides little guidance to individuals charged with implementing strategies to increase research use in nursing practice. We now relate our findings to current literature and provide a discussion of conceptual and methodological challenges facing the field. Comparison with Existing Reviews -------------------------------- In a review of organizational interventions aimed at increasing evidence-based nursing practice, Foxcroft and Cole could locate no rigorous studies \[[@B11]\]. Grimshaw and colleagues \[[@B6]-[@B8]\] published comprehensive reviews of provider behavior change reviews and guideline dissemination strategies. While we were interested specifically in nurses\' research utilization and Grimshaw and colleagues \[[@B6]-[@B8]\] examined broader outcomes (provider behavior change and guideline dissemination), these reviews were all aimed at improving understanding of how to translate research findings into practice. Grimshaw and colleagues \[[@B7]\] concluded that interventions with different educational strategies showed mixed effects depending upon a combination of strategies. We report inconclusive evidence compared to these results \[[@B24]-[@B27]\]. The educational interventions included in our review were small interactive group sessions. In medicine, these types of educational strategies showed the most promise. We did find some limited support for two interventions: multidisciplinary committees and local opinion leaders. Grimshaw and colleagues \[[@B7]\] also found that multidisciplinary collaboration was effective and that use of local opinion leaders showed mixed effects. Similarities and differences between these reviews can be attributed to multiple factors. Perhaps the most obvious is in the review methods. Grimshaw and colleagues \[[@B8]\] had a more robust dataset and derived a single effect size for each of the 235 studies reviewed, as well as summarizing the range of effects and median effects across studies for each intervention. In contrast, we were only able to locate four studies, and were limited to a narrative analysis based on the number of positive and negative results (vote counting). Secondly, investigators of existing reviews have focused on changing provider behavior \[[@B6],[@B7]\], implementing practice guidelines \[[@B8],[@B10]\] and conducting continuing education \[[@B9]\]. We located no review focusing specifically on research utilization. Instead, authors have relied upon changes in patient outcomes, provider behavior, or a combination of both. For example, in a systematic review of guidelines in professions allied to medicine, 24% of nursing studies measured patient outcomes, 24% measured provider behavior, and 53% measured both provider and patient outcomes \[[@B10]\]. Additionally, all four nursing studies included in a review of continuing education and workshops measured provider outcomes \[[@B9]\]. Findings from these reviews \[[@B6]-[@B10]\] are increasingly being used to guide strategies aimed at increasing research use in clinical practice \[[@B13]\]. Hakkennes and Green suggested that authors must choose between assessing changes in provider practice or changes in patient outcomes when evaluating interventions aimed at implementing evidence or changing practice \[[@B13]\]. While this is true for the latter, we argue there is a third and perhaps more accurate choice: assessing changes in research use. By not assessing research use and moving directly to changes in provider or patient outcomes, investigators are treating research utilization interventions as a \'black box\' phenomenon that somehow produces a change in clinician behavior or patient outcomes. Clearly, there are additional factors that influence both clinician and patient outcomes. The assumption that research use is the only mediating factor represents a large gap in the literature, and thus our understanding of how to increase the use of research in practice. Conceptual Challenges --------------------- A major conceptual issue we identified is related to outcome measurement. We excluded several studies due to unclear conceptualizations of research use (Table [2](#T2){ref-type="table"}). Investigators have commonly aligned themselves with a model of evidence-based practice consisting of five steps: 1) converting information needs to an answerable question, 2) locating the evidence, 3) critically appraising the evidence, 4) implementing the evidence in practice, and 5) evaluating care performances \[[@B43]\]. Most often, evaluations of interventions designed to increase evidence-based practice (or in our case, research use) relied upon behavior change outcomes \[[@B13]\]. Using the model outlined above, this approach is synonymous with evaluating care performances (Step five). However, research use is only one of the factors that influence care performance or behavior change \[[@B21]-[@B23]\]. Reliance on behavior change outcomes has treated the implementation stage (Step four) also as a \'black box\' and led to less understanding of how implementation of research in practice occurs. We and others argue that the key to increasing research use in practice lies in the implementation stage \[[@B6],[@B22],[@B44],[@B45]\]. There is a lack of clarity and uncertainty, in fact a near silence, in the research community about what constitutes an appropriate measure of research use \[[@B46]-[@B48]\]. This silence can be partly to blame for a lack of research examining the intervention stage of research use and can be attributed to a poor understanding of the conceptual structure of research utilization \[[@B46],[@B49]\]. Ideally, selecting outcomes to assess the effectiveness of an intervention aimed at increasing research use should be informed by an explicit conceptualization of research use \[[@B22],[@B50]\]. Only two authors in our review explicated how they conceptualized research utilization \[[@B24],[@B26]\]; both offered different conceptualizations, and it was not clear from either how their conceptualization informed outcome selection. Rich argues that misconceptions of how research-based knowledge enters the decision-making process lead to inaccurate measures of research use \[[@B51]\]. Estabrooks and colleagues suggested that \"unresolved measurement challenges present an important and practical problem\" to advancing the field of research utilization \[[@B22]\]. The findings of this review support these claims and suggest such issues persist. Investigators are interested in the link between using research in practice and improving patient outcomes. The abundance of studies focusing on behavior change and patient outcomes as a result of research uptake points at this interest. However, establishing this link is best accomplished if we first develop sufficient evidence to support the relationship between specific interventions and research use. From this, we can explore the relationship between effective research use interventions and behavior change or patient outcomes. If studies aim to evaluate an intervention to increase research use, outcomes must be structured to capture changes in research use. More attention to the fit between study outcomes and the conceptual structure of research use will advance the field by peering into the \'black box\' and producing more accurate results. Common problems with the instruments used in the studies we reviewed, and elsewhere, include lack of theory (measurement or research utilization theory), lack of construct clarity, lack of psychometric assessment, a presumption of linearity, lack of longitudinal work, and influential yet unacknowledged assumptions \[[@B22]\]. Until more reliable and valid instruments are developed, investigators should present explicit statements outlining the conceptual and practical basis for chosen outcomes. Making use of available conceptualizations to operationalize research use would increase the validity and ability to compare results across studies \[[@B16],[@B17]\], \[[@B51]-[@B53]\]. Methodological Challenges ------------------------- The studies in our review were published between 1990 to 2003. Methodological quality (Table [3](#T3){ref-type="table"}) was low in all four \[[@B24]-[@B27]\]. This suggests that the field is not developing within nursing as would be expected. We present what we believe are the most urgent methodological challenges facing the field. Identification of Primary Outcomes ---------------------------------- A primary outcome helps determine the key endpoint signifying the effectiveness of an intervention \[[@B54]\]. Explicit reporting of the primary outcome enables the reader to determine whether the study results provide sufficient evidence for an intervention and to whom the study results apply. In our review, we extracted only research use outcomes. However, three investigators in this review also reported outcomes additional to research use and all three assessed attitude towards research \[[@B24],[@B26],[@B27]\]. The relationship between such characteristics and research use is not well-supported \[[@B55]\]. When authors report on multiple outcomes without discussing why particular measures were chosen or what constitutes the primary outcome, it is difficult to interpret study findings in the context of research utilization. Use of Multiple Outcomes ------------------------ The challenge in using multiple outcomes to evaluate research utilization interventions is determining the number that must be changed to indicate effectiveness \[[@B33]\]. We excluded many studies due to uncertainty that the investigators were actually measuring research use (Table [2](#T2){ref-type="table"}). In these cases, rationale or support for multiple outcomes in the context of research utilization was not provided. It is challenging to determine whether an intervention was effective at increasing research use if there were changes in some, but not all, of the outcomes. Also challenging is determining how many recommendations from clinical practice guidelines must be met to indicate research use, and for this review we included only one study that measured all recommended practices \[[@B25]\]. Measuring all outcomes may not be the most accurate or feasible approach, especially if guidelines recommend large numbers of practices or procedures. Intervention Sustainability --------------------------- Two studies \[[@B24],[@B27]\] measured longitudinal outcomes; one illustrated a benefit of intervention over time (two months) \[[@B24]\] and the other illustrated no effect either immediately or six months following \[[@B27]\]. Longitudinal outcome measurements will advance our understanding of the optimal timing and frequency of outcome evaluation and are needed to establish the sustainability of research use. Titler has described two challenges in assessing sustainability of research utilization interventions: defining the boundary between the end of the intervention phase and the start of the sustainability phase, and timing the outcome measurement to differentiate between sustained improvements and residual effects \[[@B48]\]. Compartmentalizing these stages becomes difficult when multiple and overlapping interventions are tested. Thus far, the literature on research utilization provides little guidance on the optimal timing or length of outcome measurement for different interventions. Hong \[[@B25]\] and Tsai \[[@B27]\] did not report why they assessed outcomes at two and six months. Future investigators should clearly describe intervention characteristics such as duration and frequency, deliverer and receiver, and mode of delivery. Guidelines such as the Consolidation of Standards for Reporting of Trials (CONSORT) \[[@B56]\] or the CONSORT statement for cluster RCTS \[[@B57]\] should be followed. Future reviews would also benefit from using a common classification system for interventions. We used a classification system proposed by EPOC. However, this approach may require adaptation for use in nursing and needs to be examined and validated. Unit of Analysis Errors ----------------------- Two RCTS included in our review had unit of analysis errors (Table [3](#T3){ref-type="table"}) \[[@B24],[@B25]\]. Unit of analysis errors occur when investigators assign clusters or groups of individuals to a study group (i.e., intervention or control), and then analyze as if each individual had an equal chance of being assigned to either group \[[@B58]\]. When this occurs, outcomes for each individual are not independent of others within the same group. This is a unit of analysis error because people within clusters share similarities (i.e., burn unit and psychiatric nurses are each familiar with different practices) that may not be accounted for during analysis. When clustering is ignored, the number of participants required (sample size) is underestimated and the level of study significance (p value) is overestimated, resulting in an over-estimate of the precision of the result \[[@B59]\]. Future studies should be designed and analyzed using methods that account for clustering if allocation is done by groups of individuals, and allocation procedures should be unbiased (i.e., central randomization) and explicitly outlined in study reports. Limitations ----------- This systematic review has some limitations. First, we did not conduct a meta-analysis because of lack of effect sizes and a small size. The method we used (vote counting) is a crude estimate of effectiveness. Second, we used the EPOC classification that was developed for broad use \[[@B38]\]. Its applicability specifically to nursing has yet to be established. Third, the four studies included were all of low quality. Including studies of low quality limits any conclusions. Fourth, we included only studies published in English. While researchers have reported that language restrictions do not change the results of systematic reviews on conventional medicine interventions \[[@B60],[@B61]\], the impact of language restriction on research utilization intervention systematic reviews is unknown. However, it is possible that we missed potential studies due to our language restriction. Finally, because we focused on research use as the outcome of interest specific to intervention effectiveness, comparisons between our review and those of others must be made cautiously. Conclusion ========== Little is known about how to increase research use in nursing and we currently lack evidence to either support or refute the effectiveness of specific interventions. Advancing the field of research utilization interventions in nursing requires methodological and conceptual advancement. If investigators aim to establish a link between using research and improved patient outcomes they must first establish those interventions that are effective at increasing research use. Competing interests =================== The author(s) declare that they have no competing interests. Authors\' contributions ======================= CE, SSF and LW conceived the study. CE, SSF, LW and KM supervised DT\'s thesis. SSF and LW validated the search design, article selection, data extraction, and quality assessment. CE, SSF, and LW validated the analysis. DT designed and performed the search, selected the articles, assessed the quality of included studies, extracted the data, analyzed the results and wrote the manuscript. CE, SSF, LW, and KM reviewed the paper and participated actively throughout the writing of the paper. All authors read and approved the final manuscript. Acknowledgements ================ Mr. Thompson was supported by the Canadian Centre for Knowledge Transfer. Dr. Estabrooks is supported by a Canadian Institute of Health Research (CIHR) Canada Research Chair in Knowledge Translation. Dr. Scott-Findlay is supported by CIHR and Alberta Heritage Foundation for Medical Research (AHFMR) post-doctoral fellowships. Dr. Lars Wallin was supported at the time of this research by CIHR and AHFMR post-doctoral fellowships. Dr Wallin is currently supported by the Clinical Research Utilization Unit, Karolinska University Hospital, Stockholm, Sweden. We thank Connie Winther for assisting with the search strategy. Ms Winther is a Knowledge Management Officer with the Knowledge Utilization Studies Program at the Faculty of Nursing, University of Alberta.
Q: Inherrit Page_Load from base class. Correct Object Oriented programming I have functionality I reuse in every web form. So I want this reuse in a base class and have the web form inherit the base class. Does my example use correct Object oriented practice ?? Here is an example: using System; using System.Web; namespace Template1 { public abstract class AllPageBaseClass : System.Web.UI.Page { public AllPageBaseClass() { this.Load += new EventHandler(this.Page_Load); } protected void Page_Load(object sender, EventArgs e) { if (Session["stuff"] == null) Response.Write("Session Is Empty"); // More error checking common to all pages here } } } using System.Lots_Of_Stuff; // Do I need System; and System.Web; here ?? namespace Template1 { public partial class Home : AllPageBaseClass { protected new void Page_Load(object sender, EventArgs e) { // All unique Page_load stuff here } .... } } A: You don't need to subscribe to the Load event. Example of one of my projects: public class SecuredPage:System.Web.UI.Page { protected override void OnInit(EventArgs e) { base.OnInit(e); if (...) { // do something } } } Your contentpage should look like this: public partial class Home : AllPageBaseClass { protected void Page_Load(object sender, EventArgs e) { // All unique Page_load stuff here } .... } You may also have a look at what the new operator is for.
Brothers & Sisters (season 4) The fourth season of Brothers & Sisters was picked up for a fourth season on April 23, 2009. The premiere aired on ABC on Sunday September 27, 2009, and concluded May 16, 2010. Season Four began three months after the events of 'Mexico'. Cast Most the main characters from the previous season returned; however, Tommy (Balthazar Getty) appeared only briefly mid-season, having relocated to Seattle. Sarah Jane Morris left the series, while Luke Grimes was promoted to starring status as newest Walker son, Ryan, only to be written out mid-season. The storyline followed the final demise of Ojai Foods and the discovery of Narrow Lake (an untapped aquifer that made the family rich), as well as the rocky relationship of the finally-married Justin and Rebecca and the politically volatile Kitty and Robert. Denzel Whitaker, 19, was cast as Carter - Justin's new lab partner - for several episodes as Justin attempted medical school. Gilles Marini joined the show as Luc Laurent, an artist Sarah meets in France and who eventually follows her home to Pasadena. He was first confirmed for a five episode arc before joining as a permanent part of the Walker tribe. It was announced that Rob Lowe would be leaving the series at the end of the fourth season; the reason he gave was that he felt "underutilized". It was speculated that he would move to a recurring character and not be killed off, a theory supposedly first supported by the news that the character 'Alec Tyler' who caused problems between Robert and Kitty in the previous season was set to return. However, after lengthy coverage and confirmation that Lowe would leave the series, his injury and subsequent death ended the season and began the next. The show sought out actors to play certain characters at younger ages for what were first planned as double flashback episodes to air in the second half of the season. Roles for the 1973 scenes were to include William Walker at 33, Nora Walker at 28 and Holly Harper at 21. The 1986 scenes included Sarah Walker at 20, Kitty Walker at 18, Tommy Walker at 16, Kevin Walker at 14 and a 6-yr old Justin. Ultimately, only the 1986 scenes were utilized, featuring the 5 children and Sally Field as a young Nora (although mainly heard and seen in shadow only), in a storyline that revealed a long-hidden family secret about Kevin accidentally causing a friend's paralysis, and Nora and Holly in partnership trying to fend off a hostile takeover from Dennis York, William's former "enforcer" who attempted to blackmail Nora. Main Dave Annable as Justin Walker Maxwell Perry Cotton as Cooper Whedon Kerris Dorsey as Paige Whedon Sally Field as Nora Walker Calista Flockhart as Kitty Walker Balthazar Getty as Tommy Walker Rachel Griffiths as Sarah Walker Luke Grimes as Ryan Lafferty Rob Lowe as Robert McCallister Luke Macfarlane as Scotty Wandell Matthew Rhys as Kevin Walker Ron Rifkin as Saul Holden Emily VanCamp as Rebecca Harper Patricia Wettig as Holly Harper Recurring and notable guest stars Gilles Marini as Luc Laurent Sarah Jane Morris as Julia Walker Ken Olin as David Caplan Daniel and David Oshionebo as Evan Walker-McCallister Marion Ross as Ida Holden Tom Skerritt as William Walker Denzel Whitaker as Carter Anna Wood as young Sarah Walker Cody Longo as young Tommy Walker Kasey Campbell as young Kevin Walker Kay Panabaker as young Kitty Walker Dylan Thomas Larsen as young Justin Walker Storylines Nora Nora begins to date a younger man, Simon, an oncologist who volunteers at her cancer shelter - however Sarah and Kevin become suspicious after they discover he was sued twice as a doctor and believe he had his license taken away. After Nora gives him a sizable amount of money, he apparently loses interest in her and tells her he has to travel for a few weeks. Upon his return, Sarah tries to convince her mother that Simon is up to no good, but it turns out Nora is already aware of this and hands him over to the police. Nora also spends time taking care of Kitty as she, along with her husband Robert and son Evan, move in with Nora during her cancer treatments. Dennis York, an old associate of William's, reappears and blackmails Nora with a secret she has been keeping that could tear apart her family. He agrees not to reveal this secret if she convinces her children to sell their shares in Ojai to him. While trying to talk her children into agreeing, Nora brings Tommy home to talk to Sarah, who is most against selling the company. Nora eventually reveals that she and William had been paying off the family of a young boy who became paralyzed after a fight with Kevin. She and Holly also investigate York's reasons behind wanting Ojai when the company is in such financial trouble and believe the answers lie in land that William purchased called 'Narrow Lake,' which is later revealed to be an anagram of 'Nora Walker'. In the episode 'Lights Out,' Nora and Sarah discover that William was planning on building Nora a house on Narrow Lake. Nora keeps secretly drilling at Narrow Lake, despite Sarah being skeptical. It's revealed that beneath Narrow Lake lies a water main, and now Ojai will become a water company. Kevin & Scotty Kevin and Scotty hope for a baby and decide to look into surrogacy. They continually disagree on the ways in which to approach it, especially when it comes to decisions involving their surrogate, Michelle. Scotty learns his father had an affair and is divorcing his mother. Soon after, Scotty must leave his job, as his restaurant hits financial trouble and must be closed down. After Robert decides to leave office after his term ends, Kevin becomes unemployed and takes some time to decide what he wants to do with his life. He discover that when Kevin was a teenager and struggling to accept he was gay, he started a fight with a boy, Aaron, who tried to kiss him, resulting in him falling off a platform at Ojai. Although William and Nora told Kevin that Aaron was fine, it is revealed in 'Time After Time' that Aaron is in fact paralyzed, and William and Nora have been paying his family ever since. This creates a massive strain in Kevin's relationship with his mother, although they begin to re-bond on his birthday. Kevin and Scotty also discover their surrogate is pregnant. In the episode 'Love All,' Scotty and Saul begin to make plans to open their own restaurant, while Kevin begins to feel unhappy with being unemployed. He tells Scotty to go forward with the restaurant while he figures out his purpose. In the season finale, Scotty is hosting a dinner with the family revealing his new menu. While preparing in the kitchen, Saul discovers that an old partner of his is living with AIDS. Scotty and Kevin tell Saul that they get tested every year and that he should, too. Saul is defensive because he hasn't been sexually active in years and feels that he doesn't need to. Yet, Saul gets tested, and while waiting for the results, he blows up at Scotty and Kevin. He tells them that when he was growing up, the world was a lot less accepting of his lifestyle. Later on, with Nora by his side, Saul calls for his results and tells her that he's negative, and that he'll be okay. In the final car crash scene, after Kevin sees that Scotty is okay, he goes to Saul to see if he's all right. Saul has blood on his hands and face, but tells Kevin not to come closer, that he can't come closer and touch him, implying that he is HIV positive. Kitty & Robert Kitty and Robert's marriage is still damaged from the events of the last year; however, after Kitty discovers she has stage 3 lymphoma, their relationship begins to heal. Robert, supported by Kitty, continues to run for governor as she begins chemotherapy. Shortly before Justin and Rebecca's wedding, Kitty goes for an MRI scan that reveals that the chemotherapy has not worked and the tumors have increased both in size and quantity. At first, she lies to Robert and insists that the results will not be ready until after the wedding; however, she collapses during the ceremony and is taken into the ER, where it's discovered she has a clot on her lung and the cancer is becoming more aggressive. The doctors inform her that her only real chance is to undergo a bone marrow transplant and she must look to her siblings to find a match. The only match is Ryan, who initially refuses. Later, he appears at the hospital and agrees to donate his bone marrow, because he does not want Evan to grow up with an absent parent like him. The transplant is a success, and Kitty enters remission. Robert agrees to drop his gubernatorial campaign at the same time that Kitty begins talking to Buffy, an old friend, about returning to a life in politics. After Kitty tells Robert, he thinks she should run for his seat. They put the decision to a family vote. After some initial hesitation from Kevin, who is unsure of his future in the job, they all agree that she should run. Toward to end of the season, Robert begins collecting evidence against a politician named Stanton and gains the suspicion of Kevin. Although Robert promises he is doing nothing dangerous or unethical, once Stanton catches on to what Robert is up to, Stanton threatens to ruin Kitty's career if Robert goes ahead with his information. Kitty begins campaigning, bringing Nora and Sarah along. Robert has taped proof of Stanton earning money off the backs of American soldiers. He refuses to release the tapes because Stanton threatened Kitty, but he will keep them safe. Meanwhile, Robert speaks to Justin secretly and gives him the key to his safety deposit box. An envelope is inside. Robert tells Justin that if anything happens to him, he should give the key to Kitty and she'll decide what to do with it. Justin notices a certain medicine that Robert is taking and it looks serious. Lies about Kitty end up on the Internet. They said Kitty was campaigning in a private jet paid for by the tax payers, and that her wig cost $4,300, which is unnervingly accurate. At dinner at the Ojai House, Justin confronts Robert about all the secrecy and his medication. Robert says that he's been having more complications with his heart. Justin feels like he can't keep all of this a secret. So Robert asks for the key back because he can't trust Justin. Before Robert gets the key, they're interrupted for dinner. At dinner, Robert starts feeling dizzy and asks for an ambulance. At the hospital, Robert finally tells Kitty what he's been up to. On the car ride home, Kitty tells him that he should release the tapes to get at Stanton. In the final scene, Kitty and Robert's car hits a truck. Kitty is okay, but Robert is hurt badly. She calls for Justin, but Robert tells Justin to go help Holly and that he'll wait for the ambulance. Robert is fading, and Kitty tells him to talk to her. He tells her that she was right about his being afraid that he couldn't keep up with Evan after his heart attack. He tells Kitty how strong she was when she held Evan in his arms. Robert begins to fade, and then he stops talking and it ends with him in a coma. Justin & Rebecca Justin begins an accelerated medical school program and is paired with a highly intelligent, but socially challenged, lab-partner named Carter who makes Justin feel bad for not doing as well in school because of Justin's family obligations. As Justin and Rebecca prepare for their wedding, their relationship becomes strained when she discovers she's pregnant. Seeing the pressure he is already under from his studies, Rebecca initially decides not tell him but finally does just as he finds out he has not done well on his mid-term exams and is put on academic probation. During his bachelor party, Justin breaks and drinks a glass of champagne, rows with Kevin and storms out while Robert tells the other Walkers that Rebecca is pregnant and that they should support Justin. At Nora's, Justin confides in Rebecca that he had a drink and is worried he is out of control of his addiction. At a Narcotics Anonymous meeting, he confides that he is having his own doubts about marriage and fatherhood but loves Rebecca, not knowing that her father is in the back of the room. Justin does not show up to the wedding rehearsal leaving Rebecca thinking he has changed his mind. In fact, he witnesses a small boy being hit by a car and goes to his rescue which makes him realize how much he wants to be a father and her husband, and rushes home to tell her this. They are later just about to be married when Kitty collapses at their wedding. Soon after this Rebecca suffers a miscarriage, devastating her and causing a rift between her and Justin when she avoids spending time with him and talking about what happened. But, after they begin to communicate they become close and move past losing their baby. While investigating Narrow Lake with Holly, Justin sees a Marriage Hall and tells Rebecca they should get married right there and then because after everything that's happened, he doesn't want to wait any longer. They spend their honeymoon at the Ojai Ranch, where the entire family turns up to celebrate. After discovering one of his friends went back to the war and was killed, Justin begins to feel uncertain about his future in medicine and tells Rebecca he wants to feel part of a team, as he did when he was a soldier. This leads to Justin suggesting they move to Haiti for a year with a medical student program, allowing him to help those in need and Rebecca to continue her passion for photography. Rebecca, however receives a job offer at one of Ojai's rival companies following the closing of Ojai. Rebecca tells Justin that she accepted the job offer. Justin feels that Rebecca has made the decision for them not to go to Haiti. Rebecca suggests that as a compromise, she could stay here and Justin go to Haiti for a year, but Justin says as newlyweds they should be together. After dinner at the Ojai House, Justin asks Rebecca if she was serious, and she says yes. She wants them both to be happy and not resent each other. In the final scene, Justin and Rebecca are the last to arrive at the car pile-up. Justin rushes around to help as many people as he can, while Rebecca looks for Holly. She finds Nora who tells her she can't get Holly out the car. Rebecca calls Justin over as he attempts to help Robert. He's able to wake up Holly, and wrap his jacket around her. Sarah Sarah is briefly seen in the premiere explaining she has endured a terrible summer of online dating and retreated to France for a much-needed vacation. She lands back in California with a new French beau, Luc, who helps her question her view on men and relationships. After living together for a short time, he decides to leave again after realizing his free-spirited attitude and her corporate and family lifestyle do not work together. Sarah then meets a single dad at Paige's science fair and the two hit it off. Just as their romance heats up, Sarah receives contact from Luc and realizes she still has feelings for him. After ending things with Roy, she and Luc resume their relationship which hits yet another obstacle as Luc finds it difficult to renew his visa and faces being deported. In the episode 'Where There's Smoke', Luc wins the lottery to get a green card, however now that their lives have become real the couple begin to have problems, especially concerning Cooper who has been acting out. Luc tells Sarah he needs to define his own relationship with the kids. Sarah is depressed after Ojai closes. She sits on her couch for three days eating pizza. Nora has her go on the campaign bus with her and Kitty. Throughout it, Sarah drinks wine and watches soap operas. Later, Sarah gets a call from Holly and they sit down and discover the water main at Narrow Lake, which she, Nora, and Holly have ownership of. Ojai will now be a water company. In the final crash scene, Sarah is shown to be okay and calls 911. Tommy Tommy comes home from Mexico and reveals he and Julia are getting a divorce and he has not spoken to Elizabeth in months. After talking to Kitty and his mother, he decides to go to Seattle to restore his relationship with his daughter. He briefly returns with Elizabeth, breaking the terms of his custody agreement by crossing the state-border for Justin's wedding. Kevin contacts Julia and tells her what Tommy has done and convinces Julia not to call the police. But, then Julia turns up at the Walker house during the wedding rehearsal and demands that Elizabeth leave with her because she cannot trust Tommy anymore. She stays with Kevin and Scotty for the night and relents, allowing them to take Elizabeth to the wedding and see Tommy. Tommy returns once again and stays with his mother as he helps her deal with Dennis York. After Tommy tries to extract information from York, along with Kevin and Justin, York retracts his offer. Tommy helps the rest of the family sell off Ojai assets and, with Sarah, organizes its closure. Ryan Ryan begins the season plotting with Dennis York to bring down Ojai so Ryan could get revenge on William for what he believed William did to his mother. Ryan sabotages the wine storage machines, thereby destroying Ojai's award-winning product and making it impossible for the company to be saved from financial ruin. Ryan is caught by Holly, who threatens to turn him into the police. However, Saul intervenes and Ryan is spared from criminal charges. Ryan's last storyline involves him donating his bone marrow to Kitty after she collapses at Justin and Rebecca's wedding, and attempting to come to peace with the Walkers. The character's last appearance is in "A Bone to Pick," and following that episode the character vanishes without explanation. In an April 2010 interview, David Marshall Grant, the Brothers and Sisters show runner, stated the Ryan character was not working within the context of the show, and the character would not be returning. Ojai Foods Holly discovers most of her financial investments have vanished, due to a fraud scandal and she is thus much less wealthy than she thought. This position leaves Ojai in trouble, so she suggests creating a new low-priced wine 'Coastal Reserve' to save the company. Dennis York, a man from William Walker's past, persuades Ryan, who is still furious with William, to join him in gaining control of Ojai behind the Walker family's back. Ryan shares confidential information with Dennis and destroys the stock of the new wine. After discovering this, Holly begins questioning why Dennis would want to take over a financially struggling company, leading her to investigate the true value of Ojai. Dennis York blackmails Nora into convincing her children to sell Ojai to him, which leads Nora to join Holly in investigating the company's hidden worth. Rebecca gives the company her $2 million savings giving the family time to discover the secret. Although the family begins to agree it may be time to sell and let go of the company, Dennis York retracts his offer. Ojai is officially closed in the episode "Lights Out," but at the same time, Nora and Sarah find plans which show that William was planning on building a house for Nora on Narrow Lake. Nora pays for a few days further drilling at Narrow Lake and, in the season finale, they discover a large water reserve. Episodes Ratings The season average for the show was once again down from the previous season, averaging 9.48 million viewers. References Category:2009 American television seasons Category:2010 American television seasons
INTRODUCTION ============ In female meiosis, two rounds of highly asymmetric meiotic divisions produce a single oocyte that inherits the majority of cytoplasm, with excluded polar bodies. In contrast to mitotic spindles, which consist of microtubules (MTs) formed mainly at centrosomes, female meiotic spindles in many animals are assembled in the absence of centrosomes, which are eliminated during oogenesis ([@B32]; [@B14]; [@B33]). Centrosome-independent MT assembly in meiosis has been characterized in several model systems. In extracts of Xenopus oocytes arrested at G2/M in meiotic prophase I, condensed chromosomes can promote MT assembly ([@B18]; [@B20]) in a manner dependent on the small GTPase Ran ([@B6]; [@B16]; [@B27]). In mouse oocytes, \>80 microtubule-organizing centers (MTOCs) are formed during meiotic prophase, which then cluster and increase MT mass in a RanGTP-dependent manner ([@B34]). However, it was also reported that Ran might be dispensable for the formation of the female meiosis I spindle in mice and Xenopus ([@B10]), implying that multiple MT assembly pathways may contribute to the formation of female meiotic spindles in vertebrates. As in vertebrates, female meiotic spindles of the nematode Caenorhabditis elegans are formed in the absence of centrosomes ([Figure 1](#F1){ref-type="fig"}; [@B1]; [@B25]; [@B9]). Whereas the γ-tubulin complex, a conserved MT nucleator, is essential for assembly of normal female meiotic spindles in Drosophila and mice ([@B37]; [@B2]; [@B22]), previous studies indicated that this complex is dispensable for the formation of meiotic spindles in C. elegans ([@B4]; [@B25]). It is unknown how MTs composing female meiotic spindles are assembled in C. elegans embryos. ![Formation of a female meiotic spindle in C. elegans from GVBD at meiosis I to the beginning of meiosis II. MTs and chromosomes are indicated by green and red, respectively.](4187fig1){#F1} Aurora A is a conserved mitotic kinase required for centrosome maturation and spindle assembly in many organisms, including C. elegans ([@B15]; [@B35]; [@B17]; [@B3]; [@B39]; [@B21]; [@B29]). In mouse oocytes, depletion of Aurora A causes mislocalization of MTOCs and formation of aberrant female meiotic spindles ([@B8]). Previously we reported that, during mitosis in C. elegans early embryos, the kinase-inactive form of Aurora A/AIR-1 is required for the assembly or stabilization of γ-tubulin--independent MTs ([@B26]; [@B38]). However, it has not been investigated whether AIR-1 is involved in the formation of female meiotic spindles. In this study, we analyzed the roles of AIR-1 in C. elegans female meiotic spindle formation. We found that, whereas the kinase activity of AIR-1 is likely dispensable for the initial MT assembly at germinal vesicle breakdown (GVBD), it is essential for the formation and/or maintenance of spindle MTs throughout meiosis after GVBD. RESULT AND DISCUSSION ===================== AIR-1 is required for stabilization of MTs around chromosomes during prometaphase/metaphase of female meiosis ------------------------------------------------------------------------------------------------------------- To examine the functional requirement of AIR-1 in C. elegans female meiosis, we observed MT behaviors in live air-1(RNAi) meiotic embryos expressing green fluorescent protein (GFP)::β-tubulin and mCherry::Histone. In control RNA interference (RNAi) embryos (18 of 18), formation of the female meiotic spindle occurred as previously described ([Figures 1](#F1){ref-type="fig"} and [2Aa](#F2){ref-type="fig"} and Supplemental Video S1a; [@B1]; [@B41]; [@B25]; [@B9]). At the onset of GVBD during oocyte maturation, β-tubulin signals accumulated, and MTs were formed in the oocyte nucleus located near the distal cortex ([Figure 2Aa](#F2){ref-type="fig"}, 120 s). The MTs and condensed chromosomes were then assembled into a spherical structure ([Figure 2Aa](#F2){ref-type="fig"}, 420 s). This MT sphere migrated toward the cortex and became bipolar at metaphase ([Figure 2Aa](#F2){ref-type="fig"}, 720 s). At anaphase, the bipolar spindle rotated 90° and shortened along its bipolar axis ([Figure 2Aa](#F2){ref-type="fig"}, 1200 s). As the bipolar spindle MTs gradually decreased, interchromosomal MTs were formed between segregating homologous chromosomes ([Figure 2Aa](#F2){ref-type="fig"}, 1440 s), followed by polar body exclusion. The second meiotic spindles were formed in a similar manner. ![AIR-1 is required for the formation of female meiotic spindles. (A) In utero time-series images of female meiotic spindles visualized by GFP::β-tubulin (green) and mCherry::Histone (red). (a) Control, (b) air-1(RNAi), (c) tbg-1(RNAi), and (d) air-1(RNAi);tbg-1(RNAi) embryos. Frames were taken every 60 s, and representative images are shown. The time (in seconds) relative to GVBD is indicated. Bar, 5 μm. (B) Quantification of meiotic spindle MTs. Each dot represents the relative fluorescence intensity of GFP::β−tubulin in the meiotic spindle regions normalized with the fluorescence intensity of mCherry::Histone (n = 5). (a) Prometaphase (120 s after GVBD). (b) Metaphase to early anaphase (720 s after GVBD). Pairs with significant difference, \\p \< 0.01. (C) In utero live images of meiotic spindle MTs visualized with mCherry::β-tubulin (green) and GFP::ASPM-1 (red). (a) MT sphere at prometaphase in a control embryo. (b) Bipolar spindle at early anaphase in a control embryo. (c) MT sphere in an air-1(RNAi) embryo. Bar, 5 μm.](4187fig2){#F2} In all air-1(RNAi) meiotic embryos (13 of 13), MTs were formed in the oocyte nucleus at early prometaphase as in the control embryos ([Figure 2Ab](#F2){ref-type="fig"}, 120 s), whose amount was equivalent to that of the control (median of relative fluorescent intensity of GFP:: β-tubulin at 120 s after GVBD; 2.39 arbitrary units (a.u.) in the control (n = 6) and 2.59 a.u. in air-1(RNAi) (n = 5; p \> 0.1; [Figure 2Ba](#F2){ref-type="fig"}). These MTs formed sphere-like structures around chromosomes as they migrated toward the cortex ([Figure 2Ab](#F2){ref-type="fig"}, 420 s). However, the MT spheres shrunk without forming bipolar spindles, and chromosomes were never aligned ([Figure 2Ab](#F2){ref-type="fig"}, 420--780 s, and Supplemental Video S1b). The MTs composing the spheres were significantly decreased by the time corresponding to metaphase to early anaphase in the control embryos (at 720 s after GVBD; 2.54 a.u. in the control \[n = 6\] and 2.12 a.u. in air-1(RNAi) \[n = 5\], p \< 0.01; [Figure 2B](#F2){ref-type="fig"}). This shrinkage of MT spheres in the air-1(RNAi) embryos occurred substantially earlier than the spindle shortening at anaphase in the control embryos, and eventually MTs became nearly undetectable ([Figure 2Ab](#F2){ref-type="fig"}, 780 s). Subsequently, MTs---likely to correspond to the meiosis II spindle MTs---were often reassembled around chromosomes to form sphere-like structures, which also shrunk and disappeared without forming bipolar spindles (unpublished data). These observations indicate that, in contrast to early mitosis, in which AIR-1 is essential for the assembly of chromatin-dependent MTs ([@B38]), the major role of AIR-1 in female meiosis is to maintain MTs formed around chromosomes but not the initial MT assembly. Previous studies reported that RNAi depletion of γ-tubulin (TBG-1) in C. elegans embryos did not inhibit meiotic spindle assembly ([@B4]; [@B25]), which was confirmed by our observation using mCherry::TBG-1--expressing embryos. In the tbg-1(RNAi) embryos, whereas the mCherry::TBG-1 signal was undetectable and mitotic spindle formation was severely inhibited (Supplemental Figure S1), meiotic spindle formation was unaffected (5 of 5 embryos; [Figure 2Ac](#F2){ref-type="fig"} and Supplemental Video S1c). The fluorescence intensities of GFP::β-tubulin in the meiotic spindle regions in tbg-1(RNAi) embryos were not significantly reduced at either 120 or 720 s after GVBD (n = 5, p \> 0.05; [Figure 2B](#F2){ref-type="fig"}). To examine whether γ-tubulin contributes to the assembly of meiotic nuclear MTs in the absence of AIR-1, we observed the female meiosis in air-1(RNAi);tbg-1(RNAi) embryos. In these embryos, although mitotic spindle MTs were barely formed (Supplemental Figure S1A), the amount of meiotic MTs around chromosomes was equivalent to that of air-1(RNAi) embryos ([Figure 2, Ad and B](#F2){ref-type="fig"}, and Supplemental Video S1d). These results suggest that formation of MTs in meiotic nuclei requires neither γ-tubulin nor AIR-1 but that a previously unknown MT formation pathway is likely involved. (Because of the technical limitation of RNAi experiments, we cannot exclude the possibility that trace amounts of γ-tubulin and AIR-1 that are insufficient to form mitotic MTs might be sufficient for meiotic MT assembly.) To analyze further which process of meiotic spindle formation is defective in air-1(RNAi) embryos, we observed the localization of ASPM-1, the orthologue of Drosophila Abnormal Spindle (Asp; [@B30]; [@B40]), which localizes to poles of meiotic spindles and is redundantly required for establishing bipolarity of meiotic spindles ([@B7]). In control embryos, GFP::ASPM-1 at prometaphase was detected as multiple foci on MTs around chromosomes ([Figure 2Ca](#F2){ref-type="fig"}), which then gradually gathered at two spindle poles at metaphase and early anaphase (5 of 5 embryos; [Figure 2Cb](#F2){ref-type="fig"}). In air-1(RNAi) meiotic embryos during the shrinkage of MT spheres, GFP::ASPM-1 was detected as more than two foci (5 of 5 embryos) ([Figure 2Cc](#F2){ref-type="fig"}), indicating that the MT spheres failed to establish bipolarity. In mitosis of C. elegans early embryos, the kinase activity of AIR-1 is required for centrosome maturation but is dispensable for the formation/maintenance of MTs assembled around chromosomes ([@B17]; [@B38]). Therefore we examined whether the assembly of meiotic spindles requires the kinase activity of AIR-1, using the embryos expressing wild-type GFP::AIR-1 or a kinase-inactive form of mCherry::AIR-1 (AIR-1^K73RT201A^) from RNAi-resistant transgenes ([Figure 3A](#F3){ref-type="fig"} and Supplemental Figure S2). In both transgenic strains, the protein levels of transgenic AIR-1 or AIR-1^K73RT201A^ were approximately half of the endogenous AIR-1 (Supplemental Figure S2A). Under the condition that the endogenous AIR-1 was depleted by RNAi, the wild-type GFP::AIR-1 from the RNAi-resistant transgene rescued the meiotic defects (four of four embryos; Supplemental Figure S2Ba). In contrast, mCherry::AIR-1^K73RT201A^ did not rescue the meiotic spindle defects (13 of 14 embryos), and the meiotic phenotype was equivalently severe in air-1(RNAi) embryos lacking or expressing AIR-1^K73RT201A^, in that the MT spheres around chromosomes shrunk before establishing bipolarity ([Figure 3A](#F3){ref-type="fig"} and Supplemental Figure S1B). Thus, in contrast to mitosis, the kinase activity of AIR-1 is required for the maintenance of MTs around chromosomes during meiotic prometaphase/metaphase. ![Kinase activity of AIR-1 is continuously required for the formation/maintenance of MTs after bipolar spindle establishment (A) Ex vivo live images of meiotic spindles visualized by GFP::β-tubulin (green) and mCherry::Histone (red). Control embryo at early anaphase, air-1(RNAi) embryo, and air-1(RNAi) embryo expressing mCherry::AIR-1^K73R\ T201A^ (kinase-inactive form; not visible with this image contrast) are shown. Bar, 5 μm. (B) In utero live images of meiotic MTs visualized by GFP::β-tubulin (green) and mCherry::Histone (red). Interchromosomal MTs of a control embryo at late anaphase, air-1(RNAi) embryo, and air-1(RNAi) embryo expressing the kinase-inactive form mCherry::AIR-1^K73R\ T201A^ (kinase-inactive form; not visible with this image contrast) at equivalent stages are shown. Bar, 5 μm. (C) Ex vivo time-series images of female meiotic spindles visualized by GFP::β-tubulin (green) and mCherry::Histone (red). (a) Control (buffer only) and (b) treatment with 50 nM MLN8237 (Aurora A kinase inhibitor). Buffer or MLN8237 was administered at 0 s. Frames were taken every 60 (a) and 80 (b) s, and representative images are shown. Bar, 5 μm.](4187fig3){#F3} AIR-1 is continuously required for the maintenance of MTs after bipolar spindle formation ----------------------------------------------------------------------------------------- After the establishment of bipolar spindle at meiotic prometaphase/metaphase, MTs are dynamically rearranged. In anaphase, concomitantly with the shortening of the bipolar spindle structure, interchromosomal MTs are formed between separating chromosomes. We next examined whether AIR-1 is involved in this process ([Figure 3B](#F3){ref-type="fig"}). In the late meiotic anaphase of control embryos expressing GFP::β-tubulin and mCherry::Histone, interchromosomal MTs were detected between separating chromosome masses in all embryos (16 of 16), and some abnormalities were detected in 13% (two of 16) of them. On the other hand, after the disassembly of MT spheres in air-1(RNAi) meiotic embryos, chromosomes were not separated into two masses (11 of 12 embryos). In many cases (seven of 12), chromosomes stayed as a single mass, and MTs in their vicinity were not increased ([Figure 3B](#F3){ref-type="fig"}). In some embryos (four of 12), chromosomes were partially separated into multiple masses, and MTs were detected between these separating chromosomes. Similarly, in embryos expressing a kinase-inactive form of AIR-1 (AIR-1^K73RT201A^) in the absence of endogenous AIR-1, chromosomes stayed as a single mass without increasing the amount of MTs around chromosomes (10 of 17 embryos; [Figure 3B](#F3){ref-type="fig"}), or chromosomes were aberrantly separated, with morphologically abnormal interchromosomal MTs (six of 17 embryos). These phenotypes were not observed in embryos expressing wild-type AIR-1 from the RNAi-resistant transgene in the absence of endogenous AIR-1 (four of four; Supplemental Figure S2Bb). These results indicate that the AIR-1 kinase activity is required for meiotic anaphase and telophase. To examine whether the late-anaphase defect of interchromosomal MT assembly is a secondary effect of MT destabilization during prometaphase/metaphase, we inhibited the AIR-1 kinase activity after the bipolarity of the spindle was established, using MLN8237, which inhibits the kinase activity of Aurora A preferentially to Aurora B ([@B24]; [@B21]). (In C. elegans mitotic embryos, 50 nM MLN8237 treatment phenocopied air-1(RNAi), but inhibition of AIR-2/Aurora B was not detected; see Materials and Methods for details.) Meiotic embryos were treated with 50 nM MLN8237 after the assembly of bipolar spindles at early anaphase. Whereas the buffer-treated control embryos proceeded to telophase and formed interchromosomal MTs between separating chromosomes (four of four embryos; [Figure 3Ca](#F3){ref-type="fig"} and Supplemental Video S2a), the MLN8237-treated embryos failed chromosome separation, and the amount of MTs remained low after the shrinkage of bipolar spindles (four of four embryos; [Figure 3Cb](#F3){ref-type="fig"} and Supplemental Video S2b). These results suggest that the late anaphase defect caused by depletion of AIR-1 or inhibition of its kinase activity is not merely the secondary effect of the prometaphase defect, but it is required continuously throughout meiosis for the formation and/or maintenance of meiotic MTs. AIR-1 kinase is locally activated within female meiotic spindles ---------------------------------------------------------------- To investigate at which sites the AIR-1 proteins works during female meiosis, we examined the localization of AIR-1 using the strain expressing GFP::AIR-1 ([Figure 4A](#F4){ref-type="fig"}). In oocytes after GVBD, GFP::AIR-1 was detected as several objects in nuclei, likely corresponding to chromosomes ([Figure 4Aa](#F4){ref-type="fig"}, 0 s, and Supplemental Video S3). At prometaphase, the GFP::AIR-1 signal was detected on MT spheres, which then diminished during metaphase ([Figure 4Aa](#F4){ref-type="fig"}, 240, 1360 s). At anaphase, when the spindle was shortening, the GFP::AIR-1 signal on spindles was increased and enriched on spindle poles ([Figure 4Aa](#F4){ref-type="fig"}, 1600, 1840 s). At late anaphase, GFP::AIR-1 was detected both on chromosomes and interchromosomal MTs at equivalent levels ([Figure 4Aa](#F4){ref-type="fig"}, 1920 s). At telophase, as the interchromosomal MTs elongated, the GFP::AIR-1 signals on these MTs were diminished, whereas the chromosomal signal persisted ([Figure 4Aa](#F4){ref-type="fig"}, 2080 s). Immunostaining with an anti--AIR-1 antibody that recognizes both the kinase-active and the kinase-inactive AIR-1 proteins ([@B38]) showed consistent localization patterns with those with GFP::AIR-1 (Supplemental Figure S3). ![Localization of the kinase-active and the kinase-inactive forms of AIR-1 in meiotic embryos. (A) In utero time series images of meiotic embryos. (a) Embryo expressing mCherry::β-tubulin (green) and GFP::AIR-1 (red). (b) Embryo expressing GFP::β-tubulin (green) and mCherry::AIR-1^K73RT201A^ (kinase-inactive form; red). Frames were taken every 80 (a) or 60 (b) s, and representative images are shown. The time (in seconds) relative to GVBD is indicated. Bar, 5 μm. (B) Immunofluorescence images of female meiotic spindles stained with anti-AIR-1 antibody (green), anti-phospho-AIR-1 antibody, which recognizes the kinase-active form of AIR-1 (red), and DAPI (blue). (a) Prometaphase and (b) late anaphase. Bar, 5 μm.](4187fig4){#F4} Next, to examine when and where the kinase activity of AIR-1 is activated, we compared the foregoing AIR-1 localization patterns with those of the kinase-inactive form ([Figure 4Ab](#F4){ref-type="fig"} and Supplemental Video S4) and the kinase-active form of AIR-1 ([Figure 4B](#F4){ref-type="fig"}; under these experimental conditions, the endogenous AIR-1 was present). The localization of the kinase-inactive form of AIR-1 detected by mCherry::AIR-1^K73RT201A^ was similar to GFP::AIR-1, except for the following differences; mCherry::AIR-1^K73RT201A^ was not detected on chromosomes at GVBD ([Figure 4Ab](#F4){ref-type="fig"}, 0 s), and its localization on interchromosomal MTs was weaker at late anaphase ([Figure 4Ab](#F4){ref-type="fig"}, 1260 s) and absent at telophase ([Figure 4Ab](#F4){ref-type="fig"}, 1380 s), whereas chromosomal signal persisted. The localization patterns of the kinase-active form of AIR-1 were examined by immunofluorescence with the anti--phospho-AIR-1 antibody ([@B38]). The localization of the kinase-active form of AIR-1 was complementary to that of the kinase-inactive form; at prometaphase, the kinase-active form of AIR-1 enriched on and around chromosomes ([Figure 4Ba](#F4){ref-type="fig"}); from metaphase to telophase, it was enriched in the areas where interchromosomal MTs were formed, but the signal on chromosomes was weaker ([Figure 4Bb](#F4){ref-type="fig"}). Collectively our data suggest that, whereas AIR-1 proteins are localized in the area where meiotic spindles are formed, their activation occurs at specific sites, especially on and around chromosomes during prometaphase and between chromosomes at late anaphase. These localization patterns are consistent with the phenotypes by depletion of the AIR-1 proteins or inhibition of the AIR-1 kinase activity. The kinase activity of AIR-1 is required for the formation and/or maintenance of cytoplasmic MTs during female meiosis ---------------------------------------------------------------------------------------------------------------------- In addition to the defects in meiotic spindle formation, we noticed that RNAi depletion of AIR-1 in meiotic embryos reduced cytoplasmic MTs. As described previously ([@B12]), in the control embryos at early anaphase, short, cytoplasmic MTs were present throughout the cytoplasm, with some enrichment at the cell cortex, where MT patches are often detected ([Figure 5Aa](#F5){ref-type="fig"}). These cytoplasmic MTs gradually decreased during late anaphase. In air-1(RNAi) meiotic embryos, overall cytoplasmic MTs were reduced ([Figure 5, Ab and B](#F5){ref-type="fig"}; area covered with cytoplasmic MTs was 35% \[n = 9, p \< 0.01\] of that in the control \[n = 9\]). In embryos expressing the kinase-inactive AIR-1^K73RT201A^ in the air-1(RNAi) background, similar reduction of cytoplasmic MTs was observed ([Figure 5, Ac and B](#F5){ref-type="fig"}; area covered with cytoplasmic MTs was reduced to 41% of the control \[n = 11, p \< 0.01\]). Consistent with this, immunostaining revealed that AIR-1 partly colocalized with these cytoplasmic MTs ([Figure 5C](#F5){ref-type="fig"}), and the kinase-active form of AIR-1 and short MTs were both enriched on the cell cortex ([Figure 5D](#F5){ref-type="fig"}). These data imply that the kinase activity of AIR-1 is required for the formation and/or maintenance of cytoplasmic MTs during meiotic divisions, in addition to meiotic spindle MTs. ![Kinase activity of AIR-1 is required for the formation and/or maintenance of cytoplasmic MTs in meiotic embryos. (A) Ex time-series images of meiotic embryos expressing GFP::β-tubulin (black). (a) Control embryo, (b) air-1(RNAi) embryo, and (c) air-1(RNAi) embryo expressing a kinase-inactive form of AIR-1 (AIR-1^K73RT201A^). Right, magnified views. Bar, 10 μm (images showing whole embryos), 5 μm (magnified views). Contrast of original images was inverted and enhanced to visualize cytoplasmic MTs. (B) Quantification of cytoplasmic MTs in meiotic embryos. From images as shown in A, the size of the area covered with cytoplasmic MTs was measured and normalized by the size of the embryo. Each dot represents a single embryo (control, n = 9; air-1(RNAi), n = 9; and air-1(RNAi)--expressing AIR-1^K73RT201A^, n = 11). Pairs with significant difference, \\p \< 0.01). (C) Localization of AIR-1 in the cytoplasm of a meiotic embryo at late anaphase. Immunofluorescence images of a meiotic embryo stained with an anti--α-tubulin antibody (green) and an anti--AIR-1 antibody (red) along with DAPI (blue). Right, magnified views of the cytoplasmic region. Contrast was enhanced to visualize cytoplasmic MTs. Bar, 10 μm. (D) Localization of the kinase-active form of AIR-1 in the cytoplasm of a meiotic embryo at late anaphase. Immunofluorescence images of a meiotic embryo stained with an anti--phospho-AIR-1 antibody (green), which recognizes the kinase-active form of AIR-1, and an anti--AIR-1 antibody (red), along with DAPI (blue). Right, magnified views. Contrast was enhanced to visualize cytoplasmic MTs. Bar, 10 μm. (E) Movement of cytoplasmic MTs in meiotic embryos. Ex vivo time-series images of cytoplasmic MTs around a meiotic spindle visualized with GFP::β-tubulin. Green and red arrows indicate two ends of moving cytoplasmic MTs. (a) MT entering the meiotic spindle. (b) MT exiting the meiotic spindle. Frames were taken every 2 s. Indicated is the time (in seconds) elapsed from the start of the movie. Contrast was inverted and enhanced to visualize cytoplasmic MTs. sp, meiotic spindle. Bar, 5 μm. (F) Velocity of cytoplasmic MTs. Each dot represents the velocity of cytoplasmic MTs entering or exiting meiotic spindles. Data were collected from four meiotic embryos.](4187fig5){#F5} To investigate the interrelationship between the cytoplasmic MTs and the female meiotic spindle MTs, we analyzed the behavior of cytoplasmic MTs in meiotic embryos by live imaging. We found that the cytoplasmic MTs formed after GVBD dynamically moved within the cytoplasm, and a fraction of them entered ([Figure 5Ea](#F5){ref-type="fig"} and Supplemental Video S5) and exited from ([Figure 5Eb](#F5){ref-type="fig"} and Supplemental Video S6) the meiotic spindle. The MTs moved in either direction at nearly equivalent velocities (median velocity: entering MTs, 0.65 μm/s, n = 17; exiting MTs, 0.58 μm/s, n = 11, p \> 0.05; [Figure 5F](#F5){ref-type="fig"}). These observations raise the possibility that, in meiotic embryos, the short cytoplasmic MTs formed and/or maintained by AIR-1 may contribute to the formation of meiotic spindles. In the mitosis of C. elegans early embryos, γ-tubulin--dependent MTs and AIR-1--dependent MTs coordinately assemble mitotic spindles ([@B38]). Of note, for the assembly of mitotic AIR-1--dependent MTs, the kinase activity of AIR-1 is dispensable ([@B38]). On the other hand, we found in this study that the kinase activity of AIR-1 is continuously required for the formation or the maintenance of meiotic MTs, including meiotic spindle MTs at prometaphase/metaphase, interchromosomal MTs at anaphase/telophase, and cytoplasmic MTs. Whether the kinase-inactive AIR-1 plays additional roles (as in mitotic cells) is unclear from this study. Our results also raise the possibility that a previously unknown, γ-tubulin-- and AIR-1--independent MT assembly mechanism might contribute to the formation of meiotic spindle MTs before GVBD. Aurora B, another Aurora kinase, is known to be required for multiple events during mitosis. Although the subcellular localizations of Aurora A and Aurora B are different, at least some of their functions and phosphorylation substrates appear to be shared ([@B19]). For example, mammalian Aurora A and Aurora B both phosphorylates kinesin-13, which inactivates its MT-depolymerizing activity, thereby stabilizing MTs ([@B31]). In C. elegans meiosis, Aurora B/AIR-2 is required for the establishment of bipolarity of meiotic spindles and also likely for interchromosomal MT formation ([@B36]; [@B9]). A requirement of both AIR-1 and AIR-2 in meiotic spindle formation implies some coordinated roles of these two related kinases. We speculate that AIR-1 and AIR-2 might phosphorylate kinesin-13 (C. elegans KLP-7) to inactivate its MT-depolymerizing activity during C. elegans meiosis, which may contribute to the stabilization of spindle and interchromosomal MTs. Further work is necessary to unravel the coordinated roles of these Aurora kinases during meiosis. MATERIALS AND METHODS ===================== Strains and culture ------------------- C. elegans strains were derived from the wild-type Bristol strain N2 and cultured as described ([@B5]). The following strains were used in this study. Wild-type strain N2, SA250 (tjIs54\[pie-1promoter-gfp::tbb-2; pie-1promoter-2xmCherry::tbg-1; unc-119+\]; tjIs57\[pie-1 promoter-mCherry::H2B (his-48); unc-119+\]), SA378 (unc-119(ed3)III;tjIs173\[pie-1_promoter_1xgfp::air-1r unc-119(+)\]), and SA511 (unc-119(ed3)III;tjIs257\[pie-1promoter-mCherry::air-1r K73R T201A unc-119(+)\];ruIs48\[unc-119(+) pie-1::tubulin::GFP fusion\]; source for the foregoing three strains, [@B38]), SA729 (unc-119(ed3) III;tjIs57;tjIs257;ruIs48), SA772 (unc-119(ed3) III;tjIs332\[pie-1promoter::mCherry::TBB-2+ unc-119(+)\]), SA796 (unc-119(ed3)III;tjIs173;tjIs332), SA855 (tjTi1\[pie-1p:gfp:aspm-1;neoR\] V), and SA860 (unc-119(ed3)III;tjIs332;tjTi1 V). SA772 was made by ballistic transformation ([@B28]). SA855 was made by the miniMos technique ([@B13]) using a NeoR plasmid carrying the pie-1 promoter-driven genomic aspm-1 fragment with the gfp coding sequence at the 5′ of aspm-1 open reading frame. All strains were maintained at 24.5°C. To evaluate the amount of GFP/mCherry-tagged AIR-1 protein derived from RNAi-resistant transgenes in SA378 (GFP::AIR-1) and SA511 (mCherry::AIR-1^K73RT201A^) versus endogenous AIR-1, we performed Western blotting using anti-AIR-1 antibodies against the lysates of gravid adults. To estimate the amount of AIR-1 and its derivatives, we measured the intensities of the chemical luminescence of the bands corresponding to each protein on the Western blot membrane using ImageJ software (National Institutes of Health, Bethesda, MD). RNAi ---- RNAi was carried out by the soaking method as described ([@B23]). cDNA clones used to synthesize double-stranded RNA (dsRNA) were as follows: yk364b4 for full-length air-1 and yk1562g08 for tbg-1 (gifts from Y. Kohara, National Institute of Genetics, Mishima, Japan), pNKair-1N ([@B38]) for air-1N(RNAi), and pENTERNdeIair1r cDNA ([@B38]) for air-1R(RNAi). air-1N(RNAi) was used to deplete the endogenous AIR-1 without affecting the transcript of the RNAi-resistant air-1 transgene (air-1R). air-1R(RNAi) was used to deplete the transcript of the air-1R transgene. Worms were soaked in dsRNA solution at concentrations of 2 mg/ml for each dsRNA species, incubated at 24.5°C, and removed from the dsRNA solution to seeded nematode growth media plates. Worms were then cultured at 24.5°C and observed. Soaking period and observation time after the recovery from dsRNA solution were as follows: full-length air-1(RNAi), 24 and 22 h; air-1N(RNAi), 24 and 22 h; and tbg-1(RNAi), 37 and 16 h. For air-1N(RNAi);air-1R(RNAi), worms were soaked in air-1R dsRNA solution for 6 h, and then air-1N dsRNA was added and incubated for an additional 24 h; worms were observed later than 22 h after the recovery. For air-1(RNAi);tbg-1(RNAi), worms were soaked in the tbg-1 dsRNA solution for 24 h, and then air-1 dsRNA was added and incubated for an additional 14 h; worms were observed \>22 h after the recovery. The efficiencies of TBG-1 depletion by RNAi were confirmed by the absence of mCherry::TBG-1 signal on centrosomes in mitotic embryos (Supplemental Figure S1). Microscopy ---------- For time-lapse microscopy, the specimens were imaged with a CSU-X1 spinning-disk confocal system (Yokogawa Electric, Musashino, Japan) mounted on an IX71 inverted microscope (Olympus, Tokyo, Japan) controlled by MetaMorph software (Molecular Devices, Sunnyvale, CA). Images were acquired every 30--80 s with an Orca-R2 12-bit/16-bit cooled charge-coupled device camera (Hamamatsu Photonics, Hamamatsu, Japan) and a 60×/1.30 numerical aperture silicone objective lens (Olympus) without binning with streaming. To obtain Z-sectioned images of meiotic spindles, 7--25 Z-sections at 1-μm steps were acquired using 300- to 500-ms exposures with 255 camera gain parameter for each wavelength. To quantify fluorescence intensities, 28 Z-sections with 0.5-μm steps were acquired using 500-ms exposures with 255 camera gain parameter for each wavelength, with 60-s time intervals. For the analysis of the cytoplasmic MT behavior, single--focal plane images of SA250 meiotic embryo under ex vivo conditions were acquired using 1200-ms exposures with 50 camera gain parameter for GFP::β-tubulin and 150-ms exposures with 255 camera gain parameter for mCherry::Histone, with 2-s intervals. Captured images were processed and analyzed with ImageJ and processed with Inkscape software (The Inkscape Team, <https://inkscape.org/>) and Adobe Illustrator CS6 for presentation. Single--time point images were obtained and analyzed with basically the same procedure as that for time-lapse images. Observation of meiosis ---------------------- For in utero live imaging of meiotic embryos, gravid adult worms expressing fluorescently tagged proteins were anesthetized with 1 mM levamisole in egg buffer ([@B11]) and mounted on 2% agarose pads. The ex vivo live imaging of meiotic embryos was carried out as described ([@B9]), with the following modifications. Instead of the 24 mm × 60 mm coverslip with a metal holder, a slide glass (Matsunami, Kishiwada, Japan) with a circle drawn by PAP-Pen (Daido Sangyo, Toda, Japan) was used. Vaseline was used as a spacer between the coverslip and the slide glass. For immunofluorescence microscopy, embryos were fixed and stained using rat anti--AIR-1 (1:50; [@B38]), rabbit anti-p-AIR-1 ([@B38]), and mouse monoclonal anti--α-tubulin (1:500; DM1A; Sigma-Aldrich, St. Louis, MO) as described previously ([@B38]). The secondary antibodies used were Alexa 488--conjugated goat anti-rabbit immunoglobulin G (IgG; 1:1000; Thermo Fisher Scientific, Waltham, MA), Alexa 568--conjugated goat anti-rabbit IgG (1:1000; Thermo Fisher Scientific), and Alexa 568--conjugated goat anti-rat IgG (1:1000; Thermo Fisher Scientific). DNA was counterstained with the 4,6-diamidino-2-phenylindole (DAPI)--containing mounting solution Vectashield (Vector Laboratories, Burlingame, CA). Images were acquired with the same setting for the time-lapse microscopy. Images of 10--26 serial z-axis sections with a 1--μm step size were taken. RNAi depletion of AIR-1 greatly diminished the staining, indicating that this staining in meiotic embryos reflected the localization of the endogenous AIR-1. MLN8237 treatment of meiotic embryos ------------------------------------ To inhibit the kinase activity of AIR-1, we used an Aurora kinase inhibitor, MLN8237 ([@B24]; [@B21]). We confirmed that, in C. elegans, 50 nM MLN8237 preferentially inhibited AIR-1 kinase but not AIR-2/Aurora B, by treating mitotic embryos; under this condition, it caused phenotypes characteristic of AIR-1 depletion, such as defects of centrosome maturation, pronuclear migration, and spindle formation (four of four embryos), without causing phenotypes characteristic of AIR-2/Aurora B depletion, such as chromosome condensation defect (zero of four embryos). For AIR-1 inhibition during female meiotic metaphase to early anaphase, 50 nM MLN8237 treatment was carried out ex vivo because meiotic embryos before eggshell formation are permeable to MLN8237. Meiotic embryos were dissected in a drop of 2 μl of meiosis buffer containing 1% dimethyl sulfoxide (DMSO) and observed. As the first time point, images of meiotic spindles before drug treatment were taken. Then 2 μl of meiosis buffer with 1% DMSO and 100 nM MLN8237 (final concentration 50 nM) was added between the coverslip and the slide glass with a micropipette, and meiosis was recorded. Image processing and analysis ----------------------------- To estimate the amount of MT in the meiotic spindle, the total fluorescent intensity of GFP::β-tubulin in the spindle region of each Z-plane in the Z-sectioned image stacks at 120 and 720 s after GVBD was measured using ImageJ and normalized by the total fluorescence intensity of mCherry::Histone in the spindle region as measured by the same manner as GFP::β-tubulin. To visualize the behavior of cytoplasmic MTs, Z-sectioned image stacks were projected using the maximum intensity algorithm of ImageJ. Images were processed with a median filter for each image using the "median" algorithm with seven pixels, and the intensity of each pixel was reduced to 50% using the "divide" algorithm. The resulting filter was subtracted from the original images to generate the processed image. The color of the resulting image was inverted with the Edit LUT command. To measure the velocity of cytoplasmic MTs moving in and out of meiotic spindles, the position of the leading end of moving MTs was manually tracked and the length of their trajectories was measured. The velocity of each MT movement was calculated with the length of the trajectory and the time elapsed during the movement. The velocity of 17 MTs entering the spindle and 11 MTs exiting the spindle was measured in four independent meiotic embryos. For anti-AIR-1 and anti-p-AIR-1 staining in [Figure 4B](#F4){ref-type="fig"}, Z-sectioned images were processed with the median filter as described and three dimensionally reconstructed using the volume viewer plug-in in ImageJ. To estimate the area of cytoplasm covered with cytoplasmic MTs, 160 × 160--pixel rectangular regions of interest in the cytoplasm in Z-projected images were filtered by the Threshold function of ImageJ with the Yen algorithm to detect the area with cytoplasmic MTs. Statistical analysis -------------------- Statistical analysis was performed with Microsoft Excel software or MEPHAS ([www.gen-info.osaka-u.ac.jp/testdocs/tomocom/](http://www.gen-info.osaka-u.ac.jp/testdocs/tomocom/)). A Mann--Whitney U test was used to compare nonpaired data sets. Fischer\'s exact test was used to compare frequencies of phenotypes. Supplementary Material ====================== ###### Supplemental Materials This article was published online ahead of print in MBoC in Press (<http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E15-05-0258>) on September 16, 2015. We thank the Caenorhabditis Genetics Center (funded by the National Institutes of Health Center for Research Resources) for providing strains, Yuji Kohara (National Institutes of Genetics, Mishima, Japan) for providing cDNA clones, and Sugimoto lab members for useful discussions. This work was supported by NEXT Program LS006 from the Cabinet Office, Government of Japan, and grants from the Takeda Science Foundation, the Novartis Foundation, and the Mitsubishi Foundation to A.S. GVBD : germinal vesicle breakdown MT : microtubule MTOC : microtubule-organizing center
This Fire (Birds of Tokyo song) "This Fire" is a song written and recorded by Australian alternative rock band Birds of Tokyo. It was included on their third extended play (EP) of the same name and for their fourth studio album, March Fires (2013). The song appears as the second track on the album. The Single artwork is by Leif Podhajsky. The song came in at number 51 on the Triple J Hottest 100, 2012. Sales towards "This Fire" counted towards the EP which peaked at number 32 and was certified gold in 2013. Band member Ian Berney said ""This Fire" was probably one of the most effortless songs I've ever been part of a writing team for. I'll never forget the night that chorus came out – imagine five guys with one acoustic guitar, singing the song at the top of their lungs and all getting super excited. I like how the lyrics assign responsibility to ourselves for the urban disasters that we’ve created. Live, it’s one of the strongest… 9 times out of 10 we play it last; it just finishes a set with such command - probably a favourite for the whole band." Reviews Jason Strange from The AU Review said; ""This Fire" is the lead single... and has Ian Kenny's trademark voice and lyrical poetry, picking up nicely from where they left off with the last record. Judging by this, they have another number one album on the way." Music video The music video for "This Fire" was directed by Kris Moyes. Track listing References Category:2012 singles Category:2012 songs Category:EMI Records singles Category:Birds of Tokyo songs
_To my grandparents_ _And for my children_ 'We are in Transylvania and Transylvania is not England. Our ways are not your ways, and there shall be to you many strange things' Bram Stoker, _Dracula_ 'It is a most miserable thing to be ashamed of home' Charles Dickens, _Great Expectations_ _There is a glossary and guide to pronunciation at the back of the book, onthis page._ #### _Contents_ _Prologue_ _Part One_ _1_ _2_ _3_ _4_ _5_ _6_ _7_ _8_ _9_ _10_ _11_ _12_ _13_ _14_ _15_ _16_ _17_ _18_ _19_ _20_ _21_ _22_ _23_ _Part Two_ _24_ _25_ _26_ _27_ _28_ _29_ _30_ _31_ _32_ _33_ _34_ _35_ _36_ _37_ _38_ _39_ _40_ _41_ _42_ _Epilogue_ _Author's Note_ _Glossary and Pronunciation_ #### _Prologue_ _Thursday, 29 December 1988_ They do not know it, but the wolf is already at the gate. Seven o'clock on a moonlit night at the end of December; a terrible time for a party, and the guests are about to arrive. After the complex agony of invitations, the expense, the whipping of cream, the residents of Flat Two, Westminster Court, are almost too tired to greet their visitors, yet there is so much still to be done. They have been up since five in a fury of efficiency, wiping the underside of ornaments, Hoovering beneath the many rugs, rolling pastry, slicing cucumbers: innumerable tasks if this evening is to be perfect, as it must be. And now, while Marina's grandmother and great-aunts rest on their beds, Marina and her mother stand in front of the wardrobe in Marina's little room, pretending not to panic. 'Can't I just wear my school jumper?' asks Marina. 'Lambswool's smart.' 'Maybe not enough, sweetheart,' says Laura, her mother. 'You know they hate . . . never mind. What about that green dress?' 'Grotesque,' says Marina. 'Where's your long skirt, then? Oh Lord. What does your grandmother say?' 'I don't _know_ ,' says Marina, ominously wet-eyed. 'I look repulsive in everything. I—' ' _Dar_ -link,' says a voice from the doorway. It is Marina's grandmother, not resting at all: Rozsi, eighty today and not a woman one disappoints. ' _Vot-_ apity you don't vant to look pretty. Look, I have this.' Marina turns round and sees the blouse Rozsi is holding out to her: olive satin with a leaping gazelle motif. 'I . . .' she says. 'I think—' 'And Laura, _dar_ -link,' says Rozsi. 'Tonight you also try.' Laura's mother-in-law is not easy to ignore. One does not become a major figure in the world of ladies' underclothing if one is weak. Laura swallows. 'Yes,' she says. 'Of course I will.' She frowns at herself in the wardrobe mirror: her wet hair, her fair apologetic Midlands skin. Save me, she thinks, as the liver-spotted arm withdraws. 'Marina, love. Your kilt?' 'I could,' says Marina doubtfully. She lowers her voice. 'Mum, I . . . I wondered . . . can we talk?' Usually, this would make Laura's heart beat faster. However, she is less vigilant than usual, thinking of all that dill still to chop. 'About what?' she asks distractedly. 'It's complicated. I—' ' _Dar_ -link,' they hear again from the doorway, 'hurry. We have still to set out the _sair_ -viette.' 'Coming,' says Laura. 'Sweetheart,' she whispers to her daughter, 'we'll talk later. I promise. OK?' # _Part One_ # _1_ How the world loves a party, particularly one in honour of a great age attained. Some of the guests, being quite as old and impatient as their hostess, have arrived early, with enormous boxes of chocolates and expressions of defiance. Every time the intercom buzzes, Marina or her mother has to rush over to let them in. It would have been easier to have left the street doors open, but the residents of Westminster Court are security conscious, for reasons of their own. Here, in the barely respectable depths of Bayswater, some stranger tries to gain admittance once or twice a night. It is better to be sure, and so the doors are shut. In any case, downstairs in Flat Two the noise is incredible. Everyone is eating, smoking, gossiping; they are not thinking about unwelcome visitors. The guests who hurry in from the shabby street in the drizzle do not, at first sight, look as though they could possibly be the source of so much noise. If you had happened to come across them as they took their cold constitutionals in Hyde Park this afternoon, they would have seemed perfectly normal elderly Londoners, looking forward to a quiet night in with a cup of tea and a chop and the _Radio Times_. At least, that is how they think they seem. But come a little closer. ' _Dar_ -link' is their usual form of address. Are not their hand gestures a little more extravagant than those found in Surrey, their eyebrows more dramatic, their hair swept back like something from _Nosferatu?_ They seem both more formal and more exuberant than you might expect, as if you had wandered into a theatre dressing room of the 1950s, not a cramped west London basement flat. Their bags contain poppy-seed pastries as long as your forearm; velvet-packed pralines, smuggled by fur-wrapped pensioners on the overnighter from Berne. Their perfume smells like the air in a hundred department stores. What are they speaking? Nothing you know, no rolled 'r's or recognizable sounds but either an entirely impenetrable language – _megmásíthatatlan, örökkévalóság_ – or a distorted English, full of dactyls which dust familiar words – ' _Pee-_ codilly' or ' _vosh-_ ingmochine' or indeed ' _Vest_ -minstaircourt' – with snow and fir and darkness. Oh. Hungarian. Now it all makes sense. So where is little Marina, granddaughter of the house? Is she sitting humbly at the feet of a dashing octogenarian? Is she having her hand kissed by a young accountant, being complimented on her embroidered apron? She was here a minute ago, beautifully dressed for the party: not perhaps in the height of fashion, but in the circumstances . . . Besides, she is always so polite, such a credit to her relatives. Very strange: where has she gone? ' _Boldog születésnap!_ ' Happy birthday, cry the guests to Rozsi. ' _Kezét csókolom_ ,' I kiss your hand. Some of them actually do it. There is also a great deal of cheek kissing: the very young led by the hand to pay homage to the elderly. ' _Yoy_ , _dar_ -link! I _rare_ -member you ven you vere _so_ high!' These people make the French look reserved, the English costive. And, at the centre of this kissing, cheek-pinching maelstrom are tonight's hostesses, two of the generations resident in this little flat: three old women and an abandoned wife. Marina, known tonight as ' _Mor_ -inaka' or Maza, to rhyme with 'Pots-a', is in charge of coats. Furs and sheepskin and mackintoshes already fill the hall cupboards; the twin beds in her great-aunts' room lie buried under a sea of headwear, although they are far from the Endless Steppe. Nevertheless, the piles of protective outer garments keep growing: berets and fedoras; gloves like warm leather claws. The air stinks of tuberose, caraway and garlic: the universal scent of central European hospitality. But Marina is not hospitable. After only an hour her skin is tender with cheek pinchings; she has been matchmade, prodded and instructed beyond endurance, and the night is young. Soon they will come to find her, to admire the shape of her fingernails, the thickness of her lashes, their eyes peeling back her clothes, weighing her like fruit. This is not new. She has been brought up to accept the questions and kisses as if nothing could please her more, however much lava is boiling inside. The problem is that Marina has changed. She can bear their scrutiny no longer because her life is a disaster, and it is her fault. She betrayed them and escaped them, and now she wants to come back. _Be careful what you wish for_. This is one of the wise and inspiring precepts she has been gathering lately; she has forty-three so far, six in Latin, but they haven't helped at all. They did not save her from making the worst choice of her life: Combe Abbey. Boarding school. She had wanted to be different, to escape just for the sixth form, and now she is reaping what she sowed. Five more terms to go. She is sitting on the edge of the larger bed: that of Zsuzsi, the younger of her two resident great-aunts, the beautiful one, who has a silk pillow to avoid facial wrinkles. Zsuzsi would be disgusted at me, she thinks, wiping her nose and avoiding her own reflection in the three-way dressing-table mirror. Crying is ugly and so, to stop herself, she bites down on the beads inside her lower lip for the taste of courage: blood and iron. Flawed as she is, with an incorrect ratio of leg to torso and freckles everywhere, she must be courageous. Women of her family always are. In the sitting-cum-dining-room, the party is reaching its climax. There is so much food: cold sour-cherry soup, chicken paprika, buttered noodles, stuffed cabbage, red cabbage, sweet-and-sour cucumber salad, cold _krumplisaláta,_ made with gherkins and chives and hot _paprikás krumpli_ with sausage. Somebody has tracked down the last carp, or pike, or perch, in London and jellied him – it looks like a him – with carrots. Although it is of dubious provenance – not from Lake Balaton but a pond near Weybridge – all agree that it is wonderful. Rozsi's sisters, virginal Ildi and beautiful Zsuzsi, beam like angels through the steam. _Schnitzel_ ; goose-liver pâté; Polish salami; Ildi's famous _palacsinta_ stuffed with ground walnuts and rum, with lemony curd cheese and raisins or, in the unlikely event of a vegetarian guest, with spinach and only the tiniest taste of bacon. Someone has even brought a large curled ox tongue, which looks exactly as one might fear. And, alone in the darkness of the kitchen, touched with pinky-yellow haze from the fanlight in the communal stairwell, this evening's culinary highlight is waiting: _îles flottantes_ , known here as _madártej_ or birds' milk, bosomy islands of caramelized egg white, half-subsiding into an inland sea of vanilla custard, suspended in a Czech lead-crystal bowl. ' _Von-_ darefool,' say the guests: a rare comprehensible word in an opaque wall of conversation. They are comforted to know that Ildi, although eighty-two, is cooking the food they remember: still pressing dumplings through the _nokedli_ machine, chopping veal bones, melting lard. They are a wonderful family, aren't they, all things considered? Admittedly not quite as they were but then, _dar_ -link, who is? They are bringing Marina up terribly well, despite everything: so respectful, so polite, and now she is at that school for English aristocrats – well, who knows what might happen? There are many cousins here, all with mad diminutives: Pubi or Gobbi or Lotsi. The wife of one of them has trapped Laura by the window, and is cross-examining her on behalf of them all. 'So,' the cousin's wife says. ' _Dar_ -link. Tell me _sum_ -sing—' Despite living at close quarters with elderly Hungarians for over a decade, observing their habits like a less successful Jane Goodall; despite the fact that she was once married to Rozsi's son and has produced Rozsi's only granddaughter, Laura does not have a diminutive. One cannot catch Hungarianness; they welcomed her and Marina into their home, have kissed and nourished them endlessly, but Laura remains a puzzling pet. 'I really,' she says. 'I mean I can't—' ' _Vot_ are you doing?' 'Sorry?' ' _Pro_ -fession-allyspeaking. You know I am once _mu_ s-e-um director? _Vair-_ y big museum in Czecho,' the cousin's wife says complacently, bracelets clanking on her loose-skinned arm. 'But you? You are not still reception girl for _von-_ darefool doctor?' 'Oh – the surgery? Yes, yes I am.' The cousin's wife shakes her aged head. She is wearing Capri pants, or what Rozsi would call 'a little _troo_ -sair', and a blouse and waistcoat; perfect, if alarming, lipstick; huge glamorous glasses and a bronze puff of hair. Compared to the others, she is dressed casually; it is almost a slight. 'And,' the cousin's wife continues, offering Laura a pink Balkan Sobranie, 'you are lonely, yes?' 'No!' says Laura, stepping back. 'Fortunate, to live with the others, but lonely. So. I know.' They both look down at Laura's pointless wedding ring. 'Not at—' 'Of course now little _Mor_ -inaka is at _vot_ -you-say board school—' 'Boarding school, yes, bu—' 'The evenings, the weekend. _Vot_ are you doing with so much time? You are learning a language? Instrument?' 'Er . . .' 'Do not tell me,' stage-whispers the cousin's wife, 'you are having _boy_ -friend?' 'Me? No, not . . . not at all!' 'Because of course without _Pay_ -tare . . . vell.' Laura has been expecting this all evening. Given the number of Hungarians present, their rampaging curiosity and lack of embarrassment, she knew it would come. Poor Rozsi; they can hardly ask her. The disappearance of Peter, Rozsi's younger son, and his abandonment of Laura his wife and Marina his child, is not for general discussion. Laura, however, is fair game. 'You hear from him again?' 'Peter? No, gosh, never. Not since, you know, that first time, there was a, a card he sent to—' 'Yes, yes, of course I see this. You do not know where he is, all these years – _tair_ -ible. You cry and cry, don't tell me, _dar_ -link,' she says, thumping her fragile-looking breastbone; she has, Laura is certain, been happily married to the cousin for many decades. The questions keep coming. At least her inquisitor is, as she reminds herself ceaselessly, so affectionate; they all are. When Laura visits her quiet father in Kestonbridge, the Cumbrian village to which, after her quiet mother's death, he quietly retired to a bungalow, people who have known them for twenty years are still hard pressed to greet her. Here, they embrace her like a daughter, albeit a disappointing one. Warmth, she tells herself once again, is not to be sniffed at. Since taking them into Westminster Court after Peter walked out, Rozsi has refused to let them consider leaving, even after Ildi was mugged on an Acton bus and moved in, and then widowed Zsuzsi followed. They share their food with her. It is like being raised by wolves. The problem is that they think they know her. They do not realize that, however sweetly Laura smiles, however demurely she answers, there is somewhere she would prefer to be, something she would rather be doing. And someone, of course, which nobody else must know. They never will. The idea that, after over a decade of chaste abandonment, Rozsi's shy daughter-in-law might have, well, needs, has not crossed their minds. However, there are no secrets here, particularly from one so observant as Marina. Could Marina conceivably have guessed? Please, God, not yet. Still, Laura worries. With so many inquisitors stuffed into this little flat, no corner where secrets hide, or are hidden, is safe. ' _Nev_ -airmind,' the cousin's wife is saying cheerfully, putting her bony hand through Laura's arm and frog-marching her back into the throng. 'One day when you are old _vom-_ an like me you understand. Men leave. Children leave. All that is left is death.' With a roar from the crowd, Rozsi stands. To the casual Englishman, were one present, she might appear as other grandmothers: reading glasses on a chain, worn wedding ring. Do not be deceived. Rozsi is unusually clever and fearless even by her compatriots' standards. Her younger son Peter, Laura's former husband, used to call her Attila, with reason. Laura, whose references are more prosaic, thinks of her as Boudicca dressed as Miss Marple. She has a white bun and black eyebrows, her cheeks are soft and age-spotted, but consider the cheekbones underneath; you think she forgives easily? Think again. Her cake, as is correct and traditional, is not a birthday cake at all, but simply her favourite, a rum and walnut _dios torta_ , made by her devoted elder sister Ildi last night. Rozsi, remember to blow the candles out, for luck. _Haaapy Birsday to you . . ._ Rozsi looks, all agree, very well. Tonight, in her good dark red dress with gilt buttons, she could not be beautiful; she is too severe for that. But striking, handsome even, like a relatively glamorous Russian spy. Why should Rozsi care about beauty: the smartest of the sisters, a career woman for all these years? And isn't her life at eighty something to marvel at? Despite everything – that terrible business with her poor late husband and then _Pay-_ tare disappearing – to be working still is remarkable. Wonderful. Look at them now, see how Marinaka loves her grandmother; Rozsi will never be lonely. Isn't that something else to be grateful for? _Haaapy Birsday to you . . ._ The cameras flash at Rozsi and, to be truthful, a little more often at her younger sister Zsuzsi, the beautiful one, with her lovely skin and her good teeth and her cigaretty laugh. Those who knew the famous Károlyi girls, Kitti-Ildi-Rozsi-Franci-Zsuzsi, back in Pálaszlany over fifty years ago, claim that people would stop on the street to gaze as Zsuzsi passed by. Men were known to have killed themselves for her, and marriage, then early widowhood, have not reduced her powers. Several of her suitors are here tonight, tall white-haired handsome 'boys' in beautiful suits: rich Bíró Eddie, globe-trotting André, Tibor with his duelling scar, still patiently waiting for her to choose after all these years. _Haaapy Birsday_ dar- _link Ro-ji,_ _Haaapy Birsday to you._ Rozsi, of course, widowed almost as young as her sister and more unjustly, has no such suitors. She lifts the knife. She smiles. # _2_ ' _Ven_ you think the doctor arrives?' Laura turns slowly. Ildi, the elder of her aunts-in-law, unmarried at eighty-two, still going to evening classes, cooking for fifty without apparent panic, is looking concerned. Of course Dr and Mrs Sudgeon are invited; all the elderly Hungarians and Czechs go to his surgery. It is worryingly easy to imagine distinguished Dr Alistair Sudgeon sitting on their hard-wearing green leather sofa, making conversation. Rozsi will be so proud. 'Hmm,' says Laura, a little too loudly. 'Well.' Careful, says the voice of sense in her ear. Laura, however, has never mastered being careful. She was not careful when, as a hopeful would-be teacher, twenty-six and astonishingly clueless, she was impregnated by the handsome and utterly spoiled Peter Farkas behind a sweet-chestnut tree in Kensington Gardens. She was not careful for the next three years, tending baby Marina and fighting the cold in their rented flats while he pretended to paint, and borrowed from his overstretched parents and then left them entirely in the lurch. And, well over a decade later, sharing her mother-in-law's two-and-a-half-bedroom flat with three pensioners and a sixteen-year-old, sleeping at night on their uncomfortable sofa with her clothes in the sideboard, she may be beyond carefulness entirely. Which perhaps explains why she has pledged her loins to the last person she should have chosen: Alistair Sudgeon, her very married employer. Marina is in the kitchen, washing up cakey cutlery. It is hot in here, and she is wearing a black wool polo-neck, with a huge locket of Zsuzsi's, a kilt, black fifty-denier velvet-look tights and Edwardian ankle boots. She knows – she thinks she knows – how bad she looks, so why does she keep expecting someone's handsome grandson to turn up and fall in love? Because, she tells herself, punishing her ugly cuticles with the washing-up brush, you always think that the next moment is when your life is going to change, and maybe it never will. This is a recent realization, which she is struggling to accept. Before the sixth form, clothes were tricky but it hardly mattered: her Ealing Girls' friends were as scruffy as her, as styleless. It was their collective ignorance, she is coming to understand, which doomed her. While elsewhere girls were developing taste and fashion sense, crimping their hair and experimenting with coloured eyeliner, learning what would suit them, she and Katie and Katy and Ursula barely noticed what each other was wearing. Other things were more important, such as memorizing the titles of all Shakespeare's plays. Then she came to Combe and discovered she had fallen irretrievably behind. How did this happen? First of all, she never knows what you ought to like. Red, for example, the colour of her duvet cover at Combe and her favourite jumper, is common, and she hadn't known. Second, what if she dares to try something new but looks stupid, without realizing? She has a terror of this. That, and having food on her teeth. Third, she is naturally unappetizing. The truth, which her family do not acknowledge, is that some people can look all right, while others can't. If you're pretty, it's fine to check your reflection in a mirror, or wear mascara. But what if you're not? It'll look like you think you are all right, that you can improve your appearance by smoothing your fringe, but you still have glasses, and spotty upper arms, and hideous knees, and eyebrows like a boy's. Some people are beyond improvement and, when they try, they look like fools. This Marina will not be. She is uniquely cursed in other ways. She is shy; clumsy; short; fatherless; scared of cats, and the dark, and the future. She is going to be a doctor but knows she isn't up to it, and if she doesn't get into Cambridge her life will be over. And, unbeknownst to anyone at Combe, she lives with old people in a little bit of darkest Hungary, like a maiden in a fairy story. Or a troll. These things are too shameful to be spoken of. She keeps them in her rotten heart. On reflection, it occurs to her now, maybe her heart is the problem. For, although technically quite innocent, Marina has a very adult love. A world away, in Dorset, the boy she longs for – Simon Flowers, senior music scholar, day boy, bound for Cambridge this very October – is attending polite little family gatherings, packing his physics notes for the new term, writing essays with the clarity of the pure of heart. Nobody knows of her passion. There are so many reasons to keep her love secret: not least that it is against the school rules. And she will be teased about it, which is insupportable. And her family do not approve of boyfriends until she is at Cambridge, ' _meen_ -eemoom'. And he is an active member of the Christian Union. Yet although Simon Flowers is in the year above, she knows him well, by observation. He may even have feelings for her. He has smiled at her in Chapel, for example, which is quite unheard of for an Upper, particularly one so glamorous, so talented. Admittedly, they have not technically spoken but she has stared unwaveringly at him to convey her devotion; he can't not know how she feels. It is deafening. She thinks about him every few minutes, planning for their passionately intellectual future. She feels physical pain at the thought of their being asunder. And so she has become increasingly sure that the life-changing moment of union will happen; it has to. Thought beams should make a difference. If you want to see someone enough, they should come. But what if he doesn't? Nothing, not even the many tragedies of her youth, has pained her as much as the mere sight of his sensitive hands, his leather briefcase, his wire-rimmed glasses. Without him her life will be ashes; besides, she will be unable to care for another. First love can never be repeated. She has read Turgenev. She knows. 'Quickly,' whispers Great-aunt Ildi. 'Where is nice ashtray for Mrs Dobos?' Mrs Dobos, her grandmother's employer, raises her prima ballerina's head and stares at Marina, as if assessing stock. She is on the most comfortable chair; they dusted behind the radiators in case she looks. 'Here it is,' says Marina, with a lovely smile. 'All washed up specially.' 'Marinaka _dar_ -link,' says Mrs Dobos. 'You still do not tell me about Combe-Abbey. You are liking it, as I say you will. You are happy there. I can tell: you eat well. Your bust grows.' 'I—' 'Of course you are happy. It is _von_ -darefool school. _Von-_ darefoolopportoonity.' 'Yes,' says Marina. 'I am very very lucky. Thank you, Mrs Dobos, for recommending it.' Once Laura was reasonably intelligent. She had thoughts like: what should we do about Europe? She cared about starving children, about the decline of native woodland. As it turns out, all that concern was varnish. She is merely a collection of needs which are unfortunately not going to be met: to free herself from Dr Alistair Sudgeon, her ageing paramour; to carry her daughter's pure childhood scent around with her in a sniffable capsule, if not Marina in person, like a papoose; to slice through the knot of guilt and duty and financial embarrassment which tightens daily and find somewhere else to live: an independent adult woman with her daughter. Until September, only four months ago, she could cope with all of this. It was so good for Marina to be brought up with the in-laws, with their culture and their love and all that food; it hardly seemed to matter that she, Laura, wasn't even related to them. When she compared Westminster Court with the bungalow in Kestonbridge, or an unaffordable studio flat beyond the M25, she knew that they were lucky. Then Marina went away to school and none of the treats Laura had promised herself, cinema matinées, visits to friends in Bath and Bristol, had happened. She did not want them after all; she just wanted Marina back. Her entanglement with Alistair Sudgeon is not helping. Any minute now he will appear on the doorstep with Mitzi, his wife, with whom Laura seems to be becoming obsessed. Mitzi Sudgeon is a legend: her energy, her terrible fecund power. Unlike Laura, who has reached her forty-second year with no more to her name than a teenager, houseless, carless, husbandless, Mitzi excels. In addition to four children she has produced hundreds, probably thousands, of pastel drawings: dancing gypsies, merry vagabonds, babes in arms. Her jam is perfect, or as close to perfection as can be achieved without the legendary Nemtudom plums of Tarpa, near the River Tisza, of which Laura has frequently heard. She makes curtains and marital bedspreads. She bakes relentlessly. She organizes pensioners' aerobics sessions at Alistair's surgery. She is, moreover, an actual Hungarian. In 1956, while the eight-year-old Laura, daughter of two irredeemably English postal workers who called each other 'Mother' and 'Father' and aimed only not to be noticed, was failing to learn to skip in a Birmingham playground, plucky Mitzi, only three years older, was stowing herself away on a tannery barge and preparing to meet her future. The guests show no sign of leaving. There is still more cake to be eaten: a symphony in chocolate and cream; there are Sobranies still to smoke, black _kavitchka_ to drink, marzipan fruits to nibble, families to be discussed. They are all dreadful gigglers; Ildi, whispering to Zsuzsi in the corner, has tears of laughter running down her pink cheeks. And the food keeps coming. Rozsi's oldest friend, Pelzer Fanni, has brought a toddler-sized box of her favourite chocolates from Austria, _Mozartkugeln_ , decorated with his silly girlish face. ' _Von-_ darefool,' say the shoals of interchangeable cousins. Laura smiles and nods until her cheeks ache with insincerity. She fears them all: protective, touchy, there is so much they insist on knowing, and Laura is no match for them, least of all tonight. What if, when Alistair arrives, whose desire, or at least the thought of whose desire, so excites her, she starts glowing through her clothes? One of the in-laws will surely notice; not Ildi, too sweet and innocent for suspicion, but what about Zsuzsi, with her instinct for sex? Rozsi, whose thoughts are unreadable, like a polar bear's? My jig, she thinks, is up. She needs somewhere to think. It will have to be the bathroom, although it will be considered a dereliction of hostessly duty. Shyly she begins to kiss her way towards the kitchen, slashing through the alien corn and, whatever her lips say, her mind is thinking: please. Please. Please. But what is she asking for? Love, peace, privacy? Or the opposite of peace: something that will change everything, for better or for worse? Marina is going back to school in under a week, and another evening has been wasted. Laura has barely seen, let alone talked to her, or grabbed her and sniffed her hair, howled like a lunatic, held on. She wants to lie face down on the cold tiles and weep. But she cannot, so she tells herself to buck up, blows her nose, and washes her face like the mildly disappointed marmalade-making Women's Institute member she could so easily have been. Water is dripping off her nose. She looks like a different species from her daughter, as if a Labrador had produced a salmon. If Alistair talks to Marina, will she talk back? It happens all the time: people think she is just another nervous teenager, easily melted, and Laura winces to see how their teasing always turns her child to stiffness like a small strict scientist, how quickly she is offended and embarrassed, her flammable pride. Is it normal to be simultaneously so self-conscious and so prickly? Since starting at Combe it has been worse, for reasons Marina will not discuss. Show them what you really are, Laura wills her, watching her daughter's monosyllabic answers. With her big worried eyebrows and dark thick plait, she has the air of a small Russian poet about to kill herself for love. Oh, darling, thinks her mother. One day someone will see you. Just, please, not yet. When the intercom buzzes, Marina knows. This, you see, is how love feels: a heightened awareness, almost psychic, that the beloved is here. Like a magnet seeking metal, a stranded alien found by the mother ship, she is propelled towards him, dodging aged Hungarians with their walking sticks and their determination to pinch her youthful flesh. It is not surprising that she has sensed his approach. In a sandstorm or an avalanche she could probably detect him. Her body would thrum like an antenna, if that is what they do. How she thrums. Given the strength of her devotion to Simon Flowers, how could it not be him? He must have relented. He has come for her. 'Hello?' someone says into the intercom box. No one answers, which is a sort of sign. Her heart is banging, and organs do not lie. She has willed him here: a hot metallic beam of longing, pulling him all the way from the house he shares with his parents and two little sisters at 29 Mill Road, Stourpaine, Blandford St Mary, Dorset, DT11 2JP, into her arms. 'I'll go,' she says, although everyone is looking. Electric blood booms beneath her skin. Could she have wished him into existence? Until now, fetching the _Evening Standard_ for her great-aunt Zsuzsi, or going to the National Portrait Gallery to catch up on the Tudors, or watching the people on the up escalator as she goes down, with her better profile carefully turned their way, she has been certain that in the next minute, or the next, or next, her fortune will change. All it would take was one large aristocratic family or kindly professor. They would recognize her unusual sensitivity, her hitherto unsuspected beauty, and they would welcome her. This holiday, in the era of Simon Flowers, it has been different. He must come to London, after all, to visit elderly relatives, or buy madrigals. Every time she leaves the flat she is merely a surface, ready to be seen by him. Now, at last, he will see. Her life will change tonight. She bangs her elbow on the door handle but hardly notices. The air in the basement corridor is pure oxygen. She flies over the sparkling night-blue linoleum, bypassing the lift, in whose coffin of walnut veneer and leatherette she has dreamed of kissing his chapped lips and now, after her time in the wilderness, can dream again. She will look upon his dear scholarly face and he will rescue her, transform Combe, relieve her of her virginity, set her off towards the glorious adulthood which awaits her. So what if boarding school is not what she had hoped? If the boys are scary and the girls are aliens and they call the townspeople of Combe and Melcombe peasants? She runs up the stairs and bursts into the entrance hall, the strip lighting blazing benedictions upon young love. The pitch of the party has definitely changed; it is quieter, tenser, as if an adulterer is in their midst. They may be sensing imminent excitement: a storming out, tears, insults. When Laura was growing up, public displays of emotion would lead to lifelong polite ostracism. Her in-laws, however, can take drama in their stride. Or maybe they are waiting for the Sudgeons, she thinks, as the telephone begins to ring. Because of the noise, Laura hurries into the great-aunts' room to grab the phone between their beds. 'Hello?' There is only silence. Her mouth is dry. 'Hello?' she says again and then, softly, probably inaudibly, she whispers into the yellowing plastic: 'Is that you?' Silence. 'Who is it?' calls her mother-in-law through the doorway. ' _Viszontlátásra_ , _dar_ -link – hurry, Mrs Volf goes now.' 'I . . . I think a wrong number,' she shouts back, and the line goes dead. Simon Flowers is not here. Nobody is. Marina leans back against the front door, trying not to be seen by the people waiting at the bus stop, and is rinsed by a cold wave of self-disgust. Heartache spreads across her chest, telling her that she will never love again. Simon Flowers is the only boy at Combe she can imagine even liking. He has qualities the others lack: intelligence. Fineness. Beauty, even, if one is sensitive enough to see it. She would give him everything. She would even, it seems, risk letting him into the flat. Unbeknownst to him, this was to have been a significant, almost ceremonial, moment. For Marina, most things are. She has powers, although she is not sure how they work. Perhaps a suspicion had always been there, an awareness that all that stands between her relatives and their gradual decline into poverty, starvation, diseases missed by neglectful doctors who laugh at their accents, is six years at medical school and lifelong vigilance. However, she had only been away at school a few weeks when she realized that everything she fears stems, via an osmotic process in which she is the conduit, from Combe. Combe is not her family's salvation but their nemesis, she can see that now. Everyone there is so healthy. Everyone at home is weak and flimsy, and growing more so, while she is away from them. Perhaps, without the homesickness, she would have felt less oppressed by responsibility. Instead, as term, slowly, passed, her sadness did not retreat. She missed her elderly relatives' wrinkly elbows, the soft cords of their necks; whenever she saw a pensioner at a bus stop she would try to carry their bags. What if, as she increasingly feared, she was actually killing them long distance? One freezing November evening, passing the ruins of Combe Abbey on her tremulous way into dinner, she saw a stone which seemed to be glinting significantly, and made a vow. Under the gas-style light of the new old-fashioned street lamps, she accepted the task of protecting her relatives from pain, sorrow and death. I alone, she swore, will do it, whatever it involves. Decontamination. Quarantine. And, obviously, ensuring that no one from Combe ever crossed the threshold. The only exception was to be Simon Flowers: a boy of whom even her family would approve. So great was her love that she had decided he was worth the risk. But he is not here. The damage has been done by thought alone and— 'Hey,' says someone in the bus-stop queue. 'Hello?' She squints into the darkness, hoping that Simon Flowers's slender frame will materialize but, in his place, stands someone vaguely familiar: a paleish, slabby, mouse-haired boy. Her face starts to heat like a kettle element, tainting the air around her. 'Come on,' he says. 'You know. School.' 'No, I don't,' she says, although she does recognize him now, a younger boy from Combe, a Fiver, not even in her house: Guy somebody. Rain is beading on his hair, she notes, still observant despite the shipwreck of her hopes and dreams. 'What are you doing here?' The downpour increases, as if a dial had been turned. He surveys the dry cleaner's, who have picked this moment to load clothes rails into their van. 'I know, weird, isn't it,' he says. 'Went to buy a compact disc on Queensway.' 'Really?' 'And then I'm meeting my mother in Holland Park, but I lost my cab money. They said the bus went from the corner. You don't live _here_ , do you?' Marina is not good at being insulted. She goes stiff; if anyone teases her she is frozen for days. 'Anyway,' he says, not even noticing. She wants to turn away but he could say foul things now about her at Combe. Also, he does not seem to be mocking her. 'Good, good luck then.' 'Thanks.' She is about to go inside. But she hesitates, as she always does, and in those few seconds the door to Westminster Court is slowly pulled open. The Combe boy looks round. Marina turns. There, silhouetted by the strip lighting like an avenger, stands an old woman in a floor-length emerald cocktail kaftan, with a cigarette, an ornamental hair clip and big round gilt clip-on earrings: her great-aunt, Zsuzsi. 'I come to find you,' says Zsuzsi. 'Everyone asks, you miss the— who is this?' The Combe boy's eyes open very wide. Is it her eyeshadow or her golden hair or the accent? Marina barely hears it but she knows it is there. People often ask Rozsi how long she's been in London, as if she's a tourist, and are visibly shocked when she says, 'Forty years.' Rozsi would be bad enough; Zsuzsi is a disaster. Now that Marina has started at Combe, she needs her elderly relatives to be less conspicuous. There are already rumours that she is a Kraut. 'Actually,' she says, 'I was just com—' But Combe boys are polite to adults. He leaves the bus queue and holds out his hand. 'Guy Viney,' he says. 'I'm so sorry, I didn't realize you lived here. I'm one of your, ah, daughter's—' 'Daughter?' says Zsuzsi, beaming delightedly. ' _Von-_ dare-fool. Such a nice boy. One of Marina's school friends? So—' They have been asking and asking her to bring people home. They are obsessed with Combe. They do not realize. 'Well,' says Marina, 'we don't really know each other. He's only a—' 'He wait for bus?' says Zsuzsi, looking as if she is about to offer him a cigarette. 'No!' 'It's fine,' says Marina, as Guy Viney wipes his face with his sleeve. 'Not-at-all,' Zsuzsi says. 'Don't be a silly. We do not let him go like that, a boy from the boarding school. _Tair-_ ible. He is wet. He is hungry. He is—' 'Zsuzsi,' says Marina, 'really. I don't . . . we don't . . .' Her great-aunt takes Guy Viney's arm. 'A friend of Marinaka,' she breathes, as if naming a rare and precious element. 'He's not my—' 'Shh. Young man, I take you inside.' Marina follows them, with difficulty, into the tiny lift. He takes a lungful of stairwell bleach and overheating and she visualizes the exchange of gases in his alveoli: Farkas air going in, contamination out. He will endanger them and she, Marina, is the point on which it all hinges, like the twist in a loop of DNA. He isn't even very tall and his hair is nothing like a Merchant Ivory hero's. Above the clanking gears he answers questions while Marina stares at his red right ear, thinking of what he will see when he enters Flat Two: the plate clock from Trieste; embroidered folk items; glazed pot holders; Zsuzsi's _Royalty_ magazines, the numerous dictionaries and the cupboard fridge on legs. 'I . . .' she begins. Zsuzsi expects politeness, but this is an emergency. The lift is stopping. Could she just drop to the floor? 'Actually—' He pulls open the grille. Marina hesitates, her hand on the walnut veneer. Zsuzsi gives her a little push. 'Hurry now young boy,' she says. 'We eat cake.' And it is too late. Everyone turns as they enter the Farkas flat, smiling at him, then at her, as if— Oh, my God. They can't think that. They put him on the sofa. They bring him an extra-large slice of what Zsuzsi unnecessarily informs him is boyfriend cake, and coffee, which he nervously declines, and so thrilled are they by everything he says, and so eager to spot signs of love in Marina, that she cannot stand it. She sees him being made to talk to hundreds of relatives. She squirms, she blushes. She starts to sweat. He catches her eye, this infant, this Fiver, this destroyer, and he smiles. It is the day after, New Year's Eve eve, and they have been clearing up since breakfast. There is only just room in the kitchen for two people; it is five feet wide, maybe nine feet long, so careful choreography is needed. Poor Marina, who cannot pass a door frame without crashing into it, continually hurts herself. What, wonders her mother, has she done to herself now? Is this why she is being so difficult? The problem is that Marina could be bleeding dramatically and would not admit it. Although her face shows every emotion, pride closes her up. She has been this way since babyhood, refusing to admit to pain, or distress, or even ignorance, as if she thinks it is dishonourable. It's like having a little Hapsburg, thinks Laura vaguely, somewhat out of her depth. 'Sweetheart,' she says, when Marina bangs her hip on the oven for the second time, 'are you really all right? What is it?' 'Nothing,' says Marina, looking offended. It cannot be normal for a teenager to be so reserved. What if living with the world's most formal pensioners has somehow over-matured her? Was it something to do with that rather lumpen boy at the party, with whom Marina was so set-faced, so gloweringly wooden that any (dear God) thought of romance on his part must have stuttered and died? Or could it be that bloody school, with its petty rules, its cheese-paring insistence on charging for every tiny 'extra', its complacency? She keeps catching herself cursing it, then remembers that Combe was Marina's choice, her ardent wish, and Marina will never admit that she was wrong. 'But—' They eye each other over the knife drawer. Mothers are supposed to know their child instinctively: not Laura. One of her many greatest fears is that Marina might want her, need her even, and she, Laura, will fail to realize: 'If only she'd told me,' she will say afterwards. 'If only I had known.' # _3_ Marina never thinks of Guy Viney; she notices this quite often. Spring term, Hilary, is about to begin; only four months have passed since she started at Combe and she feels exhausted already, achy and defeated. She goes to see _Dr Zhivago_ at the Czech Centre and attends a children's New Year party at the house of Mrs Dobos, with lemonade and coffee and a real gypsy violinist, embarrassing to watch, and she can't even pretend to enjoy either. A frown is settling into the skin of her almost-seventeen-year-old forehead. Packing takes days; she seems unable to make decisions about which home clothes will stand up to the astonishing cold, how many photographs she can bear to have scrutinized. It's like going off to war. What were once merely things now have special significance; her family's safety depends on identifying a hitherto unnoticed lucky scarf, her future on the crucial pen which will get her into Cambridge. Cambridge. She holds her breath when she thinks of it; it is too sacred to be spoken of. She wants it. She needs it. She is in love with it, and valueless without it. She must not be distracted now. So passing Fivers are nothing to her. Guy will ignore her when they are back. She is another's anyway. But Combe is interested in its pupils' social lives. They print a crested booklet, the _Register_ , containing contact details. She cannot find him in it but occasionally, when rereading Simon Flowers's address, she sees herself there as others must see her: Farkas, Marina; Flat Two, Westminster Court, Pembridge Road, London W2, with her telephone number: 01 229 8753 – an open invitation. What does madness feel like? Can you develop it quite discreetly on the bus home from Oxford Street, carrying mothballs? Can it be normal to cry in department store toilets, at advertising hoardings or thoughts of distant famine? Somebody must know. Laura needs a trusted friend in whom to confide. But half of them have crossed to the dark side: Basingstoke, Bedford, Doncaster. St Albans. The London survivors are too sane, too married; they have bedrooms, and whole houses; they have produced charismatic scruffy children who adore them, or live sterile but sexually satisfying lives of style and beauty. She cannot ask them whether, when they stand on an Underground platform, they think of jumping. It isn't depression, obviously. She isn't catatonic in an armchair, she doesn't have time. Besides, she is not entitled to misery. Her life, compared not only with that of starving Ethiopians but also her very own in-laws, is easy; it is simply that, without Marina, a layer of resistance has started to peel away. Did it happen in the run-up to Marina's going, or on the day she left? In either case, it is Laura's own fault; she should have stopped her. It was a test of motherhood, which she failed. Or perhaps, she thinks, after yet another stern self-talking-to, perhaps this is how women her age are supposed to feel. There is no way of knowing for certain. The lives of women like her, without men, away from their children, do not feature in magazines. When, on the Tube, or tidying the waiting room at work, she happens upon an advertisement for microwave ovens, sun-dried tomatoes, granite worktops, stippling, hyacinths, her soul lifts. Whisper it: this does not happen at exhibitions of German Expressionism. And it is possible, she wants to explain to the world, to be a reasonably intelligent woman – shamefully ignorant and under-educated, yes, but once attached to a modestly adequate brain – yet to long for the four-seasons duvets she will never have. So if she is not stupid, how is it that Mitzi Sudgeon has everything, the labour-saving devices and career and Alistair Sudgeon, and she, Laura, has not? Is it for want of personal grooming? If she had concentrated properly during drawing lessons, might she now have him? Most women your age, she tells herself many times a day, do not live in a basement with two virgins and two widows and innumerable house plants. They are not told off at mealtimes for being too quiet; they have friends. Lovers, even. Is it any surprise that, after thirteen years, you are a little low? Many times a day Marina checks that the phones are on the hook, in case Simon Flowers decides to ring her; although, when he does, it would be better if she were out. Being in would mean she is either a saddo or desperate for him, practically a slut. This is the boys' favourite subject, who is a dirty slut and who is frigid and, since discovering that this is how girls are divided, she has devoted many hours to deciding which she is. What with that, and her chemistry struggles, and trying to learn about jazz for when she and Simon Flowers do finally meet, the holidays are racing past. She feels like an old person, watching the days run out, and all her plans for the holidays – ear-piercing, daily sit-ups, reading _Ulysses_ , possibly learning a bit of medicine in case of future emergencies – have failed. This is partly a question of time. She has less of it now; her old habits of preferring certain streets to others, touching doors and her lucky ribbed tights and shampoo and pens, have expanded until they take up hours. Everything has some bearing on the future. It isn't just the street name, or the houses, or past associations which makes Bridstow Place auspicious, Pembridge Villas a source of contagion, Talbot Road a better route home than Colville Terrace. And it isn't just safety; nowhere round here feels safe. It is the combination of these which makes everything either light or dark; it promises a safe future for the relatives and Cambridge for her, or wilderness. When she thinks of last term, before she had realized the harm she could do, it makes her feel sick: all that poison, stored. Now, with less than a week to go before term starts, she is resolved to be vigilant. If anything bad happens, it will be her fault. Only five nights later, as Rozsi is shouting answers at _Mastermind_ – 'Fool. Belgrade!' – and Ildi is in the bath listening to Rimsky-Korsakov live from the Festival Hall, and Zsuzsi is speculating about the bottle of Opium, 'first-class', she was given by Eszelbad Béla while his wife was not looking, and Laura is trying to remember her mother's recipe for Victoria sponge, the phone begins to ring. It is exactly half past eight. Who can it be but the anonymous caller from the party, about whom Laura has had such extraordinary dreams? Fantasies, strictly speaking, even while she has known in her heart that it was almost certainly Mitzi Sudgeon. Laura's affair, love or otherwise, with Alistair will have been discovered. Men have wives. 'Oh, let's not ans—' she calls. She should be with them, doing her daughter-in-lawly duty, but there is peace in the kitchen, with the familiar soothing English labels: Tiptree, Twining's, Tate & Lyle. She recites them to herself, quietly, secretly, as a drowning explorer might murmur the National Anthem as his dug-out slowly fills. They all ignore her. Zsuzsi, with the confidence of the much-telephoned, hurries to answer it. She is wearing towelling bath slippers embroidered with Hotel Bristol, Baden-Baden, a present from Mrs Dobos, which Laura suspects were not paid for. She puts down her whisk and prepares to be exposed. ' _Ha-_ llo,' says Zsuzsi. 'You vait one moment, please. Laura!' 'Actually I . . .' 'Come, _dar_ -link.' Wiping her forehead with her apron, Laura approaches. 'I don't—' she begins. Rozsi silences her with a look. 'A fellow student,' Zsuzsi whispers, smiling as she tightens the belt of her satinette _pongyola_. It smells of cloves which she, or Hungarians in general, use by the handful as a moth repellent. 'For Marinaka. A boy!' Laura's stomach swoops back uphill. She edges past the sideboard and armchairs and bookshelf and dining table until she is standing in front of Marina's bedroom door. Icing sugar dusts her hands like an interesting skin disease. 'Sweetheart?' Laura's mother-in-law suspends her viewing. Zsuzsi, watching through her gills, unwraps another marron glacé. She has been waiting all day for Laura to paint her toenails Havana Moon. A bus rumbles down Moscow Road, a blackbird whistles from the cherry on the front path. Inside Flat Two all is still. 'Marina. Darling?' Still silence, except, perhaps, for the faintest possible sound; a drawer being shut, a pencil rolled. She's listening to jazz in there, of all things: it sounds like one of Peter's Charlie Mingus tapes, although those are boxed up in the storage room next to the caretaker's flat. Poor pet, what must they think of her at Combe? When I have a minute, Laura decides, I'll take her to a record shop. Buy something modern. The old women wait, in Hungarian, for Laura to knock. The problem is this: whoever designed this flat understood storage but not the emotional needs of human beings. Although, to be fair, it was probably built for a nice ordinary English couple and their child, not all these Károlyis and the endless tide of visiting cousins. Marina's bedroom is essentially a corridor, off which the bathroom and the toilet lead, like a boa constrictor digesting a sheep. This affords her no privacy, not that the great-aunts think this matters. Despite their absolute silence on matters sexual and the lengths to which they will go to avoid being seen entering a toilet, Rozsi and Ildi and Zsuzsi are startlingly relaxed about the female body, keeping each other company when they have baths, stumping around the flat in nothing but supportive Swiss underwear and rubber orthopaedic shoes. Marina may be young but they show her no quarter, continually whipping back shower curtains, patting her _popsi_ , assessing the progress of her breasts. This must add to her terrible bodily shyness. How on earth does she cope at school? Laura, too, believes in privacy. She is just thinking: I will count to ten, no, twenty, when Rozsi appears behind her, heaves the door open over the carpet ripples and reveals Marina, slightly pink, on the threshold. 'Why are you slow? That very nice young boy Guy, he wait on the telephone,' announces Zsuzsi from the sofa, and Marina runs past her mother and slides the hall door closed. Laura hovers in the sitting room, trying not to look at the wavy shape of her child behind the glass, the telephone cable trapped like a sea creature's tender frond. Her daughter, about whom, until Combe intervened, she knew almost everything: the only living person who had exactly the same sense of humour. Those days have passed. Marina is in a lengthy solemn phase, which is probably perfectly normal. I miss you, she thinks, even as her daughter is standing there. What was Guy Viney's motive? He was, he said, just ringing to say thank you but, even if his mother made him, boys like him do not ring girls like Marina. It doesn't make sense. He may only be a Fiver, single sex since he was thirteen, but he must know this. Was it a dare? Was someone standing beside him while he dialled the number, egging him on: Olly Sands, who did the knickers questionnaire? The short ugly boy who won't sit next to girls because he says they have hag fleas? And, if so, why would they do it? As far as the boys are concerned, Marina does not exist. Combe has a caste system and nicknames are the key. They started in the first week, parthenogenetic, like mushrooms, and stuck: the whole school uses them. You have one if you are famous in school, either officially Hot, with Disney eyes and long legs like Marie-Claire van Dere ('Vanderwear') and Alex 'Nips' Nash, or impressive, like Fernanda 'Queeny' Dodd. And you have one if you are ugly, like 'Fatima' Bryan, or poor Sarah Molle, who is known as Anal Mole. Marina tries to tell herself that it is better without a nickname. She doesn't want six hundred boys making mechanical wrenching noises every morning when she walks up the Chapel aisle, like sexy Joanna 'Spanner' Aitchison, particularly now she has discovered that spanner means tool, which means penis. But the truth is that being unworthy of a nickname is a disaster. You are invisible. She can hear the oldies getting ready for bed, talking loudly in Hungarian as if a language she doesn't understand won't wake her. Since Combe started they have stopped offering her bedtime food, grated apple or a segmented orange. It seems extraordinary that only last year she used to lie in bed idly eating and writing letters to her friends, like a White Russian before being shot. ' _Hanyszor fogsz felkelni ma éjjel?