proba
float64 0.5
1
| text
stringlengths 16
174k
|
|---|---|
0.999995 |
Why do I want to attend a design thinking conference?
In a nutshell, I’m looking to network, learn, be inspired, and have fun in the process. Firstly, nothing beats the power of meeting fellow design thinkers in person. I believe there’s tremendous power in shared-interest communities and the ability to bounce ideas off others in real-time. Second, I’m always on the lookout for the latest trends in design thinking and actively seek to advance my knowledge in the field. The educational seminars, best practices, and innovative ideas that a design thinking conference can provide, would be hugely valuable to myself and the teams that I lead. Finally, I believe it would be a ton of fun. I love to travel to interesting places, learn new skills, and meet cool people; I imagine that design thinking conferences could easily deliver all three.
As I research design thinking conferences, I have 5 criterion that are guiding my decision making process.
Content/Agenda: Who are the speakers? How rich/diverse/interesting is the agenda? If the conference has been held in the past, how strong was the previous agenda?
Location: Conferences closer to home (for me, this means North America) are certainly attractive from a cost & logistics standpoint. However, I’ve noticed there are design thinking conferences in lots of enticing locations beyond the US; places easy to visit through a business trip or fun enough to include as part of a family vacation.
Length of Time: Assuming a great agenda and attendee base, 2-3 days of dedicated focus is my ideal.
Cost: This includes flights, accommodations, and the cost of the conference itself.
Conferences dedicated to design thinking are harder to find than I expected.
As I began researching design thinking conferences, I was surprised not to find more conferences dedicated solely to design thinking. I often found design thinking as a component or workshop within a related but different type of conference (e.g. UX, innovation, design, entrepreneurship conferences). While I’ve identified design thinking conferences in 6 of 7 continents, they’re available more by the handful than by the dozens.
I love to plan in advance and have reached out to peers and searched the web to identify the best design thinking conference for me to attend next year. While there are attractive potential options for the first half of 2018, I’ve found many conferences haven’t solidified dates & locations for 2018 (unsurprisingly as we’re still in 2017). Additionally, agendas & lists of speakers often aren’t published or finalized until much closer to the actual conference date.
My initial strategy for evaluating design thinking conferences includes 1) getting recommendations from peers, 2) finding conferences in 2018 with information already listed, and 3) identifying established conferences that have had great reviews in the past to get a sense of when and where they might occur in 2018.
2017 was the first year this conference was conducted but I heard it was well attended and had some strong facilitators. Fingers crossed this conference returns.
Not a pure design thinking conference, heavy focus on the holistic creativity/pure design side. However, have heard great reviews from prior sessions. I also love Cape Town!
Not available but coming eventually? I hear there are lots of experiments and innovation projects happening on Antarctica so perhaps it’s only a matter of time before someone converts one of those Antarctica-bound cruise ships from Ushuaia or Punta Arenas, into a design thinking cruise ship conference!
An expansion of the ‘Innovation by Design Conference’ held in Singapore the past 2 years. Part of Singapore Design Week. Some great companies & speakers, with a few videos from 2017 available on the site. Participants can submit interest but must then be “invited”.
Smaller conference with has some interesting speakers. Videos from the 2016 session are posted on their website. Participants can submit interest but must then be “invited”.
2 days / Cost ?
Conference happens annually during Fall. Some great speakers and interesting topics. In 2017, it happened the same week as DTIA (the conference above), but on different days of the week.
I know little about this conference and my info here is very speculative.
A very non-traditional conference, this design thinking conference by DesignThinkers Academy is heavily influenced by the world of theater. There is a heavy focus on learning by doing in this conference. Fantastic & seasoned facilitators (or “actors”/”actresses” as they refer to them).
This is actually a course, not a conference. It’s also very small in size. However, it would meet many of my objectives of attending a DT conference. Described as a ‘design safari’, the course content feels very thoughtfully curated.
A mix of academic & practical insights for the world of service design. It feels much more academic in nature than other conferences I’ve evaluated.
They’ve had some interesting speakers in the past. Videos from prior speakers are available on the website.
4 days / Cost ?
Fantastic list of speakers, this one has been recommended to me by a handful of people and is one of my top choices if I plan to stay closer to home.
Interaction and UX design centric conference. Features both Spanish & English speaking presenters. Location in South America changes every year.
With a full time job outside the field of design thinking, and limited time/budget, I’m thinking a North American conference might be my best bet for 2018. However, I plan to keep this list handy and up-to-date in case my business travel or vacation plans take me to another continent. If there are other good ones I’m missing for 2018 or updated info for the ones I’ve identified, please let me know!
It’s not a conference, but you could add the world’s biggest event which uses design thinking: the Global Service Jam (and the sister events Global GovJam and Global Sustainability Jam). The #GSJam takes piace in around 100 cities simultaneously, where thousands of participants work on the same challenge, publishing hundreds of new prototypes at the end of the Jam.
Thank you for reaching out and for sharing! I have heard a little bit about Global Service Jam and am interesting in exploring it a bit more. From what I know and have heard thus far, it sounds like a wonderful event!
Hi!! Thank you for the list, i’m trying to find design thinking conferences in north america but its been really difficult to find something, everything is in europe. is there anyway you can send me information of other conferences u find?
Hi Victoria! Thank you for reading my article and for your question. I will be updating this article again as I collect new info and the best way to stay connected to latest updates is through my Facebook page: https://www.facebook.com/theaccidentaldesignthinker/ .
Where in North America are you most interested in? Most of my NA connections are in the US & Canada. If you are looking for Central or South America, you might want to try asking people in the Facebook Group ‘design thinking para tod@s’.
Let me know what you’re looking for and I’ll try and help!
Thank you for sharing Suanne! Will you be attending in March?
Design thinking in action in HK costs US$200 to attend.
Thank you Jeffrey! Were you able to attend in October this year?
Hi Lu, thank you very much for the update! I’ll make sure to update the post with the latest information on Interaction Latin America. Were you able to attend Interaction South America last year? If so, what did you think?
I would like to add to this list one more design thinking event of 2018.
On August 1st-3rd a conference called “Design Thinking Camp” will take place for the second time in Moscow, Russia. The main theme of the conference will be “Customer Insights”, but we will surely hear about other topics in human-centered design as well as master new skills in many of workshops we will be offering. We are scheduled to announce the first set of speakers soon.
Thank you for sharing Sergey. Looks like it was a great 3 day session last year with a nice list of speakers and topics. I’ll be curious to see the agenda for this year when it is available.
In 2018 Design Thinking Forum will take place on 20 September.
Thank you for sharing Tudor. Were you able to attend Design Thinking Forum last year? Curious to see what the agenda is for 2018.
has anyone attended the design thinking bootcamp in Amsterdam? how is it in terms of learning for people healthcare improvement background?
|
0.996753 |
In computing, performance per watt is a measure of the energy efficiency of a particular computer architecture or computer hardware. Literally, it measures the rate of computation that can be delivered by a computer for every watt of power consumed. Performance (unlike watt) isn't an objective thing, it depends on what the computer is working on, but the Green500 list ranks the most efficient computers, according to one (possible) benchmark.
System designers building parallel computers, such as Google's hardware, pick CPUs based on their (other than Green500) performance per watt of power, because the cost of powering the CPU outweighs the cost of the CPU itself.
The performance and power consumption metrics used depend on the definition; reasonable measures of performance are FLOPS, MIPS, or the score for any performance benchmark. Several measures of power usage may be employed, depending on the purposes of the metric; for example, a metric might only consider the electrical power delivered to a machine directly, while another might include all power necessary to run a computer, such as cooling and monitoring systems. The power measurement is often the average power used while running the benchmark, but other measures of power usage may be employed (e.g. peak power, idle power).
For example, the early UNIVAC I computer performed approximately 0.015 operations per watt-second (performing 1,905 operations per second (OPS), while consuming 125 kW). The Fujitsu FR-V VLIW/vector processor system on a chip in the 4 FR550 core variant released 2005 performs 51 Giga-OPS with 3 watts of power consumption resulting in 17 billion operations per watt-second. This is an improvement by over a trillion times in 54 years.
Most of the power a computer uses is converted into heat, so a system that takes fewer watts to do a job will require less cooling to maintain a given operating temperature. Reduced cooling demands makes it easier to quiet a computer. Lower energy consumption can also make it less costly to run, and reduce the environmental impact of powering the computer (see green computing). If installed where there is limited climate control, a lower power computer will operate at a lower temperature, which may make it more reliable. In a climate controlled environment, reductions in direct power use may also create savings in climate control energy.
Computing energy consumption is sometimes also measured by reporting the energy required to run a particular benchmark, for instance EEMBC EnergyBench. Energy consumption figures for a standard workload may make it easier to judge the effect of an improvement in energy efficiency.
Performance (in operations/second) per watt can also be written as operations/watt-second, or operations/joule, since 1 watt = 1 joule/second.
Exponential growth of supercomputer performance per watt based on data from the Green500 list. The red crosses denote the most power efficient computer, while the blue ones denote the computer ranked#500.
FLOPS (Floating Point Operations Per Second) per watt is a common measure. Like the FLOPS it is based on, the metric is usually applied to scientific computing and simulations involving many floating point calculations.
As of June 2016, the Green500 list rates the two most efficient supercomputers highest – those are both based on the same manycore accelerator PEZY-SCnp Japanese technology in addition to Intel Xeon processors – both at RIKEN, the top one at 6673.8 MFLOPS/watt; and the third ranked is the Chinese-technology Sunway TaihuLight (a much bigger machine, that is the highest ranked on TOP500, the others are not on that list) at 6051.3 MFLOPS/watt.
In June 2012, the Green500 list rated BlueGene/Q, Power BQC 16C as the most efficient supercomputer on the TOP500 in terms of FLOPS per watt, running at 2,100.88 MFLOPS/watt.
On 9 June 2008, CNN reported that IBM's Roadrunner supercomputer achieves 376 MFLOPS/watt.
In November 2010, IBM machine, Blue Gene/Q achieves 1,684 MFLOPS/watt.
As part of Intel's Tera-Scale research project, the team produced an 80 core CPU that can achieve over 16,000 MFLOPS/watt. The future of that CPU is not certain.
Microwulf, a low cost desktop Beowulf cluster of 4 dual core Athlon 64 x2 3800+ computers, runs at 58 MFLOPS/watt.
Kalray has developed a 256-core VLIW CPU that achieves 25,000 MFLOPS/watt. Next generation is expected to achieve 75,000 MFLOPS/watt.
Parallella has announced the Epiphany-V, a 1024-core 64-bit RISC processor intended to achieve 75 GFLOPS/Watt.
The Green500 list ranks computers from the TOP500 list of supercomputers in terms of energy efficiency, typically measured as LINPACK FLOPS per watt.
As of August 2015, the Shoubu supercomputer of RIKEN outside Tokyo Japan tops the Green500 list with 7032 MFLOPS/W. The top three supercomputers of the list use PEZY-SC accelerators (GPU-like that use OpenCL) by PEZY Computing with 1024 cores each and 6-7 GFLOPS/W efficiency.
As of November 2014, the L-CSC supercomputer of the Helmholtz Association at the GSI in Darmstadt Germany topped the Green500 list with 5271 MFLOPS/W and was the first cluster to surpass an efficiency of 5 GFLOPS/W. It runs on Intel Xeon E5-2690 Processors with the Intel Ivy Bridge Architecture and AMD FirePro™ S9150 GPU Accelerators. It uses in rack watercooling and Cooling Towers to reduce the energy required for cooling.
As of June 2013, the Eurotech supercomputer Eurora at Cineca topped the Green500 list with 3208 LINPACK MFLOPS/W. The Cineca Eurora supercomputer is equipped with two Intel Xeon E5-2687W CPUs and two PCI-e connected NVIDIA Tesla K20 accelerators per node. Water cooling and electronics design allows for very high densities to be reached with a peak performance of 350 TFlop/s per rack.
As of November 2012, an Appro International, Inc. Xtreme-X supercomputer (Beacon) topped the Green500 list with 2499 LINPACK MFLOPS/W. Beacon is deployed by NICS of the University of Tennessee and is a GreenBlade GB824M, Xeon E5-2670 based, eight cores (8C), 2.6 GHz, Infiniband FDR, Intel Xeon Phi 5110P computer.
Graphics processing units (GPU) have continued to increase in energy usage, while CPUs designers have recently focused on improving performance per watt. High performance GPUs may draw large amount of power and hence, intelligent techniques are required to manage GPU power consumption. Measures like 3DMark2006 score per watt can help identify more efficient GPUs. However that may not adequately incorporate efficiency in typical use, where much time is spent doing less demanding tasks.
With modern GPUs, energy usage is an important constraint on the maximum computational capabilities that can be achieved. GPU designs are usually highly scalable, allowing the manufacturer to put multiple chips on the same video card, or to use multiple video cards that work in parallel. Peak performance of any system is essentially limited by the amount of power it can draw and the amount of heat it can dissipate. Consequently, performance per watt of a GPU design translates directly into peak performance of a system that uses that design.
Since GPUs may also be used for some general purpose computation, sometimes their performance is measured in terms also applied to CPUs, such as FLOPS per watt.
While performance per watt is useful, absolute power requirements are also important. Claims of improved performance per watt may be used to mask increasing power demands. For instance, though newer generation GPU architectures may provide better performance per watt, continued performance increases can negate the gains in efficiency, and the GPUs continue to consume large amounts of power.
Benchmarks that measure power under heavy load may not adequately reflect typical efficiency. For instance, 3DMark stresses the 3D performance of a GPU, but many computers spend most of their time doing less intense display tasks (idle, 2D tasks, displaying video). So the 2D or idle efficiency of the graphics system may be at least as significant for overall energy efficiency. Likewise, systems that spend much of their time in standby or soft off are not adequately characterized by just efficiency under load. To help address this some benchmarks, like SPECpower, include measurements at a series of load levels.
The efficiency of some electrical components, such as voltage regulators, decreases with increasing temperature, so the power used may increase with temperature. Power supplies, motherboards, and some video cards are some of the subsystems affected by this. So their power draw may depend on temperature, and the temperature or temperature dependence should be noted when measuring.
Performance per watt also typically does not include full life-cycle costs. Since computer manufacturing is energy intensive, and computers often have a relatively short lifespan, energy and materials involved in production, distribution, disposal and recycling often make up significant portions of their cost, energy use, and environmental impact.
Energy required for climate control of the computer's surroundings is often not counted in the wattage calculation, but it can be significant.
SWaP (space, wattage and performance) is a Sun Microsystems metric for data centers, incorporating energy and space.
Where performance is measured by any appropriate benchmark, and space is size of the computer.
↑ "Green500 List for June 2016".
↑ "The Green500 List". Green500.
↑ "Government unveils world's fastest computer". CNN. Archived from the original on 2008-06-10. performing 376 million calculations for every watt of electricity used.
↑ "Top500 Supercomputing List Reveals Computing Trends". IBM... BlueGene/Q system .. setting a record in power efficiency with a value of 1,680 Mflops/watt, more than twice that of the next best system.
↑ "Intel squeezes 1.8 TFlops out of one processor". TG Daily.
↑ "Teraflops Research Chip". Intel Technology and Research.
↑ Joel Adams. "Microwulf: Power Efficiency". Microwulf: A Personal, Portable Beowulf Cluster.
↑ "MPPA MANYCORE - Many-core processors - KALRAY - Agile Performance".
↑ Olofsson, Andreas. "Epiphany-V: A 1024-core 64-bit RISC processor". Retrieved 6 October 2016.
↑ Olofsson, Andreas. "Epiphany-V: A 1024 processor 64-bit RISC System-On-Chip" (PDF). Retrieved 6 October 2016.
↑ Hindriksen, Vincent (2 Aug 2015). "he knowns and unknowns of the PEZY-SC accelerator at RIKEN". streamcomputing.eu. Retrieved 8 Jan 2016.
↑ Tiffany, Tiffany (August 4, 2015). "Japan Takes Top Three Spots on Green500 List". HPCWire. Retrieved 8 January 2016.
↑ "PEZY & ExaScaler Step Up on the Green500 List with Immersive Cooling". InsideHPC. September 23, 2015. Retrieved 8 January 2016.
↑ "The Green500 List - November 2014".
↑ "Eurotech Eurora, the PRACE prototype deployed by Cineca and INFN, scores first in Green500 list". Cineca. Cineca. Retrieved 28 June 2013.
↑ "Eurora - Aurora Tigon - Top500 list". top500.org. Retrieved 28 June 2013.
↑ "University of Tennessee Supercomputer Sets World Record for Energy Efficiency". National Institute for Computational Sciences News. University of Tennessee & Oak Ridge National Laboratory. Retrieved 21 November 2012.
↑ "Beacon - Appro GreenBlade - Green500 list". top500.org. Retrieved 21 November 2012.
↑ Mittal et al., "A Survey of Methods for Analyzing and Improving GPU Energy Efficiency", ACM Computing Surveys, 2015.
↑ Atwood, Jeff (2006-08-18). "Video Card Power Consumption".
↑ "Video card power consumption". Xbit Labs.
↑ Tim Smalley. "Performance per What?". Bit Tech. Retrieved 2008-04-21.
↑ "SPEC launches standardized energy efficiency benchmark". ZDNet.
↑ Mike Chin. "Asus EN9600GT Silent Edition Graphics Card". Silent PC Review. p. 5. Retrieved 2008-04-21.
↑ MIke Chin. "80 Plus expands podium for Bronze, Silver & Gold". Silent PC Review. Retrieved 2008-04-21.
↑ Mike Chin. "Life Cycle Analysis and Eco PC Review". Eco PC Review.
↑ Eric Williams (2004). "Energy intensity of computer manufacturing: hybrid assessment combining process and economic input-output methods". Environ. Sci. Technol. 38 (22): 6166–74. doi:10.1021/es035152j. PMID 15573621.
↑ Wu-chun Feng (2005). "The Importance of Being Low Power in High Performance Computing". CT Watch Quarterly. 1 (5).
↑ Greenhill, David. "SWaP Space Watts and Power" (PDF). US EPA Energystar. Retrieved 14 November 2013.
Wu-Chun Feng (October 2003). "Making a case for Efficient Supercomputing". ACM Queue. 1 (7).
Kirk W. Cameron (November 2013). "HPC Power Efficiency and the Green500". HPC Wire. 27 (11).
Wu-Chun Feng and Kirk W. Cameron (December 2007). "The Green500 List: Encouraging Sustainable Supercomputing". IEEE Computer. 40 (12).
|
0.999983 |
Why did my foolproof activity just fail with that class?
Summary: Why did my foolproof activity just fail with that class? … and how to make sure it works again next time.
... and how to make sure it works again next time.
I find that if you do the same activity too many times, you don't present it with as much enthusiasm as you used to. There is a lot of evidence to suggest that a teacher's belief in what they are doing in the classroom is by far the biggest influence on its success- much more so than the theoretical soundness of the methodology. Ways of retaining your enthusiasm without having to abandon an activity completely include thinking up variations each time, rewriting the worksheet or textbook page (to polish it up, change the level, make it more interesting or relevant for a particular group of students etc), and using that as an opportunity to polish up your worksheets and explanation ready to explain it to other teachers in an article or workshop.
This one is connected to the one above. Many teachers report that they finish an explanation of something that they've done in class many times before only to see the blank faces of their students looking back at them. The first unspoken reaction by the teacher is often, "Oh come on, I've explained what you have to do/ we've done this loads of times before", only for them to then realise that in this case neither of these things is true. Ways around this include giving them the written instructions to work it out from (also a nice variation to keep you interested, and something you can polish up after the lesson to make sure you are still learning from doing that activity), and writing down gestures etc that you can use to improve your explanation on your lesson plan.
It could be that the previous classes you used that activity with were already used to working in pairs, doing communicative activities before being given the language, guessing vocabulary from context etc, but this class is not. That could be because their previous teachers didn't use such activities, because it is earlier in the course than it usually is when you do this activity (maybe because they are higher level and so the language point came up earlier in the book), or just because such activities are more difficult for them and they need more time to adapt. You can get round these potential problems by planning the introduction of things like students being put in charge of their own learning or peer correction in exactly the same way as you would plan any other thing on the syllabus, with little steps up in challenge until they reach the point you are trying to get to.
This is similar to the point above, but seeing it more as what you could do in that situation rather than timing using that activity well. More support could mean a longer explanation, more examples of what to do etc, but most often means more language support, e.g. giving them functional language that they can use in the roleplay. This is something that varies a lot from class to class and student to student, with some students ignoring language in a "useful language" box even when you've pointed it out and practised it, and others freezing if they are forced to use their own words to cope. This is less easy to guess from level than you might think.
If they have done those activities with a different teacher, the admin solution is to have a system of telling other teachers what supplementary activities you have used. Techniques include a "games played/ activities used" section of the lesson notes, having a "the students are familiar with" section of handover notes, and having a slip of paper in each supplementary book where you write which pages you have used and with which classes. Failing that, the options are to hold a worksheet up in the teacher's room and shout "Has anyone used this this year?" or to rewrite worksheets so that at least the details are unique to your version.
In this case, you are probably guilty yourself! It might be that the similarities between the activities weren't obvious when you thought about doing it. Parallels that are less than obvious to a teacher who is focused on more fundamental things include any ones that involve standing up, matching things, moving around bits of paper, and logical puzzles.
This is a weakness of PPP and some other methods as they are often taught- however well you teach and practice the phrasal verbs of the day, students' brains are not likely to be ready to produce them in natural speech until they've had the chance to subconsciously absorb them and consciously or subconsciously reinforce those memories for many weeks or months, and certainly not by the end of the same lesson! Early on in my career I often ran over on my warmers, lead ins, language presentation and using the nice controlled practice games I had discovered or made up, and sometimes didn't find time to do the free production activity until the third lesson on that language point. Needless to say, my training made me think of this as a huge failure. I was quite surprised to find, though, that when my timing became more "successful" the free production activities became less so, with a previously successful third lesson free production task turning into a painfully difficult first lesson one and producing that familiar "Well, it always worked before" feeling. Now I think I understand a little why.
One approach that can help you avoid this problem is leaving freer tasks and more demanding controlled practice tasks until students have had a time to sleep on the language a couple of times, e.g. by setting the homework straight after the controlled practice stage and doing further controlled practice and free production in the next class, or by taking a break from that language point and then coming back to it later.
This could be because it's after lunch, because it's near the end of term, because the lesson or work they had before your class was particularly tough, or because the language input etc you gave them before that activity (earlier in the lesson or even earlier in the week) tired them out. Trying to predict what mood they will be in and their energy level is a standard thing to include in your lesson planning for kids' classes, but should probably be done with all kinds of classes. For example, business classes tend to be tired or even absent at the end of accounting periods and at times like New Year when there is lots of business entertaining going on.
This could be because you tried it straight after a long weekend, because they never do their homework, because other commitments or stresses are distracting them, or because they have never developed good memory skills. If there is any chance of this being the case, you could brainstorm language they could use before the activity starts and then do some more improvised controlled practice if they need it.
This has been mentioned as a factor in tiredness and being "trained up" to do those kinds of activities, but where they are in the course could also affect how focused they are on what will come up in the test (and so maybe make them less willing to do speaking activities if there is no speaking test) or mean that they want to do more activities where they get to know you and each other (e.g. near the beginning of the course).
"The future with will" comes up in books from Elementary to Advanced, but you cannot use the same practice activities with every one of these classes. This due to factors like the level of intellectual challenge, combinations of different meanings of that tense, combinations with other tenses, and combining it with new or difficult vocabulary. Even with classes that are labelled the same, you should be able to fine tune your analysis to informally decide if that class is "low Upper Int" or "high Upper Int". The next stage is to decide if particular skills are higher or lower than that level, e.g. "the class are generally good Upper Intermediate, but their fluency is Intermediate at best". Knowing this should help you choose activities more carefully.
As well as their general level being different from other classes you tried that activity with, there is also the amount of challenge they were ready for at that time. Some classes love to be challenged, and some tend to let challenges get them down. Most classes, however, like to coast and have their confidence boosted sometimes, and then to be given something to "get their teeth into" at other times.
Possible effects of age include being embarrassed by something that seems childish (something teenagers are even more sensitive about than adults), having gone through the education system where using your imagination and being left to study your own way was less common, which topics you are interested in, what you think the role of a teacher should be, etc.
To give an example, I tend to play a lot of games in my classes, and some students cannot see through that fact to notice that they are also speaking more in English than they ever have before and mainly using the language we are working on. Knowing that this is a fairly common reaction, I now make a huge effort in my early classes to appear the epitome of the serious teacher in every other way (dress smart, using phonemic symbols, be strict about homework etc). If I have been a bit slack about that with one group of students, I am much more reluctant to use the more "adventurous" games with them. I am also similarly careful with a class that hasn't responded well to a couple of activities, making sure I switch to activities that are really failsafe (but maybe a little dull) rather than ones that usually go great but have a one in a hundred chance of bombing.
For example, after the last time you did that activity with another class you thought that adding some functional language would be useful, but that has made the whole activity unwieldy or not so much fun.
Seemingly tiny changes, including ones that have no connection to the language used, can make a big difference in how difficult a task is to complete. For example, telling students to come up with their own questions seems just one step above using the questions in the book, but if some imagination is needed to think of enough questions about the chosen topic then the level of challenge has at least doubled for students who aren't confident about using their imaginations.
Maybe you kept the activity the same length as every other time and also keep the level of challenge the same but spent less time on error correction than in previous classes and so failed to make up for the silliness of the game by doing something "serious".
|
0.991263 |
Anyone, but especially useful to people in conflict and intermediaries who are trying to help others deal with conflict.
Active listening is designed to deal with the problem that people often do not listen attentively to the person they are talking with. They are often distracted, half listening, half thinking about something else. When people are engaged in a conflict, they are often busy formulating a response to what is being said. Often, they assume that they have heard what their opponent is saying many times before, so rather than paying attention, they focus on how they can respond to win the argument.
Active listening is a structured form of listening and responding that focuses the attention on the speaker. The listener must take care to attend to the speaker fully, and then repeat, in the listener's own words, what he or she thinks the speaker has said. The listener does not have to agree with the speaker -- he or she must simply state what s/he thinks the speaker said. This enables the speaker to find out whether the listener really understood. If the listener did not, the speaker can explain some more.
Often, the listener is encouraged to interpret the speaker's words in terms of feelings. Thus, instead of just repeating what happened, the active listener might add "I gather that you felt angry or frustrated or confused when". . .[a particular event happened]. Then the speaker can go beyond confirming that the listener understood what happened, but can indicate that he or she also understood the speaker's psychological response to it.
A parent got a call from her child's school, reporting that Bonnie (the child) had missed her last three English classes. The parent has a choice: she can confront Bonnie by saying "I heard that you skipped your last three English classes!" Bonnie might then respond "I felt sick, so I went to the nurse." Mom could then say, "Well, you didn't seem very sick at home...." and an argument would ensue. Active listening provides another approach. Mom: "The school called today." Bonnie: "Yeah?" Mom: "They said that you've missed several English classes." Bonnie: "Hmm." Mom: "What's going on in English?" Bonnie: "Nothing, it's just dumb stuff." Mom: "You sound like you are bored with the class." Bonnie: "Yeah, I'm bored, but it's really hard, too." Mom: "So it is boring and frustrating at the same time." Bonnie: "Yeah, like the teacher goes so fast, and I can't do the homework because I don't understand it."
Rather than accusing Bonnie of wrong-doing, which would likely make Bonnie defensive, and quite possibly get her to stop talking or withdraw from the conversation altogether, the Mom just restates what she hears Bonnie saying. This begins to get Bonnie to open up more, rather than close down. Often it will encourage the speaker to figure out a solution for herself, as it encourages her to think through her problem in an effort to explain it to another person who really seems to care what she has to say.
While active listening can be helpful in most conversations, it is especially helpful in difficult or uncomfortable conversations where there is high potential for misunderstanding and/or escalation. Not only does it force people to listen attentively to the other person, it also avoids misunderstandings, since people have to confirm that they interpreted the speaker correctly. If they didn't, the speaker has a chance to restate what she was saying. Another benefit is that it slows the conversation down, allowing people to "cool off" before they respond. In addition, it tends to open people up, to get them to say more. When people are in conflict, they often contradict each other, denying the opponent's description of a situation. This tends to make people defensive, and they will either lash out or withdraw and say nothing more. However, if they feel that their opponent is really attuned to their concerns and wants to listen, they are likely to explain in detail what they feel and why. If both parties to a conflict do this, the chances of being able to develop a solution to their mutual problem becomes much greater.
Although active listening is useful in any situation (conflict or not) where one really wants to understand the other person's concerns, there are times when it is not appropriate to use. One is when you really don't care what the other person has to say. If your concern is more about telling them what YOU feel, active listening may be too frustrating to do well. On the other hand, if you listen actively to the other person first, they may be more willing to listen to you in return. Active listening is also sometimes awkward to do if the statement the other person said made simple and clear--"I wasn't able to answer your call yesterday," for instance. That can lead to a "parroting" response, "You weren't able to answer my call.," where it sounds like you are making fun of the other person. Try to read something more into the statement--such as a feeling--or ask an open ended question to try to avoid that problem. "Sounds like you had a really busy day yesterday," for example.
|
0.999799 |
American diplomat and ambassador. Name variations: Roz Ridgway. Born on August 22, 1935, in St. Paul, Minnesota; daughter of H. Clay Ridgway and Ethel Rozanne (Cote) Ridgway; Hamline University in Minnesota, B.A., 1957; married Theodore (Ted) Deming (an officer in the Coast Guard), in 1983.
Became the first woman to actively participate in a presidential summit, at the Geneva conference between President Ronald Reagan and Soviet Premier Mikhail Gorbachev (November 1985).
After graduating from Hamline University in Minnesota, 21-year-old Rozanne Ridgway entered the Foreign Service in 1957, at a time when women were neither wanted nor welcomed there. Her first assignments took her to Manila and Palermo where she gained experience in personnel and visa issues, but did not move her career forward with any speed. Her mentor George Vest encouraged her to maintain her standards and work hard, a recommendation she took to heart. By 1967, she landed a position as a class 4 political officer in Oslo, Norway, working for Ambassador Margaret Tibbetts . Later, with Tibbetts' encouragement, she accepted a position as desk officer for Ecuador.
During her tenure as desk officer, Ridgway became embroiled in the fishery war, when Ecuador seized 51 American fishing vessels. Washington canceled its aid program as well as foreign military assistance before Ecuador removed the military from power. While still in Ecuador, Ridgway moved to deputy director in the Latin American policy office, where she continued working with fisheries. She considered this a vital learning time, when she honed her writing and analytical skills. While attached to the delegation charged with negotiating tuna agreements with Chile, Ecuador and Peru, Ridgway was christened "Tuna Roz." Upon the completion of this assignment, Ron Spiers, ambassador to the Bahamas, offered her a position in the Bahamas.
Ridgway, who did not accept all assignments presented to her, had the knack of being able to turn down a position without causing animosity. In one situation, an undersecretary offered Ridgway the temporary position of special assistant in access and fisheries affairs. Someone was needed to fill in while a replacement was sought. Ridgway refused the temporary position but suggested herself for the permanent deputy assistant secretary post and got the job. Within a year, her team had rewritten postwar international fisheries laws as they applied to the United States as well as negotiated bilateral fishing treaties with 14 nations. This accomplishment earned her a second informal title, "Lobster Lady of the Bahamas."
Though Ridgway was then offered the post of ambassador at the embassy in Trinidad-Tobago, she had tired of living and working on islands. Instead, she asked for the ambassadorship to Finland, and her request was granted. She saw her mission in Finland as one of facilitating Finnish-American dialogue, which during the Cold War was sometimes strained by Finland's determinedly neutral status. Her diplomacy and tact easily won over Finnish society.
In 1980, Ridgway returned to the United States to work as a counselor in the State Department, one of the most disappointing years in her career. She soon realized that she was there only to fulfill gender diversity requirements. Stuck in a dead-end job with few duties, she was relegated to virtual obscurity until a fisheries problem with the Canadians arose. As Secretary of State Al Haig was preparing for President Ronald Reagan's 1981 Canadian summit in Ottawa, he was told by the Canadian foreign minister that the summit would be a disaster if a commercial fishing conflict over scallops off of George's Island were not resolved. Ridgway was called upon to fix the conflict. Shuttling between Ottawa, Washington and New England, she eventually put forth a solution which was unanimously passed in the Senate.
Ridgway's name was proposed for several positions, but nothing surfaced until she was offered the ambassador's post in East Germany. She agreed, even though she married Captain Theodore Deming, an officer in the Coast Guard, before leaving the States. After the wedding, she headed for East Germany, and Deming remained at his assignment in Alaska.
In February 1985, Secretary George Schultz suggested that Ridgway consider becoming assistant secretary for European and Canadian Affairs. The nomination appeared to be going smoothly until Senator Jesse Helms of North Carolina suggested that her loyalty to the Reagan administration was questionable given her earlier service to Democratic President Jimmy Carter. There was considerable wrangling by Helms over situations that had occurred during Ridgway's post in East Germany, and it took the efforts of Senators Charles Mathias, Ted Kennedy, John Kerry, Claiborne Pell and Joe Biden to finally win the vote. Although her relationship with her new boss, George Schultz, had its rocky moments, they grew to respect one another. Ridgway's experience in this capacity led to her becoming the first woman to actively participate in a presidential summit, when she took part in the November 1985 Geneva conference between President Ronald Reagan and Soviet Premier Mikhail Gorbachev.
Given her experience, many thought Ridgway would achieve the personal rank of career ambassador. The number of positions, however, is based on the percentage of career ministers and by the time a position opened, it went to George Vest. On May 22, 1989, Ridgway received the Diplomatic Award from the American Academy for Diplomacy. She retired a month later. At her retirement ceremony, she received the Distinguished Honor Award, her department's highest recognition, and the Wilbur J. Carr Award, given to a career officer for special achievements as an assistant secretary. On Foreign Service Day in 1992, Ridgway received the Director General's Cup, during a ceremony in which she was described as a "brilliant negotiator, a diplomat of uncommon skill and a superior strategist." By 1995, she had become president of the Atlantic Council.
Morin, Ann Miller. Her Excellency: An Oral History of American Women Ambassadors. NY: Twayne, 1995.
"Ridgway, Rozanne Lejeanne (1935—)." Women in World History: A Biographical Encyclopedia. . Encyclopedia.com. 25 Apr. 2019 <https://www.encyclopedia.com>.
|
0.998232 |
I am honored to be asked to write to you, to express some thoughts about the continuing (and growing) problem of bastardization and exploitation (also known as misappropriation) of native cultural traditions.
Let me introduce myself to you: my name is Donna Smith. Originally I am from the southwest but now live in Tennessee. I am an adoptee who's found her birth family - both indian and non-indian. Although I am now "found", who I am was never in question. I grew up in Costa Rica and in Colombia, South America but have lived in the US for the last 32 years or so. I am a 9th grade drop-out who is a simple housewife, married with four sons (2 are grown).
Why am I speaking out on the subject of protecting native cultural traditions? Over the last few years, it's become very obvious how rampant exploitation and bastardization of native traditions, cultures, languages, and most importantly ceremonies has become in non-indian societies. To say that it's reached a critical point is an understatement. It seems that anywhere one turns these days, a person can find someone 'performing' an imitation (re: bastardized) form of a sweatlodge or sundance. Those two particular traditional ceremonies have become the favorites of people claiming indian descendancy or who "feel indian". There are people who claim to be Cherokee, Delaware, Hopi, and other Nations who are participating in the traditions that are not traditional to their own People. And of course, there are non-indians who also participate in the imitation ceremonies; mostly in a vain effort to try and be something else or to try and find something they feel is missing in their lives.
The protection of any Nation's traditions is vital to its cultural survival. As has been well documented over the last several centuries, when a culture is invaded by outside forces - be they materialistic forces, military forces, or forces that claim to speak on behalf of a religion, which is not the same as a spiritual force - the original ways can and have been lost. Forever. When an old way is blended with anything foreign, it is no longer an original way. It has become bastardized - mixed, blended......forever changed.
Traditional ceremonies include spiritual rites, methods and items (sometimes referred to as "artifacts"). Each Nation's People were given specific Sacred Laws for living. The duty of caring for the ceremonies has been handed down through time to individuals through the traditions of each Nation. In other words, persons were traditionally acknowledged for possessing and caring for the knowledge and understanding of each rite, song, and other ceremonial item in a sacred way. When outsiders are allowed to participate in sacred ceremonies that are not of their origins, many times it's often difficult for the outsiders to grasp the full meaning of the ceremony and its purpose(s). If simply imitating a ceremony was sufficient to making it 'work', then leaders wouldn't have been traditionally chosen/selected, ceremonial items wouldn't be important and handed down, and neither would it be important to preserve the ceremony as it has always been done traditionally.
Those with an understanding of the importance of protecting spiritual ways know that there is no halfway mark. If there is a real belief in the traditional ways of one's People, one knows things were done deliberately and with purpose. There was meaning behind each ceremony; there was a purpose for each ceremony. With that also comes the understanding that there can be harmful consequences for those who participate in and allow the perpetuation of bastardized, imitations of sacred traditions.
Hate is a wasted emotion that serves no good purpose; it only serves to destroy one's spirit. It has never been traditional to tell another what to do or how to believe. Cultural traditions and the respective ceremonies do not belong to the person(s) who is/are traditionally responsible for their preservation and continuation, they belong to the Nation. There is a difference between teaching respect for each other through the sharing of basic cultural traditions such as the sharing of food, material items such as clothing, housing, horses, a way of living in a good way with each other in spite of differences, etc - and taking what belongs to the People as a whole and 'sharing it' with anyone and everyone. Simple honor and respect are also basic traditions to almost all peoples but those important and basic traditions seem to have been forgotten along the way.
When traditions of a Nation are stolen from the People - even by one of their own - it hurts the person and the Nation. Is it any wonder why non-indian society is so confused about Native Peoples? Is it any wonder why the Nations are in turmoil, why the planet is being destroyed, why our children's future looks bleak, why so many are committing suicide, taking drugs and drinking, etc.? The list goes on.
It has to stop. Many traditional people are working together to spread understanding of this particular and important issue - to try and somehow make a difference. Unfortunately there are some 'leaders' who've become well-known in the new-age circuits, whose followers will defend the right of their 'leader' to perform imitation ceremonies. What is not seen or understood by the people participating in such things is that the supposed benefits of/in the imitation ceremonies do not exist - all that exists in such a circumstance is greed and ego, in direct opposition to anything dealing with spiritual issues.
I do not expect that my thoughts make much of a difference. It's not my intent to 'convert' anyone or force my beliefs on anyone else's way of believing. I merely want to provide an 'outsider's' view on this important issue and also lend support to the traditional leaders who are actively trying to protect the cultural and spiritual ways for their People - on behalf of all Native People. I believe we can all reach a level of respect, knowledge, and understanding for each others' cultures and traditions without crossing the lines of misappropriating what does not belong to the other.
Thank you for your time in reading this and any considerations you may give to my thoughts.
|
0.998495 |
Our organization promotes the stewardship of our waterfront and is building awareness regarding sewer overflow issues that affect the Gowanus Canal in Brooklyn, NY. Activities are conducted on the canal and shoreline, with occasional voyages to neighboring waterfront communities of Red Hook, Sunset Park and Brooklyn Heights.
The Dredgers need enthusiastic volunteers who love the sport of canoeing, the Gowanus neighborhood, or just generally care about supporting the environment and revitalization of New York Harbor. Volunteers need to be independent self-starters and our leadership will help you build and expand your inherent talents. Past volunteers would help with outreach, volunteer for specific events and serve as guide assistants on our tours. You will learn of the neighborhoods rich history so you may answer basic questions and greet guests. You may be asked to help with a few other tasks depending on the event or activity.
Since 1999 the Dredgers have empowered people to care for the Gowanus Canal through advocacy, conservation, and education. We encourage an understanding of the NY-NJ harbor as a resource for recreation and education as well as a waterway for commuters, tourists and goods. This past season, we logged over 2,000 voyages on the Gowanus Canal with over 1,000 individuals, including more than 200 youth, participating in our programs! As people experience and enjoy our waterfront they become advocates for its revitalization. Our advocacy efforts are proving to be fruitful as recent legislation has provided funding primarily due to the rise in popularity of paddling on the Gowanus Canal.
“The Gowanus Dredgers in All World”?
Create a subscription for company vacancies "The Gowanus Dredgers in All World"
You have created a subscription to the company's vacancies "The Gowanus Dredgers in All World"
|
0.953682 |
John Glenburn Airlie was born 12 February 1929 in Edinburgh to John and Catherine Airlie. He was educated at Trinity Primary School and Trinity Academy, which he left aged 15 with no formal qualifications. He was then apprenticed as an auto electrician before being called up to serve in the RAF in May 1947. John was discharged that December for 'ceasing to fulfil physical requirements'.
For the next 15 years, he worked in a variety of jobs: erecting TV aerials, window cleaning, logging, selling fruit , working as a ring groom in a circus, and as a guard on the railways. While working on the railways, he spent many a happy hour sitting in sidings with his sketch pad, keeping alive his interest in art. In 1962, he became a park keeper at Holyrood Park in Edinburgh and worked there until 1966.
In 1964, John began studying for formal qualifications with a view to his eventual entry into art college. He passed basic level examinations in English and art in 1965 and was awarded a grant to study for further qualifications that year. During 1966 and 1967, he passed sufficient higher level qualifications in English, art, history, modern studies and French to gain entry into Edinburgh College of Art, which he entered as one of its oldest students in 1968.
Although John initially expected to study sculpture, he was quickly drawn to the glass department, then headed by Helen Monro Turner assisted by John Lawrie and the department's technical brains, Ken Wainwright. John and Ken became firm friends and spent many a happy hour 'tinkering' in the furnace room.
John was eventually to make the development of a small-scale glass furnace the subject of his diploma thesis. While he was in the glass department, he met two part-time students who had also studied glass engraving under Helen Monro Turner: Norman Orr and Alison Kinnaird. John was to work in collaboration with both of them for some years thereafter.
During 1971, his graduation year, he set up a furnace based on his thesis and established Kirkhill Glass to produce small soda glass items. At the same time, he produced lead glass for engravers, some free-form glass sculptures and several sculptures in wood to commission.
Although Kirkhill Glass could have been a full-time occupation, John also studied for his teacher's diploma at Moray House in Edinburgh, graduating from there in 1972 and going straight to teach in the art department at Broughton High School in Edinburgh. He worked there until his retirement in 1981.
Despite John's teaching load, Kirkhill Glass thrived from 1971 until he was forced to close it in 1976 through physical disability.
Kirkhill Glass is noted for its sparkling blue colour, a by-product of the kiln design. Generally, pieces were never more than a few inches high, although some larger items were made to commission for Jenner's store in Edinburgh and for one of the major Scottish banks.
Some pieces were purchased for the V&A Museum's collection in London. His lead glass, produced either as free-form sculptures or for engraving, found its way into many public collections, including those in Edinburgh and Glasgow museums, The Royal Scottish Museum, and many important private collections. Sadly, most of the glass he produced at Edinburgh College of Art, all of it lead, was stolen from Dalkeith, Scotland, in the early 1970s and has never been recovered.
|
0.998641 |
- I believe the first opinion is more convincing, etc.).
- Which produces а greater impression, the theatrical performance or the film?
- Some people prefer the cinema as it can show many things which you cannot see at а theatre. Others prefer the theatre as the acting of live actors produces а stronger impression. What do you think?
- Чим слід керуватися при виборі професії?
- Чи може школяр усвідомлювати своє покликання?
- А як бути, якщо його не маєш?
- Можна полюбити професію в процесі роботи?
Пропонуючи таким, що вчиться подібного роду питання, викладач не лише стимулює їх бажання висловитися, але одночасно дає напрям їх думці. А то, що учні не можуть спиратися на мовну форму питань, вказує на реальність усвідомлення ними єства проблеми, на справжню спонтанність їх мовного акту. Зрозуміло, серія дискусійних питань не повинна виходити за межі мовних можливостей учнів. Останній вигляд роботи по суті вже є учбовою дискусією з експозицією, вираженою в полегшеній формі .
Teacher: I've written an English proverb on the blackboard. It reads, "He who knows how to work knows how to rest." Let us discuss it. Is this proverb always true? Are there any pupils who know well how to rest but know little how to work (to study)? Which in your opinion is more difficult, to learn how to work or to learn how to rest?
Pupil 1: I think the proverb is true, really, why not? I can say from my own experience that those people who work well they can rest well. They never sit idle, doing nothing. It's just difficult for them to do nothing. They go in for sports, travel, work in the garden .
Pupil 2: I'm sorry for interrupting. You said, They work in the garden.' And we are talking about rest, aren't we?
Teacher: Oleg, please don't interrupt Vanya, you'll have your own say.
Pupil 2: Valentina Ivanovna, I am sorry.
Pupil 1: Well, I'm going to round up. To my mind, the proverb is true. Practically, I can't add anything. Thank you.
Pupi1 2: I do not agree with the English proverb. There are many people who can work well but who cannot spend their free time. They just don't know how or maybe they simply do not like to rest. I read somewhere (I don't remember whether in an article or in а book) that Academician Korolyov was so much carried away by his work that he didn't find time for rest, he did not like to rest, he had no hobby. And of course he worked very well. If what I said is true it ruins the English proverb.
Pupil 3: On the whole I agree with what Oleg said. There are different types of people. I (for one) know а pupil who is in our class and he can neither study nor rest. He just idles away his time. What would you say about that?
Pupil 4: May I say а few words? Well, as far as I can understand the English proverb which we are discussing, it says nothing about those who cannot work. It deals with those who know how to work. Anyhow I agree with Oleg and Volodya who believe the proverb is not always true. Many people know how to work well but they don't know how to rest well. To arrange а good rest is not so simple, it requires wish or some skill, for instance, playing chess or playing the guitar. People should be taught how to rest, I think. Young people are taught some profession, and they are taught very well, but sometimes nobody shows them how to rest.
Pupil 5: Still, I believe it's easier to learn to rest well than to work well.
Teacher: Thank you for your participation in the discussion. I'd like only to add that many of you don't see the other meaning of the English proverb that corresponds to the Russian saying: Кінчив справу — гуляй сміливо.
Вчитель резюмував хід дискусії, висловлював свою думку по окремих положеннях, коментував ті ідеї, які були недостатньо досліджені у виступах учнів.
|
0.934283 |
Suppose that a Wiener process gains a known drift rate at some unobservable disorder time with some zero-modified exponential distribution. The process is observed only at known fixed discrete time epochs, which may not always be spaced in equal distances. The problem is to detect the disorder time as quickly as possible by means of an alarm that depends only on the observations of Wiener process at those discrete time epochs. We show that Bayes optimal alarm times, which minimize expected total cost of frequent false alarms and detection delay time, always exist. Optimal alarms may in general sound between observation times and when the space-time process of the odds that disorder happened in the past hits a set with a nontrivial boundary. The optimal stopping boundary is piecewise-continuous and explodes as time approaches from left to each observation time. On each observation interval, if the boundary is not strictly increasing everywhere, then it irst decreases and then increases. It is strictly monotone wherever it does not vanish. Its decreasing portion always coincides with some explicit function. We develop numerical algorithms to calculate nearly optimal detection algorithms and their Bayes risks, and we illustrate their use on numerical examples. The solution of Wiener disorder problem with discretely spaced observation times will help reduce risks and costs associated with disease outbreak and production quality control, where the observations are often collected and/or inspected periodically.
|
0.987455 |
Demand response is an increasingly popular program ensuring power grid stability during a sudden surge in power demand. We expect high-performance computing (HPC) systems to be valued participants in such program for their massive power consumption. In this paper, we propose an emergency demand-response model exploiting both power capping of HPC systems and node scaling of HPC applications. First, we present power and performance prediction models for HPC systems with only power capping, upon which we propose our demand-response model. We validate the models with real-life measurements of application characteristics. Next, we present models to predict energy-to-solution for HPC applications with different numbers of nodes and power-capping values, and we validate the models. Based on the prediction models, we propose an emergency demand response participation model for HPC systems to determine optimal resource allocation based on power capping and node scaling. Finally, we demonstrate the effectiveness of our proposed demand-response model using real-life measurements and trace data. We show that our approach can reduce energy consumption with only a slight increase in the execution time for HPC applications during critical demand response periods.
|
0.994677 |
Churches are making traditional Christmas carols politically correct by removing words such as "king", "son" and "virgin", it is claimed.
Enduring favourites such as Hark the Herald Angels Sing and God Rest Ye Merry, Gentlemen are being altered by clergy to make them more "modern and inclusive".
But churchgoers say there is no need to change the popular carols and complain that the result is a "festive car crash" if not everyone is singing from the same hymn sheet.
It comes just a day after a Church of England vicar banned his congregation from singing O Little Town of Bethlehem because he believed its words do not reflect the suffering endured by modern residents of Jesus's birthplace.
Another clergyman has rewritten the Twelve Days of Christmas to include Aids victims, drug addicts and hoodies.
Steve Goddard, co-editor of the Christian website Ship of Fools, which is running a competition to find the worst example of a rewritten carol, said: "It's a festive car crash.
"Half the congregation sing familiar words from memory, while the rest stumble over revised alternatives. Our readers are telling us straight – for some new versions there should be no room at the inn."
Among the "theologically-modified, politically-corrected" carols encountered by visitors to the website are Hark the Herald Angels Sing in which the line "Glory to the newborn King" has been replaced by "Glory to the Christ child, bring".
The well-known refrain of O Come All Ye Faithful – "O come let us adore Him" – has also been changed in one church to "O come in adoration", both changes apparently made for fear the original was sexist.
"[One reader] wrote in asking if the original line was considered too gender-specific," Mr Goddard said. "But as he rightly pointed out, Jesus wasn't hermaphrodite, neither was he a girl."
Churchgoers at one carol service will not be allowed to sing the words "all in white" during Once in Royal David's City in case they appear racist, while another cleric has removed the word "virgin" from God Rest Ye Merry, Gentlemen.
|
0.999987 |
When is the best time to visit Austin?
Best Time To Visit Austin for Sightseeing: The best time to walk around the city, enjoying the sights and beautiful parks like 351-acre Zilker Park, is in the spring and autumn when the weather is often ideal. These seasons also bring the biggest crowds, so if you’d rather enjoy the city during a more peaceful time, you might want to consider visiting in November or February. Temperatures are often rather pleasant then, although you may need a rain jacket for the occasional wet day. The worst time for sightseeing is during the peak of summer, July and August, when temperatures are scorching and just a short stroll down the street can be rather miserable.
Best Time for Barton Springs Pool: No matter what the weather brings, the spring-fed waters of Barton Springs Pool, one of Austin’s most popular attractions, stays at a steady 20°C year round. This is the place to be in the summer, when everyone is seeking relief from the heat. Summer weekends are the busiest, so if you come during this time, arrive before 8am (it opens at 5am) or be prepared to wait in a long line, and know that parking is at a premium. Another option for avoiding crowds (and the fees), is to go during the hour of free swimming, every night from 9pm to 10pm. While you can go at other times of the year, many feel the water is too chilly to brave unless it’s at least 32°C outside, which can happen outside the summer months, usually in May, September and October.
Best Time to Visit the State Capitol: The Texas State Capitol building sits atop a hill with a picturesque view of downtown Austin and is listed on the National Register of Historic Places. One of the city’s most rewarding attractions, free guided tours are available daily throughout the year with the exception of major holidays, Monday through Saturday from 8:30am to 4:30pm. To avoid waiting in line, secure a reservation and plan to come on a weekday as early in the morning as possible. Even if you have a reservation, due to security and screening, you’ll need arrive at least 45 minutes before your scheduled time.
Best Time to See the Bats: Austin’s Congress Avenue Bridge is home to the largest urban bat colony in North America, with 1.5 million bats. Every March, the bats return to give birth and raise their pups, sticking around through October. The best time to come and see them is in late August and early September when the babies join their mothers in flight. Each evening, just before the sun sets, visitors gather on the bridge to watch the bats emerge. While it usually happens at sunset, it can happen up to 30 minutes before or after, so you’ll want to arrive early to ensure that you don’t miss it.
High Season (March through May, September and October): Austin’s high season comes twice each year, mainly during spring and fall, when the weather is generally mild and the city hosts a number of festivals, concerts parades and festivals. This is when you’ll experience the biggest crowds and usually the highest rates, though compared to many other cities, Austin is relatively affordable even during the busiest times of year. You’ll get the best rates by planning ahead, especially if you go during major festivals such as South by Southwest in March, and in late September/early October when the Austin City Limits Music Festival arrives. If you’re looking for a cheap room at the last minute during high season, you may need to raise your budget a bit, or stick to bare bones, economy accommodation.
Shoulder Season (November through February, June): Once November rolls around, you’ll have a much greater choice of affordably priced rooms. Booking at the last minute is likely to be easier, and temperatures remain fairly pleasant, even throughout much of the winter, typically ranging from 13° to 18°C. It’s a perfect time for enjoying the areas outdoor activities, and sometimes, you’ll even be able to enjoy the numerous biking, hiking and horse riding trails all to yourself.
Low Season (July and August): The peak of summer in Austin means scorching temperatures that keep many tourists away, but if you can stand the heat, you’ll be able to take advantage of a significant drop in hotel prices as well as thinner crowds.
Free Week – “Free Week,” meaning the first week of January, is a great time to be in Austin, as hundreds of local bands participate in this annual event held at multiple venues across the city – and, the best part is that every show is (you guessed it) free.