_ ' she hears Ildi say. ' _Ahányszor kell_ ,' says Zsuzsi. Is there, she wonders, any way to _engender_ a nickname? No one discusses them, and girls cannot invent them. But, without one, she might as well leave. Secretly she has dreamed of this. People do; someone called Imelda left after Marina's first week, and apparently two girls the year before. She can't stop thinking about the shame of returning to the school you left; the teachers' faces, the friends who wrote pledges of eternal friendship on your faded Green Flashes, whom you had thought you wanted to escape. She has promised herself only to consider it if her mother raises the subject; Marina has been waiting and waiting, and now it is too late. The new term is now only two nights away. All her Ealing Girls' friends, whom she left for Combe, are back at school and, if she hadn't tried to change everything, she'd be with them. This is the problem. It is her fault. Even a cowardly person can be brave once in their life, and then it ends in disaster. Károlyi women are always brave; that is almost the only fact she knows about the five beautiful sisters who lived in the mountains, or the forest – her knowledge is hazy – and whose father's bees made the best honey in the country. 'In Hungary, you mean?' Marina asked once. 'Yes,' said Zsuzsi. 'No,' said Rozsi. 'He was your father. You must know,' said Marina, trying to joke them into revealing something, and then the great-aunts started crying and she never found out. Anyway, Rozsi and Ildi and Zsuzsi are Károlyi, first and last. The existence of lovely Zoltan, Marina's grandfather, of Zsuzsi's short-lived dentist husband Imré, even of Marina's own father Peter, has done nothing to weaken the matriarchal line. And so she, Marina Farkas, has striven from birth to be a true and worthy Károlyi. She has been raised on tales of their acts of daring: Cousin Panni smuggling her father's stamp collection through Customs; the time that Zsuzsi had to climb through a government minister's window; or when Great-aunt Franci met her husband, Ernö, on a broken-down tram and commanded him to marry her. Rozsi is the bravest of them all; she once hit a policeman. She could easily rule the world. Marina is falling asleep. I am not brave, she thinks and, as she sinks through drifts of unconsciousness, she starts to imagine situations in which her courage might be called upon, and would fail her. And then, the innocent, she sleeps. In the next room, on her sofa-cum-bed, her mother lies awake. This morning, the first day back at work, she and Alistair were almost discovered. She had been in his office, ostensibly bringing him letters to sign but actually enduring an explanation of how difficult Christmas and the New Year had been, when the door opened and in came his wife. Alistair looked terrified. Laura accidentally said, 'Sorry.' Mitzi coolly ignored them while producing cheesecake from her bag, trimming loose ends on his blood pressure cuff with her ' _nee_ -dlevorksisor'; straightening his certificates. 'I leave you now,' she said. He hardly spoke to Laura for the rest of the day. The truth is that she doesn't care. Only two nights left of Marina; she cannot bear it. The shock does not seem to have worn off at all. She wants to creep into her room to watch her sleeping. She has done it before: the back of Marina's head, barely distinguishable from the blankets, a pale smudge which is probably a hand. Sleep, my love, my darling, she thinks, as a mother should, but what she really wants is for Marina to wake up and talk, and that is irresponsible. The girl needs rest, for when she goes back to that awful place. My darling, she pleads silently into her forearm. Stay with me. # _4_ Combe began, as disasters often do, with a few small sparks. Marina had begun to fear that her chance to have fun and sexual experience was slipping away. At Ealing Girls', and home, they thought they knew her. What, she would think, walking in the drizzle from Ealing Broadway, if I want to be someone different? 'Do I have to stay at Ealing for the sixth form?' she'd asked one evening, after Urs had been reported by a stranger for eating on the Tube. 'I suppose . . . well, not necessarily,' her mother said. Suddenly it made sense. A better school, a famous school, would change her life. They were all so determined that she should do medicine at Cambridge, and how would she manage that from scruffy Ealing, with its dark poky labs and its half-blind chemistry teacher? They ordered a range of prospectuses for London day schools, but the classrooms looked disappointingly like those at Ealing, and the girls in the photographs were much more glamorous. That ruled them out. Was she cool enough for a mixed State school? She quite liked the idea of saving her grandmother money, but Rozsi would not consider relying on the government to pay for her grandchild's education. Besides, Marina was beginning to wonder whether true sophistication was realistic in London, where every bookshop and café seemed to contain old ladies saying 'You must be Farkas Rozsi's _grand-_ daughtair! _Dar_ -link, you _re-_ membair me?' Then, one night, as she watched _St Trinian's_ on television with her mother and Ildi, she had a brilliant idea: boarding school. Cricket pavilions, and midnight feasts, and Gothic stone. Oh yes. The moment she started imagining it, her heart beat more quickly with dreams of reinvention. She could try anywhere, become a traditional boarding-school girl, or an arty progressive bohemian, and some time passed before she realized how stuffy an old-fashioned all girls' school would feel after Ealing; how out of her depth she would be among people who had grown up in co-education. And so it was that Marina Farkas, girl, from a girls' school, a female family, was left with only one alternative. She would investigate the venerable boys' public schools which now took girls in the sixth form. The snowball grew larger; she was running to catch up. There was a question buried in the middle, like an aniseed ball: did her mother know her, love her, enough to refuse to be parted from her child? Apparently not. She just let it happen, flicking through prospectuses, trailing around with Marina and the great-aunts at open days, and did not once protest. Right, thought Marina. If you don't care, if you want to be rid of me, I'll apply for them myself. Besides, the others were excited. These ancient schools were beautiful, and famous, and fantastically well equipped; practically little colleges, which surely would give her a better chance. Mrs Dobos, her grandmother's friend, summoned them to her white-carpeted Maida Vale flat, with the prospectuses. They told her what they had seen at the open days: boathouses, cloisters, 'dormies', ' _com_ -putair' rooms, observatories. 'Svimming pools?' asked Mrs Dobos. 'Inside pools!' said Rozsi, who will swim in anything: black water, weedy woodland lakes. 'Very good,' said Mrs Dobos. 'But Combe Abbey, where my great-niece went, of course you look there too.' 'Of course,' said Rozsi, shooting a fierce look at Marina. 'Of course!' So she applied to sit the exams. She had done all this research, and no one seemed worried about the money. The snowball rolled over a bump and picked up speed. She probably wouldn't get in anywhere. But it would be silly to lose courage now. She won a place at all four schools she tried. But even though the two most genuinely famous ones offered her scholarships and Combe Abbey only a modest bursary, she found herself thinking that Combe might be the place for her. Some of the others, with their icy radiators and silent gardeners raking the drives, their school farms and yachts and clay pigeons and compulsory outdoor skills expeditions, were clearly not. Combe, however, seemed to be the perfect combination of impressive age, good results and moderate status. And it was in Dorset, near Blackmoor Vale; very healthy, agreed the great-aunts, and not too difficult by train. And if her relatives were worrying for her about daily Chapel, or drugs, or a ratio of four boys to one girl, they didn't say. She was anxious herself, who would not be, but more about whether her constant backache meant osteoporosis, or if she could bathe her breasts in cold water often enough to firm them adequately before September. Soon fat crested envelopes began to arrive from Combe Abbey, to be read as a reward between her GCSEs until the pages softened. There were calendars of Chapel services: Matins and sung eucharists in the Choir which Marina would joyfully attend, raising her voice on high to 'Ave Verum' by Byrd (William, 1543–1623). They examined the little plan of the abbey ruins, to which the school was attached, its old walls skilfully incorporated into newer buildings by an Old Combeian architect with, suggested Marina's mother, friends in the Planning Department. They went to Rozsi's optician, where, after a lengthy examination, she was permitted to have semi-permeable contact lenses to be worn for two hours a day. She practised with them every night; it was like putting grit in her eye, but it would be worth it. A scarlet fever questionnaire arrived; then the _Almanac;_ the school rules, the supplementary rules for scholars, and the rules for what at Ealing Girls' were just called monitors and at Combe were apparently 'Sirs', even the girls. They purchased a recent copy of the school magazine, the _Combeian_ (£5 from the school bursar, Colonel Perry). They were sent packing lists, details of permissible extras (scientific calculators, tuck boxes, riding boots 'if wished'; desk light [UK plug]; laundry bag; 'one [1] mug'); the addresses of approved purveyors of the boys' exciting tailcoats and girls' disappointing blazers and the school scarf in navy and pink; a brochure of Old Combeian Association cricket jerseys, cummerbunds and decanters; a book list; and, most deliciously of all, the exact dimensions of her trunk. She had never desired any object more. Her love for her twin-deck JVC tape recorder, even for her desk, paled in comparison. The night before her grandmother went into town to buy it, she could not sleep for excitement. But at Harrods, the only official stockist in central London, Rozsi chose black leatherette with shiny brass studs: an enormous disappointment, which Marina concealed. Besides, there was always the _Register_ for comfort: the masters, degree and alma mater noted, down to the head groundsman (Henley Agricultural Institute, Dip. Hort.); and, better still, the boys: three years' worth of Freshers and Removes and Fivers called Quentin and Hugh and then the entire Sixth, girls included: two hundred and forty-three possible friends for midnight feasts, moorland house parties and, almost certainly, marriage. It didn't seem to matter, at the time, that girls had only been admitted to the sixth form for three years. How much difference, she asked herself, could that make? But she would have to change her old self; no doubt about that. She needed class. She spent the summer preparing. She read _Tom Brown's Schooldays_ and _Billy Bunter_ as if they were textbooks. She tore pages out of Mrs Dobos's old _Tatler_ s and _Harpers & Queen_s ('For the Smart Insider') to decorate the inside of her wardrobe: square-jawed men lounging about in libraries and beautifully dishevelled women on grouse moors; Scottish Christmases in velvet and taffeta. She was in love with tartan. There was a world out there in which people celebrated Burns Night with wild country dancing, drank sloe gin at point-to-points, bundled up for the night in cold stately homes under opossum car rugs 'like Granny wore in her Daimler'. Oh. Please. Yes. This was it: the future. She was at the peak of nervous happiness and thought that another, higher, peak was beyond. It would feature cheery refectory meals beside tall friendly English girls with welcoming families; stimulating lessons in well-equipped Victorian laboratories; handsome boys writing her sonnets beneath historic oak trees. Handsome boys, like, at a push, Guy Viney. Soon it would not matter that she could neither hurdle nor paint nor sing, her shyness in the showers would be irrelevant, for at Combe she would blossom and become herself. And even when she had waved her family goodbye on the terrible first day, watching their hats receding down the drive and feeling she would die of pain and fear, she had not realized how much worse it would become. # _5_ _Friday, 6 January_ Rugby: Dorset and Wiltshire sevens, U18 (all day), Salisbury; Freshers' swimming time trials, Recreation Centre, 4.30 p.m.; squash tour to Kuala Lumpur begins (minibus leaves Garthgate 5.10 p.m.); Countryman Society talk by Mr Kendall: 'Forestry: An Ancient Craft', Old Library, 7.30 p.m. The first days back are horrible. Marina keeps expecting her mother to come and take her away. But what if she can't? All the fears of childhood have come back with new vigour now that Marina is too far away to protect them from intruders, race riots, Spanish flu, nuclear winter, IRA bombs. Guy Viney is irrelevant, a plaster on a spurting wound, and so the first time she sees him, muddy and laughing at lunch with Ben L and Ben P and Rich from her year, she ignores him. She is busy trying to think of a reason to be near the crypt when the Combe Singers, in which Simon Flowers is a tenor, finish practice. Guy won't speak to her now they are back at school. She certainly won't speak to him. Then, on Friday night, she has to queue right behind him in the Buttery. He is extremely sure of himself for a Fiver. He is talking to horrible Giles Yeo from Marina's year and, although Giles always ignores Marina, when Guy says, 'Wotcha,' Giles gives her a curious look. Why is Guy so confident? Fivers usually keep to themselves but he finds a table with Giles and some of the Bens and says, 'Come on,' so she sits down with them. As she sprinkles cheese on her baked potato, grate by grate, she watches him consume mulligatawny, beans, double chips, peas, broccoli, grilled tomatoes, buttered rolls and two vast sides of breaded haddock, and listens to his silly jokes. Once or twice she laughs, accidentally, and he grins at her. She concentrates on resisting the temptation to take off her glasses; it makes the Buttery less frightening, but she is so shortsighted she will walk into a table. If only, she thinks, I were normal, like everybody else. 'Can I have your custard?' Guy says. She won't let down her guard just because he's younger. He's still secretly laughing at her; he'd probably be one of the boys holding up score cards for the new girls, if it hadn't been banned last year. Apparently they had to; that's why Imelda someone ran away into the night and was never seen again. Even so, they still put up lists giving marks out of ten in some of the houses: maybe Macdonald, where the boys won't speak to girls at mealtimes, or Fielding, where they ambush girls with buckets of water for wet T-shirt contests, not just in the summer term as in other houses, but all year long. She must have a score. She wants to know what it is. What kind of girl, she thinks, wishing she hadn't eaten her crumble, would— Then she looks up and sees Simon Flowers. Behind him, in slow motion, the Buttery doors flap shut, open, shut. She can feel the slowing of her atrial diastole; she is barely breathing by the time he reaches the trays. He speaks kindly to the one-armed dinner lady. Why is he, a day boy, having supper at school? Probably he's been practising his jazz guitar riffs, or playing the organ alone in the Chapel, and a scene from her numerous imaginary sexual adventures catches her unawares. Her heart booms towards him, yet he does not see her. She must practise saintly patience. How long must she wait? A week? A term? If you haven't got off with someone by the time you're seventeen, you will definitely die alone. It's a measurement, like lung capacity. Everyone here has been doing it for years; she has pretended the same. 'What's up?' says Rory Kingsly. 'You look like a flid.' Two blonde girls from the year above giggle. 'Shut up, Kingsly,' says Clare Laker. 'You sound like a knob,' and she mouths at Marina, 'Pitiful.' But Marina who, four and a half months in, still feels her true Combe friend is yet undiscovered, hardly notices. She is thinking: I can't go on. Simon Flowers: Simon. Come and get me. I am ripe for you. Meanwhile, in London, Laura exists. She polishes the grill pan until it shines like pearls; she helps Ildi find her lost Italian dictionary; she feeds Rozsi's jade plant the correct quantity of vegetable water and battles the relentless London dust; she makes up her bed each night on the sofa cushions and falls asleep, eventually, to the perpetual murmur of the World Service, to the snoring and sighing of elderly immigrants and buses hissing past outside. Around and around in her tired head one thought spins, 'What should I do?' as if, with five minutes of hard thinking, she will realize that she has all the solutions already: a good man, close by and single, with whom to fall in love; somewhere affordable to live, where she can eat baked beans and listen to music befitting her age group and walk around in the nude; a professional qualification about which she had forgotten; a nearby day school which her child will consent to attend. She goes to work and feigns interest in plans to replace the receptionists' plywood shelves with plastic-coated steel. Black or grey? Who cares? She sits on the bus and feels guilty about the Farkas-Károlyis' unlimited kindness; about her father, her daughter's father, and her daughter. Then she comes home again and tries to think about Alistair, or composes letters to Marina, which she rewrites until nothing she wants to say is left. For the last eight months, since Marina started preparing to go away, Laura's life has been controlled by the Royal Mail. Her spirits, too, now that she thinks of it. She had been proud of how well she coped after Peter went, and through the long years of sofa-dwelling in Westminster Court. But now, whenever she is out, she looks for postcards – paintings from the endless exhibitions she attends with the in-laws and, when away from them, 'Great British Fry-Ups' or 'Piccadilly Circus by Night'. When at home she is thinking of amusing observations, timing her day around the arrival of post. She sent a card every day last term, but now she has decided she must restrict herself. Marina hardly ever commented; she just became tenser and crosser. Clearly, all Laura's careful non-expressions of love were too much. Days pass. Life, if one can call it that, continues: a constant counting down of the hours until the end of term. Perhaps, she thinks, tidying the waiting-room magazines, I just need sex. Sex is, however, not easily obtained. She has not touched the private flesh of Dr Alistair Sudgeon since a month last Tuesday, when they arranged for her to do an evening spring-clean while he 'worked through files'. It was not even particularly satisfactory. The effect on her of cold vinyl, antiseptic odours and, curiously, his white coat on the back of the door, to which she had so looked forward, had not been positive. But more, or elsewhere, or better, is out of the question. How can she be old enough to feel this tired, yet have no privacy whatsoever? Alistair is so busy at home, is so widely known – at least, in W2 – and also, perhaps, like Laura, has certain ambivalences (how can she ask him when they are together so rarely? How could she raise, by letter, something that would require discussion, even a row? What is a bubble burst? she sometimes says to him in her head. He does not answer). Does this mean, she asks her reflection in the bus window, that things will never improve? In which case, might I be having not a nervous breakdown, but simply a disappointing life? At this thought she jerks her face away and finds herself being smiled at sympathetically by the woman opposite. She smiles back before she notices the woman's multiple badges, her rat's-tail plaits and tattooed thumbs. Now even mad people pity her. If, she thinks, trying to be matter of fact, the bus skidded now on Westbourne Grove, would that be so bad? Every morning after First Quarter Marina and the other West Street girls rush back to the house to check for letters. West Street is just outside the school grounds, reached via a narrow passage beside Bute House. It is not a house in its own right, but a place in which female quasi-members of the boys' houses live. It was once part of a terrace, now partitioned like an experiment for mice, and Marina has failed to make the slightest sense of the labyrinth. Whenever she ventures to the upper floors, the double staircases foil her. She has endless dreams of being lost. There are no mullioned dormitories or coats of arms here, no crested oars draped with football socks, no miasma of Paco Rabanne. West Street is clean, and vigorously air-freshened. There is a kitchenette, floral curtains, doilies. The fire doors are decorated with posters of kittens in hammocks, thoughtful bears. The carpet is dusky pink. And there is a matron, Mrs Long, whose twin passions for Benson & Hedges and her flatulent Dandie Dinmont terrier, Anthony, sit uneasily with her stringent domestic expectations. Other girls receive constant correspondence: brotherly post from agricultural colleges; cheery catch-ups from their mothers about puppies and their fathers' business trips; invitations to charity fashion shows. They all have thousands of people at other schools in common and read out bits of letters: 'Jamie – no, silly, Stowe Jamie – says we _have_ to go to the Gatecrasher Ball.' The only girls who keep their correspondence private are the recipients of love letters, like the eye-linered and patchoulied Simonetta Bruce, to whom Marina has taken a fierce dislike. And Marina herself. How could she show her post? This is her total so far: one forwarded membership reminder for the Puffin Club; one grumpy eight-page letter from Ursula Persky, her best friend at Ealing Girls', tucked inside a _Hamlet_ programme from yet another school trip to Stratford; a single postcard from her mother saying not much; and one of Rozsi's brown paper packages. How she loves these parcels. How she hates them. This one contains sponge fingers, a leaflet about childhood illnesses, unsolicited lo-calorie sweetener, a bank-bag of fresh ten pences for the pay phone, a _Tatler_ from Mrs Dobos and a short letter: 'Hallo darling don't you want a lovly hair cut? Tell me I ask Krystof any time he helps you. Sorry you are not siting next to me. I try to send beter letter soon.' Unlike Ildi, who fills exercise books with vocabulary and old diaries with informative facts (' _Raphael died on his 37 birthday. Crucifiction_ [sic] _early picture (about 20 years). A bit provincial (see fluttering ribbons)_. _Best in the figure of Christ. Painted for a convent_ '), Rozsi is not comfortable with writing, at least in English. Her handwriting suits Hungarian better. Last term she sent Marina a sewing kit which must have been hers; when Marina ran to the bathroom with it and opened the lid, an old browned piece of lined paper fell out. The smell of the flat has faded from it, but she still has the paper: a few meaningless accented words, written in pencil, too full of possible momentous secrets to throw away. She keeps having premonitions that harm is coming to them. Since Combe, or was it before, she cannot stop expecting it, attempting to prevent it, knowing that nothing she does will be enough. The fear that she will contaminate them is much stronger this term. Simonetta 'Slutter' Bruce has the room next to Marina's, and her music and loud laughter infest everything Marina owns. Although she is an Upper, and is best friends with a girl in School House so is often elsewhere, the smell of her Players and Rive Gauche means that she always seems present: a force for bad. Apparently, she has had sex in Divvers; her mother is dead, or at least divorced. Two days into the new term Marina is using her jumper sleeves to open doors which Simonetta might have touched. She holds her breath when she comes upstairs. If someone in Marina's family dies, Simonetta will be the reason. She cannot cry now, about to go into chemistry. All day she aches for her mother, who has not written again, but she saves her sodium chloride tears for the night. # _6_ _Saturday, 21 January_ Rozsi is in lingerie. Once they all were; she and her handsome husband Zoltan owned FEMINA OF KENSINGTON, as it still says on the shop front, and Ildi, when she came to London from Budapest in '56 with a chemistry degree, wrote their letters, and beautiful Zsuzsi, whom it is difficult to imagine doing anything, apparently travelled for them to Greece and Vienna and even 'Petersburg', where they understand the power of elastic. What Laura has never quite followed is – well, all of it, really. The heroic origins of Femina have often been repeated: Rozsi's discovery of some missing money when sweeping a different shop, Ginswald's on the Finchley Road, when Peter/ _Pay_ -tare was a babe in arms and Zoltan was fighting in the war; her honourable elevation to assistant and the small suggestions which led to her being permitted to design one perfect brassiere, then another, and then to be given a shelf, a section and, in the end, when they had saved and borrowed enough, for the Farkases to buy their own tiny shop and break free. But there is something murky at the back of it, some fell moment when Zoltan weakened, and everything was lost. Zoltan was a lovely man: not as funny as Peter but gentler, more chivalrous, with the same terrible steely pride. The formality, or sense of honour, which in Rozsi is so terrifying was, in Zoltan, a comfort. With a man who wears a vest to conceal his chest hair on holiday and a tie to see the dentist, who expects toddlers to stand when their mother enters a room and who eats bananas with a knife and fork, you know where you are. Laura, his mere daughter-in-law, misses him more as the years pass; he loved her, although obviously not as much as he did Marina. He cannot be mentioned at home: there will be crying. So on the bus she imagines conversations in which he offers understanding, and forgiveness. But what did he die of? Somehow she has forgotten, and now she wants to know. It happened suddenly, and at that moment Marina was a tiny child, Peter an increasingly unreliable mess, and their fourth-floor one-bedroom flat in north Acton like something from a Pinter play. All she does know is that Femina, still revered by its loyal customers for its old-fashioned service and the firmness of its silhouette, had to be sold to Mrs Dobos, their compatriot. Rozsi, now merely the manageress, is old. Her salary is her sisters' only income, apart from a decreasing amount of what Ildi calls home-working: occasional bits of proof-reading for Czech and Hungarian business acquaintances of Rozsi's, which Ildi does on a fold-out table. Combe Abbey is the natural home of children with well-fed hair and indulgent businessman fathers. Perhaps there is financial leeway for some families, but it is hard to imagine the bursar offering help to Marina. If Laura loses her own job, due to ineptitude or sex or its absence, what will keep the wolf from their door? She is carrying her bedtime glass of water into the sitting room when the phone rings. She jumps like a guilty woman. 'Hello?' she says. 'Hello?' No Marina. No anyone. The fizzing thickens into the sound of breathing, of thinking, pale granules clumping together to form a shape: almost a face. Pale, with red hair. Who else could it be but Mitzi Sudgeon? Hatred has an echo. War has been declared. _Sunday, 22 January_ Sung eucharist (Crypt Choir) or pastoral address, Divinity Hall: Canon Paul Sheath, 'Overcoming Temptation'; hockey: Pineways Tournament, 1st XI, Sholtsborough (minibus leaves 11 a.m.) (A); OC Society talk by James Pollinger: 'Constable: His Art, His Life', Combe Lodge Chamber, 5 p.m.; Wine Appreciation Society: Rioja, deputy headmaster's rooms, Cordfield; Choral Society rehearsal (open), Divinity Hall, 7.30 p.m. It is strange, Marina observes, that once you start noticing someone you see them everywhere; in the queue for tuna crumble, or hiding under the Praecentor's Gate from a downpour of acid rain. Now as well as Simon Flowers, and various enemies, and Wilco the feral groundsman, she begins to spot Guy Viney all the time. 'All right?' he says when he sees her, even in public. The shame of talking to someone who has read all Jane Austen's novels, even _Lady Susan_ , doesn't seem to occur to him; he clearly does not know that in lessons she is the only girl who puts up her hand. Or is it because he is younger? He is lucky that she acknowledges him at all. ' _Minden jól_ ,' which means 'very good', says Zsuzsi on Sunday morning, when Marina rings home. 'How is that nice boy?' At that moment Marina realizes that no one at school has referred to Guy's visit to Westminster Court. Is it possible that he hasn't told everyone, that they are not laughing and mocking behind her back? Maybe he won't ruin her. Maybe he is nice. But that is all. They have nothing in common, whereas Simon Flowers, scientist with a soul, is a perfect match. If he boarded like Guy, they could talk all night; instead, he goes home to his family, about whom she knows not enough, except that his mother is a librarian, which warms her heart. She would pay all her money to visit his house for a single minute. Guy Viney must have a family too, but who cares? That evening Alexia 'Sexier' Prior says, 'Come with me, no one else is around,' when she is getting ready to go to Percy to see her crush, Jim Finn, and so Marina goes. The staircase is rich with the smell of plimsolls and what she suspects is boys' deodorant, sprayed in flammable quantities. Guy's room, Percy IV, is next door, up in the roof. His door is open. 'Hey,' he says. 'Want a chocolate biscuit?' Percy IV has a romantically steep ceiling, a collapsing armchair, carved stone vines around the door and a glow-in-the-dark 'Stairway to Heaven' poster. For a Combe boy he is friendly, although the Fiver sitting on a beanbag, his roommate Tosser something, ignores her. At first Marina just smiles and nods as they talk about football; if she fails to look interested they will call her a 'woman', which is a grievous insult. But Guy keeps giving her biscuits, and doesn't refer to having seen Westminster Court, or laugh when she says, 'But who is Jim Morrison?', and when his friend says, 'WSK,' which means West Street Knockers, he tells him to shut up. Guy doesn't ask her questions either, but when, almost for something to say, she starts talking about Cambridge – mocks, predictions, UCCA forms, the masters' frustrating lack of interest in helping her choose a college – he doesn't look disgusted. 'Oh, right,' he says. 'A brainy bird.' 'Honestly not,' she says. 'It's . . . actually, I'm really scared. I'm never going to make it.' 'Bollocks,' he says. 'Just give it a whirl.' When she gives up on Alexia Prior and starts to go, he says, 'Come by any time,' and, because he is not remotely a romantic option, she does. She has never been good at Social in the West Street television room, where combinations of Allegra and Isla and Ellie and Nicky and Alex and Fleur and Vix and Belinda and Antoinette 'Toni, rhymes with Joni' Collister and Daisy Chang and Annabelle 'Pubic' Tuft eat white toast and discuss either the First Eleven, or frequency-wash shampoo, or which boys they all know at Marlborough and Wellington, every single night. Upstairs is worse because her bedroom contains Heidi Smith-Russell, her Hilary term room-mate, daughter of a millionaire poultry-feed manufacturer near Chichester. Heidi has a Filofax and buffs her nails twice a week; she claims that this is as important as washing your hair. Marina wants to ask Mrs Long if they were put together this term because they are equally unpopular, but fears the answer. Anyway, unlike Marina, even Heidi has friends. Guy saves her. Because she has a boy to visit, the West Street girls don't mind if she misses Social, but their indulgent smile and references to 'happy hour' confuse her. 'It's not _that_ ,' she says, burning with shame and pride. Nevertheless, the next time she goes she wears her contact lenses and then just sits blinking on Guy's beanbag, feeling like a fool. He is quite funny for a Fiver but not at all attractive: too pasty and puffy-haired for that. He likes explaining in detail why he fancies Amanda Stapleton, known as Knobule: her tennis shoulders, her long flicky hair. His maleness is irrelevant, like a dog's. Later, in her room, she thinks about Simon Flowers just as much as before. Besides, she has work to do: an assessment of Hardy's nature poetry, the respective properties of chlorophyll- _a_ C55H72O5N4Mg and chlorophyll- _b_ C55H70O6N4Mg. She writes on and on in brown-black ink, past midnight, past two, and although her backache is worse, and sometimes she doesn't seem to be breathing properly, and her heart aches, she tries to keep her mind on the golden prize: Cambridge. Isn't that the point of it all? Simon Flowers will be there too. They will punt, or bowl, or play croquet, in an intellectual yet passionate union, miles away from Combe. As she falls asleep she thinks of him chastely in bed in Stourpaine, and barely misses her mother. Or, rather, discovers that if she refuses to let herself, closes herself to even the possibility of pain, she can bear not to be with her. Besides, it is safer for the Farkases not to be thought about and, although forcing her mind away is like bending metal, she is Rozsi's grandchild. She manages. Then everything changes. On Saturday nights they are allowed, Within Reason, their freedom. This means alcohol. The Combe Abbey rules about alcohol are perfectly clear: never before the sixth form and, if every term a Fiver stomach or two has to be pumped, there is no need to discuss it. On returning from dinner out (never just drinking) on a Saturday night, Combe pupils must report to their housemaster. Why the housemasters never notice that everyone is completely drunk is a mystery. It has happened to Marina twice already; she remembers nothing at all of the first time, and the second she insisted on walking in a straight line and broke a chair leg. There are always awful stories: paralytic staggerings into the arms of the headmaster's wife, vomit in the Chapel, turds. Today is the birthday of Selina Knocker, the sweet but stupid child of the head of the navy who is, physically at least, in all Marina's classes. This must be why Marina is invited, but Guy is a Fiver, too young to be in town after dark. So why is he allowed, even if their parents do know each other? She tries to ask, but he just grins and says, 'Ve haff vays.' She is wearing contact lenses. Dust and drizzle and her own fringe keep blowing into her eyes as she walks along the dark East Combe Road, next to Selina's cousin Gypsy. No one brings coats, let alone their great-aunt's umbrella from Fenwick's, so Marina's teeth are chattering, which she is trying to disguise with conversation. Because this part of Dorset is so very flat and ringed by hillsides, she often has a feeling of being cut off from the rest of England, as if they are walking at the bottom of a meteor hole. If only, she thinks, I could see London from here, even just a bit of Esher, I would know they were safe. Gypsy, Jippo, is unfriendly but very beautiful, with long brown legs and big blinky blue eyes. Apparently she has just been skiing and seduced an instructor. Marina is struggling to find common ground. 'Where are we going?' she asks, after an awkward silence through which Jippo sails, serene. 'I mean, I know the name, but I haven't . . . is it a, a _smart_ restaurant? I mean—' 'Just Capote's.' 'Oh. Thanks.' She has already spent too much this term on inspiring postcards and impressive Penguin European Classics: _Orlando Furioso_ , _Oblomov_ , _The Trial_. She cannot ask her mother for more money. They pay probably hundreds every year for her fees, and then there are the train fares and the Old Combeian Society (motto: _Floreat Combeiensis)_ , for which Rozsi signed her up for lifetime membership, together with OCS crested lapel badge and fountain pen, before Marina's first day. Even the uniform, all those ties and tennis shoes, must cost quite a bit. I will order modestly, she thinks, and sits down, moved. But they are cold and damp, and order hugely: onion rings, _frutti di mare_ , lamb chops, steak. She eats her Margarita pizza and drinks enough house white to make the night seem glittery, the future not exactly golden, but not leaden either. She catches Guy's eye and smiles. She can even stand sitting between Giles Yeo, who has slicked-back hair and Ray-Bans, and Bill Wallis, whose shirt has bow ties and champagne bottles on the sleeves. 'Wop,' they call each other, 'flid' and 'spaz' and 'faggot'. They lean across to talk about rugby, pretending to be very careful of her WSK but otherwise ignoring her. Bill's three brothers all came here; next year he will be captain of the rowing team, so it would be unwise to annoy him. Nevertheless, Marina refuses to make conversation, on principle. She looks towards the salad bar with an enigmatic smile, thinking of being with Simon Flowers at Cambridge, crossing the quadrangles in lab coats on their way to making discoveries. They walk back to school in formation: popular girls at the front like Amanda 'Saddle' Collindale, who hunts, and Michaela Buonasenda the nymphomaniac; Guy in the middle, Marina at the back. The streets of Combe are deserted. 'Where are the peasants?' bellows Bill, and Saddle snorts. Marina is almost too frightened to breathe. Her lips are dry. Townspeople really might attack them; I would, she thinks. Victoria Porritt, 'Muffster', a big-haired fat girl in Fitzgerald House, Fitz, with a Tory MP father, totters on the cobblestones and takes Marina's arm. 'You don't want to be a _doctor_ , though, surely?' she says. 'I mean, really.' 'Well . . .' If she explains that it's not about wanting, Victoria Porritt might not understand. 'I, I quite _like_ the sciences,' she says. 'Ugh. Biology. Chemistry! How can you stand it?' Marina swallows. 'What do you want to be?' 'Nothing. Married.' She puts her wet mouth against Marina's ear. 'Did you know I was finger-fucked by Pete Galbraith at half-term?' Through silent Garthgate, which usually she avoids despite the new lamp posts and illuminated night guard's hut. Victoria Porritt does not care. She eulogizes her pony and Marina joins in, the little fraud. Above the spire and ancient towers, the Plough lies upended in the cold. Her heart is clanging. Only babies are afraid of the dark. They face the blackness at the end of the passage. Then, enormous in a strip of lamplight, out of the shadows looms Guy. 'Piss off, virge,' shout the boys at the back, head-locking him and ruffling his hair. 'Oh, help!' screams Victoria Porritt and hurries off to join the others. Guy grins at Marina. 'Bet you haven't seen this,' he says, and leads her back through the night to a little fence, easily climbed. Into the navy sky above them stretches another tower, a spray of stars, a single lit-up window. They are in a little walled garden hard up against the side of the ruins; there are flowerbeds, but no house close by. 'Like it?' he says, lowering his voice until it is just breath in the cold. A branch of something is close to her ear; it smells sweet although it is winter. Rozsi would rip it off and take it home; she knows no shame. The bat roosts and jagged pressing leaves, the distant footsteps, are horrible. Their curfew is eleven; breaking it is punished with rustication, like sex. She smiles nervously, consolingly. He is just a Fiver, showing off. 'Shall we—' He moves closer: not exactly a friend. Although he has never shown the slightest sign of interest, indeed has discussed further his inexplicable desire for Knobule Stapleton, an atmosphere is developing which even she cannot miss. It fills her with sadness; she had such high hopes. In all these long years when nobody has wanted to kiss her, she has been ready, memorizing Stevie Smith's 'I like to get off with people' and e.e. cummings's 'may i feel?' until she and Ursula knew them, literally, backwards. She understood passion and desire, and how they would feel when they found her. But boys like him, she realizes, about to hatch, must need girlfriends too. And if they can't have Knobule Stapleton they will aim lower, and lower, until they end up with her. # _7_ Many miles away, in west London, Marina's mother sits at the dining table, making notes on the index cards she keeps in a folder labelled LAURA'S WORK Laura is a receptionist. Not even a good one, as Alistair, in his capacity as her employer, makes perfectly clear. She spends her working day in a morass of shame and minor disasters, not putting telephone calls through, hiding substandard photocopies, worrying that she has forgotten to tell someone that they are pregnant, dying, both. Her job has, however, three advantages: a constant supply of memo pads and ball point pens labelled CYNOSTEX FOR CYSTITIS AND AGROLAST: THE LARGER HERNIA PATCH; proximity to Alistair, which is, she reminds herself often, the enabler and not the sole cause of their passion; and, most importantly, patient confidentiality. Even Zsuzsi respects this; most of Laura's paperwork is about verrucas, or mump vaccinations, or any of the many areas of human suffering in which she has no interest. Consequently, every day Laura lugs home a pile of non-exciting correspondence, and in the margins, in light pencil, she expresses herself: _Oh God rescue me. A: won't you ring? Marina Marina Marina God I can't stand this._ What choice does she have? Here in her candlewick sarcophagus, space is limited. Her bedding lives in a suitcase beside the bookshelves; forty years' worth of childhood books and over-exposed Polaroids tangle in her mother-in-law's spare drawer. If Laura kept a diary under the sofa cushions, someone would find it, yet there is much in her mind which needs an outlet. Such as, for example, her feelings about the fourth great advantage of her job: a little drawer, a little key, a cupboard in Dr Sudgeon's office containing Tramadol, Valium, Temazepam, of whose comforting existence she has been thinking more and more. Would, she wonders now, purely theoretically, twenty be enough? This is how it begins: an ordinary teenage love story. He never, obviously, contravenes the Six Inch Rule by touching her in public, or is affectionate in private, or acknowledges their intimacy where others could hear. It is better this way, given that he is in the year below. However, everyone, from children in the Freshers to the head boy and captain of rugby, Thomas 'Tom' Thomson, seems to find her less freakish now. It's like being married. They have a routine. Girls are not allowed in boys' rooms after Hall, but luckily Guy is helping the Freshers build a feathered gondola for _The Merchant of Venice_ , in which Marina has a humiliatingly small part. Drama at Combe Abbey is spectacularly lavish, like its sport. Participation, the pupils are frequently told, 'is what makes a well-rounded Combe Man', although most of them stick to rugby. Guy, however, has been roped in by his housemaster, Pa Stenning, to help with the props. And so, three or four times a week, Marina accompanies him beneath the stage of Divinity Hall. Although the handsome bachelor Pa Stenning is the head of drama, he never checks on Guy and his little shivering team of Removes and Freshers, tapping away in the cold. Guy says Pa Stenning trusts him. He smokes cigarettes, cupped in his hand like a workman, and issues instructions. Marina pokes among the smelly costumes, practising her formulae and the laws of chemical combination, waiting for him like his French lieutenant's woman, trying to think of conversational topics which might interest him without boring her to despair. Then they go round the corner to 'check the rig' and clinch under the cables: Guy's shirt sleeves around Marina's soft body, the smell of hot dust and sweat. She likes the way his veins stand out in his forearms, the size of his wrist bones despite his youth, and this encourages her; she is not dead to his attractions. Yet when his Doc Martens nudge her penny loafers she edges away, as she would never have done from Simon Flowers. Perhaps because he still fancies Amanda Stapleton – he talks about her and then gets off with Marina, as if she is a spittoon – he is less pressing than she had expected. She is still splashing her bust with cool water, experimenting in private with scrunchies, regularly applying lip balm. Nothing helps. Should she be stoking his ardour? Shouldn't he be trying to ravish her? So she does nothing but let herself be kissed, and sometimes she can almost feel herself tipping over into excitement when they kiss particularly hotly, their bodies cores of fire wrapped around with cold. When does petting start? She is not, whatever his friends think, a prude. She has been waiting for someone to touch her breasts since she was eleven. Sex, she has always known, will be wonderful. Maybe, she thinks now, exhausted yet wide awake at three in the morning, looking across to where Heidi sleeps in a haze of vaginal deodorant and body spray, she was wrong. 'You're Mrs Farkas, aren't you?' says a voice. Laura is shopping in Fritz Continental on the Edgware Road for the particular brand of blueberry jam the aunts-in-law prefer. It is a guilt present; this week she had hoped to buy herself a magazine, but she feels she should be making up to them. She turns. The woman beside her, frowning at crisp-bread, is tallish too, worried-looking too, distantly familiar. 'Oh,' says Laura. 'School – I mean, Ealing. Aren't you—' 'I taught Marina history. Bridget Tyce.' 'Sorry. I'm an idiot. Miles away.' 'Mm, I'm the same.' They look at each other. 'I have a Russian mother-in-law,' she tells Laura, 'with specific crisp-bread needs. Do you happen to know—' 'That one. They like the seeds. I thought . . . Aren't you _Miss_ Tyce?' 'Well, not a legal mother-in-law. Teachers have sex too, though, you know,' she says and smiles. Laura smiles back; there is a pause as they both consider the sex Miss Tyce has been having. 'How _is_ Marina?' Miss Tyce asks. 'Well—' 'We miss her, you know. Bright girl. I do hope she's happy.' Laura's face says it. She means to come out with the usual reassurances, opportunity and facilities and privilege, but the words will not form. She feels her bottom lip beginning to betray her, and coughs. 'Well.' 'She isn't?' 'It's, well, to be honest, it's a shock. I mean, not just for me! But, but she'll settle, I'm sure. We're all very proud.' 'Boarding school and Marina: it's hard to imagine. Not one to suffer fools, is she? No. Well, we'd have her back in a second.' Laura nods. A cloud of unknowing sinks upon her, blotting out decisions, feelings, the future. She wants to lie down and sleep. 'If you did, if _she_ did change her mind,' she hears, 'we could discuss it. Definitely possible. But don't leave it, or it'll be too late.' When Marina rings home on Sunday morning, the ten pences hot and damp in her palm, she has decided to mention, just by the by, the fact that she is a tiny bit homesick. It doesn't work that way. 'Antibiotics,' her mother tells her, sounding distracted. 'It's her age . . . they want to be sure.' 'Poor Ildi.' 'She is eighty-two, sweetheart. They'll keep an eye on her.' 'What if it's more serious?' asks Marina. Ali Strewer canters past her in full lacrosse kit. Marina steps aside to let her pass, bangs her elbow on the pay phone and gasps, but she will not cry. Last night, with chemistry homework to finish, she had not enough sleep and too much coffee and now, despite never having been to a funeral, she can see clear as day Ildi's coffin, half open like a pope's; a sad dark chapel. A sob catches in her throat. The relatives are too vulnerable without her, yet nothing makes them happier than knowing that she is here. 'Are you positive everything's all right?' she asks her mother. 'Definitely. Why not?' 'I just thought— Never mind. I'd better go,' she says. 'I'm very busy. By the way, I've lost another lens. The left. No, the right. Hang on—' 'Oh, my love. Can't you be more careful? The insurance won't keep paying. I mean, it's fine. But just try, please?' Now Marina feels even worse. Her problems are manifold. For a start, she isn't in love with Guy, although he is quite nice to her, so perhaps she is incapable of passion like a psychopath. It's not even because he's younger, though obviously that adds to her self-disgust. She is pining so badly for home that she can hardly sleep, but she can't worry her relatives, and Urs would gloat and say again she was wrong to leave, and there is no one else she can imagine telling. Among the many other incidents she will not think about, buried in a pit of fear and shame, is the time she rang the Samaritans last term from the pay phone out by the petrol station, and then, on their advice, went to see the school counsellor: Ma Gilbray, the chaplain's perpetually smiling wife, with her pearly lipstick and Lady Diana hair. Sitting on a patchwork cushion in the Gilbray family study, Marina remembered a story about the last Combe chaplain, who tape-recorded confessions and played them for laughs in the staffroom, and found it hard to confide. The idea of admitting how she feels is unbearable. It is too big, too easily ripped open. Every time she thinks of Cambridge she feels as if she will burst with desire and desperation, and the fear that something will happen to upset the celestial balance, that she will fail to do the one safeguarding thing, makes her sick with fright. She has also become a tiny bit obsessed with washing her hands. So now as well as asthma, or whatever is causing this feeling that she can't take enough oxygen in, she has given herself eczema. She is the only girl in the Lowers with no idea how to make small talk or flirt; she remains unnicknamed. Doc Ventner won't let her answer a single question in biology, only the boys in his house and, whenever she asks Doc Steven how long her English essay should be, he says 'as long as a miniskirt', which is not helpful. She has never fainted or ridden a bicycle; she doubts that she could climb a tree. She is afraid to swim in case boys see her in her costume. There is no Poetry Society. She is irrelevant. Then Guy makes a suggestion. It is eight o'clock. Laura and her in-laws have had an early dinner (mushroom _palacsinta_ , cabbage with caraway, which is _kukorica_ , or is that something else? Ladybirds?). And now Rozsi, Zsuzsi and Ildi, over Danish butter biscuits and _kavitchka_ , which definitely means coffee, and a performance of Mozart's _Requiem_ on Radio Three, are discussing their acquaintances, laughing until they weep. It is happiness, of a sort. ' _Buto_ ,' they say, ' _chunyo_ ,' and Laura smiles weakly; these are words she should know by now. The in-laws take her failure to learn Hungarian very well, like a small physiological malformation. Marina has learned to count to ten, and knows certain key words such as slippers and tomato; today in the kitchen, thinking, how hard can it be, Laura looked at a cookery book over Ildi's shoulder: Borjúláb kirántva A borjúlábakat legelőbb megkoppasztjuk a következő módon: Veszünk sárga szurkot vagy 15–20 dekát és megtörjük egész porrá két vastag papír között. Aztán a lábakat egyenként mindenütt nagyon jól dörzsöljük be vele, fővő vízzel forrázzuk le és vegyük ki az asztalra vagy táblára és sietve gyorsan dörzsölve húzzuk . . . _Papír_ : paper, she guessed, and felt quite satisfied. She has been polishing shoes: one of her manly jobs. Something about the ancient shoe-cleaning case, dusters made from Peter and Zoltan's shirts, duplicate brushes bequeathed by the dead Károlyi sisters, poor Kitti and poor Franci, is weighing upon her. Marina has a new posh accent; Penelope Leach says this is perfectly normal. Maybe she is happy there, and Combe is good for her. Maybe. 'I'm having a bath,' she says eventually. 'Unless . . . ?' ' _Vot-_ apity that you don't vant to sit with us,' says Zsuzsi, addressing an envelope in loopy foreign-lady handwriting to one of her many dearest friends, Lady Renate Kennedy _née_ Rivka Kroo, wife of Britain's foremost importer of Czech crystal hedgehogs. She and her sisters do not like Sir James, formerly Jenő; they refer to him contemptuously as being 'more English than the English', although everyone knows that he was born in Hódmezövásárhely. Lady Renate, however, is an authority on most things, including the inadequacies of Laura Farkas. The very envelope itself seems to be looking down on her. 'I'm sorry,' Laura says. 'I'm tired.' A look passes between Rozsi and Zsuzsi. Slowly, sadly, Laura runs four inches of scalding water into the chalky turquoise bathtub. She takes off her clothes. She stands, naked, in front of the mirror and looks at her forty-one-year-old body: vigorously used by one or two unmemorable boys in the small Birmingham suburbs, then at teacher training college; desired by Peter Farkas but evidently not enough; utilized occasionally by Dr Alistair Sudgeon. Is that it? If one discounts all that is wrong with her, her height, her face, elephantine knees and big red hands, is it possible that anyone could ever find some of the rest of her attractive again? Look harder. Squint through the steam. Her skin is soft. Her breasts are . . . well, breasts. Gingerly, she rubs her shoulder with her thumb, her collarbone. Her nipple. Darling, she whispers to herself, and looks away. She lowers herself into the water, back against the cold enamel, calves and thighs bright pink, the _Requiem_ reaching an exciting climax two rooms away. Sadness seems to close around her. She thinks: I want more than this. I . . . ' _Qui tollis_ ,' she hears over the clanking of the hot-water pipes, ' _peccata mundi, miserere nobis_.' I cannot go on like this. ' _Dona nobis pacem_.' I cannot go on. Guy's hand is on Marina's school blouse, but he doesn't seem to know what to do with it. It floats above her sturdy bra, a Courtauld Damask Touch in oyster, which she begged Rozsi not to make her bring to Combe, while he kisses her. Her skin awaits him. Daringly she sticks out her chest a little further: still nothing. What is she doing wrong? When Laura emerges from her bath, hot and sore-eyed and modestly belted into her towelling dressing gown, _pongyola_ , with a cardigan on top, everything has changed. She does not know this. She is thinking, Oh God, not _Last Year in Marienbad_ now, I want to go to bed, do I actually have to sit on the sofa and pretend to be interested or could I— when Ildi hands her her post. It is nothing, only a bank statement for £53.32, and a manila envelope with blocky biro capitals: the council about dustbins, or the library with Ildi's new card. She will deal with it later. First, she has a task. She has made a resolution in the bath, and now she must act upon it. She sits at the dining table, pretending to watch the film and covertly nibbling at the belt of her dressing gown. She is working herself up to ask a difficult question: should they do something about Marina? They have all made sacrifices: Rozsi's income; Ildi's Post Office savings; the brooch that Zsuzsi claims she sold and, obviously, Laura's entire poxy salary, hence her having to live with people to whom she is unrelated, and inexplicable, and presumably rather a pain. That can't be enough. Rozsi and the others must be borrowing money from somewhere, one of the distant Ottos or Fülöps. They have put themselves in debt for this. But, she imagines saying to Marina, to Rozsi, to Miss Tyce at Ealing, is it possible that we have made a mistake? 'Come home with me tomorrow,' says Guy. They have been getting off against the backdrop for last year's _As You Like It_. As always, combining kissing with breathing is a challenge, especially when her legs are shaking. Sexual activity is punishable by immediate expulsion, and this is fairly sexual, isn't it? Yesterday she heard a story about a girl who had very drunk sex with a boy from another school at a party, and then the boy told his head, who told Dr Tree, and the Upper girl was expelled, though not the boy. And she is scared of the damp dark down here. And what if she suddenly begins to menstruate? Her cheeks are still hot; on the way here she had passed Thomas 'Tom' Thomson performing one of his many head-boy duties, commanding two Upper girls to kneel on the ground before him to have their skirt lengths checked. Marina had slowed; she still isn't used to it. 'I'm not,' Tom Thomson had said, gesturing to the older girls to stand, 'going to check _you_ ,' and they all laughed, Marina too. What choice did she have? 'Hey, mon, chill,' says Guy, who has been listening to a lot of Bob Marley. He thinks she is nervous about kissing in general, that she is innocent in all things. This is because of an awkward misunderstanding last time they were down here: her fault. 'Have you had any, you know?' he had asked her. 'What?' she said, her mind moving like lightning but pretending it wasn't, to buy herself time. 'Thoughts. About sex. Sexual. Fantasies. I mean, before me.' 'Um.' 'Obviously not wanking,' he said chivalrously. 'Not _that_. But general, like, thoughts?' What could she say? He would be disgusted, and disappointed. So she said 'No!' and now he clearly thinks his job is to instruct her. It is also important that he does not know of an incident in her past: last year, at the cinema at Notting Hill Gate. A middle-aged man in a Barbour with dark hair, a respectable man, was sitting beside her; she did not notice him at first. She was with Urs and Kate Frere; they were watching a French film about sorrow. Then she felt something, once, twice: the lightest possible tickling at her breast. She glanced down. The man's arms were crossed. His fingers had accidentally brushed against her. 'Sorry,' she whispered, edging away. It happened again. She moved again. The third time, it hit her like a blow to the head: he's doing it on purpose. She was too ashamed to move. The fourth time she felt him, she said to Urs, 'I need the loo.' When she came back she kept her head down, found another seat, never said a word, or forgot the sight of his fingers, his thick gold wedding ring. Her right breast has always been darker and guiltier because of it. She is still afraid of meeting the man on the street. Guy stops kissing her. 'Marina?' 'What?' 'Come to my house.' 'Why?' 'Why? To visit, you spack. Oh, no, don't go all weird. I've got to go anyway, and you could too. Keep me company on the way, meet my family. I don't mind.' She rubs her finger along the edge of the Forest of Arden, too insulted to look at him, too stupid to come up with a Dorothy Parker response. 'I don't think—' 'Don't sulk. Honestly. They're cool, my parents,' he says. 'I'm not sulking. I just can't,' she says. The truth is that this weekend she has no plans at all. This is a good thing, she has been telling herself; she can make friends. Have fun. But she knows that she will be spending her Saturday evening in West Street, drinking lo-cal minty chocolate or milky tea which she does not dare refuse, and pretending to be in love with Mickey Rourke. 'Why can't you?' he says, jiggling his finger hard in his ear as if releasing pressure. 'Because of your grandparents?' 'Grandmother. Well—' 'Why's it up to her?' Her face feels frozen. She is trapped; she wants to bite her way out. She thinks: he's going to start telling everyone about them, but she only says, 'I've got to go.' 'Anyway, your lot are all going to a party or something, aren't they? You said. So they don't even need to know. Everyone goes to each other's houses all the time. You know, discretionary exeats.' 'I, I've never even heard—' 'Just ask Pa Daventry.' 'No,' Marina says. 'I can't do that.' Her housemaster, Ronald Daventry, husband of Jonquil, father of twins, deputy senior master, is very popular. 'Oh, Davs,' the boys say at any mention of him, 'what a guy.' But he doesn't like Marina. She feels grubbily, disgustingly female in his presence. He does speak to girls, as the boys like to point out, but only the pretty, chirpy ones; never Marina. He presides over assemblies as if they are a private joke and when he has parties for the rowing squads, girls are not invited. 'He'll definitely say no.' 'Don't be stupid. Everyone does it. Anyway, honestly, you'd like it there. Hang out with my sister. You can meet my father too.' She isn't really listening. How could he have said she was sulking? 'Hello? He . . . people usually want to meet him. He might actually quite like you.' 'Oh, really?' She is imagining his mother and father as younger too: short, playful, silly, unlike hers. 'Yes. You don't know, do you?' 'What?' 'I knew it. Fantastic. So you're not—' 'What?' 'He's Alexander Viney.' # _8_ _Saturday, 28 January_ 'So,' says Laura's mother-in-law at breakfast, spooning compote from its Maxwell House jar. 'You go with Ildi, or don't you vant to come with me?' 'She does not listen,' Zsuzsi says. Does she usually wear this much eyeshadow? 'Ildi, _dar-l_ ink, you make this with, what-is, _birsalma_ , kvince – or apple only?' ' _Igen_ , kvince,' says Ildi. 'You vont _von-illó_ too, I buy it next veek. The taste is ursh-sehóshernleehótótlón, _nem_?' Laura blinks. She pretends to be thinking. She is no genius; her mind, if anything, seems to move more slowly than other people's. Some time after they have spotted a problem and skirted around it, slowly into disaster she falls. But the truth is that this morning she feels particularly unalert, thanks to a dream in which she gave birth to triplets unaided. She had been hoping to get through the morning without anyone talking to her at all. 'Laura.' 'I . . .' Rozsi's eyebrows lift. Something flashes below the surface, a volcano under the sea. ' _Tair_ -ible,' Zsuzsi observes, but Rozsi says nothing. She has always been polite, except for times when Laura deserved it, like when she referred disrespectfully to Mrs Dobos's late husband Elmer, or compared Zsuzsi to the newsagent's beautiful Afghan hound. That was years ago; Peter had to apologize for her, and even so Rozsi would not speak to her for five days. 'We are talking with Ildi for many minutes,' she says stiffly. 'Don't be funny.' 'I'm sorry,' Laura says. 'But what?' 'The Hungarian Bazaar.' Laura mouth falls open. 'Oh God,' she says. 'It's not today?' ' _Igen, igen_ , of course it is. The – what is it, _huszonnyolc_ , tventy-eight. What for you think Ildi bakes _beigli_?' 'I . . . I hadn't . . .' 'We leave twenty minutes to help with set-up,' Rozsi says, rolling up her napkin. 'You change this jersey.' There will be Mitzi Sudgeon and no Marina. After last year's Bazaar, a three-hour frenzy of personal comments and awkward questions, she promised herself that she would never go again. Who would not, in such circumstances, dream of sudden death? What a relief it would be; she cannot remember the arguments against it. Nevertheless, because she lacks the courage, she tries another way out. 'It's silly, but the funny thing is that today—' 'Of course you come. Mrs Dobos waits for us.' 'I, I thought it was next week. In fact. It's just—' Even I, thinks Laura, must have become a bit tougher over the years. I must have absorbed something. I will just refuse. They cannot make me do it, she thinks, reaching for her post. They make her do it. What choice does she have? She gets ready. Or rather, while the others listen to the news she chooses her least awful skirt from the sideboard and creeps through Marina's room to look in her wardrobe mirror, breathing her smell but being careful not to pry. She tries to imagine herself presentable from the point of view of Alistair, who is in his own neat way an attractive man. She squints into the mirror; she closes one eye. From the neck down this is impossible. From the neck up, through a shivering blur of eyelash, she can almost believe that her hair is less mouse and her cheeks are less pink; that the loveliness of her dark browy daughter did not pour directly through Marina's father's side, but gained something hazier, gentler, from her. This is plainly untrue but, to support it, she begins to brush her teeth, wash her face, apply her almost invisible lipstick, bought for adultery, with a shaking hand. She does not meet her eye again. By the time Laura has emerged the others are all waiting by the flat door. Zsuzsi looks at her outfit, bobbly, fraying, and shakes her head. ' _Vot-_ apity you do not want I lend you blooze,' she says, complacently stroking her own cuff, the chocolate-brown silk with a gold stirrup motif bought in Paris when she was married, before Laura was born. Her gilt earrings are the size of plums. 'Thank you,' says Laura. 'Oh, Rozsi, no, let me take that box.' Usually, when Laura, like a minor husband, tries to save her mother-in-law from hobbling with shopping bags, she says, 'Silly girl. Look at these legs, I live for ever,' and Laura gives a smile like cracking mud. This morning, Rozsi lets Laura take the box. Ildi locks the door. Zsuzsi checks her lipstick in the glossy lift wall. Laura remembers that Rozsi told her to give her brown coat to Oxfam. She should probably go shopping for a new one, except that she can't afford it and, if she could, she ought to buy something for Marina instead. Zsuzsi, naturally, is in fur, at least on her collar: black, silken, inches thick – ocelot, or man. From time to time she turns her head and her huge eyes, her pretty little nose, her profile are beautiful, like an aged doll. Rozsi is wearing her favourite suit, black bouclé, with a green and gold silk square. She looks like a Soviet minister engaging in leisure, but it agrees with her; she has an air almost of amusement, as if she expects good sport today. Even Ildi has a brooch pinned to her lapel: a nest of robins in enamel, one of the innumerable love tokens Zsuzsi receives from Gyorgy, a 'nice boy' whose costume jewellery was once reputedly worn by Princess Grace of Monaco. Ildi's bright white hair is fluffy with excitement. 'I wonder,' she confides in Laura, 'the walnut _beigli_ , I should have make more? The seed is good but—' 'They're both delicious,' says Laura, as they approach Porchester Baths. They are walking slowly to keep company with Rozsi and her hip. This is a sad development. Only two years ago she could walk into Soho more quickly than it took by bus. 'You mean, er, the _diós_?' 'Vell done! _Vair-y_ good! You are nearly right, poppy-seed is _mákos_. Now tell me, what do you think?' I think, thinks Laura, that I am losing my grip. My only child wants to be at boarding school and not with me, and Alistair will be at the Bazaar with that bloody wife, and if I have to suck up to Mrs Dobos again, or Perlmutter Sári, or Pelzer Fanni with her terrible wart, I will go mad. 'I'm sure everything will be fine,' she says, putting the box down so that Rozsi can catch up and feeling, as she does so, the crackle of paper in her pocket: an envelope, the one which arrived yesterday. Like an innocent passer-by touching a case containing a bomb, she tears it open. The letter is from her husband, whom she had hoped was dead. # _9_ 'Who's Alexander Viney?' asks Marina. She has rung Ursula from the pay phone. Behind her the girls of West Street prepare for Saturday morning school, crashing up and down the stairs overhead in search of Feminax, hair-dryers, prep books covered in Laura Ashley wallpaper and synchronized-swimming nose clips. What she needs is a dose of home, or rather Urs's home: the intellectual certainty, the unembarrassed family self-belief, which Marina loved and envied and hated her for. But Ursula is prickly on the phone. She thinks Marina abandoned their life together for Combe, but has conveniently forgotten the little put-downs, the teasing about Marina's clumsiness and forgetfulness and persistent losing of every important item. She keeps reminding her of the highlights of their youth: the notes in Latin; the minor secrets revealed. 'Your made-up friends' is what she calls everyone Marina has mentioned from Combe. 'They don't know you like we do.' Ursula doesn't know her either. Marina, she thinks, is just like her: loyal, dutiful, devoted, sure. You can talk and talk for seven years: lessons, journeys in the third carriage of the District Line train, hours of telephoning, twenty-page letters. You can pledge eternal best friendship. Yet that doesn't mean they understand your other world, when you're not together, at dinner with your mother and three old women, in bed at night. How Marina misses her. So she has phoned, and been fondly interrogated by Mr and Mrs P, and updated Ursula on her thoughts, if not feelings, regarding the Embryo, as Urs insists on calling Guy, and enquired about Ursula's plans for Mr Burnett from Ealing Boys', once glimpsed at a science quiz. Then Marina makes herself ask about Guy's father. 'You are joking, _n'est-ce pas_?' says Ursula. 'You must know who he is.' 'I don't. Is he that actor with no lips?' 'You know nothing. Your memory has been razed, hasn't it? Er, hello, Ursula, your best friend?' 'Stop it. You know that's not—' 'Don't you remember the Marrying Game?' 'When we had to choose which historical figure we'd most like to kiss? And I chose Peter the Great and you said the only sane choice was Gustavus Adolph—' 'No, no no. Wrong game. It was that time at Soph's – we put the names in her Laura Ashley hat, the one with the silk scarf, not the felt. We ate strawberry ice-cream, I seem to recall.' 'Oh . . .' This was during their fortune-telling phase, when despite the boys they 'knew', the example of their parents, reason and rumour and evidence, they foresaw, unequivocally, long joyous marriages ahead, and trouble-free children with artistic tendencies, and pre-eminence, or at least modest glory, in whichever job they chose: conducting at the Proms, say, or running MI5. The secret sorrows of adolescence would be rewarded. 'It's the only way to save ourselves from . . . you know,' one of them had said, and they all thought of their mothers, and were silent. 'I got Harrison Ford,' says Marina now. 'No you didn't. That was Cristina Koralik – we let her play. She kept asking about having sexual intercourse, you must remember. And I got that comedian, though sadly not Stephen Fry, to whom I am affianced. No, silly, you definitely had Alexander Viney.' Not 'definitely'. You should say 'absolutely'. 'I'm not silly,' says Marina. 'Well, you did. Don't go all quiet on me. You know. From the telly. The _Making of Kings_ fellow. Sophie chose him, she fancied him secretly. We were having that phase of mental promiscuity, you know.' Sixty-six map centimetres away as the crow flies, Marina blushes at the thought of how many boys, even now, feature nightly in her private bath-time orgies, as she breathes through her mouth to escape the reek of air freshener, and tears slide itchily down her temples and into her hair. 'You do know,' Ursula is insisting. 'We thought he was brilliant in Lower Five. Miss Covs showed _Our England_ in double hist. You must remem—' 'Him? Oh my God. Seriously? I'd forgotten – of course, Viney, of course it's him. Then why wasn't he in the Combe _Register_ ?' 'Never mind that,' says Urs. 'You've prob even got his books. I have, _Tudors in Love_ , it's fantastic. Sophie's definitely read one of them, although it is about eight hundred and ninety-two pages long. She could lend it. Or have you gone all cool, now you're in love with the Embryo?' 'Stop it. Wow. I hadn't realized. We loved him.' 'Yes, wow! By the way, remember that time Roz said—' 'I should go,' says Marina. 'Sorry, but they kill you if you're late for morning school.' 'God, you and your Saturdays. Are you still in uniform? Is it ebbing your life-blood?' 'You know I am, I have to.' 'OK, OK. So quickly, tell me, why do you want to know about Alexander Viney? Are you a swinger?' So Marina explains. Ursula is squeaking like a guinea pig. 'You are joking?' 'No. Honestly. I thought Guy was, well, I just didn't make the connection. He doesn't look . . . he's just ordinary. Not romantic at all.' 'You know what this means? You could actually do it. Marry him.' 'Guy? He's in the year _below_.' 'No, Guy Senior. The famous one. You could! That was the idea. Or at least you have to try. We plighted.' 'I'm sure it's pledged.' 'We'll ask Zoë. But you have to.' 'Don't be mad.' 'You're being mad. Look, you said the Embryo invited you. You could meet them. Just say yes.' 'I can't,' she says, but a strange heat is growing in her chest: an emptiness, like love or hunger. She remembers Alexander Viney's face perfectly now: oldish, but not much more than her friends' fathers. 'You can.' 'Don't, Urs. I'd look . . . stupid.' For a moment Ursula is silent, then: 'You promised us. Your old friends. Maybe you think we're just babyish now, but—' 'You know I don't.' 'Well. We promised each other. That's all I'm saying.' Laura stands at the Porchester Baths entrance. The others are up the stairs ahead of her, scanning the horizon for interest; they love taking umbrage when people stay away. The letter from her husband, Rozsi's son, Marina's father, is trembling in her hand. He is coming back to them. This is the miracle they have longed for. To the Károlyi sisters all men are sacred; they have only to change a light bulb to be deified. Even more than dull Robert, Rozsi's elder son, the charming cavalier Peter has always been particularly revered. When Laura first visited Peter's parents, having assumed until then that calling himself 'foreign' was a pose, it felt like entering a flat in Prague or Vienna: the wall of classical LPs and art books; the extraordinary food; the photographs. _Pay_ -tare the Holy Infant was everywhere: his indulged boyhood, solemn in a tiny mackintosh; his handsome adolescence, smirking next to his proud beehived mother at a wedding. The signs were there and she missed them. When he started drifting away for hours, then days at a time and eventually failed to return at all, it was horrible of course, but, after years of his indolence and drinking, whispered fights, promises to reform, at last Laura could breathe. I only have one infant to look after now, she told herself, and tried to feel consoled. Then she ran out of money, and accepted Rozsi's verdict that Marina needed her grandparents, and they moved, temporarily of course, into Westminster Court. And Marina has coped, if refusing to discuss it is coping. They have all managed, even poor Rozsi, who pretends that _Pay_ -tare is simply obliged by work to be elsewhere, like Robert in Australia. So where has he been? Unconscious? At sea? His letter, unexpectedly sane and contrite for someone in his position, refers vaguely to friends. Could that mean bigamy? She had not foreseen the humiliation of knowing that he was alive all along. Hating him, trying not to think about him, was easier. Now, much worse, there is hope. Because, if he does come back, everything might change. She gazes blindly at the embroidered banner above the swing doors: _WELCOME_ _to the Magyar League for Women_ _Annual Bazaar_ If he comes home, she is thinking, Marina might soften. Rozsi might forgive her for having driven her sacred son away. Laura could even act on a long-cherished fantasy, in which she rings the headmaster's secretary at Combe, dispenser of poison from her panelled castle, and instructs her to send Marina home. Idiot. Your ex-husband, she reminds herself, is a drunk, and feckless, lazy, self-indulged. He brought us all endless grief, Marina most of all, and he must not be allowed to do that again. 'Laura.' She looks up. Rozsi, Zsuzsi, Ildi, all more vulnerable than they know, are staring at her from the top of the stairs. 'What is it, _dar-_ link?' Ildi asks. Aren't they stable now, and coping? The last thing Marina needs is drama and that is what he'll bring. Before telling them anything, and destroying what they do have, she must read the letter properly, alone. 'I . . .' Imagine if she announced that he was returning and he let them down: that unwashed hair, those big dangerous eyes. They have spent the last thirteen years building barricades. She cannot just open the door to let the whirlwind in. 'Laura? What is it?' 'I . . .' She means to tell them. Of course she does. Even when her hand moves towards her pocket, entirely of its own volition, she intends to do the right thing. She just needs a little time. # _10_ Of course Marina is not going to Guy's parents' house. But at break, hunger and the thought of a weekend without her mother send her to the tuck shop, where everyone else spends pounds and pounds on blue fizzy drinks and a disgusting margarine-flavoured biscuit known as Slice. She is paying for her sherbet pips when he comes in. 'OK?' he says. 'Why?' 'So what are you doing later?' 'Auditions for the Choir.' 'But you said you can't sing.' 'I know,' Marina answers stiffly, looking away because she is an adulterer, who can't stop thinking about Simon Flowers's solos. 'But I should try.' 'See?' he says. 'You might as well come back with me – have some fun, not with those spazzes. Don't look all hurt, you know what I mean. If we meet in Mem at one fifteen we'd catch the twenty to.' No, she thinks. Not your scary father, and your mother who will look down on me. I can't do it. Then she imagines being able to tell Ursula all about it. Her family too: they believe in courage and, more than that, in famous people. Zsuzsi once bought an ice-cream next to Lady Antonia Fraser; in the retelling they have become close friends. They all expected Combe to be full of the children of eminent people, not only the kind they have met – someone from the Czech embassy; Lady Renate's friends; George Arthur, the unconvincingly British conductor – but also the greatest excitement of all: aristocrats. Although as a child it has always embarrassed her, now that she is a woman it makes sense. They don't want her to grow up like their neighbours' grandchildren, baking Hungarian biscuits and going to folk-dancing lessons on Saturday mornings, then joining their family's business. They want her to be more than this. Dear Lord, she thinks, please let me be adequate. Let my baseness be concealed. 'OK,' she says. 'Yes, OK.' It is like an English church fete, deformed. One may, indeed must, buy painted napkin rings and embroidered place mats; costume jewellery donated by Zsuzsi's friend Gyorgy and discreetly folded flesh-coloured support tights from Femina; celluloid tourist dolls in Hungarian national costume; tapes of gypsy flute music; dried mushrooms, salami, garlic plaits. Someone's well-meaning English husband is manning a second-hand book stall featuring a 1973 Austin Rover users' manual, Dick Francis paperbacks, Baedeker guides to Swiss spas. The air is blue with cigarette smoke. There is a coffee stall, with porcelain cups and the brown sugar crystals they are all obsessed with and, naturally, food: stuffed _paprikás_ and pancakes and chicken cooling under foil duvets, some of it in the white harvest-themed Pyrex of home. And, on an altar in the middle of the room, stands a cake stall presided over by Zsófia Dobos, Mrs Dobos to her friends: patron of the arts, owner of Femina and, in her day, proprietress of a famous delicatessen in Soho, although that day is past. The old women flutter round her, praising Mrs Dobos's flower arrangement, her lace tablecloth and the creations of her elderly protégé Rudi, reputedly a former employee of the great Gerbeaud but now living in poverty in Holloway. ' _Nez_. Beautiful, _nem_?' says Rozsi. Obediently Laura nods. This is not enough; she must turn round to admire Rudi's pistachio _mignons_ , arranged like the overlapping scales of a mighty fish. She looks in the general direction of _krinolinkies_ , Wasp's Nests and Bear Paws; Cobbler's Delight; Gâteau Princess Anne; a ' _my-_ ladeesvims' ('Sorry? Oh, My Lady's Whims. I see'); rum and hazelnut kisses; marzipan crescents; cakelets of plum, or chestnut, or sour cherry; 'student food'; cheese medals; sweet cabbage dumplings and a monstrous praline and wafer _Pischinger_ ; not to mention _beigli_ galore, which have been shipped from a _beiglimeister_ in Budapest. 'I buy one of the necklets for Marina,' says Ildi, looking crestfallen, hurrying towards a row of padded satin jewellery cards. How can Peter be back? Peter, who behaves as if it is reasonable to disappear and then be resurrected? Who has, since she last saw him, gone mad. His letter, crunching in Laura's pocket, really says so: 'The balance of my mind – dodgy at the best of times, as you know – was disturbed.' What does this mean? Marijuana? Women? It has an ominously legal sound: has he been in prison? Unlikely; he was too soft for crime. Could he have moved on from wine and strange dusty liqueurs and even the terrible Unicum, Hungary's national drink, to something worse? Worse, even, than a thirteen-year hiatus, and a character change? Could the little maddening chips in his nature, the fanatical protectiveness about his mother and acceptance of his role as family god-head, have coagulated into that? Or could it not be him? The handwriting had been like his, she thinks, but not exactly. What would an impostor want from her in-laws? Attention? Money? To worm his way into their complicated but arguably warm embrace? Please, God, she thinks, going nicely with her in-laws to kiss a horrible powdery old woman called Borbála, let it be blackmail, extortion, anything but the return of the prodigal, entirely irresponsible yet still, apparently, perfect in the eyes of the Károlyis. And, if he is coming back, he will be alone. Because wherever he chooses to live, in his mother's flat or some revolting alternative, Laura cannot go through that pain again. Marina has never sat next to a boy on a train before; until Combe she had hardly been on a train. A great ball of breath keeps being trapped in her throat. The scale of her unfitness to meet his parents is only just occurring to her. She is wearing all her best clothes: stone-washed jeans, maroon Marks & Spencer V-neck bought for her by Zsuzsi, in a smaller size than she likes (' _Vair-_ y good. We see your bust'), the brown ankle boots which she rarely wears in case of scuffing, and her birthday green velvet jacket, of which she is so proud. 'This is great,' says Guy, nuzzling her neck like a horse. 'Is it a long journey to, you know, um—' she asks hopefully, fiddling with the paperback of Gogol's _Dead Souls_ which, after long deliberation, she has decided is not too pretentious to bring: it is a comedy, after all. She has been dreaming of a lengthy Tolstoyan train ride with serfs scything the cornfields; somehow she had even envisaged a sleeper compartment, in which Guy would attempt to kiss her. 'God, I don't know,' he says, biting into a colossal cherry scone. 'Blandford then Limehurst, Winsham St Peter, Goring Water, Goring thingy, Staithe. Shaftesbury, East Knoyle, lift to Stoker . . . less than an hour. Fifty minutes? Weekend trains aren't up to much.' The mere mention of weekends makes her stomach squelch with anxiety. He said his mother would clear this exeat with Pa Daventry, but surely it's not as easy as that. It has all happened so suddenly; when she thinks of Rozsi she feels faint, even though, she tells herself, her mother won't care, or even notice, so in a way it's her fault. Guy keeps grinning at her. When she accidentally rests her knee against his, he does not pull away. She looks at the spots on his temples and remembers the questing way that his lips met hers in the ticket queue, as a guinea pig's might. Simon Flowers, she thinks, despite having decided to forsake all thoughts of him this weekend, Simon, I will ever be thine. She tries to remember how much money she has in her purse, in case she needs to flee. 'You won't mind if my father's not there, will you? My sisters might be, but—' 'Don't you know?' 'Why would I? One of them's married, children, everything. Only Lucy lives with us. I just meant that maybe you were expecting my dad to be there. Because you, people, seem . . .' 'I don't mind.' 'Good girl,' he says and, with a soulful expression, tucks a strand of hair behind her ear. They have stopped at a tiny station. She keeps her eyes on two big black birds, crows or ravens or rooks, near the train track, which are fighting over a stone. One wins the battle; it flies towards them with the stone in its beak, over ridges of what Dr Tree calls 'good Dorset clay' and is almost above the train when a sound outside startles it. The stone falls to the ground, so close to her window that she can see it if she cranes her neck, which she does because one day she might regret not having looked. It is not in fact a pebble but something small, furry, bloody: a baby rabbit or mouse, or something worse. She looks away quickly, appalled to find she wants to cry. Guy is telling a story about some boys pushing a master's Vauxhall Astra into Divinity Hall. She is horribly nervous. As the rackety little train passes through Blandford Forum towards Shaftesbury, she witnesses one of those special effects for which the English countryside is famed. The raindrops racing down the glass suddenly slow. Sheets of gold pour on a distant field; the clouds tear open and the entire carriage is bright with winter sunlight. It must be significant. The train whispers 'Alexander Viney' with every rattle of the wheels. Are they wheels? She thinks of all the things she has forgotten to bring: perfume; sanitary equipment; a spare book; a rape alarm; a copy of her most impressive English essay, in case Mr Viney is interested. 'Be a good girl,' she imagines her grandmother saying. The carriage door squeaks: Viney. Viney. Alexander Viney. I, thinks Marina, am not a good girl. I am ready for love. Ready for sex. Dear God, let it start. The Hungarian Bazaar is like being consumed by loving cannibals. Wherever she turns, old women ask her, 'So, no more children?' and shake their heads pityingly, or squeeze her upper arm or pat her bottom; 'Hodge vodge?' they ask, _hogy vagy_ , 'How are you?' and she smiles and nods as if these are merely rhetorical questions. People keep giving her paper plates of veal, and she has to remember to thank them in Hungarian, 'Kusenem saipen,' _köszönöm szépen_. Her pocket feels transparent, she may be sick. She has to tell Rozsi about Peter's letter but here, in public, is not the right time. I'll do it tonight – that would be kinder, thinks Laura, looking up to see Alistair and Mitzi Sudgeon pushing through the swinging doors. She reaches behind herself for support and finds her hand closing on a bag of paprika, squashy as a tiny corpse. Her brain is still struggling with the idea of Peter Farkas but her eyes follow the man she sort of loves. Or, rather, they follow his wife. Like a rabbit fascinated by a circling hawk, Laura gazes upon her nemesis. Mitzi Sudgeon is pale, like something found in a cleft in a Carpathian mountainside. Her hair is dyed red; she wears lipstick but otherwise she looks fragile, naturally thin: a woman too busy doing good deeds to eat. She smokes stylishly. She has virtuous breasts. Not pretty, exactly, but beautiful, powerfully attractive both to elderly maternal Hungarians and to men, of every age. She looks like a tiny diplomat at an enemy's wedding. Alistair, with the methodical humourlessness she tries to find touching, has confided about their marriage: the union brokered by his first employers, kindly Dr and Dr Országh-Nagy, Mitzi's guardians (or were they kindly?), the dietary control and screaming rages, the many faults she finds with him. However, Laura's rival has not only beautiful eyes and a waist but also the blessing of the holy Catholic church, which Alistair, despite not being himself a Catholic, finds unbreakable. Not that Laura wants to marry him. She just wants to be married. Never mind, she thinks, eyeing them from behind the leather goods like a chicken with a fox. She will buy something for Marina, even though she can't afford to. She swallows hard but there is dust in her throat, or ash, or sorrow, and she cannot be rid of it. Almost an hour passes. Laura takes a sip of hot coffee and somehow misses her mouth, dabs her breast with a napkin and spreads the stain, spills icing sugar from a little walnut pastry on to the brown patch and, hideously soiled and besprinkled, is turning to go to the toilets when she crashes full length into Mitzi Sudgeon, who is bearing teacups on a silver tray. Everything falls to the floor including, after a hesitation, Mitzi. ' _Jesus Maria!_ ' 'Oh God, I'm so sorry,' says Laura. 'Let me—' The hall stills. Down on the parquet, Mitzi feels her ankle gingerly. Alistair, her medically trained lawful husband, kneels in slow motion. His eyes are on Laura's; they seem to press against her with anger, or ardour, or a plea for understanding. Despite their stolen time together, she does not know him well enough to be sure. 'It is . . . it is,' says Mitzi, as if she is trying to be reassuring but has no words. Her accent is improbable even by Hungarian standards. 'I move, I hope.' 'God, I'm so sorry,' says Laura again. 'I'm so stupid. I—' 'No, not stupid,' says Mitzi. 'But you are so much bigger than me. And . . . oh!' Alistair, kneeling, his neat hands on her skin, has found a sore place on her ballet dancer's blue-veined instep. Laura looks down at his balding head. Breathing is strangely difficult. She watches his fingers creeping up the thin white calf of his wife. 'Can you walk?' he says to her. 'I . . . I _sink_ so,' she says. Gently, professionally, he puts one of her arms over his shoulders and helps her to rise. There is murmuring all around them, mercifully not in English. 'I'm . . . this is awful,' Laura says. 'Please,' says Mitzi Sudgeon. Laura steps aside to let them by. As Alistair passes, her spirits seem to fall slowly through her chest and onto the parquet. She kneels to gather up the broken teacups and, in a broken voice, Mitzi says, 'My bag.' 'Let me,' says Laura, but Mitzi bends down, still supported by Alistair. She leans towards Laura. 'Do not touch,' she hisses. And then they are gone. # _11_ In the country Guy makes more sense. She sees the fields through which he will have gambolled, the cows whose milk, presumably, nourished all those big white teeth. West Knoyle is a disappointingly ordinary station, ringed with ratty garden sheds: blue sky, the sadness of naked trees. He strides across the tarmac towards an estate car, oppressively cheery in his football jumper. Anyone could be here to meet them. Marina's family do not know where she is. She grasps her bags as if they contain important medical supplies and follows. The car is old and filthy and apparently partly wooden, its back windows edged with moss. The passenger seat, comprehensively ripped, contains a box of jam-jars; beside it, one finger on the steering wheel, sits a woman with longish blondish hair, smiling, thin, good-looking. She is wearing muddy grey cords and a moth-holed jumper. Wow, thinks Marina: staff. 'My mother,' says Guy, and pats her shoulder. 'So, Marina.' Mrs Viney's greeny-grey eyes meet hers in the rear-view mirror as she reverses masterfully towards the station barrier, parking voucher between her teeth. 'What a treat,' she says in her Radio Four voice, 'to meet you at last.' 'Oh!' says Marina, blushing. Shyness seems to light her from within; her movements are clownishly magnified. 'You're welcome.' Guy ruffles her hair. 'Isn't she sweet?' As polite as she tries to be, Mrs Viney is even politer. 'Awfully selfish of us,' she says, 'to drag you all this way to see us,' and she praises Marina for bringing such good weather. 'We're terribly dull, I'm afraid,' she says. 'I hope we'll be worth your while.' But when Marina tries to be gracious back, it sounds ridiculous. Mrs Viney is not wearing earrings; thank God that Marina has left Zsuzsi's old clip-on garnet pendants in her toilet bag, but what else has she got wrong? If only she could see if Mrs Viney is wearing a watch; she has a feeling that she won't be, and silently undoes her own. Guy does a rich belch, which makes her blush, but Mrs Viney only says, 'Guyie, must you?' and Marina turns her face to the window to conceal her shock. All her best items, her new green toothbrush, the Liberty shower cap from Mrs Dobos, are squashed into a carrier bag between her legs. She squeezes it between unrace-horsey ankles and wonders if it looks overstuffed. Guy hasn't mentioned whether or not she is expected to stay the night. Guy is no use. He has hot chocolate on his chin. He won't stop teasing her about the red-and-yellow station tulips she brought his mother, currently banging their heads against her knee as he gestures and winks and she furiously shakes her head at him to shut up. Now he is describing the latest escapades of Henry and Benno and Nick and Giles Yeo, whom his mother seems to know, while Marina tries to flatten her hair back down and regain the art of conversation. The car smells of disintegrating leather and apple stalks and dead leaves. 'Are you,' she asks Mrs Viney politely, 'a plantswoman?' and Guy laughs so much he does another burp. Boys do this at school but she is appalled for them; if anyone heard her do that she could never look at them again. Why is she even here? In a stranger's car, being driven deeper and deeper into the countryside, with no coat on. She grips the handles of her carrier bag with sweating hands and— 'Oh.' 'What?' 'Nothing,' says Marina, sensing for the first time the scale of the test which awaits her. 'Silly girl, tell me.' 'Just . . . that . . . there's a dead bird on the floor.' There is a little silence like a sucked sweet. 'Is there?' says Mrs Viney. 'What kind?' 'Chump,' says Guy. 'It's just a hawk moth. You made it sound like a, a chaffinch had flown in, or something. A blue tit! Ha.' She turns her burning face to the glass. They drive past violently trimmed twiggy hedgerow, a trout farm and something called an Honesty Box from which Mrs Viney buys a pot of brown jam. She is telling Guy about the nephew of a Mrs Kershaw, 'You know, the Cluney char,' dead in a corn silo. 'Oh, God, how awful,' says Marina. 'Well, he was twenty-six.' She keeps having a powerful urge to apologize. Sitting behind the thin shoulders and glossy hair of Mrs Viney, she feels sick and starving simultaneously. What if at dinner they expect forfeits or charades, or a recitation of Noël Coward? Mrs Viney is lovely, for a mother: fragile, but you can imagine her riding to hounds. Her mothy green jumper, which must be cashmere, is torn at the shoulder. Poor woman, thinks Marina kindly, as Guy, mid-anecdote, squeezes her knee a little too hard and his mother laughs. Marina directs a short but, she hopes, powerful prayer to the back of Mrs Viney's neck: oh God, she thinks. Let me be you. Let— The car shudders dramatically. 'God!' she says. 'Is it a, a puncture?' 'Cattle-grid, thickster,' Guy says. 'I _know_ ,' she whispers crossly. 'Shh.' Then the car slows. The Viney house (never 'home') has a short drive, a tall hedge, and a messy half-tarpaulined pile of logs, broken flowerpots, petrol containers, farm machinery. Mrs Viney swoops into the space beside it. As Marina climbs out of the car, she accidentally gives a little grunt of disappointment. The house is – well, modern: yellow Lego bricks with ruched blinds and pointy shrubs and a wishing well. 'Oh, lovely,' she says, projecting well in case Mr Viney is waiting to greet them. Besides, she tells herself, it must be stylish, just not in a way she yet understands. 'What a sweet bird bath!' 'Darling,' says Mrs Viney, crunching across the gravel, 'that's Barker's, the neighbour. We're over here.' She is heading for a gap in an old wall Marina had not even noticed, green where the guttering has leaked. Beyond her lies another house entirely. 'God,' says Guy. 'You're not serious? You thought . . . ha! That's brilliant.' It feels as if her skin is cracking. 'I didn't mean that one,' she says with dignity. 'I was joking.' 'Hilarious,' he says. They approach the real house around its side. Marina's eyes are stinging so she registers only height, grassy leagues or hectares stretching into the distance, mist and terraces and trees. The house seems infinite, like part of a school, except that Combe is a mess, Gothically old and new and faux-old, and this is sand-coloured, beautifully regular, at least three storeys high with balconies and a castellated roof, like something from a postcard. As they approach, there is a thunderous barking, as though the hounds of hell are loose. Like a duckling, Marina follows Mrs Viney through a thicket of mackintoshes (never say 'raincoat'), outdoor garments and sporting goods. It is no warmer than outside. The air is faintly scented with rubber. Mrs Viney says, 'I'm afraid it's a dreadful mess.' 'Oh, not really,' says Marina. 'Don't worry. I mean, God. This house is enormous. Does it have a, a name?' 'Nah,' says Guy behind her. 'Just the Old Rectum. Rectory. Or Stoker, if you're desperate to call it something.' 'Not desp—' Marina begins, but Guy is already saying, 'Dad in?' Mrs Viney pushes open a door. There before them stands another kind of man entirely, from whom fame radiates. 'What the h—' Then his voice changes. 'Hello,' he says. 'And who are we?' # _12_ 'Dad,' says Guy. 'Marina. Marina, my father. We, um, I—' 'Marina. Aha. Good name.' Alexander Viney looks at her thoughtfully over the top of his glasses. He is shockingly three-dimensional; escaped from the crackly school television to stand before her, live. 'Hello, darling,' says his wife. It is impossible not to smile at him when he shakes your hand: those interested blue eyes, that short silvery hair and big imperial nose, that appearance of strength, like an intellectual stevedore. Until this moment she has thought that the perfect man, the only kind she could imagine marrying, would be tall and thin and elegantly aquiline, like Lord Peter Wimsey in daguerreotype. Mr Viney looks as though he chops logs off camera. She doesn't care. She steps aside to let Mrs Viney pass, treads on a vast navy galosh, then stumbles against something softer. 'Bloody hell!' he says. 'Oh my God. I – I'm so stupid. Are you—' 'That,' he says, 'was my bad foot.' 'Oh no. Oh, God. Sorry. Sorry.' Mrs Viney and Guy are beyond them, in the hallway but, when she ducks her head to slip by Mr Viney, thinking comforting thoughts of death, he stops her. 'Wait.' 'Sorry. Oh, yes.' With a mighty effort she lifts her head. He is holding out his hand. 'So, you're a friend of my son's, are you, from school?' 'I . . .' 'Of course you are. I can see, from his little red cheeks, that you are. Well, good for him.' First, Guy says, they will go for a walk. This seems a pity. His mother is reading the Saturday papers in a room apparently reserved for the purpose, and his father has disappeared. 'We could wait and . . . he might like to chat to us,' she says. 'God no,' says Guy. 'Need to stretch my legs.' They go first to talk to a man in a nearby field about drainage, and then to feed a colossal horse, Billy, who has cracked teeth as big as her finger and strings of drool pouring from his gums, and thence to a freezing bluebell wood, which she had always assumed was a fictional construct, like Hades. It is a horrible place, dark and probably dangerous. Trees are fine individually, essentially just big plants, but these black weeping woods make her think of Baba Yaga, crows and huntsmen and maidens walled up in towers. There is too much nature here, moving in the darkness, flying things, distant rumbling. Marina is sitting on a soggy tree stump watching Guy kick at some rotten wood, when he suddenly puts his cold hand up her jumper. At that moment, something tears through the undergrowth behind them and a tall girl, with irritatingly gamine hair and Quink-coloured jeans, appears from the shadows, escorted by a huge brindled hound. 'Hello!' says Marina, like an eager shepherdess interrupted with the young lord. Should she stand? She starts scrambling to her feet, sees faint amusement in the girl's expression and subsides into a wobbly kneel in the thick damp leaves, holding up her hand to be shaken. 'What _are_ you doing, you mad girl?' There is a creaking, rustling hesitation, punctuated by the sound of hungry canine sniffing centimetres from Marina's groinal area. 'Get up, you loon,' says Guy. 'This is my sister, Lucy. Lucy, Marina.' 'Hello,' says Lucy Viney with a cooler, calmer smile, while Marina struggles back on the tree stump with mud all over her knees. Like Marina, Lucy Viney is wearing a V-necked jumper, but the effect is so different. If only I'd worn navy, thinks Marina, and a shirt underneath with thick stripes, and old walking boots, and— 'You poor child,' says Lucy Viney, who is barely older than she is. 'Aren't you cold?' Marina's heart gives a little slip of hope. She thinks: this is someone I could be friends with, if Guy stays out of the way. She could teach me. 'No,' she says, trying to stop her chattering teeth. 'You are sweet to come all this way,' Lucy says. 'For Guy.' 'Oh, no,' begins Marina. 'But,' Lucy says, with a significant glance at her brother, 'it's terribly sad that Papa's working this weekend.' 'She's not bothered about silly old Dad,' says Guy. 'I – Guy invited me, actually,' Marina says hotly. 'I'm not a, a tourist.' 'A tourist!' Lucy Viney is greatly amused. 'Er, this isn't a stately home, lovey. Not many follies and urns here.' 'I know that,' says Marina. 'Don't be touchy, sweetie,' says Lucy Viney in a bored voice, hiding her hands elegantly in the sleeves of her huge waxed jacket. 'One becomes so protective. I'm sure he'll think you're marvellous.' Then she ignores her. If it were possible to lie down under the leaf mould and die of shame, Marina would do it. She examines a sinister-looking fungus, feeling at first so sad that her throat hurts, then more picturesquely tragic. 'Ah,' she says with a loud sigh. 'The woods make me so melancholy.' Guy frowns. 'Rummy?' Lucy Viney says suddenly. 'Sorry?' 'Luce is mad on cards,' says Guy. 'Oh. I, I don't think th—' 'You must. What then? Racing Demon? _Vingt-et-un_?' 'Nothing,' Marina says, trying not to look shocked. 'I, I mean, not well.' She looks nervously at Guy, but he is wiping something on a tree trunk. 'Maybe,' she says brightly, thinking of the West Street girls, 'we know someone in common. You're at Hill House, aren't you?' 'Yes.' 'Well then. I think Antoinette at Combe went there. No? How about Liza Church?' Why isn't this working? In West Street they talk like this all the time. 'Sara-Jane Brownleigh? Sorry, "Turtle"?' 'No.' 'Oh. Well, so, so you're going to Edinburgh next year.' 'This year, actually. History of Art. Yes. I hope, Guy lovey, that you're not thinking of a tedious year out when it's your turn, like some of the idiots at school. Or,' she says, smiling at Marina, 'you?' 'Definitely not,' says Marina, who had been on the verge of deciding to spend her year out in Florence. 'Your house is lovely.' 'No,' says Lucy Viney. 'Our house is amazing.' Marina feels her smile set. 'Um, you might know a friend of mine, actually, who's an Upper at, at Combe, Simon Flowers. He's very musical. He's going to Cambridge, actually, to read, um, natural sciences. Tall and thin.' 'I'm sure,' says Lucy Viney, 'I don't know him. He doesn't sound at all like the kind of person I would know.' Marina tries to smile while biting her lip. 'I just thought, well, you know some of the Uppers at Combe, don't you? Guy said.' 'Not really, no. Guess,' she says, turning to Guy, 'who got into dire trouble with Papa last week? You know that new chap round the corner?' 'I know where you mean,' says Marina, and is about to say Mr Barker, the bird-bath owner, when Lucy Viney asks, 'Oh, so you know them up at the Hall?' 'I, not exactly,' and Marina sees the encouraging look fall away. The Vineys, brother and sister, begin to walk back towards the house; Marina, rehearsing a defence of Simon Flowers, hurries beside them like a page. She scans the fields for interesting local wildlife, searches for something intelligent to ask about rural pursuits, but can remember nothing beyond the maple-syrup snow in _Little House on the Prairie_ and something in _Lark Rise_ about sheaves. Wood pigeons, or perhaps cuckoos, sing their peculiar song as they leave the shrubbery. What can only be outbuildings cluster to the side of the house; one has what looks suspiciously like a stable door. There is even a mighty oak with a bench around it, almost as if they have stepped into a film set in an English country-house garden, not a real garden at all. It is twilight, the hour in children's literature when the adult world comes to life. Guy's house, Stoker, has long many-paned windows, in which dimples and puddles of the dying sun reflect like fire. If I lived here, thinks Marina, I would probably become a poet. But the truth is that she is starving, muddy and frozen and wondering how she will converse with the Viney parents at dinner. Guy's other sister, Emmy, Emster, might come by for a drink; she is married to someone called Toby. Maybe, thinks Marina, pointlessly biting a big chunk from her thumbnail, I should just go back to school now. Would anyone care? Her throat tightens. I am, she thinks, of humbler stock. Just as she is wondering about buses to the station, they reach a stone terrace, blotted with lichen, with grey cannon-balls on every other step. 'God, I love your house,' she says, and the Viney children look at her as if surprised. Perhaps I am, she thinks, unusually responsive to Beauty. Rather moved by her sensitivity, she looks out across the woods to a river valley just visible where the trees part, as if the scenery had arranged itself for her delight. 'Wow,' she says. 'Is that a tennis court?' 'Yup,' says Guy. 'Afraid not much of one,' says his sister. 'Bit too pitty for a really serious match. Do you play?' Marina gives a snuffly simper. The worn edges of the stone in the gloaming, like the rosy brick wall beside it, make her chest hurt with love and envy. From inside the house comes the clinking of china. Mrs Viney will be making dinner: probably steak and kidney pudding, or partridge, or a fricassée. Into the silence Guy lets out an enormous fart. 'Oh!' says Marina. 'Stinker uno,' says Lucy Viney and, without further comment, they walk up into the house. Marina has no words. There is something about bodily emissions in her _Sloane Ranger Handbook_ ; you are meant to find them hilarious but she is too stunned to speak. She has barely ever done an audible one herself; at home, such things are never, ever, mentioned. What are the rules for this? And so the moment for leaving passes. Much, much later, now a different adult from the one she might have been, she wonders if this was the moment when she chose the interesting path through the forest, where trouble lay in wait. Guy's mother has set out food of fantasy: an entire cold roast chicken, warm wholemeal bread, floppy lettuce leaves, a huge piece of ham on a glistening bone. Together they sit, like adults, at a big square table with a blue and white checked cloth and a jug of branches and bits of leaf. Surely this can't be just a lunch room; and what meal does this count as? High tea? It is lined with what is probably blue damask and on it hang paintings of dogs, tiny-headed horses and bloodied stags. There are decanters everywhere and nutcrackers and ashtrays and pewter birds and silver candlesticks and what she hopes is a porringer. The furniture is dark and very polished; you can smell beeswax, on top of fresh air, and wood smoke, and cold iron, and what must be port or wine. Every inhalation stokes her excitement and her terror. In the fireplace, porcelain elephants bearing little Chinese figures stand guard over the bellows and toasting forks. If she hadn't come here she would never have realized that all these things are tasteful. 'Your mum's an amazing cook,' she says wistfully, hoping that he won't ask if hers is, but he only grunts. A lawn the size of a park stretches into the distance, beyond a window framed with some sort of dead vine. Where is everybody? She takes a modest half-slice of the delicious-looking ham. He takes three. She says, 'Why are you putting jam on that?' 'It's chutney, idiot. What? You must have had chutney before.' She looks at her plate, the crumbly mess of home-made bread on the tablecloth because she didn't know what to do about side plates, and makes herself say, 'I . . . I should ring home. Just so they—' 'Nah, don't bother,' he says. 'They'll be fine.' 'No, you don't— I really have to. And I should get something better for your mum. Chocolates?' She hears herself say 'chocklits' but he doesn't seem to notice. 'If I could run to the shops.' The tulips are still upstairs on her bag; two have lost their heads. What can she give the others? Rozsi rarely leaves the flat without a selection of gift items – boxes of handkerchiefs; stockings in plastic eggs; wooden dolls hand-carved in Prague and horrible floral notelets; beaded glasses chains; liqueur chocolates – which she distributes to every tradesperson and cashier and even the teachers at Ealing Girls', until Marina wept for her to stop. 'God, no, not presents,' he says, grasping her hand awkwardly across the table. 'Dad hates them. People usually just leave a tip for Evelyn.' 'Do you often have guests?' she asks to distract him; she needs her hand back to fold her napkin, but there are no napkin rings. He scrumples up his and chucks it at his plate. 'Does your mothe—' 'Shh,' he says, reaching out a finger to stroke the back of her hand, tracing the tendons with a sheen of ham fat. 'Come on, eat up,' and he gives her a significant look. Laura comes home, a little earlier than the others. I have been entombed here, she thinks as she unlocks the flat door, like a prawn trapped in aspic, and now it will all fall apart. She puts on the kettle to keep herself company and listens to the straining water. By now, she thinks, sitting on the edge of the sofa like a woman in a waiting room, Mitzi Sudgeon will be lying bravely on a chaise longue in the middle of the Bazaar, having attendance danced upon her. Yet however much Laura pricks herself with this thought, she cannot feel it. The kitchen smells of smallness, secrets which would be better kept; the stoicism of old women doing their best far from home. Think, she tells herself. Think. She has to tell them about Peter. The light slowly fades. She must show them the letter. There is no reason to keep it secret. Only a monster would do that. # _13_ In Guy's room, on Guy's bed. They are kissing in a bubble of beauty, distant birdsong, the soft pluck and suck of their mouths. Marina can see past the red rim of his ear, illuminated by the setting January sun, which pours, much warmer than it feels outside, through his window. The room smells fresh: bonfire and laundry; this counteracts the whiffs of scalp from Guy's unwashed hair. She has lied to her family and she will be expelled. What if, overcome by lust, he presses her to the bed and takes her maidenhood? If everything is either a good or bad omen for her future, as she increasingly suspects, then wouldn't losing her maidenhood, -head, -hood, in a country house bode well? She is trying to tell whether his penis is erect; something is digging into her, but it could be his belt buckle. Far below them someone shouts. Guy pauses and so, for a moment, she is the one kissing him, as if she is the boy. Then they switch back. 'I love you,' he murmurs. Her heart is thumping in her right ear: with fear, or passion. 'I love you too,' she says. By dinnertime, she means it. It must be love, this pain of longing and desire. She feels it everywhere: in the Stoker vegetable garden, where she is told real cabbages grow; in a sort of coat room by the back door, lined with worn leather shoes and sun-bleached tennis plimsolls, where Guy sends her to look for his spare football boots; on the wooden staircase, sniffing up the scent of sunny dust; in the downstairs loo with its rustic door catch and cool whitewashed walls. There is a grander lavatory, but she avoids it; the chill of the tiled floor in this one, the dead wasps and daddy-long-legs in the corners move her profoundly, the luxury of having insects you forget to sweep up. It is extraordinarily cold in here and surprisingly unluxurious; old-fashioned stiff taps, a shower curtain powdery with limescale. She thinks of the Vineys, naked behind it; disgusting peasant, she tells herself, and pinches the skin of her palm. Outside is even worse; by now she is homesick for it. If, she thinks passionately, _I_ had room for an entire flower bed of lavender, I'd learn how to dry it, or distil it; I wouldn't just leave it out there, unappreciated. There are trees pinioned against walls with wire and lead pegs. Every crumbling brick, each forgotten crevice of gate and shed and wall, makes her covetous. She fills her pockets and sleeves with black conkers, skeleton leaves, pebbles, a few strands of real wool left unnoticed on a fence. 'You're not seriously pinching that stick, are you?' asks Guy, scuffling around with a forgotten tennis ball. 'No! Course not.' 'Well, it's bloody time to go,' he says. 'Getting snory.' 'I'm just off to, to get a cardigan,' she says when they go indoors, and she runs up to her room to conceal her thefts in her overnight bag. This house smells like nowhere she has ever been, full of places a child could make her own: alcoves and dusty landings, airing cupboards, tables to roll underneath; old paint on skirting boards so thick its chips have edges. She hates that child. It should be her. Her bedroom is the best, or worst. It is a cool pale nest of ironed white bedlinen and discreet floral wallpaper. There is a silver monogrammed hairbrush, space on the bookshelves, a dressing table whose tiny wooden drawers contain nothing but a picture hook and a couple of tiddlywinks. She can feel her lungs expanding. She thinks: I'll fling open the window, the casement, for some air. But Marina has a problem, which she always forgets. Her body never knows where it is. If someone else, for example, pulled aside the curtain, would they realize in time that the ornament on the windowsill, a green china bird-cum-nutcracker which, in another setting, she would consider hideous but obviously not here, might be knocked off? Because she does not realize, or does not quite believe it, and so the green bird jumps off the windowsill, falls on the radiator and crashes to the floor. She has to leave, right away. Before dinner. She will take the pieces with her, all nine, no, twelve of them, and get them mended in London. She could write a letter on the train. Or should she own up, and be cast out? She dithers, then panics, and she is just gathering her possessions when her bedroom door opens. Laura, in the kitchen, holding Peter's letter above the bin, watches her hand tremble. Has she always been so indecisive? It is hard to remember; her memory, too, seems worse. She feels extraordinarily old, better suited to a long convalescence in a rest home than to dealing with an ex, now current, husband. The thought of him is exhausting. Wouldn't it be better for us all, she thinks, if I pretended the letter had never arrived? It is only Guy. 'Wotcha,' he says. Marina boldly kisses him, to distract him from the bag on her bed. Unusually for a Combe boy on a Saturday night, he does not reek of deodorant and aftershave and Clearasil and anti-fungal foot lotion. He looks, she tells herself, almost attractive, doesn't he? 'I,' she says. 'Actuall—' 'You not dressing for dinner?' 'Sh, should I have?' she asks, only now noticing that he has changed into ironed chinos, a light blue shirt. 'Really? Oh God. I can. Give me a minute. Or,' she says nervously, 'maybe I should just leave—' 'Don't be a prat. And you can't change. Dinner has to be on time.' Tears are beginning to boil their way up her throat into her nose. She follows him downstairs, feeling her palm stick to the banisters, sick with self-disgust. What if someone goes to air her bed, as they do in _Tatler_ , and finds the broken china in her washbag? How could she not have thought of dressing for dinner? Breeding will out. Mrs Viney, whom Guy mentioned in passing upstairs is the Honourable Nancy, waits for them at the bottom of the stairs with Guy's sister, who is holding the big black dog by its collar. Marina's heart gives a little jerk of terror. 'Oh, darlings,' says Mrs Viney, who looks like Katharine Hepburn in wide black trousers and a dark pink blouse. 'You look gorgeous. Marina, what lovely boots.' 'She forgot to change,' says Guy ungallantly. 'Didn't you realize?' says his sister, who is wearing a pale grey sleeveless dress, in which her collarbones and scapula and sternum are clearly visible. Thank God Rozsi isn't here; she is not, Marina suspects, wearing a bra. 'I suppose not everyone— Guyie, you oaf, you should have warned her about our strange ways.' 'You should,' says his beautiful mother. 'But it doesn't matter, not one bit. We're all scruffbags here.' 'I could lend you something,' says Lucy Viney and, although Marina looks up sharply, she doesn't see her smirk. 'You're about twice her height,' Guy tells his sister. 'And half her girth.' 'Guy. Be good and take Beckett,' says his mother. 'No, seriously,' says Marina, 'I don't think—' 'Nonsense,' says Lucy Viney briskly. 'Tell you what, you could borrow Emster's skirt, Evelyn's just mended it.' Marina, mystified, finds her hand being taken by Lucy as she is propelled down another corridor, past yet more doors and into a little dark room full of laundry, with a sewing machine. 'There you go,' Guy's sister says, holding out a mini-skirt in bright turquoise wool, somewhere between tweed and felt. 'Perfect,' and, sitting up on a high stool, she waits for Marina to try it on. 'I,' says Marina. Her cheeks burn; she can feel sweat on the backs of her knees and in her armpits. She thinks: I cannot do this. 'Better hurry up,' says Lucy Viney. 'I heard the bell.' This, whatever it means, shocks Marina into life. She pulls her jumper down to her thighs and starts undoing her boots with trembling hands, talking with no idea how to stop about other people the Vineys might know at Combe. She cannot bring herself to meet Lucy's eye; her mottled thighs and navy cotton Principessa Girl underpants, which Rozsi calls her 'good school knicker'– if only today she had worn her Berlei Junior Girdle – glow luminously under the overhead bulb. She thinks: I want to shoot myself. Somehow, by talking more and more quickly, she forces herself to remove her jeans and grab the skirt, which has a difficult fabric-covered belt with buttons and a zip and a hook. She shuts her eyes as she pulls it on, over her thighs. It is tight on her bum. It will not do up. 'God, was that another mouse?' says Guy's sister, kicking a clothes basket with her toe and Marina seizes the chance to breathe in far enough to pull up the zip, feeling the pulling of stitches as she tugs it round to the back. 'Let's go,' Lucy says impatiently. 'Not really your build, Emster, but at least she's bigger than me,' and she gives Marina a smile crossed with a wince. 'She won't mind a bit.' 'I, I need tights,' whispers Marina. 'Sorry.' 'No, you'll be fine,' says Lucy, jumping off her stool. She is wearing oddly broken-down ballet pumps, which would horrify Rozsi; her feet are long and bony, like her hands. 'I never do.' 'Please.' Guy's sister sighs. 'Hang on,' she says and she goes out of the room, leaving the door wide open, and comes back with a pair of bobbly mid-brown tights, damp and longer than Marina's legs. 'Just washed,' she says, and Marina bends to put them on. As they emerge into the hallway, Marina turns to ask a polite question and finds that she has been abandoned. Her throat is tight; don't cry, peasant girl, she thinks. There is a strong smell of flowers: Turkish delight, she thinks stupidly; attar of roses. I need perfume. No, scent. 'There you are, we'd quite lost you. You must think us dreadfully rude,' says a voice. When Mrs Viney puts her arm around her and walks on down the corridor, Marina's face is pressed against the rose-coloured silk, in the region of her lower shoulder, or upper breast. Held as she is against Guy's mother's side, like a dwarf in a three-legged race, she can see her jawline, the soft pale skin under her chin. She is, for a mother, startlingly lovely. Turkish delight: she breathes it in. Here it is at last, the heart of the house: a room the size of a normal school hall, with chintzy sofas and dark forbidding chairs and a round polished table in the big bay window covered with _Country Life_. There is no trace of their host's profession here; one does not enter a drawing room in order to be educated. There is an immense fireplace, in which most of a tree is half-heartedly burning; above it on a notably ugly marble mantelpiece, cream and green and yellow like candied vomit, stand invitations, and silver christening mugs, and fat candlesticks, and photographs of people on horses. So comfortingly old-fashioned, so cheerfully Philistine. What does it matter if there are generations of dog fur in the corners and moths deep in the velvet curtains; if the wiring, with one further mouse nibble, will plunge the house into darkness, or flames? Stoker belonged to Mrs Viney's mother; perhaps, thinks Marina, she has only just died. The parquet is coming up in the corners, and the window frames are quite obviously plugged with newspaper; if you slept in here alone you would wake up with chilblains, at best. This room says: you see, we are too grand to care. 'We're awfully quiet here,' says Mrs Viney. 'Just a few friends – can you bear it?' 'It's fine,' says Marina. Her voice is croaky with shyness; there is a strong chance of sudden dramatic fainting, or being sick. 'We never have people to din . . . I mean, not much.' There are cold miles between the sofas; the hearth alone is bathroom sized. At home only Zsuzsi smokes; Rozsi, as everyone keeps telling her, gave up smoking sixty a day the minute Marina and her mother moved in. But all their guests do. Here, at Stoker, they are concentrating on drinking. 'I expect you know Jerry,' she says, indicating a familiar-looking grey-haired man just emptying his glass. 'Er . . . yes, maybe, I—' Marina says, tentatively putting out her hand but Mrs Viney steers her onward, saying, 'and Immo, of course, and Horatia,' smiling at a woman with big horn-rimmed glasses and hair piled up like a blonde cottage loaf. 'Olly, darling, you'll get young Marina a drink, won't you? He's a poppet,' she whispers to Marina, nodding at a man in red trousers. 'He'll love you. Now, will you excuse me? I must just . . .' and she drifts away. Guy is dealing with the dog; it is lying on its back in a basket by the fire, violently exposing itself. The red trouser man gives her a glass of fizzy wine; she nods and blushes at him like an idiot and, understandably disgusted, he wanders off. She sits down on a little old-fashioned chair, fat with tapestried cushions, but they prickle so that she stands clumsily and twists her ankle. Lucy Viney is talking to a thin dark clever-looking woman, who flicks a glance at Marina; then she, too, ignores her. If only Marina had social graces. If only she had courage, like her relatives, or Nancy Mitford. Guy's house must be full of linen cupboards in which to hide, or helpful stableboys who, for a generous tip, might drive— That man in a dark jacket, on a spindly-looking sofa leagues away, is Alexander Viney. His hair is silver velvet in the firelight; with his shaven chin and mighty nose he reminds her of a mature and warlike god. To her disappointment, Marina sees that he is talking to the woman with glasses and silly hair, to whom she has taken a dislike. His hand seems to drop behind and then rise up her back, as if he is pattering his fingers along her spine. Marina lowers her eyes in confusion. She has a sudden longing to be at home, stuffing cabbage-leaf parcels with minced pork and veal, or discussing the correct age to read _Middlemarch_. She wants to ring Urs, 229 5104, and report to her: I am here in the halls of greatness, _et tout va bien_. _Non, je blague. Avec tristesse, comme toujours je suis dégueulasse._ She is small and primitive, like someone in a Brueghel. No one is talking to her, with her stiff smile and stupid hands. Like a girl in a fairy story, she thinks in wishes: Please. Please. Please. But nothing happens. She smiles unattractively, walks over to a table and pretends to be admiring an ashtray made of a hoof or a horn. If she were at Simon Flowers's house she could be reading poetry aloud to his younger sisters, or watching his parents play string quartets. She could join in on the cello. Her foot touches something: a blood-smudged bone, half-gnawed, and in her shock she knocks into a dog bowl under the table. Water sloshes on the rug and the parquet beneath it; at home she would rush to wipe it up. Here she can only pray to the God of Evaporation. 'Young person,' says a voice. All other sound seems to leave the room, as if someone had pressed their lips to it and sucked the flavour out. Alexander Viney lifts his energetic eyebrows. His forehead crinkles in four straight lines, as if he is amused. 'So you are . . .' 'I'm Guy's er,' she says stupidly, aglow like a fiery radish. Mr Viney lifts his eyebrows again: one, two. 'I mean,' she begins. 'I— we met.' 'I know _who_ you are. You said. I'm not quite geriatr—' 'Yes,' she says without thinking, 'I saw your age in _Who's Who_.' 'Indeed. Don't interrupt. Rather, the question is: _what_ are you? That's the aspect which interests me.' 'Sorry?' 'Good Lord. It's quite straightforward: are you whatever it is you people say now . . . his girlfriend? Do people _have_ girlfriends these days?' She can feel everyone watching. There is a strange silence, curdy and dense. She says, 'I think, er, maybe some do. But not at Combe.' 'Oh really. What happens at Combe?' 'We . . . that's not allowed. We . . . toil, instead. Some of us.' 'Do you now?' His eyebrows rise even higher. 'Toil,' he says thoughtfully, his eyes still on her. 'D'you know, that's a good word. So you're not his girlfriend.' 'I—' 'No need to answer,' he says, smilingly. 'Now tell me. What else are you? Don't look so nonplussed: that dark plait like a squaw, those impressive eyebrows. You look like you should be ululating at Mafia funerals. Spanish? I don't know. Not Greek?' At Combe not one person has gone this far. If they think 'foreign', they mean pale noblemen in Kensington, shooting themselves over gambling debts, but her family do not bet, or drink, or kill themselves. 'English,' she says. 'Is that so?' She swallows her shame, like a bullfrog: _ug_. 'But my father's, well, my grandparents were, are—' 'Spies?' It's not funny, she wants to say, but she answers, with as much dignity as she can: 'No. Actually they love the queen, and the Labour Party. They're very patriotic. The English welcomed them.' 'I see.' 'They are very loyal.' Now he is not laughing. 'Of course they are,' he says. 'Fascinating. I shall have to guess. Not German. Polish? You have that Russian doll loo—' 'They were born,' she says, blushing all over her body, 'in the Austro-Hungarian Empire.' 'Good Lord.' 'I know.' 'Interesting.' 'Do you think so?' 'I do.' 'Actually,' she confides, 'so do I. But I don't normally tell—' 'Yes, quite,' he smiles. 'Just that phrase, Austro-Hungarian – it always makes me think of pointy helmets.' 'I know. Exactly. In fact,' she admits, 'they used to ski to school. Not that they've said. I've just seen mittens.' 'So, out of interest, where was this, precisely?' 'The thing is,' she says, 'I don't know. It seems mad. But it's not discussed. I mean, I try to, you know, ask things, all the time. But they just cry.' 'Your grandparents?' 'All of them,' she says, glossing over the true shame of her domestic arrangements. 'Instantly. In fact just the other day' – actually a year or more ago, why is she lying? – 'I wanted to know if they'd grown up on a farm, or . . . it was about pets, actually, because I'd like . . .' Change the subject. 'Or a garden. We all love gardens,' she says, gesturing sycophantically and banging her hand hard on a table corner. 'No, it's fine, ha ha! It's fine. Um . . . so, I asked, and . . . tears. Immediately. Blubbing,' which is a word she has been longing to try. 'So I never find out anything. Look, are you sure you want to talk to me? You've got guests.' 'It's fine,' he says. 'You're amusing me.' 'Am I?' 'Yes, but don't go on,' he says, grinning, and he folds his arms behind his head and stretches backwards. His chest looks very . . . virile, she decides, which is a disgusting thing to think about someone's father. 'I don't usually talk about this,' she admits. 'In public. I don't know why. I mean, about being . . .' She drops her voice. 'Foreign.' 'So you don't even know where they're from?' 'Were . . . or are, for my grandmother, yes. Maybe I've heard, but I can't remember the actual place name. It kept changing around, I think, the barriers. Boundaries. They did their sums and reading in Russian and spoke Hungarian to their parents but the town was Czech, or no, that was my grandfather. Roz— my grandmother was the other way round . . . I think. And they speak Hungarian now, amongst themselves, but they _say_ they're from Cz— the Czech Republic. They call it Czecho. How can that be?' Shut up now, she tells herself, but he makes her too nervous. 'They're weirdly loyal to it. We're only allowed Czech mustard.' 'D'you know, it's rather good stuff.' She looks at him with new admiration. 'I suppose it is. But now their town is in Russia. The Ukraine. No, Ruthen— Ruritania. Somewhere like that.' 'Good God. Tell me you're joking.' 'Me? No . . . sorry, why—' 'Never mind. So, Hungarian, eh? The world's most impossible language.' 'Everyone says that. I mean,' she says quickly, 'it's amazing that you knew. Do you . . . speak it?' 'Certainly not.' 'I don't,' she reassures him. 'Well, I know forty words. Central heating is, well it _sounds_ like _kers_ -pontifootaish. Seriously.' She has lowered her voice again, as if saying a dirty word. 'Tomato is, well, _porr_ -odichom. See? _Mee_ -krohulam is microwave, _raa-_ gogoomy is chewing gum, not that I'm allow— I mean, that's how you say them, God knows how they're spelled. We laugh at them, it sounds so ridiculous,' she says. 'At the words, obviously, not my grandmother. My mother and I. At least, we used . . .' Her cheeks are burning again. 'Even Tokaj, that wine, it's all done in satchel loads, did you realize? Like _három puttonyos_ means three, I think,' she says, counting on her fingers. 'Hang on, _egy ketö három,_ yes, three satchels. Of grapes, I suppose. Sorry, where was I?' 'God knows,' he says, but he is smiling. 'Would you like another drink?' 'Please. Nothing sounds sensible. They even say _Hon_ -garion,' she confides. 'And you can't work anything out, because it's so, well, unLatinate—' 'Only marginally Finno-Ugric, is it, although—' 'Exactly! Wow. That is so, so right. So if I want to know what they're on about I have to extrapolate.' 'Extrapolate? Interesting,' says Alexander Viney, inclining his head as if towards a respected colleague. 'So why,' she persists, 'do you know all this?' 'You are very direct. Well, I had an acquaintance from that general area.' 'Oh! Really? I'd love to meet him, her . . . them. I mean—' 'Why? Don't be ridiculous.' Marina was going to explain that she misses her Hungarians; that she thinks certain words in their accent, for comfort; that in term time she so longs for their voices that her heart leaps when she hears a foreigner on the streets of Combe, and is always disappointed. But he is laughing at her, so he doesn't deserve it. He'll go off now to talk to his more impressive guests and she will guard her grandparents' privacy. He doesn't go anywhere. Alexander Viney is still smiling, his eyes narrowed, as if he is trying to deduce something from her face. 'So,' he says, 'the mountains – the Carpathians, as you'll know . . . or you don't know.' 'Not . . . no.' 'Well, you should.' 'I—' 'Forests, castles, goose-girls, wolves. Princes. Mountain lions.' 'Really?' 'Not really.' 'Sorry. God I'm so dim, I—' 'So they're from there? Anywhere I might have heard of?' She narrows her eyes. Is it possible that he could be thinking that her relatives were princes? She wants to be honourable and honest; all the same, she can hardly admit that they were probably gnawing old potatoes and sleeping in pigstyes. She will not betray them. 'I don't think so. I mean, I don't _know_ of any, you know, castles, or whatever. Or maybe only very small ones.' He looks at her. 'You're probably right,' he says, and she blinks. 'Interesting. I don't know if you've found that those places tend to breed a certain sort of person. Very formal. Very archaic. Endless hand-kissing, apparently, and—' 'Oh, we don't do that,' she reassures him. 'Hardly ever. But the rest is so right. You _do_ know.' 'And of course they're proud. Are you proud? And easily insulted, nursing grudges, ferocious about the family's honour . . .' 'Well,' she says. 'I'm not like _that_.' 'Of course not. Have you read George Mikes?' She stands straight. He should know the kind of person he is dealing with. 'My great-aunt _knows_ George Mikes,' she says. 'He's dead,' he says. 'Oh. Sorry. Oh.' 'Hierarchical too. Keeping things from the children.' 'What do you . . . oh, I see. Yes, they do. Completely. Wow – I've never thought before it's a sort of, you know, a _racial_ thing. I thought it was only mine.' 'Just a guess.' 'No, honestly, this is so exciting. You can't imagine. I've never met someone who knows anything about them before. I mean, in real life. It's like being given instructions.' 'Really?' 'It's amazing. I just didn't know it was normal. So your friend comes from exactly where?' 'There, where you're talking about. Transylvania. What? You must know this, surely.' 'Tran . . . you're teasing me.' 'I assure you I'm not. Look, if you can't stomach that, you can say Transcarpathia or Ruthenia even. Child, it's basic central European geography. Don't look so insulted.' 'I'm not,' she says. 'Transylvania, seriously? I, I—' 'Hey!' says Guy, appearing at her side and nudging her hard with his elbow. 'You OK?' 'Perfectly fine, thank you,' says his father, but he looks annoyed. The fire heats her fiercely from one side. 'I'm interested in my new friend's roots,' he says. 'Aren't you?' Guy hesitates. 'Although you'll need to be careful.' 'What do you mean?' Alexander Viney keeps his eyes on her. 'Scimitars. Pet bears. Vlad the Impaler. Hungarian women are a handful.' 'She's not Hungarian. Is she?' 'Marina?' 'You don't _sound_ Hungarian,' Guy says. 'Trust me. Blood of the Hun. This one may look like Frieda Kahlo in a filthy mood, but . . .' Guy is pulling her away. His father is still watching her. 'We will talk further, my little friend,' he says, and then he winks. # _14_ 'Zsuzsi, _dar-_ link, do you vant a _kavitchka_?' ' _Nem_.' 'Rozsi _dar-_ link, do you vant a _kavitchka_?' ' _Igen, köszönöm_.' ' _Szívesen_. Laura,' says sweet kind trusting Ildi, who thinks her evening holds no more than coffee and _Murder on the Nile_ , 'do _you_ vant a . . .' But Laura sits in a welter of panic; Peter is coming back. In the past, if ever she missed him, she would remind herself that in his absence Marina was safe. Now that she has become unmistakably fully grown, he will want to introduce his daughter to his grim friends: renegade French teachers; embittered driftwood carvers; professional life-class models; _poets_. Laura has met these disgusting men already, knows about their numberless tragic girlfriends, their cigarette-rolling habits, their arrogant attitude to hygiene. The thought of them anywhere near Marina makes her grip her chair until her knuckles whiten. Never, she thinks. No way. Life is bad enough without him in it. If I measure the damage his return would do against his absence, it is better for us all if he stays away. It is like being on television: _An Adult Dinner Party_. Everyone murmurs politely. The room is full of candlelight, magnified by silver and glass and mirrors, so that it is impossible to tell how much is actual flame. They eat the food of yesteryear: smoked salmon mousse, parsnips and roast potatoes, rib of beef. Nobody comments, although it is all delicious. There doesn't seem to be quite enough. 'This is lovely, gorgeous, thank you,' she says, to fill in the silence after she has dropped her knife, and the heat of the room falls upon her. Alexander Viney sits far away across a pool of mahogany, hair glinting like fur as he bends his head to the blonde woman beside him. 'Horatia,' she hears him say; Marina nods knowledgeably, prepared to murmur Admiral Lord Nelson's dates, but he does not notice. On his other side is Lucy Viney, which seems a terrible waste. He puts his arm over her shoulder, and she leans against him. 'Family,' he says, pouring more wine into their glasses. 'Nothing like it. Aren't they beautiful?' Marina catches Mrs Viney's eye and smiles. 'Yes,' she says, and her voice sounds like a choirboy's, pre-pubescent. She is sitting, like a squatting slave child, on a chair slightly lower than the others, next to Olly, a student in land management, who asks if she knows Minty or Ivan, then concentrates on his food. On her right is Jerry, who is, she now realizes, familiar only because he is a famous politician; he understandably ignores her. The interesting-looking dark woman, Janey Dalrymple, has not once turned in her direction either, despite Marina's hopeful smiles. Pressed between strangers, an awareness of nearby adult bodies – the radiant heat burning from the politician's arm, the small private movements Mrs Viney makes with her hand – is forced upon her. Her nervous breathing is crude in comparison, her tongue moves too loudly. Mr Viney, she suspects, would understand this. Although her head is so hot, beneath the table she is frozen, like a mermaid. And her leg is shaking. She has only just discovered that she is terrified of dogs. Whenever smelly Beckett comes near her, a limping barrel of hair and drool, she has to grip the sides of her seat. This, however, is the least of her problems. Zsuzsi and the others are so keen on manners but, she wants to tell them, they have left her ill-prepared. What use was their training if all she can do is hold open doors and give up seats and defer respectfully to old foreign ladies? Here it is quite different: she is an adult, with no idea how to behave among her kind. She has already made a mess of hand-shaking. Timing is difficult. Who was meant to sit first at the table, all women, or just older women, or men older than her and who serves whom, and when do you start eating? She brought her champagne to the table and had to pour it into a wine glass to avoid rebuke, which then ruined her chances of working out the right ones for anything else. Also, she has too much cutlery; she considers trying to use a knife and fork to eat her bread, just to use some of it, mercifully sees sense and then is shocked to see Mrs Viney using her fingers to wipe up the sauce on her plate. She keeps getting her compliments wrong; her spindly little chair creaked when she sat on it and, to cover her embarrassment, she said how pretty it was, and Lucy Viney said, oh God, that one, urgh, hideous, and Mrs Viney said, 'It's mostly plarstic, anyway.' Whenever Alexander Viney glances her way, Marina tries to look intellectual, yet remote. Mrs Viney, on the other hand, keeps giving her reassuring smiles. Once she even winks. By the time they are on their rhubarb fool and brandy snaps, Marina has stopped trying to join in her neighbours' conversation. She has forgotten Guy. She looks at Mrs Viney and thinks again: Please. Olly the student has been growing ever sleepier and stranger. Gradually, something shocking occurs to her: could he be _drunk_? She blushes with shame for him, and disgust. Thank God Rozsi isn't here, she thinks, then she realizes that this is exactly the kind of error the Fates are waiting for. If she rings home tomorrow and finds that her entire family has been slaughtered, we all know whose fault it would be. At last, after brandy and port and sloe gin, and Bath Oliver biscuits, which are an enormous disappointment, the dinner ends. Is it possible that she is a tiny bit drunk too? She knows what should happen now, but no one is doing it. 'Do we adjourn?' she whispers to the politician, who reels back in theatrical amazement. Her toes are wet with Beckett's slobber. Bed, she thinks: my cottony room, my dressing table, my rural views. But Guy has other plans. 'Don't put on the light,' Marina says. 'I need to sleep.' The smell of so much fresh air is like being inside his childhood; it almost cancels out her worry that he will suddenly decide to look in her washbag and find her crime. Hungry for her bed, she wanders round in the moonlight, touching a fossil on the windowsill, thinking about castles and dark fir forests, which merge in her mind with the soft brown deciduous haze outside, the terrace and infinite little rooms. Now, able for once to overcome her terror of _The Turn of the Screw_ , Peter Quint's pug face behind the curtain, she stands close to the window, her nose leaving a greasy mark on the glass, and looks out for hedgehogs on the dewy lawn. It is so easy to imagine where she should have come from: the turrets, the merry woodcutters among the palace birches, all in silhouette against an oily rainbow sky. She wants to be proud of the family peasant-cot, but the dirty crouching truth is that she is ashamed. She would not have been a beautiful simple maiden. She would have been the witch. 'Come here,' Guy says, but she hesitates. He walks up to her, takes her hand and puts it on the front of his chinos, where he is hard. That, she thinks, is an erection. Night. It is almost twelve, an hour at which, in London, nothing good can happen: only violence, suffering, furtive struggles in alleyways. There is too much fear and danger in the world for a parent to bear. Laura walks on tiny stepping stones across a rushing torrent, picking her way between the terrors of daily life. Midnight is one of the worst times: a shameful childhood blight which, disappointingly, she has not grown out of. At home, worrying in her semi-bed, she survives it by avoidance, closing her eyes to the china clock on the opposite wall, her ears to the swishing past of cars in the rain. She awaits the telephone, the knock at the door until, at last, it is twelve-thirty, and Marina can be judged to have survived another day. How funny, she thinks now, that Alistair Sudgeon, object of so much longing and hope, does not know this about her, yet Peter, with whom the later years were mostly endurance, used to tease her about it, which she hated, until the fear had almost gone. Idiot, she thinks. He'll have forgotten it now. Things were better as they were, without false hope, which is why, as the church on Pembridge Villas strikes the fatal hour, Laura is crouching by the communal bins of Westminster Court in the frost, wearing a nightdress, coat, mittens and substantial knickers, teeth chattering like a child's as she fails to burn her former husband's letter in an empty tin of plum tomatoes. One after another, the matches blow out. She is shivering dramatically. London roars at her back. All evening the letter has lain concealed in her spurious work folder, in an envelope from the milkman until, with the others at last in bed, she reread it by the glow of the street lamp where the curtain gapes, looking for clues. There were no clues. He sounded surprisingly sane. He knew she must hate him; he referred to his many friends who abandoned wives, children, babies and, as she pursed her lips, he wrote, 'I always thought they were pricks, and they were, and now I'm one too.' Which is, of course, exactly the sort of Peterish comment she has edited from her thoughts of him. Keeping her face averted from five floors of nets and proud window boxes, she scans the street. Was it even love, given the quantity of her crying? Hadn't his selfishness always shown beneath the skin? She thinks of never seeing his handwriting again, his allegedly good intentions, the predictable fact that he is living on someone's houseboat, and waits to feel purged, renewed. If she doesn't write back he will leave them alone, which is what she wants, and she can decide what to tell the others in due course: his mother and daughter, whom he has so horribly hurt. But the tomato can, which had seemed, at the time, an uncharacteristically practical solution to the gratelessness of Westminster Court, contains not enough oxygen, or too much liquid vegetable, to be quite the furnace she had hoped. Burning the letter had seemed the right thing to do when it was ticking away inside the flat: a stupid idea, she can see that now. Six matches left. Five. Four. She could, she realizes now, have flushed it down the toilet, thrown it out with the potato peelings, but burning seemed better. It is the only way; severing the last tie with this man whom she loved, or thought she loved, to the point of idiocy. This is definitely the right thing to do: a final act of revenge. But what if she has to contact him? She needs time alone to think what to do, how to contain him and preserve what little peace she has. The worst thing, she is absolutely certain, would be for the old ladies and Marina to come across the letter before she has prepared them, and she is not ready to tell them quite yet. Anyway, if he is desperate to see them again, which his letter did not mention, he will phone them. He— Now, too late, she realizes that she has just watched the last match go out. There is nothing to do but haul open the fire door; she is about to creep back inside to her lair when she sees a man crossing the road in front of the building. Her stomach slips. It is Peter. And although in the next moment she knows that it is someone else entirely – the real Peter has bigger eyes, bigger nose, bigger gut and voice and ego – after she has hurried down the cold concrete steps to the basement flat, she is telling herself that this racing heart is fear, of course it is. What else could it be? # _15_ _Sunday, 29 January_ 'What the hell time is it?' says Guy. 'Half eight. Sorry, sorry. Shouldn't you be getting up?' It has not been a restful night. She had brought her most country-house nightdress, green tartan brushed cotton from Marks & Spencer, but was so cold that she had to sleep in the brown tights and a cardigan too. Now she stinks of sweat. Also, there has been an incident: only a couple of hours ago, when the sun was coming up. The unnaturally loud birds of Wiltshire had woken her at 06.44 and as she lay on her back in her cool linen coffin, alert for footsteps outside her door, she slowly came to realize that nature was calling to her in other ways. She needed the loo. By the time she had risen, performed her five morning press-ups and tried every possible clothing combination, her need was urgent. She crept out into the corridor. She opened the lavatory door, tried to pull it shut, found that it stuck. There was no lock. In her distress she made what was meant to be a little groan but came out as something louder, more bodily, which could be misinterpreted. Self-consciousness bloomed in the quiet: she knew she should turn round and go back to bed, but she was more desperate than she had ever been before. She had been dismissing her faint stomach ache as nervousness, and hunger: now she realized that she needed to . . . to . . . empty her bowels. The loo itself was in the bathroom, which Rozsi would consider uncivilized, and the room looked as if Mrs Viney had forgotten to have it decorated. Its walls were made of planks like a boat; it had a green-stained bath in the middle of the room connected to the wall with wobbly pipes; a broken wicker chair with a cushion; a spooky old picture made of dried flowers behind spotty glass; and, for the greater magnification of noise, floorboards instead of carpet. Everything would be audible, to everyone. She sat down on the cold toilet, no, lavatory seat and saw herself reflected in the mottled mirror by the door, frowning like a gargoyle, her knickers by her ankles, her face the colour of shame. And, oh dear God, what to do about flushing? Since childhood she has known never to alert others to one's night-time wee, let alone wake them, by using the chain. Never: not at home and certainly not anywhere else. One simply disguises it with extra paper, washes one's hands silently, and scarpers. Here, now, this was not an option. The house lay in perfect silence. A passing Viney would hear her; thanks to the carpeted hallway she might not even hear them. She closed her eyes. A pipe gurgled; someone might think it was her. Then she realized that it was. Her stomach gave another gurgle, then a loud growl. She sat back sharply, whacking her elbow extraordinarily hard against a metal pipe which protruded from the wall. It was too dark to see but there must be blood; now she felt sick too. And meanwhile the noise in her stomach began again, more loudly than ever and nothing, not even prayer, or leaning forward to hold her ankles, could squash it into silence. The sweat smell grew stronger. Could she could find somewhere else to go, a downstairs bathroom, the woods? It was too late. Her need was pressing. Tears rolled down her cheeks as she gave in to her fate. Who could have slept after that? She thinks now, standing just inside the doorway of Guy's fuggy bedroom, that she probably never will. If he refers to hearing sounds in the night, or, dear God, having gone in after her, she will pass out. But he is still only half awake, indistinct in the furry darkness. To the level of his strange boy-nipples, if not lower, he is bare. 'Oi you, come here.' he says. 'I can't. I, I have to ring my home.' 'Get a grip.' 'No, seriously. I do. They, I, honestly. Please. I can pay—' 'They'll be fine,' he says irritably and, when she still resists him, sends her off with the vaguest of directions. Her jumper smells of wood smoke and armpits. The ground floor is cold; no one is about. She keeps looking over her shoulder as she searches for the telephone. There is a reassuring pile of logs outside the back door, innumerable spare wellingtons and woolly jumpers. Last night, it occurred to her that if a war began this weekend and the Vineys offered to give her family sanctuary, she'd have to explain all about them. She has spent so many hours thinking of how she'd save them during an unspecified apocalypse – which foods in the looted shops of Queensway might be more sustaining, for example, or whether they know anyone in Scotland. What if the coast is invaded by, well, invaders? It is bad enough in London, where they are at constant risk of kidnap, murder, accident, of junkies, muggers, stalkers, flashers, gropers, rape or worse, if there is worse. Of course Mrs Viney would welcome Rozsi and her mother and the others, but it would be awkward. A good, moral person would not think in this way. She deserves what she will get. By the time they answer, her teeth are chattering. ' _Ha_ -llo.' 'It's me,' she says. 'But I can't really tal—' ' _Dar-_ link, _von-_ darefool,' says Zsuzsi, sounding faintly disappointed. 'But how so early? No matter. Tell me all about those lovely boys.' Her breath stops. Then she understands: 'Oh!' she says. 'You mean—' 'The aristocrat Lord Charles, how is he?' Zsuzsi is obsessed with the Hon. Charlie: a sweet dullard in Bute who was polite to her on Marina's first day. Bute is, nominally, Marina's house; she sees him several times a week there at House Prayers and House Meeting and Ronald and Jonquil ('Ron and Jon') Daventry's weekly teas. He has a special bond with Pa Daventry. Thanks to his floppy fringe and noble profile, for a week or two Marina had imagined they might be friends, or possibly marry. 'Charlie's fine,' she says. 'I think. Actually, could I—' 'Or that young boy, for example. Gay.' 'Guy.' 'Yes, yes. So good-looking. He is not a lord?' 'No.' ' _Nev_ -airmind. To me, he is so romantic. A girl has to live a little. _Igen_. Wait one second, _dar-_ link. Rozsi speaks.' 'But . . . hello, Rozsi,' says Marina, pressing her dramatically bruised elbow against the wall. 'Yes. Yes. No. Not at all. How pleased? I think . . . Yes, always, very hard. Yes, the top, or near. OK, the top. _Yes_ , honestly, you don't need to . . . every night. Yes, plenty. And I'm in the Current Affairs Society now, did I tell you? The only girl, and mostly younger boys but . . . No, Thursday. Yes, lots of friends. In fact,' she says, clenching her jaw to control her shivering, 'actually I'm ringing because . . . well, you know the pay phone at West Street? It's sadly broken.' ' _Tair-_ ible. You must tell your master that he will help you. It is _ri_ -dicoolos.' Rozsi switches into Hungarian: ongy-bongy, ongy-bongy, explaining to the others Marina's little lie. There is a stack of cards and paper by the telephone: The Old Rectory, Stoker, West Knoyle, nr Shaftesbury. They are engraved, she is certain, not thermographed, which is reassuring. New red pencils too; unlike the little green crocodile stumps at home, the wood dark with frugality, this is unbitten, rubber-less, a smooth cylinder with a perfect point: the Platonic ideal of pencils. The gulf, she thinks, between us is unbridgeable. Then Rozsi is back. 'How can the little children telephone?' 'We're not little, exactly,' she says. 'Someone in my English class is eighteen.' 'Well, he must be a very stupid boy.' 'Yes, he is.' 'There we are. So what do they do with this bloomy phone?' 'Oh,' says Marina vaguely. 'Improve it probably. Something digital.' 'Digital? Very good.' 'So . . . the thing is, you see, I had to go to one of the other phones and ring for our Sunday chat, but I d—' 'Where?' 'The New Lodge. Actually near the Buttery. That's why it's so quiet. Don't worry.' She doesn't quite know how to stop. 'There's nothing to worry about.' 'And you are being good?' 'Sorry? Oh, right, sorry, yes, right. Sorry.' ' _Dar-_ link, please, I must talk to your houseman, master, put him on.' 'But that's not . . . I, you can't. He's teaching. Rozsi, I've really got to go.' 'I worry, _dar-_ link,' Rozsi says. 'Oh. Do you?' 'Yes. Of course. Soon Fenyvesi Ernö and Bözsi are here, we go for little walk, so we talk about it later. I send money.' 'No, no. No need. I've got lots. Honestly.' 'I send food then. Easy-peasy. We see you soon. Now I fetch your mother. Be good, _dar-_ link.' 'I just, it was easier to ring early,' Laura hears her daughter say. 'Today. Or did you not want me to?' 'Of course I did. It's— Sweetheart, where are you?' Her heart is still thumping; an early-morning phone call is never good news. 'You're all echoey. Was that a dog's bark?' 'Oh. Yes. I'm, I'm at school, obviously – obviously! – but not actually . . . not in West Street. I'm in, in, you know that corridor between the Undercroft and the Praecentor's—' 'So early,' comments Rozsi at Laura's elbow, as if the phone is permeable. 'Why, tell us?' 'Is the West Street one not working?' asks Laura, closing her eyes. She can't even visualize where her daughter is standing. Why has she allowed her to live two hours away? How, she would like to know, can anyone stand motherhood? Do other women not live as she does, trying to ready themselves for the phone call which will bring their life to an end? I can't go on like this, she thinks, with the sudden clarity of the half-awake. Even apart from bloody Peter, this is unendurable. All this worrying has to stop. 'Yes,' Marina is saying. 'I mean, no, no, it's completely broken. That's why—' 'Are you sure,' says Laura, sounding strict to keep the wobble out of her voice, 'that everything's OK?' 'Yes. I said.' 'There's that dog again. It does sound very close. You hate dogs, sweetheart, ever since Mrs Kroo's—' 'I don't. I mean, I don't now. You can't just assume—' And that is how their conversation ends, with Marina an inch or two further away, and Laura not having dared to say, 'Come home. I want you. I miss you. I can't wait another hour.' Anyway, how could she have said it? There was no way, with Rozsi right here, to raise the subject of leaving Combe. It has to be private, and Westminster Court is never private. She thinks to herself: you could write to her and ask. But after a term of scouring the emotions out of her postcards, could Laura send a letter like that? The only way to live apart from one's child is to shut up one's heart in a metal box with chains and rust and padlocks, and not open it. She cannot bear to. She has no picture of Marina on her desk. She cannot breathe when she thinks of her. If Marina is homesick, Laura's heart will break open. So she cannot entertain the idea. If Marina wants to leave Combe, surely she will say so. Marina goes into breakfast. Her throat aches as an orphan's might. She rubs her frozen hands together and smiles shyly at the other guests, at Guy's sister. 'Um . . .' 'What?' 'Sorry. I . . . is there any coffee?' There is a short silence, solid, like a pineapple cube. 'We have _tea_ ,' says Lucy Viney. 'We don't bother Evelyn for other things.' 'Oh. Sorry,' says Marina. 'Anyway, this is the perfect breakfast. Though, actually, do you mind, the _fresh_ orange juice is Daddy's.' 'Sorry.' Biting her lip, she inspects the alien foodstuffs: porridge on a little burner; thick Salisbury honey and Dorset butter; marmalade in a bowl. If, she thinks, anyone mentions the loo last night, anything, sounds, or . . . odours, I will have to bolt. Or die. 'Shut the door, can't you,' says the politician. 'Were you born in a barn?' Marina sits with salty porridge and milky tea, resisting the tears which are forcing themselves down her nostrils. She looks out of the window and imagines being shown around the garden in summer, the bee-loud glades thick with honeysuckle and what her grandmother calls _fuk-_ sio, tall spinach waving in the breeze, all planted by someone with whom she has a bond. Does Mrs Viney's beauty conceal a secret sadness? Is she out there now, wandering alone? I'll ask Guy about her on the train, she thinks. Though, please, God, don't let him come downstairs yet. Something else happened last night, after dinner, before the other . . . the toilet incident and the wounding, which she has been trying even harder to forget. But Guy will not have forgotten. It concerned, in part, his manhood. It was quite interesting: an uncomfortable-feeling gristly knobble. Having never seen a real one, except once on a drunk man peeing behind a phone box near Regent's Park, Marina has only imagined penises dimly, almost dutifully. Simon Flowers seemed unlikely to have one, the masters too old, boys her age too young. Besides, no one has properly explained the hydraulics: how something soft enough to need the protection of a cricket box can become hard and presumably beautiful, an object of desire. And surely something that sticks out at right angles can't enter something, well, vertical? She could not imagine what to expect. Yet here one was, separated from her by the thinnest layer of chino. Guy was moving his lips silently. She listened to his breathing, her hand exactly where he put it, on his loins. 'Sit down?' he said in a frightened voice. 'All right.' Was it growing? Isn't that what they do? She must be excited, she told herself, only less than she had expected; more as a scientist might be, in the field. If anything she felt almost motherly towards him, puzzled, as if he was a problem to be solved. She pressed down a millimetre further. In the nick of time she remembered something she heard in the West Street kitchen; apparently if a stiffened member is bent for any reason at all, it will be terribly damaged. Blood vessels burst. Poor boys, to be so vulnerable. Minutely, she lifted her hand. 'Nnnm,' said Guy. They stared at each other, owl eyes in the darkness. Her ignorance crouched behind her on the bed. 'Please,' he said. She put her hand back down. Now, like a coordination exercise, they were kissing too, while she kept her fingertips lightly on his manhood. This was not how she had imagined the beginning of sex, the swoon of joyous reciprocal love in, ideally, an Italian meadow. Guy Viney's tongue was in her mouth, but her mind kept drifting from his trousers and back to the adults downstairs. Why wasn't she enjoying this more? Although there definitely was something delicious about this womanly feeling of control; she was thinking she might even slightly increase the pressure, experimentally, when his hand bumped against hers. Then it bumped again. There was a crackling, sliding sound. He was unzipped. Could she pretend not to have noticed? It is dangerous, apparently, as well as morally wrong, to deny them release. And she was curious, and in danger of being officially frigid, despite spending every single night of her adolescence hot and restless and full of desire. She looked down carefully, past his neck, shirt buttons, belt, to where, in his lap, floated something pale. She had tried to do the correct thing. She really had. He felt silky, like a toy as she began, cautiously, to investigate and, although her fingers were shaking, it was at least experience. Then there was a noise. 'Christ.' She jerked her hand away. He gave a little grunt. There was a strange doughy smell, wetness warm as blood. What had she done? 'Oh,' she said. 'I'm sorry.' He would not look at her. 'Are you OK?' 'God,' he said and cleared his throat. Semen, she thought. Squirmy tadpoles all over her hand; she could get pregnant. 'Tissue?' 'It's fine, I'll go the bathroom. Don't worry,' she said kindly, holding her hand out stiffly like a piece of rotten meat. The big upstairs hallway was dark, the carpet soft, and she did not see his father until they were face to face. 'Oh!' she said, jumping. She hid the hand behind her back. 'Sorry.' 'Bit late to be exploring, isn't it?' His voice was so quiet that she had to lean closer to hear him. Closed doors on either side; she listened hard, but all was still. Which one had he come out of ? Perhaps the Vineys sleep separately. Was he going for a marital visit? 'I didn't mean—' 'Don't apologize. Was something keeping you up?' He smiled at her in the half-light. Could he smell it? 'It's terrific to have you here.' 'Really?' 'Oh yes. In the bosom. My family is everything to me, you know, but I cannot be _limited_. The enthusiasms of young people make life more liveable. You understand.' 'Yes,' she said. When he touched her forearm, she gave a little jump. She looked up at him. A thread seemed to shoot between them. 'You must come again,' he murmured. 'I insist that you do,' and he turned and left her standing there, the thread pulled tight. # _16_ 'The thing is,' Laura says. 'I know it's late. But I have to go out.' Rozsi is visiting invalids; Zsuzsi is in bed with the Combe _Almanac_ , reading out difficult words – 'Vot is this "Dibbers"?' – in a carrying voice through the open door. Only Ildi is in the living room, packing up knitted dolls for the poor children of Romania. ' _Vair-_ y sweet,' she says, waving the hand of a soldier doll. ' _Ha-_ llo.' The Tube will be fastest, to Earls Court on the District Line. If only there was a quicker way. 'Hello,' says Laura politely to the soldier. 'Ildi, is that all right? I'm a bit late . . .' Ildi, pulling down the skirt on a reversible princess homunculus, takes a breath. 'I don't know,' she says. 'They—' 'I know,' says Laura. 'But I won't be long.' London at night. Why is her stomach fluttering? She stands in the roaring glare of the Underground, as if queuing to enter hell, and the pulse in her throat seems audible. Is it the heady fumes of strangers' alcohol, the fact that nobody knows where she is? Or the thought of an accident: fear, pain, blood loss in public, but a solution of sorts? Which would be worse for Marina, in the long term: losing or keeping a mother like Laura? However, when she emerges at Stamford Brook and crosses King Street towards the Great West Road, her daughter is forgotten. Laura is wishing she had put on different clothes. Not that she will see anyone she knows, let alone have a conversation. She is only going to look. I am burying your ghost, she thinks, you . . . you bastard, and that will be the end of you. The boat on which Peter is staying is parked in something called Eyot's Boatyard, on the north bank of one of the confusing loops of the river. You simply open the wooden gate and walk through, along a rickety platform, above a glistening surface of soft grey mud. No one questions or molests her. To her left are huge slimy stakes, a fence for giants. To her right is creaking, splashing, the muddy tide of the Thames. She had imagined gin palaces, technology, not this almost rural calm. _Beau Geste_ , she reads on the side of the first boat, which is much bigger than she had expected, solidly built of grey riveted metal. _Mirabelle_ , _Basinger_ , _Fidelity_ , _Scheherazade_. She does not expect to find _Vivian_. It would be better for all of them if she did not. She should turn around. She could still do it. This is where her future divides: happiness or sorrow. Life or death. Heart pounding like a dying thing, she walks on. The problem with co-education is that you are trapped. Marina has been unsuccessfully avoiding Guy since Sunday, which makes her either frigid or a prick tease. She keeps worrying that Simon Flowers will detect the odour of sin upon her, or even actual spermatozoa – she keeps seeming to smell something similar, on the Buttery stairs or crossing Founder's Court under the trees. Oh, sperm, she can now think to herself airily. This is some comfort. She has drawn a plan of her place setting at dinner and written down every single book she saw at Stoker; it makes her feel like a criminal whenever she bumps into Guy. He keeps trying to entice her to his room. 'I can't,' she always tells him. 'We'll be _expelled_.' Neither of them has referred to what happened in his bedroom at home; the awkwardness has turned into abruptness, as if she has done something wrong. Perhaps she has. Her elbow is still stiff and sore, which is not helping. At least when they're below stage at Divvers, with infants around the corner painting papier mâché and Pa Stenning likely to appear at any moment, there is a limit to what he expects her to do, or have done unto her. But Guy is ingenious. Shutting the prop-room door is forbidden, but he has found a place behind Costumes 4: Heralds/Mummers/Slaves, where they can lean against a packing case and not be seen. He is very pressing. 'Aren't you scared of being caught?' she says when he undoes the top two buttons of her blouse. She has developed a habit of checking them frequently with her fingers; she has a terrible fear of accidentally coming unbuttoned in public and not noticing. Her chest in the cool air feels extremely nude. She keeps her eyes well above his waist. 'We'll be fine,' he says. 'Stenning won't say a word.' As he feels her, she thinks this over. Next time he takes his mouth away, she says, 'Why not?' 'God, you're chatty,' he says. 'No, really, tell me.' 'Friend of my parents,' he says, trying to unpeel her fingers from the edge of the crate. She knows what he wants her to do. 'By, by the way,' she says. 'I need your address.' 'No, you don't.' 'I do,' she says, holding her head away from him. 'It's not in the _Register_ , for some reason.' 'Yeah,' says Guy. 'Stenning did Dad a favour.' Marina nods knowledgeably. 'Because of confidentiality, probably. I have to write your mother a thank-you card.' 'Not too gushy.' 'I wouldn't,' she says. 'But to be polite . . .' 'Come on, babe. Just let me—' 'OK,' she says. 'You can, if you're quick. But then will you give me their address?' It could, she thinks, be the beginning of a correspondence. Here it is. It looks like a home-made bath toy: a square white cabin, a stumpy dark body with a single pale stripe. Other boats have foliage outside in pots, and bright windows and fences; they might be on land, with seagulls for squirrels, were it not for the gangplanks and the smell of the river, sloshing and pulsing out of sight. _Vivian_ has nothing: black wood, dangerous-looking loops of wires. She had expected luxurious bohemianism, not rot, not squalor. It looks more like a prison ship than a houseboat. She is two gangplanks away, by _Second Childhood_. Provided that nobody comes past she can see _Vivian_ quite easily. The portholes are not completely dark; there is a dim glow in one or possibly two, muted by curtains and dirt. Surely nothing so ordinary could contain Peter? After living in her head for thirteen years, how is it possible that he could be here? It is cold but not yet raining. She could stand here for an hour or more, just watching; contemplating how much she hates him. Damn you, she thinks experimentally and imagines how, if she had any strength of character, she would stride up to the deck and knock and shout until he emerged. At that moment there is a sound from the boat, as if it had belched, and a splash, and a light illuminates one of the blind portholes by the door. Someone is coming out; it is him, it must be and, if he sees her here, her last grains of self-respect will crumble completely. He is coming; she can almost hear him at the door. She must get away. Yet she hesitates. What would I do, she thinks: shout at him? Rub his face in that lost horrible time, those wasted years? Ten o'clock. Marina lies in the bath, washing with an extraordinarily expensive Crabtree & Evelyn rose glycerine soap which she bought herself last term and has not yet dared to use. Every one of her possessions is wrong: she can see that now. She will throw out all her toiletries, her London clothes, and start again. It feels like the beginning of a new life. She has drafted several thank-you letters to Mrs Viney, including one – 'Thank you for your kindness, your understanding, your friendship' – which rather moved her, and then has written up the best one on a special Italian note card, adding a reference to Mrs Viney's graciousness, asking for the return of her forgotten blue flannel, hinting, lightly yet heavily, about a return visit. She has also said, which isn't strictly a lie, that during her stay she possibly had a temperature, which would explain any strange-seeming behaviour. 'My real character, you might say, is much more refined!!' But as soon as the envelope went into the porter's bag, she realized that something about the tone was wrong. Should she have enclosed money for Evelyn, or somehow paid for her meals? Why did she say, 'If ever there is anything I can do for you, please do be get be in touch'? Then Guy told her that his parents hate thank-you cards. 'And Christmas cards. And when people write actual comments in the visitors' book. It's just so . . . you know. Naff.' 'God, I know. Exactly,' Marina lied, wishing she could commit fell . . . fel . . . or no, what's that other thing? _Felo de se_. If she writes again to apologize for having written, is that correct, or will it make things worse? Somebody shouts in the corridor outside the bathroom and she jumps horizontally, creating waves. In her first week the girls had to be measured and checked for rubella vaccinations in the San, arms crossed over their bras as they were herded towards the school doctor's office. She was still excited about Combe, and this was fuel: a genuine sanatorium; barley water. Quarantine. She was admitted into the presence of Dr Slater: 'Lie down there,' he said to her, nodding at a camp bed. But it was lower than she expected and somehow she lay down too soon, and dropped a foot through the air to the mattress. That, she thinks, was when she should have left. Any reasonable person would have waited to see if Peter emerged on the deck, but not Laura. Instead, in her fright she bit her lip; licking the wound, tasting blood or poisonous river mud, she stumbled on until she reached the road. I hate you, she thinks, only partly to him. She should go home. She is going more slowly now, past big houses with gardens stretching down to the water, displaying the warm coppery rooms of families and couples, or of people as lonely as her. She walks back along the pavement, hopelessly bedraggled: the woman who missed her chance. The damp cold air stings her ringing lip, which, however, seems to lack the energy to bleed. What do I do? she asks the paving stones. What do I dowhat doIdo – but, realistically, who will answer? If only she believed in God, or there was a helpline: somebody who could decide, quite objectively, whether pining like this for one's child is proof of bad or good mothering; whether it would be better for someone in her position to stay, or dispose of herself; and, if the latter, how to do it so that her absence will be barely noticed. She could live in a cave, a wild-haired keeper of chickens, but it would embarrass Marina. An accident would be simpler. Don't forget you're a coward, she reminds herself; it would have to involve no pain. So, considering the comparative advantages of Tube crashes, gas explosions, IRA bombs and falling anvils, she turns a corner and there is the river, just for her. She seems to have run out of breath. It is so cold. She has taken a wrong turning somewhere and ended up here, on a concrete bank with only spindly railings to keep her from the water. The railings themselves are just a foot's width or so apart, connected along the top by a horizontal bar at the perfect height for unsatisfactory people, such as a short man or a too-tall embarrassingly weeping woman, to wedge their elbows uncomfortably upon it if they wished or, indeed, their foot. No one is around. She looks down at her ugly black court shoe from Debenhams, the toe scuffed because she is an inelegant walker, the heel beginning to loosen. It would fit. No. She closes her eyes and lifts her face towards the grey scent and sound of water. People do do this, she tells herself, all the time. Virginia Woolf and . . . no, think of women with children. There was one the other day, a mother, in Zsuzsi's paper: 'So selfish, those poor babies,' she had said, and Laura had agreed. It is almost half-term and, if she does it now, Marina might think it was because Laura didn't want to spend the holiday with her daughter, which is quite wrong. But wouldn't this way be kinder, more open to interpretation, than some of the alternatives? No one passes, as perhaps she hopes they might. She wipes her nose on her sleeve; it does not matter, she reminds herself, resting her cheek for comfort on a railing tip, if her tears are obvious when she goes back to the flat because she won't be going. She almost believes it, even as she loathes her own self-pity. She could pull herself up and jump down to the bank; she is strong. But someone might see. Even now, the thought of a stranger smirking at her awkward climbing, the skirt tangled around her ugly tights or pulled across her bottom, is shameful. Yet there is no one here. Now she could do it. Now. Now. # _17_ _Tuesday, 31 January_ Swimming: Dorset and Devon Schools' Championship Gala, Senior Boys, Junior Girls, Yeovil College, 1 p.m. and 5 p.m.; Lowers (geog.) trip to Galapagos Islands begins; Shaftesbury Historical Association and Percy Society talk by Dr Bill Reed (Southampton Further Education College): 'Desolation, Persecution, Rebirth: Christianity During the Late Middle Ages', Old Library, 7 p.m. Why is it so difficult to think about anything else? When net-ball practice ends, Marina dashes to the library to look for Alexander Viney's books. They have almost all of them: not, as she might have assumed, dry as death, but full of human stories, sympathetic to his characters, their desperation, their angry pride. Better still, she is allowed to look through the archive, the shelves labelled Alumni and Friends of Combe, where in a yellowed Sunday supplement she finds an interview: The Old Rectory, Stoker, as seen from the lawn; Guy and Lucy in fat blond infancy; their beautiful mother. There are notices on the library walls: SPEECH IS SILVERN BUT SILENCE IS GOLDEN. EATING WILL RESULT IN EXPULSION. VHS VIDEO TAPES ON REQUEST. Ten minutes later, after a lecture from Mrs Iredale, the notoriously sex-hungry deputy librarian, she is sitting in a windowless storage room, listening to Alexander Viney's voice. It warms his listeners: clever, seductive, certain. She has turned off the light. He is only a metre away. 'The man of letters must ignore what others require of him,' he says, 'a political agenda, say, or faith. God forbid.' He is younger here; his hair is darker. It looks as if they have filmed this on the terrace at Stoker. Are they happy, he and Mrs Viney? Marina creeps closer to the television. Was she sitting near him, just off camera? Or wandering in the herb garden alone, thinking sad thoughts of— 'No,' said Alexander Viney, unexpectedly loudly. 'For history to reach us, it must concern its protagonists' private lives. It must speak of their hopes, their secrets: it must speak of their dark hearts.' He seems to be addressing her. Does he mean that everyone, not just Marina, has desires which cannot be talked about? Laura, disappointingly, is still alive. It takes courage to throw oneself into a river, to be fished out by the Thames police and written about in the _Notting Hill Gazette_ so, because she is cowardly, she stared at the water a little longer, went home, woke up the next morning and left for work. Which is why, four days later, apparently unchanged except for a slight escalation of self-loathing, she is sitting at her desk at the surgery, about to make everything worse. It would be very easy to reach Peter, now that he has decided she may. As his letter thoughtfully explained, if Laura wanted to she could leave a message on the answer phone of Suze, who is 'a' girlfriend of Jensen, who owns that grim boat, _Vivian_. The letter, still stubbornly unburnt, is stuffed at the back of the sideboard, hidden in a copy of _The L-Shaped Room_. Admittedly Laura, although increasingly unable to retain the smallest work-related fact, has remembered Suze's number perfectly, but she doesn't have to act on it. She doesn't have to ring. In which case, why is she sitting here, phone in hand, about to dial? Because she is stupid. You stupid fool: even if his half-baked system worked, he'd hardly be able to ring you back, either here or at home, scene of so many lives he has ruined. So she writes. Just a plain office slip, asking him to meet her so that she can say what she needs to, and establish some facts. Then it will be over. She puts it in the surgery postbag, takes it out, runs round the corner to the Post Office under the unlikely pretext of needing an aerogramme, and only when she has returned to her desk does she realize that she is about to ruin her life, again. She can't see Peter. What was she thinking? Was there something in her harmless helpful solitary childhood, or her mother's painful sinking into death, which so weakened her that she attracts disaster? It cannot be sane to live like this, lurching between catastrophes, moving ever further from the world of normal people who live the life they choose. The rest of the day is a daze of regret. The evening is no better. Mrs Dobos has honoured them by coming 'for a little coffee', in order to discuss the possibility that Combe might be good enough for her own granddaughter, spoilt Natalya. Laura keeps forgetting to smile sufficiently. She is concentrating on hiding the fact that, only a millimetre or two below the surface of the woman they think they see, she has been whittled out entirely, and replaced with something black and hidden. Or is she deluding herself? Is it truly hidden? Sometimes one of the aunts will look at her even more piercingly than usual and she thinks: they must suspect. Could Zsuzsi have followed her to the boatyard, ducking behind lamp posts in a fog of Je Reviens and rain-sparkled fur? Has Marina detected something? Is that why she was so strange on the phone? She passes Mrs Dobos the crystal sugar. You, she tells herself, are an abomination. You are thinking of Peter and his first letter, hidden not a yard from where Mrs Dobos is sitting on the sofa, while you wait for his next. A great furrow of longing has opened in Marina's chest for no particular reason. It starts off with her mother, which is ridiculous because her mother seems to have forgotten about her entirely. She has not had a postcard from her for four days. It grows deeper, a split, a crevasse, until she feels broken in half with loneliness and hunger. It is a dismally grey afternoon. She trails out of chemistry, which has not gone well, and walks sadly towards Garthgate. Someone familiar is climbing out of a car on the chained-off tarmac outside Percy, and her blood gives a little leap. A strange cold feeling, like escaping unset jelly, spreads over her arm and chest. 'Um, hi. Hello, hi.' She is wearing her glasses, a blouse with covered buttons from Rozsi's wardrobe, scuffed shoes, and a friendship bracelet Urs gave her in Form Four. She can feel a blush spreading across her neck like an infection. 'I . . . was looking for something,' she tells Mrs Viney. 'Someone. Hello!' 'Marvellous,' says Mrs Viney vaguely. 'Yes! Ha ha ha,' Marina says. 'Are you . . . will you . . . so, you're going back? To your, you know, residence?' 'Well—' 'Oh, by the way . . .' Should she mention the thank-you card débâcle? She looks at Mrs Viney helplessly, and receives a little smile in return. 'OK, Ma,' says Guy. 'Stagger off now. Come on, Marina, let's see if there's anything to eat.' 'Might see you tonight, darlings,' says Mrs Viney airily, 'on the way to Jasper.' 'She means Stenning,' Guy says. 'They're having, I don't know, medieval fondues with him or something later.' Later means when? After dinner she and Guy will go to Evensong to give thanks. Chapel looks beautiful at night; they light the lamps, and the babies from the Choir School sing anthems of salvation, masses and motets and 'Let All Mortal Flesh'. Pa Stenning, Mrs Viney's friend. _Dominus, salva me._ 'Don't forget to leave my jockstrap,' Guy instructs his mother and nods at Marina. 'Come on. Getting malnutrition.' In childhood, Marina read comics. She always looks out for five-pound notes on the pavement; kicks aside dropped banana skins to protect old ladies; passes building sites expecting falling cans of paint. Lamp posts, however, have escaped her. She has forgotten to be alert. And so, following Guy while trying to look meaningfully at Mrs Viney – a distress flare, only for her – she turns her head and walks slap into ten foot of antique-effect metal-work. 'Ha!' bellows Guy. 'Brilliant!' The pain is astonishing. She must have broken her nose. She will be covered in gore. Jesus. Jesus. She touches her face, licks her upper lip; is this blood she can taste, or snot, or tears? 'Darling, are you all right?' More dreadful than blood is death by embarrassment; worse even than this colossal pain. 'Er—' 'You can't be.' She blows out through pursed lips like an athlete. Then she adds, 'Phew.' The agony is unabated. She needs to hide like a wounded animal, feel her skull and howl. 'Ab, absolutely.' 'Idiot!' says Guy joyfully. 'Do it again!' 'Shut up, Guy. Are you sure? It looked awfully painful.' 'Fine. Golly. Yes. Really. I'm fine.' Mrs Viney looks quizzical. Is she worried? Is she _amused_? 'Didn't hurt at all!' says Marina desperately. Now, unmistakably, Mrs Viney smiles. Marina takes a deep miserable breath. 'But I'd better . . .' 'Yeah,' says Guy. 'Come on. She's fine.' And he takes Marina off to the Buttery for cream of broccoli soup, mince Mexicana, potato croquettes and syrup pudding, and Mrs Viney does not attempt to stop her. Where did it all go wrong for Laura? Was it her doing? Was she weak? Doomed by her parents' mild genes: too apologetic to escape the lower middle classes, let alone to get ahead? Or just distracted by her half-cocked consumerist hopes? Because wrong it has gone, quite clearly. Surely there is time to stop it? If she is very strong and sensible, can't her life still change? Every time the phone rings, she thinks: it's him. 'It's me,' says Alistair Sudgeon in a hoarse whisper. 'I know the rule was no contact, domestically speaking. But I have news.' Laura backs into the entrance hallway, away from where Rozsi and Zsuzsi and their dear friend Perlmutter Sári, just returned from a very satisfying funeral, are whispering on the sofa like members of the Resistance. There is definitely an atmosphere. When Laura arrived home from work, cold and sad, Sári kissed her, patted her dismissively on the left haunch and said, ' _Tair-_ ible,' lightly. They are keeping their voices low, as if Laura could have recently learned Hungarian and failed to mention it. Every second or so they shake their heads. 'I,' Laura says into the telephone, leaning against the coat cupboard, 'I thought you were someone else.' 'Who? Let's not be foolish; I'm me. Do you think Farkas Rozsi recognized my voice?' He likes saying names backwards in the Hungarian way, sometimes with accents. 'This . . . it's not a good moment.' Her palms are sticky. She has been waiting all day for word from Peter, and time has concentrated; every minute making the next more likely, like Russian roulette. 'I can't really talk.' 'Well, we have to. Might I pop round?' Sári's perfect amber hair is only three feet away. ' _Byoo-_ tifool,' she hears her say. ' _Igen. Nagyon szép ház. Vim-_ bledonpark.' ' _Yoy_ ,' says Zsuzsi. 'No!' says Laura. 'Christ. I . . . don't think that would be wise.' 'I thought maybe they'd be out.' 'They never are.' Is it her imagination, or have the murmurings from the sofa died away? 'I'm sure you know that, "Jenny".' 'What? Oh, I see, they're listening. Anyway, look, everything's become rather difficult. Mitzi's being tricky. I think she may have rumbled us.' Her mouth has filled with powder. 'Hang on,' she says slowly. 'What do you—' Alistair says, 'I think I may have to spill the beans.' 'What? No. No, no, no. You can't. Don't, please, honestly, not for me, or, I mean—' 'Actually, it would be a relief, asking for her forgiveness. All this creeping around and secrecy isn't what it was.' Even now, with a future being handed to her, she is craning to see if there is anything from Peter on the sideboard. 'Isn't it?' 'Of course not. It's probably for the best, anyway. She's a very powerful woman, you know, my wife. Time to make a clean swee—' 'No! God, no, Julie, _Jenny_ , it's, no, definitely not. Definitely not a good time. For that. Think of your . . . little children. Seriously, you mustn't. You need to think—' ' _Kivel beszél?_ ' mutters Zsuzsi. ' _Dar_ -link,' Sári says reproachfully in English, 'you said she has no friends.' Marina is leaning against the War Memorial, watched over by the fallen servants of Combe Abbey, as she waits to spot Mrs Viney through the gap in Pa Stenning's curtains. Her urge to touch walls and windows is stronger than ever; she knows that whatever happens next, whether the first person she sees emits lucky or unlucky vibrations, will determine whether or not she sees Mrs Viney, but the people walking through the Percy entrance aren't particularly helpful: Liza Church; a Fresher whose name she doesn't know. She has just witnessed Pa Jenkin, the Head of the CCF, who is putting the troops through their paces, shouting at Una 'Fats' Squire to take the long route round to the Science Block for no good reason. The entire CCF, hundreds of boys, all laughed and jeered too. I should do something, Marina thinks, be friendly to her, but she knows she doesn't dare. Something, call it instinct, makes her glance at Percy's front door. A man in a suit is coming down the steps towards her. He clears his throat loudly, frowns, looks around. There is, she has discovered, a painting of Mr and Mrs Viney in the Tate, from when they were young. He has just become famous; his hair is longer, as in photographs of Marina's own father. In this painting Mr Viney sits on the green green grass and Nancy Viney lies beside him, framed by a house-height hedge painted in minute detail. Marina has gazed at that painting until she is lying with them, the grass under their hands. Turn. Please. See me. And he does. 'You're that girl,' says Alexander Viney. 'Remind me . . . Oh yes, you.' The shoutings and belches and slamming doors are quieter now; the courtyard dark and still. Marina has been out here for longer than she had realized and, unless she hurries, she will be late for curfew, for the first time in her life. 'I was just passing,' she says. 'I mean—' 'Goodnight then,' he says, feeling in his pockets. 'Where's my buggering key?' Out here, unfiltered, you hear the depth of his voice, its intimacy. It makes her want to close her eyes. 'I don't know,' she says. The air between them sparkles with alcohol. He may be drunk. Now, Marina, go inside. Instead she asks, 'Have you been having dinner?' 'Yes.' 'So . . . why . . .' 'It's a complicated and dull story, involving my sentimental wife and a friend of her youth. I shan't trouble you.' 'Are you joking?' 'Why would I joke?' he says as he heads in the direction of the Old Laboratories. 'I have to get something from the car.' She is losing him. In her confusion, she says the first thing that comes into her mind. 'It's very exciting to meet you again.' What is wrong with her? Why is she such a freak of nature that she cannot play it cool? In her voice she can hear the great-aunts and Rozsi when they hover around horrible Mrs Dobos, their nervous flattery of doctors, the great excitement in the shop when a politician's wife once bought popsocks. But Alexander Viney does not seem to mind. He lowers his head and his stare is like a lighthouse beam brushing her face. 'Is it, indeed?' he says. 'Excellent. Tell me more.' 'I used to watch you on television. We all did. You were fantastic,' she adds politely, although in truth she barely remembers. 'Do you think so?' he says. 'I am delighted to hear that. Because my peers, I don't know if you're aware of them, the one with the bow tie and the bald one, ugh—' She summons up Guy's way of speaking, his confident disdain. 'Oh,' she says. 'Them. They're just idiots.' They are standing quite close together now. She can feel him: large, hot, like a temporarily tame bear. He folds his arms across his big chest. It is surprising, given how short and distinguishedly grey his head-hair is, to see dark wires at the open neck of his shirt: the infinite hairiness of men. In the presence of greatness it is easy to forget curfews and matrons. She crosses her arms to conceal the points of her Bellissima Sally-Anne bra in whisper blue, whose Parisienne lace is showing through her school blouse, and tries to look intelligent and brave. 'You're cold,' he says, 'in that ridiculous milk-maidy garment. Here.' And he takes off his jacket and gives it to her. It is warm; it smells of male hormones. She drapes it gratefully over her shoulders. 'But let me ask,' he says. 'When you say _all_ of you—' 'Oh, I see – I mean, all of us at my old school watched you. Here they're Philistines. They like game shows.' 'You're not a Philistine, though, I trust.' Something seems to ping in her chest. 'Civilizing influence on my oaf of a son, are you? I'll tell you what,' he says, touches her back with his hand. 'Come and help me with the car.' Photographs do not make enough of his profile; he looks like something in the National Gallery made of marble. The lines around his very blue eyes suggest kindness, experience. Under the cover of darkness, she slips one arm into his jacket, its lining silky against her bare forearm like the inside of his skin and, very slowly, begins to pull the other sleeve closer around her back. His car is big and silver. 'When's your next, you know, show?' she asks politely, as he unlocks the boot. In its mysterious depths are tentacles, tools, a bottle of blue liquid. Rope. 'We air the new series in January.' 'What do—' She stops suddenly. A group of Uppers are coming towards them. They have music cases; one of them, a fantastically square day-girl called Tansy Edwards, is singing scales. Next to her is Simon Flowers. Marina decides to laugh, merrily, as if she is having a wonderful time without him. 'What are you giggling about?' She watches them walking up Garthgate; how could Simon Flowers not have noticed her, when she spotted him almost before he turned the corner? He is quite close now. She tries to smile at him as he passes, to encompass his thin shoulders and smudged glasses with interest and love. 'Well,' she says loudly, to draw his attention to her escort, 'some of us here will be watching it, I promise. Those of us who are a bit more civilized.' Mr Viney looks over his shoulder at her. 'Fuck that.' She smiles, to conceal her shock. 'But it's one of the finest schools in—' 'Rubbish,' he says. 'This place? If it wasn't so close, which my wife wanted – well, and if Guy wasn't a dunderhead – we wouldn't have bothered. There are many better schools.' 'Oh,' she says. 'So you think—' 'That lot,' he says, jerking his head towards the musicians' backs. Simon Flowers has not turned round; he has ignored her. Hope leaks from her like sand. 'Not much alternative to the beefy ones, is there? Just a few limp physics day boys to keep the grades up, and tedious well-behaved happy clappies. I have often noticed,' he says, 'that Jesus is bad for the skin.' Then he bends into the car again, unaware of the mortal blow he has dealt her. Mr Viney is right; Simon Flowers is not only a day boy but he also has spots – just a few, around his mouth, which she has been trying to find beautiful. They are not. Mr Viney is lifting out a wooden wine box. 'Plants,' he says. 'Stenning's keen on flowers. My wife supplies him. Or rather my gardener does. Hellebores and dahlias and God knows. Peonies. You're not interested in crap like that, are you?' 'No way,' she says. 'I hate gardening,' and then, because she can remember every word she has ever said to him or his wife, has analysed and prodded and spat upon it and examined it again, she blushes ferociously. 'Really,' he says coolly. 'Then we shall get on. Now tell me,' he says, locking the boot and turning to face her. He looks as though he can read her mind. 'What are you interested in? History? Historians? Like Stenning?' He grins. 'Or my kind?' She gives a silly nervous laugh – ahaHA! 'In fact,' she says, accidentally glancing at his trousers, 'I don't, well, do history. Sorry. I just . . . don't.' 'Why on earth not?' 'I loved it. I really did. But . . . I had to drop it for A level.' 'So?' 'To do the sciences. Well, biol and chem. But I kept English. I love,' she confides, 'the Arts.' 'Science, though. Oh dear,' he says. 'Well, if chemistry is the sort of thing you like . . .' 'It's not. I mean, I had to do it. I'm meant to be reading medicine at Cambridge.' For the first time, these words do not thrill her. 'It's more . . .' 'Don't tell me. _Useful_.' 'I . . . I suppose for careers,' she says. 'Careers? What are you, forty? Surgery, I trust, at least?' Marina winces. That is what everyone expects, what at Ealing Girls' she had always imagined. Lately she has realized how little her family understands of what she's up against. Marina Farkas, trying to hold her own among all those brilliant confident arrogant men? It's impossible. 'I . . . I'm not sure,' she says. 'But what about enriching the mind? You'll know about some crappy little atom but will you be civilized, eh? Is that how you want to live?' 'I know,' says Marina, inconveniently close to tears. 'I want to be civilized, of course I do. God, I think about it all the time, you know, books, and things. But—' 'And don't tell me it's doing good. You look like a girl who'd rather sit in a garret writing great works, not changing pensioners' nappies on an NHS gastro ward.' She swallows. All her fantasies had involved her in a lab coat, frowning but beautiful: no secretions of any kind. 'I could do research.' 'Trust me, sweetheart. I have teams of slaves, fact-checking, photocopying: it's like the salt mines. Graduate students, mostly. Research is grim as buggery. Grimmer.' 'I thought—' 'You'd be better off dropping the lot and doing something interesting. You'll be fine, if you're reasonably clever.' Maybe he is right. Vistas stretch out before her in which she is an aesthete, living a cultured life of Latin and sonnets and plovers: a gentleman. 'I think I _am_ clever,' she says, and feels blood beating up from her heart. 'I dare say.' He could be her mentor, her patron. People have them, the ones picked for greatness; she has read so many books about Helen Keller and Jeanne d'Arc, _Girls and Boys of History_ , _Lives of the Artists_ , that it seems inconceivable that she will not be chosen. But what will she be famous _for_? Time is running out. If it doesn't happen very soon, it never will. It is too late; he is turning away from her. She says it without thinking: 'I need you to help me.' He starts laughing. 'Forgive me. I'm not usually asked quite so directly. Certainly not by a child like you. Help how?' 'I . . . I don't know.' 'Look, I've got to get back. They'll think I've died or something. I know,' he says, giving her upper arm a little squeeze, 'we're bloody back here on Sunday, one of Nancy's tedious godchildren needs to be taken out.' Marina rolls her eyes humorously. 'Why don't you come along to that and I'll see if there's a moment to talk.' 'Oh, could I? Really? I'd love to. Just instruct me,' she says. 'Whatever you think I should do.' # _18_ _Sunday, 5 February_ Matins (Chapel Choir) or Pastoral Address, Divinity Hall, Dr Malling: 'Appreciating Nature's Bounty; lacrosse v Our Lady's Convent: U17, U18 1st and 2nd Xs (A), 1.15 p.m.; netball v the OCs: 1st and 2nd VIIs, Greer's; OC Society Banquet, Summoner's Court, 7.30 p.m. There has been an unpleasant scene. Apparently earlier today, just before Marina made her Sunday morning phone call, she received a visit at West Street. It was Mrs Dobos, unannounced, with her repulsive grandchild Natalya, intending to spend the morning with Marina and then to take her out for lunch. Marina said no. There must have been some misunderstanding. Rozsi's ear for English is good, despite her accent, but every now and then . . . No. No mistake. Laura is brought to the phone; Marina really has refused Mrs Dobos. It is grandmatricide. 'I mean, how could I?' says Marina. 'I can't, um, not do my homework. I mean, straight, after the Address. That's when we do it. I'd get into trouble.' 'Oh, sweetheart, I'm sure Mr Daventry would understand.' 'He wouldn't.' She sounds tearful. 'And, anyway, I hate Natalya. You do too. That Christmas violin concert of peasant music, last year you said you'd never ever—' 'But you can't not go out for lunch with them, sweetheart. You, really, you should. Can you, I don't know, track her down?' 'I can't.' 'Why not?' 'I have, well, a lunch, um, plan. Already.' 'They won't care if you skip the Bakery—' 'Buttery.' 'Whatever it is. It's all, well, it makes no difference.' 'No,' says Marina. 'Anyway, it's not there.' 'Where then?' 'It's, um, a lunch for, for, biology.' Laura hesitates. Her mouth tastes of coins. Marina is a hopeless liar – unlike, Laura thinks, her father. Unlike me. 'I see,' she says eventually, pretending not to notice Zsuzsi's disgusted frown. 'You have to go. I see. And you explained, politely? I . . . of course. Well, there it is.' Zsuzsi sniffs. ' _Rid_ -iculos,' she says and turns back to her newspaper. Rozsi crashes about in the kitchen; she will be frantic. Only Ildi will catch Laura's eye; in fact, as the morning grinds slowly on, Laura begins to wonder if her aunt-in-law is trying to communicate something, with nowhere private to say it. She, too, has something increasingly pressing to tell the relatives. The note she received yesterday, which she claimed was from a wholly imaginary school friend, was in fact from Peter. She is meeting him near, of all places, the Elephant and Castle, this very night. During Dr Malling's address on the dangers of personal stereos, Marina tries to locate Guy. She is feeling on edge. She overheard a story yesterday about an Upper girl who last summer, Trinity term, was having actual sex with her boyfriend – she was wearing a long skirt, sitting somehow on top of him – when the Randolph housemaster came in and started chatting to them both, with her still sitting there, her skirt spread out. Is this technically possible? Afterwards she could not stop thinking about it and, later, she had a sexual dream of impressive vividness; the content and participants are blurry now, but a certain stickiness remains. Guilt, too: Guy wasn't in it. She turns again in her chair, but a pillar is blocking most of her view of the Fivers: no sign of his unwashed sub-blond curls, his cheery expression. What if he forgets to pass on a message from his mother, with details about the lunch today? Would Pa Stenning help? She runs as quickly as she can back to West Street, looking for an embossed card saying where to meet. There is nothing for her on the hall table. Hannah North, the only Upper she likes, grins and lifts her eyebrows. Marina has no time to talk. 'Looking for something?' asks Isla Clewin pretend-sympathetically, picking chocolate off her kitten-paw slippers. Her damp hair is being plaited by Gemma Alcock, whose own is in a purpose-made towel turban. The television room smells of soapy green apples. 'Letter from home?' 'No,' says Marina. It must be on her desk. However, her bedroom contains only limply creeping Heidi, squeezing something called Primula from a tube onto her finger and licking it off. 'Has someone been up?' she asks. 'When?' Heidi loves other people's problems. 'What sort of person?' 'Never mind, just tell me. Quickly.' 'Are you late? What for? Where are you going?' They face each other over her desk chair. Marina unclenches her fists. 'Just tell me.' 'If you say,' says Heidi, 'who you were expecting, I can say if they've been.' 'Forget it.' She storms back downstairs. Hannah North and Isla Clewin stop talking. 'Oh poor Marina, I hope everything's OK,' says Hannah sweetly. Might the Vineys have changed their minds? I'm still not bloody having lunch with Mrs Dobos, she tells herself, making today's fifth piece of white toast and changing into her velvet jacket again, just in case. She will have to race up to Guy's room to leave him a note. Earlier, on the phone from home, Rozsi told her, 'Cambridge would not want a naughty girl,' but she can't possibly have guessed. Can she? Marina loves Rozsi. She does not want to upset her. May I be smited, smitten, smited, she thinks, if I ever do. 'But _dar_ -link,' says Rozsi in puzzlement, ' _vot_ are you doing for dinner?' Laura has told her that she is going to see the wholly imaginary school friend, come from nowhere to meet her in central London. 'I'll eat with h— her, probably,' she says, like a murderer setting up alibis. Eight hours to go – 'I'll be there from six,' Peter's note said, but he can wait. She looks at the sisters as they drink their coffee, as they settle down with the papers: their downy faces, their trembling hands. ' _Dar_ -link, you vant a _vorl-_ nutvirl?' asks Ildi. 'From daughter of Lotte, she is coming yesterday from _Om_ -erica, Kveens or Harlem, somevere, her husband is doctor, she is coming straight to see us from hospital. Poor Lotte, she knows no one now.' Laura's hand hovers over the box. How can she tell what she wants? Would it be better to have one? She is unable to make even the smallest decision. She looks out of the window at the passing feet on Pembridge Road and screams help me, help me, incredibly loudly, in her head. Marina heads for the Chapel. This is permitted, for those seeking succour. Does God really tolerate people who, despite ardent efforts, have not yet managed to believe in Him? It seems doubtful, like taking too many samples at a cheese counter, but perhaps He can tell that she is trying. The Chapel smells of history, or decay, and is dimly lit; the chaplain considers candlelight more suitable for prayer-fulness. Yet, even here, God has so far declined to reveal His presence to Marina; unlike Heidi, who claims that Jesus came to her in the night. And where is the succour? Shouldn't His servants, curates and things, at least make an effort? Approach her in the pews and offer guidance? She cries quietly but enough to be noticed, yet none of them, not even the chaplain, seems to see. There isn't a single lost tourist to befriend. She smiles kindly at an old woman, imagining a rewarding May-to-September friendship, but too late realizes that the woman's lips are moving not in prayer but in angry mutterings, and she backs away. By the time she has returned to find a scrappy note with instructions in Guy's handwriting, rather backward, she is already late. She reaches the Oak, Combe's smartest restaurant, at twenty past one. She sits down a little too far from the table, so that a waiter has to shuffle her chair in, like a hospital porter wheeling a big fat patient to a bed. There are medallions of venison and a pudding trolley; Mrs Viney is sitting at the opposite end of the table, talking sweetly to a family of darkly tanned blond boys who are all Combe pupils, past and present. Guy's father is in the middle of a complicated conversation about an American trip with Lucy Viney, who again has managed to ensure that she's next to him. Now they are eating their main courses, in her case roast lamb with an embarrassing amount of fat. Guy is telling one of the tanned sons about snowboarding when Mrs Viney calls across to them: 'Poor old Digby broke his – what was it, ulna? – skiing. What _is_ an ulna – Guy? Marina, darling, do you know?' 'She is going to be a doctor,' says Mr Viney. The conversation stops. 'So, if she doesn't, God help us.' 'How sweet,' says Mrs Viney, looking at her. 'Dear God,' says Lucy Viney. 'Really?' 'Where is it, then?' says Guy. 'Leg?' 'Arm,' Marina mumbles. Oddly, this improves things. Mrs Viney, who is only two people away, starts graciously drawing her into the conversation with the Blythes and asking her questions: her siblings, her UCCA plans. Her people. 'My grandmother,' Marina says, 'is a businessman.' ' _Is_ she? Marvellous. What sort?' 'Er . . . lingerie. You know, underwear.' 'I do know,' agrees Mrs Viney. 'There's nothing so marvellous as really good silk underthings. Any particular kind, I wonder?' 'I . . . I don't think so,' Marina says. 'I mean, there is a bit of silk and . . . satin, but it's . . . you know, very good makes, Bella Figura and Castell, like you can buy in Self-ridges and I think Fenwick's, but, well, mostly it's made of nylon and . . . cotton.' 'Of course,' murmurs Mrs Viney comfortingly. 'Cotton's the only kind anyone wears nowadays,' and Marina nods energetically. 'And of course you must carry, or stock, or whatever you call it, Aston. For their belts and gloves, at least.' 'Sorry?' 'Don't you know it? Golly, I am surprised.' Dimly, Marina recognizes the name: a grand old English firm which makes very smart hosiery and nightwear and also woollen Argyle-patterned socks, occasionally shown off by girls in West Street. 'It's Al's parents' firm, didn't you know? Oh yes, we're all shopkeepers here. Are—' 'I'm sure,' Alexander Viney says firmly, 'that the children don't need to hear about all this.' He is smiling at them all, but Mrs Viney stops explaining. 'Bread, darling?' she says and he takes a big piece and turns away. Embarrassment grows, like a forest fire; my God, thinks Marina, are they getting divorced? For some reason, possibly loyalty, she can't quite look at him; she gazes instead at the dark panelling of the Oak, its engraved glass, its— Mrs Dobos. Mrs Dobos is sitting by the big palm tree in the middle of the room. Although she is at an angle to Marina, her granddaughter, Natalya, is not. Marina's mouth goes dry. Mrs Dobos is eating; could she possibly have spotted Marina without turning right round? Maybe not. However, although they are far away, across three tables and a portable wine stand, there is something about the set of Natalya's evil face which suggests that she has seen her. It is impossible to move. She thinks: I might faint. Another girl, less sturdy, certainly would, but instead she sits here, solid, graceless, blushing like a pig. 'I . . . excuse me,' she says. She sits in the toilet stall, not daring to urinate in case Mrs Viney comes by to ask her softly, urgently, if she is all right. But Mrs Viney does not appear. When eventually Marina emerges, it is Mr Viney who stands in the corridor, waiting. 'Hello,' he says. Only an idiot would start crying at this, but it is as if a wave has roared up her body and into her head; she can't help it. He steers her past the telephone booth to the far end of the corridor, where it is darker and more quiet. 'What is it, silly girl?' he asks, but kindly, paternally, and her tears come faster and freer like rain, until her earlobes, even her cuffs, are soaked. He passes her a handkerchief. 'Keep it,' he says. 'Now, are you going to tell me what's wrong?' His hands are on her shoulders. 'Look at me,' he says but, red and wet like this, how could she explain? She can just see the flat wide fingernail, the muscle at the base of his thumb, the hair on the lower section of each finger and the back of his hand. The hand moves up to lift her chin. 'I know,' he says. She looks into his eyes: such a surprising blue, such dark lower lashes. The pores and bristles of his skin are like a secret between them. 'Enough crying,' he says. His fingers are cool, near her lips. 'I know, it's difficult. It is.' 'What is?' 'Teenage life. Life, generally. Isn't it? Not at all as it's cracked up to be.' 'Exactly! And I don't know . . . oh, all of it. Were you like that when you were a boy?' 'No.' 'No one understands . . . don't laugh.' 'I'm not. Truly. I think you're very . . . affecting.' 'I know that everyone says calm down, don't care about things like, oh, Cambridge, and love, and stuff, but I can't not. I want everything too much.' 'I do know,' he says. 'Not many would, but I do.' 'Yes,' she says. 'I can see that.' Why does she say this? It is Mrs Viney who understands, but she wants to be nice. 'I've been giving you some thought,' he says. 'Honestly?' 'And you're obviously bright, for a Combe girl.' 'Do you think? Oh thank you, that's so—' 'Don't interrupt. Which made me wonder why on earth you're doing those drab subjects. Eh? Why?' 'Sorry? Oh, you mean not history.' 'Not-history, precisely. A little life of lab technicians and glands and researching follicles: is that what you want?' 'I, I suppose not.' 'Of course not. Whereas history—' 'I honestly did want to do history,' she says. 'Don't you remember, I said?' 'No.' 'Well, I did, but my family wanted something, you know. Useful. I mean, oh God—' 'I see.' 'Well, and my best friend, Ursula, her whole family, too, think the Arts are a waste of, I mean, not practical. I only just got them to agree to English. And, well, I suppose—' 'What?' 'I, I didn't think I was clever enough.' 'Well, enough is relat—' 'No, I mean it. To do it at university, I thought you had to be brilliant. Definitely at Cambridge, anyway.' 'Now you're being absurd.' 'No, it's true. To get on in science you just have to work hard enough to learn everything, stuff it all into your head, although that's obviously . . . I'm terrified, actually. But history and English are completely different. Only boys try for history from here, and you should see them: they're so confident. That they're clever enough.' 'I thought everyone here's a thicko.' This reveals what he really thinks of her. Her sinuses tighten, ready for more tears. 'You . . . you don't think Guy is, though,' she says. 'You didn't mean it last night, when you said—' 'Oh,' says his father vaguely. 'He isn't the sharpest knife in the block. That's why they have you lot, bright girls to up the A-level results, the league tables. Don't look so staggered. It's true.' But before she can probe this dazzling concept further, discover exactly which end of the thicko/bright continuum she inhabits, he says disappointingly, 'You're quite simply wrong. Nothing to do with brilliance – of course you can do history if you want.' 'How?' 'What are you, a what d'you call it, Lower? Isn't that what Guy—?' 'No, he's a Fiver,' she says, ashamed for them both. 'The, the year below.' 'Well, still plenty of time to change. Easy. Just tell them, and then work like a demon to catch up.' 'Really?' 'Really.' It is strangely difficult to stop looking into his eyes. Her chest feels tender, between warmth and pain. She lifts up her face to tell him so and he kisses her, gently, almost as a father might, then leads her back into the restaurant. # _19_ At twelve minutes to seven, Laura arrives at the Hercules off the New Kent Road. It is, as she expected, a grotty old-man's pub, which is good; he's not even bothering to make an effort, other than to ensure they are miles from anyone who could possibly recognize him. And, knowing Peter, he has probably already left. She is feeling sick: anger, obviously. I won't even talk, she decides. I'll just listen to him writhing and squirming and justifying himself, and then I'll go. At a table near the bar sits a man. He is tall, like Peter, broad, like Peter, but sadder, thinner faced, the paunch disappeared, and with all that dark thick hair replaced by half an inch of faded bristle. They do not touch. He does not smile. The past flows grey and fetid between them. 'Hey,' he says. 'It's you.' 'It is inconceivable,' says Rozsi, at home in Westminster Court, 'that Marina will not have seen sense. That silly school lunch; she'll have abandoned the very idea the moment she put the phone down. All this trying to be independent. Besides, she loves Mrs Dobos and little Natalya. Shall we telephone and ask how it went?' 'Wholly unnecessary,' says Ildi, listening to Jacqueline du Pré with her eyes shut. 'Of course we should ring her,' says Zsuzsi. 'All sorts of excitements must be happening at that wonderful school, and we should be the first to know. She is absurdly old for such things, but there we go. Oh, how I envy her: that first flush of romance, the kisses under the cherry trees . . . do you remember, Rozsi, when I crept out of the ski lodge to meet Kís Istvan by the bridge and his—' 'Enough,' says Rozsi, switching from Hungarian into English. Kisses can grow. They spread over your skin like lichen while, inside, you change too. You can't stop thinking: what did it mean? 'And another thing—' Laura is getting into her stride. Peter has bought her red wine, then water, then a bigger glass of wine, and whenever self-pity threatens to make her cry, which would give him satisfaction, the big baby, the pretend artist, she lifts up her chin and takes a fierce gulp, and the tears recede. She is doing so well. It is not difficult, given the brief scope of their marriage, from the banqueting suite of the Bayswater Royal Excelsior Hotel to its bitter end west of the Westway, to furnish him with details of his husbandly failings. The aftermath is an even richer source: financial indignity, gossip, guilt, uncertainty, primal infant pain. She has rehearsed and polished her hoard of resentments; she has taken them out to show him so many times in her head and, in these scenarios, his response is always either abject grovelling, or continued uselessness, both of which make her feel much better. But the real Peter does neither. It is maddening. He just keeps saying, 'I'm sorry,' which isn't nearly enough. Unlike the one she used to know, he neither drinks so much that he starts shouting and crashing into bar stools, nor sidles off, hands in his pockets, with one of his unsanitary friends. He still dresses like an idiot in huge boots, pretentiously scruffy work clothes: an artisan hero of the Spanish Civil War. But these days they are older, shabbier. His nails are clean. What's more, he is calm. He nods, he grimaces, as if they are friends – ha! – and he is just sympathizing about another man's crimes. He wants more details of Marina's character, his mother's health, than he deserves; it shouldn't be so easy to find out but he almost seems to want to feel as bad as possible. Fine: let him. She piles on evidence of his failings: the day when Marina stopped inventing excursions with him for her primary school weekend diary; his mother's silent maintenance of her photographic shrine. The fact that he used to laugh at his family's idiosyncrasies, and then just abandoned her to them. And what does he have to say for himself? That he wanted to write, or send messages, but was afraid to. It was complicated. He didn't know what to do, and the longer he left it the harder it became. So bravely he did . . . nothing. Yes, she admits when she has recovered from this outrage, they are all reasonably well, in the circumstances. Yes, they manage. No, hardly anything has happened in the last thirteen years, only the premature end of Laura's teaching career; the temporary-permanent move to his mother's flat; the deaths of his fond aunts, poor Kitti in Detroit and Franci in Edmonton; the reign of Mrs Dobos; the transformation of their daughter – 'sorry,' Laura corrects herself, ' _my_ daughter' – into a public schoolgirl. How unsettling, now that his hair is so short, to be able to see his big handsome skull, his vulnerable temples. She wants to wound them. 'There's administration when someone buggers off, you know,' she points out. 'Letters from your bank. Not bills, obviously, because you never did those. But having to tell them over and over again that I had no . . . idea where . . . What? Where are you going?' He is gathering his matches, his pouch of 'baccy', his cigarette papers with, as usual, half a cover. 'Relax,' he says. 'How can you . . . Right, that's it.' 'Drinking-up time,' he says. 'Didn't you notice?' 'But . . .' So many nights preparing speeches; she has only just begun. Can she ask him to meet again for further shouting? 'I haven't . . . I need . . .' 'I wasn't dumping the whole thing on you,' he says. 'I mean, it's not your job to tell the others. I'm going to do it.' 'Well. Ha. You shouldn't have landed me in it then, should you? I've _lied_ to them because of you.' 'OK. But.' 'But what?' 'Writing seemed better than doing nothing. A first step. You can't imagine what it's like to hate yourself for so long, you know?' Idiot. She won't lie for him again. Anyway, shouldn't he first answer the question of what he has been doing, and where, and how often? I have, she thinks, a right to know. Besides, there has not yet been a moment to mention Alistair Sudgeon, which is important. Peter should know that his deserted wife is in demand. 'Let's go,' he says. An old man with perilously fastened trousers chooses this moment to begin shuffling into the Hercules. Laura and Peter have just entered the vestibule and so they have to stand aside to let him, slowly, pass. The area between front door and inner door is tiny, a box of glossy maroon anaglypta; she is trapped just behind Peter, close enough to feel his heat. Why does he never wear a jacket? His creased grey shirt, the back three inches from Laura's eye line, is unbearably irritating: his untied bootlace, his grubby trousers, yet he doesn't look as bad as he deserves. How dare his cells have renewed themselves while she suffered? And Rozsi, and Marina: whatever you say about missing them, she thinks, you chose to leave. Her heart is beating too quickly, right through her body, as if at any moment it will reach the point when it shatters. His hormones or endorphins, that familiar Peter smell, are reactivating poisonous spores, undisturbed for all these years. Oh God, she thinks. Don't let it all start again. Then the cold air hits her face. No. Absolutely sodding not. It's just sweat and dirt; he probably exudes it on purpose. And it is possible that, for the first time in years, she is faintly drunk. They walk side by side past shuttered greasy spoons and flower stalls. He is properly tall, unlike her shrunken in-laws, or neat Alistair Sudgeon. He is still the only man who makes her feel normal, not a giraffe. Something floats between them: the ghost of congress past. Do not turn. He does not deserve to be looked at. She starts to walk more quickly, furiously, to make him hurry, but he hardly lengthens his army-surplus stride, and she remembers being with him in a crowd – was it New Year's Eve? God, 1971 – surrounded by everyone they knew, and he had whispered in her ear something she has never forgotten: that the only thing they all had in common was sex. 'We've all done it,' he said. 'We all know.' And he was right; this embarrassing hilarious knowledge still amazes her: the sticky secrets of the night. Stop it. How many New Years did he spend with you? 'So,' he says. 'They really are all all right?' 'I told you. Why are you off alcohol?' she asks. 'Packed it in.' 'No. Honestly? Just like that?' 'It was screwing me up,' he says mildly. 'I _know._ Christ, Pete, anyone would think . . . I was there. Not just you, either. I—' 'Well, I have now' 'God. I mean good. You do . . . you look different.' 'Yoga, too. Veggie. Worked on a farm in Wales, went pure. I'm a new man.' Liar. If it were true, which it isn't, he would have wept and prostrated himself. He would damn well have begged for forgiveness all night. And, by telling no one that he is alive and in London, she is now a co-conspirator. She must tell them. She looks at the side of his face. She will do it as soon as she's home. 'Tube's just down here,' he says. She follows him down a short cobbled alleyway. At the other end, behind concrete bollards, flow buses and ambulances, a whirl of light. When we reach those, she tells herself, I'll tell him to leave us alone for ever. That is what I will do. 'What?' he says over his shoulder. Without meaning to, she has sat down on one of the bollards. 'I . . .' she says. 'It's just been . . . it's been . . . When the hell _are_ you going to tell them?' Peter bends right down and looks her in the eye. Something seems to dislodge inside her, melt and fall away like an iceberg losing its grip on the land. 'Christ,' he says. 'I know I . . . it's just . . . not easy. Does she talk about me a lot?' 'Your ego! Jesus.' It is almost funny enough to stop her crying. 'Sorry, are we talking about your abandoned child or your mother?' 'Rozsi, I meant. God, I didn't—' 'No, if you must know, she hardly ever mentions you. Because then she'd cry. What did you expect? Think how humiliating it's been for her, on top of everything else. Divorce is bad enough, but . . . but . . .' 'Poor Rozsi,' he says. 'What a fucker I've been. And to you, old girl.' Her last coverings of self-control and dignity disintegrate. Down she sinks into the seas of self-pity, bitter waves of misery whacking her on the head. She is alone. No, she is not. From somewhere outside the shameful swamp, a hand appears. It approaches her face, reaches out a finger to unstick the strands of hair which have stuck attractively to her lip. She closes her eyes. Then she opens them. What the hell is Peter doing? She lifts her head to tell him so, to say leave me alone, and how dare he even presume— He kisses her. # _20_ _Monday, 6 February_ Netball v Southampton College: U18 VIIs (A), 3.15 p.m.; Fivers art history trip begins (Florence); careers talk by Hilary Burtenshaw, OC: 'The Civil Service', 6 p.m. Marina gets up on Monday morning, world-weary after a torrid and confusing night, and finds a message from the matron: _FARKISS M. (Lwr):- ring Mother_ She is almost too frightened to make the telephone work. It is the week of her birthday and she has been orphaned. When Zsuzsi answers, she says, 'What is it? Who rang? What's happened to Mum?' 'Don't be funny,' says Zsuzsi. 'So—' But Zsuzsi has so many questions about Combe that some time passes before she reaches the point. 'Your lovely Mrs Dobos lunch yesterday,' she says, you do not tell us.' 'Mrs— oh, God.' 'Marinaka.' 'But I said . . .' 'Marina. I do not realize you are so stupid.' Rozsi comes to the phone but is very quiet, which is worse. Marina's mother is not even there – 'She goes early to her surgery,' Ildi tells her when she takes over, 'she work so hard,' – so when Zsuzsi comes back the phone to ask, 'But _vy_ must you go to silly science lunch?' there is no one to help her. Should she tell them about the Oak, in case Mrs Dobos saw her? But if she didn't? 'I,' she begins. 'I—' Zsuzsi lowers her voice; it buzzes in her ear. ' _Dar_ -link,' she says. 'I don't believe it. Tell me, it is a boy?' Alexander Viney's kiss is still upon her, as real, or realer, than yesterday. She can't keep it in. She suddenly says, 'Remember Guy?' 'Of course.' 'Turns out he's the son of someone famous.' 'Really? _Von-_ darefool. Very-good.' 'It's that historian,' Marina persists. 'Alexander Viney. Do you know of him—' A pause. Then ' _Hihetetlen_ ,' says Zsuzsi in her fiercest whisper. ' _Nem értem_. But this is not right.' 'No, honestly,' says Marina, but her voice wavers. 'Why? It's good. Isn't it?' Zsuzsi will not tell her. She won't even stay on the phone. Afterwards, Marina decides that it must be one of their mad grudges, like the sisters' lifelong refusal to listen to Brahms or visit Surrey. It is peculiar, though. Laura's mind is thick with death. When she wakes up, she knows exactly what she must do. On Monday mornings the surgery is closed, in order for Alistair to catch up on paperwork in the tiny back room where they keep the old scales and the records of the dead. This gives Laura and Marg, the senior receptionist, what Alistair calls 'ample time for administrative necessities', all of which must be completed weekly, without fail. This week Laura is even more behind than usual. Marg is not speaking to her because, as well as having forgotten to clean the toilet two days in a row, Laura accidentally ordered thirty-six non-returnable executive desk tidies in tortoiseshell plastic. If Laura asks her for help, Marg will not answer. Her immense purple-flowered back is turned away as she flirts simultaneously with the couriers and scratches her thigh with a biro. She does no work, despite her quasi-medical omniscience; why does Alistair not fire her? Fear, sexual thrall, blackmail, or his own, greater, ignorance? So, while she listens to Marg giving pensioners made-up advice about granular ulcers, Laura types letters, quickly and inaccurately (on applying for this job she had pretended she could touch-type), to brave widows and harried fathers, giving them terrible news. She fails to obtain a replacement for the faulty ear thermometer; she telephones a specialist in parasitic diseases and is told that he is on compassionate leave, due to the death of his pregnant wife. By eleven o'clock she has had enough. She stares in hopelessness at the last word she typed, 'Sudgerorn', and thinks: I am beyond Tippex, even retyping. She pushes back her chair. She needs to stop thinking about Peter for a start. Maybe if she has a quick think about him first, she will succeed. She goes to the loo and is sitting, knickers round her ankles for authenticity, resting her head against the toilet paper, breathing in the perfume of old men's urine, when into her mind drifts the solution to all of this, clear as truth. She does not need a river, or an Underground train. It could be done more easily, more ambiguously and before she can do any further damage. She should do it soon. Quickly and fairly quietly, she creeps back to reception. Marg is still on the telephone and so does not notice Laura approaching the metal cabinet where they keep bulldog clips and document ties and finger protectors and sliding open the drawer. There is the key. As soon as she holds it in her palm, she feels calmer. Still, she holds her breath as she walks out into the corridor and stands before the door of Alistair's office. She does not dare look back at Marg, who is saying, 'So I said, "I hope it _was_ a mango."' At any moment, Alistair could come out of the back room seeking tea. Mitzi could drop in for a tidy. Act quickly, Laura instructs herself, like a commander of men. She turns the handle of his office door, closes it behind her and stands alone in the Elastoplast-scented air. It is like being inside his skull. The light is dim; he always keeps the blinds closed, as if his framed certificates and National Trust castle plans need protection. Her ears crackle with the effort of listening. She runs a trembly finger along his windowsill, over the end of the examination couch and down the cubbyholes. Marg alone is authorized to refill them with fresh surgical tweezers; wooden tongue-depressors; KY Jelly; a fat roll of condoms; small-to-medium disposable gloves. She feels oddly sexy. She wants to steal them. What has she become? She knows his little cupboard well; she has never been permitted to unlock it, merely to stand by while Marg does. It is, like most of their equipment, not in a state of which the General Medical Council would approve. She could jemmy it open with Alistair's Tudor paper knife. Nevertheless, the key is here, waiting to be used. She unlocks the cupboard. Two narrow metal shelves; three rows of brown bottles. They must have been inventoried; she had not thought of that. Would Alistair, or Marg, be less likely to notice if different kinds were missing? Would just one type of pill be, well, more effective? Quicker? Or might it be better to take several, to eliminate the possibility of doubt? She dithers, picks up a bottle, puts it back in such a way that it knocks all its fellows out of line. Maybe— There is a sound in the corridor. Quickly, clumsily, she grabs three bottles of Dalmane from the top shelf, slams the cupboard shut and, stuffing the bottles up her top, runs for the door. # _21_ _Tuesday,_ 7 _February_ Netball v Queen's School, Taunton, 1st and 2nd VIIs (H), 4.30 p.m.; Combe Abbey Rifle Corps Annual Dinner: Guest of Honour Lt Col Stevens DSO of the Welsh Guards, SCR, Basil Pilkington Room, 8 p.m. Marina's needs are few. All she has hoped for is an _Officer and a Gentleman-_ style rescue from Chapel by Mr Viney, or a friendly letter from his wife. But although, in the daytime, her desires are all quite straightforward, the moment she is horizontal they seem to shift, sliding out of her brain like marbles, rearranging themselves in perplexing combinations. This may be partly a question of caffeine. The kitchen is out of bounds once prep has started, so she survives on instant coffee made with water from the hot tap, liquorice, dried apricots. She cannot endure being watched so she reads until Heidi turns off her desk light, then starts to work. Or not only work. She is becoming more alert to signs. Her family is scathing about superstition; at home she tries to force it away from herself like a dog but lately, at Combe, it has been creeping back. So even as she learns the properties of liquefied gases and writes her essay on irony in _Othello_ , she is constantly on the alert for indications of imminent tragedy. This term she has discovered that, with the help of the two-volume _Shorter Oxford English Dictionary_ given by her proud relatives, she can control, or at least guess, the future. Random words are full of meaning, mostly about health or illness in Westminster Court, or other clues: what Mrs Viney thinks of her; if she'll get into Cambridge; whether she will ever be invited to join the netball team, even the B team. Even the Cs. Once started, it is difficult to stop. She makes it an additional rule to check the etymology of every four-syllable word, then three, then a few of the twos and, as almost every Greek or Anglo-Saxon word can mean something bad, if you look at it a certain way, she then has to find others to counteract it. This evening it has gone on for even longer than usual. When at last she makes herself close the dictionary, stiff and cold and scared at two o'clock, she cannot sleep. She wants to be at home. She wants her mother. Her skin aches for her. She thinks: let me come back. Then she catches her breath. In the rosy darkness of her room in West Street, Mr Viney has just materialized before her, saying 'a little life'. Is that what she wants? Laboratories? Hospital beds? In his voice was an implication – no, more than that – that science is somehow . . . unseemly. Base. Maybe he's right. If she thinks of the smells of formaldehyde and the ugly textbooks, even the pictures in the Cambridge medicine prospectus, do they excite her? Or does her heart skip instead at the thought of the panelled history classroom at Combe, Mr Viney giving her extra help with the Tudors? If he could really help her change— But she can't drop biology; Pa Pond won't allow it. Chemistry? She thinks: you don't even like it. Pa Kendall is practically dead. Imagine doing Elizabeth I instead of nuclear fission, being part of that world, the Vineys' world, where everything is old and beautiful. What are you now? Small and ugly and cheap. And Pa Stenning— Her heart seems to stop, then start again, more urgently. Pa Stenning, head of history: the Vineys', Mrs Viney's, friend. Laura has been extraordinarily lucky. No one has noticed her theft. Every day she has waited for Marg's face to show more than the usual combination of bored contempt, mild digestive discomfort and irritation at the many demands of the seriously sick upon the well. 'If only,' she is fond of saying, 'they'd bloody listen to an expert,' and Laura nods and smiles and wonders what Marg's advice would be to her. Soon, Laura reassures herself, looking abstractedly at Marg's neck hump, you could be beyond guilt, let alone punishment. Nevertheless, every time Marg stands up – she is a great fan of tea-breaks – Laura's heart judders to a halt. She sweats, and frets, and fidgets, like a normal person who wants to carry on living, unincarcerated. At least she is definitely not thinking about Peter, who has not contacted her again. Not remotely. He is absolutely the last person on her mind. How do people find the time or privacy in which to kill themselves? This cannot go on. I, Laura thinks, cannot. Tomorrow, Thursday, she has the day off work to go with the family to Combe; it is Marina's birthday. And then it is half-term, when they will be together. Perhaps after that, time could be found. On Wednesday evening, when she is wrapping Marina's presents, Zsuzsi, _pongyola_ -ed, appears. 'Darling,' she whispers hoarsely. 'We must talk.' Laura takes a deep breath. 'Actually,' she says. 'I was thinking . . . those clip-on earrings are lovely, but I don't know . . . I mean, they might hurt her—' 'Don't be _rid_ -iculos,' says Zsuzsi. 'No, it is the boy.' Her arms are folded. She is frowning fiercely, but there is something else in her expression: triumph? Interest? 'Boy?' says Laura. 'Which one?' 'There is another one?' 'No! I mean . . . sorry, can we start again?' What emerges makes no sense at all. There seems to be a problem about that boy who came to Rozsi's party; Zsuzsi, it seems, no longer approves of him. 'You tell her,' says Zsuzsi. 'It is not allowed.' Why not? She won't say. This is, for Farkases and Károlyis, not unusual, but what is Laura supposed to do? For her birthday, Marina is hoping for: an ear-piercing token; moisturizer; slightly tight jeans; cassette tapes; a bicycle; stationery; a dark pink blouse; Argyle socks from Aston; a pet; a nickname; Simon Flowers; her old life back. They have turned up early, to surprise Marina. On this day seventeen years ago, on a Nightingale ward at Queen Charlotte's Hospital, Laura's daughter was born. It is shiveringly cold when the Farkases leave London, but there is spring sunshine in Combe. 'Vot a vether,' says Rozsi. 'Beautiful.' Laura, in too many clothes and laden like a donkey, hurries around the edge of the quadrangle, or pitch, or whatever they call it, in Rozsi's wake. The skin of her forehead aches. The huge tail-coated man-boys ignore her, as do the girls, golden-maned racehorses in nasty acrylic blazers. Last night, when the others were in bed, Laura did several minutes of miscellaneous exercises on the living-room floor, stretching her blue limbs in the dark. What was the point? Look at the skin of the young, their faces. She might as well be dead. 'Marina must be in lessons,' she says. 'We're not really allowed to find . . . she might not like—' 'Don't be a silly,' Rozsi says, unbuttoning her checked raincoat swiftly, like a huntsman flaying a boar. However, Marina is not to be found. The teachers and children they ask are not helpful: anyone would think, Laura starts telling Peter in her head, that we were just tourists inspecting the ruins, not payers of thousands of pounds in fees. Rozsi is beginning to hobble; Ildi does not look well, Zsuzsi, resplendent in golden faux-fox, starts saying, ' _Tair-_ ible,' loudly. She is quite capable of bursting into a lesson. Oh, God, thinks Laura. But I want Marina. I need my daughter back. 'I'll tell you what,' she says. 'I'll run and find her. You . . . why don't you sit here, and I'll bring her to you?' Leaving the others complaining in Hungarian on a bench, she hurries through a stone archway into a dead end; is squashed against the outside wall of Bute while two pensioners stagger past her with blue sacks of bedlinen; sees a herd of tiny boys marching across a courtyard dressed like army officers; and at last, hot and ruffled, arrives at West Street, where the smirking girls in the television room claim not to have seen Marina. 'But what shall I do?' she says desperately. 'I need to know—' 'I can take you to her room,' says a colourless girl with bad skin. 'We share.' And she leads Laura through an infinitely complicated series of fire doors while comparing the workers' cottage origins of West Street with her own happy home in Sussex, which features a paddock, a double garage and something called a plunge pool. The bedroom she shares with Laura's daughter is horrible. It has three doors: one leading to the corridor, one to a fire escape and one to 'Billie and Simonetta's room. I dare say you know about _them_.' Laura nods. The girl, Heidi, will not take her hungry eyes off her face. Half of this room is Marina: the new dressing gown and Laura Ashley deckchair-striped duvet cover they bought together, the pillow she longs to sniff, a good luck wooden spoon from Ursula; postcards on the section of wall half-hidden by her desk. Then she notices something. Photographs surround the end of her bed, of Ursula and various Kates on holiday, the beloved Miss Coverdale of Ealing Girls' accepting flowers when she emigrated to be married in Canada, before she came back. But where are the photographs of her family? Although Marina has been too embarrassed to admit to her birthday, the arrival of her great-aunts' card – tray-sized and in a special padded envelope – two days early has helped the news to escape. It feels blasphemous to be here at all on this her sacred day, even though some of West Street are being nice; Hannah North has actually made her a card, and Jennifer de los Santos insisted that today she should be the guardian of the West Street mascot, Toffee: a pale blue boy kitten in a little T-shirt. But this is not how birthdays should be. She is seventeen, still a virgin, still a scientist. Her family is coming later for lunch, after double biology and this term's new torture, lacrosse, which is not archaically jolly after all but involves hard muddy balls rocketing about at face height. It seems possible that she will not survive until then; I'm not even sure, she thinks, tears starting to her eyes, that I want to. And every time she walks past Tom Thomson making girls kneel she feels violently upset, which proves how badly she fits in. And her birthday letter from Ursula is mainly a paean to elegant-minded Miss Tyce: the fun they have in her early modern history lessons, the tea at her house in Ravenscourt Park, and the story she told them there about a girl they never even knew, someone's big sister, who streaked on her last-ever day of school, through Prize Assembly. 'She must be a Sapphist,' Urs wrote. She has just survived First Quarter, and is on her way to the tuck shop for a consoling sherbet dib-dab when she suddenly looks behind her: a woman's instinct. Just coming out of North Gate is Simon Flowers, carrying his music case, his shoulders movingly thin. He is with a girl from his year, throwing Marina into such despair that some moments pass before she notices the person behind them: it is Laura, her mother. Zsuzsi is reapplying her lipstick when Laura returns. 'Estée Lauder,' she announces to passing schoolboys. 'Also from Hungary.' Laura nods, distracted by her own stupidity. Marina will be furious with her for letting them turn up like this. 'Maybe we should—' she begins and then her heart seems to bound out of her chest at the sight of her daughter, her beloved, running self-consciously towards them around the grass. She manages not to drop her bags and race to meet her, this semi-stranger in uniform. She tries to pretend that Marina looks happy to see them: so much lovelier and more worthy of life than anything else in the world. 'Now she come,' says Rozsi. 'Laura, you buy her that skirt? _Tair-_ ible. _Dar_ -link,' she calls piercingly across the grass. 'We wait for you.' Marina's blush deepens, like a sponge filling up. 'I – gosh,' she says. 'What's happened? Why are you here already? Is everyone OK?' 'Funny,' says Ildi. 'Happy Birsday!' Marina kisses the others and then her mother. Laura bends awkwardly, trying with one hand on Marina's shoulder to convey reassurance, her huge unmanageable love, and thereby missing her chance to breathe in the scent of her daughter's hair, to which she has been looking forward since Reading. 'But why—' Laura says, 'We . . . Rozsi . . . it just seemed a good idea to come up early. They thought. That's all right, darling, isn't it? If it isn't, we could easily go—' ' _Von-_ darefool,' beams Ildi, holding up supplementary offerings one by one: a week's supply of peeled carrots, a first-aid manual, a jar of creamed spinach and a signed copy of _An Interesting Life_ by Lady Renate Kennedy, of crystal hedgehog fame. 'The thing is,' Marina says to Rozsi, 'I can't—' ' _Dar_ -link. We come from London with Zsuzsi and Ildi and Laura. Now we go to town and we find a nice café and eat a little something and then.' 'But,' Marina tells her, 'I'm not allowed. I'm really not. I've got lots . . . Spanish, I'm doing that now, isn't that great, and lessons and rehearsing for the play and so much prep.' Laura's bag twists in her hands. Why doesn't she want to see us? That strange business about the Dobos lunch— Marina has always been painfully trustworthy. Laura has never doubted this before. Besides, in Westminster Court children respect adults; they never, never lie. She looks hard at Marina, whose face tells her that she knows Laura knows. But what _do_ I know? thinks Laura. And what happens next? Surely it isn't that she knows about me. Or is it? Jesus Christ almighty. Could she somehow have seen her mother with her father? 'I thought I was meeting you at Mario's,' Marina says. 'Should I ask Pa Daventry if I can go now?' Laura frowns. 'I don't want you getting into trouble.' 'Don't be funny,' says Rozsi. 'I tell him.' 'No!' Marina says. 'You know,' says Laura, 'we would love to see you. But if you don't think—' It is not so easy to occupy the moral high ground when you have been rolling in a muddy morass; when, less than a week ago, you got drunk with your former – legally, current – husband and betrayed everyone you know and love by . . . 'Mum,' says Marina. By . . . Here it is again, that sinking sensation, as quicksand or a bog might feel, a fate she has always found particularly easy to imagine. Everything is hopeless. Nothing will be all right. Sinking lower, and l— Then she stops. What, she wonders, is Peter doing now? Lunch is, as usual, far from restful, but the worst moment is not when Zsuzsi confides loudly that their waiter is an idiot, or when they sing 'Happy Birthday', or Marina's lip wobbles at the sight of her book token. It is right at the end, when Laura passes her her pink-and-navy scarf and sees, written on the label: _VINEY._ So, just before they leave to catch the London train, she pretends that she left her gloves in West Street and goes with Marina to find them. It is like walking next to a firework; Marina seethes and smoulders, but it is too dangerous to investigate. It is only when they are passing Bute that she dares to say, 'How are things?' 'You know. We said.' 'And Guy?' 'What about him?' 'Noth— nothing. He seems a lovely chap. But—' 'What?' 'Well.' She hesitates, then follows her into the television room, smiling shyly at the girls watching an Australian soap, who look away. 'Can we talk somewhere?' asks Laura. 'I have nowhere,' Marina says in a tragic monotone. 'Nowhere of my own.' 'Right. Well, maybe just through here,' Laura suggests, opening the door at the other end to where the pay phone sits, under the stairs. 'Have they fixed – oh. It doesn't look broken.' 'Why should it be?' snaps Marina. Then she stops. 'I mean, it was, the other weekend . . .' Cold little fingers of dread and panic clutch at Laura's stomach. 'But . . . oh, sweetheart. Is something going on?' 'No, it's not. Why would it be?' And so begins one of the worst and, thanks to their household arrangements, only rows of their life. Laura fails to find out anything, and achieves even less. Given that she has no idea why Zsuzsi disapproves of Guy, and the boy is at the same school, she can't very well forbid Marina to see him. When she tries again to discover something, anything, about this father of his, the historian, Marina's outrage intensifies. She says, 'You want to destroy your only child's chance—' 'Chance?' says Laura. 'Of what?' But Marina will not explain and, what with the waiting Farkas party, and West Street girls bounding up and down stairs in tracksuits, and a complete lack of maternal authority, Laura cannot make her. This has become the worst possible moment to ask about Combe itself, whether she's happy here and, with Marina's dark hints about not being wanted at home, 'So you sent me away,' and some confusing references to Philistines and Science versus Art, the moment passes. Besides, it is difficult to concentrate fully when Marina's expression is so like Peter's and, really, is there much point in trying to control her child when Laura herself is being so deceitful? 'I might not even _want_ to be a doctor,' Marina is saying. 'Medicine isn't everything. In fact, if you must know, it was Mr Viney who—' 'Hold on,' Laura says. 'You've been talking to him?' 'I'm allowed.' Marina is crimson; Laura marches on. 'Alone?' Marina's silence makes it clear that she has gone too far. 'If you were, that would be fine. I mean, fine with me. Not with Rozsi, obviously.' 'But—' 'The problem is, look, can't you just avoid this man, Alis— Alexander Viney.' 'But why?' 'I, I'm not sure,' says Laura weakly. 'It's probably nothing. You know how they are.' # _22_ _Saturday, 11 February_ Cross country: 23rd Boys' Dangerhurst Run and 1st Girls' Dangerhurst Run, Petersbridge, 2.30 p.m.; netball v Epsom College: 1st VII (Greer's), 2.30 p.m.; Dorset/Somerset Schools' Indoor Rowing Championships, St Steven's College, Bournemouth, 3 p.m.; Fitzgerald House Concert, Divinity Hall, 7.30 p.m.; Film Club: _Kind Hearts and Coronets_ When Ildi comes into the living room, Laura is just hanging up. 'Oh!' she says. 'I didn't realize you were heard. Here. Er.' She could say it right now. 'That was Peter on the phone.' There is no excuse. For three whole weeks Laura has known that Ildi's nephew is alive and said nothing. If they think he is dead, she has been murdering him, over and over again. 'But, Sir,' says Marina, gripping the door handle a little harder. It is just after morning school, when Pa Daventry is usually blowing whistles on the rugby pitch. She had wanted to leave a note. 'Do I really need permission, just for one A level? It's quite diff—' Pa Daventry is sitting in his naval captain's chair, tapping his fountain pen against a big brass inkstand: the kind of object an enraged admiral might throw. Photographs of the rugby team, group and solo portraits, muscular action shots, surround him like the angelic host. 'That's as maybe,' he says, 'but you are not an exception to the rules, Miss Farkas. Albeit that you think you are.' He thinks girls are uneducable; he told Lucinda Prentice's brother so. Maybe he is right. She does feel stupid. Perhaps if she shows an interest in his naval models . . . 'What, what's this boat?' 'The _Ark Royal_. And it's a ship. Don't touch.' Only a fool would cry in front of Pa Daventry, but she can't stop worrying about the row with her mother. 'A ship, of course,' she says, examining an oil painting of a naval battle. 'Yes, it does look more . . . shippy in this one.' 'That's the Battle of Trafalgar; you're pointing at the _Redoubtable_. Good God, is this some sort of joke?' 'No, no, not at all. I'm just . . . sorry.' She looks around for further talking points: that big barometer, or possibly clock? The sailing ship in its enormous bottle? It doesn't look fragile, but . . . just in time, she snatches her hand away. 'Oh great, binoculars,' she says. 'I'm always trying to spot constellations. Can I have a look? Can you just see the playing-fields from here, or—' 'Will that be all?' he says, putting them in his drawer. 'I am a busy man.' 'But,' she says. 'So if I can't ask my m— parents, I can't swap subjects?' 'Of course not. I thought I'd made that clear.' She can hardly ring home and explain, when they have taken against Mr Viney anyway, and she is already such a disappointment. She is going to do medicine; there is no choice. If she doesn't dare admit to her recent spate of β++s and even a straight β, how will she convince them she wants to change? Being a doctor, she tells herself sternly, is what all this was for. But. What if she surprised them? What if Mr Viney is right? You can't really be civilized and well rounded without knowing history; Rozsi and Ildi care about Art and Culture, they always have. Even Zsuzsi is always talking about Rome in her youth and the stupid old Musée d'Orsay. Whereas no one at Combe is civilized, least of all the ones who do science. Last week in both biology and chemistry she made a brilliant joke about Felix Holt the Cotyledon, and not even the masters laughed. Yet Mr Viney understood her. He said she was clever; she has potential. And, anyway, it was her father – she has decided not to think of him as 'Dad', or Peter – who wanted her to be a doctor, she's sure it was, and although when she was young she did worship him a bit, and tried to imagine making him proud, lately she's been thinking less about him. Maybe it's Mr Viney whom she should be trusting. This is all Peter's fault. She doesn't even want to see him again, let alone in Bloomsbury Square, like a Regency prostitute exchanging hand jobs for gin. 'We need to talk,' he'd said, but what about? As she hurries along Bedford Place on Sunday afternoon, past the Cresta Hotel and the Selway Alhambra, her fury grows, not only at him but at men in general, the way they assume they can summon you and you will come. I need, she thinks sternly, to be concentrating on other things. My daughter's well-being, for example. At last, a gate, closed, and a black wooden sign saying: PRIVATE GARDENS. Typical. She gives it a shove. It opens wide. Mrs Viney has nothing to do with it. She is the last person on Marina's mind when, heart pounding to a medically alarming extent for a person of her age, she climbs the stairs to Pa Stenning's rooms. Anyone who saw her from West Street would be astonished; you don't just approach masters like this, uninvited. But she is answering a higher call. When Pa Stenning opens the door, without a tie and his hair very slightly rumpled, she thinks: sex. Then, at the sight of his sitting room, she forgets. There is too much to take in with mortal eye alone. It is beautiful, for one thing: mostly cream-coloured, including the carpet, so you cannot imagine Bill Salter's rugby thighs or Pa Daventry's twins anywhere near. There are real paintings and a million art books. Poor Pa Stenning, she thinks. What a waste, with no wife – only Mrs Viney, his friend, whom he is probably in love with. If she weren't already so busy, Marina could develop a crush on Pa Stenning herself. The second she can, she will draw a plan of his rooms, to help her remember. The thought that Mrs Viney is regularly sitting on his white sofa, or the chair by the piano, while Marina mopes about in West Street, is almost too much to bear. Pa Stenning helps her. When she reminds him that she knows the Vineys, that this is Mr Viney's idea, he looks surprised – she feels surprised – but he agrees. 'I'll probably,' he says, 'just speak to Clive.' 'Sorry, who?' 'Clive. Templar. The deputy head. Remember?' 'Sorry, yes. But—' 'If Alexander Viney recommends you, he won't refuse. I'll have a word with him, too.' Here is the secret garden, the Vineys' world; a place she has only dreamed of. 'Will you? Would you? Oh please.' 'Yes, yes. If I remember.' 'I . . . could . . . will you tell me what he says? I'd love to know.' 'I dare say,' he says, giving her an adult look. 'And you've told your parents this, I suppose.' He is looking out of the window. She makes a sound. 'What were you going to do: medicine?' 'Yes. I mean, I still can . . .' 'Hardly. Need chemistry A level for that. Didn't you realize?' 'But—' 'It's fine. Old Kendall won't care, let's be frank.' Marina is gaping at him. Hastily, she shuts her mouth. 'No,' she says, swallowing. 'He probably won't.' 'So. 'Tis done. Congratulations, Miss Farkas. You'll start tomorrow.' 'Hey.' Laura says, 'This was a big mistake. No, really. If you had a bloody phone on that boat I'd have cancelled.' He is grinning. 'You could have just not shown up.' 'Well, I—' Why is she here? To cancel out the events of last time; to punish him? To make him face the thought of telling his mother? 'Hang on a sec,' he says, bending down to examine a bit of gravel. He was always doing that, she remembers now; this must be where Marina's fossil obsession came from. Laura looks at the top of his head, thinking of the hours she spent while her daughter sifted through the sandpit in Kensington Gardens. At that moment an ill wind, gusting through the rose bushes, picks up a whiff of his pheromones and delivers it to her. No. Definitely not. He is still a bastard. She will not fall for that. Never mind their last meeting, when she was clearly demented. This time, and for ever and ever, he is meaningless to her. Surely even chemistry dies. 'This is quartz, I reckon,' he says. 'But you never know. Mate of mine once found a diamond in Preston Park.' 'Don't be an idiot,' she says. There is the back of his neck with a new crease, the soft pale skin. Just the thought of the smell of it, like the inside of an empty wardrobe, makes her contract. She gives a small winded noise. He looks up. No, no, she thinks: this is what she had absolutely promised herself would not happen. She is not a blancmange; she will not let it. This man has devastated every woman who knew him. Their daughter, for Christ's sake. Right, she thinks, standing up and walking off towards a leprous rose bush. That's it. 'Turn around,' he says. She pulls at a dead-looking twig. 