Martin Luther King March and Festival – Martin Luther King’s legacy is celebrated on the third Monday of January each year, with an annual community march, kicking off with a short program at the civil rights leader’s statue on the University of Texas campus. The event is followed by a festival that features local musicians and a variety of vendors.
Austin Marathon and Half Marathon – This mid-February event that will take place on February 19 in 2017, brings over 20,000 runners and thousands more spectators as one of the largest combined marathons and half marathons in the country. Both courses run through some of the city’s most scenic and historic areas, including Lady Bird Johnson Lake, the Allandale and Hyde Park neighborhoods, Congress Avenue, the University of Texas campus, and the State Capital complex.
Valentine’s Day – Austin offers special events for just about everyone on Valentine’s Day, whether you’re looking to share the love or celebrate singledom. One of the most popular restaurants for romance is Green Pastures, set within a magnificent Victorian home serving gourmet fare, fine wine and Southern hospitality. Area wineries and hotels typically offer a variety of special romance packages for the holiday as well. One of the favorite “Anti-Valentine’s Day” events is the Home Wreckers & Heartbreakers Ball, hosted at Gibson Bar, where everyone celebrates being single, dancing the night away with old and new friends to a DJ that spins tunes all night long. Alamo Drafthouse presents “Love Bites” sing-along shows, where crowds of people gather holding lighters in the air and defying traditions by belting out anti-love power ballads.
No Idea Festival – The No Idea Festival is hosted over four days in late February and is focused on improvised music and performance art. It brings together musicians and sound artists from across the globe collaborating in multiple gradations of free improvisation, composition, noise, and sonic interventions.
Texas Union Film Festival – The annual Texas Union Film Festival held in late February, AKA TUFF, is a night that highlights the cinematic talents of the students at UT Austin.
Zilker Kite Festival – This fun, free event held in early March features a kite competition, using only homemade, single-line kites, and is open to anyone who wants to compete. A variety of contests are held, including kids only competitions, contests for the smallest and largest kites, oldest and youngest kite-fliers, and more. A VIP breakfast, as well as food and exhibitor booths are also hosted.
South by Southwest (SXSW) – One of Austin’s biggest events of the year, the South by Southwest Conferences and Festivals offer the latest and greatest in the music, film and interactive industries, along with performances by more than 2,000 bands from around the world. It takes place over 10 days in mid-March, March 10-19, 2017, at numerous venues across more than100 stages throughout central Austin, including the Austin Convention Center.
St. Patrick’s Day – St. Patrick’s Day in Austin brings a family-friendly event celebrating Irish culture, taking place annually on March 17th at Pioneer Farms. Festivities include two stages of local and international Celtic musicians as well as performances by Irish dancers and bagpipe bands. Of course, there will also be plenty of authentic Irish cuisine and Irish brews, including Guinness.
Rodeo Austin – This two-week long event in mid-March, March 11-25 in 2017, features a Top 10 ProRodeo, daily concerts, a livestock show and more.
Austin Urban Music Festival – A two-day festival held in early April, this event features a variety of family-friendly entertainment showcasing soul, R&B, hip hop, gospel and neo-soul, as a platform for talented local African-American artists to reach a diverse audience.
Zilker Garden Festival – Also held over two days in early April, the Zilker Garden Festival includes a flower show that showcases flowers across the state of Texas, a food court, beer garden, live entertainment, kids’ corner with activities that include building a birdhouse and making butterfly wings, and a host of vendors selling plants, pottery, garden-themed accessories, jewelry and herbal products.
Texas Community Music Festival – This festival held over 15 days during the second half of April at Central Market North, features free performances across a wide variety of music genres, including everything from solo acts to 70-piece ensembles.
Austin Reggae Festival – Featuring three days of reggae in mid-April, April 14-16, 2017, this festival takes place at Auditorium Shores in downtown Austin.
Texas Burlesque Festival – This three-day showdown in late April celebrates the revival of burlesque, vaudeville and cabaret through a variety of parties, a brunch/roundtable, workshops and performances.
Lone Star Jam – The Lone Star Jam is held over a weekend in early May, May 7-8, 2016, and showcases a diverse lineup of regional and national country music artists along with some of Austin’s best food trucks.
Pecan Street Festival – If you aren’t into country, the Pecan Street Festival is typically held the same weekend in May as the Lone Star Jam and is one of the longest-running and largest arts, crafts and music festivals. It takes place in the historic Sixth Street District and features an extensive lineup of music performances, street magicians, dance performers, a petting zoo, all sorts of foo options and a classic carnival.
Renegade Craft Fair – Every year over a weekend in mid-May, May 14-15, 2016, this fair held at Fair Market showcases some of the very best in modern craft and design with over 125 makers selling everything from jewelry, clothing and accessories to modern home décor.
Deutschen Pfest – Held annually on the third weekend of May, this festival in Pflugerville, 17 miles north of Austin, features a parade, live music and a carnival, include lots of rides, food and drink and vendors selling all sorts of wares.
X Games Austin – The X Games come to Austin in early June, June 2-5, 2016, featuring world-class action sports competitions, live music, interactive festivals and more.
Soul to Sole Festival – One of the oldest festivals of its kind, this annual celebration brings dancers and instructors from across the globe for five days in June, June 7-12, 2016, hosting tap jams, master classes, choreography classes, panel discussions and a variety of performances.
ATX Television Festival – Held over four days in June, June 9-12, 2016, this unique festival celebrates television through screenings, panels, Q&As and other industry events featuring people who work in all aspects of TV. It spotlights classic shows, shows that were cancelled too soon, cult hits, never-aired pilots and more.
Blanco Lavender Fest – Located in Texas Hill Country, less than an hour’s drive west of Austin, this festival held over three days in mid-June, is all about lavender. Admission to the area lavender farms is free and many offer special entertainment and activities, while some allow visitors to pick their own lavender. In Blanco, the whole town participates with restaurants serving lavender-flavored dishes and merchants offering all sorts of lavender merchandise. Speakers also provide lavender-related educational programs at the courthouse.
Keep Austin Weird Festival – This festival in late June, June 25 in 2016, is aimed at “keeping the weird tradition going strong.” It starts with a 5k fun run and is followed by a variety of local food vendors with delicious offerings, live music, games and entertainment. Costumes are encouraged, and the weirder the better.
Fourth of July Symphony & Fireworks – One of the largest Independence Day celebrations in Texas, this event is hosted annually on 4th of July each year at Circuit of the Americas. It features games and contests in the afternoon followed by a massive fireworks display accompanied by the sounds of the Austin Symphony Orchestra.
Chamber Music Festival – For over two weeks in July, July 9-24 in 2016, this festival showcases classical music through free community concerts, workshops, master classes and behind-the-scenes lecture performances given by classical musicians.
Pachanga Presents – Formerly known as the Pachanga Latino Music Festival, this event in mid-July, July 16, 2016, takes place at the Moody Theater and features Latin music, culture and cuisine. There are also special events for the kids, including a piñata party, folk arts and crafts, and music workshops.
Float Fest – Held over a weekend in mid-July, July 16-17, 2016, at Cool River Ranch in San Marcos, about a 30-minute drive south of Austin, this outdoor music festival hosts a lineup of nationally acclaimed acts. Many attendees camp on the grounds and tubing companies offer inner tubes for floating down the San Marcos River as well.
Body Mind Spirit Expo – This two-day event is held around the third weekend of July, July 23-24, 2016 at the Palmer Events Center. It showcases alternative health products, psychics and mediums as well as wellness, health and fitness industry experts.
Austin Ice Cream Festival – A celebration of ice cream, this event takes place in mid-August, August 13, 2016, at Fiesta Gardens by Festival Beach. Attendees can enjoy lots of local and national ice creams as well as live music, contests, kids’ activities and more.
Austin Hot Sauce Festival – Also held in mid-August, August 13, 2016, at Fiesta Gardens, is the annual Hot Sauce Festival which attracts over 15,000 participants who sample as many different types of hot sauce as they can. There are over 350 varieties of hot sauce as well as lots of food, live music and entertainment.
Bat Fest – Another one of Austin’s most popular festivals, Bat Fest celebrates the one-and-a-half million Mexican free-tailed bats that emerge from under the Congress Avenue Bridge downtown at dusk. Typically held on the third Saturday of August, it features three stages with live music, over 75 arts and crafts vendors, food and drink, children’s activities, a bat costume contest and other bat-related activities.
Pride Festival – Held on the last Saturday of August, August 27, 2016, this festival held in Fiesta Gardens on the shores of Lady Bird Lake celebrates gay pride with a variety of live performers followed by an evening parade with all types of grand floats that begins at the State Capitol.
Capital City Black Film Festival – Taking place over four days in late August, August 25-28, 2016, this festival brings together talented African Americans involved in media and the film industry, featuring films, acting seminars, panel discussions, weekend parties and more.
Austin Triathlon – Taking place annually on Labor Day, this event in the heart of downtown Austin begins with a swim in Lady Bird Lake, followed by a bike course with scenic views over Congress Street Bridge, and finishes with a run along the path at Auditorium Shores.
Eastside Kings Festival – This mid-September festival features a weekend of blues, gospel and jazz acts to celebrate some of the greatest living musicians. In 2016, it will be held over the weekend of September 10-11.
Austin Music Video Festival – This four-day festival celebrates music videos produced by local artists and provides a platform to connect with professionals in music, film, gaming and technology industries. Held in early September, September 7-10, 2016, it features an award show, screenings, interactive video technology, a live VJ battle, panels, workshops, live concerts and parties.
Texas Craft Brewers Festival – Held on the third Saturday of September, this is the state’s largest craft beer event focused exclusively on beers brewed in Texas. Taking place at Fiesta Gardens, beer enthusiasts can enjoy unlimited tastings from more than 60 breweries across the state.
Fantastic Fest – This cinematic celebration takes place around the last week of September, September 22-29, 2016, showcasing the best films in fantasy, sci-fi, horror and action. A movie marathon is hosted at Alamo Drafthouse, featuring more than 50 independent feature-length and short works. It also hosts Q&A sessions with actors and directors, film discussions with nationally recognized critics, movie-themed karaoke parties, live podcast recordings, geek pub trivia and award ceremonies.
Austin City Limits Music Festival – Generally held over two weekends in early October, with 2016’s festival taking place on September 30-October 2 and again October 7-9, this massive event at Zilker Park draws people from all over the world to enjoy multiple stages that host over 130 bands with a diverse range of genres and styles. It also includes a wide variety of fantastic local eats, a children’s area and family-friendly activities.
MondoCon – This celebration of art, comics, movies, music, toys and food is typically held over the first weekend in October and features artists and creators from across the globe as well as screenings, panels, food trucks and interactive events.
Austin Film Festival – Running for just over a week in mid-October, October 13-20, 2016, the Austin Film Festival (also known as the Writers Festival) is dedicated to the screenwriters of the film industry. It hosts some of the most acclaimed filmmakers for round table discussions, panels, and the judging of a famous screenwriting contest. It also screens more than 100 films, including feature films, documentaries, shorts and more.
Texas Trucklandia Fest – Celebrating Austin’s food truck culture, this six-day event in mid-October features the diverse cuisine from some of the city’s most popular food trucks which serve up their signature dishes and compete for cash prizes.
Austin Days of the Dead – Beginning in mid-October and running through early November, this cross-cultural celebration blends Halloween-themed festivities with the traditions of the Days of the Dead (Dia de los Muertos). It features a variety of events held across the city, including parades, live music and cultural performances, exhibitions, workshops and more. Costumes are encouraged.
Austin Celtic Festival – Celebrating all things Celtic on the first weekend of November at Fiesta Gardens, the festivities include regional and international Celtic musicians, Celtic dance performers, Celtic sporting events, workshops and more.
Austin Powwow and Native American Heritage Festival – This event celebrating the culture and tradition of American Indians is held on the first Saturday of November at the Travis County Expo Center and features competition dancing, an authentic Indian market and educational and heritage programs.
East Austin Studio Tour – This event held over two weekends in the second half of November is a self-guided tour that features galleries, commercial studios, installations and art-themed parties. The opening party is a special culinary event highlighting local chefs, educational programs and competitions.
Austin Trail of Lights – Starting around the 1st of December and running throughout the month, the Trail of Lights held in Zilker Park is a festive mile-long walk through spectacular light displays.
German Christmas Market – This annual market held on the first Saturday of December at the German Free School, features traditional German Christmas music, authentic German items handcrafted in the country’s Erzgebirge region, German cuisine, St. Nikolaus and more.
Armadillo Christmas Bazaar – This 10-day event held at the Palmer Events Center in mid-December is an art fair and music festival featuring handcrafted items from more than 160 artists, live local music, and a full bar.
New Year’s Eve Festival – On December 31st each year, Austin hosts a free New Year’s Eve festival at Auditorium Shores & Vic Mathias Shores. It includes live music, local artists and exhibitors, entertainment such as aerialists and live painting, art installations, children’s activities and food trucks. It culminates with a spectacular fireworks finale at 10pm.
|
0.998835 |
Design and construction of a new four bedroom, four and a half bath home. The architectural style reflects a Florida Vernacular design. The site features an infinity pool, a private guest suite and a cabana which includes a bar, coffered ceiling and bath. Sliding doors on 3 sides of the cabana disappear into the walls for open air breezes from the intercoastal. Pecky cypress backets and decorative stone work surround the exterior of the home, while the interior includes a dining room with a cove ceiling and a two-sided fireplace in the family room. A hand-crafted staircase with wrought iron railings and stain wood handrail lead to the second floor.
|
0.94096 |
Many works of art and science by Leonardo are regarded as masterpieces even today, because of their specifics and uniqueness.
"Annunciation", painted around 1473, is a representation of the Christian subject of Annunciation, where the Angel Gabriel informs the Virgin Mary that she is the chosen one to carry the child that is going to be world's savior. This image depicts the Angel Gabriel with extended bird wings, which emphasized the situation of event and humility more than the rest of the painting.
"The Lady with the Ermine, 1483", painted around 1483, represents Cecilia Gallerani, the most famous mistress of the Duke of Milan, Ludovico Sforza, with whom Leonardo worked for a certain period of his life. The Duke often asked Leonardo to create interesting feats of art and science but he also requested a portrait of his mistress. Leonardo painted Cecilia, with her holding an Ermine, which symbolically represented the Duke, who was held tightly by her charisma and personal influence.
"Portrait of a Musician" is a painting made around 1490, and the man represented is believed to be the maestro di cappela of the Cathedral in Milan, Franchino Gaffurio. The painting's most interesting element is its ornate, tiny details illustrating a musical score with notes on it. Also, this painting has been restored multiple times throughout history.
"Vitruvian Man" is one of the most famous drawings made by Leonardo Da Vinci, somewhere around 1492. The drawing is based off of a architectural manual by the famous Roman architect, Marcus Vitruvius which is how the illustration got the name. The image illustrates a man positioned in a square and a circle, showing the human being as a principal source for symmetry and proportion while relating this to classical architecture.
"The Last Supper, 1495" is one of the most famous murals ever created by Leonardo in 1495. This large wall painting was planned as part of renovation process of Convent of Santa Maria delle Grazie in Milan. The image shows the last supper that Jesus had with his disciples, depicting the scene in which Jesus says that someone among them will betray him. Environmental factors and the technique of painting used caused the masterpiece to fade over the years. As a result, it has been restored a number of times in the past. The interesting thing about its creation is that Leonardo was often seen working on the painting without stopping, and then leaving for a few days to walk around the town and look for the perfect faces for the disciples. This enormous mural measures at 181" x 346" (15 ft x 28 ft).
"Mona Lisa, 1503", the most famous portrait in the world, was unofficially completed around 1503. However, Leonardo always carried the painting with him and perfected it over 15 or more years. The woman in the painting is now recognized as Lisa Gheradini, a wife of an official of that time. She had five children at that moment, and some speculate that her mysterious smile comes from the fact that she was pregnant. Although many theories and speculations have been made about the "Mona Lisa", critics all agree that it is an amazing work of art. This painting is considered to be Leonardo's masterpiece and was later acquired by the French King Francis I, as a beautification for his royal bath-house. After the French revolution, the painting was left in the palace to be seen by the public, and was later transferred to the Louvre, where it stands today. The painting is considered a national treasure of France, and its price cannot be measured.
"The Virgin, Child, and St. Anne, 1503" was painted around 1503, and depicts the child Jesus playing with a lamb, while his mother, Mary, tries to teach him to be more peaceful and calm. This image also illustrates Saint Anne, Virgin Mary's mother in whose lap the Virgin Mary is sitting. The painting shows Saint Anne as significantly larger than Mary. This however is not because she is physically bigger but simply to show that she, as a mother, is the greater generation and always caring for her daughter, even while her own daughter watches over her grandchild.
"Head of a Young Woman with Tousled Hair, 1508", or "La Scapigliata" was painted around 1508 with oil on canvas and is currently located in National Gallery of Parma in Italy. This painting illustrates a woman's face together with her hair floating around in simple, gradient colors but with exquisite detail.
"Saint John the Baptist, 1514" was painted around 1514, and depicts John the Baptist, pointing upwards with his index finger, while smiling. This embodies the notion that while pretty things in life can be found in people, true beauty is really up in heaven (the sky). Some critics think that the face of Saint John is actually the face of his pupil Salai, which was used as a model for this painting. This great work of art is presented in the Louvre museum in Paris.
|
0.98241 |
to cut someone down to something or a smaller size. I will have to pare the budget down to the minimum. I hope we can pare down the budget. After much arguing, we pared it down.
1. To reduce the size of something by cutting or shaving off its outer layers; trim something: I pared down the tiles so that they would fit snugly together. The pegs were too big for the hole, so I pared them down with a pocketknife.
2. To reduce the size or amount of something by gradually taking away parts of it: We should pare down the supplies we keep in our storage room until we have only what we absolutely need. The article was too long, and it took me a long time to pare it down.
|
0.968865 |
How are app developers enhancing their iOS development strategies to improve user adoption ?
It’s not a matter of the distant past when the spectacular announcements made at the Apple WWDC 2018 developers’ conference have amazed us. Mainly, the major updates are rolled out on iOS version, Apple watch, Apple TV and Mac in the gala event. The new iOS 12 version steals the show with a slew of new features, major improvements, and stability optimization. Even, after the WWDC event, it’s heard that the keynote is primarily for the developers to make iOS app development better.
The latest iOS 12 is also warm-cuddled by the developers due to the immense opportunities it offers to the developers in the form of improved performance, stability, new technology, and resources to build the breathtaking apps. That’s the reason, the developers are sincerely taking the iOS 12 updates into the account to create iOS app development strategies that make the apps highly usable, efficient, brilliantly use the hardware features, and stay up-to-date as per the changing trends.
|
0.999732 |
Normal tissue stem cells possess the ability to produce a set of stem and progenitor cells by asymmetric cell division. Progenitor cells lose self-renewal ability but still can proliferate and convert to terminally differentiated cells. During such differentiation process, DNA methylation has a crucial role through epigenetic regulation of target gene expression at the right timing and environment. In other words, a cell population at each differentiation stage has an inherent DNA methylation profile. Similar to normal tissue, heterogeneity of cancer is thought to result from replicating a series of differentiation processes from cancer stem cells (cancer stem cell hypothesis) [1–5]. Cancer stem cells might be derived from normal stem cells and therefore show stem cell abilities such as self-renewal, asymmetric cell division and resistance to drug and to hypoxia, which result in low therapeutic efficacy of conventional chemotherapy or radiation therapy.
|
0.99999 |
How does the brain stem act as a mapmaker?
The brain stem maps information both from the outside world and from inside the body. Nerves originating in the skin, muscles, skeletal system, blood vessels, and viscera (internal organs) all connect to neurons in the brain stem. The firing patterns of these nerves are then mirrored in the firing patterns of the brain stem neurons. In this way, the brain forms a representation of the internal state of the body, and this representation is updated on a moment-by-moment basis. Likewise, some types of sensory information, such as sound and touch, are sent to the brain stem in the initial stages of perception.
|
0.999994 |
Read the AP report on the final stages of the operation that should finally permanently seal the blown-out well in the Gulf of Mexico, and tell me it doesn't sound like the plot from a Jules Verne novel: "One man guides a drill more than two miles beneath the sea floor and three miles from the surface, trying to hit a target less than half the size of a dartboard. The drill is about as wide as a grapefruit. And now the target, BP's blown-out oil well in the Gulf of Mexico, lies less than 100 feet away." Intrigued? So am I.That passage underscores the vast complexity and technological dexterity required of drilling at such depths -- and once again emphasizes how difficult and dangerous the practice is.
If that target is successfully hit, then the well that has spewed 5 million barrels of oil into the Gulf of Mexico may be considered permanently and finally sealed -- and the nightmare that has been the BP spill will reach an all-important milestone. That is, the well, which was finally blocked off last week with a procedure called the 'static kill' could be deemed totally shut.
The relief well, the ultimate solution to stopping oil from gushing into the Gulf as it has since April, could reach the crippled oil well by Friday. If it hits, engineers will perform a "bottom kill" by pouring in mud and cement to permanently seal the blown-out well that's spewed an estimated 207 million gallons.
A "static kill" last week pushed mud and cement into the top of the crippled well, leaving very little chance oil could leak into the Gulf again, said retired Coast Guard Adm. Thad Allen, the government's point man overseeing the cleanup operation. Neither he nor BP officials have been willing to declare victory yet -- but Allen said that day isn't far off.
BP began drilling the relief well not long after the initial accident, and drilling has been ongoing for months. Engineers are working on the finishing the relief well as I type this, and the well could be sealed once and for all before long. Keep those fingers crossed.
|
0.931518 |
What is the approximated time frame required for a good (not complete) coverage of Angkor Wat greatest sights? Is the April is a good time to visit Angkor Wat?
I did the standard three-day tour and another day around Siem Reap itself. It was enough time to visit the major sites but one could easily spend more time there.
The boat trip from Siem Reap to Battambang was a great experience. I would avoid the 'speedboat' if possible and take the ferry if it's running. Slower means more photo ops. The nice thing about this trip is that most of it in a fairly narrow river so it's easy to take in life along the river.
The train from Battambang to Pursat was a particular joy. A rocking and rolling wreck of a train, rarely going faster than one would ride on a bicycle.
Hi Thien. As Bob says, three days is the "usual" amount of time, and should provide you enough time to get lots of great pics although the temple area is so huge you could easily spend a week or more there. I believe in April you should be ok weatherwise. Both times I have visited Angkor, it has been in August which is considered part of the worst time (rainy season) yet I have not found this to be a huge hindrance.
I know it is off topic, but I feel this is also a great time to mention the most important accessory you can bring with you. In the temples themselves, a tripod is an absolute must IMO. I can't say how many shots I took at 1/20th or 1/30th, which would be impossible without a tripod. I know you shoot a DSLR where I was shooting 100iso slide film, so you do have the option to bump up the ISO, but even so, I would not venture into the temples without the tripod. The good thing is that the nuns and monks who inhabit the temples are not realy moving anywhere, so you have time to set up your tripod as well as being static enough to get away with slow shutter speeds. If you are worried about the amount of gear you have to bring with you Thien, I did see a couple of photographers who paid local boys to act as porters. I am sure the costs for that are low ($10us a day or less likely). I lugged my own stuff, but I know others were not quite so ambitious.
Have a great trip Thien, Angkor is a truly amazing place.
Thank you, Bob. I think I will fly in from VN directly to Siem Reap so I am not so sure about the boat trip yet. My goal for this time is limiting the Cambodia trip to Angkor Wat but if there is absolutely something around the Siem Reap area that you think is a must visit, please let me know.
Can a person stay in the complex overnight or you will have to get out as soon as the sun goes down?
I am pretty sure you will have to leave Thien, but not 100% positive. There certainly isn't any lodging within the complex, but Siem Reap is very nearby. Send me an e-mail if you would like a guest house recommendation.
I'd say three mandatory days for the temples, that's what I also did plus another day to go around (Tonle sap).
I like my confort and was really happy to find a pool at the hotel we were in. I think the most clever way to move is to get up early, coome back around 12, stick around fresh water and shade for an hour or two then go back around 3PM.
The Temples are very near Siem Reap, i'd say a maximum of 10mn drive with the exceptions of Banteai Srey and ta prhm which a bit further, then there is no need to stay overnight in Angkor, if you want the best shooting hours, just cut the day in halves, hire your driver early in the morning for sunrise and re-starting the day after 3PM. Many people do that and the local guides or drivers are happy with that.
As for myself I managed to get back everyday at sunset at Angkor Wat temple, -and no other one-, for monk shooting time in the golden hours (sounds like hunting...and it is!).
Prepare yourself i.e. schedule your sights according to best light conditions, you can find much stuff about it in the internet (for example Banteay Srei should be seen in the very morning). Note that some areas are roped off, especially walls with the best reliefs.
Not that I don't believe Robert when he says that from his own experience, rainy season was just over in April, but that is totally different from what friends living there told me.
"The hot season follows the cool season from about March to May. High temperatures at this time can reach 40°C (104°F) and average 33 to 35°C. The temples at Angkor, high up on their plateau, can be particularly baking.
The rainy season runs from around June to October, when the monsoons arrive from the Gulf of Thailand. Temperatures are almost as high as the hot season, but this isn't an entirely bad time to visit. The rains usually only last an hour or two in the afternoon, leaving the rest of the time to explore with the sights pretty much to yourself".
Reading that, I can figure out I was strolling Angkor temples through the "cool" season (!!!) : as for myself I think I may come back to Siem reap, but this time I will definitely choose the wet season period.
I also cannot stand hot weather very well. I can stand the cold but the sun sometimes just throw me into this "don't move, don't breath" metabolism state :D.
Actually, I think both you and Robert are right. I think the hot temperature that you describe supposed to be there. Although, I think last year, the weather was pretty strange. I was in VN in March timeframe and we had more rain than the other years that I have been there. Normally, March and April in HCM, the weather prediction on the TV can be translated word for word: "clear night, sunny day". Yet last year we had rain almost every afternoon.
I am expecting a sweat drenching visit to Angkor Wat but will gladly settle for some short afternoon shower on each day. I also think that I will take that noon siestas like you did, Luko. It would be better for me that way.
How did you guys managed in the temples? Do I need a guide to take the full advantage of it? I usually wander around by myself because I don't like to get pressured when I am taking photos. What are the best time for various temples that you have come accross?
|
0.999972 |
The simplehuman quick grip napkin holder features a weighted tension arm that gently holds down the napkins, so it's easy to pull out just one at a time. Perfect for table settings, buffets, picnics or a busy kitchen countertop. The sturdy, stainless steel base cradles your napkins, keeping them neat and tidy.
|
0.978986 |
If you would like to teach your children about the environment, there are several ways that you can do this effectively. The modern age has made it possible for computers, software programs, and the Internet, to help kids learn more about this very important subject. Decades ago, prior to the near full acceptance of problems such as global warming and climate change, these issues were not that important because they were not part of our daily lives. However, times have changed dramatically, creating situations where the way that we live our lives is becoming compromised. In order to convey information to children, one of the easiest ways that this can be done is by presenting this information in the form of online games. Let’s look at different ways that issues related to the environment can be presented to children in a game that they will enjoy playing, and at the same time educate them on one of the most important topics of our lives.
Thinking from the perspective of a child, games are a large part of their lives. Back in the 1980s when video games were first introduced, they have made incredible advancements, especially those that can be played on the web. Most people have heard about interactive games where people can compete against each other who live in completely different countries. They will form armies, go on a quest, or become part of a military mission, all from the comfort of their home. Virtual reality gaming has also improved how real games can be, allowing people to literally place themselves within that virtual reality. Games such as these can be very influential in helping kids understand how important the environment truly is.
Games that are going to teach children about the environment need to show both sides of the story. The games need to show them how the world can actually look when the environment is not facing constant peril. It should then show kids many of the problems we’re facing today including global warming, climate change, and how seasons are becoming compromised. Normal weather patterns are harder to predict than ever before of the planet. These topics and many more should be presented in a gaming format, allowing kids to have fun and also learn how to potentially improve the environment that we live in. Whether they are interacting with other players on their phone, or participating in a VR setting, games can really cement their interest in this topic, and theoretically motivate them to make choices and decisions that can help our world recover.
This is a game that will teach children the importance of recycling, and also how detrimental it can be for the world if we do not each do our part. Your goal is to take your team and learn to hunt for recyclable materials such as glass, plastic, and other recyclables which would otherwise land in landfills and not decompose for potentially thousands of years. This is a good game to introduce the topic of aquifers and how landfills could actually compromise our drinking water many centuries in the future. At the pace that mankind is reproducing, increasing our population by exponential amounts, it is absolutely imperative that kids learn about the importance of recycling everything that we can.
This game focuses upon the climate, and your job in the game is to reach specific climate related goals. The overall concept is based upon reducing greenhouse emissions, and doing so within a certain timeframe. It also allows the children to create alternative sources of energy, and reduce overall human consumption. By allowing them to learn about the climate, and how it can be affected in a positive way, this will help them understand what they will need to do when they are adults.
After your kids have played all of these games which focus on different aspects of climate change and how we can save our environment, they will have a strong foundation built upon not only the visuals of the game, but the information that will be presented. Games are a fantastic medium by which children can learn very important concepts, and remember them because they will be learned in a fun filled way. This is a great way to create a solid foundation for all kids, regardless of how old or young they are, about how to help fix our environment.
|
0.954084 |
Describe about the Tax Avoidance by UK Companies?
Tax avoidance can be termed as a legal management of one’s financial scenario in such a manner that it will lead to minimize the tax liability. The major tools which are used in this regard are tax havens, secrecy jurisdiction in order to accelerate the profit. According to a survey it has been noticed that half of the world trade takes place by dint of tax havens states (ChristianAid, 2008). This paper will put an emphasis on the phenomenon of tax avoidance in UK.
Tax avoidance by the multinationals can be said to be a direct component of transfer pricing which has raised huge concerns in international taxation (Muchlinski, 1999). The multinational operates and rakes the route of transfer pricing in order to evade taxes. It has been witnessed that with the advent in technology and enhancement in the mobility of capital have led to cross border economic activity and has linked each corner of the world. This paper is a strong attempt to show that global value and the wealth chain do not make the same path. The main point of discussion is that the multinational companies in UK navigate various jurisdictions and even place their revenue generating activities in tune with their accounting regulations and policies. Hence, a mismatch is bound to occur and this implies that value is created somewhere and wealth is accumulated elsewhere. With the alarming increment in the tax avoidance methods, the government has become highly apprehensive and has infused a number of methods in order to counter attack the term called tax evasion. It has also been of a high profile nature. The use of method such as retrospective legislation has ensured that the companies don’t evade taxes and cheat the government. The Tax Avoidance Disclosure regime has been implemented and is one of the major weapons to tackle the problem of tax avoidance. The unacceptable tax avoidance is one of the major issues which are unacceptable and hence the authorities are taking this an opportunity to raise revenues in this regard (Avery Jones, 1996). Tax avoidance is not a new method. In the recent years it has reached phenomenal attention in the current years both internationally and also in UK.
The main inspiration of this research arises from the concept of tax avoidance by UK companies. With the due passage of time, this debate has arisen in stature and potential reform is necessary to iron out the matter. The tax structure in UK is complex and that is evident from the tax law which is in effect. With the help of surveys it is clear as well as evident that the UK tax code is the longest in the world and has even over taken India in this regard. Moreover, it has been noticed that with the due passage of years, the amount and even the complexity has enhanced which makes it complex and tends to raise the compliance cost of the business. This is the sole reason why there has been a huge increase in the tax avoidance. The flat tax rate is one of the paramount reasons why such a matter has been noticed (Forbes, 2005). In the present scenario, a major part of the cross border trade remains in the hand of multinational enterprises, which takes into consideration the major chunk of their transactions within various entities under control which is common. The presence of intra group transaction has given rise to fix the internal price which is less or more than the price which is prevailing in the market. Recent years have shown that the government of UK has lost considerable amount due to the process of tax avoidance. This thesis also stress on the fact that the Tax Avoidance Disclosures Rules needs to be followed which helps in better formulation of tax and even needs to be intimated to the authorities shortly after it is marketed.
The thesis starts with an introduction to the tax system prevalent in UK and the approach which is undertaken in order to avoid the tax. Further, the tax system of UK and the legislation is studied. The main reason behind the tax avoidance is due to the loopholes which is existence in the system. Evidences of various companies are shown which enables smooth study and also provides a balancing act. Various companies employ different technique in order to avoid tax. Hence, through this study the methods which are opted for exploiting the tax loophole will be studied. Various findings are gathered through this process and help to simplify the problem.
Most of the parties who have an interest in the tax system or the companies which are incorporated there have the primary view that the structure is complex. According to surveys it has been clearly indicated that it has the longest tax code in the world and has even surpassed India in this regard. The complexity has increased with the due passage of time and that is the sole reason why there has been a sharp increase in tax avoidance by the UK companies. Considering this case, it has also been noted that the compliance cost of the companies has increased. In this scenario it would be worthwhile to shed light on the tax avoidance scheme and the methods which can be adopted to counter attack those situation. But, little importance has been paid to such situation which has raised this process and tends to be a major problem for the government and the authorities. The reason for avoidance and the methods which are used for avoidance is the main focus behind this thesis. The thesis covers the concept of tax avoidance and the way it differs from tax evasion. Moreover, the thesis provides a snapshot of the UK rules and legislations which are prevalent.
Tax avoidance can be said to be a function of the tax base. In other terms it signifies the problem which is involved in defining the legislative terms (Avi-Yonah, 1995). In reality, it is probably the case that creates obstacles for avoidance. The structure of taxation in the United Kingdom incorporates payments from the Central Government (Her Majesty’s Revenue and Customs) and the Local Government. The revenue of the Central Government consists of the various types of taxes such as income tax; value added tax, corporation tax, contributions from the National Insurance and the duties. Local tax consists of the parking fees, grants from the central government’s funds, rates of business prevailing in England and Wales etc. Lots of amendments and modifications were noticed in the taxation of the United Kingdom. In the beginning an individual was taxed regardless of the fact that the income belonged to him but now an individual with an owed income in charged to tax. Many companies backed out when the corporation tax was introduced in the United Kingdom. This thesis put emphasis on the tax structure which is prevalent in US and the way the companies utilize the loopholes in order to abstain from huge taxes (Moffett et. al, 2011). There are various methods which are employed by the companies in order to have the better of the tax laws. Similarly, other countries also undertake this mechanism in order to be away from the tax liability. This thesis refers to tax avoidance and sheds light on the tax practice which is used by the country. As a matter of fact tax avoidance can be termed as highly subjective and contains the political term. It covers innumerable range of actions. In the current scenario it is not of paramount importance to have the difference between avoidance and evasion. The terms are highly complicated and exaggerated by the use of terms such as acceptable and unacceptable tax avoidance. This raises the question acceptable to whom? Hence, it is crystal clear that tax avoidance is a major factor which has created the so called tax gap that is the gap between what the authorities collected in revenue and what they predict why it should be collected (Murphy, 2012). It is suggested that tax avoidance must be tackled and must be considered at a very fast pace. This can be done only when the cause of avoidance is identified and dealt with preciseness. For this purpose some costs needs to be incurred and this will not only be the revenues which are lost from the avoidance but also the cost of the measures which are undertaken by the tax payers, the authorities as well as the economy in overall.
As an element of good governance, a company tries to minimize the tax liability through particular tax planning. This provides a great opportunity to the business to take into consideration and use the tools and mechanism such as allowances, rebates, deductions, etc. This entirely depends on the business on how to conduct their operations in the light of all implications which have tax consequences. As a matter of fact tax planning can be treated as a compliant behaviour while tax avoidance is sometimes treated as a grey issue. Generally tax avoidance is legitimate but may be used in an aggressive manner. The procedures which are used may be in a form which is not anticipated by the government. The manner in which overseas tax haven is utilized is a glaring example. Beyond question the biggest issues of tax avoidance has been seen in UK.
2.2. Making Tax Avoidance ethical issue?
Avoidance of tax by moulding the tax system is not illegal, but it should be managed in a manner which goes in letter and spirit of the law. Companies are required to pay taxes according to the legislation which is set (Delanty, 1998). The issue falls under the concept of ethics because business contains an approach to interpret the situation accordingly. In a legal manner, the business tries to interpret the affairs. Tax avoidance has been treated as unethical because it undermines the integrity of the entire tax system. This is also due to the fact that tax is a social responsibility and payment of tax in which the operation is done is one of the major acts. This enhances the goodwill of the company and also helps the public in an indirect manner. Public services such as education, healthcare and infrastructure can be enhanced with ease and flexibility. Beyond question, a cut in the government spending can impact the lives of the people and it is being argued that the multinational companies which avoid tax are not ethical. This behaviour can make a company open to accusations of greed as well as selfishness which damage the reputation and erodes the trust that the public have in them. It is being argued by the directors of the company that it is their responsibility to look after the tax affairs and keep it to a minimum so that the entire class of shareholders gets the benefit (Dastard, 2005). Many allegations have been put forward regarding the companies in UK which pay little or no corporation tax. The estimates speak volume on this matter.Many individual and business companies pay taxes whereas; on the other hand there are few people who tend to ignore to pay taxes. The gap or difference between the expectation of the revenues by the HM Revenue and Customs’ and the revenue collected by them is known as the tax gap.
Tax evasion or avoidance by the individuals or companies, failure to implant reasonable steps to collect taxes, legal interpretation, etc tends to create a larger gap. So the United Kingdom Government is becoming very rigid with the tax payers to make the payment on time. Through the processes i.e. firstly, the taxation laws were mad every resilient for the tax payers, secondly, the customers were made well aware about the approach of avoidance, thirdly, increasing the areas of operation of taxation and etc. There was a huge gap in terms of indirect and direct taxes. For example, the tax gap in the financial year 2010-2011 was estimated to be 32 billion pounds i.e. 6.7% of the total taxes estimated by HMRC, the evaded taxes amounted to 9 billion pounds. The avoidance of tax tends to affect the long term growth of the economy and the delivery of public services. The United Kingdom markets tend to get distorted and the reward gets mismatched with the hard work and the returns.
Through the effective legislations the avoidance would be curbed down.
The customers and the economy would be well aware of the prevailing strategies and the plans.
In depth investigations and analysis would be carried in order to reduce the curbing of taxes.
The non tax payers would be given higher attention and they would be treated as a proportion of high risk.
Various comments and suggestions would be provided on the areas and thinking where the Government finds it ineffective.
Observing any changes in the tax gap.
Examining and applying a qualitative approach.
Effective monitoring of risks associated with the implementation of strategies.
The success of implementation of such strategies would depend upon the joint effort made by the Central Government and the Local Government. The term tax avoidance and tax evasion are separate terms, contains a big dimension. There is clear cut demarcation between the process of tax evasion and tax avoidance. As a rule tax evasion refers to illegal practice which helps to escape from the clutches of taxation. Here the profits, taxable income, etc are concealed and even the source of income is manipulated or overstated. Enterprises indulge in tax evasion so that the tax is eliminated.
Tax avoidance is simply taking advantage of the loopholes which exist in the system of taxation. The companies indulge in such activities which enable to reduce the amount of tax by taking advantage of the tax codes. It can also be termed as a process of strategic planning where the matters are arranged in a manner which helps to reduce the burden of tax. Tax avoidance is not illegal if not used in a manner which is against the policy framed by the authorities. For example making false comments on the tax returns will be tagged as illegal which will be a matter of evasion and hence subjected to strict action by the authorities.
The current scenario in international trade is market with innumerable development. Firstly, credits to the innovation in technology which has impacted transportation, communication as well as information technology, elimination of tariff and non-tariff behaviour, establishment of trade which is regulated by WTO and cross border movement of capital as well as goods. This has given a huge impetus to international trade. In 1960, the foreign trade in goods and services comprised of 11% of GNP and accelerated to 22% in the year 1982. On the other hand it needs to be noted that a major portion of the international trade is in the hands of big multinational companies. An MNE can be termed as an enterprise which in part or full owns, manages as well as control the assets which generates income over more than a state. It is imported as well as organized in a particular country and conduct cross border transaction apart from the country of origin through the links of branches which may be subsidiaries, affiliates and joint ventures in the nature of partly or wholly owned. Ten years back, MNE comprised for 25% of the world trade and 25% of the world GNP. The same trend is witnessed and continues to rise with the due passage of time. Currently the world is now dominated by 500 MNEs which holds more than 90% of the foreign direct investment and over 50% of the trade.
As a matter of fact tax avoidance is not a brand new phenomenon but with the due passage of time it has received more attention. As shown in the Table 1.1, the measures are termed or stated as protecting revenues or in a wider sense protecting tax revenues which was introduced in the year 2002 and it comprises of more than £4½ billion in 2005. It is clear and evident that some revenue raising methods are always opted and feasible for preventing a huge gap in the existing tax bracket.
In case of international trade the majority of transactions take place between entities which are related within MNEs and which do not pass through the market which is neutral as well as independent. This helps them to tune the internal prices of goods as well as services in accordance and flexibility of their own. These are called transfer prices. It can also be termed as the price where goods as well as intangible properties are transferred or services which are provided between the related enterprises do not portray a true and real nature of the prices of the transactions. Transfer pricing is one of the main weapon of the companies which are located in UK and denotes an idea of manipulation which happens between the enterprises which are related. Beyond question the transfer price is dealt in the light of market or arm’s length price which can be said to be the price of similar transaction which takes place between the third parties which are unrelated (Pagan & Wilkie, 1993). In case of UK companies, transfer pricing happens between the related enterprises such as parent and subsidiaries and between the same parents. In this scenario it happens between parents and foreign affiliates. The transactions which appear in transfer pricing includes transfer of tangible goods, capital assets and other assets which are tangible, providing services, arrangement of lease, letting out properties, etc. Hence, the transfer pricing manipulation is done entirely for the increment of total after tax profit of the MNE and elimination of before tax declared profit. Transfer pricing enables to transfer the funds to an entity which lacks in liquidity. It is used as a powerful tool by the UK enterprises which help the concern. The transfer pricing mechanism was used in the case of Librium and Valium in UK where the price was significantly high (Emmanuel & Mehafdi, 1994). After establishment of the parent company Hoffman-La-Roche the prices were manipulated on transactions where the Roche products were ordered which reduced the price of Librium by 40% and Valium by 25%.
This is one of the strategies which are attained by limiting the operational activities in the state where the tax rates are high. Then the related income is moved to a subsidiary which is present in a state where the tax rate is low (Neville & Mailk, 2012).
The entities which are located in the lower tax states provide intercompany loans and advances to the higher tax bracket companies. In this scenario the interest income is passed to the lower tax state. This method diminishes the profit in the higher tax country. This profit is further reduced when the interest rate or the level of debt goes up.
A group company which falls under the lower tax environment with company IPR ownership rights, charges the other group entity which is situated in a higher tax rate for the use of such intangibles which may be in the form of technology, licenses, royalty, brands, etc. In this scenario the pricing must showcase the technology value, that is how important is the technology for creating the profits. Usually the MNC’s in UK owns its IPR in a country which has no tax certainty on the license fees and charge affiliates for using it.
This is one of the procedures which help the UK companies in tax avoidance. These are found in the jurisdiction which has a huge tax network and offers a low rate on dividend as well as capital gain. The holding company may be a shell company where no real trading or production happens but may be related to some other activities. Shell holding companies are utilized in various manners for the purpose of tax planning.
These mainly hover around obtaining a deduction of the same cost pattern which is in the form of loan interest. This will happen from two different countries and would depend on the structure of the affiliate’s company. The same thing is witnessed when countries are allowed to have companies of dual residence. For example, company in UK will have a tax haven in Bermuda.
At times the countries like UK, Cyprus, Netherlands, etc provides a negotiation in direct terms with company and the tax authority. Hence, it needs to be noted that different tax treatment may exist in various countries which attempts to attract FDI.
Adobe – the average tax rate on the overseas profit of below 7%. The Irish undertaking generated 80% of the income which was non-US. The local units of Adobe around the world contained a tax residence in their markets but not as a seller of software but as a service provider which is termed as a support function. This is basically known as the ServicePE model.
Amazon - According to the reports it was seen that Amazon paid little or no UK corporate tax in the time period ranging from 2009 and 2011 considering the fact that the company has a massive sales of £7.7 billion. Amazon UK which had a staff of more than 15000 is known for its service operation to the Luxembourg based company (UK Corporate Tax, 2013).
Apple – it reported an n effective rate of tax which was in the range of 2% in the current time on the profits which was on the non US profits. Around 60% of the sales happened by way of Irish subsidiaries. According to a research it was clarified that the tax strategy of Apple was done in such a fashion which do not reflect its business.
Google – It contained an effective tax rate of 2.4% in the year 2009 which was on the non US profits with the fact that major chunk of the Google non US sales was billed in Ireland. The service which was provided by the1400 staff was paid by Google Ireland in UK and majority of the sales was channelized from Ireland (Warman, 2012).
Implication of tax in all transactions to all parties.
Most of the companies in UK use the scenario of cash flow to determine the taxable profit. As a matter of this is against the current accounting landmark in the UK which require that the accounts needs to be prepared on accrual basis (Christian, 2008). Accounts which are prepared on cash basis can be easily manipulated by delaying or attracting payment close to the end of the year and both of this impact the liability the companies.
According to (Weisbach, 2000) it has been noted that there has been a major debate over the timing of transaction. The date of transaction is an important consideration and influences the income tax. Hence, it is crystal clear that complexity which is generated by dint of accrual is removed. But, this can be easily manipulated by way of postponement of taxes. It is because of the fact that the postponement of tax will lead to cash flow based tax and it depends on the sales income arising from the current year and can be delayed to the next year which can be either due to customer collusion or delay in issue of sales invoice. In case of a growing business it portrays the deferral of tax. On the contrary under the system of accrual accounting such plans are not effective. It needs to be noted that the scheme has certain problems and this depends on the payment pattern as well as the business. Companies which are incurring losses and under pressure may like to defer the payment but the cost of transaction as well as interest adjustment to carry forward may be an issue.
Generally the purchases are eliminated from income in order to reach the taxable profit which helps in the reduction of the liability of the company for the particular period and provides a benefit of cash flow. This can be said to be the opposite of the above strategy and needs the agreement of the other party in consideration. To undertake such agreement implicit taxes may become a factor which may force to negate the strategy.
The tax scenario remains vulnerable to the strategic planning process. This is because of the fact that many sources of income are exempt under the provisions of tax. The exempt includes investment as well as other incomes so there is an incentive in this regard. Hence, this propels the UK companies to take the process of strategic planning and avoid the taxes. The current tax system of UK is complex and helps to differentiate between the financial return and services. In this scenario it needs to be noted that the flat tax structure needs to be more equipped in order to have a strong enforcement.
The interest income is exempted which happens from the sale of goods and the services are taxable. Under the current existing system both are taxable. This provides a good exposure to companies to treat the income as interest which can be done with ease and flexibility using the financial instruments by a simple straight forward planning. Sales income may be converted to interest income by providing the buyer a sales price which is lower and in consideration for a high rate of interest on an instalment which was paid in the next tax year. But, the success of this plan rests on the transaction party.
In case of flat tax, both purchases of goods as well as capital assets are eligible for deduction but not the interest payment (Fuest, Peichl & Schaefer, 2007). On the other hand both are deductible under the current system of UK. Hence, this becomes a very lucrative option to treat the interest payment as purchases.
Through effective collaboration of work, proper technical analysis and investigations would be made by the experts in order to reduce tax evasions. The technical testing would assist the experts to identify the vulnerabilities which lead to tax evasion. Areas requiring a higher attention would be forwarded to the Ministry the government would assure that the strategies and the schemes were well understood by the individuals and the economy. The disclosure of rules would increase the transparency and the general knowledge. Proper consultations would be carried by HMRC and HMT with the tax practitioners to develop new ways to create a hindrance. New databases and the Enterprise Resource Planning activities would be carried out in order to enhance the programming activities of the system.
An extensive research would lead to a greater transparency and this further would lead to recognition of high risk tax payers. The Government would assist the payers of tax in meeting their needs and obligations. The moment Government finds anything fishy it would incorporate its steps to analyze the areas of fault and evasion.
HMRC would develop an aura where the tax evaders would undergo a tremendous investigation and would set out a resolution policy which would help the tax payer on a long term growth. The evasion which may face dishonesty and criminality would be further processed as criminal investigations. With the assistance of project management techniques and mechanisms the tax payers of the same category or linked with agreements with evasion would be identified. Defensive strategies and techniques would be applied to get rid of tax evasion or the tax pending cases. After a proper consultation and suggestions the HMRC would take a conclusion as to how the tax collection would be maximized. Various schemes and mechanisms adopted may not make a huge difference so it is further suggested that a massive “Even Up” campaign should be push out by the people to remove the inequality associated in the country, so that the rich don’t become richer and poor gets a fairer and a better share.
The legislative approach deals in two manners, firstly, legislation undergoes an alteration along with an alteration in tax and secondly, anti tax avoidance rules are forced upon the exiting legislation. Due to the first approach, the underlying information is looked upon while covering the loop holes, so few changes rather increase the potential of tax avoidance (Gammie, 2008). This approach failed due to being more reactive than proactive.
It has been seen that the cases under judicial approach required parliamentary pressure or exertion over the truth of the transactions of the tax payer. This approach was mainly applied to determine the legality of the approach as whether the particular transaction fitted to the case the parliament holds. This purposive approach set out its limits for the anti tax avoidance schemes. This approach gained less importance as various cases were unanswered by the parliament and the wrong implement of the pressure created harassment for the tax payers.
This approach created a relationship between the HMRC and its tax payers i.e. individuals or large business corporate. Under this approach, “Risk Rating Approach” has been applied where the companies are given a rating by the HMRC and this factor determines the degree of involvement the company calculates from its taxation affairs and the process of working linkage between HMRC and the companies. This approach motivates the tax payers to increase the transparency and to curtail the activities which lead to tax avoidance. Many a times it is noticed that the companies tend to exhibit themselves as fair and transparent, but this may not be the case many a times. This takes place when the companies believe that the judgment of HMRS is not in line with the legislation and the case is not fair. Due to this the large corporate companies tends to get a cost benefit analysis done where a company does not consider the benefits of a decreased involvement of HMRC and a much fairer working linkage to move ahead of the costs associated, then it would not change its behaviour. An ongoing consistency and transparency is required to apply this approach as many companies depend blindly on the laws and the approaches set out by the HMRC.
Some studies has revealed that higher rate of taxes is the main reason behind tax avoidance as well as evasion. The main concept behind such thinking is that higher rate of taxes increases the burden of tax and diminishes the disposable income of the tax payer. The rate of taxes in case of UK is high and as a result of it, the companies try to escape the structure of tax and start finding way of tax avoidance.
Lack of accountability as well as transparency in the utilization of public funds provides contribution both to the public distrust in terms of tax system as well as the government. This in process enhances the will to evade or avoid taxes (Kirchler et al., 2007).
Level of corruption also has a huge impact and impact the process of tax avoidance. Tax avoidance is done in order to skip the taxes. Till the time legitimate action is taken to avoid the taxes it is feasible but once the process turns into an illegal one it hampers the smooth operations. Corruption in case of companies increases once the board officials bribes the auditors and gets a false report. In case of UK too, it has been witnessed that material misstatements has been produced in order to avoid taxes.
Compliance costs are the cost that the company needs to bear in order to have the proper information, filling out forms etc can be one of the potent reason for the companies to avoid tax. Compliance cost tends to burden the company and various rules and regulations needs to be followed. By ensuring proper compliance the tax structure tends to increase considerably and viewing this company tries to negate this. In all probability, the companies in UK tends to have high compliance cost and as a result of it, the avoidance is higher. Such situation leads to worry and creates an administrative burden which each and every company tries to eliminate at every possible cost. It has been noticed that small as well as medium sized enterprises are more vulnerable to the compliance costs. A survey done on UK firms on the regulatory costs provides a clear cut indication that taxes, VAT in general, are the most problematic which is followed along with labour legislation.
The tax avoidance machine is being operated by professionals who are highly paid on a grand scale. According to some experienced observers it is being stated that the tax revenues of British corporation are vulnerable to attacks from innumerable companies and accounting firms who have mass production and establishment of tax avoidance. A legislator stated to the UK House of Lords that the companies have an army of bankers, lawyers as well as accountants who ensure that the law which are formulated and implemented is being respected and at the same time, the tax is avoided. To hide the true meaning, new ways are developed which does not mean that new and varied techniques are adopted rather it means that the business is registered in a tax haven and then enjoy the tax benefits. Accountancy firms such as PricewaterhouseCoopers, Deloitte, Ernst & Young, KPMG are known as the Big four are the main force in the making of a complex structure which helps to avoid taxes. Their operation takes from many countries and has more than 80 offices in offshore tax havens which do not impose income and corporate taxes or at times even do not need to file the audited accounts.
The Big Four accounting firms have huge gross global annual revenue which consists of US$103 billion (£68 billion) through the process of audit, tax and other consultancy services which makes it the 54th largest economy worldwide. A chunk of £8 billion comes from UK. It is to be noted that secretive firms do not portray the fees which is earned through the process of tax avoidance. In the year 2005 an internal HMRC study provided estimation that the UK offices of the Big Four accounting firms generated fees of £1 billion through the process of commercial planning and schemes of artificial tax avoidance.