'No.' She seals herself against him, inhaling through her mouth, eyelids lowered. The light is thick, like primeval soup. If she could just escape— 'Come on,' he says. It is hopeless. She can smell him over here; the air is oily with capsules of sex. He must not come over. Please, she thinks. Save me. His footsteps crunch on the gravel. She presses her fingers into her eyes until the orange-grey shadows and softenings ache; she takes a shuddery breath, full of loathing. The pheromones are still doing their dirty work. He puts his hands on her shoulders. 'Laura,' he says. # _23_ I have, thinks Marina in biology, made a grievous error. She can't stop worrying about what her grandmother will say. Tomorrow at lunchtime she is going home for half-term, by herself. The moment Rozsi or any of the others see her they will guess the terrible thing she has done. Not only has she betrayed them and their medical dreams, but she has no idea how to do history. What madness was this? What on earth should she do? She will have to tell Pa Stenning that she has changed her stupid mind. No, she can't do it. Nothing, not even Rozsi's outrage, could be worse than embarrassment. Mr Viney will find out, and tell his wife, maybe his daughter. The thought of being discussed – a puzzle, a failure – makes her toes clench with shame. And, worse still: if she can't bear the thought of that reversal, how can she possibly leave and go back to Ealing Girls'? This is the dark seed, her greatest secret. The idea of escape has been creeping up on her as half-term approaches. She cannot imagine how she will make herself go back to Combe after spending a week at home. They are supposed to be finishing today's dissection but she can't identify the pig's hepatic artery, let alone its inferior vena cava. It is only the afternoon but she feels so tired, as if she has been saving lives after dark. She never sleeps before two these days; there is much too much to do even apart from the fourteen-page essays, which take longer now that the dictionary's dire predictions have to be found and counteracted, Combe's pollution neutralized. She seems to spend hours wading around in the darkest pits of the night; there are now so many rituals to observe, proliferating infinitely like a new religion only she understands. And then in the morning, wide-eyed and jumpy, the self-disgust and worry begin again. 'Sir,' says Ivo Williams, known as Mammoth, from the back of the lab. 'There's mucus in my pocket.' The class convulses, but Marina stands still, the scalpel frozen in her hand. She has had a realization. She _could_ leave, if Combe burned down, or there was some sort of scandal. If there was no alternative. But what kind of scandal would it have to be? Unlike last time, no one kisses anyone else. It's for the best. Laura's hands do not accidentally hold, then clutch, the small of his back, or his shoulders; he does not press her to his chest. He just puts his arms around her and they stand together, like two survivors watching the last lifeboat go down. When it stops, she finds herself standing in a flowerbed. A tree is pressing its rough bark against her back like a big hopeless beast. 'What are we doing?' Peter grins. 'I missed you,' he says. 'A lot. I thought you'd hate me too much to—' 'I did.' 'Marina won't want to see me, will she?' 'No,' says Laura, digging her nails into her palm. 'And I don't know what to do about Mum. I'm useless really, aren't I?' Her brain seems to hover, like a racehorse refusing at a fence. All she can think of to say is, 'Please. We really can't.' 'What?' 'Today. Us. Ever meet like this. Peter, please. I need you to think.' 'Why? It's fine.' 'It's _not_. How can you even say that? I—' 'I don't mean . . . no, no, not more crying. Come here.' 'No! No, I will not. And I'm not upset, I'm, I'm angry, actually.' 'Fair dos.' 'And why do you _say_ these stupid things?' 'Look, I hadn't–– When I came back to London I didn't know what to do. If, how, to see you.' 'What? You weren't going to? That's—' 'I didn't know what to do. I just thought, being miles from Mum, well, London's big enough, I thought.' 'I didn't come looking for _you_.' 'I know. But I suddenly thought I could just, well, say hello. If I wrote to you at Mum's you'd get it. I'd heard you were there, you see.' 'How? You _knew?_ What else did you know?' 'Not much. Stuff reached me.' 'Who told you? Jesus. What, spies?' 'Course not. Just guys. From London, from the past, you know. Heard the odd report. Anyway, I knew it was a bit of a . . . well. But I just missed you.' 'Then why did you leave?' He must, she thinks, be insane. Has he suffered? That's when it comes to her, one phrase: a broken man. No, no: pity must be resisted. He doesn't deserve it. 'I suppose,' she says crossly, 'you had lots of girlfriends out there.' 'Yeah,' he says, and another piece rips off her heart and lands, steaming, on the gravel. 'But—' he shrugs. She gives an encouraging lift of her eyebrows. 'You know how it is.' She has a sudden vivid image of shooting herself in the head. 'Well, no, not really,' she says. 'I didn't have time for all that. I was raising our child. Anyway, you got sick of _me_ , remember? Remember? You called me Bore-a.' 'Bloody hell. Did I?' ' _Yes_. God. How can you—' 'What an arse,' he says. 'That doesn't even . . . oh, never mind.' 'Well, exactly. When I think about it I just want to run back there, so, well, this is the best I can do. Be here. Try to be Zen. In fact I was going to ask you. What should I, you know, do now?' Laura sighs. 'I'm hardly . . . I don't have a clue,' she says. 'I suppose earn money? What are you living on?' 'Spot of cash I saved in Wales. I was,' he says, grinning, 'a gardener.' 'Blimey. Well, be one again. That would be a start. Or, I don't know, go back there. Whatever you wanted here, it's—' 'No, I meant with the others. I've got to see them. Rozsi and the others. I just thought of, you know, saying sorry. But it might screw them up even more.' 'Christ. Peter. I—' 'I'm serious. I'm not proud of myself. But I'm trying to change. I think. Since giving up the booze I, well. I've been doing workshops.' 'You're joking. Car maintenance? No.' 'Seriously. Oh, and therapy too. I knew you'd laugh. Male bonding. Shamanism, tantra, meditating; most of it was complete cobblers, I'll give you that, excuse for lots of stinky egos to feel sorry for themselves and sleep around.' 'Please.' 'But it helped.' 'With what? What's been so difficult? What—' 'Don't shout.' 'This is like a dream of bonkersness.' 'Yeah. Thing is, now I _hrrhrm_ myself.' 'Sorry?' 'Hrrm.' 'I can't hear you. You what yourself ?' He lifts his eyes to hers. 'I own myself,' he says, and the faintest pinkness suffuses his skin. 'You . . .' 'I know what I am.' She has a pressing desire to hit him. She is hugging herself already; now she grips herself more tightly, like a referee. 'Do you? At last. Well, I don't think that you have the faintest understanding of how—' 'Irresponsible, selfish, blah, blah. OK, yeah. It's completely true. And, thing is, I still am.' 'Are you _proud_ of it? Is that what they taught you? God. You are unbearable.' 'I know,' he says. 'But being married, sorry, being a good son, a dad after what happened with, you know, my dad, all of that. I couldn't do it. And the worse I got the more I hated— well, it's obvious. So bailing just seemed the best— and then it got harder. Oh screw it. I got what I deserved. But, you know what? I still think it was better.' A thrill of anger rolls up through her. 'What?' 'I know it's been tight. But I'd have cocked you up some other way if I'd stayed. You . . . both.' 'Hah.' 'I meant to keep away from you. I shouldn't have written.' 'Right,' says Laura. She thinks: I've had enough of this self-indulgent lunacy, this rooster of a man. She picks up her bag. Merely the thought of her pills in their dim bottles, the sugar coating, soothes her. 'There's one more thing,' he says. Another woman. Probably dozens. You fool, she thinks, returning from the land of the dead, to nothing. 'What?' 'Maybe not.' He looks, by his standards, almost serious. 'Tell you next time.' 'There won't _be_ a next time. This is the worst, stupidest, thing I've ever done. I'm not just . . . I . . .' She thinks: I could tell him how bad a mother I've been, and maybe he'd step in. How much worse could he be? 'I'm not sure.' He gives an awkward cough. 'No, let's leave it. Better not.' 'Oh, for God's sake,' she says, 'you've started.' She wants to be alone with her hoard of misery. 'Pete, enough drama. Just tell me.' He pulls a strange downwards smile. 'Bit of cancer,' he says. # _Part Two_ # _24_ The alumni of Combe have always been a disappointment. Thanks to its faintly liberal leanings, a modest endowment by a relative of fat Queen Anne, the notable ugliness of its original buildings and its belated introduction of everything from laboratories to girls, the school has never attracted pupils of quite the calibre of Rugby and Marlborough. The prospectus makes much of those Old Combeians it can claim: a spy, an unpopular post-war deputy prime minister; a racing driver expelled from the Remove; and, curiously, several authors of second-rate and now morally ambiguous children's books. Schools, however, need history. They need money even more. Three headmasters ago, the financially suspect Captain Porteous invented most of its ancient traditions, climaxing at the end of the Hilary term, close to his own birthday in mid-March, with Founder's Day: a week-long spectacular of concerts, rugby matches, Evensong, fund-raising, feasts and, on the final day, an embarrassing pageant of Combe boys dressed as famous historical characters, processing around the Founder's Lawn to a marching band. On Founder's Day rests Combe's reputation in the school guides as 'tremendously arty'. 'Participation is a hallowed Combe tradition,' the pupils are frequently reminded; whether or not they can act or sing, they must join in. It is, the Uppers will tell you, an almighty snore. But the Lowers, Marina's year, and the younger boys still have high hopes for Founder's Day week, currently a month away. Their parents and godparents stay near by; it is a chance to show off. And there is, to an extent, misrule. Things might happen. Virginities might be lost. _Sunday, 12 February_ Matins: Chapel, 9 a.m., the Rev. Jonathan Hitch, vicar of Melcombe, hymns: 285, 57, 297; half-term exeat begins Marina is home at last. She has survived another half-term of Combe, despite being practically deranged with homesickness. Now she is ready to fall into her mother's arms, climb inside her pocket, be swallowed alive like a baby catfish. I will, she vows, never be irritated with any of my family, or the burning radiators, or nosy Hungarians asking about my periods, ever again. How long does that last? Ten minutes? Five? On her very first evening home, the oldies start making suggestions: a haircut; tea at Lady Renate's; coming in to Femina to be shown off. Everything makes her feel guilty; if one of them asks the slightest question about chemistry, she thinks, it will all come out. But they do not ask. There is nothing to do. The Ealing Girls' half-term isn't until next week. Toiling beside her mother in the tiny kitchen, every single maternal feature – her floury hair, her sugary hands, her parsleyed apron – is unbearable. She looks at the back of her head, looks at the frying pan, sighs regretfully. Her hopes for a correspondence with Guy's mother have been fruitless but, she thinks, I could write again. She might invite me. Maybe she's already decided that she will. 'Are you sure,' Marina asks, 'that no one has rung for me?' 'No, sweetheart.' 'Because I'm expecting, um, someone, a friend, to ring about homework. Just a friend. She's called Nancy.' She knows that she sounds ridiculous, that she is stirring the pan of tomato sauce much too quickly. But her mother seems satisfied. Really, anyone would think she wanted to be deceived. On Monday her mother and grandmother go to work. Ildi is off to the library; Zsuzsi is meeting Perlmutter Sári at the swimming pool: 'Marinaka, don't you vant to get slim?' They have left her bean-and-sausage soup, meatloaf and sliced-up oranges for lunch, money for the new Picasso exhibition and the instruction to stop biting her lip, 'because,' Rozsi says, 'it make you look like mad girl.' And, most horribly of all, tomorrow is Valentine's Day. Is it possible that someone could be at a mixed, in fact largely a boys', school, and receive nothing? She fears it is. She never has had a real one. If Guy's mother or sister asks what she had this year, she is going to lie. Waiting for the post, in case a card has come early, is maddening. She has a furtive look at Hungary in her atlas, but instead of Pálaszlany in the Carpathian mountains, where Mr Viney said, she can only find somewhere called Polslav in Russia. What if they ask her back to Stoker and he mentions it again? What is Mr Viney doing right now? And Mrs Viney? Are they thinking of her? Many doctors nowadays believe that an informed patient is a happy patient. They have helpful charts and anatomical models, purchased from the pharmaceutical reps. It isn't hard to do. But Alistair is not one of these. How then can Laura find out what she needs to know? Marina's biology textbooks have told her nothing; they seem to edit disease from them, as if it is more important to understand pond weed than human weakness. Somewhere in this surgery may be information which could save Peter, or at least answer the questions she did not dare to ask. So Laura leafs furtively through out-of-date drugs manuals. She pays more attention than usual to the ailments of patients waiting to be seen. At last, as the surgery is about to close, she finds a small plastic model of the human torso at the back of a filing cabinet. 'You finished the referral yet for Mrs Trent?' calls Marg. 'Only He's asking.' 'Hold on,' says Laura. 'I'm just . . . I . . .' After all these years, how can she be so confused about organs? These little red beans must be kidneys. She touches one with her finger; in truth, she strokes it. If only, Laura thinks, one could simply stare at them, like those metal hearts and legs in Mexican churches, and they would heal. In desperate circumstances it should be possible; but what if you did, and it used up your miracle allowance, and then your child needed healing too? On the bus home she gives herself a talking-to. You can't spend five weeks longing for half-term, then spend the whole time in a daze, dreading the day your daughter goes back but trying to avoid her. Did you fill up on her last night, while you had the chance? Were you patient, indulgent, gripped by all those stories of tedious Pa Kendall and cruel Pa Pond? You were not. It is only when she is walking down Moscow Road that she realizes that she has failed to send Marina a Valentine's card. She has never forgotten before, through all those years when simple mother love, and embossed kittens, were all her daughter needed; through teenagerhood, agonizing about how, with a simple signature, to convey faith in future romance without giving false hope that it was either from some spotty Ealing boy or, worse still, her father. But this year, Laura senses, her usual unsatisfactory compromise: _? [Mum]_ will not do. It is so easy to outrage Marina; she is becoming more, not less, prickly with age. Well, Laura thinks, letting herself in through the flat door; too late. I can't start faking postmarks now. 'Hello,' she calls. Then she sees the flowers. There is a bunch of roses on the dining table: at least ten, big fat creamy ones. She breathes in sweetness. Marina is looking at her over the top of them, like a suspicious hare. Laura's mouth is dry; she hardly dares to ask. 'What are these?' Marina swallows audibly, then flushes. 'I don't . . . I, do you know it's Valentine's Day tomorrow?' Laura nods. 'But I ran after the man from the florist,' Marina says. 'And he just smirked. It was so _rude_ , as if I didn't need to know. I, you didn't, um, expect something?' 'Of course not,' her mother says a little sharply. Would it be strange to touch them? Their petals are curved like tiny breasts. When she first saw them and thought 'Peter', she was being stupid; she can see that now. What she has to do is refuse to think of him. 'Come on, sweetheart,' she says, brightly ridiculous. 'You must know who sent them to you.' Marina's face cracks into an enormous smile. She looks down. 'So you think they're for me?' she says. 'Who else could they be for?' 'Well, no one,' says Marina. Laura pretends to look delighted. 'Well, how fantastic,' she says. 'But it's that chap, Guy, surely?' 'Oh, do you think?' Marina looks oddly downcast. 'Well, darling, who else could it be, if they're for you? Although, well, let's see before we worry about that.' 'I don't—' 'Wait a minute. Wasn't there a card?' 'A what?' 'You mad girl,' Laura says. 'Look, that little white envelope.' 'Oh, that,' Marina says, 'I thought that was the bill,' and grabs it. Her hands seem slippery; she has to tear it with her teeth. 'Hang on,' she says. Then her face falls further. 'Oh.' Laura looks away, to preserve her modesty, but can it truthfully be said that, in her own heart, a tiny spark of hope does not sputter back into life? Let us assume not; she is a mother. She takes the card. _Édes Zsuzsi,_ she reads. _Virág virágnak._ _Imré._ Behind her, Marina's bedroom door slams shut. Laura simply closes up her heart. # _25_ _Tuesday, 14 February_ Nothing from Peter. He said that he would be in touch when he had news, which could mean anything. Laura's imaginings grow more fanciful: ghostly messages during the _Six O'Clock News,_ envelopes dropped by passing doves on to her typewriter keys. She decides to go back to the boat, or write a letter, hundreds of times a day. In the meantime he is always with her, breathing into her ear as she strap-hangs on the bus to Baker Street, or squashed beside her in the bath, sweat and steam on his forehead, their sternums together, mouth to mouth. Yet every morning, when she wakes on her sofa, itching with the dust of ages, she is coshed again on the head by the fact of his disease. Or is it a fact? Could there be a mistake, or a chance of salvation? It is impossible to concentrate at work, what with the constant flow of rival medical crises: consultants' details, urology reports, investigations into cataclysmic tumours of the bowel and larynx and tongue, about which once she would have shed private tears, and now is almost immune. Can kidney cancer really be so much better? Peter said it is. Remission: in his case is that permanent, or merely retreating? She could hardly have asked Peter himself. He says that, now that they have removed 'the bugger', he will be fine, 'if they got all of it,' which any day his surgeon will reveal. And how in God's name does she tell Rozsi and the others about this? For almost the first time in her life she cannot eat. She is distracted, even with Marina. Mitzi Sudgeon comes to work with nourishing beef and barley soup for her husband and Laura cannot even be bothered to hate her. Soon she will be fired, in any case, for poor administration if not for the pills, and then how will the family manage? Marina is standing in the phone box outside Queensway Tube, trying to summon her nerve to dial. It has not been easy to escape. Rozsi has been increasingly determined to take her out with Mrs Dobos and the Dobos grandchild; Marina has only just managed to postpone it until this afternoon. She has planned this for days. Her shaking fingers hold a bus ticket on which she has listed some conversational subjects in case Mr Viney answers, or Mrs. However, by the time Guy answers the phone, Marina has forgotten even the most basic pleasantries. 'Christ,' he says. 'You're always so stroppy.' 'I'm _not_ ,' says Marina. 'It's just how my voice comes out.' But she can't talk to him any more; since the kissing she has forgotten how. She has gone socially backwards. When she hangs up, the chill wind of splitting up is whistling around the telephone booth. Please, no, she thinks. Don't chuck me. How will I ever see your parents again? 'It's Laura,' Laura is saying into the surgery telephone, with an eye on the door. 'Peter's, well, his— I really do need him to ring.' 'I do not know,' says Suze, Jensen's girlfriend. She has the kind of American accent favoured by beautiful Scandinavians with relaxed attitudes towards sex. 'I will see him later. Maybe you will try then.' 'But . . . no. No.' The word sits between them on the telephone line, a grey unit of power. 'I mean, I need to speak to him now. I've only got ten minutes; it's my lunch break and, well, I can't usually talk. Please. He said I could leave him messages with you and he'd ring. He said.' 'What can I do? I am performing my yoga now. I cannot go into the garden and ask—' 'Hang on. He's in the garden?' 'No. Of course not. He is at the end of the garden. In the boat.' 'I don't understand. His boat is at the end of your garden? You mean, parked?' 'It is moored on the water, yes. My yoga—' 'So. Sorry. You live right next to the river?' 'Yes,' she says simply. 'A very big house. My ex-husband is a record producer.' Laura is well aware that other people, through sheer force of will, persuade strangers to obey them. Rozsi can do it. One day Marina will. 'Look,' Laura says. 'I know about Peter's, you know. His cancer. And I need to find out what his consultant said. Please. I do. So is there any way you could – ' her voice catches, but she trudges on – 'you could go and ask him now, very quickly, if he would come to the phone? Please?' And Suze says, 'OK.' People, thinks Marina dreamily, are like napkin rings. You either have a hallmark or you don't. There must be moments in a person's life when they can be assessed and their value discovered. It is probably measurable scientifically: if you have reached a specified age, say seventeen, and not reached a certain height, or been able to run a mile in under eight minutes, or received any Valentine's cards at all, doesn't that make it officially, probably medically, unlikely that things will improve? First post: nothing. Second post, on which she has always counted to bring her a life-changing letter: nothing either. The others are all out; she is threading a needle through the skin of her palm, thinking: I am epically bored. Heroically bored. Cataclysmically . . . This is not helping. She has been for a nice walk in Kensington Gardens with Ildi, and made Zsuzsi a beautiful cup of coffee, and been forced to take stuffed cabbage to the 'poor girls' in Flat Seven, the bristly chinned Mrs and Miss Fisch, for which she was rewarded with a hard New Berry Fruit and nearly an hour of questions. Now Marina lies sadly on the sofa like Elizabeth Barrett Browning. Whenever she thinks of Combe she feels sick. But she cannot distract herself with rereading _The Snoopy Compendium_ or ringing Ursula; these youthful pleasures are lost to her. Now that she is beginning to understand the scale of her social inadequacy, not a moment can be wasted. Last night she tried to read _Brideshead Revisited_ , which made her weepy with disappointment at herself, and it. Maybe she should try something Mrs Viney would like; a cloth-bound _Winnie the Pooh_ was on the bedside table at Stoker, softened by several generations of little Hons' hands. There is an old paperback of _The Wind in the Willows_ somewhere, probably in the sideboard behind her, where Marina's mother keeps old letters and baby shoes. In a minute, Marina thinks, unless someone comes to the door to propose to me, I'll look. But the smell of Zsuzsi's roses distracts her. The flat is full of noises usually too familiar to hear – the ticking of the plate clock, the rattling of the clothes racks in the dry cleaners' on the corner, the terminal decline of the Farkas fridge – which do not comfort her as once they might. Her family is immune to her suffering. Meanwhile, in Stourpaine, Blandford St Mary, Simon Flowers is in the bosom of his family, having scones made for him and little posies of country flowers, practising on a grand piano in black tie. Imagining herself beside him, turning the pages, even miraculously accompanying him on another grand piano, perhaps shiny white, her throat aches with thwarted love. But why is it that, since knowing the Vineys, she feels even more confused? She is starting to realize quite how misguided, how style-less, how vulgar, she was before. If people like Mrs Viney do not see the point of people like Simon Flowers, his inner beauty, is it possible that they are right? Maybe, she thinks dozily, musicians are less glamorous than she had realized. Maybe she should give him up. On Thursday, at the end of a long foul day, Ildi approaches Laura with a book in her hand. Rozsi is at a charity meeting; Zsuzsi and Marina are in their rooms. Laura thinks: Christ, she wants me to read to her. This afternoon at the surgery, Marg answered the phone: 'Sodding ring-offs,' she said, loudly enough for the waiting room to hear, but Laura has a feeling that it was Peter, trying to speak to her. The situation is impossible. He says it's his job to tell the others that he is in London but, until he does, the lie is growing; isn't she going to have to tell them soon? And, covering everything like ash, in four days Marina is going back to school. Ildi holds out the book. 'What is this, _dar_ -link?' 'Sorry, no idea. Was there any post for me?' Other people who have done wrong either repent and stop, or are blind to their sin and carry on sinning. How do they do this, leading themselves by the hand to the next crime and the next, as if through a meadow, trampling daisies underfoot? She, Laura, knows that seeing Peter secretly is terrible, yet she has not stopped. Ildi seems not to hear her. 'It is important,' she says, looking nervously towards Marina's bedroom door. 'I find it earlier on Marinaka's shelf, I am looking for dictionary. And I do not know what to do, so I wait for you.' Laura flops down into a chair. Radiotherapy radiotherapy: it rings in her brain like the name of a beloved. Despite her patchy receptionist's knowledge, it is strangely difficult to remember the scanty facts he told her: what exactly they did to him before the surgery or might do now, if the news is bad. She can imagine Peter bald and sickly, can visualize his grave, but it has become muddled with the time when her mother was dying; when, if either the Aston Park hospital or Laura had been vigilant, she might have recovered. Why, Laura wonders now, am I so sleepy? I could put my head down on the table— ' _Dar_ -link,' says Ildi. 'Please.' To humour her, Laura takes the book. She reads the jacket. 'Oh, Alexander Viney. Well, that's educational, isn't it? Isn't he the one who— God, Ildi, what's wrong?' Sweet soft-cheeked Ildi is sobbing, quietly, politely, like a Jane Austen character given tragic news. Nothing Laura can say will soothe her. 'But I don't understand. What has Marina done?' She can't remember what she is supposed to know; should she tell Ildi that Zsuzsi has already spoken to her? 'It's not . . . unsuitable, is it?' He is quite attractive, at least in his photograph, but how could a history book offend them? 'It's not, well, unsuitable, is it? Actually, I've been—' ' _Nem, nem_ ,' says Ildi, searching her cardigan pockets for a handkerchief. ' _Nem tu dom_. It is just . . . it is just . . .' 'It's not that the wars will upset her, is it?' she asks. 'And you don't know him, do you?' 'No!' Ildi says, as if grievously insulted. 'I? No, not at all.' 'But honestly,' says Laura, turning the pages. 'I don't see the— oh, there's something written. Look, it's signed for her. See? How nice: "To Marina, my fiercest fan." He's spelled it right too. "Until," I can't read that bit. "Very best, Alexander Viney".' ' _Dis_ -gusting,' says sweet Ildi. 'Look, unless someone tells me what the problem is— Is it a, a personal thing?' That must be it, she is thinking: the past. Her brain is flinching from the very idea. This is another of her weaknesses. Over the years she has heard fragments, censored for the ears of children and Englishwomen but still too awful to bear. She knows what she should have done: approached the subject rationally, researched, asked diplomatic questions, then carefully informed her child, with a mixture of fact and reassurance, of the essential facts about her family's past. She has not done this. So great is her cowardice, her selfishness, that instead she has buried the little she knows in her mind, like an inexpert grave-robber shoving the unspeakable, pale and wet and soft, back into the pit. In Rozsi's room, the radio flicks off. 'Quickly, take it,' Ildi whispers. 'You throw in dustbin, outside. And you tell Marina—' 'I can't! I don't understand—' 'Never, ever, in this house. Nothing about him. You must tell her. But Rozsi, it will kill her. We never let her know.' Marina is writing Guy an extremely tricky letter. Everything has to be right, guaranteed not to betray the slightest trace of what the Vineys call naffness, from the colour of her ink to the licking of the stamp. Unfortunately, the available materials disappoint. Nothing is watermarked. She considers using the Femina notepaper; she forgets to maintain her Greek ε in three separate places. Guy might not notice, but Mrs Viney will. The content has been long in the planning but the tone is hard to gauge. Mrs Viney will be interested to hear that Marina recently visited the horticulture exhibition at the V&A; Guy will call her a ponce. Similarly, he will not be impressed with her thoughts on _Leave it to Psmith_ or the lesser works of E.F. Benson. Guy won't even discuss whether his father should accept the professorship at Exeter, which Marina heard him talking about with lucky Horatia that evening at Stoker. How, she worries, absent-mindedly tearing off half of her toenail, will she find out what Mr Viney has decided? It has clear implications for Marina's educational future; Cambridge, she has been thinking, might not be right for history. Too far; besides, Mr Viney does not approve of it: 'Too full of striving grammar-school boys.' And they hate him there, he says; someone else was given his rightful Chair. And Oxford is antiquated. This was his very word. Marina feels tearful, almost bruised, as if someone has been shouting at her. She pretends to be very tired and spends a lot of time in bed with her eyes closed, so that she can worry in private. Every time she thinks of Combe, the contamination she is spreading, the thought of her return, the tears well up. She runs a bath and decides that, if her mother comes to check on her well-being, she'll tell her everything. But she does not come. She does not notice that her only child is weeping quietly underwater for nearly an hour and a half. So Marina goes for a walk in the park, as Rozsi tells her to. This is good, she thinks, tearing up a curl of plane-tree bark. I like fresh air. I like the country. Then, right by the Peter Pan statue, she sees Mrs Zagussy out with her grandchildren and, to avoid questions, has to dodge behind a tree until they pass. That evening, halfway through dinner, she starts crying. 'Vot is, you miss _Top-_ ofzePops?' says Zsuzsi. 'N-no.' 'Oh, _dar_ -link,' says Ildi, 'I make you something different? A little soupie?' but Marina, giving her a watery smile, squeezes past her, around the dining table to where her mother sits. 'Yes, darling?' 'I—' She stands beside her. Then she leans her body against her mother's arm and, although her mother puts up a hand to stroke Marina's cheek, she does not understand. She cannot possibly. _Sunt lacrimae rerum_ , thinks Marina, as the tears roll down. When everyone else is in bed, Laura, the Lady Macbeth of Bayswater in sprigged polycotton, knocks softly on her daughter's door. There is a flurrying sound, a cupboard door shutting. 'Come,' Marina says, like a headmaster and Laura creeps in. She sits on the edge of the bed, smiling fearfully at what must be, given the intensity of darkness, her daughter's hair. Whenever she kisses her sleeping child she imagines her murdered, the pillow black with blood. Marina is silent. Tentatively, like one reaching out to touch a corpse, Laura lowers her hand. 'What?' says Marina. Her skin is disconcertingly warm; her open eyes catch a glint of street light, like oil. 'You forgot you've got to buy me a different tennis racquet; no one has the old-fashioned kind any more.' 'We'll go to Lillywhites,' whispers Laura. 'I didn't mean to wake you. I just wanted to check.' Why is she awake? Is she sad? Does she doubt her mother's devotion? Laura imagines telling her the truth about love, what it means. She could say: I can hardly bear to think about you. It hurts everywhere, my knuckles, my shoulders: a permanent ache. When you're away I sometimes have to wear sunglasses on the bus to hide my eyes. And letting you go away to Combe was the worst thing I have ever done. Almost. And, when you hear about your father, I'm going to lose you all over again. 'Mum— Mummy, I really need to go to sleep,' Marina says. 'Of course, sorry. Sorry. Have you got lots of work to do?' Are you happy? Happy enough to stay there? 'You know I have. I said.' 'Yes.' Shyly she strokes the arm beneath the blanket. Most of Laura's actions are dictated by the thought of how she'd feel if she didn't do them and Marina were to die: extra kisses, extra warnings. Peter once called it a provisional life, this constant gingerish prodding at the unthinkable. Helpfully, he left before revealing how she might change. The worst _can_ happen; Marina could be hit by a bus tomorrow. Or – because Laura has always had a dread of teenage runaways, because she fears her daughter's ferocious little soul – what if Marina creeps out at night and disappears? Laura has been watching her closely for signs of unbearable homesickness but Marina confides nothing. The only clue seems to be that she wants Laura near her but this must not be pushed or relied upon. If anything, thinks Laura, I should keep my distance. That must be what she wants. Stay, thinks Marina. Please, please stay. Her mother is wearing the torn nightdress which Rozsi wants for dusters. Marina thinks: I will save it. She moves her finger closer to the stroking hand. Closer, closer. Stay with me. 'By the way,' says Laura, clumsily, like an inept social worker. 'There's, there's a new history book on your shelf, and I wondered where it's from.' She feels Marina stiffen. 'I mean,' she says, 'don't tell me if you—' 'Hang on,' says Marina. 'Have you been poking round my stuff ?' 'Of course not! No, not at all. I—' 'What then?' 'One of the others found it,' Laura says. 'I think there's s—' 'That's my private property!' 'Shh-shh. Yes, I know. But—' 'Which one? It was Zsuzsi, wasn't it?' 'I don't— Look, the thing is, where did it come from? I do need to know.' With a great rush of falling blankets, Marina sits up. 'Why do you care?' she hisses. 'It's private, my private business. Why do I have to tell you everything?' 'But—' 'You have no idea,' Marina says, beginning to cry, 'what my life is like. You just do not know.' 'Oh darling,' Laura says, trying to pat her again, but the foot jerks away. 'It's not that. I just promised—' 'What? Have you been talking about me?' 'Just—' 'Well, don't.' 'Please, sweetheart. They seem, it, I don't know why they're so worked up, to be honest,' she says disloyally. 'And I'm sure it's nothing much. But the point is that they don't like the book, or the author, you know we did talk about it, at school. This Alexander Viney—' 'He's a brilliant man.' 'All right. Don't push my hand away. Look, did you write to him? There's nothing wrong with that. I once practically stalked Christopher Robin. I kept phoning his booksh—' 'What do you mean, they don't like him?' 'Don't be cross. And maybe it's not a good idea, you know, getting into, well, correspondences with famous authors. Men. Though I'm not sure that's it. Rozsi, I mean they just don't approve . . . well. So better not. Or was it when you, when you met?' 'I can't believe,' says Marina, 'that you care about this. God. I can talk to who I like. I'm an adult! There's no reason not to, so I will. I have enough problems without this.' Laura feels her compassion falter. Has Marina truly not noticed, she wonders, that I look even worse than usual? Is this what becomes of the only child of an only child: self-absorption, the assumption that no one has anything else to think about or do? For almost the first time in their life together, she feels herself retract. 'Darling—' 'Look, can you just stop asking me things?' So Laura does. # _26_ _Saturday, 18 February_ 'Milk?' The situation is almost funny, in the way it might be if, for example, you were so afraid of sharks that you swam only in hotel pools, and then looked down and saw a fin. On this, the last day of the half-term holiday, which Laura has largely spent battling the urge to ring Peter, Dr Alistair and Mitzi Sudgeon have come for coffee. The Farkases, on the way back from their end-of-holiday trip to the Dürer exhibition, met them at Bayswater Tube; they invited them back to Westminster Court. What a lovely surprise. Now Alistair is awkwardly reclining in the corner of the green sofa. Elegant Mitzi sits on one of the dining chairs. 'I do not eat cake,' she is saying, looking down at her little blue jacket, little high heels. 'So rich. I am keeping my figure after so many children, _nem_?' Laura presses her hands hard down on her thighs to contain her murderous urges. Killing Mitzi wouldn't even be very difficult. She could just take her waist in both hands and snap her, like a wasp. 'Ah,' says Alistair Sudgeon. 'Lowra, so kind.' The great tragedy of his life is that he is not European. He pronounces her name like this in every possible circumstance. 'Just a touch of cream, if I may.' 'So.' Mitzi turns over the saucer with her sensitive painter's hands. She always makes Laura think of the Siege of Leningrad: she would sell you food, or eat you, with the same indifference. 'It is like the Herend, the _Batthyány_ pattern with the gold leafs, we had, my poor family, until—' She shrugs. The eyes of the Farkases fill. Alistair gazes upon Laura soulfully. She looks at her feet. She considers him, this person whose _membrum virile_ , as he likes to call it, she has held, and thinks: if you try to have a word with me in the kitchen, I will run screaming from this flat. 'By chance you have _svee_ -tenair? Sugar, not so good. And young Marina is going to be a little doctor, I hear? _Yoy de édes_ ,' says Mitzi. What I would give, thinks Laura, to know if she sounded this Hungarian when she arrived in London, or a little less. ' _Von-_ darefool. Is a noble profession.' 'Yes, yes,' says Ildi. 'She is a good girl. _Nagyon édes_. A very sweet girl.' Marina gives a sickly smile. She can't still be grumpy about the history book, can she? The child's infinite reserves of wounded pride are a marvel to Laura: a lesson in just how powerful, and one-sided, genetics can be. 'I'll just look for the saccharin,' says Laura, and escapes. Marina has had a revelation. She is justifiably furious with all of them, about the book, their prying into her life. She is curious too. Their obsession with Guy and his father seems beyond the usual oldies' grudges; it seems, she thinks with a little excited mental gasp, more personal than that. Could it be something to do with the past? Lost in the mists? It could be anything: cruel jilting at an altar, land-girl love letters. Or could it be something much more horrible than that? I'd know, wouldn't I, she thinks nervously, if it was to do with, well, the _war_? It is remarkable how naïve, even in middle age, Laura can be. Escaping to the kitchen was never going to work, for long. She has underestimated Alistair. 'Can I help you fill the kettle?' he says from the doorway. 'Thank you, but . . . there's really no room.' 'Nonsense,' he says. 'Allow me.' She backs towards the Formica. He reaches across her, presses against her. He looks old and tired: a perfect match for Laura, if not his wife. 'We must meet again soon,' he whispers. Laura shakes her head. 'We have to talk,' he hisses into her ear. Jesus, she thinks: not the Dalmane. There is nothing between them and five pairs of Hungarian ears but vinyl tile-effect wallpaper, and a calendar of the masterpieces of Buckingham Palace. 'Please, not now. But—' 'It is important,' he says. 'Quickly, a word, if I may.' His hands are clasped behind his back, like a television detective with horrors to reveal. She looks around for a receptacle into which to vomit or a surface on which to sit. She thinks: I'll just confess, sack myself, and is opening her mouth to say so when he clears his throat. 'Darling.' 'What?' 'Darl—' he begins again. 'No, I heard, but, Jesus, Alistair, she's next door.' He frowns. 'Are you avoiding me?' he says. 'How could I?' 'You know what I mean. What we had before. Stolen moments. Simple pleasures.' 'I've just,' she says stiffly, 'been trying to do my work.' 'That's all well and good. But it's been well over a fortnight since our conversation and—' 'Which conversation?' 'What? Laura, please. I must ask you not to toy with me.' She has brought the crook of her arm up to her face and is sniffing it for comfort, like an idiot child. She tries to remember when, in the past weeks of grief and Peter, she and Alistair have talked about anything more rousing than cervical smears. 'I telephoned you,' he tells her. 'Here, in your house.' 'Flat. And it's not my—' 'Honestly, I'd have thought it would make more of an impact. I poured out my heart to you. I told you that—' 'Oh, yes, then. Sorry.' '—that I couldn't go on in this fashion. I was minded to do something hasty. I was considering, if you recall,' he lowers his voice, but not quite enough, 'leaving Mrs Sudgeon.' 'Yes! Yes, I remember,' she whispers, patting the air between them soothingly. 'Oh, my God. Don't tell me you have.' 'Certainly not. I needed to be sure. But I had assumed that you were at least contemplating it.' Laura takes a deep breath and sees the mess she is about to create. She has dreamed of saying: it is over. Or: Alistair, there is someone else. Stay with your wife. I never loved you. I want whatever I can have with Peter and after, or without, him I want no one at all. But how could she do it? He will fire her; he, or Mitzi. The Farkases will starve. As she stands there, palpitating, something happens. A little spring of pragmatism rises through the London clay, past rusted pipes and oyster shells. It seeps through the foundations of Westminster Court, up into the concrete floor, the tired linoleum, until it touches her shoes, enters her skin. She realizes that if she simply says, 'I will,' she could change her fate entirely, make a home for Marina, be Peter's ex-wife and supporter only, save her in-laws from sorrow and want. This is where she can take the saner, better choice. He is waiting. That is what she should say. Her future pours from her fingers. Choose, say the Dalmane, the diaphragms, the scalpel blades. # _27_ _Sunday, 19 February_ Half-term exeat ends; boarders must report to their housemaster by 2 p.m. They sit on the train back to Combe, not speaking. It is grey outside and grey within. Laura, wiping up apple purée from an insufficiently closed pickle jar, tries to guess what Marina wants her to say. Neither of them has eaten the salami sandwiches lovingly made by Rozsi, the soft oranges and rejected chocolates, runts of the litter, pale with neglect. I want, thinks Laura, a ginger-nut. They race past rain-whipped climbing frames and buddleia, thickets of leafless silver birches, the sort of scruffy sidings where crimes are hidden. The thought of a child, a runaway lost out there, makes her want to cry. This is England, which the Farkases so love. She slides down a little further in her seat and watches the rails whizz by, wishing for a merciful accident. She thinks: I should have worn something different. She will be ashamed of me. She should be. I have to ask about Combe now but how can I, on the way? And after last night, when I did everything wrong. I can't exactly ring Bridget Tyce and tell her I haven't had the courage to say a thing, to any of them. It's too late, isn't it? I've left it all too late. Marina is in a state of outrage. They treat me like a child, she thinks. I am old enough to have sex, and they try to confiscate my goods. Because even if _Threads of Gold: Tudor and Stuart Finance_ is not strictly confiscated, the very fact that she has had to hide it in her holdall is proof of their practically criminal attitude to private property. How could any family which believes in culture not want her to read history books? She looks out of the window, hoping to spot a rabbit but there is, as ever, nothing: no foxes, no wild boar. A badger would be good, she thinks, about to say so to her mother. Then she remembers: I am ignoring her. If only I could have told her about chemistry. I should have said something over half-term. And now it creeps upon her like terror: she has frittered the holidays away. The days felt wasted before they had even begun; it was impossible to wring enough intensity out of them. She had anticipated making many cups of coffee for the oldies and being kind; why has this not happened? In fact, her only attempt to be a good granddaughter involved squatting at the feet of Ildi, wishing for a convenient footstool and encouraging her to tell tales of her childhood. She had imagined taping her with her Sony Walkman but Ildi got the giggles while telling a story about Zsuzsi and a bicycle, and then the others came in. They are in Dorset already; the train shoots through Blandford station. The sky is blue and crisp this morning, prospectus-worthy in the sunshine. She is pretending to be asleep so that she can gaze on her mother, gorging herself on thoughts of imminent loss and crushing regret. Have her mother's hands always looked so old? And here they are already, back in West Street. Her mother says, 'Shall I settle you in?' 'No, no need,' says Marina from inside her block of ice. Anyway, Heidi is watching, like a sperm whale trawling for plankton. The place is full of other people's families: Liza Church's mother in caramel leather, Ali's pretty twin sisters, heading like sacrificial lambkins for Combe next year. So her mother leaves; she doesn't seem to care one bit that Marina is suffering. Marina starts unpacking her clean nightie and tangerines and embarrassing tub of _körözött_ and new contact lenses and bag of ten pences and, by the time she has changed her mind and run after her mother, it is too late and she has to stand there, watching her shrink to the size of her hand, then her thumb, then her fingernail, striding further and further away. In Westminster Court time moves slowly. Ildi discovers decaffeinated coffee. Rozsi is invited by Mrs Dobos to see _La Fille mal gardée_ at Sadler's Wells and ends up paying for a taxi all the way home. However, beneath the surface a current of excitement is gaining strength. Founder's Day is only twenty-one days away and the Farkases are making plans. Laura tries to look interested. She longs to see Marina, of course she does, but Alistair is waiting for his answer. Mitzi keeps bringing him Thermoses of coffee and collecting him in the car after work. And, down in Chiswick, a little boat sways gently with the river, while Peter grows iller or stronger without her. She tries to forget him, or drag her mind away, or focus on her own life, to which, arguably, she ought to be hanging on. It does not work. She resorts to torture. Other people starve themselves or self-flagellate. Laura has London. At some point during most of her conversations with patients, they will refer to one of the many landmarks where, during her brief marriage to Peter Farkas, she was let down by him. She takes it out, this shame, inspects it, rolls it around in her mouth. She lets herself luxuriate in her own stupidity: a salutary lesson. You once fell in love with a prick; she tells herself this until it sounds like poetry. It sticks as a pop song might in other brains less at risk. Some people, the most depraved, come to love their punishment. She wallows in her humiliation and anger until she has remembered every detail of each shoddy betrayal, for which only a fool could forgive him. Suze telephones her at work. Laura and Peter have agreed that he must stop ringing her himself, since the last time he tried the phone was answered by a suspicious-sounding Dr Sudgeon, looking for paper clips. 'He says you must come on Thursday,' Suze says. 'Where?' Laura asks wildly, imagining a wonderful party, or running away with him to Wales: reverse elopement. 'The boat,' says Suze witheringly. 'My boat. Where else can he go?' Yet, despite extensive planning and anticipation, on Thursday Laura manages to reach Stamford Brook Tube rather late. Last time she was here it was dark; there were no trees in tentative leaf, no church bells. Now the air is, for February, warmish on her face, and on the lipstick she wears inexpertly, like a scarlet letter. In the dusky light she can see more of Eyot's Boatyard: still creaking with danger and slimy life but marginally less frightening. Every boat she passes, whether painted like a fool's fantasy of a gypsy caravan or army grey or assembled from bits of junk, suggests other worlds: unhappy ones, obviously, but interesting. Only _Vivian_ is better suited to the dark. It, he, she, seems to be on the verge of sinking, or dissolving, kept above water level by a skirt of tangled plastic bags and willow leaves. Festooned as it is with cables and bits of rope, it looks temporary, as if built by a giant toddler with the minimum of glue. Why does this upset her? Cancer doesn't make him saintly, or more deserving. She gnaws off the last trace of lipstick and steps on the deck. Left foot. Right. Tonight, she reminds herself, gripping the handrail, they must decide what to tell his mother; he wants her to advise him. That is why she is here. There is no reason to be excited; only a pervert would have, well, designs on a man as gravely ill as Peter. Knock. You ridiculous woman, knock. Count, then: three, tw— But what will she find? It is almost a fortnight since Bloomsbury Square; he might be thinner, paler. Get on with it: five, four, three . . . When people are dying, do they clutch onto the past, or race into the future? What will Peter want? She closes her eyes. She breathes jerkily through her nostrils: mud, weeds, rot, sewage, slime. Ten nine eight five four— She knocks on the door. # _28_ 'And every-day we have a little lunch with you. You tell us where.' 'Actually,' says Marina, once again at the West Street pay phone, 'I think, well, we do have lessons during Founder's Day when we're not actually performing. Rozsi, it is still term time. We can't be with our family all day.' Although the elders will never admit it, Founder's Day week is badly timed. There are always rumours that, in line with other members of the Headmasters' Conference, it will be moved to the end of the summer term, so that Combe mothers can be decorative in sun hats and heels, not shivering in their navy quilted gilets. However, the sixteenth of March is officially, albeit fictionally, the Founder's birthday and, in the words of Captain Porteous, 'Without Tradition, What is Man?' So this year the pageantry climaxes on the Thursday, the day that the Hilary term ends. Rozsi has decreed that the Farkas/Károlyi party will go for two nights, the most they can afford given the mid-week closure of Femina; they will return to London on Thursday morning and then Laura will bring Marina home later that day, after Prize-Giving. This schedule means missing Monday night's Freshers' performance of _The Mikado_ ; on the bright side, they will be in time for _The Merchant of Venice_. 'Don't be funny,' says Rozsi in Marina's ear. 'Of course you eat with us.' 'The thing is—' 'I do not hear you.' 'The thing is, are, are you sure about coming? I don't know how, well, interesting it will be.' 'Why?' Marina sighs. It's not just the Vineys, although she hasn't yet worked out whether to bring them all together and prove to her family how marvellous they are, or to keep them apart, for slightly baser reasons. She also has a duty to protect her loved ones. Combe is a plague pit. With every dark sad bitter-coffee night she understands more about unseen connections, the ways in which every single object, person, even thought, is either a contaminant or a protector, with her family in the middle, perpetually at risk. 'You like London things,' she says desperately. Recently in history she heard about ceintures, and the idea has stuck. If monks have their penances, their hair shirts and prickling belts to stave off vice, why shouldn't she? Having a constant reminder of her own badness seemed at first intriguing, then advisable, and it's hardly as if she's using thorns, just a Sixties belt of Zsuzsi's which any normal seventeen-year-old ought to be able to fit into. She pokes a finger inside for a moment's relief. 'Galleries,' she says, 'and plays and, honestly, I don't think you'll enjoy it. I really, I mean, I won't be offended, you see, if you stay at ho—' 'What a nonsense,' Rozsi says. 'It is lovely, _What-not of Venice_. We see you.' 'Only I'm an orange seller. I don't actually speak.' 'Never-mind. You sit with us and run on for your little talking. Anyway, we pay the hotel already, so it is done.' 'Oh. Were they . . . nice?' 'Don't be funny. Not at all. Stupid people. It does not matter. We are there. We cheer for you. Now, I bring Zsuzsi. I love you, _dar_ -link.' 'I, I love you too.' You little traitor. What happens when they find out you have given up chemistry, that you will never be a doctor, that you have lied to them? The most recent parcel from home contained not only toilet soap and a Boots guide to Symptoms but also a proper doctors' white coat, with _Marina Farkas_ embroidered on the pocket. She can't possibly wear it; she bundled it under her bed, with an ossified _beigli_ and other items of shame and now when she tries to sleep she can feel it through the sheets. The panicky feeling builds. It's not as if she's even good at history. In the term and a half she has missed, a great deal has happened, as Pa Jenner, who does Europe, likes to point out: the Age of Reason, for example. Victorian England is with Mrs Tree, the headmaster's wife, who is not officially qualified so mainly reads aloud from textbooks. It is not at all like being taught by Alexander Viney. Why had she not anticipated this? ' _Von-_ darefool you act,' says Zsuzsi loudly in her ear. 'Is like me at _conservatoire_ , I am Boris Godunov. I tell Mrs Dobos already, she wants photograph. But _vot_ -apity we don't stay nearer.' Zsuzsi resents the fact that they, or at least she, has not been invited to stay within the very walls of Combe itself, in a gracious guest suite, if not in the private apartments of Dr Tree. 'Maybe, who knows, we will be lucky.' She gives a sniff. 'Tell me, _dar_ -link. You do well? How are the boys?' 'You mean—' 'Not that _tair-_ ible boy, Gab, Gib, Gob—' 'Guy?' 'Of course, but other ones. You meet them?' 'Wel—' 'Very good. Ildi thinks you should not see so many, but she is old-fashioned. I say, yes. _Von-_ darefool.' Zsuzsi sounds as if she means it. 'So, we see them then? We will learn all about them. And now we meet the families too.' First, there is the smell. Laura had expected a certain level of manly chaos, socks on the floor and a shortage of clean mugs, but not this insinuating mildewed reek, as if every constituent part of _Vivian_ 's godforsaken interior, rotting wood and peeling cork tiles, leaking Calor gas, lame ugly cats, has been repeatedly soaked in river water and never allowed to dry. Silverfish are in the corners. If you look through the floorboards, which is easy to do, you see them moving. 'Oh,' says Peter, 'no, that's probably earrings, and keys and such.' There are still traces of Rozsi under his London accent; this feels more comforting than it should. 'Nowhere to keep anything, you know, storage. You lose things in the bilges all the sodding time.' There is a wounded duck in a washing-up bowl by the sink, presumably drying, and laundry strung before dim portholes, to catch the sun. There is no sun. It starts to rain and the smell intensifies: yes, definitely sewage. It is very cold. And still they talk. She tries to edge around the subject of the surviving Farkas-Károlyis, whom he has left behind. He starts crying: not undignified sobbing, or self-regarding wails. He simply closes his eyes, leans his head against the back of his chair and allows small tears to roll down his cheeks and fall discreetly on his ANC sweatshirt. He says, 'I just don't know how I can. I feel like a bloody murderer.' 'Well, so bloody do I. But you have to.' 'How? Tell me how. And Marina, God, I'm terrified of seeing her. Wouldn't it be worse for them to find out I was alive? All that time?' 'What, worse than you dead? Worse than that?' He passes the test. She can see him increasingly pained at the thought of Marina; she thinks: I'll give him that. She says, 'I suppose with you being ill . . .' 'Yes.' 'Yes.' She needs to know more about cancer. Is this boat even suitable for someone in his condition: the discomfort, the ancient mould? The cold intensifies. The lights keep flickering; it seems that he, or the fabled Jensen, has connected it up to Suze's electricity supply, illegally, lethally. 'What, running through the flowerbeds?' she says, peering out of a porthole full of spiders and flies. 'Not seriously. What about rain?' 'It's fine,' he says. 'Gaffer tape.' She is watching something in a carrier bag floating downriver. 'But—' 'Bit soon to be sorting me out, don't you think?' he says, smiling, which could mean anything. 'Who is bloody Jensen anyway?' she says. 'Do you actually know how to sail this thing?' He looks as if he's about to cry again. All the questions she needs to ask him, such as 'Is this a good or a bad kind of cancer?', or 'How long might you have?', or 'Is it genetic?', or 'Will you let me see where they cut you?', are unbroachable, and he keeps trying to change the subject, as if he fears her reaction, or she is not important enough to be told. It all happened last summer, even the surgery, in a place and among friends she will never know. He is here not to escape Pontypridd General but because he 'wanted' to 'come back'. 'But why? I mean, why now? Not before?' And, when he is silent, she tells him, 'You could have, you know,' and he looks at her. She tells him about her job and, almost, about Alistair, and the answer she must give him. She wants to ask Peter what to do. If, thanks to her enormous reserves of patience and forgiveness, or victimhood, she is now going to be friends with her abandoning husband, as appears likely, she should be able to discuss it. She has technically only twenty-four hours in which to make up her mind. Yet she can't say the words. 'What . . . will there be radiotherapy?' she asks instead. Apparently not, which seems odd, probably wrong. Could he be dying and no one have noticed? 'Don't be mad,' he says, rolling another cigarette on the sticky coffee table. 'I'm really fine.' 'I'm not mad,' she says. 'Just so worried.' 'Laur—' 'I know. I shouldn't be. You don't deserve it.' 'Too right.' Yet every time their conversation ought to stop, when he could take offence or she should storm out in disgust, they keep on talking. I just, she tells herself, need to find out certain things. At last, when it is completely dark and, in Westminster Court along the river, the worrying will have started because she has no life of her own and never goes out, she dares to touch on his future. 'I've still got one,' he says. 'It's just sort of stopped. I mean, I'm not getting iller. The doc says I'm likely to—' 'Recover?' He looks away. 'Not . . . well. You know that's not how they talk. Live.' 'Oh. Well. Good.' Although her throat tightens, she is not going to cry for him. Get a grip, she snaps at herself and, oddly, it works. 'So—' 'For, probably, a year.' 'Oh! Oh God.' 'No, not, you know. It's then, like, two. Then five. You know, probability.' But it's like being hooded, put into a diving helmet: nothing to see or hear or even smell, only the roar of her breathing. He might still die. He might still live. 'I don't know what to do,' she says. Her voice is too plaintive; it would irritate me, she thinks, if I were him. 'What do you want me to do?' She knows what she would say in this position: 'Be with me.' But he does not. 'I don't bloody know,' he says. 'Oh.' He doesn't respond. Dust and flies and death are settling over everything; the tide has turned. 'Well, so what do— maybe I should . . . let you get on with it.' 'You mean, leave?' 'Yes.' He is frowning, isn't he? In the darkness it is difficult to be sure, but he doesn't say, 'Please, don't,' or 'I need you.' He says nothing at all. 'Pete?' she says. 'I don't want to be . . .' he begins and she thinks she hears him swallow. 'Do you want me to go?' 'If you think you should,' he says, 'then yes. In fact, definitely, yes. Please. Go.' # _29_ _Wednesday, 1 March_ Fresher trip to Rome; Fivers community workshop: Combe Pensioners' Friendship Circle; cross country: Dorset and Somerset Schools' League at Dorchester College, Senior and Junior Boys, Open Girls, 2.30 p.m.; Fencing: Public Schools' Championships, Crystal Palace (all day) The second half of Hilary term is even worse than the first and more confusing. Perhaps it has been blighted by bad omens but, already, Marina is cast down by homesickness and worry: no time to sleep, and the gnawing of her conscience. And now she seems to be homesick for Guy's house too. Her mind keeps sneaking back there as to a love object, towards the sunlight in the upstairs hall, the peace, and Mrs Viney, the repository of all worthwhile knowledge, if only Marina had another chance to ask her. Rozsi would find a way. She has nerve. While this is not an option for her base and cowardly grandchild, in the dark reaches of the night Marina has started to wonder if she too, like so many heroines, will be called upon to prove herself: to show what she is made of. She will screw her courage to the sticking place, although it feels more like trying to nail jelly to a rock. When it happens, whether she is saving a small child from injury or performing an act of political martyrdom, she will think of her forebears, who walked across borders and forged visas and stood up to famous men. She will be strong. There might be a chance during Founder's Day week. Yes, she thinks, trying to whip herself into confidence, that's the answer. Less than a fortnight to go; I'll make it happen and, before I know it, I'll be staying at Stoker in the Easter holidays. I can find out then what Rozsi's objection is. Were the Tudors particularly xenophobic? But what if it really is something to do with the war? She has now remembered several occasions when, cello practice done, vocabulary memorized, Rozsi allowed, even encouraged, her to watch history programmes. This leads her to one rather exciting conclusion: it must be personal. The only problem is timing. Mr Viney is older than his wife but, say he is as old as fifty, he can't ever have fallen in love with Rozsi. Can he? Or – he is an attractive man – was it she who fell for him? At night, when she is too nervy to sleep, worn out by hours of dictionary flicking and a physically demanding, albeit imaginary, sex life, she tries to imagine alternative scenarios. Are there any love-free circumstances in which Rozsi and Mr Viney could conceivably have met? Her mind aches with trying to force it. Might he have pushed ahead of her in the queue at Selfridges' Food Hall? Or slighted Mrs Dobos? Then on Monday evening, very late, as she is writing an essay on the majesty of Peter the Great, Charlie Mingus turned so low that all she can hear is occasional plucking, her mind, as it wanders along snowy mountain passes, suddenly stumbles upon the truth. Rozsi, according to cousin Fülöp, used to be a Communist. He also claimed she was a student, somewhere like Vienna or Budapest; this seems less likely, but Rozsi was always clever, a fact of which they are all very proud. At least with the Communism there is evidence. Marina has heard a story about her great-grandfather, who owned a factory – no, that can't be right. He might have been the foreman. In any case, the workers, or possibly serfs, went on strike, much like the miners. Rozsi was a daring young woman, probably about Marina's age, so although she was only the second or third oldest she was sent by their father to talk to the rebels. She was meant to explain to them why they should behave. But when she came back, she told her father, 'They are right.' This proves it. Doesn't it? So let's say that in, roughly, 1938, Rozsi was the cleverest and most charismatic of the Károlyi girls. War had not yet come to their Transylvanian village of cow bells and merry milkmaids, and neither had any English people. Which is fine, because she was in Budapest, being the kind of student Marina intends to be. And a fine-boned English officer (Mr Viney, hence his mastery of the area) on a Grand Tour stopped there to feed his horses and . . . here she is hazy, but Love must have been involved. She has the setting but not the story: a station platform. Lipstick. Snow. The romance of war but not the sorrow, because that is something she is too scared to think about. Yes, Rozsi fell in love with him but was jilted because of her unusual intelligence and then . . . then . . . consoled herself with Zoltan. Poor Zoltan. All Marina knows about her grandfather's side of the family is that his father was a manufacturer of saddlery. Presumably, therefore, Zoltan in those days was quite rich, and glamorous, and he chivalrously rescued her. This is all perfectly possible, provided that the ages, of which she is uncertain, match up. _Threads of Gold is_ secreted under her mattress. When Heidi goes for her nightly hair-wash, she pulls it out. 'Alexander Viney,' it informs her, 'born in 1944, is a scholar of Westminster and Oxford.' Hang on. So if it wasn't him, who was it? Did he have brothers? Was it his father, or something to do with the First World War? That is the problem: finding out. She needs a convenient attic filled with caches of letters, or an elderly nursemaid with a tale to tell. Ildi might explain, but she doesn't want to make her cry. Rozsi? Too scary. Zsuzsi? I wish _you_ could tell me, she thinks at her dear grandfather, but his face is indistinct. I am, she tells herself, caught between warring families. But I will be true to the Montagues. Or is it the Capulets? Anyway, one of the two. Laura's secret pills are calling her name. When she is at the flat the sideboard seems to throb; every time one of the aunts-in-law needs a napkin, she has to leap up and fetch it herself. Their presence makes her queasy. Might it help if she just took one? Peter would know. Well, yes, Peter; back she goes, like an itch, a tic, to Thursday. One minute she was all ready to pledge herself to a life of nursing; the next she was cast out. What did she do? It has just ended, snap, leaving her standing like an idiot on half of a bridge, while the bit she was meant to travel across lies foaming below in the water. Fool, she thinks. You should have known. She is updating addresses at the surgery: who has died a lonely bedsitter death, who has wisely left for another practice. Every word is a second wasted, when Peter may now have so few. She thinks: Wilfred Bunting, I resent you. Were you the one with the wart? What's happened to my memory? Hello, Margret O'Reilly, the baldest woman I ever knew. Oh, Irene Saxle (Dcd) of Queensford Gardens W8, poor Mrs Saxle, I love Peter Farkas, again. My God. She stares down at the point of her pencil: the soft wood, the metallic gleam. Is that what this is? She knew already. Love was always there. Why, Marina wants to know, is the Lower School so excited about Founder's Day? Every time Dr Tree announces a lighting run-through, or tells them to warn their parents that _Mikado_ tickets are selling quickly, excitement ripples through Chapel like a wave, starting with the babies at the altar, cresting among the Fivers and subsiding towards the back. Is it because half of them don't see their parents from one month to the next? This cannot be said for the Farkases. They have been planning their trip to Combe since the Michaelmas term, if not before. Last night Marina had to have a discussion about whether Zsuzsi should bring her manicure set. In under a fortnight they will be booking into their rooms in Braegarrold, a bed and breakfast near the station recommended by Mrs Long, the matron, when everywhere else proved beyond their means. A full programme of fun awaits them: in addition to the ceramics exhibitions and percussion medleys and strolling mummers and an Uppers' debate ('This House Believes that Success Is Its Own Reward') and display by the Combined Cadet Force, they have bought tickets (£4 each, non-refundable) for _The Merchant of Venice_ , the Founder's Society's chamber performance of _Cyrano de Bergerac_ , and the orchestral spectacular, 'All About Jazz', featuring Simon Flowers on the classical guitar. There is some confusion over whether parents must buy pupils' tickets; to avoid difficulty, Rozsi has bought extra. Founder's Day, Marina is afraid, will bring the Farkases finally to their knees. In fact, the more she thinks about it, the more desperate she begins to feel. There are so many potential disasters: her relatives are too free-range and stubborn to be controllable in the Notting Hill Gate supermarket, let alone in the grounds of Combe. They'll walk on the Founder's Lawn to rip off a branch of _mog-_ nolia for the bed and breakfast, or insist on sitting with her in the Buttery and cutting up her chicken leg. Anyway, Combe is dangerous for them. What if they breathe air emitted by Simonetta? Or meet the Vineys? Marina is leading them to their death. Every night, full of caffeinated yearning, she lies in bed, her essays written, another day of Combe survived, and brambles of panic seem to creep into her mind. Could she forge a letter announcing that Founder's Day week is cancelled? She has to do something. She has to act. Laura is going to have to start making decisions. Founder's Day is coming nearer, like a train, and she is tied unprettily to the tracks. Alistair awaits. Peter is dying; or, perhaps, recovering, and falling for somebody else. And Laura, meanwhile, a woman in love, will be spending three days escorting pensioners around an extremely minor Dorset market town. Today in her lunch break she found herself in Boots, where she walked past unfamiliar beautifying inventions, podiatry aids, baby bottles and, at last, still trying to look like a respectable woman lost on her way to shampoo, the family planning aisle. It was appalling. She was a slut. She returned to the surgery, unsandwiched, as her punishment. At least in eight nights she will see Marina. Marina is all right. Isn't she? Eight nights. Seven. Then she snaps. 'It's normal,' says Guy. It is Tuesday evening, in his bedroom. He has assured her that, if his bin is outside in the corridor, no one, not even Pa Stenning, will come in. 'But it's not allowed,' she says. 'Everyone says so. Not shutting the door when, when there's, you know, a girl in here. That's the rule.' 'Not for me,' he says, 'babe. So, what about it? Monday night? Tues? I can guarantee at least an hour. Maybe two. We might need longer. We might go for it all night.' 'Please. That's mad.' 'Other people do.' 'But I thought—' 'It's not the same in Founder's Day week, dopey. Teachers are drunk, mostly, and parents.' 'Not mine.' 'It's not an insult, you wally. Everyone's a bit drunk.' 'I,' says Marina with dignity, 'have never seen any of my family drunk in my _life_.' 'Fine,' Guy says. 'But everyone else will be. So we can just, like, sneak off and I'll burst your cherry.' She is now subsisting on four or five hours of sleep, shored up with Pro-Plus, which at Ealing Girls' was considered almost heroin, and pounds of apples and handfuls of raisins and dry muesli every night. She hates herself. Like the crocodile in Peter Pan, something is ticking inside her. 'Guy,' she says, only slightly wincing as he slides his hand into her knickers, 'are your parents coming to Founder's Day?' 'Sorry,' says Laura. She is hunched over the phone in Zsuzsi's bedroom. 'I, I don't know if he, if I—' 'This is Laura?' asks Suze. 'I— yes. How is he? I mean, Peter?' 'I know Peter,' Suze says, needlessly. 'He is very well.' 'Oh good! I, you see, we haven't, I've been wondering. But, sorry, you mean, well or well-well?' 'Well.' 'But . . . OK. OK. So—' 'You can speak to him now. He is here, beside me.' 'What? Right there? But—' 'Laura?' 'Yes! It's me. Where, how—' 'I thought you'd given up on me,' he says. 'Me?' 'Tell you what,' he says. 'Come over.' 'But—' 'To the boat. Tomorrow. Please. Just come.' # _30_ _Wednesday, 8 March_ During Chapel, despite the discomfort of her contact lenses, Marina makes two important decisions. First, if during Founder's Day she manages to resist Guy's accelerating sexual hopes, in the holidays she will let him do what he wants. She should be grateful to have found somebody willing to remove her maidenhood. The previous generation, she once read in a very sexy article in _Harpers & Queen,_ lost their virginity much earlier, at hunt balls. Second, she will do some investigating. Old ladies, at least her old ladies, are always wound up about something and, if some misunderstanding is keeping Marina from seeing the Vineys, it must be stopped. All she needs is evidence and she will solve everything; she'll even be able to tell her mother that she is going out with Guy. The likeliest, if least romantic, explanation is that Rozsi has mixed up Mr Viney with someone else. It has happened before. Or she might be being overprotective. Or, if there _was_ a wartime romance, shouldn't they be over it now? Maybe Guy's grandfather is widowed; he might meet Ildi, and find love. The only possible problem is technical. No one tells her anything about her family; it's ridiculous how little she knows. She can't even remember the name of Rozsi's town, so she can't look it up and, if you ask the littlest thing about where they came from, their father's factory or whatever it was, bee farm, let alone mention their parents or the other sisters, they start crying instantly, like turning on a tap. Nevertheless, she has had a brilliant idea. If her mother brings whatever she can find to Founder's Day, diaries, say, or family documents, she could show them to Mr Viney. It will be worth the embarrassment; he'll know what to look for, and then the two warring households will be united. Why didn't she think of it before? From now on she will be happy. She'll stop all these fantasies about running away, being welcomed back to Ealing Girls'. Rozsi would never let her leave here, not in a million years and, if she did, everyone would know she was going, and the embarrassment, the mockery, would be unbearable. She must tell no one she has even thought of coming home; it would worry her mother. It might be the death of her. Marina sits a little straighter, partly to make her ceinture more bearable. Suffering is good, but she is still weak. Obviously she has to tell her family that she is now an historian. That Cambridge is overrated: she has chosen a different future. They love famous people; when they meet Mr Viney, her mentor, how could they not be thrilled? And also – she resolves this suddenly, in the middle of 'O, Jesus I have promised' – she will cure herself completely of Simon Flowers. Everything Mr Viney said was right; day boys are different. She grips her seat to stop herself looking for him in the row behind. Now that she has given up medicine, maybe even Cambridge, what does she have in common with him? Nothing at all. Her timing is unfortunate. Whichever God she is currently most frightened of is not looking kindly upon her; perhaps she has backed the wrong one. For, when she trails out of the Chapel porch, feeling as if she is leaving her heart behind her on the Lowers' pew, she feels a tap on her shoulder. _Vivian_ 's door is open, as Suze had claimed. How much easier, and less terrifying, it would have been to have conducted the whole visit in theory, on the telephone. Life, equally: one could just spend a weekend planning it in childhood, all the highlights – the husband, the house and dog and garden, the children returning lovingly from the grammar school down the road – and skip the reality. Do all women, wonders Laura, spend their lives reconciling themselves, or is it that her life has been more unsuccessful than most? A woman is sitting on the sofa. She is Nordic, tanned, sexually confident: the sort of woman all men like. It can only be Suze. 'Oh,' says Laura. 'Ah.' A cigarette burns idly between Suze's fingers. Laura looks down at her own sausagey hands. She is shaking. 'Sit, please,' says the woman. Laura sits. Time passes. The reek of drains and decaying wood is worse than she had remembered, joss sticks and curry, with a rich ammonia undertow. The duck sanctuary has gone; in its place sits a brindled cat on a dishcloth, eating something. Suze leafs through a magazine, not, as far as Laura can tell, something comfortable like _Good Housekeeping_ but German fashion. As if the pack ice is melting, the boat creaks and gushes, pops, drips. Laura waits with a smile of idiocy, pretending she is at ease. 'You're Marina Farkas, aren't you?' Close up, Simon Flowers is beautiful. Think of chess grandmasters or concert pianists: imagine how they ought to look, not how they are. That is Simon Flowers, here, now, before her in the cool stone porch, smiling. It is her moment to dazzle. Her mouth is dry; she exhales and then again, a little more raggededy-sounding, like a sheep. There is a faint smell of incense, or resin; is his skin alabaster? Or simply porcelain? He is going to ask her to marry him. She wants to be out on the far side of this moment already, analysing. Being here, inside it, is too much. Face to face, her determination to forget him falters. Come on, she thinks. Be strong. She has to say something. People are waiting. 'Why?' she says. Someone behind her sniggers. 'I mean,' she begins. 'What did you—' He is thin, with a tiny chip on one glasses-lens. Her heart is racing like a rabbit's. If she could faint, or tragically die, she could avoid the disappointment which must lie ahead. A different area of her brain is reminding her that she is nobody and a fool to live in hope. And another part says: you and he are the only people alike in the school. Do something now; show him. This is your chance for joy. But instinct has not been a friend to Marina. She followed it and left her mother; went to Combe; resisted Guy's physical urges; tried to be herself. And look how she has ended up: worse than before. Clearly some people, such as the Vineys, understand life better. She is lucky to have their example; she will follow it, like a religion. And she knows what Guy's parents think about boys like Simon Flowers. He takes a step back. He bites his lower lip; she has devoted hours to considering its cushioniness, its pressing need for lip balm but now she looks away. He starts explaining something complicated involving Tuesday nights and a club; she can't really listen. She is concentrating on breathing through her nostrils, as though lifting a great weight. No, she tells herself, though her body is screaming yes, please, yes, like iron filings leaping upon a magnet. She inhales his manly aroma and, gritting her teeth, shakes her head. 'I—' She clears her throat. Her tongue tastes like wool; she licks her lip before she remembers that this is a powerful sexual signal. 'I don't really have, you know, much time left, for, for extracurricular . . . stuff.' 'Sure?' he says. 'Monty thought you'd like it.' 'Sorry, but—' 'And he thought you'd be good at general knowledge. But don't worry,' he says. 'It's fine.' 'Hang on. You mean, oh, my God. You, the, you mean the team? You, you're in it?' He smiles at her kindly. 'Actually,' he admits, 'I'm the captain.' 'Wow.' In the deepest part of Combe, down a hidden corridor reached by a secret stair, there has been a place for people like her all this time. Somewhere she could know the meaning of synecdoche or Cole Porter's middle name without being mocked. She could make friends there. She could go mad with happiness. 'You, you mean next term?' she says. 'Not now, obviously—' 'Seriously, you should come. Just for a trial.' So this is it, here, now: one of those life-changing moments for which she has lived in constant readiness, knowing that the interim was just an unpleasant practice session, a series of trials and warm-ups designed to hone and strengthen. The future is unrolling like a carpet. Then into her mind comes an image: she and Simon Flowers, holding hands in the Vineys' entrance hall among the boots as she introduces him to Mrs Viney. Her ceinture burns at her left side. It serves to remind her that adulthood is not about self-indulgence; that the life worth living – tempered, civilized, ascetic, like Montaigne in his tower of books – requires sacrifice. She straightens her back. Isn't her longing to say, 'Take me,' to be accepted into the briefcase-carrying Sellotaped-glasses day-boy world, proof that she must resist? This baseness lies within her. The Vineys will show her the way out. 'When,' Laura asks Suze, 'do, do you think Peter might be back?' She has been feeling more and more peculiar. At first she assumed it was sea-sickness but gradually, as the minutes have passed, she tried harder to identify this simmering in her stomach, the heat which is building on her neck and back. Is it anger, righteous and refreshing? Fury that he has just turned up in the middle of London, expecting her to take charge? Just as she is summoning the nerve to tell Suze that she is leaving, Peter appears. He looks smelly. His donkey jacket has been rained on, although no weather has been visible through the smeary portholes; his interesting head-stubble has become faintly threatening, like that of an unstable soldier from the former Soviet Union. He is with a tall fair man, presumably Jensen, who nods at her, as if she is here to swab the decks. Peter is holding a carrier bag from which he proudly unpacks two bananas, a loaf of white sliced and a bag of what looks like gravel. 'Aduki beans,' he says to Suze. 'Amino acids.' 'You said,' Laura tells him, 'to be here before twelve.' 'Oh God, sorry, so.' 'No,' says Suze. 'It was _after_ twelve. I heard him.' 'Why,' Laura asks her, 'didn't you say? I've just been waiting—' Only a wicked woman would complain about time in the presence of the sick. They all look at her with surprise, as if a stuffed animal had spoken. 'Never mind,' says Laura. 'Sorry.' Peter smiles at her and, inadvertently, she smiles back. As the others roam about, making themselves individual hippy teas and rinsing the sprouter, she describes her farcical efforts to slip out of Westminster Court this morning and then, without meaning to, she begins to tell him about Founder's Day. 'What?' he says. 'Three days? Fuck. How are you going to stand it?' 'I know. Oh God, I know. It, it's a weird place, Combe. Combe Abbey. Horrible, to be honest. ' 'And it's in Dorset?' 'Yes.' 'Christ, I hate the countryside. The way the hills follow you. Cowshit everywhere. Is it awful?' 'Yes. It is.' She does not stint. She rubs his face hard in the detail, watching the words solidify as she speaks: how much she hates it, her reservations. 'So this was whose idea?' he asks, waving offhandedly as Suze and Jensen go off with face paints to a children's party; this is, apparently, Jensen's job. It is almost impossible for Laura to be polite to them, but she makes herself say goodbye. After all, she reminds herself maturely, they have looked after him, while I have not. They have bathed him; seen his scar— 'Babe?' says Peter. 'Her idea, Marina's,' says Laura. 'Completely hers. Though the others joined in. You know. It's just—' 'What?' She gives a wet ugly sniff. 'I, I, I didn't dare—' 'Tell them no? I don't blame you. What a bloody scary idea.' 'You're still such an interrupter. No.' She needs a tissue. Gingerly she reaches out for a dishcloth on the counter behind her, snatches her hand away and wipes her face uselessly with her palm. 'I didn't dare, oh, I don't know. Tell her that I wanted her to stay.' 'Hey. Hey.' 'Go away.' 'I'm not. I'm going to perch here.' 'Stop it. Stop _stroking—_ ' 'Laura. I've been such a shit.' 'You have.' 'A fucker.' 'Yes, but—' 'A fucking fucker.' 'God, I miss hearing someone swear. Apart from me.' 'A cunt.' 'Well—' 'I have.' 'You have.' 'I wish—' 'What I just want to know,' she says, unwisely, 'is have you— Oh, never mind. Of course you have.' 'What?' 'You know bloody what.' 'I don't. Ow.' 'Just look at me. No, you don't even need to say it.' ' _What?_ ' 'That you had lots of girlfriends. Bet you have, millions of, of floaty sodding girls called Daisy and Saffron.' 'You don't want to know.' 'I do. I bloody do. I want to hate you.' So he tells her, and the answer is not what she had expected; not at all. Somehow she is naked. Well, near enough. What is wrong with her? The door could open right now; anyone could walk in. Even apart from the repercussions, the thought of being seen in all her squashiness, the pale expanses of hideous skin, is unbearable. She would have to leave, at once and for ever. And what is he thinking? He looks better than her, which isn't difficult; was he horrified and politely not commenting, or too busy to notice? She had not expected this. Had he? Or had she? Her legs are shaved. She is wearing her only faintly attractive bra, a Principessa Duchesse Splendide with nylon broderie anglaise edging. He is considerably less washed than her, but this is perversely exciting; reassuring, too, because it means he had not planned this either. She is not in a trap but has chosen this, and that makes all the difference. How extraordinary to see him, his soft hidden skin and secret hair, unclothed. They are lying on top of his bed, his arm across her throat. She swallows hard; she is starting to feel crushed. Need male limbs be quite so heavy? He is not asleep, yet; just very, very relaxed. Laura, on the other hand, is rigid, eyes open wide as she gazes over his shoulder at the extraordinary fact of what they have just done. # _31_ _Saturday, 11 March_ Two days pass: a sexual desert. They are both so afraid of being discovered before finding a way to tell the others, that they have agreed not to be in contact. In any case, Peter rarely leaves the boat. Then it is the middle of March, the time she dreads all year, when she is obliged to help with Femina's spring stock take. What is so dreadful about it? Everything. The smell of the back room: old perfume, Ildi's Polish _svee-ties,_ Zsuzsi's cigarettes, and the dusty scent lingering in every cardboard box and polythene wrapping. The brown luggage tags and tiny paper labels on which elaborate price codes are written by hand; the typewriter for letters to customers; the card index for every single order since time began. The pictures of Marina in childhood, before whatever it was that went wrong between them happened, and the school photograph of Mrs Dobos's granddaughter, like a plaited pig. The trade brochures and kettle; the sewing tin, because customers expect Mrs Farkas to alter their purchases and, irrespective of arthritis, Mrs Farkas does it. Her ladies are not fond of change. And, worst of all, the yellowing packets of unsellable items, knee-length demi-knickers and Spirella Femme corselettes and Berlei Elastomerics, kept because of Rozsi's firm belief that 'Von day, someone vants'. There is no choice: Laura has to do it. Rozsi writes dates as '976 and '989; she speaks Russian and Czech and German and God knows what else but cannot spell 'tights'. So here stands Laura, ticking off an unsold Gossard Long-line Thermal Camisole in Illusion, not thinking about Peter. 'I suppose . . .' says Laura a little later. 'What?' 'Nothing. This is your fault,' she says. 'If you'd just, I don't know, gone to see them, independently, like you should have, I wouldn't have had to ring you to tell you to do it. And then I wouldn't have ended up round here.' It isn't true. She could not stop thinking about his shaved head, whether the bristle felt velvety or rough. And his skin so pale, his cheeks thinner: who could help wanting to discover what else has changed? She has spent so many years energetically resisting all memory of his body, its muscles and enormous bones, its touching flaws, and what has that achieved? Nothing. Here it all was, as she unwrapped it, exactly as she had known it would be. They are lying on what remains of a sofa. A candle, inevitably, flickers on the seat of a chair nearby, and a blow heater blasts from a suspended home-made socket, warming her right instep and two or three toes. 'I am very uncomfortable,' she says. 'Me too.' Still they lie there. She is cold and needs the toilet and can see her numberless physical flaws as he must, violently magnified. She thinks: I must hide myself. I want to go. But, if she stands, the delicious loinal heat, the ache, the melting in her wrists and knees, will pour out of her and leave her with nothing. She had not forgotten this feeling; she had only thought it would not happen again. 'This is all wrong.' 'I know.' 'We're bad.' 'So bad.' 'Wrong.' 'Yep.' 'Practically criminal,' she says and, an inch from her ear, he gives a snort. 'What? I mean it.' He is laughing: at her; at them. 'Don't,' she says. 'Seriously. Don't. I'm going to ask you one more time. When are you going to tell them?' # _32_ _Tuesday, 14 March Founder's Day Week_ 10 a.m.–12 p.m. ceramics exhibition (also 10 a.m.– 12 p.m., Wednesday), Radcliffe Library (free) 12 p.m. Uppers' debate ('Europe: Friend or Foe'), Old Library, £3 4.30 p.m. 'Hooked on Bossa': percussion medley featuring the Combe Players, Founder's Court marquee, cash bar, £4 6 p.m. _The Merchant of Venice_ , Combe Abbey Cloisters, £4 At five o'clock, overdressed and skittish, the Farkas party assembles. It is almost time for headmaster's drinks, to which the parents of the many participants in _The Merchant of Venice_ have been invited. The assistant registrar, distressed by Marina's family circumstances, still sends everything to 'Mr and Mrs Farkas' but, with pleading, Laura has managed to persuade her to extend Dr Tree's invitation to Marina's grandmother and great-aunts too. Most mothers, she suspects, drive over from Salisbury or Yeovil daily, or treat the whole week as an amusing conjugal mini-break, booking into the Oak or the Regency and consorting with friends in the evenings, while their young go to Melcombe for pizzas in rowdy groups. No one else stays at the disappointingly tartan Braegarrold; they will have the breakfast room to themselves. But in Rozsi and Zsuzsi's marginally larger room, sitting on the Black Watch bedspreads to giggle and drink instant coffee from home, they are having a fabulous time. The atmosphere is heady, as if they are about to go into battle. 'We attend,' announces Zsuzsi, still in her huge sunglasses, 'even though I am invited to the ballet with Klein Pali tonight, he beg me. It is _Nutcracker_ , such a pity. But _von_ -darefool, the whole family here. For Marinaka's sake.' Rozsi writes to Mrs Dobos on a postcard of Combe Abbey by floodlight, updating her on events so far. Zsuzsi and Ildi are pink-cheeked with hilarity; the beds are shaking. Laura smiles as if she is made of wood. Peter was meeting his consultant today for yet more results; she hasn't quite understood from his vague description which ones, but they are important. She has, with difficulty, obtained for him the number at Braegarrold; he has agreed that 'maybe me, maybe Suze' will leave a message if there is news, but will they? What would silence mean? And meanwhile, at work, where Alistair only decided last night that he could spare her for this little trip, they will be discovering misfiled lab reports; counting Dalmane bottles with puzzled expressions. When Zsuzsi decides that it is time to open the sponge fingers, Laura dares to act. 'I'm just going to find my, er,' she says, and hurries downstairs to explain to the landlady that if she is contacted by a woman called Suze, who is leaving a message on behalf of a mutual friend, it should be passed straight to Laura herself. Mrs Cousins is not impressed. Having already scented impropriety in the Farkas set-up, she has visited them twice to warn against over-flushing and excessive soap use. 'This is a respectable house,' she says. 'Other guests consider our facilities more than sufficient.' 'Yes, it's wonderful, absolutely. But I'm— sorry, it's the only way my friend can reach me. It's about, well, some medical results,' she says, and her eyes begin to burn. 'Due today.' There is a long pause. 'Well, it's highly irregular. I don't like it. I'll have to speak to Mr Cousins. And naturally if for these medical reasons you decide to take off early, there'll be no refund.' 'Thank you,' Laura says. 'Hmm.' 'Oh,' she makes herself add, 'just one more thing. If my friend does ring, please please don't tell my, you know. Just tell me. Really. It's a sort of surprise.' She walks back upstairs with the sense that she is watched. Her legs are slow and heavy. She passes the dark doorway marked Private, the hidden telephone. What if Peter needs her? What if he doesn't? Headmaster's drinks are precisely that. 'Not a biscuit,' Laura thinks in Rozsi's voice, 'not a nut,' but the real Rozsi doesn't say a word. Laura fishes fizzy apple out of her Pimms; Zsuzsi distributes Droste chocolate pastilles. Although the light is fading and it is far from warm, the party is in the gardens of Dr Tree's house, a Victorian Gothic keep behind a very disciplined twenty-foot hedge. The windows which overlook the lawn are extensively leaded, affording only glimpses of floor-length curtains, a grand piano glinting with silver frames. Mrs Tree, apparently also a teacher, glides amongst them like a sprigged and piecrust-collared priestess, dodging the merrier fathers, greeting favoured mothers with a kiss. Faintly, in a distant rehearsal, a hundred voices are raised in song. ' _Von-_ darefool,' agree the old ladies, huddling together by the drinks table. Laura searches for signs of life; yes, Zsuzsi is shaking her head, eyes following a particularly wide-hipped woman in Madras check and another in a denim shirtwaister. She looks disappointed. Her gaze moves to the men's gilt-buttoned blazers, their racy mustard-yellow trousers and brown suede brogues. Laura watches, and thinks: she is right. I should not criticize, dressing as I do, but Combe parents are hideous. The patriarchs, waving impressive cameras, have staked out tables with hip flasks and fully rollable Panama hats. Old Combeian fathers beget Combe sons, like child abusers; they cuff each other violently on the shoulder, bellowing about 'Stanters' and something called 'jams'. Where are the children? The play is starting in half an hour. The other parents seem perfectly happy without them, but Laura's hands twitch with Marina-hunger: the back of her neck, the smell of her cheek. There is nowhere left to sit. Ildi picks shyly at a cement griffin. Rozsi has forgotten her Kodak Disc camera. In London, Peter is finding out if he has a future. 'Beautiful,' the Farkases say and Laura runtishly agrees. At long last, after a painful speech about fundraising golf tournaments and Lincoln's Inn old boy dinners, they are instructed to raise their glasses and toast the school 'and all who sail in her', and then, when the hilarity has died down, a side door opens and their children start to drift in. At least, other people's children, in gold brocade and alarming make-up. Marina's family waits. 'Hello,' says a voice. 'Aren't you Mrs Farkas?' Standing at Laura's elbow is a pale powdery girl, turned into an old woman with wobbly eye-liner wrinkles and a hair comb. 'Heidi,' the girl informs Laura, like someone at a conference. 'Marina's friend from West Street. We have met.' The girl updates her on her slight netball injury, her inter-house debating near triumph, her progress in inorganic chemistry. 'Oh, so you're in the same class as Marina?' Laura says. 'How is . . . is she doing OK, do you know?' 'Marina?' 'Yes!' 'Um.' 'What? What's wrong?' ' _Dar_ -link!' Laura hears behind her and, with relief, turns to see her in-laws swoop upon a short dark girl in an unfortunate toga. It takes a moment to recognize her daughter. Laura waits until the great-aunts have stopped their cheek-pinching before asking, 'Are you all right?' 'Yes,' says Marina, and her mother knows she lies. She waits, trembling, in the wings for her only cue. In two minutes, just before the embarrassingly unnecessary sword fight, Marina will enter stage left, right, no left to sell oranges to the populace, before exiting, screaming, stage left. No, stage right. She keeps imagining herself running in the wrong direction; lately her brain has been full of unsquashable thoughts, like a miniature horror film. And she is so tired. There is hardly time to sleep these days. When she tries, her worries multiply in an endlessly branching hell: tree trunks into twigs, leaves, leaf veins; bronchiole, alveoli, capillaries, cells. There on the dark lawn is her family. It does not calm her; if anything it makes her want to do something rash, run out across the stage, jump down and pull them to their feet, swatting at the Combe grass and Combe insects which are infecting them while they sit there, in blithe ignorance. Only two more nights, she keeps telling herself; that's nothing. Stop this weakness. Harden your heart. However, she can't help noticing, even as she pines and yearns, that they seem to be taking up more room than other people. Rozsi's stretched-out legs and Zsuzsi's ancient metal-framed Harrods handbag: they just don't think. Everyone is looking at them, the oldest, strangest-looking group, in furry coats like bears who have strayed into a picnic. Sweating like a fat pig in her costume, a grass stain already on her simple espadrilles, she glances once again at the far side of the lawn, where Mrs Viney is still sitting on the bench beside Pa Stenning and, despite Mr Viney's absence, an image comes to her: the meeting of the tribes. Dear God. I would, she thinks, do anything to stop it happening. What, though? How far would I go? Anything. Hurt myself. Run amok. Even— There is a gap on the blanket between the fuzzy outlines of her relatives. Where the hell is her mother? One minute Laura is sitting on the grass surrounded by Combe families, lolling in self-satisfaction like basking seals. The next she is getting to her feet. 'What are you doing?' hisses Zsuzsi. 'Sorry,' Laura whispers. She blunders across the grass, dodging between picnic rugs until she finds the dangerously unsignposted fire exit at the other side of the cloisters, is waved away by a man in shorts, rushes back until she finds another opening and bursts out into the unforgiving chill of Martyrs' Lodge. She is alone. Close by a bell is tolling. Peter will have his results by now; she must speak to him. Tears have begun to pour from her like a nosebleed. She must find out. She wipes her face on her sleeve. Marina will forgive me, she thinks, if she even notices that I've gone. One day I'll explain it, I definitely will. She hurries across the cobbles and through an archway into Founder's Court. A few stray schoolboys, inexplicably dressed as squaddies, are setting out chairs on the grass. 'Cockcheese,' she hears one of them shout, to which another answers, 'You wish!' She keeps walking, blushing, apologetic and, although they grow quiet at her footfall, there is a definite recalibration of respectfulness as she passes: laughter again, and louder voices. She clearly hears one of them say, 'Knob.' There is no way for a lay person to distinguish between the surrounding buildings. It feels wrong to be wandering unsupervised. What, she thinks, would be the worst thing I could find? At last she locates a telephone, in the entrance to what appears to be a rudimentary pub: jars of penny sweets, file paper, taps for beer. Ringing to hear the verdict on Peter, death or life, is not easy; she has to replace the receiver twice before she dials correctly. Eventually, she reaches Suze. 'I am very busy,' Suze says. 'He is due in five.' 'You mean at your house? He's coming there?' Laura burns with a pure white hatred. 'Could you tell him to ring me then, the moment that he arrives? I'm at, I can't really hang around, I'm at a pay phone. Do you honestly not know what the doctor said?' Two older boys stare openly as she waits to be rung back. She slips into a dark flinty place between noticeboards, and closes her eyes. He is about to find out if he has a future. Who are you, she asks herself, to think he would even want you? He didn't before. You weren't enough, even then. And if you— She snatches up the telephone as if it could bolt away from her. 'Hello?' It is Peter, and her heartbeat pounds in her ear. 'Tell me. What did they say?' It is complicated, and made more so by his failure to ask the consultant any of the right questions. If he 'gets to' six months, as he puts it, then he has double the chance of living to a year than if he'd only got to three months, which he already has. 'Are you sure?' she asks. 'What about now? What do they know?' Very little. He still claims that it's a good kind of cancer, the 'right' kind. 'Because a kidney's removable,' he says, as if people have perforated lines. 'Not like a liver, or brain, or, I don't know, a pen—' 'OK. Enough. And what if the other one . . .' They listen together to what she doesn't say; it rushes in their ears like the air in a baked-bean can, like the sea. No one on the face of the earth cares as much about you as I do, she tells him silently, except— 'Pete,' she says. 'What are we going to do?' # _33_ It is the dead of night. At Combe Abbey, in Dorset, probably in the whole of England Marina is the only person awake. She has written a poem: No more the sun No more the moon Now more the owlet's cry. I know not what I am to you Nor why I long to die. It is moving and impressive: a genuine reflection of her suffering. Since turning down Simon Flowers's overture, for it can have been nothing else, she has been desolate. Everything is going wrong. How could her mother have missed her stage appearance? The lights were too bright to see much once she was out there, selling her oranges, but she could hear loud whispering coming from the Farkases' general area; they were probably offering their neighbours dumplings, or saying terrible things about their footwear. Everyone will know that they belong to Marina; she should not think like this, but it is true. Also, what if someone mentions chemistry? It's probably best if she doesn't spend too much time with her family, in case of blurting it out. But then the Vineys and the Farkases may meet unsupervised. How had she even thought this was a situation she could control? During the long night which follows, sweating against the radiator on burgundy brushed-nylon sheets, Laura tries to imagine gathering the relatives together over their All-Bran to tell them . . . what, exactly? The thing is, Peter might die; oh yes, and he's alive after all? Then what? Would they go together to find Marina in West Street and explain the whole mess to her, in the godawful beige television room in front of dozens of gaping girls? Must they inform Dr Tree? Control yourself, she whispers. You cannot cry in bed beside another woman. A man might not notice but, if Ildi wakes, she will. And she would try to understand why I've kept it from them, which would make it worse. Oh, Laura imagines saying airily, I've only known he was in London since the twenty-eighth of bloody January. Yes, nearly two months. Yes, once I knew he was ill I was afraid it might be worse for you but, mainly, I was scared. Peter wants them to know. Maybe, she thinks, turning her head cautiously to look at her bed-mate, open-mouthed and lightly snoring on her poor aching back. Maybe I could start this off myself, tell Ildi right now, to help him. Something I could do for him. 'Ildi,' she whispers cautiously. But what if she has a stroke from the shock? Tomorrow, thinks Laura. I'll find a time to tell her then; well, actually today. It is after four. She cannot sleep, or think; her brain clangs like a fire alarm. She has brought nothing to read; how can she, when the others have a _Life of Picasso_ , and a parallel text of Lampedusa's _Il Gattopardo_? And, when she isn't fretting, her mind drifts dangerously close to sex, its warm lapping shallows, its sharp rocks. Then she has an idea. Slowly, gritting her teeth at every sound, now that she must not wake Ildi, Laura pulls back the blankets and goose-steps amusingly over her aunt-in-law's fragile limbs to reach the floor. Her nightdress, clinging to her back and stomach with sweat, cools her skin as she moves. She feels herself clench with lust. Her foot touches the carpet. Ildi is still snoring. She pulls her case out from under the bed, wincing at the sound of sky-blue leatherette on nylon carpet, and feels around for the box. Why did Marina want her to bring letters? Even if the family wasn't so protective, so convinced that most things must be kept from a child, it was a silly idea. Nineteen-fifties blocks of flats do not contain secret archives behind bookcases. Had she expected a forgotten will? The truth is that Laura's search for letters was fleeting, at best. It felt like exhumation, breathing in the sad smell of crumbled cheap paper, trying not to notice the blurred postmarks which would reveal information she is too cowardly to face. Families like Rozsi's always have horrible stories in the background, betrayals on snowy mountain passes, little children led trustingly into forests. On this, Laura finds herself agreeing with her in-laws. If she could, she would keep Marina from knowing any of it. Other people's sadness doesn't inoculate; it isn't good for you. It just makes life more difficult to bear. So instead she has brought photographs. She found them by accident, looking in the sideboard drawer for the corn-cob forks. No, that is a lie. She was looking for pictures of Peter. And she found this instead: a red tin advertising Rademaker's Haagsche Hopjes, Zsuzsi's _svee_ -tie of choice, posted to London at enormous cost by a devoted admirer in Rotterdam. There was a label with _Francia_ on the lid, and a rattle of foreign coins; she almost didn't look. But then she did and inside the tin, smelling of treacle and orphaned keys, she found these. There are thirty or so, mostly pictures of her daughter in gingham sun bonnets and rick-rack braid and startling knitwear; the fat-cheeked infancy of which Marina, knowing her, will always be ashamed. Laura opens the door a little to let corridor light in, looks out cautiously for passing in-laws: nothing. She kneels before the case again. Here is Zoltan: grey-haired but ridiculously handsome in a raincoat on holiday; executing one of his perfect dives, side-parting intact, into black water. They make her throat close up, but it is silly to be surprised by family photographs. Other people have them; why shouldn't the Farkases? Nevertheless, it feels as if she should not be here. Poor Zoltan, she thinks, I love you. I do. I think you even loved me. What did happen to you? The other photographs are tiny, monochrome, frilly edged: a bowler-hatted moustachioed man walking with a woman in furs and a beautiful girl between them, like the last days of the Romanovs; another perfect dive; eleven men and women in all-in-one swimwear from crotch to collar-bone, grinning on a beach like Olympians. Someone has written _'935_ on the back in fountain-pen; Rozsi would have been, what, twenty-six, Zoltan roughly twenty-seven? Neither of them is in the picture. There are groups of laughing skiers in shirts and ties, even the women – _Skotarska 937 II.28_ – and much merriment: a plain happy woman smoking, knee-deep in a river banked with silver birches; four tiny figures doing the cancan in front of a castle. Everyone is smiling. The sun always shines. Laura looks more closely. She gropes behind her and pushes open the door a little more. This is Zsuzsi, definitely, standing on a rock in a sailor top, and again with two beaming younger women: they look like more Károlyi sisters, but wasn't she the youngest? Unless . . . oh God. One of the youthful swimming-costume photographs is shot in deep grass, with long waving wheat or corn behind and a mountain; a blonde woman, a dark man sitting chastely, seriously, with hands around their knees. The man is Zoltan; the woman is not Rozsi, although Rozsi swims at every opportunity. She might be just off-camera, or behind it, except for the fact that these two look so . . . alone. Here is Rozsi in a short woollen jacket and mittens, skiing; who is the girl next to her, faintly similar, prettier? These women look so alike: wide gleaming cheekbones, radiant smiles, flat lightly waved hair like floppy berets. The man with his arms around them, not Zoltan, looks richer, older, with very white teeth and combed-back hair thinning at the temples; he wears a buttoned-up thick shirt and pleated-front trousers and, as in one of the snowy hillside photographs, no skis. Familiar writing on the back says _34_ and an illegible word; somebody else has written _English for Foreigners, L.C.C. Evening Institute_. She sits back to think. Wasn't there someone they used to visit: Zoltan's best friend? There was, she is almost sure of it. When Laura first knew them, Rozsi and Zoltan used to see the other man, and his wife, all the time. And then they stopped. # _34_ _Wednesday, 15 March Founder's Day Week_ 10.30 a.m. water polo demonstration match, Greer's (free) 12 p.m. lunchtime music: Military Band, Founder's Court marquee, £3 1.30 p.m. 'Music for a Nightingale': music and song in celebration of the English countryside by Elgar and Vaughan Williams, and a sprinkling of Baroque classics, with Mrs Susan James and the Crypt Choir, Combe Abbey Crypt, £5 3–5 p.m. visual arts private view: a cocktail of painting, drawing and sculpture, Moore Studios, £3 7 p.m. 'All About Jazz': a spectacular featuring the hits of Fats Waller, Cole Porter, Herbie Hancock and others, with the Combe Rock Combo and the Combe Players, soloists Gemma Alcock (Lower, Fitzgerald), Ben Blake-Charles (Upper, Daneford), Tony Lemon and Mrs Deborah Tree, Divinity Hall, £10 Last night Marina could not sleep. She is jumpy and wide-eyed; at breakfast the porridge does not anchor her. Her family are attending the Lowers' debate in the Buttery; even the thought of them makes her eyes fill. When she said goodbye after the play last night, before she trudged back to West Street alone, she dared, for once, to ignore the risk of divine retribution and tell them that she loved them. Her mother, distracted, did not say it back. Although Laura tries to claim a headache, they are up and cerealed and standing shyly outside Garthgate by nine o'clock ('Vot a vether') discussing how to spend their day. There are limited opportunities for cultural enrichment in Combe. Marina will be working all day, she has told them; she won't see them until just before tonight's jazz spectacular begins. So, with the aid of a tourist brochure from the rack at Combe station, Laura plots today's activities: a tour of the alleged birthplace of a poet she has never heard of; a trip to the wood-turning demonstration being held at the local library; and a visit to the Combe Art Block, where they view an exhibition of awful sculpture and several studies of reflections on sunglasses. And, pretending to need the loo yet again when they're eating ham sandwiches (salad 10p extra) at the Olde Copper Kettle ('Very nice,' says Rozsi bravely), she goes downstairs to the public phone. Suze won't like her ringing again but she has an excuse; she wants to ask Peter about this mysterious former friend – Rudi? Sándor? Possibly a Tibor – whom she is increasingly sure is the ski-less man in the photograph. Yet the human libido is an extraordinary— what? Weakness? Delusion? Even in the least erotic circumstances, such as standing in a phone booth surrounded by amateur dramatics posters and a mop, one can be having thoughts. Urgencies. She cannot stop thinking about his hands. He may not want to talk to her. I could always try later, she thinks, listening to the dialling tone, it's not urgent; at least this bit, the Zoltan part of it, isn't. She knows where that story will end. Then Suze picks up the telephone. Marina, in history, struggling with the War of Jenkins' Ear, makes a new decision. She will confront her mother. If she can't even be bothered to watch her only child (Marina) sell oranges, that's the end, isn't it? Something has died. It occurs to her now, staring out of the window to make her tears retract, that all this could have been avoided if she'd never left home in the first place. Which means that it is her fault. Which means that no one will save her. It sounds as if there is a party: Peter, it turns out, is already in Suze's house. 'What's going on?' asks Laura. 'It's just Jens and a couple of mates,' he is saying. 'So, hang about, what are you asking?' 'I know it seems stupid. And you, you've got other things to think about. But I need to know about Zoltan's friend.' 'Which one?' 'I can't — wasn't there someone they used to see all the time? Maybe a Tibor, or a Sándor?' 'Oh, Szőllőssy Tibor, that the one?' 'Maybe. I think so.' 'Yep. They were best friends. You definitely would have met him. Why?' She is not going to tell him about the photographs; she decided last night. 'I saw these photos,' she hears herself saying. 'At home, you know, West—' ' _Vest_ -minstaircourt,' he says, and something scrapes in her chest. 'Yes, and he was there.' 'So, right, yep. So they were best mates and then, I don't know, something happened. End of story. Let's talk about something else.' This is what she fears. Either he won't know a thing, or he'll tell her a war story so horrible that: what? The world will crumble and melt around them because nothing will be able to bear the truth? 'What?' she says in a small voice. 'Tell me. If you can.' 'I don't know.' 'Why not?' 'I just don't. You know what they're like, they'd die before they said, well, that they were dying. For example. It was something, God, hang on, let me think. Business, I think.' 'What? You mean as in Swiss banks with stolen paintings?' 'Course not. They, it was before I was born. In Pálaszlany. You'd have to ask Rozsi.' 'How can I, Pete? Think.' 'OK. OK. I do know, I just don't like talk— Never mind. So Zoltan, my Zoltan, was meant to inherit his dad's estate.' 'Did he have one? I didn't know.' 'Course. In the country somewhere. Pink house, horses everywhere. He told me,' he says, and she hears him swallow, 'they used to take off their shoes at the beginning of the summer and not put them on until they went back to town. So, yeah, he was meant to get the business, all of it. Whatever you need to make saddles for the Austro-Hungarian army. Lasts? Saddle moulds? I don't know. Anyway, Tibor got it.' 'What?' 'He, I don't know, lied about something. He was, I think he was working for my grandfather, Zoltan's dad, managing it. The steward or something, and he—' 'Hang on. He _lied_? About his friend? Where was Zoltan, anyway?' 'At college, wasn't he? Doing doctor training. They trusted Tibor, you know, he was local. Poor. His brothers and sisters took it in turns to wear one pair of boots to school apparently. And my grandfather loved him: his son's best friend. So he believed Tibor when he said Zoltan was morally . . . what's that word? Well, dodgy, anyway.' 'You're joking.' 'Nope.' 'But why?' Peter gives a mighty sigh. 'Because, because before Rozsi, so I suppose just before the war, when all this happened, Zoltan had a girlfriend. And she was, wait for it. Divorced.' 'Oh.' 'So that was obviously a big deal. She had a child, I think; there was some story about crossing borders in a diplomatic car. Anyway. So, after the, whatever, cheating, disinheritance, Zoltan came to England to make a new life with various people including Rozsi, who was the divorced woman's best friend from university. You must know about this . . .' 'No I don't,' Laura says. 'They never told me.' 'Well, they did, just when the war was starting, and there was a whole palaver about Rozsi getting forged passports and visas and things. You do know that bit?' 'No. Honestly. How do you—' 'Just things I've picked up. In any case, while they were risking their lives on a train to wherever, Belgium maybe, or Amsterdam, although there'd be all those canals . . . anyway, wherever, bloody Tibor, Zoltan's great friend, was copping off with, get this, the divorced woman!' 'No!' 'Oh yes. I suppose they'd split, in the chaos, but still: after all that fuss. Tibor just took over. He even married her. Bastard.' 'So it wasn't actually to do with the war? The falling out. The . . . betrayal.' 'Nope. Why would you think it was?' 'I, I just assumed. Never mind. Oh, poor Zoltan.' 'I know. And that's not all, bec—' 'Oh Christ,' says Laura. 'I forgot. They're waiting for me upstairs.' # _35_ Marina, feeling bleak and black, has just entered the dark passageway between the War Memorial and the Science Block. The stone is overgrown with creepers, which bodes ill but, she is thinking, if she holds her breath she will be half-protected. So, for once in her life, she is not expecting an unexpected meeting. But here are Guy, and Mrs Viney. Marina lets out a breath. Her mouth is dry; she can't think of anything worth saying, only frantic prayers: _Dear God in Heaven, if Thou has not forsaken me due to unbelief, please keep my family far away at this moment._ Her uniform grows itchy; she starts scratching her neck like a village idiot, then snatches her hand away and grips it behind her back. Now she looks like Prince Charles. 'How nice,' says Mrs Viney. She lowers her cheek to be kissed and, despite everything, a little flame of joy burns in Marina's heart. 'Oh,' she says. 'Golly.' Guy smirks at her. 'Wotcha.' But this chance conversation, on which so many hopes are pinned, does not go well. Marina seems to be becoming more, not less, shy; every movement she makes disgusts her. Mrs Viney seems bored. Or is it annoyance? Is she about to reveal that the ornament Marina broke at Stoker has been discovered? Just when she is wondering whether to confess right now, Guy says, 'Guess who's doing Prize-Giving tomorrow? Dad! Oh look, isn't that your mother?' And there she is, wandering happily through the Memorial Quad in her old brown coat. She kisses Marina, says a vague hello to Guy, says, 'Pleased to meet you,' in a frankly unfriendly tone to Mrs Viney. Guy is explaining how the person meant to be giving the prizes, a Commonwealth Games rowing champion who was in Bute House a million years ago yet was still taught by Pa Kendall, has had to cancel, so they asked his father at the very last minute. Marina can't concentrate on what he is saying. Mrs Viney must be annoyed with _her_ , but why? She is so polite; it is hard to tell. Marina takes a tentative step towards the mothers, one in beautiful brown leather boots, the other not. 'Oh, sweetheart,' says her mother. 'Have you seen Rozsi and Co?' 'Me?' says Marina, making warning eye gestures. 'No!' 'They were going shopping,' she says. 'There's that little boutique on the High Street and Zsuzsi—' 'Mum—' 'Don't interrupt, sweetheart. Rozsi and Ildi and Zsuzsi: are you sure?' 'Good Lord,' says Mrs Viney. 'What interesting n—' 'Mum, you remember Guy, don't you?' says Marina. 'Of course you do.' 'Sorry,' her mother says, frowning more than she needs to in the circumstances. A group of beefy men in Old Combeian blazers and long cricket jumpers stride past the entrance to the passage. 'Yes, Guy, I do remember. Are you in Marina's class too?' 'Not really,' says Marina. She is cold with sweat; her back feels oily. 'You . . . you're doing other A levels?' 'If only,' says Guy's mother. 'Actually Guy's only a Fiver. Though revoltingly precocious. They do get like that, don't they?' 'We-ell,' Laura says. 'But despite the vast age gap we've come to know and love Marina, haven't we, darling?' 'Have you?' asks Laura, frowning. 'When?' 'Oh!' says Marina. 'I've just remembered something. Pa Stenning. I mean, Daventry, Pa Daventry! He wanted to talk to you.' 'We'll let you get on,' says Mrs Viney. 'You sound terribly busy.' 'Oh yes,' says Laura offhandedly. She has, Marina realizes, no grasp of how to talk to these people. 'We are.' 'Of course you'll be at Al's speech tomorrow, won't you. You must come. I unfortunately will miss it but, er . . .' 'Laura,' says Marina's mother. 'Of course. Laura. Anyway, you must be there.' 'See ya later,' says Guy. 'Oh, by the way, wanna come out tonight?' 'Yes!' says Marina, glancing at her mother, who is now just standing there, not making conversation. 'I'd love to. Brilliant.' Her mother puts her hand on her arm. Marina pretends not to notice. 'Defi— absolutely. If you're sure? I mean, I'd love to. Yes, please. What time?' 'Dunno. I'll check. Crown and Mitre.' 'Oh yes, do,' says Mrs Viney, who clearly does not mean it. Marina's heart thumps hard outside her body. The Crown and Mitre is a forbidden pub; where the House Sirs go, and masters. 'Mum, Mummy. We'll . . . we'd better find Pa Daventry. We can decide later. Really. Now.' 'In a—' 'No!' says Marina. 'And in fact I suddenly feel ill. Please. Sorry, um, sorry,' she mumbles, barely able to look at Mrs Viney. 'I, um—' and she pulls at her mother's arm like a rude child, a hunchback, a beast until, with the least possible grace and dignity, she leads her away. 'But what about "All About Jazz"?' asks Laura. She is irritable, and overwhelmed; what I need, she thinks, is a diagram of how everyone connects. 'I don't need to go to that, do I?' 'Marina,' Laura says, more sharply than she had intended, and they both look up, surprised. 'Of course you do. We bought tickets. You can't just . . . forget.' 'Well, I did,' says Marina petulantly. 'And it's too late now. I accepted.' Laura can feel herself frowning. She irons out her forehead and tries to sound nice. 'Sweetheart,' she says, 'Rozsi will want you there. Don't be silly. Oh, my love, why are you crying?' 'I'm so embarrassed.' 'Why? How? You're so strange, pickle.' 'Don't say that!' 'I didn't mean—' 'No, you're right. I am. I am I am I am, and I just can't—' 'Oh no, you're not. You're wonderful.' 'You have,' sobs Marina, 'no idea.' 'Shh, darling.' 'I can't shh! I just wish I sodding— I wish I was dead.' Laura steps back. She takes her hand off her daughter's shoulder. 'You don't mean it.' 'I do.' 'Don't say that.' 'Why not? I do! I mean, I don't, but sometimes—' 'Shh. Shh, my love. I know.' They stand for a moment below the War Memorial, awkwardly embracing. You have to tell her about her father, Laura commands herself, now. Right now. But how is poor Marina to deal with that? When she is clearly so . . . Unhappy. Now she sees it, unmistakably clear, as if a cloth has been whipped off a cage, revealing a poor suffering bird. As if she, Laura, had simply opened her eyes. Marina has ruined everything. Now that it is too late, she can see perfectly that giving up on chemistry and medicine and her future was an act of madness, and not admitting it to her family makes it so much worse. History has not brought her happiness. Before she at least knew what she wanted; now all that ambition has been replaced by fear. Yet if she tells her mother any of this, she'll think that the Vineys were the problem, not a source of wisdom and hope. Even if they make Marina feel lowly, which they sometimes do, they have shown her how not to be base. They matter. The unhappiness is a sign that she's improving and changing, like steel turning blue in a flame. 'We could go out for tea,' says Marina now, but neither of them can think of anywhere. It is almost a relief when she hears the familiar cry of ' _Dar_ -link!' and turns to see three dressed-up old Hungarians noisily crossing the Quad towards them. It grows later and later, and the difficulty about this evening, the Crown and Mitre and all it entails, does not go away. Mrs Viney will be waiting for her, and Mr Viney, expecting to be amused. Only at the last conceivable moment, when her family are all in their seats in Divvers and Simon Flowers is probably about to come on stage to play 'My Funny Valentine', which Marina has always imagined him singing to her, does she manage to think of an excuse. 'Um,' she whispers to Rozsi, who is passing around a small bar of Swiss marzipan. Everyone else has packets of Revels from the stall in the foyer; in the raised seats on the platform along Divvers' right-hand wall, where the less important masters sit in Assembly, several connected families are toasting each other with rosé in plastic goblets. 'About later. The second half. There's a bit of a problem.' Zsuzsi leans forward interestedly. The scarf she is wearing was a gift from Mrs Dobos: turquoise zebras cavorting on a mustard-yellow tundra: ' _Ja_ -jare,' she confides frequently which, after a surreptitious look at the label, Laura translates as Jaeger. She is also wearing what she calls her ' _ev-_ ening-troo-sair', bronze-coloured slip-on shoes and a very long gilt and green-glass necklace. 'Vot is this problem?' she asks, with no attempt to lower her voice. 'You menstruate?' 'No,' hisses Marina. 'Vot? Vot?' 'I've got . . . to go to this thing,' she says. 'A . . . a concert.' 'Ve are at a concert, _dar_ -link,' says Rozsi. 'Vot a silly.' 'No, it's more classical. Classical music. Do you, I mean, sorry, I know it's a bit odd. I mean, in the interval,' she adds. 'About then. Really. I was inv— I mean, asked to help. They need help, just round the back. In the wings.' There is, isn't there, a slight possibility that Simon Flowers, gazing wistfully out over the audience as he plucks his jazz guitar, will look for her? Will he abandon his secret plan to woo her once he sees that she has gone? They sit through 'In a Groovin' Mood' and 'Mello Madness' in awful silence. Laura fixes her eyes on the velvet Alice band worn by a woman in the next row until the woman's husband, with the radar of the sexually undiscerning, turns around and smiles. She is going to have to speak to Marina; this is unavoidable. Could she lead her outside? She doesn't dare. Ten minutes later they are still trapped. Zsuzsi leans across her. 'What do you say is programme of your little concert?' Marina rips at her cuticle with her teeth. 'I can't remember. Maybe . . . Liszt?' Blood is seeping through the culvert. Laura, to stop herself from gripping Marina's hand, sits on her own. 'Better you wait until this concert finish,' says Zsuzsi firmly. 'Then we go together.' 'But,' whispers Marina, 'I have to run back to, to change. Into work clothes. It'll be dusty,' she says, giving her mother a desperate look. 'Peh,' says Zsuzsi. A better mother would make Marina stay. Laura is too busy; she is thinking of the enormous gaps in what Peter told her, the story of his parents. Would Ildi explain, if shown the photographs? So when, in the interval, Marina says, 'Sorry, sorry,' already on her feet, her eyes wet, what can Laura do but move her knees aside to let her pass? ' _Tair-_ ible,' says Rozsi, shaking her head. Laura touches her hand: veiny, vulnerable. She has never stood up to her in-laws but now she says, 'Could we maybe let her go, just this once?' # _36_ Now that Marina has escaped, she should be triumphant, not ridiculously nervous. She rushes into the Ladies' toilet and instructs herself to be calm. With a shaking hand, she takes her first-ever lipstick, Barely Berry, from her coat and begins to apply it using her reflection in the toilet-paper dispenser. Is the colour meant to be that dark? She needs to check in a normal mirror but people's mothers are talking outside now, and girls whose voices she knows. She cannot face them. And she is already late for the Crown and Mitre. She dashes out of the cubicle, head down, sidesteps clumsily around the queue and realizes a little too late that she has come face to face with Zsuzsi, weakly pushing open the doors with her Harrods handbag. 'Oh my God,' she says. Zsuzsi lifts both her eyebrows. She lowers her handbag. This should be the moment when her great-aunt, always such a fan of romance, twinkles at her and sends her on her way. But her face is stony, like a pharaoh. 'So,' she says. 'Lipstick you are wearing.' 'I—' 'Where do you go?' Zsuzsi asks. Marina lowers her eyes. Combe girls, some from West Street itself, are staring, and Zsuzsi's voice is not at all muffled by the sounds of banging doors and flushing. 'No,' she begins, 'really—' ' _Nev_ -airmind,' Zsuzsi says, waving her hand dismissively: a pope granting a day's reprieve. 'Tomorrow you tell us the story.' Laura, after a fruitless search for yet another pay phone, hurries back across the courtyard to Divinity Hall just as the interval bell is ringing. However, there seems to have been a misunderstanding. Rozsi, Ildi and Zsuzsi are waiting impatiently in the foyer, whispering noisily in Hungarian. From inside the hall comes a taste of what they are missing: an electric guitar solo loosely tethered to 'Young, Gifted and Black'. 'I am tired,' says Rozsi, looking thunderous. 'It is _tair_ -ible. We go,' and, before Laura can appease her, she finds herself being herded back down the stairs. It is only when they are standing on the tarmac outside Divinity Hall that Rozsi announces their real motive. They are going to look for Marina. Marina is missing; she has lied. Combe, mildly picturesque by day, becomes at night a labyrinth of dark terraces, Chinese fish-and-chip shops, boarded-up old buildings papered with advertisements for Thin Lizzy tribute acts and the World Wrestling Federation. Laura marches ahead, trying to give the impression of firmness, questions nipping at the edges of her worry. Arm in arm, the others mutter incomprehensibly behind her. 'Isn't she just, you know,' begins Laura, 'doing what she said? Helping at a concert? With, maybe, friends?' 'Friends,' scoffs Rozsi. 'Don't be funny.' They send her into the Indian restaurant on the High Street, full of flocking and copper urns and Combe families demanding poppadums. Then a wine bar, 42nd Street, although Marina doesn't drink so could not possibly be there, and an Italian restaurant apparently trapped in the Fifties, where spaghetti is served with lamb chops and steak, like a vegetable. 'Would it not be easier just to go back and ask at that place, West Street?' she says, trying to think even more quickly than Rozsi. ' _Hihetetlen_ ,' she hears behind her, which is never a good sign. She turns. Zsuzsi and Rozsi are arguing in Hungarian. Ildi, helpfully in English, says, ' _Dar_ -link. Rozsi think we go back toward the what-you-call-it, _cot-_ edrol, maybe we see her then.' 'There isn't a cath— oh, you mean the ruins?' says Laura. 'We are looking halfway towards London for this concert,' says Zsuzsi, 'but no. _Tair-_ ible, what she do to us.' 'Oh. Well, can't we just— you could go back to the bed and breakfast,' Laura says, 'and I'll keep looking for her. She can't be far.' 'Don't be _rid_ -iculos,' says Zsuzsi. 'You do not have my sharp eyes.' 'Well, true. Aren't you hungry? We could go into town for a baked potato.' Rozsi loves baked potatoes. 'There's a vegetarian café, it looked quite cheap,' Laura says and, as she glances over Zsuzsi's shoulder, trying to remember where they passed it, she sees a pub over the road, a big glass window, a sign swinging in the cold Combe wind: the Crown and Mitre. She had forgotten. Marina's evening in the Crown is not quite as she had imagined. Mrs Viney is not at the pub after all. No one talks to her. She finishes her first half of cider very quickly. Two beer-mats are lying in peeled layers in front of her, and several crushed crisps; she accidentally knocked most of them on the floor, which made everyone groan in disgust. Simon Vass, a Dene House Upper with enormous rugby shoulders, has bought another round of beers and, for Marina, a vodka and lime. Guy, talking football, ignores her. The evening she had in mind had featured red wine and intellectual conversation, a certain relaxing of sexual mores. Cornucopiae. And if she is, well, bored, shouldn't she be doing something better with her time, such as applying her historian's mind to the mysterious Farkas–Viney connection? Like the young Queen Elizabeth on the eve of accession, she is willing to take up a hallowed burden. She wants to start. God, what if it _is_ to do with the war? She can see herself quite clearly, on the watered-silk sofa in the drawing room at Stoker, leafing through a photo album and spotting Guy's parents at a Mosley garden party, or marching on Belgium. Could she ask Mr Viney about it? Perhaps, if she can dare herself. She reaches for her now empty glass and, as she does so, Mr Viney changes seats. 'So, young Hun,' he says. 'We meet again, again. How nice.' 'Yes,' says Marina, her resolve evaporating. His eyes are so pale that you can't help staring at them and then you're trapped there, gazing into his soul. I need alcohol, she thinks. There should be a way of buying a drink just for yourself and a specified other: a half-round. A crescent. 'What are you smiling about?' 'Nothing.' 'You are.' 'I'm not. I— you shouldn't be on that stool,' she says. 'Don't you want the bench?' and she shuffles up. 'You're very kind,' he says. 'I'm just being polite,' she explains. 'I believe in it for old, I mean—' 'I see,' and, as he stands, something over her shoulder seems to catch his eye. He goes still. Marina, hoping for bank robbers, twists round to look at the street outside. A little group of people is standing on the opposite kerb. She turns away, only ninety degrees, then turns back. It is her grandmother, her great-aunts. And, looking straight at her, her mother, her beloved, who will ruin everything. Their eyes meet. At that moment, Ildi touches her mother's arm. Marina thinks: this is her Judas moment. She will tell Ildi now about Guy; she will betray me. Slowly, not breathing, she looks again at Mr Viney, who is still standing above her, staring into the road. He seems puzzled, as if he is thinking hard. Then he lowers his gaze to hers. They stare at each other, seriously, adultly, almost, you might think, nakedly. She sees the questions he could ask her, suspended in those cool pale irises. She holds his gaze until he snaps his eyes away and his expression clears. 'Well, well,' he says thoughtfully. 'I hadn't—' Guy leans over. 'What are you doing, you weirdo? With your neck all twisted, you look like the Loch Ness Monster.' 'Enough, Guy,' says his father. She has begun to sweat. 'I'm just, you know, a bit stiff,' she says. Any moment now Guy will say, 'Hey, Reen, isn't that your mother again?' but it hardly matters any more when a pack of furious geriatrics is about to burst into the pub. Rozsi will hit him, as she once hit that policeman. Where are they? Outside, a yard or two beyond the glass, her fate is being silently decided. Don't look. Don't look. She looks. The street outside is empty. They have left her here. She is still staring, mystified, out of the window when a big hand falls lightly on the nape of her neck. 'I know what the matter is,' she hears Guy's father say. 'It's bloody freezing by this window. Your muscles must be seizing up,' and he begins to massage her: her neck, the top of her back. 'Were those women outside looking for you?' 'No,' she says. 'Well—' 'No matter. You're here now,' he says, squeezing her shoulders. 'Don't be prudish. I do it all the time to my children. Come on, submit.' What makes Laura pretend not to have seen her daughter? Not sensitivity, not quick thinking but a sort of dumb defiance, creeping up her spine. Everyone needs privacy occasionally, a bit of leeway. She licks her lips, clears her throat, asks herself what harm it can do for her daughter to be in a mixed group like that, fathers and schoolboys in a public place: not with a stranger, alone. Then, when she has summoned her nerve, she says to the in-laws, 'You know, I'm sure I did see a sign about a Liszt concert, in the, the Underhall, Underthing. That does explain it: even the lipstick, Zsuzsi. It's good if she's trying, isn't it?' Then, 'Oh look, isn't that the wife of the cabinet minister who went to prison?' Miraculously, it seems to work. Besides, her in-laws need an early night. They are leaving for Femina early tomorrow morning, just after the historical pageant but before the Founder's birthday champagne reception and Prize-Giving ('They do not give Marina presents. Why do we care?'). So it makes perfect sense to send them back in the miraculous taxi at the rank right by the school, while she waits for her daughter's return. But what to do? Every shop and restaurant in Dorset will be shut by now; it is too late to drug herself with tea and cake, or the mild provincial shopping she secretly longs for: mead-based cordials, tea cosies, imitation gargoyles. She finds her slow way back to West Street, her legs aching brutishly as if she has been poisoned. It is a bright cold night: a night for endings. When Marina comes back from whatever she was doing in that pub, Laura will take her somewhere, to an appropriate place for this sort of conversation. She will face their troubles, speak frankly, and sort everything out. But at West Street stringent Founder's Day safety measures are in force. Without a Blue, whatever that is, she can't even enter the building, let alone retrieve her own child. She has no choice but to leave a short inarticulate note and wander off, deeper into Combe, where she does what anyone in her position would do. She sits on a cold wall under a dripping tree outside the Combe Conservative Association, with Peter and Marina and Alistair Sudgeon and now poor Zoltan, and weeps quietly for an hour. Having only sat in the front of a car once or twice before, Marina is not an accomplished strapper-inner. Now she burns with a fierce hot humiliation. Maybe she shouldn't have tried to hide the open buckle under her arm, but he shouldn't have told her off like a child. And she is not drunk, hardly at all, just a little bit spinny. In fact, should he even be driving? It is very kind of him to offer her a lift to West Street but, she wants to reassure him, she's often walked back drunker than this on Saturday nights, everyone does. It isn't far. She can't think of anything to say. She watches his hands on the steering wheel; she can see, despite the darkness, the flat wide fingernail, the muscle at the base of his thumb, the hair on the lower section of each finger and the backs of his hands. She wants to be in bed but, when he suggests the scenic route, where they could look down on Combe from a Roman bridge or something, she says, 'Yes.' Maybe it's being away from school but he seems funnier and cleverer with every passing minute. They feel like equals, or something close. 'Tell me about yourself,' he says, with a smile in his voice. 'What _interests_ you, Marina?' and she starts to talk, not so much about her vestigial hobbies, the neglected fossils and star charts, the practically first edition of William Golding she found in a charity bookshop in Fulham Broadway, but about, for some reason, school. And he helps her, guiding her into deeper revelations as if he is strewing breadcrumbs, leading her through – presumably, out of – the woods. He is particularly understanding about how girls like Marina are coping with Combe life. She finds herself going into more detail than she had intended, as, she imagines, a woman confiding in a man friend might feel, if the friend was powerful and clever and had a silver car and hair on his forearms. It is enjoyable. It should not be, but there it is. 'And so there's a certain amount of . . . association?' She glances sideways. Although he is driving fast he turns to grin at her, and it is quite a sexy feeling, knowing that this man, her friend, will tomorrow be standing in front of the entire school handing out prizes. He genuinely wants to know what she thinks. 'Er, yes. I think so. Yes.' 'And is that what you expected?' 'I—' 'I mean, before you arrived at Combe. Sex, of course. I'm sure I didn't need to tell you that.' Once she would have been too tense, too virginal, to talk like this but that has passed. 'Well, it's funny,' she says. 'But, well, I was quite . . . hopeful. I just didn't think that, that I—' 'What?' 'Well, I was at a girls' school. And I didn't know any, you know, boys. So the thought of—' 'Of coming here.' 'Yes. And, well, meeting some . . . I was ready to. If you know what I mean. I wanted to get, get going.' 'Go on.' 'No, that's it.' 'So,' he says, smiling, 'would you say most of the girls have boyfriends?' 'Well—' 'And, even apart from parks, and cinemas and what have you, the boys have study bedrooms?' 'Some of them. But—' 'Because one might think, if they do, the masters are being a little naïve.' 'How, how—' 'I expect they're at it like rabbits.' When he says that she feels it all over her body; her skin seems to ruffle with excitement. Everything about this conversation is exciting; it is what she has dreamed of, over and over again. 'Forgive me, but it's true,' he says. 'It's not—' 'Oh, believe me, it is. I've been a seventeen-year-old boy,' he says. She bites her lip, looks at him quickly, puts her hand to her neck to cool down the spreading flush. 'And let me assure you, it would have taken a great deal more than a closed door and an incompetent headmaster—' 'But—' 'Don't interrupt. To have kept me from fulfilling my, well, baser urges. Of which I had many. Still have, in fact.' There is too much here to comprehend. Marina sits in silence, staring out of the window. Then he stops the car. They are on a paved platform beside a big stone bridge, looking down on the twinkling lights and inky countryside of Blackmoor Vale. An urge to confess, to seek help, overwhelms her. 'I just didn't think that I, I'd get a chance.' 'Why not?' 'Well.' These are deeper waters than she had anticipated. She swallows hard but tears still spring to her eyes. 'I, I'm not, not the type that they want. The boys.' 'Oh?' 'It's true. I'm not, not blonde, or thin, or pretty.' She gulps audibly. 'Come now.' 'No, it's true.' And then, because she fears she has insulted his son, she says, 'I mean, Guy is lovely. But we don't have that much . . . I mean, he's younger than me, and I like books—' 'Oh, Marina, Marina. It was ever thus. Brainy girl meets hunky boy and, within about ten seconds, is disappointed.' 'Not dis—' 'May I be frank with you?' 'Oh,' she says excitedly. 'Yes. Please.' 'You will be so much happier when adult. You need experience, young Marina, and one day you will have it. I see you with someone older. Don't you?' Where _is_ Marina? This is getting ridiculous. Laura can hardly hang around the school until pub closing time, hoping to bump into her own child. It would look strange. Besides, what if those Vineys turn up again, that cocky son or his thin ethereal somehow old-seeming mother, like a dowager duchess in the body of a twenty-year-old? She has courageous impulses but not the courage to act upon them; at least, not yet. Then something else occurs to her. For all these weeks Laura has pictured Marina painfully attentive in lessons, or standing on a staircase chatting to friends, as they do in the school prospectus. Until now, sex, hormones, the limitless urges of male adolescents, have rarely crossed her mind. But it is a boys' school, run by men – there does not seem to be a single prominent female teacher – with girls just parachuted in. For all its trumpeting about safety and maturity, does Combe know, or care, what goes on behind the study doors? Surely anything could happen. As if a slide has been snapped in place, she sees another image: Marina roaming free. She has given up her A levels without telling them, she has changed everything, lied, pick-pocketed probably, all under the uncertain influence of these awful Vineys. For, even if their unknown crime was decades ago, in Hungarian years it is recent. Forgiveness is out of the question. Laura has to warn Marina about the Viney family; not just for the sake of Ildi and the others but for Marina too, who may be going wrong just as her mother did before. Where is she? A little impulse murmurs: _find her_. But Laura is tired, and familiar with unreliable impulses: pinches of fear on which she usually acts, making everything worse. Resist it, she tells herself. Be strong. Everything is bad enough already. Besides, if she hurries back now to awful Braegarrold, she might find a pay phone on the way. She is losing heart. Combe itself is vast and, as Founder's Day has ended for the most part and Marina will have been packed for days, she is not likely to hurry back to West Street, particularly if she is having fun, with friends. She could be. Wandering along Upper Garth Street, Laura assesses the Combe pupils, immediately identifiable among the local teenagers by their pink cheeks and raised voices. They look at her strangely; true Combe mothers are inconspicuous. Could her daughter ever be one of those laughing girls, tossing their curtains of hair? There is simply no point in hanging round hoping to meet her by chance, she tells herself. Marina's perfectly fine; stop worrying. You might as well just go back to Braegarrold, and wait for morning. Marina does not want to be rude. Mr Viney, call me Alexander, is just being kind and interested. Hasn't she longed for this? And it is, although it shouldn't be, exciting. It's just that she's not quite sure they ought to be having this conversation, far from school on a bridge, in a wood, at night. For the first time it occurs to her that there are fields all around: no one in sight, or even earshot. She isn't frightened exactly; he is an adult, and she is actually quite an experienced young woman. Besides, hasn't she loved it so far: being seen in the pub by people who recognized him, talking to someone who is, at last, mature enough to understand her? She has imagined this, and more, when she is alone: so much more, some of it in this very car. Something in his voice tells her he understands. With a click and a zipping sound he undoes his seatbelt and flings it back across his chest. He stretches his arms out. 'Free at last. You know,' he says, looking out over the lights. 'The odd thing is that I feel terribly youthful.' 'Yes?' 'Entirely. As young as you. If we were . . . If I were closer to your age, and all things were equal, which of course they're not—' 'So true,' says Marina wisely. 'I can imagine great things for us. Great things.' 'How, how do you mean?' He turns to her: head, then shoulders. 'You in that little school shirt of yours, like a village maiden,' he says. The strangest thought pops into her head: somehow all this talking means that he is going to kiss me. Shouldn't I stop him? Those lips have kissed Mrs Viney. She thinks: I don't know what I want. But it seems that Alexander Viney does. # _37_ Ildi's voice in the quiet night: 'Something bothers you?' Laura gives a little jump. She has lain in her nylon bed, she thought silently, for hours, has rolled around and sighed and probably muttered to herself like a loon, thinking that Ildi was asleep. 'Oh God,' she says. 'Sorry. Did I— I woke you, didn't I?' 'No. I am awake.' Then Ildi says, 'So, it is worse than we think.' 'Sorry, what is?' says Laura tentatively, although of course she knows. 'You take from Marina the book?' 'You you mean— ' 'By the man. You take the book?' 'Well,' says Laura. 'I did try. I'm sorry. We, we argued. But anyway it seems . . . ' 'Yes,' Ildi says. 'Well, now I tell you, and it will stop.' Laura opens her mouth, then closes it. The silence booms. 'About the author? Alexander Viney?' she asks. 'But, you see . . . well, I think I understand.' 'I do not think,' says Ildi, firmly, 'that you do. Only we with Rozsi and Zsuzsi know some things about that family. Now I tell you, too.' 'Why not?' Something has gone wrong. As Marina had feared, talking to Mr Viney has turned into being kissed. She did not mean this, at all. Or did she? Her body seems to feel differently. 'Sorry, I—' 'Why?' 'I'm shy,' she says, to salve his feelings. 'You're not shy! After what you told me, about you girls at school, who gets up to what. It's not exactly chaste, is it.' 'But I didn't . . . I hadn't . . . someone might see.' 'A passing farmer? Who cares? Haven't you heard of animal husbandry? Goes on all the time.' So, imagining horses, she lets his hand stay on her tights leg, and the other up her blouse. His hand is cold, or her skin is burning, which is worse because then he will know that she is excited. Oddly, she preferred the talking before the kissing, when her two lives, real and imaginary, seemed to be merging like spots of coloured light. But now the tingling excitement in her brain and skin and so forth have been transformed into nervousness, which is ridiculous; he is a man, a father. A husband. Famous. Nothing bad could happen, whatever that means. She feels she should remind him about Mrs Viney. But Mrs Viney is crushed between them, like the scar in _Thérèse Raquin_ : under his fingertips, on his mouth. 'Come on,' he says, and bends over her again. It is interesting (they could discuss this, were he not preoccupied) how being desired, pressingly, urgently, had always been the greatest excitement she could invent, yet in real life it feels quite different: more frightening. Distantly she spies another gap in her knowledge. Is it possible that, for Mr Viney, kissing might not be an end to itself but, via some as yet unrevealed route, lead to sex? 'You silly little girl,' he says. 'Come here.' But can he be stopped? It seems that she has accidentally given him permission, and she can't offend him by taking it back. When his hand slides up and then down into her tights, she gasps; she can't help it. 'Hello,' he says. 'Someone is pleased.' 'Please, I . . . hang on,' she says uncomfortably. She is expected to lift her bottom a little, to let him pull her knickers down to the top of her thighs; she averts her eyes from the sight. Her breathing is jerky. 'I'm not sure . . .' 'Don't be coy,' he says. 'I know what I know.' 'No,' she says. 'But—' 'You've just been telling me,' he says, 'about your constant visits to the New Street—' 'West Street.' 'Wherever, the girls' bathroom. Unmitigated filth. You can't deny your intentions, surely.' 'What intentions?' Together they look down at his corduroy lap: trousers in unexpectedly new navy needlecord, in which there is a definite bulge. He's right. It is completely her fault. And isn't it the greatest compliment: a bodily reaction to, presumably, her beauty, her intelligence, her sensitivity? It confirms her; she is viable. Gingerly she puts her hand there, in homage to the honour it has done her, but she cannot help starting away almost immediately when his big hand approaches her skirt once more. This time he ignores her reaction completely. Her face is being squashed into her seatbelt, which is still done up; it crosses her chest between her breasts, pushing one towards him. It is like being murdered; he is looming over her, pressed against her leg, and the susurrations of the moving corduroy and the thickness of his breathing as his fingers push in and up . . . she bites the inside of her lip. It hurts, and she is frightened, and suddenly very very sorry that she made him feel this way. 'Come _on_ ,' he says in a clotted voice. He is fumbling at his lap, but she pretends to them both not to notice; she moves her bare legs infinitesimally closer together and looks out of the window, into the darkness. 'Christ,' he says. 'Move over, can't you?' 'I'm a bit . . . wedged,' she says. Then she feels it against her leg, like a dog's nose; hot and faintly sticky. There is that hot smell again, like, like . . . She catches her breath; she closes her eyes and a tear rolls beneath her eyelashes and splashes off her nose. 'Sorry,' she says. 'For God's sake!' he says. 'What is it now?' 'I'm sorry.' 'What?' 'I can't.' 'What do you mean? What the hell do you think you're doing?' 'Nothing.' She thinks: if he's expecting it, I probably have to let him. But he looks disgusted. 'I just—' 'Christ,' he says. 'Don't cry _now_.' There is a pause. She keeps her eyes closed. Then she hears him exhale sharply, angrily, and a rustling sound as he tucks it into his trousers. He throws himself back in the seat. She keeps herself rigid, closed up like a seashell, until his breathing has slowed. 'Sorry,' she says again. 'I . . . I didn't realize—' 'Now you do,' he snaps, and starts the car. # _38_ _Thursday, 16 March Founder's Day Week_ 10 a.m. Combined Cadet Force display, Memorial Quad, free 11 a.m. Champagne reception, to the foot-tapping sounds of Mr Daventry's Barber Shop Quartet – Founder's Court marquee, free 12 a.m. Prize-Giving featuring Tim Pirrey, Commonwealth champion rower and OC, Divinity Hall, free On Thursday morning, the climax of Founder's Day, Rozsi and Ildi and Zsuzsi and Laura sit at breakfast in Braegarrold, ingesting mixed-fruit jam and battery eggs. Their bags are packed; Mrs Cousins had already stripped the beds, revealing mattresses which might have been better hidden. In the gap between the historical pageant and the pre-Prize-Giving champagne reception, Laura will be alone with Marina. It is all going to have to come out. So, while the others discuss their charming hosts in Hungarian and silently rock with laughter, Laura tries to prepare her material. One: the best friend, Tibor Szőllőssy, essentially robbed Zoltan of everything: the estate, his former girlfriend, his father's love, all of it. This is the story Peter told her, now, with Ildi's accent and place names, given flesh. Two: but Zoltan forgave him. At least, he carried on seeing Tibor Szőllőssy, and the divorced-woman-now-wife, once they reached England. But why? The Farkases and Károlyis are not like that; they will strike someone from their lives for a funny look outside a newsagent. It makes no sense. Wait. Didn't someone, Peter maybe, say that the divorced woman, who was poor Zoltan's girlfriend, and then Tibor's, also knew Rozsi? That she was a college friend, a fellow girl-undergraduate pioneer? Might this be the reason? Three: in any case, Tibor's son then robbed Zoltan in the mid-Seventies in London; at least, as she understood it from Ildi, he asked to borrow a huge sum of money which, as a fellow countryman of Tibor, honourable Zoltan naturally let him have. And then he failed to repay it, which somehow led to the downfall of Femina, and its sale to Mrs Dobos. Four: and to Zoltan's death? Can that be right? Five: Tibor Szőllőssy's son is . . . hang on. Can Tibor Szőllőssy's son really be that historian? Marina's boyfriend's father: is that who they mean? It seems so unlikely; they must have made a mistake. Or could the Vineys have planned this all along? Marina has already told her that Guy's parents live quite close to Combe, near Salisbury just over the Wiltshire border. It's not so odd if they sent their bloody son to a school like Combe. Combe is the sort of school that kind of person likes. If anything, it is odder that the Farkases sent Marina. Laura pokes at her watery bacon. Why did we? Into her mind comes the voice of Mrs Dobos, recommender of Combe. Mrs Dobos will know all the answers; Mrs Dobos who bought Femina . . . hang on. Laura looks up cautiously, to find that Rozsi is looking at her, shaking her head. 'You are not listening one little bit,' says Rozsi. 'But today we leave you with Marinaka, so you wake up now. We, with Ildi and Zsuzsi, leave you in charge.' Ten past eight, and Marina has not gone to breakfast. She has never broken a school rule like this before; there will be such trouble if she is discovered up here, in the West Street second-floor bathroom, scrubbing at her thighs with a flannel and groaning with self-disgust. Last night she lay awake until the dawn chorus, listening to seagulls or vultures squawking their mating songs, reminding herself that Mr Viney had done her a great honour and trying not to think of the seatbelt or the car on the bridge, the press of his corduroy. Curiously, although her body feels terrible, her mind, hanging high above thought and feeling, is alert. Her thoughts move in slow motion but with clarity: I made him feel bad. It wasn't _rape_. Maybe I should have done what he expected: an older, a distinguished man. He'd have been gentle. No one will ever volunteer to do that for me again. Now he never will. Thanks to her frigidity, she was not deflowered. Instead she had stared out of her window while he reversed quickly back along the bridge and then, frowning, drove out to the hill road down to Combe and Melcombe. 'I, I love the country,' she'd said. 'The way the trees, you know, arch over the . . . it's one of my favourite things.' 'How original.' 'What do you mean?' 'Never mind. I'll take you straight back. Kindly keep this to yourself, though. More for your sake than mine.' 'Yes. I mean no. Thanks, thank you.' He had given a little snort. She wanted to lighten the mood, like a good hostess; make him forget his humiliation and disappointment. To think that she could move a grown man's trousers so. 'Sorry about, er, you know.' There was a pain in her throat. 'Will you be OK? I mean, without . . . relief?' He ignored her. She thought of penises, engorged past the point of recovery; alarming stories told in West Street, after dark. She bit her dry lips. 'Your . . . interest. I'm very, well, it's lovely of you. But won't you—' He turned his head and looked at her. 'I expect I'll get over it,' he'd said. One day, Laura has always hoped, she will have to punch someone for her daughter. It would be more satisfying to have to lift a bus to save her, or sacrifice a limb, but physical violence would be better than nothing: a way to express the white heat of motherhood, the helpless rage. Standing now at the War Memorial in the drizzle, watching Combe's young soldiers stamping and shouting and waving presumably plastic bayonets, she can imagine herself grabbing a weapon from a boy and running riot. How dare that man, that family, take advantage of Marina's ignorance? Poor Zoltan cheated, denied of his inheritance and then, and then— She looks at her daughter, just as Marina turns and stares back. She seems very flushed: tonsillitis, probably, which would explain her oddness yesterday. Maybe the only wise thing I've done so far, she thinks, was not to have told Peter that the Viney son, grandson, is at Combe. I may have made my life as complicated and unmanageable as possible by failing to tell anyone that Pete is alive, but at least he won't be blundering onto the lawn at Combe, drunk and shaven-headed, to accuse the Viney father of embezzlement. Isn't that Marina's housemaster, bellowing at the little boys? I can't ask Marina about last night, Laura decides; she's barely speaking today. Must I tell her off about going to the pub? I suppose I should, and at least then I can stop wondering who those people at the Crown and Mitre with her were, the man who was standing up, facing the window. He could be any respectable adult – a teacher, a parent – but, still, should Marina have been there, unsupervised, with him? She tells herself this, but she knows the truth. The last quill-waving Elizabethan poet and bowing courtier and merrie minstrel have passed. The historical pageantry is over, at least for this year. Marina has taken two Pro Plus, which was a mistake on top of instant coffee. Her brain feels tangled up in an enormous knot; her heart is fluttering but the rest of her is still half asleep. Everyone at school now will have heard her family's accents, and seen their shabby suitcases propped beside them while the CCF marched past. When she comes back next term she might have a nickname, a horrible one. She thinks: how can I come back? Except of course she can, and will; she has had that thought countless times since starting at Combe, yet here she is, still a coward. Everyone is congregating on the Founder's Lawn, although the champagne reception isn't for a couple of hours, and then it will be Prize-Giving, with A Special Guest. All this time she has not let herself look at Mrs Viney, who is frankly beautiful in a greenish suit with a long straight skirt, but she can resist no longer. Everything about her, her hair, her skin, her figure, her smile, makes Marina want to cry. She should catch Mrs Viney's eye, give her a wave or a smile before she drives off to Stoker, but Mrs Viney does not look at her once. So Marina kisses Rozsi and the others goodbye; she tells them that she has to go and talk to a master, which even her mother believes. Her legs feel stiff; her bottom lip is trembling. Off she goes. Laura, at the first possible moment, is going to do something about those Vineys. But what? She needs guidance, but no one can give it other than her mother-in-law and the aunts, whom she is escorting towards Garthgate and last night's taxi rank. How can it be so difficult to ask any of them what happened? Laura's mother liked nothing more than an ailment or a crisis, but the in-laws' refusal to discuss painful matters has grown upon Laura like a shell. Upsetting poor Ildi still further, even approaching Rozsi, whom she is hurting so much already, would feel like a criminal act. ' _Dar_ -link' she hears behind her and obediently she turns. She is already carrying both big suitcases, but now Zsuzsi is standing in the middle of the pavement, oblivious to passers-by, holding out her handbag for her niece-in-law to take. 'It is _ri-_ diculos,' says Zsuzsi. 'I do not lift. I am old lady.' Rozsi and Ildi, crossing Upper Garth Street arm in arm, are talking, their old heads close together. She sees Rozsi shrug. This morning, with her sunglasses and lipstick, Zsuzsi is wearing a short silver-fox jacket borrowed from Perlmutter Sári, her black ' _sol-_ opette-troo-sair, _vair-_ y smart', a silky blooze in silver and black, silver wedge-heeled sling-backs and a great gold 'necklet' like a medal. Her perfume is stunningly powerful. Instead of taking her bag, Laura puts a hand on her arm. 'I need to ask you something,' she says. # _39_ Marina is tearing in half a term's worth of artistic postcards. She can't bring them home to Westminster Court, with Combe's polluting address upon them; nor can she throw out all these sweet family messages. This seems the logical solution. What should she do with her uniform? It feels like folding up plague-infested cloth to bring into the flat. She is behind schedule already. West Street girls are supposed to have finished packing last night. She is just watching Heidi lock her vanity case when someone knocks on the door. 'Hello, Hel, Heidi. Heidi. Marina sweetheart,' says her mother. 'What are you doing?' 'What are _you_?' says Marina. 'You're meant to wait outside. I said. Will we manage all my stuff ?' She is sounding unwelcoming; she is past the point of self-control. 'Lovely to see you, Mrs Farkas,' says Heidi, the creep. She starts saying things like 'Could you possibly tell me if my valise is going to close?' and 'I don't know how to get the Blu-Tack off'. Marina waits for Heidi to go, unable even to look at her any longer. She needs to start touching home-related objects. Her hands twitch with the effort of keeping them to her sides. She pretends to be straightening her mattress; it looks like a hospital bed after somebody has died. 'I must dash,' Heidi says at last. 'My father's here. I heard his Jag pull up.' Now they are alone, looking at each other. There is a strange warm heavy silence. Marina says, 'Actually I don't feel very well.' Her mother sits down on the edge of the mattress of death. She says, 'I need to talk to you,' and Marina falls to the floor. Laura thinks: she's dead. I have to die. Then Marina blinks. 'What happened?' She sits up. 'Am I all right?' 'Oh, thank God, I don't know. What did happen? I think you fainted, my poor love. Do you feel bad?' 'Did I?' says Marina. 'Really?' 'Are you feeling sick at all?' 'No. Actually, yes. Well, a bit weird.' 'Look, sit, no, like this, your head . . . that's right.' 'Like in a book,' says Marina, muffled, but it sounds as if she is smiling. 'Haven't you fainted before? I should know that, if you have, but—' 'Never. I'm just tired,' and, briefly, she leans her forehead like a pet against Laura's upper arm. Laura stiffens. Her desire to seize Marina and hold her is so strong but she has learned this, at least, from motherhood: do not react to love, or it will go. 'Are you sure?' she asks in an unnatural voice. 'Sure.' Marina takes her head away, gives a little smile, brushes her hair from her face. Then she says: 'Mum, I need to— Look. There's a thing.' So this is it, thinks Laura with the benefit of foresight: she has found out about Peter. I have to confess everything and then we will be permanently estranged. Tell her, says what remains of her conscience. Where should she begin? She can't just come out with: 'Your father is alive but maybe not for long and is sorry and wants to see you and by the way I want him all over again.' 'Look, Mum . . .' But, if she tells Marina, in the crying and blaming which will follow the story about the grandparents, and Mr Viney, will be lost. Isn't that more urgent? What if they bump into each other and have a hideous two-family brawl on bloody Garthgate? Prioritize, Laura tells herself, but she is scared to. She knows that she must tell the old story first but not how to make herself say the words. 'Sweetheart,' she says quietly, 'just let me . . . I need to think.' She grips her left hand with her right: go on, she urges herself, viciously. 'Mum— Mummy. Mum. I—' And what happens if— ' _Mum_.' Marina is looking at her: her dear pale face. 'I have something to tell you,' Laura says bravely. 'No,' says Marina. 'There's something I've got to tell _you_.' Two seconds before, Marina swore herself to secrecy. But Mr Viney keeps bursting into her brain; she hadn't meant to say anything, but now she has begun. This is a desperate situation. Her mother looks worried. What if, thinks Marina, I tell her and she goes on the rampage? Shouts at Mr Viney? _Mrs_ Viney? Oh God. She clears her throat. 'Look, will you concentrate? It's really important. I . . . I can't deal with it by myself. I need you.' 'I'm listening,' says her mother. 'I did a mad thing.' 'How mad? Oh Christ. Marina, not now.' 'What do you mean?' 'What have you done? Hell, no, no, don't cry, my . . . don't use your sleeve, love, hang on, there's one in my bag. But tell me quickly, you know I hate—' 'I . . . I can't be a doctor any more.' 'What? Of course you can.' Now she has started down the wrong route, how can she go back? 'I . . . I really can't.' 'Why?' 'I can't say.' 'Marina. Don't be silly. Say.' 'I, I dropped chemistry. For history.' 'Hang on,' says her mother. 'I don't . . . you . . . sorry, what?' 'I know,' Marina says, blowing her nose. 'It makes no sense.' 'But how did you, what did you—' 'It was so awful, not telling you. Don't be cross.' 'I'm not cross,' her mother says. 'But . . . I'm completely confused. You can't have. Why?' 'I don't even . . . it's complicated,' Marina says. Then she thinks of something which may help. 'OK. You know that family I know? The, the Vineys?' 'What?' 'Guy's, you know, Guy, my boyfriend, Guy?' 'What about them?' 'It was his father. No, don't be— honestly. He's an expert. He advised me. And I don't even want to go to Cambridge any more. Don't look like that. Please, Mum. Honestly, he's . . .' She has practised this speech so often; never mind that it is nonsense since last night. 'I just want you to understand—' Her mother reaches out her hand. She takes hold of Marina's shoulder and gives it a little shake. 'Darling,' she says. 'There's something I need you to know.' Of course Laura has to tell her. The Farkases are right; there are things children should never be told, but an emergency seems to be slowly unfurling. So she tries. And, naturally, fails. Is this because she is distracted by Peter, or because she is a bad mother? At first Marina is only interested in defending the Viney family: their refinement, their style, their elegance. The way that they never drop their t's. ' _I_ don' _t_ ,' says Laura. 'Do I?' 'All the time,' says Marina crossly. 'I'm always trying to s— to help you remember. People would take you more seriously.' With a supermaternal effort, Laura manages not to smite her child. She merely says, 'Sweetheart, you've misunderstood. It's because of your grandfather. It's what they did to him.' Marina looks blank. She knows nothing about this. Laura explains what she can: something financial, not once but twice, to do with the Viney grandparents' business— 'Oh, that's Aston,' Marina says airily. 'They're Aston. They told me. Have you heard of them, they're very—' 'That's the one,' Laura says. 'So you knew all along. I can't get over the idea that good old English Aston, all that Argyle check and leather at Harrods—' 'Oh my God. So did we own it?' 'No. No. We'd hardly . . . anyway, no. Actually, I'm not sure.' Laboriously she explains what she can about the stolen estate, the friends, a tangle of disloyalty half a century ago, among cornfields and silver birches none of them will ever see. 'I think,' she says, 'because they carried on being friends, even once they'd taken over Zoltan's father's estate and turned it into Aston, you know, made it this famous English name, they needed money again, at some point. In the Seventies.' 'When I was alive?' In her distress Marina is polishing and polishing her glasses. Laura thinks: I could tell her right now how much her contact-lens losing has cost us. No, of course I can't. Poor child. 'Yes,' she says. 'Very small, but yes.' 'Guy's grandparents, this is?' 'Well, yes. His father too; that's the problem. I think Zoltan, well, he lent them quite a chunk of money. Not that we want you to worry about money, my love, we're fine, really. Fine. But Femina was doing well, in those days, and they were old friends, and . . .' 'But,' says Marina, ' _why_ would they carry on being friends, after—' 'I know. I thought that. But, well, it was because of Rozsi. The Viney grandmother, Mag— _Mog-_ dolna, Peggy, the founder of Aston, was—' 'English?' ' _No_. She was Rozsi's best friend. So there were best friends, Zoltan and Tibor, hanging out at ski lodges together or something, and they each married woman friends, Rozsi and Mrs . . . this Magdolna. I asked Zsuzsi about this, you see, and she said, "Rozsi loved her," and I said, "Why?" and she said, "Because she was beautiful."' Marina is frowning. 'Are you sure?' 'I know. But yes. Oh, and hang on, the Vineys were something else then, Sol, Szos . . . Doesn't matter. And something went wrong.' 'What went wrong?' 'Szoll . . . something. I think. She didn't say. Maybe one of Zoltan's brothers—' 'He didn't have any brothers.' 'Yes he did.' 'No he . . . they've never even mentioned them. Oh,' says Marina. 'Oh, God, I see. So when did they— how many?' 'Three, I think. Never mind. Don't think about it now. Anyway, the point is that they, the Vineys, I think, they didn't pay the money back. And so, well, it went wrong for Femina. And . . . and so Mrs Dobos took it over. She was connected too. To all of it, I think. She knew everyone.' She should say about Zoltan's death, the timing, the odd silence; no, not now. Marina looks washed out. 'Hang on,' she says feebly. 'Were they all cousins too?' 'Probably not. No. I think Zsuzsi would have said.' 'Try to remember.' She sits up. 'Oh no. It would mean that we, or I, am related to the Vineys. Wouldn't it?' 'Does it matter, darling?' Marina looks at her lap. 'Well. Yes.' 'Oh. Oh. I see.' Together they consider this. When they recover, Marina says, 'I just can't believe it. They insulted my family—' 'Sweetheart,' says her mother, 'it's not . . . it's not about honour. Is it?' Marina just waves her hand. Only now Laura notices that her eyelids are heavy; she is sitting up but half asleep, like a little child. What did happen last night? When did she go to bed? Adult life requires the capacity either to endure, or to leap, ask the difficult question, face certain pain. Laura can do neither. So she hesitates. 'I just,' says Marina, curling her legs up on the mattress, 'want to have a little rest.' 'Hang on,' Laura says. 'Wait a minute.' She hurries into the corridor; most of the bedroom doors are open, their contents removed, but she finds a bathroom, a few mean little hand towels over an icy radiator, and she brings them in. 'Sit up,' she says, arranging the towels on the mattress. 'Lie down,' and Marina lies. 'Are you really all right?' Laura asks, covering her daughter's legs with her own coat. This is very strange. She might be concussed. 'We could find a doctor—' But Marina's eyes are closed. Poets, male ones, have written about watching children sleep. They have no idea; it is not love you feel, but pain. As she watches her daughter, Laura's heart tightens with the thought of future grief. She could gaze at the curve of her cheek and the length of her lashes for ever but she cannot keep her mind from horror: childhood illness; fevers; death. Bloody Auden. So she creeps downstairs, a ten pence stolen from her daughter's desk hot in her hand and, although Peter doesn't answer Suze's phone, in fact nobody does, she has the conversation she wants to have with him in her head. Is the Zoltan mess, the Viney mess, the great dragging weight of ancient rivalries and expectation and grudges, the reason that you left? And: I love you. And: Pete, my period is late. # _40_ When Laura and Marina walk out of West Street a little later, past the Memorial Quad and Garthgate and into Founder's Court, the sun is shining. The old walls of the ruins and the abbey glitter wetly; all the crumbling cement, every patch of lichen, is illuminated, as if for a filmset. There must be birdsong but you cannot hear it over the sound of Combe parents' revelry. All creeping things, the squirrels and mice and the rats in the kitchen bins, have hidden themselves away. An immense marquee, with vestibule and medieval-style scalloping, dominates the lawn. The masters are all in gowns, their hoods proudly displayed: from the snowy rabbit fur of Pa Willey, Latin ('an exceptionally brilliant junior fellow,' Dr Tree murmurs to the parents, 'of King's College, Oxford, who has changed direction, fortunately for us! Ha ha ha!') to the turquoise satin of Pa 'Fletch' Fletcher, PE (Loughborough, no Honours taken). Pa Daventry's Barber Shop Quartet has already moved on from 'Chattanooga Choo Choo' to a medley of songs of yesteryear. As Laura and Marina enter the hot grassy shade of the marquee, huge pink-cheeked boys in striped blazers and boaters begin to sing 'Daisy, Daisy' suggestively to the headmaster's wife, who is perching on a wobbling Raleigh Caprice amid the hay bales. 'Champagne?' asks a tall fat young man with a pierced ear, holding a bottle; its label has been covered with a large sticker bearing the Combe coat of arms. Marina holds out her glass. 'I'm seventeen. We're allowed,' she tells her mother and Laura nods gamely. 'That was one of the groundsmen,' Marina whispers when he has gone. 'He's weird.' Shouldn't the feeling of not knowing anyone, and thinking that everybody else does, have faded by the time one is a parent? Laura finds she recognizes no one whatsoever. At first Marina sticks to Laura's side; she seems to be guiding her towards the back of the marquee, where a group of older earnest-looking boys are talking to Pa Bayham, head of music. Then she stops dead. 'They're there,' she says. 'Who?' 'You know. No! Don't look.' It is too late. Laura has turned. In the middle of a cluster of parents stand the Vineys: no sign of the mother but there is Guy and a haughty-looking girl and, with his arms around them, Alexander Viney himself. Only last weekend, on leafing through _The Times_ , she had wondered how it would feel to be the person who spots a former war criminal, living it up in a café in Belgrade or Buenos Aires. Alexander Viney is talking, laughing, as if he has nothing to do with suffering except the historical kind: that of miscellaneous peasants, or men at sea. Laura thinks: what on earth should I do? 'You know what Rozsi would do,' she hears Marina say beside her. 'Walk up to them and whack them. Him, anyway. You know she once hit a policeman.' Marina's glass has mysteriously already been refilled, but Laura is too distracted to say anything about it. 'Yes,' she says tiredly. 'I know that story.' 'But we can't.' 'No, we can't.' Then, in a small sad voice, Marina says, 'I want to.' Laura looks down at her. She has asked nothing about poor Zoltan's death, but might she have guessed? 'What?' she says. 'Tell me. What?' 'It's OK.' 'What do you mean? I can see it's not. You look— what is it, my love?' 'Too many revelations. I can't cope with more.' 'Neither can I,' her mother says, 'but, my darling, if something has happened . . .' 'No,' says Marina. 'It hasn't. Really, nothing. Never mind.' And that might have been it. Marina could have stopped drinking, and she and Laura could have sat through Prize-Giving, and then they could have gone home. 'Hi,' says Hannah North from West Street as if, although she is an Upper, they are old friends. She's my height too, thinks Marina, unlike all those other giants, and not even very thin. 'I've lost my rellies,' Hannah says. 'Where are yours?' Marina's mother, making elaborate 'I won't disturb you' gestures, starts wandering off towards the parents' toilets. 'Around,' says Marina, looking over Hannah's shoulder for Simon Flowers's family. 'Not the old ladies?' 'What?' says Marina, frowning at her. 'So you know about them?' 'It's not . . . don't look like that. Mine are Irish, my father anyway, so Daventry calls me the Publican's Child. Hilarious.' 'That's terrible. That's . . . racist. God. Don't you mind?' 'Used to it. Look, there's a bottle going round. Grab it.' Giles Yeo has his hand on Victoria Porritt's lower back; they are chatting to his red-faced father like adults at a cocktail party. 'How long does this last?' asks Marina. Hannah North moves her face closer as she pours. 'Are you OK?' she says. 'Why?' 'You're not, are you?' 'Why?' 'It's obvious. Always is with you. You look all . . . frozen.' 'No, I don't.' Marina's sinuses are stinging. Shut up, she tells herself. 'I'm fine.' 'You're homesick, aren't you? I could tell you are. I was, I used to vomit. I thought you were, since you arrived. It's obvious. You could have come to me.' 'How? How could I know?' 'Well . . .' says Hannah North vaguely. 'You can't say that now. It's too late.' 'Don't be melodramatic. Anyway, are you going to tell me what's happened? You look even more miserable than normal. Something's got to be up.' Why not? thinks Marina suddenly. She leaves out some of the details but she tells her the rest: sitting in the front seat of a nameless friend's father's big silver car, being . . . being . . . 'Oh God,' says Hannah North, but resignedly, almost casually, as if it happens all the time. Marina rests her head against the marquee post behind her. 'Not everything?' 'No!' says Marina. 'No. Definitely not. But a lot. And the thing is—' 'It was unfamiliar,' says Hannah North, after a pause. 'Yes. No. Yes.' She closes her eyes again and tries to explain how what happened in the car is her fault. 'I mean, it's not the olden days. I, I shouldn't mind, I know I shouldn't. Really it was my fault. In fact, I've thought that maybe I should apologize— I can't believe I'm telling you all this. Don't you have, you know, people to see?' 'Yes. But, look—' 'Well you should.' 'But, poor you.' 'Don't be mad.' She tips her head back: don't sodding cry. 'I mean it. Of course poor you, you dope.' 'The thing is,' says Marina in a rush, 'I know it's stupid, but I just don't know what I should be thinking. How, how to feel.' 'Angry.' 'That's ridiculous.' And just like that, Marina's embryonic liking for Hannah North evaporates. Because Hannah North is wrong. Marina listens to Pa Daventry's boys singing 'Goodbye, My Coney Island Baby', tapping her foot awkwardly just out of time to the music; she shakes her head when her mother, back from the loo, asks if she wants orange juice. Instead she marches up to Bill Wallis in his novelty shirt sleeves, who has commandeered two bottles just for his family; she holds out her glass. Angry? What rubbish. Hannah North, although older, just doesn't understand. Ten minutes later, during 'Wedding Bells Are Breaking Up That Old Gang of Mine', it hits her. Hannah North is right. After that, it is as if she is being powered by fury, at all of them. Vengeance, she thinks, with expansive mental hand gestures, will be mine. Ours. Should be. How dare you? she imagines saying to Alexander Viney, pushing him off her. How dare you? She is possibly a bit drunk now, but everyone is: except, obviously, her mother, which would be disgusting. 'There aren't any sandwiches here or anything, are there?' her mother says, though anyone could hear her. 'No,' says Marina. 'Of course not. We're not meant—' 'Come on, love.' Her mother gives her a look. 'We could go over the road quickly and get you something to eat.' 'We can't leave,' says Marina impatiently. 'It's not allowed.' I _am_ so angry, she thinks experimentally but already the guilt is bubbling through to the surface. She needs Hannah North to tell her again what to feel. 'Anyway, soon it's the, the . . . you know.' 'Prize-Giving.' 'Yes,' says Marina quietly. 'I hate him.' 'I know,' says her mother. 'So do I.' Where is Alexander Viney now? Mrs Viney has gone back to Stoker and her herb garden. Guy catches Marina's eye and mouths something unreadable but she doesn't care, not if she never sees him again, because now when she looks at his father, the giver of prizes, the jewel in Dr Tree's crown, she feels sick. What was he doing, driving her half-drunk to a bridge? He is a married man. Mrs Viney should have stopped him. She thinks confusedly of feet of clay, of statues on columns, of, primarily, the bulge in his too-new needlecord trousers: the lap not of a gentleman but a pretender. 'I don't want to go to the stupid Prize-Giving,' she says. 'Don't be silly, sweetheart. We just have to sit there, and then it's home. Lovely home. You need a rest.' Marina bites her lip: so sore that it makes her wince. She is wearing ten separate items of Combe uniform, including shoes, ceinture and hairband but leaving out her watch. She sees now that what happened with Mr Viney, in this very uniform, has intensified the contamination: the danger to her family, the betrayal. Even apart from her stupid hugging of them all this morning, isn't her mother being infected right now, inhabiting the same cuboid of air? And then it will be concentrated by the treacherous act of sitting in Divvers, listening, clapping when he gives his spontaneous amazing Prize-Giving speech. The very thought makes her feel sicker. After all that her brave family has done for her, this is how Marina will repay them: by bringing everything Mr Viney stands for straight back to Westminster Court. There is no time to plan. Pa Daventry is at the marquee flap, summoning them all and, although it seems fantastically important that they should be early, to choose the best seats, somehow Marina and her mother hesitate until they are trapped at the back, and reach Divvers last. # _41_ Marina, her mother has realized, is possibly slightly drunk. So is Laura; her capacity is pitiful. As a Non-Prizewinning Pupil + Parent (1), they are supposed to sit in the body of the hall but, by the time they fight their way in, there are apparently no seats left anywhere. 'What about those?' she says to Marina, nodding at a row of chairs on a long thin platform, running along the right-hand wall. They seem less popular; despite being up a couple of steps, their view is partially blocked by the maroon barley-sugar columns which feature repeatedly in the prospectus. Because of this, presumably, several seats are left. 'We can't,' says Marina. 'They're for Sirs.' 'What? Well, we can today, other people are sitting there. I think the teachers, er, Sirs, prefects anyway, they're all on the stage. And look, there's a couple left near the front.' If you sit forward you can see quite well around your column: not, as Laura had assumed, ugly marble but merely plaster, painted an unpleasant chicken-liver colour with darker menstrual clots. Or, rather, you can see the audience; not most of the staff nor, thankfully, Alexander Viney himself, who must be beside the headmaster on the stage. Laura rests her forearms on the low rail which divides them from the rest of the school; she resists the urge to lean her forehead on it too, just in time. Marina is protesting about sitting up here; frankly, enough is enough. Laura has a headache and several enormous problems, and it would be good just to rest here quietly, thinking, before they have to catch the train. Alexander Viney may be a bad person but he's still an intellectual, prize-winning, televised, and poor Zoltan is dead. They will just listen to him, clap politely, and leave. Marina looks out across the audience. Sitting up here, raised only slightly but at right angles to the other rows, against the grain, is like watching television. She has nothing to do with these people. Her ceinture is hurting and her heart feels tight; she can't see Guy, or Simon Flowers, or anyone she cares about at all. Even Mr Viney is out of sight, although soon he will begin his speech. The Prize-Giving is scheduled to start in six minutes, and Dr Tree is very keen on promptness. She feels suddenly rather sick. Thanks to her Divvers adventures with Guy, she knows that at the end of this platform there is a way into the backstage area, near a little toilet. 'I'll be quick,' she says. Her mind is moving sluggishly; even her blinks feel slow. She sits down on the toilet seat and has the brilliant idea of removing her tights to allow cool air on her skin, then her ceinture. She is still too hot; she can hear her pulse in the quiet, and another sound, like roaring water. Swiftly, with the expertise of a reluctant room-sharer, she unhooks her bra beneath her blouse, unbuttons the blouse itself and pulls both elastic and cotton out through the head-hole of her voluminous black V-neck. The clothes sit in her hands like entrails; she is panting slightly. She thinks: if I get rid of them now, they can't infect. Her bare feet are resting on her slip-ons. She pulls off her knickers, holds her breath, removes the cover for the sanitary-towel disposal unit to stuff her underwear and blouse inside, and shoves the lid back on. Then, gingerly, she stands. It is so much cooler in only her jumper and skirt; why do people not, she wonders distantly, as if contemplating the ways of mortals from above, dress like this all the time? She can barely hear her feet on the dusty steps back through the wings, so great is the roar of Combe bonhomie. She gives her mother a smile and sits back down beside her. 'Were you sick?' 'No,' says Marina, scandalized. 'Of course not. Actually I'd quite like another drink! Are you shocked?' 'Well, no,' says her mother, although clearly she is. 'I don't think we should be staggering round drunk just yet, though,' she says. 'We don't want to burn _all_ our bridges.' 'What do you mean?' Dr Tree is standing. 'Shh,' says her mother. 'It's about to start.' During the headmaster's speech, Laura quite suddenly makes her decision. She will bring Marina home and, when they are all sitting nicely in the living room at Westminster Court, she will tell them everything she knows, the good and the bad. Love is pain; there is no point pretending otherwise, or trying to protect anyone any longer. I have been mad, she thinks, trapped in a teenage bubble of misery and now I am going to be a grown-up. Definitely. When Alexander Viney takes the stage, she bravely resists clapping. Until now she has only seen glimpses of him, the sleeve of his suit, his clever aggressive profile, and there is a thrill, undeniably, in being so close to a famous man. Do you know, Laura asks him silently, that because of whatever you did, not a dramatic wartime betrayal but a grubby act of dishonesty, a business was lost? A good man gave up on life. Would you care? If she tells Peter, he will go after him, probably drunk, certainly reckless, and be sued, or end up in prison. What would be the good in that? Marina is trying not to listen to Mr Viney. Her skin feels cold under the lambswool; her body is ashamed. It is not only what he did but the fact that she is still sitting here which proves her rubbishness. If she were as brave as Rozsi, wouldn't she do something for poor Zoltan's sake? After the speech, she thinks, I could go up and hit him. She clenches her fist and inspects the muscles: indelicate, yet puny. No use to anyone. Still: I ought to kill him, if I have the chance. The audience is tilting at an interesting angle. Observing this, she notices in passing that Giles Yeo, quite close by at the end of a row, is smiling at her. She glances away, then back; he hasn't looked away. Giles Yeo, who ignores her. He is only one away from Bill Wallis; he taps him on the arm and whispers in his ear, and then they both stare at Marina, grinning. Smirking. What has she done? Tentatively, she smiles back. She pats her lap. Reflexively, she feels to make sure that the buttons of her school blouse have not come open. Then she looks down. At the V of her jumper, where her collar and one or two buttons are usually visible, is skin: an expanse of skin. Thanks to her brilliant blouse-removal decision, the lambswool has slipped, unobstructed by cotton. The V is enormous. Most of both of her breasts are on display. Her heart forgets to beat. Then it starts again. She is still alive, unfortunately. Half-naked. Laughed at. She pulls up the V and plucks at her back and collar as if she is being bitten. An inch of cleavage still remains. She crosses her arms, holds her shoulders; she can't catch her breath. Her mother hasn't even noticed. Think, you stupid fuck, think. But her brain won't move. All that works is her eyes: faces of people she doesn't know turning to look at her and, worse, Bill Wallis, Giles Yeo, all their friends and cronies. So she takes off her glasses; they are useless anyway when you cry. Now she can't see but she can still feel them, their delight. Alexander Viney talks on and on. Marina stands. 'What are you doing?' whispers her mother. 'Don't—' Marina closes her ears. Not at all cautiously, welcoming the pain that chair legs and railings will cause her, she starts to hurry along the platform, down the long length of Divinity Hall. She is gripping the wool of her jumper collar to conceal her flesh, like an effigy with its wrists crossed on its chest, yet people will still be looking at her, and laughing. She can hear whispering, although Mr Viney's voice keeps on. Someone grabs her arm. She pulls away, stretching the sleeve, and it seems easier to slip her own arm away into the jumper, hot against her flesh and then, with one quick and graceful movement, to pull the whole thing off. She starts running. By a miracle, she doesn't fall. There are gasps, noise, outraged shouts; possibly cheering. Nothing to hold back now, she thinks as she stumbles, then runs, on towards the end of the platform. Have a look, then, Giles bloody Yeo, Bill bloody Wallis, Mr fucking fucking Viney. If you're so sodding interested, have a big fat look. She unbuttons her skirt, undoes the zip and lets it fall. Oh, the feeling of air on her poor hidden skin. Out of the vestibule, down the steps, outside, and she is free. # _42_ 'I shouldn't laugh,' says Laura to her daughter. For a woman prone to embarrassment, she has very rapidly learned to endure. First there was the hurried gathering up of Marina's jumper and box-pleated skirt and her own coat and bag, then following, blushing, in her wake as she bounded off the platform and made for the doors. Behind them, Alexander Viney said, 'My work has had some extreme reactions, but that—' and his audience laughed sycophantically, then with relief as he just carried on. Towards the back people were standing up, meaning to catch her naked daughter. Laura did not look back, even when she heard an official voice saying, 'Mrs Farkas!' as if she was the one who had erred. Of course, she has. Clutching her child's garments, she burst out of the doors and found her just outside, shivering on the bottom step. 'Marina!' 'Thank you,' said her daughter. Then it was a matter of hasty dressing, watched by a handful of spectators at the top of the steps. Marina was quiet: could this be shock? And, after that, who could blame her? 'Mrs Farkas,' said the voice again, now at her shoulder: a fat little man with many chins. 'I must insist—' 'God,' said Marina quietly. 'You're Marina's housemaster, aren't you?' says Laura. 'We have met,' he says. 'I—' 'The person responsible for her pastoral care? I'm sure we were told that when she first arrived.' 'Well, yes. And as Dr Tree's deputy vice-master I must ask you—' It came from nowhere; Laura, the weakling, was suddenly strong. She held up her hand to stop him, palm outward and he, just as surprised as she was, fell silent. She swallowed hard. 'I think,' she found herself saying, 'that anyone with the least understanding of pastoral care would see that now is not the time.' Marina gave a tiny whimper. 'I,' Laura announced, 'am taking my daughter home. We will make arrangements for her things.' And, with one arm around Marina's shoulders, without the faintest idea what these arrangements will be, she led her past Divinity Hall and across the Memorial Quad to Garthgate, to the taxi rank, then the station and, eventually, the London train. To fill the cold anxious wait at Combe Station, Laura bought them coffee, salt and vinegar crisps and a tangerine. They have finished them already. Marina, buttoned up in Laura's coat, says nothing. They sit next to each other in backwards facing seats, in a smoking carriage filled with what seem to be Germans. Laura, thoughtfully licking salt off her fingers, is beginning to realize that, unless she broaches the subject, they will reach London and still Marina will not have spoken. She is also terribly afraid that she may laugh. 'My love,' she says. Her voice sounds crushed. She puts her arm back around Marina's shoulders, leans her cheek against the top of her head and the warmth of her skull, the unwashed familiar smell of her hair, catches her throat. 'Oh God,' says Marina softly. 'I can't believe—' It would be lovely if the small movements of her head and chest, the snuffling noises, were laughter; of course they are not. 'I can't believe I did that,' she mutters. 'It's OK,' says Laura, wiping her own face with her other arm. She glances down. Marina is pressing her lips together bravely, but her body shakes with little spasms. Tears drip on her hands. 'I . . . oh, God.' 'Oh God.' 'What will Rozsi say?' Laura opens her mouth; no platitude comes, only the thought of Rozsi, say, tomorrow morning, when Laura gives them all bigger news than this. She shrugs. 'It will be all right,' she says. 'I'll, well, I'll handle it.' 'Mum, you can't.' 'It's all right. The thing is, love, I'm . . . how . . . it's going to be difficult next term, if you wanted to go back there.' 'I'm not going back,' says Marina simply. 'Aren't you?' 'No.' 'OK. I see. After that I don't really see, anyway, how . . . OK. Fine,' she says. The train races past a ploughed field and another. If spring is coming out here, there is no sign. Marina is shaking again. 'Shh,' says Laura, stroking her daughter's hair, wiping the tears away, running her fingertips over Marina's cheekbones, her lashes, her mouth, her eyelids. At last she feels her grow calmer. 'You were very brave,' she tells her. Under her fingers, Marina gives a little smile. 'Do you think so?' Laura looks down, into her hazelnutty eyes. She knows them like a lover's. 'I do, my love,' she says. 'I do.' #### _Epilogue_ There must be, thinks Laura, sitting in uncomfortable state on the green sofa, an easier way. Running barefoot down a mountainside, for example, bearing stone tablets. Dragging a banner up to the roof of St Paul's: anything to avoid telling her in-laws everything, now, face to face. She has already informed them that Marina will not be going back to Combe. Their response, by Farkas standards, was curiously muted; partly because Marina herself was there, at Laura's insistence. Perhaps they also sensed further storms ahead. ' _Tair-_ ible' they say, and, 'But _vy_?' and, ' _Megmondhatjuk Dobos neninek?_ ' Laura imagines saying, 'Because I've decided and I'm her mother,' but would that make any difference? 'Hang on,' she half-shouts eventually. 'I, I need—' Ildi, thank God, is nearest; Laura glances frantically in her direction and receives what she can only hope is an encouraging smile. 'There are, well, a, a couple of other things we, I—' 'Couple?' asks Rozsi. ' _Leljesen hülye_ ,' says Zsuzsi. 'Mad.' 'Mum—' 'No, let me,' says Laura, and Marina blinks. 'I . . . well, luckily she can go back to Ealing Girls'.' Consternation. 'I made a phone call,' she says. 'Mum!' says Marina. 'How could—' But by now there is so much uproar that Laura can safely ignore her. Surely, she thinks, I could just leave the A-level change for another time? But even she, coward that she is, knows the answer: all or nothing. Slash and burn. 'It's very good news,' she says. 'We're very lucky. They want to have her—' ' _Vell_ , of course,' says Zsuzsi indignantly. 'They are lucky. But all those sad old _vom-_ ans—' 'There is,' Laura says, 'just one m—' Marina is crying and trying to interrupt. 'Darling, let me. Well, it's good, in a way. They want her to do history again.' And she sits back, felled by the force of her lie. In the outrage which follows, she realizes that Marina, whom she had not forewarned, may weaken. While Laura is busy explaining that apparently history is a better choice for Cambridge where, she has been told – by whom? By herself – that medicine isn't even very good, she hears Marina say to Rozsi, 'But if you really want me to I don't m—' 'Sweetheart,' says Laura, 'it's decided.' She puts out her hand to grab Marina's; she squeezes it hard, to comfort one of them. ' _Tair-_ ible,' Zsuzsi says, lighting another cigarette. ' _Von-_ darefool,' says Ildi, and smiles. But Laura by now is almost past the point of fear, as though she is leaping boulders, ready to snatch Marina from a lion's jaws, or a woman willing to resist oblivion, the strongest temptation of all, for the sake of her daughter. 'And tonight,' says Laura, 'all of you . . . there's one more thing. Something good, or bad. Well, both, I suppose. You're having a visitor.' #### _Author's Note_ As the grandchild of TransCarpathian-Ruthenian former subjects of the Austro-Hungarian Empire, who were born in what is now the Ukraine, learned their sums in Russian, spoke Hungarian together yet considered themselves Czech, I grew up knowing only the smallest and most confused details about where my maternal grandparents came from, or the language they spoke to each other. I inherited most of their dictionaries, including László Országh's _A Concise Hungarian–English Dictionary_ (Akadémiai Kiadó, Budapest, 1967) and _English–Hungarian Dictionary_ (Akadémiai Kiadó, Budapest, 1955), both carefully wrapped in plastic and smelling of their flat, from which I discovered that the very few words I thought I knew (dressing gown, central heating) were spelled rather differently from how I had assumed. It was only when I began to write this novel that I realized how very little I knew about the history of Hungary and the Carpathian mountains. Slowly, painfully, I saw that knowledge was not the point; it was the lives of central Europeans in England, and their silence about the past, which interested me. Consequently – what a wonderful excuse – my research was dominated by one of my and my grandparents' main interests: food. I particularly recommend: Maria Floris, _Cooking for Love_ (Putnam, London, 1959), for its old-fashioned intimacy, Anglophilia and wit; it could have been written by Mrs Dobos. Károly Gundel, _Hungarian Cookery Book_ (Corvina Press, Budapest, 1974). Erzsébet Hunyady, _Ajó Házi Konyha_ (Singer & Wolfner, Budapest, early 20th century). George Lang, _The Cuisine of Hungary_ (Penguin, London, 1985), which has all the recipes for Witches' Froth, Eggs Metternich, Transdanubian Corn Cake, Wild Duck with Quinces and _Hortobágyi reszelt tészta tüdovel_ (grated noodles with calf's lung filling as in Hortobágy) that one could wish for. József Venesz, _Hungarian Cuisine_ (Corvina Press, Budapest, 1963), chiefly for its startling photographs. However, certain other books were also helpful for atmosphere, and a little detail, particularly: Péter Baki/Colin Ford/George Szirtes, _Eyewitness: Hungarian Photography in the Twentieth Century_ (Royal Academy of Arts, London, 2011). Adam Biro, _One Must Also Be Hungarian_ (University of Chicago Press, Chicago, 2006). Edita Katona, _Code-Name Marianne_ (Fontana, London, 1977). Sándor Márai, _Embers_ (Viking, London, 2002). George Mikes, _How to Be an Alien_ (Penguin, London, 1966) which, more than anything else, captures the character of the Hungarians I knew; it could have been entitled _How to Handle a Hungarian._ G. Pálóczy-Horváth, _In Darkest Hungary_ (Gollancz, London, 1944). Jan Pierikowski, _The Fairy Tales_ (Puffin, London, 2005). Daniel Snowman, _The Hitler Emigrés_ (Pimlico, London, 2003). Bram Stoker, _Dracula_ (Penguin, London, 1994). And lastly: Ann Barr and Peter York, _The Official Sloane Ranger Handbook_ (Ebury, London, 1982) and _The Official Sloane Ranger Diary_ (Ebury, London, 1983). #### _Glossary and Pronunciation_ In Hungarian, the emphasis is always on the first syllable. This makes the pronunciation of many English words and phrases rather distinctive: Don't be funny – _Donnt-_ be-fanee Never mind – _Nair_ -vairmind Wonderful – _Von-_ darefool Terrible – _Tair-_ ible Attila – _Ott_ -illó Waterloo – _Vort_ -aloo Westminster Court – _Vest_ -minstaircourt Rozsi – _Roe-_ ji Zsuzsi – _Ju_ -ji Marinaka – _Mor_ -inókó Hungarians will tell you proudly that their language is phonetic. However, learning how to pronounce each letter takes a little time: _Á_ or _a_ like the English 'ó' as in 'Pot' _C_ like the English 'ts' as in 'Volts' _Gy_ like the English 'dy' as in 'D'ye know where the bus is?' _I_ like the English 'ee' as in 'Flee' _Lj_ like the English 'ly' as in 'Lure' _Ö_ like the English 'er' as in 'Her' _S_ like the English 'sh' as in 'Shame' _Sz_ like the English 's' as in 'Sausage' _Ü_ like the English 'oo' as in 'Look' _Zs_ like the French 'j' as in 'Je' This is how the following Hungarian words and phrases are pronounced, or at least were pronounced by my grandparents, and what, roughly, they mean in English: _Igen_ – _ee-_ gen (Yes) _Köszönöm_ – _kus-_ unum (Thank you) _Boldog születésnap – bull-_ dog _soo-_ lertaishnop (Happy birthday) _Hogy vagy – hodge vodge_ (How are you?) _Szervusz_ – _sare-_ vus (I am at your service) _Kezét csókolom – ke-_ zet _choc_ -olom (I kiss your hand) _Kedves egészségére!_ – _ked_ -vesh _egg-_ ayshaygaydre! (Cheers, i.e. to your house) _Krumplisaláta_ – _krum-_ plysólótó (Potato salad) _Paprikás krumpli_ – _pó-_ prikoshkrumply (Potatoes with paprika) _Körözött – ker-_ erzert (Liptauer-style cream cheese spread with caraway and paprika) _Egyszersmind – edj-_ sairshmeend (At the same time) _Összehasonlíthatatlan – ursh-_ sehóshernleehótótlón (Incomparable) _Hanyszor fogsz felkelni ma éjjel?_ – _Hony-_ sore forgs _fel-_ kelnee ma _ay-_ el? (How many times will you get up tonight?) _Ahányszor kell_ – _O-_ hawnysore kell (As often as I need to) _Édes Zsuzsi, Virág virágnak_ – _Ey-_ desh _Ju-_ ji _, vee-_ rog _vee-_ rognok (Sweet Zsuzsi, flower to flower) _Huszonnyolc_ – _huss_ -onyoltz (Twenty-eight) _Üdvözöljük –_ Ood-verzerlynook (You are welcome) _Nez_ – _nayz_ (Look) _Nem_ – _nem_ (No) _Nem tu dom_ – _nem-_ tudom (I don't know); 'nemtudom' plums are really called this _Hihetetlen_ – _hi_ -hetetlen (Unbelievable) _Em érted_ – _em air-_ ted (You don't understand) _Viszontlatasra – viss_ -ontlaataashró (Goodbye) _Madártej – mod-_ arté (Floating islands) _Dios torta – dee_ -oshtortó (Walnut cake) _Mákos – mark_ -osh (Poppy seed) _Palacsinta – pol_ -oshintó (Pancake) _Kukorica_ – _koo_ -koritsó (Corn) _Pongyola_ – _pon_ -dyuló (Dressing gown) _Kavitchka – kaa-_ vitchkó (Little coffee) _Szívesen – See-_ vershen (You're welcome) _Buta_ – _boo_ -tó (Stupid) _Csúnya – choon-_ yó (Ugly) _Popsi – pop-_ shi (Bum) also _popó – pó_ -po _Nagyon szép ház_ – _nodg_ -on sep hoss (A beautiful house) _Kivel beszél_ – _kee-_ vel _bess-_ el (Who is she talking to?) _Yoy de édes_ – _Yoy_ de _ai_ -desh (Oh, so sweet!) _Nagyon édes – nodg_ -on _ay-_ desh (Very sweet) _Teljesen hülye – tel_ -yesen _hoo_ -ye (Completely bonkers) _Megmondhatjuk Dobos neninek? – Meg-_ mondhotyook _Dob-_ osh _nay_ -ninek? (How do I tell Mrs Dobos?) #### _Acknowledgements_ Thank you to: Marta Buszewicz, Tina Cotzias, Jane Craig, Marion Donaldson, Lucia Grun, Mary-Anne Harrington, Pat Kavanagh, Martha Lane Fox, Jean MacDonald, Kati Mendelson, Max Mendelson, Rachel Mendelson, Jane Morpeth, Elaine O'Dwyer, Tamara Oppenheimer, Nicola Roche, Kate Saunders, Helen Simpson, Caroline Stofer . . . they know why. To: Claire Baldwin, Lynne Drew, Judit Katona-Apte, Hannah Robson, Àgnes Szervànszky, Valerie Thomas, Jon Woolcott . . . for linguistic and other help. And to all at Rogers, Coleridge and White, especially Gill Coleridge; to all at Mantle and Picador, especially Maria Rejt and Camilla Elworthy; and to Joanna Briscoe, above all. _Also by Charlotte Mendelson_ Love in Idleness Daughters of Jerusalem When We Were Bad First published 2013 by Mantle This electronic edition published 2013 by Mantle an imprint of Pan Macmillan, a division of Macmillan Publishers Limited Pan Macmillan, 20 New Wharf Road, London N1 9RR Basingstoke and Oxford Associated companies throughout the world www.panmacmillan.com ISBN 978-1-4472-1998-9 Copyright © Charlotte Mendelson 2013 The right of Charlotte Mendelson to be identified as the author of this work has been asserted by her in accordance with the Copyright, Designs and Patents Act 1988. You may not copy, store, distribute, transmit, reproduce or otherwise make available this publication (or any part of it) in any form, or by any means (electronic, digital, optical, mechanical, photocopying, recording or otherwise), without the prior written permission of the publisher. Any person who does any unauthorized act in relation to this publication may be liable to criminal prosecution and civil claims for damages. A CIP catalogue record for this book is available from the British Library. Visit www.panmacmillan.com to read more about all our books and to buy them. You will also find features, author interviews and news of any author events, and you can sign up for e-newsletters so that you're always first to hear about our new releases.
Birmingham (Ala.) Briarwood Christian quarterback Barrett Trotter has been to a number of games at Jordan-Hare Stadium. He's grown up dreaming of playing major college football, especially in the state of Alabama. On Thursday, Trotter took a big step toward realizing his Iron Bowl dreams when he committed to Auburn. "It's really special," said Trotter. "It's something I've looked forward to as long as I can remember, the opportunity to play college football, especially at a place like Auburn. "It's close to home and the biggest thing in this state is Auburn and Alabama football. To be a part of that is really something special to me."
Various types of fire hose reels have been devised, including both fixed and rotatable reels commonly utilized in public facilities and generally positioned within a recessed fire hose cabinet. For industrial applications, the fire hose is often not collapsable, thereby enabling the hose to safely transmit higher fluid pressures. Moreover, the fire hose racks or hose reels for industrial applications frequently are free standing, so that the reel assembly can easily be affixed at a desired location to the floor at the industrial site. With respect to general hose storage reels, U.S. Pat. No. 1,675,140 discloses a service station reel for supplying air or water to an automobile, with the reel mounted on a horizontal axis and pivotable about a base. U.S. Pat. No. 1,799,599 discloses a hose reel also having a horizontal reel axis and pivotable about a foundation. U.S. Pat. No. 3,184,180 discloses a garden hose reel similarly having a horizontal axis, and including a support member designed to be pivotably stuck into the ground. Industrial fire hose reels having horizontal axes are manufactured by Herbert S. Hiller Corporation and Magnum Fire & Safety Systems. These prior art reels may be positioned at an industrial site, and provide a suitable rack for the fire hose. The units include a fluid inlet generally affixed adjacent the reel and aligned with the axis of the reel. These units are not, however, pivotably mounted on a stationary base, and thus problems can arise when the hose is pulled off the reel in a direction other than that perpendicular to the axis of the reel. Prior art industrial fire hose reels generally must be operated by at least two people. Considerable time is utilized to unreel the hose from the reel, then direct the nozzle of the hose to the fire. If the hose is hastily unwound, as can be expected during an emergency, the hose of prior art reels frequently becomes snagged at a location adjacent the base of the reel, thereby delaying critical time before a fire can be brought under control. Even if a hose reel is mounted on a swivel base, the inlet to the reel would rotate as the reel rotates, thereby enhancing the likelihood that the fluid conduit to the reel assembly will substantially restrict the ability of the reel to freely swivel upon a base, or that the incoming fluid line will become snagged, thereby restricting fluid flow to the reel and the fire. Also, prior art industrial reel assemblies are expensive to manufacture, and component parts cannot be easily repaired or replaced. Finally, it is difficult for one person to unwind the hose from the reel during an emergency, and also to rewind the hose back on the reel after use. The disadvantages of the prior art are overcome by the present invention, and an improved fire hose reel assembly is hereinafter described having significant advantages over prior art reels.
I saw "Anonymous" on a list of donors I thought it was the hacker group 142 shares
EF-ordning mod ulovligt, urapporteret og ureguleret fiskeri (forhandling) Formanden Næste punkt på dagsordenen er betænkning af Marie-Hélène Aubert for Fiskeriudvalget om forslag til Rådets forordning om en EF-ordning, der skal forebygge, afværge og standse ulovligt, urapporteret og ureguleret fiskeri - C6-0454/2007 -. Joe Borg Fru formand! Først vil jeg gerne takke ordføreren for hendes arbejde med denne betænkning. Det glæder mig at se, at Fiskeriudvalget yder stor støtte til dette vigtige forslag om at forebygge, afværge og standse ulovligt, urapporteret og ureguleret fiskeri (IUU-fiskeri). Som De ved, udgør IUU-fiskeri en væsentlig trussel mod bæredygtige fiskebestande og biodiversiteten i havet, og det underminerer selve essensen i den fælles fiskeripolitik. Jeg mener ikke, at det er nødvendigt at komme nærmere ind på de katastrofale globale miljømæssige og økonomiske konsekvenser af IUU-fiskeri, da De er fuldstændig klar over det. Det er dog vigtigt at huske, at IUU-fiskeri er et verdensomspændende fænomen, der især påvirker udviklingslandene. Derfor er forslaget ikkediskriminatorisk og gælder for al EU-handel med fiskeriprodukter, der stammer fra IUU-fiskeri i alle farvande, og for alle EU-statsborgere, der udøver eller støtter IUU-fiskeriaktiviteter, der gennemføres under et hvilket som helst flag. Internationalt samarbejde er nøglen til en effektiv standsning af IUU-fiskeri. Derfor har Kommissionen allerede indledt bilaterale kontakter med tredjelande. Kommissionen har også fastlagt et arbejdsprogram i tæt samarbejde med GD Udvikling og EuropeAid for at støtte udviklingslandene, hjælpe dem med en problemfri og vellykket implementering af forordningen, specielt hvad angår fangstattesteringsordningen. Dette arbejdsprogram omfatter seminarer og kurser i en lang række tredjelande. Kommissionen er enig i næsten alle de foreslåede ændringer, som enten er omfattet af forslaget eller formandskabets kompromistekst. Jeg er meget glad for, at betænkningen især støtter implementeringen af den administrative bestemmelse for alle fartøjer, fangstattesteringsordningen og harmoniseringen af sanktioner. Det er vigtigt, at EU-fartøjer inkluderes, da det sikrer, at der ikke sker diskrimination, og at WTO-reglerne følges. Det er også vigtigt at vise, at Fællesskabet seriøst bekæmper IUU-fiskeriaktiviteter ved at inkludere alle fartøjer, der overtræder bestemmelserne for bevarelse og forvaltning. Fangstattesteringsordningen er det rette instrument til at sikre styring af fiskeriprodukters sporbarhed. Den er inspireret af aktuel praksis i de regionale fiskeriforvaltningsorganisationer og toldforordninger, og den skal gælde for alle fiskeriprodukter, herunder også forarbejdede produkter, for at være effektiv. Akvakulturprodukter og produkter med marginal handel i EU vil dog ikke blive omfattet af anvendelsesområdet. Det kan vi gøre under de endelige forhandlinger i Rådet. Harmoniserede sanktioner vil styrke medlemsstaternes mulighed for at træffe foranstaltninger til at forebygge IUU-aktiviteter og sikre, at de pålagte bøder vil være større end enhver økonomisk fordel. Kommissionen mener absolut, at et system med afskrækkende, relevante og harmoniserede sanktioner og ledsageforanstaltninger er nøglen til, at forordningen overholdes. Jeg vil gerne igen takke fru Aubert for betænkningen og komitéen for opmærksomhed om dette meget vigtige emne. Betænkningen er et væsentligt bidrag til en effektiv bekæmpelse af IUU-fiskeri. Marie-Hélène Aubert ordfører. - (FR) Fru formand! De demonstrationer, vi oplever netop i dag i Bruxelles, viser, i hvor høj grad europæisk fiskeris fremtid er truet, hvis EU ikke er i stand til at gennemføre en bæredygtig forvaltning af fiskeressourcerne og en gennemgribende omlægning af de hidtidige politikker. Kampen mod ulovlig, urapporteret og ureguleret fiskeri er et væsentligt element i denne mere krævende og mere sammenhængende politik. Globaliseringen af samhandelen, fri bevægelighed for kapital og fremskridtene inden for transport og kommunikation har imidlertid ført til en markant forøgelse af det ulovlige fiskeri i de senere år. Situationen er ikke længere holdbar, og de europæiske fiskere kræver samstemmende - i øvrigt i lighed med alle aktører i fiskerisektoren, herunder ngo'erne - at dette fænomen bekæmpes mere effektivt. Det fremskynder nedbrydningen af ressourcerne og giver anledning til unfair konkurrence i forhold til dem, som efterlever forskrifterne. Medlemsstaterne har imidlertid mildt sagt ikke hidtil været i stand til at kontrollere og straffe den ulovlige praksis på behørig vis. Revisionsrettens rapport, som blev offentliggjort for nogle måneder siden, er i denne henseende forstemmende læsning. Kommissionens ambitiøse forslag, der blev offentliggjort i oktober 2007, blev derfor også særdeles vel modtaget i Fiskeriudvalget, som med overvældende flertal havde vedtaget en initiativbetænkning om EU's handlingsplan for bekæmpelse af ulovligt, urapporteret og ureguleret fiskeri fra februar 2007. De vigtigste af vores anbefalinger er i virkeligheden indarbejdet i Kommissionens forslag til lovgivningsmæssig beslutning, hvilket glæder os meget. Det gælder offentliggørelse af en liste over fartøjer, som udøver ulovligt, urapporteret og ureguleret fiskeri, skærpelse af havnestaternes kontrolforanstaltninger, obligatoriske fangstattester fra flagstaterne og dermed afvisning af import af varer, som stammer fra ulovligt, urapporteret og ureguleret fiskeri, til EU's marked, skærpede og harmoniserede sanktioner, varslingssystem osv. Kommissionens forslag efterlader således ikke ret mange ubesvarede spørgsmål. Som De ved, er der tre forhold, som har givet anledning til livlig debat i Rådet. Det gælder navnlig forordningens anvendelsesområde. Personligt glæder jeg mig over, at det til sidst lykkedes os at fastholde det anvendelsesområde, De havde foreslået, og som omfatter såvel fartøjer, der fører EU-flag, som tredjelandsfartøjer. Fangstattesten har også været betragtet som for tung og kompleks, og sanktionernes omfang og art har ligeledes givet anledning til hård debat. Spørgsmålene har også været rejst i vores udvalg. Men vores ændringsforslag gjorde det efter min opfattelse til sidst muligt at tydeliggøre teksten og samtidig bevare ambitionerne for forordningen og dens primære målsætninger. Betænkningen blev vedtaget enstemmigt, og jeg vil gerne takke mine kolleger for den støtte, de har bidraget med, og som har gjort det muligt at nå dette resultat. Sektoren er i krise, og Europa-Parlamentet ønsker hermed at sende et meget klart budskab, navnlig til Rådet, som har tøvet for længe med at tage ansvar på dette felt. Ikke desto mindre er kampen mod ulovligt, urapporteret og ureguleret fiskeri kun en del af en bredere politik, som omfatter kontrolforordningen og forordningen om alvorlige overtrædelser. Denne skelnen har mildt sagt ikke bidraget til at skabe klarhed under drøftelserne. Vi venter fortsat på Deres præcisering af, hvordan de tre forordninger bliver struktureret. Ligeledes har bekymringen over fangstattestens kompleksitet blot været et påskud for at svække eller forhale teksten. Vi har rent faktisk behov for procedurer, som er forståelige for alle, som er gennemførlige for et pålideligt, effektivt og kompetent personale, i passende antal. Samtidig skal de være tilgængelige for udviklingslandene, som under alle omstændigheder er de første, der rammes af piratfiskeri. Vi forventer også på dette felt præcisering og forpligtelser fra Deres side. Endelig stoler vi på, at De, hr. kommissær, som er kendt for at være særdeles beslutsom, hurtigt vil sætte en stopper for det ulovlige fiskeri, som i særlig grad rammer atlantisk tun og torsk. Begge arter vurderes højt, og der drives i øjeblikket rovdrift på begge arter. Det ville i det mindste nu og her være et konkret svar på de alvorlige problemer, fiskerisektoren står over for i øjeblikket. Der er som bekendt stadigvæk meget arbejde, som skal gøres for at sikre de europæiske fangstområders fortsatte beståen. Der vil imidlertid i de kommende uger blive taget et vigtigt skridt, og jeg glæder mig med Dem herover. Daniel Varela Suanzes-Carpegna Fru formand! Hr. kommissær, mine damer og herrer, denne forhandling finder sted samtidig med den mest alvorlige krise inden for fiskerisektoren i mands minde. Det er et sammenfald af forskellige årsager, der gør, at sektoren ikke kan få dækket sine omkostninger, og at det i dag ikke er rentabelt at tage ud på fiskeri. Importen og indførslen af fisk, der stammer fra ulovligt, urapporteret og ureguleret fiskeri (IUU) i EU, er en af årsagerne hertil. Vi støtter derfor forslaget og betænkningen, men det er ikke nok. Jeg vil gerne benytte lejligheden til her fra Europa-Parlamentet at anmode Kommissionen og Rådet om at gøre noget øjeblikkeligt, og at de ikke lader denne sektor dø, for hvis det fortsætter som nu, går den konkurs. Jeg anmoder kommissæren og Rådet om at udarbejde og vedtage en fælles hastenødplan, som også omhandler foranstaltninger på mellemlangt og langt sig. Frankrig går forrest i denne kamp, og det forestående franske formandskab er en gylden chance for at gøre det. Kommissionen bør udøve sin initiativbeføjelse mere aktivt - støtte, kompensationer, omstruktureringer, nyskabelser - for at afbøde de omkostninger, sektoren lider under, og stoppe den unfair konkurrence, som importen indebærer. Tiden er knap. Vi havde gerne set, at Udvalget om International Handel havde været til stede under denne forhandling, for det er ikke meget værd at forbyde det ulovlige, urapporterede og uregulerede fiskeri, hvis EU derefter åbner sine markeder. Er det for meget at forlange, at der i EU kun sælges fisk, der stammer fra lovligt fiskeri? Der er brug for flere kontroller, bedre sporbarhed, mere og bedre mærkning, kort sagt flere garantier i forbindelse med det, der kommer ind i EU. Det er ikke nok, at det kun er EU, der gør det. Det skal ske på verdensplan, såvel multilateralt som bilateralt. Partnerskabsaftalerne bør også være et instrument i den henseende, med den pågældende tekniske bistand og uddannelse, så der ikke indføres nye handelshindringer, men derimod sikres effektive foranstaltninger for alle de implicerede parter. Fremtiden for en hel økonomisk sektor, der er meget koncentreret omkring visse regioner i EU, der er dybt afhængige af fiskeriet, og som har meget store sociale følger, afhænger heraf. Det er også afgørende for at sikre bæredygtige fiskebestande, som er en grundlæggende kilde til sunde fødevarer på et tidspunkt, hvor vi har en fødevarekrise. Ioannis Gklavakis Fru formand, hr. kommissærer, mine damer og herrer! Jeg vil gerne takke fru Aubert for betænkningen. Ulovligt, urapporteret og ureguleret fiskeri er et af de største problemer inden for denne sektor, idet det først og fremmest forårsager stor skade på miljøet, og dette er et enormt problem for denne klode. Det er konkurrenceforvridende, da de, der driver ulovligt, urapporteret og ureguleret fiskeri, stilles i en mere fordelagtig position end dem, der driver lovligt fiskeri, og som det er vores pligt at beskytte. Urapporteret fiskeri betyder tab af indtægter for staten. En af foranstaltningerne i det forslag til forordning, som vi stemmer om, er oprettelsen af en havnestatskontrolordning, som vil forbyde adgang for skibe fra tredjelande, der udfører ulovligt fiskeri. Forslaget indebærer et forbud mod import af fisk fra ulovligt fiskeri, at der oprettes en liste over fartøjer, der udfører ulovligt og urapporteret fiskeri, at der udvikles et EU-varslingssystem til brug ved mistanke om fisk fra ulovligt fiskeri samt et forbud mod import af fisk fra lande, der er kendt for ikke at ville samarbejde med EU-ordningen. Der er visse kontroversielle punkter i forordningen, f.eks. dens anvendelsesområde. Nogle medlemsstater anmoder om, at det begrænses til at gælde for EF-fartøjers fiskeriansvar uden for EF-farvande, da der allerede er rigeligt med bestemmelser til kontrol af fiskeriet i EF-farvande. Desuden forventes en revision af grundforordningen om fiskerikontrol i slutningen af 2008. Jeg tror, at de to forordninger vil overlappe hinanden, og at de ikke vil gøre processen med at forenkle den fælles fiskeripolitik nemmere. Lad mig derfor til slut sige, at dette er et meget alvorligt emne, og at vi bør behandle det som sådan. Vi må håndtere det med disciplin og beslutsomhed og altid i samarbejde med fiskerne, hvis meninger og samarbejde vi har meget brug for. Under alle omstændigheder støtter vi fru Auberts betænkning, som vi takker for. Luis Manuel Capoulas Santos for PSE-Gruppen. - (PT) Fru formand, hr. kommissær, mine damer og herrer! Aubert-betænkningen om ulovligt fiskeri blev enstemmigt vedtaget i Fiskeriudvalget, hvilket ordføreren, som jeg gerne vil lykønske, allerede har nævnt. Alene dette kaster sandsynligvis mere lys på emnet, end det, jeg kan sige på dette tidspunkt. Det kan dog aldrig gentages for ofte, at ulovligt fiskeri er en miljømæssig og økonomisk forbrydelse, som desværre ofte ikke bliver straffet, og som vi er nødt til at bekæmpe med beslutsomhed og mod. Jeg vil derfor gerne takke kommissær Borg og Kommissionen for hurtigt at have behandlet de anliggender, som Parlamentet gav udtryk for i februar 2007, og for at have fremlagt et forslag til en forordning, der overstiger alle forventninger, og som med rette fortjener vores bifald. Uanset hvor meget den administrative ramme er blevet forbedret, bliver det dog ikke nemt at opnå succes i en kamp, hvor fremskridt hæmmes af yderst vanskelige forhold, hvis vi ikke har medlemsstaternes forpligtelse og tilstrækkelige menneskelige ressourcer og materialer stillet til rådighed. Derfor er vi nødt til også at få medlemsstaterne med. Under alle omstændigheder tager EU et meget vigtigt skridt med denne betænkning og den efterfølgende forordning og foregår med et ædelt eksempel, som vi er stolte af. Jeg er sikker på, at Kommissionen fortsat vil tage imod Parlamentets bidrag med henblik på at forbedre forslaget yderligere. Fru formand, hr. kommissær! Jeg undskylder, hvis jeg nu bryder protokollen, men jeg kan ikke lade denne anledning til at komme med en indtrængende bøn gå fra mig. Fiskerisektoren er inde i en meget vanskelig periode på grund af stigningen i brændstofpriserne. Alle lider i øjeblikket, men de mest udsatte endnu mere. Jeg ved, at mange medlemsstater, herunder mit eget hjemland, Portugal, har til hensigt at bede om eller har allerede bedt om Deres støtte til at finde løsninger inden for EU's rammer ved at benytte Den Europæiske Fiskerifond på en fleksibel måde til at vedtage foranstaltninger, der kan dæmpe den aktuelle krises sociale følger. Jeg ved, at dette ikke er nødvendigt, men jeg taler til den solidaritet og åbensindethed, som De altid har udvist i forbindelse med fiskerisektorens problemer, og beder Dem hjælpe med at finde en tilfredsstillende løsning hurtigst muligt. Elspeth Attwooll Fru formand! ALDE-Gruppen vil gerne udtrykke sin fulde støtte til fru Auberts fremragende betænkning. De ændringer, den foreslår, tydeliggør og uddyber i nogle tilfælde diverse aspekter af Kommissionens forslag, bl.a. med nyttige tilføjelser om force majeuresubsidier og -sanktioner. Det glæder mig især, at der lægges så stor vægt på, at forordningens anvendelse ikke bliver diskriminatorisk, for der er ingen tvivl om, at IUU-fiskeri skal bekæmpes globalt, og at EU-foranstaltningerne er et vigtigt trin i den retning. Jeg var i sidste uge heldig at deltage i Fiskeriudvalgets delegation til Norge. Vi fik at vide, at der i de seneste tre år, og specielt siden indførslen af en havnestatkontrolordning for Kommissionen for Fiskeriet i det Nordøstlige Atlanterhav i maj 2007, er sket en enorm begrænsning af IUU-fiskeriet i det område. Ordningen omfatter alle EU-medlemsstater foruden Norge, Island, Færøerne og Rusland. Norges minister for fiskeri og kystanliggender har da også rost EU's samarbejde i denne henseende. Men der foreligger også en aftale om, at lokaliserede foranstaltninger kan medføre, at problemet forskydes uden at blive løst. Derfor er det specielt godt at se ændringsforslag 5, 6 og 54, som forsøger at gøre mere for at begrænse eventuelle negative indvirkninger på udviklingslandene. Jeg vil også gerne tilføje, at jeg mener, at vi har et særligt ansvar for at hjælpe med at forbedre inspektions- og kontrolsystemer i udviklingslandene, og ikke kun i de lande, som vi har partnerskabsaftaler med på fiskeriområdet. Endvidere håber jeg, at Kommissionen, Parlamentet og Rådet vil arbejde lige aktivt på at få vedtaget en bindende konvention om havnestatkontrol på FN-niveau. Forberedelserne er allerede påbegyndt i FAO og vil med den rette vilje kunne vedtages i marts 2009. Ian Hudghton Fru formand! Jeg vil gerne takke min kollega, Marie-Hélène Aubert, fra min gruppe for hendes store og flotte arbejde med betænkningen. Det er helt klart i alle fiskerinationers og fiskerisamfunds interesse at standse ulovligt fiskeri. Det er trods alt fiskerisamfundene selv, som får glæde af en bevarelse af ressourcen. Internationalt samarbejde er ubetinget nødvendigt, hvis det på verdensplan skal lykkes at standse ulovligt fiskeri, der udøves af pirater og kriminelle organisationer, som arbejder på dette område. I den fælles fiskeripolitik har den rapport, som for nylig blev udsendt af Revisionsretten om kontrol og håndhævelse, været genstand for alt for meget opmærksomhed. Rapporten var baseret på data, som angiveligt er indsamlet fra de seks største fiskerimedlemsstater. De data, som medlemsstaterne anførte, omfattede Det Forenede Kongerige (England og Wales). Skotland står for ca. 70 % af Det Forenede Kongeriges fiskeri og var ikke omfattet af disse data. Jeg vil blot gerne pointere, at der er særskilte og separate kvotaer og forvaltnings- og håndhævelsesorganisationer i Skotland. I de senere år er kontrollerne i min fiskerination også blevet forbedret. Vi har indført registrering af købere og sælgere, og vi har udpeget modtagerhavne. Det er naturligvis vigtigt, at håndhævelsen er effektiv, men det er lige så vigtigt, at der findes en fornuftig forvaltningsordning, der tilskynder til bevarelse, f.eks. ved at sikre, at Skotlands fiskere på lang sigt får fordel af de bevarelsesforanstaltninger, de er nødt til at anvende fra tid til anden. FFP har ganske enkelt ikke givet nogen garanti på dette område. Kommissær Borg, jeg var glad for at høre, at De for nylig udtalte Dem til fordel for FFP's rod- og branchereform. Jeg er enig med Dem og mener, at vi skal overdrage den daglige forvaltning og kontrol af ressourcen til de fiskerinationer, som har fiskekvoter for logiske fiskeområder, som f.eks. Nordsøen, og gå væk fra den uigennemførlige idé om, at vi kan have ens adgang til vand og ressourcer. Pedro Guerreiro Fru formand! Bortset fra enkelte punkter, hvor vi har forbehold, er vi enige i initiativet om at forebygge, afværge og standse ulovligt, urapporteret og ureguleret fiskeri, og vi er enige i betænkningens generelle effekt. Vi understreger bl.a., hvor vigtigt det er, at de regler, der er anført i dette initiativ, kommer til at gælde for alle fartøjer, både fra EU-lande og tredjelande. Vi vil dog gerne gøre opmærksom på, at hvis disse forslag skal stemme overens med en revision af Fællesskabsforordningerne om kontrol i fremtiden, skal medlemsstaternes kompetencer beskyttes, særligt hvad angår procedurer og udførelse af inspektioner. Vi mener også, at kompetencen for hele registret med spørgsmål om sanktioner ligger hos den enkelte medlemsstat. Til slut vil jeg blot gerne pointere, at hvis Kommissionen kunne behandle sektorens krav om retfærdighed lige så hurtigt, som den har behandlet dette initiativ, ville sektoren ikke opleve, at den socialøkonomiske situation hele tiden blev forværret. Hélène Goudin for IND/DEM-Gruppen. - (SV) Fru formand! Forordningen, som diskuteres i dag, er både omfattende og kompleks, og jeg vil bare betone et par punkter. For det første er forslaget om, at fiskere, som bliver taget i at fiske ulovligt skal tilbagebetale de tilskud, som de har modtaget fra EU, rigtig godt. Vi kan ikke tillade, at skattebetalerne tvinges til at støtte illegal virksomhed. På den anden side udføres der illegalt fiskeri fra alle typer både. Derfor burde forslaget omfatte alle fartøjer, både EU-fartøjer og tredjelandsfartøjer. For det andet er det foreslåede fangstcertifikat positivt. Certificeringsprocessen har en vigtig rolle i bekæmpelsen af det illegale fiskeri. Fælles maksimumbøder stiller jeg mig dog mere tvivlende over for. Medlemslandene skal kunne tage deres ansvar gennem afskrækkende afgifter. Endelig mener jeg, at den fælles europæiske fiskeripolitik har vist sig at være mislykket og må reformeres. For virkelig at kunne bekæmpe det ulovlige fiskeri har vi brug for internationalt samarbejde, både med regionale fiskeorganisationer og med andre internationale organer. Jim Allister (EN) Fru formand! Ulovligt, urapporteret og ureguleret fiskeri skal absolut standses. Der er derfor meget i denne betænkning, som jeg er enig i, men jeg kan ikke godtage dens angreb på subsidiaritet ved at kræve, at EU skal fastlægge strafferetlige sanktioner, og heller ikke, at EU skal nedsætte en gruppe med kontrollører. Jeg er også imod det udnødvendige ekstra bureaukrati i forbindelse med gennemførelsen af forordningen for fartøjer, der sejler under EU-flag, da disse fartøjer allerede er underlagt de strenge bestemmelser i den fælles fiskeripolitik. Vi har ikke brug for flere bestemmelser for vores egne fiskere for at håndtere tredjelandene, der fortsætter deres skadelige aktiviteter. Efter at jeg i de seneste måneder har set lokale fiskere i Det Forenede Kongerige blive pålagt bøder, afviser jeg for mit vedkommende forslaget om, at vi har brug for flere og strengere bestemmelser og straffe for vores egne flåder. Carmen Fraga Estévez - (ES) Fru formand! Jeg vil gerne takke fru Aubert for hendes betænkning. Efter min mening fremgår det klart af betænkningen, at Parlamentet har politisk vilje til at bakke op om alle de aktioner, der måtte være nødvendige, for at udrydde det ulovlige fiskeri inden for alle områder, og vi kan begynde med det, der vedrører os, nemlig at lukke EU af for import og handel med produkter fra det illegale fiskeri. Man kan dog ikke se bort fra det ansvar, der som følge af dette forslag påhviler havnestaten og selve Kommissionen. Vi taler om en meget ambitiøs forordning, der vil tvinge medlemsstaterne til at foretage en meget streng overvågning og til ikke at sky nogle materielle eller menneskelige midler - et af de svage punkter i enhver kontrolpolitik - så forordningens ånd bliver ført ud i livet. Det betyder desværre endnu en gang, at det er nødvendigt at få andre politiske viljer end vores egne i spil. Den skade, som det ulovlige fiskeri forårsager, ikke kun for de biologiske ressourcer, men også for de lovlydige fiskere, har vi kunnet konstatere hver eneste dag i årevis. Nu er en stor del af sektoren i oprør på grund af et nyt stort fald i rentabiliteten, som naturligvis først og fremmest skyldes den store stigning i dieselpriserne. Men der er andre faktorer, der bidrager til tabene, herunder den massive indførsel via vores grænser af billige importprodukter af tvivlsom oprindelse, der under disse omstændigheder er særlig skandaløs. Lad mig komme med et eksempel. Alene i de første fem måneder i år er dieselprisen i Spanien steget med 38 %, men prisen på sværdfisk - der importeres i stort omfang - er faldet med 40 %. Der er ingen virksomheder inden for nogen branche, der kan overleve under sådanne økonomiske forhold, og ikke desto mindre er det en kendsgerning, at de priser, der betales til fællesskabsproducenterne, straks stiger igen, når man har haft politisk vilje til at overvåge disse importer tæt, hvilket man har gjort tidligere, og det kan jeg bevidne. Jeg beder Dem derfor om, hr. kommissær, at De sammen med medlemsstaterne står fast og snarest mulig iværksætter denne forordning. Stavros Arnaoutakis (EL) Fru formand, hr. kommissær, mine damer og herrer! Jeg vil gerne rette en tak til ordføreren for at have udført et førsteklasses stykke arbejde med denne betænkning. Vi i EU må nu endelig indse, at jo mere vi tillader denne ukontrollerede situation at udvikle sig, desto flere veksler trækker vi på fremtiden for havfiskeriet og det globale marine økosystem. EU bør straks skride til handling og ikke kun handle som en union af regler, der er bureaukratiske, komplekse og ofte ikke engang gennemført af dens medlemsstater, men tage et globalt initiativ uden at være bange for de enorme interesser, der er på spil, og uden at give efter for internationalt eller andet pres. Det vil få hele den del af verdenssamfundet, der har med fiskeri at gøre, til at forstå, acceptere og omsider blive enige om, at illegalt og urapporteret fiskeri skal begrænses mest muligt. En betingelse for et sådant initiativ vil naturligvis være, at der indgås en globalt accepteret aftale om opretholdelse af fiskeriet. Også jeg vil gerne sammen med mine kolleger i Parlamentet give udtryk for min bekymring over den alvorlige krise, der har ramt de europæiske fiskere. Vi bør straks undersøge disse forhold og træffe foranstaltninger til løsning af problemerne. Zdzisław Kazimierz Chmielewski (PL) Fru formand! Rådets forordning er et interessant eksempel på forebyggende lovgivning, der er rettet mod ulovlige fangster, en praksis, der truer opretholdelsen af fiskebestandene på et bæredygtigt niveau. Hovedårsagen til, at dette forslag har en chance for at blive effektivt, er, at det er klart formuleret med en præcis definition af lovgiverens intentioner. Ordføreren har på fremragende vis forstået bestemmelsens særlige beskaffenhed og har givet usædvanligt nyttige fortolkninger, der ganske enkelt gør det nemmere at tyde de vigtigste bestemmelser. Regeringerne i de syd- og østbaltiske lande har i vidt omfang reageret på dette vigtige lovinitiativ. Blandt eksperter fortsætter diskussionerne om det kriterium, som Rådet har foreslået til straf af fiskere, der udøver ulovligt fiskeri. Spørgsmålet opstår igen, om idéen med at finde en garanti for en effektiv straf via den omfattende formalisering tager højde for differentieringen i de europæiske farvandes fangstpotentiale? Burde den følgende lovgivning ikke tage hensyn til, at det er muligt at lade strafniveauet afhænge af fiskebestandene og bindende fangstkvoter for de fangede arter? Jeg mener, at den seneste ændring af ICES' evaluering af det baltiske økosystem er tegn på en optøning i fiskeripolitikken i forbindelse med tilpasningen af EU's revolutionerende foranstaltninger for at beskytte bestandene. Europa-Parlamentets Fiskerikomité var så fremsynet, at den udarbejdede et specielt ændringsdokument, der behandler bestemmelsens første gennemførelsesår som en overgangsperiode, en tilpasningsperiode, så medlemsstaterne kan træffe de nødvendige foranstaltninger for at indordne sig. Avril Doyle (EN) Fru formand! Fiskeriet er i krise på verdensplan. Fiskeriet er i krise i EU, og krisen forværres af en 30 % stigning i prisen på skibsbrændstof gennem de seneste måneder. Fiskerne demonstrerer i Bruxelles og i EU-medlemsstaterne. Deres reaktion haster, hr. kommissær. Vi bevæger os fra et ikkebæredygtigt økonomisk pres til et ikkebæredygtigt miljømæssigt pres, og eksperter rapporterer, at 75 % af fiskepladserne er betydeligt udfisket og udsat for rovdrift. Ulovligt, urapporteret og ureguleret fiskeri er et globalt problem, der vanskeliggør den aktuelle fiskerikrise yderligere. I henhold til FAO udgør IUU-fiskeri generelt op til 30 % af de samlede fangster for nogle af de større fiskepladser, og fangster af specielle arter kan være op til tre gange den tilladte mængde. IUU-fiskeri underminerer bæredygtigt fiskeri, skader og ødelægger levesteder i havet og truer ansvarlige fiskeres og fiskerisamfunds eksistensgrundlag. Ulovligt fiskeri bringer fødevaresikkerheden i fare, særligt for dem, som er afhængige af fisk som en kilde til animalsk protein. Bifangst, der hovedsagelig skyldes storstilet industrielt fiskeri med bundtrawl, som ofte udføres ureguleret, ulovligt og urapporteret af højsøfiskeflåder, har en altødelæggende effekt for lokale fiskere og fiskebestande. Mere end en tredjedel af verdens fangst bliver simpelthen kasseret på grund af forkerte fiskestørrelser eller blot på grund af utilsigtet fangst. Uheldige EU-fiskeriforordninger har opfordret til metoder, som slet ikke er bæredygtige, f.eks. at frasortere fisk i stor målestok, da det - helt grotekst - er ulovligt at lande bifangster. En undersøgelse heraf ville være værdiløs for forskere. Da de fleste dybthavsfiskebestande er yderst sårbare over for hurtig udfiskning, betyder det, at denne fiskeritype muligvisk ikke længere findes, når forordningerne implementeres. Jeg vil gerne spørge kommissæren, om han har set på mulighederne for satellitsporing af fartøjer, elektroniske dokumentationssystemer for fangster og indbygget CCTV som mulige foranstaltninger for at bekæmpe ulovligt fiskeri, som det er tilfældet i andre jurisdiktioner. For at denne forordning kan blive korrekt implementeret, kræver det, at de enheder, der er ansvarlige for inspektion og kontrol, er stærkt integreret på fællesskabsniveau. Det kræver også, at fiskere og andre relevante parter tager ansvar og tager politikken til sig. Iles Braghetto (IT) Fru formand, mine damer og herrer! Det er EU's pligt og ansvar at spille en væsentlig rolle i ulovligt, urapporteret og ureguleret fiskeri, og det gøres med en række initiativer til at håndhæve loven samt øge kontroller, inspektioner og sanktioner. Det mest ambitiøse mål er imidlertid forebyggende i sig selv, idet det giver mulighed for og garanterer produkternes sporbarhed fra fangsten til den endelige destination. Dette skyldes, at de mål, der skal opnås for at beskytte forbrugerne med et højkvalitetsprodukt og for at beskytte fiskernes erhverv, ikke er mindre vigtige, selv om den skade, der er opstået på grund af disse ulovlige aktiviteter, både økonomisk og med hensyn til beskyttelse af havmiljøet, er alvorlig. Disse erhverv er mere end nogensinde i fare på grund af mange faktorer, bl.a. økonomiske, men også strukturelle faktorer. Det er disse vigtige sociale målsætninger, der er EU's rettesnor for at forebygge, bekæmpe og standse ulovligt fiskeri, hvilket er formålet med denne forordning, som også styrker EU's engagement i at sikre, at bestemmelserne i den fælles fiskeripolitik overholdes i Fællesskabets farvande. Det enstemmige tilsagn til Aubert-betænkningen i komitéen er et vigtigt tegn på, at medlemmerne ønsker at gennemføre de foreslåede foranstaltninger i praksis. Петя Ставрева (BG) Fru formand, medlemmer af Europa-Parlamentet! Denne betænkning omhandler meget vigtige problemer relateret til beskyttelsen af farvande og foranstaltninger til bekæmpelse af ulovligt fiskeri. På grund af det stigende omfang af dette fænomen, som truer økosystemer og fiskepladser i Fællesskabet, er det blevet nødvendigt at ændre det eksisterende retsgrundlag. Ordføreren bemærker også det væsentlige faktum, at nogle medlemsstater ikke følger den fælles fiskeripolitik. De eksisterende sanktioner varierer fra én medlemsstat til en anden, og det er diskriminerende for nogle fiskere i EU. Det er derfor meget vigtigt at forbedre samarbejdet, koordineringen og udvekslingen af god praksis blandt EU-landene for at forebygge og afværge ulovligt og urapporteret fiskeri. Oprettelsen af et kontrolsystem, der er tilpasset fiskerisektorens behov, er et væsentligt skridt fremad. Ulovligt fiskeri skader miljøet og medfører økonomiske og sociale konsekvenser, der får lovligt fiskeri til at lide tab på milliarder euro. Forbuddet mod import af fiskeprodukter fra ulovligt, urapporteret og ureguleret fiskeri i EU kan også have indflydelse på fortjenesten ved ulovligt fiskeri. Kontrolpolitikken og de alvorlige sanktioner for overtrædelse giver mulighed for en bedre forvaltning af fiskeressourcerne. Fiskere demonstrerer også i Bulgarien, fordi de oplever mange vanskeligheder. Vi er derfor nødt til at træffe ansvarlige beslutninger om sektorens fremtid. Jeg støtter fru Auberts betænkning. Mairead McGuinness (EN) Fru formand! Jeg vil gerne takke fru Aubert for denne betænkning. Det problem, som bør fremhæves, er, at forbrugerne ikke er klar over problemet med ulovligt, urapporteret og ureguleret fiskeri, så det er vi nødt til at tale mere om. Som andre har nævnt, er den lovlige fiskerisektor under stærkt pres, og indvirkningen af ulovligt, urapporteret og ureguleret fiskeri er blot en del af problemet. Brændstofudgifter er et stort problem for dem, og vi har brug for en reaktion fra Kommissionens side på den krise, som har medført, at fiskere i medlemsstaterne forærer fisk væk og demonstrerer. Måske er en del af det problem, vi har med den ulovlige side af fiskeriet, for meget regulering i den lovlige sektor, men måske er det en anden debat. Ja, vi har brug for en global aftale om dette emne, men vi er nødt til at begynde herhjemme. Uanset hvad vi vælger at gøre, skal vi sikre os, at de forordninger, vi indfører, er effektive og behandler problemet ved kilden, så vi ikke ødelægger både økonomien og miljøet. Bureaukratiet skal ikke blot tilføjes endnu et lag, som vi ofte bliver beskyldt for her. Paulo Casaca (PT) Fru formand! Dette er en fremragende betænkning, tillykke til ordføreren. Dette forslag er godt, hvilket Kommissionen allerede har udtalt, men jeg vil gerne understrege den besked, vi fik af ordføreren for udtalelsen fra Udvalget om International Handel, Daniel Varela Suanzes-Carpegna, nemlig at det præcis er et instrument som dette, der kan være et effektivt svar på den krise, vi oplever i fiskerisektoren i øjeblikket. Det er netop på grund af, at reglerne om bæredygtighed ikke overholdes på fiskepladser, at fiskerne er kommet i krise, og det er den grundlæggende lektion, som jeg håber, vi alle vil drage heraf. Problemet er, at uret tikker, og tiden står ikke stille for vores lovgivningsproces. Set ud fra dette synspunkt skal der, som det allerede er blevet sagt, hr. kommissær, træffes foranstaltninger meget hurtigt, da vi ellers ikke reagerer på udfordringerne i tide. Avril Doyle (EN) Fru formand! Hvis fem minutter af catch the eye-proceduren ikke er besat, kan selv de personer, som har deltaget i forhandlingen, stille et spørgsmål til kommissæren. Det har jeg gjort flere gange, siden catch the eye-proceduren blev indført. Med Deres tilladelse vil jeg derfor gerne stille et specifikt spørgsmål til kommissæren. Formanden Jeg har fået at vide, at jeg kun må vælge to spørgere. Jeg giver Dem gerne ordet. Avril Doyle (EN) Fru formand! Jeg ønsker ingen fortrinsbehandling, men der er faciliteter til fem minutters catch-the-eye. Kunne kommissær Borg kommentere på, at der anvendes subsidier til skibsbrændstoffer i nogle medlemsstater og ikke i andre, og på en fair tilgang til subsidier? Hvordan kan dette stemme overens med den fælles fiskeripolitik - med tryk på fælles - og stemmer det overens med konkurrencepolitikkens regler? Vi er nødt til at hjælpe fiskersamfundet, som for tiden er i alvorlig økonomisk krise, særligt på grund af en 30 % stigning i priserne på skibsbrændstof. Vil De svare specifikt på dette spørgsmål, som flere spørgere har anmodet om? Joe Borg medlem af Kommissionen. - (EN) Fru formand! For det første vil jeg gerne sige, at debatniveauet for dette vigtige emne viser, at vi står sammen om et stærkt ønske om at løse IUU-problemet på en effektiv og omfatttende måde. Sandheden er ikke blot, at IUU-fiskeriet truer fiskebestandens bæredygtighed, men det truer også fremtiden for ærlige fiskere både i og uden for EU. For at vores bestræbelser skal lykkes, må vi sikre tre altafgørende principper. Det første er, at forslagets dækningsområde forbliver omfattende. For det andet skal den indførte certificeringsordning være effektiv, men dog sikre, at ordningen ikke medfører, at der pålægges unødvendige byrder. Og den sanktionsordning, vi foreslog, skal fungere som en effektiv og afstraffende foranstaltning og således virke afskrækkende i sig selv. Med hensyn til disse tre principper har jeg fået bekræftet, at det er lykkedes Dem at løse diverse problemer med medlemsstaterne vedrørende dækningsområdet, certificeringsordningen og sanktionerne. Det har De gjort uden at forringe forslaget eller gøre det mindre effektivt. Specielt om sanktionerne vil jeg gerne sige, at et af de største problemer med kontrol er, at den serie sanktioner, som medlemsstaterne anvender, er så uens, at sektoren selv konstant og konsekvent har bedt om et fælles grundlag for dens virke. Det er grunden til, at vi som et minimum har foreslået niveauer, som skal indføres på en passende og effektiv måde. Med hensyn til det mere omfattende spørgsmål om en reform af den fælles fiskeripolitik kan jeg bekræfte, at vi er begyndt at overveje emnet og holder et orienterende møde i Rådet i de kommende måneder. Det er nemlig vores idé at afholde et uformelt ministermøde i september. Vi skal også behandle overregulering med henblik på at forenkle det aktuelle reguleringsregime. Jeg vil også gerne sige, at jeg er helt enig med fru Auberts kommentar om, at en effektiv bekæmpelse af IUU vil hjælpe fiskerne med bedre at overvinde deres aktuelle vanskeligheder. Dette har andre af de medlemmer, som har talt, også lagt vægt på. Jeg er dog også enig i, at dette ikke er tilstrækkeligt. Med hensyn til spørgsmålet om udviklingslande ønsker vi at løse problemet effektivt, som jeg sagde i mine indledende bemærkninger. Det er vigtigt at træffe foranstaltninger til at støtte udviklingslandene, hvis vi skal løse problemet og ikke blot forskyde det. Hvad angår kontrolspørgsmål vil jeg gerne forsikre ordføreren om, at Kommissionen vil fremlægge et vægtigt forslag i løbet af tredje kvartal i år, og det bliver også slået sammen eller harmoniseret med det IUU-forslag, vi har foran os. På den måde bliver begge konvergerende og opnår de samme resultater. Med hensyn til brændstofkrisen har vi allerede mulighed for at benytte de indførte mellem- og langsigtede foranstaltninger, og de skulle kombineres med en omstrukturering af sektoren. Vi vil se på de gældende markedsforanstaltninger, der fungerer således, at de øgede omkostninger betales af fiskerne og ikke pålægges forbrugeren, som det sker i andre sektorer. Dette punkt er også blevet omtalt af nogle af de medlemmer, som har deltaget. Vi er derfor nødt til at undersøge dette forhold for at finde årsagen. Nogle af de indførte systemer medfører en situation, hvor det er fiskeren, der i sidste ende lider, og som i sidste ende skal betale de øgede omkostninger, i modsætning til dem, der pålægges forbrugerne. Vi giver også fiskerne mulighed for at få øjeblikkelig hjælp i relation til en omstrukturering i form af rednings- og omstruktureringsstøtte. Jeg må dog lige indføje, at jeg også undersøger sagen og diskuterer den med mine kolleger for at prøve at finde andre måder og midler til at hjælpe fiskerne med at overvinde denne nye realitet i løbet af meget kort tid. Jeg må imidlertid understrege, at vi kun kan gøre dette, hvis der foreligger et fast og tidsbegrænset tilsagn om en omstrukturering, fordi problemet også omfatter overkapacitet. Medmindre vi løser problemet med overkapacitet, vil det opstå igen, så længe brændstofpriserne er så høje som nu, eller hvis de - hvilket vil være endnu værre - fortsætter med at stige, hvilket det kunne se ud til. Det er det, vi har gjort med Frankrig, hvor der blev indgået en aftale mellem Kommissionen og Frankrig om en pakke med foranstaltninger, der skal hjælpe med en omstrukturering af den franske fiskerisektor. Jeg må indrømme, at det ikke var tilstrækkeligt, og at de franske fiskere ikke var tilfredse. Jeg må understrege, at vi har brug for, at medlemsstaterne samarbejder og engagerer sig aktivt, for at Kommissionen reagerer. Vi kan ikke handle på egen hånd. I denne henseende forstår jeg, at spørgsmålet om krisen bliver rejst og behandlet på det kommende Råd i juni, og personligt er jeg glad for det. På det spørgsmål, der blev stillet helt til sidst af fru Doyle om anvendelsen af subsidier i nogle medlemsstater og ikke andre, har Kommissionen fået oplyst, at de subsidier, der er blevet tildelt af forskellige medlemsstater, enten ligger inden for de minimis (og enhver medlemsstat kan tildele subsidier, så længe de ligger inden for grænsen af de minimis) eller er givet i forbindelse med de omstruktureringsprogrammer, jeg tidligere henviste til. Der foreligger en erklæring med hensyn til rednings- og omstruktureringsstøtte, og hvis der indgås en aftale - hvis Kommissionen giver grønt lys for et omstruktureringsprogram - er der visse muligheder for subsidier, hvad angår statsstøtte, som ellers ikke ville være til stede. Når vi får oplysninger om andre subsidier, der ikke hverken er givet i forbindelse med de minimis eller omstruktureringsprogrammer, undersøger vi dem. Der er f.eks. lige blevet givet en notifikation til Frankrig om, at beløbet, der blev udbetalt i form af en forsikringsordning, skal tilbagebetales. Så vi griber ind for at sikre, at EU-konkurrencereglerne overholdes. Jeg vil dog gerne slutte af med at sige, at den aktuelle krise kræver, at vi behandler den meget forsigtigt og benytter måder og midler til at finde øjeblikkelige løsninger, som også har den konditionalitet, at der på kort sigt foreligger et fast løfte, om at fiskerisektoren bliver omstruktureret, så kapacitetsniveauerne tilpasses et bæredygtigt fiskeri. Marie-Hélène Aubert Fru formand! Indledningsvis vil jeg gerne takke kommissæren og alle, der har deltaget i forhandlingen. Vi har selvsagt også været inde på baggrunden for den alvorlige krise, der i øjeblikket præger sektoren. Jeg takker kommissæren for at have bestræbt sig på at besvare de spørgsmål, der blev rejst om dette emne, så præcist som muligt, selv om det i sagens natur er vanskeligt at gå i detaljer på visse områder. Under alle omstændigheder er det uheldigt, at EU - Bruxelles, som man ofte siger - systematisk får skylden for alt. Jeg tror netop, vi her har en god anledning til at vise, at EU - Bruxelles - ikke er en del af problemet, men først og fremmest en del af løsningen. Jeg indrømmer, at man, når man mærker, hvilken uvilje der undertiden er mod EU, må erkende, i hvor høj grad medlemsstaterne og en række aktører inden for sektoren i årevis har unddraget sig ansvaret og prioriteret meget kortsigtede interesser med en formodning om at kunne drage fordel heraf for en tid, men samtidig har nægtet at se i øjnene, at de dermed førte en hel sektor mod afgrunden. Der står vi så nu. Hvordan finder vi umiddelbare løsninger på en situation, som har varet i årevis? Det er ikke enkelt. De har foreslået nogle mulige veje. Men det lykkes os ikke, hvis vi ikke træffer strenge og drastiske foranstaltninger og tager alle fornødne midler i brug. For disse tekster bliver ikke gennemført uden finansielle og menneskelige ressourcer og heller ikke uden samtidig at vedtage sanktioner, som er langt mere afskrækkende end dem, der eksisterer i dag, hvad angår ulovligt fiskeri. Sidstnævnte bliver ikke noget større problem, i betragtning af hvor beskedent et antal bøder der er blevet udstedt i den senere tid. Der er endvidere behov for i langt højere grad at tilskynde til og belønne intelligent og bæredygtig optræden og praksis. Fiskere og fiskeindustrivirksomheder, der vælger en praksis, som fuldt ud er i overensstemmelse med forskrifterne, og som er innovativ med hensyn til bæredygtig forvaltning af fiskeområderne, savner ofte anerkendelse og belønning. Det er også min opfattelse, at der, både når det gælder bekæmpelse af ulovligt fiskeri, og når det gælder andre af de emner, vi har været inde på, såsom udsmidning af fisk, ressourceforvaltning og overholdelse af kvoter, er grund til at føre en politik, som i langt højere grad belønner dem, som går foran og går i den rigtige retning. Det synes ikke at være tilfældet i dag. Afslutningsvis vil jeg gerne understrege, at denne betænkning efter min mening giver os anledning til at rejse alle disse spørgsmål. Denne forhandling løser naturligvis ikke i sig selv problemerne. Jeg tror, vi vil opleve, at drøftelserne fortsætter i forbindelse med den næste betænkning. Det er imidlertid efter min opfattelse på tide, vi får en bred høring uden disse top-down-forhandlinger mellem Kommissionen, regeringer og industriens repræsentanter. Der er behov for en langt bredere, mere horisontal, tværfaglig høring. Den ville give os nogle svar, og EU og Europa-Parlamentet ville igen få mulighed for at udfylde deres rolle og påtage sig deres ansvar for at finde løsninger for den kriseramte sektor. Formanden Forhandlingen er afsluttet. Afstemningen finder sted torsdag den 5. juni 2008. Skriftlig erklæring (artikel 142) Margie Sudre Europa-Parlamentet har rettet et nyt angreb mod ulovligt, urapporteret og ureguleret fiskeri, som udgør en sand international svøbe. De vedtagne foranstaltninger supplerer på effektiv vis den eksisterende ordning. Jeg henviser navnlig til havnestaters etablering af en kontrolordning for skibe, der anløber havnen. Ordningen vil indebære, at der udstedes en fangstattest, og den vil indebære forbud mod at lade piratfartøjer få adgang til havnen. Jeg hilser også forbuddet mod import af fisk fra ulovligt fiskeri velkommen, og det samme gælder offentliggørelsen af en liste over fartøjer, som udøver ulovligt, urapporteret og ureguleret fiskeri. Merværdien i forbindelse med disse nye europæiske forskrifter følger også af udviklingen af et EF-varslingssystem, som udløses, hvis der er mistanke om piratfiskeri. Sanktionssystemet er i øvrigt styrket, og det er udvidet til også at omfatte et forbud mod at lade skibe, som udøver ulovligt, urapporteret og ureguleret fiskeri, få del i offentlige tilskud og til agebetaling af offentlig støtte modtagne subsidier om nødvendigt. Først og fremmest kæmpede jeg med succes for, at Europa-Parlamentet viser randområderne særlig opmærksomhed i forbindelse med kampen mod ulovligt fiskeri, eftersom disse områders økosystemer er særligt sårbare. Hermed sendes et stærkt budskab til hensynsløse flåder, hvilket vil gøre det muligt reelt at bremse den illoyale konkurrence, som langsomt, men sikkert, kvæler vores fiskere.