It has been widely noted that the number of cases in UK has increased rapidly and has been referred to tax tribunals. The entire process relates to tax avoidance schemes. The disputes arising out of tax avoidance schemes reached a galloping 22,100. Every year it has been witnessed that around 40% of the UK Finance Bill attempts to manage the abusive schemes. Due to this, the UK Finance Act 2004 was put into implementation and the Disclosure of Tax Avoidance Scheme (DOTAS) came into operation. The practice of tax avoidance by the firms is due to the accounting firms which are into action. This will give an overview of tax avoidance strategies which are established by the accountancy firms. There has been many claims of ethical conduct which are continuously involved in tax avoidance as well as evasion (Sikka, 2010). KPMG received immense exposure when the collapse of WorldCom which was a huge US communication corporation. For a fee of US$9.3 million KMPG advised WorldCom to enhance its profits by creation of management foresight which is known to be intangible asset. As a matter of fact management foresight is more than just providing multiple services. The asset was linked to a subsidiary which was present in a low tax jurisdiction and this licensed it with other companies in the WorldCom group for payments of annual royalty. The payment of royalty by subsidiaries qualified as an expense which is deductible whereas the income which appears in the hand of the receiving company attracts lower tax rate. In all probability, no cash was leaked or out flowed from the group. This arrangement was a big approach and hence enabled WorldCom to avoid taxes between US$100 million and US$340 million in terms of taxes. The case of KMPG was clearly evident from the 2007 UK case of John Astall and Graham Edwards v Her Majesty’s Revenue and Custom. The case revolves around two huge and well off entrepreneurs who shielded almost £5 million from UK income tax. In this scheme, specially created trust was loaned huge cash and then the IOUs were traded at the banks at a relative loss. On the other hand, the loss was neutralizing by offsetting against the personal tax bills. This enabled KMPG to earn a profit of £15 million from the entire scheme. The Special Commissioner rejected the claims because the losses were no real and did not stand in the phase of economic losses. The Case reached to Court of Appeal, but the judgment which was original was upheld. This case was of paramount importance because of the fact that innumerable millionaires purchased the blueprints of the particular schemes so that around £156 million can be protected with ease and flexibility. On the other hand mass marketed scheme of KMPG provided companies as well as their employees to keep at bay National Insurance Corporation (NIC) and income tax by dint of payment to directors through the debts of the company instead of original cash. This scheme was later eliminated by Special Commissioners.
Ernst & Young has a past history of creating ingenious schemes of tax avoidance. Once enabled Phones 4U directors to pay in terms of gold bars, fine wine and sponge of platinum. This helped to avoid the National Insurance Contribution. When the strategy was defeated Ernst & Young devised another plan. The plan provided higher pay to employees as well as directors of Phones 4U which avoided NIC as well as income taxes by securing the payments through an offshore employee benefit trust. The main plan of this scheme was that as long as the transaction appears in the form of loan for example by way of interest, tax will be avoided and skipped by the company as well as employee. It was held by the House of Lords that the contributions which are provided by the company to the structure of EBT are emoluments in potential form and hence liable to NIC as well as income tax. The Ernst & Young factory devised another scheme of avoidance which was done in order to avoid the VAT and ultimately enhance the profits. The outward sign of the scheme contained a statement which was printed on the credit card receipts of the customers. It was written that I agree 2.5% of the above computed value will be payable to DCHS (Debenhams Card Handling Services Ltd, a wholly owned subsidiary of Debenhams Retail) for the purpose of card handling. The total amount which is paid remains the same and the price which was paid by the customer of the credit sale will be same as the cash sale. The financial service was exempted from VAT Debenhams claimed that 2.5% of the extract were not subjected to VAT and hence the output tax which is payable to the Treasury will be low.
The paper attempts to raw into action the theme of tax avoidance. In considering this, the other factors such as quality of life, social justice as well as survival of the democracy needs to be handled. The avoidance of tax by the companies in UK creates a big dilemma for the normal citizens. Avoidance of taxes results into wealth transfer and to have a clear path. It has been noticed that major accounting firms are associated with the global tax avoidance. There are pressures from economic class, government has even reduced the corporate taxes and rate of income tax but this has not been a great device for curbing the tax avoidance. It has been due to the activity of the Big Four firms that the tax avoidance scheme has gone at an alarming rate (Castells, 2008). They have always been willing to make private profit at any cost and hence have added wings to the scheme of tax avoidance and has even turned out to be major reason for tax evasion. Some of the partners are sent to prison and some are fined but this never raised the sense of alertness. The UK tax law isn’t unable to counter attack the tax avoidance scheme with ease and flexibility due to the back dated practices. Hence, it is very much essential that a new social settlement is needed. The tax return for all the companies above the median income should be available to the public which will help in transparency. The fear of public exposure can help in reduction of such schemes. Economic transactions should be taxed at the place of occurrence. Hence, companies should not be allowed to generate the transactions in the UK and book the profits in offshore tax havens.
The major landmark which was seen in the legislative front concerning tax avoidance has been the arrival of Tax Avoidance Disclosure (TAD) rules which was brought by Finance Act, 2004 ad many other Statutory Instruments, this is one of the framework which provides early estimates to the tax authorities of planning which falls under some pre determined heads. The main reason why this scheme was introduced was due to the scheme of Gilt Scripts which eliminates tax on big bonus payments. The occurrence of this and other major planning provided the tax authorities as well as government in the UK that the battle was being lost against tax avoidance and moreover, huge revenues were in danger. The presence of TAD is a big help to the authorities because there are several rules which are needed to be followed. Promoters need to disclose marketed schemes within five days before making them available. Moreover, the process of tax planning needs to be disclosed within 5 days of starting so that it can be implemented. Disclosures are needed only if an employment product or financial product is involved. Keeping into consideration disclosures of VAT will also provide a safe route. The disclosure of VAT will provide proper planning and the value shifting can be easily shifted. Secondly, planning with hallmarks or sharing of VAT saved information will also provide a huge boost. The main aim of the disclosure regime is to have innovative ideas. It is important to witness that disclosures is not only suited to marketed schemes. Another attempt which can be made by HM Revenue & Customs is to raise awareness among the senior management of the companies who are under scanner (HM Revenue & Customs, 2012). This needs to be intimated that if the company are caught under the process then it will fall in big trouble.
This is one of the anti – abuse rule which makes UK more attractive to multinational companies. Still considering this decision the government rejected the opportunity to introduce a General Anti – Avoidance Principle which aims at tackling tax avoidance, elevate revenue and enhancing the equity of the tax system by declining the opportunities for the well off individuals and large corporations to minimize their tax contribution (Castells, 2000).
The entire process through which an attempt is made to solve the problem is known as research method. It is a well planned and carefully executed activities in order to solve a problem or to shed light on a topic which demands intense study. Research encompasses the steps of inquiry, investigation, evaluation and experimentation. In this particular project the research needs to carry on with proper objective and rationally. The end result can be noted to justify the research topic. This helps in decision making and finding a rational answer to the research topic.
The research methodology in this scenario consists of both qualitative as well as quantitative methods. A mixed blend of qualitative as well as quantitative is used because it provides a balanced result. As a matter of fact qualitative can be termed as exploratory in feature which enables to gain an understanding of the notions, principles which are underlying (Creswell, 2008). Moreover, it helps to develop a hypothesis for a well developed quantitative research. Since the topic in focus is that of tax avoidance by U.K companies special emphasis needs to be provided on thoughts as well as idea which will help to decode the trend. The semi structured method is used in this particular scenario. Here, observation is used as a main tool and various companies in U.K were observed which helped to cover this assignment.
Quantitative method is utilized to project problem by building of data which are numerical inform or which can be easily converted into statistics. Beyond question it this method quantifies the behaviour, attitude, etc. In this particular topic various measurable data was used which enabled to formulate patterns (Creswell,2008). The main use was that of online surveys and discussions. The use of qualitative as quantitative can be termed as the best approach because it helps in creating a feasible and unbiased situation. It makes the study easy and free from any flaws. Depending on a particular method will tend to create biasness and will ultimately question the integrity of the project. Since, tax avoidance by U.K companies is a vast concept and needs a lot of analysis both in terms of original data as well as past study; the need of both the methods is required. A mixture of both will provide answers from both the angle. The discovery of answers can be expected from such method. Two sorts of answers can be generated from this concept, one being the real time study and the other being the answer derived from past data.
A disadvantage which is attached to both the method is that both are mutually exclusive and hence generating an answer which can be compared easily is difficult. Both the method will generate different set of answers and comparison on these is difficult to gain. Therefore, when it comes to comparison and discovery of the difference it is difficult to be established in this scenario. Various methods are adopted by the companies in order to evade taxes but the point of differentiation in the manner of choice between the methods by considering the qualitative as well as quantitative approach is difficult to establish.
Case studies research method can be apt in this particular scenario because it involves study of the companies in U.K which wants to evade the taxes. As a matter of fact case studies involve in-depth analysis of similar situation in other organization where the nature of the question or practice is similar to that of the current situation (Gauch, 2003). Since, the dealing is with the topic tax avoidance by U.K companies and stress is on the tax avoidance methods therefore the case study method will help to gather data and a hypothesis can be generated by the study of various organizations. Case study is particularly chosen here because the tax evasion topic is same and hence the study can be uniform in this scenario. This is critical for problem solving and will help in the establishment of facts and figures.
Secondly, action research can be used in this particular case study which will help to implement the changes. Since the problem is already defined, the relevant data is gathered so as to provide a solution to the problem on the tentative basis (Greenhalgh, 2002). The dealing is with the tax evasion method and the study will help in providing an answer that what are the consequences following such courses of action. Hence, action research can be said to be a continuous evolving project with free interplay among the effects and ultimately the solution (Kara, 2012).
There are certain problems while setting up of such methods. It may be difficult to consider such vast data. As the question is on tax evasion by U.K companies there may be many methods which are taken into consideration. Hence, studying the impact of all may be cumbersome and time consuming. Furthermore it might be difficult to ascertain the pros and cons of each methods due to which the exact answer of the research will be difficult to ascertain.
Using such methods is of great advantage which will help in the sensible and realistic problem definition. Moreover, the study can be done in-depth which will help to get the problem resolved. Moreover, case study implementation is relatively easy therefore analysis can be easily and without much problem. This will also tend to provide great solidity to the practical application and hence there will less flaws in the approach.
To ensure that adequate data is gathered it needs to be noted that the methods are used exclusively and all the process is in tune with the project. To gather data it needs to be noted that the study is done exclusively considering the methods in an in depth manner. The data collection can be divided into various other plans such as primary and secondary research. This will help to attain the needful data required for the purpose. The primary as well as secondary approach will help to accumulate data which can be very useful in ascertaining the answer and finding a reliable answer.
Keeping into consideration the needs of the thesis and the manner in which it can be presented, the research is done with the help of literature which is available. This contains papers from academic journals, various books, reports, websites, etc. To keep the thesis in a genuine position, criticism and evaluation of the literature from various authors has also been included. This has provided a great balance to the entire project as all the elements is properly included in the project.
According to the research and studies it has been noted that in order to stop the flourish of tax avoidance scheme, strong reforms are of utmost importance. It has been noticed that much of the revenues are lost due to the process of tax avoidance which is indirectly by dint of the presence of tax havens. This happens either by shifting profits into jurisdictions which have low tax or using secret methods to keep the tax authorities at bay. From the scheme and practice of tax avoidance it can be said that issues relating to tax havens as well as secrecy will need international cooperation. Then only UK can act in a better way and ensure that the process of tax avoidance is eliminated. UK can even act in this regard on a unilateral basis that will help to tackle and control the network of Overseas Territories and Crown Dependencies like the Cayman Islands or the Channel islands which are the main region of the tax avoidance. The government must act with a sense of urgency so that the process can be brought to a grinding halt. Moreover, it needs to be noted that the corporate tax system needs a major overhaul which can uplift the entire tax system and provide a speedy relief to the authorities.
From the study it is observed that tax avoidance is a complex procedure and it is arrived at by utilizing the loopholes in the tax procedure. The process of tax avoidance in UK is of alarming nature as it erodes the revenue earning capability of the government. This does not allow the government to earn in huge amount because a major chunk is being eliminated by dint of tax avoidance. Hence, consider this the UK government must plan accordingly and ensure reform which will help in adequate planning. Tax avoidance can be said to fundamentally unjust as it provides huge advantage to rich individuals as well as the multinationals companies which shortens their tax bills which is never wanted by the government. Tax avoidance undermines the skills of the tax system to meet the core purpose, to enhance the revenue, to fund the public services and the impact of reduction in public spending is being witnessed. Moreover, evaluation of tax avoidance is not an easy task for the authorities. This brings a wide tax gap into effect. UK as well as other countries is working so as to make proper calculation and estimate the tax gap. But, it needs to be noted that such estimates serves only as proxies and comparison is not feasible here. This is because of the fact that technique of estimation as well as the data which is being used differs to a considerable extent. Considering the claim that higher corporate tax and personal tax rates demotes investment and also gives wings to tax avoidance, successive UK governments have lessened the rate of corporation as well as income taxes. The corporation tax has diminished from 52% of taxable profits in 1982 and reached a huge low of 22% in the year 2014. The top marginal rate of income tax has reduced from 83% in addition to 15% surcharge on the investment income in 1978-79 to 15% in 2012. The government has moved taxes to labour, savings and consumption through the process of national insurance contribution, enhanced VAT and the defeat of allowances which are tax free in nature and even the band of income tax to keep in tune with inflation. Due to this, in 2011-12 somewhere 8, 00,000 middle income earners became subjected to 40% tax rate and the number increases by leaps and bounds in the year 2014. Overall, the share of national income in UK in the form of tax as well as insurance contribution reduced from 39% in 1982-83 to 34% in 2009-10. The movement of tax burden and the decline in the tax led to stimulation of the entire economy. Moreover, it needs to be considered that even though the government as well as authority has made the rules friendly yet the process of tax avoidance by companies are still into operation. It is difficult to estimate the tax which has been avoided as it is entirely upon the economic models which in turn relies upon various sources of data. The knowledge and news of underground economy is very slippery. The estimation of the UK Treasury indicates that every year £40 billion of tax revenues cannot be collected (HMRC, 2010). On the other hand, the leaked papers of government show that the amount of tax which is avoided by the companies ranges between £98 billion and £150 billion. According to various economic models it is estimated that around £100 billion (Lyssiotou, Pashardes and Stengos, 2004) and probably £122 billion (Murphy, 2010) of the revenues in terms of tax are lost each and every year which is huge enough to cover the yearly cost of operating the National Health Service. According to a UK government report ( National Audit Office, 2007) it is revealed that in the year 2005-2006 around 250 of the 700 biggest companies paid no corporation, and on the top of it 210 companies paid less than £10 million individually, 12 of the major companies eliminated all liabilities in 2005-2006 and claimed more than tax losses. In the year 2009, Barclays Bank declared a whooping profit of £4.6 billion but paid only £114 million in UK corporation tax, the effective rate was 2.5%. In the year 2012, the UK government introduced the concept of retrospective legislation which stopped two tax schemes which enabled Barclays to keep at bay around £500 million in corporate taxes. Viewing such case the Treasury referred this case as highly abusive and the new regulations were brought into effect so as to avoid the process of tax avoidance. The UK’s 100 top listed companies on the London Stock Exchange contain more than 32,000 subsidiaries as well as joint ventures. Around 7,000 of these are located in the tax havens which offer low tax rates or need limited disclosure to other tax authorities. 97 of the FTSE 100 companies have their location in tax havens.
The government’s proposed anti – abuse rule will have a little impact on tax avoidance and gives a go signal to large businesses and companies to engage in activity what has been termed as tax avoidance.
Recommendation I –The government should try to curtail its plan for anti – abuse rule ad introduce provisions of General Anti – Avoidance Principle which is based on the concept of fair and equitable tax system.
Recommendation II – The government must put an end to the cuts to HMRC staff and should ensure that investment is done in a strong as well as effective workforce which will help to curb tax avoidance.
The tax avoidance by the companies in UK is entirely due to the outdated tax system in practice which treats the national subsidiaries of a multinational company in the same manner as individual companies, rather than establishing the fact that they accelerate as a global company. Hence, bringing a new model where companies are based on tax on which they function will check the tax avoidance methods of the companies and hence profits cannot be shifted to the low tax jurisdiction without tax payment. It is only by dint of such reforms that the tax system can counter the impact of tax avoidance and uproot it from the economy. The tax risk can also be a huge weapon in increasing uncertainty among the tax payers. If the reputational risk is high then the companies will not be willing to take the scheme of tax avoidance. Stringent rules will provide a clear cut impact and will rank high on the transparency factor. The government should look into the prospect and must ensure that the plans are designed in manner which will help to eliminate the process of tax evasion as well as tax avoidance.
In viewing this, the process of transfer pricing comes to the forefront. However, each and every transfer pricing incidence does not lead to tax avoidance. It is to be noted that transfer pricing may be entirely for business consideration but it may have some impact of tax avoidance. Tax authorities are strict only when it is doubted that transfer pricing leads to avoidance of tax. Beyond question, the sight of tax officials as well as MNEs is totally different. An MNE thinks form a broader perspective while the tax officials thinks on a smaller view. An MNE thinks from a global perspective which helps to determine the global profits and operations on the other hand the main view of tax authorities is national spending all the effort to ensure that the country is not devoid of the share in the tax. If this particular needs to be controlled then the only provision which is available is to make proper adjustment on the basis of arm’s length principle. It is to be noted that the methods are not totally perfect but the means can be utilized for getting a suitable result.
The effective rate consisted of 2.4% in 2009 and this was on the non US profits. The profits which accrued were billed in Ireland and the entire scheme is presented below.
Manner in which Google evaded taxes.
The above estimates can be used in and can recover between £2bn and £5.5bn every year from corporate as well as individual tax avoidance.
Aaronson, G. (2011) GAAR Study: A study to consider whether a general anti-avoidance rule should be introduced into the UK tax system.
Adam Chris and Graham Peter (1999) Transfer Pricing: A UK Perspective, Butterworths London, Edinburgh & Dublin.
Creswell, J. W. (2008). Educational Research: Planning, Conducting, and Evaluating Quantitative and Qualitative Research. Upper Saddle River, NJ. Pearson Education, Inc.
Castells, M. (2000) The Rise of the Network Society. Oxford: John Wiley and Sons Ltd.
Christian, Aid (2008) Death and taxes: The true toll of tax dodging.Oxford Press.
Christian, Aid (2013) Who pays the price? Hunger: the hidden cost of tax injustice. Mosby-Year Book.
Cooper, G. (1993) Themes and issues in tax simplification. Australian Tax Forum. 31(2), pp. 417-460.
Emmanuel, Clive R and Mehafdi, Messaoud (1994) Transfer Pricing, Academic Press Harcourt Brace and Company, Publishers.
Forbes, S. (2005) Flat Tax Revolution. Regnery Publishing.
Gammie, M. (2008) Tax simplification. 2nd ed. Green Budget.
Gauch, Jr., H.G. (2003). Scientific method in practice. Cambridge, UK: Cambridge University Press.
Greenhalgh, T. (2002) Integrating qualitative research into evidence based practice. North Am.
HM Revenue & Customs (2012) Measuring Tax Gaps 2012. HM Revenue & CustomsKara, H (2012) Research and Evaluation for Busy Practitioners: A Time-Saving Guide, Bristol: The Policy Press.
Muchlinski, Peter (1999) Multinational Enterprises and the Law. Cambridge USA.
Murphy, R. (2008) The Missing Billions: The UK Tax Gap. TUC.
Department of Business Innovation and Skills (2013) Report on the affairs of Phoenix Venture Holdings Limited, MG Rover Group Limited and 33 other companies, London: TSO.
Lyssiotou, P., Pashardes, P., and Stengos, T. (2004) Estimates of the Black Economy Based on Consumer Demand Approaches, Economic Journal, July: 622-640.
National Audit Office (2007). Management of large business corporation tax. London: NAO.
UK Office for National Statistics (2011), The effects of taxes and benefits on household income, 2009/10, May 2011, London: ONS.
US Senate Permanent Subcommittee on Investigations (2006). Tax haven abuses: The enablers, the tools and secrecy, Washington DC: USGPO.
|
0.999975 |
Acton, Donald F. et al. "Physiographic Regions". The Canadian Encyclopedia, 10 September 2018, Historica Canada. https://www.thecanadianencyclopedia.ca/en/article/physiographic-regions. Accessed 18 April 2019.
Canada may be divided into seven physiographic regions: Arctic Lands, Cordillera, Interior Plains, Hudson Bay Lowland, Canadian Shield Forest Lands, St Lawrence Lowlands and Appalachia.
Interior Plains near Regina, Saskatchewan (photo by J.A. Kraulis/Masterfile).
The mixed-wood forest is characteristic of the St Lawrence Lowland region (photo by Tim Fitzharris).
Canada may be divided into seven physiographic regions: Arctic Lands, Cordillera, Interior Plains, Hudson Bay Lowland, Canadian Shield Forest Lands, St Lawrence Lowlands and Appalachia. Divisions are based on each area’s relatively similar physical geography and landforms.
Physiography originally meant "the study of natural phenomena," but later usage limited its application to physical geography in particular and, more recently, to landforms alone. Physiographic regionalization is defined here as the process by which regions with relatively homogeneous physical geography are determined.
Geologic structure (see Geological Regions), relief attributes of land, the distribution of continuous permafrost and the position of the treeline are the criteria used in the following physiographic regionalization.
Combinations of these criteria, but with primary emphasis on geologic structures in southern Canada and the overwhelming influence of continuous permafrost in northern Canada, generate the major physiographic regions of Canada discussed in this article: Arctic Lands, Cordillera, Interior Plains, Hudson Bay Lowland, Canadian Shield Forest Lands, St Lawrence Lowlands and Appalachia. These seven large regions have broadly homogeneous physical geographic characteristics, and differences between them are visible from satellite images (see Remote Sensing). Areas quoted for these regions are the land areas and do not include adjacent continental shelves or bodies of ocean water within Canada's territorial limits. The ecozones of Canada (see Natural Regions) provide more detailed breakdowns of Canada's land mass based on an ecological classification system.
Canada's Arctic Lands are generally thought to lie north of the treeline and cover 2.6 million km2 (26 per cent of the country). They include the Arctic Coastal Plains and Arctic Lowlands, the Innuitian Region of the High Arctic, and parts of the Canadian Shield in Nunavut, northern Québec and Labrador. However, extensive areas of Subarctic Lands must also be recognized. Taken together, Canada's Arctic and Subarctic Lands comprise nearly 40–45 per cent of Canada's land surface.
Geological structure and lithology (i.e., physical characteristics of rock) largely shape the landscape. For example, the mainland east of Great Bear and Great Slave lakes, the Ungava Peninsula and most of Baffin Island are part of the Canadian Shield, and are composed of resistant igneous, metamorphic and sedimentary rock. Higher elevations consist of bedrock outcrops, while upland surfaces and upper valley-side slopes are covered by angular rock-rubble accumulations. Bedrock is disrupted by joint and fissure widening, and by its separation into angular blocks. By contrast, areas of unconsolidated sediments from the Paleocene to Quaternary periods (65 million to 10,000 years ago) form more undulating, poorly drained lowland terrain. Several distinctive landforms occur in the Arctic Lands, most often associated with the growth of permafrost and ground ice. Tundra polygons, a tortoise-shell pattern of cracks up to 30 m apart with ice wedges below the cracks, cover many thousands of square kilometres. Other distinctive periglacial landforms are pingos, over 1,500 of which have been counted near the Mackenzie Delta.
Glaciation over much of northern Canada formed a landscape similar to an upright saucer with its centre flooded by Hudson Bay. The eastern rim, extending from Labrador north along Baffin Island and into Ellesmere Island, is a mountainous zone with elevations of 1,500 m and higher in the north, and a heavily fjorded coast. Glaciers cover about five per cent of the Arctic land surface. The zone between the Shield and the Western Cordillera is a Palaeozoic plain (542–253 million years old) gently sloping from 500 m in elevation downwards to the Arctic Ocean. The islands are mostly sedimentary rocks forming plains, uplands and hills. The rock layers in the south are mainly flat lying, but in the Arctic Archipelago they have been folded and then eroded. Surface elevations rise from near sea level in the northwest to approach the high mountain rim in the east. Faulting followed by further deepening during glaciation may have caused the many channels among the islands.
Canada's Arctic lands are regarded as being either Arctic or subarctic in nature. The boundary between the two approximates the northern limit of trees. This is a zone, 30–150 km in extent, north of which trees are no longer able to survive. Ecologists refer to the barren, treeless Arctic as tundra. The tundra progressively changes into polar desert at extreme high latitude as climate becomes increasingly colder and drier. The treeline also approximates the southern boundary of the zone of continuous permafrost; that is, north of the treeline, the terrain is perennially frozen and the surface thaws for a period of only two-to-three months each year.
Lakes and rivers are ice-free from June–October in the south and from July–August in the north; they are ice-covered for the rest of the year. The largest river in Canada, the Mackenzie, flows north from Great Slave Lake and empties into the Beaufort Sea.
This region is part of the mountain system that extends the length of the western third of North and South America. The Canadian part of the Cordillera is about 800 km wide, and extends from southern British Columbia north to the Yukon and the Beaufort Sea. While most of the Cordillera lies within these regions it also extends into southwestern Alberta and the Northwest Territories. The total area covered by this physiographic region is 1.6 million km2 (16 per cent of Canada).
The Cordillera includes plateaus, valleys and plains as well as rugged mountains. The most continuous mountain chains, known as the Coast and Rocky Mountains, form high rims along the southwestern and southeastern sides of a belt of varied terrain.
There are three distinct mountain systems within the Cordillera. The Eastern system consists of sedimentary rocks that have been tilted, faulted and folded. The Interior system's mountain ranges and dissected plateaus are underlain by folded sedimentary and layers of volcanic rock, by metamorphic rocks and numerous, small igneous intrusions. In the Western system, the Coast Mountains consist of a mass of interlocking igneous intrusions and metamorphic rocks, but the westernmost mountains (the Haida Gwaii and Vancouver Island ranges) are geologically similar to the Interior system.
The oldest recognizable feature of the Cordilleran landscape is the gently rolling upland of its interior plateaus. This ancient surface was sculpted by erosion many millions of years ago. Since then, it has been uplifted, partly buried by lava flows, dissected by river erosion and modified by glaciers. The most widespread landforms and surface deposits of the Cordillera date from the glaciations of the past million years. South of 60° N, only the highest mountain peaks projected above the Cordilleran ice sheet. Farther north, extensive parts of the Yukon, Nunavut and the Northwest Territories were too dry for glacier formation, although very cold.
In the glaciated areas landforms such as cirques (i.e., a basin with steep walls) and U-shaped valleys are common in the mountains and along the edges of higher plateaus. Features such as striations (i.e., grooves or channels), drumlins, eskers and till plains (i.e., a flat plain of glacial deposits) are widespread on plateaus and plains. Valleys and lowlands commonly contain thick silts and clays that were deposited in ice-dammed lakes during glacier melting, and sands and gravels that were deposited by meltwater streams.
During the 12,000 years of postglacial time, rivers have formed terraces, alluvial fans, floodplains and deltas (see River Landform). Valley sides have been modified by rockfalls, debris flows, landslides, soil creep and snow avalanches. Periglacial landforms are present above the treeline. In the south, permafrost exists beneath only the highest, windswept ridge crests, but northward, the permafrost limit becomes lower and, in the central and northern Yukon, there is permafrost at all elevations.
Volcanic activity has occurred sporadically at scattered locations in the Western and Interior systems up to the present. Some eruptions occurred during glaciation. The youngest lava flows and cinder cones are only a few hundred years old; these eruptions are described in certain legends told by Aboriginal peoples.
The Cordillera encompasses a great variety of climates because of its great latitudinal extent, its location between the Pacific Ocean and the continental interior, and its rugged terrain. Several significant effects of climate are visible in the natural landscape. Heavy rain and snow on the Coast Mountains give rise to dense forests and maintain extensive snowfields and glaciers at relatively low elevations.
The altitudinal timberline (i.e., the upper limit of forest) and the snowline rise eastward as snowfall decreases, and descend northward as temperature declines. Differences in climate caused by elevation in any particular area are reflected by altitudinal vegetation zones. The highest of these is the alpine tundra. In the semiarid valleys of the Interior system, the lowest vegetation zone is grassland.
The Cordillera as a whole is distinguished by its mountainous and irregular topography, and its great variety of climates, soils and vegetation. Many aspects of its physiography, including steep slopes, natural hazards and severe climate, restrict land use by humans. Other features, such as forests, grasslands, lakes and rivers are natural resources.
The Interior Plains area of Canada encompasses the region between the Canadian Shield and the western Cordillera. The plains are distinguished by vast expanses (1.8 million km2, or 18 per cent of Canada's land surface) of sedimentary bedrock consisting mainly of poorly consolidated shales, siltstones and sandstones. Bedrock relief plays a role in large-scale physiographic features, but small-scale features are largely the result of Quaternary glaciation (2.6 million to 10,000 years ago). Where the Interior Plains extend northwards, as in the Northwest Territories, they become subarctic in nature while, even further north in the islands of the western Canadian Arctic, they constitute tundra lowlands that are truly arctic in nature.
The regional topography is partly determined by flat-lying limestones and shales of marine origin underlying the entire region. Younger, non-marine sediments, largely sands and gravels representing deposits from rivers flowing eastward from the newly developing mountains to the west, covered these marine sediments in the western part of the region. Erosion of the less resistant of these non-marine sediments, in association with uneven uplift that continued with mountain building to the west, resulted in the carving of the western part of the region into a series of isolated uplands.
In addition to these erosional remnants, the relatively uniform slope of the southern portion of the region is broken into three steps (levels) by the Manitoba Escarpment and the Missouri Coteau. The first step is the Manitoba Plain in the southeast, which lies below the Manitoba Escarpment at elevations under 400 m. The Manitoba Plain is the lowest and flattest of the three prairie steps. The underlying Palaeozoic rocks (544–250 million years old) are covered by glacial lake silts and clays deposited by Lake Agassiz.
The next step to the west is the Saskatchewan Plain, the dip slope of the Manitoba Escarpment, which is underlain primarily by marine shales of the Cretaceous age (144.2–65 million years ago). The marine bedrock is covered by glacial deposits, predominantly rolling moraines and till plains, and to a lesser extent, the large, flat deposits of former glacial lakes. The Saskatchewan Plain, which is lower and smoother than the plains to the west, has surface elevations that range from 460 to 790 m, reaching 915 m in hillier areas.
To the west of the Saskatchewan Plain lies the Missouri Coteau, a gradual slope upwards to the Rocky Mountains representing a thickening of non-marine sediments of the Cretaceous age. Beyond the Coteau, the third step begins with the Eastern Alberta Plains, only slightly higher than the Saskatchewan Plain, and extends to the Western Alberta Plains, where elevations reach 1,100 m. Except for the Cypress Hills, which are isolated, the Southern Alberta Uplands form a buffer between the plains and the mountains, with elevations approaching 1,650 m. This third step has a bolder, more varied relief, reflecting the close proximity of the erosion-resistant bedrock surface in many areas. Most striking are the badlands, formed from the dissection of soft underlying rocks in the arid southern region.
The Northern Alberta Uplands, north of Lesser Slave Lake, are a series of disconnected plateaus rising 250–700 m from the surrounding Northern Alberta Lowlands to summits ranging from 760 to 1,050 m. The valleys of the Peace, Athabasca and Hay rivers are the most striking features in the lowlands. Glacial lake deposits and till plains, which are largely peat-covered, are widespread in the lowlands, whereas a mantle of glacial till (i.e., an unsorted mixture of clay, sand, etc.) covers most of the plateau areas.
The Interior Plains continue northward to the Arctic Ocean where they are bounded by the Arctic Coastal Plain and Arctic Lowlands. Elevations generally decrease northward along the drainage of the Mackenzie River Valley, with a gentle rise eastward from the valley to the Precambrian Shield and a sharp rise, with several large plateaus, westward to the Rocky Mountains.
The southern Interior Plains are mostly characterized by grassland vegetation (see Prairie) under semiarid climatic conditions throughout the plains, but islands of mixed-wood forest prevail at high elevations on uplands in western Alberta. The grassland gives way to an aspen parkland to the north and east, under slightly cooler temperatures and higher precipitation. As this trend continues northward, a mixed-wood forest transitions to the dominantly coniferous boreal forest. Finally, at the northern extension of the Interior Plains, forest gives way to treeless tundra and polar deserts.
This land area of 320,000 km2 (or 3.2 per cent of Canada's land surface) is only 40 per cent of a sedimentary basin in the middle of the Canadian Shield, the remaining 60 per cent of which lies beneath Hudson Bay and James Bay. Apart from the Sutton Ridges in the northeast of the lowland, the bedrock terrain is completely masked by a mantle of glacial and marine sediments associated with the advance and retreat of ice during the last glaciation.
The inland edge of the lowland (about 180 m high) coincides approximately with the highest level of marine inundation which followed the disappearance of glacial ice from Hudson Bay about 7,500 years ago. Nearer the Shield adjacent to the lowlands are streamlined hills of glacial till (i.e., an unsorted mixture of clay, sand, etc.), which were formed beneath ice moving southwest from Hudson Bay towards Manitoba, and south and southeast out of James Bay. These have not been totally masked by younger marine deposits and therefore give the surface a corrugated appearance.
Closer to the coast, where the marine mantle is thicker, there are typically vast level plains of muskeg with thick peat accumulations and innumerable ponds. These plains contrast with terrain in a wide zone (50–80 km) inland of the coast. There, scores of parallel, gravel beach ridges were thrown up by storm waves during the last 5,000–6,000 years, as sea level fell in response to rapid uplift of the Earth's crust. Dry, forested, low ridges separated by boggy depressions characterize this zone.
At the coast the almost level nearshore zone is exposed at low tide as marshy and muddy flats, often strewn with glacial boulders (see Wetlands). At present, sea level is still falling at approximately 90 cm per 100 years, continually exposing more of the offshore zone.
In the eastern lowland, flooding by marine waters was immediately followed by a re-advance of the ice sheet margin approximately along longitude 76–77º west. This caused the moulding of the marine deposits into more prominent, streamlined hills.
Shield proper (about 5 million km2) covers 48 per cent of Canada's land surface (including freshwater lakes and Arctic islands). Even if the Arctic Shield is excluded, the Canadian Shield Forest Lands remain the largest physiographic region in Canada, comprising 32 per cent of the land surface. It is a vast, saucer-shaped region: the rim on its south, east and northeast sides like that of a soup plate; the centre a sedimentary rock basin, the southern fringe of which underlies the Hudson Bay Lowland.
The Shield is composed of crystalline Precambrian rocks formed during several phases of mountain building between four and one billion years ago. In the last billion years it has remained a relatively stable bulwark, unaffected by the plate tectonic movements, which have impinged on it to form the mountainous fringe of Canada. The stability of the Shield has allowed denudation to level its surface, giving it characteristic level or undulating skylines.
The southeastern and eastern borders have been uplifted in the relatively recent geological past as a result of tectonic movements associated with the opening of the Atlantic Ocean. Glacial erosion had little effect, except along the eastern rim. Approximately half of the Shield is classified as upland. Extending from northwestern Québec through northern Ontario, Manitoba, Saskatchewan and southern Nunavut to northwestern mainland Nunavut and the eastern Mackenzie districts in the Northwest Territories, this terrain (200–500 m elevation) is upland only by virtue of its elevation above the Hudson Bay Lowland and the Interior Plains which border it. Bedrock relief of only 50–60 m has been smoothed by a thin mantle of glacial till (i.e., an unsorted mixture of clay, sand, etc.) and sediment deposited in glacial lakes.
Hudson Bay and the Gulf of St Lawrence dominate the eastern Shield. Elevations increase from 300 m near the coasts to 900 m in central Labrador and Québec. Relief of 150–300 m is caused by incision of valleys into the higher terrain. At several places over the Shield, uplands and plateaus are broken by belts of hills. The relief of the hills increases because of differential erosion of linear geological structures formed in former mountain belts. Examples are the Labrador and Port Arthur hills.
The high, rugged terrain along the east and southeast rim of the Shield is classified as highland. In Baffin Island and northern Labrador it stands at 800–1,500 m and possesses rolling plateau surfaces which are deeply dissected by glacial troughs, giving a fjord-like aspect to these coasts. Highlands north of the St Lawrence River stand at 500–900 m with isolated summits at 1,000–1,200 m in terrain, which is more dissected, with few plateaus.
The two extensive shield zones, east and west of Hudson Bay, were the centres of ice sheet outflow during the last glaciation (from 75,000 to 6,000 years ago). The central parts of these zones show unorganized terrain mantled with till and also pocked with irregular, shallow lake basins. Around these, glacial scouring of the bedrock is more obvious, with occasional ice-moulded till hills and many eskers marking the courses of sub-glacial rivers, and large moraines marking pauses in retreat of the ice front across the Shield. The periphery of these two core areas is marked by more level terrain which was flooded by lakes and seas during ice retreat.
This subregion lies between the Shield and lakes Huron, Erie and Ontario. The West St Lawrence Lowland consists of a limestone plain (elevation 200–250 m) that is separated by a broad, shale lowland from a broader dolomite and limestone plateau west of Lake Ontario. This plateau is bounded by the Niagara Escarpment. From the escarpment the plateau slopes gently southwest to lakes Huron and Erie (elevation 173 m). Glaciation has mantled this subregion with several layers of glacial till (i.e., an unsorted mixture of clay, sand, etc.), the youngest forming extensive, undulating till plains, often enclosing rolling drumlin fields.
Prominent moraines on the western plateau and north of Lake Ontario mark temporary pauses in the retreat of glaciers, between 14,500 and 12,500 years ago. Level clay and sand plains, which were deposited in glacial lakes, fringe the present lakes.
This subregion in southeastern Ontario and southern Québec has undulating topography, developed on sedimentary rocks that are largely masked by glacial and marine deposits. The seven Monteregian Hills (e.g., Mont Royal), which are aligned approximately west–east between the Shield west of Montréal and the Appalachians, stand at 200–500 m. They are the exhumed roots of volcanoes that formed as the Atlantic Ocean was forming about 120 million years ago.
Along the Shield and Appalachian fringes of the lowland, sandy terraces (elevation up to 200 m) were deposited in the Champlain Sea, which flooded the newly deglaciated lowland approximately 13,000 years ago. These terraces have been eroded by postglacial streams to form more broken terrain. The low, rolling moraine trends southwest from near Québec City to near the Vermont border.
This is a subregion that widens from the lower St Lawrence estuary into the Gulf of St Lawrence and narrows again to the northeast at the Strait of Belle Isle. There are small, isolated low plateaus and plains along the north shore of the Gulf of St Lawrence, such as Îles de Mingan; a coastal plain at less than 100 m in northwestern Newfoundland; and a larger, undulating plateau at 100–200 m with a central spine at 300 m on Île d'Anticosti. These fragments have a smooth terrain influenced by flat or gently dipping sedimentary bedrock. Surface conditions may be barren and dry, forested or boggy, depending on surface slope and the influence of coastal winds.
The Appalachian Region (360,000 km2, about 3.6 per cent of Canada's land surface) lies between the St Lawrence Lowlands to the northwest and the Atlantic Continental Shelf to the east and southeast. Like other mountain regions, its terrain is a mosaic of uplands and lowlands, the characters, boundaries and shapes of which reflect the complexity of rocks and structures. These were inherited from tectonic movements between 480 and 280 million years ago. Since then, denudation (i.e., removal of surface layers) has removed several kilometres of rock, revealing once deeply buried structures.
At the same time, regional uplift has maintained smooth-topped uplands and highlands on stronger rocks, while weaker rocks have been fashioned into lowlands and plains. Highlands and mountains are disposed in a Z-shaped belt, from the Québec border with Vermont and New Hampshire, northeastwards to the Gaspé Peninsula, then southwestwards across New Brunswick, and then continuing northeast north of the Bay of Fundy to Cape Breton Island. From there, broken by Cabot Strait, the belt continues along the high, western spine of Newfoundland. These highlands reach over 1,200 m in the central Gaspé Peninsula (Mont Jacques-Cartier, 1,268 m).
In western Newfoundland and northeastern New Brunswick summits stand at 600–800 m; elsewhere in the region, this highland belt is flanked by uplands at 300–600 m in Québec, northwestern New Brunswick, southern and eastern Newfoundland, and southern Nova Scotia. Except in southern Nova Scotia, the uplands share with the highlands smoothly undulating skylines and deeply cut valleys.
In eastern New Brunswick, Prince Edward Island, Îles de la Madeleine, northern Nova Scotia and the triangular Newfoundland Central Lowland, weaker rocks have allowed the development of plains and lowlands. In Newfoundland and southern Nova Scotia, terrain strongly resembles that of the Shield, with extensive, glacially smoothed bedrock plains, patchily covered with bouldery till and dotted with irregular lakes. In the rest of the region, even highland and mountain zones show only locally severe glacial erosion, particularly in valleys crossing the "grain" of the terrain. Glacial deposits are thicker there and the soil is mostly sandy and infertile.
With deglaciation, between 14,000 and 10,000 years ago, crustal uplift was sufficiently great to exceed sea-level rise in the central and northern zones of the Appalachian Region, so that a coastal fringe exhibits raised marine terraces which often provide pockets of sandy, arable land. In the south, bordering the Atlantic Ocean, post-glacial sea-level rise has exceeded uplift along this submerging coast with rocky headlands, irregular bays and salt marshes. Sea level continues to rise at up to 30 cm per 100 years.
Hugh S. Bostock, "Physiographic Regions of Canada," Geological Survey of Canada Map 1245-A (1967); Olav Slaymaker, "Physiography of Canada and Its Effects on Geomorphic Processes," Quaternary Geology of Canada and Greenland (1989); Alan S. Trenhaile, Geomorphology: A Canadian Perspective (1998, 4th edition, 2010) and The Geomorphology of Canada (1990).
Physiographic RegionsA map of the physiographic regions of Canada from National Resources Canada.
Canada's EcozonesClick on the map to view the natural history of specific ecozones in Canada. From McGill University.
|
0.975285 |
A seizure can be defined as abnormal, uncontrolled electrical activity in brain cells. Nerve cells transmit signals to and from the brain in two ways by (1) altering the concentrations of salts (sodium, potassium, calcium) within the cell and (2) releasing chemicals called neurotransmitters (gamma aminobutyric acid). The change in salt concentration conducts the impulse from one end of the nerve cell to the other.
At the end, a neurotransmitter is released, which carries the impulse to the next nerve cell. Neurotransmitters either slow down or stop cell-to-cell communication (called inhibitory neurotransmitters) or stimulate this process (called excitatory neurotransmitters).
Normally, nerve transmission in the brain occurs in an orderly way, allowing a smooth flow of electrical activity. Improper concentration of salts within the cell and overactivity of either type of neurotransmitter can disrupt orderly nerve cell transmission and trigger seizure activity.
A seizure often has three distinct phases: aura, ictus, and postictal state. The first phase involves alterations in smell, taste, visual perception, hearing, and emotional state. This is known as an aura, which is actually a small partial seizure that is often followed by a larger event.
The seizure is known as ictus. There are two major types of seizure: partial and generalized. What happens to the person during the seizure depends on where in the brain the disruption of neural activity occurs.
Following a seizure, the person enters into the postictal state. Drowsiness and confusion are commonly experienced during this phase. The postictal state is the period in which the brain recovers from the insult it has experienced.
|
0.999955 |
is the extra radiant heat warming things up?
Yes it is, they are known as urban heat islands. Temeratures in large urban areas are increasing faster than rural areas. There has been quite a bit of research into the effect on local weather that I am aware of, and no doubt, the effect on climate change too.
There is a world wide push for what is called Cool Roofs - http://en.wikipedia.org/wiki/Cool_roofs. It has even hit Melbourne - http://www.heraldsun.com.au/news/time-to-paint-melbourne-white-robert-doyle/story-e6frf7jo-1225814264802.
Cool roofs would be beneficial for decreasing urban heat island effect and also for decreasing building cooling costs.
The same principle applies to roads. Lighter coloured roads, which could be achieved with the use of lighter coloured sealing aggregates, would reflect more heat than black roads.
It has been implicated in contributing to global warming - but perhaps not as much as other factors.
A subject for more research?
Reflecting heat certainly keeps houses or roads cool, but does that reflected energy radiate back to space or is it captured in the atmosphere on the way up? If the specific heat capacity of the "ground" is higher than that of the atmopshere, then reflecting heat (if it doesn't escape back in to space) may heat the atmosphere more?
The oceans have vastly greater heat storing capacity than the land masses or atmosphere, and they are already heating up. Since the deep (under ~2m) soil temperatures are usually close to the annual average temperature for most places, there's probably not a lot more that could be done to store heat in the ground anyway, as it aleady happens through natural processes such as conductivity.
zzsstt wrote: Reflecting heat certainly keeps houses or roads cool, but does that reflected energy radiate back to space or is it captured in the atmosphere on the way up?
My understanding is that the solar radiation would be reflected back at the same wavelengths that it came into the earth's atmosphere. So therefore those reflected wavelengths when going back up through the atmosphere are not absorbed in great quantities.
When Solar radiation hits a surface with low reflectivity (such as a black asphalt road) most of it is absorbed, heating the material. The surface of that hot material then radiates but now the radiation is primarily in the infrared spectrum - long wave lengths. It is the infrared spectrum that can be captured by the Greenhouse gases - contributing to global warming.
The oceans and the earth have a large heat capacity (and the melting of the ice caps contribute substantially to this capacity due to latent heat capacity effects of melting ice - a lot of energy is absorbed when melting ice). This heat capacity is one of the reasons global warming has not impacted more - there is a substantial lag effect. The heat capacity while large is only finite - so can not keep absorbing heat on an open ended basis.
BarKing wrote: My understanding is that the solar radiation would be reflected back at the same wavelengths that it came into the earth's atmosphere. So therefore those reflected wavelengths when going back up through the atmosphere are not absorbed in great quantities.
I think that's basically what happens, except that it would appear that a fair amount of visbile light is in fact absorbed by the atmosphere. This graph (admittedly on wiki!) http://en.wikipedia.org/wiki/File:Solar_Spectrum.png would indicate that between 25% and 33% of visible light is absorbed in the atmosphere. It would seem likely that a similar amount would be absorbed on the way back? The IR frequencies that are absorbed by the atmosphere "on the way down" are likely to also be absorbed (if energy is radiated by the black surface at those frequencies) but the subject is muddied by the molecular absorption and "reradiation in a random direction" of IR energy.
BarKing wrote: The oceans and the earth have a large heat capacity (and the melting of the ice caps contribute substantially to this capacity due to latent heat capacity effects of melting ice - a lot of energy is absorbed when melting ice). This heat capacity is one of the reasons global warming has not impacted more - there is a substantial lag effect. The heat capacity while large is only finite - so can not keep absorbing heat on an open ended basis.
I'm not a big believer in the "science" behind man-made global warming*, but the concept that anything with a large specific heat capacity will change temperature quite slowly when exposed to minor energy addition or loss is indeed accurate.
2/ only 68 of these agreed in their original contributions that man was the probable cause of "climate change"
3/ only 43 people provided the "peer reviewing", and these people extracted the data they wanted to publish form the original 600 contributors.
I do not know how true the above is, but I have read previously that many people walked away from the process or requested their "contributions" be removed due to the editing and out-of-context usage of data.
AND - If you are interested, he is talking to people on Wed 27th at 1730 at the "Sheraton on the park", Sydney.. I'll be there..!
Great interview , about time people starting talking about the truth and facts , cant believe how many have been sucked in by the global warming , excess carbon emissions con!
I read with interest a statement by the head of the IPCC who said that the massive error in their statement that the Himalayan glaciers could be completely gone by 2035 was down to "human error".
With all their supposed checking and peer reviewing, they published this statement which the authors have now admitted was based on a news report, which in turn was based on a short telephone conversation with a little known Indian scientist, who in turns admits it was pure speculation and not based on any formal research.
It would seem to me that this glacier situation is complete proof that my suspicions are well founded. An utterly unfounded claim that originated as a speculative comment in a phone call has been published by the IPCC as "fact", and has passed the entire peer reviewing and editing process simply because it is what they want to hear!
well actually it was a typo that glaciers would be gone by 2350 and not 2035 , it was point out by the reviewers of this section but the head wanted it left that way to get some ergentcy and get people to take notice , now really I agree it should not be done like this , but still the studies still found that the glaciers would be drasticly reduce by 2350 is that really any better just because we will be dead !! .
also on Alan Jones, Monckton said Stern was not even an economist just a civil servant , does he forget he served as a Professor of Economics at the University of Warwick from 1978 to 1987 , and the Chief Economist and Senior Vice-President of the World Bank from 2000 to 2003 so i think he was a bit more than a civil servant .
|
0.982972 |
Can you imagine a school without books or teachers? Well, that can be a reality by using computers. Now a day computer is used extensively in the field of education.
We can use the computer as a tutor or teacher. Computer can teach almost any subject in a simpler and more interesting manner through educational CDs. Learning with the help of multimedia computer is exciting.
We can draw the diagrams of Science and solve sums of mathematics on computers.
Important facts about History and Sciences can be stored in computers for further use.
Computers can be used to record such as student fees and attendance details, prepare and print question papers, mark lists, letters, posters and banners.
In the field of education, computers are also used to check examination papers, prepare results, finalize syllabi and time tables, etc.
Given below are few features of computer: Which of the following options is/are correct features of computer in schools?
1. Computer cannot be used as tutor.
2. Computer is used for keeping student details.
3. Computer is also used for checking examination papers.
(A) In education computers are used for many purposes such as keeping student details, checking examination papers, etc.
(B) Feature 1 is incorrect but feature 3 is correct.
(C) All the given features are not correct.
(D) All the given features are not incorrect.
4. All of these Which of the above statements is/are incorrect?
(A) Statement 1 is correct but statement 2 is incorrect.
(B) All the statements are not incorrect.
(D) Statement 1 and 3 are correct.
|
0.951379 |
- Why is bet sizing important?
- When to be high and when to bet low.
- Betting with pot odds.
Why is bet sizing important?
This one should really be a no brainer, but still many players don't consider the size of their bets. Most often inexperienced players bet too high when they're bluffing and too low when they're value betting. But, by controlling your bet sizing in the right way and using pot odds to adjust the size of your bets in certain situations, you can maximize your profits and limit your losses.
When to bet high and when to bet low in poker?
Contrary to what many inexperienced players think, you don't bet high to get players to fold or low to get players to call. I know that sounds illogical, but let me explain why.
First, when you are bluffing or semi-bluffing and you want players to fold, you should bet low. I don't mean betting $2 into a pot of $50, that is much too low. What I mean is don't get too carried away and over bet the pot. There is a correct amount to bet based on the pot to get players to fold. This is because an opponent has usually already decided whether they are going to call or fold regardless of the bet size, within a certain range of course. For example, if you're heads up on the flop with another player in a pot of $30, you go crazy and over bet the pot with $50 and he folds, you just took an unnecessary risk. If he folded to $50 he was already going to fold to a much smaller bet. With a bet of 2/3 pot, you're betting enough to get him to fold any draw he might have. If he already made a hand and would call $20, then he's going to call $50 as well, so why put so many more chips at risk.
On the other hand, when you know you have the winning hand, and you want players to call, you should bet high. Just as in the previous example, I don't mean getting carried away and betting too much. But you should be betting as high as possible while still making a call an attractive option for your opponent. In the same pot of $30, if you lead out with a bet of $3 and your opponent calls, they would have probably called a much higher bet as well. If they fold to a $10 they were probably going to fold to $3 as well and even if that's not true in every case. getting a caller for your $10 bet in 1 out of 3 hands is still more profitable in the long run than getting that same player to call $3 in 3 out of 3 hands.
Betting with pot odds against opponents on a draw.
Pot odds refers to the odds you're getting to make a call based on the size of the call and the money in the pot. In a pot of $30, with an opponent betting $10, you're getting 4 to 1 odds. $30 in the pot plus your opponents bet makes $40. It costs you $10 to call, so you're getting $4 for every $1 you put in the pot. That means you need to pay 25% of the pot to call. To make that call, you want to have a better than 25% chance to win the pot. But this is a topic for a whole different article. What were going to be talking about here, is how to destroy pot odds for your opponents when they're on a draw.
Lets imagine you're in a hand against a player who raised you pre flop from the dealer button. You made a call from the big blind with KsKc and the flop comes up Kh, 7h, 4d with a pot of $30. You have the first move and you know here that the only hand your opponent could have that he'll call with is a flush draw, an open ended straight draw, or a strong king,. You have the king beat but you can still lose to a flush or a straight. If you're opponent is drawing to the flush, they have a slightly better than 1 in 3 chance of catching it by the river and a little lower chance if they're on the straight draw, so you have to bet large enough to destroy the pot odds for them. With a pot of $30 a bet of $10 is too low because you're giving him 4 to 1 odds on a call. If he's drawing to the flush or straight, he'll call call that bet every time and in the long run this is a negative value situation, meaning you're going to lose money. You need to bet enough money so that you're opponent is not getting good odds, but still small enough that they may call. A bet of 2/3 the pot here gives your opponent 5 to 2 odds on a call. That means that if they call that bet every time on the flush or straight draw, you're going to win money in the long run. You just have to make sure you don't pay them off any more when their draw does come through for them. When you include the money you win when they fold to that bet, this becomes a very profitable situation in the long run.
|
0.999578 |
Let's assume, you have given a gold bar of 7 kgs weight, with indicators (a line) for every one kg. You need to give the gold to your friend, such that you are allowed to give 1 KG of gold every day for 7 days. First Day, he will have 1Kg, 2nd day 2kgs, 3rd day 3kgs and at 7th day he will have 7kgs.
The restriction here is you can cut the gold bar only 2 times, not more than that. let's think how to solve this puzzle?
1. First of all you need to understand that, it is a puzzle, which means it won't give you complete details. To solve puzzles kind of these, you need to think out of the box. Out of the box means thinking different possible ways.
2. The first thought, you'll get into your mind is cutting the gold bar into 7 equal pieces. So you'll try to cut the bar into middle and you'll be only having one cut remaining and cutting the remaining pieces into 7 equal bars will never possible.
3. You need to think about the solution in different way, with respect to the real world, just like when ever you go to a shop, and if you had made a bill of 400 rs and if you have 500 rs, you'll take 100 rs back from shop keeper. Let's think in this scenario. The actual solution is below.
4. First cut the gold bar into 3 pieces with 2 cuts. i.e 1 kg, 2 kg, 4 kg.
5. 1st day you'll give 1 kg, and you'll have 2kg, 4kg.
6. 2nd day you'll give 2kg and you'll take back 1kg you've already given. so you'll have 2kg, 4kg, and your friend will have 2 kg with him at 2nd day.
7. 3rd day you'll give 1kg and you'll have 4kg piece with you and your friend will have 3kgs totally at day 3.
8. 4th day you'll give 4kgs and you'll take the 1kg, 2kg piece from your friend. so now you'll have 3 kgs with you and your friend will have 4 kgs on 4th day.
9. 5 th day, you'll give 1kg, so your friend will have 5kgs totally and you'll have 2 kgs left with you for next two days.
10. at 6th day, you'll give 2kgs and takes 1kg back, now you'll have 1kg left and your friend will have 6 kgs with him on 6th day.
11. finally at 7th day, you'll give 1 kg back.
The pictorial representation is below.
I was asked this puzzle in an interview. I didn't solve this puzzle at that time, after that i did a google search and found the solution.
|
0.992284 |
Dieter Hofrichter's - "Sina" Text face - nice classically proportioned contemporary look. Great for headlines.
Generate a ASCII graphic from a word or text.
|
0.706196 |
For other people with the same name, see Kevin Brown (disambiguation).
James Kevin Brown (born March 14, 1965) is a former Major League Baseball right-handed pitcher. He played from 1986 to 2005, leading the American League in wins once and leading the National League in earned run average twice. He was also a six-time All-Star.
Brown attended Wilkinson County High School in Irwinton, Georgia and was a student and a letterman in football, baseball, and tennis. Brown played three years of collegiate baseball at Georgia Tech for their baseball team.
In 1986, Brown was drafted by the Texas Rangers in the first round (fourth pick overall). Starting in 1989, Brown was second in the Rangers' rotation behind ace Nolan Ryan and posted a 12–9 record with a 3.35 ERA and 104 strikeouts in 1989 and a 12–10 record with a 3.60 ERA and 88 strikeouts in 1990. By 1992, Brown had improved his record with the Rangers to a 21–11 with 173 strikeouts and a 3.32 ERA, was tied for the league lead in victories and was the first since Ferguson Jenkins in 1974 to win 20 games in a Ranger uniform.
Brown became a free agent following the strike settlement in 1994 and signed with the Baltimore Orioles for a season, posting a 10–9 record with 117 strikeouts and a 3.60 ERA.
Following the 1995 season, Brown again became a free agent, signing with the Florida Marlins. In his first season with the Marlins, Brown posted a 17–11 record with 159 strikeouts and an MLB best 1.89 ERA, finishing second in the Cy Young Award voting.
In 1997, Brown threw a one-hitter against the Los Angeles Dodgers in his first appearance and a no-hitter against the San Francisco Giants on June 10, 1997. The only baserunner in the game for the Giants came via a HBP with two outs and two strikes in the eighth inning.
In the 1997 National League Championship Series, Brown, riddled with the flu, proceeded to pitch a complete game in Game Six, defeating the Atlanta Braves and helping the Marlins reach the World Series, which they eventually won over the Cleveland Indians.
Following the disassembly of the Marlins' championship team, Brown was traded to the San Diego Padres for Derrek Lee and prospects, where he pitched one season. He posted an 18–7 record with a career-high 257 strikeouts and a 2.38 ERA, finishing third in the Cy Young Award voting.
Masterful during the National League Division Series against the Houston Astros, San Diego won both of Brown's starts by a 2–1 score. As the Game 1 starter opposing Randy Johnson, he allowed no runs in eight innings and struck out 16 Astros, a career-high, and second to that point in MLB playoff history only to Bob Gibson's 17-strikeout performance in the 1968 World Series.
He helped to lead the Padres to the World Series, but not before blowing a save in Game 5 of the NLCS during a rare relief appearance. The Padres would then lose to the New York Yankees in the 1998 World Series in a four-game sweep.
Kevin Brown's tenure with the Padres during the 1998 season was somewhat marred when the San Diego fans chose to cheer slugger Sammy Sosa during his home run chase along with Mark McGwire. Frustrated by the fact that the Padres were trying to win games during a pennant race, Kevin Brown insulted San Diego fans to the media.
Following the 1998 season, Brown again became a free agent. He signed a lucrative contract with the Los Angeles Dodgers for 7 years/$105 million USD, becoming the first $100 million man in baseball. Many fans, both in San Diego and nationally, were taken aback by the immensity of the contract given to a player in his mid 30's (almost $40 million more than the Padres offer, the next highest offer he received), and also the choice of team, given Brown expressed a desire to play in a city closer to his Georgia home than San Diego during the season. Enrique Rojas of ESPN Deportes called the contract "one of the worst deals ever from a team's point of view" because Brown averaged only nine wins per season and was frequently injured during the seven years of the deal. That contract is currently listed as the 82nd largest in the history of sports tied with NBA Star Juwan Howard.
His first season in Los Angeles, he posted an 18–9 record with 221 strikeouts and a 3.00 ERA. After leading the NL in ERA during an injury-plagued 2000 season, his performance began to dwindle as Brown was hampered by injuries and poor run support. In 2003, Brown rebounded, producing a respectable 14–9 record with 185 strikeouts and a 2.39 ERA, although LA Times sportswriter Bill Plaschke noted following the release of the Mitchell Report "(his numbers that year are) no longer believe(able)."
On December 11, 2003, Brown was traded to the New York Yankees as part of a deal that sent Jeff Weaver, Yhency Brazobán, Brandon Weeden, and $2.6 million in cash to Los Angeles. He went on a 10–6 record with a 4.09 ERA, but experienced health problems during the season. Toward the end of the season, he punched a wall in frustration, injuring his hand. He did pitch well in the Division Series, but it was his performance in Game 7 of the 2004 American League Championship Series that he is remembered for, lasting less than two innings while giving up five earned runs, including a two-run homer to David Ortiz.
Brown would attempt to come back in 2005, but missed several games during the season due to injury. He would go 4–7 with a 6.50 ERA. On February 20, 2006, Brown announced his retirement.
The Mitchell Report named Brown as one of a group of Los Angeles Dodgers implicated in steroid use. The report documents allegations by Kirk Radomski that he sold Brown human growth hormone and Deca-Durabolin over a period of two or three years beginning in either 2000 or 2001. Radomski claims he was introduced to Brown by Paul Lo Duca. Radomski's claims were supported by an Express Mail receipt dated June 7, 2004, addressed to Brown. The report also contains notes from a meeting of Dodgers executives in 2003 during which they question the medication Brown takes and include a note stating "Steroids speculated by GM". Brown declined to meet with the Mitchell investigators.
Plaschke states that by 2003 "it was obvious to me...(and) Dodger management that...(he was) probably on steroids. We would even talk about it while watching their bulging, straining bodies from the dugout during batting practice. But the players would admit nothing, so there was nothing I could write.". Brown's temper tantrums, he notes, may have in fact been "'roid rage."
Brown was a pitcher who had the rare talent of relying both on movement and velocity. His main pitch was a sinking fastball that averaged 91–96 mph, with tremendous tailing, downward movement. He could spot it to either side of the plate. Batters facing him generally pounded this pitch into the ground or missed it entirely. He complemented this pitch with a sharp slider in the high 80s, and a solid split fingered fastball he used against left-handed hitters or for another look.
Over his career, Brown won 211 games and finished his career with a 127 ERA+ (27% better than the league-wide earned run average). Only seven pitchers have won between 200 and 220 wins with an ERA+ between 120 and 135. Of those seven, Stan Coveleski (215 wins, 128 ERA+), John Smoltz (213/125), Don Drysdale (209/121), and Hal Newhouser (207/130) are in the Baseball Hall of Fame, and Curt Schilling is a probable future inductee. Only Eddie Cicotte (209/123) of Black Sox infamy has been excluded.
In 2006, a neighbor accused Brown of pulling a gun on him after Brown accused the neighbor of putting yard debris on his side of the yard. He is currently an assistant baseball coach at Tattnall Square academy.
In 16 major league seasons, Brown made over $130 million.
He currently resides in Macon, Georgia with his wife Candace, three sons—Ridge, Grayson, and Dawson—and five dogs.
↑ Swydan, Paul (May 17, 2013). "The 1998 Astros were pretty good at hitting". Fangraphs. Retrieved February 16, 2016.
↑ Newhan, Ross (October 5, 1998). "Once again, Biggio Bagwell and Bell are wannabes in playoffs". Los Angeles Times. Retrieved March 21, 2016.
↑ Newhan, Ross (September 30, 1998). "Powerful Astros are shut down by a Brown out". Los Angeles Times. Retrieved March 21, 2016.
↑ Plaschke, Bill (2007-12-14). "A sullied part of Dodgers' history". Los Angeles Times. Retrieved 2007-12-14.
↑ "Mitchell Report pp. 214-17" (PDF).
↑ "Ex-hurler Kevin Brown, neighbor at odds". USA Today. 2006-08-17. Retrieved 2009-08-23.
|
0.999697 |
What are plants that mosquitoes love to hate?
There are billions of insects all over the world. Some are harmless, but some insects like mosquitoes can harm human beings. They transmit dangerous diseases like dengue, malaria, yellow fever, and encephalitis. More than one million people die every year due to mosquito-borne illnesses.
Many repellents used to control the mosquito menace are loaded with chemicals like propoxur, dichlorvos, and transfluthrin, which are harmful to human beings. Because of this fact, people are increasingly seeking out natural ways to repel mosquitoes. One natural and effective way to repel mosquitoes is the use of certain plants that mosquitoes hate.
Try using any of the plants above to keep mosquitoes at bay. If you want to try making your own repellent using essential oils, I've included an easy recipe and variations of ingredients you can use to create it.
You may know the pyrethrum daisy as tanacetum cinerariifolium or Dalmatian pyrethrum. This white-petaled and yellow-centered flowers were used by soldiers in the Napoleonic wars to repel insects. It is well known for its insecticidal properties.
Marigold plants bear yellow or orange flowers. They have a pungent odor due to terthienyl production. This compound repels mosquitoes and other insects. Farmers usually grow marigold as interval plants in their vegetable garden. Hindus use marigold extensively to worship their deities at home and in the temples, and Hindu women wear marigold flowers on their heads.
Citronella is a perennial clumping grass. This natural mosquito repellent grows up to six feet tall. Its strong aroma masks other attractants to mosquitoes, making it impossible for them to find you.
You can grow it directly in the ground if you live in a climate where frost does not occur. It is advisable to plant them in the background behind small decorative flowers and shrubs. In cold regions, they can also be grown in a large pot, preferably with casters so they can be rolled indoors during the winter months.
Like most grasses, citronella plants are easy to maintain. They are sold as small plants in pots. You can transplant them into raised garden beds on the ground or into a large pot. They grow well in full sun and well-drained locations. It is advisable to apply nitrogen-rich fertilizers once a year during early spring.
Clove plants (syzygium aromaticum) are well-known for their mosquito-repelling properties. They grow well in tropical conditions and come from the myrtaceae family.
Rosemary herb grows up to five feet and bears blue flowers. It grows well under warm climatic conditions and needs to be protected during the winter months. You need to arrange for a warm shelter.
I'd advise growing rosemary in pots to make it easy for you to move them indoors during the winter months. You can place the pots in your yard during the warm months.
Horsemint is used in many parts of the world to repel mosquitoes. This fast-growing plant’s incense-like odor makes it impossible for mosquitoes to find you. You can also pinch a bloom or two off the plant, rub them in your hands, and apply the residue to the exposed areas of your skin to keep mosquitoes at bay.
Horsemint is a drought-resistant and shade-tolerant plant. It grows well in dry, sandy soil and grows up to three feet. It is known to tolerate salty conditions. You should sow horsemint seeds in late summer in cold climate zones, either in the ground or in pots.
Nepeta cataria,commonly known as catnip, is 10 times more effective than DEET, a chemical found in most commercial mosquito repellents. Whether it acts as an irritant or its odor acts as a repellent, no one knows. However, lab tests conducted in many parts of the world have proved its effectiveness as a mosquito repellent. This perennial herb is easy to grow.
Ageratum is a low-lying annual ornamental plant also known as floss flowers. It grows up to 18 inches tall and usually bears blue flowers. You can find varieties of ageratum with pink, violet, and white flowers.
Mosquitoes find its characteristic odor offensive. Coumarin, secreted by ageratum, is used extensively in manufactured mosquito repellents. The plants grow well in full or partial sun and do not need rich soil. It is not advisable to rub the crushed leaves of ageratum plants on your skin.
Lavender works as an excellent mosquito repellent. It is easy to grow and thrives in sunny climates. The plant grows up to four feet, and I'd suggest keeping lavender plants around seating areas. It'll smell and look good.
Vetiver grass is a tropical plant, and its roots emit an aroma that repels mosquitoes. You can use the roots to weave screens to cover windows.
Lemongrass is nature’s own mosquito repellent that has a pleasant and fresh lemony aroma. Mosquitoes hate lemongrass. It is advisable to grow it in the landscape or in containers. You can place them on your patio, deck, or outdoor living spaces.
Mosquitoes hate garlic plants because of their strong odor. I suggest you plant garlic plants in the border areas of your garden.
If you want to try to make your own mosquito repellent, it should be a blend of essential oil (5-10%) and a carrier (remaining).
Which mosquito repellent plant do you have?
How many people die from mosquito-related deaths?
hi sir can i ask some question? Can we use sun flower seed mixed with lemon grass? is it useful for making some repellent in mosquitoes?
Very informative and truly helpful. Thank you so much for sharing.
Thanks for the helpful tips to repel mosquitoes. I already have some of these planted and made a list to include additional plants to help keep the pests at bay.
This has been very informative. I don't like using chemical-based repellents, and I did purchase lavender plants to use as a natural mosquito repellent. But, wow! I have a number of the plants you have listed in your hub. I had no idea that many of the plants I already grow are plants that repel mosquitoes.
Very useful tips for the summer mosquito attacks! Thanks.
Great hub. Eco-friendly ways to get rid of these pests. I like it.
This has been most helpful! Great information! Thank you!
Thank you! Glad to know that the article is useful!
This hub is fantastic and filled with useful information. I need to add a few more of these plants to my garden. Well written and researched. Definitely sharing.
|
0.999972 |
- Date: 11/2009, Series C: $15.18 M (post valuation: $300).
- Date: 01/2008, Series A: $10 M (post valuation: undisclosed amount).
The #1 social gaming company on the web.
Zynga was featured in a VatorNews article: "Meet Amitt Mahajan, Managing Partner at Presence"
Zynga was featured in a VatorNews article: "Zynga gets a new CEO, hires EA exec Frank Gibeau"
Zynga was featured in a VatorNews article: "M&A roundup - week ending 2/13/16"
Zynga was featured in a VatorNews article: "11 new faces: some of the biggest CEO turnovers in 2015"
Zynga was featured in a VatorNews article: "Tinder rehires ex-CEO Sean Rad months after he lost the job"
Zynga was featured in a VatorNews article: "Zynga buys Mark Pincus' Superlabs incubator for $1"
Zynga was featured in a VatorNews article: "Twitter's revolving door makes it an outlier in SV"
Zynga was featured in a VatorNews article: "FanDuel hires the team from Zynga's sports division"
Zynga was featured in a VatorNews article: "He's baaaaaack: Mark Pincus returns as Zynga CEO"
Zynga was featured in a VatorNews article: "Kabam makes two new purchases to expand to LA"
Zynga was featured in a VatorNews article: "Churchill Downs buys Big Fish Games for $885M"
Zynga was featured in a VatorNews article: "Zynga beats on Q3 bookings, shares pop 9%"
Zynga was featured in a VatorNews article: "Red Hot Labs launches Toro, a Facebook mobile app tool "
Zynga was featured in a VatorNews article: "Industry Ventures closes new $170M fund"
Zynga was featured in a VatorNews article: "A slew of KPCB computers stolen during break in"
Zynga was featured in a VatorNews article: "eBay in talks to accept Bitcoin through Braintree"
Zynga was featured in a VatorNews article: "Zynga falls 10% after whiffing on bookings in Q2"
Zynga was featured in a VatorNews article: "Japanese resale app Mercari is heading to the U.S."
Zynga was featured in a VatorNews article: "California passes law to legalize digital currencies"
Zynga was featured in a VatorNews article: "Zynga sees double digit audience growth on mobile in Q1"
|
0.965898 |
The term as most often used applies to introduced species (also called "non-indigenous" or "non-native") that adversely affect the habitats and bioregions they invade economically, environmentally, and/or ecologically. Such invasive species may be either plants or animals and may disrupt by dominating a region, wilderness areas, particular habitats, or wildland-urban interface land from loss of natural controls (such as predators or herbivores). This includes non-native invasive plant species labeled as exotic pest plants and invasive exotics growing in native plant communities. It has been used in this sense by government organizations as well as conservation groups such as the International Union for Conservation of Nature (IUCN) and the California Native Plant Society. The European Union defines "Invasive Alien Species" as those that are, firstly, outside their natural distribution area, and secondly, threaten biological diversity. It is also used by land managers, botanists, researchers, horticulturalists, conservationists, and the public for noxious weeds. The kudzu vine (Pueraria lobata), Andean Pampas grass (Cortaderia jubata), and yellow starthistle (Centaurea solstitialis) are examples.
An alternate usage broadens the term to include indigenous or "native" species along with non-native species, that have colonized natural areas (p. 136). Deer are an example, considered to be overpopulating their native zones and adjacent suburban gardens, by some in the Northeastern and Pacific Coast regions of the United States.
Sometimes the term is used to describe a non-native or introduced species that has become widespread (p. 136). However, not every introduced species has adverse effects on the environment. A nonadverse example is the common goldfish (Carassius auratus), which is found throughout the United States, but rarely achieves high densities (p. 136).
Scientists include species- and ecosystem factors among the mechanisms that when combined, establish invasiveness in a newly introduced species.
While all species compete to survive, invasive species appear to have specific traits or specific combinations of traits that allow them to outcompete native species. In some cases the competition is about rates of growth and reproduction. In other cases species interact with each other more directly.
An introduced species might become invasive if it can outcompete native species for resources such as nutrients, light, physical space, water, or food. If these species evolved under great competition or predation, then the new environment may host fewer able competitors, allowing the invader to proliferate quickly. Ecosystems in which are being used to their fullest capacity by native species can be modeled as zero-sum systems, where any gain for the invader is a loss for the native. However, such unilateral competitive superiority (and extinction of native species with increased populations of the invader) is not the rule. Invasive species often coexist with native species for an extended time, and gradually the superior competitive ability of an invasive species becomes apparent as its population grows larger and denser and it adapts to its new location.
An invasive species might be able to use resources that were previously unavailable to native species, such as deep water sources accessed by a long taproot, or an ability to live on previously uninhabited soil types. For example, barbed goatgrass (Aegilops triuncialis) was introduced to California on serpentine soils, which have low water-retention, low nutrient levels, a high Magnesium/Calcium ratio, and possible heavy metal toxicity. Plant populations on these soils tend to show low density, but goatgrass can form dense stands on these soils, crowding out native species that have adapted poorly to serpentine soils.
Ecological facilitation occurs when a species alters its environment by using chemicals or manipulating abiotic factors, allowing the species to thrive while making the environment less favorable to competitors. One such facilitative mechanism is allelopathy, also known as chemical competition or interference competition, where a plant secretes chemicals that make the surrounding soil uninhabitable, or at least inhibitory, to competing species.
Examples of this in Centaurea are Centaurea solstitialis (yellow starthistle) and Centaurea diffusa (diffuse knapweed). These Eastern European noxious weeds have spread through the western and West Coast states. Experiments show that 8-hydroxyquinoline, a chemical produced at the root of C. diffusa, has a negative effect only on plants that have not co-evolved with it. Such co-evolved native plants have also evolved defenses. C. diffusa and C. solstitialis do not appear in their native habitats to be overwhelmingly successful competitors. Success or lack of success in one habitat does not necessarily imply success in others. Conversely, examining habitats in which a species is less successful can reveal novel weapons to defeat invasiveness.
Facilitation also occurs where one species so physically modifies a habitat in ways that are advantageous to other species. For example, zebra mussels increase habitat complexity on lake floors, providing crevices in which invertebrates live. This increase in complexity, together with the nutrition provided by the waste products of mussel filter-feeding, increases the density and diversity of benthic invertebrate communities.
In ecosystems, the amount of available resources and the extent to which those resources are used by organisms determines the effects of additional species on the ecosystem. In stable ecosystems, equilibrium exists in the use of available resources. These mechanisms describe a situation in which the ecosystem has suffered a disturbance which changes the fundamental nature of the ecosystem.
Every species occupies a niche in its native ecosystem; some species fill large and varied roles, while others are highly specialized. Some invading species fill niches that are not used by native species, and they also can create new niches.
Ecosystem changes can alter species' distributions. For example edge effects describe what happens when part of an ecosystem is disturbed as when land is cleared for agriculture. The boundary between remaining undisturbed habitat and the newly cleared land itself forms a distinct habitat, creating new winners and losers and possibly hosting species that would not thrive outside the boundary habitat.
One interesting finding in studies of invasive species has shown that introduced populations have great potential for rapid adaptation and this is used to explain how so many introduced species are able to establish and become invasive in new environments. When bottlenecks and founder effects cause a great decrease in the population size, the individuals begin to show additive variance as opposed to epistatic variance. This conversion can actually lead to increased variance in the founding populations which then allows for rapid adaptive evolution. Following invasion events, selection may initially act on the capacity to disperse as well as physiological tolerance to the new stressors in the environment. Adaptation then proceeds to respond to the selective pressures of the new environment. These responses would most likely be due to temperature and climate change, or the presence of native species whether it be predator or prey. Adaptations include changes in morphology, physiology, phenology, and plasticity.
Rapid adaptive evolution in these species leads to offspring that have higher fitness and are better suited for their environment. Intraspecific phenotypic plasticity, pre- adaptation and post-introduction evolution are all major factors in adaptive evolution. Plasticity in populations allows room for changes to better suit the individual in its environment. This is key in adaptive evolution because the main goal is how to best be suited to the ecosystem that the species has been introduced. The ability to accomplish this as quickly as possible will lead to a population with a very high fitness. Pre-adaptations and evolution after the initial introduction also play a role in the success of the introduced species. If the species has adapted to a similar ecosystem or contains traits that happen to be well suited to the area that it is introduced, it is more likely to fare better in the new environment. This, in addition to evolution that takes place after introduction, all determine if the species will be able to become established in the new ecosystem and if it will reproduce and thrive.
Invasion was more likely in ecosystems that were similar to the one in which the potential invader evolved. Island ecosystems may be more prone to invasion because their species faced few strong competitors and predators, or because their distance from colonizing species populations makes them more likely to have "open" niches. An example of this phenomenon was the decimation of native bird populations on Guam by the invasive brown tree snake. Conversely, invaded ecosystems may lack the natural competitors and predators that check invasives' growth in their native ecosystems, a factor that affected Guam snake populations.
Vectors include plants or seeds imported for horticulture. The pet trade moves animals across borders, where they can escape and become invasive. Organisms stow away on transport vehicles. Ballast water taken up at sea and released in port by transoceanic vessels is the largest vector for non-native aquatic species invasions. Around the world on the average day, more than 3,000 different species of aquatic life may be transported on these vessels. For example, freshwater zebra mussels, native to the Black, Caspian and Azov seas, probably reached the Great Lakes via ballast water from a transoceanic vessel. Although the zebra mussel invasion was first noted in 1988, and a mitigation plan was successfully implemented shortly thereafter, the plan had (and continued to have as of 2005) a serious flaw or loophole, whereby ships that are loaded with cargo when they reach the Seaway need not be tested, but all the same they transfer ballast 'puddles' between Seaway ports.
Species have also been introduced intentionally. For example, to feel more "at home", American colonists formed "Acclimation Societies" that repeatedly imported birds that were native to Europe to North America and other distant lands. In 2008, U.S. postal workers in Pennsylvania noticed noises coming from inside a box from Taiwan; the box contained more than two dozen live beetles. Agricultural Research Service entomologists identified them as rhinoceros beetle, hercules beetle, and king stag beetle. Because these species were not native to the U.S., they could have threatened native ecosystems. To prevent exotic species from becoming a problem in the U.S., special handling and permits are required when living materials are shipped from foreign countries. USDA programs such as Smuggling Interdiction and Trade Compliance (SITC) attempt to prevent exotic species outbreaks in America.
Fire suppression vehicles are often major culprits in such outbreaks, as the vehicles are often driven on back roads often overgrown with invasive plant species. The undercarriage of the vehicle becomes a prime vessel of transport. In response, on large fires, washing stations "decontaminate" vehicles before engaging in suppression activities. Large wild fires attract firefighters from remote places, further increasing the potential for seed transport.
Non-native species can have benefits. Asian oysters, for example, filter water pollutants better than native[clarification needed] oysters. They also grow faster and withstand disease better than natives. Biologists are currently considering releasing this mollusk in the Chesapeake Bay to help restore oyster stocks and remove pollution. A recent study by the Johns Hopkins School of Public Health found the Asian oyster could significantly benefit the bay's deteriorating water quality.
Some invasions offer potential commercial benefits. For instance, silver carp and common carp can be harvested for human food and exported to markets already familiar with the product, or processed into pet foods, or mink feed. Vegetative invasives such as water hyacinth can be turned into fuel by methane digesters.
Weeds reduce yield in agriculture, though they may provide essential nutrients. Some deep-rooted weeds can "mine" nutrients (see dynamic accumulator) from the subsoil and deposit them on the topsoil, while others provide habitat for beneficial insects and/or provide foods for pest species. Many weed species are accidental introductions that accompany seeds and imported plant material. Many introduced weeds in pastures compete with native forage plants, threaten young cattle (e.g., leafy spurge, Euphorbia esula) or are unpalatable because of thorns and spines (e.g., yellow starthistle). Forage loss from invasive weeds on pastures amounts to nearly US$1 billion in the U.S. alone. A decline in pollinator services and loss of fruit production has been caused by honey bees infected by the invasive varroa mite. Introduced rats (Rattus rattus and R. norvegicus) have become serious pests on farms, destroying stored grains.
The unintentional introduction of forest pest species and plant pathogens can change forest ecology and damage the timber industry. The Asian long-horned beetle (Anoplophora glabripennis) was first introduced into the U.S. in 1996, and was expected to infect and damage millions of acres of hardwood trees. As of 2005 thirty million dollars had been spent in attempts to eradicate this pest and protect millions of trees in the affected regions.
In North America, the woolly adelgid has inflicted damage on old-growth spruce, fir and hemlock forests and damages the Christmas tree industry.
The chestnut blight fungus (Cryphonectria parasitica) and Dutch elm disease (Ophiostoma novo-ulmi) are two plant pathogens with serious impacts on these two species, and forest health.
Garlic mustard, Alliaria petiolata, is one of the most problematic invasive plant species in eastern North American forests. The characteristics of garlic mustard are slightly different from those of the surrounding native plants, which results in a highly successful species that is altering the composition and function of the native communities it invades. When garlic mustard invades the understory of a forest, it affects the growth rate of tree seedlings, which is likely to alter forest regeneration of impact forest composition in the future.
Invasive species can impact outdoor recreation, such as fishing, hunting, hiking, wildlife viewing, and water-based activities. They can damage a wide array of environmental services that are important to recreation, including, but not limited to, water quality and quantity, plant and animal diversity, and species abundance. Eiswerth states, "very little research has been performed to estimate the corresponding economic losses at spatial scales such as regions, states, and watersheds." Eurasian watermilfoil (Myriophyllum spicatum) in parts of the US, fill lakes with plants complicating fishing and boating. The very loud call of the introduced common coqui depresses real estate values in affected neighborhoods of Hawaii.
Encroachment of humans into previously remote ecosystems has exposed exotic diseases such as AIDS virus to the wider population. Introduced birds (e.g. pigeons), rodents and insects (e.g. mosquito, flea, louse and tsetse fly pests) can serve as vectors and reservoirs of human afflictions. The introduced Chinese mitten crabs are carriers of Asian lung fluke. Throughout recorded history, epidemics of human diseases, such as malaria, yellow fever, typhus, and bubonic plague, spread via these vectors. A recent example of an introduced disease is the spread of the West Nile virus, which killed humans, birds, mammals, and reptiles. Waterborne disease agents, such as cholera bacteria (Vibrio cholerae), and causative agents of harmful algal blooms are often transported via ballast water. Invasive species and accompanying control efforts can have long term public health implications. For instance, pesticides applied to treat a particular pest species could pollute soil and surface water.
Invasive species may drive local native species to extinction via competitive exclusion, niche displacement, or hybridisation with related native species. Therefore, besides their economic ramifications, alien invasions may result in extensive changes in the structure, composition and global distribution of the biota of sites of introduction, leading ultimately to the homogenisation of the world’s fauna and flora and the loss of biodiversity. Nevertheless, it is difficult to unequivocally attribute extinctions to a species invasion, and the few scientific studies that have done so have been with animal taxa. Concern over the impacts of invasive species on biodiversity must therefore consider the actual evidence (either ecological or economic), in relation to the potential risk.
Native species can be threatened with extinction through the process of genetic pollution. Genetic pollution is unintentional hybridization and introgression, which leads to homogenization or replacement of local genotypes as a result of either a numerical or fitness advantage of the introduced species. Genetic pollution can operate either through introduction or through habitat modification, bringing previously isolated species into contact. Hybrids resulting from rare species that interbreed with abundant species can swamp the rarer species' gene pool. This is not always apparent from morphological observations alone. Some degree of gene flow is normal, and preserves constellations of genes and genotypes. An example of this is the interbreeding of migrating coyotes with the red wolf, in areas of eastern North Carolina where the red wolf was reintroduced.
Invasion biology terminology for a review of the terminology used in invasion biology.
^ "Definition of terms", Non-native Species Secretariat, accessed August 31, 2014.
^ USA (1999). "Executive Order 13112 of February 3, 1999: Invasive Species". Federal Register 64 (25): 6183–6186.
^ "Communication From The Commission To The Council, The European Parliament, The European Economic And Social Committee And The Committee Of The Regions Towards An EU Strategy On InvasFpollive Species" (PDF). Retrieved 2011-05-17.
^ a b Kolar, C.S.; D.M. Lodge (2001). "Progress in invasion biology: predicting invaders". Trends in Ecology & Evolution 16 (4): 199–204. PMID 11245943. doi:10.1016/S0169-5347(01)02101-2.
^ Thebaud, C.; A.C. Finzi, L. Affre, M. Debussche, J. Escarre (1996). "Assessing why two introduced Conyza differ in their ability to invade Mediterranean old fields". Ecology (Ecology, Vol. 77, No. 3) 77 (3): 791–804. JSTOR 2265502. doi:10.2307/2265502.
^ Reichard, S.H.; C. W. Hamilton (1997). "Predicting invasions of woody plants introduced into North America". Conservation Biology 11 (1): 193–203. doi:10.1046/j.1523-1739.1997.95473.x.
^ a b Williams, J.D.; G. K. Meffe (1998). "Nonindigenous Species". Status and Trends of the Nation's Biological Resources. Reston, Virginia: United States Department of the Interior, Geological Survey 1.
^ Ewell, J.J.; D.J. O’Dowd, J. Bergelson, C.C. Daehler, C.M. D’Antonio, L.D. Gomez, D.R. Gordon, R.J. Hobbs, A. Holt, K.R. Hopper, C.E. Hughes, M. LaHart, R.R.B. Leakey, W.G. Wong, L.L. Loope, D.H. Lorence, S.M. Louda, A.E. Lugo, P.B. McEvoy, D.M. Richardson, and P.M. Vitousek (1999). "Deliberate introductions of species: Research needs - Benefits can be reaped, but risks are high". BioScience 49 (8): 619–630. JSTOR 1313438. doi:10.2307/1313438.
^ a b Tilman, D. (2004). "Niche tradeoffs, neutrality, and community structure: A stochastic theory of resource competition, invasion, and community assembly". Proceedings of the National Academy of Sciences 101 (30): 10854–10861. PMC 503710. PMID 15243158. doi:10.1073/pnas.0403458101.
^ Verling, E.; G.M. Ruiz, L.D. Smith, B. Galil, A.W. Miller, and K.R. Murphy (2005). "Supply-side invasion ecology: characterizing propagule pressure in coastal ecosystems". Proceedings of the Royal Society B 272 (1569): 1249–1256. PMC 1564104. PMID 16024389. doi:10.1098/rspb.2005.3090.
^ Stohlgren, T.J.; D. Binkley, G.W. Chong, M.A. Kalkhan, L.D. Schell, K.A. Bull, Y. Otsuki, G. Newman, M. Bashkin, and Y. Son; Chong, Geneva W.; Kalkhan, Mohammed A.; Schell, Lisa D.; Bull, Kelly A.; Otsuki, Yuka; Newman, Gregory; Bashkin, Michael; Son, Yowhan (1999). "Exotic plant species invade hot spots of native plant diversity". Ecological Monographs 69: 25–46. doi:10.1890/0012-9615(1999)069[0025:EPSIHS]2.0.CO;2.
^ Sax, D.F.; S. D. Gaines and J. H. Brown (2002). "Species Invasions Exceed Extinctions on Islands Worldwide: A Comparative Study of Plants and Birds". American Naturalist 160 (6): 766–783. PMID 18707464. doi:10.1086/343877.
^ Huenneke, L.; S. Hamburg; R. Koide; H. Mooney; P. Vitousek (1990). "Effects of soil resources on plant invasion and community structure in California (USA) serpentine grassland". Ecology 71 (2): 478–491. JSTOR 1940302. doi:10.2307/1940302.
^ Hierro, J.L.; R.M. Callaway (2003). "Allelopathy and exotic plant invasion". Plant and Soil 256 (1): 29–39. doi:10.1023/A:1026208327014.
^ Vivanco, J.M.; Bais, H.P.; Stermitz, F.R.; Thelen, G.C.; Callaway, R.M. (2004). "Biogeographical variation in community response to root allelochemistry: Novel weapons and exotic invasion". Ecology Letters 7 (4): 285–292. doi:10.1111/j.1461-0248.2004.00576.x.
^ a b Brooks, M.L.; D'Antonio, C.M.; Richardson, D.M.; Grace, J.B.; Keeley, J.E.; DiTomaso, J.M.; Hobbs, R.J.; Pellant, M.; Pyke, D. (2004). "Effects of invasive alien plants on fire". BioScience 54 (54): 677–688. doi:10.1641/0006-3568(2004)054[0677:EOIAPO]2.0.CO;2.
^ Byers, J.E. (2002). "Impact of non-indigenous species on natives enhanced by anthropogenic alteration of selection regimes". Oikos 97 (3): 449–458. doi:10.1034/j.1600-0706.2002.970316.x.
^ a b Davis, M.A.; Grime, J.P.; Thompson, K. (2000). "Fluctuating resources in plant communities: A general theory of invisibility". Journal of Ecology 88 (3): 528–534. doi:10.1046/j.1365-2745.2000.00473.x.
^ Prentis, Peter. "Adaptive evolution in invasive species". Trends in Plant Science 13 (6): 288–294. doi:10.1016/j.tplants.2008.03.004.
^ Lee, Carol Eunmi. "Evolutionary genetics of invasive species". Trends in Ecology & Evolution 17 (86): 386–391.
^ Zenni, R.D. "Adaptive Evolution and Phenotypic Plasticity During Naturalization and Spread of Invasive Species: Implications for Tree Invasion Biology". Biological Invasions 16 (3): 635–644. doi:10.1007/s10530-013-0607-8.
^ a b Elton, C.S. (2000) . The Ecology of Invasions by Animals and Plants. Foreword by Daniel Simberloff. Chicago: University of Chicago Press. p. 196. ISBN 0-226-20638-6.
^ Stohlgren, T.J.; Binkley, D.; Chong, G.W.; Kalkhan, M.A.; Schell, L.D.; Bull, K.A.; Otsuki, Y.; Newman, G.; Bashkin, M.; Son, Y. (1999). "Exotic plant species invade hot spots of native plant diversity". Ecological Monographs 69: 25–46. doi:10.1890/0012-9615(1999)069[0025:EPSIHS]2.0.CO;2.
^ Byers, J.E.; E.G. Noonburg (2003). "Scale dependent effects of biotic resistance to biological invasion". Ecology 84 (6): 1428–1433. doi:10.1890/02-3131.
^ Levine, J. M. (2000). "Species diversity and biological invasions: Relating local process to community pattern". Science 288 (5467): 852–854. PMID 10797006. doi:10.1126/science.288.5467.852.
^ Williams, J.D.; G. K. Meffe (1998). "Nonindigenous Species". Status and Trends of the Nation's Biological Resources. Reston, Virginia: United States Department of the Interior, Geological Survey 1.
^ Stachowicz, J.J.; D. Tilman (2005). "Species invasions and the relationships between species diversity, community saturation, and ecosystem functioning". In D.F. Sax, J.J. Stachowicz, and S.D. Gaines. Species Invasions: Insights into Ecology, Evolution, and Biogeography. Sunderland, Massachusetts: Sinauer Associates. ISBN 0-87893-811-7.
^ Fritts, T.H.; D. Leasman-Tanner (2001). "The Brown Treesnake on Guam: How the arrival of one invasive species damaged the ecology, commerce, electrical systems, and human health on Guam: A comprehensive information source". Retrieved 2007-09-01.
^ Molnar, Jennifer L; Gamboa, Rebecca L; Revenga, Carmen; Spalding, Mark D (2008). "Assessing the global threat of invasive species to marine biodiversity". Frontiers in Ecology and the Environment 6 (9): 485–492. ISSN 1540-9295. doi:10.1890/070064.
^ Xu, Jian; Wickramarathne, Thanuka L.; Chawla, Nitesh V.; Grey, Erin K.; Steinhaeuser, Karsten; Keller, Reuben P.; Drake, John M.; Lodge, David M. (2014). "Improving management of aquatic invasions by integrating shipping network, ecological, and environmental data". pp. 1699–1708. doi:10.1145/2623330.2623364.
^ F. Moretzsohn, J.A. Sánchez Chávez, and J.W. Tunnell, Jr. (ed.). "Invasive Species". GulfBase: Resource Database for Gulf of Mexico Research. Harte Research Institute for Gulf of Mexico Studies at Texas A&M University-Corpus Christi. Retrieved March 19, 2013.
^ Leung, B.; N.E. Mandrak (2007). "The risk of establishment of aquatic invasive species: joining invasibility and propagule pressure". Proceedings of the Royal Society B 274 (1625): 2733–2739. PMC 2275890. PMID 17711834. doi:10.1098/rspb.2007.0841.
^ Grosholz, E.D. (2005). "Recent biological invasion may hasten invasional meltdown by accelerating historical introductions". Proceedings of the National Academy of Sciences 102 (4): 1088–1091. PMC 545825. PMID 15657121. doi:10.1073/pnas.0308547102.
^ Rhymer, J. M.; Simberloff, D. (1996). "Extinction by hybridization and introgression". Annual Review of Ecology and Systematics 27 (27): 83–109. doi:10.1146/annurev.ecolsys.27.1.83.
^ Primtel, David (2005). "Update on the environmental and economic costs associated with alien-invasive species in the United States". Ecological Economics 52 (4): 1088–1091. PMC 545825. PMID 15657121. doi:10.1073/pnas.0308547102.
^ Simberloff, D. (2001). "Biological invasions - How are they affecting us, and what can we do about them?". Western North American Naturalist 61: 308–315.
^ Azevedo-Santos, V.M.; O. Rigolin-Sá; F.M. Pelicice (2011). "Growing, losing or introducing? Cage aquaculture as a vector for the introduction of non-native fish in Furnas Reservoir, Minas Gerais, Brazil". Neotropical Ichthyology 9 (4): 915–9. ISSN 1679-6225. doi:10.1590/S1679-62252011000400024.
^ Scott E. Schlarbaum, Frederick Hebard, Pauline C. Spaine, and Joseph C. Kamalay (1997). "Three American Tragedies: Chestnut Blight, Butternut Canker and Dutch Elm Disease". (originally published via: Proceedings: Exotic Pests of Eastern Forests; (1997 April 8–10); Nashville, TN. Tennessee Exotic Pest Plant Council: 45-54.). Southern Research Station, Forest Service, United States Department of Agriculture. Retrieved June 22, 2012.
^ Rodger, Vikki; Stinson, Kristin; Finzi, Adrian (2008). "Ready or Not, Garlic Mustard Is Moving In: Alliaria petiolata as a Member of Eastern North American Forests". BioScience 58: 5.
^ Eiswerth, M.E.; Darden, Tim D.; Johnson, Wayne S.; Agapoff, Jeanmarie; Harris, Thomas R. (2005). "Input-output modeling, outdoor recreation, and the economic impacts of weeds". Weed Science 53: 130–137. doi:10.1614/WS-04-022R.
^ Lanciotti, R. S.; Roehrig, J. T.; Deubel, V.; Smith, J.; Parker, M.; Steele, K.; Crise, B.; Volpe, K. E. et al. (1999). "Origin of the West Nile virus responsible for an outbreak of encephalitis in the northeastern United States". Science 286 (5448): 2333–2337. PMID 10600742. doi:10.1126/science.286.5448.2333.
^ Hallegraeff, G.M. (1998). "Transport of toxic dinoflagellates via ships' ballast water: Bioeconomic risk assessment and efficacy of possible ballast water management strategies". Marine Ecology Progress Series 168: 297–309. doi:10.3354/meps168297.
^ a b Odendaal, L. J.; Haupt, T. M.; Griffiths, C. L. (2008). "The alien invasive land snail Theba pisana in the West Coast National Park: Is there cause for concern?".". Koedoe - African Protected Area Conservation and Science 50 (1): 93–98. doi:10.4102/koedoe.v50i1.153.
^ Mooney, HA; Cleland, EE (2001). "The evolutionary impact of invasive species". Proceedings of the National Academy of Sciences of the United States of America (date=) 98 (10): 5446–51. PMC 33232. PMID 11344292. doi:10.1073/pnas.091093398.
^ "Glossary: definitions from the following publication: Aubry, C., R. Shoal and V. Erickson. 2005. Grass cultivars: their origins, development, and use on national forests and grasslands in the Pacific Northwest. USDA Forest Service. 44 pages, plus appendices.; Native Seed Network (NSN), Institute for Applied Ecology, 563 SW Jefferson Ave, Corvallis, OR 97333, USA". Nativeseednetwork.org. Retrieved 2011-05-17.
^ a b c d Lowry, E; Rollinson, EJ; Laybourn, AJ; Scott, TE; Aiello-Lammens, ME; Gray, SM; Mickley, J; Gurevitch, J (2012). "Biological invasions: A field synopsis, systematic review, and database of the literature". Ecology and evolution 3 (1): 182–96. PMC 3568853. PMID 23404636. doi:10.1002/ece3.431.
^ Colautti, Robert I.; Hugh J. MacIsaac (2004). "A neutral terminology to define 'invasive' species" (PDF). Diversity and Distributions 10 (2): 135–141. doi:10.1111/j.1366-9516.2004.00061.x. Retrieved 2007-09-01.
Burdick, Alan (2006) . Out of Eden: An Odyssey of Ecological Invasion. Farrar Straus and Giroux. p. 336. ISBN 0-374-53043-2.
Davis, Mark A. (2009). Invasion Biology. Oxford University Press. p. 243. ISBN 0-19-921876-5.
Terrill, Ceiridwen (2007). Unnatural Landscapes: Tracking Invasive Species. University of Arizona Press. p. 240. ISBN 0-8165-2523-4.
Schierenbeck, Kristina A.; Lee, Carol Eunmi; Holt, Robert D. (February 26, 2010). "EDITORIAL: Synthesizing ecology and evolution for the study of invasive species". Evolutionary Applications (John Wiley & Sons) 3 (2): 96. ISSN 1752-4571. OCLC 769072511. doi:10.1111/j.1752-4571.2010.00123.x. Archived from the original on March 30, 2014. Retrieved March 30, 2014.
|
0.999996 |
Wireless Sensor Networks (WSNs) have garnered significant attention in recent years. They consist in a set of spatially distributed autonomous devices, usually battery-powered and designed to operate for a long period of time. Consequently, minimizing the energy consumption is a very important design consideration and very energy-efficient wireless transmission schemes together with ultra low- power platforms and very light software must be combined for data processing and transfer over the WSN.
The radio in both transmit and receive modes consumes the bulk of the total power consumption of WSN systems. Therefore, protocol optimization is one of the main sources of significant energy reduction to be able to achieve self-powered autonomous systems. Reducing power due to radio communications can be achieved by two complementary main objectives: (i) minimizing the output transmit power while maintaining sufficient wireless link quality and (ii) minimizing useless wake-up and channel hearing while still being reactive.
As the physical layer affects all higher layers in the protocol stack, it plays an important role in the energy-constrained design of WSNs. The question to answer can be summarized as: how much signal processing can be added to decrease the transmission energy (i.e. the output power level at the antenna) such that the global energy consumption be decreased? The temporal and spatial diversity of relay and multiple antenna techniques are very attractive due to their simplicity and their performance for wireless transmission over fading channels. Cooperative MIMO (multiple-input and multiple-output) techniques have been studied a lot and have shown their efficiency in terms of energy consumption. Our research aims at finding new energy-efficient cooperative protocols associating distributed MIMO with opportunistic and/or multiple relays and considering wireless channel impairments such as transmitters desynchronisation.
Another way to reduce the energy consumption consists in decreasing the radio activity, controlled by the medium access (MAC) layer protocols. In this regard, low duty-cycle protocols, such as preamble- sampling MAC protocols, are very efficient because they improve the lifetime of the network by reducing the unnecessary energy waste. As the network parameters (data rate, topology, etc.) can vary, we propose new adaptive MAC protocols to avoid overhearing and idle listening.
Energy modeling is an important issue for designing and dimensioning low power WSNs. To help developers to optimize the energy burned by WSN nodes, a pragmatic and precise hybrid energy model has been proposed. This model is a combination of analytical derivations and real time measurements and considers different scenarios that occur during the communication. It is particularly useful to understand the MAC layer mechanisms, such as wake up or data collisions for the preamble sampling category, and the energy wasted by collisions can be evaluated. An adaptive wake-up-interval scheme for preamble sampling MAC protocols for variable traffic in WSN is then proposed. The wake-up-interval is updated based on the traffic status register (whose contents depend on the presence of messages for a particular node). The results show that the sensor node adapts and converges its wake-up-interval to the best trade-off value for fixed and variable traffic patterns. A wireless body area sensor network (WBASN) exhibits wide range of traffic variations based on different physiological data emanating from monitored patients. In this context, we proposed a novel energy efficient traffic-aware dynamic (TAD) MAC protocol for WBASN. A comparison with other energy efficient protocols for three different widely used radio chips i.e. cc2420, cc1000 and amis52100 was performed, showing that TAD-MAC outperforms all the other protocols under fixed and variable traffic rates.
We have proposed and developed PowWow (Power Optimized Hardware and Software FrameWork for Wireless Motes), a hardware and software platform designed to handle sensor networks and related applications. The main innovating features of the platform are: an energy-efficient MAC protocol (15x less power than the ZigBee standard was reported for equivalent applications), a much more light memory usage, a low-power FPGA for acceleration of part of the software stack (energy reduction of two orders of magnitude was reported for error control and correction) and, more recently, a board including small-scale energy harvesting features. Our work take benefit from PowWow to perform power measurements that can be directly introduced in energy consumption models, leading to very precise predictions for the class of preamble sampling MAC protocols. We strongly rely on this platform for the prototyping of future research in this domain.
|
0.98286 |
This article will cover a simple implementation of the Diffie–Hellman Key Exchange(D-H) method using Python as a way to explain the simplicity and elegance of the method. The basic implementation of the D-H method is actually quite simple, as the below code shows. The D-H method allows two people to agree on a shared secret number (a symmetric key) over a communications medium that is not secure. The benefit of a symmetric key verses a public key is that a symmetric key can encrypt and decrypt much faster, and is easier to implement.
Important note: Never try to create your own encryption system for use on production software. An excellent breakdown of this can be found in Bruce Schneier’s article: Cryptography: The Importance of Not Being Different.
The basic purpose of the Diffie-Hellman (D-H) method is for two parties (Alice and Bob) to agree on a shared secret (the symetric key) over an insecure medium where an attacker (Eve) is listening (these names are all common cryptography placeholder names, used to help clarify discussions of cryptography by using common names for various actors in a cryptographic exchange. A listing of these actors can be found here). A good explination of the D-H method can be found on Wikipedia.
Line 3: This code ensures that the print function works the same in Python 2.x and 3.x.
Line 6 & 7: First Alice and Bob agree on a Prime number: P, and a Base: G. These numbers are not secret, and can be known by Eve.
P must be a prime number, and G is a Primitive root modulo.
Line 9 & 10: Alice and Bob then each randomly select their own private integer that they keep secret (even from each other), a and b.
Line 18: Alice calculates A = g^a mod p. Alice sends A to Bob over the insecure channel (Eve can see this number).
Line 22: Bob calculates B = g^b mod p. Bob sends B to Eve over the insecure channel.
Line 28: Alice computes the shared secret, s = B^a mod p.
Line 32: Bob computes the shared secret, s = A^b mod p.
Now Alice and Bob have a shared secret key, s, that Eve does not know, even though Eve knows p, b, A, and B.
Applied Cryptography: Protocols, Algorithms, and Source Code in C : If you have any interest in cryptography, this book is incredible. The author is Bruce Schneier, well known in the cryptography and computer security field. The book covers the theory of cryptography, as well as how to properly add cryptography to your project. This is one of the best technical books I have ever read. It is a well written, authoritative, and comprehensive books on Cryptography.
Take a look at the Python bindings for OpenSSL: pyOpenSSL.
See how Diffie-Hellman is used in Perfect Forward Secrecy.
The OpenSSL Cookbook is a free eBook on OpenSSL. This is a good read.
An easy to understand article on the theory Forward Security: SSL Labs: Deploying Forward Secrecy, mentioning SSL and Diffie-Hellman.
A good article on implementing Forward Security: Configuring Apache, Nginx, and OpenSSL for Forward Secrecy.
Mozilla’s configuration guide for server-side TLS: Security/Server Side TLS. This is a fairly dense article, but is excellent and worth looking over.
Efficient methods for calculating prime numbers in Python from O’Reily: Recipe 18.10: Computing Prime Numbers.
|
0.977053 |
Can I download the videos from YouTube?
Please use the free web service, KeepVid, to download the full-quality YouTube video. To do so, click the link and post the game URL into the line and click "Download". Allow the pop-up applet to run, and when the links show up, please click "Download MP4" 720p or 1080p, whichever highest quality is available. This will begin downloading the full-quality full game.
|
0.999944 |
I walked in exceptic after reading the Google reviews. My experience was that the food portions were acceptable. The price paid wasn't bad. The place is not wow, but it's depends the particular preferences. Maybe around they have something else.
I will recommend to walk in and check the menu. As well, ask the waitress and they will recommend you to get accordingly with your preferences.
We went to this place by recommendation and here are the details: We walk in and wait by front desk for 5 to 10 minutes with no one greeting us. I then walk over to the bar and ask the female, she said to sit anywhere. We find a place to sit (Only like 3 tables are occupied. We wait 15 minutes, No waitress, water, or menu. A rowdy group enters, they are waited on immediately and beers serves to them quickly. Still waiting and notice that patrons around us don't look to happy. Table next to us gets food brought out to them and sent it back to kitchen. Th woman who sent food back told us she had been waiting over an hour for her order, and when it finally was served, her chicken was not cooked. We got up and left. Definitely will not spend our money there. I gave it 1 star just to rate it.
Entering the Camuy River Caverns Park a gentleman gave us a flyer of the restaurant, so as we ended our Caverns trip we were starving and decided to give it a try.
The place is huge, very good parking, clean and Puerto Rico themed inside and out.
I think they should have a host outside the main to receive guests ( we thought it was closed).
They took our order pretty fast. Our drinks were on the table fast, too. Sangria was delish! The entries had a very generous amount, looked good and was very savory (it's authentic Puerto Rican food).
We ordered papaya and white local cheese as the dessert and it was way too yummy!
When we got there around 4:30 it was pretty easy but as we stepped out it was packed.
Hubby and I enjoyed the gastronomic experience.