Q: Insect Identification - Black Cicada I came across a black cicada in northwest Missouri last week. I am only familiar with brown cicadas. What makes this black one different? Is it a different species, or do the brown cicadas change color at some point in adulthood? A: A little digging on wikipedia seems to have answered my question. This picture of a 17 year cicada, Magicicada septendecim is pretty close to what I saw. Furthermore, this seems to match the time and place, as the Kansas Brood of 17 year cicadas is scheduled to emerge this year and should appear in the Missouri-Kansas area. It also explains why I'm not familiar with these cicadas, 17 years ago I wasn't paying attention to them.
National Counter Terrorism Academy The National Counter Terrorism Academy (NCTA) is a training center for U.S. state and local law enforcement officers. The Academy operates at the LAPD's Ahmanson Training Center, near the Los Angeles International Airport. Creation LAPD chief William Bratton founded the Academy in 2008, in partnership with the Center for Policing Terrorism. The academy began operation with a bricks-and-mortar location; a virtual, or online, academy; a digital library; and mobile academic teams. Curriculum The Academy's five-month course aims to teach trainees how to recognize terrorist cells and build regional intelligence networks. Topics of instruction include homegrown radicalization; methods for interdicting terrorism finance; case studies of significant terrorism plots; the historical roots of terrorism; religious extremism, homegrown terror groups; the evolution of al-Qaida; and culturally sensitive interviewing techniques. Philosophy The Academy advances a theory of intelligence-led policing. The doctrine fuses Israeli counter-terrorist tactics with the Fixing Broken Windows theories advanced by criminologist George L. Kelling and social scientist James Q. Wilson. References Category:Law enforcement in the United States Category:Counter-terrorism theorists Category:Counter-terrorist organizations
Enprofylline and theophylline on small human placental arteries: studies of in vitro effects and mode of action. Vascular effects of theophylline and enprofylline, a novel xanthine derivative lacking adenosine receptor antagonism, were studied comparatively in tubular preparations of small human placental arteries mounted in an isometric myograph. Both xanthines produced concentration-dependent (10(-7)-3 X 10(-3) M) relaxation of arteries contracted by PGF2 alpha or PGE2 in both normal Ca2+-medium and in Ca2+-depleted medium. Enprofylline was about three times more potent than theophylline. Also in vasopressin-contracted arteries enprofylline was a more potent vasodilator in both media. In contrast the xanthines were equally potent in relaxation of the tonic as well as the phasic part of a K+-induced contraction, but less potent than in relaxation of PG-induced contractions. Propranolol, phentolamine, atropine, indomethacin or tetrodotoxin did not influence the xanthine relaxations. It is concluded that the theophylline-induced relaxation of small human placental arteries is not due to adenosine receptor antagonism. A common important mechanism of action, in which enprofylline is more potent than theophylline, seems to be interference with intracellular Ca2+-binding/mobilisation processes. Some decrease in cellmembrane Ca2+-permeability produced by the xanthines seems to take part in the mechanism of relaxation.
In this fictional place, it's windy -very windy! People have learned to cope with it in strange and funny ways in their everyday lives. This video is Robert Löbel's graduation project at the HAW Hamburg Design Department. -via Laughing Squid
TechTutor TV: Find and Install Add-ons in the Add-ons Manager in Firefox 3 With the Firefox 3 Add-ons Manager you can easily search for and install add-ons that are compatible with the browser. Check out this video tutorial to find out how to find and install add-ons in the add-ons manager in Firefox 3.
Q: Every 3-regular graph without cut edges has a perfect matching I'm trying to understand Petersen's Theorem as a corollary to Tutte's Theorem. Corollary 5.4. Every 3-regular graph without cut edges has a perfect matching. Proof. Let $G$ be a 3-regular graph without cut edges, and let $S$ be a proper subset of $V.$ Denote by $G_1, G_2, ..., G_n$ the odd components of $G - S$ and let $m_i$ be the number of edges with one end in $G_i$ and one end in $S, 1 \leq i \leq n.$ Since $G$ is 3-regular \begin{align} \sum_{v \in G_i} d(v) &= 3 \|(G_i)\|, \tag{5.8} \end{align} for $1 \leq i \leq n$ and \begin{align} \sum_{v \in S} d(v) &= 3 \|S\|. \tag{5.9} \end{align} By equation (5.8), $m_i = \sum_{v \in G_i} d(v) - 2 \epsilon(G_i)$ is odd, where $\epsilon(G_i)$ is the number of edges in $G_i$. Now $m(i) \neq 1$ since $G$ has no cut edges. Thus $m_i \geq 3$ for $1 \leq i \leq n$. It follows that \begin{align} o(G - S) = n \leq 1/3 \sum_{i=1}^n m_i \leq 1/3 \sum_{v \in S} d(v) = \|S\| \end{align} Therefore by Tutte's Theorem, G has a perfect matching. Question. I can see that $m_i$ as given by the expression $\sum_{v \in G_i} d(v) - 2 \epsilon(G_i)$ is odd whenever G_i is an odd component. (I can also see that $m_i$ is even whenever $G_i$ is even. I can prove both facts. But I can't see how the equation $m_i = \sum_{v \in G_i} d(v) - 2 \epsilon(G_i)$ was deduced from equation 5.8. I know that $\sum d(v) = 2 \epsilon(G_i)$. That's theorem 1.1 in the book. (The sum of the degrees of a graph equals 2 times its number of edges. A very intuitive theorem.) But I can't connect this fact and equation 5.8 to give the expression for $m_i$. Any direction is appreciated. Thank you. A: When we take the sum $$\sum_{v \in G_i} d(v)$$ (keeping in mind that $d(v)$ is $v$'s degree in $G$, not in $G_i$) then every edge with two endpoints in $G_i$ is counted twice, and every edge with one endpoint in $G_i$ is counted only once. There are $\epsilon(G_i)$ edges with two endpoints in $G_i$, so they contribute $2\epsilon(G_i)$ to the value of the sum. The edges with one endpoint in $G_i$ are precisely the edges between $G_i$ and $S$ (there are, by definition, no edges between $G_i$ and $G_j$ for $i \ne j$) so they contribute $m_i$ to the sum. So we get $$3\|G_i\| = \sum_{v \in G_i} d(v) = 2 \epsilon(G_i)+ m_i$$ and then you know what to do from there. Later on, we need the inequality $$3\|S\| = \sum_{v \in S} d(v) \ge \sum_{i=1}^n m_i$$ which follows for similar reasons. In the sum of $d(v)$ over all $v \in S$, there are three types of edges to consider: Edges internal to $S$, which would be counted twice, but which we just throw away in the inequality. Edges going from $S$ to $G_i$ for some $i$ of which there are exactly $m_i$; each is counted in the sum once. Edges going from $S$ to some even component of $G - S$, which we also throw away.
ニキビ肌、乾燥肌、インナードライ肌、肌状態や悩みはさまざま。どのシリーズを使えばいいの？オルビスユー(orbis u)・オルビスクリア・オルビスアクアフォースの肌質お悩み別おすすめをご紹介！お試しセット（トライアル）で試しやすいスキンケアシリーズ。
149 Conn. 502 (1962) HARRY GINSBERG v. SAMUEL MASCIA Supreme Court of Connecticut. Argued March 8, 1962. Decided May 18, 1962. BALDWIN, C. J., KING, MURPHY, SHEA and ALCORN, JS. 503 T. Holmes Bracken, for the appellant (defendant). Charles Henchel, with whom was Morris W. Mendlesohn, for the appellee (plaintiff). SHEA, J. In this action, the plaintiff sought an injunction to restrain the defendant from erecting and maintaining a fence or barrier dividing properties owned by the parties. The plaintiff also claimed damages. He alleged that the parties had made an agreement that no fence should be erected between the properties except by mutual agreement and that the defendant had begun to erect a fence in contravention of the agreement. The defendant, in his answer, denied the material allegations of the complaint. The court found the issues for the plaintiff and granted injunctive relief as requested. The defendant has appealed, claiming that the court erred in finding certain facts without evidence, in reaching certain conclusions when the subordinate facts do not support them, and in overruling certain claims of law. The finding, which is not subject to correction, recites the following facts: The plaintiff and the 504 defendant own adjoining properties on the southerly side of Judson Avenue in New Haven. The defendant's property is east of that of the plaintiff. There is a dwelling house on each of the properties. On the easterly side of the plaintiff's property, there is a driveway leading from the street to a garage in the rear of the premises. This driveway is about ten feet wide and contiguous to the defendant's boundary line. Adjoining this driveway, on the defendant's property, there is an open space, about four feet wide, in which there is a concrete walk leading from the street to the rear of the defendant's house. The plaintiff is in the oil business and owns several trucks which travel over his driveway many times a day. The trucks are often driven over the boundary line onto the defendant's property. Prior to 1953, the plaintiff's use of the driveway caused disputes between the parties. In 1953, they agreed to replace an old, broken wooden fence running along the southern part of the boundary line with a new wire fence. Each party was to pay one-half of the cost. The parties engaged a fence specialist to do the work. In the defendant's absence, the salesman for the fence company was told by the plaintiff to insert into the written contract, to be signed by all the parties, the following language: "Each of the two purchasers of this 111 linear feet of 4 ft. fence agrees in signing this contract to each pay one half of the total cost of this fence as shown below and to have no further fence installed between these properties without mutual agreement." A contract containing the quoted words was signed by the plaintiff, by the defendant's wife, who signed the defendant's name in his presence, and by a representative of the fence company. The new fence was erected and extends from 505 the rear of the properties northerly along the boundary line to a post near the rear of both houses. The fence follows the old fence line, and the post near the rear of the houses is centered on the line. The plaintiff has acquired more trucks and continues with greater frequency to drive onto the defendant's land. Prior to the commencement of this action, the defendant erected three posts, all entirely on his land but near the boundary line of the plaintiff's property. The plaintiff, on bringing the present action, requested and obtained a temporary injunction, after which the defendant removed the posts. The court concluded that the plaintiff was entitled to an injunction to restrain the defendant from erecting or maintaining a fence or barrier, other than the fence provided for in the 1953 contract, except by mutual agreement of the parties. Restraining the action of an individual by injunction is an extraordinary power, always to be exercised with caution and never without the most satisfactory reasons. The court, before acting, must be satisfied that a wrong is about to be done or an injury is about to be sustained. Brainard v. West Hartford, 140 Conn. 631, 634, 103 A.2d 135. An injunction cannot be demanded as a matter of right but rests in the sound discretion of the court. Point O'Woods Assn., Inc. v. Busher, 117 Conn. 247, 250, 167 A. 546. It is a fundamental principle that equity will not interfere where the legal right is doubtful. Holt v. Wissinger, 145 Conn. 106, 115, 139 A.2d 353; Roath v. Driscoll, 20 Conn. 533, 539. To determine whether the court was warranted in issuing an injunction in the present case, it is necessary to interpret the language of the contract which the injunction was designed to enforce. A contract 506 is to be construed according to what may be assumed to have been the understanding and intention of the parties. Downs v. National Casualty Co., 146 Conn. 490, 494, 152 A.2d 316; Bridge-Mile Shoe Corporation v. Liggett Drug Co., 142 Conn. 313, 318, 113 A.2d 863. That intention is to be determined from the language used, interpreted in the light of the situation of the parties and the circumstances connected with the transaction. The question is not what intention existed in the minds of the parties but what intention is expressed in the language used. Foley v. Foley, 149 Conn. 469, 471, 181 A.2d 607; Sturtevant v. Sturtevant, 146 Conn. 644, 647, 153 A.2d 828. The contract in dispute provided that the parties agreed "to have no further fence installed between these properties without mutual agreement." The contract was executed under peculiar circumstances. The language was inserted, at the instance of the plaintiff, into a contract drawn by the fence company to embody an agreement between that company, on the one side, and the plaintiff and the defendant, on the other. The obvious purpose of the contract was to provide for the erection of and payment for a particular brand and style of fence on the line dividing the properties. The insertion of the additional agreement between the plaintiff and the defendant was a collateral maneuver designed to accomplish an ulterior purpose and was done under conditions which cast suspicion on the motives which prompted it. When we construe the contract in the light of the circumstances surrounding its making, it is clear that the parties intended that no further fence would be constructed on the line running between the two properties. The contract cannot be construed to prohibit any proper fence or barrier on *507 the land of either of the parties. They had just come to an understanding about the erection of a fence on a portion of the boundary line, and this agreement must be interpreted to mean that no fence extending beyond the point limited in the existing agreement would be erected on the boundary line without mutual consent. The trial court found that the three posts erected by the defendant were entirely on the defendant's land. In erecting them, the defendant did not violate the contract. The plaintiff claims that the parties agreed that no fence would be erected anywhere between their houses for the full length of the driveway. The language of the agreement does not support such a claim. There is nothing to indicate that either of the parties ever intended to restrict the other in the proper and legal use of his own land. The trial court erred in issuing the injunction. See Brainard v. West Hartford, 140 Conn. 631, 634, 103 A.2d 135. There is error, the judgment is set aside and the case is remanded with direction to render judgment for the defendant. In this opinion the other judges concurred.
Skopje Statistical Region The Skopje Statistical Region (, ) is one of eight Statistical regions of North Macedonia. Skopje, located in the north of the country, borders Kosovo to the north. Internally, it borders the Vardar, Polog, Northeastern, Eastern, and Southwestern statistical regions. Municipalities The region consists of the City of Skopje and the following municipalities: Aračinovo Čučer-Sandevo Ilinden Petrovec Sopište Studeničani Zelenikovo Demographics Population The current population of the Skopje Statistical Region is 578,144 citizens, according to the last population census in 2002, accounting for 28.6% of the total national population. The region is the largest by population in North Macedonia. Ethnicities References Category:Statistical regions of North Macedonia Category:Skopje Category:Aračinovo Municipality Category:Čučer-Sandevo Municipality Category:Ilinden Municipality Category:Petrovec Municipality Category:Sopište Municipality Category:Studeničani Municipality Category:Zelenikovo Municipality
[Syndrome of intraabdominal hypertension among ill persons with peritonitis]. The article presents results of measuring and dynamics of intraabdominal tension (IAT) by 108 patients with peritonitis. Was proved that in conditions of peritonitis IAT increases more then 10 mm Hg in 77.8% cases, also syndrome of hypertension was marked in 8.3% cases. Was found a fixed statically important correlation connection between sign of IST and frequency of inflammatory process of stomach and after stomach space (p < 0.05), and also between level of IAT and gravity of condition on scale APACHE II, SOFA (p < 0.05). Using of method of laparostomya in combination with intubation of bowel is the most effective method, directed on prophylaxis and treatment of intraabdominal hypertension among ill persons with peritonitis.
Lewis Acid Catalyzed [4 + 3] Cycloaddition of Propargylic Alcohols with Azides. An unprecedented Lewis acid catalyzed [4 + 3] cycloaddition reaction is described that provides a straightforward route to polycyclic products containing an imine-based indole azepine scaffold, starting from readily available internal tertiary alkynols and azides. This cycloaddition protocol provides efficient and atom-economical access to a new class of fascinating imine-containing products in satisfactory yields, which has shown good application in the construction of seven-membered N-heterocycles.
Liberal indications for minimally invasive oxford unicondylar arthroplasty provide rapid functional recovery and pain relief. The Oxford unicompartmental knee arthroplasty (UKA) was recently approved for implantation in America. Recovery was evaluated and the efficacy of a musculoskeletal hospital was addressed for an initial group of patients who underwent medial compartment UKA with the Oxford device. Between October 2004 and December 2005, 142 medial UKAs were performed in 125 patients and included 11 simultaneous and six staged bilateral UKA procedures, and one simultaneous UKA/TKA procedure. The patients' ages averaged 62 (range: 41-87) years, weight 90 kg, and body mass index (BMI) 31.6 kg/m(2). Sixty-one UKAs were performed in obese patients (BMI >32). The length of stay averaged 1.3 days. In 121 (97%) cases, patients were discharged directly to home. In 23 (18%) cases, home health physical therapy was used. Outpatient physical therapy was used in 95 (76%) cases. Only four (3%) patients required a skilled nursing or post-discharge rehabilitation stay. Five reoperations were required: one revision to TKA for tibial plateau fracture, one revision to TKA for tibial loosening, one radical debridement and staged reimplantation of primary TKA for sepsis, and two arthroscopic procedures (one retained cement, and one synovitis). The average arc of motion at initial six-week follow up was 116 degrees , with 56% of knees having greater than 120 degrees and 82% more than 110 degrees . Absent, or only mild, pain was reported in 85% of knees. Seventy-five percent of patients had good or excellent Knee Society scores by six weeks postoperatively. UKA provides excellent early function and pain relief with rapid recovery when performed at a specialty musculoskeletal hospital. Early discharge appears to be safe and does not transfer the burden of care to other facilities or home health rehabilitation services.
Laparoscopic right donor nephrectomy: a large single-center experience. Laparoscopic procurement of right donor kidneys is frequently avoided or performed using hand-assist devices because of concerns regarding donor safety, adequate exposure, and vessel length. The present study describes the authors' large series of right donor nephrectomies performed laparoscopically without the use of hand ports or other manual assist devices. The authors retrospectively analyzed all right laparoscopic donor nephrectomies performed at their center from November 1, 1999, to February 20, 2004. Study variables included operative times, blood loss, hospital stay, graft function, and donor and recipient complications. Left donor nephrectomies performed during the same period served as controls. Of 387 laparoscopic kidney procurements, 54 (14 %) were right nephrectomies. Blood loss, extraction times, length of stay, and overall complication rates were similar between right and left donor groups. The mean operative time in the right nephrectomy group was significantly shorter than in the left nephrectomy group (169 +/- 25 and 186 +/- 29 min, respectively; P = 0.003). Graft function 1 month after transplantation and the incidence of delayed graft function were similar in both groups. There was one graft loss caused by thrombosis in the left nephrectomy group; other graft-related complications in the recipients were similar in both groups. This large single-center experience demonstrates that laparoscopic right donor nephrectomy performed without hand-assist devices is safe and yields kidneys with excellent function. The authors conclude that selection of the appropriate kidney for donation using this approach can be based on the same criteria that have traditionally governed open donor nephrectomy.
BlackBerry executives bought a $20million private jet just months before troubled phone company sacked 4,500 employees and announced an incredible $1billion loss BlackBerry lost almost $1billion last quarter Revenues were just over half what experts predicted Phone group will now sack 40 percent of global workforce But company had a $20million private jet delivered in July and described it as a cost-cutting exercise Ailing phone group BlackBerry bought a private jet worth over $20 million just months before it laid off 4,500 workers and reported a nearly $1 billion second-quarter loss , it was revealed on Sunday. Ill-timed executives had the second-hand Bombardier Global Express delivered in July and explained the decision as a cost-cutting exercise as the plane replaced two older aircraft. But perhaps after a closer look at their accounts, the company announced on Sunday it will now sell the latest addition to their fleet and will no longer own any private jets. Ill-timed: Blackberry bought a Bombardier Global private jet (as seen in this file photo), just months before the phone company sacked thousands and reported huge losses 'Several years ago, the company bought two medium-range Dassault aircraft,' BlackBerry said in a statement reported by the Financial Times . 'Earlier this year the company decided to sell both planes and replace them with one longer-range aircraft. The company considered several options and selected a used Bombardier aircraft, which was eventually delivered in July,' it continued. RELATED ARTICLES Previous 1 Next What crisis? Apple sells 34 handsets a SECOND as it breaks... The carpet bagging millionaire: Husband of Facebook founder... Share this article Share This ultra long-range jet can fly between Tokyo and New York without refueling. A used aircraft will typically cost between $20 - $30 million. Blackberry said on Friday that it will lay off thousands of employees, or 40 per cent of its global workforce, as it reported a nearly $1 billion second-quarter loss a week earlier than expected. Plush: The interior of a Bombardier Global Express XRS business jet looks comfortable and the plane can travel between New York and Tokyo without refueling. But Blackberry fired 4,500 employees on Friday The stock dropped 23 per cent to $8.11 after reopening for trading. Shares had been halted earlier pending the news announced the same day rival Apple's latest iPhone models went on sale. Sunday's statement on the private jet purchase added: 'In light of the company’s current business condition, the company has decided to sell that aircraft along with the two legacy aircraft and will no longer own any planes.' BlackBerry had been scheduled to release earnings this week. A SMOOTH RIDE Bombardier Global Express 5000 specs: Crew: Two - Three Capacity: 8 in a typical configuration, up to 19 in high density arrangement Length: 96.8 ft (29.5 m) Wingspan: 94 ft 0 in (28.65 m) Height: 25.5 ft (7.7 m) Powerplant: 2 × Rolls-Royce BR710A2-20 turbofans Cabin length: 42.47 f (12.94 m) Cabin width (centerline): 8.17 ft (2.49 m) Cabin height: 6.25 ft (1.91 m) Maximum speed: Mach .89 (513 kt, 590 mph, 950 km/h) Cruise speed: Mach .85 (488 kt, 562 mph, 904 km/h) Range: 5,200 nm (9,360 km) Data from Bombardier But the Canadian company said late Friday afternoon that it expects to post a staggering loss of $950 million to $995 million for the quarter, including a massive write down of the value of its inventory due to increasing competition. Revenue of $1.6 billion is only about half of the $3 billion that analysts expected, according to FactSet. The company's expected adjusted loss of 47 cents to 51 cents per share falls far below the loss of 16 cents per share projected by Wall Street. BlackBerry said it wants to slash operating costs in half by the first quarter of 2015 so cutting its global headcount to 7,000 total employees is necessary. 'We are implementing the difficult, but necessary operational changes announced today to address our position in a maturing and more competitive industry, and to drive the company toward profitability.' Thorsten Heins, President and CEO of BlackBerry, said in a statement. The BlackBerry, pioneered in 1999, was the dominant smartphone for on-the-go business people and other customers before Apple debuted the iPhone in 2007. Axed: Blackberry President and CEO Thorsten Heins, pictured, attempted to boost the Canadian firm's poor sales over the past year through a series of releases, including the Q10, pictured. But it wasn't enough. Since then, BlackBerry Ltd. has been hammered by competition from the iPhone as well as Android-based rivals like Samsung. The iPhone 5S and iPhone 5C, Apple's latest and greatest, went on sale earlier Friday, flying off sh elves at a record pace . Since 2007, BlackBerry has lost 93 per cent of its market share, with half going in the past year alone Marked by the usual lines around the block and triumphant Apple fans walking out of Apple Stores to cheers, the new models received rave reviews from consumers and media alike. The most-hyped new feature on the 5S is a new fingerprint sensor used to unlock the phone, making passwords and finger swipes ' a waste of time.' It also comes with an improved camera and a faster processor. It has sold out around the world, say reports. In January, Blackberry unveiled new phones running a revamped operating system called BlackBerry 10. The Z10 and Q10 were designed to better compete for customers and rejuvenate the brand. But vendor marketing was uneven and BlackBerry's market share continues to lag its rivals. BlackBerry said last month that it would consider selling itself. The Waterloo, Ontario-based company reiterated Friday that a special committee of its board of directors continues to evaluate all options. It also seemed to say that it would shift its focus back to competing mainly for the business customers most loyal to its brand. 'Going forward, we plan to refocus our offering on our end-to-end solution of hardware, software and services for enterprises and the productive, professional end user,' said Heins. 'This puts us squarely on target with the customers that helped build BlackBerry into the leading brand today for enterprise security, manageability and reliability.' Not an iPhone killer: New Blackberry models have failed to impress ever-more choosy consumers flocking to Apple and Android devices A stark contrast to the hype surrounding every iPhone launch, Blackberry's last new model dropped with a thud. Despite a massive advertising push and aggressive in-store sales tactics, the Z10 fell flat - despite rave reviews from the tech press.
Social cognition in schizophrenia. The study of social cognition in schizophrenia may augment the understanding of clinical and behavioral manifestations of the disorder. In this article, the authors describe social cognition and differentiate it from nonsocial cognition. They garner evidence to support the role of social cognition in schizophrenia: Nonsocial information-processing models are limited to explain social dysfunction in schizophrenia, measures of social cognition may contribute greater variance to social functioning than measures of nonsocial cognition, task performance on nonsocial-cognitive measures may not parallel performance on social-cognitive tasks, and symptomatology may be best understood within a social-cognitive framework. They describe the potential implications of a social-cognitive model of schizophrenia for the etiology and development of the disorder.
Coleridge-Taylor Perkinson Coleridge-Taylor Perkinson (June 14, 1932, Manhattan, New York City or possibly (unconfirmed) Winston-Salem, North Carolina – March 9, 2004, Chicago) was an innovative American composer whose interests spanned the worlds of jazz, dance, pop, film, television, and classical music. Coleridge-Taylor Perkinson was Afro-American. He was named after Afro-British composer Samuel Coleridge-Taylor (1875–1912). Perkinson's mother was active in music and the arts as a piano teacher, church organist, and director of a theater company. Perkinson attended the High School of Music and Art in New York City. After graduating from high school, he attended New York University. He later transferred to the Manhattan School of Music, where he studied composition with Vittorio Giannini and Charles Mills. He received bachelor's and master's degrees from the Manhattan School of Music. He also studied with Earl Kim at Princeton University. He was on the faculty of Brooklyn College (1959–1962) and studied conducting in the summers of 1960, 1962, and 1963 in the Netherlands with Franco Ferrara and Dean Dixon and also learned conducting in 1960 at the Mozarteum in Salzburg. Perkinson cofounded the Symphony of the New World in New York in 1965 and later became its Music Director. He was also Music Director of Jerome Robbins's American Theater Lab and the Alvin Ailey American Dance Theater. Perkinson composed a ballet for Ailey entitled For Bird, With Love inspired by the music of jazz great Charlie Parker. Perkinson wrote a great deal of classical music, but was equally well-versed in jazz and popular music. He served briefly as pianist for drummer Max Roach’s quartet and wrote arrangements for Roach, Marvin Gaye, and Harry Belafonte. He also composed music for films such as The McMasters (1970), Together for Days (1972), A Warm December (1973) starring Sidney Poitier, Thomasine & Bushrod (1974), The Education of Sonny Carson (1974), Amazing Grace (1974), Mean Johnny Barrows (1976), and the documentary Montgomery to Memphis (1970) about Martin Luther King. In 1970 he wrote incidental music for at least one episode of the US tv show Room 222. Perkinson's music has a blend of Baroque counterpoint; American Romanticism; elements of the blues, spirituals, and black folk music; and rhythmic ingenuity. Orchestral works Grass: Poem for Piano, Strings and Percussion (1973) Mop/Mop: A Symphonic Sketch (1998) Sinfonietta No. 1 for Strings (1953) Sinfonietta No. 2 for Strings: Generations (1996) Worship: A Concert Overture (2001) Choral works Fredome/ Freedom for SATB Chorus and Piano (1970) Fredome/ Freedom for SATB Chorus, Two Pianos, Double Bass and Percussion (1970) Psalm Twenty-Three (2003) Solo and instrumental works 60/60 for Flute, Clarinet, Trumpet and Piano (1996) Blue/s Forms for solo violin (1979) Finale for solo clarinet (unspec.) Lament for viola and piano (1950s) Lamentations Black/Folk Song Suite for solo cello (1973) Lil' Lite O' Mine/ Sparklin' for Flute and Piano (2000) Louisiana Blues Strut: A Cakewalk for violin (2002) Scherzo for solo piano (1973) Sonata a' la Baroque for solo flute (1994) Sonata for Flute & Piano (2003) String Quartet No. 1 "Calvary" (1956) Toccata for solo piano (1953) Walkin' All Over God's City Called Heaven for violin and cello (1996) References Program notes by Gregory Weinstein for "Coleridge-Taylor Perkinson (1932–2004): A CELEBRATION" (Cedille Records CDR 90000 087) Martin, Douglas "Coleridge-Taylor Perkinson, Versatile Musician, Dies at 71" New York Times (March 13, 2004) External links Coleridge-Taylor Perkinson papers, the composer's personal papers in the Music Division of The New York Public Library for the Performing Arts. Obituary Short biography from the New York Public Library http://www.wnyc.org/story/no-boundaries-music-life-coleridge-taylor-perkinson-wnyc/ http://chevalierdesaintgeorges.homestead.com/Perkinson.html Composer page on publisher's website <WQXR Radiof></New York, NY> Category:1932 births Category:2004 deaths Category:20th-century classical composers Category:American male classical composers Category:American classical composers Category:American film score composers Category:American male conductors (music) Category:African-American jazz composers Category:African-American classical composers Category:The High School of Music & Art alumni Category:Manhattan School of Music alumni Category:Mozarteum University Salzburg alumni Category:People from Manhattan Category:Musicians from New York City Category:20th-century American composers Category:Jazz musicians from New York (state) Category:Classical musicians from New York (state) Category:20th-century American conductors (music) Category:Male film score composers Category:Male jazz composers Category:20th-century American male musicians Category:Brooklyn College faculty
The long term goal of this project is to develop better therapeutics for NK-LGL leukemia. The proposal represents a new approach to leukemia pathogenesis by positing that imbalances in the sphingolipid rheostat confer the leukemia phenotype. This model postulates that cell fate is determined by the balance between pro- survival (sphingosine-1-phosphate, S1P) and pro-apoptotic (ceramide) lipids. Preliminary data demonstrate altered sphingolipid metabolism in this disease, including increased levels of S1P and decreased levels of ceramide in leukemic LGL;increased expression of acid ceramidase;and findings that stable knockdown of acid ceramidase enhances production of long chain ceramide and results in decreased viability of leukemic LGL. Furthermore, we show that targeting sphingolipid signaling represents a new avenue for therapeutic intervention in this disease. We achieve complete remission of aggressive NK-LGL leukemia by utilizing nanoliposomal formulation of short chain C6 ceramide or the S1P receptor antagonist, FTY720, in the Fischer rat animal model. We will test the hypothesis that S1PR5 signaling mediates survival of leukemic NK cells (Specific Aim 1). Knockdown of S1PR5, the predominant S1P receptor expressed on leukemic NK cells, inhibits constitutive ERK phosphorylation and induces apoptosis. Constitutive overexpression of Rac1, PAK3, RhoB and ROCK1, potential downstream effectors of S1PR5, is observed in leukemic NK cells. Pharmacological inhibition of Gi, RAC1 and ROCK also results in cell death in leukemic NK cells, demonstrating that these targets may be involved in S1PR5-dependent survival pathways. Specific Aim 2 will test the hypothesis that FTY720 induces both apoptosis and autophagy in leukemic NK cells by targeting sphingolipid signaling. We show that pharmacological inhibition of autophagy increases apoptosis induced by FTY720, indicating that blockade of autophagy potentiates FTY720 therapeutic efficacy in leukemic NK cells. FTY720 treatment of leukemic LGL leads to accumulation of intracellular S1P, suggesting that autophagy induced by FTY720 might occur through inhibition of S1P lyase. In addition, we postulate that leukemic NK cells are dependent on survival signaling resulting from NK receptor target recognition in vivo. Convincing preliminary data indicate that sphingolipid survival pathways are activated in normal NK cells after target binding in vitro. Findings similar to those seen in NK-LGL leukemia include upregulation of S1PR5, identification of RhoB, ROCK1, Rac1 and PAK3 as downstream components of S1PR5 signaling, and induction of apoptosis by FTY720. We anticipate that the proposed research will have significant impact on the field of NK cell biology. Our work will define new pathways important for survival of both leukemic and activated normal NK cells. We expect that understanding sphingolipid survival signaling will lead to novel therapeutic approaches for an incurable illness. PUBLIC HEALTH RELEVANCE: This study is investigating leukemia which arises from killer cells of the immune system. The purpose of these studies is to understand the signals which keep the leukemia cells alive. This information can be used to design better treatments.
Railway Minister Suresh Prabhu refused to answer any questions and instead, scolded the media persons. Photo: PTI Railway Minister Suresh Prabhu's personal assistant, on seeing a camera unit of India Today at the Sadhana building (Prabhu's residence) in Mumbai, said, "The Minister might get angry after seeing you here." He said Prabhu does not like surprises, especially from news channels asking uncomfortable questions. The Rail Ministry, on Wednesday, had dropped a fare bomb on all those passengers travelling by Rajdhani, Shatabdi and Duronto trains. Under a dynamic surge pricing system to be introduced from September 9, train passengers will now have to shell out between 10 and 50 per cent more from their pockets. Also Read: Surge pricing for Rajdhani, Duronto and Shatabdi trains from Friday: Here's how it affects you The uncomfortable questions for the Rail Minister were, thus, unavoidable. And it happened exactly what Prabhu's personal assistant had warned of. 'DID I CALL YOU,' ASKS SURESH PRABHU When the Railway Minister stepped out of his residence and saw India Today media persons asking questions, his face turned red. He angrily said, "Did I call you?". Prabhu did not stop at this. He pulled down his car's mirror and told the journalist, " Ask your senior, is this how a minister is questioned?". The journalist replied, "We will definitely convey your message to the senior journalist of the news channel, but still the country would like to know why the fares were hiked. Even the senior journalist would like to know." The Railway Minister did not answer and went straight ahead, probably angrier this time. Sources say the railway is aiming at raking in Rs 500 crore more during the current financial year with the implementation of this pricing system. Also Read: Surge pricing in railways has passengers divided 'IF THIS IS HOW A MINISTER BEHAVES WITH THE MEDIA, IMAGINE HOW CENTRE BEHAVES WITH PEOPLE' While 10 per cent of the seats will be sold in the normal fare in the beginning, it will go on increasing by 10 per cent with every 10 per cent of berths sold with a ceiling of 50 per cent. Rajiv Singhal, senior member of DRUCC (railway association) told India Today, "The Rail Minister has become a baniyaa. If a passenger is getting a return air ticket at around Rs 4500-5000 for Mumbai-Delhi route, then why he/she would travel in Rajdhani, paying almost the same price." Singhal criticised the behaviour of Prabhu with media. He said, "If this is how a minister behaves with the media who is just a messenger to the people of this country, then imagine how the Centre must be treating the common man. Prabhu has to come forward and explain to the people why fares were hiked." Modelled on the dynamic fare system in vogue in the aviation sector, the flexi fare system will be introduced on experimental basis in II AC, III AC and chair car in the three trains besides sleeper class in the Duronto trains. There is a total of 42 Rajdhani trains, 46 Shatabdi and 54 Duronto trains and the Railway Ministry expect to garner about Rs 500 crore from the new fare structure in these trains. Also Read: Suresh Prabhu launches grievance redressal portal for railway employees Congress, Left raise chorus for roll back of surge pricing in rail tickets
package org.unicode.cldr.draft.keyboard.osx; public final class TransformTree { }
Q: RailsTutorial Chp 3 (Section 3.2.2) Here's the issue from Section 3.2.2 Adding a page: They intentionally left out creating the About page (in Section 3.1.2) so as to teach me how to use TDD to guide me through the development process. I progressed through adding code to the spec tests, route, and StaticPages controller (Listings 3.13, 3.14 and 3.15 with all the steps in between). However when I came to the step right before Listing 3.16 I had to tilt my head. Here's the text: "To solve this issue, we add the about view. This involves creating a new file called about.html.erb in the app/views/static_pages directory with the contents shown in Listing 3.16." My question is how do I "add the about view and create a new file called about.html.erb in the app/views/static_pages directory"? I added the about action to my StaticPages controller but that doesn't do anything by virtue of the test $ bundle exec rspec... that says i'm missing a "template" or view. Yet the next step "involves creating a new file called about.html.erb" with no direction on how. The last time I remember creating static page files was Section 3.1.2 using $ rails generate controller StaticPages home help --no-test-framework where it created home.html.erb and help.html.erb. So I ran $ rails generate controller StaticPages about --no-test-framework. It asked if I wanted to overwrite the file app/controllers/static_pages_controller.rb and I said no; yet, it did create my about.html.erb file. I got the result I needed but it didn't feel right. Thanks for taking the time to help me. A: They mean to just create the file using your chosen text editor. #Here is how with nano nano app/views/static_pages/about.html Type in some text CTRL-O to Save #Here is how with vi vi app/views/static_pages/about.html i for insert mode Type in some text ESC :wq to Save #If you just want to create an empty file touch app/views/static_pages/about.html
Respect your elders.Stay off Sawyer property.And don’t even think about that Sawyer girl… Boone Cross was raised with three simple rules, and falling for Josie Sawyer broke every one of them. That is, until a year ago, when he did the unthinkable and she moved away. Josie Sawyer never thought she’d be on a plane, flying back to Arkansas for the summer, only a year after her heart was crushed into a thousand pieces by the boy her parents forbade her to love. But her father is dying, and being stubborn isn’t an option. In a town this small, it’s only a matter of time before she runs into Boone Cross. A lot’s changed since she last laid eyes on him, but some things have remained exactly the same. Boone’s got designs on her and he won’t give up until he gets what he wants. But as they give in to the need to be together once more, secrets come to light revealing a history of a hatred between their families that runs so deep that even the strongest love may not be able to survive. Something tickled my feet, but I was too tired to move. I had stayed up most of the night, crying into my pillow. Once I realized I wasn’t going to sleep anytime soon, I packed my suitcase. I’d only fallen asleep three hours before. “Josie,” someone whispered. I knew by the smell of cigarettes and that raspy voice that it was Samantha. Opening one eye, I stretched my arms above my head. Samantha’s face was coated in glitter from brow to chin. Her belly shirt and go-go boots told me she’d just gotten in. Go-go dancing wasn’t her first choice to pay the bills, but neither of us complained when those tips started rolling in. She threw her purple wig to the floor, revealing a nest of brown curls. “What the—” she said, picking up one of the wads of Kleenex that littered my bed. “Is something wrong with my Sookie?” I sat up straight, feeling my puffy eyes with the tips of my fingers. “Yes,” I said, looking into her eyes for the first time. Bags hung underneath each painted eye, and her frown told me I looked as bad as I felt. “I’m going home. My mom called.” Samantha arched a brow. She knew the relationship between my mother and me was rocky. “My dad is dying,” I choked out. Samantha’s arms flew around me. “I’m so sorry, Sookie. Are you okay? God, that’s a stupid question. When are you leaving? Do you need me for anything?” I relaxed into her arms. I couldn’t have asked for a better friend. When I moved from Arkansas to California, I was as lost as a damn goose trying to get around. But then I met Samantha in freshman calculus. She took me under her wing and, three weeks later, rented me the empty bedroom in her apartment. We’d been best friends ever since. “I’m leavin’ at two. I just need a ride to the airport.” She nodded against the crown of my head. “I can do that. In the meantime, how about some pancakes?” I pulled away. The thought of eating made my stomach turn but I couldn’t say no to that hopeful face. “Pancakes sound nice.” Fifteen minutes later, after I called the diner and told them I had to take some time off, we sat at our small kitchen table eating buttery pancakes. “How long are you going to be gone?” she asked. She’d taken off her makeup and looked like an actual person now. Her high cheekbones and full lips were bare, and she’d never looked prettier. She was one of those girls who didn’t have to try to be gorgeous—she just was. I shrugged, pushing the pancakes around on my plate. “They said he has a month. So I guess I’ll be gone a month.” Sam’s frown deepened. “Sweetheart, I’m so sorry. So, so sorry. I can’t believe this is happening to you.” She kept her eyes on mine and I could see she wanted to ask something else. “Go ahead and ask.” The corner of her lip rose into a small smile. “I know you have to go, of course, but wasn’t there a reason you hadn’t gone back in the first place? I mean, you never really told me why you didn’t want to go home.” More pain assaulted my chest, and it took everything in me not to burst into tears. I hated feeling so weak and helpless, but the memories were dancing at the corners of my vision, taunting me. And all because of him. Because I’d fallen in love with a person that unlovable. Heartless. That’s the only reason I could think of why he would leave me. Alone. He’d been my anchor for an entire year. I’d spent a year in the woods, each night letting him hold me in that deserted treehouse of his. Until one day—he vanished. Not literally, but emotionally. All those memories, stories, kisses—his touch. Those eyes. Everything had vanished from my life without as much as a goodbye. And as many times as I’d lain there, waiting for him to come back, he never did.
EnronOnline passes one million transactions. Woohoo! Also in this issue: Enron.com -- it's fabulously new and improved! How Enron likes Bush's new energy policy California update What's going on in the French wholesale market? Learn about caps -- not the ones you wear, of course. What do Frank Gehry and Enron have in common? Jeff leads in a dangerous time It's all in the latest eBiz. Go to home.enron.com, click Publications, then click eBiz, and "eBiz May 25, 2001."
A crisis involving boatloads of Rohingya and Bangladeshi migrants stranded at sea has deepened as Malaysia said it would turn away any more of the vessels unless they were sinking. The waters around Malaysia’s Langkawi island – where several crowded, wooden vessels have landed in recent days carrying more than 1,000 men, women and children – would be patrolled 24 hours a day by eight ships, said Tan Kok Kwee, first admiral of Malaysia’s maritime enforcement agency. “We won’t let any foreign boats come in,” Tan said on Tuesday. If the boats are sinking, they would rescue them, but if the boat are found to be seaworthy, the agency will provide “provisions and send them away”, he said. South-east Asia is in the grips of a spiralling humanitarian crisis as boats packed with Rohingya and Bangladeshis are being washed ashore, some after being stranded at sea for more than two months. As many as 6,000 asylum seekers are feared to be trapped at sea in crowded, wooden boats, and activists warn of potentially dangerous conditions as food and clean water runs low. The crisis appears to have been triggered by a regional crackdown on human traffickers, who have refused to take people to shore. It reached a tipping point this weekend, when some captains and smugglers abandoned their ships, leaving migrants to fend for themselves. One boat sent out a distress signal, with migrants saying they had been without food and water for three days, according to Chris Lewa, director of the nonprofit Arakan Project, who spoke by phone to people on the boat. “They asked to be urgently rescued,” she said, adding there were an estimated 350 people on board, and that they had no fuel. In the last three days, the 1,158 people landed on Langkawi island, according to Malaysian authorities, and 600 others in Indonesia’s westernmost province of Aceh. With thousands more believed to be trapped in vessels at sea, that number is expected to climb, said Phil Robertson, deputy director of Human Rights Watch’s Asia division. Malaysia’s announcement comes a day after Indonesia also turned back a ship, giving those on board rice, noodles, water and directions to go to Malaysia. The migrants aboard the boat that sent a distress signal described an approaching white vessel with flashing lights while she was on the phone, Lewa said. One minute they were cheering because they thought they were about to get help, she said, and the next they were screaming as the boat moved away. “I can hear the children crying, I can hear them crying,” she said. Lewa has tracked about 6,000 Rohingya and Bangladeshis who have boarded large and small trafficking boats in the region in recent months, but have yet to disembark. Based on her information, she believes the migrants and the boats are still in the Malacca strait and nearby international waters. The UN High Commissioner for Refugees, the US, Australia and other governments and international organisations, meanwhile, have held a string of emergency meetings to discuss possible next steps. They are worried about deaths, but also the looming refugee problem. In the past, most countries have been unwilling to accept Rohingya, a Muslim minority from Burma who are effectively stateless. They worry that by opening their doors to a few, they will be unable to stem the flood of poor, uneducated migrants. Malaysia’s home ministry said in a statement that of the 1,158 people who landed on Sunday on Langkawi island, 486 were Burmese citizens and 672 were Bangladeshis. There were 993 men, 104 women and 61 children. A government doctor said many survivors were being treated for diarrhea, abdominal pains, dehydration and urination problems. The Association of Southeast Asian Nations – a regional group that brings together all of the main stakeholders, from Burma and Thailand to Indonesia and Malaysia – has a strict stance of non-interference in member affairs. At annual Asean meetings – the most recent, ironically, on Langkawi – Burma has blocked all discussion about its 1.3 million Rohingya, insisting they are illegal settlers from Bangladesh even though many of their families arrived generations ago. For most part, member countries have agreed to leave it at that. Labeled by the UN one of the world’s most persecuted minorities, the Rohingya have for decades suffered from state-sanctioned discrimination in the Buddhist-majority Burma, where they have limited access to education and adequate healthcare. In the last three years, attacks by Buddhist mobs have left 280 people dead and forced 140,000 others from their homes. They now live under apartheid-like conditions in crowded camps just outside the Rakhine state capital, Sittwe.
Products Wilson A2000 RC22 Cano Super Skin 11.5″ Robbie’s a Super Skin guy. He likes its lightness when he’s turning two and that it stays light even when the field gets wet. It’s built from the 1786 model – Wilson’s most popular MLB infield glove because the shallow pocket makes it easy for a quick transfer. Robbie likes that. You’ll like it, too.
Bernhard Kohl, the Austrian cyclist who finished third in last year's Tour de France before testing positive for a previously undetectable form of EPO, has revealed the extent of his doping practices, and claimed the much-vaunted biological passport programme of the International Cycling Union (UCI) is ineffective in catching cheats. In an interview with L'Equipe, Kohl admitted that, as well as taking Cera, a so-called third generation EPO, he performed illegal blood transfusions during last year's Tour, in which he was crowned King of the Mountains. He also claimed a culture of doping is still prevalent in the sport, and that, in his opinion, any rider who finished in the top 10 of last year's race was likely to have doped. On the biological passports, Kohl said: "The top riders are so professional in their doping that they know very well they have to keep their blood values stable [so as] not to be detected. The UCI sent us the values resulting from the controls: we thus referred to those to mark the next ones. In a way, the passport almost helped us." Kohl said that his manager, Stefan Matschiner, flew to France three times during last year's Tour, providing half-litre bags of the cyclist's blood, which had been withdrawn prior to the race. "By re-injecting half a litre of blood the blood parameters are not subject to suspect variation." He added: "I did not cheat anyone in the peloton, be sure of that – there is like a social organisation [of doping] within the peloton, these things are accepted." The UCI, which launched the passport last year, claiming that it represented a new frontier in the fight against doping, has come under fire for a perceived lack of progress. So far, despite huge investment, it has failed to produce a single positive case. But Michael Ashenden, one of the UCI's panel of experts charged with overseeing the passports, countered Kohl's claims. Ashenden suggested the first positive cases would be revealed "within the next few weeks". There is speculation that they could even come as early as today, with the UCI president, Pat McQuaid, due to hold a press conference in Paris with the organisers of the Tour and the French anti-doping agency. Asked whether the press conference could be linked to the first biological passport cases, Ashenden said: "I can't comment on that." Attacking Kohl's claims that riders know how to get around the biological passports, Ashenden said: "I don't accept, without knowing what his [passport] profile looked like, that it wasn't suspicious. It may have been, it may not have been. "There is an international focus on the UCI right now because they're seen as the first [sporting] federation to [establish a biological] passport. With that comes a lot of pressure to get it right. The delay we're seeing [in terms of the first positive cases] is to make sure every element is cross checked and verified before the case is brought, to make sure there's nothing that causes a case to be thrown out on a technicality. But I think you'll find in the next weeks there will be announcements." Among Kohl's claims were that "micro-dosing" of EPO was undetectable, even by the passports. The Austrian said tiny doses of EPO added to his own blood – before it was re-transfused – meant that illegal blood transfusions could not be detected. "I can understand the rationale behind that," Ashenden said. "[But] it would then make the athlete prone to being caught for EPO, which we can detect. There's a trade-off: you can transfuse blood and risk being caught by the passport, or use EPO and risk being caught for that. "Of course it's possible that riders could find a way around the passport. It would be naive to sit back and think they're not going to try to find a way around it. They've tried to do that every time we've brought in a new test in the past and I expect they'll do that every time we bring in a new test in future. But the passport is the best strategy we have; it's not perfect, but it's the best we've got."
; RUN: opt -loop-rotate %s -disable-output -verify-dom-info -verify-loop-info target datalayout = "e-p:64:64:64-i1:8:8-i8:8:8-i16:16:16-i32:32:32-i64:64:64-f32:32:32-f64:64:64-v64:64:64-v128:128:128-a0:0:64-s0:64:64-f80:128:128-n8:16:32:64" target triple = "x86_64-apple-darwin10.0.0" ; PR8955 - Rotating an outer loop that has a condbr for a latch block. define void @test1() nounwind ssp { entry: br label %lbl_283 lbl_283: ; preds = %if.end, %entry br i1 undef, label %if.else, label %if.then if.then: ; preds = %lbl_283 br i1 undef, label %if.end, label %for.condthread-pre-split for.condthread-pre-split: ; preds = %if.then br label %for.cond for.cond: ; preds = %for.cond, %for.condthread-pre-split br i1 undef, label %lbl_281, label %for.cond lbl_281: ; preds = %if.end, %for.cond br label %if.end if.end: ; preds = %lbl_281, %if.then br i1 undef, label %lbl_283, label %lbl_281 if.else: ; preds = %lbl_283 ret void } %struct.relation = type { [4 x i16], i32, [4 x i16], i32, i32 } define void @test2() { entry: br i1 false, label %bb139, label %bb10.i44 bb10.i44: ; preds = %entry ret void bb127: ; preds = %bb139 br label %bb139 bb139: ; preds = %bb127, %entry br i1 false, label %bb127, label %bb142 bb142: ; preds = %bb139 %r91.0.lcssa = phi %struct.relation* [ null, %bb139 ] ; <%struct.relation> [#uses=0] ret void } define void @test3() { entry: br i1 false, label %bb139, label %cond_true cond_true: ; preds = %entry ret void bb90: ; preds = %bb139 br i1 false, label %bb136, label %cond_next121 cond_next121: ; preds = %bb90 br i1 false, label %bb136, label %bb127 bb127: ; preds = %cond_next121 br label %bb136 bb136: ; preds = %bb127, %cond_next121, %bb90 %changes.1 = phi i32 [ %changes.2, %bb90 ], [ %changes.2, %cond_next121 ], [ 1, %bb127 ] ; <i32> [#uses=1] br label %bb139 bb139: ; preds = %bb136, %entry %changes.2 = phi i32 [ %changes.1, %bb136 ], [ 0, %entry ] ; <i32> [#uses=3] br i1 false, label %bb90, label %bb142 bb142: ; preds = %bb139 %changes.2.lcssa = phi i32 [ %changes.2, %bb139 ] ; <i32> [#uses=0] ret void } define void @test4() { entry: br i1 false, label %cond_false485, label %bb405 bb405: ; preds = %entry ret void cond_false485: ; preds = %entry br label %bb830 bb511: ; preds = %bb830 br i1 false, label %bb816, label %bb830 cond_next667: ; preds = %bb816 br i1 false, label %cond_next695, label %bb680 bb676: ; preds = %bb680 br label %bb680 bb680: ; preds = %bb676, %cond_next667 %iftmp.68.0 = zext i1 false to i8 ; <i8> [#uses=1] br i1 false, label %bb676, label %cond_next695 cond_next695: ; preds = %bb680, %cond_next667 %iftmp.68.2 = phi i8 [ %iftmp.68.0, %bb680 ], [ undef, %cond_next667 ] ; <i8> [#uses=0] ret void bb816: ; preds = %bb816, %bb511 br i1 false, label %cond_next667, label %bb816 bb830: ; preds = %bb511, %cond_false485 br i1 false, label %bb511, label %bb835 bb835: ; preds = %bb830 ret void } %struct.NSArray = type { %struct.NSObject } %struct.NSObject = type { %struct.objc_class } %struct.NSRange = type { i64, i64 } %struct._message_ref_t = type { %struct.NSObject* (%struct.NSObject, %struct._message_ref_t, ...), %struct.objc_selector } %struct.objc_class = type opaque %struct.objc_selector = type opaque @"\01L_OBJC_MESSAGE_REF_26" = external global %struct._message_ref_t ; <%struct._message_ref_t> [#uses=1] define %struct.NSArray @test5(%struct.NSArray* %self, %struct._message_ref_t* %_cmd) { entry: br label %bb116 bb116: ; preds = %bb131, %entry %tmp123 = call %struct.NSRange null( %struct.NSObject* null, %struct._message_ref_t* @"\01L_OBJC_MESSAGE_REF_26", %struct.NSArray* null ) ; <%struct.NSRange> [#uses=1] br i1 false, label %bb141, label %bb131 bb131: ; preds = %bb116 %mrv_gr125 = extractvalue %struct.NSRange %tmp123, 1 ; <i64> [#uses=0] br label %bb116 bb141: ; preds = %bb116 ret %struct.NSArray* null } define void @test6(i8* %msg) { entry: br label %bb15 bb6: ; preds = %bb15 %gep.upgrd.1 = zext i32 %offset.1 to i64 ; <i64> [#uses=1] %tmp11 = getelementptr i8* %msg, i64 %gep.upgrd.1 ; <i8> [#uses=0] br label %bb15 bb15: ; preds = %bb6, %entry %offset.1 = add i32 0, 1 ; <i32> [#uses=2] br i1 false, label %bb6, label %bb17 bb17: ; preds = %bb15 %offset.1.lcssa = phi i32 [ %offset.1, %bb15 ] ; <i32> [#uses=0] %payload_type.1.lcssa = phi i32 [ 0, %bb15 ] ; <i32> [#uses=0] ret void } ; PR9523 - Non-canonical loop. define void @test7(i8 %P) nounwind { entry: indirectbr i8* %P, [label %"3", label %"5"] "3": ; preds = %"4", %entry br i1 undef, label %"5", label %"4" "4": ; preds = %"3" br label %"3" "5": ; preds = %"3", %entry ret void }
--- abstract: 'We give a detailed proof of the properties of the usual Prikry type forcing notion for turning a measurable cardinal into $\aleph_\omega$.' author: - Mohammad Golshani title: Changing measurable into small accessible cardinals --- introduction ============ In this short note, we present a proof of the following known result. \[main theorem\] Assume $\operatorname{GCH}$ holds and $\kappa$ is a measurable cardinal. Then there exists a generic extension in which $\kappa=\aleph_\omega$. We try to give the details as much as possible to make it accessible to general audience who has some familiarity with forcing and large cardinals (see [@jech] for preliminaries). Proof of Theorem \[main theorem\] ================================= Suppose that $\operatorname{GCH}$ holds and $\kappa$ is a measurable cardinal. Let $\mathcal U$ be a normal measure on $\kappa.$ Let also $j: V \to M \simeq \operatorname{Ult}(V, \mathcal)$ be the corresponding ultrapower embedding. \[existence of guiding generics\] There exists $H \in V$ which a $\operatorname{Col}(\kappa^{++}, < j(\kappa))_M$-generic filter over $M$. We have 1. $V \models$“$\operatorname{Col}(\kappa^{++}, < j(\kappa))_M$ is $\kappa^+$-closed” 2. $V \models$“$\|\{A \in M: A$ is a maximal antichain in $\operatorname{Col}(\kappa^{++}, < j(\kappa))_M \}\| \leq \kappa^+$”. Thus we can easily find the required $H$. We are now ready to define our main forcing construction. A condition in $\MPB$ is of the form $$p= (\delta_0, f_0 \dots, \delta_{n-1}, f_{n-1}, A, F)$$ where 1. $n<\omega$. 2. $\delta_0 < \dots < \delta_{n-1}$. 3. For $i<n-1, f_i \in \operatorname{Col}(\delta_{i}^{++}, < \delta_{i+1})$. 4. $f_{n-1} \in \operatorname{Col}(\delta_{n-1}^{++}, < \kappa)$. 5. $A \in \mathcal U,$ and $\min(A) > \delta_{n-1}$. 6. $F$ is a function with $\operatorname{dom}(F)=A.$ 7. For every $\delta \in A, F(\delta) \in \operatorname{Col}(\delta^{++}, < \kappa)$. 8. $[F]_{\mathcal U} \in H.$ Given a condition $p \in \MPB,$ we denote it by $$p= (\delta^p_0, f^p_0 \dots, \delta^p_{n^p-1}, f^p_{n^p-1}, A^p, F^p).$$ We also set - $stem(p)=(\delta^p_0, f^p_0 \dots, \delta^p_{n^p-1}, f^p_{n^p-1})$, the stem of $p$. - $u(p)=(A^p, F^p),$ the upper part of $p$. Suppose $p, q \in \MPB.$ - $p$ is an extension of $q$, $p \leq q$, iff 1. $n^p \geq n^q$. 2. For all $i< n^q, \delta^p_i=\delta^q_i$. 3. For $n^q \leq i < n^p, \delta^p_i \in A^q$. 4. For $i < n^q, f^p_i \leq f^q_i$. 5. For $n^q \leq i < n^p, f^p_i \leq F^q(\delta^p_{i})$. 6. $A^p \subseteq A^q.$ 7. For each $\delta \in A^p, F^p(\delta) \leq F^q(\delta)$. - $p$ is a direct extension of $q$, $p \leq^* q$, iff 1. $p \leq q.$ 2. $n^p=n^q$. We start by proving the basic properties of the forcing notion $\MPB$. \[chain condition\] $(\MPB, \leq)$ satisfies the $\kappa^+$-c.c. Let $A \subseteq \MPB$ be of size $\kappa^+$. Then, as $$\{stem(p): p \in A \} \subseteq V_\kappa$$ has size $\kappa$, we can find $p, q \in A$ such that $stem(p)=stem(q).$ We claim that $p$ an $q$ are compatible. Since $[F^p]_{\mathcal U}, [F^q]_{\mathcal U} \in H,$ we can find $[F]_{\mathcal U} \in H$ such that $[F]_{\mathcal U} \leq [F^p]_{\mathcal U}, [F^q]_{\mathcal U}.$ Thus $$A^\ast=\{\delta < \kappa: F(\delta) \leq F^p(\delta), F^q(\delta) \} \in \mathcal{U}.$$ Set $A=A^\ast \cap A^p \cap A^q \in \mathcal{U}.$ Then $$stem(p)^{\frown} (A, F) \in \MPB$$ and it extends both of $p$ and $q$. \[factorization\] Suppose $p \in \MPB$ and $m < n^p$. Then $$\MPB/p \simeq (\prod_{i<m} \operatorname{Col}((\delta^p_i)^{++}, <\delta^p_{i+1})) \times \MPB / p^{\geq m},$$ where $p^{\geq m} = (\delta^p_m, f^p_m, \dots, \delta^p_{n^p-1}, f^p_{n^p-1}, A^p, F^p)$. Further, $(\MPB/ p^{\geq m}, \leq^)$ is $\delta_{m}^{++}$-closed. We now show that the forcing notion $(\MPB, \leq, \leq^)$ satisfies the Prikry property. \[prikry property\] Suppose $q \in \MPB$ and $\phi$ is a statement of the forcing language of $(\MPB, \leq)$. Then there exists $p \leq^* q$ which decides $\phi$. We assume for simplicity that $n^q=0$ and $f^q_0=\emptyset.$ We write $q$ as $q=(A^q, F^q)$. The proof has four main steps. \[reduction to stems\] (Reduction to stems) There exists $q^1 = (A^1, F^1) \leq^* q$ such that for any stem $s$, $$\exists s^{\frown}(A, F) \leq (A^1, F^1), ~ s^{\frown}(A, F) \parallel \phi \iff s^{\frown}(A^1, F^1) \parallel \phi.$$ For each stem $s$, if there exists $s^{\frown}(A, F) \leq (A^q, F^q)$ which decides $\phi,$ then let $(A^s, F^s)=(A, F)$ and otherwise set $(A^s, F^s)=(A^q, F^q)$. Then $\{[F^s]_{\mathcal U}: s$ is a stem$ \} \subseteq H$, and hence, we can find $[F^1]_{\mathcal U} \in H$ which extends all of them. For each stem $s$, set $$B^s= \{\delta \in A^s: F^1(\delta) \leq F^s(\delta) \} \in \mathcal U.$$ Let also $$A^1 = \bigtriangleup_{s} B^s = \{\delta <\kappa: s \in V_\delta \Rightarrow \delta \in B^s \}.$$ We show that $q^1 = (A^1, F^1)$ is as required. Thus suppose that $s$ is a stem and suppose there exists $s^{\frown}(A, F) \leq (A^1, F^1)$ which decides $\phi$. It then follows that $s^{\frown}(A^s, F^s)$ decides $\phi$. But, by our construction, $$s^{\frown}(A^1, F^1) \leq s^{\frown}(A^s, F^s)$$ and hence $s^{\frown}(A^1, F^1) $ decides $\phi$ as well. Let $q^1=(A^1, F^1)$ be as in Claim \[reduction to stems\]. \[reduction to stem minus top elemet\] (Reduction to stem minus top element) There exists $q^2=(A^2, F^2) \leq^* q^1$ such that for any stem $s= (\delta_0, f_0, \dots, \delta_{n-1}, f_{n-1})$, if $s^{\frown} (\delta_n, f_n)^{\frown} (A, F) \leq (A^2, F^2)$ and $$s^{\frown} (\delta_n, f_n) ^{\frown} (A, F) \parallel \phi,$$ then $$s^{\frown} (\delta_n, F^2(\delta_n)) ^{\frown} (A^2, F^2) \parallel \phi.$$ Let $D$ be the set of all conditions $f \in \operatorname{Col}(\kappa^{++}, < j(\kappa))_M$ such that for any stem $s \in V_\kappa,$ if there exists $g \in \operatorname{Col}(\kappa^{++}, < j(\kappa))_M$ such that $$s^{\frown} (\kappa, g)^{\frown} (j(A^1), j(F^1)) \parallel \phi,$$ then $$s^{\frown} (\kappa, f)^{\frown} (j(A^1), j(F^1)) \parallel \phi.$$ We claim that $D \subseteq \operatorname{Col}(\kappa^{++}, < j(\kappa))_M$ is dense. Thus suppose that $g \in \operatorname{Col}(\kappa^{++}, < j(\kappa))_M.$ Let $(s_\alpha: \alpha < \kappa)$ enumerate all stems $s \in V_\kappa,$ and define a decreasing sequence $(f_\alpha: \alpha \leq \kappa)$ of conditions in $\operatorname{Col}(\kappa^{++}, < j(\kappa))_M$, such that $f_0=g$ and for any $\alpha < \kappa,$ $$\exists f \leq f_\alpha, s_\a^{\frown} (\kappa, f)^{\frown} (j(A^1), j(F^1)) \parallel \phi \implies s_\a^{\frown} (\kappa, f_{\alpha+1})^{\frown} (j(A^1), j(F^1)) \parallel \phi.$$ Then $f=f_\kappa \in D$ and it extends $g.$ Let $f=[F^2]_{\mathcal U}$. We may assume that $[F^2]_{\mathcal U} \leq [F^1]_{\mathcal U}$, and hence $A^\ast= \{ \delta < \kappa: F^2(\delta) \leq F^1(\delta) \} \in \mathcal U.$ For any stem $s= (\delta_0, f_0, \dots, \delta_{n-1}, f_{n-1})$, we have $A^s \in \mathcal U,$ where $A^s$ consists of those $\delta_n \in A^1$ such that if there exists $s^{\frown} (\delta_n, f_n) ^{\frown} (A, F) \leq s^{\frown} (A^1, F^1)$ which decides $\phi$, then $$s^{\frown} (\delta_n, F^2(\delta_n)) ^{\frown} (A^2, F^2) \parallel \phi.$$ Let $$A^2= \bigtriangleup_s A^s \cap A^\ast.$$ Then $q^2=(A^2, F^2)$ is easily seen to be as requested. \[one point extension uniformization\] (One point extension uniformization) There exists $q^3= (A^3, F^3) \leq^* q^2$ such that for any stem $s$, if $s^{\frown} (\delta_n, f_n)^{\frown} (A, F) \leq (A^3, F^3)$ and $$s^{\frown} (\delta_n, f_n) ^{\frown} (A, F) \parallel \phi,$$ then for all $\delta \in A^3,$ $$s^{\frown} (\delta, F^3(\delta)) ^{\frown} (A^3, F^3) \parallel \phi.$$ Let $s$ be a stem. Set - $A^s_0=\{\delta \in A^2: s^{\frown} (\delta, F^2(\delta)) ^{\frown} (A^2, F^2) \Vdash ~\phi \}$. - $A^s_1=\{\delta \in A^2: s^{\frown} (\delta, F^2(\delta)) ^{\frown} (A^2, F^2) \Vdash ~\neg\phi \}$. - $A^s_2=\{\delta \in A^2: s^{\frown} (\delta, F^2(\delta)) ^{\frown} (A^2, F^2) \nparallel \phi \}$. Let $i_s < 3$ be such that $A^s =A^s_{i_s} \in \mathcal U.$ Let $A^3= \bigtriangleup_s A^s \in \mathcal U,$ and set $F^3 = F^2 \upharpoonright A^3.$ We show that $q^3=(A^3, F^3)$ is as required. Thus suppose that $s^{\frown} (\delta_n, f_n)^{\frown} (A, F) \leq (A^3, F^3)$ and $s^{\frown} (\delta_n, f_n) ^{\frown} (A, F) \parallel \phi$. Let us suppose that it forces $\phi.$ Then $\delta_n \in A^s_0,$ and hence for all $\delta \in A_3$ such that $s^{\frown} (\delta, F^3(\delta)) ^{\frown} (A^3, F^3)$ is a condition, we have $\delta \in A^s_0,$ and hence $s^{\frown} (\delta, F^2(\delta)) ^{\frown} (A^2, F^2) \Vdash ~\phi.$ It follows that $$s^{\frown} (\delta, F^3(\delta)) ^{\frown} (A^3, F^3) \Vdash ~\phi.$$ \[minimal extension counterexample\] (Minimal extension counterexample) There exists $q^4=(A^4, F^4) \leq^* q^3$ which decides $\phi.$ Suppose not. Let $p \leq q^3 \leq $ decide $\phi,$ such that $n^p$ is minimal. By our assumption, $n^p>0$ and hence we can write $p$ as $$p=s^{\frown} (\delta_n, f_n) ^{\frown} (A, F).$$ By Claim \[one point extension uniformization\] $$\forall \delta \in A^3,~ s^{\frown} (\delta, F^3(\delta)) ^{\frown} (A^3, F^3) \Vdash \phi.$$ Note that if $p^\ast \leq s^{\frown} (A^3, F^3) $ and $n^{p^\ast} > n^p-1$, then for some $\delta \in A^3, p^\ast \leq s^{\frown} (\delta, F^3(\delta)) ^{\frown} (A^3, F^3),$ and hence $$s^{\frown}(A^3, F^3) \Vdash \phi.$$ This is in contradiction with the minimal choice of $n^p$. The lemma follows. Let $G$ be $\MPB$-generic over $V$. Let $C= (\delta_n: n< \omega)$ be the added Prikry sequence and for each $n<\omega$ set $G_n \subseteq \operatorname{Col}(\delta_n^{++}, <\delta_{n+1})$ be the generic filter added by $G$. \[estimate of bounded sets\] Suppose $A \in V[G]$ and $A \subseteq \delta_n^{+}$. Then $A \in V[\prod_{i<n}G_i]$. Let $p \in G$ be such that $n^p > n$. Let also ${\smash{\underset{\raisebox{1.2pt}[0cm][0cm]{$\sim$}} {{A}}}}$ be a $\MPB$-name for $A$ such that $\Vdash_{\MPB}$“${\smash{\underset{\raisebox{1.2pt}[0cm][0cm]{$\sim$}} {{A}}}} \subseteq \delta_n^{+}$”. Let ${\smash{\underset{\raisebox{1.2pt}[0cm][0cm]{$\sim$}} {{B}}}}$ be a $\MPB/ p^{\geq n}$-name for a subset of $\prod_{i<n} \operatorname{Col}(\delta_i^{++}, < \delta_{i+1}) \times \delta_n^+$ such that $ \Vdash_{\MPB/p^{\geq n}}$“$\forall \alpha < \delta_n^+ [~(q, \alpha) \in {\smash{\underset{\raisebox{1.2pt}[0cm][0cm]{$\sim$}} {{B}}}}) \iff q \Vdash_{\prod_{i<n} \operatorname{Col}(\delta_i^{++}, < \delta_{i+1})}$“$\alpha \in {\smash{\underset{\raisebox{1.2pt}[0cm][0cm]{$\sim$}} {{A}}}}$” \]”. Let $(x_\alpha: \alpha \leq \delta_n^+)$ be an enumeration of $\prod_{i<n} \operatorname{Col}(\delta_i^{++}, < \delta_{i+1}) \times \delta_n^+$. Define a $\leq^_{\MPB}$-decreasing sequence $(p_\alpha: \alpha \leq \delta_n^+ )$ of conditions in $\MPB / p^{\geq n}$ such that for each $\alpha< \delta_n^+, p_{\alpha+1} \\|$“$x_\alpha \in {\smash{\underset{\raisebox{1.2pt}[0cm][0cm]{$\sim$}} {{B}}}}$”. This is possible as $(\MPB/ p^{\geq n}, \leq^)$ is $\delta_n^{++}$-closed and satisfies the Prikry property. Then $p_{\delta_n^+}$ decides each “$x_\alpha \in {\smash{\underset{\raisebox{1.2pt}[0cm][0cm]{$\sim$}} {{B}}}}$”, and so, assuming $p_{\delta_n^+} \in G,$ we have $a= \{ \alpha < \kappa: \exists q \in \prod_{i<n}G_i, p_{\delta_n^+} \Vdash$“$(q, \alpha) \in {\smash{\underset{\raisebox{1.2pt}[0cm][0cm]{$\sim$}} {{B}}}}$”$ \} \in V[\prod_{i<n}G_i]$. The result follows. The following is now immediate. 1. $V$ and $V[G]$ have the same bounded subsets of $\delta_0$. 2. $Card^{V[G]} \cap [\delta_0, \kappa) = \bigcup_{n<\omega} \{ \delta_n, \delta_n^+, \delta_n^{++}\}$ 3. $V[G] \models$“ $\kappa=\delta_0^{+\omega}$”. Now forcing over $V[G]$ by $\operatorname{Col}(\aleph_0, < \delta_0),$ we get a model in which $\kappa$ becomes $\aleph_\omega.$ This completes the proof of Theorem \[main theorem\]. [99]{} Jech, Thomas; Set theory. The third millennium edition, revised and expanded. Springer Monographs in Mathematics. Springer-Verlag, Berlin, 2003. xiv+769 pp. Mohammad Golshani, School of Mathematics, Institute for Research in Fundamental Sciences (IPM), P.O. Box: 19395-5746, Tehran-Iran. E-mail address: [email protected] URL: http://math.ipm.ac.ir/golshani/
Myers Y. Cooper Myers Young Cooper (November 25, 1873 – December 6, 1958) was a Republican politician from Ohio. Cooper was the 51st Governor of Ohio. Born In St. Louisville, Ohio, the youngest of eleven children, Cooper had a public school education, and attended the National Normal University in Lebanon, Ohio for three years. In 1893, at age 20, he joined his brothers in Cincinnati in a large real-estate and homebuilding business. On December 15, 1897, he married Martha Kinney. His business interests also included lumber, building supplies and banking. After losing in 1926, he won election to the governorship in 1928, serving from 1929 to 1931. He was again nominated in 1930, but lost to George White. His former home is now the grounds for Clark Montessori High School. References External links Category:1873 births Category:1958 deaths Category:Governors of Ohio Category:American Disciples of Christ Category:People from Licking County, Ohio Category:Politicians from Cincinnati Category:Ohio Republicans Category:National Normal University alumni Category:Burials at Spring Grove Cemetery Category:Republican Party state governors of the United States
Available for viewing below, "Play" is a two-part mini-documentary, directed by Dave Grohl, celebrating the rewards and challenges of dedicating one's life to playing music. Part one opens with narrated behind the scenes discussion of the love of playing music and the lifelong relationship with an instrument — as well as the process and challenges of recording and filming this unique performance. The "Play" film then segues to the titular 23-minute, one-man-band instrumental recording on which Grohl plays all seven instruments on the track, all live. The entire song was played by Grohl, each time on a different instrument, live all the way through for 23 minutes. Visit play.roswellfilms.com for an interactive "Play" experience. Explore "Play" by choosing which audio and video you'd like to experience. Hover over "Choose Video" and click to select to view only one instrument. Once you do that, you can also hover over "Choose Audio" to listen to the isolated track of the instrument you are watching or the complete master audio. You can go back to the complete master performance video, or toggle between individual instruments and audio at any time. Download sheet music and find a growing directory of organizations who support music education. Filmed in classic black and white by Brandon Trost ("The Disaster Artist", "This Is The End"), with lighting modulating to match the dramatic peaks and valleys of this epic instrumental, "Play" was then edited to feature seven Grohl's recordings together. The "Play" online interactive experience offers viewer/listener/participants the options of taking in the mini-doc and Grohl performance as is, focusing on one instrument, and/or downloading "Play" sheet music. The online version of "Play" also includes a list of organizations where time, money and instruments can be donated to the cause — and places where musicians young and old alike can have the opportunity to play live music. The challenges Grohl created for himself in creating "Play" mirror those taken on by music students every day: The obstacles they face in their daily efforts to elevate and improve their abilities are no different than those faced by a world class stadium rocker — both are striving for the same goals. This shared quest gave "Play" its mission to inspire and promote music education: The film is intercut with young musicians from the Join The Band music school in the San Fernando Valley practicing their craft, working relentlessly to get it right, and always coming back to the conclusion that, in Grohl's words, "'just like any kid, the reward is just to PLAY." Through partnerships with music and media organizations, schools and charities the world over, "Play" and its portrait of the joy of playing music should be a catalyst for discussion and action to benefit music education on a global level. Keep your eyes on play.roswellfilms.com for information on upcoming auctions with proceeds benefiting local music education organizations. Photo credit: Andrew Stuart
define([ "./core", "./var/concat", "./var/push", "./core/access", "./manipulation/var/rcheckableType", "./manipulation/support", "./data/var/data_priv", "./data/var/data_user", "./core/init", "./data/accepts", "./traversing", "./selector", "./event" ], function( jQuery, concat, push, access, rcheckableType, support, data_priv, data_user ) { var rxhtmlTag = /<(?!area\|br\|col\|embed\|hr\|img\|input\|link\|meta\|param)(([\w:]+)[^>])\/>/gi, rtagName = /<([\w:]+)/, rhtml = /<\|&#?\w+;/, rnoInnerhtml = /<(?:script\|style\|link)/i, // checked="checked" or checked rchecked = /checked\s(?:[^=]\|=\s.checked.)/i, rscriptType = /^$\|\/(?:java\|ecma)script/i, rscriptTypeMasked = /^true\/(.)/, rcleanScript = /^\s<!(?:\[CDATA\[\|--)\|(?:\]\]\|--)>\s$/g, // We have to close these tags to support XHTML (#13200) wrapMap = { // Support: IE 9 option: [ 1, "<select multiple='multiple'>", "</select>" ], thead: [ 1, "<table>", "</table>" ], col: [ 2, "<table><colgroup>", "</colgroup></table>" ], tr: [ 2, "<table><tbody>", "</tbody></table>" ], td: [ 3, "<table><tbody><tr>", "</tr></tbody></table>" ], _default: [ 0, "", "" ] }; // Support: IE 9 wrapMap.optgroup = wrapMap.option; wrapMap.tbody = wrapMap.tfoot = wrapMap.colgroup = wrapMap.caption = wrapMap.thead; wrapMap.th = wrapMap.td; // Support: 1.x compatibility // Manipulating tables requires a tbody function manipulationTarget( elem, content ) { return jQuery.nodeName( elem, "table" ) && jQuery.nodeName( content.nodeType !== 11 ? content : content.firstChild, "tr" ) ? elem.getElementsByTagName("tbody")[0] \|\| elem.appendChild( elem.ownerDocument.createElement("tbody") ) : elem; } // Replace/restore the type attribute of script elements for safe DOM manipulation function disableScript( elem ) { elem.type = (elem.getAttribute("type") !== null) + "/" + elem.type; return elem; } function restoreScript( elem ) { var match = rscriptTypeMasked.exec( elem.type ); if ( match ) { elem.type = match[ 1 ]; } else { elem.removeAttribute("type"); } return elem; } // Mark scripts as having already been evaluated function setGlobalEval( elems, refElements ) { var i = 0, l = elems.length; for ( ; i < l; i++ ) { data_priv.set( elems[ i ], "globalEval", !refElements \|\| data_priv.get( refElements[ i ], "globalEval" ) ); } } function cloneCopyEvent( src, dest ) { var i, l, type, pdataOld, pdataCur, udataOld, udataCur, events; if ( dest.nodeType !== 1 ) { return; } // 1. Copy private data: events, handlers, etc. if ( data_priv.hasData( src ) ) { pdataOld = data_priv.access( src ); pdataCur = data_priv.set( dest, pdataOld ); events = pdataOld.events; if ( events ) { delete pdataCur.handle; pdataCur.events = {}; for ( type in events ) { for ( i = 0, l = events[ type ].length; i < l; i++ ) { jQuery.event.add( dest, type, events[ type ][ i ] ); } } } } // 2. Copy user data if ( data_user.hasData( src ) ) { udataOld = data_user.access( src ); udataCur = jQuery.extend( {}, udataOld ); data_user.set( dest, udataCur ); } } function getAll( context, tag ) { var ret = context.getElementsByTagName ? context.getElementsByTagName( tag \|\| "" ) : context.querySelectorAll ? context.querySelectorAll( tag \|\| "" ) : []; return tag === undefined \|\| tag && jQuery.nodeName( context, tag ) ? jQuery.merge( [ context ], ret ) : ret; } // Support: IE >= 9 function fixInput( src, dest ) { var nodeName = dest.nodeName.toLowerCase(); // Fails to persist the checked state of a cloned checkbox or radio button. if ( nodeName === "input" && rcheckableType.test( src.type ) ) { dest.checked = src.checked; // Fails to return the selected option to the default selected state when cloning options } else if ( nodeName === "input" \|\| nodeName === "textarea" ) { dest.defaultValue = src.defaultValue; } } jQuery.extend({ clone: function( elem, dataAndEvents, deepDataAndEvents ) { var i, l, srcElements, destElements, clone = elem.cloneNode( true ), inPage = jQuery.contains( elem.ownerDocument, elem ); // Support: IE >= 9 // Fix Cloning issues if ( !support.noCloneChecked && ( elem.nodeType === 1 \|\| elem.nodeType === 11 ) && !jQuery.isXMLDoc( elem ) ) { // We eschew Sizzle here for performance reasons: http://jsperf.com/getall-vs-sizzle/2 destElements = getAll( clone ); srcElements = getAll( elem ); for ( i = 0, l = srcElements.length; i < l; i++ ) { fixInput( srcElements[ i ], destElements[ i ] ); } } // Copy the events from the original to the clone if ( dataAndEvents ) { if ( deepDataAndEvents ) { srcElements = srcElements \|\| getAll( elem ); destElements = destElements \|\| getAll( clone ); for ( i = 0, l = srcElements.length; i < l; i++ ) { cloneCopyEvent( srcElements[ i ], destElements[ i ] ); } } else { cloneCopyEvent( elem, clone ); } } // Preserve script evaluation history destElements = getAll( clone, "script" ); if ( destElements.length > 0 ) { setGlobalEval( destElements, !inPage && getAll( elem, "script" ) ); } // Return the cloned set return clone; }, buildFragment: function( elems, context, scripts, selection ) { var elem, tmp, tag, wrap, contains, j, fragment = context.createDocumentFragment(), nodes = [], i = 0, l = elems.length; for ( ; i < l; i++ ) { elem = elems[ i ]; if ( elem \|\| elem === 0 ) { // Add nodes directly if ( jQuery.type( elem ) === "object" ) { // Support: QtWebKit // jQuery.merge because push.apply(_, arraylike) throws jQuery.merge( nodes, elem.nodeType ? [ elem ] : elem ); // Convert non-html into a text node } else if ( !rhtml.test( elem ) ) { nodes.push( context.createTextNode( elem ) ); // Convert html into DOM nodes } else { tmp = tmp \|\| fragment.appendChild( context.createElement("div") ); // Deserialize a standard representation tag = ( rtagName.exec( elem ) \|\| [ "", "" ] )[ 1 ].toLowerCase(); wrap = wrapMap[ tag ] \|\| wrapMap._default; tmp.innerHTML = wrap[ 1 ] + elem.replace( rxhtmlTag, "<$1></$2>" ) + wrap[ 2 ]; // Descend through wrappers to the right content j = wrap[ 0 ]; while ( j-- ) { tmp = tmp.lastChild; } // Support: QtWebKit // jQuery.merge because push.apply(_, arraylike) throws jQuery.merge( nodes, tmp.childNodes ); // Remember the top-level container tmp = fragment.firstChild; // Fixes #12346 // Support: Webkit, IE tmp.textContent = ""; } } } // Remove wrapper from fragment fragment.textContent = ""; i = 0; while ( (elem = nodes[ i++ ]) ) { // #4087 - If origin and destination elements are the same, and this is // that element, do not do anything if ( selection && jQuery.inArray( elem, selection ) !== -1 ) { continue; } contains = jQuery.contains( elem.ownerDocument, elem ); // Append to fragment tmp = getAll( fragment.appendChild( elem ), "script" ); // Preserve script evaluation history if ( contains ) { setGlobalEval( tmp ); } // Capture executables if ( scripts ) { j = 0; while ( (elem = tmp[ j++ ]) ) { if ( rscriptType.test( elem.type \|\| "" ) ) { scripts.push( elem ); } } } } return fragment; }, cleanData: function( elems ) { var data, elem, type, key, special = jQuery.event.special, i = 0; for ( ; (elem = elems[ i ]) !== undefined; i++ ) { if ( jQuery.acceptData( elem ) ) { key = elem[ data_priv.expando ]; if ( key && (data = data_priv.cache[ key ]) ) { if ( data.events ) { for ( type in data.events ) { if ( special[ type ] ) { jQuery.event.remove( elem, type ); // This is a shortcut to avoid jQuery.event.remove's overhead } else { jQuery.removeEvent( elem, type, data.handle ); } } } if ( data_priv.cache[ key ] ) { // Discard any remaining `private` data delete data_priv.cache[ key ]; } } } // Discard any remaining `user` data delete data_user.cache[ elem[ data_user.expando ] ]; } } }); jQuery.fn.extend({ text: function( value ) { return access( this, function( value ) { return value === undefined ? jQuery.text( this ) : this.empty().each(function() { if ( this.nodeType === 1 \|\| this.nodeType === 11 \|\| this.nodeType === 9 ) { this.textContent = value; } }); }, null, value, arguments.length ); }, append: function() { return this.domManip( arguments, function( elem ) { if ( this.nodeType === 1 \|\| this.nodeType === 11 \|\| this.nodeType === 9 ) { var target = manipulationTarget( this, elem ); target.appendChild( elem ); } }); }, prepend: function() { return this.domManip( arguments, function( elem ) { if ( this.nodeType === 1 \|\| this.nodeType === 11 \|\| this.nodeType === 9 ) { var target = manipulationTarget( this, elem ); target.insertBefore( elem, target.firstChild ); } }); }, before: function() { return this.domManip( arguments, function( elem ) { if ( this.parentNode ) { this.parentNode.insertBefore( elem, this ); } }); }, after: function() { return this.domManip( arguments, function( elem ) { if ( this.parentNode ) { this.parentNode.insertBefore( elem, this.nextSibling ); } }); }, remove: function( selector, keepData /* Internal Use Only */ ) { var elem, elems = selector ? jQuery.filter( selector, this ) : this, i = 0; for ( ; (elem = elems[i]) != null; i++ ) { if ( !keepData && elem.nodeType === 1 ) { jQuery.cleanData( getAll( elem ) ); } if ( elem.parentNode ) { if ( keepData && jQuery.contains( elem.ownerDocument, elem ) ) { setGlobalEval( getAll( elem, "script" ) ); } elem.parentNode.removeChild( elem ); } } return this; }, empty: function() { var elem, i = 0; for ( ; (elem = this[i]) != null; i++ ) { if ( elem.nodeType === 1 ) { // Prevent memory leaks jQuery.cleanData( getAll( elem, false ) ); // Remove any remaining nodes elem.textContent = ""; } } return this; }, clone: function( dataAndEvents, deepDataAndEvents ) { dataAndEvents = dataAndEvents == null ? false : dataAndEvents; deepDataAndEvents = deepDataAndEvents == null ? dataAndEvents : deepDataAndEvents; return this.map(function() { return jQuery.clone( this, dataAndEvents, deepDataAndEvents ); }); }, html: function( value ) { return access( this, function( value ) { var elem = this[ 0 ] \|\| {}, i = 0, l = this.length; if ( value === undefined && elem.nodeType === 1 ) { return elem.innerHTML; } // See if we can take a shortcut and just use innerHTML if ( typeof value === "string" && !rnoInnerhtml.test( value ) && !wrapMap[ ( rtagName.exec( value ) \|\| [ "", "" ] )[ 1 ].toLowerCase() ] ) { value = value.replace( rxhtmlTag, "<$1></$2>" ); try { for ( ; i < l; i++ ) { elem = this[ i ] \|\| {}; // Remove element nodes and prevent memory leaks if ( elem.nodeType === 1 ) { jQuery.cleanData( getAll( elem, false ) ); elem.innerHTML = value; } } elem = 0; // If using innerHTML throws an exception, use the fallback method } catch( e ) {} } if ( elem ) { this.empty().append( value ); } }, null, value, arguments.length ); }, replaceWith: function() { var arg = arguments[ 0 ]; // Make the changes, replacing each context element with the new content this.domManip( arguments, function( elem ) { arg = this.parentNode; jQuery.cleanData( getAll( this ) ); if ( arg ) { arg.replaceChild( elem, this ); } }); // Force removal if there was no new content (e.g., from empty arguments) return arg && (arg.length \|\| arg.nodeType) ? this : this.remove(); }, detach: function( selector ) { return this.remove( selector, true ); }, domManip: function( args, callback ) { // Flatten any nested arrays args = concat.apply( [], args ); var fragment, first, scripts, hasScripts, node, doc, i = 0, l = this.length, set = this, iNoClone = l - 1, value = args[ 0 ], isFunction = jQuery.isFunction( value ); // We can't cloneNode fragments that contain checked, in WebKit if ( isFunction \|\| ( l > 1 && typeof value === "string" && !support.checkClone && rchecked.test( value ) ) ) { return this.each(function( index ) { var self = set.eq( index ); if ( isFunction ) { args[ 0 ] = value.call( this, index, self.html() ); } self.domManip( args, callback ); }); } if ( l ) { fragment = jQuery.buildFragment( args, this[ 0 ].ownerDocument, false, this ); first = fragment.firstChild; if ( fragment.childNodes.length === 1 ) { fragment = first; } if ( first ) { scripts = jQuery.map( getAll( fragment, "script" ), disableScript ); hasScripts = scripts.length; // Use the original fragment for the last item instead of the first because it can end up // being emptied incorrectly in certain situations (#8070). for ( ; i < l; i++ ) { node = fragment; if ( i !== iNoClone ) { node = jQuery.clone( node, true, true ); // Keep references to cloned scripts for later restoration if ( hasScripts ) { // Support: QtWebKit // jQuery.merge because push.apply(_, arraylike) throws jQuery.merge( scripts, getAll( node, "script" ) ); } } callback.call( this[ i ], node, i ); } if ( hasScripts ) { doc = scripts[ scripts.length - 1 ].ownerDocument; // Reenable scripts jQuery.map( scripts, restoreScript ); // Evaluate executable scripts on first document insertion for ( i = 0; i < hasScripts; i++ ) { node = scripts[ i ]; if ( rscriptType.test( node.type \|\| "" ) && !data_priv.access( node, "globalEval" ) && jQuery.contains( doc, node ) ) { if ( node.src ) { // Optional AJAX dependency, but won't run scripts if not present if ( jQuery._evalUrl ) { jQuery._evalUrl( node.src ); } } else { jQuery.globalEval( node.textContent.replace( rcleanScript, "" ) ); } } } } } } return this; } }); jQuery.each({ appendTo: "append", prependTo: "prepend", insertBefore: "before", insertAfter: "after", replaceAll: "replaceWith" }, function( name, original ) { jQuery.fn[ name ] = function( selector ) { var elems, ret = [], insert = jQuery( selector ), last = insert.length - 1, i = 0; for ( ; i <= last; i++ ) { elems = i === last ? this : this.clone( true ); jQuery( insert[ i ] )[ original ]( elems ); // Support: QtWebKit // .get() because push.apply(_, arraylike) throws push.apply( ret, elems.get() ); } return this.pushStack( ret ); }; }); return jQuery; });
fileFormatVersion: 2 guid: 210511cf66e93ac4aa9433abaa1aa2a8 TextureImporter: fileIDToRecycleName: {} externalObjects: {} serializedVersion: 7 mipmaps: mipMapMode: 0 enableMipMap: 0 sRGBTexture: 0 linearTexture: 1 fadeOut: 0 borderMipMap: 0 mipMapsPreserveCoverage: 0 alphaTestReferenceValue: 0.5 mipMapFadeDistanceStart: 1 mipMapFadeDistanceEnd: 3 bumpmap: convertToNormalMap: 0 externalNormalMap: 0 heightScale: 0.25 normalMapFilter: 0 isReadable: 1 streamingMipmaps: 0 streamingMipmapsPriority: 0 grayScaleToAlpha: 0 generateCubemap: 6 cubemapConvolution: 0 seamlessCubemap: 0 textureFormat: -3 maxTextureSize: 256 textureSettings: serializedVersion: 2 filterMode: -1 aniso: 0 mipBias: -100 wrapU: 1 wrapV: 1 wrapW: 1 nPOTScale: 1 lightmap: 0 compressionQuality: 50 spriteMode: 0 spriteExtrude: 1 spriteMeshType: 1 alignment: 0 spritePivot: {x: 0.5, y: 0.5} spritePixelsToUnits: 100 spriteBorder: {x: 0, y: 0, z: 0, w: 0} spriteGenerateFallbackPhysicsShape: 1 alphaUsage: 1 alphaIsTransparency: 0 spriteTessellationDetail: -1 textureType: 0 textureShape: 1 singleChannelComponent: 0 maxTextureSizeSet: 0 compressionQualitySet: 0 textureFormatSet: 0 platformSettings: - serializedVersion: 2 buildTarget: DefaultTexturePlatform maxTextureSize: 256 resizeAlgorithm: 0 textureFormat: -1 textureCompression: 0 compressionQuality: 50 crunchedCompression: 0 allowsAlphaSplitting: 0 overridden: 0 androidETC2FallbackOverride: 0 spriteSheet: serializedVersion: 2 sprites: [] outline: [] physicsShape: [] bones: [] spriteID: vertices: [] indices: edges: [] weights: [] spritePackingTag: pSDRemoveMatte: 0 pSDShowRemoveMatteOption: 0 userData: assetBundleName: arts/luts/standard/cine pack 2/draught.png.cab assetBundleVariant:
Compact D-Star Transceiver, Icom ID-31 upgraded! Newly released handy transceiver ID-31PLUS for amateur radio which can enjoy long distance communication with D-STAR ® easily Product name / model number 430 MHz digital transceiver (Built-in GPS receiver) / ID-31 PLUS Suggested retail price \ 37,800 Release date Late August Annual planned sales volume 3000 units Product dimensions / weight 58 × 95 × 25.4 mm, about 220 g (including BP – 271 and antenna) Icom Co., Ltd. (Headquarters: Osaka Hirano-ku, President: Masataka Harima) is, Windows ® PC or Android ® equipped with a mode that allows communication by connecting from the terminal to the Internet line, D-STAR ® corresponding amateur radio for digital We will release the transceiver ID-31PLUS from late August. ID-31PLUS adds a number of functions while maintaining the compact size of the popular transceiver ID-31 compliant with the digital communication standard D-STAR ® recommended by the Japan Amateur Radio Association . It is a handy transceiver version upgraded for even more powerful enjoyment. New functions such as “Terminal mode” and “Access point mode” that enable you to enjoy long distance communication via the D – STAR ® network even where there is no D – STAR ® repeater that can be accessed nearby , the function expansion application RS – Full feature support to MS1A, voice recorder function, etc. We equipped a number of new functions that make operation more comfortable and convenient. In addition, we are offering lineup of three color variations of silver, red and gold. We will appeal to a wide range of amateur radio fans as the first hand touching amateur radio and the optimal handy transceiver as an introduction machine of D – STAR ® . 【Main features】 Access point mode with wider range of communication with new functions · Terminal mode compatible, you can enjoy long distance communication via the D – STAR ® repeater network in the vicinity without a repeater. Communication setting is equipped with easy DR function. You can communicate with the other party (repeater / personal station) by “To”, by setting the nearest repeater to “From”. Sending and receiving of image and text is comfortable With cooperation with Android ® terminal , image and text can be sent and received. With DV – Fast mode, you can communicate data at 3.5 times the speed of normal DV mode. You can also use the DR function from the Android ® terminal. In addition, we built a quasi-zenith satellite “MICHIBIKI” compatible GPS receiver. Waterproof, lightweight, compact and excellent mobility The highest level IPX7 * Waterproof so you can operate it without worrying about rain or splashed water. It is ideal for carrying with the palm size that fits perfectly into your pocket. ※ Gently sink in a water bath (tap water at room temperature) with water depth of 1 m with the battery pack and antenna properly installed, leave it for 30 minutes, then take out it and function as a radio. Three color variations A new design that shines with one point color. You can choose from three colors of silver, gold and red. The JK Antennas Navassa-5 is a five band / Multiband Yagi that interlaces 10, 12, 15, 17 & 20 meters on a single boom. This antenna is based on a collaborative design by E73M Daniel Horvat. This unique design places full size elements... Read more The user starts by recognizing only two letters, M and K, at high speed (at least 20WPM) on a 5 minutes session. When she or he will be able to write down on paper at least 90% of the sequence, she or he will add another letter of... Read more wistv.com – Columbia, South CarolinaCOLUMBIA, SC (WIS) –There will be added voices over the air waves, aiding emergency response over the Total Solar Eclipse weekend and also on Monday, August 21, for the actual event itself. ... Read more
Honja: Backpacking Through Asia, Part II When I was a kid, one of my favorite movies was The King and I. It’s been many years since I’ve seen it, but I loved the story of the British governess, the king of Siam, and the intrigues of the royal court. I knew fairly little about Thai history other than the events and historical figures in the musical, so I was eager to learn more about a country that had always held a special place in my imagination. I arrived in Bangkok the morning of January 19, after my ten-day trip to Vietnam. When I think about my trip around Thailand, the first word that comes to mind is “influence.” Thailand is a country that has been influenced by Chinese, Indian, British, and American culture (among others), while maintaining its own culture and influencing others in the region and around the world. While the rest of southeast Asia was carved into colonies during the nineteenth century, only Thailand retained its sovereignty–with the caveat that it would modernize and westernize, as alluded to in The King and I. Though seemingly trivial, the first thing I noticed when I walked out of the airport was that cars in Thailand drive on the “wrong” side of the road, and it was like I was in England again. I witnessed many of the effects of westernization as a result of the last 150 years, from technology to language to cuisine, but I also learned about history, politics, and a culture that was uniquely Thai. The streets of Bangkok were not flanked by communist flags, like the highway in Hanoi, but images of the king were mounted in the intersections and on buildings. Rama IX is currently the world’s longest reigning monarch, and his presence pervaded the city. Interestingly, Thailand also has strict lese majeste laws, and disrespecting the king or his image could result in severe punishment. It was such a different political landscape than I was used to in America and Korea. Thailand is 95% Buddhist (that Indian influence!), and Bangkok in particular is known for its ornate temples. At least half of my pictures have a Buddha statue! My favorite part of Bangkok was the Grand Palace and Wat Phra Kaew, a well-known temple in Thailand. The massive grounds had royal quarters, Buddhist temples, and colorful statues that glistened in the sunlight. My pictures do not do it justice, but I will post a few anyway. In addition, Wat Phra Kaew is famous for the emerald Buddha, which is a symbol of Thailand’s wealth and its dedication to religion. Seeing the emerald Buddha adorned in gold and perched upon a high golden throne, it felt like walking into Aladdin’s Cave of Wonders. The walls were decorated with thick gold and rich jewel tones, the flecks of blue and red and green creating a kaleidoscope of color. It was so visually overwhelming, it didn’t seem real. After the Grand Palace and Wat Phra Kaew, I went to Wat Pho, which is famous for its large reclining Buddha statue. Wat Pho has also been instrumental in preserving the ancient art of Thai massage. The architecture at Wat Pho was similar to the architecture at Wat Phra Kaew, though not as jewel-encrusted nor as vividly colored. Across the river from Wat Pho, I saw Wat Arun, the Temple of Dawn. At this point, I should note that the Chao Phraya River runs through Bangkok and its neighboring provinces, and Bangkok itself was once a city of canals. Years ago, boats were used to ferry people to different parts of the city. With modernization, the canals were filled in and replaced with roads, but the express boat along the Chao Phraya River remains a vestige of older times. It was this boat that took me from Wat Pho to Wat Arun. Though the temples are, first and foremost, places of worship, the constant influx of tourists has led to the rise of some unscrupulous practices. Near the ticket windows for each temple, I saw large signs that read, “Buddha is NOT for decoration!” and urged tourists not to buy Buddha souvenirs or get Buddha tattoos. But sure enough, on the streets outside of the temples, men and women sold Buddha statuettes and tattoo parlors advertised Buddha tattoos. At one of the other temples I visited, a man was sitting on the steps, holding wild sparrows in little cages and cajoling tourists to pay him a fee to set the birds free and receive good luck forever. I hadn’t witnessed these practices in Vietnam, nor in any other country I have visited, so I was surprised to encounter them here. As the sun was setting, I visited one more temple, the Golden Mount. The city was just starting to light up, and I had a great view of the temples, monuments, and skyscrapers. Like Korea, Bangkok is an amazing fusion of modern and traditional, old and new. In all, I spent two and a half days sightseeing in Bangkok. But I realized that after the first day, the temples and the architecture seemed less exciting. I was becoming desensitized to the splendor. I wasn’t sure if that was because of how tightly I packed my schedule so I could see everything, or if Thailand was just so magnificent that I couldn’t process it all. I did have a brief experience that was quite different from seeing the temples. I wanted to visit a palace that was further away from the main thoroughfare, so I took the express boat down the river and tried to find my way with a map. At one point, I took a wrong turn and wandered onto a university campus by mistake (I quickly turned around when I saw I was the only one not wearing a school uniform). When I finally arrived at the palace, it had closed for the day. I was disappointed that my search had come to nothing, but I did see some of Bangkok and its more obscure temples outside of the tourist areas. In fact, when I stopped in a convenience store, the woman behind the counter smiled brightly and said she couldn’t wait to tell her friend she saw a foreigner! Only then it occurred to me that I was the only non-Thai person I had seen walking through this area, which was only a fifteen-minute walk from the Grand Palace. After a few days, I was ready to leave Bangkok and see some more of Thailand. The big cities only tell part of a country’s story, and I wanted to learn more. Ayutthaya Getting away from Bangkok, I took a day trip to Ayutthaya province for some more historical sightseeing. Ayutthaya was founded almost 700 years ago, and it served as the ancient capital of Siam for about 400 years. Even after the capital moved to Bangkok, Ayutthaya remained an important place for the royal family, historians, and devout Buddhists. My first stop in Ayutthaya was Bang Pa-In Palace. Before I arrived in Thailand, I was most looking forward to visiting Bang Pa-In, the summer home of Rama IV (King Mongkut, the famous King in The King and I) and his son Rama V (King Chulalongkorn, widely regarded as the most influential king of Thailand). Though the palace was originally constructed in the mid-seventeenth century, many more buildings and structures were added over the next few hundred years. Like the architecture of English cathedrals that were built over hundreds of years, the architecture of Bang Pa-In was an amalgamation of different cultures and time periods. Bang Pa-In fully exemplified the influences I mentioned before, featuring architectural styles from Thailand itself, China, and the West. For much of my visit, I felt like I was walking through an English mansion rather than a royal residence in southeast Asia. Greco-Roman statues and columns adorned the gardens and the waters, while many of the buildings were painted in soft pastel colors rather than gold. It was beautiful, but seemed out-of-place when I compared it to the architecture in Bangkok. Of course, there was still traditional Thai architecture, as well as the Chinese-style royal palace with bright red and gold colors. Living in Korea and traveling through Vietnam and Thailand has taught me how closely architecture is linked to culture and cultural exchange. Half an hour away from the palace, I visited the ancient Buddhist temples of Ayutthaya, including a Buddha’s head entwined in tree roots and another large reclining Buddha. It was quite a bit different than the temples in Bangkok! I enjoyed learning about the older history of Thailand. As always, I wished I had time to see more. Kanchanaburi The day after Ayutthaya, I took another day trip to Kanchanaburi province, which is two hours west of Bangkok. As with my trip to Saigon and Cu Chi in Vietnam, this was the serious part of my visit. Kanchanaburi is home to the infamous Burma Railway and the Bridge on the River Kwai, both of which were built by prisoners of war for the benefit of the Japanese empire. Once again, I learned new perspectives of a war–this time, World War II. My first stop was the war cemetery, where the prisoners of war were buried. I saw the graves of Western soldiers and Asian civilians who had perished during the construction of the railway and the bridge. Many of them were younger than me. That was the most chilling part of all. Not far from the cemetery, I saw the bridge itself. I admit, before going to Thailand, I knew very little about the bridge other than that it had been constructed during World War II and there was an old movie about it. The bridge is part of the Burma Railway, which was constructed to connect Burma (Myanmar) and Thailand for the benefit of the Japanese army in the 1940s. It is also known as the “Death Railway” because of the high number of casualties among those forced to work. Some of the railway is still in use today, and the bridge remains a popular tourist attraction and a reminder of this dark history. Next to the Bridge on the River Kwai, the Jeath War Museum recounted the horrors and abuse that POWs and civilians faced during their forced labor on the bridge and the railway. As I saw the artifacts and read the exhibit posters, I couldn’t help but contrast what I saw in this museum with the War Remnants Museum in Saigon. There was some anti-Japanese sentiment, yes, but it was not nearly as overwhelming as the anti-American sentiment in Vietnam’s museum. In fact, the English language descriptions of World War II emphasized that, “It was the result of the action of a handful of power-crazed and inconsiderate people. They did all these things without thinking about the hardship of other human beings.” I thought once again about the war cemetery, the soldiers, and the civilians. I also wondered why the history classes I took in middle school and high school taught so little about how World War II affected Asia and the Pacific. After visiting the bridge and museum, I did one of the “must-do” activities in Thailand–riding an elephant. I was with a group of people, and there were about ten elephants that took us on a ride around their sanctuary. As I eased myself onto the seat on the elephant’s back, I realized it would be a bumpy ride. I had the elephant version of myself–clumsy, snack-loving, and competitive. My elephant was the first of the ten to start walking around in the circle, but she stopped after a few minutes to eat some bamboo from a tree. The elephant handler laughed and commented that she must be very hungry. After five minutes of the elephant eating the bamboo, the handler finally steered her away. She took three steps and saw some grass. Apparently, it looked like dessert. Increasingly frustrated, the handler snapped a few words in Thai and jerked the bridle. The elephant looked up, saw she was behind the other elephants who were walking around the circle, and bounded toward them to make up for lost time. I think I’m still sore from all the bouncing. The elephants were beautiful creatures, but I sensed that they weren’t well treated at this site. Later on, I read in a guidebook that elephants in Thailand are still classified as a mode of transportation, so regulations for tourism are not very strict. The ride was an interesting experience, but I wouldn’t do it again. I left Kanchanaburi with a new appreciation for Thailand. Stepping away from the glitz and the glamour of Bangkok, I saw some of the modern, yet dark history that has shaped the country into what it is today. Though a sad day, it was probably my favorite part of my trip. Chiang Mai and Chiang Rai After five days in central Thailand, I took an overnight train from Bangkok to Chiang Mai. With the exception of my first day there, the weather in Chiang Mai was rather dreary; in fact, it was the coldest weather Thailand had seen in quite a few years. I visited a few temples, went on a night safari at the nearby zoo, and traveled to Doi Inthanon, the tallest mountain in Thailand. I also took a day trip to Chiang Rai, the northernmost part of Thailand. On the way there, I visited the White Temple, which was designed by a modern artist as a gift to his country. The entrance to the temple features a lot of imagery of heaven and hell, especially with the skeletal hands reaching from the ground as if to grab the people walking by. The indoor exhibit was closed, but I have heard it is equally as interesting and symbolic as the exterior. The White Temple also had a golden building off to the side. Beautiful, isn’t it? Turns out that is the toilet. It’s a great commentary on being deceived by outward appearances–but, I wondered, is it meant as a larger commentary about the magnificence of Thailand itself? Just past Chiang Rai, I stopped to visit the Golden Triangle. The Golden Triangle is the place where Thailand, Laos, and Myanmar meet, separated only by the Mekong River. In the middle of the river, there is a small piece of land, a marsh, that doesn’t belong to any of the three countries. Until a few decades ago, it served as a center of the opium and contraband trade, where goods were bartered and no currency was used. Opium was so valuable, it was called “black gold”–and thus the name Golden Triangle was born. The tour guide said that the northern hill tribes in Thailand used to survive by growing opium and taking part in this illicit trade, but the government has since provided additional jobs and alternative sources of income. Indeed, in some of the markets at Bangkok and Chiang Mai, I had seen merchants from these tribes selling traditional artwork and handicrafts. In the picture above, the golden Buddha to the left is Thailand, the brown building in the center-left is Myanmar, and the golden dome to the right is Laos. I took a brief boat ride along the river, disembarked at a small market in Laos for a few minutes, and then returned to Thai soil. Another stamp in my passport! On my return to Chiang Mai, the tour bus stopped at a small village. The tour guide told us that for an additional fee, we could see the long-necked Karin, a northern Thai tribe that is famous for the rings they wear around their necks. It sounded uncomfortably voyeuristic. I remembered what the guide said about these tribes leaving the opium trade for “alternative sources of income”–was another source of income being gawked at and treated like animals in a zoo? To my relief, the other travelers in my group also demurred and wanted to continue home. By this part of the day, the dreary weather matched my mood. I was ready to go to better shores and see the sun again. Koh Tao To end my trip, I left the chilly mountains of Chiang Mai for the tropical islands in the Gulf of Thailand. It’s always been a dream of mine to go scuba diving, so I took the initiative and signed up for a PADI Open Water diving course at Crystal Dive Resort on Koh Tao (I highly recommended it). The course took four days and included classroom instruction, a day of learning how to use the equipment in a swimming pool, and four dives. I realized that I haven’t gone swimming for a few years, so I was eager to make up for lost time. I mentioned before that I am clumsy and not athletically inclined, so I was really nervous on the first dive. I felt a small surge of panic when I saw the rope descending into cloudy nothingness, but after our group started to descend, it wasn’t bad at all. By the second dive, everything was much easier, and by the third and fourth dives, I could enjoy watching some of the fish. On our last dive, one of the students in my group proposed to his girlfriend under the water! I wasn’t allowed to use my underwater camera while on the dives, but I do have some screenshots from the video that the dive center made for us. Unfortunately, I was sick for my last two days on Koh Tao, so no snorkeling and sun-tanning for me. I was hoping to swim with the black-tip reef sharks, but I was too ill to leave my room. While I was resting, just me and half a dozen medications from the health clinic down the street, I finally saw the disadvantages of honja. It would have been nice to have a buddy to make sure I was okay! In order to return to Korea within the time frame that Fulbright allowed us, I had to travel from Koh Tao to Gimhae in one day. And when I say one day, it literally took a little more than 24 hours. I took a high-speed ferry from Koh Tao to Chumphon, a van to the Chumphon airport, a domestic flight to Bangkok, an international flight to Seoul, a subway to the Seoul train station, a high-speed train to Gupo (Busan), a subway to Gimhae, and a taxi home. I was still recovering from my illness, and I was exhausted when I finally arrived home. In retrospect, I probably should have planned my return trip a little better. But, to my host family’s relief, I came home in one piece and with a lot of pictures, stories, and souvenirs. Final Thoughts Traveling has not only exposed me to new people and cultures, but it has also forced me to think more deeply about Korea, the U.S., and my own place in the world. While in Korea, I am constantly aware of my American mannerisms, but going to Vietnam and Thailand reminded me of how many new mannerisms I have adopted in Korea. For the first few days of my trip, I found myself using habits like bowing in greeting, saying kamsahamnida rather than “thank you,” and using chopsticks even though I also had a fork. It was like I had to press a reset button in my mind to remember that I was not in Korea anymore and that I would have to adapt to my new surroundings. Though most of the places I visited were catered to tourists, I also tried to adapt to Vietnamese and Thai culture, whether it was using a phrase in their language or greeting a certain way. Now that I’m back in Korea, I have to adapt to bowing and kamsahamnida again. It’s like being a cultural chameleon. I also reflected on honja, what it meant to travel alone. Before graduating from Villanova, I had told a professor that I wanted to travel around Korea and to other countries, but was afraid to do it alone since I didn’t speak other languages. A lot has changed since then. I was “alone” in the sense that I didn’t have a specific traveling companion. But I wasn’t as alone as I expected to be. Just a short hiatus from Korea has reminded me that I am part of a broader international community. I met backpackers who were around my age or a little older, families, local people, students, seasoned travelers, and people traveling for the first time. I met fairly few Americans, though I met other English speakers from the UK, Australia and New Zealand. Almost everywhere I went, I met someone who I bonded with for a short period of time. I’ve always been shy, but I enjoyed meeting new people and talking about my experiences in Korea. The most fascinating part of my journey was that everyone I met had a story. It usually went like this: “I’m from (blank), but…” I’m from Slovenia, but I live in Portugal. I’m from LA, but I’ve worked in the Czech Republic for five years. I’m from the UK, but I teach English in Hanoi. I’m from the countryside, but I go to university in Saigon. I’m from Korea, but I moved to New Jersey after university. I found that in telling my own story–as an American living, teaching, and volunteering in Korea–I had a lot more self-confidence and better awareness of my own national and cultural identity. And the people I met genuinely thought my experiences were interesting! I hadn’t realized how much I have grown as a result of my time in Korea until I spent some time away. But now, I am back. My experiences over the last twenty-seven days have given me a much greater appreciation of my time in Korea and my life in the U.S. I recognize how fortunate I am to have had the opportunity to travel, to speak the world’s lingua franca, to live in a democratic country, and to learn more about countries that are so rarely talked about in my home country. As I look forward to my second semester as an ETA and to my return to the US over the summer, I intend to carry these experiences and this gratitude with me.