Been to Restaurante El Taino? Share your experiences!
|
0.988906 |
Stop using credit and develop an action plan to get out of debt.
MyFICO, the consumer division of the Fair Isaac Corporation, recommends that you request a free copy of your credit from each of the three major credit bureaus from annualcreditreport.com and use these as a starting point. Review each one for accuracy and use the dispute process each bureau has to correct any errors. Make a list of your credit card accounts, outstanding balances, interest rates and minimum monthly payments, using your credit reports and credit card statements as references.
Self-discipline and a realistic budget are essential for meeting essential expenses while paying off credit card debt. If you need help, the Federal Trade Commission Consumer Information website has a free budgeting worksheet you can use. When creating a budget, keep in mind that while you must make at least the minimum monthly payment on each credit card, paying only the minimum is the slowest and most expensive way to reach your goals. Review the payment information chart that credit card companies must include with each bill to see how many years it will take to pay each bill, and how much you will actually pay in interest by only making minimum payments.
If you can't pay off all of your credit card debt in a single payment without taking out a new loan, the American Institute of CPAs recommends debt targeting as the next best option. With debt targeting, you focus on paying off one card at a time. Pay as much as you can to the account with the highest interest rate and send minimum payments to the other accounts. Although this is the best way to minimize interest expenses, paying off credit cards according to their outstanding balance with the smallest balance first is another option.
Credit card companies often point out the advantages of opening a new account and transferring outstanding balances to the new card. Many offer "teasers" like an interest-free introductory period. If you can pay the entire balance within this time, balance transfers can reduce interest expenses. If you decide on this option, do not use or close the accounts from which you transferred balances, as these actions may lower your credit score.
|
0.99963 |
Ocean is known as the cradle of life. Being a maritime power, China has a continental shoreline as long as 18,000 kilometers, with a rich maritime biodiversity, and various marine ecosystems such as coastal wetlands, islands, gulfs and estuaries. The following issues need to be addressed.
First, China faces multiple challenges in maritime ecological management. 1. The development of marine industry remains to be strengthened with a green concept and maritime ecological protection is in dire need of binding regulations. Currently, the maritime economy has contributed nearly one tenth to China’s total GDP and serve as a major pillar to shore up national economy. However, its development approach is still extensive and the administration of maritime sector by law remains to be strengthened. 2. Due to the segmented system for maritime and continental management, the coordination mechanism for law enforcement between departments of environmental protection, public security, legislation, supervision and inspection is incomplete, thus making maritime environmental protection departments have their eyes only on consequences, while neglecting the reasons leading to pollution. 3. The capability for maritime ecological management remains to be improved.
Second, we need to improve the maritime ecological management in a multi-pronged approach. 1. Maritime legislation needs to be fleshed out to improve the marine ecological management system. 2. It is necessary to establish an accountability system based on maritime ecological and environmental protection targets and a cross-regional coordinated maritime and continental mechanism. 3. China needs to accelerate the green transformation of maritime economy, promote ecological breeding, develop clean ocean energy, and combine the exploitation and protection of maritime resources with continental economic development. 4. Maritime ecological recovery should be effectively advanced, and maritime ecological and maritime environmental monitoring should be reinforced. 5. We need to bring into full play the role of science and technology, talents as well as capital, build up people’s maritime awareness, and participate in global maritime governance. China needs to strengthen basic maritime research and enhance frontier maritime technology, and make breakthroughs in deep-water, green and safe maritime hi-tech fields.
|
0.956338 |
U.S. Route 201 (US 201) is part of the nationwide system of United States Numbered Highways. It runs for 157.46 miles (253.41 km) entirely within the state of Maine and is a spur route of U.S. Route 1. Its southern terminus is in Brunswick at US 1 and Maine State Route 24 Business. Its northern terminus is at the Canada–US border near Jackman (a terminus it shares with Maine State Route 6), where it connects to Quebec Route 173.
U.S. Route 201 in Jackman, Maine.
North of The Forks, US 201 climbs in elevation over Johnson Mountain and around Coburn Mountain near Upper Enchanted and Parlin Pond Townships. Before reaching Jackman, the road peaks at the Attean Pond Lookout, a popular rest area, before descending into town. US 201 intersects the northern end of SR 15 in Jackman and is cosigned with SR 6 for the remaining 16.4 miles (26.4 km) north to the Canadian border. The road continues through parts of Moose River and Dennistown before reaching the Armstrong-Jackman Border Crossing at Sandy Bay Township. US 201 and SR 6 ends as the highway crosses into Quebec, Canada and becomes Route 173.
US 201 used to be New England Interstate Route 20 (NEI 20) in the 1920s. The original 1922 plan had NEI 20 starting in Portland. The southern half was later shifted east to start in Brunswick (the realignment may have been done prior to actual signing of the route.) The southern end of the original NEI 20 is now SR 100 from Portland to Augusta.[ citation needed] The Brunswick end of the original NEI 20 intersected with NEI 1 (which is now US 1), which remained the southern terminus of US 201 until the construction of the US 1 freeway, at which point its terminus was moved to its current location on SR 24.
Since its designation in 1926, US 201 has only undergone one major realignment. The original highway used to run through Norridgewock, Anson, and Madison on its way to Solon. In 1954, US 201 was moved to a new eastern alignment which completely bypasses this area and the existing alignment was redesignated US 201A. US 201 has also undergone various other minor route adjustments, but largely maintains its original 1926 routing.
SR 137 Bus. – China Southern end of concurrency with SR 137 Bus.
SR 137 Bus. (Spring Street) to I‑95 – Oakland Northern end of concurrency with SR 137 Bus.
U.S. Route 201 Alternate (US 201A) is the designation of a former alignment of US 201 in the towns of Skowhegan, Norridgewock, Madison and Anson. The route is 26.18 miles (42.13 km) long and forms a western loop of US 201, which was rerouted in 1954 to bypass to the east. US 201A runs along the Kennebec River over its entire length.
The southern terminus of US 201A is at US 2, US 201 and State Route 104 in Skowhegan. The northern terminus is at US 201 in Anson, a terminus it shares with State Route 8.
US 201A is also part of the Arnold Highway (named for Benedict Arnold), established in 1931 over the original US 201.
US 201A is completely overlapped with other routes due to various realignments of the routes signed over it.
US 201A begins in Skowhegan just south of the Kennebec River, at an intersection with US 2, US 201, and SR 104 (which has its northern terminus here). US 201A begins overlapped with US 2 and the two routes proceed southwest along the southern bank of the river on the way to Norridgewock. Upon reaching town, the highway intersects with SR 8 and SR 139. SR 139 has its western terminus at this intersection while SR 8 northbound joins the concurrency. Just to the west, US 2 splits off to the southwest, while US 201A goes to the northwest with SR 8 in tow. US 201A and SR 8 are cosigned for the remainder of their lengths.
US 201A and SR 8 continue along the riverbank, turning north into Madison and intersecting with SR 43 and SR 148. US 201A and SR 8 then turn west, joining the converging routes to cross the river as a four-route concurrency. On the west side of the bridge lies the town of Anson, where US 201A and SR 8 split to the north off SR 43 and SR 148, which continue west concurrently. The highway turns north along the west bank of the river into the village of North Anson, intersecting the eastern end of SR 234 before meeting SR 16 just to the north. SR 16 joins US 201A and SR 8, proceeding north along the river out of town, and eventually passing into Solon. Nearing the riverbank once more, SR 16 splits to continue north along the river, while US 201A and SR 8 turn northeast to cross the river. Both routes terminate at US 201.
^ a b U.S. Numbered Highways – 1989 Edition (current). AASHTO. Retrieved 13 July 2012.
^ Scenic Byway. visitmaine.com. Retrieved 13 July 2012.
^ Maine Scenic Drives: Old Canada Road Scenic Byway. HowStuffWorks. Retrieved 14 July 2012.
^ Gibson, John (1998). Maine's Most Scenic Roads: 25 Routes Off the Beaten Path. Camden, Maine: Down East Books. pp. 123–130.
^ Old Canada Road Scenic Byway (Route 201). exploremaine.org. Retrieved 13 July 2012.
^ Old Canada Road Scenic Byway – Official Designations. byways.org. Retrieved 13 July 2012.
^ a b c d "MaineDOT Public Map Viewer". Maine Department of Transportation. Retrieved April 10, 2017.
|
0.999965 |
What defines a golden age? Conventional wisdom echoes that a golden age is when the quality of the product being produced is at its highest level possible; When every new innovation or release is equal to or superior to the standards of excellence that have already been achieved. It is nearly impossible to determine when you are experiencing a golden age until many years after is has passed ' rarely can you identify a golden age while it is taking place. And there are some well-noted golden ages: the golden age of television, radio and movies being the most identifiable; all arts that are based upon creativity and public distraction.
When it comes to electronics, anyone can surmise that the quality that is being released is far superior to anything that has ever been created before. High-definition televisions are becoming even higher defined. Video game systems, such as the Playstation or the Xbox 360 are taking the gaming diversion from pastime to exhilaration. The broadcasting of music is now done with the giant powers of satellites or the tiny circuits of the iPod. Everything being released is better, faster and more fantastic than everything released before it? Technically, by the earlier stated definition, we should be in a golden age of electronics?
The only flaw with that argument is that if we are in a golden period of electronic and technical innovation, then we should enter a period of decline and mediocrity at some point. It's hard to envision new electronic items becoming worse in quality as time progresses. Unlike say, film and cinema, where there is no way that a film like Speed can be compared to Citizen Kane ' the drop off in quality is simply too great. But, the difference between an iPod Mini and an iPod Nano is negligible at its most visible.
And since technology is always on an upward trend, can it then be debated that since the introduction of the last industrial revolution in the late 1800s, we have constantly been in a period of electronic excellence? Technological advancements have just been that ' advancing. It's rare that a new and important electronic release stepped backwards rather than forward: the Xbox 360 is much better than the original Nintendo. A DVD player is exponentially better than a Betamax.
If one had to pinpoint a time period where electronic and technical advancements were being produced and released at such an impressive rate, it could be argued the periods between 1919-1945. The monster of war required a great many food sources, and in order to get the upper hand, technological edges needed to be found at any and all costs. Necessity is deemed to be the mother of invention, and the requirement to survive, win and defend a way of life resulted in some of the most impressive electronic creations in an incredibly short period of time.
Back to the original question at hand, which is are we in a golden age of electronics? It would appear that we are, because the ability for electronics to connect the world has never been greater. If that is the case, then what exactly is the next goal for technical innovations? Video games and iPods and camcorders can be improved in design, but what about function? Is a digital camcorder destined to only become the feeding tube for YouTube, or can it do more?
Perhaps the question about the golden age of technology will never be answered, and maybe that's a good thing. It would be unwise to declare that we have reached the pinnacle of invention and that everything else from here on in will be a disappointment. And while we may not be able to define the era we are in, that does not prohibit us from enjoying the benefits and innovations of it.
|
0.935055 |
Braziw was ruwed by a series of monarchs in de period 1815–1889; first as a kingdom united wif Portugaw in de United Kingdom of Portugaw, Braziw and de Awgarves (1815–1822), subseqwentwy as a sovereign and independent state, de Empire of Braziw (1822–1889). Aww four of de country's monarchs were members of de House of Braganza.
Before 1815, Braziw was a cowony of de Kingdom of Portugaw. Thus, from de formaw arrivaw of de Portuguese in 1500, when de wand was cwaimed by de Portuguese Crown, untiw 1815 when de Kingdom of Braziw was created and de cowoniaw bond was formawwy terminated and repwaced by a powiticaw union wif Portugaw, de Kings of Portugaw were monarchs over Braziw.
During de cowoniaw era, from 1645 onwards, de heir apparent of de Portuguese Crown was stywed Prince of Braziw. In 1817, in de wake of de creation of de United Kingdom of Portugaw, Braziw and de Awgarves, de heir apparent's titwe was changed to Prince Royaw.
Braziw had two monarchs during de United Kingdom epoch: Queen Maria I (1815–1816) and King John VI (1816–1822). By de time of de creation of de United Kingdom of Portugaw, Braziw and de Awgarves, Queen Maria I was wong incapacitated, and de Portuguese Empire was ruwed by Prince John, de future King John VI, as Prince Regent.
As an independent nation-state, Braziw had two monarchs: Emperors Pedro I (1822–1831) and Pedro II (1831–1889). In 1889, de monarchy was abowished in a miwitary coup d'état dat procwaimed Braziw a repubwic.
During de imperiaw era, King John VI of Portugaw briefwy hewd de honorific stywe of Emperor of Braziw under de 1825 Treaty of Rio de Janeiro, by which Portugaw recognized de independence of Braziw. The stywe of emperor was a wife titwe, and became extinct upon de howder's demise. John VI hewd de imperiaw titwe for a few monds onwy, from de ratification of de Treaty in November 1825 untiw his deaf in March 1826. During dose monds, however, as John's imperiaw titwe was purewy honorific, Emperor Pedro I remained de sowe monarch of de empire.
Accwamation of King John VI of de United Kingdom of Portugaw, Braziw and de Awgarves in Rio de Janeiro, 1818.
Members of de House of Braganza had awready ruwed Braziw as part of de Kingdom of Portugaw since de restoration of de independence of Portugaw in 1640. Previous Portuguese monarchs of oder royaw houses awso ruwed de Cowony of Braziw from Lisbon since 1500. Thus de monarchicaw titwe to Braziw was created onwy in 1815 when de cowony was ewevated to de status of Kingdom eqwaw and united wif Portugaw, after seven years of de Portuguese court's stay in Rio de Janeiro. The Kingdom of Braziw was a country inside de United Kingdom of Portugaw, Braziw and Awgarves in dynastic union under de Portuguese crown, uh-hah-hah-hah. However, dere was never exactwy a titwe of King of Braziw, but King of de United Kingdom of Portugaw, Braziw and Awgarves. The main difference is dat de previous Portuguese Kings and de Kings of Braziw ruwed de country as an absowute monarchy untiw 1822 in personaw union wif de Kingdom of Portugaw untiw de independence and subseqwent creation of de Empire of Braziw, which was ruwed by de Emperors as a constitutionaw monarchy untiw its deposition in 1889 in a miwitary coup d'état.
The titwe of emperor was created after independence to designate de monarch of Braziw. The choice of emperor, instead of king, was a suggestion of José Bonifácio de Andrada to discredit de royaw titwe of de Portuguese monarchy of de Kings of Braziw, but awso to wive up to de continentaw size of de nationaw territory. Pedro was accwaimed as constitutionaw emperor on 12 October 1822 and crowned on 1 December. His titwe "Perpetuaw Defender of Braziw" was given to him by accwamation when he was Prince Royaw of de United Kingdom of Portugaw, Braziw and de Awgarves and Regent of de Kingdom of Braziw and was water made part of de officiaw regnaw titwe of de Emperors of Braziw.
Coronation of Emperor Pedro II of Braziw in Rio de Janeiro, 1841.
The Braziwian monarchs had an extensive wist of titwes and cwaims dat refwected de geographic expanse and diversity of de wands ruwed by de House of Braganza.
Maria I: Her Most Faidfuw Majesty Maria I, By de Grace of God, Queen of de United Kingdom of Portugaw, Braziw, and de Awgarves, of eider side of de sea in Africa, Lady of Guinea and of Conqwest, Navigation and Commerce of Ediopia, Arabia, Persia and India, etc.
João VI: His Most Faidfuw Majesty João VI, By de Grace of God, King of de United Kingdom of Portugaw, Braziw, and de Awgarves, of eider side of de sea in Africa, Lord of Guinea and of Conqwest, Navigation and Commerce of Ediopia, Arabia, Persia and India, etc.
Pedro I: His Imperiaw Majesty Pedro I, By de Grace of God and Unanimous Accwamation of de Peopwes, Constitutionaw Emperor and Perpetuaw Defender of Braziw.
Pedro II: His Imperiaw Majesty Pedro II, By de Grace of God and Unanimous Accwamation of de Peopwes, Constitutionaw Emperor and Perpetuaw Defender of Braziw.
Since de Procwamation of de Repubwic, de exiwed monarch Pedro II did not consider himsewf eider as pretender or monarch, awdough Pedro II never formawwy abdicated. He continued to be treated as "His Imperiaw Majesty de Emperor". After his deaf in 1891, his daughter and heiress, Isabew, Princess Imperiaw of Braziw, was recognized by de Braziwian monarchists as Empress de jure, whiwe formawwy titwed Head of de Imperiaw Famiwy of Braziw. Since den, de pretender to de titwe of Emperor is cawwed Head of de Imperiaw House of Braziw; The heir apparent to de drone bore de titwe of Prince Imperiaw of Braziw; de heir presumptive, owdest chiwdren of de Prince Imperiaw, is titwed Prince of Grão-Pará; The oder Princes are simpwy Princes of Braziw.
Isabew's successor was her grandson, Prince Pedro Henriqwe of Orwéans-Braganza, since her ewdest son resigned his rights in 1908 and her second son died earwier dan she. Pedro Henriqwe activewy cwaimed de imperiaw drone of Braziw untiw his deaf in 1981. He was succeeded by his ewdest son, Prince Luiz of Orwéans-Braganza, who is currentwy de cwaimant and active. Widout chiwdren, his heir apparent is Bertrand, Prince Imperiaw of Braziw, his broder.
*Awso tituwar Emperor of Braziw.
This page was wast edited on 6 November 2018, at 15:28 (UTC).
|
0.996685 |
Christian Smith, professor of sociology at Notre Dame, wrote in the most recent Books and Culture a review of six books that deal with the new phenomenon of "adultolescence"—that is, the postponement of adulthood into the thirties. I want to relate this phenomenon to the church. But first here is a summary from Smith's article of what it is and how it came about.
"Teenager" and "adolescence" as representing a distinct stage of life were very much 20th-century inventions, brought into being by changes in mass education, child labor laws, urbanization and suburbanization, mass consumerism, and the media. Similarly, a new, distinct, and important stage in life, situated between the teenage years and full-fledged adulthood, has emerged in our culture in recent decades—reshaping the meaning of self, youth, relationships, and life commitments as well as a variety of behaviors and dispositions among the young.
What has emerged from this new situation has been variously labeled "extended adolescence," "youthhood," "adultolescence," "young adulthood," the "twenty-somethings," and "emerging adulthood."
One way of describing this group is to highlight the tendency to delay adulthood or stay in the youth mindset longer than we used to. Smith suggests the following causes for this delay in arriving at mature, responsible adulthood.
First is the growth of higher education. The GI Bill, changes in the American economy, and government subsidizing of community colleges and state universities led in the second half of the last century to a dramatic rise in the number of high school graduates going on to college and university. More recently, many feel pressured—in pursuit of the American dream—to add years of graduate school education on top of their bachelor's degree. As a result, a huge proportion of American youth are no longer stopping school and beginning stable careers at age 18 but are extending their formal schooling well into their twenties. And those who are aiming to join America's professional and knowledge classes—those who most powerfully shape our culture and society—are continuing in graduate and professional school programs often up until their thirties.
A second and related social change crucial to the rise of emerging adulthood is the delay of marriage by American youth over the last decades. Between 1950 and 2000, the median age of first marriage for women rose from 20 to 25 years old. For men during that same time the median age rose from 22 to 27 years old. The sharpest increase for both took place after 1970. Half a century ago, many young people were anxious to get out of high school, marry, settle down, have children, and start a long-term career. But many youth today, especially but not exclusively men, face almost a decade between high school graduation and marriage to spend exploring life's many options in unprecedented freedom.
A third major social transformation contributing to the rise of emerging adulthood as a distinct life phase concerns changes in the American and global economy that undermine stable, lifelong careers and replace them instead with careers of lower security, more frequent job changes, and an ongoing need for new training and education. Most young people today know they need to approach their careers with a variety of skills, maximal flexibility, and readiness to re tool as needed. That itself pushes youth toward extended schooling, delay of marriage, and, arguably, a general psychological orientation of maximizing options and postponing commitments.
Finally, and in part as a response to all of the above, parents of today's youth, aware of the resources often required to succeed, seem increasingly willing to extend financial and other support to their children, well into their twenties and even into their early thirties.
How might the church respond to this phenomenon in our culture? Here are my suggestions.
1. The church will encourage maturity, not the opposite. "Do not be children in your thinking. Be infants in evil, but in your thinking be mature" (1 Corinthians 14:20).
2. The church will press the fact that maturity is not a function of being out of school but is possible to develop while in school.
3. While celebrating the call to life long singleness, the church will not encourage those who don't have the cal to wait till late in their twenties or thirties to marry, even if it means marrying while in school.
4. The church will foster flexibility in life through living by faith and resist the notion that learning to be professionally flexible must happen through a decade of experimentation.
5. The church will help parents prepare their youth for independent financial living by age 22 or sooner, where disabilities do not prevent.
6. The church will provide a stability and steadiness in life for young adults who find a significant identity there.
7. The church will provide inspiring, worldview-forming teaching week in and week out that will deepen the mature mind.
8. The church will provide a web of serious, maturing relationships.
9. The church will be a corporate communion of believers with God in his word and his ordinances that provide a regular experience of universal significance.
10. The church will be a beacon of truth that helps young adults keep their bearings in the uncertainties of cultural fog and riptides.
11. The church will regularly sound the trumpet for young adults that Christ is Lord of their lives and that they are not dependent on mom and dad for ultimate guidance.
12. The church will provide leadership and service roles that call for the responsibility of maturity in the young adults who fill them.
13. The church will continually clarify and encourage a God-centered perspective on college and grad school and career development.
14. The church will lift up the incentives and values of chaste and holy singleness, as well as faithful and holy marriage.
15. The church will relentlessly extol the maturing and strengthening effects of the only infallible life charter for young adults, the Bible.
In these ways, I pray that the Lord Jesus, through his church, will nurture a provocative and compelling cultural alternative among our "emerging adults." This counter-cultural band will have more stability, clearer identity, deeper wisdom, Christ-dependent flexibility, an orientation on the good of others not just themselves, a readiness to bear responsibility and not just demand rights, an expectation that they will suffer without returning evil for evil, an awareness that life is short and after that comes judgment, and a bent to defer gratification till heaven if necessary so as to do maximum good and not forfeit final joy in God.
|
0.997923 |
How Did the Settlements Begin?
"Jewish settlement in the territory of ancient Judea and Samaria (the West Bank) is often presented as merely a modern phenomenon. In fact,Jewish presence in this territory has existed for thousands of years and was recognized as legitimate in the Mandate for Palestine adopted by the League of Nations in 1922, which provided for the establishment of a Jewish state in the Jewish people's ancient homeland.
"'The Administration of Palestine, while ensuring that the rights and position of other sections of the population are not prejudiced, shall facilitate Jewish immigration under suitable conditions and shall encourage, in cooperation with the Jewish Agency referred to in Article 4, close settlement by Jews on the land, including State lands not required for public use.'"
Jews continued to live in the West Bank under the rule of the Ottoman Empire and the British administration that controlled Palestine between 1923 and 1948, when the modern nation of Israel was established.
But with the armistice that ended the first Arab-Israeli war in 1948-49, the West Bank became part of Jordan. During its control of the West Bank, Jordan made the sale of land to Jews a capital offense. So, by the 1967 Arab-Israeli war, in which Israeli forces captured the West Bank, reportedly no Israeli citizens had lived there for nearly two decades [source: Myre and Kaplow].
After the 1967 war, the Israeli government didn't want to appear as if it was colonizing the Arab-majority West Bank [source: Grose]. But a group of would-be Israeli settlers decided to force the issue. In 1968, they drove from Jerusalem to the West Bank city of Hebron, where Jews had been driven away by Arab armies in 1929; checked into a hotel and didn't leave. As the group's leader, Rabbi Moshe Levinger, told an interviewer years later, the objective was to reclaim land that was part of biblical Israel: "Jews are entitled to have it," he said.
Then-Israeli Prime Minister Levi Eshkol wasn't sure what to do about the squatters, since public opinion in Israel was divided. Eventually, the settlers struck a deal with their government, which provided $50 million to help them build the first settlement, Kiryat Arba, in the hills outside Hebron, complete with fences and watchtowers to protect residents. By 2016, it had grown to a community of 7,000 people [source: Englash].
Other settlers followed in droves, and their numbers steadily grew over the next 50 years. Though the Israeli government didn't start the settlement movement, over time it came to support it. The settlers became a political force that elected officials didn't want to challenge. On the few occasions when the government tried to shut down communities, the settlers wouldn't leave their new homes without a struggle. As a result, even moderate and liberal Israeli leaders allowed settlements to expand. Israeli conservatives, such as current Prime Minister Benjamin Netanyahu, have gone further, and become active backers.
|
0.950172 |
Large 19th-century landscape park forming picturesque setting to the Victorian mock Tudor castle occupying area of Glasbury's medieval open fields enclosed in the late 18th century, with remnant areas of ancient semi-natural woodland.
Little ancient settlement evidence has so far been found within the historic landscape character area. In the earlier medieval period the area formed part of the kingdom of Brycheiniog and fell within the extensive ecclesiastical parish of Glasbury. Following the conquest led by Bernard de Neufmarché in the 1080s it formed part of the marcher lordship of Brecon. An English-held manor was established at Glasbury before the late 13th century. At the time of the Act of Union in 1536 the area formed part of the hundred of Painscastle in Radnorshire. In the mid 19th century the area fell within the tithe parish of Glasbury.
The area occupies gently sloping ground, facing south-east, on the north side of the Wye Valley, between a height of 85m to 200m above Ordnance Datum. The soils are predominantly well-drained fine reddish loams which overlie sandstone bedrock (Milford Series). Present-day land-use is mostly pasture with some fodder crops, with areas of semi-natural ancient broad-leaved woodland on steeper slopes, as at The Nursery, including ash, silver birch, and oak.
Settlement within the area is dominated by the service wing and stables of Maesllwch Castle, a Victorian mock castle in castellated Tudor style which replaced a former house demolished in 1729 and which had in turn replaced a late 16th-century house. The Victorian house was requisitioned for use as a Canadian hospital and by the Land Army in the second world war, the west end of the house being demolished when is was derequisitioned in 1951. Associated with the country house are a walled kitchen garden, a formal garden and wooded pleasure grounds, with former orchards and gardener's cottage and a lodge with associated gate piers and screen at the entrance to the eastern drive. Settlement within the area is otherwise largely confined to a number of dispersed stone farm complexes towards the eastern side of the area such as the 18th-century stone farmhouse and outbuildings and stone-walled yard at Maesyronnen, and the large late 18th to early 19th-century farmhouse at Glan-hen-Wye with its associated earlier 19th-century stone coachhouse and stables arranged around yard.
The former 19th-century landscape park surrounding Maesllwch Castle country house, represented by scattered mature parkland oaks and chestnuts with some small conifer plantings, was probably first established in the 1770s, in association with a former house on the site, a ha-ha to the north-west and north-east of the house probably being of 18th-century date. The parkland is now subdivided into large rectangular fields with hedged and post and wire boundaries, part of the outer boundary of the park being defined by drystone walling. A number of older boundaries in the northern part of the area have multi-species hedges, including holly, ash and maple, with occasional boundaries on the higher ground formed of orthostatic walling.
The western and southern sides of the area are bounded by more recent roads. The road to the south is a late 18th-century turnpike and the road to Ffynnon Gynydd Common on the west was resited when the parkland was created during the 19th century. The winding lane up to the common past Maesyronnen on the eastern side of the area is more ancient and runs in a hollow-way up to 1.5m deep. A milestone belonging to the turnpike period of road transport survives near Little Mill Cottages.
Industrial archaeology within the area is represented by a former water corn mill known as Little Mill. This was in operation between the beginning of the 17th century and the end of the 19th century, taking water by means of a weir from the Cilcenni brook, a tributary of the Wye. Maesllwch Castle was provided with its own gas works to light the house in the late 19th century. Traces of the retort and gasometer associated with the production and storage of the coal gas still survive in the woodland to the east of the house.
Maesyronnen Chapel and cottage, on the higher ground towards the eastern side of the area, is important in bieng one of the earliest surviving nonconformist places of worship in Wales. The stone-built chapel, founded in the 1690s, was originally a 16th-century cruck-built farm and barn.
|
0.998489 |
Bloomberg is reporting that Apple is considering overhauling its iOS App Store with features like paid search. According to the article, "Apple Inc. has constructed a secret team to explore changes to the App Store, including a new strategy for charging developers to have their apps more prominently displayed, according to people familiar with the plans." Bloomberg says that about 100 people are involved in the project, which is being led by Apple Vice President Todd Teresi.
The report adds that the team is also looking for other ways to improve browsing in the App Store.
|
0.947268 |
Does paper use contribute to deforestation?
Many people and groups insist that it does because large amounts of trees are cut down to produce paper. Thus some amount of the forest lost every year must be the consequence of paper consumption.
Other people insist that the trees used to produce paper are farmed, planted and cut down for the purpose of producing paper. Thus the net less of forest has nothing to do with paper consumption, as those tree were only planted to produce paper.
Today, Disney adds its significant voice to the growing chorus of companies demonstrating that there's no need to sacrifice endangered forests in Indonesia or elsewhere for the paper we use every day.
Rainforest Action Network began working with Disney in 2010 after lab tests found that its children's books were printed with rainforest fiber from Indonesia.
This shows that some wild forest is still being harvested for paper, and implies that there are other/alternative sources of paper.
|
0.999998 |
Best GPS for Deer Hunting: There is No One Perfect GPS for Deer Hunting Thats right, there is no one perfect GPS for deer hunting. There may be one that you consider perfect for yourself, but probably not everyone has the same needs you do. However, overall there are highly recommended GPS for deer hunting out there, and they are all listed below. These are considered the best GPS for deer hunting. The hunting community has rated these as the most popular GPS for deer hunting. However, choosing a good GPS for hunting depends on what and how you, personally, plan on using your GPS for the hunt.
I can't tell you the one single GPS that has been proven the best for hunting, though I have put together a list of the most qualified and top rated GPS for hunting. So I encourage you to look into each of these GPS and find what exactly it is that you are looking for and choose which GPS is best suited for you. GPS technology is constantly changing so check back often for updates. Features of the Best GPS for Deer Hunting: -Long battery life (between 15-25 hours) -Plenty of memory to hold waypoints (14-25 MB should be good) -Easily portable/light weight (hand held) -I hunt at night so a easily readable screen -WAAS capability (allows for accuracy of up to 3 meters) -Water proof/resistant Top Rated GPS for Deer Hunting -Garmin GPSMAP 60CSx -Garmin Etrex Camo -Magellan Explorist 200 -Garmin GPS 60 Long Battery Life for a Handheld GPS One of the best features a handheld GPS can have is a long battery life. Deer hunting is not a short event most go deer hunting for days even.
A long battery life for a GPS can save a lot of frustration while deer hunting. It allows for longer hunting trips to locations you would not be able to go without a GPS with longer battery life. So be sure you add this feature to your list when deciding the best GPS for deer hunting. GPS Needs Plenty of Memory While Deer Hunting It is a common practice to revisit waypoints several times because most deer hunters have spots the like. If you are one to revisit waypoints your GPS will start to run out of memory and no one wants to delete spots that have been good to them in the past for deer hunting. So when shopping for a GPS be sure you save yourself the hassle of having to decide which waypoints are more important and get plenty of memory for your deer hunting GPS. Deer Hunting GPS Should be Light Weight and Portable No one enjoys walking around the woods deer hunting while carrying a big heavy burden of a GPS. There are some handheld GPS that weigh up to 3.5 pounds. That would be a terror to go hunting with.
Anything over 2 pounds is a little to heavy to be considered in the best GPS for deer hunting category. So try and stay under 2 pounds when shopping for your deer hunting GPS. GPS Should Have WAAS Capability to be Good for Deer Hunting WAAS has been around for awhile and yet many GPS owners still have no idea what it is. WAAS capability basically allows for a GPS unit's accuracy to be within 3 meters. When hunting you want to know exactly where you are and how far you have to go in case of an accident. So when deciding which GPS is the best for your deer hunting needs be sure to include WAAS capability as a must have feature. When Deer Hunting GPS Need to be Water Resistant/Water Proof As most already know, deer hunting, is an outdoor sport, which means weather applys. When it comes to a $100+ piece of equipment thats primary use is outdoors you don't want a little water to ruin it. So be sure your deer hunting GPS is some what water resistant. Particularly if you are one to go deer hunting in the woods where there are plenty of places to accidentally drop the GPS into standing water.
|
0.962558 |
The greater Ark, also referred to as the Ark or the Beginning Place,[note 1] was a Forerunner megastructure, and the first of the two Arks used to manufacture Halo rings. It produced the original Halo Array, comprised of rings 30,000 kilometers in diameter as opposed to the 10,000 kilometers of the final Array, which was produced by the smaller Installation 00 instead. Like Installation 00, the greater Ark was located outside the Milky Way galaxy, one-third of the way around the outer boundaries of the galaxy.
The greater Ark possessed a sizable defensive fleet led by the Contender-class metarch Offensive Bias. By the end of the Forerunner-Flood war, all remaining Forerunner fleets were assimilated into this fleet. After the greater Ark's destruction, Offensive Bias managed to save several thousand warships—only a fraction of its original fleet—and use them to successfully fend off Mendicant Bias in the Battle of the Maginot Sphere.
A Halo ring above the greater Ark.
The greater Ark was commissioned by Master Builder Faber shortly following the end of the human-Forerunner wars in 106,445 BCE, and constructed soon after with the Old Council's approval. Twelve 30,000 kilometer-wide Halos were produced by its Foundry. Over the following millennia, the Builders continued to refine the design of the Halos and soon discovered a number of flaws with the original rings - most notably, their enormous size which made them unwieldy to transport. These plans led to the commissioning of a smaller array of Halos as well as a new Ark to produce them, as the greater Ark was incapable of building smaller installations. However, the construction of the second Ark was delayed by the Council for several thousand years, until the Master Builder gained complete control over it circa 98,445 BCE.
While the greater Ark stopped producing Halos after the original twelve, the installation remained as the most significant repository of the Conservation Measure, the Lifeworker's effort to index and preserve as many sentient species as possible in the event of Halo activation. As a part of the Librarian's pact with the Master Builder, the greater Ark - like its successor - had been constructed to possess a surface capable of supporting various biospheres to house the Lifeworkers' specimens. While the greater Ark served as the primary facility of this enormous undertaking, the lesser Ark remained secret to all but a few in order to ensure it would not fall in the hands of the Flood. At some point in time, the Forerunners placed a holographic projector capable of displaying a Halo from the greater Ark in a repository on Janjur Qom along with a Luminary.
Around 97,445 BCE, strategic command of the ecumene was placed at the greater Ark, as the Capital system was almost completely conquered by the Flood. The greater Ark served as the final refuge for most of the surviving Forerunner population, while the Lifeworkers' specimens formerly stored there were relocated on the nearby Omega Halo, the last surviving ring of the original twelve-strong array (excluding the repurposed Installation 07). The specimens included the Librarian's largest population of humans, which would later be destroyed when the Ur-Didact harvested their essences with the Composer. Shortly after this, the Flood attacked the greater Ark and destroyed it, leaving the lesser Ark and its new Array of rings as the Forerunners' last resort. The destruction of the greater Ark also led to the death of the majority of the remaining Forerunners, with only a handful escaping to the lesser Ark to carry out their final mission.
French L'Arche in the Forerunner Saga.
La grande Arche in Halo: Primordium and Halo: Silentium.
↑ 1.0 1.1 1.2 Though the Ark featured in Halo: Cryptum is never identified as the greater Ark and is only referred to as "the Ark" or the "Beginning Place", its description differs considerably from that of Installation 00. Halo: Silentium further clarifies that the Librarian used the greater Ark as her base of operations before its destruction; because of its use as the Lifeshaper's main base, (combined with the secrecy of Installation 00), the greater Ark was almost universally referred to as "the Ark". As such, it is assumed the Ark described in Cryptum is the greater Ark.
However, this also raises an apparent discrepancy regarding the lesser Ark and its secret array of six Halos. Halo: Cryptum describes a separate array of six Halo rings stationed over what is assumed to be the greater Ark for the aforementioned reasons. However, Halo: Silentium clarifies that the newer array of six Halos was manufactured by, and hidden at, the lesser Ark. This makes the rings' apparent presence at the greater Ark a contradiction, since there are no evident reasons for the six rings (the Forerunners' carefully-guarded last resort) being temporarily transported to the greater Ark.
|
0.999972 |
Who is James R Kirk?
Most people are familiar with the iconic James T. (Tiberius) Kirk from Star Trek. But in the original series episode "Where No Man Has Gone Before" a tomb stone is created for Kirk that shows his name as James R. Kirk.
Who was James R. Kirk and when did his name change?
According to D.C. Fontana in the introduction for Star Trek: The Classic Episodes 1, when the mistake over the middle initial was discovered, Gene Roddenberry decided that if pressed for an answer on the discrepancy, the response was to be "Gary Mitchell had godlike powers, but at base he was Human. He made a mistake."
Found in the article on Where No Man Has Gone Before and in the section on "Sets and Props".
Then the in universe explanation is that Gary Mitchell forget and the out of universe explanation is essentially Word of God, with the producers saying it's a mistake.
James R Kirk is in fact James T Kirk. The out of universe explanation is that in that episode, there was a production goof. The in universe explanation is that the man who created that tombstone, Gary Mitchell, must have misremembered Kirk's middle initial. Everywhere else in The Original Series, he's referred to as James T Kirk.
Other answers include that "James R. Kirk" was an in-joke between them (the "My Brother's Keeper" novel series), or that "James R. Kirk" was an alternate-timeline version of "James T. Kirk" (Q-Squared). Peter David had run with the idea that the slightly different uniforms and careers (Physicist Sulu?) of "Where No Man Has Gone Before" represented a parallel universe (called "Track A").
Explanations that the uniforms had changed soon after "Where No Man..." are contradicted by Kirk and Helen Noel's uniforms in flashback during "Dagger of the Mind".
This episode was the second pilot for the series. The first pilot, "The Cage," was rejected by NBC. It was more than a year before it actually aired. By then, numerous changes had been made to the characters, storyline, costumes, and appearance of the Enterprise. I have heard that for the Blu-Ray release they actually considered changing the "R." to a "T," but decided against it. This is only one of many plot contradictions, errors, and continuity problems that appeared throughout the series' three year run.
One interesting possible answer to this question can be drawn from a reference in one of the original line of Star Trek novels (which, albeit generally considered non-canon, where often written by people close to the original productions and may give some insight into original plans that were dropped, etc).
In this case, the novel is The Galactic Whirlpool by David Gerrold, which includes a section explaining that "Tiberius" is not part of Kirk's given name, but instead is a nickname that was given to him by one of his Academy instructors and which he later officially adopted in order to remind himself of that instructor's lessons.
If this is accepted as true, then it leaves open the possibility that "R" was the initial of an original middle name that he dropped when adopting the nickname.
As some have already stated, this was just a mistake. If you watch more Star Trek TOS episodes you will find simular strange mistakes. For example in the Episode "Court Martial" which is in the 1st season also, Kirk makes a statement that the ships computer can be boosted to hear noises at 1 to the 4th power. Which of course is still one. In the Movie series Kirk is heard to say "Prayer Mr Saavik, Klingons do not take prisoners", yet they are heard a couple times referring to prisoners they have either taken or want to take. Sorry this went long but I just wanted to show some examples that they made plenty of mistakes making the TV shows and the movies, James R. Kirk just being one of the many. Which always makes for a good discussion.
Back in their Academy days, Gary was Kirk's best friend, but the Barrier energy changed him. Maybe "R" stood for a nickname--perhaps "Ratface" or something cruel like that--given to Kirk by Finnegan! The upperclassman would definitely have pounced on Kirk's unusual middle name "Tiberius"! The altered Gary wanted to get under Kirk's skin and brought up that old painful memory.
If anybody else has got a better explanation...go for it! LOL!
It is possible that Kirk's full name was James Romulus Tiberius Kirk or James Tiberius Ronald Kirk or something and that Kirk preferred to be known as James R. Kirk until "Where No Man Has Gone before" and then switched to using James T. Kirk because he didn't want to be reminded of the tombstone created by his best friend.
read on another forum that the R stands for Roddenberry, the guy claims his parents were involved in script writing and he owns some original notes from the time, apparently the Tiberius name was first coined in the animated series and is the only thing from this taken as canon.
Not the answer you're looking for? Browse other questions tagged star-trek or ask your own question.
James T. Kirk: Why “Tiberius”?
When Did Vulcans Change from No Emotions to Buried Emotions?
In Star Trek (2009), Did the Original Timeline Survive?
Who was more of a Casanova , Kirk or Riker (based on count of bedmates)?
Why did they not call it “Wagon Train to the Stars”?
Is there any reference to intergalactic relations in Star Trek’s future?
What consequences were there for Kirk in the TOS episode “A Private Little War”?
Were The Original Star Trek Sound Effects Used Before Star Trek?
What is James T. Kirk's ethnic background?
|
0.99836 |
Replace your Airport Extreme Card!
Some people furrow their brows in trying to imagine what a completely wireless world will look like. Others simply look at paintings of the world before wires. Expedite the exit of wires from world history today with our MacBook Core 2 Duo 802.11n Airport Extreme Card.
Provides wireless 802.11n capability to your laptop. Backwards compatible with 802.11g, however an 802.11n base station is required for improved speed. This card has 3 antenna connections and cannot be installed as an upgrade in Core Duo or Penryn computers.
Not exactly what I had expected.
My girlfriends macbook starting having issues connecting to the wireless router. The airport finally lost it's ability to turn on at all. So I had to replace the airport card.
It all went pretty smoothly until I opened the anti-static bag with the new MacBook Core 2 Duo 802.11 Airport Extreme Card.
Upon opening the anti-static bag with the new airport card in it I noticed something.
The new card had 3 little antenna slots for the antenna cables where as the old one only had 2.
I was baffled as to why there was a 3rd antenna port and how to connect it up with the 2 I had available.
I checked online again to make sure I got the recommended hardware from iFixit's Airport repair page for the proper macbook model, I triple checked the model to make sure I was looking at the right one.
I googled a solution and found a few people having the same problem I had but no one had a solution so I was left with trial and error.
The new MacBook Core 2 Duo 802.11n Airport card had 3 antenna ports and I had 2 antenna to connect to it.
Each port was labeled 0, 1 and 2. So I decided to plug the open macbook into the wall and do some trial and error. I plugged in 0,2 at first and that actually worked for a few minutes until it no longer connected and then refused to turn on.
I connected 1,2 and that failed completly. No connection what-so-ever.
I then connected 0,1 and success! The Macbook booted up, connected to one of our wifi networks, I turned the airport off and back on and connected to another network just fine. I rebooted once more just to be sure and it still worked so I closed it up.
TL;DR For those of you using the new Airport card with 3 antenna ports in an old 2 antenna cable system, the ports you want are 0 and 1.
Tried various external (USB) Wi-Fi upgrades dongles. All worked off and on with various degrees of success. My old PowerBook just wasn't really happy with any of them. So I decided to upgrade the internal Apple Wi-Fi micro card.
The repair went smoothly, referred to the online repair guide pictures a few times, but I have opened and replaced internal components before so nothing really new or difficult about swapping out the micro-card. Took about 15-20 minutes total. Just the time it takes to unscrew and screw the dozen or so tiny case screws.
Just what was recommended in the online repair. The keyboard ribbon is very small and fragile so care must be taken when disconnecting and re-connecting the plug.
The repair went smoothly, referred to the online repair guide picture . . .
The airport card instal was a breeze. The parts arrived Christmas Eve as hoped, and I followed the instructions on Christmas morning to instal the card. I was up and running witihin . . .
After upgrading to OSX Lion, my Airport Card stopped working. After talking to an Apple Genius, he said it would be at least a $500 repair. I'd rather do it myself!
The process was smooth. Only about a 10 minute job. The hardest part was keeping all of the screws organized so I knew where they went during reassembly.
The process was smooth. Only about a 10 minute job. The hardest part was keeping all of the screws organized so I knew where they went d . . .
My 2007 Macbook had the oddest problem with wireless that started one day. I could connect to any wireless network, but I couldn't browse the Internet. At first I thought this was a software problem. After trying different browsers, and then finally a reload of Mac OS, I realized this was a hardware problem.
I printed out and followed the guide. Overall the replacement took me 20 minutes. No real gotchas.
Just make sure you have the proper tools. Fortunately for me I had recently ordered a Mac screwdriver set from iFixit a few months prior. I had used them to replace the hard drive on my Macbook Pro. Having the proper size screwdriver is key.
My 2007 Macbook had the oddest problem with wireless that started one day. I could connect to any wireless network, but I couldn't browse the Internet. At first I thought this was a software problem. After trying different browsers, and then finally a reload of Mac OS, I realized this was a hardware . . .
Tea kills air port card!
Wires are so passé. After drying out my laptop, I found it no longer recognized my card! Using the guide, I opened my computer and removed the water-stained card. Then I ordered the new one!
Just do it! Cheap and easy to do . . .
|
0.94838 |
Who is the workshop addressed to?
The workshop is addressed to anyone that has experience in any sort of dance, especially contemporary dance or any urban style.
What kind of dance experience should the participants have?
I would recommend that people have at least some sort of experience in dance, preferably anintermediate level or some experience in movement or other techniques that engage the body.
Which elements/techniques will participants learn?
• More body awareness, how to isolate body parts without engaging other ones.
experimental influences, acrobatics and martial arts inspiration.
The idea is to start the class with improvisation exercises to warm up while at the same time, bringing us into a full awareness of our own body. We mix it with fixed exercises to understand how our joints work, how to get a healthier body and how to use our body to get more possibilities when it comes to movement and mobility. Followed by simple exercises and small sequences where we will learn tools and elements that later on will help us go through the class. The aim is to build a very high & dynamic energy. We will learn choreographies in which we will apply the elements we passed through during the class, where each one of us will add his own personality and movement quality to express himself individually.
Destinatários: Bailarinos profissionais e estudantes de dança.
As línguas oficiais do workshop serão espanhol e inglês.
|
0.98149 |
You're in the car business, your job is to make cars on-demand. The object-oriented programmer in you says: "no problem, I'll make a blueprint that I can use to make as many cars as I want!".
There's the blueprint for every car you'll make! Next up, your boss comes to you and says there's a new client and he wants an electric car.
So you end up doing this.
"Beautifully solved"—you think. There's of course that redundant normal engine that's created when calling parent::__construct(), but at least you could re-use the wheels!
I think you can see where this is going. The next client wants a car with some fancy wheel covers, another one would like a diesel engine with those same wheel covers, another one requests a race car, and the last one wants a self driving car.
Oh—there also was a client who wanted to buy an engine to build a boat with himself, but you told your boss that wouldn't be possible.
After a while, there's a ton of blueprints in your office, each describing a very specific variation of a car. You started with a neatly ordered pile of blueprints. But after a while you had to group them in different folders and boxes, because it was taking too long to find the blueprint you're looking for.
Object oriented programmers often fall into this trap of inheritance, ending in a completely messed up codebase. So let's look at a better approach. Maybe you've heard about "composition over inheritance" before?
That's a lot of buzzwords. Let's just look at our car example. The principle states that Car should achieve its polymorphic behaviour by being composed of other classes.
The word polymorphic literally means "many shapes" and implies that Car should be able to do drive in many different ways, depending on the context it's used in.
With code reuse, we're trying to make code reusable; so that we don't end up with tens of classes doing almost exectly the same.
# What does this have to do with dependency injection?
Instead of making a unique blueprint that describes every single possible variation of a car, we'd rather have Car do one thing, and do it good: drive.
Given a working engine and four wheels, I'm able to drive!
We could say that in order for Car to work, it needs an engine and wheels. In other words: Car depends on Engine and a collection of Wheels.
Those dependencies should be given to the car. Or, said otherwise: injected.
Would you like a race car? No problem!
That client who wanted special wheel covers? You've got that covered!
You've got a lot more flexibility now!
Dependency injection is the idea of giving a class its requirements from the outside, instead of having that class being responsible for them itself.
Built upon this simple principle, there are frameworks and tools that take it to the next level. You might, for example, have heard about the following things before.
One of the most beneficial side effects of injecting dependencies, is that the outside context can control them. This means that you can give the same instance of a class to several others that have a dependency on that class.
Shared- or reusable dependencies are the ones most often getting the label "dependency injection". Though it's certainly a very good practice, sharing a dependency is not actually the core meaning of dependency injection.
Sometimes it's also called "inversion of control" container, though that's not an accurate name.
Whatever the exact name, the container is a set of class definitions. It's a big box that knows how objects in your application can be constructed with other dependencies. While such a container definitely has a lot of use cases, it's not necessary to do dependency injection.
To give developers even more flexibility, some containers allow for smart, automatically determined, class definitions. This means you don't have to manually describe how every class should be constructed. These containers will scan your code, and determine which dependencies are needed by looking at type hints and doc blocks.
A lot of magic happens here, but auto wiring can be a useful tool for rapid application development.
Instead of injecting dependencies into a class, there are some tools and frameworks that allow a class to ask the container to "give it an instance of another class".
This might seem beneficial at first, because our class doesn't need to know how to construct a certain dependency anymore. However: by allowing a class to ask for dependencies on its own account, we're back to square one.
For service location to work, our class needs to know about the systems on the outside. It doesn't differ a lot from calling new in the class itself. This idea is actually the opposite of what dependency injection tries to achieve. It's a misuse of what the container is meant to do.
As it goes in real-life projects, you'll notice that dependency injection in not always the solution for your problem.
It's important to realise that there's limits to the benefits of everything. You should always be alert that you're not taking this to the extreme, as there are valid cases in which a pragmatic approach is the better solution.
The core idea behind dependency injection is very simple, yet allows for better maintainable, testable and decoupled code to be written.
Because it's such a powerful pattern, it's only natural that lots of tools emerge around it. I believe it's a good thing to first understand the underlying principle, before using the tools built upon it. And I hope this blog post has helped with that.
If there are any thoughts coming to your mind that you want to share, feel free to reach out to me on via Twitter or e-mail.
Also special thanks to /u/ImSuperObjective2 on Reddit and my colleague Sebastian for proof reading this post.
|
0.98267 |
Why might a company use a back door listing?
If a company has a lot of cash or very good credit, but for whatever reason cannot meet the requirements to go public, the company may instead choose to purchase a company that has already had success going public. Back door listings are not the most common kind of merger or acquisition, because if a company has the resources to purchase another public company, it is often able to meet the listing requirements of the exchange. Also, another drawback is because when using a back door listing strategy, the company doing the acquiring must then continue doing business in the name of the public company that they acquired rather than their own name.
Once a private company has successfully purchased a public company, it must then change operations to take place under the name of the newly acquired publicly listed company, as the name is technically the point of the purchase. One of the reasons a company would be willing to give up its name and spend a significant amount of money to obtain a back door listing is that filing costs for a public listing, as well as the regulatory costs, have grown to be high enough that simply buying a public company can be a more economical way for a private firm to begin trading publicly.
The writers at The Bull pride themselves on providing the latest and greatest financial news, and they love sharing it with new readers. Become one today.
|
0.992085 |
Are Christian affirmations scripturally correct, or do they defy biblical principals?
Living in a time exactly where the "law of attraction" and "abundance" mentality is really rising at an alarming price, this question is one particular that may be often asked by Bible teachers and students alike.
In a society that has been blessed with abundance for years, man is still in search of each avenue whereby he might handle to obtain "everything he desires" out of life. There's normally that never-ending search for riches to lavish upon himself to be able to enable him to live a especially desired lifestyle.
Generally this can be driven by greed, or necessity to "fit in", or even just the want for a thing somewhat much better.
In reality, man has determined that he himself, and no other, is in total manage of his life, as well as the only governing force outside his personal self is simply "the universe"! It really is believed that by way of the usage of everyday affirmations, he can "manifest" whatever he desires.
Sadly, a lot of people have forgotten that the scriptures teach us that all of our possessions come from God above, and that we are able to do practically nothing of our own selves.
The truth is, God is in complete control of anything we've, or for that matter, have not. All the things in our lives is either ordered by or permitted by Him.
3John 1:two -"Beloved, I wish above all points that thou mayest prosper and be in wellness, even as thy soul prospereth".
So, prosperity just isn't contradictory to what the scriptures teach, so long as it's not a controlling aspect inside a person's life. And, in searching for that "prosperity", Christian affirmations can play a determining part within the outcome.
However, I think you will find specific avenues a single must adhere to, or "keys to success", that need to be applied along this spiritual journey.
1.- Prayer - Every thing really should start off with prayer, as this can be the incredibly foundation from the Christian life. The cause we by no means look to obtain the issues we need is that we in no way genuinely ask God for them. IF we earnestly need prosperity in our life, we should submit our request to God, and permit him to choose IF our request is worthy. With supplication and thanksgiving we are to let our requests be produced identified unto God.
So, earnest prayer before God may be the first and most important essential to good results.
2. - Faith - Normally as a youngster I'd ask for something, although I KNEW that I wasn't going to acquire it. I believe numerous of us do the same when presenting our petitions to God. We go using a half-hearted approach, and typically doubting, so we never essentially see the fruit of our requests come to pass. If we're to receive something, we need to have faith that what we're asking isn't against God's will nor against what the scriptures teach ought to be element of our character.
Faith is most likely essentially the most determinate aspect when producing our requests to God. We ask for the wrong items, and often for the incorrect causes, and as a result they never come to pass.
Our desires and intentions will have to be pure ahead of God, if we count on to get any of our petitions.
three. - Meditation - Far also generally I see other people who never ever believe regarding the issues they wish in life, until they decide to start asking for them. But if we want to receive the very good issues of the Lord, we must meditate upon these items. Things which might be correct, sincere, just, pure, beautiful, of good report and of virtue and praise are all of God. If these issues we desire are points which will truly add worth to our life plus the lives of other people, we are taught to "think upon them!"
four. - Action - Too typically when we ask for something, we want it "all done" for us. You can find so many factors in our life that are extremely much inside our reach, yet we lack the discipline to just go get them. Often there are points within our reach that we will need not even ask for, because they've already been placed there for our very good, however we never uncover them worthy of our "efforts". Faith without having functions attached is absolutely nothing but dead faith, or just empty wish.
If we're petitioning for something we need, but however are not willing to "put some legs on our prayers", then we can be assured our petitions is not going to be granted. By utilizing Christian affirmations in our each day life, we have a tendency to implant the ideas into our head of our position as well as our blessings which are created freely out there to us in Christ.
|
0.990446 |
Genomic imprinting occurs in both marsupial and eutherian mammals. The CDKN1C and IGF2 genes are both imprinted and syntenic in the mouse and human, but in marsupials only IGF2 is imprinted. This study examines the evolution of features that, in eutherians, regulate CDKN1C imprinting.
Despite the absence of imprinting, CDKN1C protein was present in the tammar wallaby placenta. Genomic analysis of the tammar region confirmed that CDKN1C is syntenic with IGF2. However, there are fewer LTR and DNA elements in the region and in intron 9 of KCNQ1. In addition there are fewer LINEs in the tammar compared with human and mouse. While the CpG island in intron 10 of KCNQ1 and promoter elements could not be detected, the antisense transcript KCNQ1OT1 that regulates CDKN1C imprinting in human and mouse is still expressed.
CDKN1C has a conserved function, likely antagonistic to IGF2, in the mammalian placenta that preceded its acquisition of imprinting. CDKN1C resides in synteny with IGF2, demonstrating that imprinting of the two genes did not occur concurrently to balance maternal and paternal influences on the growth of the placenta. The expression of KCNQ1OT1 in the absence of CDKN1C imprinting suggests that antisense transcription at this locus preceded imprinting of this domain. These findings demonstrate the stepwise accumulation of control mechanisms within imprinted domains and show that CDKN1C imprinting cannot be due to its synteny with IGF2 or with its placental expression in mammals.
Eutherians and marsupials (therian mammals) diverged between 125–145 million years ago [1–3]. Genomic imprinting, in which the monoallelic expression of certain genes depends on the parent of origin, occurs in both therian mammal lineages. This is in contrast to all other vertebrate species including monotreme mammals in which imprinting of endogenous genes has not been demonstrated [4–7]. Monoallelic expression negates the advantage of diploidy, namely the masking of deleterious alleles. The cost of imprinting must, therefore, be outweighed by its potential benefits to the genetic fitness of the individual. The parental conflict hypothesis proposes that imprinting is the product of asymmetric selection on parental genomes, with selection favouring the expression of paternal genes that increase the amount of maternal nutrient transfer while expression from maternally-inherited genes will be favoured if they reduce nutritional demands on the mother [8–10]. The placentas of marsupials and eutherians mediate the transfer of nutrients between mother and young and the placentas of both groups of mammal express imprinted genes [11–16]. However, the marsupial placenta is comparatively short-lived and the majority of support for growth and development of the marsupial young occurs during an extended and complex period of lactation . Thus marsupials are ideal models in which to examine the evolution of imprinting and its association with mammalian placentation.
CDKN1C (expressed from the maternally inherited allele) and IGF2 (expressed from the paternally inherited allele) are syntenic, and implicated in growth disorders such as Beckwith-Wiedemann syndrome . IGF2 is paternally expressed in mouse and human and stimulates cell cycle progression. IGF2 is highly conserved in all vertebrates and is expressed during marsupial placentation, as it in the eutherian placenta . IGF2 is also imprinted in the tammar placenta, indicating imprinting at this locus evolved before the eutherian-marsupial split . In contrast, progression through the cell cycle is negatively controlled by cyclin-dependent kinase (CDK) inhibitors, such as p57KIP2, encoded by the gene CDKN1C [20–22]. CDKN1C is expressed from the maternal allele in many tissues of mouse and human, including the placenta [23, 24], but is bi-alellically expressed (ie, not imprinted) in the tammar wallaby . Placental development is disrupted in mice carrying a maternally-derived mutation in Cdkn1c [18, 25] and mutations in CDKN1C are associated with trophoblastic disease in humans [26, 27]. Unlike IGF2, CDKN1C is rapidly evolving in mammals and has low homology between mouse, human, and tammar, with only the CDK-inhibiting domain conserved [14, 28]. Divergence in the structure of p57KIP2 suggests functional specialisation in different species and may explain species-specific patterns of expression, subtle differences in the pathologies of human and mouse CDKN1C mutants , and the absence of imprinting of this gene in the tammar .
Most imprinted genes aggregate within the genome and in each imprinted domain gene order and imprint status show considerable similarity between mouse and human [30–32]. IGF2 and CDKN1C are syntenic, and reside in an imprinted cluster on mouse distal chromosome 7. Included in this region are the maternally expressed genes Ipl/Tssc3, Slc22a1l/Tssc4, Mash2/Ascl2, and Cdkn1c and the paternally expressed genes Igf2 and Ins2. Gene order and the imprint status of most genes within this region are conserved with human chromosome 11p15.5 . The entire region is regulated by two differentially methylated imprinting control regions (ICRs) one of which is the KCNQ1OT1 antisense-RNA transcript, that regulates the expression of Cdkn1c, Kcnq1, and Ascl2 [31, 32]. Conserved synteny may reflect the co-ordinated transcriptional regulation of several imprinted genes within each domain [34, 35]. The IGF2-CDKN1C region is highly conserved even between human and chicken, despite a lack of imprinting in the chicken . Nevertheless, synteny may facilitate the co-evolution of maternal and paternal imprints in adjacent regions of the genome [35, 37], possibly by the spread of imprinting mechanisms from one locus to another, as described by the bystander hypothesis . INS and IGF2 are syntenous in mouse, human and tammar [15, 39, 40]. Extension of this synteny from IGF2 to CDKN1C has recently been described in marsupials . This is of particular importance given that IGF2 and INS are imprinted in the tammar, as in mouse and human, but CDKN1C is not [14, 15].
Differentially methylated regions (DMRs), often found at CpG islands in or near imprinted genes, clearly contribute to the regulation of imprinted expression in eutherians [34, 41–43]. However, not all imprinted genes depend on this mechanism. Antisense transcripts and various forms of chromatin modification also regulate imprinted expression in eutherians [44–46]. Kcnq1ot1 (LIT1) is a paternally expressed antisense transcript originating from intron 10 of the maternally expressed Kcnq1 (KvLQT1) gene [47, 48]. The human KCNQ1OT1 promoter starts approximately 40 bp upstream of the transcription initiation site and spans 300 to 350 bp , although associated transcription factor binding sites may extend as far as 2000 bp upstream [36, 47]. The transcription initiation site is located in a CpG island that is methylated in oocytes, but not in sperm. Methylation blocks transcription of the maternal allele of Kcnq1ot1 and deletion of either the CpG island or Kcnq1ot1 increases expression of Cdkn1c, Kcnq1, and Ascl2, indicating its role in the coordinated regulation of these loci .
DNA methylation as a regulator of imprinted expression may have evolved from the molecular systems associated with the silencing of transposable elements. The host defence hypothesis suggests that DNA methylation fortuitously provided a mechanism to regulate parental specific gene expression and similar circumstances may have led to the silencing function of antisense transcripts at imprinted loci [50, 51]. Indeed, many imprinted genes are found in association with repeat sequences such as non-LTR elements (long and short interspersed transposable elements – LINEs/SINEs), DNA elements, and endogenous retroviruses [37, 52–54] and are all known to attract methylation .
We determined the expression of CDKN1C and the cellular localisation of its protein, p57KIP2, in the placenta of the tammar wallaby because of their evolutionary divergence from eutherian mammals. We examined whether CDKN1C became imprinted after it acquired a role in placental development, or if its placental expression pre-dated the evolution of its imprinting. In addition, to gain insight into the evolution of imprinting within this cluster, the structure and repeat distribution of the CDKN1C domain, including KCNQ1 and the ICR, KCNQ1OT1, were investigated in the tammar.
While CDKN1C is imprinted in eutherians and vital for placentation, it is not imprinted in the tammar . The chorio-vitelline placenta of the tammar (Macropus eugenii) consists of two functional regions, a vascular and non-vascular one. The vascular, trilaminar placenta is thought to be the primary site of gas exchange, while that of the avascular, bilaminar region, the predominant site for nutritional exchange [55, 56]. We used immunohistochemistry to examine P57KIP2 in both regions of the marsupial placenta. P57KIP2 was localised in the cytoplasm and nucleus of all cell types in the bilaminar and trilaminar yolk sac placenta (Figure 1). However, while the protein was consistently present in many cells of the yolk sac endoderm and trophoblast, staining in the mesenchymal and endothelial cells was sporadic (Figure 1). No notable difference in staining intensity or in the cross-reactivity of different cell types was evident for the stages examined (days 19–26 of the 26.5 day gestation). Weak non-specific cytoplasmic staining was evident in the yolk sac endoderm and, to a lesser extent, the trophoblast in matched goat IgG treated controls (Figure 1), but was clearly distinguishable from the dense staining in both the cytoplasm and nucleus with p57Kip2 Ab-7. There was no cytoplasmic or nuclear staining in no-antibody negative controls (not shown).
Immunohistochemical localisation of p57 KIP2 in the tammar yolk sac. Haematoxylin and eosin stained bilaminar yolk sac (BYS, A.) and trilaminar yolk sac (TYS, B.) showing trophoblast cells (Tr), yolk sac endodermal cells (En), and, in the trilaminar yolk sac only, mesenchymal cells (Me) and vitelline vessels (VV). The trophoblast lies adjacent to the maternal endometrium (Endo). p57KIP2 was found in the cytoplasm and nucleus of most trophoblast and endodermal cells in the bilaminar (C.) and trilaminar (D.) yolk sac placenta. Although mesenchymal cells were also stained, fewer were positive. IgG antibody controls also showed weak cytoplasmic, but not nuclear staining (bilaminar, E; trilaminar, F). Day 25 of gestation stages are shown, but staining did not change notably over the stages examined (Days 19 to 26).
CDKN1C was expressed in the tammar placenta, but immunohistochemistry did not indicate if there were changes in the quantity of protein over time. We used quantitative RT-PCR to examine quantitative changes in the expression of CDKN1C. Between days 19 and 24, CDKN1C expression was higher in the trilaminar yolk sac than in the bilaminar yolk sac placenta (Bonferroni adjusted paired t-test, n ≥ 5, α ≤ 0.039) (Figure 2). However, in the two days before birth (days 25 and 26) there was no longer a significant difference in CDKN1C expression between vascular and avascular regions (Bonferroni adjusted paired t-test, n = 5, α = 0.158), but there was a significant increase in CDKN1C expression in both regions of the placenta (Bonferroni adjusted unpaired t-test, n ≥ 5, α ≤ 0.043).
CDKN1C expression in the bilaminar (BYS-diamonds) and trilaminar (TYS-squares) yolk sac placenta. Stages examined; 19–21 (n = 8), 22–24 (n = 7), and 25–26 (n = 6). CDKN1C mRNA levels were higher in the TYS between days 19 and 24 than the BYS, but most notable was the significant increase in expression, in both regions of the yolk sac, after day 24 (days 25–26). Means sharing the same superscripted letters are not significantly different (P > 0.05). Means with different superscripts are significantly different (P ≤ 0.05).
We examined the region containing IGF2 and CDKN1C in the tammar and compared this to human and mouse. A BLAST-N with tammar CDKN1C sequence identified a single clone of tammar genomic DNA (GenBank: CU041371.1, clone MEKBa-36303). Successive BLAST-N searches identified five more overlapping clones joining the IGF2-contianing clone to the CDKN1C-containing clone [Genbank: CR925759.7, Genbank: CR848708.12, Genbank: CU024874.2, Genbank: CU024865.1, Genbank: CU311200.1] (Figure 3A). Each set of overlapping clones showed 100% identity over at least 1000 bp. The overlapping clones provided almost 1 Mb of continuous sequence spanning the domains bordered by IGF2 and CDKN1C.
Structure of the IGF2 to CDKN1C region. Tammar BAC clones from GenBank (NCBI) were used to derive the tammar sequence (A). A multiple PIP alignment of mouse and tammar sequence against human (B). Conserved regions (red) and regions of homology (green) occur mostly in gene-rich regions (black boxes), but also in the intergenic regions. The KCNQ1OT1 region is highly conserved between mouse and human, but divergent in tammar (indicated by white). IGF2 to CDKN1C in the tammar (C, top), human (C, middle), and mouse (C, bottom). In human and mouse the region includes two imprinted domains regulated the paternally methylated DMR1 and the maternally methylated DMR2 (blue and pink lollipops respectively). Mouse and human regions have been modified from published figures [31, 33, 74, 75]. Gene order is conserved between human, mouse, and tammar. The imprint status of eight of the fourteen genes are conserved between mouse and human (paternally expressed, blue; maternally expressed, pink; biallelic, black). In the tammar, IGF2 and INS are also paternally expressed, while CDKN1C is biallelic. The imprint status of the remaining genes has not been determined (grey). CpG islands and the distribution of repetitive elements are similar between mouse and human and tammar. However, the CpG island associated with DMR2 is absent in the tammar. There are similar numbers of LINE/SINE elements (blue bars) and simple repeats (green) in all species, but fewer DNA elements and LTR elements (pink and purple bars respectively) in the tammar.
Several regions were conserved or homologous between human, mouse, and tammar as indicated by a multi-species percent identity plot (PIP) (Figure 3B). Most of the conserved regions corresponded to genomic locations with a high gene density, such as the gene cluster bordered by ASCL2 and TRPM5. However, the large intergenic region between TH and ASCL2 also had two regions conserved or homologous in all three species (see Genomic Analysis below).
A PIP of the orthologous region of human against the tammar sequence was generated. Regions of high homology to human indicated the location of putative exons in the tammar sequence. The sequence of each possible exon was entered into a BLASTN to confirm gene identity and was aligned back to human sequences to confirm the location of exon-intron boundaries (data not shown). Of the nine genes located between IGF2 and CDKN1C in human, eight were identified in the tammar with KCNQ1OT1 the only gene not found by homology (Figure 3C). Exons homologous to human TSSC5, which lies downstream of CDKN1C, were also identified, but the partial sequence available did not extend to cover the entire gene.
Gene order was highly conserved between human, mouse, and tammar (Figure 3C), as was gene structure. A multi-species PIP of the KCNQ1 gene of human against mouse, tammar, and chicken, shows conserved gene structure in all four species, with regions of homology corresponding to exon locations (Figure 4A). However, while the exon-intron structure of KCNQ1 was generally highly conserved, intron 4 was absent in chicken and intron 9 was significantly reduced in length in the tammar and in chicken (Figure 4B). In mouse and human the KCNQ1OT1 transcript starts in intron 10 and extends into intron 9. Mouse intron 9 and 10 of KCNQ1 had significant homology with human introns 9 and 10, while no homology was evident for the tammar or chicken (Figure 5A).
The KCNQ1 region in human, tammar, mouse and chicken. Exons 1a/b to 15 are shown as vertical lines and intronic distances by horizontal lines. The KCNQ1OT1 transcript (blue line) is transcribed from a promoter within the maternally methylated CpG island (red box with pink lollipops). A multiple PIP alignment of mouse, tammar and chicken against human KCNQ1 (A.). Conserved (red) and homologous regions (green) are common between mouse and human, especially in intron 10 (spanning the majority of KCNQ1OT1). Both tammar and chicken are divergent from human (divergence indicated by white) in this, and other intronic regions, with only exons showing high homology. The exon-intron structure of human and tammar is highly conserved, with the notable exception of intron 9, which is markedly reduced in the tammar (B). Human, mouse and chicken have at least one CpG island in the KCNQ1 region, while tammar has no CpG islands. There is a notable reduction in the number of repetitive elements in chicken compared to the mammalian species. DNA elements (pink), LTR elements (purple), simple repeats (green) and non-LTR (LINE/SINEs, blue). A conserved region of highly repetitive sequence in mouse and human in intron 9 is indicated by a red dashed box.
A multiple PIP alignment of mouse, tammar, and chicken intron 10 against human (A). There are many areas of high conservation (red) and homology (green) between human and mouse, but little with tammar and chicken. The transcription start site (TSS) of KCNQ1OT1 is indicated by a blue arrow. Although the TSS is not highly conserved between mouse and human, the upstream promoter region is, as is the position of the CpG island relative to the TSS (B.). Although mouse and human have a similar numbers and types of repetitive elements, only the L1MB element upstream of the TSS may be conserved. In tammar, as in other regions, there are fewer DNA elements (pink) and LTR elements (purple) compared to human and mouse. Simple repeats (green) and non-LTR (LINE/SINEs, blue) are similar in human, mouse and tammar, but significantly fewer in chicken.
The CpG island in intron 10 of KCNQ1 is essential for imprinted expression of the KCNQ1OT1 transcript in mouse and human. We examined the CpG content of the orthologous region in the tammar. There were 24 CpG islands, grouped into nine clusters, in the sequence spanning IGF2 to CDKN1C in the tammar, while in human there were 51 (in 31 clusters) and in mouse 29 (in 12 clusters, Figure 3C). Six CpG islands in the human sequence were greater than 1000 bp in length with the longest island 2671 bp. In comparison, only one of the islands in the tammar sequence was longer than 1000 bp (1373 bp). However, mouse also had only two CpG islands over 1000 bp (the longest reaching 1025 bp). Although both human and mouse had fewer CpG islands in KCNQ1 compared to the remaining sequence assessed (see IGF2-CDKN1C in Figure 3C), there were no CpG islands in KCNQ1 of the tammar (Figure 4B). Like human and mouse, chicken had a CpG island in KCNQ1 (Figure 4B). Despite differences in the CpG island content of KCNQ1 in the human and tammar, the overall percent GC was similar (50.9% in the tammar and 51.4% in human).
In human, mouse and chicken at least one CpG island was located in intron 10 of KCNQ1 (Figure 5B). In human and mouse the position of the CpG island and the KCNQ1OT1 promoter region were highly conserved (Figure 5A and 5B). Although a CpG island was also present in the chicken intron 10, it is not clear if this is orthologous, as no significant homology to the KCNQ1OT1 transcription start site could be found, and the CpG island was located approximately 20 and 15 Kb downstream of the orthologous CpG islands in human and mouse respectively.
Primers were designed within the tammar KCNQ1 intron 10 to determine if it still encoded a KCNQ1OT1 antisense RNA molecule despite its lack of conservation with human and mouse. Since primers did not span an intron, extracted RNA was DNased and an aliquot removed for PCR to ensure there was no genomic DNA contamination (RT- control). Surprisingly, transcription of the putative KCNQ1O1 gene was detected in the trilaminar, but not the bilaminar placenta and only during the final stages of pregnancy (Figure 6). The resulting PCR band was sequence verified to ensure amplification of the correct product.
Expression analysis of the KCNQ1OT1 . Primers designed from intron 10 of KCNQ1 were used to determine expression of the KCNQ1OT1 anti-sense RNA. Primers yield a single 400 bp band as confirmed by genomic DNA PCR (result not shown). Expression was only detected in the trilaminar portion of the placenta (TYS) and not the bilaminar (BYS) and only in the final stages of pregnancy. RT+ denotes samples that have been reverse transcribed. RT- denotes DNased RNA, also used in the PCR reaction to ensure no DNA carryover. -VE represents the negative control reaction in which template was omitted and M, indicates DNA marker.
Repeat sequences may contribute to the evolution and or regulation of many imprinted regions and so the distribution of repetitive elements in the tammar IGF2-CDKNIC region was assessed. Two regions of high homology were identified in the intergenic DNA between TH and ASCL2 (Figure 3B) and represent areas of high LINE/SINE density in all three species (Figure 3C).
The percent sequence covered by all repetitive elements in the region from IGF2-CDKN1C was not significantly different between species (Figure 7A). When the KCNQ1 region was assessed separately, the percent covered by all repetitive sequences in introns 1, 1b, 9, 10, and 14 (the largest introns) still did not differ significantly between species. However, the percentage of sequenced covered by specific classes of repetitive sequence did differ significantly between species (Figure 7A).
The sequence coverage of repetitive elements in sequences from human, mouse, and tammar. A box plot showing the percent of total sequence masked by SINEs (dark blue), LINEs (light blue), LTR elements (purple), DNA elements (pink), simple repeats (teal), and low complexity regions (pale green) in intron 1, 1b, 9, 10, and 14 of KCNQ1 (A). The percent sequence coverage for each element over the entire region from IGF2-CDKN1C is shown by open circles. There was significantly less sequence masked by LTR and DNA elements in tammar compared to both mouse and human, while there was significantly more sequence occupied by low complexity regions (*). There was significantly less sequence occupied by LINEs in mouse compared to human (**). There was a large range in the sequence covered by LINEs in all species, but particularly in human and mouse. The percent sequence occupied by different types of repetitive elements in the region from IGF2-CDKN1C, in all of KCNQ1, and in introns 9, 10, 1, 1b, and 14 assessed separately (B). The relative percentage of sequence occupied by LINEs is noticeably more than the percentage occupied by LINEs in any other intron from KCNQ1 and this increase was significant for mouse (*). No other significant differences in the relative amounts of sequence covered by different types of elements was seen between regions within species. However, there was also a noticeable increase in the relative amount of simple repeats in intron 9 of tammar compared to other KCNQ1 introns in the tammar.
There were significantly fewer long-terminal repeat (LTR) elements (GLM; α = 0.000) and DNA elements (GLM; α = 0.001) in tammar KCNQ1 introns 1, 1b, 9, 10, and 14 compared to the same introns in mouse and human, while there were significantly more low complexity regions (α = 0.000). However, the lower percentage of sequence covered by LTR and DNA elements in the tammar compared to mouse and human was also evident across the entire region from IGF2 to CDKN1C (Figure 3C, 4B, and 7A). However, the relative proportion of LINE/SINEs and simple repeats was not notably different between species in either KCNQ1 or the entire IGF2-CDKN1C region (Figure 3C and 7A).
In both human and mouse there was high concentration of repetitive elements in intron 9, largely due to an increase in LINEs, which are largely absent in tammar intron 9 (Figure 4B and 7B). This was significantly different in mouse compared to tammar (Grubb's critical = 1.71; n = 5; z value = 1.785), but not with human (Grubb's critical = 1.71; n = 5; z value = 1.646). A decrease in SINEs is associated with imprinted regions . However, there was no significant difference in the percentage of sequence covered by SINEs between tammar and human and mouse.
Despite similarities in the overall proportions of different types of repetitive elements in mouse and human, no specific repetitive elements in intron 9, intron 10, or at the transcription start site, were clearly identified as homologous (Figure 5B). However, in both human and mouse an L1MB element (L1MB8 in human and L1MB7 in mouse) was located approximately 10 to 15 Kb upstream of the KCNQ1OT1 transcription start site (Figure 5B).
We have confirmed the synteny of CDKN1C with IGF2 in the tammar wallaby and shown it is highly conserved between the human, mouse and tammar. IGF2 and p57KIP2 antagonistically regulate growth of the eutherian placenta. Although CDKN1C is not imprinted in the tammar wallaby, it is expressed in the placenta and so could antagonise the growth promoting effects of IGF2 on the marsupial placenta. Furthermore, the antisense transcript, KCNQ1OT1, known to regulate CDKN1C imprinting in eutherians is also expressed in the marsupial placenta. However, a CpG island and promoter, orthologous to eutherian KCNQ1OT1, were absent in the tammar genome. These data suggest that imprinting of the CDKN1C gene is not contingent on its synteny with IGF2, expression in the placenta or the expression of the KCNQ1OT1 gene.
The p57KIP2 protein was present in the trophoblast, yolk sac endoderm, and some mesenchymal cells of the yolk sac placenta. In eutherians, P57KIP2 binds cyclin-dependent kinases in the nucleus. In the tammar, P57KIP2 was found in the nucleus as well as the cytoplasm of cells in all tissue types, suggesting that this protein is functional in the marsupial placenta, as in eutherians. However, members of the KIP family, including p57KIP2, also have roles outside their CDK activity that may account for their cytoplasmic location [57–60].
CDKN1C mRNA expression was higher in the trilaminar placenta compared to the bilaminar, but this difference was only significant when expression was low (days 22 to 24). More conspicuous was the significant increase in CDKN1C expression in both regions of the yolk sac placenta in the two days before birth (days 25 to 26). The vascular region of the placenta develops rapidly between days 19–24 to facilitate transfer of nutrients to the developing fetus, consistent with a low CDKN1C expression. The increase in CDKN1C expression immediately before birth is consistent with retarded growth of the placenta at this time . The slightly higher expression of CDKN1C in the trilaminar placenta may represent the terminal differentiation of haematopoietic tissue in this region that requires exit from the cell cycle. CDKN1C expression in the marsupial placenta is therefore consistent with a role for P57KIP2 in the inhibition of cell cycle progression and regulation of marsupial placental growth.
IGF2 and CDKN1C are co-expressed in the placentas of human, mouse, and tammar, suggesting these genes were also co-expressed in the placenta of the therian ancestor. The antagonistic functional relationship between these genes is also likely to have existed in the ancestor of marsupials and eutherians. However, the CDKN1C imprint must have been acquired later and only in the eutherian lineage .
All genes located between IGF2 and CDKN1C in human were also syntenic in the tammar. However, homology to KCNQ1OT1 was lacking. Despite high conservation of KCNQT1 exons between mouse, human and tammar, intron 10 of the tammar KCNQT1 gene showed no homology to the KCNQ1OT1 eutherian transcript. The promoter region and associated CpG island, conserved in human and mouse , could not be detected in the tammar. Intron 9 of KCNQ1, which encodes the terminal end of KCNQ1OT1, also lacks homology with its eutherian counterpart and is considerably shorter in the tammar (and chicken) than in human and mouse. Since KCNQ1OT is a non-coding RNA transcript, its sequence conservation with eutherians is not critical to its function . We therefore examined the expression of KCNQT1 intron 10 by RT-PCR. Despite the sequence divergence, transcription was detected suggesting that an antisense RNA KCNQ1OT1-orthologue exists in marsupials as in eutherians. This is especially interesting, since CDKN1C is not imprinted in marsupials, despite the presence of KCNQ1OT1. It will be important to determine whether KCNQ1 and KCNQ1OT1 are imprinted in the tammar, as in eutherians. As none of the promoter elements of eutherian KCNQ1OT1 were identified, it is possible that marsupial KCNQ1OT1 is regulated by a completely different means and has not yet been co-opted into regulating imprinting of CDKN1C. However, it does show that evolution of KCNQ1OT1 preceded imprinting of CDKN1C.
Throughout the rest of the IGF2-CDKN1C region, there was little cross-species sequence homology in the intergenic regions. However, two regions of high homology were identified in mammals between the TH and ASCL2 genes. Both sites of homology corresponded to regions of high LINE/SINE density suggesting conservation of repetitive elements may account for the sequence homology, rather than any regulatory or control regions. These repeats may be important for establishing a boundary region between two independently regulated domains, leading to their conservation.
There were significantly fewer DNA elements and endogenous retroviruses (LTR elements) across the entire region, spanning both the imprinted IGF2 domain and the non-imprinted CDKN1C domain. However, in both mouse and human there was a considerable increase in repetitive elements in intron 9, when compared with the tammar. This was due to the accumulation of LINEs that appear to coincide with the termination of the KCNQ1OT1 transcript. These results suggest that the truncation of KCNQ1 intron 9 in the tammar and the increase in LINEs in mouse and human may be associated with the evolution of KCNQ1 imprinting in the region.
Despite its lack of imprinting, marsupial CDKN1C is expressed in the developing placenta where it may antagonise the actions of IGF2 on cell-cycle progression, as it does in eutherians. Since CDKN1C resides in synteny with IGF2, imprinting of the two genes did not occur concurrently to balance maternal and paternal influences on the growth of the placenta. The expression of KCNQ1OT1 in the absence of CDKN1C imprinting suggests that antisense transcription at this locus may have preceded imprinting of this domain. These findings demonstrate the stepwise accumulation of control mechanisms within imprinted domains and show that CDKN1C imprinting is not due to its synteny with IGF2 or its placental expression in mammals.
Adult females carrying fetuses in the final third of gestation (day 19 to day 26 of a 26.5 day gestation) were euthanised either by cervical dislocation or by an anaesthetic overdose (sodium pentobarbitone, 60 mg/ml, to effect) and portions of the bilaminar (BYS) and trilaminar (TYS) yolk sac placenta collected as previously described [55, 62]. All experiments were approved by the University of Melbourne Animal Experimentation Ethics Committees and the animal handling and husbandry were in accordance with the CSIRO/Australian Bureau of Agriculture and National Health and Medical Research Council of Australia (1990) guidelines.
Small pieces of uterus with placenta attached were collected from days 19–21, 22–24, and 25–26 of pregnancy and fixed in 4% PFA before paraffin embedding. After sectioning at 7 μm, dewaxing and rehydration, an antigen retrieval step of 90°C for 60 min in 10 mM sodium citrate buffer pH 6.0 was performed. A rabbit polyclonal p57Kip2 Ab-7 antibody (NeoMarkers, RB-1637-P0) was used to localise p57KIP2 in the yolk sac. The antibody epitope corresponded to the C-terminus, which is conserved in marsupial and eutherian p57KIP2 proteins . Sections were blocked with 10% normal goat serum/TBS/1% BSA for 25 minutes at room temperature and subsequently incubated overnight at 4°C with the primary antibody (0.004 g/L). IgG antibody (Santa Cruz, normal rabbit IgG, # sc-2027) negative controls (0.004 g/L) and no-antibody (diluent only) negative controls were run concurrently with the p57Kip2 Ab-7 antibody. A biotinylated secondary antibody, goat anti-rabbit (DAKO, # E0432), was used with ABComplex/HRP kit (DAKO, # K0355) and colour developed with DAB Chromagen tablets (DAKO, # S3000). Sections were counterstained in haematoxylin. Sections from each individual were treated in at least two independent immunohistochemical runs to assess the consistency of staining.
PCR conditions consisted of: 95°C for 2 mins, followed by 40 cycles of: 95°C for 30 s, 60°C for 30 s, 72°C for 1 min), were performed on RT- and RT+ samples to control for the complete absence of contaminating genomic DNA carryover. Resulting products were sequenced to verified correct product amplification.
Approximately 300 ng of DNase treated (DNA-free, Ambion, # 1906) total RNA (GenElute Mammalian Total RNA Kit, Sigma, # RTN70) was used in an Oligo (dT)12–18 primed cDNA synthesis reaction (SuperScript First Strand Synthesis System for RT-PCR, Invitrogen, # 11904-018). SYBR green (Quantitect, # 204143) was used in a quantitative PCR on the MJ Research Opticon 2. Primer sequences and PCR conditions are given in Table 1. Melting curve analysis and agarose gel electrophoresis ensured a single product. B-ACT was used as a calibrator and endogenous gene control (forward primer 5' GATCCATTGGAGGGCAAGTCT 3' and reverse primer 5' CCAAGATCCAACTACGAGCTTTTT 3'). Standard curves confirmed linearity over three orders of magnitude of yolk sac cDNA dilutions. Reactions were performed in triplicate and the data exported into Microsoft Excel and Systat for analysis. The standard curve showed linearity over three orders of magnitude of yolk sac cDNA dilutions, indicating that the primers work over a range of cDNA concentrations and had a correlation co-efficient of 0.999. The standard deviation of CT values amongst triplicates ranged from 0.01 to 0.99 indicating that within each triplicate CT values were within 1 cycle of each other.
Quantitative RT-PCR primer sequences and reaction conditions for CDKN1C.
Melting curve analyses were performed after each PCR and one sample from each triplicate was assessed by gel electrophoresis to confirm there was no contamination.
A partial cDNA sequence of tammar CDKN1C (Suzuki et al., 2005) was used in a BLAST-N (NCBI; to identify a BAC clone of tammar genomic DNA. Overlapping clones were identified by successive BLAST-Ns of the terminal 1000 – 3000 bp of each new clone. All human, mouse, and chicken sequences were obtained from Ensembl . Sequences were examined for CpG islands (EMBOSS CpG Plot; ). CpG islands were searched using default settings (200 bp with a CG percentage greater than 50% for a 10 window set and an observed over expected of 0.6).
Repetitive elements were searched using species-specific databases available as option settings in RepeatMasker and Censor [67, 68]. However, Monodelphis domestica was used in analysis of Macropus eugenii when performing a Censor search and, for RepeatFinder, the Mammalian repeat database was searched as no specific marsupial repeat databases were available. Repeat sequences were assessed in the region from IGF2 to CDKN1C as a single unit and in all large introns of KCNQ1 (introns 1, 1b, 9, 10, and 14), each as single units. Only large introns were assessed as smaller introns have fewer repetitive elements of all types and, as such, comparisons between introns 9 and 10 where assessed against similarly sized introns.
Percent identity plots (PIPMaker and MultiPIPMaker: were used to identify conserved and homologous regions between species and to locate putative exons in the tammar. BLASTN (NCBI tools) and ClustalW (EBI tools; ) were used to confirm the identity of genes/exons. KCNQ1OT1 (intron 10 of KCNQ1) was assessed with mVISTA to identify sequence homology within the putative promoter region. The percent sequence conservation, which refers to number of sequences with 70% homology over at least 100 bp.
Univariate statistics (means, variation) and Grubbs' test for outliers were performed using Microsoft Excel (version Microsoft XP 2003). Analysis of quantitative gene expression followed standard procedures [72, 73]. Paired (BYS versus TYS) and unpaired (comparisons between stages) t-tests were Bonferroni adjusted (using Systat Version 10.2) to correct for multiple comparisons. The percent coverage of different types of repetitive elements was arcsine transformed and differences between species assessed by general liner model (GLM) least squares analyses using Systat Version 10.2. Grubbs' test for outliers was used to assess if the percent sequence coverage of each element was significantly different in one intron compared to all other similarly sized introns. Quantitative data are presented as means ± s.e.m. for quantitative RT-PCR or as box plots or stacked column graphs for repeat sequence data. Statistical significance was at the 5% level (α-value less than 0.05).
This study was supported by the Australian Research Council Centre of Excellence for Kangaroo Genomics grant, an Australian Postgraduate Award and a Post-Graduate Overseas Research Scholarship, a Drummond Award, and an Albert Shimmins Award from the University of Melbourne to EIA, an Australian Research Council Federation Fellowship to MBR, and a National Health and Medical Research Council RD Wright Fellowship to AJP.
MBR, GS, AJP, EIA, HMG and other members of the Renfree Research Group collected the samples; EIA and HMG performed all the experiments and genome analysis. All authors provided suggestions for the experiments, and read, modified and approved the final manuscript.
|
0.986118 |
In the decades between the end of the Civil War and Reconstruction and the beginning of American involvement in World War I, North Carolina had witnessed significant economic, social, and political change. On the eve of the war, North Carolina's 2.5 million citizens lived different, and in most cases better, lives than their turn of the century predecessors. Health conditions, standards of living, educational opportunities, and access to information about the larger world had all improved. The latter included news about the outbreak of war in August 1914 between Germany, Austria-Hungary, Turkey, and Bulgaria, popularly known as the Central Powers, and France, Russia, Great Britain, and Japan, known as the Allies. In the meantime, the degree of change from the nineteenth century varied depending on where Tar Heels lived and what they did for a living. In addition, gender and race still greatly influenced the opportunities available to North Carolinians, as they had in the previous era. Many women, both black and white, and black men seized upon the war as a chance to test those limits.
Over 80 percent of North Carolina's population was still rural in the 1910s, and agriculture still dominated the economy. An expanding urban-industrial crescent, however, stretched from Charlotte north to Winston-Salem, then east to Raleigh. The cities of Greenville, Fayetteville, and Wilmington were important commercial hubs in the eastern section of the state, and numerous smaller towns and mill villages also dotted the landscape. Work and life in most of these cities and towns revolved around textile mills, tobacco factories, and other industries, although Wilmington and, to a lesser degree, Fayetteville, remained shipping centers as they had been since the colonial era. Textile magnates, tobacco barons, and other industrialists shaped economics and politics at both the local and state level. These men would play central roles in directing North Carolina's war effort. Many of their sons, such as Robert March Hanes, saw action as Army officers.
Mill hands and tobacco industry workers found greater economic security in the factories than on the farms that they or their parents had left behind, but neither their work nor their lives could be described as profitable or comfortable. As a result, a number of North Carolina workers had made sporadic efforts to unionize since the 1890s. These organizing efforts were largely put on hold during the war as laborers churned out uniforms and Lucky Strike cigarettes for the "doughboys," as American soldiers were nicknamed. Others donned the khaki uniform themselves to serve in France.
Agriculture remained the linchpin of North Carolina's economy throughout the first half of the twentieth century. Before World War I, half of all Tar Heels still lived on farms. They supplied the crops that nourished their fellow North Carolinians, as well as the voracious textile mills and tobacco factories. Between 1900 and 1914, North Carolina agriculture became more diverse, modern, and prosperous than it had been in previous decades. The World War created a boom in agricultural demand and prices, especially for North Carolina's cotton and tobacco growers. Other Tar Heel farmers helped feed the Allied troops while many of their sons joined the armed services. Three of the soldier-authors whose works are included in this site, Paul Green, Edgar Hallyburton, and William Bradley Umstead, grew up on prosperous farms.
Umstead entered the world of North Carolina politics after his service in World War I. Political scientist V. O. Key describes the Southern political realm in the 1900s as a "Progressive Plutocracy," and notes that North Carolina was by-and-large a one-party Democratic state, in which only a minority of Tar Heels had access to the political system. Women and African Americans did not have the legal right to vote and the majority of white men chose not to cast ballots in most elections.
While North Carolina's political system remained fairly closed on the eve of World War I, state government was becoming more progressive, that is to say, more active and responsive to the needs and interests of the people. The legislature stepped up nineteenth century efforts to improve public education, especially for white children, through increased spending, equalized funding, and compulsory attendance laws. Progressive reformers also tried to ban child labor in the years immediately preceding the war, though the best they could manage was limited regulation by 1917. The state proved much more vigorous in preventing "the scourge of alcohol." North Carolina voters approved statewide prohibition in 1908.
North Carolina women had been the backbone of most of these reforms efforts before the war. They also fought for more legal and political rights for women, but the North Carolina legislature voted against the Nineteenth Amendment in 1920. Elsewhere in America, the democratic spirit engendered by the war propelled the amendment to victory that same year, when the necessary three-fourths of the states had approved it.
In the meantime, prominent Tar Heels exercised a good deal of influence over the federal government and America's approach to the war in Europe. First elected in 1912, President Woodrow Wilson, a southern Democrat, peppered his administration with North Carolinians. Raleigh News and Observer publisher Josephus Daniels became Secretary of the Navy and pushed, over Wilson's early objections, to expand the American fleet in preparation for another war. Liberal journalist and expatriate Tar Heel Walter Hines Page served as ambassador to England. After Britain entered the war in 1914, Page rejected the American tradition of neutrality in favor of support for the Allies. David Houston, a Tar Heel native who had moved to Missouri, served as Secretary of Agriculture.
North Carolina had a powerful congressional delegation, whose views on American involvement in the war diverged. Senator Furnifold Simmons chaired the important Finance Committee and came to share Page's view that the U.S. should join the war. In the House of Representatives, Claude Kitchin reigned as Majority Leader. Unlike Simmons, Kitchin remained a steadfast proponent of American neutrality in the European war. In 1916, Kitchin and one other North Carolina congressman, Robert N. Page, voted against a large increase in army and navy appropriations. North Carolina editorialists criticized Kitchin, but most citizens were not ready to go to war, though they sympathized with the suffering of the French and Belgian people at the hands of the German army. The federal government produced posters urging Americans to "Remember Belgium." North Carolina Governor Locke Craig made an official appeal for Belgium relief in March 1916. A year later, when it seemed clear that the United States would be drawn into the war by German submarine attacks on American shipping, Kitchin still opposed American intervention.
On April 2, 1917, President Wilson delivered his war message to Congress and envisioned a fight, not to preserve old European empires, but to protect American interests and to "make the world safe for democracy." The majority of Senators and Representatives, including all members of the North Carolina delegation with the exception of Kitchin, were swayed by events and Wilson's idealism and voted to declare war on Germany. Kitchin was one of fifty House members who opposed the measure. In a dramatic speech, he explained that his conscience had charted a "path of my duty and I have made up my mind to walk it, if I go barefooted and alone." Kitchin won favor with his colleagues and constituents back home for his conviction and for his resolve to "work with all of my soul and might in defense" of the country after the declaration passed.
In Washington, Kitchin and other North Carolinians played important roles in the war effort. Kitchin and Simmons pushed through a new federal income tax bill to help pay for the war. Senator Lee Overman sponsored early legislation to give the President new powers to regulate business in the name of war production. North Carolina Congressmen, such as James H. Pou, delivered rousing, patriotic speeches in the House chamber and to military and civilian audiences in North Carolina. State officials gave similar orations, and all of this rhetoric was widely circulated in the North Carolina press.
At the federal level, Josephus Daniels continued to oversee the American navy, while Ambassador Page conferred with British officials and visited Allied and later American troops in the field. The stress of work proved so great, however, that Page was forced to resign in 1918. Angus McLean, a successful Lumberton banker and a future governor, became a member of the new War Finance Corporation. The WFC issued war bonds and used the proceeds to provide loans to defense-related industries. McLean also took on the job of assistant Secretary of the Treasury. Walter Clark, chief Justice of the North Carolina Supreme Court and a long-time champion of the rights of labor, women, and African Americans, served on the new National War Labor Board. In the meantime, Clark's son, Walter Jr., served as an infantry captain in France.
Back home, North Carolinians quickly rallied around the flag and prepared for war. Governor Thomas Walter Bickett assumed the helm of North Carolina government in 1917, less than one month before the United States entered the war. Bickett had campaigned as one of North Carolina's leading Progressives, a record built in two terms as Attorney General and a stint in the General Assembly. On the one hand, America's declaration of war overshadowed Bickett's ambitious agenda of tax restructuring, educational expansion, and prison and public health reform. On the other hand, the demands of World War I forced the state to become more involved in the economy and the private lives of its citizens than most Progressive reformers had ever imagined or than conservative Democrats would ever have tolerated during peacetime.
The state's first task was to muster a military force. Actually, several Tar Heel men and women already had begun serving as volunteers in France in the Allied armed forces and medical corps shortly after the start of the war in 1914. Kiffin Yates Rockwell and James R. McConnell flew for the French air force and were shot down and killed. Benjamin Muse volunteered for the British Army in 1916 and became a prisoner of war of the Germans in November 1917. Once the U.S. declared war, President Wilson also called North Carolina's National Guard into service. Waves of propaganda posters drew in additional volunteers with masculine slogans, such as "Wanted: Husky Young Americans." The biggest surge of recruits, however, came from a new draft instituted in May 1917, covering all healthy black and white men between the ages of twenty-one and thirty-five.
While nearly 87,000 Tar Heel men and two hundred women left home for training and combat, Governor Bickett, state and local governments, and private charities such as the Red Cross undertook an ambitious campaign to mobilize the financial and material necessities for war. Public school teachers and college and university faculty and students, especially at the University of North Carolina, also devoted themselves to the war effort.
The American military needed massive amounts of food, fuel, armaments, and other material and the money to pay farmers and private industry for their production. Where production fell short, North Carolinians made up the difference by finding creative ways to conserve everything from potatoes to coal to socks in order to donate the surplus to the military. African Americans and white women in particular contributed vigorously to the war effort to express their patriotism and prove to white men they were worthy of greater citizenship rights.
Public and private groups attempted to mold public opinion as well as manage resources. One set of tools was editorials and public addresses, many examples of which are included in this site. Governor Bickett proved to be an especially inspiring orator, as illustrated by a speech he delivered in Ashe County. Schoolteachers also set lessons to music in patriotic ditties for their impressionable young charges to sing. By far the most widely seen and influential element of wartime propaganda was the posters produced by the federal Office of War Information.
American involvement in World War I was brief, but the experience significantly changed the political and social environment in North Carolina. In 1919, North Carolina communities mourned their dead: 629 Tar Heels were killed in action, another 204 perished from battle wounds, and a final 1,542 succumbed to disease. Over 3,600 men had been wounded and others carried the mental scars of combat trauma and many Tar Heel doughboys buried their memories for decades. Local communities welcomed their returning veterans with relatively little fanfare. By the early 1920s, however, Armistice Day anniversary celebrations, Fourth of July speeches, and newly published histories of North Carolina regiments all took great pride in commemorating North Carolina's service and sacrifices during the war.
Not all of North Carolina's wartime causalities occurred on the battlefield. North Carolina, along with much of the rest of the world, also suffered a public health crisis. Before the war, poor rural sanitation had been a breeding ground for flies carrying Typhoid fever. Between 1914 and 1917, Typhoid reached epidemic proportions, killing 2,911 North Carolinians. In response, the state Board of Health launched a public awareness campaign to encourage citizens to enclose their privies and cover open windows. Even small children learned their "Fly Catechism." The transport of men back and forth between Europe and America during the war also spread Spanish Influenza, a deadly strain of flu that also produced pneumonia. Millions succumbed to the disease across the globe and 13,644 North Carolinians died during the winter of 1918-19. Typhoid and other diseases killed another 1,542 Tar Heel troops in France. Public health agencies, county Councils of Defense, and private charities rushed to set up makeshift hospitals across the state to accommodate the thousands of patients. In the 1920s, the twin epidemics also created the political momentum to permanently expand the budget and duties of the state Board of Health.
In addition to health, the war provided the impetus for other public policy initiatives. Between 1917 and 1919, state government took the lead in coordinating the war effort by mobilizing financial resources and raw materials and molding public opinion in support of the war. It also assumed other duties beyond the immediate demands of supplying the war and this government activism continued after the peace into the 1920s.
Finally, the war set the stage for profound changes that would shape North Carolina's economy and the lives of farmers and workers in the 1920s. William Henry Glasson, in his 1920 essay on "Some Economic Effects of the World War," notes that the war drove up prices on consumer goods while devaluing the dollar, but the inflationary spike soon declined within a year. Of more lasting significance was the fact that the artificial wartime boom for North Carolina agriculture and the textile industry had turned to bust by the mid 1920s. North Carolina's tobacco manufacturing giants, however, rode out the recession as they would the Great Depression. Tobacco workers had also managed to organize unions and force new contracts on their employers in Winston-Salem at the end of the war. Tar Heel tobacco and cotton farmers saw prices drop first to prewar and then to turn of the century levels. Eventually, North Carolina agriculture was dragged into a depression two years before the famous stock market crash of 1929.
The textile industry also underwent two fundamental changes after the war. First, peace robbed the mills of their military market and changing consumer tastes lessened demand for cotton fabrics. Owners resolved to keep churning out goods at reduced prices. They would maintain a profit margin by reducing labor and production costs. Second, a decade of hiring since 1910 had turned a prewar labor shortage into a postwar surplus of mill hands. Workers had lost a vital source of leverage in labor relations and they felt helpless to resist the lay-offs, wage cuts, and increased workloads that their employers imposed on them. Mill hands in Charlotte and elsewhere went out on strike in 1919, but their protests were quickly crushed and the unionization effort in the textile industry was blunted for another decade. By 1929, the industry had entered into a decade of economic crisis and labor unrest.
With contributions by well-known historians as well as talented younger scholars, this volume offers new insights into all the key issues of the Civil War era that played out in pronounced ways in the Tar Heel State. In nine fascinating essays composed specifically for this volume, contributors address themes such as ambivalent whites, freed blacks, the political establishment, racial hopes and fears, postwar ideology, and North Carolina women. These issues of the Civil War and Reconstruction eras were so powerful that they continue to agitate North Carolinians today.
Origins of the nicknames "Old North State" and "Tar Heel State"
Postwar violence and political instability led the federal government to deploy elements of the U.S. Army in the Tar Heel State, but their twelve-year occupation was marked by uneven success: it proved more adept at conciliating white ex-Confederates than at protecting the civil and political rights of black Carolinians. Bluecoats and Tar Heels is the first book to focus on the army’s role as post-bellum conciliator, providing readers the opportunity to discover a rich but neglected chapter in Reconstruction history.
Foner initially describes the African-American experience during the Civil War and Reconstruction. He argues that African-Americans were not simply figures that took little or no action in the events of the day, and notes the enlistment of thousands of African-Americans in the Union army during the war. Foner also notes that many of the African-Americans that eventually became civil leaders had at one time served in the Union Army. He states, "For men of talent and ambition, the army flung open a door to advancement and respectability." He notes that as reconstruction progressed, African-Americans were the targets of violence and racism.
Foner believes that the transition of slaves into free laborers and equal citizens was the most drastic example of change following the end of the war. He notes how African-Americans were eventually forced to return to the plantations, not as slaves but as share croppers, and were thus introduced to a new form of slavery. He argues that this arrangement introduced a new class structure to the South, and states "It was an economic transformation that would culminate, long after the end of Reconstruction, in the consolidation of a rural proletariat composed of a new owning class of planters and merchants, itself subordinate to Northern financiers and industrialists.” The author illustrates how both blacks and whites struggled to use the state and local governments to develop their own interests and establish their respective place in the evolving social orders.
Another theme that he addresses in this excellent study is racism itself and the interconnection of race and class in the South.
Another subject he addresses is the expanded presence of federal authority, as well as a growing idea and commitment to the idea that equal rights belonged to all citizens, regardless of race. Foner shows how both Northern and Southern blacks embraced the power to vote, and, as Reconstruction ended, many blacks saw the loss of suffrage and the loss of freedom. Foner illustrates that because the presence of blacks at the poll threatened the established traditions, corruption increased, which helped to undermine the support for Reconstruction. The former leaders of the Confederacy were barred from political office, who were the regions "natural leaders," a reversal of sympathies took place which portrayed the Southern whites as victims, and blacks unfit to exercise suffrage.
Reconstruction affected the North as well, but argues that it was obviously less revolutionary than it was in the South. Foner notes that a new group of elites surfaced after the war, industrialists and railroad entrepreneurs emerged as powerful and influential leaders alongside the former commercial elite. The Republicans in the North did attempt to improve the lives of Northern blacks. However, there were far fewer blacks in the North, so it was more difficult for blacks to have their agendas and needs addressed in the local legislatures. He states, "Most Northern blacks remained trapped in inferior housing and menial and unskilled jobs." Foner adds that the few jobs blacks were able to acquire were constantly being challenged by the huge influx of European immigrants.
Foner's subject is definitely worthy of his original volume. Reconstruction is a subject that can still be interpreted in several ways, including the revisionist school of thought. Foner, however, seems to be as objective as possible on this subject, and has fairly addressed all major issues that apply.
About the Author: Eric Foner, DeWitt Clinton Professor of American History at Columbia University, is the author of numerous works on American history, including Free Soil, Free Labor, Free Men: The Ideology of the Republican Party Before the Civil War; Tom Paine and Revolutionary America; and The Story of American Freedom. He has served as president of both the Organization of American Historians and the American Historical Association, and has been named Scholar of the Year by the New York Council for the Humanities.
Sources: Sarah McCulloh Lemmon, North Carolina's Role in the First World War (Raleigh: Division of Archives and History, 1966) and R. Jackson Marshall III, Memories of World War I: North Carolina Doughboys on the Western Front (Raleigh: Division of Archives and History, 1998). For Josephus Daniels' view of the Navy and his secretariat, see Daniels, Our Navy at War (New York: G.H. Doran, 1922). On Walter Hines Page's tenure, see Ross Gregory, Walter Hines Page; Ambassador to the Court of St. James's (Lexington: University Press of Kentucky, 1970). For sources on the role of government, see the introduction to The Home Front/Mobilizing Resources. On Claude Kitchin's evolving stance on the war, see Claude Kitchin and the Wilson War Policies (New York: Russell & Russell, 1971). On the disease epidemics and the public health response, see David L. Cockrell, "A Blessing in Disguise: the Influenza Pandemic of 1918 and North Carolina's Medical and Public Health Communities," North Carolina Historical Review, 73 (July 1996): 309-27. For a general history of the American home front, see Robert H. Zieger, America's Great War: World War I and the American Experience (Lanham, Md.: Rowman & Littlefield Publishers, 2000).
The Reconstruction Era pages offer questions and answers to the following subjects and topics: North Carolina and Civil War Reconstruction Era History: The results, details, purpose, facts, goal of the Reconstruction Acts; The Civil War Reconstruction Acts accomplished what primary objective? Includes a comprehensive Reconstruction Timeline with pages on the Reconstruction achievements, accomplishments, with goals (missed opportunities) as well as the weaknesses of the Reconstruction, restrictive Civil Rights Acts, and a failed military rule.
|
0.981138 |
Build the perfect scene for your next adventure with the city of the Dead statues & monuments set! WizKids, the industry leader in quality pre-painted plastic miniatures, presents its newest Dungeons & dragons set, city of the Dead!
This gorgeous Set of miniatures includes several beautifully carved statues & monuments as well as several coffins that can be used in a variety of locations! this fantastic pre-painted Set contains a variety of pieces to create an immersive roleplaying game experience.