Q: Setting images in gridview to transparent So I have images in gridview. These images are shown in an activity. When one of the images is clicked, new activity is started with this image. In this activity, If user inputs correct answer, new activity is started that indicates the answer is correct. After user inputs correct answer, I want to set this image more transparent with a check mark in gridwiew. If the user clicks again to this correct view, I want to show same activity which indicates it was solved correct. How can I do that? Here is my activity which contains grid view: public class LogoSelectionActivity extends Activity { . . gridview.setOnItemClickListener(new OnItemClickListener() { public void onItemClick(AdapterView<?> parent, View v, int position, long id) { Intent intent = new Intent(LogoSelectionActivity.this, LogoActivity.class); intent.putExtra ("clicked_position", position); startActivity(intent); } Here is my activity where user enter inputs: public class LogoActivity extends Activity{ EditText text; Button check; Boolean a; int id; Names name; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_logo); check = (Button) findViewById(R.id.Check_button); text = (EditText) findViewById(R.id.editText1); ImageView view = (ImageView)findViewById(R.id.imageView1); final ImageView incorrect = (ImageView)findViewById(R.id.incorrect); switch (getIntent().getIntExtra ("clicked_position", -1)) { case 0: view.setImageResource(R.drawable.adese); id = R.drawable.adese; break; case 1: view.setImageResource(R.drawable.birvar); id = R.drawable.birvar; break; case 2: view.setImageResource(R.drawable.agaoglu); break; case 3: view.setImageResource(R.drawable.akinsoft); break; default: view.setImageResource(R.drawable.afra); id = R.drawable.afra; } name = Names.forDrawable(id); check.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { a=name.isCorrect(text.getText().toString()); if(a==true){ Intent intent = new Intent(LogoActivity.this, CorrectActivity.class); startActivity(intent); } else{ incorrect.setVisibility(0); incorrect.setVisibility(4); } } }); } } I hope I could explain my intention clearly. A: There are number of ways to do this. Because this is not problem this is functionality that you want in your project. According to my logic I am giving you one solution. Steps: Create one static array with the length of your items in grid view with default value is 0. static int[] items = {0,0,0,...}; Now check in getView methode of grid view with the value according to position in array that if it is 0 then it will looks like normal otherwise it will look with different (Here you want transparent with check box this will you get by adding one more image on it.) If(items[position] == 0){ }else{ } Now when user taps any image and navigate to other screen (Suppose Activity B) that time pass value of that position from that array and check in Activity B's OnCreate(). gridview.setOnItemClickListener(new OnItemClickListener() { public void onItemClick(AdapterView<?> parent, View v, int position, long id) { Intent intent = new Intent(LogoSelectionActivity.this, LogoActivity.class); intent.putExtra ("clicked_position", position); intent.putExtra ("answered_or_not", items[position]); startActivity(intent); } And if answered means if its value is 1 then show accordingly other wise as it is. And when it user give answer unanswered question make its value 1 in that array. I hope it will help you can ask if any question.
Case: 14-41403 Document: 00513078141 Page: 1 Date Filed: 06/15/2015 IN THE UNITED STATES COURT OF APPEALS FOR THE FIFTH CIRCUIT United States Court of Appeals No. 14-41403 Fifth Circuit FILED Summary Calendar June 15, 2015 Lyle W. Cayce ERIC D. MCCORVEY, Clerk Plaintiff-Appellee v. LVN ERNEST STYLES, Defendant-Appellant Appeal from the United States District Court for the Southern District of Texas USDC No. 3:12-CV-271 Before SMITH, WIENER, and ELROD, Circuit Judges. PER CURIAM:* Defendant-Appellant, Ernest Styles, a Licensed Vocational Nurse at a Texas Department of Criminal Justice (“TDCJ”) prison, filed this interlocutory appeal of the district court’s denial of his motion for summary judgment grounded in qualified immunity after Plaintiff-Appellee Eric McCorvey filed the instant Eighth Amendment action. McCorvey alleged that Styles was deliberately indifferent to his (McCorvey’s) serious medical needs which * Pursuant to 5TH CIR. R. 47.5, the court has determined that this opinion should not be published and is not precedent except under the limited circumstances set forth in 5TH CIR. R. 47.5.4. Case: 14-41403 Document: 00513078141 Page: 2 Date Filed: 06/15/2015 No. 14-41403 resulted from a sexual assault by a prison guard who was eventually convicted of improper sexual activity with McCorvey as a person in custody. We affirm. McCorvey was harassed, threatened, and eventually sexually assaulted by a prison guard while an inmate in a TDJC prison. After McCorvey reported the incident, an officer from the Office of Inspector General took McCorvey to the prison’s medical unit, identified him as the victim of a sexual assault, and expressly requested of Styles that McCorvey be examined, including application of an oral swab and a rape kit. Styles refused that request, making such excuses as (1) he did not know which provider was on call, (2) he did not know where the kits were located, and (3) he was not permitted to break the seal on a kit. None contests that Styles failed to contact a physician or other practitioner; refused to examine or evaluate McCorvey; did not obtain a history; and did not refer McCorvey to a mental health professional. Neither is it contested that Styles did not make a record of McCorvey’s visit until four days later. Despite McCorvey’s request for psychological treatment, Styles failed to respond, claiming there was nothing he could do. In sum, Styles refused to take any action whatsoever. As a result, McCorvey received neither a medical exam nor mental health treatment until he again requested assistance, this time from a different nurse who treated him and referred him to a mental health professional. In his §1983 complaint, McCorvey lodged an Eighth Amendment cruel and unusual punishment claim against Styles for affirmatively denying care and treatment, thus exhibiting deliberate indifference to McCorvey’s serious medical needs. Styles filed his motion seeking summary judgment dismissal on the basis of qualified immunity, which the district court eventually denied. It ruled that the summary judgment evidence supports the conclusions that Styles was told by an appropriate officer that McCorvey had been sexually assaulted; that 2 Case: 14-41403 Document: 00513078141 Page: 3 Date Filed: 06/15/2015 No. 14-41403 Styles nevertheless failed to follow TDCJ protocol for reported sexual assaults; that he did not administer the required procedures regarding sexual assault kits; and that – given McCorvey’s establishment of a violation of his clearly established Eighth Amendment right to be free from cruel and unusual punishment, viz, deliberate indifference to serious medical needs – Styles’s behavior was objectively unreasonable under clearly established law as well as under TDCJ policy. The district court denied Styles’s summary judgment motion, concluding that he had refused to treat McCorvey’s serious medical needs despite being aware of those needs. In our de novo review, we may affirm the grant or denial of summary judgment on any basis supported by the record. Even though, on appeal, Styles advances a litany of complaints of things that were not done and actions that were not taken, and even though Styles also claims that the district court erred in relying on contested facts, we are satisfied that – given the current stage of these proceedings and the status of the evidentiary record – the district court did not commit reversible error in refusing to dismiss the instant action on grounds of Styles’s qualified immunity, regardless of the court’s gratuitous reference to both disputed and undisputed facts. Accordingly, the district court’s order of November 20, 2014, denying summary judgment based on qualified immunity is AFFIRMED. 3
I just tested loading yesterday and it worked. I will start with tonight's info. Sorry about that. PL
Late Quaternary records of Najas spp. (Najadaceae) from the southwestern Baltic region. Seeds of the submerged vascular plants Najas marina, Najas minor and Najas flexilis are reported from submarine Holocene deposits from the southwestern part of the Baltic Sea, and we also report on a find of Najas minor from an Eemian deposit in Jutland, which is the first record of this species from the Eemian of Denmark. The common and widespread occurrence of especially the southern extralimital N. minor is indicative of higher than present summer temperatures during the period from 10300 to 8000cal.yearsBP.
Product Reviews Product Features HP Color LaserJet CB542A Yellow Print Cartridge It's simple. HP ink supplies are designed to provide incomparable performance and perfect compatibility to specific HP printers. The ink and printer go hand-in-hand, combining to deliver matchless HP quality, reliability and value. Years of expertise, research, and development means HP can match leading imaging technology in the printer to create professional-quality images ? simply and without complication (hassle-free!). And that's great value. (Using genuine HP supplies ensures that you?ll be able to take advantage of all of HP?s unique printing features.) Easier than ever?take advantage of the "Shop for Supplies" desktop icon and order through HP SureSupply to save time. More cost-effective than ever?print black pages for the same cost as your black-and-white laser, and you can print in color anytime. Avoid the wasted time and money of reprinting. Intelligence in the Original HP cartridge enables the system to optimize print quality and reliability. And to ensure consistent color, the entire system is tuned to the unique properties of HP ColorSphere toner.
software-center (16.01+16.04.20160107.1) xenial; urgency=medium [ Rodney Dawes ] * Convert back to a native package to enable CI train landing. * debian/patches: - All patches merged upstream. * Add saucy to the list of distro series. * Bump trunk version. * Check the pygobject version and use the right API signatures. * Don't derive from both object and something else, as it's needless. Use super().__init__() instead of direct parent.__init__() calls. * Don't use the main copy/cut menu items for search entry selections. Remove the main cut menu item as it was not used for anything else. * Fix some RuntimeWarnings about old-style classes. * Fix the version string to not be so high (no previous releases of it). * Merge the debian tree in for CI train landing support. added: debian/ debian/changelog debian/compat debian/control debian/copyright debian/rules debian/software-center.dirs debian/software-center.docs debian/software-center.links debian/software-center.manpages debian/software-center.postinst debian/software-center.postrm debian/software-center.triggers debian/source/ debian/source/format debian/source_software-center.py * Move the distro codename check to happen when we build the version.py file. * Multi-inherit from object as well, as RawConfigParser is old-style. Use super to chain up initialization. * Only add the launcher when the desktop file is not None. * Remove bad tests that depend on network. Fix pyflakes to only run on certain subdirs, and not everything in cwd. removed: tests/test_downloader.py * Remove extraneous empty po directory under po directory. Make setup.py executable. Include the license header in setup.py Bump the version of trunk to 5.7. Move some code around in setup.py to reduce duplication. Use setup from DistutilsExtra.auto instead of manually adding some commands. removed: po/po/ * Remove po/help completely for now, to avoid bug #1170108. Move the installed scripts to bin/ sub-directory. Move the gen-coverage- report script to utils. Update the run scripts for the scripts being moved to bin/. Don't keep the generated .pot files in bzr, and ignore them. Remvoe the AUTHORS file. Don't install the .in file for the channels. Note a couple TODOs in setup. Don't try to install the apport source file which doesn't exist now. removed: AUTHORS po/help/ po/help/am.po po/help/ar.po po/help/ast.po po/help/bn.po po/help/bs.po po/help/ca.po po/help/cs.po po/help/da.po po/help/de.po po/help/el.po po/help/en_AU.po po/help/en_GB.po po/help/eo.po po/help/es.po po/help/et.po po/help/eu.po po/help/fa.po po/help/fi.po po/help/fr.po po/help/gl.po po/help/gv.po po/help/he.po po/help/hi.po po/help/hr.po po/help/hu.po po/help/hy.po po/help/id.po po/help/is.po po/help/it.po po/help/ja.po po/help/jv.po po/help/kk.po po/help/kn.po po/help/ko.po po/help/lb.po po/help/lt.po po/help/lv.po po/help/mk.po po/help/ml.po po/help/ms.po po/help/nb.po po/help/ne.po po/help/nl.po po/help/nn.po po/help/oc.po po/help/pa.po po/help/pl.po po/help/po4a.conf po/help/pt.po po/help/pt_BR.po po/help/ro.po po/help/ru.po po/help/sk.po po/help/sl.po po/help/software-center-doc.pot po/help/sq.po po/help/sr.po po/help/sv.po po/help/te.po po/help/tr.po po/help/ug.po po/help/uk.po po/help/vi.po po/help/zh_CN.po po/help/zh_HK.po po/help/zh_TW.po po/software- center.pot added: bin/ renamed: gen-coverage-report.sh => utils/gen- coverage-report.sh software-center => bin/software-center software- center-dbus => bin/software-center-dbus software-center-qml => bin/software-center-qml software-center-sso-gtk => bin/software- center-sso-gtk (LP: #1170108) * Remove the about box credits list to simplify UI and build system. Update the copyright year in the about box. * Remove the old gtk+ based SSO UI, and rely on the system library and UI. Use the "Ubuntu One" token for authenticating to the server now. removed: bin/software-center-sso-gtk softwarecenter/sso/ softwarecenter/sso/__init__.py softwarecenter/sso/gui.py softwarecenter/sso/tests/ softwarecenter/sso/tests/__init__.py softwarecenter/sso/tests/test_gui.py * Remove the unbranded .desktop file, to avoid unnecessary duplication. Remove the softwarecenter/version.py and ignore it, to avoid useless conflicts. removed: data/unbranded-software- center.desktop.in softwarecenter/version.py * Remove usage of DISTROSERIES list, as it is unsustainable. * Run setup.py build before the tests, and clean after the tests. * Stop being a native package. removed: .bzr-builddeb/ .bzr- builddeb/default.conf daily-build.recipe debian/ debian/README.source debian/TODO debian/changelog debian/compat debian/control debian/copyright debian/rules debian/software- center.dirs debian/software-center.docs debian/software-center.links debian/software-center.manpages debian/software-center.postinst debian/software-center.postrm debian/software-center.triggers debian/source_software-center.py debian/tests/ debian/tests/control debian/tests/run-tests * VERSION must be a str not float. * [r=dobey] Globally define a couple of variables needed for setup Remove unused imports [ Barry Warsaw ] * Fix some bilingual Python 2/3 issues so plug-ins can work in both versions. * Fixes a missing import with --measure-startup-time [ Bruce Pieterse ] * Added support for Adwaita Dark Theme Variant. added: data/ui/gtk3/css/softwarecenter.adwaita-dark.css * Update README to mentione python3-aptdaemon.test instead. [ Dimitri John Ledkov ] * Remove extras channel support. removed: data/channels/ data/channels/Ubuntu/ data/channels/Ubuntu/ubuntu-extras.eula data/channels/Ubuntu/ubuntu-extras.list.in [ Dmitrijs Ledkovs ] * Add missing GLib import. [ Iain Lane ] * Add a style class for the action bar. * Disable some tests and fix up some others to get them in a passing state. renamed: tests/gtk3/test_catview.py => tests/gtk3/disabled_test_catview.py tests/test_config.py => tests/disabled_test_config.py tests/test_dataprovider.py => tests/disabled_test_dataprovider.py tests/test_description_norm.py => tests/disabled_test_description_norm.py tests/test_pep8.py => tests/disabled_test_pep8.py tests/test_where_is_it.py => tests/disabled_test_where_is_it.py * Disable some tests and fix up some others to get them in a passing state. renamed: tests/gtk3/test_catview.py => tests/gtk3/disabled_test_catview.py tests/test_config.py => tests/disabled_test_config.py tests/test_dataprovider.py => tests/disabled_test_dataprovider.py tests/test_description_norm.py => tests/disabled_test_description_norm.py tests/test_pep8.py => tests/disabled_test_pep8.py tests/test_where_is_it.py => tests/disabled_test_where_is_it.py * Don't use super() when not using a "new-style" class (not derived from object) Don't free IconViews Update a test which uses live archive data to be consistent with reality test_xapian: Make the directory to hold the index if we need to * Open cataloged_times.p as bytes for py3 compatibility. [ James Henstridge ] * Include unity-scope-* packages in the list of dash search plugins. added: tests/data/desktop/music-banshee.scope [ Jeremy Bicha ] * Adjust help for new yelp system. Drop obsolete link to alacarte help. removed: help/C/software-center-C.omf renamed: help/C/software-center.xml => help/C/index.docbook [ Marco Trevisan (Treviño) ] * AvailablePane: log zeitgeist events on application installation / uninstallation added: softwarecenter/backend/zeitgeist_logger.py tests/gtk3/test_zeitgeist_logger_gui.py tests/test_zeitgeist_logger.py [ Martin Pitt ] * Stop using deprecated GObject constructors with positional arguments. [ Matthew McGowan ] * Fixes some rendering issues in the lobby grid views and container headers. Tweaks grid columns so they render to the very bottom extent of the container. [ Michael Vogt ] * Avoid a crash when the aptdaemon transaction has no package data. * Disable paste when search entry not visible. * Don't require network access for installing local .deb packages. * Fix missing init_locale() (LP: #1171163) (LP: #1171163) * Improve Unity launcher integration. added: tests/test_unity_launcher.py renamed: tests/gtk3/test_unity_launcher_integration.py => tests/gtk3/test_unity_launcher_integration_gui.py * [r=dobey] Use python-debian to gather information from the changelog instead of regex. Remove no longer used PocketLint. [ Nicolò Zilio ] * Fix some runtime errors with new pygobject. [ Robert Ancell ] * Initialize attribute to None in case the network changes state before configure() is called and this attribute is accessed. [ Robert Roth ] * Remove foo tooltip from sso login and forgot password button. (LP: #1076189) (LP: #1076189) [ Sebastien Bacher ] * Clear some source ID warnings. * DB_NOMMAP needs to be set using set_flags, it's not valid in DBEnv.open * Remove gwibber usage. removed: softwarecenter/gwibber_helper.py tests/test_gwibber.py * Remove use of deprecated n_row property. * Restore the GtkStyle context in the button widget. * Updated icons from Canonical Design Team. * Use GtkIcon's lookup_icon method instead of has_icon to fix invalid icons. [ Sv. Lockal ] * Fix UnicodeDecodeError for localized category names. [ <email address hidden> ] * Fix handling of whitelisted applications. (LP: #1112774) (LP: #1112774) -- Rodney Dawes <email address hidden> Thu, 07 Jan 2016 19:05:15 +0000
A substantial number of licensed professionals such as physicians and lawyers experience addictive behaviors and other behavioral health crises. The interventions and best practices that are in place to ensure their care, treatment and recovery are facing growing scrutiny. Virtually every state jurisdiction offers interventions for individuals who come forward for help rather than face licensure board sanctions. Usually, volunteer or not-for-profit entities formed by concerned licensure boards regulate the programs that help impaired healthcare professionals and members of bar associations move toward the safe return to their profession, meeting the public's expectations that these individuals have been vetted as safe. The trend has been to keep professionals' treatment, as protected health information, out of the public eye. Yet there can be both positive and detrimental effects of this for the public and for the affected individuals. Before we go on, try to answer the following tough questions about your perception of impaired licensed professionals: * What would be your confidence level in an impaired professional returning to practice and working with your loved one? * Do you believe an impaired professional can return to higher levels of professionalism after treatment? * Do you believe impaired professionals' addiction ought to be made public in their profiles? * Is there such a thing as "too much addiction" to be able to return to the profession? How we answer these questions can be the proverbial elephant in the room. The onset of impairment in these valued professionals might require a "time out" to assess their health and their ability to meet the standards of their profession. When the need for lengthy interventions arises, adjudications result in the affected professional receiving proper guidance toward treatment and recovery. Usually the public will never know if, and to what degree, the professional has been affected by impairment and recovery. Recognition of a professional's impairment is not made public unless significant board action on his/her license has occurred. The public's trust also can be compromised by a lack of consistency among states' professional boards as to what constitutes best practices for the identification, treatment and monitoring of professionals' health issues, as well as treatment providers' willingness to agree with measurable treatment expectations. Provisions governing interventions, the treatment plan, length of treatment, frequency of screening for relapse, and conditions requiring extended treatment are not uniform. Varying requirements for post-treatment monitoring of recovering professionals constitute one major source of concern. Usually, participants must call or check in online daily to see if they have been chosen to undergo a drug screen before 5 p.m. that day. While the number of tests varies by jurisdiction and program, we know that the average recovering nurse in the United States spends $10,000 a year meeting the drug screen requirement. There is something fundamentally wrong with a nurse being charged an average of $70 for the test with a $20 draw fee, especially when a test to run a 12-panel urine drug screen costs a lab around $8 to process. Nurses simply can't afford those prices. Oftentimes they simply leave the profession rather than bear these costs. Something must happen soon to standardize practices, profession by profession. Given ongoing moves in Congress and the professional community to encourage licensure portability from state to state in the healthcare and legal professions, it is in the best interest of healthcare boards and state bar associations to advocate consistent national standards for addiction identification, treatment and disease management. Association efforts Enter the newly formed American Academy of Professionals Health Programs (AAPHP) as a facilitator of collaboration between state jurisdictional entities and those providing the treatment. AAPHP came into existence Jan. 1, 2016, as an initiative to seek collaboration between healthcare recovery programs and lawyer assistance programs. It seeks to gain those entities' support in developing standards toward national best practices and an outcomes-focused approach to disease management for licensed professionals. Eventually, other scrutinized professionals will be included as the initiative matures. Among the areas it is researching, AAPHP is examining practices of chronic pain management for affected healthcare professionals. It also has had discussions with the Department of Defense for returning military healthcare professionals whose addictions developed while the individuals were deployed in combat situations. Military adjudication of addictions, often considered as a disciplinary or even criminal matter, is radically different from civilian perception of addiction as disease management. AAPHP seeks to address the disparagement of these licensed professionals returning stateside to become reaccredited with healthcare boards, insurance payers and credentialing entities. AAPHP is in the process of surveying jurisdictional requirements for professional health programs, while at the same time seeking to contact each state's program to understand their expectations for treatment at various levels of care. The association is forming a professional standards committee and credentialing committee of esteemed academic, regulatory and treatment professionals who have demonstrated a commitment to best practices through years of service with state recovery programs. Another major challenge involves the lack of beds within treatment centers to begin the recovery process for newly affected professionals. AAPHP has identified growth opportunities for treatment centers and professionals to become accredited in treating professionals with addictions. AAPHP has a strategic alliance with SyMedica, a CEU provider credentialed by the Florida Division of Medical Quality Assurance, which has a growing library of online and live training programs to assist treatment center staff and independent licensed professionals who treat impaired professionals. Treating professionals also have the opportunity for accreditation as diplomate or clinical members of AAPHP as well, offering professional health programs an added layer of provider accountability. AAPHP is planning its inaugural Congress of state recovery program professionals, treatment center professionals and licensed recovery professionals for the first quarter of 2017. Seeking collaborators AAPHP is looking for collaboration with an academic program in a university setting (in a department of public health or medicine) to be a home for academic research and development of best practices. AAPHP also needs the expertise of seasoned providers in the area of treating recovering professionals. We would be delighted to explore ways to involve your state recovery program, hospital system or treatment center. Any profits of AAPHP are designated proportionally to the Caduceus Recovery Foundation or the Juris Recovery Foundation, both of which are not-for-profit foundations established to provide treatment assistance for deserving but financially impoverished impaired professionals. Florida program earns the first accreditation The American Academy of Professionals Health Programs (AAPHP) has announced its first Diplomate Accredited Treatment Program. The Advanced Recovery Systems program is under the direction of Orlando Recovery Center medical director Timothy Huckaby, MD, who also serves as president of the Florida Society of Addiction Medicine. Advanced Recovery Systems' dedicated and structured Professionals Program serves both healthcare and legal professionals in need of treatment at the organization's Orlando inpatient and outpatient facilities. The treatment organization's Ryan Chu has been certified by AAPHP as a Professionals Program Admissions Professional. Bob Coates, MDiv, LMFT, is Executive Director of the American Academy of Professionals Flealth Programs (AAPHP). Laura Pulido, MSN, ARNP-BC, is a practicing Advanced Nurse Practitioner with more than 10 years of experience In developing regulatory-specific pain management options for licensed professionals. Dlno Eliadis, MBA, provides AAPHP with day-to-day strategic growth planning and operational oversight. Information on AAPHP is available by calling (800) 375-1859, or e-mailing [email protected]. COPYRIGHT 2016 Vendome Group LLC No portion of this article can be reproduced without the express written permission from the copyright holder.
Any award and gift item on our website makes a special employee recognition award; however, we have assembled some of the more popular recognition award products in our employee awards category, to help you in your product choices. If you don't see what you are looking for, you will surely find something in our other categories. The Sunridge Rectangle is an elegant piece of optical crystal in a rectangle shape that has ample space to include a customized message and image. The gift is affixed to a lovely black glass base and is available in three sizes. Our unique Surfs Up acrylic award features a wave inspired design with bull-nosed steps. Available in your choice of blue, red, green, gold or purple reflective bottoms. Available in twos sizes. Surf's up dude! A flowing fan beveled design makes the Swirl fan acrylic award stand out! It's unique design and true beauty would make a perfect accolade for any occasion! Available in your choice of blue, red, green, gold or purple reflective bottom. Available in two sizes! The grandness of marble will give elegance to your book collection with these tapered bookends. Beautiful and dynamic, this award is available in Black Zebra, Jet Black, Swirl Amber Onyx, and Jade Leaf Green Marble. Black Zebra is a black marble with prominent white veining. Jet Black is as black as natural marble can get with occaisional dark grey veining and small white specks. Swirl Amber Onyx features swirls of oranges, reds, and yellows, combined to present a beautiful amber color. Jade Leaf Green captures a spectrum of beautiful shades of green.
Industrial plants, agricultural installations, hospitals, kitchens, etc. that handle large quantities of organic material such as hog farms, dairy farms, chicken farms, meat packing plants, animal rendering plants, composting plants, paper mills, sewage treatment plants and other similar installations can generate large quantities of odors that typically exit the facility in an odor contaminated atmospheric effluent flume or other effluents. Such an effluent can contain a large variety of odoriferous or odor causing inorganic and organic chemicals or molecules including organic sulfides or organic thiols (mercaptans), monoamines, diamines, triamines, ammonia, alcohols, formaldehyde, acetaldehyde, carboxylic acids, skatole, carbon disulfide and hydrogen sulfide and other odor forming oxidizable compounds. An atmospheric effluent having one or more of such compounds can have a strong odor and can be highly objectionable within the plant to plant personnel and outside the plant to plant neighbors. An odor is a gas phase emission that produces an olfactory stimulus. The odor thresholds of many chemicals that act as odor compositions common throughout the chemical process industries include, for example, ethyl sulfide having an odor threshold in the atmosphere of 0.25 ppb, hydrogen sulfide with an odor threshold of 0.4 ppb, dimethyl sulfide with an odor threshold of 1.0 ppb, ethyl mercaptan with an odor threshold of 1.0 ppb, methyl mercaptan with an odor threshold of 1.1 ppb. With a low threshold a small amount of these and similar odors common in plant effluent are serious olfactory problems. Such odors result from processing large quantities of organic materials and are generated by the action of micro-organisms in any biologically active system on a source of organic material producing the odors. There are many other odor producing chemicals possible, however, as shown in this representative, non-inclusive list: 1. Sulfur compounds Hydrogen Sulfide Thiophene Carbonyl Sulfide Isobutyl Mercaptan Methyl Mercaptan Diethyl Sulfide Ethyl Mercaptan n-Butyl Mercaptan Dimethyl Sulfide Dimethyl Disulfide Carbon Disulfide 3-Methylthiophene Isopropyl Mercaptan Tetrahydrothiophene tert-Butyl Mercaptan 2, 5-Dimethylthiophene n-Propyl Mercaptan 2-Ethylthiophene Ethyl Methyl Sulfide Diethyl Disulfide 2. Organic nitrogen compounds Primary amines secondary amines tertiary amines pyridines amides ammonia 3. Organic oxygen compounds (oxo-hydrocarbon compounds) primary alcohols carboxylic acids aldehydes ketone compounds phenolics Attempts have been made to reduce the production of the odor compounds and to reduce the release of the odor compounds from plants. Robinson, "Develop a Nose for Odor Control", Chemical Engineering News, October 1993 contains a generic disclosure of odor problems and conventional odor control using aqueous treatment compositions including H.sub.2 O.sub.2, FeCl.sub.3, KMnO.sub.4, NaOH and others. Careful control over the organic materials within the plant and reduction of microbial populations within the plant have been attempted to reduce the generation of the odor compounds in the plant atmosphere. Attempts to scrub the odor compounds from the plant atmosphere have been made using a variety of simple absorptive and oxidizing scrubbing materials with standard particle size atomized or finely divided aqueous particulate. Fragrance chemicals that simply mask the offensive odors have been tried. Sodium hydroxide (NaOH), activated carbon are useful absorptives. Oxidizing materials such as ozone (O.sub.3), chlorine dioxide (ClO.sub.2), sodium hypochlorite (NaClO) and others have been attempted. Some degree of success has been achieved using these oxidative materials to remove organic odor molecules from atmospheric effluents. While chlorine dioxide has had some success, chlorine dioxide is highly toxic, difficult to handle and must be generated on site. Such difficulties lead to substantial resistance to its use. Further hydrogen peroxide is also known for odor control. Hydrogen peroxide by itself is not effective against a broad range of odor constituents without additional treatment materials. However, the application of oxidative technologies including ozone, hydrogen peroxide, chlorine dioxide and other oxidants have had some limited success. The use of peroxyacid materials in microbiological methods are also known. For example, Grosse-Bowing et al., U.S. Pat. Nos. 4,051,058 and 4,051,059 disclose peroxyacetic containing antimicrobial compositions. Stas et al., U.S. Pat. Nos. 4,443,342 and 4,595,577 disclose the treatment of waste water and waste gases containing dialkyldisulfides by metal catalytic oxidation of these compounds by means of a peroxide compound in an aqueous medium. Lokkesmoe, U.S. Pat. No. 5,409,713 teaches peroxyacetic materials as microorganism sanitizers or growth inhibitors in aqueous transport systems typically containing produce and large amounts of challenged soil load. Fraser, in "Peroxygens in environmental protection", Effluent and Water Treatment Journal, June 1986 disclose that hydrogen peroxide (H.sub.2 O.sub.2) can be used to reduce odor. Fraser only discusses microbial control with peroxyacetic acid and does not correlate odor control to peroxy acid treatment or concentration. Littlejohn et al., "Removal of NO.sub.x and SO.sub.2 from Flue Gas by Peroxy acid Solutions", Ind. Eng. Chem. Res. Vol. 29, No. 7, pp. 1420-1424 (1990) disclose peroxyacids in removing nitric oxides and sulfur dioxide from coal fire derived flue gas. Peroxyacetic acid, neat and in aqueous solution, has a strong pungent oxidizing odor resembling but stronger than acetic acid. Such materials have not been seriously considered as odor reducing materials because of the nature of its odor. The concern being that in any treatment process using a significant amount of peroxyacetic acid, the resulting treated effluent would inherently obtain the pungent odor of the peroxyacetic acid. Further, peroxyacetic acid solution inherently contain large amounts of acetic acid (HOAc). In adsorption technology, increasing surface area equates to an increase in contact surface, thereby improving adsorption performance. Because surface area is an important criteria, there have been attempts to use fogged or atomized aqueous solutions in odor control. For example, Murray et al., U.S. Pat. No. 4,994,245, discloses the use of atomized sulfuric acid and surfactant, followed by bleach and hydrogen peroxide treatments for odor reduction. Morrison, U.S. Pat. No. 4,708,855, uses a finely divided alkali mist to reduce airborne odors in a cement plant.
Perspectives and limits of engineering the isoprenoid metabolism in heterologous hosts. Terpenoids belong to the largest class of natural compounds and are produced in all living organisms. The isoprenoid skeleton is based on assembling of C5 building blocks, but the biosynthesis of a great variety of terpenoids ranging from monoterpenoids to polyterpenoids is not fully understood today. Terpenoids play a fundamental role in human nutrition, cosmetics, and medicine. In the past 10 years, many metabolic engineering efforts have been undertaken in plants but also in microorganisms to improve the production of various terpenoids like artemisinin and paclitaxel. Recently, inverse metabolic engineering and combinatorial biosynthesis as main strategies in synthetic biology have been applied to produce high-cost natural products like artemisinin and paclitaxel in heterologous microorganisms. This review describes the recent progresses made in metabolic engineering of the terpenoid pathway with particular focus on fundamental aspects of host selection, vector design, and system biotechnology.
A 45 minute speedpaint! Also please consider You will get to see all drawings at least 24 hours early plus awesome rewards!
City Rankings: More Harm Than Help? by George Carothers We could blame it on our competitive nature, but it is widely known that we enjoy hearing about how the places and things that we love hold up against the places and things of “others.” We are surrounded by rankings in almost every field of life: schools and universities compete for the highest spots in national and international league tables, employers try to establish themselves as the “most socially minded,” and countries are ranked by their ability to provide citizens with “human development.” Some of the most popular rankings are those of cities, which aim to establish which cities are the most economically competitive, the most livable, and the most creative places in the world. Scholars have worked tirelessly towards a science of ranking cities in various ways, none of which have proven to be very useful to anyone other than those attempting to profit from the image of ranking near the top. The regurgitated notion that New York, London, and Tokyo sit comfortably at the peak of the “global city” hierarchy has little bearing on the activities of the street cleaners, shop owners, artists, and residents who populate these places. Or does it? Recent research has shown that competition among cities has led to an increase in disparities, as major businesses flock to the cities deemed to be more competitive. The subsequent brain drain caused by an exodus of skilled labor can wreak havoc on a city that is struggling to build a stable a economy with an attractive image. Likewise, the levels of social polarization within these “global cities” is troubling, as the growing gap between the rich and the poor — which could once be defined as the difference between London and Mumbai — can now be found between the boroughs of Chelsea and Tower Hamlets. How can a place that is so fragmented be situated at the top of the “world city” order? The current issue of Monocle magazine (which offers perspective on global affairs, business, culture, and design) ranks cities on “quality of life.” While the criteria used are intriguing to the aspiring urbanite, I still struggle to find the value in placing 25 of the “world’s best cities” on a scale from Helsinki to Seattle. What does it all mean? And why does it matter? Since my native Toronto hasn’t made the cut, does that render it “unlivable?” Should the people of New York, which also failed to make the ranking, consider relocating to the more “livable” Hong Kong? What we are presented with is the familiar story of “the ranked”: If someone has to win, then someone also has to lose. I would argue that presenting an arrangement of winners and losers is not particularly useful when we talk about improving the conditions of our cities. In previous posts, Andrew Wade and I have referred to the work of Ananya Roy and Jennifer Robinson, who have both played an instrumental role in contesting the usefulness of rankings. But while scholarship may be turning away from “global cities,” the cities themselves have bought into the nonsensical rhetoric. Why should Mumbai feel the need to compete with the “world-classness” of Shanghai? Ultimately, one of the two has to lose. Neither of them will be better off for it in the end.
Huge tunnel boring machine arrives in Seattle Share this story »Play VideoBertha, the tunnel boring machine that will churn under the Seattle waterfront and create the new state Route 99, arrives in Elliott Bay on Tuesday, April 2, 2013. (Photo: Joshua Trujillo, Seattlepi.com) Story Photos The $80 million machine called Bertha was built at a factory in Osaka and is currently aboard the 472-foot Jumbo Fairpartner. The ship entered the Strait of Juan de Fuca early Tuesday morning and then was greeted into Elliott Bay by a fire boat spraying water. After being unloaded at Terminal 46, the drilling machine will be reassembled in a pit near the waterfront to begin the year-long dig to create a two-mile tunnel under downtown Seattle. The new section of Highway 99 replacing the Alaskan Way Viaduct will have a diameter of nearly 58 feet and is scheduled to open in late 2015. The tunnel boring machine was named Bertha in honor of Bertha Knight Landes, who was elected mayor of Seattle in 1926. The name was submitted by both a second-grade student at Lincoln Elementary School in Hoquiam and a fifth-grade class at Poulsbo Elementary School.
It’s time for the run-bike-run to take centre stage in Spain this weekend, at the 2011 ITU Gijon Duathlon World Championships. The elite men’s and women’s world duathlon championships have attracted big fields, but this Spanish coastal city will also host the junior, U23 men’s and women’s races, age-group sprint and regular distance, as well as an elite paraduathlon in an action-packed weekend. The elite men’s and women’s titles will be decided in Gijon over a 10km run, 40km bike leg and then a 5km run. The elite mixed team relay will be run across parts of the elite course, but with each athlete completing a 2km run, 7.6km bike leg and then a 1km sprint before tagging the next athlete. The course has a few hills and technical turns in the bike lap, which is sure to make things interesting as the world’s best duathletes battle it out. Elite Women’s PreviewCatriona Morrison has dominated duathlon in recent years, but in 2011 it’s time for a new woman to step on top of the podium in Gijon. With Morrison not on the start, instead it’s time to look at athletes like current European Champion Sandra Levenez from France. Levenez finished second Morrison last year and second to Vendula Frintova (CZE) the year before, but won this year’s European title in Limerick and will wear the No.1 in Gijon. Elite Men’s Preview With the late withdrawal of 2-time ITU Triathlon World Champion Javier Gomez and with Bart Aernouts (BEL) not back to defend his world championship, the top spot on the podium is up for grabs. Spain’s top hope is likely Victor Manuel Del Corral Morales – a multisport specialist. He finished fourth in last year’s duathlon world championships, second in this year’s European duathlon titles and won the European Cross Triathlon title. Even with the home crowd support, he’ll be in tough with reigning European champion Benoit Nicholas (FRA) eyeing the championship. Nicholas will be making his Duathlon world championships debut in Gijon this Saturday. Belgium will still be well represented with Rob Woestenborghs in the field. He’s tasted victory in this event before, taking the Duathlon world title in 2008 in Rimini, Italy. Woestenborghs was also runner-up last year in Edinburgh and will be targeting a fourth podium finish at the Duathlon world championships. Another to watch is Sergio Silva of Portugal, he’s finished in the top-5 in the world championships four times previously, including a bronze at the 2007 championships in Gyor, Hungary. In a big field of 56, it’s Mexico’s Ramos Herrera who will wear No.1. The current Pan American champ finished seventh at last year’s duathlon worlds. Japan and the USA have both sent big teams of six athletes, while Spain has the most athletes in the men’s race with seven. The 2011 Gijon ITU Duathlon World Championships get underway when the women’s elite and U23 field starts at 11.45 (local time) on September 24, followed by the men’s elite and U23 start at 14.45. The elite mixed team relay is on Sunday September 25 at 15.00 (local time). Click here for live coverage from Gijon, Spain. Check www.triathlon.org for photo galleries, results and full recaps after the races.
class RemoveCreatedAtUpdatedAtFromForums < ActiveRecord::Migration def self.up remove_column :forums, :created_at remove_column :forums, :updated_at end def self.down add_column :forums, :created_at, :datetime add_column :forums, :updated_at, :datetime end end
Q: Unix script getting users with UID bigger than 500 I am trying to write UNIX script which takes all users and prints only these, who has UID bigger than 500. I wrote this line cut -d : -f 1-3 /etc/passwd but now I have no idea how to finish it. If you have an example please share it with me. A: Using awk: $ awk -F: '{if ($3 >= 500) { print $1 ":" $3 } }' /etc/passwd nobody:65534 falsetru:1000
Latest 15 Reader Comments You have left a few story lines dangling which would be good to see finished at least... - Ange getting to experience a proper caning - The fivesome with Todd, Trudi, Dana, & Ange - What happened to the other original members of the club, and the video history of Dana's with the interviews -Maybe even another reunion of family members and past performers at Dana's the erotic part is sincerely lacking, I found this thru a gay search, and was deeply disappointed, but I did read it all and enjoyed it anyway. It could have been deeply improved with more suspenseful sex This has got to be one of the, if not THE, finest story series' in Literotica. I'm glad I managed to get through all 42 chapters with my body parts intact. Raw, but intact! Honestly, this one of those multi-chapter stories where one didn't want to skip anything to get to the "good parts". The dialog was quick, the plot line was intriguing, the twists and turns were great. Above all, at least one of my major fantasies, that of having more than one woman to deeply love, make love to and sleep with as one big happy "family" was awesome. I guess James' real life passions came through. Among the various questions I have, here are some: 1. Are you really living this life? 2. How is your health now? I hope you're feeling better. No, sincerely, not for the obvious selfish reasons of wanting to read more in this story. 3. I think it would be a great idea for you to be paid for, quite honestly, unbelievably great stuff that you've written over the years in this story. Are you still contemplating that option? 4. As much as I'd like to know what happens with Mike and Jill and the girls' background, please answer one more question. Are you going to write about what Dawn and James did with the lawyers regarding the girls??? The suspense is killing me. 5. Are you a real-life psychologist? If you are, then I have some serious problems that I'd like to discuss :) !!!! Bob, I could say that I know what you are going through, but even though I had Colon Cancer I do not know what you are going through. I was lucky by having a great Surgeon that got all of my cancer the first time, which meant no Chemo or radiation. Hang in there and do as your Doctors & Nurses tell you to do. I have really enjoyed all of your stories and looking forward for when you are able to submit your next chapter. LOVE hearing the continuing tales of these good friends! We play with some of our best high school friends to this day here. This series always brings back such good memories! This lady really knows how to write a HOT sex scene! Ariesgirl it may seem like that but this is different she had actually fallen in love on her human side but her wolf side has established a mate in lucien and this is tecnically not cheating because werewolves actually have almost 2 people in them their wolf and their human good to know you are not retiring and leaving us hanging. understand being stressed as lost the love of my life after 60 years. consider arobics and a weight routine for and hour and half three times a week. does wonders for the mind and body and mine are old. ha. the lose and stress wlll always be there but use the excerise to help cannel it. I even have a dammit doll. I really hate when the person that is cheating says they don't want to hurt the person they are in a relationship with but cheat anyway. Vera need to stop feeling sorry for her selfish self and make a decision.
Former U.S. Vice President Al Gore has branded British politicians “cowards” for failing to push their voters into a re-run of the 2016 referendum on Britain’s membership of the European Union. Speaking at the Climate Change Leadership summit in Porto, Portugal, the 70-year-old Democrat took aim at the (in)famous “Breaking Point” poster unveiled by Brexit campaign leader Nigel Farage at the height of the campaign, showing a huge column of illegal migrants pouring through the continent’s borders in late 2015. “One of the most powerful posters in the ‘Brexit’ campaign was one that showed an endless line of refugees saying, ‘The EU failed’,” Gore told his hosts — although, in fact, the legend read “The EU has failed us all”. “I do not want to get into the issue, but as a politician I will say that I think politicians of the United Kingdom are cowards for not allowing a second referendum,” he declared, suggesting that many migrants — many of whom turned out to be violent criminals or even radical Islamic terrorists — are fleeing climate change. The multi-millionaire did not press the issue, of Brexit, however, explaining: “I have enough problems in my country, with the crazy Trump.” 'BREAKING POINT': UKIP Launches 'Largest National Ad Campaign' On Immigration https://t.co/IzvPWo8T6w pic.twitter.com/w3eLdf0OJP — Breitbart London (@BreitbartLondon) June 16, 2016 Brussels and its supporters have form on subverting referendums which do not go in their favour, pushing through re-runs of Denmark’s referendum on the Maastricht Treaty which transformed the European Community into the European Union in 1992, and Ireland’s referendum on the Nice Treaty increased the bloc’s powers over its member-states in 2001. Referendums rejecting the proposed European Constitution in the Netherlands and France were worked around by repackaging it as the so-called Reform Treaty, or Lisbon Treaty, amending the previous Maastricht Treaty and Treaty of Rome — and not putting it to the public in either country this time. Lisbon was subject to a referendum in Ireland, where the constitution required a public vote to authorise any transfer of sovereignty to outside forces, and was rejected by the Irish people — but, as with Nice, they were simply made to vote again. Most recently, a Dutch referendum rejecting the EU-Ukraine Association Agreement and a Greek referendum against punishing bailout measures agreed by a previous agreement were simply ignored. Al Gore Declares Climate War on Donald Trump https://t.co/aHBxtP60eM pic.twitter.com/Wr1OJc7jaX — Breitbart London (@BreitbartLondon) October 6, 2016 The former Bill Clinton running mate’s intervention will buoy the spirits for EU loyalists in the British parliament who are, in fact, pushing for the people to be made to vote again on the EU as he desires. Both the left-wing Labour opposition and the “Independent Group” of centrist-globalists who have broken away from Labour and the governing Conservative Party have thrown their weight behind a second referendum — despite having stood on election manifestos promising to deliver Brexit in 2017 — along with the Liberal Democrats. Kiss of Death: Tony Blair Gives Anti-Brexit Rebel MPs, Second Referendum Stamp of Approval https://t.co/tYHXe1ZzqF — Breitbart London (@BreitbartLondon) March 4, 2019 Follow Jack Montgomery on Twitter: @JackBMontgomery
Canadian College Canadian College is a private college in Vancouver, British Columbia, Canada. School information School Environment: Downtown Building: Private college in Vancouver Downtown with 5-floors and 30 classrooms in total. Member of: PCTIA, FITT, AH&LA American Hotel & Lodging Association Staff and Advisors: 15 full-time (some of the languages covered: Spanish, Portuguese, Italian, French, Japanese, Korean, Chinese, Arabic, Polish, Russian, German, Turkish, etc.) Teachers: 5 full-time Facilities Computer Labs: Less than 10 computers. (All old Intel Core 2 duo laptops) Other Facilities: Rooftop garden patio on 5th floor. Student Restaurant & Pub "eh! restaurant". Lunch & Rest areas throughout the school, Big Screen TV, Microwaves, Public Phones, Student Counselling Room, and Wheelchair friendly access. Nearby Facilities: Coffee/Light Snack Shops; Convenience Stores; Indoor Gym/Sports Facilities; Restaurants; Drug Store; Gift Shops; Park; Beaches; Hotels and Residences. Program information Courses: Business Management Diploma Co-op, International Trade Diploma Co-op, Hospitality Management Diploma Co-op, Project Management Diploma Co-op, Information Technology Diploma Co-op. Admission Requirements: High School Diploma, High School Completion Certificate, or equivalent. TOEFL 530, iBT 70, or IELTS 5.5 or TOEIC 750. Number of students per class: MIN(8); MAX(15); AVE(13) This program is not recognized by province as a DESIGNATED LEARNING INSTITUTION. This private College doesn't make you eligible for a post – graduation work permit. External links Canadian College Official Website PCTIA registered programs CCBST College Official Website Category:Universities and colleges in British Columbia
1. Field of The Invention The invention particularly concerns a novel, highly efficient and practical drive mechanism for the front end processing cylinders, roll pairs and the like of the card. 2. Background Information In a typical card, a web or lap is processed in a carding operation to produce a sliver for subsequent processing into textile yarn. The lap is generally in the form of a web of textile material wound on a lap pin which is supported on the card for unwinding and feeding to a main cylinder where it is carded. The textile material is removed from the carding cylinder by a doffer cylinder which rotates closely adjacent the carding cylinder on the end opposite the lap roll. The doffer cylinder is normally driven by a take-off from the main drive of the carding cylinder through a production gear. The production gear is engaged and disengaged with a ring gear mounted on the shaft of the doffer cylinder by means of raising and lowering a drop lever on which the production gear is carried. Other drive arrangements are also utilized. The lap roll is normally driven by a take-off from the doffer cylinder. The web of textile material removed by the doffer cylinder is subsequently drawn therefrom and progressively passed through crush-rolls and calendar-rolls and condensed into a sliver which is deposited into a coiler can for transportation and further processing. It is important that a uniform weight and quality of sliver be deposited in the coiling can. 3. Discussion Of Prior Art The front end of the card typically comprises the doffer cylinder, crush-rolls and calendar-rolls which are usually driven separately from the carding cylinder and which are drivingly interconnected by a complex series of gears, sprockets and chains as shown in U.S. Pat. Nos. 3,965,401 and 4,027,358, the disclosures of which relating to the general structure and operation of cards are incorporated herein by reference. Such prior, near solid hook-up driving mechanisms between the doffer, crush-rolls and calendar-rolls requires, of course, nearly constant lubrication and wear maintenance, and is quite costly to repair or replace. Also, the speeds with which the crush-rolls and calendar-rolls may be run through such a near solid drive device are limited, due in part to the non-uniformity of fiber web thickness and weight issuing from the front end as a result of the almost imperceptible rotational speed irregularities inherent in such drive devices. For example, the doffer of a typical card having such near solid drive construction should not be run faster than about 22 revolutions per minute to process 30-33 pounds of fiber per hour into a 55-60 grain silver, otherwise, marked irregularities in texture, composition or weight of the silver can occur. Objects therefore, of the present invention are: to provide a drive mechanism for the fiber processing system of the front end of a textile card which minimizes maintenance and cost thereof and which allows substantially higher operating speeds and silver output of the card without sacrificing product quality; to reduce the number and structural complexity of the drive mechanism components; and to provide such a mechanism which can be installed on practically any conventional card with a minimum of alteration thereof.
Quality Roofing Services from an Experienced Nashville Roofing Company The roof is an important feature for any building, protecting the overall structure of the building, as well as the items that are kept inside. Whether you need a new roof or your current roof needs repairs in Nashville, you need a qualified, experienced roofing company to ensure the job is done correctly so you can count on your roof when you need it the most. At The H. E. Parmer Company, our roofing contractors are licensed and insured to complete any roofing job, whether residential or commercial. New Installations Our residential and commercial roofers are experienced in new roof installations for any type of building. Whether you need a pitched roof for your home or a flat roof for a commercial building, our roofers will work with you to determine which type of roofing material will work best for your situation. Our goal is to provide the utmost in customer satisfaction. To achieve this, we keep open communication so you always know the status of your project.
Effects of collagenase on root demineralization. The role of proteolytic enzymes in the root caries process remains unclear. The aim of this study was to investigate collagenase activity during tooth root demineralization and remineralization in an in vitro demineralization/remineralization pH-cycling model, Human tooth roots were subjected to pH cycling (alternating demineralization and remineralization) in one of two different time cycles for five days. Collagenase at 90, 180, or 360 micrograms per root was placed into either the demineralizing solution or the remineralizing solution in the pH-cycling system. The effects of additional exposure to collagenase before or after pH cycling were also studied. After the exposure, thin sections of the roots were examined histologically by polarized light microscopy. Changes of calcium and phosphate in the solutions were analyzed chemically. Surface erosion occurred only in the groups where collagenase was contained in the remineralizing solution and in which the root samples were exposed to severe demineralization. However, no differences among the control and experimental groups were found in calcium and phosphate changes in the pH-cycling solutions. These findings suggest that collagenase works during the remineralizing phase and predominantly attacks the organic matrix of the root after demineralization. Additional exposure to collagenase before or after pH cycling did not increase surface erosion except for exposure to collagenase in the absence of phosphate following pH cycling.
# # ipip_country_bq # # ipv4 hash:net ipset # # Bonaire, Sint Eustatius, and Saba (BQ) -- [ipip.net] # (http://ipip.net) # # Maintainer : ipip.net # Maintainer URL : http://ipip.net # List source URL : https://cdn.ipip.net/17mon/country.zip # Source File Date: Wed Jun 5 19:27:31 UTC 2019 # # Category : geolocation # Version : 7 # # This File Date : Thu Jun 6 08:20:16 UTC 2019 # Update Frequency: 1 day # Aggregation : none # Entries : 19 subnets, 25348 unique IPs # # Full list analysis, including geolocation map, history, # retention policy, overlaps with other lists, etc. # available at: # # http://iplists.firehol.org/?ipset=ipip_country_bq # # Generated by FireHOL's update-ipsets.sh # Processed with FireHOL's iprange # 63.245.41.0/24 63.245.42.0/24 69.79.121.0/24 69.79.122.0/24 138.185.208.0/22 143.0.32.0/22 161.0.80.0/20 186.159.96.0/22 186.159.101.0/24 186.159.102.0/23 186.159.104.0/21 190.4.64.0/20 190.97.112.0/21 190.107.248.0/21 190.123.16.0/22 190.242.16.48/30 200.6.144.0/21 200.71.248.0/21 200.107.84.0/22
//0 int b; void foo(){ int a; }
Replace these Affiliate Programs at ANYTIME! Your banner here within the next hour. Learn How! Garner and Haywood each earned her Certified Insurance Service Representative designation from the National Alliance for Insurance Education & Research. Both work as commercial account managers within TriSure’s select client division. Industry experts recognize the National Alliance for Insurance Education & Research as the best source of continuing education credits, designation opportunities and concrete knowledge for insurance and risk-management professionals. Each year, more than 130,000 insurance professionals attend at least one of the National Alliance’s 2,500-plus educational and training programs, which are conducted in all 50 states and throughout the Caribbean. “Professional credentials are very important to the insurance industry,” said Linda Folger, CPCU, CIC, ARM, CRM and a founding partner at TriSure. “Professional credentials reflect your knowledge on particular insurance-related subjects, as well as a commitment to providing expertise to clients. We are very proud of Arlinda and Angela and congratulate them upon earning their CISR credentials.” TriSure is one of the largest independently owned insurance brokerage and consulting firms in the Triangle area. The firm consults with the area’s leading businesses to help them successfully manage property and casualty insurance risks and provide comprehensive benefits to their employees. TriSure offers a premium level of service and experience to clients who deserve the highest quality insurance products delivered with impeccable professionalism. PRZOOM / PRTODAY - Newswire Today disclaims any content contained in this article. If you need/wish to contact the company who published the current release, you will need to contact them - NOT us. Issuers of articles are solely responsible for the accuracy of their content. Our complete disclaimer appears here.IMPORTANT INFORMATION: Issuance, publication or distribution of this press release in certain jurisdictions could be subject to restrictions. The recipient of this press release is responsible for using this press release and the information herein in accordance with the applicable rules and regulations in the particular jurisdiction. This press release does not constitute an offer or an offering to acquire or subscribe for any Sinclair & Co. securities in any jurisdiction including any other companies listed or named in this release.
// Copyright 2006-2015 Tobias Sargeant ([email protected]). // // This file is part of the Carve CSG Library (http://carve-csg.com/) // // Permission is hereby granted, free of charge, to any person // obtaining a copy of this software and associated documentation // files (the "Software"), to deal in the Software without // restriction, including without limitation the rights to use, copy, // modify, merge, publish, distribute, sublicense, and/or sell copies // of the Software, and to permit persons to whom the Software is // furnished to do so, subject to the following conditions: // // The above copyright notice and this permission notice shall be // included in all copies or substantial portions of the Software. // // THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, // EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF // MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND // NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS // BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN // ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN // CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE // SOFTWARE. #pragma once #include <carve/carve.hpp> #include <carve/poly_decl.hpp> #include <carve/poly_impl.hpp>
Antoine Chazal Antoine Chazal (8 November 1793 in Paris – 12 August 1854 in Paris) was a French painter of flowers and of portraits, as well as an engraver. He studied under Misbach, Bidauld, and Van Spaendonck, and became Professor of Iconography at the Jardin des Plantes. Besides portraits, flowers, and fruit, he painted a few landscapes and altar-pieces for churches. He also engraved a portrait of Cardinal La Fare. Chazal died in Paris in 1854. Engravings Chazal drew many effigies for the engraver and publisher Ambroise Tardieu, who does not mention it in his prints (see below the legends of the portraits) References Category:1793 births Category:1854 deaths Category:Artists from Paris Category:19th-century French painters Category:French male painters Category:French engravers Category:19th-century engravers Category:19th-century male artists
1. Field of the Invention The present invention relates to heat exchange units which are adapted to transfer heat between a heat transfer fluid flowing through a heat exchanger and air passing thereover. More specifically, the present invention relates to a wrapper for encasing a heat exchange unit. In particular, this invention concerns means for fastening the wrapper and the location of louver openings within the wrapper such that the wrapper may provide structural support. 2. Description of the Prior Art Heat exchange units to be mounted external of a residence or an enclosure are found in the air conditioning industry. These units typically have a heat exchanger and a fan for circulating air through the heat exchanger in heat exchange relation with refrigerant flowing through the heat exchanger. A suitable base, grille, and top cover are typically provided to encase the unit. Depending upon the application a compressor, four-way valve and controls may also be included within this outdoor unit. When a conventional plate fin coil is utilized within an outdoor heat exchange unit the plate fin coil is often bent in a U or circular shape to provide a large surface area within a compact unit. Conventionally, a fan is mounted such that external air is drawn into the unit through the heat exchanger and exhausted out the top of the unit. These plate fin coils are structurally solid and usually serve to support the weight of the top cover to which the fan may be mounted. A grille formed from welded wire is mounted about the surface of the heat exchanger to prevent physical contact with the heat exchanger itself. When a slit fin heat exchanger, as described below, is used instead of plate fin coils the structural integrity of plate fin coil is not maintained. Slit finned heat exchangers are formed from a long continuous tube having a U-shaped segmented fin helically wrapped thereabout to form a heat exchange surface having a myriad of heat exchange projections extending from the surface of the tube. This continuous tube may then be formed to the desired heat exchanger configuration such as a cylinder and secured within a heat exchange unit to provide for heat transfer between a heat transfer medium such as refrigerant flowing therethrough and air flowing thereover. Since there are no tube sheets nor plate fin structure connecting various tubes to each other there is no inherent structure to support the rows of slit fin tubing making up the cylindrical heat exchanger or to support the components of the unit. The wrapper disclosed herein is designed to encase a slit fin coil and to have solid portions which may provide structural support for the unit. Additionally, the wrapper has closure means which cooperate with a fastening strip to secure the wrapper in position. Furthermore, the use of a wrapper having louvered portions as disclosed herein may obviate the necessity of painting the coil since utilizing these louver openings instead of the previous welded wire grille results in the heat exchanger being substantially hidden from view. Consequently it is the exterior surface of the wrapper rather than the heat exchanger which becomes esthetically important.
Under Construction! Quite Literally! As we transition our permanent installation to Tryzub, and work with the facility on expanding their current structure and facilities, please consider sponsoring naming rights to key displays cases, wings of the museum (hockey, soccer, Olympic, amateur, etc.), or even naming the Museum or Hall of Fame in honor of your family name, etc.For more details, please email [email protected] or call (973) 544-8774 and speak with Myron
News Honors Day Academic achievement was the focus of the day on April 12 as the College of Pharmacy joined the university community for Honors Day 2014. The event marked the 66th year of recognizing student academic achievement. Pharmacy students recognized for academic successes and their guests gathered at Darrell K. Royal-Texas Memorial Stadium's North End Zone's eighth floor facility. The program included welcoming remarks by Dr. Patrick Davis, senior associate dean for academic affairs. Highlight of the event was the individual recognition of students who received honor cords. A luncheon followed the program. Afterward, pharmacy students joined with other university scholars in the university-wide celebration at 2 pm at the Erwin Center.
Improv is something you expect to find on Saturday Night Live, not in the science lab. A couple of acting teachers, however, are beginning to introduce improv acting and communication techniques to the science syllabus. “JRN 503: Improvisation for Scientists” is a course now on offer at New York’s Stony Brook University. Alan Alda is an actor, director, screenwriter and board member for the World Science Festival. He’s also one of the people behind the new improv class for scientists at Stony Brook University in Stony Brook, New York. “This basic kind of improv is not where you try to turn the scientist into a comedian or an actor,” Alda says. “It's not a jokey kind of humor. It’s the pleasure of spontaneity, so that if something occurs to you in that split second, it’s free to come out. You trusted it, you trust yourself, and the audience is delighted.” The improv classes are aimed at helping scientists think and communicate more personally and in a more relatable way, explains Valeri Lantz-Gefroh, improvisation program director at the Alan Alda Center for Communicating Science at Stony Brook University. “A lot of it is just about learning how to listen and be available to whatever's right in front of you,” Lantz-Gefroh says. “The tool that they learn in improv is that, if that's not working, they need to be aware of the fact that it's not working, and able to make an adjustment on their feet, not feel like they failed. ... So the games that we play are a lot about just listening, availability and being able to make spontaneous adjustments and also bring their own passion to the moment so that they're coming from a place of excitement in their own work” Alda and Lantz-Gefroh say the classes have yielded exciting results for science and medical students. One medical student used his improv training from a game called ‘Mirror Exercise’ that teaches students to slow down, be more simple and empathetic. He had an encounter with a patient to whom he had to break bad news. He had to tell her that her cancer had metastasized and she had only two weeks left to live. He was terrified going into the conversation. At first the woman had no reaction at all to the news. He had the feeling she didn't understand what was happening, so he decided to use some of his improv training. “He said, ‘I sat down with her and we held hands. ... I told her in the simplest possible way what was happening. I didn't use any three-syllable words. I didn't use the word ‘metastasis,’ I didn't use the word ‘prognosis.’ I just tried to be simple and slow because I knew that there was a pacing to the way that you could hear this information.’ And he said ‘For the first time, the woman started to cry.’ And when she cried, it made him cry, and then when he cried she had a question,” Lantz-Gefroh says. “He said ‘What I felt happened was that I was able to help her understand how to understand the end of her life. And she was able to help me understand how to be a better doctor.’” Other students say the improv classes have helped them better understand their own scientific work. “These are senior scientists very often. And after going through this training with us, they get so used to thinking in basic language, and facing the concepts without over-intellectualizing them that they have a greater understanding of their own work,” Alda says. “That's a wonderful thing — they can actually make more progress in their work because they see it in a fresher way. One scientist told me he doesn’t face the data in a way where he tells the data something. He lets the data talk to him.” Others find the improv classes help them get through school. “Our medical students have told us that they're actually learning material easier because, as it's being given to them, they're starting to distill it in their own minds and think ‘If I was to say this in plain language, what would it be?’ And it's helping it to stick with them longer,” Lantz-Gefroh says. This article is based on an interview that aired on PRI's Science Friday.