The perfect setting for your Water deep Dragon heist adventure and a beautiful display Set as well!
|
0.961041 |
Can you give me reasons why becoming a better community is important.
My Original Essay Question: How can cities in the U.S. be better designed to create a safer and more economically productive community?
I need you list a way or (a few ways) becoming a better community would benefit everyone.
By doing so, you are helping me tremendously with my 9th grade research paper.
Let's start with your ideas. We don't want to duplicate ways you've already thought about.
What do you mean by ideas?
Your ideas about how becoming about how becoming a better community would help everyone.
This is for writing an expository essay on why the wheel is so important. Ca someone help me and figure out 3 reasons why the wheel is so important?
you have 4 reasons for saying "no" two of them are very strong reasons, one has a tiny loophole, and one is very weak. in your message you should: a. Include all 4 reasons, b.Omit the very weak reason and use the other three, c.
|
0.999334 |
Laparoscopic gallstone surgery or laparoscopic cholecystectomy is a most widely recognized and accepted surgical procedure. It involves removal of gallstone or gallbladder through various cuts or holes in the abdomen.
The gallbladder is a pear-shaped organ in the body. It plays a role of collecting the digestive juice produced by the liver and transferring it to the small intestine through the bile ducts.
Small and hard stones consisting of cholesterol and bile salts formed in the gallbladder. The cause is uncertain but females, age above 40 years and being overweight are some of the associated risk factors. These stones block the outflow of the bile causing the gallbladder to swell.
The symptoms such as pain, vomiting, indigestion, fever, and jaundice can show up. Surgical removal of the gallbladder or cholecystectomy is the safest treatment of gallstones or any other gallbladder disease, and laparoscopic gallbladder surgery is the safest and the most opted procedure by the best laparoscopic cholecystectomy surgeon in India.
A laparoscope is a small and a thin tube, which is inserted into the abdomen through the tiny incisions made below the navel. The surgeon can view the gallbladder on the screen and do the surgery with the equipment inserted. The gallbladder is taken out through one of these incisions.
What are the benefits of laparoscopic gallstone surgery?
• Laparoscopic surgery does not require any large cut on the abdomen muscles, as in the open surgery. The incision is small and recovery is faster.
• The hospital stay is shorter due to a fast recovery. The patient can resume work soon.
• As compared to the open surgery procedure the pain is very less.
Along with the above benefits, this surgery has a few limitations, when laparoscopic gallbladder surgery cannot be performed.
• Age: Old aged people are not allowed the laparoscopic surgery, as they might not be able to bear the effects of anesthesia.
• Pregnancy: A pregnant female cannot undergo laparoscopic surgery.
• Previous abdominal surgery: a person who has undergone an open abdominal surgery within one year is not advised for laparoscopic surgery.
• Disease condition: a person with a disease condition such as asthma, paralysis or liver failure is not permitted for laparoscopic surgery. They instead have to go ahead with the open surgery.
• Bleeding or infection, which is very rare if handled by an experienced surgeon.
• Nausea and vomiting post-surgical procedure.
• Injury to the bile duct, intestine or the blood vessels, which might further require a corrective surgery.
• In a few cases, there might be a problem removing the gallbladder with a laparoscope. Immediate open surgery is then performed immediately.
The above-mentioned risks have a very low occurrence chance. Laparoscopic cholecystectomy is the primary option for gallbladder surgery by many surgeons because of the numerous benefits it bears.
|
0.997654 |
Category: Exercise/Fitness - 20-Something Professional And her product reviewing adventures!
This muscle roller is great. I love hat each of the rollers move on their own, so when you press it against your back or wherever, they all roll based on the pressure they have with the skin. I have found this to give a MUCH better massaging effect because of this quality. It is easy to handle and it feels really great. I am very impressed with this product. I am even able to use this on myself so it is great. :) I would recommend this for anyone.
Overall, I like this exercise ball. I like that it comes in different sizes, so you can customize it for your height and ideal workout. It also comes with very helpful instructions and a hand-pump. The material of the ball was medium thickness, it wasn't super cheap material, but I felt like it wasn't "thick" per say. I would have preferred material that felt much thicker and sturdier. However, that is only a concern if you are going to be using it as a chair and sitting on top of it. I've been using mine (55 cm) for yoga and doing crunches. It is a little too small to sit comfortably on, but it has worked great for yoga and stretching! I think this is a great option for an exercise ball in this price range! I give this product 4 out of 5 because the material is not as sturdy as I would like it to be, but the exercise ball still has a lot of other really good qualities.
One of my favorite things about this jump rope is that it is adjustable. Being petite, finding a jump rope that fits, is high-quality, and isn't for kids is very hard to come by. So the adjustable aspect of this is much appreciated by me. There are directions on the back of the package that walk you through how to adjust it. The directions say to cut the rope to your desired length, but I just sort of moved the plastic stopped were I wanted it and didn't cut it completely down to size so someone taller than me could slide the plastic up and have it longer for their use. The sizing part is covered, as it is inside the handles (you can unscrew the handles to get to it). This makes the jump rope look sleek, without looking different from other non-adjustable jump ropes. The handles are very easy to grip and comfortable. The jump rope itself is made out of very light-weight plastic, but is still very durable. Since it is so light-weight, it doesn't hurt that bad if/when it hits your foot (though it obviously does hurt a little). You do need to make the rope go faster if you want it to work best (as the name Limm High Speed Jump Rope) suggests. Overall, this jump rope works really well and is very high-quality. I am glad I have a jump rope that I can customize to be perfect for my size, and not have to sacrifice quality or break the bank to get it. Highly recommend.
|
0.941918 |
A letter from space at St Columban's Mayfield mnnews.todaySt Columban's Primary School, Mayfield may just have a future astronaut on their hands in the form of Year 1 student, Ethan Gleeson.
Lost Diggers of Weston exhibition opens on Anzac Day The Maitland MercuryON DISPLAY: The Lost Diggers of Weston exhibit will launch on Anzac Day, unveiling lost glass plate negative portraits, pictured, of local World War I soldiers.
Arsenal starlet Ainsley Maitland-Niles is ‘next Gareth Bale’, Tony Cascarino says – ‘Sorry, Spurs fans’ talkSPORTFormer Chelsea forward Tony Cascarino has apologised to Tottenham fans for discovering the 'next Gareth Bale'… who just happens to play for Arsenal.
Waratahs in Super comeback win over Rebels The Maitland MercuryThe NSW Waratahs have breathed *fresh* life into their Super Rugby campaign with a crucial comeback win over the conference-leading Melbourne Rebels.
Jets crush Roar in lopsided A-League clash The Maitland MercuryA lustrous A-League future seemingly beckons for Newcastle after their youth brigade dazzled in a 6-1 demolition of Brisbane at Suncorp Stadium. While neither.
Fast finishing Fremantle beat GWS in AFL The Maitland MercuryFremantle have come from behind at the final change, kicking the opening six goals of the fourth quarter to defeat GWS in their AFL clash in Canberra. Leon Ca.
Heavy traffic on Maitland Road approaching Newcastle after two-vehicle crash near Hexham Bowling Club Newcastle HeraldThe driver of a white Mitsubishi Lancer has been taken to hospital after suffering minor injuries in a crash on Maitland Road on Saturday afternoon.
Adelaide United defeat Victory in A-League The Maitland MercuryA late George Blackwood header has given Adelaide United a precious 1-0 win against arch foe Melbourne Victory in their Good Friday A-League fixture.
Star Bombers set for Anzac Day AFL game The Maitland MercuryA red-hot Essendon are set for an Anzac Day boost with David Zaharakis and Devon Smith expected to return for the marquee AFL clash with Collingwood.
Proud dad Poppa praises Perth in A-League The Maitland MercuryPerth coach Tony Popovic is a proud dad after giving his son an A-League debut in a loss to Sydney he feels demonstrates just how far his rising club have com.
|
0.945214 |
< p>[#image: /photos/53e30696dddaa35c30f6a7cb]||||||< br>< em>He's less cuddly than a bunny, but the Aussies love their "Easter Bilby."< br>< em>Photo: < ahref="http://www.epa.qld.gov.au/about_the_epa/public_reporting/epa_bulletin/issue_11_22_march_2005/" target="perrin">Queensland gov. EPA < br>< p>< ahref="/perrin-post/2007/04/new_blogger_joi">By Tara Kyle< p>In the spirit of Easter, I thought I'd highlight a few of the stranger ways the holiday is being acknowledged around the world.< p>< ahref="http://www.concierge.com/destination/mexicocity">Mexico City: The middle and upper classes in landlocked Mexico City typically spend Easter fleeing for the coasts, but this year the city hosted the < ahref="http://www.worldhum.com/weblog/item/lifes_a_beach_in_mexico_city_20070405/" target="perrin">grand opening of a fake beach, according to < ahref="http://www.worldhum.com/" target="perrin">Worldhum. The idea of a spit of sand alongside a noisy road junction sounds pretty bizarre, not to mention that < ahref="http://www.reuters.com/" target="perrin">Reuters reports the < ahref="http://uk.reuters.com/article/oddlyEnoughNews/idUKN0326373920070403?feedType=RSS&pageNumber=1" target="perrin">government spent $200k on it. But I felt more sympathetic when I read Mayor Marcelo Ebrard's justification: "There are those upset by the artificial beaches. Perhaps they can get to other beaches, but this was built for the majority, and it's free."< p>< ahref="http://www.concierge.com/destination/australia">Australia: < ahref="http://www.treehugger.com/" target="perrin">TreeHugger reminds us that in Australia it's time to < ahref="http://www.treehugger.com/files/2007/03/get_hopping_its.php" target="perrin">"get hopping" for the "Easter Bilby." This little furball is sadly endangered, and since 1999 has been the subject of a passionate < ahref="http://www.savethebilbyfund.com/" target="perrin">"Save the Bilby" campaign.< p>< ahref="http://www.concierge.com/destination/london">London: Chocolatier < ahref="http://www.thorntons.co.uk/ThorntonsSite/pages/home/default.asp?&cookie%5Ftest=1" target="perrin">Thornton's built an < ahref="http://www.jaunted.com/story/2007/4/4/4264/91952/travel/Londoners+Are+Pigs+%28When+Chocolate%27s+Around%29" target="perrin">860-pound chocolate billboard for Easter week, < ahref="http://www.jaunted.com/" target="perrin">Jaunted reports, only to watch passersby devour it within three hours of its Tuesday opening.< p>What are some other Easter traditions you've encountered?
|
0.998316 |
US distorting Salvador rights picture?
A recent cable from the United States Embassy in San Salvador to the US State Department distorts the true picture of human rights in El Salvador. So charges the director of the agency whose statistics are cited in the embassy cable as proof that the rights situation here is improving.
The embassy document, which was leaked to The Christian Science Monitor, cites statistics compiled by Tutela Legal, the human rights office of the Salvadorean Roman Catholic archdiocese, to show that the numbers of killings by death squads has declined and that most civilians killed in warfare are people who travel or live with leftist guerrillas.
''While much of what it (the cable) presents is correct, what it omits distorts the reality of the human rights situation,'' says Ms. Hernandez.
The cable, which has been given to some US congressmen, appears to have been used in recent congressional debates on the human rights situation in El Salvador. In the weeks just ahead, Congress is weighing whether to increase aid appropriations to El Salvador.
''I do not think then it is fair to say that abductions have gone down or up, indeed they appear, from what we have, to be about the same,'' Hernandez says. She adds that the number of civilians killed in the last six months of 1983 appears to have gone up.
''We have not published figures for the first four months of 1982, so would not presume to make a comparison on abductions,'' Hernandez says.
Tutela Legal statistics show the number of civilians killed in the last six months of 1983 by the Salvadorean Army, security forces, and clandestine paramilitary squads was 2,615. This number represents an increase over the first six months of 1983, as well as an increase over the last six months of 1982. Killings of civilians by government forces in noncombat situations averaged about 120 per week in the last three months of 1983, Tutela Legal says. Government forces have killed more than 38,000 civilians since 1979, it adds.
Death squad murders have never accounted for a large share of civilian deaths , Tutela Legal contends. The agency says the Army is responsible for an average of 76 percent of the civilians killed per month. If paramilitary squads, or so-called ''informal death squads,'' are included in the figures, the number rises to 99 percent of civilians killed.
|
0.989589 |
UK Video Streaming Channels. The following table lists the UK video streaming channels that are currently unblocked. Channel Devices Notes; BBC iPlayer: Web Browser iOS Devices Android Roku (UK) WD TV Live PS3/PS4 Xbox: The iOS app can be downloaded with a UK iTunes account. BBC Sport: Web Browser iOS Devices Android Roku (UK) PS3: The iOS app can be downloaded with a UK …... The Australian Open 2017 will be broadcast live online and on TV all across the globe. AO TV live will provide coverage online, while the list of TV broadcasters from across the world is listed below.
The Australian Open 2017 will be broadcast live online and on TV all across the globe. AO TV live will provide coverage online, while the list of TV broadcasters from across the world is listed below. how to stop wheezing immediately in tamil The Australian Open 2017 will be broadcast live online and on TV all across the globe. AO TV live will provide coverage online, while the list of TV broadcasters from across the world is listed below.
But overall, there's a reason that streaming services are now bigger than pay TV in Australia. They offer a wide range of content, generally ad-free, for a significantly lower price.
The Australian Open 2017 will be broadcast live online and on TV all across the globe. AO TV live will provide coverage online, while the list of TV broadcasters from across the world is listed below.
|
0.99331 |
Create an interactive two-way dialogue that will intimately engage customers and draw quality traffic.
Your every strategic move online will become deliberate. It will be driven by a concrete and measurable business goal. It's all well and good to aspire for 10,000 Facebook likes. The actual aim should be focused on generating qualified inbound leads, an operation requiring more than just sheer volume.
Decide which channels will best address your business goals. Then, we will learn more about what drives engagement across channels within your industry.
Find the right people within your organization to execute the plan, across each of the channels you’ve decided to tackle.
Are you doing all you can to engaged your customers?
The right social media strategy can be result in a highly efficient way of starting the conversations you want.
I'd like to better connect with my customers using social media.
|
0.999999 |
"Ironforge - the Awakening of the Dwarves" is a section of the History of Warcraft, Chapter II. It is set 2,500 years before Warcraft: Orcs & Humans.
When the world was sundered by the Well of Eternity's implosion, the earthen were deeply affected. Reeling with the pain of the earth itself, the earthen lost much of their identity and sealed themselves within the stone chambers where they were first created. Uldaman, Uldum, Ulduar... these were the names of the ancient Titan cities where the earthen first took shape and form. Buried deep beneath the world, the earthen rested in peace for nearly eight thousand years.
Calling themselves dwarves, the last of the earthen left the halls of Uldaman and ventured out into the waking world. Still lulled by the safety and wonders of the deep places, they founded a vast kingdom under the highest mountain in the land. They named their land Khaz Modan, or "Mountain of Khaz", in honor of the Titan shaper, Khaz'goroth. Constructing an altar for their Titan father, the dwarves crafted a mighty forge within the heart of the mountain. Thus, the city that grew around the forge would be called Ironforge ever after.
The site's version of a sentence: Their rocky hides had softened and became smooth skin, and their powers over stone and earth had waned. They had become mortal creatures.
|
0.996209 |
Hail to the Thief (or The Gloaming), usually referred to without its alternative title as simply Hail to the Thief, is the sixth studio album by the English alternative rock band Radiohead. It was produced by Nigel Godrich and released on 9 June 2003. It was the last album released under Radiohead's six-album record contract with Parlophone.
After two Radiohead albums incorporating electronica, jazz and 20th-century classical music influences, Hail to the Thief was seen as a return to a more conventional rock sound while maintaining electronic and jazz elements. Following difficult recording sessions for previous albums, the band worked deliberately quickly, employing a live, "spontaneous" approach, and cited the Beatles, the Pixies, Charlie Mingus, Can, New Order, Tubeway Army and Siouxsie and the Banshees as influences. George Orwell, Dante, and fairy tales influenced the lyrics, much of which were written in response to the "War on Terror" and the subsequent War in Afghanistan. Songwriter and vocalist Thom Yorke said the album addresses "frustration and powerlessness and anger, and the huge gap between the people that put themselves in control and the people that allegedly voted for them."
Hail to the Thief debuted at number one in the United Kingdom and at number three in the United States, and produced three charting singles: "There There", "Go to Sleep" and "2 + 2 = 5". It was praised by critics, though many felt it was not Radiohead's strongest work, and it became the fifth consecutive Radiohead album to be nominated for a Grammy Award for Best Alternative Music Album. In 2010, Rolling Stone magazine ranked Hail to the Thief the 89th best album of the 2000s.
So here it is at last. The most anticipated album release of the year. Many of you probably became sick of all the incredible hype weeks ago. Those lucky few who've been listening to Hail To The Thief, by fair means or foul, have been ranting and raving for weeks. Annoying the rest of us who have to (or want to) wait until the official release date. They've been foaming at the mouth with excitement; "The Saviours of Rock 'n' Roll return with best album in the world ever!!" and such like. But is it justified?
To be honest, I loved OK Computer but was alienated by Kid A and didn't really get into Amnesiac for one reason or another. Hail To The Thief is without question more accessible than its two predecessors. But to say it's a step backwards or disappointing in any way is foolish.
Radiohead, the most popular innovative band on the planet, haven't broken any new ground here, as they did with Kid A. This album sees a return to simple song construction. Guitar, drums and keyboards form the backbone of these 14 indie pop songs.
"Go To Sleep" and "Where I End and You Begin" are fantastic. Driving guitars attack from all sides, demanding your attention, juddering with impressive force. Yorke's vocals are in fine form here; melancholic and hypnotic.
"A Punchup At A Wedding" is sublime. The song rolls effortlessly along taking the listener on a serene journey which also provides subtle amusement along the way: 'You had to piss on our parade, you had to shred our big day...in a drunken punch up at a wedding'.
There are still the wonderfully eerie sounds ("The Gloaming") and the computerised electronic bleeps ("Sit Down, Stand Up"). These songs provide evidence that Radiohead are still capable of producing ambitious music which is remarkably enjoyable.
Current single "There There" is number four in the charts and the album is about to set up residence at number 1. How do Radiohead maintain their position as the world's most successful, non-mainstream band? Is it because Thom Yorke rarely smiles? And doesn't have a celebrity girlfriend? I suspect it's because they make some of the most amazing, anthemic, inspiring music around today.
|
0.93995 |
What causes diarrhea, blood in stool and lower left-sided abdominal pain?
Question: Hi for the last couple years every once in a while like 6-7 months I will have a episode of diarrhea and blood in my stool that and pain in my lower left side. I usually only have the diarrhea once but than hard stools with blood on them for the next day or so than in back to normal for another few months. I was always to embarrassed to see a dr now I'm really worried.
Colonoscopy has to be done.
Diarrhea and blood in stool at your age can be a sign of inflammatory bowels disease (Crohns disease). Especially if you have also some mucus in the stool, lost some weight recently, have allergies, skin changes (like eczema) or joint pains. Blood is usually mixed with the stool.
I suggest you to do not wait with it any longer. Please consult your doctor. Colonoscopy has to be done to rule this issue out.
|
0.994866 |
Think of those sixteen words as a movie logline. For the time being, that is almost all the government is willing to say. Other than that the press release headline is 16 words long, it is hard to find a connection between what seem to be three overlapping cases and the Pagans.
One indictment is a case called USA v. Barbara Caylor-Hernandez, aka “Barb,” aka “Barbie” and others. Barbie’s codefendants in that indictment include Ramiro Fraire-Chavarria, Michael Babin, Melanie Kerr, Keith Simmons, Carla Ray, Spencer Burkard, Robert Foster, Daniel Barbarino, Andrew “Yeti” Shettler, Brian “Sledge” Burt and Lawrence Sann. Everybody except Sann is accused of conspiring to distribute 50 grams or more of methamphetamine. Sann only conspired to distribute five grams. They are all facing life in prison except Sann, who could be sentenced to 40 years.
A second indictment charges Keith Kirchoff, Michael “Clutch” Andrews and Shettler with conspiring to distribute 50 grams or more of methamphetamine. Kirchoff allegedly carried a gun while he allegedly talked about doing his alleged two ounce drug deals.
And, according to the press release, a third indictment has been returned against Cindy Bledsoe, Jason Stringer and Andrews. Bledsoe and Andrews are accused of plotting to get their hands on 50 grams of crank to sell. There is no indication whether this is the same drug plot Andrews is charged with in the second indictment. Stringer is accused of trying to get his hands on five grams of meth.
The press release was issued before the third indictment was filed – if there is actually a third indictment. And there is no mention of the Pagans or any other motorcycle club in either of the two filed indictments.
Another good factual study on militarization(SWAT)of pigs used against the civilian population. Militarization FAILS to enhance police safety and reduce crime. SWAT used 90% of the time to serve warrants.Jonathan Mummolo laid it out.
“Criminal Justice” is maybe an oxymoron, or maybe real…ever see the Movie “M”? The criminals hold court,,,and try a pederast. Good movie.
Conspiracy means breathing together, and it is not per se illegal. Unless it’s related to a crime… So?
Well, a judge I once knew said to me: “How often do we hear that the cops got involved through an anonymous tip, and they can’t say who did the tip? Right, that’s a conspiracy to conceal a material witness.” That’s a crime, generally. Cops do it every day. Common sense says that the “material witness” is in reality sometimes imaginary…so maybe it’s a conspiracy to fraudulently manipulate a judge…and if the judge goes along? He’d be part of the conspiracy, no?
And they conspire to do other stuff too: http://www.pnas.org/content/pnas/early/2018/08/14/1805161115.full.pdf They conspire to become an army… an yerit, brother.
Conspiracy? Thinking about? You should put all the prosecutors in jail for CONSPIRACY TO USE Cocaine. These slimy lawyers think about it and then use drugs every weekend.
Prospected. Not prosecuted. Ugh. Fukn auto spell.
What makes you an expert of the lifestyle of a 1%er?
@ Oldskewl. Finding out the brother you prosecuted with is a lying snitch. Realizing that your best intrest isn’t always what many brothers put first. Knowing that you might just go to prison because of a one of those brothers actions.
Yeah…..not what I signed up for. Still love the club, but I’m out! So are many many more. Most definitely not what it used to be.
Either die or go to prison, life of a 1%. Not good options, but you play you pay.
So the incitement was pre drafted waiting to see if it ever happen?
28 grams makes 1 ounce, good grief there’s hardly much more than 2 ounces of crank and all these people were involved in this little bit of dope. So everyone was going to get a $0.79 cut of the profits. Another case without the DEA, this is all lawyer wordsmithing because there isn’t enough of a crime for the DEA to have bothering with it.
Life for that? Wow. That group of Pagans have always been Stand up, especially Sledge 1%er. Hope they beat the case. There are people doing much worse in that area that always seem to be right back out on the streets a week later but they aren’t flying a patch so who cares what they do, right? victimless crimes.
How ironic. John Oliver bashing a criminal justice system that is nowhere near as bad as the criminal justice system that operates in the country he fled from.
Louie Da Lip is smiling in his grave today.
|
0.999869 |
To ensure security, passwords should be A. a combination of letters and numbers. B. kept near the main computer. C. hard for you to remember. D. less than six characters long.
To ensure security, passwords should be a combination of letters and numbers.
|
0.952184 |
This method will for for a regular MacBook Pro display, not a Retina display. I’ve seen different tutorials on the internet where they explain how to remove a non cracked glass with a suction cup. This method doesn’t work with a cracked glass.... Product Information: The Apple MacBook Pro ME665LL/A is a high-end machine that offers a variety of practical and convenient features. The 15.4-inch large screen uses high-end Retina Display technology.
The next generation MacBook Pro 2016 finally appeared to offer enough new and future-proof technology, so I pulled the trigger and purchased a new 15-inch MacBook Pro with the fastest available CPU (2.9 GHz Core i7), the fastest available GPU (Radeon 460) and a … how to ask for parking in job nogotiations 26/02/2017 · Costco sells a very light screen cleaner fluid that is safe for use on the keys\screen\chasis of a Macbook Pro. It's light enough to not have concern for damage, but there's enough to it that it'll just cut through the fingerprint grease on the keys.
Question Q How do i clean my macbook pro retina screen?
4 Ways to Clean a Macbook Pro Screen - wikiHow Wikihow.com How to Clean a Macbook Pro Screen. In this Article: Polish with a Dry Cloth Wipe with a Moist Cloth Using Formula Cleansers Using LCD and Plasma Wipes Community Q&A You need to exercise caution when cleaning your Macbook Pro screen since abrasive or heavily saturated cloths can cause serious damage to the computer.
They are available for the 2016 MacBook Pro 13'' and 2016 MacBook Pro 15''. Macbook Cleaning Tip: How to Clean Your MacBook Ports If you find your ports getting grime or dust in them, you can use a makeup brush to help remove the grime.
26/02/2017 · Costco sells a very light screen cleaner fluid that is safe for use on the keys\screen\chasis of a Macbook Pro. It's light enough to not have concern for damage, but there's enough to it that it'll just cut through the fingerprint grease on the keys.
|
0.999622 |
Ask any mountain biker why they do it and you'll likely hear, "because it's fun." My knee-jerk response when people question my sport of choice is no different. But it should be. There's a reason everyone from pre-schoolers to former presidents and school-aged children to cycling legends have fallen in love with riding their bike off-road. In addition to being fun, mountain biking offers a plethora of physical, emotional and social benefits to those who partake. So hop on your steed and search for the nearest singletrack, because you have no excuse not to join the millions of others who mountain bike.
Though you may encounter a few bumps and bruises along the way, mountain biking helps more than it harms. According to Peopleforbikes.org, three hours of biking per week decreases your chance of heart disease and stroke by 50 percent. A study in the European Journal of Epidemiology found that women who bike more than 30 minutes each day have a reduced risk of breast cancer. Furthermore, teenagers who bike are 48 percent less likely to be overweight in adulthood.
The Centers for Disease Control and Prevention recommends that adults get at least two and a half hours of moderate-intensity physical activity every week. This type of exercise must be rigorous enough for a person to break a sweat and raise their heart rate. I think it's safe to say that mountain biking counts toward the CDC's weekly guidelines!
One last thing to note, mountain biking proves to be an ideal alternative for the growing number of older Americans who may be suffering from knee injuries after years of high-impact sports, such as running. The sport offers similar cardiovascular benefits to running, but without the impact on your joints. Former president George W. Bush took up mountain biking after a knee injury put an end to his running regimen.
In addition to the myriad physical benefits of mountain biking, the sport also plays an important role in participants' emotional well-being. According to a 2007 study by Dr. Andrew Lepp at Kent State University, outdoor activities decrease stress, raise self-esteem and provide people with a sense of challenge and adventure.
Lastly, mountain biking acts as a distraction and helps riders to temporarily take their mind off of any worries. This escape from reality breaks the cycle of negative thoughts that contribute to anxiety.
There are plenty of opportunities for interaction in this sport, whether you join your local cycling club, sign up for a mountain bike race or bump into other riders at the trailhead. Pleasant social interaction can improve your mood and provide you with the opportunity to make new friends--or at the very least, new riding buddies. And riding with others is not only enjoyable, it's safe, especially if you were to come across any furry friends along the way.
|
0.948007 |
What type of code should I use in my application?
UPC/EAN/JAN Codes - These codes are all based on the Uniform Product Code that you see every day on retail products. You've probably noticed that the code seems to consist of two halves separated by a couple of long bars in the center. The first half represents the manufacturer and the second half represents the product that the code is on. UPC is a fixed length code, that is it always has the same number of characters. There is a shortened version called UPC-E which contains fewer characters but actually can be reconstructed back to the full length code by the decoding software. EAN (European Article Numbering) and JAN (Japanese Article Numbering) are variations of the basic UPC design.
Codabar - Codabar was one of the first non-retail barcodes developed. I has come to be used almost exclusively by the photo processing and Health Care industries. Since these industries among the first to adopt barcode technology, they used the Codabar symbology.
2 of 5 Code - This again, was code developed in the early days of barcoding. It has since been replaced with Interleaved 2 of 5 which can encode almost twice as much data in the same space.
MSI/Plessy Code - Again an early symbology that is not widely used today.
Code 93 - This code was developed by Intermec Corporation as a replacement for Code 39. It encodes all 128 characters of the ASCII data set. It also encodes data in a more compact (shorter) symbol than does Code 39. Unfortunately, by the time this symbology came along, Code 39 was widely accepted and users saw little advantage in switching to the new code. A full ASCII version of Code 39 has since been developed.
The following three codes are commonly used in industrial (non-retail) applications today. Each code has its particular advantages and disadvantages. Which one you use depends largely on the type of data you have to encode (numbers, letters or full ASCII Character Set), the space that the code can occupy on the label and the printing technology.
Interleaved 2 of 5 Code - This code is used to encode numeric data only. There are no alphabetic characters or special characters. The code is composed of wide and narrow bars and wide and narrow spaces. There are always two wide elements and three narrow elements comprising each digit. One digit is encoded in the bars and another digit is encoded in the spaces. For this reason there always has to be an even number of digits in an Interleaved 2 of 5 symbol. This problem is usually overcome by adding a leading zero if the desired number of characters is odd. There is another basic problem with Interleaved 2 of 5 code that results from its fairly simple start and stop patterns. (All codes have unique patterns at the beginning and end to indicate which way the code is being read.) That is, partial reads of the code symbol can happen. This is why Interleaved 2 of 5 is usually kept at a fixed length. The decoder is told to only report data on symbols that contain a specified number of characters. Again leading zeros can be used to pad the size of the code. Another way to overcome this problem is to use a check character. All barcode printing programs that we are familiar with support the generation of a check digit and all Custom Sensors Decoders can be programmed by the user to look for a check digit. The main advantage of this code is that the code symbol is more compact than other symbologies.
Code 39 - This code is probably the most popular industrial barcode format in use today. It can be used to encode both upper case alphabetic and numeric characters as well as some special characters. The beginning and end characters are always an asterisk (*). As with interleaved 2 of 5 the code uses narrow and wide bars along with narrow and wide spaces. The difference is that the encoding for a single character is made up of a pattern of bars and spaces, so there is no requirement for an even number of characters. Code 39 can use a check character to make it more secure. Barcode printing software should automatically calculate this character and append it to the code. The decoder will verify that the check character is correct if it is setup to do so. If you are planning to use a check digit for added security, make sure your printing and decoding equipment will both handle this requirement. If you need to use characters other than upper case alpha and the few special characters, consider using the full ASCII version of the code. Again, make sure your printing and decoding hardware can handle this.
Code 128 - Code 128 is a more complex, but more versatile code than any discussed so far. It actually has three different character sets to select from. One set encodes all upper case characters and all ASCII control characters. Another encodes all upper and lower case characters and a third encodes all numeric characters. Also, through the use of special characters, you can switch between character sets within a single code symbol. To accomplish this Code 128 uses four different bar and space widths, not just two as in most codes. This obviously puts more demands on the printing and decoding technologies. An example of Code 128 usage is the package tracking labels currently used by UPS. You will also note that in this application the code is made up of fairly large bars and spaces. This lessens the demand on the printing process and makes the code readable at a further distance.
What can we conclude from all of this? First you should limit your choice of code types to Code 39, Interleaved 2 of 5 or Code 128. Second, if you've got all numeric information to encode, then Interleaved 2 of 5 is your first choice; but only use it if you can make all your codes the same length (same number of characters), or use a check digit. Otherwise use Code 39. Third, if you have alpha characters to encode as well as numbers, then use Code 39. Determine if you need the standard version or the full ASCII version by the type of information you have to encode. Fourth, if you have to encode alphanumeric information and the Code 39 symbol turns out to be too long (you can't afford the space on your label) then look at Code 128. One of these three symbologies should be able to solve most any barcoding problem.
|
0.954944 |
For other persons named Benjamin Harrison, see Benjamin Harrison (disambiguation).
Benjamin Harrison (August 20, 1833 – March 13, 1901) was the 23rd President of the United States, serving one term from 1889 to 1893. Harrison was born in North Bend, Ohio, and at age 21 moved to Indianapolis, Indiana, where he became a prominent state politician. During the American Civil War Harrison served as a Brigadier General in the XXI Corps of the Army of the Cumberland. After the war he unsuccessfully ran for the governorship of Indiana, but was later elected to the U.S. Senate from that state.
Harrison, a Republican, was elected to the presidency in 1888, defeating the Democratic incumbent, Grover Cleveland. He was the first and only president from the state of Indiana. His presidential administration is best known for its economic legislation, including the McKinley Tariff and the Sherman Antitrust Act, and for annual federal spending that reached one billion dollars for the first time. Democrats attacked the "Billion Dollar Congress", and used the issue, along with the growing unpopularity of the high tariff, to defeat the Republicans, both in the 1890 mid-term elections and in Harrison's bid for re-election in 1892.
After failing to win reelection he returned to private life at his home in Indianapolis where he remarried, wrote a book, and later represented the Republic of Venezuela in an international case against the United Kingdom of Great Britain and Ireland. In 1900 he traveled to Europe as part of the case and, after a brief stay, returned to Indianapolis where he died the following year from complications arising from influenza.
The Harrisons were among the First Families of Virginia, with their presence in the New World dating back to the arrival of an Englishman, named Benjamin Harrison, at Jamestown, Virginia in 1630. The future president Benjamin was born on August 20, 1833, in North Bend, Hamilton County, Ohio, as the second of eight children of John Scott Harrison (later a U.S. Congressman from Ohio) and Elizabeth Ramsey Irwin. Benjamin was a grandson of President William Henry Harrison and great-grandson of revolutionary leader and former Virginia governor Benjamin Harrison V. Harrison was seven years old when his grandfather was elected President, but he did not attend the inauguration. Although Harrison's family was old and distinguished, he did not grow up in a wealthy household, as most of John Scott Harrison's farm income was expended on his children's education. Despite the meager income, Harrison's boyhood was enjoyable, with much of it spent outdoors fishing or hunting.
Harrison's early schooling took place in a one-room schoolhouse near his home, but he was later provided with a tutor to help him with college preparatory studies. Harrison and his brother, Irwin, enrolled in Farmer's College near Cincinnati, Ohio in 1847. Harrison attended the college for two years. In 1850, he transferred to Miami University in Oxford, Ohio, where he was a member of the fraternity Phi Delta Theta and graduated in 1852. Harrison attended Miami University with John Alexander Anderson, who would become a six term congressman, and Whitelaw Reid, who would be Harrison's vice presidential candidate in his reelection campaign. While attending Miami University, was greatly influenced by one his professors, Robert Hamilton Bishop, who instructed him in history and political economy. At Miami, Harrison joined a Presbyterian church and, like his mother, he would remain a member for the rest his life. After completing college Harrison took up the study of law in the Cincinnati law office of Storer & Gwynne, but before completing his law studies he returned to Oxford to marry.
While at Farmer's College, Harrison met Caroline Lavinia Scott, the daughter of the University's president, John W. Scott, a Presbyterian minister. On October 20, 1853, they married in Oxford, Ohio, with Caroline's father performing the ceremony. The Harrisons had two children, Russell Benjamin Harrison (August 12, 1854 – December 13, 1936) and Mary "Mamie" Scott Harrison McKee (April 3, 1858 – October 28, 1930).
After his marriage in 1853, Harrison returned to live on his father's farm where he finished his law studies. In the same year, he inherited $800 after the death of an aunt, using the money to move to Indianapolis, Indiana in 1854. He was admitted to the bar there and began practicing law in the office of John H. Ray. The same year he became a crier for the Federal Court in Indianapolis, making $2.50 per day. He was responsible for passing through the streets and declaring announcements from the court.
While in Indianapolis, Benjamin Harrison was both the first President of the University Club, a private gentlemen's club, and the first President of the Phi Delta Theta Alumni Club of Indianapolis, the fraternity's first such club. Both clubs were still in existence in 2008. Harrison grew up in a Whig household and was himself a supporter of Whig politics in his early life. He joined the Republican Party shortly after its formation in 1856 and that year campaigned on behalf of the Republican presidential candidate John C. Frémont. He won election to become Indianapolis City Attorney in the same election, a position that paid an annual salary of $400.
In 1858 Harrison entered into a law partnership, opening an office as Wallace & Harrison. Harrison was the Republican candidate for the position of reporter of the Indiana Supreme Court in 1860, his first foray into politics. Although this office was not political, he was an active supporter of his party's platform. During the election he debated Thomas Hendricks, the Democratic candidate for governor and future Vice President of the United States, on behalf of the Republican Party. After his law partner William Wallace was elected county clerk in 1860, Harrison opened a new firm with William Fishback, named Fishback & Harrison, where he worked until his entry into the army.
At the outbreak of the Civil War, Harrison wished to join the Union Army, but initially resisted, as he was concerned that his young family would need his financial support. In 1862, President Abraham Lincoln issued a call for more recruits. While visiting Governor Oliver Morton, Harrison found him distressed over the shortage of men answering the latest call. Harrison told the governor, "If I can be of any service, I will go". Morton then asked Harrison if he could help to recruit a regiment, though he would not ask him to serve. Harrison proceeded to raise a regiment, recruiting throughout northern Indiana. Morton offered its command to Harrison, but he declined because of his lack of military experience, and instead was commissioned as a Second Lieutenant. In August 1862, when the regiment left Indiana to join the Union Army at Louisville, Kentucky, Harrison was promoted by Morton to the rank of Colonel, and his regiment was commissioned as the 70th Regiment Indiana Volunteer Infantry.
The 70th Indiana first saw action in the Battle of Perryville, but spent most of the next two years performing reconnaissance duty and guarding railroads in Kentucky and Tennessee. In 1864, Harrison and his regiment joined William T. Sherman's Atlanta Campaign and moved to the front lines. On January 2, 1864, Harrison was promoted to command the 1st Brigade of the 1st Division of the XXI Army Corps. He commanded the brigade at the Battles of Resaca, Cassville, New Hope Church, Lost Mountain, Kennesaw Mountain, Marietta, Peachtree Creek and Atlanta. Harrison was later transferred to the Army of the Cumberland and participated in the Battle of Nashville. On March 22, 1865, Harrison earned his final promotion, to the rank of Brigadier General, and marched in the Grand Review in Washington, D.C. before mustering out of the army on June 8, 1865.
While serving in the army in October 1864, Harrison was reelected reporter of the Supreme Court of Indiana and served four more years. The position was not politically powerful, but did afford Harrison a steady income. Harrison's public profile was raised when President Grant appointed him to represent the federal government in a civil claim brought by Lambdin P. Milligan, whose wartime conviction for treason had been reversed by the Supreme Court. Due to Harrison's advocacy, the damages awarded against the government were minimal. Local Republicans urged Harrison to run for Congress, but he initially confined his political activities to speaking on behalf of other Republican candidates, a task for which he received high praises from his colleagues.
In 1872, Harrison entered the race for the Republican nomination for governor of Indiana. He was unable to get the support of former Governor Oliver Morton, who favored his opponent, Thomas M. Browne, and ultimately Harrison lost his bid for statewide office. Harrison returned to his law practice where, despite the Panic of 1873, he was financially successful enough to build a grand new home in Indianapolis in 1874. He continued to make speeches on behalf of Republican candidates and policies.
In 1876 Harrison did not initially seek his party's nomination for governor, but when the original nominee dropped out of the race, Harrison accepted the Republicans' invitation to take his place on the ticket. His campaign was based strongly on economic policy, and he was in favor of deflating the national currency. His policies proved popular with his base, but he was ultimately defeated by a plurality to James D. Williams, losing by 5,084 votes out of a total 434,457 cast. Harrison remained a prominent Republican in Indiana following his defeat, and when the Great Railroad Strike of 1877 reached Indianapolis, he helped to mediate between the workers and management and to preserve public order.
When Senator Morton died in 1878, the Republicans nominated Harrison to run for the seat, but the party failed to gain a majority in the state legislature, and the Democratic majority elected Daniel W. Voorhees instead. President Hayes appointed Harrison to the Mississippi River Commission in 1879, which was founded to facilitate internal improvements on that river. He was a delegate at the 1880 Republican National Convention the following year.
After Harrison led the Republican delegation to the National Convention, he was again mentioned as a possible Senate candidate. He gave speeches in favor of Garfield in Indiana and New York, further raising his profile in the party. When the Republicans retook the state legislature, Harrison's election to the Senate was threatened by his intra-party rival Judge Walter Q. Gresham, but the contest was decided in favor of Harrison. After President James Garfield's victory in 1880, Harrison was offered a cabinet position, but he declined in order to begin his term as senator.
Harrison served in the Senate from March 4, 1881, to March 4, 1887. He was chairman of the U.S. Senate Committee on Transportation Routes to the Seaboard (47th Congress) and U.S. Senate Committee on Territories (48th and 49th Congresses). The major issue confronting Senator Harrison in 1881 was the budget surplus. Democrats wished to reduce the tariff, thus limiting the amount of money the government took in; Republicans instead wished to spend the money on internal improvements and pensions for Civil War veterans. Harrison took his party's side and advocated for generous pensions for veterans and their widows. Harrison also supported, unsuccessfully, aid for education of Southerners, especially the children of the slaves freed in the Civil War, believing that education was necessary to make the white and black populations truly equal in political and economic power. Harrison differed from his party in opposing the Chinese Exclusion Act of 1882, believing that it violated existing treaties with China.
In 1884, Harrison and Gresham again opposed each other, this time for influence at the 1884 Republican National Convention. The delegation ended up supporting James G. Blaine, the eventual nominee. In the Senate, Harrison achieved passage of his Dependent Pension Bill only to see it vetoed by President Grover Cleveland. His efforts to further the admission of new western states were stymied by Democrats, who feared that the new states would elect Republicans to Congress.
In 1885, the Democrats redistricted the Indiana state legislature, which resulted in an increased Democratic majority in 1886, despite an overall Republican majority statewide. Harrison was defeated in his bid for reelection, the result being determined against him after a deadlock in the state senate, with the legislature eventually choosing Democrat David Turpie. Harrison returned to Indianapolis and his law practice, but stayed active in state and national politics.
Results of the 1888 election, with states won by Harrison in red, and those won by Cleveland in blue.
The initial favorite for the Republican nomination was the previous nominee, James G. Blaine of Maine. After Blaine wrote several letters denying any interest in the nomination, his supporters divided among other candidates, with John Sherman of Ohio as the leader among them. Others, including Chauncey Depew of New York, Russell Alger of Michigan, and Harrison's old nemesis Walter Q. Gresham, now a federal appellate court judge in Chicago, also sought the delegates' support at the 1888 Republican National Convention. Blaine did not choose any of the candidates as a successor, so none entered the convention with a majority of the Blaine supporters.
Harrison placed fourth on the first ballot, with Sherman in the lead, and the next few ballots showed little change. The Blaine supporters shifted their support around among the candidates they found acceptable, and when they shifted to Harrison, they found a candidate who could attract the votes of many delegates. He was nominated on the eighth ballot by 544 to 108 votes, winning the Republican presidential nomination. Levi P. Morton of New York was chosen as his running mate.
Harrison's opponent in the general election was incumbent President Grover Cleveland. He ran a front-porch campaign, typical of the era, in which the candidate does not campaign but only receives delegations and makes pronouncements from his home town. The Republicans campaigned heavily on the issue of protective tariffs, turning out protectionist voters in the important industrial states of the North. The election focused on the swing states of New York, New Jersey, Connecticut, and Harrison's home state of Indiana. Harrison and Cleveland split these four states, with Harrison winning by means of notoriously fraudulent balloting in New York and Indiana. Voter turnout was 79.3% because of a large interest in the campaign issue, and nearly eleven million votes were cast. Although Harrison received 90,000 fewer popular votes than Cleveland, he carried the Electoral College 233 to 168.
Although he had made no political bargains, his supporters had given many pledges upon his behalf. When Boss Matthew Quay of Pennsylvania, who rebuffed for a Cabinet position for his political support during the convention, heard that Harrison ascribed his narrow victory to Providence, Quay exclaimed that Harrison would never know "how close a number of men were compelled to approach...the penitentiary to make him President." Harrison was known as the Centennial President because his inauguration celebrated the centenary of the first inauguration of George Washington in 1789.
Civil service reform was a prominent issue following Harrison's election. Harrison had campaigned as a supporter of the merit system, as opposed to the spoils system. Although some of the civil service had been classified under the Pendleton Act by previous administrations, Harrison spent much of his first months in office deciding on political appointments. Congress was widely divided on the issue and Harrison was reluctant to address the issue in hope of preventing the alienation of either side. The issue became a political football of the time and was immortalized in a cartoon captioned "What can I do when both parties insist on kicking?" Harrison appointed Theodore Roosevelt and Hugh Smith Thompson, both reformers, to the Civil Service Commission, but otherwise did little to further the reform cause.
Harrison quickly saw the enactment of the Dependent and Disability Pension Act in 1890, a cause he had championed while in Congress. In addition to providing pensions to disabled Civil War veterans (regardless of the cause of their disability,) the Act depleted some of the troublesome federal budget surplus. Pension expenditures reached $135 million under Harrison, the largest expenditure of its kind to that point in American history, a problem exacerbated by Pension Bureau commissioner James R. Tanner's expansive interpretation of the pension laws.
Start your search on Benjamin Harrison.
|
0.999943 |
We specialize in coordinating custom trips to the most beautiful and interesting areas of Peru. what type of adventure you are looking for the guides at Cordillera Blanca will help make your stay in Peru most enjoyable. High Summit Peru is an Adventure travel company venturing into the Cordillera Blanca, Cordillera Huayhuash, Cusco, Arequipa, Puno areas. Some adventures include: Climbing Expeditions to the most beautifull mountain in the world ALPAMAYO; climbing expeditions to the highest mountain in Peru HUASCARAN; Hiking the Inka Trail Trek to Machupicchu, Tours to Sacred Valley in Cusco, Sailing on Lake Titicaca, and trekking through the jungle Tambopata and Manu.
|
0.997916 |
El Niño (meaning "Christ child") is a periodic climatic event described by the warming of surface water in the Southwestern Pacific and weakening or reversal of equatorial trade winds. The El Niño-Southern Oscillation (ENSO) is a dominant force that affects global climate patterns. It is especially pronounced in the central and eastern equatorial Pacific regions of South America and Australia. ENSO events occur, on average, every two to seven years. These events are highly variable both in frequency and intensity, however, and their origins are still unknown to science.
During ENSO events, the classic Walker Cell either weakens or reverses, which leads to warm water propagating across the Pacific. This warm, low pressure system rises in the Eastern Pacific, which brings increased rain and flooding to Chile and Peru. Along the coast of South America, there is reduced nutrient upwelling. The colder, nutrient rich water does not rise to the surface, which leads to fishery collapse.
Across the Pacific Ocean, in Australia, the opposite processes occur. Descending low pressure systems led to a reduction in precipitation. This places Australia at risk for both drought and forest fires. Drought conditions in Asia have led to sever famine in China and India over the past few centuries.
Often increased precipitation, flooding, and weakening of trade winds are typical patterns for an El Niño event. With the warming of the sea surface temperatures and slowing of trade winds, fisheries start to collapse, and there is a positive feedback of other ecosystems failing. El Niño events have increased dramatically over the past 50 years and it is believed to be induced by anthropogenic factors.
|
0.999999 |
More detail on this person: Bruce Earl Darley UT United States Bruce Darley, 72, of Logan, Utah, formerly of Hyrum, Utah, passed away at home with his wife and family at his side on Sept. 6, 2009, after a 35-year struggle with Parkinson's disease. Bruce was born Oct. 24, 1936, in Brigham City, Utah, to J. Earl and Berenece Brunker Darley. He spent his first 12 years growing up at the family home in Portage, Utah. His family then moved to Hyrum, Utah. Bruce enjoyed his time there helping with the family farm. He graduated from South Cache High where he was active in many clubs and excelled in several different sports. After serving two years in the Northern States Mission, he attended Utah State University and graduated with a composite degree in psychology and minor animal husbandry. Bruce enrolled in the ROTC program while at USU and began a lifelong dream of learning to fly. After graduation, Bruce entered active military duty and attended flight school at Camp Wolters, Texas, and Fort Rucker, Ala. He served in Vietnam and was decorated with the Bronze Star and an Air Metal for valor. Bruce was honorably discharged in 1968. Bruce married Nina Lee Cooper and to that union were born five children: Lisa, Layne, Lance, Landon and Ladd. They were later divorced. Bruce served six years on the Hyrum City Council and eight years as the mayor of Hyrum. He taught seminary at Sky View High School for two years then began a 22-year career with Utah State University until Parkinson's disease forced his retirement in 1991. As part of his work at USU, he participated in the creation of the Summer Citizen Program and was a director of that program. Many summer citizens remember him and speak highly of him. In February of 2000 Bruce married Ayako Maeda Pease, and they moved to Mountain Home, Idaho. Bruce's health continued to deteriorate and Ayako eventually resigned her position to spend full time caring for Bruce. They then moved back to Cache Valley to be closer to family and friends, settling in Logan, Utah. Throughout his life church was very important to him. He served in many church positions as a member of The Church of Jesus Christ of Latter-day Saints, including bishop and as a counselor in a stake presidency. He loved golf, hunting, camping and fishing with his sons. He enjoyed working and playing on the family farm. Bruce enjoyed life and greeted everyone with his characteristic twinkle in the eye. He loved everyone he met. He never did complain about his Parkinson's disease; he just took it in stride as part of his life. Bruce spent most of his life in community service and serving others. It was his special gift to make others feel good about themselves. Bruce was preceded in death by his father and mother. He is survived by his companion, Ayako; his children: Lisa, Layne (Annette), Lance (Josi), Landon (Teri), Ladd (Erica); his stepchildren: Heidi, Christopher and Chanel Pease (Mark Hellner); two brothers: Ralph (Sherien) and Dennis (Barbara). He has nine grandchildren. Bruce will be missed by his family and many friends. Bruce and Ayako belonged to the Cache Valley Parkinson's Support Group and were grateful for the support and camaraderie they had with the other members of that group. The family wishes to thank those who helped in Bruce's care during the final year of his life: doctors Lars Bergeson, Hal Astle, Ryan Larsen; Integrity Home Health and Hospice, BRAG Aging Program, Options for Independence, friends and neighbors. Funeral services will be held at 11 a.m. Friday, Sept. 11, 2009, at the Hyrum North Stake Center, 245 Apple Drive, Hyrum, Utah. Friends and family may call from 6 to 8 p.m. Thursday at Nelson Funeral Home, 162 E. 400 North, Logan, and from 9:30 to 10:30 a.m. Friday at the church prior to services. Interment will be in the Hyrum City Cemetery.
|
0.586463 |
HABIT 1: BE PROACTIVE: Proactive kids are responsible for their own actions. They recognize they are making their own choices and are empowered by that understanding.
Use positive language. - try avoiding phrases like "I can't" or "I won't"
How can you begin with the end in mind?
Set goals- knowing where you want to be will help you figure out how to get there.
Budget your money- think about how you spend your money. Should you save it for something special later, or get something not as important now?
How can you put first things first?
Make a to-do list and prioritize important things. - Clean your room before you play outside. Help your mom with the dishes before you leave the kitchen after dinner.
Do your classwork before you have free time. - Check your classwork folder to make sure you've turned in all require assignments before you play on the computer or read a book.
Study even if you don't have a test the next day.- If you study a little each day, it's better than studying for 2 hours the night before a test.
How can you think win-win?
Be cooperative. - Have an open minded attitude instead of a "my way or the highway" outlook.
Be considerate. - Think about what other people want, not just what you want.
Be a good problem solver. - Find ways to make both sides happy without having to compromise.
How can you seek first to understand, then to be understood?
Listen with your eyes, ears, and heart. -Try to make eye contact when someone is talking to show them that you're paying attention. Use your ears to hear what they have to say and how they feel. Lastly, use your heart to empathize with them and care about what they are sharing with you.
Repeat back what you hear. -To make sure you really understand, repeat what the other person said.
Help friends when you see them having a misunderstanding. -Help them take turns explaining their sides of the story. Remind the other person that it is not their turn to talk yet. After they listen to the other person, they'll get their chance to share their feelings. When that time comes, make sure the one who already shared listens to other as well.
Use cooperative learning strategies at school. - When you're working on a group project, share everyone's ideas. Work together to brainstorm ways to use those ideas to create a project.
Help other people. - If you and your brother both need to clean your rooms before you can play, why not team up. You can both clean his room, then you can both clean yours. Both rooms will get cleaned better and faster, and then you can play.
Share victories. - If you play on a sports team, don't let one player do all the action. Use each player's individual strengths to make the best team possible.
How can you sharpen the saw?
Play outside, stretch, go for a walk, sing, meditate, do yoga, volunteer, visit with friends, spend time with your family, play games, make new friends, have fun with your pets, etc.
|
0.940248 |
surprise with tagging interfaces today.
is known. In this case, it is not.
|
0.993745 |
tender, 4 to 5 minutes.
are tender, 10 to 15 minutes.
Spoon over the hot pasta and toss. Servings: 4.
Variation: Substitute spaghetti for the angel hair pasta.
|
0.999914 |
A is as ○○ as B.
"A is not as ○○ as B."は"AはBほど○○でない"
|
0.9964 |
A quantum computer is a highly-advanced computer system that works exponentially faster than today’s conventional computers. Quantum computing is the practice of studying quantum computers and their potential. This practice is growing and has caused the rapid decrease in the size of computers at the same time as these systems are rapidly increasing in their capability. However, quantum computers are still being developed and have not yet become accessible.
A quantum computer is an advanced computer system. Quantum computing studies theoretical computation systems which use quantum-mechanical phenomena (e.g., superposition, entanglement) to perform data operations. While the average computer’s memory is made up of bits, a quantum computer’s memory is made up of qubits. A regular computer saves information in binary form using zeroes and ones, which are called bits. These strings of numbers, which are comprised of 0s and 1s, create codes that instruct the computer on how to proceed. However, a qubit in a quantum computer is a particle (e.g., atom, electron, photon) which is manipulated to store information. It is a two-state quantum-mechanical system, such as the polarization of a single photon, which can be vertical and horizontal polarization. So, the particle is manipulated in its quantum properties, like its spin or polarization, and can have multiple properties. Because of the flexibility and variation of qubits, more information can be stored on a quantum computer. Most importantly, information can be processed at an exponentially faster rate. For example, a problem that would take a conventional computer several minutes to solve due it its complexity, could be solved in less than a second by a quantum computer. This is because today’s conventional computers must go through each problem one step at a time, where a quantum computer has the ability to solve multiple problems instantaneously.
What are the legal ramifications of quantum computing?
Quantum computers have the ability to affect many industries, including, but not limited to, technology, financial, pharmaceutical, and automotive sectors. The positive effects of quantum computers seem real and exciting. For example, new scientific discoveries can bring valuable benefits towards society. However, the regulation of this new technology is a major concern. This is especially true because quantum computers are able to decipher (i.e., decrypt) encrypted information at a remarkable speed. This can lead to privacy concerns when the confidential information of consumers has been uploaded onto the cloud, with the assumption that it is safe because it is encrypted. In other words, communications between consumers and financial institutions could be accessed by anyone with a quantum computer.
One question is whether the National Security Agency should be permitted to use quantum computers in order to gain access to information? At this time, Google is probably working on methods to repel the attack of the NSA quantum computer. What happens if a quantum computer is used to hack into third-party computers? These are issues that will be unfolding in the near future.
At our law firm, we assist clients with legal issues related to internet, technology, and privacy laws. You may contact us to set up an initial consultation.
|
0.999925 |
Entertaible concept: combination of electronic gaming and traditional board games. The Entertaible concept is a tabletop gaming platform that marries traditional multi-player board and computer games in a uniquely simple and intuitive way. Entertaible comprises a 32-inch horizontal LCD, sophisticated touch screen-based multi-object position detection, and all supporting control electronics. It allows the players to engage in a new class of electronic games which combines the features of computer gaming, such as dynamic playing fields and gaming levels, with the social interaction and tangible playing pieces, such as pawns and dies, of traditional board games.
Initially targeting social gaming away from home in locations such as pubs, bars, hotels or restaurants, Entertaible has the potential to evolve into a gaming platform for the consumer market.
|
0.991385 |
Текст: Discussing engine-room matters. Dialogue 5.
Discussing engine-room matters. Dialogue 5.
E.: Hello, how are you today? Let's go to my cabin.
A.: I'm fine, thank you. Let's go.
E.: I've got a request for you. The matter is we need a vertical centrifugal pump badly.
A.: I don't think it'll make a problem,Sir. What do you need this pump for?
E.: The pump's duty is to deliver water and foam to the monitors installed aboard. You know that fire-fighting facilities are very important for tankers. And yesterday's inspection showed that one of our pumps is out of order.
A.:You are right., fire-prevention is of vital importance for all ships, especially for tankers. Well, what are the technical data for the required pump?
E.: The pump capacity required is 50 cu. m. per hour at a head of 30 m.
A.: Good. Will you wait a little bit. I'll make a phone call to our technical suppliers.
Well, Sir, we can supply you with such a pump.
E.: I'm deeply satisfied that me have solved the problem.
E.:When will supply us with this pump?
A.: I think tomorrow by noon.
E.:Great! I appreciate your help very much. Good bye.
|
0.999434 |
When the subject of evolution comes up, many people imagine that this is a scientific problem—and that for anyone less knowledgeable than scientists, Darwinism is impossible to understand. They assume it's pointless to argue the issue, one way or the other. Indeed, Darwinists employ Latin words and scientific terms generally unfamiliar to the public in order to encourage this mistaken idea. They engage in complicated descriptions and frequently resort to demagoguery and hollow slogans in order to give the impression they are discussing a highly scientific matter.
In fact, however, Darwinism's basic claim is completely unscientific, and its logical poverty is so obvious that even primary school age children can see it. According to Darwinism, in some unexplained manner, the first cell supposedly formed in the Earth's primeval environment, in a pool of muddy water. And out of that single cell, a literally endless series of coincidences later gave rise to animals, plants, human beings and civilizations. In other words, all of mankind, as well as the entire plant and animal kingdoms, are supposedly the work of an ideal quantity of mud, a long period of time and plentiful coincidences.
According to Darwinists, who are suffering from an obvious logical deficiency, these materials, each one of which is unconscious, gave rise to human beings possessed of reason and conscience, who think, love, feel compassion, possess sound judgment, produce paintings and statues, compose symphonies, write novels, build skyscrapers, construct nuclear reactors, discover the causes of diseases and manufacture drugs to cure them, or engage in politics. They claim that when sufficient time had passed, lions, tigers, rabbits, deer, elephants, cats, dogs, moths, flies, crocodiles and birds all evolved by chance from muddy water. A whole range of fruits and vegetables, with their own unique tastes and smells—oranges, strawberries, bananas, apples, grapes, tomatoes, peppers—flowers with their matchless appearances and other plants all emerged from that same mud.
In short, ever since Darwin's time, countless articles, papers, films, newspaper reports, magazine articles and television programs have repeated the evolutionist scenario in which all of life emerged by chance from mud. In other words, if you ask a Darwinist "How did our civilization arise?" or, "How did such a wide range of life forms come into being?" or, "How did mankind come into existence?" the essential answer you will receive is this: Coincidences gave rise to all these things from mud, over the course of time.
One would doubtless need to be devoid of reason or lack any facility for understanding in order to believe such a tale. Yet surprisingly, that very irrational and illogical theory has had its adherents for many years and is still being propagated constantly under a scientific guise.
The theory of evolution, first proposed under the primitive conditions of the 19th century, has been disproved by advances in science and technology. It has been recognized that Darwin's claims are totally unrealistic: Natural selection and mutations, cited as the mechanisms that drive the process of evolution, have no effects of the kind envisaged by Darwinists. In short, it is impossible for them to give rise to new species.
Crocodiles are one example of living fossils. They appeared with all their physical structures fully formed and have survived down to the present day without undergoing any change at all over a period of around 100 million years (there are crocodile fossils dating back 140 million years). The fact that there is no difference between the 100-million-year-old fossil crocodile in the picture and those alive today once again emphasizes this fact.
The final death blow to Darwinism was dealt by the fossil record. Darwin claimed that all the millions of different life forms had come into being through descent from a supposed single common ancestor. In order for his claim to be verified, there should be traces in the fossil record—an irrefutable document of natural history—of this supposed primitive ancestor and of the various life forms that developed from it. For example, if all mammals were descended from reptiles, as evolutionists maintain, then there would have to be fossil remains of a series of half-mammalian, half-reptilian life forms. To date, millions of fossils, belonging to a great many species, have been unearthed during excavations. Yet not a single one showing a transition between species has ever been found. Every fossil ever found shows that each living thing emerged suddenly, with all its characteristics complete. In other words, every species of plant and animal was created.
Confronted by this fact, evolutionists have resorted to various falsehoods. They have produced hoaxes—counterfeit, artificial fossils that have come to be regarded as disgraces to paleontology. They have tried to deceive the lay public by tampering with genuine fossils of extinct life forms and inventing a series of imaginary scenarios.
The diagrams of the evolution of the horse, which evolutionists propose solely on the basis of their own imaginations, are not scientific. They are obtained by laying out fossil specimens of species that lived in different parts of the world and at different times. The fact is that no such evolutionary process ever happened.
One of the best known of them is the so-called "evolution of the horse." Fossils belonging to entirely different species that once lived in India, South America, North America and Europe were arranged in order of size—from small to large—in the light of evolutionist imaginations. So far, different researchers have come up with more than 20 different equine evolution scenarios.
Moreover, it has been established that breeds of horse living today have also been discovered in the same rock strata as Eohippus.20 This means that the horse and its supposed ancestor were both living at the same time, which proves that the horse never underwent any such process as evolution.
Using the skulls of extinct apes and various races of humans that once lived in the past, evolutionists seek to establish an imaginary family tree. However, the scientific evidence denies them the opportunity.
The invalidity of the "equine series" proposed by evolutionists also applies to birds, fish, reptiles and mammals, in short, to all living things, to their supposedly common ancestors and supposed family trees. It has been determined that every fossil species suggested as being the ancestor of some other living thing either belongs to an independent extinct life form or is the result of evolutionists tampering with fossils of the species in question.
Darwinism has been exposed as the most wide-ranging and astonishing deception in the world's history. That millions have been taken in by this deception, as if hypnotized, and have been influenced by all of Darwinism's illogical claims, is truly miraculous. The support lent to the theory of evolution and the acceptance it has enjoyed up to now are the result of tricks played on mankind by satan, who urges vast numbers of people towards Darwinism.
Until recently, no one had the courage to unmask this ruse of satan's and to publicize the true facts. But in the present century, the response to this deception has finally been laid out in full detail, and the public has been made fully aware of the state of affairs. By the will of God, the collapse of Darwinism has advanced beyond any point of recovery. Indeed, that is the fundamental reason for the panic in the Darwinian global empire.
19. F. Hitching, The Neck of the Giraffe: Where Darwin Went Wrong, New York: Ticknor and Fields, 1982, pp. 30-31.
20. F. Hitching, The Neck of the Giraffe, pp. 30-31.
|
0.961773 |
The only large cat with stripes, tigers live in fragmented habitats throughout eastern and central Asia. Their fur usually is orange, with southern species displaying rich, almost reddish hues and northern species showing paler coloration. Black or brown stripes appear not only on their fur but also on their skin. Tigers' fur actually helps them blend into their environments.
Tigers’ stripes help conceal them in their preferred habitats, such as grasslands and forests, where shadows and branches create a stippling effect that matches the stripes. Combined with many animals’ lack of color perception, this effectively enables tigers to remain camouflaged while they stalk their prey. Ambush attackers, before striking they creep to within 15 to 30 feet of potential prey, which includes deer, elk, water buffalo, feral pigs and other large ungulates, as well as bears, young rhinos and even elephants.
Tigers live in a range of environments, from tropical areas in southern Asia to subfreezing zones of Siberia, where temperatures can dip to 40 degrees below zero Fahrenheit. Fur helps the northern subspecies, such as the Amur or Siberian tiger, survive extreme cold; they have longer, thicker and denser fur than southern subspecies, and they grow heavier coats during the winter months. In warmer climates where tigers need to cool off, they take advantage of their camouflaging stripes to lounge in shadowed streams and ponds.
Like human fingerprints, no tiger's stripes are exactly the same as another's, although subspecies have similarly shaped markings. While people might have trouble distinguishing individual tigers based only on stripes, it’s possible that the distinct patterns, along with scent markings, help tigers identify each other.
The greatest threat to tigers’ survival is humans. Their beautiful fur serves as a significant incentive for poachers, and a black-market trade exists for fur coats, wall hangings and rugs. Their bones are valued in traditional Chinese medicine. Along with habitat destruction, excessive hunting has decimated some subspecies, such as Siberian, South China and Sumatran tigers, which now are critically endangered. Conservationists believe that tigers' beautiful appearance and charismatic charm can help preserve the species. Zoos are implementing species survival plans, and ecotourism programs have launched in some areas with large tiger populations.
In Which Countries Do Black Leopards Live?
|
0.999977 |
Based off of the James Hetfield lyrics in the song "Master Of Puppets," describe why someone would continue to engage in behavior that is self-damaging, expensive, and time consuming. What effect does past consumption have in an addictive setting? How does an addiction make sense economically? You might want to refer to the article "A Theory of Rational Addiction" by Gary S. Becker and Kevin M. Murphy.
|
0.994468 |
I recently visited my local Costco, on Commerce Drive in Rochester, MN. I was especially interested in finding out what Costco carries for people with diabetes, or for anyone trying to maintain a healthy lifestyle.
My first stop was at prepared foods. In addition to cooked meats and other ready-to-eat meals, this section has a great selection of salads.I was especially excited about the quinoa salad, which is loaded with protein and fiber to help keep blood sugar levels stable.
Next, I went to the meat and seafood department. I was impressed by the large selection of organic chicken and healthy fish, like cod and salmon, which are great choices for people with diabetes.
The third stop on my tour was the produce department, where I was amazed by the huge selection of fruits and vegetables. There were eight different varieties of apples, vegetable trays, citrus, and beautiful tomatoes. I was really excited to see pre-cooked beets, which are perfect for adding to salads and casseroles, as well as easy to prepare cubed butternut squash and the Sweet Kale Vegetable Salad kit.
In the beverage section, I found a surprising variety of sugar-free and low-sugar beverages, including sparkling water, sugar-free and diet tea, and almond milk.
Wandering up and down the aisles I saw so many more items that are great for people with diabetes or anyone trying to eat healthier. I found Greek yogurt, quinoa and kale, frozen vegetables, oats, peanut butter powder and black beans to name just a few. I took home some tortilla crusted tilapia, and it was delicious on top of a green salad.
Finally, I went to the pharmacy and vitamins/supplements department. Here, I was looking for products that help people with diabetes keep their blood sugar levels under control and prevent complications from their diabetes. Costco carries CinSulin, a cinnamon supplement whose benefits including maintaining insulin levels and aiding in lowering cholesterol. I was impressed by the large selection of Nature Made vitamins, including Fish Oil, Magnesium and Super B Complex. Other supplements I saw were Kirkland Signature CoQ10, which acts as an antioxidant and helps with the digestion of food as well as protecting heart and skeletal muscles, and Cosamin, which helps keep joints healthy. Costco also carries liquid meal supplements like Glucerna, a low carbohydrate and low glycemic index drink for those who are on the go and need a quick snack.
Costco carries many personal care items in the pharmacy section, such as Colgate Total toothpaste. This is important for people with diabetes, as dental health is your first line of defense against many diseases.
After discovering the wonderful variety of items during my tour of Costco, I can safely say that Costco is your one-stop shop for healthy living with diabetes.
|
0.950348 |
As a result of the many mass school shootings that have become commonplace within America, many are advocating for tightened gun control. While the response to gun violence and ownership is predictably left or right, many do not know what one prominent institution (the Catholic Church) has to say about it.
The Vatican, known for its strong stances on global warming and other prominent social issues in recent years, has yet to officially comment on calls for gun control. And given the well-known pro-life stance of the Catholic Church, it begs to question where exactly it stands on the issue.
To help comprehend what the Church believes in regard to gun control, I asked Mr. Schueler, theology teacher, what he believed the answer to be.
We can argue that the Church does not need to take a stance on gun control because of the various countries it represents. America does have an affinity for its Second Amendment rights, though. As a result, a chief source for the Catholic view on gun control in America is none other than the United States Catholic Conference of Bishops.
According to their website, the USCCB says they have supported a “number of reasonable measures” that includes “a total ban on assault rifles.” However, the USCCB does not stop there. They also call for other gun control, such as limiting the sale of “high-capacity weapons and ammunition magazines,” laws that criminalize the trafficking of guns, background checks, handgun regulations, and child locks on guns. The USCCB goes deeper, encouraging “increased resources” and access to mental healthcare, which is often used as a factor in mass shooters’ decisions.
The USCCB offers insight into how the Catholic Church views gun control, as it has backing from the Vatican. However, the Vatican has yet to officially endorse any specific gun control laws in America.
The Catholic Church is not opposed to the Second Amendment, but it emphasizes a respect for life. If the Second Amendment interferes with life, then we, as Catholics, should take notice.
So while the Church does not adhere to a far right or far left stance on gun control, it encourages finding a balance between preserving life and preserving personal rights.
|
0.968092 |
HP in September appointed Leo Apotheker, former CEO of enterprise software maker SAP, as CEO. Apotheker had served on the SAP executive board since 2002 and was named co-CEO of SAP in 2008. His software background makes him an ideal candidate to lead the company as it takes a more serious look at the software business.
HP's executive vice president of software and solutions, Bill Veghte, spent nearly 20 years at Microsoft, where he served as senior vice president for the company's $15 billion global Windows business. HP hired Veghte in May, signaling a move to make a bigger splash in the software industry.
Marge Breya, a seasoned software executive with roots in Sun Microsystems' Java camp, serves as general manager for Software & Solutions at HP, with responsibility for all aspects of the unit's marketing worldwide, including execution of go-to-market strategy and coordination of an integrated, global marketing program that help enable the field. She also is a member of the HP Software & Solutions leadership team tasked with driving overall business strategy.
HP had already begun making noise in software, but one of its key early acquisitions was Bluestone Software in 2000. Bluestone made a Java 2 Platform, Enterprise Edition application server and provided Internet software platforms, tools and technologies for business-to-business, business-to-consumer and mobile Internet transactions. The deal expanded HP's Internet software portfolio.
HP acquired Peregrine in December 2005. Peregrine made IT asset and service management software and was bought for $425 million, enabling HP Software to deliver a more complete management software.
HP acquired Mercury for $4.5 billion in November 2006. Mercury Interactive was an application quality management, business service management, and project and portfolio management software vendor, and the company's software provides the core for the new ALM 11 technology HP announced Nov. 30.
HP bought Bristol in February 2007. This acquisition added monitoring of complex business transactions across heterogeneous and distributed IT environments.
HP in June 2007 acquired SPI Dynamics, which made application security software that allows customers to assess and identify security vulnerabilities of Web applications throughout their life cycle as part of their application quality management. SPI Dynamics software makes up part of the new HP Hybrid 2.0 security technology.
HP bought Opsware in September 2007 for $1.6 billion. The acquisition of the data center automation software company enhanced HP's BTO (business technology optimization) software portfolio to deliver a comprehensive and fully integrated solution for service automation.
HP in April 2008 acquired Tower Software, a document and records management software company, to broaden e-discovery and compliance management solutions for government and highly regulated commercial organizations. Combined, HP and Tower offer integrated electronic records management, information archiving and record retention—all in a single portfolio.
With the acquisition of Fortify, HP will offer a complete solution that helps organizations reduce business risk, meet compliance regulations and protect against malicious application attacks by integrating security assurance seamlessly across the application life cycle. HP and Fortify's history of collaboration includes the introduction in February of Hybrid 2.0, a security analysis technology that strengthened an earlier integration announced in June 2009. HP completed its acquisition of Fortify in September.
HP bought Stratavia, a privately held database and application automation company, in September. The acquisition will strengthen the HP Software and Solutions portfolio, adding deployment, configuration and management solutions for enterprise databases, middleware and packaged applications. Stratavia's database and application automation solutions, combined with HP's BSA (business service automation) portfolio, give organizations a one-stop shop for infrastructure and application deployment management. Stratavia offerings also enhance the HP Cloud Service Automation solution by simplifying and automating the deployment of databases, middleware and packaged applications in cloud computing environments.
HP closed its purchase of ArcSight in October. The combination of HP and ArcSight will improve security, reduce risk and facilitate compliance at a lower cost for customers. ArcSight's technology is complementary to HP's existing security portfolio of hardware, software and services. Integrating ArcSight's technology with HP's IT operations management portfolio will enable organizations to converge millions of events across IT operations and security, providing deeper context than either platform alone.
HP's new ALM 11 technology simplifies application development with a single unified system for developer, QA and security teams. It will reduce delivery time and costs by 50 percent, and accelerate application delivery. It also will mitigate risks by proactively securing applications, reducing application defects more than 80 percent compared with the industry average.
HP's BTO solutions ensure that every dollar invested in technology, every resource allocated, and every application or service in development or production delivers against defined business objectives. HP Software's BTO portfolio combines ArcSight, Fortify, Stratavia, OpenView, Peregrine, Mercury and Opsware strengths to enhance IT management; bolster application security; link IT performance, costs and planning; and automate critical IT functions across strategy, applications and operations.
These solutions help clients manage both structured and unstructured information to make more informed business decisions and improve operational efficiencies. The portfolio includes governance and e-discovery, business continuity and availability, and document workflow transformation tools.
These solutions help clients realize the full value of BI investments by leveraging industry and business expertise. The portfolio includes enterprise-class business intelligence solutions consisting of services, software, hardware and partner technologies.
These solutions help CIOs improve the predictability of business outcomes at every stage of a project life cycle. HP offers a comprehensive and flexible range of services to help clients be successful throughout the life cycle, including professional, support and SAAS (software as a service).
HP TRIM 7 is a records management solution built on 24 years of experience and best practices, enabling organizations to transparently manage all of their Microsoft SharePoint Server records in a single environment. This includes documents and information in SharePoint Server blogs, wikis, discussions, forms, calendars and workflows.
Based on HP Quality Center software and HP ALM services, HP Agile Accelerator manages Agile development projects from proposal to production while helping IT departments better meet application modernization initiatives. HP Agile Accelerator helps software development teams improve the efficiency and cost-effectiveness of their business initiatives with predefined workflows, configurations and user reports.
HP Service Test Management 10.5 and the enhanced HP Functional Testing 10.0 enable clients to focus their time on application quality while improving the line of sight between development and quality assurance teams. HP Service Test Management 10.5 helps clients mitigate risk and improve business agility.
The software ensures application quality to address changing business demands. With the new Web 2.0 Feature Pack and Extensibility Accelerator, HP Functional Testing now provides comprehensive support for dynamic Web 2.0 applications and enables testing of any rich Internet applications technology with a single product. The new solutions are part of the HP ALM portfolio.
The HP ten.to.one initiative includes HP LoadRunner in the Cloud application performance testing offering designed to help IT organizations optimize their Website performance for changing business demands. It's available via Amazon Elastic Compute Cloud. HP Data Protector with Hyper-V gives customers eight methods of protection when running environments using Microsoft Hyper-V Server 2008 R2. HP SiteScope Operations Manager offers midsize organizations a way to more easily and more quickly monitor IT infrastructures and applications.
HP BSM 9.0 improves IT operations by enabling staff to manage application performance and availability to meet service-level agreements. HP BSM 9.0 provides a run-time service model, new collaboration capabilities using Web 2.0 mashups and automation of the entire event resolution process to reduce troubleshooting costs. The announcements came out of the HP Universe D.C. show in June.
|
0.973517 |
For the Scottish constitutional lawyer and scholar of Sanskrit, see Arthur Berriedale Keith.
Sir Arthur Keith FRS (5 February 1866 – 7 January 1955) was a Scottish anatomist and anthropologist, and a proponent of scientific racism. He was a fellow and later the Hunterian Professor and conservator of the Hunterian Museum of the Royal College of Surgeons of England. He was a strong proponent of Piltdown Man, which was proved to be a forgery shortly before his death.
A leading figure in the study of human fossils, he became President of the Royal Anthropological Institute. The latter role stimulated his interest in the subject of human evolution, leading to the publication of his book A New Theory of Human Evolution, in which he supported the idea of group selection.
Where others had postulated that physical separation could provide a barrier to interbreeding, allowing groups to evolve along different lines, Keith introduced the idea of cultural differences as providing a mental barrier, emphasising territorial behaviour, and the concept of the 'in-group' and 'out-group'. Man had evolved, he claimed, through his tendency to live in small competing communities, a tendency which was at root determined by racial differences in his 'genetic substrate'. Writing just after World War II he particularly emphasised the racial origins of anti-Semitism, and in 'A New Theory of Evolution' he devoted a chapter to the topics of anti-Semitism and Zionism in which he argued that Jews have survived by developing a particularly strong sense of community between Jews worldwide based around cultural practices rather than homeland, while applying the 'dual code' in such a way that perceived persecution strengthened their sense of superiority and cohesion.
He is also famous for discovering the sinoatrial node, the component of the heart which makes it beat, with his student Martin Flack in 1906.
He was born at Quarry Farm near Old Machar in Aberdeenshire , the son of John Keith, a farmer, and his wife, Jessie Macpherson. He was educated at Gordon's College in Aberdeen.
He obtained a Bachelor of Medicine at the University of Aberdeen in 1888. He travelled to Siam on a gold mining trip in 1889 where he gathered plants for Royal Botanic Gardens, Kew in London in his capacity as a plant collector assistant for the Botanical Survey of the Malay Peninsula.
On returning to Britain in 1892, Keith studied anatomy at University College London and at the University of Aberdeen. It was at Aberdeen where Keith won the first Struthers Prize in 1893 for his demonstration of ligaments in humans and other apes. In 1894, he was made a fellow of the Royal College of Surgeons of England. In 1908, as he says in 'A New Theory of Evolution', he was 'put in charge of the vast treasury of things housed in the Museum of the Royal College of Surgeons', which brought about a shift in his interest from anatomy to the pursuit of 'the machinery of human evolution'.
He studied primate skulls, and in 1897 he published An Introduction to the Study of Anthropoid Apes. Other works include Human Embryology and Morphology (1902), Ancient Types of Man (1911), The Antiquity of Man (1915), Concerning Man's Origins (1927), and A New Theory of Human Evolution (1948).
Keith was editor of the Journal of Anatomy between 1915 and 1936 and elected President of the Anatomical Society of Great Britain and Ireland for 1918 to 1920. He gave the 1927 presidential address (Darwin's Theory of Man's Descent As It Stands To-day) to the British Association meeting in Leeds.
He was elected a Fellow of the Royal Society in 1913. He was knighted in 1921, and he published New Discoveries in 1931. In 1932, he helped found a research institute in Downe, Kent, where he worked until his death.
In 1899 he married Cecilia Caroline Gray (d.1934). They had no children.
He died in Downe House in Kent on 7 January 1955.
British anthropologists Keith and Grafton Elliot Smith were both fixed on European origin of humankind and were in opposition to models of Asian and African origin.
In 1925 Raymond Dart announced the discovery of Australopithecus africanus, which he claimed was evidence for an early human ancestor in Africa. The British anthropologists of the time, who firmly believed in the European hypothesis, did not accept finds outside of their own soil. Keith, for example, described “Darts child” as a juvenile ape and nothing to do with human ancestry.
In conjunction with his Eurocentric view on human evolution in Europe as being separate from Africa, Keith shared scientific racist views with a number of other intellectuals and writers during the 1920s, often based on Galtonism and the belief that opposition to cross-breeding in animals could be applied to miscegenation. In 1931, with John Walter Gregory, he delivered the annual Conway Hall lecture entitled Race as a Political Factor. The lecture contained as its abstract: The three primary racial groups within the human species are the Caucasian, mongoloid and negroid. From analogy with cross-breeding in animals and plants, and from experience of human cross-breeding, it can be asserted that inter-marriage between members of the three groups produces inferior progeny. Hence racial segregation is to be recommended. However, the different races can still assist, and co-operate with, each other, in the interests of peace and harmony.
Keith was a strong proponent of the Piltdown Man. Piltdown: A Scientific Forgery, written by the anthropologist Frank Spencer after completing the research of Ian Langham (an Australian historian of science who suspected Keith, and died in 1984), explored the link between Keith and Charles Dawson and suggested it was Keith who prepared the fake specimens for Dawson to plant. Phillip Tobias details the history of the investigation of the hoax, dismissing other theories, and listing inconsistencies in Keith's statements and actions. More recent evidence points to Martin Hinton, but the case remains open.
Concerning Man's Origins, a book based on his Presidential Address at the British Association in 1927, contains a chapter entitled 'Capital as a Factor in Evolution' in which he proposes an interesting explanation for Britain's leading role in the development of industrial society. Essentially he argues that the cold unwelcoming climate of Britain selected those who came here for a special ability to store food and supplies for the winter – those who didn't died out. This 'capitalism' provided a secure way of life with time to think and experiment, for a population that had been selected for inventiveness and resourcefulness. Out of this special population sprang the Industrial Revolution, centred on the colder Northern counties of England like Lancashire and Yorkshire where the high-tech developments of the time took place in spinning and weaving. This is a rare book today, which does not appear to be available as a reprint.
An address given to Students at Aberdeen University. Keith’s concluding sentences in this book sums up his thesis : "Even in the modern world we must listen to the voice of Nature. Under the control of reason, prejudice has to be given a place in the regulation of human affairs". (p. 54) Keith remarks that the 18th century common sense realist philosopher Thomas Reid reached the same conclusion. Keith also cites Adam Smith, the theoretical father of capitalism, who in his 'The Theory of Moral Sentiments' (1759) regarded prejudices as part of human nature, to both preserve human life and for the welfare of the common good. Keith concludes that the idea that prejudices "are not artificially acquired, but have been grafted deeply into our natures for particular purposes" is not merely a discovery of Darwinism. Indeed, from a Christian perspective, these arational feelings must serve some higher survival purpose and are so largely present in life, that they all can't be dismissed as "sin".
In A New Theory of Human Evolution, Keith puts forward his ideas on the co-evolution of Human beings, Races, and Cultures, covering topics such as Patriotism, Resentment and Revenge, Morality, Leadership, Nationalism, and Race. His particular theory emphasises the ideas of 'In-group versus Out-group', and the 'Amity-enmity complex'.
One chapter, entitled The Jews as a Nation and as a Race, tackles what is often referred to as 'the Jewish Question', postulating that the Jews are a special case of a race that has evolved to live as the 'out-group' amongst other races, developing a special culture that enables it to survive by means of strong cultural traditions that bind the 'in-group' with unusual loyalty and defensiveness. Such claims are very controversial today.
Physical copies of the book are difficult to obtain as it would seem that original copies exist only in small numbers, and that modern reprints do not exist. However, an online reprint of the book is available (see link below).
Keith wrote his memoir when he was 84, because "a short time hence someone will have to write my obituary notice, so that what I set down now may then prove of service". He recounts how he came to pursue his scientific work, and reports on important people whom he met along the way—William Boyd Dawkins, Conan Doyle, Charles Sherrington and others. Nonetheless, the lengthy volume was deemed "completely unexciting. Events of sentimental interest and happenings of pure routine get almost equal emphasis."
Keith went to live in a house very close to that which Darwin had occupied in Downe, Kent, in the latter years of his life, and took a great interest in trying to understand more about Charles Darwin. In this book, written just before he died, Keith gives a lot of detail about Darwin's family life, as well as his career.
Eighty years ago medicine was divided among three orders of specialists – physicians, surgeons, and midwives. Now there are more than fifty distinct special branches for the treatment of human ailments. It is this aspect of life – its ever growing specialization – which frightens me. Applying this law to The New York Times, I tremble when I think what its readers will find on their doorsteps every Sunday morning.
“ "Why is it that the feelings which accompany the practice of every kind of reprisal or of revenge are painful? Indeed, all the feelings which enter into the practice of the code of enmity are unpleasant and abiding. The explanation I offer is that resentment is unpleasant to make sure that it will be put into execution, so giving relief by gratification.
—Sir Arthur Keith, A New Theory of Human Evolution, (London: Watts & Co., 1948), 82.
"I have sought to prove ... that the code of enmity is a necessary part of the machinery of evolution. He who feels generous towards his enemy, and more especially if he feels forgiveness towards him, has in reality abandoned the code of enmity and so has given up his place in the turmoil of evolutionary competition. Hence the benign feeling of perfect peace that descends on him."
"Another mark of race possessed by the Jews must be mentioned. Their conduct is regulated by a ‘dual code‘; their conduct towards their fellows is based on one code (amity), and that towards all who are outside their circle on another (enmity). The use of the dual code, as we have seen, is a mark of an evolving race. My deliberate opinion is that racial characters are more strongly developed in the Jews than in any other race."
—Sir Arthur Keith, A New Theory of Human Evolution, (London: Watts & Co., 1948), 390.
"The German Führer, as I have consistently maintained, is an evolutionist; he has consciously sought to make the practice of Germany conform to the theory of evolution. He has failed, not because the theory of evolution is false, but because he has made three fatal blunders in its application. The first was in forcing the pace of evolution among his own people; he raised their warlike passions to such a heat that the only relief possible was that of aggressive war. His second mistake lay in his misconception of the evolutionary value of power. All that a sane evolutionist demands of power is that it should be sufficient to guarantee the security of a nation; more than that is an evolutionary abuse of power. When Hitler set out to conquer Europe, he had entered on that course which brought about the evolutionary destruction of Genghis Khan and his Mongol hordes (see Chapter 34). His third and greatest mistake was his failure to realize that such a monopoly of power meant insecurity for Britain, Russia, and America. His three great antagonists, although they do not preach the doctrine of evolution, are very consistent exponents of its tenets."
This supposed quote is used in an attempt to demonstrate that Sir Arthur Keith simply dismisses creationist viewpoints outright due to a presumed antitheistic bias. However, in attempting to research this statement, one finds that it usually appears without primary source documentation. In those instances where seemingly original documentation is provided, it is stated to be a foreword for a centennial edition or "100th edition" of Origin of Species. However, several facts show that the attribution of these words to Arthur Keith is erroneous.
Keith died in 1955, some four years before the 100th anniversary of Darwin's work, so that he was clearly not available to write an introduction for the centennial edition (this was actually done by William Robin Thompson). Furthermore, while Keith did write an introduction to earlier printings of Origin of Species, in use from 1928 to 1958, the words given above do not appear in that introduction. Finally, the last "edition" of Origin of Species is the sixth edition published 1879. It is for this reason that all later publications of Origin of Species are actually reprints of this or earlier editions so that there is simply no "100th edition" of Darwin's work. The quote appears to stem from a 1947 article about—not by—Arthur Keith, in the magazine The Nineteenth Century, which was then misattributed.
^ a b c Clark, W. E. L. G. (1955). "Arthur Keith 1866-1955". Biographical Memoirs of Fellows of the Royal Society. 1: 144–161. doi:10.1098/rsbm.1955.0011.
^ Read, R. C. (2007). "Arthur Keith, the anatomist who envisioned herniosis". Hernia. 11 (6): 469–471. doi:10.1007/s10029-007-0273-9. PMID 17687509.
^ Keith, A. (1912). "Anatomy in Scotland during the lifetime of Sir John Struthers (1823–1899)". Edinb. Med. J. 8: 7–33.
^ Silverman, M. E; Hollman, A. (1 October 2007). "Discovery of the sinus node by Keith and Flack: on the centennial of their 1907 publication". Heart. 93 (10): 1184–1187. doi:10.1136/hrt.2006.105049. PMC 2000948. PMID 17890694.
^ "The Anatomical Society of Great Britain and Ireland – Presidents of the Society" (PDF). The Anatomical Society. Retrieved 21 October 2012.
^ "Race as a Political Factor".
^ Tobias, Phillip V. (June 1992) An Appraisal of the Case Against Sir Arthur Keith. Current Anthropology .
^ TalkOrigins. Retrieved on 8 June 2008.
^ Keith, Arthur (13 September 1931). ""World We Hope for Runs Away with the Pen of the Prophet"; Sir Arthur Keith Doubts if His Individualist Longings Can Be Realized". The New York Times. Retrieved 15 December 2010.
^ Several examples of Creationist publications which give this quotation without any source reference are: W. A. Criswell, Did Man Just Happen? (Grand Rapids: Zondervan, 1957), 73; "Why Should We Believe?" Watchtower, 79 (15 October 1958), 618; John Fred Meldau, Why We Believe in Creation Not in Evolution (Denver, Christian Victory Publishing, 1959), 27. Examples of Creationist publications which give references from secondary sources are: Rob van de Weghe, Prepared to Answer: A Step-by-step Guide to Bring the Power of Christian Evidence to Your Life (Port Hadlock: Windmill Ministries, 2008), 80, 413, Bert Thompson, Biological Evolution, (Montgomery: Apologetics Press, 1990), 7 [both cite W. A. Criswell, Did Man Just Happen? (Grand Rapids: Zondervan, 1972), 73]; Dennis James Kennedy, Why I believe: in the Bible, God, Creation . . . The Return of Christ, rev. ed. (Nashville: W Publishing Group, 2005) 61, 218 [cites John Fred Meldau, Why We Believe in Creation Not in Evolution (Denver, Christian Victory Publishing, 1959), 27].
^ Thus after giving this citation, Christian apologist Ray Comfort speaks of Keith as "author of Forward [sic] to The Origin of Species, 100th edition" but fails to provide any page number (Intelligent Design vs. Evolution: Letters to Atheists (Orlando: Bridge-Logos, 2006), 9). Christian authors Linda Coates and Leslie S. Kelly similarly speak of Keith as "the scientist who wrote the forward [sic] to the 100 year anniversary edition of Darwin's Origin of Species" when giving this same citation also without a page number (The 12 Days of Christmas: A Guide to an Old Tradition with a New Purpose (Mustang: Oklahoma, 2008), 46).
^ cf. Thompson, W. R. (1958) introduction to On the Origin of Species, by Charles Darwin. London: J.M. Dent.
^ cf. Keith, Arthur (1928) introduction to On the Origin of Species, by Charles Darwin. London: J.M. Dent.
^ Darwin, Charles (1872) On the Origin of Species, 6th ed. London: John Murray; In discussing this edition, Tim M. Berra notes that "the 1876 printing of the sixth edition is considered the first issue of the definitive text" (Charles Darwin: the Concise Story of an Extraordinary Man (Baltimore: Johns Hopkins, 2009), 89).
^ Vol. 141-142, p. 112.
Sir Arthur Keith Biography – Who Named It?
Redman, Samuel J. Bone Rooms: From Scientific Racism to Human Prehistory in Museums. (Cambridge: Harvard University Press) 2016.
|
0.953364 |
As I turned into making an attempt out these weeks baseball schedule it turned into the Boston, Chicago game which made my take a look at. I started to surprise what number of groups at some level of history had in a single construct or one more the note Stocking in their name. The 2 that extend to mind are the Boston Purple Sox and Chicago White Sox, but fabricate who were the distinctive Chicago White Sox? The first crew to be known as the Chicago White Sox turned into in point of fact the Chicago Cubs. Help within the day Chicago had a unsuitable ball membership known as, whenever you happen to can imagine this, the Chicago Nefarious Ball Membership. In 1870 the Chicago Nefarious Ball Membership officially modified their name to the Chicago White Stockings . It turned into April 29, 1870 when the Chicago White Stocking played their first game, it turned into in opposition to the St. Louis Unions. The White Stockings obtained that first game by a earn of Forty seven to 1. The St. Louis Unions where later (1875) to develop into the St. Louis Louis Brown Stockings , who was the Browns in 1883, the Perfectos in 1899 and a 300 and sixty five days late was the St. Louis. Louis Cardinals.
In the imply time The White Stockings went on to develop into the Chicago Colts after which in 1906 they officially was the Cubs, a name that they were unofficially known as since 1902.
One other crew that took the Stockings name turned into the Cincinnati Purple Stockings . The Reds were the very first all educated baseball membership and came into being in 1869. They fashioned in 1863 and had a winning high-tail of 130 games earlier than being defeated by the Brooklyn Atlants. Now in case your outlandish, The Brooklyn Atlantics, went on to develop into the Brooklyn Greys, Bridegrooms, Grooms, help to Bridegrooms, then Superbas, then Dodgers, help to Superbas, then Robins and as soon as more known as Dodgers; within the terminate in 1957 the Dodgers moved to LA and like develop into the Los Angeles Dodgers.
Boston turned into one more crew to determine on the name of Stockings. First known as Boston American citizens the Boston Purple Sox are know to like had a curse attributable to the sale on January 2, 1920 of Babe Ruth. That turned into the 300 and sixty five days they shipped the Babe to Unusual York to give the Yankees a monopoly on the note Dynasty. The Yankees started in Baltimore in 1901 then headed to Unusual York in 1903. After being known as the Unusual York Highlanders for 10 years in 1913 they was the Unusual York Yankees. With now not ample time or home to provide you with a detailed history of the Yankees appropriate about a of their accomplishment are: winners of 27 World Series', forty AL Pennants, 45 gamers and eleven managers within the Hall of Reputation, pitcher Jack Chesbro winning Forty one games in 1904. The checklist goes on but time runs out.
This does give me a salubrious thought though. I whine every week I will characteristic a detailed history of one of our MLB groups. With the summer earlier than us there can now not be an even bigger time to imagine baseball.
Psychological Or Bodily – Which Is Extra Crucial?
|
0.9999 |
She would take the odd swipe at us but woe betide anyone else who said or did anything to hurt us. Alice, now 99, is the only one of the six Goldsmith children still alive. The director Richard Eyre cast the two actresses after finding a "correspondence of spirit between them".
She always wanted to better herself and the whole family used to call her Lady Dorothy. The school also functioned as an agency and took students to London to audition for acting jobs. His wife Elizabeth was all right, too.
Jodie FosterJohn C. Cameron was initially reluctant to cast her, preferring the stars Claire Danes or Gwyneth Paltrowbut Winslet pleaded with him, "You don't understand!
The daughter of a carpenter who had moved his family to London from the Durham coalfields during the Thirties, she became known within the family for her aspirations. It contains correspondence between Winslet and Ericsdottir, personal statements from various celebrities, and contributions from Thorsteinsson.
Winslet's character was vastly expanded from a subsidiary love-interest in the novel it was based on to a prominent code-breaker in the film. Despite her reluctance to star in another period piece, Winslet agreed to the project after empathising with Sylvia's love for her children.
She left home in to marry Bill, a haulage driver, but still remembers how tough life was for her mother. They were just ordinary people. Describing Adele's character as having "more vulnerability than strength", Winslet found her to be a departure from the strong-willed women she typically played.
For the film's soundtrack she sang " What If ", which proved to be a commercial hit; she donated her earnings from it to children's charities. You only had to say one word What method describes an example of absolute dating she would take her shoes off and throw them at you.
During the day, the youngsters were looked after by their elder sisters, Alice and Ede, while Edith went to work at a nearby Ticklers jam factory.
The workload allowed her only four hours of sleep per day and she felt drained by the experience. Not only was she wealthy in her own right, but her husband returned safely from the battlefields. She played Ginny, a temperamental housewife having an affair with a lifeguard Justin Timberlake.
Gentle and kind, Olive made sure their house, Fairfield, was filled with voices and laughter — and the children thrived in their surroundings. Winslet was attracted to the idea of playing a woman whose aspirations had not been met, and she read The Feminine Mystique to understand the psychology of unhappy housewives from the era.
She always wanted better. After her mother died of influenza when Olive was just ten, she was privately educated at Roedean. She liked a drink and smoked but who could blame her with what she had to put up with?
She wanted to be the top brick in the chimney. She was the star for making Christmas puddings in the whole family.
Impressed by her reading, Thompson cast her for the much larger part of the recklessly romantic teenager Marianne Dashwood. All the washing went in there and she used to do the Christmas puddings there as well.
She played a satirical version of herself in it—an actress, who in an effort to win an Oscar, takes the role of a nun in a Holocaust film. Enlarge Born inthe eldest of five children, Olive was always destined for a life of privilege. It made Olive Middleton a very wealthy woman. She played the supporting part of the love interest to Law's character.
The cast rehearsed the script like a play for two weeks, and Winslet brought her children with her to Paris for the eight weeks of filming. Roger Ebert believed that the part allowed Winslet to display her acting range, and praised her for the defiance she brought to the role.
Despite the loss of her brothers, Olive considered herself fortunate. She found the script brave and was challenged by the idea of portraying an unlikable, manipulative woman.
Based on the novel of the same namethe film tells the story of Sarah Pierce, an unhappy housewife who has an affair with a married neighbour played by Patrick Wilson. Reillyand Christoph Waltz co-starred.
|
0.654113 |
The cost of the east–west scheme including rolling stock was estimated at £885 million. A more ambitious proposal named "Superlink" was proposed in 2004, at an estimated cost of £13 billion, including additional infrastructure work outside London: in addition to Crossrail's east– west tunnel, lines would connect towns including Cambridge, Ipswich, Southend-on-Sea, Pitsea, Reading, Basingstoke and Northampton.Both the Labour and Conservative parties made commitments in their manifestos for the 2010 election to deliver the railway, and the coalition government formed after the election also committed to the project.
The western section, from Paddington to Heathrow Airport and Reading in Berkshire, is due to open in December 2019, completing the new east–west route across London and providing a new high-frequency commuter and suburban passenger service.Crossrail's central core section will use new east–west twin tunnels under central London, splitting into two branches at either end.The tunnelled sections will be approximately 22 kilometres (14 mi) in length.The project was approved in 2007 and construction began in 2009 on the central section and connections to existing lines that will become part of the route.An almost entirely new line will branch from the main line at Whitechapel to Canary Wharf, crossing under the River Thames, with a new station at Woolwich and finally connecting with the North Kent Line at the Abbey Wood terminus.One of the two eastern sections runs underground from Whitechapel to Stratford, then on the surface on the existing main line.
The service will replace the "Shenfield metro", with key stops at Ilford, Romford (for interchange with London Overground services to Upminster), Gidea Park (where some peak hour trains will start or terminate), and Shenfield.Crossrail is a 118-kilometre (73-mile) railway line under development in England, running through parts of London and the home counties of Berkshire, Buckinghamshire and Essex.The central section and a large portion of the line, between Paddington in central London and Abbey Wood in the south-east, are due to open in December 2018, when it will be named the Elizabeth line in honour of Queen Elizabeth II.The project that became Crossrail has origins in the 1943 County of London Plan and 1944 Greater London Plan by Patrick Abercrombie.These led to a specialist investigation by the Railway (London Plan) Committee, appointed in 1944 and reporting in 19.Although the idea was seen as imaginative, only a brief estimate of cost was given: £300 million.
P_ID=adidas-750-boost-yeezy etre a mi Prix rose chemin entre ces deux categories.
It was an onerous process, given that those lists hadn’t been updated in more like 4 years.
|
0.983835 |
I am often asked by people that are about to change their diet, how best to start? My reply is always the same: "Speak to a doctor, a nurse or a nutritionist and then contact me if you think I can help". I am very adamant that people contact professionals before I start handing out advice to anyone.
Throughout the years I have observed that people usually are divided into two groups when starting their diet over. For some it works best to throw everything out of the cupboards and start healthy (often following a realisation that they are intolerant to gluten or dairy or if they have a life threatening illness). For others the best approach seems to take baby steps until the desired level of healthy diet has been reached. A new diet should be a part of your lifestyle, something you shouldn't have to think about and it should come naturally. Below are some pointers to get you started. Remember, always consult a doctor or a professional before changing your lifestyle radically.
For most 'normal' recipes you can reduce the amount of fat and processed sugar by at least third without you even noticing. It's a good place to start.
You can use spelt instead of wheat in all your baking. You can start by combining spelt and wheat and then reduce the amount of wheat until you only use spelt. You can do this over several weeks if you prefer or you can do it at once.
Reduce the fat you use when cooking. Use healthy oils and fats such as nut oils, avocado, tahini, nut butters, coconut oil, rapeseed oil and more. Note that not all types of oils are suitable for heating. Coconut oil, rapeseed oil and grapeseed oil can tolerate higher heat than nut oils and olive oils for example.
You can use a refillable pump spray. Suggested amount is 40 millilitres water and 10 millilitres coconut oil mixed together, You will need much less fat on your frying pan when using this method.
Instead of frying meat in oil or butter, use water and a little vegetable (or other) stock. Just make sure you don't use too much salt in addition to the stock.
When baking you can often use baby food (fruit purees) instead of the whole amount of oil/butter required. This applies especially to 'soft' baked goods such as muffins, cakes, tea breads and more. Fruit purees/baby food is less suitable when making cookies as these require more fat to become crunchy. Try to match the taste of the fruit puree to what you are making. For example if you are making apple muffins, use apple puree. You can also use apple sauce (without added sugar) in place of baby food/fruit purees. Make sure that the baby food you buy is organic without added sugar.
I always use baking parchment (or silicone) when baking because it ensures the baked goods don't stick to the surface and it also means that I need less fat in the recipe. Use silicone muffins pans when making muffins (it is well worth the money to purchase one).
Instead of cream made from dairy I use oat cream (which is lighter and doesn't contain saturated fat) and I often use yoghurt in place of regular cream without anyone even noticing. When making soups I might use oat cream but I never, ever add regular cream to recipes just for the sake of it. I might use single cream once in a blue moon (for soups, to make them richer) but apart from that I don't use cream.
Instead of sour creme (or creme fraiche) for salad dressings I use yoghurt or buttermilk. If I am using creme fraiche it is only 5% fat (or the lightest version).
Use light/low fat dairy products when possible. If you are used to full fat cheese only, you can grate full fat cheese and low fat cheese (try 50/50) and combine in casseroles and any other cooking that requires cheese. Over time you can reduce the amount of full fat cheese without even noticing.
Bake instead of frying your food. I never fry food that can be baked (such as nut burgers and fish cakes/patties).
Always read the labels when food shopping. Don't be fooled by 'only 3% fat' for example. It often means that there is just that much more sugar in the product to hide any nasty taste (this especially applies to biscuits, packet sauces, cereals and more).
Same goes for 'sugar free'. Even though it is 'sugar free' doesn't mean the product is good for you. Beware of sweeteners and additives.
Instead of processed sugar use other types of sugars such as Rapadura (raw cane sugar), muscovado, demerara, date syrup, agave nectar, maple syrup, barley malt syrup, rice syrup and acacia honey. These natural sweeteners reach your blood stream much slower than processed sugar and will have retained some of their vitamins during processing (which the fully processed sugar does not). Agave nectar (the raw variety) is my preferred sweetener as it is very low on the glycemic index and superb in most baking.
Nut butters are absolutely superb in baking and I use them extensively instead of butter. I use peanut butter, tahini (sesame butter), cashew butter and hazelnut butter instead of traditional butter in my recipes. I love the taste and texture although if you are nut intolerant you will need to use alternative fats. Coconut oil (cold pressed and organic) and rapeseed oil are good options.
Dark chocolate contains less sugar than milk chocolate. I use dark chocolate (with raw cane sugar) in all my baking. It does contain some milk although if you are allergic to dairy you can always use darker chocolate with no dairy. I love the chocolate from Green & Black's and Rapunzel.
|
0.992341 |
Instagram has quickly become one of the hottest properties for online marketers and business owners. With the monthly active user base reaching one billion, there are large audiences for all kinds of niches and products. Small businesses can develop a following who become return customers, with the ability to build their brand through the platform.
However, simply setting up an account and occasionally adding posts will not be enough to stand out. A coherent Instagram strategy is required to really make an impact. The following tips can be used to develop an Instagram account that becomes a pillar of your marketing efforts.
Before developing a profile, it is important to understand your target audience. Existing users can look at Instagram Insights to find some useful information about their current followers. In most cases though, there will be established competitors who have already done the work. Look at your competition, analyzing how often they post, the style of images they use, and their audience interaction. You can also use tools like Mention and Sprout Social to simplify the research process.
Many small businesses struggle to find ideas for posts. Simply posting product images will grow stale, so you need to develop themes that keep people interested. The simplest process is to rotate different styles of posts, trying to keep the quality high at all times. Depending on your business, you could use a combination of product images, staff events, quote posts, and competitions. A tool like Canva offers beginners a quick way to create and edit images to a high standard.
Hashtags are used to categorize content, enabling audiences to find what they are looking for. Adding the right hashtags can add new followers as they will be highly focused. It is important to not add a long list of tags as this will look spammy to your followers. Instead, include a handful of focused tags, ensuring they represent the images. Avoid being too broad so you will reach your target audience. Additionally, you can create your own unique hashtag, helping your followers find related content and increasing brand awareness.
Influencers have already achieved the difficult goal of cultivating a loyal following. There are broader influencers with a diverse audience, but there are also micro influencers who can be more focused with their interests. If you can find influencers within your niche, it is worth collaborating with them to grow your audience. Along with the increased follower numbers, you can also improve your brand recognition through the association.
User-generated content has a number of benefits for a business. The business owner gets new content, the user feels more engaged with the brand, and followers can see real people enjoying a product or service. This type of content is great for building a community around a product, with customers feeling they are being recognized and appreciated.
Some businesses use Instagram as a platform to post the same content and offers that are available everywhere. The businesses getting better results treat Instagram as a separate platform that requires its own focus. The biggest social platforms demand that you work within their parameters, whether that is Twitter, Facebook, or Instagram. For best results, create exclusive Instagram promo codes and post images that do not appear everywhere.
Not everything you try on the platform will provide great results. There is no single system that is guaranteed to work for every small business. To keep on top of what works for you, it is important to analyze results. Use Instagram Insights to check the results for each post, looking for good engagement levels. You should gradually find a method that works, including a popular time of day to post and an offer that leads to new customers.
Small businesses without an Instagram following are missing out on a perfect opportunity. Instagram offers the chance to improve brand visibility, cultivate an audience, and sell more products. There are Instagram influencers building lucrative careers, solely because their following has a high value. Most small businesses already have some kind of reputation within their niche or local area. Taking this existing reputation and growing it via Instagram is a great way to increase your audience and, ultimately, take your business to the next level.
If you have any questions about how Instagram can help your business, our team would be happy to help! Call us today at (484) 893-4055.
Copyright 2019 LMS Solutions Inc | Web Design & Development done by the geniuses at...oh wait that would be US!
Ready to learn more about our services and how they can help you grow your business?
|
0.999998 |
please advise which of the two would be the better option to drink - green tea, or oolong tea. Is there a difference between the two. I am trying to lose some weight, am eating healthy now, so just curious.
Green tea is probably the best option because there is some evidence that it promotes weight loss.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.