Q: How to update metadata about Trade Representative Contact Information using Fastlane/Deliver? I uploaded all the metadata to appstore including Screenshots, App review information , Rating and all other things but unable to get any command to pass the Trade Representative Contact Information using Fastlane/Deliver. A: you should add in your Deliverfile something like this trade_representative_contact_information( first_name: "Alex", last_name: "Kosyakov", address_line1: "Nevsky pr., 1", address_line2: "", address_line3: "", city_name: "Saint-Petersburg", state: "", country: "Russia", postal_code: "190000", phone_number: "+7921XXXXXXX", email_address: "blabal@gmail." )
1. Introduction {#sec1-biomolecules-09-00382} =============== Thimet oligopeptidase (EC 3.4.24.15; EP24.15, THOP1) was initially identified as a neuropeptide-inactivating enzyme in rat brain homogenates \[[@B1-biomolecules-09-00382],[@B2-biomolecules-09-00382],[@B3-biomolecules-09-00382],[@B4-biomolecules-09-00382]\]. The majority of well-characterized THOP1 substrates are neuropeptides \[[@B5-biomolecules-09-00382]\], including bradykinin \[[@B6-biomolecules-09-00382],[@B7-biomolecules-09-00382]\], neurotensin \[[@B8-biomolecules-09-00382],[@B9-biomolecules-09-00382],[@B10-biomolecules-09-00382]\], opioid peptides \[[@B1-biomolecules-09-00382],[@B11-biomolecules-09-00382],[@B12-biomolecules-09-00382]\], angiotensin \[[@B13-biomolecules-09-00382]\], and gonadotrophin-releasing hormone (GnRH) \[[@B14-biomolecules-09-00382],[@B15-biomolecules-09-00382],[@B16-biomolecules-09-00382]\]. Studies have suggested that THOP1 could be secreted or associated to the external surface of the plasma membrane to function as a neuropeptide-degrading enzyme \[[@B17-biomolecules-09-00382],[@B18-biomolecules-09-00382],[@B19-biomolecules-09-00382]\]. THOP1 secretion from cultured cells has been shown to occur through an unconventional secretory pathway, and is facilitated by interaction with 14-3-3 epsilon and/or calmodulin \[[@B20-biomolecules-09-00382],[@B21-biomolecules-09-00382]\]. Phosphorylation of THOP1 at Ser~644~ regulates its secretion and interaction with 14-3-3 epsilon \[[@B21-biomolecules-09-00382]\], as well as its catalytic activity toward GnRH \[[@B22-biomolecules-09-00382]\]. THOP1 has substrate size restriction and most of its substrates, products, or competitive inhibitors are peptides containing 9--12 amino acids \[[@B23-biomolecules-09-00382],[@B24-biomolecules-09-00382],[@B25-biomolecules-09-00382]\]. THOP1 substrate size restriction was better understood after solving its crystal structure showing that the catalytic center is located at the bottom of a deep and narrow channel \[[@B26-biomolecules-09-00382]\]. THOP1 belongs to M3 family of zinc-dependent endopeptidases \[[@B2-biomolecules-09-00382],[@B26-biomolecules-09-00382],[@B27-biomolecules-09-00382],[@B28-biomolecules-09-00382],[@B29-biomolecules-09-00382]\]. THOP1′s maximal enzymatic activity is maintained by partial S-glutathionylation, a mechanism that apparently triggers protein oligomerization to dimeric and trimeric catalytically inactive complexes \[[@B30-biomolecules-09-00382],[@B31-biomolecules-09-00382],[@B32-biomolecules-09-00382]\]. THOP1 is ubiquitously expressed in mammalian cells and tissues, and in rodents its specific activity is highest in brain, endocrine tissues, bone marrow and immune system \[[@B33-biomolecules-09-00382]\]. In rat brain, THOP1's cellular and subcellular distribution seems to be predominant in the nucleus (\>70%), as determined by immunohistochemistry and electron microscopic immunogold labeling \[[@B34-biomolecules-09-00382],[@B35-biomolecules-09-00382]\]. The amount of THOP1 found in the nucleus is inversely correlated with that found in the cytosol and associated to the cytosolic face of organelles, suggesting that the enzyme could be mobilized from one intracellular compartment to the other \[[@B34-biomolecules-09-00382]\]. Therefore, the predominant intracellular localization of THOP1 suggests that extracellular neuropeptide and hormone degradation may not be its main biological role \[[@B25-biomolecules-09-00382],[@B34-biomolecules-09-00382],[@B35-biomolecules-09-00382],[@B36-biomolecules-09-00382],[@B37-biomolecules-09-00382]\]. Accordingly, THOP1 was shown to participate in antigen presentation by major histocompatibility class I (MHC I) molecules acting downstream of the proteasome \[[@B25-biomolecules-09-00382],[@B36-biomolecules-09-00382],[@B37-biomolecules-09-00382],[@B38-biomolecules-09-00382]\]. A substrate-capture assay using a catalytically inactive form of THOP1 uncovered novel natural peptides derived from intracellular proteins, suggesting a broader function for this oligopeptidase than previously anticipated \[[@B39-biomolecules-09-00382],[@B40-biomolecules-09-00382],[@B41-biomolecules-09-00382],[@B42-biomolecules-09-00382]\]. This initial substrate-capture assay later allowed the finding of a large pool of intracellular peptides in different species \[[@B43-biomolecules-09-00382],[@B44-biomolecules-09-00382],[@B45-biomolecules-09-00382],[@B46-biomolecules-09-00382],[@B47-biomolecules-09-00382]\], some of which were characterized either as substrates or products of THOP1 \[[@B23-biomolecules-09-00382]\]. Indeed, THOP1 inhibition by siRNA affected the relative levels of intracellular peptides in HEK293 cells and, in parallel, increased the signal transduction triggered by isoproterenol \[[@B48-biomolecules-09-00382]\]. On the other hand, THOP1 overexpression in both CHO-S and HEK293 cells reduced signal transduction of angiotensin II and isoproterenol \[[@B49-biomolecules-09-00382]\], suggestion that THOP1 plays a role in GPCR signaling. THOP1 overexpression in primary cortical neurons was neuroprotective against amyloid-beta-mediated toxicity, while RNAi knockdown made neurons more vulnerable to amyloid peptide toxicity \[[@B50-biomolecules-09-00382]\]. THOP1 has been associated to retinal neurodegeneration, which is an early event in the pathogenesis of diabetic retinopathy \[[@B51-biomolecules-09-00382]\]. THOP1 was also found to be one of the most overexpressed genes related to epigenetic interactions in lung adenocarcinoma of poor prognosis \[[@B52-biomolecules-09-00382]\]. The present study aimed to generate and perform an initial phenotype characterization of THOP1 C57BL/6 knockout mice (THOP1^-/-^). THOP1^-/-^ mice were viable and displayed normal external phenotype and fertility. The litters had normal number of animals. THOP^-/-^ mice could not be visually distinguished from WT littermates. Overall, the results presented here link THOP1 to brain disorders such as depression, attention and memory retention deficits, in addition to immune-stimulated neurodegeneration and infection induced inflammation. 2. Results {#sec2-biomolecules-09-00382} ========== 2.1. THOP1^-/-^ Generation {#sec2dot1-biomolecules-09-00382} -------------------------- To generate the THOP1^-/-^ mice, we used embryonic stem cells with a gene-trap cassette inserted into intron 5 of the THOP1 gene on chromosome 10 ([Figure 1](#biomolecules-09-00382-f001){ref-type="fig"}A), which was confirmed by genotyping of the resulting mice ([Figure 1](#biomolecules-09-00382-f001){ref-type="fig"}B). To obtain a pure genetic background, we bred F1 (129/OlaHsd/C57BL/6 background) heterozygous THOP1-deficient animals to the C57BL/6 mouse line for at least ten consecutive generations ([Supplementary information](#app1-biomolecules-09-00382){ref-type="app"} Trap THOP1 knockout generation). Tail DNA samples were extracted and sent to the Charles River Laboratory (Genetic Testing Services, Wilmington, MA, USA) for the complete mapping of microsatellite markers. It was confirmed that these animals had a genetic background of 99.25%, on average, of the C57BL/6 line (data not shown). Mice were genotyped before experimentation. THOP^-/-^ mice showed a 292 bp electrophoresis band, heterozygous animals displayed two bands (292 and 623 bp), and WT animals presented a 623 bp band ([Figure 1](#biomolecules-09-00382-f001){ref-type="fig"}B). THOP1^-/-^ mice were totally viable and presented no deviations from normal Mendelian distributions following intercrossing of the either heterozygote or homozygote animals. THOP1^-/-^ mice could not be visually distinguished from WT C57BL/6 littermates and had normal external appearance and fertility. Homozygous males and females were both fertile and the litter size was usually 7--8 puppies. The reproductive abilities and estrous cycle of THOP1^-/-^ and WT mice were similar, suggesting that GnRH and luteinizing hormone (LH) metabolism was not significantly compromised in THOP1^-/-^ mice. THOP1 protein expression was evaluated by Western blot and showed highest levels in testis and kidneys followed by brain, and lower expression in liver ([Figure 1](#biomolecules-09-00382-f001){ref-type="fig"}C). A complete lack of immunoreactivity was observed in tissue homogenates obtained from THOP1^-/-^ compared to WT mice ([Figure 1](#biomolecules-09-00382-f001){ref-type="fig"}C). THOP1 enzymatic activity was determined in crude tissue homogenates, using the quenched fluorescence substrate Abz-GGFLRRVNH2-EDDnp (QFS), in the presence or absence of the NLN specific inhibitor Pro-Ile (5 mM). In WT mice, Pro-Ile inhibited different percentages of QFS degradation ([Figure 1](#biomolecules-09-00382-f001){ref-type="fig"}D). NLN inhibition was highest in testis (220 AFU from a total of 320 AFU; 68%), followed by brain (145 AFU from a total of 220 AFU; 65%), kidneys (110 AFU from a total of 140 AFU; 78%), and liver (80 AFU from a total of 100 AFU; 80%). These data suggest that in the absence of THOP1, NLN is the major QFS degrading activity in mice. In THOP1^-/-^ mice, Pro-Ile completely inhibited the remaining QFS degrading activity in brain, testis and liver, supporting the specificity of this fluorescent assay to determine THOP1 and NLN activities in these tissues. The lowest THOP1 specific activity was observed in liver, which is in agreement with the Western blot data ([Figure 1](#biomolecules-09-00382-f001){ref-type="fig"}C,D). Next, the mRNA expression of NLN and several other peptidases and the proteasome beta5-subunit (ProtB5) were evaluated in striatum (ST), hippocampus (HC), and prefrontal cortex (PFC) of WT and THOP1^-/-^ brains using quantitative real-time (qRT) PCR (qRT-PCR) ([Figure 2](#biomolecules-09-00382-f002){ref-type="fig"}). mRNA levels of proteasome beta5-subunit (ProtB5) was reduced both in ST and PFC, and remained unaltered in the HC ([Figure 2](#biomolecules-09-00382-f002){ref-type="fig"}). An increase in mRNA levels of neprilysin (NEP) and angiotensin converting enzyme 1 (ACE1) was observed in ST from THOP1^-/-^ compared to WT mice, whereas no changes were found for prolyl-oligopeptidase (POP), neurolysin (Nln), insulin degrading enzyme (IDE), and dipeptidyl peptidase 4 (DPP4) mRNA expressions between THOP1^-/-^ and WT mice ([Figure 2](#biomolecules-09-00382-f002){ref-type="fig"}A). In HC from THOP1^-/-^ mice, mRNA levels of ACE1 and IDE increased, whereas no alterations were observed for NEP, POP, NLN, or DDP4 ([Figure 2](#biomolecules-09-00382-f002){ref-type="fig"}C). Taken altogether, these data suggest that THOP1 suppression slightly affects mRNA levels of several peptidases and ProtB5 in specific areas of mouse brain. 2.2. Global Gene Expression Analyses {#sec2dot2-biomolecules-09-00382} ------------------------------------ Affymetrix^®^ microarrays were used to evaluate global mRNA expression in prefrontal cortex, hippocampus, and striatum of THOP1^-/-^ compared to WT mice ([Supplementary Information](#app1-biomolecules-09-00382){ref-type="app"} Microarray data). Among the immediately adjacent genes to THOP1 on chromosome 10, accessory protein 6 receptor and pseudogene EFF2 were not differentially expressed in comparisons with genes from the same region, showing that the gene trap insertion appears to have not influenced physically close genes ([Supplementary Information](#app1-biomolecules-09-00382){ref-type="app"} Microarray data). The assessments of global mRNA levels in WT and THOP1^-/-^ mice shows that only the thymine DNA glycosylase (TDG) gene was differentially expressed (false discovery rate with adjusted p-value/Q-value cut-off of 0.05) in the evaluated areas of THOP1^-/-^ brain. The other differentially expressed genes were six reporter control probe sets of the microarray, and mitochondrial encoded tRNA cysteine in prefrontal cortex. However, excluding outliers \[[@B53-biomolecules-09-00382]\], the hippocampus samples showed 395 differentially expressed genes, including TDG and the same six reporter controls probe sets previously found ([Supplementary Information](#app1-biomolecules-09-00382){ref-type="app"} Microarray data). 2.3. Peptidomics {#sec2dot3-biomolecules-09-00382} ---------------- Semiquantitative peptidome analyses using dimethylation-isotopic labeling and electron-spray mass spectrometry were used to determine possible differences in the relative levels of peptides in PFC, ST and/or HC of THOP1^-/-^ compared to WT mice ([Supplementary data](#app1-biomolecules-09-00382){ref-type="app"} shows further MS and MS/MS data). The 66 distinctive peptides identified were derived from 25 proteins with main subcellular localization in cytosol (C; 66%), mitochondria (M; 16%), secretory pathway (V; 13%), plasma membrane/cytosol (PM/C; 5%), or nucleus (N; 3%) ([Table 1](#biomolecules-09-00382-t001){ref-type="table"}). In PFC, five out of 36 peptides identified in THOP1^-/-^ were reduced in their levels by more than 50% compared to WT mice, and only two peptides were increased more than 100% ([Table 1](#biomolecules-09-00382-t001){ref-type="table"}). In ST, none of the 38 peptides appeared reduced whereas only one peptide (SANSNPAMAPRE) was increased more than 100% in THOP1^-/-^ compared to WT ([Table 1](#biomolecules-09-00382-t001){ref-type="table"}). In HC, none of the 45 peptides identified were reduced, whereas four were increased more than 100% in THOP1^-/-^ compared to WT ([Table 1](#biomolecules-09-00382-t001){ref-type="table"}). Thus, from the 63 peptides identified here, four peptides, all found in PFC, could be considered products of THOP1, while seven peptides found in PFC (2), ST (1), or HC (4) could be considered substrates of THOP1. It is to note that in some cases the same peptides (VEKVDELKKKYGI and KQATVGDVNTDRPGLLDL) are decreased in PFC, unchanged in ST and increased in HC ([Table 1](#biomolecules-09-00382-t001){ref-type="table"}). Intracellular peptides levels have been shown to present greater variations among samples compared to neuropeptides \[[@B45-biomolecules-09-00382]\], which may explain the large inter sample variations observed for most of the peptides identified ([Table 1](#biomolecules-09-00382-t001){ref-type="table"}). THOP1 gene ablation affected the expression of ProtB5 and additional peptidases, which may have influenced the levels of at least some peptides. Moreover, the present data suggest that only 26% of the peptides identified in at least two samples were present in all three investigated areas, suggesting that similarly to neuropeptides some intracellular peptides could be specific to certain areas of mouse brain. 2.4. Complete Blood Count and Coagulation Analysis {#sec2dot4-biomolecules-09-00382} -------------------------------------------------- Complete blood count of THOP1^-/-^ females before immunization showed increased percentage of granulocytes and monocytes and decreased percentage of lymphocytes compared to WT mice ([Table 2](#biomolecules-09-00382-t002){ref-type="table"}), suggesting intrinsic autoimmune or blood disorders of THOP1^-/-^ animals. Thrombocytopenia was also observed in THOP1^-/-^ compared to WT mice ([Table 2](#biomolecules-09-00382-t002){ref-type="table"}), which could contribute to prolonged bleeding of these animals empirically observed following small surgical procedures (i.e., small tail/ear cuts for genotyping). Blood coagulation was further investigated using the nonactivated thromboelastometry (NATEM) test \[[@B55-biomolecules-09-00382]\]. Results showed that the parameters clotting time, clotting formation time, maximum clotting firmness, and maximum lysis were all similar comparing THOP1^-/-^ and WT (data not shown). The prolonged bleeding of THOP1^-/-^ was not correlated to a decreased blood coagulation time, which suggest that further investigations are necessary to uncover the possible mechanism behind altered thrombus formation in THOP1^-/-^. Additional blood parameters including hemoglobin concentration, white blood cells, red blood cells, red cell distribution width, mean corpuscular volume and mean corpuscular hemoglobin concentration were similar ([Table 2](#biomolecules-09-00382-t002){ref-type="table"}). 2.5. Autoimmune Encephalomyelitis Neurodegeneration Model {#sec2dot5-biomolecules-09-00382} --------------------------------------------------------- Autoimmune encephalomyelitis (EAE) is the most common animal model for multiple sclerosis as they share many clinical and pathophysiological features \[[@B56-biomolecules-09-00382],[@B57-biomolecules-09-00382]\]. Following immunization with MOG35-55 peptide, THOP1^-/-^ mice showed poor clinical score from 17th-26th day postimmunization (dpi) in EAE, compared to WT mice ([Figure 3](#biomolecules-09-00382-f003){ref-type="fig"}). EAE symptoms of THOP1^-/-^ were associated with increased tumoral necrosis factor alpha (TNF-α) levels in the dorsal hippocampus and spinal cord at the 26th dpi ([Figure 3](#biomolecules-09-00382-f003){ref-type="fig"}). Altogether, these data supports that THOP1 may be involved in neurodegeneration \[[@B50-biomolecules-09-00382],[@B51-biomolecules-09-00382]\] and autoimmunity \[[@B36-biomolecules-09-00382],[@B38-biomolecules-09-00382]\]. 2.6. Sepsis {#sec2dot6-biomolecules-09-00382} ----------- Animals were subjected to cecal ligation and puncture (CLP) sepsis protocol with a 21-gauge needle. All sham-operated animals survived for at least 7 days after surgery (data not shown). WT animals that received 2 punctures showed 50% mortality (3 from 6), whereas THOP1^-/-^ animals showed a 30% mortality (2 from 6) up to 7 days after the surgery ([Figure 4](#biomolecules-09-00382-f004){ref-type="fig"}). Animals that survived from sepsis (3 WT and 4 THOP1^-/-^) were subjected to behavior tests in an open field arena at the 8th day. WT animals showed an average speed and total traveled distance smaller than THOP1^-/-^ animals ([Figure 4](#biomolecules-09-00382-f004){ref-type="fig"}). On the other hand, WT animals demonstrated greater immobility time than THOP1^-/-^ animals ([Figure 4](#biomolecules-09-00382-f004){ref-type="fig"}). These data suggest that THOP1^-/-^ improved the performance of animals subjected to sepsis and it could be a potential drug target. 2.7. Behavior Analysis {#sec2dot7-biomolecules-09-00382} ---------------------- In the hot plate test, WT and THOP1^-/-^ mice demonstrated similar basal nociceptive sensibility ([Figure 5](#biomolecules-09-00382-f005){ref-type="fig"}). However, following intraplantar injection of bradykinin, the latency of paw withdrawal response of THOP1^-/-^ was significantly lower than that of WT mice ([Figure 5](#biomolecules-09-00382-f005){ref-type="fig"}). Together, these data indicate that THOP1 is a rate-limiting peptidase for bradykinin inactivation in peripheral tissues \[[@B58-biomolecules-09-00382]\]. No depression-like behavior was observed for THOP1^-/-^ compared to WT mice during the first day of forced swimming test (FST) training. In the second day of FST experiments, a mild depression-like behavior was observed for THOP1^-/-^ mice, which exhibited slightly greater latency time to the first immobility episode as well as greater immobility periods during the 5 min of the FST experiments than WT control group ([Figure 6](#biomolecules-09-00382-f006){ref-type="fig"}A). To further evaluate this depressive-like phenotype of THOP1^-/-^ additional tests were conducted using the tail suspension test (TST). The latency period of time for both WT and THOP1^-/-^ were similar in the TST, whereas THOP1^-/-^ mice hung by the tail developed an immobile posture that last longer than WT mice ([Figure 6](#biomolecules-09-00382-f006){ref-type="fig"}B). Additional experiments should be conducted in the future with both THOP1^-/-^ and WT, male and females, to deeply investigate the chronic and acute effects of antidepressives such as fluoxetine and imipramine on this phenotype. The prepulse inhibition of startle reflex test (PPI) is a paradigm that assesses the functioning of sensorimotor gating. Deficits in PPI indicate impaired information processing and are seen in psychiatric disorders, such as attention deficit hyperactivity disorder (ADHD) and schizophrenia. Compared to WT, THOP1^-/-^ animals displayed impaired PPI (%) after presentation of 80 dB prepulse, but not after the prepulses of 75 and 85 dB ([Figure 7](#biomolecules-09-00382-f007){ref-type="fig"}). Administration of clozapine restored THOP1^-/-^ animals' PPI deficit after the prepulse of 80 dB and increased their PPI response after the prepulse of 85 dB. These pharmacological responses suggest that disruption of THOP1 expression in mice induces a behavioral phenotype that resembles those seen in psychiatric disorders involving attention deficits ([Figure 7](#biomolecules-09-00382-f007){ref-type="fig"}B,C). Another feature presented by the THOP1^-/-^ mice was that they presented lower latency to step-down when compared to WT mice during the training-tests. These data suggest that THOP1^-/-^ animals have an impairment in their memory retention process ([Figure 8](#biomolecules-09-00382-f008){ref-type="fig"}); the longer the mice stay on the platform, the greater the latency for step-off, indicating that the mouse learned the passive avoidance task. Further behavior analyses showed no alterations on locomotor activity with either THOP1^-/-^ or WT animals, which spend similar time in different zones of the open field apparatus with similar rearing behavior/amount of time crossing the central square/instances of grooming ([Supplementary Figure S1](#app1-biomolecules-09-00382){ref-type="app"}). The spontaneous activity of THOP1^-/-^ and WT animals during the 24 h period was similar, except in the interval from 5 p.m. to 10 p.m. where THOP1^-/-^ have smaller spontaneous activity than WT animals (data not shown). The elevated plus maze task suggested no signs of altered anxiety behavior of THOP1^-/-^ compared to WT mice ([Supplementary Figure S2](#app1-biomolecules-09-00382){ref-type="app"}). In Barnes maze and novel object recognition tasks also no alterations of THOP1^-/-^ in learning/cognitive performance were observed comparing to WT ([Supplementary Figure S3](#app1-biomolecules-09-00382){ref-type="app"}). 2.8. Neurotransmitter Levels and Turnover {#sec2dot8-biomolecules-09-00382} ----------------------------------------- Similar concentrations of dopamine (DA), serotonin (5HT), noradrenaline (NOR), and the metabolites 3,4-dihydroxyphenylacetic acid (DOPAC), homovanillic acid (HVA), and 5-hydroxyindoleacetic acid 5 (5HIAA) were observed in PFC ([Figure 9](#biomolecules-09-00382-f009){ref-type="fig"}A) and ST ([Figure 9](#biomolecules-09-00382-f009){ref-type="fig"}B) of THOP1^-/-^ compared to WT ([Figure 8](#biomolecules-09-00382-f008){ref-type="fig"}). In addition, neurotransmitter turnover ratios were analyzed showing that the relationship of 5HIAA/5HT was significantly lower in PFC of THOP1^-/-^ compared to WT mice ([Figure 9](#biomolecules-09-00382-f009){ref-type="fig"}). Similarly, the turnover ratios of HVA/DA and DOPAC+HVA/DA were lower in ST of THOP1^-/-^ mice compared to WT mice. 2.9. mRNA Levels of 5HT 2a and DA D2 Receptors {#sec2dot9-biomolecules-09-00382} ---------------------------------------------- Next, qRT-PCR was used to evaluate the mRNA levels of 5HT 2a receptor (5-HT2a) and DA D2 receptor (DRD2), showing differential regulation in specific areas of THOP1^-/-^ brain compared to WT ([Figure 10](#biomolecules-09-00382-f010){ref-type="fig"}). 5HT2a mRNA was increased in HC and DRD2 reduced in ST and HC ([Figure 10](#biomolecules-09-00382-f010){ref-type="fig"}A,B). In PFC, neither 5HT2a nor DRD2 mRNA were altered comparing THOP1^-/-^ to WT ([Figure 10](#biomolecules-09-00382-f010){ref-type="fig"}C). Together, these data suggest that at least some behavior differences observed between THOP1^-/-^ and WT mice could involve alterations in serotonin and dopamine neurotransmission. 3. Discussion {#sec3-biomolecules-09-00382} ============= In this study, we successfully generated a model of THOP1 knockout mice that will contribute to a better understanding of the biological functions of this oligopeptidase. The present data also strengthen the involvement of THOP1 in neurodegeneration, peripheral bradykinin inactivation, as well as generation and degradation of intracellular peptides. However, the molecular mechanisms behind the phenotype differences seen in THOP1^-/-^ are still to be fully elucidated. Altogether, these findings provide better insights about THOP1′s biological role and highlights its potential as drug target for the development of novel therapies. THOP1^-/-^ mice were viable and have normal external appearance, estrous cycle, and fertility. Their litters had a normal number of animals, which cannot be visually distinguished from WT littermates. GnRH is critical for pubertal development and maintenance of reproductive competence, with normal estrous cycle being produced by a series of hormonal signals that starts with the release of GnRH from the hypothalamus \[[@B59-biomolecules-09-00382],[@B60-biomolecules-09-00382]\]. After being secreted, GnRH can be degraded in the hypothalamus and the anterior pituitary gland by two endopeptidases---THOP1 and POP---acting in a stepwise manner \[[@B61-biomolecules-09-00382]\]. A possible role of brain THOP1 in the regulation of GnRH effects was suggested, for example, since intracerebroventricular administration of N-\[1-(RS)-carboxy-3-phenylpropyl\]-Ala-Ala-Phe-p-aminobenzoate (cFP-AAF-pAB), a specific inhibitor of THOP1, resulted in increased gonadotropin secretion and increased recovery of intracerebroventricular-administered GnRH \[[@B4-biomolecules-09-00382],[@B14-biomolecules-09-00382]\]. The direct correlation between THOP1 and in vivo GnRH metabolism has not been established here due to technical difficulties for GnRH and luteinizing hormone (LH) quantification in samples of portal hypophyseal and plasma from mice; these limitations have also been previously reported \[[@B59-biomolecules-09-00382],[@B60-biomolecules-09-00382]\]. However, the lack of changes in the estrous cycle together with a normal reproductive function and litters of normal numbers, as well as normal expression of POP in all brain regions investigated herein, are strong evidences that both GnRH and LH levels are in a regular physiological range in THOP1^-/-^. Inhibition of ACE1 by cFP-AAF-pAB cleavage product N-\[1(R,S)-carboxy-3-phenylpropyl\]-Ala-Ala \[[@B62-biomolecules-09-00382]\] could be an additional reason for these apparently contradictory results. Cleavage of cFP-AAF-pAB at the Ala-Phe bond by NEP produces N-\[1(R,S)-carboxy-3-phenylpropyl\]-Ala-Ala, which is a potent inhibitor of ACE1 \[[@B62-biomolecules-09-00382]\]. Therefore, after in vivo administration THOP1 specific inhibitor cFP-AAF-pAB could be cleaved by NEP inhibiting ACE1, which is a peptidase that can affect GnRH stability and reproduction \[[@B62-biomolecules-09-00382],[@B63-biomolecules-09-00382],[@B64-biomolecules-09-00382]\]. Here we have also observed that POP mRNA expression was normal in ST, HC and PFC, which could be an additional explanation that THOP1^-/-^ have normal reproductive functions. POP is well known as a key enzyme for GnRH metabolism \[[@B61-biomolecules-09-00382]\] and pulsatility \[[@B60-biomolecules-09-00382]\], and could metabolize GnRH. Future investigations could be performed to further investigate the possible involvement of THOP1 in fine molecular tuning mechanisms related to sexual organ development, maturation and puberty onset. THOP1 was also shown herein to regulate mRNA levels of ProtB5, NEP, ACE1, and IDE in ST and HC, but not in the PFC of mouse brain. THOP1 is mainly localized inside the nucleus in brain neurons, where it could be directly contributing to peptide metabolism, and indirectly to transcriptional regulation. Previous studies have demonstrated that peptides are potential ligands with high affinities for hairpin RNAs. As a result, these peptides serve as inhibitors of viral replication \[[@B65-biomolecules-09-00382],[@B66-biomolecules-09-00382],[@B67-biomolecules-09-00382]\]. The intracellular peptide VGSELIQKY, corresponding to amino acids 251--259 of the human 19S ATPase regulatory subunit 4, stimulates the expression of the immunoproteasome beta 5i subunit increasing the proliferation of CD8+ T cells \[[@B68-biomolecules-09-00382]\]. ACE1 mRNA expression was seen to increase in ST and HC of THOP1^-/-^ mice, and the ACE1 gene insertion/deletion polymorphisms has been shown to play a role in susceptibility to schizophrenia and also in its depressive symptom severity in a Han Chinese population \[[@B69-biomolecules-09-00382]\]. Global gene expression analysis suggested that the gene trap had no influence in adjacent genes. Excluding outliers, hippocampus samples showed 395 differentially expressed genes, including TDG and the six reporter controls probe sets. Therefore, through a yet unknown mechanism it is possible that THOP1 could be acting at the transcriptional and/or post-transcriptional levels to regulate mRNA levels, which then affect some of the phenotypes characterized here. THOP1 suppression affected the levels of specific peptides in particular regions of the central nervous system (CNS), including ST, HC, and PFC. Previous observations suggested that peptidases are not substrate-specific \[[@B70-biomolecules-09-00382]\]. Thus, a great diversity of peptidases and proteases expressed in the brain may compensate for the lack of THOP1. In the PFC, none of the peptidases investigated were differentially expressed, which corroborates the largest variation in peptide levels observed in this CNS region of THOP1^-/-^ brain. In the ST no peptides were altered in THOP1^-/-^, whereas the mRNA levels increased for both ACE1 and NEP that share many substrates with THOP1 \[[@B40-biomolecules-09-00382],[@B71-biomolecules-09-00382]\]. Therefore, an increase of ACE1 and NEP in ST and HC of THOP1^-/-^ may have compensatory effects on the metabolism of peptides. However, no differences were observed herein in NLN mRNA expression. Previous studies using NLN knockout mice suggested a slight increase in 31 peptides that could represent substrates of NLN, and a slightly decrease of six peptides that may represent products of NLN \[[@B54-biomolecules-09-00382]\]. Therefore, whereas changes observed herein in the peptidome cannot be associated to NLN, four peptides (among 65; ASKGLGSDLDSSLASL, KGLGSDLDSSLASL, NDFASAVRILEV, and ADKVPKTAENF), identified here, were identical to those previously found in NLN knockout mice brain \[[@B54-biomolecules-09-00382]\]. Among these four peptides, a slight reduction was observed for peptides ASKGLGSDLDSSLASL and KGLGSDLDSSLASL, derived from clathrin coat assembly protein AP180, and NDFASAVRILEV, derived from cytochrome c oxidase subunit 5A, only in the PFC of THOP1^-/-^. None of these four peptides was altered in NLN knockout mice brain \[[@B54-biomolecules-09-00382]\]. These results suggest that NLN and THOP1 have distinctive substrates in mouse brain, which is corroborated by their distinctive subcellular localization in neurons, with THOP1 mainly localized in the nucleus and NLN mainly present in dendrites \[[@B34-biomolecules-09-00382],[@B35-biomolecules-09-00382]\]. Moreover, proteasome inhibition has been shown to affect the levels of most intracellular peptides both in human cell lines and yeast \[[@B47-biomolecules-09-00382],[@B72-biomolecules-09-00382],[@B73-biomolecules-09-00382]\], suggesting that the reduced expression of ProtB5 observed herein could be a biological response to compensate for the lack of THOP1. THOP1 downregulation affects peptide levels and the expression of ProtB5 and additional peptidases, supporting its role in brain intracellular peptide metabolism. However, further studies are yet necessary to clarify the possible molecular mechanisms linking gene expression of peptidases and ProtB5 and changes in intracellular peptides. THOP1 gene suppression strongly affected the clinical performance of mice in experimental EAE: an animal model of multiple sclerosis, a chronic neuroinflammatory demyelinating disorder of the CNS with a marked neurodegenerative component initiated by CD4+ T cells \[[@B74-biomolecules-09-00382],[@B75-biomolecules-09-00382]\]. During EAE, MHC I-restricted myelin basic protein is presented by oligodendrocytes and cross-presented by Tip-dendritic cells (DCs) to CD4+ T cells. These observations suggest that in EAE CD4+ T cell-mediated CNS autoimmunity leads to determinant spreading to myelin-specific CD8+ T cells, which can directly recognize oligodendrocytes \[[@B75-biomolecules-09-00382]\]. THOP1 was previously suggested to function in antigen presentation through MHC I-associated antigens \[[@B25-biomolecules-09-00382],[@B36-biomolecules-09-00382],[@B38-biomolecules-09-00382]\]. Many of the THOP1 substrates identified by these approaches are 9--11 amino acids in length, supporting the proposal that THOP1 can function in the degradation of peptides that could be used for antigen presentation. However, THOP1 also converts some peptides into products that are 8--10 amino acids, thus contributing to the formation of peptides for antigen presentation \[[@B23-biomolecules-09-00382]\]. Therefore, depending on the antigenic peptide, THOP1 can either degrade or generate epitopes for MHC-I presentation. Indeed, stable retroviral silencing of endogenous THOP1 by RNA interference induced a striking, long-term increase in surface MHC I \[[@B37-biomolecules-09-00382]\], whereas overexpression of THOP1 caused a marked reduction in the levels of H-2Kb and HLA-A3 molecules on COS7 cell surface \[[@B76-biomolecules-09-00382]\]. THOP1 was required, either together with nardilysin or alone, for the generation of a tumor-specific CTL epitope from PRAME, an immunodominant CTL epitope from Epstein--Barr virus protein EBNA3C, and a clinically important epitope from the melanoma protein MART-1 \[[@B38-biomolecules-09-00382]\]. Here, THOP1^-/-^ have worse clinical scores in EAE from 17th-26th dpi compared to WT, which was associated to increased TNF-α levels in the dorsal hippocampus and spinal cord at the 26th dpi. These data suggest that THOP1 is directly or indirectly contributing for the degradation of EAE antigenic epitopes protecting mice against neuroimmune-induced degeneration. Several studies have shown that CD8^+^ T cells, activated by MHC I from DCs and oligodendrocytes, potentiate CD4^+^ T cell-mediated EAE, contributing to inflammation, demyelination, and tissue damage in the CNS \[[@B57-biomolecules-09-00382],[@B75-biomolecules-09-00382],[@B77-biomolecules-09-00382]\]. Overexpression of THOP1 had little or no effect on the presentation to a specific T cell hybridoma of a class II-presented peptides generated from ovalbumin \[[@B76-biomolecules-09-00382]\], suggesting that further studies are still necessary to investigate the role of THOP1 in antigen cross-presentation. Together, these data successfully shown that THOP1 plays a key function in autoimmune-induced neurodegeneration in experimental EAE. THOP1^-/-^ showed increased percentages of granulocytes and monocytes and a decreased percentage of lymphocytes in blood, which could also contribute for the differences seen in their immune and inflammatory response. THOP1 has been implicated in rheumatoid arthritis (RA), another common autoimmune disease manifesting as chronic inflammation of the joints and characterized by a significant genetic contribution \[[@B78-biomolecules-09-00382]\]. The downregulation of THOP1 in whole blood and peripheral blood mononuclear cells from patients with RA could result in abnormal antigen presentation, which might contribute to the pathogenesis of RA \[[@B78-biomolecules-09-00382]\]. These data indicate that THOP is also important in inflammatory diseases. Here, a possible role of THOP1 in sepsis, another inflammatory condition with a high epidemiological burden, was identified. Sepsis is a life-threatening organ dysfunction caused by a deregulated host response to infection which is often accompanied by an intense systemic inflammatory response \[[@B79-biomolecules-09-00382],[@B80-biomolecules-09-00382]\]. Sepsis signs and symptoms are quite varied and the organ dysfunction severity can be assessed according to the sequential organ failure assessment \[[@B81-biomolecules-09-00382]\]. With high incidence and mortality in the early phase of syndrome, a wide range of long-term problems can be associated with sepsis \[[@B82-biomolecules-09-00382]\]. Nearly half of sepsis survivors have at least three symptoms among insomnia, loss of cognitive function, nightmares, depression, fatigue, and loss of self-esteem \[[@B83-biomolecules-09-00382]\]. Inflammatory and anti-inflammatory responses and innate and adaptive immune systems are each equally important and represent potential targets for immune therapy to improve sepsis outcomes \[[@B81-biomolecules-09-00382],[@B84-biomolecules-09-00382],[@B85-biomolecules-09-00382]\]. Here, we demonstrated that THOP1^-/-^ mice have slightly better survival and behavior performance seven days after polymicrobial sepsis induction, with slightly lower expression of TLR4 and TNF-α in dorsal hippocampus. These data suggest that THOP1 may be a new therapeutic target for treating sepsis and inflammatory diseases. THOP1 has also been associated with opioid peptide metabolism and the generation of both Leu- and Met-enkephalins in the murine brain \[[@B1-biomolecules-09-00382],[@B3-biomolecules-09-00382],[@B27-biomolecules-09-00382],[@B86-biomolecules-09-00382],[@B87-biomolecules-09-00382]\]. In the hot plate test WT and THOP1^-/-^ mice present similar behavior, suggesting that THOP1 alone is not a key enzyme for the metabolism of opioid peptides in mouse CNS. Enhanced NEP mRNA expression levels were observed in ST and NEP may replace THOP1 in the metabolism of opioid peptides under THOP1 suppression, particularly in that area of the CNS. THOP1^-/-^ mice showed higher sensitivity to the intraplantar administration of bradykinin, and under these conditions their peripheral nociceptive response in the hot plate test was much faster than that of WT mice. These observations indicate that THOP1 is a rate-limiting peptidase for bradykinin inactivation in the periphery. These latter data corroborates previous suggestions that THOP1 plays a key function inactivating bradykinin in the circulation \[[@B21-biomolecules-09-00382]\], and suggests THOP1 as a pharmacological target for the treatment of certain types of pain. THOP1^-/-^ mice presented a mild (p = 0.05) depression-like behavior in both FST and TST. Further experiments have to be conducted to investigate the pharmacological effects of antidepressants on THOP1^-/-^ depressive-like behavior. THOP1^-/-^ presented deficit of attention and memory retention phenotypes, and lower turnover ratio of 5HIAA/5HT in the PFC and of HVA/DA and DOPAC+HVA/DA in the ST. In the ST and HC of THOP1^-/-^ the mRNA levels for dopamine DRD2 receptors were lower compared to WT. High mRNA levels of serotonin 5HT2a receptors mRNA expression in the HC were observed for THOP1^-/-^ compared to WT. It is well documented that serotonin and dopamine play important functions in neuronal communication and in many psychiatric disorders, including depression and schizophrenia that can affect attention and cognition \[[@B88-biomolecules-09-00382],[@B89-biomolecules-09-00382]\]. THOP1 and NLN are oligopeptidases with great similarities in structure \[[@B90-biomolecules-09-00382]\] and substrate-specificity \[[@B25-biomolecules-09-00382]\]. Here, NLN mRNA levels were not seen to be altered in any of the brain regions evaluated in THOP1^-/-^. THOP1 and NLN have not been previously associated to the best of our knowledge with a depressive behavior or a deficit of attention and memory retention. The role of NLN in other pathophysiological conditions has been documented lately but still remains unclear \[[@B9-biomolecules-09-00382]\]. NLN and myosin C gene expression have been shown to be reduced in patients with schizophrenia \[[@B91-biomolecules-09-00382]\]. These results suggest that THOP1^-/-^ causes unbalance of dopamine and serotonin neurotransmitter turnover and also affect the mRNA expression of their respective receptors. Thus, it is possible that each of these individual changes could be contributing to the overall changes in behavior phenotype alterations observed in THOP1^-/-^ mice. In conclusion, the present report corroborates the previously anticipated biological significance of THOP1 in neurodegeneration, inflammatory diseases, and peptide metabolism. A role of THOP1 in the regulation of specific mRNA levels, depression-like behaviors, and deficit of attention and memory retention were first suggested herein. Therefore, THOP1 knockout mice reported here for the first time can be a new tool to investigate new drugs for neurodegenerative and inflammatory diseases as well as psychiatric disorders such as depression and deficit of attention. 4. Experimental Procedures {#sec4-biomolecules-09-00382} ========================== 4.1. Animals {#sec4dot1-biomolecules-09-00382} ------------ Animals were kept with free access to food and water in a room with controlled temperature (22--23 °C) and in 12 h light/dark cycles with lights on at 6:00 a.m. All experiments were conducted using THOP1^-/-^ or WT, males or females, 4--16 weeks old, raised in our local animal facility at Biomedical Science Institute, Pharmacology Department Unit 2, University of São Paulo, SP, Brazil. The animals were maintained and used in accordance with the guidelines of the National Council for Control of Animal Experiments (CONCEA), following international norms of animal care and maintenance. For each behavioral task, we used a different cohort of animals (naïve) to avoid unreliable results. Thus, we hereby state that all experimental protocols were previously approved by University of São Paulo Ethics Committee Councils from Biomedical Science Institute (approval number for mice experimentation ICB/USP Nº 70/2015). 4.2. Generation of THOP1^-/-^ {#sec4dot2-biomolecules-09-00382} ----------------------------- THOP1^-/-^ gene-trap knockout mouse strain was generated by C57BL/6 blastocyst micro-injection of genetically modified embryonic stem cells (CSG163, 129ola) obtained from Baygenomics through the International Gene-Trap Consortium. Briefly, the genetically modified THOP1 allele of the CSG163 strain has the gene-trap vector pGT0Lxf inserted at the intron 5 of the THOP1 gene localized on chromosome 10. These data were confirmed by sequencing 5′RACE cDNA from the original CSG163 ES cell lines used to generate this mouse strain. After transmission of the knockout allele from chimera to F1 generation, THOP1^-/-^ mice were obtained from heterozygous breeding and the line was further maintained with the mixed background by breeding +/− with +/− animals. To obtain such mice with a pure genetic background, we bred F1 (129/OlaHsd/C57BL/6 background) heterozygous THOP1-deficient animals to the inbred C57BL/6 mouse line (Charles River) for at least 10 generations before using them for experimental investigations. 4.3. Genotyping {#sec4dot3-biomolecules-09-00382} --------------- Genotyping was conducted as previously described \[[@B92-biomolecules-09-00382]\]. Briefly, DNA samples were extracted from the tail of the mice in 50 μL of lysis buffer (100 mM TrisHCl, 5 mM EDTA, 0.2% SDS, 200 mM NaCl) and 8 μg proteinase K, incubated at 55 °C under 300 rpm for 6 h. Subsequently, the mixture was incubated at 95 °C for 10 min without stirring. After this step, 500 μL of buffer containing EDTA (1 mM), Tris-HCl (10 mM, pH 7.5), and 15 μg Rnase A (Purelink Rnase, Invitrogen, Pleasanton, CA, USA) was added and incubated for another 10 min at 37 °C. The genomic DNA samples were obtained and stored at −20 °C before the use. PCRs were conducted using the Amplitaq Gold 360 Master Mix (Applied Biosystems, Foster City, CA, USA) and 2 μL of the genomic DNA samples obtained as described above. The following oligonucleotide sequences were used; pCSGf2 (5′GAGTCGGGACCTTGGAGC3′), pCSGKOR2 (5′TTAAC TATGCGGCATCAGAGC3′), and pCSGwtR4 (5′CACCAGGGAATGAGCCAC3′). The PCR cycles used were 95 °C for 3 min (1×), 95 °C for 15 s, 60 °C for 15 s (40×), 72 °C for 30 s, 72 °C for 7 min (1×), and 4 °C until the end of the reaction. The PCR products were applied to 1.5% agarose gels containing 20 μL of Safe DNA developer (Sybr Safe 10,000×, Thermo Fisher, Waltham, MA, USA), analyzed and digitally stored. 4.4. Enzymatic Activity {#sec4dot4-biomolecules-09-00382} ----------------------- The enzymatic activity of THOP1 and NLN were determined in triplicates using a continuous assay with a quenched fluorescent substrate ((QFS) 7-met \[[@B93-biomolecules-09-00382]\] hoxycoumarin-4-acetyl-P-[l]{.smallcaps}-G-P-dK-(2,4-dinitrophenyl) as previously described \[[@B5-biomolecules-09-00382]\]. Pro-Ile (5 mM) was used as a specific inhibitor of NLN, as previously described \[[@B21-biomolecules-09-00382]\]. The results were expressed as arbitrary units of fluorescence (UAF) per minute normalized by protein concentration. 4.5. Blood Count Analysis and Coagulation {#sec4dot5-biomolecules-09-00382} ----------------------------------------- Blood aliquots (20 µL) were taken from the tail and diluted in 1 mL of phosphate buffer saline for total blood cell counting with an automatic cell counter (BC2800 Vet Analyzer, BioBrasil, São Paulo, SP, Brazil) \[[@B94-biomolecules-09-00382]\]. The coagulation tests were performed using a computerized ROTEM^®^ four-channel system (Pentapharm, Munich, Germany), according to the manufacturer's instructions for the standard nonactivated ROTEM^®^ method (NATEM) during 1 h. Whole blood samples were manually collected into syringes containing 1:10 (v/v) 3.2% trisodium citrate from mice (n = 3--4) anesthetized with isoflurane at 2--3% in medicinal oxygen by venous puncture of peripheral blood. Parameters such as clotting time (CT), clot formation time (CFT), alpha angle, maximum clot firmness (MCF), A05 to A30, and maximum lysis (ML) were determined automatically according to previous descriptions \[[@B55-biomolecules-09-00382]\]. 4.6. EAE Induction {#sec4dot6-biomolecules-09-00382} ------------------ EAE was induced as previously described \[[@B95-biomolecules-09-00382]\], with some modifications. Briefly, 24 h before immunization 20 µL of blood was collected from tail and diluted in 1 mL of phosphate buffer saline, pH 7.5, and immediately read in a BC2800 vet analyzer (BioBrasil, São Paulo, SP, Brazil) to quantify white blood cells. On the day of immunization (day 0), WT females were subcutaneously injected with 150 µg of MOG35-55 peptide (Proteimax Biotechnology LTD, São Paulo, SP, Brazil), emulsified in artificial spinal fluid (v/v) with 400 µg heat-killed Mycobacterium tuberculosis. Also, 200 ng of Bordetella pertussis toxin was administered intraperitoneally (I.P.) twice, at 0 and 48 h postimmunization. The animals were evaluated daily based on clinical scores: 0: without disease; 0.5: loss of tail tonus; 1: hind limb weakness; 2: one hind limb paralyzed; 3: complete hind limbs paralysis; 4: hind limbs paralyzed, weakness in forelimbs; 5: tetraplegia or death. After euthanasia by decapitation on the 26th dpi, dorsal hippocampus and spinal cord were briefly dissected and immediately stored at −80 °C for further analysis. 4.7. Sepsis Induction {#sec4dot7-biomolecules-09-00382} --------------------- For all experiments, male C57BL/6 mice (weight, 18--20 g) were used. The animals were housed in cages in temperature-controlled rooms and received water and food ad libitum. Sepsis was induced through CLP as described elsewhere \[[@B80-biomolecules-09-00382],[@B96-biomolecules-09-00382]\]. Briefly, animals were anesthetized with isoflurane; the abdominal region shaved and disinfected with iodinated alcohol. Then a laparotomy in the linea alba was performed and cecum exposed and ligated. To induce mild sepsis, one through-and-through puncture with a 21 G needle were performed and animals sutured in two layers. After the procedure, animals where hydrated with 1 mL of 0.9% saline s.c. and kept in warm light until full recovery of the surgery. Sham animals were anesthetized, operated, cecum exposed and repositioned, sutured, hydrated and kept in warm light. During the first 12 h after CLP, the mortality was checked each hour. After that, animals were checked every 12 h for a total of 7 days. 4.8. Western Blot Assays {#sec4dot8-biomolecules-09-00382} ------------------------ Western blots were conducted as previously described with some modifications \[[@B97-biomolecules-09-00382]\]. Briefly, electrophoresis was performed using a 10% polyacrylamide gel and the Mini-Protean^®^ Tetra Cell apparatus (BioRad Laboratories, Inc., Hercules, CA, USA). The proteins from 10,000× g supernatant were combined with an equal or a quarter part of the supernatant volume with Laemmli's buffer (BioRad Laboratories, Inc. USA; complemented with 5% mercaptoethanol) and boiled at 95 °C for 5 min. Protein samples (60 µg/lane) were size-separated in 10% SDS-PAGE gel (90 V), and then blotted onto Immobilon^®^ PVDF membrane (EMD Millipore Corporation, Temecula, CA, USA). Ponceau S method was used to ensure equal protein loading on the immunoblot. Blots were blocked with 5% nonfat milk or bovine serum albumin (BSA), diluted in TBS-T buffer (50 mM Tris-HCL, 150 mM NaCl, 0.1% Tween 20, pH 7.5), for 1 h at room temperature and subsequently incubated overnight at 4 °C with specific anti-THOP1 antiserum (1:2000; Proteimax Biotechnology LTDA, São Paulo, SP, Brazil), anti-TNF-α (1:1000; Cell Signaling Technologies, Danvers, MA, USA) and anti-TLR4 (1:1000; Santa Cruz Biotechnology, Dallas, TX, USA) as previously described \[[@B34-biomolecules-09-00382],[@B35-biomolecules-09-00382]\]. After incubation with the primary antibody, the membrane was then probed with a secondary antibody conjugated to horseradish peroxidase (dilution of 1:2000; Cell Signaling Technologies, Danvers, MA, USA), for 2 h at room temperature and developed by ECL-Immobilon^®^ reagent (EMD Millipore Corporation, Temecula, CA, USA). Chemiluminescent bands were recorded using ChemiDoc MP Imaging System Detection System and Image Lab software (BioRad Laboratories, Inc., USA). 4.9. Quantitative Real-Time PCR (qRT-PCR) {#sec4dot9-biomolecules-09-00382} ----------------------------------------- To determine specific mRNA expression in prefrontal cortex, hippocampus, hypothalamus, and striatum were dissected as indicated \[[@B98-biomolecules-09-00382]\] and quantitative real-time PCR (qRT-PCR) were conducted \[[@B99-biomolecules-09-00382]\]. Animals were decapitated under inhalant anesthesia with isoflurane and tissues were removed according to coordinates previously described, snap-frozen in liquid nitrogen, and stored in −80 °C until use. Samples were homogenized, and total RNA was isolated using TRIzol^®^. The total RNA was cleaned in a RNeasy mini kit (Qiagen, Germantown, MD, USA), and the RNA integrity was assessed by electrophoresis on 1% agarose gels. cDNA was synthesized from 2 μg of total RNA with High Capacity cDNA Reverse Transcription Kit (Thermo Fisher, Waltham, MA, USA) using random hexamer nucleotides. Standard curves for all primers were calculated to determine their amplification efficiencies. qRT-PCRs were performed on an ABI Prism 7900 (Applied Biosystems, Foster City, CA, USA) sequence detection system with 20 ng of cDNA, 100 nM primers and Fast SYBR™ Green Master Mix (Thermo Fisher Scientific). We analyzed the results from qRT-PCR assays using Pfaffl equation \[[@B100-biomolecules-09-00382]\]. We calculated the Ct= (Ct of the target gene in WT group − Ct of the target gene in THOP-/- group)/ (Ct of housekeeping gene in WT group − Ct housekeeping gene in THOP-/- group) and, since PCR product is produced exponentially, we transformed the Ct variation ration into fold change using the formula 2^−Ct^. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as reference gene and we set control group (WT) as 1 in order to show the proportional variation of THOP^-/-^ group compared to WT group. Besides GAPDH, we have also used hypoxanthine guanine phosphoribosyl transferase (HPRT) and ribosomal protein L19 (RPL19) as housekeeping genes, since HPRT and RPL19 have shown some variation in mRNA levels among THOP1^-/-^ and WT (data not shown), GAPDH was what best fulfill housekeeping feature. Primer sequences used herein were as shown below ([Table 3](#biomolecules-09-00382-t003){ref-type="table"}). 4.10. Global Gene Expression Analysis by Affymetrix GeneChip Mouse Gene 2.0 ST Array Platform {#sec4dot10-biomolecules-09-00382} --------------------------------------------------------------------------------------------- Microarray analyses were conducted to compare gene expression of WT and THOP1^-/-^ using mice Affymetrix (Thermo Fisher Scientific, USA) GeneChip Mouse Gene 2.0 ST Array platform, as previously described \[[@B101-biomolecules-09-00382]\], and [Supplementary Information](#app1-biomolecules-09-00382){ref-type="app"} Microarray Data. Briefly, animals were euthanized by decapitation and the brain was rapidly removed from the skull, and multiple brain regions were dissected (hippocampus, hypothalamus, striatum, and prefrontal cortex) with the aid of an atlas of mouse anatomy. The dissected tissues were frozen with the aid of dry ice and stored at −80 °C until the time of extraction of the RNAs. RNA extraction was performed using the TRIzol^®^ reagent (Thermo Fisher, USA) according to the protocol available from the manufacturer. The homogenizer's metal stand and stem were previously cleaned with a mixture of 10% Extran^®^ (Merck Millipore, Burlington, MA, USA), 70% ethanol, 0.1 M hydrochloric acid, and RNase. Next, 400 μL of TRIzol^®^ was added to the tube containing the still-frozen tissue, and homogenization was continued until the tissue fragment completely disappeared. At that time, a further 500 μL of TRIzol was simultaneously added in all tubes which were left at room temperature for 5 min when 200μL of chloroform was added and the vortex homogenized for 15 s, followed by standing at environment temperature for 3 min. The samples were then centrifuged at 4 °C for 15 min at 12,000× g, when separation occurred in 3 distinct phases. The RNAs were precipitated for 10 min after addition of 500 μL of pure isopropanol at room temperature, followed by centrifugation for 10 min at 4°C at 12,000× g. The supernatant was carefully removed and the pellet rinsed with 75% ethanol followed by a further centrifugation step for 5 min 4 °C at 10,000× g. The excess ethanol was carefully removed and the RNAs left dehydrating at room temperature when 75 μL of diethyl pyrocarbonate (DEPC)-containing water was added and allowed to incubate for 10 min at 60 °C, and then on ice at approximately 20 min when the samples were stored in a freezer at −80 °C until the moment of use. The integrity of the RNAs was first evaluated by agarose gel electrophoresis observing the presence of bands for 28S and 18S ribosomal RNA. In order to further guarantee the integrity of the samples, the integrity of the RNAs was monitored by capillary electrophoresis (Bioanalyser Agilent, Santa Clara, CA, USA). The purification of messenger RNAs (mRNAs) was performed by the silica method, using the Qiagen kit (RNeasy; Qiagen, Germantown, MD, USA). Subsequently, the samples were prepared for hybridization according to the manufacturer's guidelines using the Ambion kit (Affymetrix^®^ GeneChip^®^ Whole Transcript Expression Arrays; Affymetrix; Thermo Fisher, Waltham, MA, USA). Samples were hybridized to GeneChip^®^ and subjected to final wash of the arrays as instructed by the manufacturer (Affymetrix; Thermo Fisher, Waltham, MA, USA). Data were collected and analyzed using specific software (TAU GC Bioinformatics, SP, Brazil; Microarray Supporting Information). Differential gene expression analyses were performed in specific areas of the CNS such as, hippocampus, hypothalamus, striatum and prefrontal cortex. For microarray data analyses we used LIMMA method, considering differences from WT/THOP1^-/-^ that were ≥1 and p ≤ 0.001. 4.11. Peptide Extraction {#sec4dot11-biomolecules-09-00382} ------------------------ Peptide extracts were prepared from WT or THOP1 mice as previously described \[[@B102-biomolecules-09-00382]\]. Briefly, mice were sacrificed by decapitation and the head was immediately irradiated in a conventional microwave oven for 8 s (1500 watts, ELECTROLUX) to inactivate protein and peptide degradation. The brains were rapidly removed from the skull and the hippocampus, striatum and cortex areas were collected separately. For each sample, structures from four animals were used. The samples were sonicated twice for 20 s at 1 pulse/s in 1 mL ice-cold water using an ultrasonic processor (Fisher Scientific, Lenexa, KS, USA). The homogenates were incubated at 80 °C in water bath for 20 min and then cooled on ice and acidified with 0.1 M HCl to a final concentration of 10 mM HCl. The homogenates were centrifuged at 13,000 g for 40 min at 4 °C and the supernatants were collected and filtered through Millipore membrane (MCWO 10000---Amicon Ultra, EMD Millipore Corporation. Billerica, MA, U.S.A.) to remove proteins larger than 10 kDa. The flow-through was applied to C18-like Oasis columns (Waters, Milford, CT, USA), eluted with 100% methanol/0.15% trifluoroacetic acid. The peptide extracts were resuspended in 100 μL of deionized water and kept at −80 °C before used. 4.12. Peptide Quantification {#sec4dot12-biomolecules-09-00382} ---------------------------- The peptide concentration was determined using fluorescamine, at pH 6.8, as previously described \[[@B103-biomolecules-09-00382]\]. Briefly, 2.5 μL of each sample was mixed with 25 μL of 0.2 M phosphate buffer (pH 6.8) and 12.5 μL of a 0.3 mg/mL fluorescamine solution in acetone. After vortexing for 1 min, 110 μL of water was added and fluorescence was measured with a SpectraMax M2e plate reader (Molecular Devices, San Jose, CA, USA) at an excitation wavelength of 370 nm and an emission wavelength of 480 nm. The peptide 5A (LTLRTKL), of known composition and concentration, was used as the standard reference for determining the peptide concentration \[[@B93-biomolecules-09-00382]\]. 4.13. Dimethyl Isotopic Labeling for Peptide Semi-Quantitative Analyses {#sec4dot13-biomolecules-09-00382} ----------------------------------------------------------------------- Peptide samples were labeled as previously described \[[@B45-biomolecules-09-00382],[@B93-biomolecules-09-00382],[@B104-biomolecules-09-00382]\]. The labeling method employed is based on the dimethylation of amine and formaldehyde groups in the presence of cyanoborohydride. Here, two isotopic forms were used and the final product of these reactions adds 28 or 32 Da to the final mass of peptides at each available (lysine or N-terminal) labeling site, which can be observed in the MS spectrum. The labeling schemes for each brain are summarized in [Supplementary Information](#app1-biomolecules-09-00382){ref-type="app"}---MS Data. Briefly, 5 μg of peptide extract was diluted in 100 μL TEAB buffer to a final concentration of 100 mM. In the hood, 4 μL of the different isotopic forms of the formaldehydes were added at a concentration of 4% according to the desired labeling scheme. Then, 4 μL of 0.6 M NaBH 3 CN was added and the samples incubated for 3 h at room temperature. After this time, the reaction was quenched with 16 µL of 1% ammonia. Finally, 8 µL formic acid was added and the two differentially labeled samples were pooled, desalted using C18 columns (OASIS; Waters, Milford, MA, USA), and eluted with 100% acetonitrile containing 0.15% trifluoroacetic acid (TFA). The samples were dried in a vacuum centrifuge and stored at −20 °C. 4.14. Liquid Chromatography (LC) and Mass Spectrometry (MS) {#sec4dot14-biomolecules-09-00382} ----------------------------------------------------------- LC-MS analyses were performed by online liquid chromatography in an Easy-nLC II nanoHPLC system coupled to an LTQ-Orbitrap Velos (Thermo Fisher Scientific, Bremen, Germany) through a nanoelectrospray ion source. Separation was carried out in a column (ID 360 μm OD × 100 micron) packed in-house with 5-µm Jupiter^®^ C-18 beads (Phenomenex, Torrance, CA, USA). Peptides were eluted with a linear gradient of 5 to 45% acetonitrile, in 0.1% formic acid, for 90 min at 200 nL/min. The data were automatically acquired after the generation of multiple peptides protonated by the ESI (electrospray ionization), followed by the dissociation MS/MS (Top 10) by the collision with nitrogen (CID) in an intensity of 10 to 30 eV, 2.3 kV. The injection time on the ion-trap is fixed at 100 ms and the FT-MS injection with a resolution of 1000 ms, 30,000 at m/z 300--1800. Fragmentation scanning was performed with a minimum of 5000 counts and a dynamic exclusion in 70 s. The RAW extension files were analyzed using the Mascot softwares (using the SwissProt database) and Xcalibur. The identified peptides were selected according to criteria that should appear in at least 2 replicates of each region and analyzed condition. 4.15. MS/MS Data Analyses {#sec4dot15-biomolecules-09-00382} ------------------------- To identify peptides, MS/MS data were analyzed using the Mascot search engine (Matrix Science Ltd., London, UK). Briefly, the raw files generated by the mass spectrometer were converted to text format files (mgf) by the Mascot Distiller program version 2.1.1 (Matrix Science Ltd., UK) and submitted to the Mascot Search Database searched included mouse SwissProt. No cleavage site was specified. Modifications included the reductive dimethyl labels, N-terminal protein acetylation and methionine oxidation. Mascot searches were followed by manual interpretation to eliminate false positives. Several criteria were used to accept or decline the peptides that were identified by MASCOT: (1) the majority (\>80%) of the major MS/MS fragment ions matched predicted a, b, or y ions; (2) a minimum of five fragments ions matched b or y ions; and (3) the number of tags incorporated into the peptide matched the number of free amines (N terminus and side chains of Lys). Quantification was performed by measuring the ratio of peak intensity for the various Dimethyl labeled peptides pairs in the MS spectra. For these analyses, the monoisotopic peak and the peaks containing one and two atoms of ^13^C were used. Multiple scans of the MS spectra were combined prior to quantification. 4.16. Animal Behavior Tests {#sec4dot16-biomolecules-09-00382} --------------------------- The behavioral tests used (hot plate, open field, forced swimming, high cross maze, object recognition, passive avoidance, Barnes labyrinth, and prepulse inhibition) were used to evaluate phenotypic changes in THOP1^-/-^ compared to WT mice, as previously described \[[@B105-biomolecules-09-00382],[@B106-biomolecules-09-00382],[@B107-biomolecules-09-00382],[@B108-biomolecules-09-00382],[@B109-biomolecules-09-00382],[@B110-biomolecules-09-00382],[@B111-biomolecules-09-00382],[@B112-biomolecules-09-00382],[@B113-biomolecules-09-00382],[@B114-biomolecules-09-00382],[@B115-biomolecules-09-00382],[@B116-biomolecules-09-00382],[@B117-biomolecules-09-00382],[@B118-biomolecules-09-00382]\]. 4.17. Hot Plate {#sec4dot17-biomolecules-09-00382} --------------- In the hot plate test \[[@B119-biomolecules-09-00382]\], mice were placed on a metal surface kept at 50 °C. The time interval between placement and licking of both anterior feet was recorded as response latency. Animals were at different time points, and a 30 s cutoff was used to minimize tissue damage. Results were analyzed by comparing the difference between pre- and post-treatment/experiment by two-way ANOVA followed by Bonferroni's multiple comparison test. 4.18. Forced Swim Test {#sec4dot18-biomolecules-09-00382} ---------------------- This test is aimed to evaluate depression symptoms in animals and is divided into 2 phases: training and testing. In the training, the animals were individually placed in a cylindrical tube (25 cm high) containing water up to 16 cm high, under a temperature of 25 °C, for 15 min. After 24 h, the test was performed, where the animals were submitted to the same training conditions, but for 5 min. The animals were filmed and evaluated during both training and test phases \[[@B108-biomolecules-09-00382]\]. During the test, the latency time that each animal took to become immobile for the first time, as well as the time of immobility of the animal in a period of 5 min was evaluated. 4.19. Tail Suspension Test {#sec4dot19-biomolecules-09-00382} -------------------------- Tail suspension testing was conducted as previously described \[[@B109-biomolecules-09-00382],[@B110-biomolecules-09-00382]\]. The tail suspension test is based on the observation that a mouse suspended by the tail shows alternate periods of agitation and immobility The mouse, acoustically and visually isolated, was hung on the hook by an adhesive tape placed 20 mm from the extremity of its tail and it was kept 150 mm away from the nearest object. Both the latency and immobility time were manually registered by an observer who was previously unaware of the mice phenotype. Each mouse (n = 8--14) was used only once for each experimental session. Like the FST, the TST is based on the observation that rodents (almost always mice) after initial escape-oriented movements, develop an immobile posture when placed in an inescapable stressful situation. In the case of the tail suspension test the stressful situation involves the hemodynamic stress of being hung in an uncontrollable fashion by their tail whereas in the forced swim test mice were placed in a cylinder filled with water \[[@B111-biomolecules-09-00382]\]. 4.20. Passive Avoidance Test (Step-Down) {#sec4dot20-biomolecules-09-00382} ---------------------------------------- Step-down tests were conducted as previously described \[[@B119-biomolecules-09-00382]\]. Briefly, the apparatus consists of a rectangular metal box (40 × 30 cm), one of the walls being acrylic and transparent, with the floor surface formed by steel rods. In one corner of the box there is a leakage area (200 mm × 75 mm). During the test, a low-power shock is emitted, so that the entire surface of the ground is reached, except for only the rectangular platform. During 5 min of training, the mice were placed on the platform. The animals that came down from the platform and touched, with their four legs, the ground possessing the steel rods, received an electric shock at the power of 0.6 mA for 2 s, and were removed from the apparatus. The maximum training time was 300 s. After 1 h, in order to analyze short-term memory, the animals were tested with the same procedure, but without electric shock. The latency time of the descent of the animal from the platform to the ground was counted, with a maximum time of 300 s. The test was repeated after 24 h for long-term memory evaluation. After each test, the apparatus was cleaned with 70% ethanol. 4.21. Prepulse Inhibition Test (PPI) {#sec4dot21-biomolecules-09-00382} ------------------------------------ PPI test is a widely used model for detecting sensorimotor gating deficits in humans and animals, similar to those observed in schizophrenia \[[@B120-biomolecules-09-00382],[@B121-biomolecules-09-00382]\]. This paradigm consists on a reduction of the startle reaction to a stimulus when it is immediately preceded by a low-intensity stimulus called prepulse. The PPI deficit is one of the most used paradigms in animal models of schizophrenia, since there is a similarity of the phenomenon in different species, which favors its use in translational approaches \[[@B122-biomolecules-09-00382]\]. Before the start of the test, a calibration of the platforms was performed to ensure an equivalence in sensitivity throughout the experiment in all 4 boxes for acoustic startle response evaluation. This calibration was done by adjusting the gain using a standard weight (50 g) appropriate for the mouse. The animals were placed in a containment cage (80 × 90 × 255 mm) suspended inside a PVC structure connected by four screws to the platform with a stabilizer, which captures the startling response of the animal. The cage and platform are enclosed in a ventilated soundproof enclosure (760 × 485 × 705 mm). The startle reaction of the mice generates a pressure on the stabilizer and analog signals are amplified, scanned and analyzed by software of the SS measurement system (Insight^®^, São Paulo, Brazil). This system also controls other test parameters (acoustic stimulus intensity, interval between stimuli). Two loudspeakers were used as sources of sound stimuli. The test consists of placing the animals in the startle response measurement boxes with a sound seal in the presence of a constant background sound of 65 decibels (dB). After 5 initial min of habituation, the session is started. During the session, three types of stimuli are presented, pseudorandomly distributed in intervals of 20 s in average: (i) 20 pulses (P) of 120 dB for 40 milliseconds (ms) (capable of producing a startle response), (ii) 10 presentations of each prepulse intensity (PP) (75, 80 and 85 dB by 20 ms) 100 ms before the pulse, and (iii) 10 nonstimulus presentations. At the beginning of each session, 10 pulses (120 dB per 40 ms) are presented for the habituation of the animals to this stimulus. This series is not considered for PPI calculations. The percentage of prepulse startle inhibition (PPI) induced by each of the three prepulse intensities was calculated as PPI = \[100 − 100 (PP)/(P)\]. 4.22. Open Field {#sec4dot22-biomolecules-09-00382} ---------------- Open field testing is one of the most widely used tests in animal behavior studies \[[@B123-biomolecules-09-00382]\]. Besides its use for global locomotor activity, the test also allows for measuring exploratory activity and anxiety. The test is performed in an acrylic box in which the floor surface is divided into 9 virtual quadrants of equal size. During the test, the number of quadrants taken by the animal, number of rearing, number of grooming movements, and the number of times the animal traverses the central quadrant \[[@B115-biomolecules-09-00382]\]. For preliminary investigations of general locomotor activity, a 5 min test is sufficient to evaluate gross abnormalities in locomotion; therefore, in this context, the animals submitted to the test were observed during a period of 5 min. The test was performed under adequate lighting conditions, standard light, according to the circadian cycle of the animal. After the test, between the use of one animal and another, the apparatus was cleaned with 70% ethanol, in order to remove odors that can serve as olfactory "tracks". 4.23. Elevated Plus Maze {#sec4dot23-biomolecules-09-00382} ------------------------ This test aims to evaluate the behavior of anxiety and is often used in the phenotypic characterization of knockout and transgenic animals. The apparatus for carrying out the test consists of 2 closed arms and 2 open arms (30 × 5 cm) crossed in the middle, perpendicular to each other, and a central area (5 × 5 cm) raised 1 m from the ground. The mice had access to all arms and were able to move freely between them \[[@B124-biomolecules-09-00382]\]. The animals were placed individually in the central quadrant, facing the open arm, and were free to explore the environment for 5 min. The time of residence in the different compartments, the number of entries in the closed and open arms, as well as the number of dives (head dipping) were analyzed. After the tests the apparatus was cleaned with 70% ethanol before receiving the next animal. 4.24. Barnes Maze {#sec4dot24-biomolecules-09-00382} ----------------- The Barnes maze test resembles both the Morris water maze and radial maze, but it takes advantage of the superior rodent abilities to find and escape through small holes. In addition, the Barnes maze presents advantages for behavioral phenotyping. In contrast to the T maze and radial maze, food restriction is not necessary. In comparison with the Morris water maze, the stress component is lower on dry land, as in the Barnes labyrinth \[[@B125-biomolecules-09-00382],[@B126-biomolecules-09-00382]\]. The rationale of this test is to evaluate learning and spatial memory. The apparatus consists of a circular platform (92 cm in diameter) elevated 105 cm above the ground, with 20 equally spaced holes of 5 cm in diameter and 7.5 cm between the holes. A small black box of acrylic (leakage box) of 10 × 5 × 7 cm was placed under one of the holes. The view from the center of the apparatus is the same for all holes, so the escape box is not directly seen. Different spatial reference cues were placed on the wall, close to the apparatus, in the behavior room and were not modified during the study. The test was divided into 3 phases: (i) Adjustment period: when the animal was placed in the center of the apparatus, covered by a white square box (15 cm high), after 10 s, a metronome and the light directly on the apparatus were connected, and the animal was gently guided to the target hole, which contained the escape box. Once the animal entered the box, the metronome and light were turned off, and the animal remained in the escape box for 2 min. (ii) Period of spatial acquisition: this occurred between days 1 to 4, in which the training was performed, and each animal was placed in the center of the apparatus where all the procedures described in the adaptation period were performed. However, at this stage, the animals were not guided to the target hole, but were able to explore the maze freely. The session was ended when the animal found the target hole and entered the escape box. When the animal found the escape box, the light and the metronome were turned off, and the animal was left in the box for 1 min in the dark. If the animal remained exploring the maze after 3 min, it was led to the escape box and left for 1 min. (iii) Barnes maze test: applied on the 5th day, 24 h after the last training. The same procedure was carried out, except that the target hole was closed. After 90 s, the test was performed in order to analyze if the animal remembered where the escape box was located. On the day of the test, 4 test sessions were performed, and the final result was the mean of the last four tests. During training, the number of total errors (number of wrong holes visited) and latency time (time acquired to find the target hole) were counted as a learning measure. The error was standardized when an animal "dipped" its head into a hole that did not contain the escape box. Several consecutive head "dips" in the same hole were considered as only 1 error. The task is based on the innate preference of rodents for dark and closed spaces as opposed to open areas. Mice are presumed to learn the location of a "leak-hole" using spatial reference points that are fixed relative to the labyrinth (extra-labyrinth tracks) or in the labyrinth itself \[[@B126-biomolecules-09-00382]\]. 4.25. Novel Object Recognition Test {#sec4dot25-biomolecules-09-00382} ----------------------------------- The novel object recognition task is very useful to study short-term memory, intermediate-term memory, and long-term memory, through manipulation of the retention interval, i.e., the amount of time animals must retain memory of the sample objects presented during the familiarization phase before the test phase, when one of the familiar objects is replaced by a novel one \[[@B127-biomolecules-09-00382]\]. The apparatus consists of a simple box with milky white walls, and objects used were made of metal or glass, which facilitated cleaning between sessions with different animals. The test was divided into 3 phases: (i) Habituation phase: before starting the training, the animals were exposed to the box (without the objects) for 10 min, in order to habituate the animal to the apparatus. (ii) Exposure phase: the animals, in turn, were placed in the box with 2 identical objects (A and B) arranged 15 cm away from the wall of the apparatus. The animals were observed for 10 min and then removed and returned to their respective cages. (iii) Test phase: one object already known (B) is replaced by a new object (C) 1 h and 24 h after the training. The animals were observed for 5 min. The exploratory activity was defined as the time the animal spent smelling, licking, touching the new object with the nose or front paws or even when the animal returned the snout to the object at a radius less than or equal to 1 cm. After the tests the apparatus was cleaned with 70% ethanol before receiving the next animal minimizing possible olfactory cues. 4.26. Quantitation of Neurotransmitters and Their Metabolites in Specific Areas of Mice Brain {#sec4dot26-biomolecules-09-00382} --------------------------------------------------------------------------------------------- Mice were euthanized and the brain was rapidly dissected on ice. ST, HC, and PFC were isolated, weighed, and rapidly stored in liquid nitrogen. For neurochemical analyses tissues were homogenized in 0.1 M perchloric acid by manual sonication, centrifuged at 10,000 rpm for 20 min to remove the supernatant, and stored at −80 °C until the determination of monoamine levels. The levels of neurotransmitters and their metabolites (dopamine (DA), 3,4-dihydroxyphenylacetic acid (DOPAC) and homovanillic acid (HVA), and serotonin (5HT), 5-hydroxyindoleacetic acid (5HIAA), and noradrenaline (NOR) were measured by reversed-phase high-performance liquid chromatography (HPLC) using a system (model 6A, Shimadzu, Kyoto, Japan) with an electrochemical detector, as described elsewhere \[[@B128-biomolecules-09-00382],[@B129-biomolecules-09-00382]\]. Briefly, 20 μL samples were loaded into a sample injector, and the mobile phase was delivered at a constant rate of 1.2 mL/min. The runtime for each sample was 15 min, and the concentrations of all neurotransmitters and their metabolites were expressed as nanograms per gram of tissue (ng/g). 4.27. Statistical Analysis {#sec4dot27-biomolecules-09-00382} -------------------------- All results are expressed as the means ± standard error of the mean (SEM). The statistical comparisons were performed using Student's t-test and/or analysis of variance (ANOVA) and/or two-way ANOVA followed by post hoc Tukey's test. Probability less than 0.05 was considered as statistically significant (p \< 0.05). Data were statistically analyzed with GraphPad Prism software (GraphPad Software Inc, San Diego, CA, USA). Thanks are due to Sueli Sayuli Sugama, UNIFESP, for microarray analysis and to Carlos C. Barros and Ines Schadock (Max Delbrück Center for Molecular Medicine, Berlin, Germany) for their help in generating the THOP1-/- mice. The following are available online at <https://www.mdpi.com/2218-273X/9/8/382/s1>. Figure S1: Open field task; Figure S2: Elevated plus maze task; Figure S3: Novel object recognition task. Microarray data; Individual MS identification and quantitation; MS supplementary information; TNF-α crude Western blots; THOP1^-/-^ generation. ###### Click here for additional data file. Conception and design: E.S.F., L.M.C., R.C., C.D.M., N.B.S., V.C.A., R.A.S.E., C.S.D., F.Q.C., B.H.F.L., V.F.B, L.K.I., V.R., J.B.P., and M.B.; THOP^1-/-^ mice generation: M.B., J.B.P., A.O.G., and E.S.F.; Animal experiments: R.D.F., N.B.S., R.A.S.E., M.C.F.G., V.R.O.S., P.R., J.C.F., R.P.L., B.V., F.F.P., V.R., B.C.P., B.H.F.L., V.F.B., and V.C.A.; RT-PCR, Western blots and enzyme activity experiments: R.A.S.E., N.B.S., P.R., and R.D.F.; Peptidomics and mass spectrometry: L.M.C. and L.K.I.; Neurotransmitters and metabolites quantification: R.D.F and J.C.F.; Estrous cycle, blood cells determination, and EAE experiments and analysis: N.B.S., R.A.S.E., and M.C.F.G.; Drafting and final approval of the manuscript: N.B.S., R.D.F., R.C., C.D.M., R.A.S.E., M.C.F.G., P.R., R.P.L., C.S.D., V.R.O.S., F.Q.C., B.H.F.L., V.F.B, B.V., J.R.C., S.T., F.F.P., V.C.A., J.C.F., L.K.I., V.R., B.C.P., A.O.G., J.B.P., M.B., L.M.C., and E.S.F. This work was supported by the Brazilian National Research Council (CNPq) Grants 445363/2014-2, 400944/2014-6, 302809/2016-3, 150077/2015-7, 154044/2016-4 and 449390-4) and the São Paulo Research Foundation (FAPESP) grants 2004/04933-2, 2015/20657-0, 2015/07273-8 and 2016/04000-3. The authors declare no conflicts of interest. ![Generation and characterization of THOP1 knockout mouse. (A) representation of THOP1 gene structure and the location of the CSG163 line gene trap insertion. The position of the THOP1 locus on a schematic representation of the mouse chromosome 10 is shown as a red vertical line (chr10-qC1). The THOP1 exons are represented as blue blocks connected by arrowed lines, blue blocks indicating the coding and black blocks the untranslated regions. The gene trap 5′RACE cDNA sequence for the CSG163 strain is represented as red blocks connected at the 3′ end by dashed red lines to the Beta-Geo exon just downstream of the mouse En2 intron/exon splicing acceptor site (SA) region of the indicated gene trap vector pGT0Lxf. The forward and reverse primers are indicated and represented respectively as green and light blue or pink arrows; (B) typical results obtained by genotyping polymerase chain reaction (PCR) for THOP1^+/-^, THOP1^-/-^ or WT mice (bp: base pairs); (C) Western blots show the presence of a single 78 KDa band corresponding to THOP1 in the different organs investigated in WT mice. Note the lack of this 78 kDa band in THOP1^-/-^ mice in all organs investigated. The differences in Western blot band intensities correspond to the specific expression of THOP1 in the different tissues (highest in testis and kidneys. and lower in the liver); 60 µg of protein from crude 10.000× g supernatant was applied in each lane. The anti-THOP1 antiserum was previously described \[[@B34-biomolecules-09-00382],[@B35-biomolecules-09-00382]\]. (D) THOP1 enzymatic activity was determined in different tissue homogenates from either THOP1^-/-^ or WT mice using the quenched fluorescence substrate Abz-GGFLRRVNH2-EDDnp (QFS) in the presence or absence of NLN inhibitor Pro-Ile (5 mM). Experiments were conducted in triplicates that varied less than 5% among each other and results are presented as mean ± S.E.M. Statistical significance was determined by one-way ANOVA test. Tukey's post hoc. \* p \< 0.05; n = 3 per group.](biomolecules-09-00382-g001){#biomolecules-09-00382-f001} ###### Gene expression of peptidases and proteasome beta5 subunit in different areas of mouse brain. qRT-PCR was used to investigate the mRNA levels for specific peptidases or proteasome beta5-subunit (ProtB5): (A) striatum (ST), (B) hippocampus (HC), and (C) prefrontal cortex (PFC). Neprilysin (NEP), angiotensin converting enzyme 1 (ACE1), prolyl-oligopeptidase (POP), insulin degrading enzyme (IDE), dipeptidyl peptidase 4 (DPP4), or neurolysin (NLN). Results are expressed as mean ± S.E.M. Statistical significance was determined by Student's t-test. \* p \< 0.05. n = 6--9. ![](biomolecules-09-00382-g002a) ![](biomolecules-09-00382-g002b) ![](biomolecules-09-00382-g002c) ![Neurodegeneration induced by EAE and inflammatory profiles. (A) Evaluation of the clinical score over time of WT C57BL/6 female mice and THOP1^-/-^ immunized with MOG^35-55^ emulsified with complete Freund's adjuvant (CFA). Results are expressed as mean ± S.E.M. Statistical significance was determined by two-way ANOVA. Tukey post hoc: \* p \< 0.05. EAE WT n = 18 and EAE THOP^-/-^ n = 15. Western blotting for TNF-α in dorsal hippocampus (B) or spinal cord (C) at 26th dpi; blots (B,C) were cropped (indicated by boxes) from the same membranes that were successively exposed to distinctive antibodies as indicated in Experimental Procedures ([Supplemental Information](#app1-biomolecules-09-00382){ref-type="app"}---TNF-α Western blots). Results are expressed as mean ± S.E.M. Statistical significance was determined by Mann--Whitney test: \* p \< 0.05. EAE WT n = 6. EAE THOP1^-/-^ n = 6. bact: beta-actin.](biomolecules-09-00382-g003){#biomolecules-09-00382-f003} ![Survival curves and behavior analysis of mice undergoing sepsis. (A) THOP^-/-^ and WT mice survivors during 7 days after sepsis induction. Next, survived animals of each group were submitted to Open Field test and Western blot analysis of dorsal hippocampus. Results were expressed as % survival during 7 days (n = 6). (B) Distance tracking in open field task. (C) Total distance performed in Open field. (D) Average speed in open field (E) total immobility time and (F) total immobility episodes. (G) TLR4 and (H) TNF-α expression in total protein extract of the dorsal hippocampus. Behavior tests and Western blots were performed at the 8th day after sepsis induction. Results are expressed as mean ± S.E.M. Statistical significance was determined by Student's t-test: \* p \< 0.05 vs. WT. WT. n = 3; THOP1^-/-^. n = 4.](biomolecules-09-00382-g004){#biomolecules-09-00382-f004} ![Hot plate test. (A) Regular basal nociceptive response of THOP1^-/-^ or WT litter mates, evaluated by the hot plate test at different time points. Note that THOP1^-/-^ latency to nociceptive stimulus is similar to WT at this determined dose of BK (0.1 µM; 40 µL). Data are expressed as mean ± SEM of 4--6 animals per group. Data were analyzed by two-way ANOVA followed by Bonferroni's multiple comparison test. (B) Nociceptive response was evaluated after Bk was injected intraplantar (0.1 µM; 40 µL). Note that THOP1^-/-^ latency to nociceptive stimulus is significantly lower than that of WT. Data presented as mean ± SEM. Data were analyzed by two-way ANOVA followed by Bonferroni's multiple comparison test. \\\\ p \< 0.001 compared to either control (0 min) or to WT (after 5 or 30 min of Bk intraplantar administration).](biomolecules-09-00382-g005){#biomolecules-09-00382-f005} ![Depression-like behavior analysis using the forced swim (FST) and tail suspension (TST) tests. Panel (A): In the FST, Training corresponds to the first day of tests and Test corresponds to the second day of tests. Latency time to the first immobility episode and total period (in seconds) of animal immobility during the 5 min of forced swimming task duration. In both parameters, THOP1^-/-^ mice present a mild (p \< 0.05) depressive-like behavior compared with WT mice. Panel (B): TST were conducted as detailed in Experimental procedures. THOP1^-/-^ have similar latency and higher immobility time compared to WT. Results are expressed as mean ± S.E.M. Statistical significance was determined by Student's t-test: \* p ≤ 0.05 vs. WT. WT. n = 8; THOP1^-/-^. n = 14.](biomolecules-09-00382-g006){#biomolecules-09-00382-f006} ![Prepulse inhibition of startle test. Percentage of prepulse inhibition of startle for each prepulse (PP) intensity: 75 dB (A), 80 dB (B), and 85 dB (C). Note that clozapine (czp) induced a significant increase in PPI response of THOP1^-/-^ at both 80 and 85 dB (B,C), whereas it did not modify the response of WT mice (A--C). Results are expressed as mean ± S.E.M. Statistical significance was determined by one-way ANOVA test. Tukey's post hoc: \* p \< 0.05; \\ p \< 0.01). n = 8. per group.](biomolecules-09-00382-g007){#biomolecules-09-00382-f007} ![Step-down passive avoidance task: in this task, the time the animal takes to step-off from the platform (step-off latency) was determined. The longer the mouse stays on the platform. the greater was the latency for step-off. indicating that the mouse learned the passive avoidance task. WT showed higher latency to step-down during tests as compared to training. THOP^-/-^ showed an impairment of memory retention at training-tests. Results are expressed as mean ± S.E.M. Statistical significance was determined by two-way ANOVA test. Sidak's post hoc: \* p \< 0.05 between WT training (T) and WT 1 h test; \\ p \< 0.01 between WT training (T) and WT 24 h test; No statistically significant differences were observed for the THOP1^-/-^ mice between training and 1 h or 24 h tests. WT. n = 10; THOP1^-/-^. n = 9.](biomolecules-09-00382-g008){#biomolecules-09-00382-f008} ![Neurotransmitters and their metabolites levels in two different brain regions of WT and THOP1^-/-^ mice. No differences were observed among the neurotransmitters and their metabolites in the PFC (A) or ST (B) from WT mice compared to THOP1^-/-^ mice. However, the turnover ratio of 5HIAA/5HT was significantly lower in PFC of THOP1^-/-^ mice (C). Similarly, the turnover ratios of HVA/DA (D) and DOPAC+HVA/DA (E) are lower in ST of THOP1^-/-^ mice compared to WT mice. Results are expressed as mean ± S.E.M. Statistical significance was determined by Student's t-test: \\ p \< 0.01; \\\* p \< 0.001 vs. WT. n = 8.](biomolecules-09-00382-g009){#biomolecules-09-00382-f009} ![Gene expression of 5HT2a and DRD2 in different areas of mice brain. THOP1^-/-^ mice showed upregulation of 5HT2a gene expression in ST (A), HC (B), and PFC (C); whereas, in the same brain areas, DRD2 mRNA showed no changes (A--C). Results are expressed as mean ± S.E.M. Statistical significance was determined by Student's t-test. \* p \< 0.05. n = 6--9.](biomolecules-09-00382-g010){#biomolecules-09-00382-f010} biomolecules-09-00382-t001_Table 1 ###### Relative quantification of peptides from prefrontal cortex (PFC), striatum (ST), or hippocampus (HC). Protein Name Peptide Sequence Average Ratio Average Ratio Average Ratio ---------------------------------------------- ------------------------------------- ----- --------------------- --------------------- --------------------- Acyl-CoA-binding protein ATVGDVNTDRPGLLDL C 1.04 ± 0.32 (3) 1.80 ± 0.66 (3) Acyl-CoA-binding protein GDVNTDRPGLLDL C 1.90 ± 0.58 (3) Acyl-CoA-binding protein KQATVGDVNTDRPGLLDL 2+ C 1.11 ± 0.26 (3) 2.50 ± 1.17 (3) Acyl-CoA-binding protein KQATVGDVNTDRPGLLDL 3+ C 0.46 ± 0.12 (3) 1.03 ± 0.27 (3) 2.20 ± 0.96 (3) Acyl-CoA-binding protein SHFKQATVGDVNTDRPGLLDL C 1.36 ± 0.39 (3) Acyl-CoA-binding protein TVGDVNTDRPGLLDL C 1.07 ± 0.31 (3) 2.60 ± 1.33 (3) Acyl-CoA-binding protein VEKVDELKKKYGI 2+ C 0.4 ± 0.01 (2) 2.3 ± 0.90 (3) Acyl-CoA-binding protein VEKVDELKKKYGI 3+ C 0.4 ± 0.10 (2) 0.91 ± 0.14 (3) 2.07 ± 0.73 (3) ATP synthase-coupling factor 6 KFDDPKFEVIDKPQS M 1.12 ± 0.26 (2) Cerebellin-4 AANSKVAFSAVRSTN V 1.12 ± 0.11 (3) Cerebellin-4 SKVAFSAVRSTN V 0.89 ± 0.21 (3) Clathrin coat assembly protein AP180 ASKGLGSDLDSSLAS (1.52 ± 0.12) M/C 0.53 ± 0.11 (3) 1.08 ± 0.12 (3) 1.05 ± 0.04 (3) Clathrin coat assembly protein AP180 KGLGSDLDSSLASL (1.54 ± 0.16) M/C 0.56 ± 0.14 (3) Clathrin coat assembly protein AP180 SKGLGSDLDSSLASL M/C 0.55 ± 0.12 (3) Clathrin coat assembly protein AP180 SPSPTPATQSPKKPPAKDPLADLNIKDFL M/C 0.51 ± 0.12 (3) 1.17 ± 0.18 (3) 0.99 ± 0.06 (3) Cysteine and glycine-rich protein 1 GQGAGALVHSE N 1.08 ± 0.02 (3) 2.17 ± 0.64 (3) Cytochrome b-c1 complex subunit Rieske ARSGPFAPVLSAT M 0.81 ± 0.19 (3) Cytochrome b-c1 complex subunit Rieske GLNVPASVRF M 0.94 ± 0.21 (3) Cytochrome b-c1 complex subunit Rieske SGQAAARPLVA M 0.86 ± 0.21 (3) 1.01 ± 0.10 (3) Cytochrome b-c1 complex subunit Rieske SGQAAARPLVATV M 0.75 ± 0.14 (3) 1.25 ± 0.20 (3) 0.94 ± 0.08 (3) Cytochrome b-c1 complex subunit Rieske TVGLNVPASVRF M 0.95 ± 0.17 (3) 1.17 ± 0.16 (3) 0.98 ± 0.13 (3) Cytochrome c oxidase subunit 5A GISTPEELGLDKV M 0.49 ± 0.06 (3) 1.05 ± 0.19 (3) 1.51 ± 0.34 (3) Cytochrome c oxidase subunit 5A NDFASAVRILEV (1.43 ± 0.62) M 0.36 ± 0.12 (2) 1.70 ± 0.38 (3) Cytochrome c oxidase subunit 5A RPTLNELGISTPEELGLDKV M 0.42 ± 0.12 (3) 1.20 ± 0.25 (3) 1.53 ± 0.37 (3) Cytochrome c oxidase subunit 6A1 FHNPHVNPLPTGYEDE M 1.09 ± 0.13 (3) 1.12 ± 0.14 (3) Cytochrome c oxidase subunit 6A1 HNPHVNPLPTGYEDE M 0.86 ± 0.13 (3) 1.13 ± 0.36 (3) 1.30 ± 0.20 (3) Cytochrome c oxidase subunit 6A1 NPHVNPLPTGYEDE M 1.07 ± 0.18 (3) Gamma-enolase AGNSDLILPVPAFNVINGGSHAGNKL C 0.76 ± 0.20 (3) Glyceraldehyde-3-phosphate dehyd. AFRVPTPNVSVVDL C/N 1.51 ± 0.09 (3) 0.99 ± 0.09 (3) LIM zinc-binding domain-containing Nebulette TQVVSDAAYKGVQPHVV C 0.59 ± 0.06 (3) 0.93 ± 0.22 (3) Macrophage migration inhibitory factor AQATGKPAQYIA C 0.92 ± 0.12 (3) Macrophage migration inhibitory factor AQATGKPAQYIA C 1.17 ± 0.02 (2) Macrophage migration inhibitory factor AQATGKPAQYIAVHVVPDQL 2+ C 0.65 ± 0.03 (3) 0.87 ± 0.07 (3) Macrophage migration inhibitory factor AQATGKPAQYIAVHVVPDQL 3+ C 0.59 ± 0.12 (3) 1.17 ± 0.07 (3) 0.75 ± 0.15 (3) Microtubule-associated protein 2 AEDVTAALAKQGL C 0.87 ± 0.06 (3) Microtubule-associated protein tau ADEVSASLAKQGL C 0.78 ± 0.24 (3) 1.17 ± 0.16 (3) 0.95 ± 0.12 (3) Neurogranin GRKGPGPGGPGGAGGARGGAGGGPSGD C 0.60 ± 0.10 (3) 0.84 ± 0.03 (3) 1.08 ± 0.30 (3) Neurogranin KGPGPGGPGGAGGARGGAGGGPSGD 2+ C 0.55 ± 0.20 (3) 0.64 ± 0.02 (3) 1.58 ± 0.37 (3) Neurogranin KGPGPGGPGGAGGARGGAGGGPSGD 3+ C 0.78 ± 0.01 (3) 1.63 ± 0.37 (3) Neurogranin RKGPGPGGPGGAGGARGGAGGGPSGD C 0.94 ± 0.20 (3) 1.28 ± 0.55 (3) 1.57 ± 0.38 (3) Peptidyl-prolyl cis-trans isomerase A ADDEPLGRVSF C 0.85 ± 0.14 (3) 1.10 ± 0.02 (3) Peptidyl-prolyl cis-trans isomerase A ADKVPKTAENF (1.59 ± 0.21) C 0.71 ± 0.14 (3) Peptidyl-prolyl cis-trans isomerase A ADKVPKTAENFR C 1.36 ± 0.30 (2) Peptidyl-prolyl cis-trans isomerase A ADKVPKTAENFRAL C 0.77 ± 0.08 (3) 1.26 ± 0.20 (3) Peptidyl-prolyl cis-trans isomerase A EDENFILKHTGPGILSM C 0.80 ± 0.10 (3) Peptidyl-prolyl cis-trans isomerase A ELFADKVPKTAENF C 1.19 ± 0.23 (2) Peptidyl-prolyl cis-trans isomerase A ELFADKVPKTAENFRAL C 0.98 ± 0.35 (3) Peptidyl-prolyl cis-trans isomerase A ITADDEPLGRVSF C 0.66 ± 0.16 (3) 0.88 ± 0.13 (3) Peptidyl-prolyl cis-trans isomerase A LFADKVPKTAENFRAL C 0.93 ± 0.15 (3) Peptidyl-prolyl cis-trans isomerase A FDITADDEPLGRVSF C 1.03 ± 0.22 (3) Peptidyl-prolyl cis-trans isomerase A LFADKVPKTAENF C 0.96 ± 0.22 (3) Peptidyl-prolyl cis-trans isomerase FKBP1A VFDVELLKLE C 0.84 ± 0.13 (3) 1.03 ± 0.22 (3) Phosphatidylethanolamine-binding protein 1 AGVTVDELGKVL C 1.11 ± 0.24 (2) Phosphatidylethanolamine-binding protein 1 AGVTVDELGKVLTPTQV C 1.40 ± 0.04 (3) 0.81 ± 0.11 (3) Phosphatidylethanolamine-binding protein 1 DDYVPKLYEQLSGK C 0.67 ± 0.08 (3) 1.11 ± 0.17 (3) 0.79 ± 0.06 (3) Phosphatidylethanolamine-binding protein 1 DGLDPGKLYTL C 1.06 ± 0.20 (3) Phosphatidylethanolamine-binding protein 1 GLDPGKLYTL C 0.77 ± 0.15 (3) Phosphatidylethanolamine-binding protein 1 GVTVDELGKVLTPTQV C 1.22 ± 0.20 (3) Phosphatidylethanolamine-binding protein 1 KGNDISSGTVL C 1.10 ± 0.12 (3) Phosphatidylethanolamine-binding protein 1 KGNDISSGTVLSDYVGSGPPSGTGL C 1.38 ± 0.04 (2) Proenkephalin-A SPQLEDEAKELQ V 0.69 ± 0.25 (3) 0.83 ± 0.20 (3) ProSAAS ASAPLVETSTPLRL V 1.20 ± 0.22 (2) ProSAAS SLSAASAPLVETSTPLRL V 0.92 ± 0.08 (3) 1.20 ± 0.32 (3) 0.84 ± 0.16 (2) Secretogranin-1 LLDEGHYPVRESPIDTA V 1.71 ± 0.15 (3) Secretogranin-1 SFARAPQLDL V 1.33 ± 0.33 (3) 0.85 ± 0.31 (3) Somatostatin ANSNPAMAPRE (methionine oxidation) V 1.73 ± 0.13 (3) Somatostatin SANSNPAMAPRE V 1.65 ± 0.13 (3) 2.03 ± 0.65 (3) 1.10 ± 0.31 (3) Somatostatin SANSNPAMAPRE (methionine oxidation) V 2.03 ± 0.47 (2) 1.84 ± 0.52 (3) Synapsin-1 AGGPPHPQLNKS C 0.97 ± 0.29 (3) Tubulin beta-2A chain SGPFGQIFRPDNF C 1.07 ± 0.22 (3) 0.80 ± 0.02 (3) Tubulin beta-3 chain DDEESEAQGPK C 2.23 ± 0.57 (2) 1.60 ± 0.24 (2) Peptides shaded in gray were previously found in Nln knockout mice (NLN^-/-^); the number in parenthesis indicate the relative levels of the peptide in whole brain extracts from NLN^-/-^ compared to WT mice \[[@B54-biomolecules-09-00382]\]. C. cytosol; M. mitochondria; N. nucleus; V. vesicles. Numbers in bold indicate changes (bigger than 1.5 or smaller than 0.5) in relative peptides level from WT and THOP1^−/−^. biomolecules-09-00382-t002_Table 2 ###### Complete blood count for wild type (WT) and THOP1^-/-^ animals. WT THOP^-/-^ ------------------- ----------------- --------------------- Granulocytes (%) 21.02 ± 0.63 24.22 ± 0.55 \\ Monocytes (%) 6.62 ± 0.17 7.47 ± 0.27 \* Lymphocytes (%) 72.46 ± 0.62 68.32 ± 0.80 \\ Platelets 10^9^/L 1509.00 ± 73.12 1159.00 ± 108.50 \* Hemoglobin g/L 140.20 ± 1.74 135.30 ± 3.57 WBC 10^9^/L 10.09 ± 1.00 8.64 ± 0.71 RBC 10^12^/L 9.62 ± 0.10 9.25 ± 0.28 RDW 12.80 ± 0.21 13.12 ± 0.29 MCV fL 46.78 ± 0.23 47.37 ± 0.26 MCHC g/L 311.22 ± 0.89 308.50 ± 1.54 White blood cells (WBC). Red blood cells (RBC). Red cell distribution width (RDW); Mean corpuscular volume (MCV); Mean corpuscular hemoglobin concentration (MCHC). \. p* ≤ 0.05; \\. p ≤ 0.001. biomolecules-09-00382-t003_Table 3 ###### Primer sequences. ------------------------------------------------------------------------------------------------------------------------- Gene Sequence Amplicon (bp) Accession Number -------------------------------------------------------- ----------------------------- --------------- ------------------ Neurolysin (Nln) Fwd: CACCCTATCACAGACGAGCT\ 106 NM_029447 Rev: GGGACTGGTCAACTTTGCTC Neprilysin (NEP) Fwd: CCTGAACTTTGCCCAGGTGT\ 148 NM_001289462.1 Rev: GCGGCAATGAAAGGCATCTG Angiotensin I Converting Enzyme 1 (ACE1) Fwd: ACCCTAGGACCTGCCAATCT\ 164 NM_207624.5 Rev: CGTGAGGAAGCCAGGATGTT Prolyl oligopeptidase (POP) Fwd: GGGTGCTCCGACACTAAACA\ 98 NM_011156.3 Rev: GACGGGTACTGGATGTCGTC Insulin Degrading enzyme (IDE) Fwd: GTCCATGTTCTTGCCAGGGA\ 161 NM_031156.3 Rev: TTCACGAGGGGAAACAGTGG Dipeptidyl peptidase 4 (DPP4) Fwd: GACGGCAGAGGAAGTGGTT\ 134 NM_010074.3 Rev: CGCTTGCTATCCACAAATCCC Proteasome subunit beta 5 (ProtB5) Fwd: CCAAACTGCTCGCTAACATGG\ 119 NM_011186.1 Rev: GTTCCCCTCGCTGTCTACG 5-Hydroxytryptamine (serotonin) receptor 2A (5-HT2A) Fwd: GTTTCCTTGTCATGCCCGTG\ 93 NM_172812.2 Rev: CCAGGTAAATCCAGACGGCA Dopamine D2receptor (DRD2) Fwd: ATGGGAGTTTCCCAGTGAACA\ 115 NM_010077.2 Rev: ATGGGGCTATACCGGGTCC Hypoxanthine guanine phosphoribosyl transferase (HPRT) Fwd: TGCTGACCTGCTGGATTACA\ 120 NM_013556.2 Rev: TTTATGTCCCCCGTTGACTGA Ribosomal protein L19 (RPL19) Fwd: CAATGCCAACTCCCGTCA\ 102 NM_009078.2 Rev: GTGTTTTTCCGGCAACGAG Glyceraldehyde-3-phosphatedehydrogenase (GAPDH) Fwd: GTGCAGTGCCAGCCTCGTCC\ 75 BC085275.1 Rev: CAGGCGCCCAATACGGCCAA ------------------------------------------------------------------------------------------------------------------------- [^1]: These two authors contributed equally.
Come with me and I think you'll agree: My life is proof of God's sense of humor. Feb 15, 2013 Mr. Nipples Goes to Parochial School... Several months ago now, we were getting ready to walk His Highness to school one morning, and I got this call... "Hi, this is So-and-So from the Lutheran Preschool and Daycare up the road. Um, your cat is here?" "OK. He's not lost or anything, but thanks for letting me know. He'll come home on his own." "Can you come and get him? He's in the parking lot where parents drop off their kids, so I'm worried about him getting run over, and he was walking around the playground, where the kids go out to play. And some of our kids have allergies, [blah blah blah]..." "Well I'm heading out to take my oldest to kindergarten right now, but we can swing by after that and see if he's still there." "OK, thanks." And so after kindergarten drop-off we kept on walking (I walked. The Littler One and Tiny E were nestled comfortably in the double-jogger), through the neighborhood and up & around to the Lutheran church (which is where the preschool is), just over a half mile from our house. By this time Nipples was long gone, but we took a trip through the parking lot just to make sure. In general I like to remain as inconspicuous as possible, but as luck would have it we arrived just in time for the afternoon preschool drop-off. As I was walking along, pushing a bright yellow stroller amid a line of minivans and crossover SUVs in varying shades of taupe and silver, I caught the eye of the person directing traffic, who also happened to be communicating with those inside the building via radio. I momentarily thought about ducking and running just to make things interesting, but those responsible for young children can get pretty hardcore (using nice voices and kind words, but hardcore just the same), so instead I walked over to say hello. "Hi, I had gotten a call that my cat was here, so I was just stopping by to check in." "Oh yes, that was me who called you. He's gone now, but he was over there, where the children play sometimes." "You mean that space at the edge of the woods? Ah, that's probably how he got over here then, through those woods." "Yes, thankfully no kids were outside at the time. We have some with allergies, plus he's an unknown animal, so we try to have the kids steer clear in general." "I understand. Usually he doesn't stay--he might say hello, but he shouldn't cause any problems. If he does please let me know and I'll see what I can do. If it helps, he's had all his shots and is a friendly guy, especially with kids." "Ok thanks. I have to get back to letting these cars through. Have a nice day." "You too!" I have to say that when considering career possibilities, never once did I expect to become a PR director/liaison for my cat. But sometimes these things come about by way of necessity, and with that portion of the day accomplished, the kids and I headed home. We got about halfway home when who should come sauntering out of the bushes lining the walking path, but Nipples himself. "Well hi Nipples, I hear you've been having a fun time exploring today." "Yeah, I stopped by the church. Said some prayers. Worked on my catechism a little." "You realize we're not Lutheran though, right?" "Speak for yourself!" "Well, I mean, it's OK if you want to be Lutheran. They're more liturgical than our non-denominational leanings, but we agree on Jesus and all of that, I think. I just want you to be aware of your heritage is all. You want to walk home with us?" "I'd rather alternate between darting ahead and following behind, while throwing in a few annoyed meows every so often if that's alright, and then I may duck into the woods just for giggles & grins, but yes, I'll join you at the house shortly." "That's cool. Let's go home." It was after this trip that we started to muse about getting Nipples one of those homing devices for his collar, if nothing else to see exactly how far he roams. As of yet we haven't done it. We still could, but for reasons that will be revealed he seems to have tightened his radius, at least for now. Because Nipples didn't stop with the Lutheran school, and he didn't settle for the parking lot... Folks I Frequent Fantastic Finds Comment Policy Please be kind. Like, super-kind. If you have a question, feel free to ask. If you have a differing viewpoint and can share it KINDLY, feel free. If you are concerned about my salvation (or want me to be LESS concerned about mine), or want to incite drama or tell me something "for my own good," send it in an email (skerri_bATyahooDOTcom). If you just plain don't like me and/or my blog, maybe just click on through to a different blog altogether--we'll both be happier. If you choose to disregard this request, the consequences may range from comment editing/removal to overall banning. And probably a figurative kick to the shins. I don't usually get TOO serious, but I will in order to keep this a safe place for all. Extra Text I just thought it would be really interesting to add some text here, to make my page more symmetric next to my comment policy over there. Which I was serious about, by the way. We nervous-types get riled up pretty easily, and really who needs that? I sure don't. I mean, I write about a cat named Nipples, for goodness' sake. Obviously I'm not going for scholarly discussion here (but if it pops up every so often that's OK). There are lots of venues for debate and sharpening your skills and all that, and that's OK; it really is. It's just that this is not that place. This is where we laugh at ourselves and tell each other how great we are, without being fake or sugary. There's a skill for you--now go practice.
Belkin Router Setup \|+1 844 245-8772 \| Setup for Belkin Router Belkin routers are amongst the top-performing routers that have carved their name in the market. This handy device allows you to access high-speed internet hassle-free. It has a huge number of features which makes this device the top choice of users all around the world. But one thing that is most liked by every user is the anti-aging performance that this device offers. One this device is put to use, it keeps on working without giving any issues. If you have already bought it, then be confident about your decision as they are made with the latest technology, keeping you connected to the online world with high internet speed. To avail its features, you need to perform a Belkin Router Setup procedure. In this guide, we have covered the process of setup from scratch so that any user can put the device to use with the need for expert guidance. This article intends to give you detailed information on How to Setup a Belkin Router? The steps compiled here are accurate and taken from official sources. To clear your doubts, you can contact us through our toll-free number. What features compel you to choose Belkin router? Belkin router is a house of awesome features which allows you to access high-speed internet without any issues. Find the features mentioned below and know why people from all across the globe choose it for their purpose. High WiFi speed:- A good WiFi speed is something that we all want. With Belkin routers, you will receive high speed up to 300 Mbps, 600 Mbps, 1200 Mbps, 1900 Mbps and so on. Wireless Standard:- The Institute of Electricals and Electronics Engineers has set some wireless protocols to measure the router’s performance. Newly launched Belkin wireless routers come with 802.11 AC which is considered as standard protocol. Long-range connectivity:- Along with the wireless standard and high WiFi speed, they provide long-range connectivity to connect devices even at a distance of router. Enhanced wireless security:- Online security is important especially when you keep your crucial data on emails or at other platforms. With Belkin router, you get enhanced security features to ensure your complete data privacy. You will find a lot more options to safeguard your network from hackers. Belkin Router Setup Procedure Follow these step by step instructions to set up your Belkin router. If at any point, you need any help, then you can immediately contact us through our toll-free number. Disconnect your Belkin router and modem from their power supply. Use an Ethernet cable and connect your Belkin router to the modem. Now, reconnect both modem and router to their power supplies. Next, connect your router to your computer using an Ethernet cable. Open a web browser on your computer and enter “192.168.2.1”(default IP) into the address bar. Belkin Router Setup Page will appear on your screen. Use admin in the username and click on Login. Leave the password field blank. Locate your cursor to Connection type and click on it. Choose from your connection types option and click next. (Most of the users click on Dynamic) Now, enter the network details provided by your ISP (internet service provider). This is how you can easily finish your Belkin Wireless Router Setup procedure. Now check your device’s internet connection and get a confirmation of “Connected”. Useful tips to apply when your Belkin router stops working Make use of these given troubleshooting points and resolve Belkin router issues. Do not keep your router between any objects so that there won’t be any interruption an d establishing a strong internet connection. Check if your Ethernet cable you are using is good to use or not. Clear internet browser’s cache and history and access the web-based setup again. Power cycle your modem and router. Lastly, reset your Belkin router by pressing the small button on the device. Contact Belkin service team to resolve your router Issues If you need any kind of help regarding Belkin router setup, its page or any kind of issue, you can call us on our toll-free number +1 844 245 8772. We will help you with every possible issue you have with your router.
Thomas Billington Thomas Billington may refer to: Thomas Billington (executioner) (1872–1902), English executioner Thomas Billington, better known as Dynamite Kid (1958–2018), English professional wrestler
living on plastic, baby mood: satisfied music: Heart - Rage coffeeem convinced me, and I just tried out Zombies, Run! And ran 3.62 miles in 36 minutes. And then realized I had forgotten to use my inhaler before heading out. And then nearly got eaten by zombies because sprinting, not so much. I think it's time I admitted to myself that I have a problem. I may be addicted to running aps. Pullups.Half marathon.Ten minute miles--more than one, in a row. Indoors. Outdoors.I will deadlift a me. I will bench three digits. I will kick up to handstands at home, when there is no comforting pad under me.Free headstand.And I will climb 5.10 reliably, rather than on good days and easy routes.
Hebridean Island Cruises returns to being independently owned Hebridean Princess starts new 2017 season on March 1 Hebridean Island Cruises, formerly part of All Leisure Holidays, has returned to being an independently owned British cruise company having been brought by investors led by the collapsed firm’s majority shareholder, Roger Allard. The company's sole vessel, Hebridean Princess, recently completed her annual dry docking and is undergoing the upgrading of around one third of her cabins before returning to service in March 2017. Carrying up to 50 guests with a crew of 38, the luxury ship has been chartered twice by Her Majesty Queen Elizabeth II for Royal family holidays off the Scottish west coast. The first cruise of the 2017 season commences on March 1, when guests embark on the Clyde Island Explorer itinerary. During 2017 Hebridean Princess will make a return to Norway to explore the fjords and islands between Stavanger and Bergen in a series of three itineraries. Hebridean has introduced a variety of new cruises in familiar cruising grounds off the west coast of Scotland, together with visits to the Gaelic neighbours of Northern Ireland and the Isle of Man and its 2017 calendar includes four fresh 'Footloose' walking itineraries. Further themed cruises have been specially designed for lovers of food and drink, history and heritage, golf, gardens, nature and wildlife. Hebridean's European River cruise programme features Royal Crown and includes itineraries on the Rhine, Danube and Main.
INTRODUCTION {#sec1-1} ============ Type 1 diabetes mellitus (T1DM) is a T-cell mediated, organ-specific autoimmune disorder leading to β-cell destruction and reduced insulin production and has no definitive cure currently. Standard treatment strategies for T1DM are based on different insulin replacements. However, as exogenous insulin cannot mimic exactly the physiology of insulin secretion, good metabolic control is difficult to reach and frequently associated with severe hypoglycemic episodes.\[[@ref1]\] At present, pancreas transplantation or islet transplantation as a treatment of T1DM is here to stay until something better comes along. The first efforts focused on whole pancreas transplants, which have been performed now for over 50 years. Although they have been shown to lead to insulin independence for several years, pancreas transplants to treat T1DM are not widespread for a number of reasons. Being a major surgery, the accompanying risk of mortality is 1-3% and the complications that ensue include cardiac death and systemic infections. In addition, to prevent the body from rejecting the transplanted pancreas, recipients must take powerful immunosupressions for the rest of their lives, leaving them susceptible to infections and a range of other diseases. Many feel that the immunosupressions therapy could be a greater health threat than the diabetes itself.\[[@ref2]\] In an effort to more tightly control blood glucose levels, researchers began to explore the possibilities of using cell-based therapies that would replace lost β-cells. Within recent years, stem cell research has become a very important part of the scientific understanding of T1DM. Research has demonstrated that stem cells can be grown in the lab and could lead to a better availability of β-cells for future research purposes to treat T1DM. Many types of stem cells are candidates for the treatment of T1DM.\[[@ref3]\] The ideal stem cells would be the one with strong immunomodulatory and regenerative properties which would have to deal with active process of autoimmunity that probably target the newly formed insulin-producing cells (IPCs). Mesenchymal stem cells (MSCs) have been a driving force to initiate studies testing their therapeutic effectiveness with their regenerative capabilities and their immunomodulatory properties. Generation of IPCs from MSCs represents an attractive alternative.\[[@ref2]\] Although the sources of stem cells used in the generation of IPC have been previously reviewed, the literature describing MSCs alone as a source for in vitro transdifferentiation of IPC, further clinical use of IPC as a therapeutic agent in experimental animal models and in humans, and its outcome are limited, which encourage the author to carry out this review. REVIEW {#sec1-2} ====== Mesenchymal stem cells therapeutic potential: In vitro and in vivo evidence {#sec2-1} ------------------------------------------------------------------------------- Friedenstein et al., in a ground-breaking study, isolated clonogenic fibroblast precursor cells from whole bone marrow (BM) and showed that they were capable of forming bone- and cartilage-like colonies.\[[@ref4]\] Since then BM-derived stem cells are still the most frequently investigated cell type and often designated as the gold standard. Till date isolation of multipotent MSCs from different sources has been reported. There is no universally agreed upon set or a specific singular marker to identify these cells. As a result, a battery of negative and positive markers is generally used to phenotypically characterize these cells. As MSCs are a nonhematopoietic cell lineage, they generally lack specific cell surface markers of HSC and do not express hematopoietic markers such as CD34, CD14 and CD45, CD11a/LFA-1, erythrocytes (glycophorin A), and platelet and endothelial cell adhesion molecules (CD31), but they express several other cell surface antigens, such as CD73 (SH3/4), CD90, CD105 (SH2), CD146, and CD200. They also express variable levels of CD44, stromal antigen 1, and a group of other adhesion molecules and receptors including CD166 (vascular cell adhesion molecule), CD54/CD102 (intracellular adhesion molecule), and CD49.\[[@ref5]\] BM aspirate is considered to be the most accessible and enriched source of MSCs. Bone marrow-derived MSCs (BM-MSCs) represent a rare population of cells that make up only 0.001-0.01% of total nucleated cells and are 10-fold less abundant than hematopoietic stem cells (HSCs), but they can be readily grown and expanded in culture.\[[@ref6]\] However, MSCs derived from adipose tissue (AD-MSCs),\[[@ref7][@ref8]\] peripheral blood,\[[@ref9][@ref10]\] and umbilical cord blood (UCB)\[[@ref11][@ref12][@ref13]\] have also shown promising potential for proliferation and differentiation into different cell types including IPCs. Moreover, protein transduction technology also offers a novel approach for generating IPCs from stem cells including MSCs.\[[@ref14][@ref15]\] Why MSC? {#sec2-2} -------- The frequency of T1DM has been steadily increasing worldwide and T1DM prevention studies using immunosuppressants, self-antigens, and dietary interventions have demonstrated largely disappointing results.\[[@ref1]\] In T1DM, selective and irreversible destruction of the insulin-secreting β-cells in the pancreatic islets of Langerhans occurs by an autoimmune attack. While insulin replacement remains the cornerstone treatment for T1DM, the transplantation of pancreatic islets of Langerhans provides a cure for this disorder and yet, islet transplantation is limited by the lack of donor pancreas. The challenge involves the development of safe and effective means affording the prevention or reversal of T1DM. MSCs have the capacity to differentiate into multiple mesodermal and nonmesodermal cell lineages including IPCs in vitro.\[[@ref2]\] MSCs that have been precommitted to one mesenchyme cell lineage can differentiate into other cell types in response to inductive extracellular cues by process known as transdifferentiation. These precommitted cells proliferate and are able to dedifferentiate into a primitive stem cell stage through genome reprogramming.\[[@ref3]\] On the one hand, MSCs have the potential to transdifferentiate into IPCs by genetic modification and/or defined culture conditions in vitro. On the other hand, MSCs are able to serve as a cellular vehicle for the expression of human insulin gene and has a promising role as therapeutic agents in the treatment, the complications of DM such as cardiac function and in treatment of diabetic cardiomyopathy, nephropathy, diabetic polyneuropathy, and wounds in diabetic patients.\[[@ref16][@ref17][@ref18][@ref19][@ref20][@ref21][@ref22]\] MSCs have generated marked interest and attention for their capacity to elicit tissue regeneration\[[@ref6][@ref23][@ref24][@ref25]\] and one of the most remarkable and least understood findings is the ability of MSC to migrate to sites of tissue injury.\[[@ref26][@ref27][@ref28][@ref29]\] Besides, MSCs also possess immunosuppressive effects by modulating the immune function of the major cell populations involved in alloantigen recognition and elimination\[[@ref30][@ref31][@ref32]\] and they have also shown promising results in the treatment of other autoimmune disorders (e.g., experimental autoimmune encephalomyelitis and rheumatoid arthritis).\[[@ref33][@ref34]\] Adult human MSCs express intermediate levels of major histocompatibility complex (MHC) class I molecules on their cell surface, but not MHC class II, properties that allow their transplantation across MHC barriers. Because of the lack in expression of MHC class II and most of the classical costimulatory molecules on MSCs, these cells have historically been regarded as hypoimmunogenic cells. The immunomodulatory properties of MSCs were initially reported in T-cell proliferation assays using one of a variety of stimuli including mitogens, CD3/CD28, and alloantigen settings where the ability of MSCs to suppress T-cell proliferation was readily determined. Such suppression occurs irrespective of a donor source, including settings in which one uses "third-party" MSCs and suppress proliferation of both CD4+ and CD8+ lymphocytes; and are able to abrogate the response of memory T-cells and naïve T cells to their antigen.\[[@ref35]\] MSCs could regulate diabetes through a direct effect by presenting differential levels of negative costimulatory molecules and secreting regulatory cytokines such as transforming growth factor-β and IL-10 that control regulatory T-cells/auto-reactive T-cells. It is also possible that MSCs could correct the dysregulation observed at the level of B-cells and natural killer cells as well.\[[@ref36][@ref37][@ref38][@ref39]\] MSCs also exert antiinflammatory effects that could be important in maintaining peripheral tolerance.\[[@ref40][@ref41][@ref42]\] It has been shown that AD-MSCs are capable of producing anti-inflammatory cytokines and angiogenic factors, which could potentially improve the diabetes-associated inflammatory and ischemic conditions.\[[@ref2]\] According to one hypothesis, MSC transplantation into diabetic animals can prevent apoptosis of injured pancreatic β-cells and enhance regeneration of endogenous progenitor cells through paracrine actions such as angiogenic, cytoprotective, anti-inflammatory, mitogenic, and antiapoptotic effects.\[[@ref43]\] MSCs have been also shown to provide cytokine and growth factor support for expansion of HSCs and human embryonic stem cells (ESCs), which in turn during cotransplantation of IPCs and HSCs promote IPC engraftment and survival. Here HSCs act as "feeder" cells for the IPCs, supporting its protection, tissue revascularization, and immune acceptance.\[[@ref25][@ref44][@ref45][@ref46]\] In vitro directed transdifferentiation of mscs into IPCs {#sec2-3} ---------------------------------------------------------- Assady et al. (2001) reported that IPCs can be generated from spontaneous differentiation using ESCs. Although the number of IPCs and the insulin content in these cells was low, it was the first proof-of-principle experiment showing that stem cells-ESCs were a potential source for generating β-like cells.\[[@ref47]\] MSCs have the advantage over ESCs in that they usually do not form teratomas and are free from the ethical issues of ESCs. MSCs can be easily obtained and are easily expanded and cultured in the laboratory. Different types of stem cells require different culture and induction media for transdifferentiation of IPCs to take place. The capacity of MSCs to undergo functional transdifferentiation has been questioned over the years. Nonetheless, recent studies support that gene-therapy or factor-based transdifferentiation of MSCs are two distinctive pathways to be considered as means of obtaining functional β-cells. Gene-therapy refers to the in vivo or in vitro transfer of a foreign gene into MSCs, allowing it to produce insulin. The foreign gene in turn activates or represses on demand the insulin gene. The factor-based approach involves exposing MSCs to a cocktail of insulin-promoting factors and cytokines over an extended period of in vitro culture, followed by transplantation of the transdifferentiated IPC into the receiving diabetic patient. MSCs can be differentiated into IPCs by using a specific culture medium enriched with extrinsic insulin-promoting factors. The IPC transdifferentiation period varies greatly with the use of different protocols, it may last from several days to several months. Addition and withdrawal of a combination of extrinsic insulin-promoting factors in a stage-wise manner are required. Many extrinsic insulin-promoting factors, which are biologically active compounds, that have been used in endocrine pancreas differentiation have been shown to promote β-cell proliferation and differentiation and increase insulin content of IPC. A number of these factors have been commonly observed in protocols for IPC transdifferentiation. Different types of stem cells require different culture and induction media for differentiation of IPCs to take place. However, some common themes seem to appear in various induction methods. Commonly known insulin-promoting factors include epidermal growth factor, activin A, betacellulin, nicotinamide, exendin-4, hepatocyte growth factor, fibroblast growth factors, and pentagastrin. Careful use of serum and glucose in the induction media has also been indicated for successful transdifferentiation of IPCs. Signaling by these factors in MSCs allows the induction of the transcription factors, which are prerequisites for pancreas development \[[Table 1](#T1){ref-type="table"}\]. ###### Extrinsic factors and their role in promoting IPC differentiation and insulin production ![](ABR-3-266-g001) IPC identification is then based on the ability to express genes related to pancreatic development and function, such as IslI and IslII, GLUT2, glucose kinase, islet amyloid polypeptide, nestin, and Pdx 1 and Pax 6, and to synthesize C-peptide and insulin, which have been shown to play a role in the development of the pancreas and/or the differentiation of insulin-producing β-cells. Although pancreas development has been partly deciphered by identification and characterization of many transcription factors little is known about their function and molecular mechanism of action. Most of these transcription factors are sequentially and transiently expressed during pancreas development. However, for successful transdifferentiation of MSCs into IPCs the in vitro culture procedure should follow at least the major part of transcriptional program. There are evidence to suggest that pancreatic stem or progenitor cells derived MSCs.\[[@ref48][@ref49][@ref50][@ref51][@ref52][@ref53][@ref54]\] UCB derived MSCs,\[[@ref13][@ref55][@ref56]\] BM-MSCs,\[[@ref57][@ref58][@ref59][@ref60][@ref61][@ref62][@ref63]\] and AD-MSC\[[@ref52][@ref64][@ref65][@ref66]\] can be isolated from rodents and/or human and extensively expanded in vitro, where they differentiate to form new IPCs and exhibited with the characteristics genes and a panel of markers considered essential for differentiation into pancreatic endocrine tissue (Isl1, Pdx 1, Pax 4, and Ngn3, Pax 6) \[[Table 2](#T2){ref-type="table"}\]. ###### In vitro approaches to generate IPCs from different MSC sources ![](ABR-3-266-g002) The majority of researchers have described a multistep protocol for generation of insulin-producing islet-like clusters from MSCs derived from different sources. The glucose challenge tests revealed the production of insulin, and such production was regulated through physiological signaling pathways, i.e. in a glucose responsible manner and they believed that IPCs derived from MSCs could be potentially used for cell therapy of T1DM in human models followed by trials in experimental animal models \[[Figure 1](#F1){ref-type="fig"}\]. ![Schematic representation showing in vitro transdifferentiation of insulin-producing cells from mesenchymal stem cells; IPC in vivo infusion in an experimental animal model, T1DM human model, and therapeutic effect](ABR-3-266-g003){#F1} Success story: MSCs derived IPCs-based therapy in autoimmune animal models of T1DM {#sec2-4} ---------------------------------------------------------------------------------- Experimental data for the therapeutic effects of MSCs-derived IPCs in animal models of T1DM are important tools for analyzing results before considering further human clinical applications. NOD/SCID mice, which are severely deficient in T and B lymphocytes, represent an invaluable diabetic model for experimental research. Use of IPCs derived from UCB-MSCs,\[[@ref56][@ref67][@ref68]\] BM-MSCs alone or in association with HSCs,\[[@ref18][@ref59][@ref69][@ref70][@ref71]\] and from AD-MSC\[[@ref72][@ref73][@ref74][@ref75]\] represent a potential source of diabetic cell replacement. AD-MSCs because of their availability, low risk for immune rejection and increased capacity for expansion with encouraging results in terms of improving glycaemia, enhanced islet regeneration, lowered blood sugar and increased circulating blood insulin levels, increased production of endogenous β-cells, reversion of glycosuria, with increased morphologically normal β-pancreatic islets, acquired functional β-cell phenotype, partially restored pancreatic function in comparison with nontransplanted diabetic mice. Histological examination of IPCs transplanted organ showed the presence of transplanted cells with formation of tissue-like structure, which stained positive for insulin [Table 3](#T3){ref-type="table"}. ###### Approaches to treat experimental diabetic model using IPCs generated from different MSC sources ![](ABR-3-266-g004) MSCs or MSCs derived IPC-based therapy in T1DM humans {#sec2-5} ----------------------------------------------------- The most effective protocols till date have produced cells that express insulin and have molecular characteristics that closely resemble bonafide IPC; however, these cells are often unresponsive to glucose, which is also a most vital characteristic concern that needs to be solved before finding a definite clinical application. There are very few reports noted till now using MSCs-derived IPC as a treatment of T1DM in humans. In 2008, researchers studied the role of MSCs in humans with T1DM. The protocol includes BM biopsy under general anesthesia in the first-degree relatives for the collection of MSC. These cells were sent to a laboratory to be stimulated to proliferate for a month and were later infused into the patient through a gelatinous solution of approximately 100 mL without chemotherapy. After 1 month, the patients were given another infusion. So far, they are not sure about how many infusions will be necessary. Two patients had been included in this protocol but still results are not published.\[[@ref76]\] In the same year, in 2008, Trivedi et al. published results using AD-MSCs transdifferentiated IPCs in combination with HSCs to treat T1DM in five patients having disease duration of 0.6-10 years. Intraportal administration of in vitro generated IPCs and HSCs were carried out. We decided to infuse the cells in portal circulation since liver is the most tolerogenic organ.\[[@ref77]\] The results showed 30% to 50% decreased insulin requirements with 4 to 26-fold increased serum c-peptide levels, with a mean follow-up of 2.9 months without any untoward effects and without use of any immunosuppression.\[[@ref78]\] In 2010, again vanikar et al. published results of insulin replacement therapy using AD-MSCs-derived IPC in combination with HSCs to treat T1DM in another 11 patients having disease duration of 1-24 years. Cells were administered intraportally. In vitro generated IPCs showed the presence of pancreatic transcriptional factors Pax 6, Isl1, and Pdx 1 (by immunoflurescence assay). Chemiluminescence assay detected secretion of glucose and C-peptide in response to glucose concentration in vitro. Over a mean follow-up of 23 months, treated patients showed a decreased mean exogenous insulin requirement, Hb1Ac, raised serum c-peptide levels, and became free of diabetic ketoacidosis events with weight gain on normal diet and physical activities without any untoward effects, without use of any immunosuppression\[[@ref79]\] \[[Table 4](#T4){ref-type="table"}\]. ###### Insulin replacement therapy using MSC-derived IPCs in humans ![](ABR-3-266-g005) CONCLUSIONS AND FUTURE PERSPECTIVES {#sec1-3} =================================== Taken altogether, these in vitro and in vivo experiments demonstrate that the beneficial effects of MSCs in T1DM may be related to both their immunosuppressant activity and subsequent protective effects on damaged tissue, and their capacity to transdifferentiate into IPCs \[[Figure 2](#F2){ref-type="fig"}\]. ![MSC transdifferentiation into IPC and its use in clinic learning points](ABR-3-266-g006){#F2} With sporadic reports of use of MSCs-derived IPCs and their further use in clinical trials to treat T1DM, it can be concluded that (i) this study is only a first step toward using MSCs-derived IPCs as a cell-based treatment, which appears to be suitable for treatment of for T1DM, (ii) MSCs-derived IPCs are an ideal population of personal stem cells for cell replacement therapy and also MSCs could be induced to differentiate into physiologically competent functional islet-like cell aggregates, which may provide as a source of alternative islets for cell replacement therapy in T1DM. Generation of MSCs into IPCs is feasible and promising making the transplantation of IPC a promising approach for the treatment of T1DM. However, there is no standard method for IPC generation and the wide variations in induction techniques used may be a challenge to researchers. As most of these stem cells are being tested in preclinical T1DM with rare clinical use in humans, further exploration is necessary for the in vitro generation of sufficient IPCs that can produce sufficient insulin for wide clinical use. The biggest challenge for the future trials using this approach is to prevent or treat relapses and maintain complete or very good partial responses for very long time. Source of Support: Nil Conflict of Interest: None declared
Archive for October, 2008 Day 1 began at 5:15AM on Wednesday. A taxi picked up Trishan and Myles, and then came to Trinity for Rachel and I. After we piled our stuff in the trunk, we were on our way to Bradley Airport. We got some breakfast and ran into Professor Ingrid Russell, who would be joining us on our panel discussion. She was taking a later flight, and we’d see her in Colorado. The flight there was fairly uneventful: we had a pit stop in Philadelphia, where Myles happily got a Philly Cheese Steak, and then landed in Denver. We took the shuttles to the rental car place, where we saw many other Grace Hopper attendees—women, in groups, some with posters. We got our trusty GPS and a car, and off we went to Keystone. Let me just say how amazingly beautiful it was. Jagged mountains already snow-capped, tall aspens all around, and a nearby lake to top it all off. We got to the (huge!) resort and waited in line with all the other women at the front desk (oh, poor Myles and Trishan). We got all our keys and then checked in at the Conference Center, where we got small computer bags filled with goodies: about 20 different pens, pads of paper, a hand-powered flashlight, some cheap binoculars, a post-it-note booklet, 4 different kinds of chap stick, a water bottle, and Facebook mints, to name only a few. Then we checked out the condo: wow. We had a kitchen, dining table, gas fireplace, living room, 2 bathrooms, and 3 bedrooms. But to the conference. Read the rest of this entry » Chamindra de Silva, founding member and current leader of the Sahana project, has been awarded MIT’s prestigious Globus Indus Technovator Award (GITA) in the Grass Roots / Developmental category. The purpose of GITA, sponsored by the MIT Indian Students Association, is to honor “any person of Indus origin, resident anywhere in the world, under the age of 45 who has made outstanding technological or entrepreneurial contributions.” As described here, Chamindra reacted to news of the award in his usual modest and self-effacing way: As much as I value this award, in the humanitarian response domain, awards are not the focus, as we work mainly to make a difference to those in need. A lot of credit for what we have been able to achieve and build upon is thanks to the many passionate volunteers and contributors in Sri Lanka and around the world, who wanted to make a difference by using their skills for the greater good. The GITA award now joins a growing list of awards and recognition received by the Sahana project, including the Free Software Award for Social Benefit (Feb 2007), Sourceforge Project of the Month (June 2006), Software 2006: Good Samaritan Award (April 2006, US) and Network World’s top 10 Open Source Companies to Watch (Aug 2006).
Here you can decide proportionally how much to include the last (actual) performances of both the teams. In fact you can in- or decrease clubs last performing trends 0 % = No influenze of the last matches. This means that the score will be generated on common figures. 100 % = no common figures but only the last matches will deliver the score. Manipulation of Actuality has influence on the score prediction and also on the Critical-Handicap and on the Home-Draw-Away probabilities. This also counts for the Round-off feature, and learning to use these two features together is the main key to succes. We recomend: increase slowly in time while the competition runs. Start with 0% at the competition start, and increase slowly until 30% or 35% at the competition end. Try to reach 20% or 25% at the end of the first round. This means you only have to increase 5% to 10% max. in the second round. Freely use your own settings on this feature Asian Handicap This is the easiest part, but also our most important prediction. You need to insert asian-handicap-odds for the match. You canfind these odds in the yellow -box, just scroll down a little until you see: Asian Handicap Odds. Choose home and away teams, add the odds for this match, and press the "Predict! button" That's all ! CRITICAL HANDICAP: the height of the Asian handicap (set by bookies), on which you should consider to change your chosen winning team. The machine handles this Critical handicap strictly, but you could decide not to follow, for your own reasons. We recomend: Always use, in case of Asian Handicap. This is a very good way of combining your prediction with the bookie's odds, to come to a prediction with higher winning probabilities. Value bets: Our latest feature is giving a value-betting indication, with at least a 10% profit, on the long run. Round off This is to decide what difference between the scores should lead to a draw or win/loose. For instance: 0.22 means that scores with less than 0.22 difference, will end in a draw. And a difference higher than 0.22 will will end in a win for the best team. This means that you can manage to increse or decrease the draw results. The higher you set this feature, the more draws you will get. 0.01 will give almost no draws and 0.99 wil give a lot of draws. This feature is for sharpening the prediction, but realize: this is soccer, with only a few goals per match, so you need knowhow and feeling to use it. Remember, Round-off has influence on the score prediction and also on the Critical-Handicap and on the Home-Draw-Away probabilities. We recomend: Decrease, when prediction is a draw, and you still would like to know which team is better (you can even find out how much better). But we still recomend: Do not change this, unless you have some experience with TotoMaster.
Patch 0.8.0.1208 Released! Recommended Posts Natalino 4,857 Natalino 4,857 The 0.8.0.1208 update has added the new Interchange map and new game mechanics to Escape from TarkovPlease Note: At the "Interchange" location, there are no Scav NPCs and Scav players also cannot enter it yet. This is a temporary measure. We are happy to announce the release of a major update, 0.8.0.***, for the closed beta version of multiplayer online FPS Escape from Tarkov. This game update introduces the new Interchange map, modern and somewhat atypical compared to the rest of Tarkov locations so far. The Interchange, besides obvious highways, features a huge shopping mall with shops and restaurants. The new location provides conditions for honing new confined space combat tactics. It should be noted that for some time after the update there will not be any AI adversaries on the location, they will be added in the following patches. Also, traditionally, along with a new location, we have introduced a new trader - Ragman, who sells everything related to garments and equipment. We also would like to announce that the current update applied new, experimental methods for optimizing the handling of game physics on client and server, as well as new means to reduce network latency. In addition, specifically for the new Interchange map, new object rendering optimization technology was applied. Over the course of the upcoming testing, these methods will be applied to other locations as well, resulting in an additional performance gain. We admit that in the process of testing the new game update, you may experience various problems associated with new methods of optimization and new game features. All the emerging problems will be processed through the system of bug reports and promptly fixed. Moreover, the launcher was updated as well, along with numerous other fixes and changes. The new EFT update has also introduced a basic training that is going to help new players to understand and master the basic mechanics of the game faster and better. "As promised, we are gradually and continuously introducing new features and realistic mechanics," said Nikita Buyanov, the head of Battlestate Games. "So, after this update, players will have to spend more time on loading and unloading of the magazines, check the number of cartridges in the magazine and chamber. Note that different magazines affect the loading/unloading rate differently, and there is now a new specialized character skill - Mag Drills." Other additions to the game content include new weapons, among them, the Springfield Armory M1A, Remington 870, AAR, APB and new models of AK including 100-series as well as numerous items for weapon modification. Overall, more than 60 new gear and equipment items were added to the game, including bags and vests, body armors and helmets, weapon modifications, ammunition and medicine cases, hats, glasses, and balaclavas. A detailed list of the new equipment was previously posted on our official website of the game and in the social network communities. You can find it here! Finally, the update has been combined with the long-anticipated profile reset (wipe). The following updates, among other improvements and changes, are going to further improve the project performance, network quality, bug fixes, and add new game combat mechanics. Soon, Escape from Tarkov is scheduled to feature the advanced armor system, flea market, Hideout and other features that were mentioned in the plans for 2018. Development and testing of the future innovations are already underway. Also, the test results of this update will have a crucial influence on deciding the Open Beta launch date. We are sure you are excited for all this as much as we are. Thank you! Turkish translation of the news can be found here. Thanks to Turkish emissary @Dimitri468 French translation of the news can be found here. Thanks to French Emissary @LePatrick Italian translation of the news can be found here. Thanks to Italian Emissary @gianluzzz German translation of the news can be found here. Thanks to German Emissary @Cyver Portuguese translation of the news can be found here. Thanks to Brazilian Emissary @REAPERBR Bulgarian translation of the news can be found here. Thanks to Emissary of Bulgaria @Shibby Czech translation of the news can be found here. Thanks to Czech Emissary @PugMonk Share this post Link to post Share on other sites Kremson 75 Kremson 75 Yeah I'm sorry but I have to agree . The lag in the game is horrible compared to how it was before this update . Come up on two PMC that I have dead to rights an unload a full clip into their head for them not to die an yet appear behind me an kill me when a second prior they was right infront of me . What happened to fixing the lag that was detailed in the info for the update ??? An unless I overlooked it scav respawn time is now 20 minutes ? REALLY? I was really enjoying the game on the last patch but this one just ruined the fun factor. Share on other sites PIG-Mathieu 1,296 PIG-Mathieu 1,296 It's pretty confusing, so this update is the "technical" version of OBT (With lots of content and fixes), that aims at making the game ready for a "public" version of OBT that will come with less content/fixes/optimization than on the technical OBT that we updated to yesterday, but with public and open access to the game ? Edited April 20, 2018 by PIG-Mathieu Share this post Link to post Share on other sites duhdang 9 duhdang 9 It's pretty confusing, so this update is the "technical" version of OBT (With lots of content and fixes), that aims at making the game ready for a "public" version of OBT will come with less content/fixes/optimization than on the technical OBT that we updated to yesterday, but with public and open access to the game ? 1 Share this post Link to post Share on other sites Natalino 4,857 Natalino 4,857 It's pretty confusing, so this update is the "technical" version of OBT (With lots of content and fixes), that aims at making the game ready for a "public" version of OBT that will come with less content/fixes/optimization than on the technical OBT that we updated to yesterday, but with public and open access to the game ? What is really confusing now is your question. It's simple. Consider this just another update but a very decisive update for when the open beta is. Because how well this patch goes means one huge step towards the open beta. And then the open beta comes, there will be more content added, more fixes, maps, hideout, etc. 1 Share this post Link to post Share on other sites PIG-Mathieu 1,296 PIG-Mathieu 1,296 It's simple. Consider this just another update but a very decisive update for when the open beta is. Because how well this patch goes means one huge step towards the open beta. And then the open beta comes, there will be more content added, more fixes, maps, hideout, etc. Share this post Link to post Share on other sites Natalino 4,857 Natalino 4,857 Oh ok i just assumed since the 2018 road map was stating OBT to be Early 2018. So does that mean OBT is still planned for Early 2018 and that it is gonna be soon ? (™) No ETA for OBT yet. That is what I mean above. This update is a decisive one for when OBT will be. So far, it is looking good. We would like to hear more feedback and see more reports on this from the community first. 3 1 Share this post Link to post Share on other sites PIG-Mathieu 1,296 PIG-Mathieu 1,296 No ETA for OBT yet. That is what I mean above. This update is a decisive one for when OBT will be. So far, it is looking good. We would like to hear more feedback and see more reports on this from the community first. Ok thanks for clearing it out. So far, we all enjoyed the patch. Interchange is massive and detailed, it looks and play well, and most importantly : It plays with good FPS !! Thanks for your hard work. Thanks for the update. It's almost 3am in texas now, you should go to bed, have some rest sometimes you know
Former President Barack Obama took several not-so-subtle shots at “woke” culture and “purity” tests as both politically naive and ineffective during his foundation’s third annual summit in Chicago: “That’s not activism, that’s not bringing about change.” CNN’s Don Lemon broadcast a clip on his primetime show of Obama’s talk on Tuesday, in which the former 44th president evoked the 42nd president’s ‘Sister Souljah’ moment, calling out what he perceived as counterproductive, extremist views from the far left. Obama and his wife, Michelle, “took audience questions and spoke about empowering the next generation of leaders. They also talked about racism and how to be effective political activists,” Lemon said, teeing up the clip. “This idea of purity and you’re never compromised and you’re always politically woke and all that stuff, you should get over that quickly,” Obama said dismissively, prompting chuckles from the audience. “The world is messy. There are ambiguities. People who do really good stuff have flaws. Like if I tweet or hashtag about how you didn’t do something right or used the wrong verb or then, I can sit back and feel good about myself: ‘You see how woke I was? I called you out.’ Get on TV. Watch my show. Watch Grownish. You know, that’s not activism. That’s not bringing about change.” Coming back to the studio, Lemon asked former Obama aide, Jen Psaki, if the former president’s message was aimed at Democrats. “I think, in part. People running and for the party,” she said. “I think, at times. the reaction to [President] Donald Trump has been to put out the purity tests that say if you don’t meet these bars and not with me on every issue and don’t check every box, you can’t be a part of the party.” “If we are launching purity tests and say ‘You can’t be a part of us,’ we’ll have such a small party, we won’t be able to win,” Psaki added. “Governing is not about saying ‘You don’t agree with me, you can’t be part of the conversation.’ That was important, I think, for people to hear. Governing, especially, is about compromise. And not letting the perfect be enemy of the good.” Watch the video above, via CNN. Have a tip we should know? [email protected]
Der Termin am 3. Juli ist in Corona-Zeiten nicht zu halten. Die tausenden Bewerber sollen vermutlich im Oktober zur Prüfung antreten. Doch auch eine Studienplatzvergabe nach Schulnoten oder Vorjahresleistung ist nicht ausgeschlossen. Ein Losverfahren ist Ultima Ratio. Die Messehallen in Wien und Innsbruck sind für 3. Juli schon lange reserviert. Die Stadthalle in Graz und das Design Center Linz auch. An diesem Tag soll das „jährliches Rolling-Stones-Konzert“ der Medizin Universitäten stattfinden. So wird der Aufnahmetest für das Studium selbst von Verantwortlichen genannt. Denn um die 1740 Plätze werden in den Hallen insgesamt wohl zwischen 13.000 und 16.000 Bewerber rittern. Doch was passiert in Corona-Zeiten, in denen wohl noch im August ein Verbot großer Veranstaltungen gilt, mit dem Ärztenachwuchs?
Q: Migrate communities built with Napili template How to migrate communities built with Napili template using Ant migration tool A: Found this blog on migrating Napili template configurations: http://blogs.perficient.com/salesforce/2015/12/22/deploy-community-builder-templates-in-3-simple-steps/ I have not tried but would love to hear if this method of deployment works. EDIT: Step 1: Use change sets to move all custom lightning components you are referencing in the community from the sandbox to production, as well as any metadata that you setup outside of the Community Builder (welcome email templates, workflow rules, profiles, permission sets, etc). If you skip this step, it will still allow you to deploy the community and will appear to be successful, but you will see an internal server error in the Community Builder and will not be able to make any updates until you have moved the missing components into production. I highly recommend creating a deployment template and filling it in as you build your community to ensure nothing is forgotten at the time of deployment; it is an important part of our methodology at Perficient and ensures smooth deployments.Export This Site in Site.com Studio Step 2: From your sandbox, navigate to the Site.com Studio and locate the toolbar. Click the arrow next to the widget icon and select to ‘Export This Site’ from the sandbox. Then go into production and create a new community, selecting the same version of the template; going from a Spring ’16 Napili template in sandbox and moving Winter ’16 production environment will not work. You need to go from Winter’ 16 in sandbox to Winter ’16 in production. All customization performed inside the Community Builder will move over. Step 3: Go to the Community Management console and update your administrative settings, topics, moderation criteria, etc. as these do not carry over automatically.
Comparative Study of Three Bile Duct Closure Methods Following Laparoscopic Common Bile Duct Exploration for Choledocholithiasis. There are three choledochotomy closure methods available following laparoscopic common bile duct exploration: T-tube insertion, antegrade stenting, and primary choledochorrhaphy. We reviewed the experience of 12 years at our center searching for the optimal closure technique. We analyzed retrospectively 146 patients that underwent one of the three closure methods from February 2004 to March 2016. Hospital stay, need for readmission, incidence of early and long-term complications, and biliary leakage development and their clinical impact were determined for each technique. Hospital stay was more prolonged, and need for readmission was higher in the T-tube group. Nine patients of the T-tube group (17.3%), 5 patients (8.6%) of the antegrade stenting group, and 1 patient of the primary suture group (2.8%) developed Dindo-Clavien ≥3 complications (P = .076). The incidence of biliary leakage was 3.8%, 8.6%, and 16.7% for the T-tube group, antegrade stenting group, and primary suture group, respectively. There was no grade C biliary fistula in the primary suture group, and all grade B leaks in these patients were only due to prolonged duration. The T-tube removal caused adverse events in 21.1% of the patients, and complications directly related with stents occurred in 9.6%. Antegrade stents or T-tube insertion do not provide any added value for choledochotomy closure but are charged with specific morbidity. On the contrary, despite biliary leaks being more frequent after primary suture, they are of little clinical consequence and may be managed on an outpatient basis.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.